repo_name
stringlengths
5
100
path
stringlengths
4
375
copies
stringclasses
991 values
size
stringlengths
4
7
content
stringlengths
666
1M
license
stringclasses
15 values
chandler14362/panda3d
direct/src/leveleditor/CurveAnimUI.py
13
7082
""" This is the GUI for the Curve Animation """ import wx from direct.interval.IntervalGlobal import * from direct.actor.Actor import * from . import ObjectGlobals as OG class CurveAnimUI(wx.Dialog): """ This is the Curve Animation Panel implementation. """ def __init__(self, parent, editor): wx.Dialog.__init__(self, parent, id=wx.ID_ANY, title="Curve Animation", pos=wx.DefaultPosition, size=(430, 140)) self.editor = editor self.nodePath = None self.curve = None self.mainPanel = wx.Panel(self, -1) self.chooseNode = wx.StaticText( self.mainPanel, -1, "Choose NodePath:") self.chooseNodeTxt = wx.TextCtrl( self.mainPanel, -1, "") self.chooseNodeButton = wx.Button( self.mainPanel, -1, "Choose..") self.chooseCurve = wx.StaticText( self.mainPanel, -1, "Choose attch Curve:") self.chooseCurveTxt = wx.TextCtrl( self.mainPanel, -1, "") self.chooseCurveButton = wx.Button( self.mainPanel, -1, "Choose..") self.duritionTime = wx.StaticText( self.mainPanel, -1, "Durition(Frame):") self.duritionTimeSpin = wx.SpinCtrl( self.mainPanel, -1, "",size = (70,25), min=24, max=10000) self.createAnimButton = wx.Button( self.mainPanel, -1, "Creat") self.saveAnimButton = wx.Button( self.mainPanel, -1, "Save Animation") self.SetProperties() self.DoLayout() self.Bind(wx.EVT_BUTTON, self.OnChooseNode, self.chooseNodeButton) self.Bind(wx.EVT_BUTTON, self.OnChooseCurve, self.chooseCurveButton) self.Bind(wx.EVT_BUTTON, self.OnCreateAnim, self.createAnimButton) self.Bind(wx.EVT_BUTTON, self.OnSaveAnim, self.saveAnimButton) self.Bind(wx.EVT_CLOSE, self.OnExit) def SetProperties(self): self.duritionTimeSpin.SetValue(24) self.chooseNodeTxt.SetMinSize((200,21)) self.chooseCurveTxt.SetMinSize((200,21)) self.saveAnimButton.SetToolTipString("Save the animation to the global animation control") def DoLayout(self): dialogSizer = wx.BoxSizer(wx.VERTICAL) mainSizer = wx.FlexGridSizer(4, 3, 0, 0) mainSizer.Add(self.chooseNode, 0, wx.ALIGN_CENTER_VERTICAL|wx.LEFT|wx.RIGHT, 10) mainSizer.Add(self.chooseNodeTxt, 0, wx.ALIGN_CENTER_VERTICAL|wx.LEFT|wx.RIGHT, 5) mainSizer.Add(self.chooseNodeButton, 0, wx.ALIGN_CENTER_VERTICAL|wx.LEFT|wx.RIGHT, 5) mainSizer.Add(self.chooseCurve, 0, wx.ALIGN_CENTER_VERTICAL|wx.LEFT|wx.RIGHT, 10) mainSizer.Add(self.chooseCurveTxt, 0, wx.ALIGN_CENTER_VERTICAL|wx.LEFT|wx.RIGHT, 5) mainSizer.Add(self.chooseCurveButton, 0, wx.ALIGN_CENTER_VERTICAL|wx.LEFT|wx.RIGHT, 5) mainSizer.Add(self.duritionTime, 0, wx.ALIGN_CENTER_VERTICAL|wx.LEFT|wx.RIGHT, 10) mainSizer.Add(self.duritionTimeSpin, 0, wx.ALIGN_CENTER_VERTICAL|wx.LEFT|wx.RIGHT, 5) mainSizer.Add(self.createAnimButton, 0, wx.ALIGN_CENTER_VERTICAL|wx.LEFT|wx.RIGHT, 5) mainSizer.Add(self.saveAnimButton, 0, wx.ALIGN_CENTER_VERTICAL|wx.LEFT|wx.RIGHT, 5) self.mainPanel.SetSizerAndFit(mainSizer) dialogSizer.Add(self.mainPanel, 1, wx.ALIGN_CENTER_VERTICAL|wx.ALL, 5) self.SetSizer(dialogSizer) self.Layout() def OnChooseNode(self, evt): if base.direct.selected.last == None or base.direct.selected.last.hasTag('Controller') or not base.direct.selected.last.hasTag('OBJRoot'): dlg = wx.MessageDialog(None, 'Please select an object.', 'NOTICE', wx.OK ) dlg.ShowModal() dlg.Destroy() else: obj = self.editor.objectMgr.findObjectByNodePath(base.direct.selected.last) if obj[OG.OBJ_DEF].name == '__Curve__': dlg = wx.MessageDialog(None, 'Please select an object, not a curve.', 'NOTICE', wx.OK ) dlg.ShowModal() dlg.Destroy() else: self.nodePath = obj self.chooseNodeTxt.SetValue(str(self.nodePath[OG.OBJ_UID])) def OnChooseCurve(self, evt): if base.direct.selected.last == None or base.direct.selected.last.hasTag('Controller') or not base.direct.selected.last.hasTag('OBJRoot'): dlg = wx.MessageDialog(None, 'Please select a curve.', 'NOTICE', wx.OK ) dlg.ShowModal() dlg.Destroy() else: obj = self.editor.objectMgr.findObjectByNodePath(base.direct.selected.last) if obj[OG.OBJ_DEF].name != '__Curve__': dlg = wx.MessageDialog(None, 'Please select a curve, not an object.', 'NOTICE', wx.OK ) dlg.ShowModal() dlg.Destroy() elif obj[OG.OBJ_DEF].name == '__Curve__': self.curve = obj self.chooseCurveTxt.SetValue(str(self.curve[OG.OBJ_UID])) def OnCreateAnim(self, evt): self.time = self.duritionTimeSpin.GetValue() if self.nodePath == None or self.curve == None: dlg = wx.MessageDialog(None, 'Please select an object and a curve first.', 'NOTICE', wx.OK ) dlg.ShowModal() dlg.Destroy() else: self.curveSequence = self.editor.animMgr.singleCurveAnimation(self.nodePath, self.curve, self.time) self.curveSequence.start() def OnSaveAnim(self,evt): if not self.curveSequence: dlg = wx.MessageDialog(None, 'Please create a animation first.', 'NOTICE', wx.OK ) dlg.ShowModal() dlg.Destroy() else: if self.editor.animMgr.curveAnimation == {}: self.editor.animMgr.curveAnimation[(self.nodePath[OG.OBJ_UID],self.curve[OG.OBJ_UID])] = (self.nodePath[OG.OBJ_UID],self.curve[OG.OBJ_UID],self.time) self.editor.updateStatusReadout('Sucessfully saved to global animation list') return hasKey = False for key in self.editor.animMgr.curveAnimation: if key == (self.nodePath[OG.OBJ_UID], self.curve[OG.OBJ_UID]): dlg = wx.MessageDialog(None, 'Already have the animation for this object attach to this curve.', 'NOTICE', wx.OK ) dlg.ShowModal() dlg.Destroy() hasKey = True return elif self.nodePath[OG.OBJ_UID] == key[0]: dlg = wx.MessageDialog(None, 'This object is already attached to a curve.', 'NOTICE', wx.OK ) dlg.ShowModal() dlg.Destroy() hasKey = True return if hasKey == False and self.editor.animMgr.curveAnimation != {}: self.editor.animMgr.curveAnimation[(self.nodePath[OG.OBJ_UID],self.curve[OG.OBJ_UID])] = (self.nodePath[OG.OBJ_UID],self.curve[OG.OBJ_UID],self.time) self.editor.updateStatusReadout('Sucessfully saved to global animation list') def OnExit(self,evt): self.Destroy() self.editor.ui.curveAnimMenuItem.Check(False)
bsd-3-clause
vipjml/python-driver
tests/integration/cqlengine/query/test_queryset.py
4
54820
# Copyright 2013-2016 DataStax, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from __future__ import absolute_import try: import unittest2 as unittest except ImportError: import unittest # noqa from datetime import datetime import time from uuid import uuid1, uuid4 import uuid from cassandra.cluster import Session from cassandra import InvalidRequest from tests.integration.cqlengine.base import BaseCassEngTestCase from cassandra.cqlengine.connection import NOT_SET import mock from cassandra.cqlengine import functions from cassandra.cqlengine.management import sync_table, drop_table from cassandra.cqlengine.models import Model from cassandra.cqlengine import columns from cassandra.cqlengine import query from cassandra.cqlengine.query import QueryException, BatchQuery from datetime import timedelta from datetime import tzinfo from cassandra.cqlengine import statements from cassandra.cqlengine import operators from cassandra.util import uuid_from_time from cassandra.cqlengine.connection import get_session from tests.integration import PROTOCOL_VERSION, CASSANDRA_VERSION, greaterthancass20, greaterthancass21 from tests.integration.cqlengine import execute_count class TzOffset(tzinfo): """Minimal implementation of a timezone offset to help testing with timezone aware datetimes. """ def __init__(self, offset): self._offset = timedelta(hours=offset) def utcoffset(self, dt): return self._offset def tzname(self, dt): return 'TzOffset: {}'.format(self._offset.hours) def dst(self, dt): return timedelta(0) class TestModel(Model): test_id = columns.Integer(primary_key=True) attempt_id = columns.Integer(primary_key=True) description = columns.Text() expected_result = columns.Integer() test_result = columns.Integer() class IndexedTestModel(Model): test_id = columns.Integer(primary_key=True) attempt_id = columns.Integer(index=True) description = columns.Text() expected_result = columns.Integer() test_result = columns.Integer(index=True) class IndexedCollectionsTestModel(Model): test_id = columns.Integer(primary_key=True) attempt_id = columns.Integer(index=True) description = columns.Text() expected_result = columns.Integer() test_result = columns.Integer(index=True) test_list = columns.List(columns.Integer, index=True) test_set = columns.Set(columns.Integer, index=True) test_map = columns.Map(columns.Text, columns.Integer, index=True) test_list_no_index = columns.List(columns.Integer, index=False) test_set_no_index = columns.Set(columns.Integer, index=False) test_map_no_index = columns.Map(columns.Text, columns.Integer, index=False) class TestMultiClusteringModel(Model): one = columns.Integer(primary_key=True) two = columns.Integer(primary_key=True) three = columns.Integer(primary_key=True) class TestQuerySetOperation(BaseCassEngTestCase): def test_query_filter_parsing(self): """ Tests the queryset filter method parses it's kwargs properly """ query1 = TestModel.objects(test_id=5) assert len(query1._where) == 1 op = query1._where[0] assert isinstance(op, statements.WhereClause) assert isinstance(op.operator, operators.EqualsOperator) assert op.value == 5 query2 = query1.filter(expected_result__gte=1) assert len(query2._where) == 2 op = query2._where[1] self.assertIsInstance(op, statements.WhereClause) self.assertIsInstance(op.operator, operators.GreaterThanOrEqualOperator) assert op.value == 1 def test_query_expression_parsing(self): """ Tests that query experessions are evaluated properly """ query1 = TestModel.filter(TestModel.test_id == 5) assert len(query1._where) == 1 op = query1._where[0] assert isinstance(op, statements.WhereClause) assert isinstance(op.operator, operators.EqualsOperator) assert op.value == 5 query2 = query1.filter(TestModel.expected_result >= 1) assert len(query2._where) == 2 op = query2._where[1] self.assertIsInstance(op, statements.WhereClause) self.assertIsInstance(op.operator, operators.GreaterThanOrEqualOperator) assert op.value == 1 def test_using_invalid_column_names_in_filter_kwargs_raises_error(self): """ Tests that using invalid or nonexistant column names for filter args raises an error """ with self.assertRaises(query.QueryException): TestModel.objects(nonsense=5) def test_using_nonexistant_column_names_in_query_args_raises_error(self): """ Tests that using invalid or nonexistant columns for query args raises an error """ with self.assertRaises(AttributeError): TestModel.objects(TestModel.nonsense == 5) def test_using_non_query_operators_in_query_args_raises_error(self): """ Tests that providing query args that are not query operator instances raises an error """ with self.assertRaises(query.QueryException): TestModel.objects(5) def test_queryset_is_immutable(self): """ Tests that calling a queryset function that changes it's state returns a new queryset """ query1 = TestModel.objects(test_id=5) assert len(query1._where) == 1 query2 = query1.filter(expected_result__gte=1) assert len(query2._where) == 2 assert len(query1._where) == 1 def test_queryset_limit_immutability(self): """ Tests that calling a queryset function that changes it's state returns a new queryset with same limit """ query1 = TestModel.objects(test_id=5).limit(1) assert query1._limit == 1 query2 = query1.filter(expected_result__gte=1) assert query2._limit == 1 query3 = query1.filter(expected_result__gte=1).limit(2) assert query1._limit == 1 assert query3._limit == 2 def test_the_all_method_duplicates_queryset(self): """ Tests that calling all on a queryset with previously defined filters duplicates queryset """ query1 = TestModel.objects(test_id=5) assert len(query1._where) == 1 query2 = query1.filter(expected_result__gte=1) assert len(query2._where) == 2 query3 = query2.all() assert query3 == query2 def test_queryset_with_distinct(self): """ Tests that calling distinct on a queryset w/without parameter are evaluated properly. """ query1 = TestModel.objects.distinct() self.assertEqual(len(query1._distinct_fields), 1) query2 = TestModel.objects.distinct(['test_id']) self.assertEqual(len(query2._distinct_fields), 1) query3 = TestModel.objects.distinct(['test_id', 'attempt_id']) self.assertEqual(len(query3._distinct_fields), 2) def test_defining_only_fields(self): """ Tests defining only fields @since 3.5 @jira_ticket PYTHON-560 @expected_result deferred fields should not be returned @test_category object_mapper """ # simple only definition q = TestModel.objects.only(['attempt_id', 'description']) self.assertEqual(q._select_fields(), ['attempt_id', 'description']) with self.assertRaises(query.QueryException): TestModel.objects.only(['nonexistent_field']) # Cannot define more than once only fields with self.assertRaises(query.QueryException): TestModel.objects.only(['description']).only(['attempt_id']) # only with defer fields q = TestModel.objects.only(['attempt_id', 'description']) q = q.defer(['description']) self.assertEqual(q._select_fields(), ['attempt_id']) # Eliminate all results confirm exception is thrown q = TestModel.objects.only(['description']) q = q.defer(['description']) with self.assertRaises(query.QueryException): q._select_fields() q = TestModel.objects.filter(test_id=0).only(['test_id', 'attempt_id', 'description']) self.assertEqual(q._select_fields(), ['attempt_id', 'description']) # no fields to select with self.assertRaises(query.QueryException): q = TestModel.objects.only(['test_id']).defer(['test_id']) q._select_fields() with self.assertRaises(query.QueryException): q = TestModel.objects.filter(test_id=0).only(['test_id']) q._select_fields() def test_defining_defer_fields(self): """ Tests defining defer fields @since 3.5 @jira_ticket PYTHON-560 @jira_ticket PYTHON-599 @expected_result deferred fields should not be returned @test_category object_mapper """ # simple defer definition q = TestModel.objects.defer(['attempt_id', 'description']) self.assertEqual(q._select_fields(), ['test_id', 'expected_result', 'test_result']) with self.assertRaises(query.QueryException): TestModel.objects.defer(['nonexistent_field']) # defer more than one q = TestModel.objects.defer(['attempt_id', 'description']) q = q.defer(['expected_result']) self.assertEqual(q._select_fields(), ['test_id', 'test_result']) # defer with only q = TestModel.objects.defer(['description', 'attempt_id']) q = q.only(['description', 'test_id']) self.assertEqual(q._select_fields(), ['test_id']) # Eliminate all results confirm exception is thrown q = TestModel.objects.defer(['description', 'attempt_id']) q = q.only(['description']) with self.assertRaises(query.QueryException): q._select_fields() # implicit defer q = TestModel.objects.filter(test_id=0) self.assertEqual(q._select_fields(), ['attempt_id', 'description', 'expected_result', 'test_result']) # when all fields are defered, it fallbacks select the partition keys q = TestModel.objects.defer(['test_id', 'attempt_id', 'description', 'expected_result', 'test_result']) self.assertEqual(q._select_fields(), ['test_id']) class BaseQuerySetUsage(BaseCassEngTestCase): @classmethod def setUpClass(cls): super(BaseQuerySetUsage, cls).setUpClass() drop_table(TestModel) drop_table(IndexedTestModel) sync_table(TestModel) sync_table(IndexedTestModel) sync_table(TestMultiClusteringModel) TestModel.objects.create(test_id=0, attempt_id=0, description='try1', expected_result=5, test_result=30) TestModel.objects.create(test_id=0, attempt_id=1, description='try2', expected_result=10, test_result=30) TestModel.objects.create(test_id=0, attempt_id=2, description='try3', expected_result=15, test_result=30) TestModel.objects.create(test_id=0, attempt_id=3, description='try4', expected_result=20, test_result=25) TestModel.objects.create(test_id=1, attempt_id=0, description='try5', expected_result=5, test_result=25) TestModel.objects.create(test_id=1, attempt_id=1, description='try6', expected_result=10, test_result=25) TestModel.objects.create(test_id=1, attempt_id=2, description='try7', expected_result=15, test_result=25) TestModel.objects.create(test_id=1, attempt_id=3, description='try8', expected_result=20, test_result=20) TestModel.objects.create(test_id=2, attempt_id=0, description='try9', expected_result=50, test_result=40) TestModel.objects.create(test_id=2, attempt_id=1, description='try10', expected_result=60, test_result=40) TestModel.objects.create(test_id=2, attempt_id=2, description='try11', expected_result=70, test_result=45) TestModel.objects.create(test_id=2, attempt_id=3, description='try12', expected_result=75, test_result=45) IndexedTestModel.objects.create(test_id=0, attempt_id=0, description='try1', expected_result=5, test_result=30) IndexedTestModel.objects.create(test_id=1, attempt_id=1, description='try2', expected_result=10, test_result=30) IndexedTestModel.objects.create(test_id=2, attempt_id=2, description='try3', expected_result=15, test_result=30) IndexedTestModel.objects.create(test_id=3, attempt_id=3, description='try4', expected_result=20, test_result=25) IndexedTestModel.objects.create(test_id=4, attempt_id=0, description='try5', expected_result=5, test_result=25) IndexedTestModel.objects.create(test_id=5, attempt_id=1, description='try6', expected_result=10, test_result=25) IndexedTestModel.objects.create(test_id=6, attempt_id=2, description='try7', expected_result=15, test_result=25) IndexedTestModel.objects.create(test_id=7, attempt_id=3, description='try8', expected_result=20, test_result=20) IndexedTestModel.objects.create(test_id=8, attempt_id=0, description='try9', expected_result=50, test_result=40) IndexedTestModel.objects.create(test_id=9, attempt_id=1, description='try10', expected_result=60, test_result=40) IndexedTestModel.objects.create(test_id=10, attempt_id=2, description='try11', expected_result=70, test_result=45) IndexedTestModel.objects.create(test_id=11, attempt_id=3, description='try12', expected_result=75, test_result=45) if(CASSANDRA_VERSION >= '2.1'): drop_table(IndexedCollectionsTestModel) sync_table(IndexedCollectionsTestModel) IndexedCollectionsTestModel.objects.create(test_id=12, attempt_id=3, description='list12', expected_result=75, test_result=45, test_list=[1, 2, 42], test_set=set([1, 2, 3]), test_map={'1': 1, '2': 2, '3': 3}) IndexedCollectionsTestModel.objects.create(test_id=13, attempt_id=3, description='list13', expected_result=75, test_result=45, test_list=[3, 4, 5], test_set=set([4, 5, 42]), test_map={'1': 5, '2': 6, '3': 7}) IndexedCollectionsTestModel.objects.create(test_id=14, attempt_id=3, description='list14', expected_result=75, test_result=45, test_list=[1, 2, 3], test_set=set([1, 2, 3]), test_map={'1': 1, '2': 2, '3': 42}) IndexedCollectionsTestModel.objects.create(test_id=15, attempt_id=4, description='list14', expected_result=75, test_result=45, test_list_no_index=[1, 2, 3], test_set_no_index=set([1, 2, 3]), test_map_no_index={'1': 1, '2': 2, '3': 42}) @classmethod def tearDownClass(cls): super(BaseQuerySetUsage, cls).tearDownClass() drop_table(TestModel) drop_table(IndexedTestModel) drop_table(TestMultiClusteringModel) class TestQuerySetCountSelectionAndIteration(BaseQuerySetUsage): @execute_count(2) def test_count(self): """ Tests that adding filtering statements affects the count query as expected """ assert TestModel.objects.count() == 12 q = TestModel.objects(test_id=0) assert q.count() == 4 @execute_count(2) def test_query_expression_count(self): """ Tests that adding query statements affects the count query as expected """ assert TestModel.objects.count() == 12 q = TestModel.objects(TestModel.test_id == 0) assert q.count() == 4 @execute_count(3) def test_iteration(self): """ Tests that iterating over a query set pulls back all of the expected results """ q = TestModel.objects(test_id=0) # tuple of expected attempt_id, expected_result values compare_set = set([(0, 5), (1, 10), (2, 15), (3, 20)]) for t in q: val = t.attempt_id, t.expected_result assert val in compare_set compare_set.remove(val) assert len(compare_set) == 0 # test with regular filtering q = TestModel.objects(attempt_id=3).allow_filtering() assert len(q) == 3 # tuple of expected test_id, expected_result values compare_set = set([(0, 20), (1, 20), (2, 75)]) for t in q: val = t.test_id, t.expected_result assert val in compare_set compare_set.remove(val) assert len(compare_set) == 0 # test with query method q = TestModel.objects(TestModel.attempt_id == 3).allow_filtering() assert len(q) == 3 # tuple of expected test_id, expected_result values compare_set = set([(0, 20), (1, 20), (2, 75)]) for t in q: val = t.test_id, t.expected_result assert val in compare_set compare_set.remove(val) assert len(compare_set) == 0 @execute_count(2) def test_multiple_iterations_work_properly(self): """ Tests that iterating over a query set more than once works """ # test with both the filtering method and the query method for q in (TestModel.objects(test_id=0), TestModel.objects(TestModel.test_id == 0)): # tuple of expected attempt_id, expected_result values compare_set = set([(0, 5), (1, 10), (2, 15), (3, 20)]) for t in q: val = t.attempt_id, t.expected_result assert val in compare_set compare_set.remove(val) assert len(compare_set) == 0 # try it again compare_set = set([(0, 5), (1, 10), (2, 15), (3, 20)]) for t in q: val = t.attempt_id, t.expected_result assert val in compare_set compare_set.remove(val) assert len(compare_set) == 0 @execute_count(2) def test_multiple_iterators_are_isolated(self): """ tests that the use of one iterator does not affect the behavior of another """ for q in (TestModel.objects(test_id=0), TestModel.objects(TestModel.test_id == 0)): q = q.order_by('attempt_id') expected_order = [0, 1, 2, 3] iter1 = iter(q) iter2 = iter(q) for attempt_id in expected_order: assert next(iter1).attempt_id == attempt_id assert next(iter2).attempt_id == attempt_id @execute_count(3) def test_get_success_case(self): """ Tests that the .get() method works on new and existing querysets """ m = TestModel.objects.get(test_id=0, attempt_id=0) assert isinstance(m, TestModel) assert m.test_id == 0 assert m.attempt_id == 0 q = TestModel.objects(test_id=0, attempt_id=0) m = q.get() assert isinstance(m, TestModel) assert m.test_id == 0 assert m.attempt_id == 0 q = TestModel.objects(test_id=0) m = q.get(attempt_id=0) assert isinstance(m, TestModel) assert m.test_id == 0 assert m.attempt_id == 0 @execute_count(3) def test_query_expression_get_success_case(self): """ Tests that the .get() method works on new and existing querysets """ m = TestModel.get(TestModel.test_id == 0, TestModel.attempt_id == 0) assert isinstance(m, TestModel) assert m.test_id == 0 assert m.attempt_id == 0 q = TestModel.objects(TestModel.test_id == 0, TestModel.attempt_id == 0) m = q.get() assert isinstance(m, TestModel) assert m.test_id == 0 assert m.attempt_id == 0 q = TestModel.objects(TestModel.test_id == 0) m = q.get(TestModel.attempt_id == 0) assert isinstance(m, TestModel) assert m.test_id == 0 assert m.attempt_id == 0 @execute_count(1) def test_get_doesnotexist_exception(self): """ Tests that get calls that don't return a result raises a DoesNotExist error """ with self.assertRaises(TestModel.DoesNotExist): TestModel.objects.get(test_id=100) @execute_count(1) def test_get_multipleobjects_exception(self): """ Tests that get calls that return multiple results raise a MultipleObjectsReturned error """ with self.assertRaises(TestModel.MultipleObjectsReturned): TestModel.objects.get(test_id=1) def test_allow_filtering_flag(self): """ """ @execute_count(4) def test_non_quality_filtering(): class NonEqualityFilteringModel(Model): example_id = columns.UUID(primary_key=True, default=uuid.uuid4) sequence_id = columns.Integer(primary_key=True) # sequence_id is a clustering key example_type = columns.Integer(index=True) created_at = columns.DateTime() drop_table(NonEqualityFilteringModel) sync_table(NonEqualityFilteringModel) # setup table, etc. NonEqualityFilteringModel.create(sequence_id=1, example_type=0, created_at=datetime.now()) NonEqualityFilteringModel.create(sequence_id=3, example_type=0, created_at=datetime.now()) NonEqualityFilteringModel.create(sequence_id=5, example_type=1, created_at=datetime.now()) qa = NonEqualityFilteringModel.objects(NonEqualityFilteringModel.sequence_id > 3).allow_filtering() num = qa.count() assert num == 1, num class TestQuerySetDistinct(BaseQuerySetUsage): @execute_count(1) def test_distinct_without_parameter(self): q = TestModel.objects.distinct() self.assertEqual(len(q), 3) @execute_count(1) def test_distinct_with_parameter(self): q = TestModel.objects.distinct(['test_id']) self.assertEqual(len(q), 3) @execute_count(1) def test_distinct_with_filter(self): q = TestModel.objects.distinct(['test_id']).filter(test_id__in=[1, 2]) self.assertEqual(len(q), 2) @execute_count(1) def test_distinct_with_non_partition(self): with self.assertRaises(InvalidRequest): q = TestModel.objects.distinct(['description']).filter(test_id__in=[1, 2]) len(q) @execute_count(1) def test_zero_result(self): q = TestModel.objects.distinct(['test_id']).filter(test_id__in=[52]) self.assertEqual(len(q), 0) @greaterthancass21 @execute_count(2) def test_distinct_with_explicit_count(self): q = TestModel.objects.distinct(['test_id']) self.assertEqual(q.count(), 3) q = TestModel.objects.distinct(['test_id']).filter(test_id__in=[1, 2]) self.assertEqual(q.count(), 2) class TestQuerySetOrdering(BaseQuerySetUsage): @execute_count(2) def test_order_by_success_case(self): q = TestModel.objects(test_id=0).order_by('attempt_id') expected_order = [0, 1, 2, 3] for model, expect in zip(q, expected_order): assert model.attempt_id == expect q = q.order_by('-attempt_id') expected_order.reverse() for model, expect in zip(q, expected_order): assert model.attempt_id == expect def test_ordering_by_non_second_primary_keys_fail(self): # kwarg filtering with self.assertRaises(query.QueryException): TestModel.objects(test_id=0).order_by('test_id') # kwarg filtering with self.assertRaises(query.QueryException): TestModel.objects(TestModel.test_id == 0).order_by('test_id') def test_ordering_by_non_primary_keys_fails(self): with self.assertRaises(query.QueryException): TestModel.objects(test_id=0).order_by('description') def test_ordering_on_indexed_columns_fails(self): with self.assertRaises(query.QueryException): IndexedTestModel.objects(test_id=0).order_by('attempt_id') @execute_count(8) def test_ordering_on_multiple_clustering_columns(self): TestMultiClusteringModel.create(one=1, two=1, three=4) TestMultiClusteringModel.create(one=1, two=1, three=2) TestMultiClusteringModel.create(one=1, two=1, three=5) TestMultiClusteringModel.create(one=1, two=1, three=1) TestMultiClusteringModel.create(one=1, two=1, three=3) results = TestMultiClusteringModel.objects.filter(one=1, two=1).order_by('-two', '-three') assert [r.three for r in results] == [5, 4, 3, 2, 1] results = TestMultiClusteringModel.objects.filter(one=1, two=1).order_by('two', 'three') assert [r.three for r in results] == [1, 2, 3, 4, 5] results = TestMultiClusteringModel.objects.filter(one=1, two=1).order_by('two').order_by('three') assert [r.three for r in results] == [1, 2, 3, 4, 5] class TestQuerySetSlicing(BaseQuerySetUsage): @execute_count(1) def test_out_of_range_index_raises_error(self): q = TestModel.objects(test_id=0).order_by('attempt_id') with self.assertRaises(IndexError): q[10] @execute_count(1) def test_array_indexing_works_properly(self): q = TestModel.objects(test_id=0).order_by('attempt_id') expected_order = [0, 1, 2, 3] for i in range(len(q)): assert q[i].attempt_id == expected_order[i] @execute_count(1) def test_negative_indexing_works_properly(self): q = TestModel.objects(test_id=0).order_by('attempt_id') expected_order = [0, 1, 2, 3] assert q[-1].attempt_id == expected_order[-1] assert q[-2].attempt_id == expected_order[-2] @execute_count(1) def test_slicing_works_properly(self): q = TestModel.objects(test_id=0).order_by('attempt_id') expected_order = [0, 1, 2, 3] for model, expect in zip(q[1:3], expected_order[1:3]): self.assertEqual(model.attempt_id, expect) for model, expect in zip(q[0:3:2], expected_order[0:3:2]): self.assertEqual(model.attempt_id, expect) @execute_count(1) def test_negative_slicing(self): q = TestModel.objects(test_id=0).order_by('attempt_id') expected_order = [0, 1, 2, 3] for model, expect in zip(q[-3:], expected_order[-3:]): self.assertEqual(model.attempt_id, expect) for model, expect in zip(q[:-1], expected_order[:-1]): self.assertEqual(model.attempt_id, expect) for model, expect in zip(q[1:-1], expected_order[1:-1]): self.assertEqual(model.attempt_id, expect) for model, expect in zip(q[-3:-1], expected_order[-3:-1]): self.assertEqual(model.attempt_id, expect) for model, expect in zip(q[-3:-1:2], expected_order[-3:-1:2]): self.assertEqual(model.attempt_id, expect) class TestQuerySetValidation(BaseQuerySetUsage): def test_primary_key_or_index_must_be_specified(self): """ Tests that queries that don't have an equals relation to a primary key or indexed field fail """ with self.assertRaises(query.QueryException): q = TestModel.objects(test_result=25) list([i for i in q]) def test_primary_key_or_index_must_have_equal_relation_filter(self): """ Tests that queries that don't have non equal (>,<, etc) relation to a primary key or indexed field fail """ with self.assertRaises(query.QueryException): q = TestModel.objects(test_id__gt=0) list([i for i in q]) @greaterthancass20 @execute_count(7) def test_indexed_field_can_be_queried(self): """ Tests that queries on an indexed field will work without any primary key relations specified """ q = IndexedTestModel.objects(test_result=25) self.assertEqual(q.count(), 4) q = IndexedCollectionsTestModel.objects.filter(test_list__contains=42) self.assertEqual(q.count(), 1) q = IndexedCollectionsTestModel.objects.filter(test_list__contains=13) self.assertEqual(q.count(), 0) q = IndexedCollectionsTestModel.objects.filter(test_set__contains=42) self.assertEqual(q.count(), 1) q = IndexedCollectionsTestModel.objects.filter(test_set__contains=13) self.assertEqual(q.count(), 0) q = IndexedCollectionsTestModel.objects.filter(test_map__contains=42) self.assertEqual(q.count(), 1) q = IndexedCollectionsTestModel.objects.filter(test_map__contains=13) self.assertEqual(q.count(), 0) class TestQuerySetDelete(BaseQuerySetUsage): @execute_count(9) def test_delete(self): TestModel.objects.create(test_id=3, attempt_id=0, description='try9', expected_result=50, test_result=40) TestModel.objects.create(test_id=3, attempt_id=1, description='try10', expected_result=60, test_result=40) TestModel.objects.create(test_id=3, attempt_id=2, description='try11', expected_result=70, test_result=45) TestModel.objects.create(test_id=3, attempt_id=3, description='try12', expected_result=75, test_result=45) assert TestModel.objects.count() == 16 assert TestModel.objects(test_id=3).count() == 4 TestModel.objects(test_id=3).delete() assert TestModel.objects.count() == 12 assert TestModel.objects(test_id=3).count() == 0 def test_delete_without_partition_key(self): """ Tests that attempting to delete a model without defining a partition key fails """ with self.assertRaises(query.QueryException): TestModel.objects(attempt_id=0).delete() def test_delete_without_any_where_args(self): """ Tests that attempting to delete a whole table without any arguments will fail """ with self.assertRaises(query.QueryException): TestModel.objects(attempt_id=0).delete() @unittest.skipIf(CASSANDRA_VERSION < '3.0', "range deletion was introduce in C* 3.0, currently running {0}".format(CASSANDRA_VERSION)) @execute_count(18) def test_range_deletion(self): """ Tests that range deletion work as expected """ for i in range(10): TestMultiClusteringModel.objects().create(one=1, two=i, three=i) TestMultiClusteringModel.objects(one=1, two__gte=0, two__lte=3).delete() self.assertEqual(6, len(TestMultiClusteringModel.objects.all())) TestMultiClusteringModel.objects(one=1, two__gt=3, two__lt=5).delete() self.assertEqual(5, len(TestMultiClusteringModel.objects.all())) TestMultiClusteringModel.objects(one=1, two__in=[8, 9]).delete() self.assertEqual(3, len(TestMultiClusteringModel.objects.all())) TestMultiClusteringModel.objects(one__in=[1], two__gte=0).delete() self.assertEqual(0, len(TestMultiClusteringModel.objects.all())) class TimeUUIDQueryModel(Model): partition = columns.UUID(primary_key=True) time = columns.TimeUUID(primary_key=True) data = columns.Text(required=False) class TestMinMaxTimeUUIDFunctions(BaseCassEngTestCase): @classmethod def setUpClass(cls): super(TestMinMaxTimeUUIDFunctions, cls).setUpClass() sync_table(TimeUUIDQueryModel) @classmethod def tearDownClass(cls): super(TestMinMaxTimeUUIDFunctions, cls).tearDownClass() drop_table(TimeUUIDQueryModel) @execute_count(7) def test_tzaware_datetime_support(self): """Test that using timezone aware datetime instances works with the MinTimeUUID/MaxTimeUUID functions. """ pk = uuid4() midpoint_utc = datetime.utcnow().replace(tzinfo=TzOffset(0)) midpoint_helsinki = midpoint_utc.astimezone(TzOffset(3)) # Assert pre-condition that we have the same logical point in time assert midpoint_utc.utctimetuple() == midpoint_helsinki.utctimetuple() assert midpoint_utc.timetuple() != midpoint_helsinki.timetuple() TimeUUIDQueryModel.create( partition=pk, time=uuid_from_time(midpoint_utc - timedelta(minutes=1)), data='1') TimeUUIDQueryModel.create( partition=pk, time=uuid_from_time(midpoint_utc), data='2') TimeUUIDQueryModel.create( partition=pk, time=uuid_from_time(midpoint_utc + timedelta(minutes=1)), data='3') assert ['1', '2'] == [o.data for o in TimeUUIDQueryModel.filter( TimeUUIDQueryModel.partition == pk, TimeUUIDQueryModel.time <= functions.MaxTimeUUID(midpoint_utc))] assert ['1', '2'] == [o.data for o in TimeUUIDQueryModel.filter( TimeUUIDQueryModel.partition == pk, TimeUUIDQueryModel.time <= functions.MaxTimeUUID(midpoint_helsinki))] assert ['2', '3'] == [o.data for o in TimeUUIDQueryModel.filter( TimeUUIDQueryModel.partition == pk, TimeUUIDQueryModel.time >= functions.MinTimeUUID(midpoint_utc))] assert ['2', '3'] == [o.data for o in TimeUUIDQueryModel.filter( TimeUUIDQueryModel.partition == pk, TimeUUIDQueryModel.time >= functions.MinTimeUUID(midpoint_helsinki))] @execute_count(8) def test_success_case(self): """ Test that the min and max time uuid functions work as expected """ pk = uuid4() startpoint = datetime.utcnow() TimeUUIDQueryModel.create(partition=pk, time=uuid_from_time(startpoint + timedelta(seconds=1)), data='1') TimeUUIDQueryModel.create(partition=pk, time=uuid_from_time(startpoint + timedelta(seconds=2)), data='2') midpoint = startpoint + timedelta(seconds=3) TimeUUIDQueryModel.create(partition=pk, time=uuid_from_time(startpoint + timedelta(seconds=4)), data='3') TimeUUIDQueryModel.create(partition=pk, time=uuid_from_time(startpoint + timedelta(seconds=5)), data='4') # test kwarg filtering q = TimeUUIDQueryModel.filter(partition=pk, time__lte=functions.MaxTimeUUID(midpoint)) q = [d for d in q] self.assertEqual(len(q), 2, msg="Got: %s" % q) datas = [d.data for d in q] assert '1' in datas assert '2' in datas q = TimeUUIDQueryModel.filter(partition=pk, time__gte=functions.MinTimeUUID(midpoint)) assert len(q) == 2 datas = [d.data for d in q] assert '3' in datas assert '4' in datas # test query expression filtering q = TimeUUIDQueryModel.filter( TimeUUIDQueryModel.partition == pk, TimeUUIDQueryModel.time <= functions.MaxTimeUUID(midpoint) ) q = [d for d in q] assert len(q) == 2 datas = [d.data for d in q] assert '1' in datas assert '2' in datas q = TimeUUIDQueryModel.filter( TimeUUIDQueryModel.partition == pk, TimeUUIDQueryModel.time >= functions.MinTimeUUID(midpoint) ) assert len(q) == 2 datas = [d.data for d in q] assert '3' in datas assert '4' in datas class TestInOperator(BaseQuerySetUsage): @execute_count(1) def test_kwarg_success_case(self): """ Tests the in operator works with the kwarg query method """ q = TestModel.filter(test_id__in=[0, 1]) assert q.count() == 8 @execute_count(1) def test_query_expression_success_case(self): """ Tests the in operator works with the query expression query method """ q = TestModel.filter(TestModel.test_id.in_([0, 1])) assert q.count() == 8 @execute_count(5) def test_bool(self): """ Adding coverage to cqlengine for bool types. @since 3.6 @jira_ticket PYTHON-596 @expected_result bool results should be filtered appropriately @test_category object_mapper """ class bool_model(Model): k = columns.Integer(primary_key=True) b = columns.Boolean(primary_key=True) v = columns.Integer(default=3) sync_table(bool_model) bool_model.create(k=0, b=True) bool_model.create(k=0, b=False) self.assertEqual(len(bool_model.objects.all()), 2) self.assertEqual(len(bool_model.objects.filter(k=0, b=True)), 1) self.assertEqual(len(bool_model.objects.filter(k=0, b=False)), 1) @execute_count(3) def test_bool_filter(self): """ Test to ensure that we don't translate boolean objects to String unnecessarily in filter clauses @since 3.6 @jira_ticket PYTHON-596 @expected_result We should not receive a server error @test_category object_mapper """ class bool_model2(Model): k = columns.Boolean(primary_key=True) b = columns.Integer(primary_key=True) v = columns.Text() drop_table(bool_model2) sync_table(bool_model2) bool_model2.create(k=True, b=1, v='a') bool_model2.create(k=False, b=1, v='b') self.assertEqual(len(list(bool_model2.objects(k__in=(True, False)))), 2) @greaterthancass20 class TestContainsOperator(BaseQuerySetUsage): @execute_count(6) def test_kwarg_success_case(self): """ Tests the CONTAINS operator works with the kwarg query method """ q = IndexedCollectionsTestModel.filter(test_list__contains=1) self.assertEqual(q.count(), 2) q = IndexedCollectionsTestModel.filter(test_list__contains=13) self.assertEqual(q.count(), 0) q = IndexedCollectionsTestModel.filter(test_set__contains=3) self.assertEqual(q.count(), 2) q = IndexedCollectionsTestModel.filter(test_set__contains=13) self.assertEqual(q.count(), 0) q = IndexedCollectionsTestModel.filter(test_map__contains=42) self.assertEqual(q.count(), 1) q = IndexedCollectionsTestModel.filter(test_map__contains=13) self.assertEqual(q.count(), 0) with self.assertRaises(QueryException): q = IndexedCollectionsTestModel.filter(test_list_no_index__contains=1) self.assertEqual(q.count(), 0) with self.assertRaises(QueryException): q = IndexedCollectionsTestModel.filter(test_set_no_index__contains=1) self.assertEqual(q.count(), 0) with self.assertRaises(QueryException): q = IndexedCollectionsTestModel.filter(test_map_no_index__contains=1) self.assertEqual(q.count(), 0) @execute_count(6) def test_query_expression_success_case(self): """ Tests the CONTAINS operator works with the query expression query method """ q = IndexedCollectionsTestModel.filter(IndexedCollectionsTestModel.test_list.contains_(1)) self.assertEqual(q.count(), 2) q = IndexedCollectionsTestModel.filter(IndexedCollectionsTestModel.test_list.contains_(13)) self.assertEqual(q.count(), 0) q = IndexedCollectionsTestModel.filter(IndexedCollectionsTestModel.test_set.contains_(3)) self.assertEqual(q.count(), 2) q = IndexedCollectionsTestModel.filter(IndexedCollectionsTestModel.test_set.contains_(13)) self.assertEqual(q.count(), 0) q = IndexedCollectionsTestModel.filter(IndexedCollectionsTestModel.test_map.contains_(42)) self.assertEqual(q.count(), 1) q = IndexedCollectionsTestModel.filter(IndexedCollectionsTestModel.test_map.contains_(13)) self.assertEqual(q.count(), 0) with self.assertRaises(QueryException): q = IndexedCollectionsTestModel.filter(IndexedCollectionsTestModel.test_map_no_index.contains_(1)) self.assertEqual(q.count(), 0) with self.assertRaises(QueryException): q = IndexedCollectionsTestModel.filter(IndexedCollectionsTestModel.test_map_no_index.contains_(1)) self.assertEqual(q.count(), 0) with self.assertRaises(QueryException): q = IndexedCollectionsTestModel.filter(IndexedCollectionsTestModel.test_map_no_index.contains_(1)) self.assertEqual(q.count(), 0) class TestValuesList(BaseQuerySetUsage): @execute_count(2) def test_values_list(self): q = TestModel.objects.filter(test_id=0, attempt_id=1) item = q.values_list('test_id', 'attempt_id', 'description', 'expected_result', 'test_result').first() assert item == [0, 1, 'try2', 10, 30] item = q.values_list('expected_result', flat=True).first() assert item == 10 class TestObjectsProperty(BaseQuerySetUsage): @execute_count(1) def test_objects_property_returns_fresh_queryset(self): assert TestModel.objects._result_cache is None len(TestModel.objects) # evaluate queryset assert TestModel.objects._result_cache is None class PageQueryTests(BaseCassEngTestCase): @execute_count(3) def test_paged_result_handling(self): if PROTOCOL_VERSION < 2: raise unittest.SkipTest("Paging requires native protocol 2+, currently using: {0}".format(PROTOCOL_VERSION)) # addresses #225 class PagingTest(Model): id = columns.Integer(primary_key=True) val = columns.Integer() sync_table(PagingTest) PagingTest.create(id=1, val=1) PagingTest.create(id=2, val=2) session = get_session() with mock.patch.object(session, 'default_fetch_size', 1): results = PagingTest.objects()[:] assert len(results) == 2 class ModelQuerySetTimeoutTestCase(BaseQuerySetUsage): def test_default_timeout(self): with mock.patch.object(Session, 'execute') as mock_execute: list(TestModel.objects()) self.assertEqual(mock_execute.call_args[-1]['timeout'], NOT_SET) def test_float_timeout(self): with mock.patch.object(Session, 'execute') as mock_execute: list(TestModel.objects().timeout(0.5)) self.assertEqual(mock_execute.call_args[-1]['timeout'], 0.5) def test_none_timeout(self): with mock.patch.object(Session, 'execute') as mock_execute: list(TestModel.objects().timeout(None)) self.assertEqual(mock_execute.call_args[-1]['timeout'], None) class DMLQueryTimeoutTestCase(BaseQuerySetUsage): def setUp(self): self.model = TestModel(test_id=1, attempt_id=1, description='timeout test') super(DMLQueryTimeoutTestCase, self).setUp() def test_default_timeout(self): with mock.patch.object(Session, 'execute') as mock_execute: self.model.save() self.assertEqual(mock_execute.call_args[-1]['timeout'], NOT_SET) def test_float_timeout(self): with mock.patch.object(Session, 'execute') as mock_execute: self.model.timeout(0.5).save() self.assertEqual(mock_execute.call_args[-1]['timeout'], 0.5) def test_none_timeout(self): with mock.patch.object(Session, 'execute') as mock_execute: self.model.timeout(None).save() self.assertEqual(mock_execute.call_args[-1]['timeout'], None) def test_timeout_then_batch(self): b = query.BatchQuery() m = self.model.timeout(None) with self.assertRaises(AssertionError): m.batch(b) def test_batch_then_timeout(self): b = query.BatchQuery() m = self.model.batch(b) with self.assertRaises(AssertionError): m.timeout(0.5) class DBFieldModel(Model): k0 = columns.Integer(partition_key=True, db_field='a') k1 = columns.Integer(partition_key=True, db_field='b') c0 = columns.Integer(primary_key=True, db_field='c') v0 = columns.Integer(db_field='d') v1 = columns.Integer(db_field='e', index=True) class DBFieldModelMixed1(Model): k0 = columns.Integer(partition_key=True, db_field='a') k1 = columns.Integer(partition_key=True) c0 = columns.Integer(primary_key=True, db_field='c') v0 = columns.Integer(db_field='d') v1 = columns.Integer(index=True) class DBFieldModelMixed2(Model): k0 = columns.Integer(partition_key=True) k1 = columns.Integer(partition_key=True, db_field='b') c0 = columns.Integer(primary_key=True) v0 = columns.Integer(db_field='d') v1 = columns.Integer(index=True, db_field='e') class TestModelQueryWithDBField(BaseCassEngTestCase): def setUp(cls): super(TestModelQueryWithDBField, cls).setUpClass() cls.model_list = [DBFieldModel, DBFieldModelMixed1, DBFieldModelMixed2] for model in cls.model_list: sync_table(model) def tearDown(cls): super(TestModelQueryWithDBField, cls).tearDownClass() for model in cls.model_list: drop_table(model) @execute_count(33) def test_basic_crud(self): """ Tests creation update and delete of object model queries that are using db_field mappings. @since 3.1 @jira_ticket PYTHON-351 @expected_result results are properly retrieved without errors @test_category object_mapper """ for model in self.model_list: values = {'k0': 1, 'k1': 2, 'c0': 3, 'v0': 4, 'v1': 5} # create i = model.create(**values) i = model.objects(k0=i.k0, k1=i.k1).first() self.assertEqual(i, model(**values)) # create values['v0'] = 101 i.update(v0=values['v0']) i = model.objects(k0=i.k0, k1=i.k1).first() self.assertEqual(i, model(**values)) # delete model.objects(k0=i.k0, k1=i.k1).delete() i = model.objects(k0=i.k0, k1=i.k1).first() self.assertIsNone(i) i = model.create(**values) i = model.objects(k0=i.k0, k1=i.k1).first() self.assertEqual(i, model(**values)) i.delete() model.objects(k0=i.k0, k1=i.k1).delete() i = model.objects(k0=i.k0, k1=i.k1).first() self.assertIsNone(i) @execute_count(21) def test_slice(self): """ Tests slice queries for object models that are using db_field mapping @since 3.1 @jira_ticket PYTHON-351 @expected_result results are properly retrieved without errors @test_category object_mapper """ for model in self.model_list: values = {'k0': 1, 'k1': 3, 'c0': 3, 'v0': 4, 'v1': 5} clustering_values = range(3) for c in clustering_values: values['c0'] = c i = model.create(**values) self.assertEqual(model.objects(k0=i.k0, k1=i.k1).count(), len(clustering_values)) self.assertEqual(model.objects(k0=i.k0, k1=i.k1, c0=i.c0).count(), 1) self.assertEqual(model.objects(k0=i.k0, k1=i.k1, c0__lt=i.c0).count(), len(clustering_values[:-1])) self.assertEqual(model.objects(k0=i.k0, k1=i.k1, c0__gt=0).count(), len(clustering_values[1:])) @execute_count(15) def test_order(self): """ Tests order by queries for object models that are using db_field mapping @since 3.1 @jira_ticket PYTHON-351 @expected_result results are properly retrieved without errors @test_category object_mapper """ for model in self.model_list: values = {'k0': 1, 'k1': 4, 'c0': 3, 'v0': 4, 'v1': 5} clustering_values = range(3) for c in clustering_values: values['c0'] = c i = model.create(**values) self.assertEqual(model.objects(k0=i.k0, k1=i.k1).order_by('c0').first().c0, clustering_values[0]) self.assertEqual(model.objects(k0=i.k0, k1=i.k1).order_by('-c0').first().c0, clustering_values[-1]) @execute_count(15) def test_index(self): """ Tests queries using index fields for object models using db_field mapping @since 3.1 @jira_ticket PYTHON-351 @expected_result results are properly retrieved without errors @test_category object_mapper """ for model in self.model_list: values = {'k0': 1, 'k1': 5, 'c0': 3, 'v0': 4, 'v1': 5} clustering_values = range(3) for c in clustering_values: values['c0'] = c values['v1'] = c i = model.create(**values) self.assertEqual(model.objects(k0=i.k0, k1=i.k1).count(), len(clustering_values)) self.assertEqual(model.objects(k0=i.k0, k1=i.k1, v1=0).count(), 1) @execute_count(1) def test_db_field_names_used(self): """ Tests to ensure that with generated cql update statements correctly utilize the db_field values. @since 3.2 @jira_ticket PYTHON-530 @expected_result resulting cql_statements will use the db_field values @test_category object_mapper """ values = ('k0', 'k1', 'c0', 'v0', 'v1') # Test QuerySet Path b = BatchQuery() DBFieldModel.objects(k0=1).batch(b).update( v0=0, v1=9, ) for value in values: self.assertTrue(value not in str(b.queries[0])) # Test DML path b2 = BatchQuery() dml_field_model = DBFieldModel.create(k0=1, k1=5, c0=3, v0=4, v1=5) dml_field_model.batch(b2).update( v0=0, v1=9, ) for value in values: self.assertTrue(value not in str(b2.queries[0])) class TestModelSmall(Model): test_id = columns.Integer(primary_key=True) class TestModelQueryWithFetchSize(BaseCassEngTestCase): """ Test FetchSize, and ensure that results are returned correctly regardless of the paging size @since 3.1 @jira_ticket PYTHON-324 @expected_result results are properly retrieved and the correct size @test_category object_mapper """ @classmethod def setUpClass(cls): super(TestModelQueryWithFetchSize, cls).setUpClass() sync_table(TestModelSmall) @classmethod def tearDownClass(cls): super(TestModelQueryWithFetchSize, cls).tearDownClass() drop_table(TestModelSmall) @execute_count(9) def test_defaultFetchSize(self): with BatchQuery() as b: for i in range(5100): TestModelSmall.batch(b).create(test_id=i) self.assertEqual(len(TestModelSmall.objects.fetch_size(1)), 5100) self.assertEqual(len(TestModelSmall.objects.fetch_size(500)), 5100) self.assertEqual(len(TestModelSmall.objects.fetch_size(4999)), 5100) self.assertEqual(len(TestModelSmall.objects.fetch_size(5000)), 5100) self.assertEqual(len(TestModelSmall.objects.fetch_size(5001)), 5100) self.assertEqual(len(TestModelSmall.objects.fetch_size(5100)), 5100) self.assertEqual(len(TestModelSmall.objects.fetch_size(5101)), 5100) self.assertEqual(len(TestModelSmall.objects.fetch_size(1)), 5100) with self.assertRaises(QueryException): TestModelSmall.objects.fetch_size(0) with self.assertRaises(QueryException): TestModelSmall.objects.fetch_size(-1) class People(Model): __table_name__ = "people" last_name = columns.Text(primary_key=True, partition_key=True) first_name = columns.Text(primary_key=True) birthday = columns.DateTime() class People2(Model): __table_name__ = "people" last_name = columns.Text(primary_key=True, partition_key=True) first_name = columns.Text(primary_key=True) middle_name = columns.Text() birthday = columns.DateTime() class TestModelQueryWithDifferedFeld(BaseCassEngTestCase): """ Tests that selects with filter will deffer population of known values until after the results are returned. I.E. Instead of generating SELECT * FROM People WHERE last_name="Smith" It will generate SELECT first_name, birthday FROM People WHERE last_name="Smith" Where last_name 'smith' will populated post query @since 3.2 @jira_ticket PYTHON-520 @expected_result only needed fields are included in the query @test_category object_mapper """ @classmethod def setUpClass(cls): super(TestModelQueryWithDifferedFeld, cls).setUpClass() sync_table(People) @classmethod def tearDownClass(cls): super(TestModelQueryWithDifferedFeld, cls).tearDownClass() drop_table(People) @execute_count(8) def test_defaultFetchSize(self): # Populate Table People.objects.create(last_name="Smith", first_name="John", birthday=datetime.now()) People.objects.create(last_name="Bestwater", first_name="Alan", birthday=datetime.now()) People.objects.create(last_name="Smith", first_name="Greg", birthday=datetime.now()) People.objects.create(last_name="Smith", first_name="Adam", birthday=datetime.now()) # Check query constructions expected_fields = ['first_name', 'birthday'] self.assertEqual(People.filter(last_name="Smith")._select_fields(), expected_fields) # Validate correct fields are fetched smiths = list(People.filter(last_name="Smith")) self.assertEqual(len(smiths), 3) self.assertTrue(smiths[0].last_name is not None) # Modify table with new value sync_table(People2) # populate new format People2.objects.create(last_name="Smith", first_name="Chris", middle_name="Raymond", birthday=datetime.now()) People2.objects.create(last_name="Smith", first_name="Andrew", middle_name="Micheal", birthday=datetime.now()) # validate query construction expected_fields = ['first_name', 'middle_name', 'birthday'] self.assertEqual(People2.filter(last_name="Smith")._select_fields(), expected_fields) # validate correct items are returneds smiths = list(People2.filter(last_name="Smith")) self.assertEqual(len(smiths), 5) self.assertTrue(smiths[0].last_name is not None)
apache-2.0
lmazuel/azure-sdk-for-python
azure-servicefabric/azure/servicefabric/models/partition_health_state.py
1
1552
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for # license information. # # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may cause incorrect behavior and will be lost if the code is # regenerated. # -------------------------------------------------------------------------- from .entity_health_state import EntityHealthState class PartitionHealthState(EntityHealthState): """Represents the health state of a partition, which contains the partition identifier and its aggregated health state. :param aggregated_health_state: The health state of a Service Fabric entity such as Cluster, Node, Application, Service, Partition, Replica etc. Possible values include: 'Invalid', 'Ok', 'Warning', 'Error', 'Unknown' :type aggregated_health_state: str or ~azure.servicefabric.models.HealthState :param partition_id: Id of the partition whose health state is described by this object. :type partition_id: str """ _attribute_map = { 'aggregated_health_state': {'key': 'AggregatedHealthState', 'type': 'str'}, 'partition_id': {'key': 'PartitionId', 'type': 'str'}, } def __init__(self, aggregated_health_state=None, partition_id=None): super(PartitionHealthState, self).__init__(aggregated_health_state=aggregated_health_state) self.partition_id = partition_id
mit
Azure/azure-sdk-for-python
sdk/authorization/azure-mgmt-authorization/azure/mgmt/authorization/v2015_07_01/operations/_global_administrator_operations.py
1
3625
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for license information. # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may cause incorrect behavior and will be lost if the code is regenerated. # -------------------------------------------------------------------------- from typing import TYPE_CHECKING import warnings from azure.core.exceptions import ClientAuthenticationError, HttpResponseError, ResourceExistsError, ResourceNotFoundError, map_error from azure.core.pipeline import PipelineResponse from azure.core.pipeline.transport import HttpRequest, HttpResponse from azure.mgmt.core.exceptions import ARMErrorFormat from .. import models as _models if TYPE_CHECKING: # pylint: disable=unused-import,ungrouped-imports from typing import Any, Callable, Dict, Generic, Optional, TypeVar T = TypeVar('T') ClsType = Optional[Callable[[PipelineResponse[HttpRequest, HttpResponse], T, Dict[str, Any]], Any]] class GlobalAdministratorOperations(object): """GlobalAdministratorOperations operations. You should not instantiate this class directly. Instead, you should create a Client instance that instantiates it for you and attaches it as an attribute. :ivar models: Alias to model classes used in this operation group. :type models: ~azure.mgmt.authorization.v2015_07_01.models :param client: Client for service requests. :param config: Configuration of service client. :param serializer: An object model serializer. :param deserializer: An object model deserializer. """ models = _models def __init__(self, client, config, serializer, deserializer): self._client = client self._serialize = serializer self._deserialize = deserializer self._config = config def elevate_access( self, **kwargs # type: Any ): # type: (...) -> None """Elevates access for a Global Administrator. :keyword callable cls: A custom type or function that will be passed the direct response :return: None, or the result of cls(response) :rtype: None :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType[None] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) api_version = "2015-07-01" # Construct URL url = self.elevate_access.metadata['url'] # type: ignore # Construct parameters query_parameters = {} # type: Dict[str, Any] query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str') # Construct headers header_parameters = {} # type: Dict[str, Any] request = self._client.post(url, query_parameters, header_parameters) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) if cls: return cls(pipeline_response, None, {}) elevate_access.metadata = {'url': '/providers/Microsoft.Authorization/elevateAccess'} # type: ignore
mit
justintweaver/mtchi-cert-game
makahiki/apps/managers/log_mgr/admin.py
9
1266
"""log model admin.""" from django.contrib import admin from django.db import models from django.forms.widgets import TextInput from apps.managers.challenge_mgr import challenge_mgr from apps.managers.log_mgr.models import MakahikiLog from apps.admin.admin import challenge_designer_site, challenge_manager_site, developer_site class MakahikiLogAdmin(admin.ModelAdmin): """admin""" list_display = ('request_url', "remote_user", 'remote_ip', 'request_time', 'request_method', 'response_status') list_filter = ('response_status', 'remote_user') search_fields = ('request_url', 'remote_ip') ordering = ["-request_time"] date_hierarchy = "request_time" formfield_overrides = { models.CharField: {'widget': TextInput(attrs={'size': '100'})}, } def has_add_permission(self, request): return False admin.site.register(MakahikiLog, MakahikiLogAdmin) challenge_designer_site.register(MakahikiLog, MakahikiLogAdmin) challenge_manager_site.register(MakahikiLog, MakahikiLogAdmin) developer_site.register(MakahikiLog, MakahikiLogAdmin) challenge_mgr.register_admin_challenge_info_model("Status", 1, MakahikiLog, 1) challenge_mgr.register_developer_challenge_info_model("Status", 4, MakahikiLog, 1)
gpl-3.0
ychen820/microblog
y/google-cloud-sdk/platform/google_appengine/lib/django-1.2/django/contrib/comments/admin.py
361
3299
from django.contrib import admin from django.contrib.comments.models import Comment from django.utils.translation import ugettext_lazy as _, ungettext from django.contrib.comments import get_model from django.contrib.comments.views.moderation import perform_flag, perform_approve, perform_delete class CommentsAdmin(admin.ModelAdmin): fieldsets = ( (None, {'fields': ('content_type', 'object_pk', 'site')} ), (_('Content'), {'fields': ('user', 'user_name', 'user_email', 'user_url', 'comment')} ), (_('Metadata'), {'fields': ('submit_date', 'ip_address', 'is_public', 'is_removed')} ), ) list_display = ('name', 'content_type', 'object_pk', 'ip_address', 'submit_date', 'is_public', 'is_removed') list_filter = ('submit_date', 'site', 'is_public', 'is_removed') date_hierarchy = 'submit_date' ordering = ('-submit_date',) raw_id_fields = ('user',) search_fields = ('comment', 'user__username', 'user_name', 'user_email', 'user_url', 'ip_address') actions = ["flag_comments", "approve_comments", "remove_comments"] def get_actions(self, request): actions = super(CommentsAdmin, self).get_actions(request) # Only superusers should be able to delete the comments from the DB. if not request.user.is_superuser and 'delete_selected' in actions: actions.pop('delete_selected') if not request.user.has_perm('comments.can_moderate'): if 'approve_comments' in actions: actions.pop('approve_comments') if 'remove_comments' in actions: actions.pop('remove_comments') return actions def flag_comments(self, request, queryset): self._bulk_flag(request, queryset, perform_flag, lambda n: ungettext('flagged', 'flagged', n)) flag_comments.short_description = _("Flag selected comments") def approve_comments(self, request, queryset): self._bulk_flag(request, queryset, perform_approve, lambda n: ungettext('approved', 'approved', n)) approve_comments.short_description = _("Approve selected comments") def remove_comments(self, request, queryset): self._bulk_flag(request, queryset, perform_delete, lambda n: ungettext('removed', 'removed', n)) remove_comments.short_description = _("Remove selected comments") def _bulk_flag(self, request, queryset, action, done_message): """ Flag, approve, or remove some comments from an admin action. Actually calls the `action` argument to perform the heavy lifting. """ n_comments = 0 for comment in queryset: action(request, comment) n_comments += 1 msg = ungettext(u'1 comment was successfully %(action)s.', u'%(count)s comments were successfully %(action)s.', n_comments) self.message_user(request, msg % {'count': n_comments, 'action': done_message(n_comments)}) # Only register the default admin if the model is the built-in comment model # (this won't be true if there's a custom comment app). if get_model() is Comment: admin.site.register(Comment, CommentsAdmin)
bsd-3-clause
liangazhou/django-rdp
packages/Django-1.8.6/tests/defer/models.py
112
1184
""" Tests for defer() and only(). """ from django.db import models from django.utils.encoding import python_2_unicode_compatible class Secondary(models.Model): first = models.CharField(max_length=50) second = models.CharField(max_length=50) @python_2_unicode_compatible class Primary(models.Model): name = models.CharField(max_length=50) value = models.CharField(max_length=50) related = models.ForeignKey(Secondary) def __str__(self): return self.name class Child(Primary): pass class BigChild(Primary): other = models.CharField(max_length=50) class ChildProxy(Child): class Meta: proxy = True class RefreshPrimaryProxy(Primary): class Meta: proxy = True def refresh_from_db(self, using=None, fields=None, **kwargs): # Reloads all deferred fields if any of the fields is deferred. if fields is not None: fields = set(fields) deferred_fields = self.get_deferred_fields() if fields.intersection(deferred_fields): fields = fields.union(deferred_fields) super(RefreshPrimaryProxy, self).refresh_from_db(using, fields, **kwargs)
apache-2.0
JoeJimFlood/NFLPrediction2014
week_pre_conf.py
1
4840
import pandas as pd import matchup import xlsxwriter import xlautofit import xlrd import sys import time import collections import os week_timer = time.time() week_number = 'conf_matrix' matchups = collections.OrderedDict() matchups['Matchups'] = [('NE', 'IND'), ('NE', 'SEA'), ('NE', 'GB'), ('IND', 'SEA'), ('IND', 'GB'), ('SEA', 'GB')] location = os.getcwd().replace('\\', '/') output_file = location + '/Weekly Forecasts/Week' + str(week_number) + '.xlsx' for read_data in range(2): week_book = xlsxwriter.Workbook(output_file) header_format = week_book.add_format({'align': 'center', 'bold': True, 'bottom': True}) index_format = week_book.add_format({'align': 'right', 'bold': True}) score_format = week_book.add_format({'num_format': '#0', 'align': 'right'}) percent_format = week_book.add_format({'num_format': '#0%', 'align': 'right'}) if read_data: colwidths = xlautofit.even_widths_single_index(output_file) for game_time in matchups: if read_data: data_book = xlrd.open_workbook(output_file) data_sheet = data_book.sheet_by_name(game_time) sheet = week_book.add_worksheet(game_time) sheet.write_string(1, 0, 'Chance of Winning', index_format) sheet.write_string(2, 0, 'Expected Score', index_format) sheet.write_string(3, 0, '2.5th Percentile Score', index_format) sheet.write_string(4, 0, '10th Percentile Score', index_format) sheet.write_string(5, 0, '25th Percentile Score', index_format) sheet.write_string(6, 0, '50th Percentile Score', index_format) sheet.write_string(7, 0, '75th Percentile Score', index_format) sheet.write_string(8, 0, '90th Percentile Score', index_format) sheet.write_string(9, 0, '97.5th Percentile score', index_format) sheet.freeze_panes(0, 1) games = matchups[game_time] for i in range(len(games)): home = games[i][0] away = games[i][1] homecol = 3 * i + 1 awaycol = 3 * i + 2 sheet.write_string(0, homecol, home, header_format) sheet.write_string(0, awaycol, away, header_format) if read_data: sheet.write_number(1, homecol, data_sheet.cell(1, homecol).value, percent_format) sheet.write_number(1, awaycol, data_sheet.cell(1, awaycol).value, percent_format) for rownum in range(2, 10): sheet.write_number(rownum, homecol, data_sheet.cell(rownum, homecol).value, score_format) sheet.write_number(rownum, awaycol, data_sheet.cell(rownum, awaycol).value, score_format) else: results = matchup.matchup(home, away) probwin = results['ProbWin'] sheet.write_number(1, homecol, probwin[home], percent_format) sheet.write_number(1, awaycol, probwin[away], percent_format) home_dist = results['Scores'][home] away_dist = results['Scores'][away] sheet.write_number(2, homecol, home_dist['mean'], score_format) sheet.write_number(2, awaycol, away_dist['mean'], score_format) sheet.write_number(3, homecol, home_dist['2.5%'], score_format) sheet.write_number(3, awaycol, away_dist['2.5%'], score_format) sheet.write_number(4, homecol, home_dist['10%'], score_format) sheet.write_number(4, awaycol, away_dist['10%'], score_format) sheet.write_number(5, homecol, home_dist['25%'], score_format) sheet.write_number(5, awaycol, away_dist['25%'], score_format) sheet.write_number(6, homecol, home_dist['50%'], score_format) sheet.write_number(6, awaycol, away_dist['50%'], score_format) sheet.write_number(7, homecol, home_dist['75%'], score_format) sheet.write_number(7, awaycol, away_dist['75%'], score_format) sheet.write_number(8, homecol, home_dist['90%'], score_format) sheet.write_number(8, awaycol, away_dist['90%'], score_format) sheet.write_number(9, homecol, home_dist['97.5%'], score_format) sheet.write_number(9, awaycol, away_dist['97.5%'], score_format) if i != len(games) - 1: sheet.write_string(0, 3 * i + 3, ' ') if read_data: for colnum in range(sheet.dim_colmax): sheet.set_column(colnum, colnum, colwidths[sheet.name][colnum]) week_book.close() print('Week ' + str(week_number) + ' predictions calculated in ' + str(round((time.time() - week_timer) / 60, 2)) + ' minutes')
mit
DakRomo/2017Challenges
challenge_4/python/slandau/reverse_tree.py
5
2555
#!/usr/bin/env python3 class Node: def __init__(self, data): self.data = data self.left = None self.right = None def __repr__(self): """ Represent tells the computer how this class should look when printed :return: The printing of this class depends on the data. """ return str(self.data) def reverse_tree(node: Node): """ Reverses a given Binary Tree :param node: The root of the binary tree :return: The root of the new (reversed) binary tree """ # Create a variable to store the reference to node.left so it is not lost # When we set it to node.right temp = node.left node.left = node.right node.right = temp if node.left is not None: # Go through the tree recursively, swapping all referenes to child nodes node.right = reverse_tree(node.left) if node.right is not None: node.left = reverse_tree(node.right) return node def create_nodes(): """ Constructs a tree of any size. :return: The head of the newly created tree """ head = Node(1) # We create a queue in order to perform Breadth First Search https://en.wikipedia.org/wiki/Breadth-first_search # Because we need to deque the head in order to access all other parts of the tree, # the head is the first object in the queue q = [head] i = 1 nodes_to_create = 200 # Change if you want to create a different number of nodes while i <= nodes_to_create: node = q[0] q.remove(node) i += 1 node.left = Node(i) q.append(node.left) i+=1 node.right = Node(i) q.append(node.right) return head if __name__ == '__main__': root = create_nodes() reversed_root = reverse_tree(root) # testing. Only use these if you have a lot of nodes. print(root.left == reversed_root.right) print(root.left.left == reversed_root.right.right) print(root.left.right == reversed_root.right.left) print(root.left.left.left == reversed_root.right.right.right) print(root.left.left.right == reversed_root.right.right.left) print(root.left.right.left == reversed_root.right.left.right) print(root.left.right.right == reversed_root.right.left.left) print(root.right.left.left == reversed_root.left.right.right) print(root.right.left.right == reversed_root.left.right.left) print(root.right.right.left == reversed_root.left.left.right) print(root.right.right.right == reversed_root.left.left.left)
mit
OpusVL/odoo
addons/account_anglo_saxon/stock.py
8
2861
# -*- encoding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2004-2009 Tiny SPRL (<http://tiny.be>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## from openerp.osv import osv class stock_move(osv.Model): _inherit = "stock.move" def _get_invoice_line_vals(self, cr, uid, move, partner, inv_type, context=None): """ Add a reference to the stock.move in the invoice line In anglo-saxon the price for COGS should be taken from stock.move if possible (fallback on standard_price) """ res = super(stock_move, self)._get_invoice_line_vals(cr, uid, move, partner, inv_type, context=context) res.update({ 'move_id': move.id, }) return res class stock_picking(osv.osv): _inherit = "stock.picking" _description = "Picking List" def action_invoice_create(self, cr, uid, ids, journal_id=False, group=False, type='out_invoice', context=None): '''Return ids of created invoices for the pickings''' res = super(stock_picking,self).action_invoice_create(cr, uid, ids, journal_id, group, type, context=context) if type in ('in_invoice', 'in_refund'): for inv in self.pool.get('account.invoice').browse(cr, uid, res, context=context): for ol in inv.invoice_line: if ol.product_id.type != 'service': oa = ol.product_id.property_stock_account_input and ol.product_id.property_stock_account_input.id if not oa: oa = ol.product_id.categ_id.property_stock_account_input_categ and ol.product_id.categ_id.property_stock_account_input_categ.id if oa: fpos = ol.invoice_id.fiscal_position or False a = self.pool.get('account.fiscal.position').map_account(cr, uid, fpos, oa) self.pool.get('account.invoice.line').write(cr, uid, [ol.id], {'account_id': a}) return res
agpl-3.0
TyRoXx/cdm
original_sources/boost_1_59_0/tools/build/src/tools/doxproc.py
50
36903
#!/usr/bin/python # Copyright 2006 Rene Rivera # Distributed under the Boost Software License, Version 1.0. # (See accompanying file LICENSE_1_0.txt or http://www.boost.org/LICENSE_1_0.txt) ''' Processing of Doxygen generated XML. ''' import os import os.path import sys import time import string import getopt import glob import re import xml.dom.minidom def usage(): print ''' Usage: %s options Options: --xmldir Directory with the Doxygen xml result files. --output Write the output BoostBook to the given location. --id The ID of the top level BoostBook section. --title The title of the top level BoostBook section. --enable-index Generate additional index sections for classes and types. ''' % ( sys.argv[0] ) def get_args( argv = sys.argv[1:] ): spec = [ 'xmldir=', 'output=', 'id=', 'title=', 'enable-index', 'help' ] options = { '--xmldir' : 'xml', '--output' : None, '--id' : 'dox', '--title' : 'Doxygen' } ( option_pairs, other ) = getopt.getopt( argv, '', spec ) map( lambda x: options.__setitem__( x[0], x[1] ), option_pairs ) if options.has_key( '--help' ): usage() sys.exit(1) return { 'xmldir' : options['--xmldir'], 'output' : options['--output'], 'id' : options['--id'], 'title' : options['--title'], 'index' : options.has_key('--enable-index') } def if_attribute(node, attribute, true_value, false_value=None): if node.getAttribute(attribute) == 'yes': return true_value else: return false_value class Doxygen2BoostBook: def __init__( self, **kwargs ): ## self.args = kwargs self.args.setdefault('id','') self.args.setdefault('title','') self.args.setdefault('last_revision', time.asctime()) self.args.setdefault('index', False) self.id = '%(id)s.reference' % self.args self.args['id'] = self.id #~ This is our template BoostBook document we insert the generated content into. self.boostbook = xml.dom.minidom.parseString('''<?xml version="1.0" encoding="UTF-8"?> <section id="%(id)s" name="%(title)s" last-revision="%(last_revision)s"> <title>%(title)s</title> <library-reference id="%(id)s.headers"> <title>Headers</title> </library-reference> <index id="%(id)s.classes"> <title>Classes</title> </index> <index id="%(id)s.index"> <title>Index</title> </index> </section> ''' % self.args ) self.section = { 'headers' : self._getChild('library-reference',id='%(id)s.headers' % self.args), 'classes' : self._getChild('index',id='%(id)s.classes' % self.args), 'index' : self._getChild('index',id='%(id)s.index' % self.args) } #~ Remove the index sections if we aren't generating it. if not self.args['index']: self.section['classes'].parentNode.removeChild(self.section['classes']) self.section['classes'].unlink() del self.section['classes'] self.section['index'].parentNode.removeChild(self.section['index']) self.section['index'].unlink() del self.section['index'] #~ The symbols, per Doxygen notion, that we translated. self.symbols = {} #~ Map of Doxygen IDs and BoostBook IDs, so we can translate as needed. self.idmap = {} #~ Marks generation, to prevent redoing it. self.generated = False #~ Add an Doxygen generated XML document to the content we are translating. def addDox( self, document ): self._translateNode(document.documentElement) #~ Turns the internal XML tree into an output UTF-8 string. def tostring( self ): self._generate() #~ return self.boostbook.toprettyxml(' ') return self.boostbook.toxml('utf-8') #~ Does post-processing on the partial generated content to generate additional info #~ now that we have the complete source documents. def _generate( self ): if not self.generated: self.generated = True symbols = self.symbols.keys() symbols.sort() #~ Populate the header section. for symbol in symbols: if self.symbols[symbol]['kind'] in ('header'): self.section['headers'].appendChild(self.symbols[symbol]['dom']) for symbol in symbols: if self.symbols[symbol]['kind'] not in ('namespace', 'header'): container = self._resolveContainer(self.symbols[symbol], self.symbols[self.symbols[symbol]['header']]['dom']) if container.nodeName != 'namespace': ## The current BoostBook to Docbook translation doesn't ## respect, nor assign, IDs to inner types of any kind. ## So nuke the ID entry so as not create bogus links. del self.idmap[self.symbols[symbol]['id']] container.appendChild(self.symbols[symbol]['dom']) self._rewriteIDs(self.boostbook.documentElement) #~ Rewrite the various IDs from Doxygen references to the newly created #~ BoostBook references. def _rewriteIDs( self, node ): if node.nodeName in ('link'): if (self.idmap.has_key(node.getAttribute('linkend'))): #~ A link, and we have someplace to repoint it at. node.setAttribute('linkend',self.idmap[node.getAttribute('linkend')]) else: #~ A link, but we don't have a generated target for it. node.removeAttribute('linkend') elif hasattr(node,'hasAttribute') and node.hasAttribute('id') and self.idmap.has_key(node.getAttribute('id')): #~ Simple ID, and we have a translation. node.setAttribute('id',self.idmap[node.getAttribute('id')]) #~ Recurse, and iterate, depth-first traversal which turns out to be #~ left-to-right and top-to-bottom for the document. if node.firstChild: self._rewriteIDs(node.firstChild) if node.nextSibling: self._rewriteIDs(node.nextSibling) def _resolveContainer( self, cpp, root ): container = root for ns in cpp['namespace']: node = self._getChild('namespace',name=ns,root=container) if not node: node = container.appendChild( self._createNode('namespace',name=ns)) container = node for inner in cpp['name'].split('::'): node = self._getChild(name=inner,root=container) if not node: break container = node return container def _setID( self, id, name ): self.idmap[id] = name.replace('::','.').replace('/','.') #~ print '--| setID:',id,'::',self.idmap[id] #~ Translate a given node within a given context. #~ The translation dispatches to a local method of the form #~ "_translate[_context0,...,_contextN]", and the keyword args are #~ passed along. If there is no translation handling method we #~ return None. def _translateNode( self, *context, **kwargs ): node = None names = [ ] for c in context: if c: if not isinstance(c,xml.dom.Node): suffix = '_'+c.replace('-','_') else: suffix = '_'+c.nodeName.replace('-','_') node = c names.append('_translate') names = map(lambda x: x+suffix,names) if node: for name in names: if hasattr(self,name): return getattr(self,name)(node,**kwargs) return None #~ Translates the children of the given parent node, appending the results #~ to the indicated target. For nodes not translated by the translation method #~ it copies the child over and recurses on that child to translate any #~ possible interior nodes. Hence this will translate the entire subtree. def _translateChildren( self, parent, **kwargs ): target = kwargs['target'] for n in parent.childNodes: child = self._translateNode(n,target=target) if child: target.appendChild(child) else: child = n.cloneNode(False) if hasattr(child,'data'): child.data = re.sub(r'\s+',' ',child.data) target.appendChild(child) self._translateChildren(n,target=child) #~ Translate the given node as a description, into the description subnode #~ of the target. If no description subnode is present in the target it #~ is created. def _translateDescription( self, node, target=None, tag='description', **kwargs ): description = self._getChild(tag,root=target) if not description: description = target.appendChild(self._createNode(tag)) self._translateChildren(node,target=description) return description #~ Top level translation of: <doxygen ...>...</doxygen>, #~ translates the children. def _translate_doxygen( self, node ): #~ print '_translate_doxygen:', node.nodeName result = [] for n in node.childNodes: newNode = self._translateNode(n) if newNode: result.append(newNode) return result #~ Top level translation of: #~ <doxygenindex ...> #~ <compound ...> #~ <member ...> #~ <name>...</name> #~ </member> #~ ... #~ </compound> #~ ... #~ </doxygenindex> #~ builds the class and symbol sections, if requested. def _translate_doxygenindex( self, node ): #~ print '_translate_doxygenindex:', node.nodeName if self.args['index']: entries = [] classes = [] #~ Accumulate all the index entries we care about. for n in node.childNodes: if n.nodeName == 'compound': if n.getAttribute('kind') not in ('file','dir','define'): cpp = self._cppName(self._getChildData('name',root=n)) entry = { 'name' : cpp['name'], 'compoundname' : cpp['compoundname'], 'id' : n.getAttribute('refid') } if n.getAttribute('kind') in ('class','struct'): classes.append(entry) entries.append(entry) for m in n.childNodes: if m.nodeName == 'member': cpp = self._cppName(self._getChildData('name',root=m)) entry = { 'name' : cpp['name'], 'compoundname' : cpp['compoundname'], 'id' : n.getAttribute('refid') } if hasattr(m,'getAttribute') and m.getAttribute('kind') in ('class','struct'): classes.append(entry) entries.append(entry) #~ Put them in a sensible order. entries.sort(lambda x,y: cmp(x['name'].lower(),y['name'].lower())) classes.sort(lambda x,y: cmp(x['name'].lower(),y['name'].lower())) #~ And generate the BoostBook for them. self._translate_index_(entries,target=self.section['index']) self._translate_index_(classes,target=self.section['classes']) return None #~ Translate a set of index entries in the BoostBook output. The output #~ is grouped into groups of the first letter of the entry names. def _translate_index_(self, entries, target=None, **kwargs ): i = 0 targetID = target.getAttribute('id') while i < len(entries): dividerKey = entries[i]['name'][0].upper() divider = target.appendChild(self._createNode('indexdiv',id=targetID+'.'+dividerKey)) divider.appendChild(self._createText('title',dividerKey)) while i < len(entries) and dividerKey == entries[i]['name'][0].upper(): iename = entries[i]['name'] ie = divider.appendChild(self._createNode('indexentry')) ie = ie.appendChild(self._createText('primaryie',iename)) while i < len(entries) and entries[i]['name'] == iename: ie.appendChild(self.boostbook.createTextNode(' (')) ie.appendChild(self._createText( 'link',entries[i]['compoundname'],linkend=entries[i]['id'])) ie.appendChild(self.boostbook.createTextNode(')')) i += 1 #~ Translate a <compounddef ...>...</compounddef>, #~ by retranslating with the "kind" of compounddef. def _translate_compounddef( self, node, target=None, **kwargs ): return self._translateNode(node,node.getAttribute('kind')) #~ Translate a <compounddef kind="namespace"...>...</compounddef>. For #~ namespaces we just collect the information for later use as there is no #~ currently namespaces are not included in the BoostBook format. In the future #~ it might be good to generate a namespace index. def _translate_compounddef_namespace( self, node, target=None, **kwargs ): namespace = { 'id' : node.getAttribute('id'), 'kind' : 'namespace', 'name' : self._getChildData('compoundname',root=node), 'brief' : self._getChildData('briefdescription',root=node), 'detailed' : self._getChildData('detaileddescription',root=node), 'parsed' : False } if self.symbols.has_key(namespace['name']): if not self.symbols[namespace['name']]['parsed']: self.symbols[namespace['name']]['parsed'] = True #~ for n in node.childNodes: #~ if hasattr(n,'getAttribute'): #~ self._translateNode(n,n.getAttribute('kind'),target=target,**kwargs) else: self.symbols[namespace['name']] = namespace #~ self._setID(namespace['id'],namespace['name']) return None #~ Translate a <compounddef kind="class"...>...</compounddef>, which #~ forwards to the kind=struct as they are the same. def _translate_compounddef_class( self, node, target=None, **kwargs ): return self._translate_compounddef_struct(node,tag='class',target=target,**kwargs) #~ Translate a <compounddef kind="struct"...>...</compounddef> into: #~ <header id="?" name="?"> #~ <struct name="?"> #~ ... #~ </struct> #~ </header> def _translate_compounddef_struct( self, node, tag='struct', target=None, **kwargs ): result = None includes = self._getChild('includes',root=node) if includes: ## Add the header into the output table. self._translate_compounddef_includes_(includes,includes,**kwargs) ## Compounds are the declared symbols, classes, types, etc. ## We add them to the symbol table, along with the partial DOM for them ## so that they can be organized into the output later. compoundname = self._getChildData('compoundname',root=node) compoundname = self._cppName(compoundname) self._setID(node.getAttribute('id'),compoundname['compoundname']) struct = self._createNode(tag,name=compoundname['name'].split('::')[-1]) self.symbols[compoundname['compoundname']] = { 'header' : includes.firstChild.data, 'namespace' : compoundname['namespace'], 'id' : node.getAttribute('id'), 'kind' : tag, 'name' : compoundname['name'], 'dom' : struct } ## Add the children which will be the members of the struct. for n in node.childNodes: self._translateNode(n,target=struct,scope=compoundname['compoundname']) result = struct return result #~ Translate a <compounddef ...><includes ...>...</includes></compounddef>, def _translate_compounddef_includes_( self, node, target=None, **kwargs ): name = node.firstChild.data if not self.symbols.has_key(name): self._setID(node.getAttribute('refid'),name) self.symbols[name] = { 'kind' : 'header', 'id' : node.getAttribute('refid'), 'dom' : self._createNode('header', id=node.getAttribute('refid'), name=name) } return None #~ Translate a <basecompoundref...>...</basecompoundref> into: #~ <inherit access="?"> #~ ... #~ </inherit> def _translate_basecompoundref( self, ref, target=None, **kwargs ): inherit = target.appendChild(self._createNode('inherit', access=ref.getAttribute('prot'))) self._translateChildren(ref,target=inherit) return #~ Translate: #~ <templateparamlist> #~ <param> #~ <type>...</type> #~ <declname>...</declname> #~ <defname>...</defname> #~ <defval>...</defval> #~ </param> #~ ... #~ </templateparamlist> #~ Into: #~ <template> #~ <template-type-parameter name="?" /> #~ <template-nontype-parameter name="?"> #~ <type>?</type> #~ <default>?</default> #~ </template-nontype-parameter> #~ </template> def _translate_templateparamlist( self, templateparamlist, target=None, **kwargs ): template = target.appendChild(self._createNode('template')) for param in templateparamlist.childNodes: if param.nodeName == 'param': type = self._getChildData('type',root=param) defval = self._getChild('defval',root=param) paramKind = None if type in ('class','typename'): paramKind = 'template-type-parameter' else: paramKind = 'template-nontype-parameter' templateParam = template.appendChild( self._createNode(paramKind, name=self._getChildData('declname',root=param))) if paramKind == 'template-nontype-parameter': template_type = templateParam.appendChild(self._createNode('type')) self._translate_type( self._getChild('type',root=param),target=template_type) if defval: value = self._getChildData('ref',root=defval.firstChild) if not value: value = self._getData(defval) templateParam.appendChild(self._createText('default',value)) return template #~ Translate: #~ <briefdescription>...</briefdescription> #~ Into: #~ <purpose>...</purpose> def _translate_briefdescription( self, brief, target=None, **kwargs ): self._translateDescription(brief,target=target,**kwargs) return self._translateDescription(brief,target=target,tag='purpose',**kwargs) #~ Translate: #~ <detaileddescription>...</detaileddescription> #~ Into: #~ <description>...</description> def _translate_detaileddescription( self, detailed, target=None, **kwargs ): return self._translateDescription(detailed,target=target,**kwargs) #~ Translate: #~ <sectiondef kind="?">...</sectiondef> #~ With kind specific translation. def _translate_sectiondef( self, sectiondef, target=None, **kwargs ): self._translateNode(sectiondef,sectiondef.getAttribute('kind'),target=target,**kwargs) #~ Translate non-function sections. def _translate_sectiondef_x_( self, sectiondef, target=None, **kwargs ): for n in sectiondef.childNodes: if hasattr(n,'getAttribute'): self._translateNode(n,n.getAttribute('kind'),target=target,**kwargs) return None #~ Translate: #~ <sectiondef kind="public-type">...</sectiondef> def _translate_sectiondef_public_type( self, sectiondef, target=None, **kwargs ): return self._translate_sectiondef_x_(sectiondef,target=target,**kwargs) #~ Translate: #~ <sectiondef kind="public-sttrib">...</sectiondef> def _translate_sectiondef_public_attrib( self, sectiondef, target=None, **kwargs): return self._translate_sectiondef_x_(sectiondef,target=target,**kwargs) #~ Translate: #~ <sectiondef kind="?-func">...</sectiondef> #~ All the various function group translations end up here for which #~ they are translated into: #~ <method-group name="?"> #~ ... #~ </method-group> def _translate_sectiondef_func_( self, sectiondef, name='functions', target=None, **kwargs ): members = target.appendChild(self._createNode('method-group',name=name)) for n in sectiondef.childNodes: if hasattr(n,'getAttribute'): self._translateNode(n,n.getAttribute('kind'),target=members,**kwargs) return members #~ Translate: #~ <sectiondef kind="public-func">...</sectiondef> def _translate_sectiondef_public_func( self, sectiondef, target=None, **kwargs ): return self._translate_sectiondef_func_(sectiondef, name='public member functions',target=target,**kwargs) #~ Translate: #~ <sectiondef kind="public-static-func">...</sectiondef> def _translate_sectiondef_public_static_func( self, sectiondef, target=None, **kwargs): return self._translate_sectiondef_func_(sectiondef, name='public static functions',target=target,**kwargs) #~ Translate: #~ <sectiondef kind="protected-func">...</sectiondef> def _translate_sectiondef_protected_func( self, sectiondef, target=None, **kwargs ): return self._translate_sectiondef_func_(sectiondef, name='protected member functions',target=target,**kwargs) #~ Translate: #~ <sectiondef kind="private-static-func">...</sectiondef> def _translate_sectiondef_private_static_func( self, sectiondef, target=None, **kwargs): return self._translate_sectiondef_func_(sectiondef, name='private static functions',target=target,**kwargs) #~ Translate: #~ <sectiondef kind="public-func">...</sectiondef> def _translate_sectiondef_private_func( self, sectiondef, target=None, **kwargs ): return self._translate_sectiondef_func_(sectiondef, name='private member functions',target=target,**kwargs) #~ Translate: #~ <sectiondef kind="user-defined"><header>...</header>...</sectiondef> def _translate_sectiondef_user_defined( self, sectiondef, target=None, **kwargs ): return self._translate_sectiondef_func_(sectiondef, name=self._getChildData('header', root=sectiondef),target=target,**kwargs) #~ Translate: #~ <memberdef kind="typedef" id="?"> #~ <name>...</name> #~ </memberdef> #~ To: #~ <typedef id="?" name="?"> #~ <type>...</type> #~ </typedef> def _translate_memberdef_typedef( self, memberdef, target=None, scope=None, **kwargs ): self._setID(memberdef.getAttribute('id'), scope+'::'+self._getChildData('name',root=memberdef)) typedef = target.appendChild(self._createNode('typedef', id=memberdef.getAttribute('id'), name=self._getChildData('name',root=memberdef))) typedef_type = typedef.appendChild(self._createNode('type')) self._translate_type(self._getChild('type',root=memberdef),target=typedef_type) return typedef #~ Translate: #~ <memberdef kind="function" id="?" const="?" static="?" explicit="?" inline="?"> #~ <name>...</name> #~ </memberdef> #~ To: #~ <method name="?" cv="?" specifiers="?"> #~ ... #~ </method> def _translate_memberdef_function( self, memberdef, target=None, scope=None, **kwargs ): name = self._getChildData('name',root=memberdef) self._setID(memberdef.getAttribute('id'),scope+'::'+name) ## Check if we have some specific kind of method. if name == scope.split('::')[-1]: kind = 'constructor' target = target.parentNode elif name == '~'+scope.split('::')[-1]: kind = 'destructor' target = target.parentNode elif name == 'operator=': kind = 'copy-assignment' target = target.parentNode else: kind = 'method' method = target.appendChild(self._createNode(kind, # id=memberdef.getAttribute('id'), name=name, cv=' '.join([ if_attribute(memberdef,'const','const','').strip() ]), specifiers=' '.join([ if_attribute(memberdef,'static','static',''), if_attribute(memberdef,'explicit','explicit',''), if_attribute(memberdef,'inline','inline','') ]).strip() )) ## We iterate the children to translate each part of the function. for n in memberdef.childNodes: self._translateNode(memberdef,'function',n,target=method) return method #~ Translate: #~ <memberdef kind="function"...><templateparamlist>...</templateparamlist></memberdef> def _translate_memberdef_function_templateparamlist( self, templateparamlist, target=None, **kwargs ): return self._translate_templateparamlist(templateparamlist,target=target,**kwargs) #~ Translate: #~ <memberdef kind="function"...><type>...</type></memberdef> #~ To: #~ ...<type>?</type> def _translate_memberdef_function_type( self, resultType, target=None, **kwargs ): methodType = self._createNode('type') self._translate_type(resultType,target=methodType) if methodType.hasChildNodes(): target.appendChild(methodType) return methodType #~ Translate: #~ <memberdef kind="function"...><briefdescription>...</briefdescription></memberdef> def _translate_memberdef_function_briefdescription( self, description, target=None, **kwargs ): result = self._translateDescription(description,target=target,**kwargs) ## For functions if we translate the brief docs to the purpose they end up ## right above the regular description. And since we just added the brief to that ## on the previous line, don't bother with the repetition. # result = self._translateDescription(description,target=target,tag='purpose',**kwargs) return result #~ Translate: #~ <memberdef kind="function"...><detaileddescription>...</detaileddescription></memberdef> def _translate_memberdef_function_detaileddescription( self, description, target=None, **kwargs ): return self._translateDescription(description,target=target,**kwargs) #~ Translate: #~ <memberdef kind="function"...><inbodydescription>...</inbodydescription></memberdef> def _translate_memberdef_function_inbodydescription( self, description, target=None, **kwargs ): return self._translateDescription(description,target=target,**kwargs) #~ Translate: #~ <memberdef kind="function"...><param>...</param></memberdef> def _translate_memberdef_function_param( self, param, target=None, **kwargs ): return self._translate_param(param,target=target,**kwargs) #~ Translate: #~ <memberdef kind="variable" id="?"> #~ <name>...</name> #~ <type>...</type> #~ </memberdef> #~ To: #~ <data-member id="?" name="?"> #~ <type>...</type> #~ </data-member> def _translate_memberdef_variable( self, memberdef, target=None, scope=None, **kwargs ): self._setID(memberdef.getAttribute('id'), scope+'::'+self._getChildData('name',root=memberdef)) data_member = target.appendChild(self._createNode('data-member', id=memberdef.getAttribute('id'), name=self._getChildData('name',root=memberdef))) data_member_type = data_member.appendChild(self._createNode('type')) self._translate_type(self._getChild('type',root=memberdef),target=data_member_type) #~ Translate: #~ <memberdef kind="enum" id="?"> #~ <name>...</name> #~ ... #~ </memberdef> #~ To: #~ <enum id="?" name="?"> #~ ... #~ </enum> def _translate_memberdef_enum( self, memberdef, target=None, scope=None, **kwargs ): self._setID(memberdef.getAttribute('id'), scope+'::'+self._getChildData('name',root=memberdef)) enum = target.appendChild(self._createNode('enum', id=memberdef.getAttribute('id'), name=self._getChildData('name',root=memberdef))) for n in memberdef.childNodes: self._translateNode(memberdef,'enum',n,target=enum,scope=scope,**kwargs) return enum #~ Translate: #~ <memberdef kind="enum"...> #~ <enumvalue id="?"> #~ <name>...</name> #~ <initializer>...</initializer> #~ </enumvalue> #~ </memberdef> #~ To: #~ <enumvalue id="?" name="?"> #~ <default>...</default> #~ </enumvalue> def _translate_memberdef_enum_enumvalue( self, enumvalue, target=None, scope=None, **kwargs ): self._setID(enumvalue.getAttribute('id'), scope+'::'+self._getChildData('name',root=enumvalue)) value = target.appendChild(self._createNode('enumvalue', id=enumvalue.getAttribute('id'), name=self._getChildData('name',root=enumvalue))) initializer = self._getChild('initializer',root=enumvalue) if initializer: self._translateChildren(initializer, target=target.appendChild(self._createNode('default'))) return value #~ Translate: #~ <param> #~ <type>...</type> #~ <declname>...</declname> #~ <defval>...</defval> #~ </param> #~ To: #~ <parameter name="?"> #~ <paramtype>...</paramtype> #~ ... #~ </parameter> def _translate_param( self, param, target=None, **kwargs): parameter = target.appendChild(self._createNode('parameter', name=self._getChildData('declname',root=param))) paramtype = parameter.appendChild(self._createNode('paramtype')) self._translate_type(self._getChild('type',root=param),target=paramtype) defval = self._getChild('defval',root=param) if defval: self._translateChildren(self._getChild('defval',root=param),target=parameter) return parameter #~ Translate: #~ <ref kindref="?" ...>...</ref> def _translate_ref( self, ref, **kwargs ): return self._translateNode(ref,ref.getAttribute('kindref')) #~ Translate: #~ <ref refid="?" kindref="compound">...</ref> #~ To: #~ <link linkend="?"><classname>...</classname></link> def _translate_ref_compound( self, ref, **kwargs ): result = self._createNode('link',linkend=ref.getAttribute('refid')) classname = result.appendChild(self._createNode('classname')) self._translateChildren(ref,target=classname) return result #~ Translate: #~ <ref refid="?" kindref="member">...</ref> #~ To: #~ <link linkend="?">...</link> def _translate_ref_member( self, ref, **kwargs ): result = self._createNode('link',linkend=ref.getAttribute('refid')) self._translateChildren(ref,target=result) return result #~ Translate: #~ <type>...</type> def _translate_type( self, type, target=None, **kwargs ): result = self._translateChildren(type,target=target,**kwargs) #~ Filter types to clean up various readability problems, most notably #~ with really long types. xml = target.toxml('utf-8'); if ( xml.startswith('<type>boost::mpl::') or xml.startswith('<type>BOOST_PP_') or re.match('<type>boost::(lazy_)?(enable|disable)_if',xml) ): while target.firstChild: target.removeChild(target.firstChild) target.appendChild(self._createText('emphasis','unspecified')) return result def _getChild( self, tag = None, id = None, name = None, root = None ): if not root: root = self.boostbook.documentElement for n in root.childNodes: found = True if tag and found: found = found and tag == n.nodeName if id and found: if n.hasAttribute('id'): found = found and n.getAttribute('id') == id else: found = found and n.hasAttribute('id') and n.getAttribute('id') == id if name and found: found = found and n.hasAttribute('name') and n.getAttribute('name') == name if found: #~ print '--|', n return n return None def _getChildData( self, tag, **kwargs ): return self._getData(self._getChild(tag,**kwargs),**kwargs) def _getData( self, node, **kwargs ): if node: text = self._getChild('#text',root=node) if text: return text.data.strip() return '' def _cppName( self, type ): parts = re.search('^([^<]+)[<]?(.*)[>]?$',type.strip().strip(':')) result = { 'compoundname' : parts.group(1), 'namespace' : parts.group(1).split('::')[0:-1], 'name' : parts.group(1).split('::')[-1], 'specialization' : parts.group(2) } if result['namespace'] and len(result['namespace']) > 0: namespace = '::'.join(result['namespace']) while ( len(result['namespace']) > 0 and ( not self.symbols.has_key(namespace) or self.symbols[namespace]['kind'] != 'namespace') ): result['name'] = result['namespace'].pop()+'::'+result['name'] namespace = '::'.join(result['namespace']) return result def _createNode( self, tag, **kwargs ): result = self.boostbook.createElement(tag) for k in kwargs.keys(): if kwargs[k] != '': if k == 'id': result.setAttribute('id',kwargs[k]) else: result.setAttribute(k,kwargs[k]) return result def _createText( self, tag, data, **kwargs ): result = self._createNode(tag,**kwargs) data = data.strip() if len(data) > 0: result.appendChild(self.boostbook.createTextNode(data)) return result def main( xmldir=None, output=None, id=None, title=None, index=False ): #~ print '--- main: xmldir = %s, output = %s' % (xmldir,output) input = glob.glob( os.path.abspath( os.path.join( xmldir, "*.xml" ) ) ) input.sort translator = Doxygen2BoostBook(id=id, title=title, index=index) #~ Feed in the namespaces first to build up the set of namespaces #~ and definitions so that lookup is unambiguous when reading in the definitions. namespace_files = filter( lambda x: os.path.basename(x).startswith('namespace'), input) decl_files = filter( lambda x: not os.path.basename(x).startswith('namespace') and not os.path.basename(x).startswith('_'), input) for dox in namespace_files: #~ print '--|',os.path.basename(dox) translator.addDox(xml.dom.minidom.parse(dox)) for dox in decl_files: #~ print '--|',os.path.basename(dox) translator.addDox(xml.dom.minidom.parse(dox)) if output: output = open(output,'w') else: output = sys.stdout if output: output.write(translator.tostring()) main( **get_args() )
mit
kifcaliph/odoo
addons/website/models/ir_http.py
41
13868
# -*- coding: utf-8 -*- import datetime import hashlib import logging import os import re import traceback import werkzeug import werkzeug.routing import werkzeug.utils import openerp from openerp.addons.base import ir from openerp.addons.base.ir import ir_qweb from openerp.addons.website.models.website import slug, url_for, _UNSLUG_RE from openerp.http import request from openerp.tools import config from openerp.osv import orm logger = logging.getLogger(__name__) class RequestUID(object): def __init__(self, **kw): self.__dict__.update(kw) class ir_http(orm.AbstractModel): _inherit = 'ir.http' rerouting_limit = 10 geo_ip_resolver = None def _get_converters(self): return dict( super(ir_http, self)._get_converters(), model=ModelConverter, page=PageConverter, ) def _auth_method_public(self): # TODO: select user_id from matching website if not request.session.uid: request.uid = self.pool['ir.model.data'].xmlid_to_res_id(request.cr, openerp.SUPERUSER_ID, 'base.public_user') else: request.uid = request.session.uid def _dispatch(self): first_pass = not hasattr(request, 'website') request.website = None func = None try: func, arguments = self._find_handler() request.website_enabled = func.routing.get('website', False) except werkzeug.exceptions.NotFound: # either we have a language prefixed route, either a real 404 # in all cases, website processes them request.website_enabled = True request.website_multilang = request.website_enabled and func and func.routing.get('multilang', True) if 'geoip' not in request.session: record = {} if self.geo_ip_resolver is None: try: import GeoIP # updated database can be downloaded on MaxMind website # http://dev.maxmind.com/geoip/legacy/install/city/ geofile = config.get('geoip_database') if os.path.exists(geofile): self.geo_ip_resolver = GeoIP.open(geofile, GeoIP.GEOIP_STANDARD) else: self.geo_ip_resolver = False logger.warning('GeoIP database file %r does not exists', geofile) except ImportError: self.geo_ip_resolver = False if self.geo_ip_resolver and request.httprequest.remote_addr: record = self.geo_ip_resolver.record_by_addr(request.httprequest.remote_addr) or {} request.session['geoip'] = record if request.website_enabled: try: if func: self._authenticate(func.routing['auth']) else: self._auth_method_public() except Exception as e: return self._handle_exception(e) request.redirect = lambda url, code=302: werkzeug.utils.redirect(url_for(url), code) request.website = request.registry['website'].get_current_website(request.cr, request.uid, context=request.context) langs = [lg[0] for lg in request.website.get_languages()] path = request.httprequest.path.split('/') if first_pass: if request.website_multilang: # If the url doesn't contains the lang and that it's the first connection, we to retreive the user preference if it exists. if not path[1] in langs and not request.httprequest.cookies.get('session_id'): if request.lang not in langs: # Try to find a similar lang. Eg: fr_BE and fr_FR short = request.lang.split('_')[0] langs_withshort = [lg[0] for lg in request.website.get_languages() if lg[0].startswith(short)] if len(langs_withshort): request.lang = langs_withshort[0] else: request.lang = request.website.default_lang_code # We redirect with the right language in url if request.lang != request.website.default_lang_code: path.insert(1, request.lang) path = '/'.join(path) or '/' return request.redirect(path + '?' + request.httprequest.query_string) else: request.lang = request.website.default_lang_code request.context['lang'] = request.lang if not func: if path[1] in langs: request.lang = request.context['lang'] = path.pop(1) path = '/'.join(path) or '/' if request.lang == request.website.default_lang_code: # If language is in the url and it is the default language, redirect # to url without language so google doesn't see duplicate content return request.redirect(path + '?' + request.httprequest.query_string, code=301) return self.reroute(path) # bind modified context request.website = request.website.with_context(request.context) return super(ir_http, self)._dispatch() def reroute(self, path): if not hasattr(request, 'rerouting'): request.rerouting = [request.httprequest.path] if path in request.rerouting: raise Exception("Rerouting loop is forbidden") request.rerouting.append(path) if len(request.rerouting) > self.rerouting_limit: raise Exception("Rerouting limit exceeded") request.httprequest.environ['PATH_INFO'] = path # void werkzeug cached_property. TODO: find a proper way to do this for key in ('path', 'full_path', 'url', 'base_url'): request.httprequest.__dict__.pop(key, None) return self._dispatch() def _postprocess_args(self, arguments, rule): super(ir_http, self)._postprocess_args(arguments, rule) for key, val in arguments.items(): # Replace uid placeholder by the current request.uid if isinstance(val, orm.BaseModel) and isinstance(val._uid, RequestUID): arguments[key] = val.sudo(request.uid) try: _, path = rule.build(arguments) assert path is not None except Exception, e: return self._handle_exception(e, code=404) if getattr(request, 'website_multilang', False) and request.httprequest.method in ('GET', 'HEAD'): generated_path = werkzeug.url_unquote_plus(path) current_path = werkzeug.url_unquote_plus(request.httprequest.path) if generated_path != current_path: if request.lang != request.website.default_lang_code: path = '/' + request.lang + path if request.httprequest.query_string: path += '?' + request.httprequest.query_string return werkzeug.utils.redirect(path, code=301) def _serve_attachment(self): domain = [('type', '=', 'binary'), ('url', '=', request.httprequest.path)] attach = self.pool['ir.attachment'].search_read(request.cr, openerp.SUPERUSER_ID, domain, ['__last_update', 'datas', 'mimetype'], context=request.context) if attach: wdate = attach[0]['__last_update'] datas = attach[0]['datas'] response = werkzeug.wrappers.Response() server_format = openerp.tools.misc.DEFAULT_SERVER_DATETIME_FORMAT try: response.last_modified = datetime.datetime.strptime(wdate, server_format + '.%f') except ValueError: # just in case we have a timestamp without microseconds response.last_modified = datetime.datetime.strptime(wdate, server_format) response.set_etag(hashlib.sha1(datas).hexdigest()) response.make_conditional(request.httprequest) if response.status_code == 304: return response response.mimetype = attach[0]['mimetype'] or 'application/octet-stream' response.data = datas.decode('base64') return response def _handle_exception(self, exception, code=500): # This is done first as the attachment path may # not match any HTTP controller, so the request # may not be website-enabled. attach = self._serve_attachment() if attach: return attach is_website_request = bool(getattr(request, 'website_enabled', False) and request.website) if not is_website_request: # Don't touch non website requests exception handling return super(ir_http, self)._handle_exception(exception) else: try: response = super(ir_http, self)._handle_exception(exception) if isinstance(response, Exception): exception = response else: # if parent excplicitely returns a plain response, then we don't touch it return response except Exception, e: exception = e values = dict( exception=exception, traceback=traceback.format_exc(exception), ) code = getattr(exception, 'code', code) if isinstance(exception, openerp.exceptions.AccessError): code = 403 if isinstance(exception, ir_qweb.QWebException): values.update(qweb_exception=exception) if isinstance(exception.qweb.get('cause'), openerp.exceptions.AccessError): code = 403 if isinstance(exception, werkzeug.exceptions.HTTPException) and code is None: # Hand-crafted HTTPException likely coming from abort(), # usually for a redirect response -> return it directly return exception if code == 500: logger.error("500 Internal Server Error:\n\n%s", values['traceback']) if 'qweb_exception' in values: view = request.registry.get("ir.ui.view") views = view._views_get(request.cr, request.uid, exception.qweb['template'], request.context) to_reset = [v for v in views if v.model_data_id.noupdate is True and not v.page] values['views'] = to_reset elif code == 403: logger.warn("403 Forbidden:\n\n%s", values['traceback']) values.update( status_message=werkzeug.http.HTTP_STATUS_CODES[code], status_code=code, ) if not request.uid: self._auth_method_public() try: html = request.website._render('website.%s' % code, values) except Exception: html = request.website._render('website.http_error', values) return werkzeug.wrappers.Response(html, status=code, content_type='text/html;charset=utf-8') class ModelConverter(ir.ir_http.ModelConverter): def __init__(self, url_map, model=False, domain='[]'): super(ModelConverter, self).__init__(url_map, model) self.domain = domain self.regex = _UNSLUG_RE.pattern def to_url(self, value): return slug(value) def to_python(self, value): m = re.match(self.regex, value) _uid = RequestUID(value=value, match=m, converter=self) record_id = int(m.group(2)) if record_id < 0: # limited support for negative IDs due to our slug pattern, assume abs() if not found if not request.registry[self.model].exists(request.cr, _uid, [record_id]): record_id = abs(record_id) return request.registry[self.model].browse( request.cr, _uid, record_id, context=request.context) def generate(self, cr, uid, query=None, args=None, context=None): obj = request.registry[self.model] domain = eval( self.domain, (args or {}).copy()) if query: domain.append((obj._rec_name, 'ilike', '%'+query+'%')) for record in obj.search_read(cr, uid, domain=domain, fields=['write_date',obj._rec_name], context=context): if record.get(obj._rec_name, False): yield {'loc': (record['id'], record[obj._rec_name])} class PageConverter(werkzeug.routing.PathConverter): """ Only point of this converter is to bundle pages enumeration logic """ def generate(self, cr, uid, query=None, args={}, context=None): View = request.registry['ir.ui.view'] views = View.search_read(cr, uid, [['page', '=', True]], fields=['xml_id','priority','write_date'], order='name', context=context) for view in views: xid = view['xml_id'].startswith('website.') and view['xml_id'][8:] or view['xml_id'] # the 'page/homepage' url is indexed as '/', avoid aving the same page referenced twice # when we will have an url mapping mechanism, replace this by a rule: page/homepage --> / if xid=='homepage': continue if query and query.lower() not in xid.lower(): continue record = {'loc': xid} if view['priority'] <> 16: record['__priority'] = min(round(view['priority'] / 32.0,1), 1) if view['write_date']: record['__lastmod'] = view['write_date'][:10] yield record
agpl-3.0
VirtueSecurity/aws-extender
BappModules/boto/glacier/exceptions.py
185
2195
# -*- coding: utf-8 -*- # Copyright (c) 2012 Thomas Parslow http://almostobsolete.net/ # # Permission is hereby granted, free of charge, to any person obtaining a # copy of this software and associated documentation files (the # "Software"), to deal in the Software without restriction, including # without limitation the rights to use, copy, modify, merge, publish, dis- # tribute, sublicense, and/or sell copies of the Software, and to permit # persons to whom the Software is furnished to do so, subject to the fol- # lowing conditions: # # The above copyright notice and this permission notice shall be included # in all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS # OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABIL- # ITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT # SHALL THE AUTHOR BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, # WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS # IN THE SOFTWARE. # from boto.compat import json class UnexpectedHTTPResponseError(Exception): def __init__(self, expected_responses, response): self.status = response.status self.body = response.read() self.code = None try: body = json.loads(self.body) self.code = body["code"] msg = 'Expected %s, got ' % expected_responses msg += '(%d, code=%s, message=%s)' % (response.status, self.code, body["message"]) except Exception: msg = 'Expected %s, got (%d, %s)' % (expected_responses, response.status, self.body) super(UnexpectedHTTPResponseError, self).__init__(msg) class ArchiveError(Exception): pass class UploadArchiveError(ArchiveError): pass class DownloadArchiveError(ArchiveError): pass class TreeHashDoesNotMatchError(ArchiveError): pass
mit
wfxiang08/django197
django/contrib/gis/gdal/raster/const.py
253
1539
""" GDAL - Constant definitions """ from ctypes import ( c_double, c_float, c_int16, c_int32, c_ubyte, c_uint16, c_uint32, ) # See http://www.gdal.org/gdal_8h.html#a22e22ce0a55036a96f652765793fb7a4 GDAL_PIXEL_TYPES = { 0: 'GDT_Unknown', # Unknown or unspecified type 1: 'GDT_Byte', # Eight bit unsigned integer 2: 'GDT_UInt16', # Sixteen bit unsigned integer 3: 'GDT_Int16', # Sixteen bit signed integer 4: 'GDT_UInt32', # Thirty-two bit unsigned integer 5: 'GDT_Int32', # Thirty-two bit signed integer 6: 'GDT_Float32', # Thirty-two bit floating point 7: 'GDT_Float64', # Sixty-four bit floating point 8: 'GDT_CInt16', # Complex Int16 9: 'GDT_CInt32', # Complex Int32 10: 'GDT_CFloat32', # Complex Float32 11: 'GDT_CFloat64', # Complex Float64 } # A list of gdal datatypes that are integers. GDAL_INTEGER_TYPES = [1, 2, 3, 4, 5] # Lookup values to convert GDAL pixel type indices into ctypes objects. # The GDAL band-io works with ctypes arrays to hold data to be written # or to hold the space for data to be read into. The lookup below helps # selecting the right ctypes object for a given gdal pixel type. GDAL_TO_CTYPES = [ None, c_ubyte, c_uint16, c_int16, c_uint32, c_int32, c_float, c_double, None, None, None, None ] # List of resampling algorithms that can be used to warp a GDALRaster. GDAL_RESAMPLE_ALGORITHMS = { 'NearestNeighbour': 0, 'Bilinear': 1, 'Cubic': 2, 'CubicSpline': 3, 'Lanczos': 4, 'Average': 5, 'Mode': 6, }
bsd-3-clause
marcialhernandez/Proyecto-titulacion
Pytaxo/Modulos/Definiciones/MC_definicionPareada.py
1
23065
#!/usr/bin/env python # -*- coding: utf-8 -*- #import sys import itertools, hashlib, threading,copy, logging from archivos import nombres, xmlSalida from clases import plantilla,alternativa try: import xml.etree.cElementTree as ET except ImportError: import xml.etree.ElementTree as ET logging.basicConfig( level=logging.DEBUG, format='[%(levelname)s] (%(threadName)-10s) %(message)s',) class Total(object): def __init__(self, valorInicial=0): self.lock = threading.Lock() self.valor = valorInicial def incrementar(self,incremento): logging.debug('Waiting for lock') self.lock.acquire() try: logging.debug('Acquired lock') self.valor = self.valor + incremento finally: self.lock.release() #Convierte una lista de lista de alternativas en una lista de alternativas def comprimeAlternativas(MatrizAlternativas): listaAlternativasComprimidas=list() for cadaListaAlternativas in MatrizAlternativas: listaAlternativasComprimidas.append(comprimeAlternativasSingle(cadaListaAlternativas)) return listaAlternativasComprimidas #Convierte lista de alternativas en una alternativa ##(Debido a que cada alternativa es realidad un grupo de terminos que tambien son alternativas) def comprimeAlternativasSingle(listaAlternativas): llave='' tipo='' puntaje=0 glosa='' comentarios='' for cadaAlternativa in listaAlternativas: llave+=cadaAlternativa.llave if cadaAlternativa.tipo not in tipo: tipo+=cadaAlternativa.tipo+' ' puntaje+=int(cadaAlternativa.puntaje) glosa+='"'+cadaAlternativa.glosa+'" ' #se debe agregar con rstrip() if hasattr(cadaAlternativa,'comentario')==True: comentarios+='"'+cadaAlternativa.comentario+'" ' else: if cadaAlternativa.tipo=='solucion': comentarios+='"Termino correcto"'+' ' else: comentarios+='"Sin comentario"'+' ' if 'solucion' in tipo and 'distractor' in tipo: tipo='distractor' #puntaje=float(puntaje)/cantidadAlternativas #print puntaje return alternativa.alternativa(llave,tipo.rstrip(),float(puntaje)/len(listaAlternativas),glosa.rstrip(),comentario=comentarios.rstrip()) #No preserva el orden y no admite datos tipo list() como por ejemplo matrices def quitaDuplicados(seq): return {}.fromkeys(seq).keys() def retornaSignificadoCadena(cadenaSimbolos,xmlEntradaObject,distractores,solucion,cantidadAlternativas,**kwuargs): listaCombinatoria=list() listaConjuntoAlternativas=list() listaConjuntoDistractores=None #Caso en que tenga varios comandos if '+' in cadenaSimbolos: for simbolos in quitaDuplicados(cadenaSimbolos.split('+')): for conjunto in retornaSignificadoSimbolo(simbolos, xmlEntradaObject, distractores, solucion): if conjunto not in listaCombinatoria: listaCombinatoria.append(conjunto) listaConjuntoDistractores=list(itertools.combinations(listaCombinatoria, cantidadAlternativas)) else: listaConjuntoDistractores=list(itertools.combinations(retornaSignificadoSimbolo(cadenaSimbolos, xmlEntradaObject, distractores, solucion), cantidadAlternativas)) if len(listaConjuntoDistractores)>0: for conjunto in listaConjuntoDistractores: conjunto=list(conjunto) conjunto.append(comprimeAlternativasSingle(solucion)) if 'orderBy' in kwuargs.keys(): if kwuargs['orderBy'].lower()=='largocreciente': conjunto.sort(key=lambda x:len(x.glosa)) elif kwuargs['orderBy'].lower()=='largodecreciente': conjunto.sort(key=lambda x:len(x.glosa),reverse=True) elif kwuargs['orderBy'].lower()=='alfabeticocreciente': conjunto.sort(key=lambda x:x.glosa.lower) elif kwuargs['orderBy'].lower()=='alfabeticodecreciente': conjunto.sort(key=lambda x:x.glosa.lower,reverse=True) else: #No se ordena quedando la alternativa solucion siempre al final pass #Luego se agrega el conjunto al conjunto de alternativas Validas listaConjuntoAlternativas.append(conjunto) #Si no se presenta el comando, no se ordena quedando la alternativa solucion siempre al final else: listaConjuntoAlternativas.append(conjunto) return listaConjuntoAlternativas def retornaSignificadoSimbolo(simbolo,xmlEntradaObject,distractores,solucion): simbolo=simbolo.lstrip().rstrip().lower() if simbolo.isdigit()==True: if int(simbolo)<=0: return list() else: return pozoDistractoresNesimo(xmlEntradaObject,distractores,int(simbolo),solucion=solucion) else: return list() def posiblesSolucionesYDistractoresConjunto(xmlEntradaObject,conjuntoTerminos): salida=dict() listaDeListaDeOpciones=list() distractores=list() for cadaDefinicion in conjuntoTerminos: posiblesTerminos=list() for cadaTermino in xmlEntradaObject.alternativas['terminos'][cadaDefinicion]: posiblesTerminos.append(cadaTermino) listaDeListaDeOpciones.append(posiblesTerminos) if cadaDefinicion in xmlEntradaObject.alternativas['distractores'].keys(): #Con esto se evita errores de intentar acceder a una llave que no existe for cadaDistractor in xmlEntradaObject.alternativas['distractores'][cadaDefinicion]: distractores.append(cadaDistractor) #Se obtiene una lista de posibles soluciones de la variante actual salida['soluciones']=list(itertools.product(*listaDeListaDeOpciones)) salida['distractores']=distractores return salida #def pozoDistractoresNesimo(xmlEntradaObject,solucion,distractores,cantidadDistractores,**kwargs):#cantidadDistractores,pozoNesimo) def pozoDistractoresNesimo(xmlEntradaObject,distractores,cantidadReemplazoDistractores,**kwargs):#cantidadDistractores,pozoNesimo) #Implica que es el primer ciclo if 'solucion' in kwargs.keys(): pozoDistractoresN=list() #Si quiere 0 reemplazos por los distractores, , es la solucion misma if cantidadReemplazoDistractores<=0 or len(distractores)==0: pozoDistractoresN.append(kwargs['solucion']) return pozoDistractoresN #Se valida que la cantidad de distractores pedidos puedan ser soportados por los distractores que se piden #En caso que no hayan distractores, no se realizara este proceso if len(xmlEntradaObject.alternativas['distractores'].keys())<=cantidadReemplazoDistractores: cantidadReemplazoDistractores=len(xmlEntradaObject.alternativas['distractores'].keys()) for cadaDistractor in distractores: contador=0 for cadaTermino in kwargs['solucion']: if cadaTermino.llave==cadaDistractor.llave: conjuntoDistractor=list(kwargs['solucion']) conjuntoDistractor[contador]=cadaDistractor if conjuntoDistractor not in pozoDistractoresN: pozoDistractoresN.append(conjuntoDistractor) break contador+=1 cantidadReemplazoDistractores=cantidadReemplazoDistractores-1 #Se termina recursion if cantidadReemplazoDistractores==0: return comprimeAlternativas(pozoDistractoresN) else: return pozoDistractoresNesimo(xmlEntradaObject,distractores,cantidadReemplazoDistractores,nuevoPozo=pozoDistractoresN) #Implica que es el nesimo ciclo if 'nuevoPozo' in kwargs.keys(): pozoDistractoresD=list() for cadaConjunto in kwargs['nuevoPozo']: for cadaDistractor in distractores: contador=0 for cadaTermino in cadaConjunto: if cadaTermino.llave==cadaDistractor.llave and cadaTermino.tipo=='solucion': conjuntoDistractor=cadaConjunto[:] conjuntoDistractor[contador]=cadaDistractor if conjuntoDistractor not in pozoDistractoresD: pozoDistractoresD.append(conjuntoDistractor) break contador+=1 cantidadReemplazoDistractores=cantidadReemplazoDistractores-1 if cantidadReemplazoDistractores==0: return comprimeAlternativas(pozoDistractoresD) else: return pozoDistractoresNesimo(xmlEntradaObject,distractores,cantidadReemplazoDistractores,nuevoPozo=pozoDistractoresD) #No es solucion pues uno de sus terminos es en realidad un distractor #reemplazar 1 elemento #de la solucion por 1 de la lista de distractores #el reemplazo tiene que se por ID, significa que se reemplaza #un termino por su propio distractor def pozoDistractoresSingle(xmlEntradaObject,solucion,distractores): pozoDistractoresS=list() if len(distractores)>=1: #En caso que no hayan distractores, no se realizara este proceso for cadaDistractor in distractores: contador=0 for cadaTermino in solucion: if cadaTermino.llave==cadaDistractor.llave: conjuntoDistractor=list(solucion) conjuntoDistractor[contador]=cadaDistractor if conjuntoDistractor not in pozoDistractoresS: pozoDistractoresS.append(conjuntoDistractor) break contador+=1 return pozoDistractoresS def pozoDistractoresDouble(xmlEntradaObject,solucion,distractores): pozoDistractoresD=list() #En caso que no hayan mas de un tipo de distractor, no se realizara este proceso if len(xmlEntradaObject.alternativas['distractores'].keys())>1: pozoDistractoresS=pozoDistractoresSingle(xmlEntradaObject, solucion, distractores) for cadaConjunto in pozoDistractoresS: for cadaDistractor in distractores: contador=0 for cadaTermino in cadaConjunto: if cadaTermino.llave==cadaDistractor.llave and cadaTermino.tipo=='solucion': conjuntoDistractor=cadaConjunto[:] conjuntoDistractor[contador]=cadaDistractor if conjuntoDistractor not in pozoDistractoresD: pozoDistractoresD.append(conjuntoDistractor) break contador+=1 return pozoDistractoresD #Admite entrada kwuargs[] 'especificacion' de la forma #2+1 ->alternativas derivadas de distractores con 1 y 2 reemplazos #1+1 ->alternativas derivadas de distractores con 1 reemplazo (se eliminan repetidos) #2 ->alternativas derivadas de distractores que tienen si o si 2 reemplazos #admite n sumas, pero entre más tenga, más recursos utiliza #ejemplo -> 1+2+3 #0 ->retorna una lista vacia #0+1 -> genera alternativas derivadas de distractores que tienen si o si 1 reemplazo #En caso que no se especifique, genera alternativas correspondientes a la entrada 1+2 #Admite entrada kwuargs[] 'orderBy' para ordenar los conjuntos por medio de un criterio #Admite entrada kwuargs[] 'creciente', si es True los ordena de menor a mayor, False de menor a mayor #Los criterios disponibles son largo y alfabetico, por default sin orden y la solucion sera la ultima alternativa def agrupamientoPareado(xmlEntradaObject,solucion,distractores,cantidadAlternativas,**kwuargs): if 'especificacion' in kwuargs.keys(): if 'orderBy' in kwuargs.keys(): return retornaSignificadoCadena(kwuargs['especificacion'],xmlEntradaObject,distractores,solucion,cantidadAlternativas-1,orderBy=kwuargs['orderBy']) else: return retornaSignificadoCadena(kwuargs['especificacion'],xmlEntradaObject,distractores,solucion,cantidadAlternativas-1) #default ->1+2 else: if 'orderBy' in kwuargs.keys(): return retornaSignificadoCadena('1+2',xmlEntradaObject,distractores,solucion,cantidadAlternativas-1,orderBy=kwuargs['orderBy']) else: return retornaSignificadoCadena('1+2',xmlEntradaObject,distractores,solucion,cantidadAlternativas-1) #Valida el correcto funcionamiento, reemplazando el return por listaAlternativas # print type(listaAlternativas) # print len(listaAlternativas) # for conjunto in listaAlternativas: # print 'conjunto' # for elem in conjunto: # print elem.tipo def procesoPareador(conjuntoDefiniciones,plantillaSalida,xmlEntradaObject,cantidadAlternativas,banderaEstado,directorioSalida, total): #Se tiene que pasar una copia de subraizSalida si se quiere utilizar con hebras #falta revisar como hacer que todas las hebras puedan incrementar el total, para luego imprimirlo #de momento cada una lo incrementa, pero este efecto no se ve reflejado en la variable global subRaizSalida=None for elem in plantillaSalida.iter('opciones'): subRaizSalida=elem # Proceso necesario cuando era monohebra # for elem in subRaizSalida.getchildren(): # subRaizSalida.remove(elem) contador=0 # for elem in subRaizSalida.getchildren(): # subRaizSalida.remove(elem) seccionDefiniciones=ET.SubElement(subRaizSalida,'definiciones') idPreguntaGenerada="" for definicion in conjuntoDefiniciones: subRaizDefinicion=ET.SubElement(seccionDefiniciones,'definicion') subRaizDefinicion.text=definicion idPreguntaGenerada+=definicion+' ' idPreguntaGenerada=hashlib.sha256(idPreguntaGenerada.rstrip()).hexdigest() for x in plantillaSalida.iter('plantilla'): x.set('id', idPreguntaGenerada) #Seccion donde estaran los terminos seccionTerminos=ET.SubElement(subRaizSalida,'terminos') #Seccion donde estaran las alternativas seccionAlternativas=ET.SubElement(subRaizSalida,'conjuntoAlternativas') #Aqui se presenta cada posible pregunta solucionesYDistractores=posiblesSolucionesYDistractoresConjunto(xmlEntradaObject,conjuntoDefiniciones) #Para cada solucion de la variante actual for solucion in solucionesYDistractores['soluciones']: listaTerminos=list(solucion)+solucionesYDistractores['distractores'] #Aqui se presenta el ordenamiento en que aparecen los terminos en el enunciado #Por default sera alfabetico creciente if xmlEntradaObject.ordenTerminos.lower()=='alfabeticocreciente': listaTerminos.sort(key=lambda x:x.glosa.lower()) elif xmlEntradaObject.ordenTerminos.lower()=='alfabeticodecreciente': listaTerminos.sort(key=lambda x:x.glosa.lower, reverse=True) elif xmlEntradaObject.ordenTerminos.lower()=='largocreciente': listaTerminos.sort(key=lambda x:len(x.glosa)) elif xmlEntradaObject.ordenTerminos.lower()=='largodecreciente': listaTerminos.sort(key=lambda x:len(x.glosa), reverse=True) else: #No se ordena pass #Por cada ciclo debo eliminar los hijos de la seccion terminos y poner los nuevos for elem in seccionTerminos.getchildren(): seccionTerminos.remove(elem) #Agrego los posibles terminos for cadaTermino in listaTerminos: subRaizTermino=ET.SubElement(seccionTerminos,'posiblePar') subRaizTermino.text=cadaTermino.glosa subRaizTermino.set('id',cadaTermino.llave) #solucion provisional ordenamientoDiferente=0 #indica que es el mismo grupo de alternativas pero estan ordenados de forma diferente for cadaConjunto in agrupamientoPareado(xmlEntradaObject,solucion,solucionesYDistractores['distractores'],cantidadAlternativas,especificacion=xmlEntradaObject.composicionDistractores, orderBy=xmlEntradaObject.criterioOrdenDistractores): for elem in seccionAlternativas.getchildren(): seccionAlternativas.remove(elem) glosasAlternativas="" idAlternativas="" for cadaTermino in cadaConjunto: subRaizAlternativa=ET.SubElement(seccionAlternativas,'alternativa') subRaizAlternativa.text=cadaTermino.glosa glosasAlternativas+=cadaTermino.glosa subRaizAlternativa.set('puntaje',str(cadaTermino.puntaje)) subRaizAlternativa.set('id',cadaTermino.llave) subRaizAlternativa.set('tipo',cadaTermino.tipo) subRaizComentario=ET.SubElement(subRaizAlternativa,'comentario') subRaizComentario.text=cadaTermino.comentario idAlternativas+=cadaTermino.identificador() subRaizSalida.set('idAlternativasGenerada',idAlternativas.rstrip()) ordenamientoDiferente+=1 # if contador==4: # print str(contador)+' Creados' # return 0 if banderaEstado==True: #Se instancia la plantilla como un elemento de element tree xmlSalida.escribePlantilla(directorioSalida,xmlEntradaObject.tipo,threading.currentThread().getName()+ idPreguntaGenerada+' '+idAlternativas.rstrip()+' '+str(ordenamientoDiferente) +' '+str(contador), plantillaSalida,'xml') else: print ET.tostring(plantillaSalida, 'utf-8', method="xml") contador+=1 #Condicion de carrera total.incrementar(contador) #Descomentar para validar funcionamiento #print threading.currentThread().getName()+' '+str(total.valor) return 0 #print contador #pass #Funcion que analiza la plantilla que corresponde a este tipo de pregunta #A esa plantilla se le añaden los datos obtenidos desde la entrada de #su mismo tipo, luego una vez completada la pregunta, se imprime #por pantalla para que la informacion pueda ser recogida por el programa #principal def recogePlantillas(nombreDirectorioPlantillas,tipoPregunta): validaPlantilla=False plantillasValidas=list() for archivoPlantilla in nombres.especificDirectoryNames(nombreDirectorioPlantillas): nombreDirectorioArchivoPlantilla=nombres.directorioReal(nombreDirectorioPlantillas+"/"+archivoPlantilla) arbolXmlPlantillaEntrada = ET.ElementTree() # instantiate an object of *class* `ElementTree` arbolXmlPlantillaEntrada.parse(nombreDirectorioArchivoPlantilla) #arbolXml=ET.ElementTree(file=nombreDirectorioArchivoPlantilla) for subRaiz in arbolXmlPlantillaEntrada.iter('plantilla'): if subRaiz.attrib['tipo']==tipoPregunta: validaPlantilla=True if validaPlantilla==True: enunciado="" for subRaiz in arbolXmlPlantillaEntrada.iter(): if subRaiz.tag=='glosa': enunciado=enunciado+subRaiz.text if subRaiz.tag=='termino': enunciado=enunciado+' @termino' #plantillasValidas.append(arbolXmlPlantillaEntrada) plantillasValidas.append(plantilla.plantilla(tipoPregunta,enunciado.rstrip())) return plantillasValidas def retornaPlantilla(nombreDirectorioPlantillas,xmlEntradaObject,cantidadAlternativas, tipoPregunta, **kwuargs): #,xmlEntradaObject): #Esto era requerido cuando se tomaba como tipo el nombre de la plantilla, y no un atributo incrustado en el xml #tipoPregunta=nombres.nombreScript(__file__) #Variable compartida, pues cada hebra aumenta el total de archivos creados total=Total() hilos=[] listaDeConjuntoDefiniciones=list() banderaEstado=False if 'directorioSalida' in kwuargs.keys(): banderaEstado=True #Indica si se debe imprimir o no el estado de la cantidad de salidas for plantilla in recogePlantillas(nombreDirectorioPlantillas,tipoPregunta): plantillaSalida=xmlSalida.plantillaGenericaSalida() for subRaizSalida in plantillaSalida.iter(): if subRaizSalida.tag=='plantilla': subRaizSalida.set('tipo',xmlEntradaObject.tipo) subRaizSalida.set('id',xmlEntradaObject.id) subRaizSalida.set('idOrigenEntrada',xmlEntradaObject.idOrigenEntrada) if subRaizSalida.tag=='enunciado': subRaizSalida.text=plantilla.enunciado if subRaizSalida.tag=='opciones': cantidadCombinacionesDefiniciones=0 #Si la cantidad de combinaciones de definiciones es 0, no se genera nada if xmlEntradaObject.cantidadCombinacionesDefiniciones==0: pass #Si la cantidad de combinaciones de definiciones es 1, se trabaja con la entrada #tal como se ingreso por el usuario elif xmlEntradaObject.cantidadCombinacionesDefiniciones==1: listaDeConjuntoDefiniciones.append(xmlEntradaObject.alternativas['terminos'].keys()) else: listaDeConjuntoDefiniciones=xmlEntradaObject.barajaDefiniciones() for conjuntoDefiniciones in listaDeConjuntoDefiniciones: if xmlEntradaObject.cantidadCombinacionesDefiniciones==cantidadCombinacionesDefiniciones: break t = threading.Thread(target=procesoPareador, args=(conjuntoDefiniciones,copy.deepcopy(plantillaSalida),xmlEntradaObject, cantidadAlternativas,banderaEstado,kwuargs['directorioSalida'],total) ) t.setDaemon(True) hilos.append(t) t.start() t.join() cantidadCombinacionesDefiniciones+=1 #Se imprime solo si se especifica directorio de salida if banderaEstado==True: print str(total.valor)+' Creados' return 0 # Declaracion de directorio de entradas nombreDirectorioEntradas="./Entradas/Definiciones" nombreDirectorioPlantillas="./Plantillas" nombreDirectorioSalidas="Salidas" nombreCompilador="python" tipoPregunta='definicionPareada' listaXmlEntrada=list() # Almacenamiento usando el parser para este tipo de pregunta #Ahora la entrada que indica la cantidad de alternativas viene incrustada como atributo en los respectivos #XML de entrada #cantidadAlternativas=xmlSalida.argParse() if nombres.validaExistenciasSubProceso(nombreDirectorioEntradas)==True: listaXmlEntrada=xmlSalida.lecturaXmls(nombreDirectorioEntradas, tipoPregunta) for cadaXmlEntrada in listaXmlEntrada: retornaPlantilla(nombreDirectorioPlantillas, cadaXmlEntrada, cadaXmlEntrada.cantidadAlternativas,tipoPregunta, directorioSalida=nombreDirectorioSalidas+'/'+tipoPregunta)
gpl-2.0
curoverse/libcloud
libcloud/compute/drivers/vpsnet.py
59
6640
# Licensed to the Apache Software Foundation (ASF) under one or more # contributor license agreements. See the NOTICE file distributed with # this work for additional information regarding copyright ownership. # The ASF licenses this file to You under the Apache License, Version 2.0 # (the "License"); you may not use this file except in compliance with # the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """ VPS.net driver """ import base64 try: import simplejson as json except ImportError: import json from libcloud.utils.py3 import b from libcloud.common.base import ConnectionUserAndKey, JsonResponse from libcloud.common.types import InvalidCredsError, MalformedResponseError from libcloud.compute.providers import Provider from libcloud.compute.types import NodeState from libcloud.compute.base import Node, NodeDriver from libcloud.compute.base import NodeSize, NodeImage, NodeLocation API_HOST = 'api.vps.net' API_VERSION = 'api10json' RAM_PER_NODE = 256 DISK_PER_NODE = 10 BANDWIDTH_PER_NODE = 250 class VPSNetResponse(JsonResponse): def parse_body(self): try: return super(VPSNetResponse, self).parse_body() except MalformedResponseError: return self.body def success(self): # vps.net wrongly uses 406 for invalid auth creds if self.status == 406 or self.status == 403: raise InvalidCredsError() return True def parse_error(self): try: errors = super(VPSNetResponse, self).parse_body()['errors'][0] except MalformedResponseError: return self.body else: return "\n".join(errors) class VPSNetConnection(ConnectionUserAndKey): """ Connection class for the VPS.net driver """ host = API_HOST responseCls = VPSNetResponse allow_insecure = False def add_default_headers(self, headers): user_b64 = base64.b64encode(b('%s:%s' % (self.user_id, self.key))) headers['Authorization'] = 'Basic %s' % (user_b64.decode('utf-8')) return headers class VPSNetNodeDriver(NodeDriver): """ VPS.net node driver """ type = Provider.VPSNET api_name = 'vps_net' name = "vps.net" website = 'http://vps.net/' connectionCls = VPSNetConnection def _to_node(self, vm): if vm['running']: state = NodeState.RUNNING else: state = NodeState.PENDING n = Node(id=vm['id'], name=vm['label'], state=state, public_ips=[vm.get('primary_ip_address', None)], private_ips=[], extra={'slices_count': vm['slices_count']}, # Number of nodes consumed by VM driver=self.connection.driver) return n def _to_image(self, image, cloud): image = NodeImage(id=image['id'], name="%s: %s" % (cloud, image['label']), driver=self.connection.driver) return image def _to_size(self, num): size = NodeSize(id=num, name="%d Node" % (num,), ram=RAM_PER_NODE * num, disk=DISK_PER_NODE, bandwidth=BANDWIDTH_PER_NODE * num, price=self._get_price_per_node(num) * num, driver=self.connection.driver) return size def _get_price_per_node(self, num): single_node_price = self._get_size_price(size_id='1') return num * single_node_price def create_node(self, name, image, size, **kwargs): """Create a new VPS.net node @inherits: :class:`NodeDriver.create_node` :keyword ex_backups_enabled: Enable automatic backups :type ex_backups_enabled: ``bool`` :keyword ex_fqdn: Fully Qualified domain of the node :type ex_fqdn: ``str`` """ headers = {'Content-Type': 'application/json'} request = {'virtual_machine': {'label': name, 'fqdn': kwargs.get('ex_fqdn', ''), 'system_template_id': image.id, 'backups_enabled': kwargs.get('ex_backups_enabled', 0), 'slices_required': size.id}} res = self.connection.request('/virtual_machines.%s' % (API_VERSION,), data=json.dumps(request), headers=headers, method='POST') node = self._to_node(res.object['virtual_machine']) return node def reboot_node(self, node): res = self.connection.request( '/virtual_machines/%s/%s.%s' % (node.id, 'reboot', API_VERSION), method="POST") node = self._to_node(res.object['virtual_machine']) return True def list_sizes(self, location=None): res = self.connection.request('/nodes.%s' % (API_VERSION,)) available_nodes = len([size for size in res.object if size['slice']['virtual_machine_id']]) sizes = [self._to_size(i) for i in range(1, available_nodes + 1)] return sizes def destroy_node(self, node): res = self.connection.request('/virtual_machines/%s.%s' % (node.id, API_VERSION), method='DELETE') return res.status == 200 def list_nodes(self): res = self.connection.request('/virtual_machines.%s' % (API_VERSION,)) return [self._to_node(i['virtual_machine']) for i in res.object] def list_images(self, location=None): res = self.connection.request('/available_clouds.%s' % (API_VERSION,)) images = [] for cloud in res.object: label = cloud['cloud']['label'] templates = cloud['cloud']['system_templates'] images.extend([self._to_image(image, label) for image in templates]) return images def list_locations(self): return [NodeLocation(0, "VPS.net Western US", 'US', self)]
apache-2.0
indico/indico
indico/modules/events/timetable/views/__init__.py
4
5581
# This file is part of Indico. # Copyright (C) 2002 - 2021 CERN # # Indico is free software; you can redistribute it and/or # modify it under the terms of the MIT License; see the # LICENSE file for more details. import posixpath from itertools import groupby from operator import attrgetter from flask import render_template, request, session from sqlalchemy.orm import joinedload from indico.core import signals from indico.modules.events.layout import theme_settings from indico.modules.events.management.views import WPEventManagement from indico.modules.events.timetable.models.entries import TimetableEntryType from indico.modules.events.timetable.views.weeks import inject_week_timetable from indico.modules.events.util import get_theme from indico.modules.events.views import WPConferenceDisplayBase from indico.util.signals import values_from_signal from indico.web.flask.templating import register_template_hook, template_hook register_template_hook('week-meeting-body', inject_week_timetable) class WPManageTimetable(WPEventManagement): template_prefix = 'events/timetable/' sidemenu_option = 'timetable' bundles = ('module_events.contributions.js',) def __init__(self, rh, event_, **kwargs): custom_links = dict(values_from_signal(signals.event.timetable_buttons.send(self))) WPEventManagement.__init__(self, rh, event_, custom_links=custom_links, **kwargs) class WPDisplayTimetable(WPConferenceDisplayBase): template_prefix = 'events/timetable/' menu_entry_name = 'timetable' @template_hook('meeting-body') def inject_meeting_body(event, **kwargs): event.preload_all_acl_entries() event_tz = event.display_tzinfo show_date = request.args.get('showDate') or 'all' show_session = request.args.get('showSession') or 'all' detail_level = request.args.get('detailLevel') or 'contribution' view = request.args.get('view') children_strategy = joinedload('children') children_strategy.joinedload('session_block').joinedload('person_links') children_strategy.joinedload('break_') children_contrib_strategy = children_strategy.subqueryload('contribution') children_contrib_strategy.joinedload('person_links') children_contrib_strategy.joinedload('subcontributions') children_contrib_strategy.joinedload('references') children_contrib_strategy.joinedload('own_room') children_contrib_strategy.joinedload('note') children_subcontrib_strategy = children_contrib_strategy.joinedload('subcontributions') children_subcontrib_strategy.joinedload('person_links') children_subcontrib_strategy.joinedload('references') contrib_strategy = joinedload('contribution') contrib_strategy.joinedload('person_links') contrib_strategy.joinedload('references') contrib_strategy.joinedload('note') subcontrib_strategy = contrib_strategy.joinedload('subcontributions') subcontrib_strategy.joinedload('person_links') subcontrib_strategy.joinedload('references') subcontrib_strategy.joinedload('note') # try to minimize the number of DB queries options = [contrib_strategy, children_strategy, joinedload('session_block').joinedload('person_links'), joinedload('session_block').joinedload('own_room'), joinedload('break_')] entries = [] show_siblings_location = False show_children_location = {} for entry in event.timetable_entries.filter_by(parent=None).options(*options): if show_date != 'all' and entry.start_dt.astimezone(event_tz).date().isoformat() != show_date: continue if (entry.type == TimetableEntryType.CONTRIBUTION and (detail_level not in ('contribution', 'all') or show_session != 'all')): continue elif (entry.type == TimetableEntryType.SESSION_BLOCK and show_session != 'all' and str(entry.object.session.friendly_id) != show_session): continue if entry.type == TimetableEntryType.BREAK: entries.append(entry) elif entry.object.can_access(session.user): entries.append(entry) if not entry.object.inherit_location: show_siblings_location = True show_children_location[entry.id] = not all(child.object.inherit_location for child in entry.children) entries.sort(key=attrgetter('end_dt'), reverse=True) entries.sort(key=lambda entry: (entry.start_dt, _entry_title_key(entry))) days = [(day, list(e)) for day, e in groupby(entries, lambda e: e.start_dt.astimezone(event_tz).date())] theme = theme_settings.themes[get_theme(event, view)[0]] plugin = theme.get('plugin') tpl_name = theme.get('tt_template', theme['template']) tt_tpl = ((plugin.name + tpl_name) if (plugin and tpl_name[0] == ':') else posixpath.join('events/timetable/display', tpl_name)) multiple_days = event.start_dt.astimezone(event_tz).date() != event.end_dt.astimezone(event_tz).date() return render_template(tt_tpl, event=event, entries=entries, days=days, timezone=event_tz.zone, tz_object=event_tz, hide_contribs=(detail_level == 'session'), theme_settings=theme.get('settings', {}), show_siblings_location=show_siblings_location, show_children_location=show_children_location, multiple_days=multiple_days, **kwargs) def _entry_title_key(entry): obj = entry.object return obj.full_title if entry.type == TimetableEntryType.SESSION_BLOCK else obj.title
mit
hryamzik/ansible
lib/ansible/modules/network/onyx/onyx_igmp.py
59
7850
#!/usr/bin/python # # Copyright: Ansible Project # GNU General Public License v3.0+ (see COPYING or https://www.gnu.org/licenses/gpl-3.0.txt) from __future__ import absolute_import, division, print_function __metaclass__ = type ANSIBLE_METADATA = {'metadata_version': '1.1', 'status': ['preview'], 'supported_by': 'community'} DOCUMENTATION = """ --- module: onyx_igmp version_added: "2.7" author: "Samer Deeb (@samerd)" short_description: Configures IGMP globl parameters description: - This module provides declarative management of IGMP protocol params on Mellanox ONYX network devices. notes: - Tested on ONYX 3.6.6107 options: state: description: - IGMP state. required: true choices: ['enabled', 'disabled'] last_member_query_interval: description: - Configure the last member query interval, range 1-25 mrouter_timeout: description: - Configure the mrouter timeout, range 60-600 port_purge_timeout: description: - Configure the host port purge timeout, range 130-1225 proxy_reporting: description: - Configure ip igmp snooping proxy and enable reporting mode choices: ['enabled', 'disabled'] report_suppression_interval: description: - Configure the report suppression interval, range 1-25 unregistered_multicast: description: - Configure the unregistered multicast mode Flood unregistered multicast Forward unregistered multicast to mrouter ports choices: ['flood', 'forward-to-mrouter-ports'] default_version: description: - Configure the default operating version of the IGMP snooping choices: ['V2','V3'] """ EXAMPLES = """ - name: configure igmp onyx_igmp: state: enabled unregistered_multicast: flood """ RETURN = """ commands: description: The list of configuration mode commands to send to the device. returned: always type: list sample: - ip igmp snooping - ip igmp snooping last-member-query-interval 10 - ip igmp snooping mrouter-timeout 150 - ip igmp snooping port-purge-timeout 150 """ import re from ansible.module_utils.basic import AnsibleModule from ansible.module_utils.six import iteritems from ansible.module_utils.network.onyx.onyx import show_cmd from ansible.module_utils.network.onyx.onyx import BaseOnyxModule class OnyxIgmpModule(BaseOnyxModule): TIME_INTERVAL_REGEX = re.compile(r'^(\d+)\s+seconds') _RANGE_INTERVALS = dict( last_member_query_interval=(1, 25, 'Last member query interval'), mrouter_timeout=(60, 600, 'Mrouter timeout'), port_purge_timeout=(130, 1225, 'Port purge timeout'), report_suppression_interval=(1, 25, 'Report suppression interval'), ) def init_module(self): """ initialize module """ element_spec = dict( state=dict(choices=['enabled', 'disabled'], required=True), last_member_query_interval=dict(type='int'), mrouter_timeout=dict(type='int'), port_purge_timeout=dict(type='int'), proxy_reporting=dict(choices=['enabled', 'disabled']), report_suppression_interval=dict(type='int'), unregistered_multicast=dict( choices=['flood', 'forward-to-mrouter-ports']), default_version=dict(choices=['V2', 'V3']), ) argument_spec = dict() argument_spec.update(element_spec) self._module = AnsibleModule( argument_spec=argument_spec, supports_check_mode=True) def _validate_key(self, param, key): interval_params = self._RANGE_VALIDATORS.get(key) if interval_params: min_val, max_val = interval_params[0], interval_params[1] value = param.get(key) self._validate_range(key, min_val, max_val, value) else: super(OnyxIgmpModule, self)._validate_key(param, key) def get_required_config(self): module_params = self._module.params self._required_config = dict(module_params) self.validate_param_values(self._required_config) def _set_igmp_config(self, igmp_config): igmp_config = igmp_config[0] if not igmp_config: return self._current_config['state'] = igmp_config.get( 'IGMP snooping globally', 'disabled') self._current_config['proxy_reporting'] = igmp_config.get( 'Proxy-reporting globally', 'disabled') self._current_config['default_version'] = igmp_config.get( 'IGMP default version for new VLAN', 'V3') self._current_config['unregistered_multicast'] = igmp_config.get( 'IGMP snooping unregistered multicast', 'flood') for interval_name, interval_params in iteritems(self._RANGE_INTERVALS): display_str = interval_params[2] value = igmp_config.get(display_str, '') match = self.TIME_INTERVAL_REGEX.match(value) if match: interval_value = int(match.group(1)) else: interval_value = None self._current_config[interval_name] = interval_value def _show_igmp(self): cmd = "show ip igmp snooping" return show_cmd(self._module, cmd, json_fmt=True, fail_on_error=False) def load_current_config(self): self._current_config = dict() igmp_config = self._show_igmp() if igmp_config: self._set_igmp_config(igmp_config) def generate_commands(self): state = self._required_config['state'] if state == 'enabled': self._generate_igmp_cmds() else: self._generate_no_igmp_cmds() def _generate_igmp_cmds(self): curr_state = self._current_config.get('state', 'disabled') if curr_state == 'disabled': self._commands.append('ip igmp snooping') for interval_name in self._RANGE_INTERVALS: req_val = self._required_config.get(interval_name) if not req_val: continue curr_value = self._current_config.get(interval_name) if curr_value == req_val: continue interval_cmd = interval_name.replace('_', '-') self._commands.append( 'ip igmp snooping %s %s' % (interval_cmd, req_val)) req_val = self._required_config.get('unregistered_multicast') if req_val: curr_value = self._current_config.get( 'unregistered_multicast', 'flood') if req_val != curr_value: self._commands.append( 'ip igmp snooping unregistered multicast %s' % req_val) req_val = self._required_config.get('proxy_reporting') if req_val: curr_value = self._current_config.get( 'proxy_reporting', 'disabled') if req_val != curr_value: cmd = 'ip igmp snooping proxy reporting' if req_val == 'disabled': cmd = 'no %s' % cmd self._commands.append(cmd) req_val = self._required_config.get('default_version') if req_val: curr_value = self._current_config.get( 'default_version', 'V3') if req_val != curr_value: version = req_val[1] # remove the 'V' and take the number only self._commands.append( 'ip igmp snooping version %s' % version) def _generate_no_igmp_cmds(self): curr_state = self._current_config.get('state', 'disabled') if curr_state != 'disabled': self._commands.append('no ip igmp snooping') def main(): """ main entry point for module execution """ OnyxIgmpModule.main() if __name__ == '__main__': main()
gpl-3.0
petrus-v/odoo
addons/project/report/__init__.py
444
1069
# -*- coding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2004-2010 Tiny SPRL (<http://tiny.be>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## import project_report # vim:expandtab:smartindent:tabstop=4:softtabstop=4:shiftwidth=4:
agpl-3.0
ashleyholman/bitcoin
qa/rpc-tests/test_framework/socks5.py
182
5701
# Copyright (c) 2015 The Bitcoin Core developers # Distributed under the MIT software license, see the accompanying # file COPYING or http://www.opensource.org/licenses/mit-license.php. ''' Dummy Socks5 server for testing. ''' from __future__ import print_function, division, unicode_literals import socket, threading, Queue import traceback, sys ### Protocol constants class Command: CONNECT = 0x01 class AddressType: IPV4 = 0x01 DOMAINNAME = 0x03 IPV6 = 0x04 ### Utility functions def recvall(s, n): '''Receive n bytes from a socket, or fail''' rv = bytearray() while n > 0: d = s.recv(n) if not d: raise IOError('Unexpected end of stream') rv.extend(d) n -= len(d) return rv ### Implementation classes class Socks5Configuration(object): '''Proxy configuration''' def __init__(self): self.addr = None # Bind address (must be set) self.af = socket.AF_INET # Bind address family self.unauth = False # Support unauthenticated self.auth = False # Support authentication class Socks5Command(object): '''Information about an incoming socks5 command''' def __init__(self, cmd, atyp, addr, port, username, password): self.cmd = cmd # Command (one of Command.*) self.atyp = atyp # Address type (one of AddressType.*) self.addr = addr # Address self.port = port # Port to connect to self.username = username self.password = password def __repr__(self): return 'Socks5Command(%s,%s,%s,%s,%s,%s)' % (self.cmd, self.atyp, self.addr, self.port, self.username, self.password) class Socks5Connection(object): def __init__(self, serv, conn, peer): self.serv = serv self.conn = conn self.peer = peer def handle(self): ''' Handle socks5 request according to RFC1928 ''' try: # Verify socks version ver = recvall(self.conn, 1)[0] if ver != 0x05: raise IOError('Invalid socks version %i' % ver) # Choose authentication method nmethods = recvall(self.conn, 1)[0] methods = bytearray(recvall(self.conn, nmethods)) method = None if 0x02 in methods and self.serv.conf.auth: method = 0x02 # username/password elif 0x00 in methods and self.serv.conf.unauth: method = 0x00 # unauthenticated if method is None: raise IOError('No supported authentication method was offered') # Send response self.conn.sendall(bytearray([0x05, method])) # Read authentication (optional) username = None password = None if method == 0x02: ver = recvall(self.conn, 1)[0] if ver != 0x01: raise IOError('Invalid auth packet version %i' % ver) ulen = recvall(self.conn, 1)[0] username = str(recvall(self.conn, ulen)) plen = recvall(self.conn, 1)[0] password = str(recvall(self.conn, plen)) # Send authentication response self.conn.sendall(bytearray([0x01, 0x00])) # Read connect request (ver,cmd,rsv,atyp) = recvall(self.conn, 4) if ver != 0x05: raise IOError('Invalid socks version %i in connect request' % ver) if cmd != Command.CONNECT: raise IOError('Unhandled command %i in connect request' % cmd) if atyp == AddressType.IPV4: addr = recvall(self.conn, 4) elif atyp == AddressType.DOMAINNAME: n = recvall(self.conn, 1)[0] addr = str(recvall(self.conn, n)) elif atyp == AddressType.IPV6: addr = recvall(self.conn, 16) else: raise IOError('Unknown address type %i' % atyp) port_hi,port_lo = recvall(self.conn, 2) port = (port_hi << 8) | port_lo # Send dummy response self.conn.sendall(bytearray([0x05, 0x00, 0x00, 0x01, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00])) cmdin = Socks5Command(cmd, atyp, addr, port, username, password) self.serv.queue.put(cmdin) print('Proxy: ', cmdin) # Fall through to disconnect except Exception,e: traceback.print_exc(file=sys.stderr) self.serv.queue.put(e) finally: self.conn.close() class Socks5Server(object): def __init__(self, conf): self.conf = conf self.s = socket.socket(conf.af) self.s.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1) self.s.bind(conf.addr) self.s.listen(5) self.running = False self.thread = None self.queue = Queue.Queue() # report connections and exceptions to client def run(self): while self.running: (sockconn, peer) = self.s.accept() if self.running: conn = Socks5Connection(self, sockconn, peer) thread = threading.Thread(None, conn.handle) thread.daemon = True thread.start() def start(self): assert(not self.running) self.running = True self.thread = threading.Thread(None, self.run) self.thread.daemon = True self.thread.start() def stop(self): self.running = False # connect to self to end run loop s = socket.socket(self.conf.af) s.connect(self.conf.addr) s.close() self.thread.join()
mit
seanli9jan/tensorflow
tensorflow/compiler/tests/scan_ops_test.py
10
7707
# Copyright 2016 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Functional tests for scan ops.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import numpy as np from tensorflow.compiler.tests import xla_test from tensorflow.python.framework import constant_op from tensorflow.python.framework import errors_impl from tensorflow.python.framework import ops from tensorflow.python.ops import array_ops from tensorflow.python.ops import math_ops from tensorflow.python.platform import test def numpy_reverse(x, axis): length = len(x.shape) if axis < 0: axis = length + axis ix = [ slice(None, None, -1) if i == axis else slice(None) for i in range(length) ] return x[ix] def handle_options(func, x, axis, exclusive, reverse): """Adds tf options to numpy scan ops.""" length = len(x.shape) if axis < 0: axis = length + axis if reverse: x = numpy_reverse(x, axis) if exclusive: ix_head = [slice(0, 1) if i == axis else slice(None) for i in range(length)] ix_init = [ slice(0, -1) if i == axis else slice(None) for i in range(length) ] if func == np.cumsum: init = np.zeros_like(x[ix_head]) elif func == np.cumprod: init = np.ones_like(x[ix_head]) else: raise ValueError("Unknown scan function.") x = np.concatenate([init, func(x[ix_init], axis)], axis=axis) else: x = func(x, axis=axis) if reverse: x = numpy_reverse(x, axis) return x class CumsumTest(xla_test.XLATestCase): valid_dtypes = [np.float32] def axis_dtypes(self): return set(self.int_types).intersection([np.int32, np.int64]) def _compare(self, x, axis, exclusive, reverse): np_out = handle_options(np.cumsum, x, axis, exclusive, reverse) with self.cached_session(), self.test_scope(): p = array_ops.placeholder(x.dtype) tf_out = math_ops.cumsum(p, axis, exclusive, reverse).eval( feed_dict={p: x}) self.assertAllClose(np_out, tf_out) def _compareAll(self, x, axis): for exclusive in [True, False]: for reverse in [True, False]: self._compare(x, axis, exclusive, reverse) def testEmpty(self): for dtype in self.valid_dtypes: x = np.zeros([0]).astype(dtype) for axis in (-1, 0): self._compareAll(x, axis) def testAxisType(self): for dtype in self.valid_dtypes: x = np.arange(1, 6).reshape([5]).astype(dtype) for axis_dtype in self.axis_dtypes(): with self.cached_session(), self.test_scope(): p = array_ops.placeholder(x.dtype) axis = constant_op.constant(0, axis_dtype) math_ops.cumsum(p, axis).eval(feed_dict={p: x}) def test1D(self): for dtype in self.valid_dtypes: x = np.arange(1, 6).reshape([5]).astype(dtype) for axis in (-1, 0): self._compareAll(x, axis) def test2D(self): for dtype in self.valid_dtypes: x = np.arange(0, 10).reshape([2, 5]).astype(dtype) for axis in (-2, -1, 0, 1): self._compareAll(x, axis) def test3D(self): for dtype in self.valid_dtypes: x = np.arange(0, 20).reshape([2, 2, 5]).astype(dtype) for axis in (-3, -2, -1, 0, 1, 2): self._compareAll(x, axis) def test6D(self): for dtype in self.valid_dtypes: x = np.arange(1, 145).reshape([2, 2, 3, 3, 2, 2]).astype(dtype) for axis in range(-6, 6, 3): self._compareAll(x, axis) def testInvalidAxis(self): x = np.arange(0, 10).reshape([2, 5]).astype(np.float32) with self.cached_session(), self.test_scope(): input_tensor = ops.convert_to_tensor(x) with self.assertRaisesWithPredicateMatch( errors_impl.InvalidArgumentError, lambda e: "Expected scan axis in the range [-2, 2)" in str(e)): math_ops.cumsum(input_tensor, -3).eval() with self.assertRaisesWithPredicateMatch( errors_impl.InvalidArgumentError, lambda e: "Expected scan axis in the range [-2, 2)" in str(e)): math_ops.cumsum(input_tensor, 2).eval() with self.assertRaisesWithPredicateMatch( errors_impl.InvalidArgumentError, lambda e: "axis must be a scalar" in str(e)): math_ops.cumsum(input_tensor, [0]).eval() class CumprodTest(xla_test.XLATestCase): valid_dtypes = [np.float32] def axis_dtypes(self): return set(self.int_types).intersection([np.int32, np.int64]) def _compare(self, x, axis, exclusive, reverse): np_out = handle_options(np.cumprod, x, axis, exclusive, reverse) with self.cached_session(), self.test_scope(): p = array_ops.placeholder(x.dtype) prod = math_ops.cumprod(p, axis, exclusive, reverse) tf_out = prod.eval(feed_dict={p: x}) self.assertAllClose(np_out, tf_out) def _compareAll(self, x, axis): for exclusive in [True, False]: for reverse in [True, False]: self._compare(x, axis, exclusive, reverse) def testEmpty(self): for dtype in self.valid_dtypes: x = np.zeros([0]).astype(dtype) for axis in (-1, 0): self._compareAll(x, axis) def testAxisType(self): for dtype in self.valid_dtypes: x = np.arange(1, 6).reshape([5]).astype(dtype) for axis_dtype in self.axis_dtypes(): with self.cached_session(), self.test_scope(): p = array_ops.placeholder(x.dtype) axis = constant_op.constant(0, axis_dtype) math_ops.cumprod(x, axis).eval(feed_dict={p: x}) def test1D(self): for dtype in self.valid_dtypes: x = np.arange(1, 6).reshape([5]).astype(dtype) for axis in (-1, 0): self._compareAll(x, axis) def test2D(self): for dtype in self.valid_dtypes: x = np.arange(1, 11).reshape([2, 5]).astype(dtype) for axis in (-2, -1, 0, 1): self._compareAll(x, axis) def test3D(self): for dtype in self.valid_dtypes: x = np.arange(1, 21).reshape([2, 2, 5]).astype(dtype) for axis in (-3, -2, -1, 0, 1, 2): self._compareAll(x, axis) def test6D(self): for dtype in self.valid_dtypes: x = np.arange(1, 145).reshape([2, 2, 3, 3, 2, 2]).astype(dtype) for axis in range(-6, 6, 3): self._compareAll(x, axis) def testInvalidAxis(self): x = np.arange(0, 10).reshape([2, 5]).astype(np.float32) with self.cached_session(), self.test_scope(): input_tensor = ops.convert_to_tensor(x) with self.assertRaisesWithPredicateMatch( errors_impl.InvalidArgumentError, lambda e: "Expected scan axis in the range [-2, 2)" in str(e)): math_ops.cumprod(input_tensor, -3).eval() with self.assertRaisesWithPredicateMatch( errors_impl.InvalidArgumentError, lambda e: "Expected scan axis in the range [-2, 2)" in str(e)): math_ops.cumprod(input_tensor, 2).eval() with self.assertRaisesWithPredicateMatch( errors_impl.InvalidArgumentError, lambda e: "axis must be a scalar" in str(e)): math_ops.cumprod(input_tensor, [0]).eval() if __name__ == "__main__": test.main()
apache-2.0
druuu/django
django/core/serializers/base.py
273
7678
""" Module for abstract serializer/unserializer base classes. """ from django.db import models from django.utils import six class SerializerDoesNotExist(KeyError): """The requested serializer was not found.""" pass class SerializationError(Exception): """Something bad happened during serialization.""" pass class DeserializationError(Exception): """Something bad happened during deserialization.""" @classmethod def WithData(cls, original_exc, model, fk, field_value): """ Factory method for creating a deserialization error which has a more explanatory messsage. """ return cls("%s: (%s:pk=%s) field_value was '%s'" % (original_exc, model, fk, field_value)) class ProgressBar(object): progress_width = 75 def __init__(self, output, total_count): self.output = output self.total_count = total_count self.prev_done = 0 def update(self, count): if not self.output: return perc = count * 100 // self.total_count done = perc * self.progress_width // 100 if self.prev_done >= done: return self.prev_done = done cr = '' if self.total_count == 1 else '\r' self.output.write(cr + '[' + '.' * done + ' ' * (self.progress_width - done) + ']') if done == self.progress_width: self.output.write('\n') self.output.flush() class Serializer(object): """ Abstract serializer base class. """ # Indicates if the implemented serializer is only available for # internal Django use. internal_use_only = False progress_class = ProgressBar def serialize(self, queryset, **options): """ Serialize a queryset. """ self.options = options self.stream = options.pop("stream", six.StringIO()) self.selected_fields = options.pop("fields", None) self.use_natural_foreign_keys = options.pop('use_natural_foreign_keys', False) self.use_natural_primary_keys = options.pop('use_natural_primary_keys', False) progress_bar = self.progress_class( options.pop('progress_output', None), options.pop('object_count', 0) ) self.start_serialization() self.first = True for count, obj in enumerate(queryset, start=1): self.start_object(obj) # Use the concrete parent class' _meta instead of the object's _meta # This is to avoid local_fields problems for proxy models. Refs #17717. concrete_model = obj._meta.concrete_model for field in concrete_model._meta.local_fields: if field.serialize: if field.remote_field is None: if self.selected_fields is None or field.attname in self.selected_fields: self.handle_field(obj, field) else: if self.selected_fields is None or field.attname[:-3] in self.selected_fields: self.handle_fk_field(obj, field) for field in concrete_model._meta.many_to_many: if field.serialize: if self.selected_fields is None or field.attname in self.selected_fields: self.handle_m2m_field(obj, field) self.end_object(obj) progress_bar.update(count) if self.first: self.first = False self.end_serialization() return self.getvalue() def start_serialization(self): """ Called when serializing of the queryset starts. """ raise NotImplementedError('subclasses of Serializer must provide a start_serialization() method') def end_serialization(self): """ Called when serializing of the queryset ends. """ pass def start_object(self, obj): """ Called when serializing of an object starts. """ raise NotImplementedError('subclasses of Serializer must provide a start_object() method') def end_object(self, obj): """ Called when serializing of an object ends. """ pass def handle_field(self, obj, field): """ Called to handle each individual (non-relational) field on an object. """ raise NotImplementedError('subclasses of Serializer must provide an handle_field() method') def handle_fk_field(self, obj, field): """ Called to handle a ForeignKey field. """ raise NotImplementedError('subclasses of Serializer must provide an handle_fk_field() method') def handle_m2m_field(self, obj, field): """ Called to handle a ManyToManyField. """ raise NotImplementedError('subclasses of Serializer must provide an handle_m2m_field() method') def getvalue(self): """ Return the fully serialized queryset (or None if the output stream is not seekable). """ if callable(getattr(self.stream, 'getvalue', None)): return self.stream.getvalue() class Deserializer(six.Iterator): """ Abstract base deserializer class. """ def __init__(self, stream_or_string, **options): """ Init this serializer given a stream or a string """ self.options = options if isinstance(stream_or_string, six.string_types): self.stream = six.StringIO(stream_or_string) else: self.stream = stream_or_string def __iter__(self): return self def __next__(self): """Iteration iterface -- return the next item in the stream""" raise NotImplementedError('subclasses of Deserializer must provide a __next__() method') class DeserializedObject(object): """ A deserialized model. Basically a container for holding the pre-saved deserialized data along with the many-to-many data saved with the object. Call ``save()`` to save the object (with the many-to-many data) to the database; call ``save(save_m2m=False)`` to save just the object fields (and not touch the many-to-many stuff.) """ def __init__(self, obj, m2m_data=None): self.object = obj self.m2m_data = m2m_data def __repr__(self): return "<DeserializedObject: %s(pk=%s)>" % ( self.object._meta.label, self.object.pk) def save(self, save_m2m=True, using=None, **kwargs): # Call save on the Model baseclass directly. This bypasses any # model-defined save. The save is also forced to be raw. # raw=True is passed to any pre/post_save signals. models.Model.save_base(self.object, using=using, raw=True, **kwargs) if self.m2m_data and save_m2m: for accessor_name, object_list in self.m2m_data.items(): setattr(self.object, accessor_name, object_list) # prevent a second (possibly accidental) call to save() from saving # the m2m data twice. self.m2m_data = None def build_instance(Model, data, db): """ Build a model instance. If the model instance doesn't have a primary key and the model supports natural keys, try to retrieve it from the database. """ obj = Model(**data) if (obj.pk is None and hasattr(Model, 'natural_key') and hasattr(Model._default_manager, 'get_by_natural_key')): natural_key = obj.natural_key() try: obj.pk = Model._default_manager.db_manager(db).get_by_natural_key(*natural_key).pk except Model.DoesNotExist: pass return obj
bsd-3-clause
aspectron/jsx
extern/boost/libs/python/test/newtest.py
46
3629
# Copyright David Abrahams 2004. Distributed under the Boost # Software License, Version 1.0. (See accompanying # file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) """ >>> from m1 import * >>> from m2 import * Prove that we get an appropriate error from trying to return a type for which we have no registered to_python converter >>> def check_unregistered(f, msgprefix): ... try: ... f(1) ... except TypeError, x: ... if not str(x).startswith(msgprefix): ... print str(x) ... else: ... print 'expected a TypeError' ... >>> check_unregistered(make_unregistered, 'No to_python (by-value) converter found for C++ type') >>> check_unregistered(make_unregistered2, 'No Python class registered for C++ class') >>> n = new_noddy() >>> s = new_simple() >>> unwrap_int(n) 42 >>> unwrap_int_ref(n) 42 >>> unwrap_int_const_ref(n) 42 >>> unwrap_simple(s) 'hello, world' >>> unwrap_simple_ref(s) 'hello, world' >>> unwrap_simple_const_ref(s) 'hello, world' >>> unwrap_int(5) 5 Can't get a non-const reference to a built-in integer object >>> try: ... unwrap_int_ref(7) ... except: pass ... else: print 'no exception' >>> unwrap_int_const_ref(9) 9 >>> wrap_int(n) 42 try: wrap_int_ref(n) ... except: pass ... else: print 'no exception' >>> wrap_int_const_ref(n) 42 >>> unwrap_simple_ref(wrap_simple(s)) 'hello, world' >>> unwrap_simple_ref(wrap_simple_ref(s)) 'hello, world' >>> unwrap_simple_ref(wrap_simple_const_ref(s)) 'hello, world' >>> f(s) 12 >>> unwrap_simple(g(s)) 'hello, world' >>> f(g(s)) 12 >>> f_mutable_ref(g(s)) 12 >>> f_const_ptr(g(s)) 12 >>> f_mutable_ptr(g(s)) 12 >>> f2(g(s)) 12 Create an extension class which wraps "complicated" (init1 and get_n) are a complicated constructor and member function, respectively. >>> c1 = complicated(s, 99) >>> c1.get_n() 99 >>> c2 = complicated(s) >>> c2.get_n() 0 a quick regression test for a bug where None could be converted to the target of any member function. To see it, we need to access the __dict__ directly, to bypass the type check supplied by the Method property which wraps the method when accessed as an attribute. >>> try: A.__dict__['name'](None) ... except TypeError: pass ... else: print 'expected an exception!' >>> a = A() >>> b = B() >>> c = C() >>> d = D() >>> take_a(a).name() 'A' >>> try: ... take_b(a) ... except: pass ... else: print 'no exception' >>> try: ... take_c(a) ... except: pass ... else: print 'no exception' >>> try: ... take_d(a) ... except: pass ... else: print 'no exception' ------ >>> take_a(b).name() 'A' >>> take_b(b).name() 'B' >>> try: ... take_c(b) ... except: pass ... else: print 'no exception' >>> try: ... take_d(b) ... except: pass ... else: print 'no exception' ------- >>> take_a(c).name() 'A' >>> try: ... take_b(c) ... except: pass ... else: print 'no exception' >>> take_c(c).name() 'C' >>> try: ... take_d(c) ... except: pass ... else: print 'no exception' ------- >>> take_a(d).name() 'A' >>> take_b(d).name() 'B' >>> take_c(d).name() 'C' >>> take_d(d).name() 'D' >>> take_d_shared_ptr(d).name() 'D' >>> d_as_a = d_factory() >>> dd = take_d(d_as_a) >>> dd.name() 'D' >>> print g.__doc__.splitlines()[1] g( (Simple)arg1) -> Simple : """ def run(args = None): import sys import doctest if args is not None: sys.argv = args return doctest.testmod(sys.modules.get(__name__)) if __name__ == '__main__': print "running..." import sys status = run()[0] if (status == 0): print "Done." sys.exit(status)
mit
ElDeveloper/qiita
qiita_db/test/test_portal.py
3
8644
# ----------------------------------------------------------------------------- # Copyright (c) 2014--, The Qiita Development Team. # # Distributed under the terms of the BSD 3-clause License. # # The full license is in the file LICENSE, distributed with this software. # ----------------------------------------------------------------------------- from unittest import TestCase, main import numpy.testing as npt from qiita_core.util import qiita_test_checker from qiita_core.qiita_settings import qiita_config import qiita_db as qdb @qiita_test_checker() class TestPortal(TestCase): def setUp(self): self.portal = qiita_config.portal self.study = qdb.study.Study(1) self.analysis = qdb.analysis.Analysis(1) self.qiita_portal = qdb.portal.Portal('QIITA') self.emp_portal = qdb.portal.Portal('EMP') def tearDown(self): qiita_config.portal = self.portal def test_list_portals(self): obs = qdb.portal.Portal.list_portals() exp = ['EMP'] self.assertEqual(obs, exp) def test_add_portal(self): obs = qdb.portal.Portal.create("NEWPORTAL", "SOMEDESC") with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add("SELECT * FROM qiita.portal_type") obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1, 'QIITA', 'QIITA portal. Access to all data stored ' 'in database.'], [2, 'EMP', 'EMP portal'], [4, 'NEWPORTAL', 'SOMEDESC']] self.assertCountEqual(obs, exp) with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add("SELECT * FROM qiita.analysis_portal") obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1, 1], [2, 1], [3, 1], [4, 1], [5, 1], [6, 1], [7, 2], [8, 2], [9, 2], [10, 2], [11, 4], [12, 4], [13, 4], [14, 4]] self.assertCountEqual(obs, exp) with self.assertRaises(qdb.exceptions.QiitaDBDuplicateError): qdb.portal.Portal.create("EMP", "DOESNTMATTERFORDESC") qdb.portal.Portal.delete('NEWPORTAL') def test_remove_portal(self): qdb.portal.Portal.create("NEWPORTAL", "SOMEDESC") # Select some samples on a default analysis qiita_config.portal = "NEWPORTAL" a = qdb.user.User("test@foo.bar").default_analysis a.add_samples({1: ['1.SKB8.640193', '1.SKD5.640186']}) qdb.portal.Portal.delete("NEWPORTAL") with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add("SELECT * FROM qiita.portal_type") obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1, 'QIITA', 'QIITA portal. Access to all data stored ' 'in database.'], [2, 'EMP', 'EMP portal']] self.assertCountEqual(obs, exp) with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add("SELECT * FROM qiita.analysis_portal") obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1, 1], [2, 1], [3, 1], [4, 1], [5, 1], [6, 1], [7, 2], [8, 2], [9, 2], [10, 2]] self.assertCountEqual(obs, exp) with self.assertRaises(qdb.exceptions.QiitaDBLookupError): qdb.portal.Portal.delete("NOEXISTPORTAL") with self.assertRaises(qdb.exceptions.QiitaDBError): qdb.portal.Portal.delete("QIITA") qdb.portal.Portal.create("NEWPORTAL2", "SOMEDESC") # Add study to this new portal and make sure error raised info = { "timeseries_type_id": 1, "metadata_complete": True, "mixs_compliant": True, "study_alias": "FCM", "study_description": "Microbiome of people who eat nothing but " "fried chicken", "study_abstract": "Exploring how a high fat diet changes the " "gut microbiome", "principal_investigator_id": qdb.study.StudyPerson(3), "lab_person_id": qdb.study.StudyPerson(1) } qdb.portal.Portal.create("NEWPORTAL3", "SOMEDESC") qiita_config.portal = "NEWPORTAL3" qdb.study.Study.create( qdb.user.User('test@foo.bar'), "Fried chicken microbiome", info) qiita_config.portal = "QIITA" with self.assertRaises(qdb.exceptions.QiitaDBError): qdb.portal.Portal.delete("NEWPORTAL3") def test_check_studies(self): with self.assertRaises(qdb.exceptions.QiitaDBError): self.qiita_portal._check_studies([2000000000000, 122222222222222]) def test_check_analyses(self): with self.assertRaises(qdb.exceptions.QiitaDBError): self.qiita_portal._check_analyses([2000000000000, 122222222222222]) with self.assertRaises(qdb.exceptions.QiitaDBError): self.qiita_portal._check_analyses([8, 9]) def test_get_studies_by_portal(self): obs = self.emp_portal.get_studies() self.assertEqual(obs, set()) obs = self.qiita_portal.get_studies() self.assertEqual(obs, {qdb.study.Study(1)}) def test_add_study_portals(self): obs = qdb.portal.Portal.create("NEWPORTAL4", "SOMEDESC") obs.add_studies([self.study.id]) self.assertCountEqual(self.study._portals, ['NEWPORTAL4', 'QIITA']) npt.assert_warns(qdb.exceptions.QiitaDBWarning, obs.add_studies, [self.study.id]) obs.remove_studies([self.study.id]) qdb.portal.Portal.delete("NEWPORTAL4") def test_remove_study_portals(self): with self.assertRaises(ValueError): self.qiita_portal.remove_studies([self.study.id]) self.emp_portal.add_studies([1]) # Set up the analysis in EMP portal self.emp_portal.add_analyses([self.analysis.id]) obs = self.analysis._portals self.assertCountEqual(obs, ['QIITA', 'EMP']) # Test study removal failure with self.assertRaises(qdb.exceptions.QiitaDBError): self.emp_portal.remove_studies([self.study.id]) obs = self.study._portals self.assertCountEqual(obs, ['QIITA', 'EMP']) # Test study removal self.emp_portal.remove_analyses([self.analysis.id]) self.emp_portal.remove_studies([self.study.id]) obs = self.study._portals self.assertEqual(obs, ['QIITA']) obs = npt.assert_warns( qdb.exceptions.QiitaDBWarning, self.emp_portal.remove_studies, [self.study.id]) def test_get_analyses_by_portal(self): qiita_config.portal = 'EMP' exp = {qdb.analysis.Analysis(7), qdb.analysis.Analysis(8), qdb.analysis.Analysis(9), qdb.analysis.Analysis(10)} obs = self.emp_portal.get_analyses() self.assertEqual(obs, exp) qiita_config.portal = 'QIITA' exp = {qdb.analysis.Analysis(1), qdb.analysis.Analysis(2), qdb.analysis.Analysis(3), qdb.analysis.Analysis(4), qdb.analysis.Analysis(5), qdb.analysis.Analysis(6)} obs = self.qiita_portal.get_analyses() self.assertEqual(obs, exp) def test_add_analysis_portals(self): obs = self.analysis._portals self.assertEqual(obs, ['QIITA']) with self.assertRaises(qdb.exceptions.QiitaDBError): self.emp_portal.add_analyses([self.analysis.id]) obs = self.analysis._portals self.assertEqual(obs, ['QIITA']) self.emp_portal.add_studies([1]) self.emp_portal.add_analyses([self.analysis.id]) obs = self.analysis._portals self.assertEqual(obs, ['EMP', 'QIITA']) npt.assert_warns( qdb.exceptions.QiitaDBWarning, self.emp_portal.add_analyses, [self.analysis.id]) self.emp_portal.remove_analyses([self.analysis.id]) self.emp_portal.remove_studies([1]) def test_remove_analysis_portals(self): with self.assertRaises(ValueError): self.qiita_portal.remove_analyses([self.analysis.id]) # set up the analysis in EMP portal self.emp_portal.add_studies([1]) self.emp_portal.add_analyses([self.analysis.id]) obs = self.analysis._portals self.assertCountEqual(obs, ['QIITA', 'EMP']) # Test removal self.emp_portal.remove_analyses([self.analysis.id]) obs = self.analysis._portals self.assertEqual(obs, ['QIITA']) obs = npt.assert_warns( qdb.exceptions.QiitaDBWarning, self.emp_portal.remove_analyses, [self.analysis.id]) self.emp_portal.remove_studies([1]) if __name__ == '__main__': main()
bsd-3-clause
Azure/azure-sdk-for-python
sdk/containerregistry/azure-containerregistry/samples/async_samples/sample_create_client_async.py
1
2454
# coding: utf-8 # ------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for # license information. # -------------------------------------------------------------------------- """ FILE: sample_create_client_async.py DESCRIPTION: These samples demonstrate creating a ContainerRegistryClient and a ContainerRepository USAGE: python sample_create_client_async.py Set the environment variables with your own values before running the sample: 1) AZURE_CONTAINERREGISTRY_URL - The URL of you Container Registry account """ import asyncio from dotenv import find_dotenv, load_dotenv import os class CreateClients(object): def __init__(self): load_dotenv(find_dotenv()) async def create_registry_client(self): # Instantiate the ContainerRegistryClient # [START create_registry_client] from azure.containerregistry.aio import ContainerRegistryClient from azure.identity.aio import DefaultAzureCredential account_url = os.environ["CONTAINERREGISTRY_ENDPOINT"] client = ContainerRegistryClient(account_url, DefaultAzureCredential()) # [END create_registry_client] async def basic_sample(self): from azure.containerregistry.aio import ContainerRegistryClient from azure.identity.aio import DefaultAzureCredential account_url = os.environ["CONTAINERREGISTRY_ENDPOINT"] # Instantiate the client client = ContainerRegistryClient(account_url, DefaultAzureCredential()) async with client: # Iterate through all the repositories async for repository_name in client.list_repository_names(): if repository_name == "hello-world": # Create a repository client from the registry client async for tag in client.list_tag_properties(repository_name): print(tag.digest) # [START delete_repository] await client.delete_repository(repository_name, "hello-world") # [END delete_repository] async def main(): sample = CreateClients() await sample.create_registry_client() await sample.basic_sample() if __name__ == "__main__": loop = asyncio.get_event_loop() loop.run_until_complete(main())
mit
McNoggins/latgen
setup.py
1
1433
#!/usr/bin/env python # -*- coding: utf-8 -*- try: from setuptools import setup, find_packages except ImportError: from distutils.core import setup readme = open('README.rst').read() history = open('HISTORY.rst').read().replace('.. :changelog:', '') requirements = [ # TODO: put package requirements here ] test_requirements = [ # TODO: put package test requirements here ] setup( name='latgen', version='0.1.0', description='Computational library to generate lattice points', long_description=readme + '\n\n' + history, author='Denis Gagnon', author_email='gagnon88@gmail.com', url='https://github.com/McNoggins/latgen', packages=['latgen'], package_dir={'latgen': 'latgen'}, include_package_data=True, install_requires=['numpy'], license="GPL", zip_safe=False, keywords='latgen', classifiers=[ 'Development Status :: 2 - Pre-Alpha', 'Intended Audience :: Developers', 'License :: OSI Approved :: BSD License', 'Natural Language :: English', "Programming Language :: Python :: 2", 'Programming Language :: Python :: 2.6', 'Programming Language :: Python :: 2.7', 'Programming Language :: Python :: 3', 'Programming Language :: Python :: 3.3', 'Programming Language :: Python :: 3.4', ], test_suite='tests', tests_require=test_requirements )
gpl-2.0
bakhtout/odoo-educ
addons/openeducat_erp/report/exam_student_lable.py
1
3860
# -*- coding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2004-2010 Tiny SPRL (<http://tiny.be>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## import time from datetime import datetime from openerp.report import report_sxw from openerp.osv import osv class exam_student_lable_report(report_sxw.rml_parse): def __init__(self, cr, uid, name, context=None): super(exam_student_lable_report, self).__init__(cr, uid, name, context=context) self.localcontext.update({ 'time': time, 'get_student_data':self.get_student_data }) def format_list(self,temp_list): cnt = 1 temp = {} lst = [] for i in temp_list: if cnt <= 3: temp.update({str(cnt): i}) cnt += 1 else: cnt = 1 lst.append(temp) temp = {} temp.update({str(cnt): i}) cnt += 1 index = len(temp_list) - len(temp_list)%3 if len(temp_list)%3 == 1: lst.append({'1': temp_list[index]}) elif len(temp_list)%3 == 2: lst.append({'1': temp_list[index],'2': temp_list[index+1]}) else: lst.append({'1': temp_list[-3],'2': temp_list[-2],'3': temp_list[-1]}) return lst def get_student_data(self, exam_session_ids): student_pool = self.pool.get('op.student') ret_list = [] for line in exam_session_ids: student_ids = student_pool.search(self.cr, self.uid, [('course_id', '=', line.course_id.id), ('standard_id', '=', line.standard_id.id), ], order= 'id asc') temp_list = [] for student in student_pool.browse(self.cr, self.uid, student_ids): res={ 'student': student.name, 'middle_name': student.middle_name, 'last_name': student.last_name, 'course': student.course_id.name, 'roll_number': student.roll_number, 'std': student.standard_id.name } temp_list.append(res) ret_list.append({'course': line.course_id.name, 'standard': line.standard_id.name, 'line': self.format_list(temp_list)}) return ret_list class report_exam_student_lable_report(osv.AbstractModel): _name = 'report.openeducat_erp.report_exam_student_lable_report' _inherit = 'report.abstract_report' _template = 'openeducat_erp.report_exam_student_lable_report' _wrapped_report_class = exam_student_lable_report #report_sxw.report_sxw('report.op.exam.student.lable','op.exam.res.allocation', 'addons/openeducat_erp/report/exam_student_lable.rml', parser=exam_student_lable_report, header=False) # vim:expandtab:smartindent:tabstop=4:softtabstop=4:shiftwidth=4:
agpl-3.0
dmacvicar/spacewalk
proxy/proxy/redirect/rhnRedirect.py
3
17780
# Spacewalk Proxy Server SSL Redirect handler code. # # Copyright (c) 2008--2012 Red Hat, Inc. # # This software is licensed to you under the GNU General Public License, # version 2 (GPLv2). There is NO WARRANTY for this software, express or # implied, including the implied warranties of MERCHANTABILITY or FITNESS # FOR A PARTICULAR PURPOSE. You should have received a copy of GPLv2 # along with this software; if not, see # http://www.gnu.org/licenses/old-licenses/gpl-2.0.txt. # # Red Hat trademarks are not licensed under GPLv2. No permission is # granted to use or replicate Red Hat trademarks that are incorporated # in this software or its documentation. # # language imports import socket import re from urlparse import urlparse, urlunparse # common module imports from spacewalk.common.rhnConfig import CFG from spacewalk.common.rhnLog import log_debug, log_error from spacewalk.common.rhnTB import Traceback from spacewalk.common import rhnFlags, rhnLib, apache # local module imports from proxy.rhnShared import SharedHandler from proxy import rhnConstants # rhnlib imports from rhn import connections # Main apache entry point for the proxy. class RedirectHandler(SharedHandler): """ Spacewalk Proxy SSL Redirect specific handler code called by rhnApache. Workflow is: Client -> Apache:Broker -> Squid -> Apache:Redirect -> Satellite Redirect handler get all request for localhost:80 and they come from Broker handler through Squid, which hadle caching. Redirect module transform destination url to parent or http proxy. Depend on what we have in CFG. """ def __init__(self, req): SharedHandler.__init__(self, req) self.componentType = 'proxy.redirect' self._initConnectionVariables(req) self.rhnParentXMLRPC = None def _initConnectionVariables(self, _req): """ set connection variables NOTE: self.{caChain,rhnParent,httpProxy*} are initialized in SharedHandler """ effectiveURI = self._getEffectiveURI() effectiveURI_parts = urlparse(effectiveURI) scheme = 'http' if CFG.USE_SSL: scheme = 'https' else: self.caChain = '' self.rhnParentXMLRPC = urlunparse((scheme, self.rhnParent, '/XMLRPC', '', '', '')) self.rhnParent = urlunparse((scheme, self.rhnParent) + effectiveURI_parts[2:]) log_debug(3, 'remapped self.rhnParent: %s' % self.rhnParent) log_debug(3, 'remapped self.rhnParentXMLRPC: %s' % self.rhnParentXMLRPC) def handler(self): """ Main handler for all requests pumped through this server. """ log_debug(4, 'In redirect handler') self._prepHandler() # Rebuild the X-Forwarded-For header so that it reflects the actual # path of the request. We must do this because squid is unable to # determine the "real" client, and will make each entry in the chain # 127.0.0.1. _oto = rhnFlags.get('outputTransportOptions') _oto['X-Forwarded-For'] = _oto['X-RHN-IP-Path'] self.rhnParent = self.rhnParent or '' # paranoid log_debug(4, 'Connecting to parent...') self._connectToParent() # part 1 log_debug(4, 'Initiating communication with server...') status = self._serverCommo() # part 2 if (status != apache.OK) and (status != apache.HTTP_PARTIAL_CONTENT): log_debug(3, "Leaving handler with status code %s" % status) return status log_debug(4, 'Initiating communication with client...') # If we got this far, it has to be a good response return self._clientCommo(status) def _handleServerResponse(self, status): """ Here, we'll override the default behavior for handling server responses so that we can adequately handle 302's. We will follow redirects unless it is redirect to (re)login page. In which case we change protocol to https and return redirect to user. """ # In case of a 302, redirect the original request to the location # specified in the response. if status == apache.HTTP_MOVED_TEMPORARILY or \ status == apache.HTTP_MOVED_PERMANENTLY: log_debug(1, "Received redirect response: ", status) # if we redirected to ssl version of login page, send redirect directly to user headers = self.responseContext.getHeaders() if headers is not None: for headerKey in headers.keys(): if headerKey == 'location': location = self._get_header(headerKey) relogin = re.compile(r'https?://.*(/rhn/(Re)?Login.do\?.*)') m = relogin.match(location[0]) if m: # pull server name out of "t:o:k:e:n:hostname1,t:o:k:e:n:hostname2,..." proxy_auth = self.req.headers_in['X-RHN-Proxy-Auth'] last_auth = proxy_auth.split(',')[-1] server_name = last_auth.split(':')[-1] log_debug(1, "Redirecting to SSL version of login page") rhnLib.setHeaderValue(self.req.headers_out, 'Location', "https://%s%s" % (server_name, m.group(1))) return apache.HTTP_MOVED_PERMANENTLY redirectStatus = self.__redirectToNextLocation() # At this point, we've either: # # (a) successfully redirected to the 3rd party # (b) been told to redirect somewhere else from the 3rd party # (c) run out of retry attempts # # We'll keep redirecting until we've received HTTP_OK or an error. while redirectStatus == apache.HTTP_MOVED_PERMANENTLY or \ redirectStatus == apache.HTTP_MOVED_TEMPORARILY: # We've been told to redirect again. We'll pass a special # argument to ensure that if we end up back at the server, we # won't be redirected again. log_debug(1, "Redirected again! Code=", redirectStatus) redirectStatus = self.__redirectToNextLocation(True) if (redirectStatus != apache.HTTP_OK) and (redirectStatus != apache.HTTP_PARTIAL_CONTENT): # We must have run out of retry attempts. Fail over to Hosted # to perform the request. log_debug(1, "Redirection failed; retries exhausted. " \ "Failing over. Code=", \ redirectStatus) redirectStatus = self.__redirectFailover() return SharedHandler._handleServerResponse(self, redirectStatus) else: # Otherwise, revert to default behavior. return SharedHandler._handleServerResponse(self, status) def __redirectToNextLocation(self, loopProtection = False): """ This function will perform a redirection to the next location, as specified in the last response's "Location" header. This function will return an actual HTTP response status code. If successful, it will return apache.HTTP_OK, not apache.OK. If unsuccessful, this function will retry a configurable number of times, as defined in CFG.NETWORK_RETRIES. The following codes define "success". HTTP_OK HTTP_PARTIAL_CONTENT HTTP_MOVED_TEMPORARILY HTTP_MOVED_PERMANENTLY Upon successful completion of this function, the responseContext should be populated with the response. Arguments: loopProtection - If True, this function will insert a special header into the new request that tells the RHN server not to issue another redirect to us, in case that's where we end up being redirected. Return: This function may return any valid HTTP_* response code. See __redirectToNextLocationNoRetry for more info. """ retriesLeft = CFG.NETWORK_RETRIES # We'll now try to redirect to the 3rd party. We will keep # retrying until we exhaust the number of allowed attempts. # Valid response codes are: # HTTP_OK # HTTP_PARTIAL_CONTENT # HTTP_MOVED_PERMANENTLY # HTTP_MOVED_TEMPORARILY redirectStatus = self.__redirectToNextLocationNoRetry(loopProtection) while redirectStatus != apache.HTTP_OK and \ redirectStatus != apache.HTTP_PARTIAL_CONTENT and \ redirectStatus != apache.HTTP_MOVED_PERMANENTLY and \ redirectStatus != apache.HTTP_MOVED_TEMPORARILY and \ retriesLeft > 0: retriesLeft = retriesLeft - 1 log_debug(1, "Redirection failed; trying again. " \ "Retries left=", \ retriesLeft, \ "Code=", \ redirectStatus) # Pop the current response context and restore the state to # the last successful response. The acts of remove the current # context will cause all of its open connections to be closed. self.responseContext.remove() # XXX: Possibly sleep here for a second? redirectStatus = \ self.__redirectToNextLocationNoRetry(loopProtection) return redirectStatus def __redirectToNextLocationNoRetry(self, loopProtection = False): """ This function will perform a redirection to the next location, as specified in the last response's "Location" header. This function will return an actual HTTP response status code. If successful, it will return apache.HTTP_OK, not apache.OK. If unsuccessful, this function will simply return; no retries will be performed. The following error codes can be returned: HTTP_OK,HTTP_PARTIAL_CONTENT - Redirect successful. HTTP_MOVED_TEMPORARILY - Redirect was redirected again by 3rd party. HTTP_MOVED_PERMANENTLY - Redirect was redirected again by 3rd party. HTTP_INTERNAL_SERVER_ERROR - Error extracting redirect information HTTP_SERVICE_UNAVAILABLE - Could not connect to 3rd party server, connection was reset, or a read error occurred during communication. HTTP_* - Any other HTTP status code may also be returned. Upon successful completion of this function, a new responseContext will be created and pushed onto the stack. """ # Obtain the redirect location first before we replace the current # response context. It's contained in the Location header of the # previous response. redirectLocation = self._get_header(rhnConstants.HEADER_LOCATION) # We are about to redirect to a new location so now we'll push a new # response context before we return any errors. self.responseContext.add() # There should always be a redirect URL passed back to us. If not, # there's an error. if not redirectLocation or len(redirectLocation) == 0: log_error(" No redirect location specified!") Traceback(mail = 0) return apache.HTTP_INTERNAL_SERVER_ERROR # The _get_header function returns the value as a list. There should # always be exactly one location specified. redirectLocation = redirectLocation[0] log_debug(1, " Redirecting to: ", redirectLocation) # Tear apart the redirect URL. We need the scheme, the host, the # port (if not the default), and the URI. _scheme, host, port, uri = self._parse_url(redirectLocation) # Add any params onto the URI since _parse_url doesn't include them. if redirectLocation.find('?') > -1: uri += redirectLocation[redirectLocation.index('?'):] # Now create a new connection. We'll use SSL if configured to do # so. params = { 'host' : host, 'port' : port, } if CFG.has_key('timeout'): params['timeout'] = CFG.TIMEOUT if CFG.USE_SSL: log_debug(1, " Redirecting with SSL. Cert= ", self.caChain) params['trusted_certs'] = [self.caChain] connection = connections.HTTPSConnection(**params) else: log_debug(1, " Redirecting withOUT SSL.") connection = connections.HTTPConnection(**params) # Put the connection into the current response context. self.responseContext.setConnection(connection) # Now open the connection to the 3rd party server. log_debug(4, "Attempting to connect to 3rd party server...") try: connection.connect() except socket.error, e: log_error("Error opening redirect connection", redirectLocation, e) Traceback(mail = 0) return apache.HTTP_SERVICE_UNAVAILABLE log_debug(4, "Connected to 3rd party server:", connection.sock.getpeername()) # Put the request out on the wire. response = None try: # We'll redirect to the URI made in the original request, but with # the new server instead. log_debug(4, "Making request: ", self.req.method, uri) connection.putrequest(self.req.method, uri) # Add some custom headers. if loopProtection: connection.putheader(rhnConstants.HEADER_RHN_REDIRECT, '0') log_debug(4, " Adding original URL header: ", self.rhnParent) connection.putheader(rhnConstants.HEADER_RHN_ORIG_LOC, self.rhnParent) # Add all the other headers in the original request in case we # need to re-authenticate with Hosted. for hdr in self.req.headers_in.keys(): if hdr.lower().startswith("x-rhn"): connection.putheader(hdr, self.req.headers_in[hdr]) log_debug(4, "Passing request header: ", hdr, self.req.headers_in[hdr]) connection.endheaders() response = connection.getresponse() except IOError, ioe: # Raised by getresponse() if server closes connection on us. log_error("Redirect connection reset by peer.", redirectLocation, ioe) Traceback(mail = 0) # The connection is saved in the current response context, and # will be closed when the caller pops the context. return apache.HTTP_SERVICE_UNAVAILABLE except socket.error, se: # Some socket error occurred. Possibly a read error. log_error("Redirect request failed.", redirectLocation, se) Traceback(mail = 0) # The connection is saved in the current response context, and # will be closed when the caller pops the context. return apache.HTTP_SERVICE_UNAVAILABLE # Save the response headers and body FD in the current communication # context. self.responseContext.setBodyFd(response) self.responseContext.setHeaders(response.msg) log_debug(4, "Response headers: ", self.responseContext.getHeaders().items()) log_debug(4, "Got redirect response. Status=", response.status) # Return the HTTP status to the caller. return response.status def __redirectFailover(self): """ This routine resends the original request back to the satellite/hosted system if a redirect to a 3rd party failed. To prevent redirection loops from occurring, an "X-RHN-Redirect: 0" header is passed along with the request. This function will return apache.HTTP_OK if everything succeeded, otherwise it will return an appropriate HTTP error code. """ # Add a special header which will tell the server not to send us any # more redirects. headers = rhnFlags.get('outputTransportOptions') headers[rhnConstants.HEADER_RHN_REDIRECT] = '0' log_debug(4, "Added X-RHN-Redirect header to outputTransportOptions:", \ headers) # Reset the existing connection and reconnect to the RHN parent server. self.responseContext.clear() self._connectToParent() # We'll just call serverCommo once more. The X-RHN-Redirect constant # will prevent us from falling into an infinite loop. Only GETs are # redirected, so we can safely pass an empty string in as the request # body. status = self._serverCommo() # This little hack isn't pretty, but lets us normalize our result code. if status == apache.OK: status = apache.HTTP_OK return status #===============================================================================
gpl-2.0
wskplho/sl4a
python-build/python-libs/gdata/src/gdata/base/__init__.py
155
24048
#!/usr/bin/python # # Copyright (C) 2006 Google Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Contains extensions to Atom objects used with Google Base.""" __author__ = 'api.jscudder (Jeffrey Scudder)' try: from xml.etree import cElementTree as ElementTree except ImportError: try: import cElementTree as ElementTree except ImportError: try: from xml.etree import ElementTree except ImportError: from elementtree import ElementTree import atom import gdata # XML namespaces which are often used in Google Base entities. GBASE_NAMESPACE = 'http://base.google.com/ns/1.0' GBASE_TEMPLATE = '{http://base.google.com/ns/1.0}%s' GMETA_NAMESPACE = 'http://base.google.com/ns-metadata/1.0' GMETA_TEMPLATE = '{http://base.google.com/ns-metadata/1.0}%s' class ItemAttributeContainer(object): """Provides methods for finding Google Base Item attributes. Google Base item attributes are child nodes in the gbase namespace. Google Base allows you to define your own item attributes and this class provides methods to interact with the custom attributes. """ def GetItemAttributes(self, name): """Returns a list of all item attributes which have the desired name. Args: name: str The tag of the desired base attributes. For example, calling this method with 'rating' would return a list of ItemAttributes represented by a 'g:rating' tag. Returns: A list of matching ItemAttribute objects. """ result = [] for attrib in self.item_attributes: if attrib.name == name: result.append(attrib) return result def FindItemAttribute(self, name): """Get the contents of the first Base item attribute which matches name. This method is deprecated, please use GetItemAttributes instead. Args: name: str The tag of the desired base attribute. For example, calling this method with name = 'rating' would search for a tag rating in the GBase namespace in the item attributes. Returns: The text contents of the item attribute, or none if the attribute was not found. """ for attrib in self.item_attributes: if attrib.name == name: return attrib.text return None def AddItemAttribute(self, name, value, value_type=None, access=None): """Adds a new item attribute tag containing the value. Creates a new extension element in the GBase namespace to represent a Google Base item attribute. Args: name: str The tag name for the new attribute. This must be a valid xml tag name. The tag will be placed in the GBase namespace. value: str Contents for the item attribute value_type: str (optional) The type of data in the vlaue, Examples: text float access: str (optional) Used to hide attributes. The attribute is not exposed in the snippets feed if access is set to 'private'. """ new_attribute = ItemAttribute(name, text=value, text_type=value_type, access=access) self.item_attributes.append(new_attribute) def SetItemAttribute(self, name, value): """Changes an existing item attribute's value.""" for attrib in self.item_attributes: if attrib.name == name: attrib.text = value return def RemoveItemAttribute(self, name): """Deletes the first extension element which matches name. Deletes the first extension element which matches name. """ for i in xrange(len(self.item_attributes)): if self.item_attributes[i].name == name: del self.item_attributes[i] return # We need to overwrite _ConvertElementTreeToMember to add special logic to # convert custom attributes to members def _ConvertElementTreeToMember(self, child_tree): # Find the element's tag in this class's list of child members if self.__class__._children.has_key(child_tree.tag): member_name = self.__class__._children[child_tree.tag][0] member_class = self.__class__._children[child_tree.tag][1] # If the class member is supposed to contain a list, make sure the # matching member is set to a list, then append the new member # instance to the list. if isinstance(member_class, list): if getattr(self, member_name) is None: setattr(self, member_name, []) getattr(self, member_name).append(atom._CreateClassFromElementTree( member_class[0], child_tree)) else: setattr(self, member_name, atom._CreateClassFromElementTree(member_class, child_tree)) elif child_tree.tag.find('{%s}' % GBASE_NAMESPACE) == 0: # If this is in the gbase namespace, make it into an extension element. name = child_tree.tag[child_tree.tag.index('}')+1:] value = child_tree.text if child_tree.attrib.has_key('type'): value_type = child_tree.attrib['type'] else: value_type = None self.AddItemAttribute(name, value, value_type) else: atom.ExtensionContainer._ConvertElementTreeToMember(self, child_tree) # We need to overwtite _AddMembersToElementTree to add special logic to # convert custom members to XML nodes. def _AddMembersToElementTree(self, tree): # Convert the members of this class which are XML child nodes. # This uses the class's _children dictionary to find the members which # should become XML child nodes. member_node_names = [values[0] for tag, values in self.__class__._children.iteritems()] for member_name in member_node_names: member = getattr(self, member_name) if member is None: pass elif isinstance(member, list): for instance in member: instance._BecomeChildElement(tree) else: member._BecomeChildElement(tree) # Convert the members of this class which are XML attributes. for xml_attribute, member_name in self.__class__._attributes.iteritems(): member = getattr(self, member_name) if member is not None: tree.attrib[xml_attribute] = member # Convert all special custom item attributes to nodes for attribute in self.item_attributes: attribute._BecomeChildElement(tree) # Lastly, call the ExtensionContainers's _AddMembersToElementTree to # convert any extension attributes. atom.ExtensionContainer._AddMembersToElementTree(self, tree) class ItemAttribute(atom.Text): """An optional or user defined attribute for a GBase item. Google Base allows items to have custom attribute child nodes. These nodes have contents and a type attribute which tells Google Base whether the contents are text, a float value with units, etc. The Atom text class has the same structure, so this class inherits from Text. """ _namespace = GBASE_NAMESPACE _children = atom.Text._children.copy() _attributes = atom.Text._attributes.copy() _attributes['access'] = 'access' def __init__(self, name, text_type=None, access=None, text=None, extension_elements=None, extension_attributes=None): """Constructor for a GBase item attribute Args: name: str The name of the attribute. Examples include price, color, make, model, pages, salary, etc. text_type: str (optional) The type associated with the text contents access: str (optional) If the access attribute is set to 'private', the attribute will not be included in the item's description in the snippets feed text: str (optional) The text data in the this element extension_elements: list (optional) A list of ExtensionElement instances extension_attributes: dict (optional) A dictionary of attribute value string pairs """ self.name = name self.type = text_type self.access = access self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def _BecomeChildElement(self, tree): new_child = ElementTree.Element('') tree.append(new_child) new_child.tag = '{%s}%s' % (self.__class__._namespace, self.name) self._AddMembersToElementTree(new_child) def _ToElementTree(self): new_tree = ElementTree.Element('{%s}%s' % (self.__class__._namespace, self.name)) self._AddMembersToElementTree(new_tree) return new_tree def ItemAttributeFromString(xml_string): element_tree = ElementTree.fromstring(xml_string) return _ItemAttributeFromElementTree(element_tree) def _ItemAttributeFromElementTree(element_tree): if element_tree.tag.find(GBASE_TEMPLATE % '') == 0: to_return = ItemAttribute('') to_return._HarvestElementTree(element_tree) to_return.name = element_tree.tag[element_tree.tag.index('}')+1:] if to_return.name and to_return.name != '': return to_return return None class Label(atom.AtomBase): """The Google Base label element""" _tag = 'label' _namespace = GBASE_NAMESPACE _children = atom.AtomBase._children.copy() _attributes = atom.AtomBase._attributes.copy() def __init__(self, text=None, extension_elements=None, extension_attributes=None): self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def LabelFromString(xml_string): return atom.CreateClassFromXMLString(Label, xml_string) class Thumbnail(atom.AtomBase): """The Google Base thumbnail element""" _tag = 'thumbnail' _namespace = GMETA_NAMESPACE _children = atom.AtomBase._children.copy() _attributes = atom.AtomBase._attributes.copy() _attributes['width'] = 'width' _attributes['height'] = 'height' def __init__(self, width=None, height=None, text=None, extension_elements=None, extension_attributes=None): self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} self.width = width self.height = height def ThumbnailFromString(xml_string): return atom.CreateClassFromXMLString(Thumbnail, xml_string) class ImageLink(atom.Text): """The Google Base image_link element""" _tag = 'image_link' _namespace = GBASE_NAMESPACE _children = atom.Text._children.copy() _attributes = atom.Text._attributes.copy() _children['{%s}thumbnail' % GMETA_NAMESPACE] = ('thumbnail', [Thumbnail]) def __init__(self, thumbnail=None, text=None, extension_elements=None, text_type=None, extension_attributes=None): self.thumbnail = thumbnail or [] self.text = text self.type = text_type self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def ImageLinkFromString(xml_string): return atom.CreateClassFromXMLString(ImageLink, xml_string) class ItemType(atom.Text): """The Google Base item_type element""" _tag = 'item_type' _namespace = GBASE_NAMESPACE _children = atom.Text._children.copy() _attributes = atom.Text._attributes.copy() def __init__(self, text=None, extension_elements=None, text_type=None, extension_attributes=None): self.text = text self.type = text_type self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def ItemTypeFromString(xml_string): return atom.CreateClassFromXMLString(ItemType, xml_string) class MetaItemType(ItemType): """The Google Base item_type element""" _tag = 'item_type' _namespace = GMETA_NAMESPACE _children = ItemType._children.copy() _attributes = ItemType._attributes.copy() def MetaItemTypeFromString(xml_string): return atom.CreateClassFromXMLString(MetaItemType, xml_string) class Value(atom.AtomBase): """Metadata about common values for a given attribute A value is a child of an attribute which comes from the attributes feed. The value's text is a commonly used value paired with an attribute name and the value's count tells how often this value appears for the given attribute in the search results. """ _tag = 'value' _namespace = GMETA_NAMESPACE _children = atom.AtomBase._children.copy() _attributes = atom.AtomBase._attributes.copy() _attributes['count'] = 'count' def __init__(self, count=None, text=None, extension_elements=None, extension_attributes=None): """Constructor for Attribute metadata element Args: count: str (optional) The number of times the value in text is given for the parent attribute. text: str (optional) The value which appears in the search results. extension_elements: list (optional) A list of ExtensionElement instances extension_attributes: dict (optional) A dictionary of attribute value string pairs """ self.count = count self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def ValueFromString(xml_string): return atom.CreateClassFromXMLString(Value, xml_string) class Attribute(atom.Text): """Metadata about an attribute from the attributes feed An entry from the attributes feed contains a list of attributes. Each attribute describes the attribute's type and count of the items which use the attribute. """ _tag = 'attribute' _namespace = GMETA_NAMESPACE _children = atom.Text._children.copy() _attributes = atom.Text._attributes.copy() _children['{%s}value' % GMETA_NAMESPACE] = ('value', [Value]) _attributes['count'] = 'count' _attributes['name'] = 'name' def __init__(self, name=None, attribute_type=None, count=None, value=None, text=None, extension_elements=None, extension_attributes=None): """Constructor for Attribute metadata element Args: name: str (optional) The name of the attribute attribute_type: str (optional) The type for the attribute. Examples: test, float, etc. count: str (optional) The number of times this attribute appears in the query results. value: list (optional) The values which are often used for this attirbute. text: str (optional) The text contents of the XML for this attribute. extension_elements: list (optional) A list of ExtensionElement instances extension_attributes: dict (optional) A dictionary of attribute value string pairs """ self.name = name self.type = attribute_type self.count = count self.value = value or [] self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def AttributeFromString(xml_string): return atom.CreateClassFromXMLString(Attribute, xml_string) class Attributes(atom.AtomBase): """A collection of Google Base metadata attributes""" _tag = 'attributes' _namespace = GMETA_NAMESPACE _children = atom.AtomBase._children.copy() _attributes = atom.AtomBase._attributes.copy() _children['{%s}attribute' % GMETA_NAMESPACE] = ('attribute', [Attribute]) def __init__(self, attribute=None, extension_elements=None, extension_attributes=None, text=None): self.attribute = attribute or [] self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} self.text = text class GBaseItem(ItemAttributeContainer, gdata.BatchEntry): """An Google Base flavor of an Atom Entry. Google Base items have required attributes, recommended attributes, and user defined attributes. The required attributes are stored in this class as members, and other attributes are stored as extension elements. You can access the recommended and user defined attributes by using AddItemAttribute, SetItemAttribute, FindItemAttribute, and RemoveItemAttribute. The Base Item """ _tag = 'entry' _namespace = atom.ATOM_NAMESPACE _children = gdata.BatchEntry._children.copy() _attributes = gdata.BatchEntry._attributes.copy() _children['{%s}label' % GBASE_NAMESPACE] = ('label', [Label]) _children['{%s}item_type' % GBASE_NAMESPACE] = ('item_type', ItemType) def __init__(self, author=None, category=None, content=None, contributor=None, atom_id=None, link=None, published=None, rights=None, source=None, summary=None, title=None, updated=None, control=None, label=None, item_type=None, item_attributes=None, batch_operation=None, batch_id=None, batch_status=None, text=None, extension_elements=None, extension_attributes=None): self.author = author or [] self.category = category or [] self.content = content self.contributor = contributor or [] self.id = atom_id self.link = link or [] self.published = published self.rights = rights self.source = source self.summary = summary self.title = title self.updated = updated self.control = control self.label = label or [] self.item_type = item_type self.item_attributes = item_attributes or [] self.batch_operation = batch_operation self.batch_id = batch_id self.batch_status = batch_status self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def GBaseItemFromString(xml_string): return atom.CreateClassFromXMLString(GBaseItem, xml_string) class GBaseSnippet(GBaseItem): _tag = 'entry' _namespace = atom.ATOM_NAMESPACE _children = GBaseItem._children.copy() _attributes = GBaseItem._attributes.copy() def GBaseSnippetFromString(xml_string): return atom.CreateClassFromXMLString(GBaseSnippet, xml_string) class GBaseAttributeEntry(gdata.GDataEntry): """An Atom Entry from the attributes feed""" _tag = 'entry' _namespace = atom.ATOM_NAMESPACE _children = gdata.GDataEntry._children.copy() _attributes = gdata.GDataEntry._attributes.copy() _children['{%s}attribute' % GMETA_NAMESPACE] = ('attribute', [Attribute]) def __init__(self, author=None, category=None, content=None, contributor=None, atom_id=None, link=None, published=None, rights=None, source=None, summary=None, title=None, updated=None, label=None, attribute=None, control=None, text=None, extension_elements=None, extension_attributes=None): self.author = author or [] self.category = category or [] self.content = content self.contributor = contributor or [] self.id = atom_id self.link = link or [] self.published = published self.rights = rights self.source = source self.summary = summary self.control = control self.title = title self.updated = updated self.label = label or [] self.attribute = attribute or [] self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def GBaseAttributeEntryFromString(xml_string): return atom.CreateClassFromXMLString(GBaseAttributeEntry, xml_string) class GBaseItemTypeEntry(gdata.GDataEntry): """An Atom entry from the item types feed These entries contain a list of attributes which are stored in one XML node called attributes. This class simplifies the data structure by treating attributes as a list of attribute instances. Note that the item_type for an item type entry is in the Google Base meta namespace as opposed to item_types encountered in other feeds. """ _tag = 'entry' _namespace = atom.ATOM_NAMESPACE _children = gdata.GDataEntry._children.copy() _attributes = gdata.GDataEntry._attributes.copy() _children['{%s}attributes' % GMETA_NAMESPACE] = ('attributes', Attributes) _children['{%s}attribute' % GMETA_NAMESPACE] = ('attribute', [Attribute]) _children['{%s}item_type' % GMETA_NAMESPACE] = ('item_type', MetaItemType) def __init__(self, author=None, category=None, content=None, contributor=None, atom_id=None, link=None, published=None, rights=None, source=None, summary=None, title=None, updated=None, label=None, item_type=None, control=None, attribute=None, attributes=None, text=None, extension_elements=None, extension_attributes=None): self.author = author or [] self.category = category or [] self.content = content self.contributor = contributor or [] self.id = atom_id self.link = link or [] self.published = published self.rights = rights self.source = source self.summary = summary self.title = title self.updated = updated self.control = control self.label = label or [] self.item_type = item_type self.attributes = attributes self.attribute = attribute or [] self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def GBaseItemTypeEntryFromString(xml_string): return atom.CreateClassFromXMLString(GBaseItemTypeEntry, xml_string) class GBaseItemFeed(gdata.BatchFeed): """A feed containing Google Base Items""" _tag = 'feed' _namespace = atom.ATOM_NAMESPACE _children = gdata.BatchFeed._children.copy() _attributes = gdata.BatchFeed._attributes.copy() _children['{%s}entry' % atom.ATOM_NAMESPACE] = ('entry', [GBaseItem]) def GBaseItemFeedFromString(xml_string): return atom.CreateClassFromXMLString(GBaseItemFeed, xml_string) class GBaseSnippetFeed(gdata.GDataFeed): """A feed containing Google Base Snippets""" _tag = 'feed' _namespace = atom.ATOM_NAMESPACE _children = gdata.GDataFeed._children.copy() _attributes = gdata.GDataFeed._attributes.copy() _children['{%s}entry' % atom.ATOM_NAMESPACE] = ('entry', [GBaseSnippet]) def GBaseSnippetFeedFromString(xml_string): return atom.CreateClassFromXMLString(GBaseSnippetFeed, xml_string) class GBaseAttributesFeed(gdata.GDataFeed): """A feed containing Google Base Attributes A query sent to the attributes feed will return a feed of attributes which are present in the items that match the query. """ _tag = 'feed' _namespace = atom.ATOM_NAMESPACE _children = gdata.GDataFeed._children.copy() _attributes = gdata.GDataFeed._attributes.copy() _children['{%s}entry' % atom.ATOM_NAMESPACE] = ('entry', [GBaseAttributeEntry]) def GBaseAttributesFeedFromString(xml_string): return atom.CreateClassFromXMLString(GBaseAttributesFeed, xml_string) class GBaseLocalesFeed(gdata.GDataFeed): """The locales feed from Google Base. This read-only feed defines the permitted locales for Google Base. The locale value identifies the language, currency, and date formats used in a feed. """ _tag = 'feed' _namespace = atom.ATOM_NAMESPACE _children = gdata.GDataFeed._children.copy() _attributes = gdata.GDataFeed._attributes.copy() def GBaseLocalesFeedFromString(xml_string): return atom.CreateClassFromXMLString(GBaseLocalesFeed, xml_string) class GBaseItemTypesFeed(gdata.GDataFeed): """A feed from the Google Base item types feed""" _tag = 'feed' _namespace = atom.ATOM_NAMESPACE _children = gdata.GDataFeed._children.copy() _attributes = gdata.GDataFeed._attributes.copy() _children['{%s}entry' % atom.ATOM_NAMESPACE] = ('entry', [GBaseItemTypeEntry]) def GBaseItemTypesFeedFromString(xml_string): return atom.CreateClassFromXMLString(GBaseItemTypesFeed, xml_string)
apache-2.0
912/M-new
virtualenvironment/experimental/lib/python2.7/site-packages/django/contrib/admin/models.py
84
3028
from __future__ import unicode_literals from django.db import models from django.conf import settings from django.contrib.contenttypes.models import ContentType from django.contrib.admin.utils import quote from django.core.urlresolvers import reverse, NoReverseMatch from django.utils.translation import ugettext, ugettext_lazy as _ from django.utils.encoding import smart_text from django.utils.encoding import python_2_unicode_compatible ADDITION = 1 CHANGE = 2 DELETION = 3 class LogEntryManager(models.Manager): def log_action(self, user_id, content_type_id, object_id, object_repr, action_flag, change_message=''): e = self.model(None, None, user_id, content_type_id, smart_text(object_id), object_repr[:200], action_flag, change_message) e.save() @python_2_unicode_compatible class LogEntry(models.Model): action_time = models.DateTimeField(_('action time'), auto_now=True) user = models.ForeignKey(settings.AUTH_USER_MODEL) content_type = models.ForeignKey(ContentType, blank=True, null=True) object_id = models.TextField(_('object id'), blank=True, null=True) object_repr = models.CharField(_('object repr'), max_length=200) action_flag = models.PositiveSmallIntegerField(_('action flag')) change_message = models.TextField(_('change message'), blank=True) objects = LogEntryManager() class Meta: verbose_name = _('log entry') verbose_name_plural = _('log entries') db_table = 'django_admin_log' ordering = ('-action_time',) def __repr__(self): return smart_text(self.action_time) def __str__(self): if self.action_flag == ADDITION: return ugettext('Added "%(object)s".') % {'object': self.object_repr} elif self.action_flag == CHANGE: return ugettext('Changed "%(object)s" - %(changes)s') % { 'object': self.object_repr, 'changes': self.change_message, } elif self.action_flag == DELETION: return ugettext('Deleted "%(object)s."') % {'object': self.object_repr} return ugettext('LogEntry Object') def is_addition(self): return self.action_flag == ADDITION def is_change(self): return self.action_flag == CHANGE def is_deletion(self): return self.action_flag == DELETION def get_edited_object(self): "Returns the edited object represented by this log entry" return self.content_type.get_object_for_this_type(pk=self.object_id) def get_admin_url(self): """ Returns the admin URL to edit the object represented by this log entry. This is relative to the Django admin index page. """ if self.content_type and self.object_id: url_name = 'admin:%s_%s_change' % (self.content_type.app_label, self.content_type.model) try: return reverse(url_name, args=(quote(self.object_id),)) except NoReverseMatch: pass return None
gpl-2.0
netsamir/dotfiles
dotbot/lib/pyyaml/tests/lib3/test_emitter.py
62
4305
import yaml def _compare_events(events1, events2): assert len(events1) == len(events2), (events1, events2) for event1, event2 in zip(events1, events2): assert event1.__class__ == event2.__class__, (event1, event2) if isinstance(event1, yaml.NodeEvent): assert event1.anchor == event2.anchor, (event1, event2) if isinstance(event1, yaml.CollectionStartEvent): assert event1.tag == event2.tag, (event1, event2) if isinstance(event1, yaml.ScalarEvent): if True not in event1.implicit+event2.implicit: assert event1.tag == event2.tag, (event1, event2) assert event1.value == event2.value, (event1, event2) def test_emitter_on_data(data_filename, canonical_filename, verbose=False): events = list(yaml.parse(open(data_filename, 'rb'))) output = yaml.emit(events) if verbose: print("OUTPUT:") print(output) new_events = list(yaml.parse(output)) _compare_events(events, new_events) test_emitter_on_data.unittest = ['.data', '.canonical'] def test_emitter_on_canonical(canonical_filename, verbose=False): events = list(yaml.parse(open(canonical_filename, 'rb'))) for canonical in [False, True]: output = yaml.emit(events, canonical=canonical) if verbose: print("OUTPUT (canonical=%s):" % canonical) print(output) new_events = list(yaml.parse(output)) _compare_events(events, new_events) test_emitter_on_canonical.unittest = ['.canonical'] def test_emitter_styles(data_filename, canonical_filename, verbose=False): for filename in [data_filename, canonical_filename]: events = list(yaml.parse(open(filename, 'rb'))) for flow_style in [False, True]: for style in ['|', '>', '"', '\'', '']: styled_events = [] for event in events: if isinstance(event, yaml.ScalarEvent): event = yaml.ScalarEvent(event.anchor, event.tag, event.implicit, event.value, style=style) elif isinstance(event, yaml.SequenceStartEvent): event = yaml.SequenceStartEvent(event.anchor, event.tag, event.implicit, flow_style=flow_style) elif isinstance(event, yaml.MappingStartEvent): event = yaml.MappingStartEvent(event.anchor, event.tag, event.implicit, flow_style=flow_style) styled_events.append(event) output = yaml.emit(styled_events) if verbose: print("OUTPUT (filename=%r, flow_style=%r, style=%r)" % (filename, flow_style, style)) print(output) new_events = list(yaml.parse(output)) _compare_events(events, new_events) test_emitter_styles.unittest = ['.data', '.canonical'] class EventsLoader(yaml.Loader): def construct_event(self, node): if isinstance(node, yaml.ScalarNode): mapping = {} else: mapping = self.construct_mapping(node) class_name = str(node.tag[1:])+'Event' if class_name in ['AliasEvent', 'ScalarEvent', 'SequenceStartEvent', 'MappingStartEvent']: mapping.setdefault('anchor', None) if class_name in ['ScalarEvent', 'SequenceStartEvent', 'MappingStartEvent']: mapping.setdefault('tag', None) if class_name in ['SequenceStartEvent', 'MappingStartEvent']: mapping.setdefault('implicit', True) if class_name == 'ScalarEvent': mapping.setdefault('implicit', (False, True)) mapping.setdefault('value', '') value = getattr(yaml, class_name)(**mapping) return value EventsLoader.add_constructor(None, EventsLoader.construct_event) def test_emitter_events(events_filename, verbose=False): events = list(yaml.load(open(events_filename, 'rb'), Loader=EventsLoader)) output = yaml.emit(events) if verbose: print("OUTPUT:") print(output) new_events = list(yaml.parse(output)) _compare_events(events, new_events) if __name__ == '__main__': import test_appliance test_appliance.run(globals())
unlicense
mmagnus/rna-pdb-tools
rna_tools/tools/rna_alignment/rna_align_seq_to_alignment.py
2
1675
#!/usr/bin/env python """ cmaling:: [mm] thf cmalign RF01831.cm 4lvv.seq # STOCKHOLM 1.0 #=GF AU Infernal 1.1.2 4lvv -GGAGAGUA-GAUGAUUCGCGUUAAGUGUGUGUGA-AUGGGAUGUCG-UCACACAACGAAGC---GAGA---GCGCGGUGAAUCAUU-GCAUCCGCUCCA #=GR 4lvv PP .********.******************9999998.***********.8999999******8...5555...8**************.************ #=GC SS_cons (((((----(((((((((((,,,,,<<-<<<<<<<<___________>>>>>>>>>>,,,<<<<______>>>>,,,)))))))))))-------))))) #=GC RF ggcaGAGUAGggugccgugcGUuAAGUGccggcgggAcGGGgaGUUGcccgccggACGAAgggcaaaauugcccGCGguacggcaccCGCAUcCgCugcc // Reads seq files:: >4lvv GGAGAGUAGAUGAUUCGCGUUAAGUGUGUGUGAAUGGGAUGUCGUCACACAACGAAGCGAGAGCGCGGUGAAUCAUUGCAUCCGCUCCA """ import rna_tools.utils.rna_alignment.rna_alignment as ra import sys import argparse def get_parser(): parser = argparse.ArgumentParser(description=__doc__, formatter_class=argparse.RawDescriptionHelpFormatter) parser.add_argument('-f', '--file', help="cmalign output") parser.add_argument('-a', '--alignment', help="alignment file", required=True) parser.add_argument('-m', '--cm', help="cm model to run cmalign on") parser.add_argument('-s', '--seq', help="seq fn, fasta!") return parser if __name__ == '__main__': args = get_parser().parse_args() # don't run cmalign if args.file: cma = ra.CMAlign(outputfn=args.file) else: cma = ra.CMAlign()#(outputfn=args.file) cma.run_cmalign(args.seq, args.cm) seq = cma.get_seq() a = ra.RNAalignment(args.alignment) print('cma hit ' + seq) print('seq ' + a.align_seq(seq)) print('a.rf ' + a.rf)
gpl-3.0
jedie/pypyjs-standalone
website/js/pypy.js-0.3.0/lib/modules/test/test_site.py
8
15799
"""Tests for 'site'. Tests assume the initial paths in sys.path once the interpreter has begun executing have not been removed. """ import unittest from test.test_support import run_unittest, TESTFN, EnvironmentVarGuard from test.test_support import captured_output import __builtin__ import os import sys import re import encodings import subprocess import sysconfig from copy import copy # Need to make sure to not import 'site' if someone specified ``-S`` at the # command-line. Detect this by just making sure 'site' has not been imported # already. if "site" in sys.modules: import site else: raise unittest.SkipTest("importation of site.py suppressed") if site.ENABLE_USER_SITE and not os.path.isdir(site.USER_SITE): # need to add user site directory for tests os.makedirs(site.USER_SITE) site.addsitedir(site.USER_SITE) class HelperFunctionsTests(unittest.TestCase): """Tests for helper functions. The setting of the encoding (set using sys.setdefaultencoding) used by the Unicode implementation is not tested. """ def setUp(self): """Save a copy of sys.path""" self.sys_path = sys.path[:] self.old_base = site.USER_BASE self.old_site = site.USER_SITE self.old_prefixes = site.PREFIXES self.old_vars = copy(sysconfig._CONFIG_VARS) def tearDown(self): """Restore sys.path""" sys.path[:] = self.sys_path site.USER_BASE = self.old_base site.USER_SITE = self.old_site site.PREFIXES = self.old_prefixes sysconfig._CONFIG_VARS = self.old_vars def test_makepath(self): # Test makepath() have an absolute path for its first return value # and a case-normalized version of the absolute path for its # second value. path_parts = ("Beginning", "End") original_dir = os.path.join(*path_parts) abs_dir, norm_dir = site.makepath(*path_parts) self.assertEqual(os.path.abspath(original_dir), abs_dir) if original_dir == os.path.normcase(original_dir): self.assertEqual(abs_dir, norm_dir) else: self.assertEqual(os.path.normcase(abs_dir), norm_dir) def test_init_pathinfo(self): dir_set = site._init_pathinfo() for entry in [site.makepath(path)[1] for path in sys.path if path and os.path.isdir(path)]: self.assertIn(entry, dir_set, "%s from sys.path not found in set returned " "by _init_pathinfo(): %s" % (entry, dir_set)) def pth_file_tests(self, pth_file): """Contain common code for testing results of reading a .pth file""" self.assertIn(pth_file.imported, sys.modules, "%s not in sys.modules" % pth_file.imported) self.assertIn(site.makepath(pth_file.good_dir_path)[0], sys.path) self.assertFalse(os.path.exists(pth_file.bad_dir_path)) def test_addpackage(self): # Make sure addpackage() imports if the line starts with 'import', # adds directories to sys.path for any line in the file that is not a # comment or import that is a valid directory name for where the .pth # file resides; invalid directories are not added pth_file = PthFile() pth_file.cleanup(prep=True) # to make sure that nothing is # pre-existing that shouldn't be try: pth_file.create() site.addpackage(pth_file.base_dir, pth_file.filename, set()) self.pth_file_tests(pth_file) finally: pth_file.cleanup() def make_pth(self, contents, pth_dir='.', pth_name=TESTFN): # Create a .pth file and return its (abspath, basename). pth_dir = os.path.abspath(pth_dir) pth_basename = pth_name + '.pth' pth_fn = os.path.join(pth_dir, pth_basename) pth_file = open(pth_fn, 'w') self.addCleanup(lambda: os.remove(pth_fn)) pth_file.write(contents) pth_file.close() return pth_dir, pth_basename def test_addpackage_import_bad_syntax(self): # Issue 10642 pth_dir, pth_fn = self.make_pth("import bad)syntax\n") with captured_output("stderr") as err_out: site.addpackage(pth_dir, pth_fn, set()) self.assertRegexpMatches(err_out.getvalue(), "line 1") self.assertRegexpMatches(err_out.getvalue(), re.escape(os.path.join(pth_dir, pth_fn))) # XXX: the previous two should be independent checks so that the # order doesn't matter. The next three could be a single check # but my regex foo isn't good enough to write it. self.assertRegexpMatches(err_out.getvalue(), 'Traceback') self.assertRegexpMatches(err_out.getvalue(), r'import bad\)syntax') self.assertRegexpMatches(err_out.getvalue(), 'SyntaxError') def test_addpackage_import_bad_exec(self): # Issue 10642 pth_dir, pth_fn = self.make_pth("randompath\nimport nosuchmodule\n") with captured_output("stderr") as err_out: site.addpackage(pth_dir, pth_fn, set()) self.assertRegexpMatches(err_out.getvalue(), "line 2") self.assertRegexpMatches(err_out.getvalue(), re.escape(os.path.join(pth_dir, pth_fn))) # XXX: ditto previous XXX comment. self.assertRegexpMatches(err_out.getvalue(), 'Traceback') self.assertRegexpMatches(err_out.getvalue(), 'ImportError') @unittest.skipIf(sys.platform == "win32", "Windows does not raise an " "error for file paths containing null characters") def test_addpackage_import_bad_pth_file(self): # Issue 5258 pth_dir, pth_fn = self.make_pth("abc\x00def\n") with captured_output("stderr") as err_out: site.addpackage(pth_dir, pth_fn, set()) self.assertRegexpMatches(err_out.getvalue(), "line 1") self.assertRegexpMatches(err_out.getvalue(), re.escape(os.path.join(pth_dir, pth_fn))) # XXX: ditto previous XXX comment. self.assertRegexpMatches(err_out.getvalue(), 'Traceback') self.assertRegexpMatches(err_out.getvalue(), 'TypeError') def test_addsitedir(self): # Same tests for test_addpackage since addsitedir() essentially just # calls addpackage() for every .pth file in the directory pth_file = PthFile() pth_file.cleanup(prep=True) # Make sure that nothing is pre-existing # that is tested for try: pth_file.create() site.addsitedir(pth_file.base_dir, set()) self.pth_file_tests(pth_file) finally: pth_file.cleanup() @unittest.skipUnless(site.ENABLE_USER_SITE, "requires access to PEP 370 " "user-site (site.ENABLE_USER_SITE)") def test_s_option(self): usersite = site.USER_SITE self.assertIn(usersite, sys.path) env = os.environ.copy() rc = subprocess.call([sys.executable, '-c', 'import sys; sys.exit(%r in sys.path)' % usersite], env=env) self.assertEqual(rc, 1, "%r is not in sys.path (sys.exit returned %r)" % (usersite, rc)) env = os.environ.copy() rc = subprocess.call([sys.executable, '-s', '-c', 'import sys; sys.exit(%r in sys.path)' % usersite], env=env) self.assertEqual(rc, 0) env = os.environ.copy() env["PYTHONNOUSERSITE"] = "1" rc = subprocess.call([sys.executable, '-c', 'import sys; sys.exit(%r in sys.path)' % usersite], env=env) self.assertEqual(rc, 0) env = os.environ.copy() env["PYTHONUSERBASE"] = "/tmp" rc = subprocess.call([sys.executable, '-c', 'import sys, site; sys.exit(site.USER_BASE.startswith("/tmp"))'], env=env) self.assertEqual(rc, 1) def test_getuserbase(self): site.USER_BASE = None user_base = site.getuserbase() # the call sets site.USER_BASE self.assertEqual(site.USER_BASE, user_base) # let's set PYTHONUSERBASE and see if it uses it site.USER_BASE = None import sysconfig sysconfig._CONFIG_VARS = None with EnvironmentVarGuard() as environ: environ['PYTHONUSERBASE'] = 'xoxo' self.assertTrue(site.getuserbase().startswith('xoxo'), site.getuserbase()) def test_getusersitepackages(self): site.USER_SITE = None site.USER_BASE = None user_site = site.getusersitepackages() # the call sets USER_BASE *and* USER_SITE self.assertEqual(site.USER_SITE, user_site) self.assertTrue(user_site.startswith(site.USER_BASE), user_site) def test_getsitepackages(self): site.PREFIXES = ['xoxo'] dirs = site.getsitepackages() if sys.platform in ('os2emx', 'riscos'): self.assertEqual(len(dirs), 1) wanted = os.path.join('xoxo', 'Lib', 'site-packages') self.assertEqual(dirs[0], wanted) elif '__pypy__' in sys.builtin_module_names: self.assertEquals(len(dirs), 1) wanted = os.path.join('xoxo', 'site-packages') self.assertEquals(dirs[0], wanted) elif (sys.platform == "darwin" and sysconfig.get_config_var("PYTHONFRAMEWORK")): # OS X framework builds site.PREFIXES = ['Python.framework'] dirs = site.getsitepackages() self.assertEqual(len(dirs), 3) wanted = os.path.join('/Library', sysconfig.get_config_var("PYTHONFRAMEWORK"), sys.version[:3], 'site-packages') self.assertEqual(dirs[2], wanted) elif os.sep == '/': # OS X non-framwework builds, Linux, FreeBSD, etc self.assertEqual(len(dirs), 2) wanted = os.path.join('xoxo', 'lib', 'python' + sys.version[:3], 'site-packages') self.assertEqual(dirs[0], wanted) wanted = os.path.join('xoxo', 'lib', 'site-python') self.assertEqual(dirs[1], wanted) else: # other platforms self.assertEqual(len(dirs), 2) self.assertEqual(dirs[0], 'xoxo') wanted = os.path.join('xoxo', 'lib', 'site-packages') self.assertEqual(dirs[1], wanted) class PthFile(object): """Helper class for handling testing of .pth files""" def __init__(self, filename_base=TESTFN, imported="time", good_dirname="__testdir__", bad_dirname="__bad"): """Initialize instance variables""" self.filename = filename_base + ".pth" self.base_dir = os.path.abspath('') self.file_path = os.path.join(self.base_dir, self.filename) self.imported = imported self.good_dirname = good_dirname self.bad_dirname = bad_dirname self.good_dir_path = os.path.join(self.base_dir, self.good_dirname) self.bad_dir_path = os.path.join(self.base_dir, self.bad_dirname) def create(self): """Create a .pth file with a comment, blank lines, an ``import <self.imported>``, a line with self.good_dirname, and a line with self.bad_dirname. Creation of the directory for self.good_dir_path (based off of self.good_dirname) is also performed. Make sure to call self.cleanup() to undo anything done by this method. """ FILE = open(self.file_path, 'w') try: print>>FILE, "#import @bad module name" print>>FILE, "\n" print>>FILE, "import %s" % self.imported print>>FILE, self.good_dirname print>>FILE, self.bad_dirname finally: FILE.close() os.mkdir(self.good_dir_path) def cleanup(self, prep=False): """Make sure that the .pth file is deleted, self.imported is not in sys.modules, and that both self.good_dirname and self.bad_dirname are not existing directories.""" if os.path.exists(self.file_path): os.remove(self.file_path) if prep: self.imported_module = sys.modules.get(self.imported) if self.imported_module: del sys.modules[self.imported] else: if self.imported_module: sys.modules[self.imported] = self.imported_module if os.path.exists(self.good_dir_path): os.rmdir(self.good_dir_path) if os.path.exists(self.bad_dir_path): os.rmdir(self.bad_dir_path) class ImportSideEffectTests(unittest.TestCase): """Test side-effects from importing 'site'.""" def setUp(self): """Make a copy of sys.path""" self.sys_path = sys.path[:] def tearDown(self): """Restore sys.path""" sys.path[:] = self.sys_path def test_abs__file__(self): # Make sure all imported modules have their __file__ attribute # as an absolute path. # Handled by abs__file__() site.abs__file__() for module in (sys, os, __builtin__): try: self.assertTrue(os.path.isabs(module.__file__), repr(module)) except AttributeError: continue # We could try everything in sys.modules; however, when regrtest.py # runs something like test_frozen before test_site, then we will # be testing things loaded *after* test_site did path normalization def test_no_duplicate_paths(self): # No duplicate paths should exist in sys.path # Handled by removeduppaths() site.removeduppaths() seen_paths = set() for path in sys.path: self.assertNotIn(path, seen_paths) seen_paths.add(path) @unittest.skip('test not implemented') def test_add_build_dir(self): # Test that the build directory's Modules directory is used when it # should be. # XXX: implement pass def test_setting_quit(self): # 'quit' and 'exit' should be injected into __builtin__ self.assertTrue(hasattr(__builtin__, "quit")) self.assertTrue(hasattr(__builtin__, "exit")) def test_setting_copyright(self): # 'copyright' and 'credits' should be in __builtin__ self.assertTrue(hasattr(__builtin__, "copyright")) self.assertTrue(hasattr(__builtin__, "credits")) def test_setting_help(self): # 'help' should be set in __builtin__ self.assertTrue(hasattr(__builtin__, "help")) def test_aliasing_mbcs(self): if sys.platform == "win32": import locale if locale.getdefaultlocale()[1].startswith('cp'): for value in encodings.aliases.aliases.itervalues(): if value == "mbcs": break else: self.fail("did not alias mbcs") def test_setdefaultencoding_removed(self): # Make sure sys.setdefaultencoding is gone self.assertTrue(not hasattr(sys, "setdefaultencoding")) def test_sitecustomize_executed(self): # If sitecustomize is available, it should have been imported. if "sitecustomize" not in sys.modules: try: import sitecustomize except ImportError: pass else: self.fail("sitecustomize not imported automatically") def test_main(): run_unittest(HelperFunctionsTests, ImportSideEffectTests) if __name__ == "__main__": test_main()
mit
hgrif/incubator-airflow
tests/contrib/operators/test_spark_sql_operator.py
16
2737
# -*- coding: utf-8 -*- # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # import datetime import unittest from airflow import DAG, configuration from airflow.contrib.operators.spark_sql_operator import SparkSqlOperator DEFAULT_DATE = datetime.datetime(2017, 1, 1) class TestSparkSqlOperator(unittest.TestCase): _config = { 'sql': 'SELECT 22', 'conn_id': 'spark_special_conn_id', 'total_executor_cores': 4, 'executor_cores': 4, 'executor_memory': '22g', 'keytab': 'privileged_user.keytab', 'principal': 'user/spark@airflow.org', 'master': 'yarn-client', 'name': 'special-application-name', 'num_executors': 8, 'yarn_queue': 'special-queue' } def setUp(self): configuration.load_test_config() args = { 'owner': 'airflow', 'start_date': DEFAULT_DATE } self.dag = DAG('test_dag_id', default_args=args) def test_execute(self): # Given / When operator = SparkSqlOperator( task_id='spark_sql_job', dag=self.dag, **self._config ) self.assertEqual(self._config['sql'], operator._sql) self.assertEqual(self._config['conn_id'], operator._conn_id) self.assertEqual(self._config['total_executor_cores'], operator._total_executor_cores) self.assertEqual(self._config['executor_cores'], operator._executor_cores) self.assertEqual(self._config['executor_memory'], operator._executor_memory) self.assertEqual(self._config['keytab'], operator._keytab) self.assertEqual(self._config['principal'], operator._principal) self.assertEqual(self._config['executor_memory'], operator._executor_memory) self.assertEqual(self._config['keytab'], operator._keytab) self.assertEqual(self._config['principal'], operator._principal) self.assertEqual(self._config['master'], operator._master) self.assertEqual(self._config['name'], operator._name) self.assertEqual(self._config['num_executors'], operator._num_executors) self.assertEqual(self._config['yarn_queue'], operator._yarn_queue) if __name__ == '__main__': unittest.main()
apache-2.0
sdgdsffdsfff/detdup
detdup/services/task.py
3
5544
# -*- coding: utf-8 -*- # TODO 多进程 有木桶最短效应。但是目前没法解决变量共享。 import json import math import time from ..utils import * from ..core import DetDupCore class DetDupTask(object): default_attrs = [ "process_count", "cache_dir", "original_model", "items_model", "features", "query_check_columns", ] def __init__(self, opts): for key1 in DetDupTask.default_attrs: setattr(self, key1, opts.get(key1, None)) self.process_count = self.process_count or max_process_count self.items_model = opts['items_model'] self.items_model.cache_dir = self.cache_dir self.items_model.datadict_type = "sqlite" self.result_cPickle = os.path.join(self.cache_dir, "detdup.cPickle") self.result_json = os.path.join(self.cache_dir, "detdup.json") def new_detdup_core(self, storage_type='memory'): """ new queryinterface """ # 每个instance只能被generator, 否则这些进程同时访问一个IO, 那么所有CPU就都处于等待IO中不动了 detdup = DetDupCore(self.cache_dir, self.items_model) detdup.is_inspect_detail = False detdup.storage_type = storage_type for feature1 in self.features: detdup.plug_features(feature1()) # 确保不会覆盖 .original.db if (detdup.storage_type == 'memory') and detdup.feeded(): detdup.load_features_from_db() self.items_model.core = detdup return detdup def extract(self): self.items_model.pull_data() """ 重新生成请全部删除 model.db 和 features.db 文件 """ cprint("[建立 self.items_model 索引] ...", "blue") core = self.new_detdup_core() tmp_items = [] def write(tmp_items): core.feed_items(tmp_items) return [] for item_id1, item1 in self.items_model.iteritems(): tmp_items.append(item1) if len(tmp_items) >= 10000: tmp_items = write(tmp_items) tmp_items = write(tmp_items) def train(self): core = self.new_detdup_core() def delete_item_ids(table, item_ids_1): step = 100 for i1 in xrange(0, len(item_ids_1), step): table.delete().where(table.item_id << item_ids_1[i1:i1+step]).execute() pickle_filename = os.path.join(self.cache_dir, "detdup.cPickle") def load_result_func(): core = self.new_detdup_core('memory') for feature1 in core.features: table = feature1.features_tree # 1. 先排除一定是不重复的 candidate_list, uniq_list = feature1.divided_into_two_parts() delete_item_ids(table, uniq_list) # 2. 删除内容空白的条目 table.delete().where(table.uniq_chars__len == 0).execute() core.candidate_dup_count = table.select().count() # 3. 正式排重 for item1 in process_notifier(feature1.features_tree.select()): dup_ids = core.detect_duplicated_items_verbose(item1.item_id, verbose=True) delete_item_ids(table, dup_ids) return core.result result = cpickle_cache(pickle_filename, load_result_func) json.dump(result.result_json(), open(self.result_json, 'wb')) # def data_check(self): """ 验证正确率,随机找个重复的,遍历全库比对。 """ """ from random import randrange from etl_utils import String cases_count = 10 recall_program_count = 0 recall_real_count = float(cases_count) for idx in xrange(cases_count): result = cpickle_cache(self.result_cPickle, lambda : True) core = self.new_detdup_core('memory') total_count = len(result.result) if not total_count: print 'NO DUPLICATION FOUND!' return program_similar_ids = result.result[randrange(total_count)] # 随机抽取的一个item current_item = self.items_model[program_similar_ids[0]] print "Begin to find %s's similar item_ids" % current_item.item_id real_similar_ids = set([current_item.item_id]) program_similar_ids = set(program_similar_ids) table = core.select_feature(current_item).features_tree basic_query = table.item_id != str(current_item.item_id) for column1 in self.query_check_columns: basic_query = basic_query & (getattr(table, column1) == getattr(current_item, column1)) scope = table.select().where(basic_query) #.dicts() for i1 in process_notifier(scope): rate1 = String.calculate_text_similarity(current_item.item_content, self.items_model[i1.item_id].item_content)['similarity_rate'] if rate1 > core.similarity_rate: real_similar_ids.add(i1.item_id) print "real_similar_ids :", sorted([str(i1) for i1 in real_similar_ids]) print "program_similar_ids:", sorted([str(i1) for i1 in program_similar_ids]) print if real_similar_ids == program_similar_ids: recall_program_count += 1 print "recall :", recall_program_count / recall_real_count """
mit
gram526/VTK
Filters/Core/Testing/Python/TestContourCases.py
9
4313
# This test requires Numpy. import sys import vtk from vtk.test import Testing try: import numpy as np except ImportError: print("WARNING: This test requires Numeric Python: http://numpy.sf.net") sys.exit(0) def GenerateCell(cellType, points): cell = vtk.vtkUnstructuredGrid() pts = vtk.vtkPoints() for p in points: pts.InsertNextPoint(p) cell.SetPoints(pts) cell.Allocate(1,1) ids = vtk.vtkIdList() for i in range(len(points)): ids.InsertId(i,i) cell.InsertNextCell(cellType, ids) return cell def Combination(sz, n): c = np.zeros(sz) i = 0 while n>0: c[i] = n%2 n=n>>1 i = i + 1 return c class CellTestBase: def test_contours(self): cell = vtk.vtkUnstructuredGrid() cell.ShallowCopy(self.Cell) np = self.Cell.GetNumberOfPoints() ncomb = pow(2, np) scalar = vtk.vtkDoubleArray() scalar.SetName("scalar") scalar.SetNumberOfTuples(np) cell.GetPointData().SetScalars(scalar) incorrectCases = [] for i in range(1,ncomb-1): c = Combination(np, i) for p in range(np): scalar.SetTuple1(p, c[p]) gradientFilter = vtk.vtkGradientFilter() gradientFilter.SetInputData(cell) gradientFilter.SetInputArrayToProcess(0,0,0,0,'scalar') gradientFilter.SetResultArrayName('grad') gradientFilter.Update() contourFilter = vtk.vtkContourFilter() contourFilter.SetInputConnection(gradientFilter.GetOutputPort()) contourFilter.SetNumberOfContours(1) contourFilter.SetValue(0, 0.5) contourFilter.Update() normalsFilter = vtk.vtkPolyDataNormals() normalsFilter.SetInputConnection(contourFilter.GetOutputPort()) normalsFilter.SetConsistency(0) normalsFilter.SetFlipNormals(0) normalsFilter.SetSplitting(0) calcFilter = vtk.vtkArrayCalculator() calcFilter.SetInputConnection(normalsFilter.GetOutputPort()) calcFilter.SetAttributeModeToUsePointData() calcFilter.AddVectorArrayName('grad') calcFilter.AddVectorArrayName('Normals') calcFilter.SetResultArrayName('dir') calcFilter.SetFunction('grad.Normals') calcFilter.Update() out = vtk.vtkUnstructuredGrid() out.ShallowCopy(calcFilter.GetOutput()) numPts = out.GetNumberOfPoints() if numPts > 0: dirArray = out.GetPointData().GetArray('dir') for p in range(numPts): if(dirArray.GetTuple1(p) > 0.0): # all normals are reversed incorrectCases.append(i) break self.assertEquals(','.join([str(i) for i in incorrectCases]), '') class TestTetra(Testing.vtkTest, CellTestBase): def setUp(self): self.Cell = GenerateCell(vtk.VTK_TETRA, [ ( 1.0, -1.0, -1.0), ( 1.0, 1.0, 1.0), (-1.0, 1.0, -1.0), (-1.0, -1.0, 1.0) ]) class TestHexahedron(Testing.vtkTest, CellTestBase): def setUp(self): self.Cell = GenerateCell(vtk.VTK_HEXAHEDRON, [ (-1.0, -1.0, -1.0), ( 1.0, -1.0, -1.0), ( 1.0, 1.0, -1.0), (-1.0, 1.0, -1.0), (-1.0, -1.0, 1.0), ( 1.0, -1.0, 1.0), ( 1.0, 1.0, 1.0), (-1.0, 1.0, 1.0) ]) class TestWedge(Testing.vtkTest, CellTestBase): def setUp(self): self.Cell = GenerateCell(vtk.VTK_WEDGE, [ (-1.0, -1.0, -1.0), ( 1.0, -1.0, -1.0), ( 0.0, -1.0, 1.0), (-1.0, 1.0, -1.0), ( 1.0, 1.0, -1.0), ( 0.0, 1.0, 0.0) ]) class TestPyramid(Testing.vtkTest, CellTestBase): def setUp(self): self.Cell = GenerateCell(vtk.VTK_PYRAMID, [ (-1.0, -1.0, -1.0), ( 1.0, -1.0, -1.0), ( 1.0, 1.0, -1.0), (-1.0, 1.0, -1.0), ( 0.0, 0.0, 1.0) ]) if __name__ == '__main__': Testing.main([(TestPyramid,'test'),(TestWedge,'test'),(TestTetra, 'test'),(TestHexahedron,'test')])
bsd-3-clause
ninneko/redash
redash/tasks/queries.py
2
17974
import json import time import logging import signal import redis from celery.result import AsyncResult from celery.utils.log import get_task_logger from redash import redis_connection, models, statsd_client, settings, utils from redash.utils import gen_query_hash from redash.worker import celery from redash.query_runner import InterruptException from .base import BaseTask from .alerts import check_alerts_for_query logger = get_task_logger(__name__) def _job_lock_id(query_hash, data_source_id): return "query_hash_job:%s:%s" % (data_source_id, query_hash) def _unlock(query_hash, data_source_id): redis_connection.delete(_job_lock_id(query_hash, data_source_id)) # TODO: # There is some duplication between this class and QueryTask, but I wanted to implement the monitoring features without # much changes to the existing code, so ended up creating another object. In the future we can merge them. class QueryTaskTracker(object): DONE_LIST = 'query_task_trackers:done' WAITING_LIST = 'query_task_trackers:waiting' IN_PROGRESS_LIST = 'query_task_trackers:in_progress' ALL_LISTS = (DONE_LIST, WAITING_LIST, IN_PROGRESS_LIST) def __init__(self, data): self.data = data @classmethod def create(cls, task_id, state, query_hash, data_source_id, scheduled, metadata): data = dict(task_id=task_id, state=state, query_hash=query_hash, data_source_id=data_source_id, scheduled=scheduled, username=metadata.get('Username', 'unknown'), query_id=metadata.get('Query ID', 'unknown'), retries=0, scheduled_retries=0, created_at=time.time(), started_at=None, run_time=None) return cls(data) def save(self, connection=None): if connection is None: connection = redis_connection self.data['updated_at'] = time.time() key_name = self._key_name(self.data['task_id']) connection.set(key_name, utils.json_dumps(self.data)) connection.zadd(self._get_list(), time.time(), key_name) for l in self.ALL_LISTS: if l != self._get_list(): connection.zrem(l, key_name) # TOOD: this is not thread/concurrency safe. In current code this is not an issue, but better to fix this. def update(self, **kwargs): self.data.update(kwargs) self.save() @staticmethod def _key_name(task_id): return 'query_task_tracker:{}'.format(task_id) def _get_list(self): if self.state in ('finished', 'failed', 'cancelled'): return self.DONE_LIST if self.state in ('created'): return self.WAITING_LIST return self.IN_PROGRESS_LIST @classmethod def get_by_task_id(cls, task_id, connection=None): if connection is None: connection = redis_connection key_name = cls._key_name(task_id) data = connection.get(key_name) return cls.create_from_data(data) @classmethod def create_from_data(cls, data): if data: data = json.loads(data) return cls(data) return None @classmethod def all(cls, list_name, offset=0, limit=-1): if limit != -1: limit -= 1 if offset != 0: offset -= 1 ids = redis_connection.zrevrange(list_name, offset, limit) pipe = redis_connection.pipeline() for id in ids: pipe.get(id) tasks = [cls.create_from_data(data) for data in pipe.execute()] return tasks @classmethod def prune(cls, list_name, keep_count): count = redis_connection.zcard(list_name) if count <= keep_count: return 0 remove_count = count - keep_count keys = redis_connection.zrange(list_name, 0, remove_count - 1) redis_connection.delete(*keys) redis_connection.zremrangebyrank(list_name, 0, remove_count - 1) return remove_count def __getattr__(self, item): return self.data[item] def __contains__(self, item): return item in self.data class QueryTask(object): # TODO: this is mapping to the old Job class statuses. Need to update the client side and remove this STATUSES = { 'PENDING': 1, 'STARTED': 2, 'SUCCESS': 3, 'FAILURE': 4, 'REVOKED': 4 } def __init__(self, job_id=None, async_result=None): if async_result: self._async_result = async_result else: self._async_result = AsyncResult(job_id, app=celery) @property def id(self): return self._async_result.id def to_dict(self): if self._async_result.status == 'STARTED': updated_at = self._async_result.result.get('start_time', 0) else: updated_at = 0 status = self.STATUSES[self._async_result.status] if isinstance(self._async_result.result, Exception): error = self._async_result.result.message status = 4 elif self._async_result.status == 'REVOKED': error = 'Query execution cancelled.' else: error = '' if self._async_result.successful() and not error: query_result_id = self._async_result.result else: query_result_id = None return { 'id': self._async_result.id, 'updated_at': updated_at, 'status': status, 'error': error, 'query_result_id': query_result_id, } @property def is_cancelled(self): return self._async_result.status == 'REVOKED' @property def celery_status(self): return self._async_result.status def ready(self): return self._async_result.ready() def cancel(self): return self._async_result.revoke(terminate=True, signal='SIGINT') def enqueue_query(query, data_source, user_id, scheduled=False, metadata={}): query_hash = gen_query_hash(query) logging.info("Inserting job for %s with metadata=%s", query_hash, metadata) try_count = 0 job = None while try_count < 5: try_count += 1 pipe = redis_connection.pipeline() try: pipe.watch(_job_lock_id(query_hash, data_source.id)) job_id = pipe.get(_job_lock_id(query_hash, data_source.id)) if job_id: logging.info("[%s] Found existing job: %s", query_hash, job_id) job = QueryTask(job_id=job_id) if job.ready(): logging.info("[%s] job found is ready (%s), removing lock", query_hash, job.celery_status) redis_connection.delete(_job_lock_id(query_hash, data_source.id)) job = None if not job: pipe.multi() if scheduled: queue_name = data_source.scheduled_queue_name else: queue_name = data_source.queue_name result = execute_query.apply_async(args=(query, data_source.id, metadata, user_id), queue=queue_name) job = QueryTask(async_result=result) tracker = QueryTaskTracker.create(result.id, 'created', query_hash, data_source.id, scheduled, metadata) tracker.save(connection=pipe) logging.info("[%s] Created new job: %s", query_hash, job.id) pipe.set(_job_lock_id(query_hash, data_source.id), job.id, settings.JOB_EXPIRY_TIME) pipe.execute() break except redis.WatchError: continue if not job: logging.error("[Manager][%s] Failed adding job for query.", query_hash) return job @celery.task(name="redash.tasks.refresh_queries", base=BaseTask) def refresh_queries(): logger.info("Refreshing queries...") outdated_queries_count = 0 query_ids = [] with statsd_client.timer('manager.outdated_queries_lookup'): for query in models.Query.outdated_queries(): if settings.FEATURE_DISABLE_REFRESH_QUERIES: logging.info("Disabled refresh queries.") elif query.data_source.paused: logging.info("Skipping refresh of %s because datasource - %s is paused (%s).", query.id, query.data_source.name, query.data_source.pause_reason) else: enqueue_query(query.query, query.data_source, query.user_id, scheduled=True, metadata={'Query ID': query.id, 'Username': 'Scheduled'}) query_ids.append(query.id) outdated_queries_count += 1 statsd_client.gauge('manager.outdated_queries', outdated_queries_count) logger.info("Done refreshing queries. Found %d outdated queries: %s" % (outdated_queries_count, query_ids)) status = redis_connection.hgetall('redash:status') now = time.time() redis_connection.hmset('redash:status', { 'outdated_queries_count': outdated_queries_count, 'last_refresh_at': now, 'query_ids': json.dumps(query_ids) }) statsd_client.gauge('manager.seconds_since_refresh', now - float(status.get('last_refresh_at', now))) @celery.task(name="redash.tasks.cleanup_tasks", base=BaseTask) def cleanup_tasks(): in_progress = QueryTaskTracker.all(QueryTaskTracker.IN_PROGRESS_LIST) for tracker in in_progress: result = AsyncResult(tracker.task_id) # If the AsyncResult status is PENDING it means there is no celery task object for this tracker, and we can # mark it as "dead": if result.status == 'PENDING': logging.info("In progress tracker for %s is no longer enqueued, cancelling (task: %s).", tracker.query_hash, tracker.task_id) _unlock(tracker.query_hash, tracker.data_source_id) tracker.update(state='cancelled') if result.ready(): logging.info("in progress tracker %s finished", tracker.query_hash) _unlock(tracker.query_hash, tracker.data_source_id) tracker.update(state='finished') waiting = QueryTaskTracker.all(QueryTaskTracker.WAITING_LIST) for tracker in waiting: result = AsyncResult(tracker.task_id) if result.ready(): logging.info("waiting tracker %s finished", tracker.query_hash) _unlock(tracker.query_hash, tracker.data_source_id) tracker.update(state='finished') # Maintain constant size of the finished tasks list: QueryTaskTracker.prune(QueryTaskTracker.DONE_LIST, 1000) @celery.task(name="redash.tasks.cleanup_query_results", base=BaseTask) def cleanup_query_results(): """ Job to cleanup unused query results -- such that no query links to them anymore, and older than settings.QUERY_RESULTS_MAX_AGE (a week by default, so it's less likely to be open in someone's browser and be used). Each time the job deletes only settings.QUERY_RESULTS_CLEANUP_COUNT (100 by default) query results so it won't choke the database in case of many such results. """ logging.info("Running query results clean up (removing maximum of %d unused results, that are %d days old or more)", settings.QUERY_RESULTS_CLEANUP_COUNT, settings.QUERY_RESULTS_CLEANUP_MAX_AGE) unused_query_results = models.QueryResult.unused(settings.QUERY_RESULTS_CLEANUP_MAX_AGE).limit(settings.QUERY_RESULTS_CLEANUP_COUNT) total_unused_query_results = models.QueryResult.unused().count() deleted_count = models.QueryResult.delete().where(models.QueryResult.id << unused_query_results).execute() logger.info("Deleted %d unused query results out of total of %d." % (deleted_count, total_unused_query_results)) @celery.task(name="redash.tasks.refresh_schemas", base=BaseTask) def refresh_schemas(): """ Refreshes the data sources schemas. """ blacklist = [int(ds_id) for ds_id in redis_connection.smembers('data_sources:schema:blacklist') if ds_id] global_start_time = time.time() logger.info(u"task=refresh_schemas state=start") for ds in models.DataSource.select(): if ds.paused: logger.info(u"task=refresh_schema state=skip ds_id=%s reason=paused(%s)", ds.id, ds.pause_reason) elif ds.id in blacklist: logger.info(u"task=refresh_schema state=skip ds_id=%s reason=blacklist", ds.id) else: logger.info(u"task=refresh_schema state=start ds_id=%s", ds.id) start_time = time.time() try: ds.get_schema(refresh=True) logger.info(u"task=refresh_schema state=finished ds_id=%s runtime=%.2f", ds.id, time.time() - start_time) except Exception: logger.exception(u"Failed refreshing schema for the data source: %s", ds.name) logger.info(u"task=refresh_schema state=failed ds_id=%s runtime=%.2f", ds.id, time.time() - start_time) logger.info(u"task=refresh_schemas state=finish total_runtime=%.2f", time.time() - global_start_time) def signal_handler(*args): raise InterruptException class QueryExecutionError(Exception): pass # We could have created this as a celery.Task derived class, and act as the task itself. But this might result in weird # issues as the task class created once per process, so decided to have a plain object instead. class QueryExecutor(object): def __init__(self, task, query, data_source_id, user_id, metadata): self.task = task self.query = query self.data_source_id = data_source_id self.metadata = metadata self.data_source = self._load_data_source() if user_id is not None: self.user = models.User.get_by_id(user_id) else: self.user = None self.query_hash = gen_query_hash(self.query) # Load existing tracker or create a new one if the job was created before code update: self.tracker = QueryTaskTracker.get_by_task_id(task.request.id) or QueryTaskTracker.create(task.request.id, 'created', self.query_hash, self.data_source_id, False, metadata) def run(self): signal.signal(signal.SIGINT, signal_handler) self.tracker.update(started_at=time.time(), state='started') logger.debug("Executing query:\n%s", self.query) self._log_progress('executing_query') query_runner = self.data_source.query_runner annotated_query = self._annotate_query(query_runner) try: data, error = query_runner.run_query(annotated_query, self.user) except Exception as e: error = unicode(e) data = None logging.warning('Unexpected error while running query:', exc_info=1) run_time = time.time() - self.tracker.started_at self.tracker.update(error=error, run_time=run_time, state='saving_results') logger.info(u"task=execute_query query_hash=%s data_length=%s error=[%s]", self.query_hash, data and len(data), error) _unlock(self.query_hash, self.data_source.id) if error: self.tracker.update(state='failed') result = QueryExecutionError(error) else: query_result, updated_query_ids = models.QueryResult.store_result(self.data_source.org_id, self.data_source.id, self.query_hash, self.query, data, run_time, utils.utcnow()) self._log_progress('checking_alerts') for query_id in updated_query_ids: check_alerts_for_query.delay(query_id) self._log_progress('finished') result = query_result.id return result def _annotate_query(self, query_runner): if query_runner.annotate_query(): self.metadata['Task ID'] = self.task.request.id self.metadata['Query Hash'] = self.query_hash self.metadata['Queue'] = self.task.request.delivery_info['routing_key'] annotation = u", ".join([u"{}: {}".format(k, v) for k, v in self.metadata.iteritems()]) annotated_query = u"/* {} */ {}".format(annotation, self.query) else: annotated_query = self.query return annotated_query def _log_progress(self, state): logger.info(u"task=execute_query state=%s query_hash=%s type=%s ds_id=%d task_id=%s queue=%s query_id=%s username=%s", state, self.query_hash, self.data_source.type, self.data_source.id, self.task.request.id, self.task.request.delivery_info['routing_key'], self.metadata.get('Query ID', 'unknown'), self.metadata.get('Username', 'unknown')) self.tracker.update(state=state) def _load_data_source(self): logger.info("task=execute_query state=load_ds ds_id=%d", self.data_source_id) return models.DataSource.get_by_id(self.data_source_id) # user_id is added last as a keyword argument for backward compatability -- to support executing previously submitted # jobs before the upgrade to this version. @celery.task(name="redash.tasks.execute_query", bind=True, base=BaseTask, track_started=True) def execute_query(self, query, data_source_id, metadata, user_id=None): return QueryExecutor(self, query, data_source_id, user_id, metadata).run()
bsd-2-clause
popazerty/zde-e2
lib/python/Plugins/SystemPlugins/HdmiCEC/plugin.py
33
5647
from Screens.Screen import Screen from Components.ConfigList import ConfigListScreen from Components.config import config, getConfigListEntry from Components.Sources.StaticText import StaticText class HdmiCECSetupScreen(Screen, ConfigListScreen): skin = """ <screen position="c-300,c-250" size="600,500" title="HDMI CEC setup"> <widget name="config" position="25,25" size="550,350" /> <widget source="current_address" render="Label" position="25,375" size="550,30" zPosition="10" font="Regular;21" halign="left" valign="center" /> <widget source="fixed_address" render="Label" position="25,405" size="550,30" zPosition="10" font="Regular;21" halign="left" valign="center" /> <ePixmap pixmap="skin_default/buttons/red.png" position="20,e-45" size="140,40" alphatest="on" /> <ePixmap pixmap="skin_default/buttons/green.png" position="160,e-45" size="140,40" alphatest="on" /> <ePixmap pixmap="skin_default/buttons/yellow.png" position="300,e-45" size="140,40" alphatest="on" /> <ePixmap pixmap="skin_default/buttons/blue.png" position="440,e-45" size="140,40" alphatest="on" /> <widget source="key_red" render="Label" position="20,e-45" zPosition="1" size="140,40" font="Regular;20" halign="center" valign="center" backgroundColor="#9f1313" transparent="1" /> <widget source="key_green" render="Label" position="160,e-45" zPosition="1" size="140,40" font="Regular;20" halign="center" valign="center" backgroundColor="#1f771f" transparent="1" /> <widget source="key_yellow" render="Label" position="300,e-45" zPosition="1" size="140,40" font="Regular;20" halign="center" valign="center" backgroundColor="#a08500" transparent="1" /> <widget source="key_blue" render="Label" position="440,e-45" zPosition="1" size="140,40" font="Regular;20" halign="center" valign="center" backgroundColor="#18188b" transparent="1" /> </screen>""" def __init__(self, session): self.skin = HdmiCECSetupScreen.skin Screen.__init__(self, session) from Components.ActionMap import ActionMap from Components.Button import Button self["key_red"] = StaticText(_("Cancel")) self["key_green"] = StaticText(_("OK")) self["key_yellow"] = StaticText(_("Set fixed")) self["key_blue"] = StaticText(_("Clear fixed")) self["current_address"] = StaticText() self["fixed_address"] = StaticText() self["actions"] = ActionMap(["SetupActions", "ColorActions", "MenuActions"], { "ok": self.keyGo, "save": self.keyGo, "cancel": self.keyCancel, "green": self.keyGo, "red": self.keyCancel, "yellow": self.setFixedAddress, "blue": self.clearFixedAddress, "menu": self.closeRecursive, }, -2) self.list = [] ConfigListScreen.__init__(self, self.list, session = self.session) self.list.append(getConfigListEntry(_("Enabled"), config.hdmicec.enabled)) self.list.append(getConfigListEntry(_("Put TV in standby"), config.hdmicec.control_tv_standby)) self.list.append(getConfigListEntry(_("Wakeup TV from standby"), config.hdmicec.control_tv_wakeup)) self.list.append(getConfigListEntry(_("Regard deep standby as standby"), config.hdmicec.handle_deepstandby_events)) self.list.append(getConfigListEntry(_("Switch TV to correct input"), config.hdmicec.report_active_source)) self.list.append(getConfigListEntry(_("Use TV remote control"), config.hdmicec.report_active_menu)) self.list.append(getConfigListEntry(_("Handle standby from TV"), config.hdmicec.handle_tv_standby)) self.list.append(getConfigListEntry(_("Handle wakeup from TV"), config.hdmicec.handle_tv_wakeup)) self.list.append(getConfigListEntry(_("Wakeup signal from TV"), config.hdmicec.tv_wakeup_detection)) self.list.append(getConfigListEntry(_("Forward volume keys"), config.hdmicec.volume_forwarding)) self.list.append(getConfigListEntry(_("Put receiver in standby"), config.hdmicec.control_receiver_standby)) self.list.append(getConfigListEntry(_("Wakeup receiver from standby"), config.hdmicec.control_receiver_wakeup)) self.list.append(getConfigListEntry(_("Minimum send interval"), config.hdmicec.minimum_send_interval)) self["config"].list = self.list self["config"].l.setList(self.list) self.updateAddress() def keyLeft(self): ConfigListScreen.keyLeft(self) def keyRight(self): ConfigListScreen.keyRight(self) def keyGo(self): for x in self["config"].list: x[1].save() self.close() def keyCancel(self): for x in self["config"].list: x[1].cancel() self.close() def setFixedAddress(self): import Components.HdmiCec Components.HdmiCec.hdmi_cec.setFixedPhysicalAddress(Components.HdmiCec.hdmi_cec.getPhysicalAddress()) self.updateAddress() def clearFixedAddress(self): import Components.HdmiCec Components.HdmiCec.hdmi_cec.setFixedPhysicalAddress("0.0.0.0") self.updateAddress() def updateAddress(self): import Components.HdmiCec self["current_address"].setText(_("Current CEC address") + ": " + Components.HdmiCec.hdmi_cec.getPhysicalAddress()) if config.hdmicec.fixed_physical_address.value == "0.0.0.0": fixedaddresslabel = "" else: fixedaddresslabel = _("Using fixed address") + ": " + config.hdmicec.fixed_physical_address.value self["fixed_address"].setText(fixedaddresslabel) def main(session, **kwargs): session.open(HdmiCECSetupScreen) def startSetup(menuid): if menuid == "system": return [(_("HDMI-CEC setup"), main, "hdmi_cec_setup", 0)] return [] def Plugins(**kwargs): from os import path if path.exists("/dev/hdmi_cec") or path.exists("/dev/misc/hdmi_cec0"): import Components.HdmiCec from Plugins.Plugin import PluginDescriptor return [PluginDescriptor(where = PluginDescriptor.WHERE_MENU, fnc = startSetup)] return []
gpl-2.0
kittehcoin/p2pool
nattraverso/pynupnp/soap.py
288
3547
""" This module is a SOAP client using twisted's deferreds. It uses the SOAPpy package. @author: Raphael Slinckx @copyright: Copyright 2005 @license: LGPL @contact: U{raphael@slinckx.net<mailto:raphael@slinckx.net>} @version: 0.1.0 """ __revision__ = "$id" import SOAPpy, logging from SOAPpy.Config import Config from twisted.web import client, error #General config Config.typed = False class SoapError(Exception): """ This is a SOAP error message, not an HTTP error message. The content of this error is a SOAPpy structure representing the SOAP error message. """ pass class SoapProxy: """ Proxy for an url to which we send SOAP rpc calls. """ def __init__(self, url, prefix): """ Init the proxy, it will connect to the given url, using the given soap namespace. @param url: The url of the remote host to call @param prefix: The namespace prefix to use, eg. 'urn:schemas-upnp-org:service:WANIPConnection:1' """ logging.debug("Soap Proxy: '%s', prefix: '%s'", url, prefix) self._url = url self._prefix = prefix def call(self, method, **kwargs): """ Call the given remote method with the given arguments, as keywords. Returns a deferred, called with SOAPpy structure representing the soap response. @param method: The method name to call, eg. 'GetExternalIP' @param kwargs: The parameters of the call, as keywords @return: A deferred called with the external ip address of this host @rtype: L{twisted.internet.defer.Deferred} """ payload = SOAPpy.buildSOAP(method=method, config=Config, namespace=self._prefix, kw=kwargs) # Here begins the nasty hack payload = payload.replace( # Upnp wants s: instead of SOAP-ENV 'SOAP-ENV','s').replace( # Doesn't seem to like these encoding stuff 'xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/"', '').replace( 'SOAP-ENC:root="1"', '').replace( # And it wants u: instead of ns1 namespace for arguments.. 'ns1','u') logging.debug("SOAP Payload:\n%s", payload) return client.getPage(self._url, postdata=payload, method="POST", headers={'content-type': 'text/xml', 'SOAPACTION': '%s#%s' % (self._prefix, method)} ).addCallbacks(self._got_page, self._got_error) def _got_page(self, result): """ The http POST command was successful, we parse the SOAP answer, and return it. @param result: the xml content """ parsed = SOAPpy.parseSOAPRPC(result) logging.debug("SOAP Answer:\n%s", result) logging.debug("SOAP Parsed Answer: %r", parsed) return parsed def _got_error(self, res): """ The HTTP POST command did not succeed, depending on the error type: - it's a SOAP error, we parse it and return a L{SoapError}. - it's another type of error (http, other), we raise it as is """ logging.debug("SOAP Error:\n%s", res) if isinstance(res.value, error.Error): try: logging.debug("SOAP Error content:\n%s", res.value.response) raise SoapError(SOAPpy.parseSOAPRPC(res.value.response)["detail"]) except: raise raise Exception(res.value)
gpl-3.0
colemanja91/PyEloqua-Examples
venv/lib/python3.4/site-packages/pip/_vendor/requests/packages/urllib3/exceptions.py
515
5599
from __future__ import absolute_import # Base Exceptions class HTTPError(Exception): "Base exception used by this module." pass class HTTPWarning(Warning): "Base warning used by this module." pass class PoolError(HTTPError): "Base exception for errors caused within a pool." def __init__(self, pool, message): self.pool = pool HTTPError.__init__(self, "%s: %s" % (pool, message)) def __reduce__(self): # For pickling purposes. return self.__class__, (None, None) class RequestError(PoolError): "Base exception for PoolErrors that have associated URLs." def __init__(self, pool, url, message): self.url = url PoolError.__init__(self, pool, message) def __reduce__(self): # For pickling purposes. return self.__class__, (None, self.url, None) class SSLError(HTTPError): "Raised when SSL certificate fails in an HTTPS connection." pass class ProxyError(HTTPError): "Raised when the connection to a proxy fails." pass class DecodeError(HTTPError): "Raised when automatic decoding based on Content-Type fails." pass class ProtocolError(HTTPError): "Raised when something unexpected happens mid-request/response." pass #: Renamed to ProtocolError but aliased for backwards compatibility. ConnectionError = ProtocolError # Leaf Exceptions class MaxRetryError(RequestError): """Raised when the maximum number of retries is exceeded. :param pool: The connection pool :type pool: :class:`~urllib3.connectionpool.HTTPConnectionPool` :param string url: The requested Url :param exceptions.Exception reason: The underlying error """ def __init__(self, pool, url, reason=None): self.reason = reason message = "Max retries exceeded with url: %s (Caused by %r)" % ( url, reason) RequestError.__init__(self, pool, url, message) class HostChangedError(RequestError): "Raised when an existing pool gets a request for a foreign host." def __init__(self, pool, url, retries=3): message = "Tried to open a foreign host with url: %s" % url RequestError.__init__(self, pool, url, message) self.retries = retries class TimeoutStateError(HTTPError): """ Raised when passing an invalid state to a timeout """ pass class TimeoutError(HTTPError): """ Raised when a socket timeout error occurs. Catching this error will catch both :exc:`ReadTimeoutErrors <ReadTimeoutError>` and :exc:`ConnectTimeoutErrors <ConnectTimeoutError>`. """ pass class ReadTimeoutError(TimeoutError, RequestError): "Raised when a socket timeout occurs while receiving data from a server" pass # This timeout error does not have a URL attached and needs to inherit from the # base HTTPError class ConnectTimeoutError(TimeoutError): "Raised when a socket timeout occurs while connecting to a server" pass class NewConnectionError(ConnectTimeoutError, PoolError): "Raised when we fail to establish a new connection. Usually ECONNREFUSED." pass class EmptyPoolError(PoolError): "Raised when a pool runs out of connections and no more are allowed." pass class ClosedPoolError(PoolError): "Raised when a request enters a pool after the pool has been closed." pass class LocationValueError(ValueError, HTTPError): "Raised when there is something wrong with a given URL input." pass class LocationParseError(LocationValueError): "Raised when get_host or similar fails to parse the URL input." def __init__(self, location): message = "Failed to parse: %s" % location HTTPError.__init__(self, message) self.location = location class ResponseError(HTTPError): "Used as a container for an error reason supplied in a MaxRetryError." GENERIC_ERROR = 'too many error responses' SPECIFIC_ERROR = 'too many {status_code} error responses' class SecurityWarning(HTTPWarning): "Warned when perfoming security reducing actions" pass class SubjectAltNameWarning(SecurityWarning): "Warned when connecting to a host with a certificate missing a SAN." pass class InsecureRequestWarning(SecurityWarning): "Warned when making an unverified HTTPS request." pass class SystemTimeWarning(SecurityWarning): "Warned when system time is suspected to be wrong" pass class InsecurePlatformWarning(SecurityWarning): "Warned when certain SSL configuration is not available on a platform." pass class SNIMissingWarning(HTTPWarning): "Warned when making a HTTPS request without SNI available." pass class DependencyWarning(HTTPWarning): """ Warned when an attempt is made to import a module with missing optional dependencies. """ pass class ResponseNotChunked(ProtocolError, ValueError): "Response needs to be chunked in order to read it as chunks." pass class ProxySchemeUnknown(AssertionError, ValueError): "ProxyManager does not support the supplied scheme" # TODO(t-8ch): Stop inheriting from AssertionError in v2.0. def __init__(self, scheme): message = "Not supported proxy scheme %s" % scheme super(ProxySchemeUnknown, self).__init__(message) class HeaderParsingError(HTTPError): "Raised by assert_header_parsing, but we convert it to a log.warning statement." def __init__(self, defects, unparsed_data): message = '%s, unparsed data: %r' % (defects or 'Unknown', unparsed_data) super(HeaderParsingError, self).__init__(message)
gpl-2.0
juanalfonsopr/odoo
addons/l10n_at/__init__.py
438
1050
# -*- encoding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) conexus.at # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## import account_wizard # vim:expandtab:smartindent:tabstop=4:softtabstop=4:shiftwidth=4:
agpl-3.0
RobSpectre/garfield
garfield/sms/models.py
1
1262
from django.db import models from contacts.models import Contact from phone_numbers.models import PhoneNumber class SmsMessage(models.Model): date_created = models.DateTimeField(auto_now_add=True, db_index=True) date_modified = models.DateTimeField(auto_now=True) deleted = models.BooleanField(default=False) sid = models.CharField(max_length=255, db_index=True) from_number = models.CharField(max_length=255, db_index=True) to_number = models.CharField(max_length=255, db_index=True) body = models.TextField(db_index=True) related_contact = models.ForeignKey(Contact, null=True, related_name="sms_messages", on_delete=models.CASCADE) related_phone_number = models.ForeignKey(PhoneNumber, null=True, related_name="sms_messages", on_delete=models.CASCADE) def __str__(self): return "{0}: from {1} to {2}".format(self.date_created, self.from_number, self.to_number)
mit
sbusso/rethinkdb
external/v8_3.30.33.16/build/gyp/test/mac/gyptest-xctest.py
221
1196
#!/usr/bin/env python # Copyright (c) 2013 Google Inc. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """ Verifies that xctest targets are correctly configured. """ import TestGyp import sys if sys.platform == 'darwin': test = TestGyp.TestGyp(formats=['xcode']) # Ignore this test if Xcode 5 is not installed import subprocess job = subprocess.Popen(['xcodebuild', '-version'], stdout=subprocess.PIPE, stderr=subprocess.STDOUT) out, err = job.communicate() if job.returncode != 0: raise Exception('Error %d running xcodebuild' % job.returncode) xcode_version, build_number = out.splitlines() # Convert the version string from 'Xcode 5.0' to ['5','0']. xcode_version = xcode_version.split()[-1].split('.') if xcode_version < ['5']: test.pass_test() CHDIR = 'xctest' test.run_gyp('test.gyp', chdir=CHDIR) test.build('test.gyp', chdir=CHDIR, arguments=['-scheme', 'classes', 'test']) test.built_file_must_match('tests.xctest/Contents/Resources/resource.txt', 'foo\n', chdir=CHDIR) test.pass_test()
agpl-3.0
pistruiatul/hartapoliticii
python/src/ro/vivi/youtube_crawler/gdata/apps/migration/__init__.py
168
8177
#!/usr/bin/python # # Copyright (C) 2008 Google # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Contains objects used with Google Apps.""" __author__ = 'google-apps-apis@googlegroups.com' import atom import gdata # XML namespaces which are often used in Google Apps entity. APPS_NAMESPACE = 'http://schemas.google.com/apps/2006' APPS_TEMPLATE = '{http://schemas.google.com/apps/2006}%s' class Rfc822Msg(atom.AtomBase): """The Migration rfc822Msg element.""" _tag = 'rfc822Msg' _namespace = APPS_NAMESPACE _children = atom.AtomBase._children.copy() _attributes = atom.AtomBase._attributes.copy() _attributes['encoding'] = 'encoding' def __init__(self, extension_elements=None, extension_attributes=None, text=None): self.text = text self.encoding = 'base64' self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def Rfc822MsgFromString(xml_string): """Parse in the Rrc822 message from the XML definition.""" return atom.CreateClassFromXMLString(Rfc822Msg, xml_string) class MailItemProperty(atom.AtomBase): """The Migration mailItemProperty element.""" _tag = 'mailItemProperty' _namespace = APPS_NAMESPACE _children = atom.AtomBase._children.copy() _attributes = atom.AtomBase._attributes.copy() _attributes['value'] = 'value' def __init__(self, value=None, extension_elements=None, extension_attributes=None, text=None): self.value = value self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def MailItemPropertyFromString(xml_string): """Parse in the MailItemProperiy from the XML definition.""" return atom.CreateClassFromXMLString(MailItemProperty, xml_string) class Label(atom.AtomBase): """The Migration label element.""" _tag = 'label' _namespace = APPS_NAMESPACE _children = atom.AtomBase._children.copy() _attributes = atom.AtomBase._attributes.copy() _attributes['labelName'] = 'label_name' def __init__(self, label_name=None, extension_elements=None, extension_attributes=None, text=None): self.label_name = label_name self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def LabelFromString(xml_string): """Parse in the mailItemProperty from the XML definition.""" return atom.CreateClassFromXMLString(Label, xml_string) class MailEntry(gdata.GDataEntry): """A Google Migration flavor of an Atom Entry.""" _tag = 'entry' _namespace = atom.ATOM_NAMESPACE _children = gdata.GDataEntry._children.copy() _attributes = gdata.GDataEntry._attributes.copy() _children['{%s}rfc822Msg' % APPS_NAMESPACE] = ('rfc822_msg', Rfc822Msg) _children['{%s}mailItemProperty' % APPS_NAMESPACE] = ('mail_item_property', [MailItemProperty]) _children['{%s}label' % APPS_NAMESPACE] = ('label', [Label]) def __init__(self, author=None, category=None, content=None, atom_id=None, link=None, published=None, title=None, updated=None, rfc822_msg=None, mail_item_property=None, label=None, extended_property=None, extension_elements=None, extension_attributes=None, text=None): gdata.GDataEntry.__init__(self, author=author, category=category, content=content, atom_id=atom_id, link=link, published=published, title=title, updated=updated) self.rfc822_msg = rfc822_msg self.mail_item_property = mail_item_property self.label = label self.extended_property = extended_property or [] self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def MailEntryFromString(xml_string): """Parse in the MailEntry from the XML definition.""" return atom.CreateClassFromXMLString(MailEntry, xml_string) class BatchMailEntry(gdata.BatchEntry): """A Google Migration flavor of an Atom Entry.""" _tag = gdata.BatchEntry._tag _namespace = gdata.BatchEntry._namespace _children = gdata.BatchEntry._children.copy() _attributes = gdata.BatchEntry._attributes.copy() _children['{%s}rfc822Msg' % APPS_NAMESPACE] = ('rfc822_msg', Rfc822Msg) _children['{%s}mailItemProperty' % APPS_NAMESPACE] = ('mail_item_property', [MailItemProperty]) _children['{%s}label' % APPS_NAMESPACE] = ('label', [Label]) def __init__(self, author=None, category=None, content=None, atom_id=None, link=None, published=None, title=None, updated=None, rfc822_msg=None, mail_item_property=None, label=None, batch_operation=None, batch_id=None, batch_status=None, extended_property=None, extension_elements=None, extension_attributes=None, text=None): gdata.BatchEntry.__init__(self, author=author, category=category, content=content, atom_id=atom_id, link=link, published=published, batch_operation=batch_operation, batch_id=batch_id, batch_status=batch_status, title=title, updated=updated) self.rfc822_msg = rfc822_msg or None self.mail_item_property = mail_item_property or [] self.label = label or [] self.extended_property = extended_property or [] self.text = text self.extension_elements = extension_elements or [] self.extension_attributes = extension_attributes or {} def BatchMailEntryFromString(xml_string): """Parse in the BatchMailEntry from the XML definition.""" return atom.CreateClassFromXMLString(BatchMailEntry, xml_string) class BatchMailEventFeed(gdata.BatchFeed): """A Migration event feed flavor of an Atom Feed.""" _tag = gdata.BatchFeed._tag _namespace = gdata.BatchFeed._namespace _children = gdata.BatchFeed._children.copy() _attributes = gdata.BatchFeed._attributes.copy() _children['{%s}entry' % atom.ATOM_NAMESPACE] = ('entry', [BatchMailEntry]) def __init__(self, author=None, category=None, contributor=None, generator=None, icon=None, atom_id=None, link=None, logo=None, rights=None, subtitle=None, title=None, updated=None, entry=None, total_results=None, start_index=None, items_per_page=None, interrupted=None, extension_elements=None, extension_attributes=None, text=None): gdata.BatchFeed.__init__(self, author=author, category=category, contributor=contributor, generator=generator, icon=icon, atom_id=atom_id, link=link, logo=logo, rights=rights, subtitle=subtitle, title=title, updated=updated, entry=entry, total_results=total_results, start_index=start_index, items_per_page=items_per_page, interrupted=interrupted, extension_elements=extension_elements, extension_attributes=extension_attributes, text=text) def BatchMailEventFeedFromString(xml_string): """Parse in the BatchMailEventFeed from the XML definition.""" return atom.CreateClassFromXMLString(BatchMailEventFeed, xml_string)
agpl-3.0
zrhans/pythonanywhere
.virtualenvs/django19/lib/python3.4/site-packages/numpy/core/fromnumeric.py
12
95796
"""Module containing non-deprecated functions borrowed from Numeric. """ from __future__ import division, absolute_import, print_function import types import warnings import numpy as np from .. import VisibleDeprecationWarning from . import multiarray as mu from . import umath as um from . import numerictypes as nt from .numeric import asarray, array, asanyarray, concatenate from . import _methods _dt_ = nt.sctype2char # functions that are methods __all__ = [ 'alen', 'all', 'alltrue', 'amax', 'amin', 'any', 'argmax', 'argmin', 'argpartition', 'argsort', 'around', 'choose', 'clip', 'compress', 'cumprod', 'cumproduct', 'cumsum', 'diagonal', 'mean', 'ndim', 'nonzero', 'partition', 'prod', 'product', 'ptp', 'put', 'rank', 'ravel', 'repeat', 'reshape', 'resize', 'round_', 'searchsorted', 'shape', 'size', 'sometrue', 'sort', 'squeeze', 'std', 'sum', 'swapaxes', 'take', 'trace', 'transpose', 'var', ] try: _gentype = types.GeneratorType except AttributeError: _gentype = type(None) # save away Python sum _sum_ = sum # functions that are now methods def _wrapit(obj, method, *args, **kwds): try: wrap = obj.__array_wrap__ except AttributeError: wrap = None result = getattr(asarray(obj), method)(*args, **kwds) if wrap: if not isinstance(result, mu.ndarray): result = asarray(result) result = wrap(result) return result def take(a, indices, axis=None, out=None, mode='raise'): """ Take elements from an array along an axis. This function does the same thing as "fancy" indexing (indexing arrays using arrays); however, it can be easier to use if you need elements along a given axis. Parameters ---------- a : array_like The source array. indices : array_like The indices of the values to extract. .. versionadded:: 1.8.0 Also allow scalars for indices. axis : int, optional The axis over which to select values. By default, the flattened input array is used. out : ndarray, optional If provided, the result will be placed in this array. It should be of the appropriate shape and dtype. mode : {'raise', 'wrap', 'clip'}, optional Specifies how out-of-bounds indices will behave. * 'raise' -- raise an error (default) * 'wrap' -- wrap around * 'clip' -- clip to the range 'clip' mode means that all indices that are too large are replaced by the index that addresses the last element along that axis. Note that this disables indexing with negative numbers. Returns ------- subarray : ndarray The returned array has the same type as `a`. See Also -------- compress : Take elements using a boolean mask ndarray.take : equivalent method Examples -------- >>> a = [4, 3, 5, 7, 6, 8] >>> indices = [0, 1, 4] >>> np.take(a, indices) array([4, 3, 6]) In this example if `a` is an ndarray, "fancy" indexing can be used. >>> a = np.array(a) >>> a[indices] array([4, 3, 6]) If `indices` is not one dimensional, the output also has these dimensions. >>> np.take(a, [[0, 1], [2, 3]]) array([[4, 3], [5, 7]]) """ try: take = a.take except AttributeError: return _wrapit(a, 'take', indices, axis, out, mode) return take(indices, axis, out, mode) # not deprecated --- copy if necessary, view otherwise def reshape(a, newshape, order='C'): """ Gives a new shape to an array without changing its data. Parameters ---------- a : array_like Array to be reshaped. newshape : int or tuple of ints The new shape should be compatible with the original shape. If an integer, then the result will be a 1-D array of that length. One shape dimension can be -1. In this case, the value is inferred from the length of the array and remaining dimensions. order : {'C', 'F', 'A'}, optional Read the elements of `a` using this index order, and place the elements into the reshaped array using this index order. 'C' means to read / write the elements using C-like index order, with the last axis index changing fastest, back to the first axis index changing slowest. 'F' means to read / write the elements using Fortran-like index order, with the first index changing fastest, and the last index changing slowest. Note that the 'C' and 'F' options take no account of the memory layout of the underlying array, and only refer to the order of indexing. 'A' means to read / write the elements in Fortran-like index order if `a` is Fortran *contiguous* in memory, C-like order otherwise. Returns ------- reshaped_array : ndarray This will be a new view object if possible; otherwise, it will be a copy. Note there is no guarantee of the *memory layout* (C- or Fortran- contiguous) of the returned array. See Also -------- ndarray.reshape : Equivalent method. Notes ----- It is not always possible to change the shape of an array without copying the data. If you want an error to be raise if the data is copied, you should assign the new shape to the shape attribute of the array:: >>> a = np.zeros((10, 2)) # A transpose make the array non-contiguous >>> b = a.T # Taking a view makes it possible to modify the shape without modifying # the initial object. >>> c = b.view() >>> c.shape = (20) AttributeError: incompatible shape for a non-contiguous array The `order` keyword gives the index ordering both for *fetching* the values from `a`, and then *placing* the values into the output array. For example, let's say you have an array: >>> a = np.arange(6).reshape((3, 2)) >>> a array([[0, 1], [2, 3], [4, 5]]) You can think of reshaping as first raveling the array (using the given index order), then inserting the elements from the raveled array into the new array using the same kind of index ordering as was used for the raveling. >>> np.reshape(a, (2, 3)) # C-like index ordering array([[0, 1, 2], [3, 4, 5]]) >>> np.reshape(np.ravel(a), (2, 3)) # equivalent to C ravel then C reshape array([[0, 1, 2], [3, 4, 5]]) >>> np.reshape(a, (2, 3), order='F') # Fortran-like index ordering array([[0, 4, 3], [2, 1, 5]]) >>> np.reshape(np.ravel(a, order='F'), (2, 3), order='F') array([[0, 4, 3], [2, 1, 5]]) Examples -------- >>> a = np.array([[1,2,3], [4,5,6]]) >>> np.reshape(a, 6) array([1, 2, 3, 4, 5, 6]) >>> np.reshape(a, 6, order='F') array([1, 4, 2, 5, 3, 6]) >>> np.reshape(a, (3,-1)) # the unspecified value is inferred to be 2 array([[1, 2], [3, 4], [5, 6]]) """ try: reshape = a.reshape except AttributeError: return _wrapit(a, 'reshape', newshape, order=order) return reshape(newshape, order=order) def choose(a, choices, out=None, mode='raise'): """ Construct an array from an index array and a set of arrays to choose from. First of all, if confused or uncertain, definitely look at the Examples - in its full generality, this function is less simple than it might seem from the following code description (below ndi = `numpy.lib.index_tricks`): ``np.choose(a,c) == np.array([c[a[I]][I] for I in ndi.ndindex(a.shape)])``. But this omits some subtleties. Here is a fully general summary: Given an "index" array (`a`) of integers and a sequence of `n` arrays (`choices`), `a` and each choice array are first broadcast, as necessary, to arrays of a common shape; calling these *Ba* and *Bchoices[i], i = 0,...,n-1* we have that, necessarily, ``Ba.shape == Bchoices[i].shape`` for each `i`. Then, a new array with shape ``Ba.shape`` is created as follows: * if ``mode=raise`` (the default), then, first of all, each element of `a` (and thus `Ba`) must be in the range `[0, n-1]`; now, suppose that `i` (in that range) is the value at the `(j0, j1, ..., jm)` position in `Ba` - then the value at the same position in the new array is the value in `Bchoices[i]` at that same position; * if ``mode=wrap``, values in `a` (and thus `Ba`) may be any (signed) integer; modular arithmetic is used to map integers outside the range `[0, n-1]` back into that range; and then the new array is constructed as above; * if ``mode=clip``, values in `a` (and thus `Ba`) may be any (signed) integer; negative integers are mapped to 0; values greater than `n-1` are mapped to `n-1`; and then the new array is constructed as above. Parameters ---------- a : int array This array must contain integers in `[0, n-1]`, where `n` is the number of choices, unless ``mode=wrap`` or ``mode=clip``, in which cases any integers are permissible. choices : sequence of arrays Choice arrays. `a` and all of the choices must be broadcastable to the same shape. If `choices` is itself an array (not recommended), then its outermost dimension (i.e., the one corresponding to ``choices.shape[0]``) is taken as defining the "sequence". out : array, optional If provided, the result will be inserted into this array. It should be of the appropriate shape and dtype. mode : {'raise' (default), 'wrap', 'clip'}, optional Specifies how indices outside `[0, n-1]` will be treated: * 'raise' : an exception is raised * 'wrap' : value becomes value mod `n` * 'clip' : values < 0 are mapped to 0, values > n-1 are mapped to n-1 Returns ------- merged_array : array The merged result. Raises ------ ValueError: shape mismatch If `a` and each choice array are not all broadcastable to the same shape. See Also -------- ndarray.choose : equivalent method Notes ----- To reduce the chance of misinterpretation, even though the following "abuse" is nominally supported, `choices` should neither be, nor be thought of as, a single array, i.e., the outermost sequence-like container should be either a list or a tuple. Examples -------- >>> choices = [[0, 1, 2, 3], [10, 11, 12, 13], ... [20, 21, 22, 23], [30, 31, 32, 33]] >>> np.choose([2, 3, 1, 0], choices ... # the first element of the result will be the first element of the ... # third (2+1) "array" in choices, namely, 20; the second element ... # will be the second element of the fourth (3+1) choice array, i.e., ... # 31, etc. ... ) array([20, 31, 12, 3]) >>> np.choose([2, 4, 1, 0], choices, mode='clip') # 4 goes to 3 (4-1) array([20, 31, 12, 3]) >>> # because there are 4 choice arrays >>> np.choose([2, 4, 1, 0], choices, mode='wrap') # 4 goes to (4 mod 4) array([20, 1, 12, 3]) >>> # i.e., 0 A couple examples illustrating how choose broadcasts: >>> a = [[1, 0, 1], [0, 1, 0], [1, 0, 1]] >>> choices = [-10, 10] >>> np.choose(a, choices) array([[ 10, -10, 10], [-10, 10, -10], [ 10, -10, 10]]) >>> # With thanks to Anne Archibald >>> a = np.array([0, 1]).reshape((2,1,1)) >>> c1 = np.array([1, 2, 3]).reshape((1,3,1)) >>> c2 = np.array([-1, -2, -3, -4, -5]).reshape((1,1,5)) >>> np.choose(a, (c1, c2)) # result is 2x3x5, res[0,:,:]=c1, res[1,:,:]=c2 array([[[ 1, 1, 1, 1, 1], [ 2, 2, 2, 2, 2], [ 3, 3, 3, 3, 3]], [[-1, -2, -3, -4, -5], [-1, -2, -3, -4, -5], [-1, -2, -3, -4, -5]]]) """ try: choose = a.choose except AttributeError: return _wrapit(a, 'choose', choices, out=out, mode=mode) return choose(choices, out=out, mode=mode) def repeat(a, repeats, axis=None): """ Repeat elements of an array. Parameters ---------- a : array_like Input array. repeats : int or array of ints The number of repetitions for each element. `repeats` is broadcasted to fit the shape of the given axis. axis : int, optional The axis along which to repeat values. By default, use the flattened input array, and return a flat output array. Returns ------- repeated_array : ndarray Output array which has the same shape as `a`, except along the given axis. See Also -------- tile : Tile an array. Examples -------- >>> x = np.array([[1,2],[3,4]]) >>> np.repeat(x, 2) array([1, 1, 2, 2, 3, 3, 4, 4]) >>> np.repeat(x, 3, axis=1) array([[1, 1, 1, 2, 2, 2], [3, 3, 3, 4, 4, 4]]) >>> np.repeat(x, [1, 2], axis=0) array([[1, 2], [3, 4], [3, 4]]) """ try: repeat = a.repeat except AttributeError: return _wrapit(a, 'repeat', repeats, axis) return repeat(repeats, axis) def put(a, ind, v, mode='raise'): """ Replaces specified elements of an array with given values. The indexing works on the flattened target array. `put` is roughly equivalent to: :: a.flat[ind] = v Parameters ---------- a : ndarray Target array. ind : array_like Target indices, interpreted as integers. v : array_like Values to place in `a` at target indices. If `v` is shorter than `ind` it will be repeated as necessary. mode : {'raise', 'wrap', 'clip'}, optional Specifies how out-of-bounds indices will behave. * 'raise' -- raise an error (default) * 'wrap' -- wrap around * 'clip' -- clip to the range 'clip' mode means that all indices that are too large are replaced by the index that addresses the last element along that axis. Note that this disables indexing with negative numbers. See Also -------- putmask, place Examples -------- >>> a = np.arange(5) >>> np.put(a, [0, 2], [-44, -55]) >>> a array([-44, 1, -55, 3, 4]) >>> a = np.arange(5) >>> np.put(a, 22, -5, mode='clip') >>> a array([ 0, 1, 2, 3, -5]) """ return a.put(ind, v, mode) def swapaxes(a, axis1, axis2): """ Interchange two axes of an array. Parameters ---------- a : array_like Input array. axis1 : int First axis. axis2 : int Second axis. Returns ------- a_swapped : ndarray For Numpy >= 1.10, if `a` is an ndarray, then a view of `a` is returned; otherwise a new array is created. For earlier Numpy versions a view of `a` is returned only if the order of the axes is changed, otherwise the input array is returned. Examples -------- >>> x = np.array([[1,2,3]]) >>> np.swapaxes(x,0,1) array([[1], [2], [3]]) >>> x = np.array([[[0,1],[2,3]],[[4,5],[6,7]]]) >>> x array([[[0, 1], [2, 3]], [[4, 5], [6, 7]]]) >>> np.swapaxes(x,0,2) array([[[0, 4], [2, 6]], [[1, 5], [3, 7]]]) """ try: swapaxes = a.swapaxes except AttributeError: return _wrapit(a, 'swapaxes', axis1, axis2) return swapaxes(axis1, axis2) def transpose(a, axes=None): """ Permute the dimensions of an array. Parameters ---------- a : array_like Input array. axes : list of ints, optional By default, reverse the dimensions, otherwise permute the axes according to the values given. Returns ------- p : ndarray `a` with its axes permuted. A view is returned whenever possible. See Also -------- rollaxis argsort Notes ----- Use `transpose(a, argsort(axes))` to invert the transposition of tensors when using the `axes` keyword argument. Transposing a 1-D array returns an unchanged view of the original array. Examples -------- >>> x = np.arange(4).reshape((2,2)) >>> x array([[0, 1], [2, 3]]) >>> np.transpose(x) array([[0, 2], [1, 3]]) >>> x = np.ones((1, 2, 3)) >>> np.transpose(x, (1, 0, 2)).shape (2, 1, 3) """ try: transpose = a.transpose except AttributeError: return _wrapit(a, 'transpose', axes) return transpose(axes) def partition(a, kth, axis=-1, kind='introselect', order=None): """ Return a partitioned copy of an array. Creates a copy of the array with its elements rearranged in such a way that the value of the element in kth position is in the position it would be in a sorted array. All elements smaller than the kth element are moved before this element and all equal or greater are moved behind it. The ordering of the elements in the two partitions is undefined. .. versionadded:: 1.8.0 Parameters ---------- a : array_like Array to be sorted. kth : int or sequence of ints Element index to partition by. The kth value of the element will be in its final sorted position and all smaller elements will be moved before it and all equal or greater elements behind it. The order all elements in the partitions is undefined. If provided with a sequence of kth it will partition all elements indexed by kth of them into their sorted position at once. axis : int or None, optional Axis along which to sort. If None, the array is flattened before sorting. The default is -1, which sorts along the last axis. kind : {'introselect'}, optional Selection algorithm. Default is 'introselect'. order : str or list of str, optional When `a` is an array with fields defined, this argument specifies which fields to compare first, second, etc. A single field can be specified as a string. Not all fields need be specified, but unspecified fields will still be used, in the order in which they come up in the dtype, to break ties. Returns ------- partitioned_array : ndarray Array of the same type and shape as `a`. See Also -------- ndarray.partition : Method to sort an array in-place. argpartition : Indirect partition. sort : Full sorting Notes ----- The various selection algorithms are characterized by their average speed, worst case performance, work space size, and whether they are stable. A stable sort keeps items with the same key in the same relative order. The available algorithms have the following properties: ================= ======= ============= ============ ======= kind speed worst case work space stable ================= ======= ============= ============ ======= 'introselect' 1 O(n) 0 no ================= ======= ============= ============ ======= All the partition algorithms make temporary copies of the data when partitioning along any but the last axis. Consequently, partitioning along the last axis is faster and uses less space than partitioning along any other axis. The sort order for complex numbers is lexicographic. If both the real and imaginary parts are non-nan then the order is determined by the real parts except when they are equal, in which case the order is determined by the imaginary parts. Examples -------- >>> a = np.array([3, 4, 2, 1]) >>> np.partition(a, 3) array([2, 1, 3, 4]) >>> np.partition(a, (1, 3)) array([1, 2, 3, 4]) """ if axis is None: a = asanyarray(a).flatten() axis = 0 else: a = asanyarray(a).copy(order="K") a.partition(kth, axis=axis, kind=kind, order=order) return a def argpartition(a, kth, axis=-1, kind='introselect', order=None): """ Perform an indirect partition along the given axis using the algorithm specified by the `kind` keyword. It returns an array of indices of the same shape as `a` that index data along the given axis in partitioned order. .. versionadded:: 1.8.0 Parameters ---------- a : array_like Array to sort. kth : int or sequence of ints Element index to partition by. The kth element will be in its final sorted position and all smaller elements will be moved before it and all larger elements behind it. The order all elements in the partitions is undefined. If provided with a sequence of kth it will partition all of them into their sorted position at once. axis : int or None, optional Axis along which to sort. The default is -1 (the last axis). If None, the flattened array is used. kind : {'introselect'}, optional Selection algorithm. Default is 'introselect' order : str or list of str, optional When `a` is an array with fields defined, this argument specifies which fields to compare first, second, etc. A single field can be specified as a string, and not all fields need be specified, but unspecified fields will still be used, in the order in which they come up in the dtype, to break ties. Returns ------- index_array : ndarray, int Array of indices that partition `a` along the specified axis. In other words, ``a[index_array]`` yields a sorted `a`. See Also -------- partition : Describes partition algorithms used. ndarray.partition : Inplace partition. argsort : Full indirect sort Notes ----- See `partition` for notes on the different selection algorithms. Examples -------- One dimensional array: >>> x = np.array([3, 4, 2, 1]) >>> x[np.argpartition(x, 3)] array([2, 1, 3, 4]) >>> x[np.argpartition(x, (1, 3))] array([1, 2, 3, 4]) >>> x = [3, 4, 2, 1] >>> np.array(x)[np.argpartition(x, 3)] array([2, 1, 3, 4]) """ try: argpartition = a.argpartition except AttributeError: return _wrapit(a, 'argpartition',kth, axis, kind, order) return argpartition(kth, axis, kind=kind, order=order) def sort(a, axis=-1, kind='quicksort', order=None): """ Return a sorted copy of an array. Parameters ---------- a : array_like Array to be sorted. axis : int or None, optional Axis along which to sort. If None, the array is flattened before sorting. The default is -1, which sorts along the last axis. kind : {'quicksort', 'mergesort', 'heapsort'}, optional Sorting algorithm. Default is 'quicksort'. order : str or list of str, optional When `a` is an array with fields defined, this argument specifies which fields to compare first, second, etc. A single field can be specified as a string, and not all fields need be specified, but unspecified fields will still be used, in the order in which they come up in the dtype, to break ties. Returns ------- sorted_array : ndarray Array of the same type and shape as `a`. See Also -------- ndarray.sort : Method to sort an array in-place. argsort : Indirect sort. lexsort : Indirect stable sort on multiple keys. searchsorted : Find elements in a sorted array. partition : Partial sort. Notes ----- The various sorting algorithms are characterized by their average speed, worst case performance, work space size, and whether they are stable. A stable sort keeps items with the same key in the same relative order. The three available algorithms have the following properties: =========== ======= ============= ============ ======= kind speed worst case work space stable =========== ======= ============= ============ ======= 'quicksort' 1 O(n^2) 0 no 'mergesort' 2 O(n*log(n)) ~n/2 yes 'heapsort' 3 O(n*log(n)) 0 no =========== ======= ============= ============ ======= All the sort algorithms make temporary copies of the data when sorting along any but the last axis. Consequently, sorting along the last axis is faster and uses less space than sorting along any other axis. The sort order for complex numbers is lexicographic. If both the real and imaginary parts are non-nan then the order is determined by the real parts except when they are equal, in which case the order is determined by the imaginary parts. Previous to numpy 1.4.0 sorting real and complex arrays containing nan values led to undefined behaviour. In numpy versions >= 1.4.0 nan values are sorted to the end. The extended sort order is: * Real: [R, nan] * Complex: [R + Rj, R + nanj, nan + Rj, nan + nanj] where R is a non-nan real value. Complex values with the same nan placements are sorted according to the non-nan part if it exists. Non-nan values are sorted as before. Examples -------- >>> a = np.array([[1,4],[3,1]]) >>> np.sort(a) # sort along the last axis array([[1, 4], [1, 3]]) >>> np.sort(a, axis=None) # sort the flattened array array([1, 1, 3, 4]) >>> np.sort(a, axis=0) # sort along the first axis array([[1, 1], [3, 4]]) Use the `order` keyword to specify a field to use when sorting a structured array: >>> dtype = [('name', 'S10'), ('height', float), ('age', int)] >>> values = [('Arthur', 1.8, 41), ('Lancelot', 1.9, 38), ... ('Galahad', 1.7, 38)] >>> a = np.array(values, dtype=dtype) # create a structured array >>> np.sort(a, order='height') # doctest: +SKIP array([('Galahad', 1.7, 38), ('Arthur', 1.8, 41), ('Lancelot', 1.8999999999999999, 38)], dtype=[('name', '|S10'), ('height', '<f8'), ('age', '<i4')]) Sort by age, then height if ages are equal: >>> np.sort(a, order=['age', 'height']) # doctest: +SKIP array([('Galahad', 1.7, 38), ('Lancelot', 1.8999999999999999, 38), ('Arthur', 1.8, 41)], dtype=[('name', '|S10'), ('height', '<f8'), ('age', '<i4')]) """ if axis is None: a = asanyarray(a).flatten() axis = 0 else: a = asanyarray(a).copy(order="K") a.sort(axis, kind, order) return a def argsort(a, axis=-1, kind='quicksort', order=None): """ Returns the indices that would sort an array. Perform an indirect sort along the given axis using the algorithm specified by the `kind` keyword. It returns an array of indices of the same shape as `a` that index data along the given axis in sorted order. Parameters ---------- a : array_like Array to sort. axis : int or None, optional Axis along which to sort. The default is -1 (the last axis). If None, the flattened array is used. kind : {'quicksort', 'mergesort', 'heapsort'}, optional Sorting algorithm. order : str or list of str, optional When `a` is an array with fields defined, this argument specifies which fields to compare first, second, etc. A single field can be specified as a string, and not all fields need be specified, but unspecified fields will still be used, in the order in which they come up in the dtype, to break ties. Returns ------- index_array : ndarray, int Array of indices that sort `a` along the specified axis. In other words, ``a[index_array]`` yields a sorted `a`. See Also -------- sort : Describes sorting algorithms used. lexsort : Indirect stable sort with multiple keys. ndarray.sort : Inplace sort. argpartition : Indirect partial sort. Notes ----- See `sort` for notes on the different sorting algorithms. As of NumPy 1.4.0 `argsort` works with real/complex arrays containing nan values. The enhanced sort order is documented in `sort`. Examples -------- One dimensional array: >>> x = np.array([3, 1, 2]) >>> np.argsort(x) array([1, 2, 0]) Two-dimensional array: >>> x = np.array([[0, 3], [2, 2]]) >>> x array([[0, 3], [2, 2]]) >>> np.argsort(x, axis=0) array([[0, 1], [1, 0]]) >>> np.argsort(x, axis=1) array([[0, 1], [0, 1]]) Sorting with keys: >>> x = np.array([(1, 0), (0, 1)], dtype=[('x', '<i4'), ('y', '<i4')]) >>> x array([(1, 0), (0, 1)], dtype=[('x', '<i4'), ('y', '<i4')]) >>> np.argsort(x, order=('x','y')) array([1, 0]) >>> np.argsort(x, order=('y','x')) array([0, 1]) """ try: argsort = a.argsort except AttributeError: return _wrapit(a, 'argsort', axis, kind, order) return argsort(axis, kind, order) def argmax(a, axis=None, out=None): """ Returns the indices of the maximum values along an axis. Parameters ---------- a : array_like Input array. axis : int, optional By default, the index is into the flattened array, otherwise along the specified axis. out : array, optional If provided, the result will be inserted into this array. It should be of the appropriate shape and dtype. Returns ------- index_array : ndarray of ints Array of indices into the array. It has the same shape as `a.shape` with the dimension along `axis` removed. See Also -------- ndarray.argmax, argmin amax : The maximum value along a given axis. unravel_index : Convert a flat index into an index tuple. Notes ----- In case of multiple occurrences of the maximum values, the indices corresponding to the first occurrence are returned. Examples -------- >>> a = np.arange(6).reshape(2,3) >>> a array([[0, 1, 2], [3, 4, 5]]) >>> np.argmax(a) 5 >>> np.argmax(a, axis=0) array([1, 1, 1]) >>> np.argmax(a, axis=1) array([2, 2]) >>> b = np.arange(6) >>> b[1] = 5 >>> b array([0, 5, 2, 3, 4, 5]) >>> np.argmax(b) # Only the first occurrence is returned. 1 """ try: argmax = a.argmax except AttributeError: return _wrapit(a, 'argmax', axis, out) return argmax(axis, out) def argmin(a, axis=None, out=None): """ Returns the indices of the minimum values along an axis. Parameters ---------- a : array_like Input array. axis : int, optional By default, the index is into the flattened array, otherwise along the specified axis. out : array, optional If provided, the result will be inserted into this array. It should be of the appropriate shape and dtype. Returns ------- index_array : ndarray of ints Array of indices into the array. It has the same shape as `a.shape` with the dimension along `axis` removed. See Also -------- ndarray.argmin, argmax amin : The minimum value along a given axis. unravel_index : Convert a flat index into an index tuple. Notes ----- In case of multiple occurrences of the minimum values, the indices corresponding to the first occurrence are returned. Examples -------- >>> a = np.arange(6).reshape(2,3) >>> a array([[0, 1, 2], [3, 4, 5]]) >>> np.argmin(a) 0 >>> np.argmin(a, axis=0) array([0, 0, 0]) >>> np.argmin(a, axis=1) array([0, 0]) >>> b = np.arange(6) >>> b[4] = 0 >>> b array([0, 1, 2, 3, 0, 5]) >>> np.argmin(b) # Only the first occurrence is returned. 0 """ try: argmin = a.argmin except AttributeError: return _wrapit(a, 'argmin', axis, out) return argmin(axis, out) def searchsorted(a, v, side='left', sorter=None): """ Find indices where elements should be inserted to maintain order. Find the indices into a sorted array `a` such that, if the corresponding elements in `v` were inserted before the indices, the order of `a` would be preserved. Parameters ---------- a : 1-D array_like Input array. If `sorter` is None, then it must be sorted in ascending order, otherwise `sorter` must be an array of indices that sort it. v : array_like Values to insert into `a`. side : {'left', 'right'}, optional If 'left', the index of the first suitable location found is given. If 'right', return the last such index. If there is no suitable index, return either 0 or N (where N is the length of `a`). sorter : 1-D array_like, optional Optional array of integer indices that sort array a into ascending order. They are typically the result of argsort. .. versionadded:: 1.7.0 Returns ------- indices : array of ints Array of insertion points with the same shape as `v`. See Also -------- sort : Return a sorted copy of an array. histogram : Produce histogram from 1-D data. Notes ----- Binary search is used to find the required insertion points. As of Numpy 1.4.0 `searchsorted` works with real/complex arrays containing `nan` values. The enhanced sort order is documented in `sort`. Examples -------- >>> np.searchsorted([1,2,3,4,5], 3) 2 >>> np.searchsorted([1,2,3,4,5], 3, side='right') 3 >>> np.searchsorted([1,2,3,4,5], [-10, 10, 2, 3]) array([0, 5, 1, 2]) """ try: searchsorted = a.searchsorted except AttributeError: return _wrapit(a, 'searchsorted', v, side, sorter) return searchsorted(v, side, sorter) def resize(a, new_shape): """ Return a new array with the specified shape. If the new array is larger than the original array, then the new array is filled with repeated copies of `a`. Note that this behavior is different from a.resize(new_shape) which fills with zeros instead of repeated copies of `a`. Parameters ---------- a : array_like Array to be resized. new_shape : int or tuple of int Shape of resized array. Returns ------- reshaped_array : ndarray The new array is formed from the data in the old array, repeated if necessary to fill out the required number of elements. The data are repeated in the order that they are stored in memory. See Also -------- ndarray.resize : resize an array in-place. Examples -------- >>> a=np.array([[0,1],[2,3]]) >>> np.resize(a,(2,3)) array([[0, 1, 2], [3, 0, 1]]) >>> np.resize(a,(1,4)) array([[0, 1, 2, 3]]) >>> np.resize(a,(2,4)) array([[0, 1, 2, 3], [0, 1, 2, 3]]) """ if isinstance(new_shape, (int, nt.integer)): new_shape = (new_shape,) a = ravel(a) Na = len(a) if not Na: return mu.zeros(new_shape, a.dtype.char) total_size = um.multiply.reduce(new_shape) n_copies = int(total_size / Na) extra = total_size % Na if total_size == 0: return a[:0] if extra != 0: n_copies = n_copies+1 extra = Na-extra a = concatenate((a,)*n_copies) if extra > 0: a = a[:-extra] return reshape(a, new_shape) def squeeze(a, axis=None): """ Remove single-dimensional entries from the shape of an array. Parameters ---------- a : array_like Input data. axis : None or int or tuple of ints, optional .. versionadded:: 1.7.0 Selects a subset of the single-dimensional entries in the shape. If an axis is selected with shape entry greater than one, an error is raised. Returns ------- squeezed : ndarray The input array, but with all or a subset of the dimensions of length 1 removed. This is always `a` itself or a view into `a`. Examples -------- >>> x = np.array([[[0], [1], [2]]]) >>> x.shape (1, 3, 1) >>> np.squeeze(x).shape (3,) >>> np.squeeze(x, axis=(2,)).shape (1, 3) """ try: squeeze = a.squeeze except AttributeError: return _wrapit(a, 'squeeze') try: # First try to use the new axis= parameter return squeeze(axis=axis) except TypeError: # For backwards compatibility return squeeze() def diagonal(a, offset=0, axis1=0, axis2=1): """ Return specified diagonals. If `a` is 2-D, returns the diagonal of `a` with the given offset, i.e., the collection of elements of the form ``a[i, i+offset]``. If `a` has more than two dimensions, then the axes specified by `axis1` and `axis2` are used to determine the 2-D sub-array whose diagonal is returned. The shape of the resulting array can be determined by removing `axis1` and `axis2` and appending an index to the right equal to the size of the resulting diagonals. In versions of NumPy prior to 1.7, this function always returned a new, independent array containing a copy of the values in the diagonal. In NumPy 1.7 and 1.8, it continues to return a copy of the diagonal, but depending on this fact is deprecated. Writing to the resulting array continues to work as it used to, but a FutureWarning is issued. In NumPy 1.9 it returns a read-only view on the original array. Attempting to write to the resulting array will produce an error. In NumPy 1.10, it will return a read/write view and writing to the returned array will alter your original array. The returned array will have the same type as the input array. If you don't write to the array returned by this function, then you can just ignore all of the above. If you depend on the current behavior, then we suggest copying the returned array explicitly, i.e., use ``np.diagonal(a).copy()`` instead of just ``np.diagonal(a)``. This will work with both past and future versions of NumPy. Parameters ---------- a : array_like Array from which the diagonals are taken. offset : int, optional Offset of the diagonal from the main diagonal. Can be positive or negative. Defaults to main diagonal (0). axis1 : int, optional Axis to be used as the first axis of the 2-D sub-arrays from which the diagonals should be taken. Defaults to first axis (0). axis2 : int, optional Axis to be used as the second axis of the 2-D sub-arrays from which the diagonals should be taken. Defaults to second axis (1). Returns ------- array_of_diagonals : ndarray If `a` is 2-D and not a matrix, a 1-D array of the same type as `a` containing the diagonal is returned. If `a` is a matrix, a 1-D array containing the diagonal is returned in order to maintain backward compatibility. If the dimension of `a` is greater than two, then an array of diagonals is returned, "packed" from left-most dimension to right-most (e.g., if `a` is 3-D, then the diagonals are "packed" along rows). Raises ------ ValueError If the dimension of `a` is less than 2. See Also -------- diag : MATLAB work-a-like for 1-D and 2-D arrays. diagflat : Create diagonal arrays. trace : Sum along diagonals. Examples -------- >>> a = np.arange(4).reshape(2,2) >>> a array([[0, 1], [2, 3]]) >>> a.diagonal() array([0, 3]) >>> a.diagonal(1) array([1]) A 3-D example: >>> a = np.arange(8).reshape(2,2,2); a array([[[0, 1], [2, 3]], [[4, 5], [6, 7]]]) >>> a.diagonal(0, # Main diagonals of two arrays created by skipping ... 0, # across the outer(left)-most axis last and ... 1) # the "middle" (row) axis first. array([[0, 6], [1, 7]]) The sub-arrays whose main diagonals we just obtained; note that each corresponds to fixing the right-most (column) axis, and that the diagonals are "packed" in rows. >>> a[:,:,0] # main diagonal is [0 6] array([[0, 2], [4, 6]]) >>> a[:,:,1] # main diagonal is [1 7] array([[1, 3], [5, 7]]) """ if isinstance(a, np.matrix): # Make diagonal of matrix 1-D to preserve backward compatibility. return asarray(a).diagonal(offset, axis1, axis2) else: return asanyarray(a).diagonal(offset, axis1, axis2) def trace(a, offset=0, axis1=0, axis2=1, dtype=None, out=None): """ Return the sum along diagonals of the array. If `a` is 2-D, the sum along its diagonal with the given offset is returned, i.e., the sum of elements ``a[i,i+offset]`` for all i. If `a` has more than two dimensions, then the axes specified by axis1 and axis2 are used to determine the 2-D sub-arrays whose traces are returned. The shape of the resulting array is the same as that of `a` with `axis1` and `axis2` removed. Parameters ---------- a : array_like Input array, from which the diagonals are taken. offset : int, optional Offset of the diagonal from the main diagonal. Can be both positive and negative. Defaults to 0. axis1, axis2 : int, optional Axes to be used as the first and second axis of the 2-D sub-arrays from which the diagonals should be taken. Defaults are the first two axes of `a`. dtype : dtype, optional Determines the data-type of the returned array and of the accumulator where the elements are summed. If dtype has the value None and `a` is of integer type of precision less than the default integer precision, then the default integer precision is used. Otherwise, the precision is the same as that of `a`. out : ndarray, optional Array into which the output is placed. Its type is preserved and it must be of the right shape to hold the output. Returns ------- sum_along_diagonals : ndarray If `a` is 2-D, the sum along the diagonal is returned. If `a` has larger dimensions, then an array of sums along diagonals is returned. See Also -------- diag, diagonal, diagflat Examples -------- >>> np.trace(np.eye(3)) 3.0 >>> a = np.arange(8).reshape((2,2,2)) >>> np.trace(a) array([6, 8]) >>> a = np.arange(24).reshape((2,2,2,3)) >>> np.trace(a).shape (2, 3) """ if isinstance(a, np.matrix): # Get trace of matrix via an array to preserve backward compatibility. return asarray(a).trace(offset, axis1, axis2, dtype, out) else: return asanyarray(a).trace(offset, axis1, axis2, dtype, out) def ravel(a, order='C'): """Return a contiguous flattened array. A 1-D array, containing the elements of the input, is returned. A copy is made only if needed. As of NumPy 1.10, the returned array will have the same type as the input array. (for example, a masked array will be returned for a masked array input) Parameters ---------- a : array_like Input array. The elements in `a` are read in the order specified by `order`, and packed as a 1-D array. order : {'C','F', 'A', 'K'}, optional The elements of `a` are read using this index order. 'C' means to index the elements in row-major, C-style order, with the last axis index changing fastest, back to the first axis index changing slowest. 'F' means to index the elements in column-major, Fortran-style order, with the first index changing fastest, and the last index changing slowest. Note that the 'C' and 'F' options take no account of the memory layout of the underlying array, and only refer to the order of axis indexing. 'A' means to read the elements in Fortran-like index order if `a` is Fortran *contiguous* in memory, C-like order otherwise. 'K' means to read the elements in the order they occur in memory, except for reversing the data when strides are negative. By default, 'C' index order is used. Returns ------- y : array_like If `a` is a matrix, y is a 1-D ndarray, otherwise y is an array of the same subtype as `a`. The shape of the returned array is ``(a.size,)``. Matrices are special cased for backward compatibility. See Also -------- ndarray.flat : 1-D iterator over an array. ndarray.flatten : 1-D array copy of the elements of an array in row-major order. ndarray.reshape : Change the shape of an array without changing its data. Notes ----- In row-major, C-style order, in two dimensions, the row index varies the slowest, and the column index the quickest. This can be generalized to multiple dimensions, where row-major order implies that the index along the first axis varies slowest, and the index along the last quickest. The opposite holds for column-major, Fortran-style index ordering. When a view is desired in as many cases as possible, ``arr.reshape(-1)`` may be preferable. Examples -------- It is equivalent to ``reshape(-1, order=order)``. >>> x = np.array([[1, 2, 3], [4, 5, 6]]) >>> print np.ravel(x) [1 2 3 4 5 6] >>> print x.reshape(-1) [1 2 3 4 5 6] >>> print np.ravel(x, order='F') [1 4 2 5 3 6] When ``order`` is 'A', it will preserve the array's 'C' or 'F' ordering: >>> print np.ravel(x.T) [1 4 2 5 3 6] >>> print np.ravel(x.T, order='A') [1 2 3 4 5 6] When ``order`` is 'K', it will preserve orderings that are neither 'C' nor 'F', but won't reverse axes: >>> a = np.arange(3)[::-1]; a array([2, 1, 0]) >>> a.ravel(order='C') array([2, 1, 0]) >>> a.ravel(order='K') array([2, 1, 0]) >>> a = np.arange(12).reshape(2,3,2).swapaxes(1,2); a array([[[ 0, 2, 4], [ 1, 3, 5]], [[ 6, 8, 10], [ 7, 9, 11]]]) >>> a.ravel(order='C') array([ 0, 2, 4, 1, 3, 5, 6, 8, 10, 7, 9, 11]) >>> a.ravel(order='K') array([ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11]) """ if isinstance(a, np.matrix): return asarray(a).ravel(order) else: return asanyarray(a).ravel(order) def nonzero(a): """ Return the indices of the elements that are non-zero. Returns a tuple of arrays, one for each dimension of `a`, containing the indices of the non-zero elements in that dimension. The values in `a` are always tested and returned in row-major, C-style order. The corresponding non-zero values can be obtained with:: a[nonzero(a)] To group the indices by element, rather than dimension, use:: transpose(nonzero(a)) The result of this is always a 2-D array, with a row for each non-zero element. Parameters ---------- a : array_like Input array. Returns ------- tuple_of_arrays : tuple Indices of elements that are non-zero. See Also -------- flatnonzero : Return indices that are non-zero in the flattened version of the input array. ndarray.nonzero : Equivalent ndarray method. count_nonzero : Counts the number of non-zero elements in the input array. Examples -------- >>> x = np.eye(3) >>> x array([[ 1., 0., 0.], [ 0., 1., 0.], [ 0., 0., 1.]]) >>> np.nonzero(x) (array([0, 1, 2]), array([0, 1, 2])) >>> x[np.nonzero(x)] array([ 1., 1., 1.]) >>> np.transpose(np.nonzero(x)) array([[0, 0], [1, 1], [2, 2]]) A common use for ``nonzero`` is to find the indices of an array, where a condition is True. Given an array `a`, the condition `a` > 3 is a boolean array and since False is interpreted as 0, np.nonzero(a > 3) yields the indices of the `a` where the condition is true. >>> a = np.array([[1,2,3],[4,5,6],[7,8,9]]) >>> a > 3 array([[False, False, False], [ True, True, True], [ True, True, True]], dtype=bool) >>> np.nonzero(a > 3) (array([1, 1, 1, 2, 2, 2]), array([0, 1, 2, 0, 1, 2])) The ``nonzero`` method of the boolean array can also be called. >>> (a > 3).nonzero() (array([1, 1, 1, 2, 2, 2]), array([0, 1, 2, 0, 1, 2])) """ try: nonzero = a.nonzero except AttributeError: res = _wrapit(a, 'nonzero') else: res = nonzero() return res def shape(a): """ Return the shape of an array. Parameters ---------- a : array_like Input array. Returns ------- shape : tuple of ints The elements of the shape tuple give the lengths of the corresponding array dimensions. See Also -------- alen ndarray.shape : Equivalent array method. Examples -------- >>> np.shape(np.eye(3)) (3, 3) >>> np.shape([[1, 2]]) (1, 2) >>> np.shape([0]) (1,) >>> np.shape(0) () >>> a = np.array([(1, 2), (3, 4)], dtype=[('x', 'i4'), ('y', 'i4')]) >>> np.shape(a) (2,) >>> a.shape (2,) """ try: result = a.shape except AttributeError: result = asarray(a).shape return result def compress(condition, a, axis=None, out=None): """ Return selected slices of an array along given axis. When working along a given axis, a slice along that axis is returned in `output` for each index where `condition` evaluates to True. When working on a 1-D array, `compress` is equivalent to `extract`. Parameters ---------- condition : 1-D array of bools Array that selects which entries to return. If len(condition) is less than the size of `a` along the given axis, then output is truncated to the length of the condition array. a : array_like Array from which to extract a part. axis : int, optional Axis along which to take slices. If None (default), work on the flattened array. out : ndarray, optional Output array. Its type is preserved and it must be of the right shape to hold the output. Returns ------- compressed_array : ndarray A copy of `a` without the slices along axis for which `condition` is false. See Also -------- take, choose, diag, diagonal, select ndarray.compress : Equivalent method in ndarray np.extract: Equivalent method when working on 1-D arrays numpy.doc.ufuncs : Section "Output arguments" Examples -------- >>> a = np.array([[1, 2], [3, 4], [5, 6]]) >>> a array([[1, 2], [3, 4], [5, 6]]) >>> np.compress([0, 1], a, axis=0) array([[3, 4]]) >>> np.compress([False, True, True], a, axis=0) array([[3, 4], [5, 6]]) >>> np.compress([False, True], a, axis=1) array([[2], [4], [6]]) Working on the flattened array does not return slices along an axis but selects elements. >>> np.compress([False, True], a) array([2]) """ try: compress = a.compress except AttributeError: return _wrapit(a, 'compress', condition, axis, out) return compress(condition, axis, out) def clip(a, a_min, a_max, out=None): """ Clip (limit) the values in an array. Given an interval, values outside the interval are clipped to the interval edges. For example, if an interval of ``[0, 1]`` is specified, values smaller than 0 become 0, and values larger than 1 become 1. Parameters ---------- a : array_like Array containing elements to clip. a_min : scalar or array_like Minimum value. a_max : scalar or array_like Maximum value. If `a_min` or `a_max` are array_like, then they will be broadcasted to the shape of `a`. out : ndarray, optional The results will be placed in this array. It may be the input array for in-place clipping. `out` must be of the right shape to hold the output. Its type is preserved. Returns ------- clipped_array : ndarray An array with the elements of `a`, but where values < `a_min` are replaced with `a_min`, and those > `a_max` with `a_max`. See Also -------- numpy.doc.ufuncs : Section "Output arguments" Examples -------- >>> a = np.arange(10) >>> np.clip(a, 1, 8) array([1, 1, 2, 3, 4, 5, 6, 7, 8, 8]) >>> a array([0, 1, 2, 3, 4, 5, 6, 7, 8, 9]) >>> np.clip(a, 3, 6, out=a) array([3, 3, 3, 3, 4, 5, 6, 6, 6, 6]) >>> a = np.arange(10) >>> a array([0, 1, 2, 3, 4, 5, 6, 7, 8, 9]) >>> np.clip(a, [3,4,1,1,1,4,4,4,4,4], 8) array([3, 4, 2, 3, 4, 5, 6, 7, 8, 8]) """ try: clip = a.clip except AttributeError: return _wrapit(a, 'clip', a_min, a_max, out) return clip(a_min, a_max, out) def sum(a, axis=None, dtype=None, out=None, keepdims=False): """ Sum of array elements over a given axis. Parameters ---------- a : array_like Elements to sum. axis : None or int or tuple of ints, optional Axis or axes along which a sum is performed. The default (`axis` = `None`) is perform a sum over all the dimensions of the input array. `axis` may be negative, in which case it counts from the last to the first axis. .. versionadded:: 1.7.0 If this is a tuple of ints, a sum is performed on multiple axes, instead of a single axis or all the axes as before. dtype : dtype, optional The type of the returned array and of the accumulator in which the elements are summed. By default, the dtype of `a` is used. An exception is when `a` has an integer type with less precision than the default platform integer. In that case, the default platform integer is used instead. out : ndarray, optional Array into which the output is placed. By default, a new array is created. If `out` is given, it must be of the appropriate shape (the shape of `a` with `axis` removed, i.e., ``numpy.delete(a.shape, axis)``). Its type is preserved. See `doc.ufuncs` (Section "Output arguments") for more details. keepdims : bool, optional If this is set to True, the axes which are reduced are left in the result as dimensions with size one. With this option, the result will broadcast correctly against the original `arr`. Returns ------- sum_along_axis : ndarray An array with the same shape as `a`, with the specified axis removed. If `a` is a 0-d array, or if `axis` is None, a scalar is returned. If an output array is specified, a reference to `out` is returned. See Also -------- ndarray.sum : Equivalent method. cumsum : Cumulative sum of array elements. trapz : Integration of array values using the composite trapezoidal rule. mean, average Notes ----- Arithmetic is modular when using integer types, and no error is raised on overflow. The sum of an empty array is the neutral element 0: >>> np.sum([]) 0.0 Examples -------- >>> np.sum([0.5, 1.5]) 2.0 >>> np.sum([0.5, 0.7, 0.2, 1.5], dtype=np.int32) 1 >>> np.sum([[0, 1], [0, 5]]) 6 >>> np.sum([[0, 1], [0, 5]], axis=0) array([0, 6]) >>> np.sum([[0, 1], [0, 5]], axis=1) array([1, 5]) If the accumulator is too small, overflow occurs: >>> np.ones(128, dtype=np.int8).sum(dtype=np.int8) -128 """ if isinstance(a, _gentype): res = _sum_(a) if out is not None: out[...] = res return out return res elif type(a) is not mu.ndarray: try: sum = a.sum except AttributeError: return _methods._sum(a, axis=axis, dtype=dtype, out=out, keepdims=keepdims) # NOTE: Dropping the keepdims parameters here... return sum(axis=axis, dtype=dtype, out=out) else: return _methods._sum(a, axis=axis, dtype=dtype, out=out, keepdims=keepdims) def product(a, axis=None, dtype=None, out=None, keepdims=False): """ Return the product of array elements over a given axis. See Also -------- prod : equivalent function; see for details. """ return um.multiply.reduce(a, axis=axis, dtype=dtype, out=out, keepdims=keepdims) def sometrue(a, axis=None, out=None, keepdims=False): """ Check whether some values are true. Refer to `any` for full documentation. See Also -------- any : equivalent function """ arr = asanyarray(a) try: return arr.any(axis=axis, out=out, keepdims=keepdims) except TypeError: return arr.any(axis=axis, out=out) def alltrue(a, axis=None, out=None, keepdims=False): """ Check if all elements of input array are true. See Also -------- numpy.all : Equivalent function; see for details. """ arr = asanyarray(a) try: return arr.all(axis=axis, out=out, keepdims=keepdims) except TypeError: return arr.all(axis=axis, out=out) def any(a, axis=None, out=None, keepdims=False): """ Test whether any array element along a given axis evaluates to True. Returns single boolean unless `axis` is not ``None`` Parameters ---------- a : array_like Input array or object that can be converted to an array. axis : None or int or tuple of ints, optional Axis or axes along which a logical OR reduction is performed. The default (`axis` = `None`) is to perform a logical OR over all the dimensions of the input array. `axis` may be negative, in which case it counts from the last to the first axis. .. versionadded:: 1.7.0 If this is a tuple of ints, a reduction is performed on multiple axes, instead of a single axis or all the axes as before. out : ndarray, optional Alternate output array in which to place the result. It must have the same shape as the expected output and its type is preserved (e.g., if it is of type float, then it will remain so, returning 1.0 for True and 0.0 for False, regardless of the type of `a`). See `doc.ufuncs` (Section "Output arguments") for details. keepdims : bool, optional If this is set to True, the axes which are reduced are left in the result as dimensions with size one. With this option, the result will broadcast correctly against the original `arr`. Returns ------- any : bool or ndarray A new boolean or `ndarray` is returned unless `out` is specified, in which case a reference to `out` is returned. See Also -------- ndarray.any : equivalent method all : Test whether all elements along a given axis evaluate to True. Notes ----- Not a Number (NaN), positive infinity and negative infinity evaluate to `True` because these are not equal to zero. Examples -------- >>> np.any([[True, False], [True, True]]) True >>> np.any([[True, False], [False, False]], axis=0) array([ True, False], dtype=bool) >>> np.any([-1, 0, 5]) True >>> np.any(np.nan) True >>> o=np.array([False]) >>> z=np.any([-1, 4, 5], out=o) >>> z, o (array([ True], dtype=bool), array([ True], dtype=bool)) >>> # Check now that z is a reference to o >>> z is o True >>> id(z), id(o) # identity of z and o # doctest: +SKIP (191614240, 191614240) """ arr = asanyarray(a) try: return arr.any(axis=axis, out=out, keepdims=keepdims) except TypeError: return arr.any(axis=axis, out=out) def all(a, axis=None, out=None, keepdims=False): """ Test whether all array elements along a given axis evaluate to True. Parameters ---------- a : array_like Input array or object that can be converted to an array. axis : None or int or tuple of ints, optional Axis or axes along which a logical AND reduction is performed. The default (`axis` = `None`) is to perform a logical AND over all the dimensions of the input array. `axis` may be negative, in which case it counts from the last to the first axis. .. versionadded:: 1.7.0 If this is a tuple of ints, a reduction is performed on multiple axes, instead of a single axis or all the axes as before. out : ndarray, optional Alternate output array in which to place the result. It must have the same shape as the expected output and its type is preserved (e.g., if ``dtype(out)`` is float, the result will consist of 0.0's and 1.0's). See `doc.ufuncs` (Section "Output arguments") for more details. keepdims : bool, optional If this is set to True, the axes which are reduced are left in the result as dimensions with size one. With this option, the result will broadcast correctly against the original `arr`. Returns ------- all : ndarray, bool A new boolean or array is returned unless `out` is specified, in which case a reference to `out` is returned. See Also -------- ndarray.all : equivalent method any : Test whether any element along a given axis evaluates to True. Notes ----- Not a Number (NaN), positive infinity and negative infinity evaluate to `True` because these are not equal to zero. Examples -------- >>> np.all([[True,False],[True,True]]) False >>> np.all([[True,False],[True,True]], axis=0) array([ True, False], dtype=bool) >>> np.all([-1, 4, 5]) True >>> np.all([1.0, np.nan]) True >>> o=np.array([False]) >>> z=np.all([-1, 4, 5], out=o) >>> id(z), id(o), z # doctest: +SKIP (28293632, 28293632, array([ True], dtype=bool)) """ arr = asanyarray(a) try: return arr.all(axis=axis, out=out, keepdims=keepdims) except TypeError: return arr.all(axis=axis, out=out) def cumsum(a, axis=None, dtype=None, out=None): """ Return the cumulative sum of the elements along a given axis. Parameters ---------- a : array_like Input array. axis : int, optional Axis along which the cumulative sum is computed. The default (None) is to compute the cumsum over the flattened array. dtype : dtype, optional Type of the returned array and of the accumulator in which the elements are summed. If `dtype` is not specified, it defaults to the dtype of `a`, unless `a` has an integer dtype with a precision less than that of the default platform integer. In that case, the default platform integer is used. out : ndarray, optional Alternative output array in which to place the result. It must have the same shape and buffer length as the expected output but the type will be cast if necessary. See `doc.ufuncs` (Section "Output arguments") for more details. Returns ------- cumsum_along_axis : ndarray. A new array holding the result is returned unless `out` is specified, in which case a reference to `out` is returned. The result has the same size as `a`, and the same shape as `a` if `axis` is not None or `a` is a 1-d array. See Also -------- sum : Sum array elements. trapz : Integration of array values using the composite trapezoidal rule. diff : Calculate the n-th order discrete difference along given axis. Notes ----- Arithmetic is modular when using integer types, and no error is raised on overflow. Examples -------- >>> a = np.array([[1,2,3], [4,5,6]]) >>> a array([[1, 2, 3], [4, 5, 6]]) >>> np.cumsum(a) array([ 1, 3, 6, 10, 15, 21]) >>> np.cumsum(a, dtype=float) # specifies type of output value(s) array([ 1., 3., 6., 10., 15., 21.]) >>> np.cumsum(a,axis=0) # sum over rows for each of the 3 columns array([[1, 2, 3], [5, 7, 9]]) >>> np.cumsum(a,axis=1) # sum over columns for each of the 2 rows array([[ 1, 3, 6], [ 4, 9, 15]]) """ try: cumsum = a.cumsum except AttributeError: return _wrapit(a, 'cumsum', axis, dtype, out) return cumsum(axis, dtype, out) def cumproduct(a, axis=None, dtype=None, out=None): """ Return the cumulative product over the given axis. See Also -------- cumprod : equivalent function; see for details. """ try: cumprod = a.cumprod except AttributeError: return _wrapit(a, 'cumprod', axis, dtype, out) return cumprod(axis, dtype, out) def ptp(a, axis=None, out=None): """ Range of values (maximum - minimum) along an axis. The name of the function comes from the acronym for 'peak to peak'. Parameters ---------- a : array_like Input values. axis : int, optional Axis along which to find the peaks. By default, flatten the array. out : array_like Alternative output array in which to place the result. It must have the same shape and buffer length as the expected output, but the type of the output values will be cast if necessary. Returns ------- ptp : ndarray A new array holding the result, unless `out` was specified, in which case a reference to `out` is returned. Examples -------- >>> x = np.arange(4).reshape((2,2)) >>> x array([[0, 1], [2, 3]]) >>> np.ptp(x, axis=0) array([2, 2]) >>> np.ptp(x, axis=1) array([1, 1]) """ try: ptp = a.ptp except AttributeError: return _wrapit(a, 'ptp', axis, out) return ptp(axis, out) def amax(a, axis=None, out=None, keepdims=False): """ Return the maximum of an array or maximum along an axis. Parameters ---------- a : array_like Input data. axis : None or int or tuple of ints, optional Axis or axes along which to operate. By default, flattened input is used. .. versionadded: 1.7.0 If this is a tuple of ints, the maximum is selected over multiple axes, instead of a single axis or all the axes as before. out : ndarray, optional Alternative output array in which to place the result. Must be of the same shape and buffer length as the expected output. See `doc.ufuncs` (Section "Output arguments") for more details. keepdims : bool, optional If this is set to True, the axes which are reduced are left in the result as dimensions with size one. With this option, the result will broadcast correctly against the original `arr`. Returns ------- amax : ndarray or scalar Maximum of `a`. If `axis` is None, the result is a scalar value. If `axis` is given, the result is an array of dimension ``a.ndim - 1``. See Also -------- amin : The minimum value of an array along a given axis, propagating any NaNs. nanmax : The maximum value of an array along a given axis, ignoring any NaNs. maximum : Element-wise maximum of two arrays, propagating any NaNs. fmax : Element-wise maximum of two arrays, ignoring any NaNs. argmax : Return the indices of the maximum values. nanmin, minimum, fmin Notes ----- NaN values are propagated, that is if at least one item is NaN, the corresponding max value will be NaN as well. To ignore NaN values (MATLAB behavior), please use nanmax. Don't use `amax` for element-wise comparison of 2 arrays; when ``a.shape[0]`` is 2, ``maximum(a[0], a[1])`` is faster than ``amax(a, axis=0)``. Examples -------- >>> a = np.arange(4).reshape((2,2)) >>> a array([[0, 1], [2, 3]]) >>> np.amax(a) # Maximum of the flattened array 3 >>> np.amax(a, axis=0) # Maxima along the first axis array([2, 3]) >>> np.amax(a, axis=1) # Maxima along the second axis array([1, 3]) >>> b = np.arange(5, dtype=np.float) >>> b[2] = np.NaN >>> np.amax(b) nan >>> np.nanmax(b) 4.0 """ if type(a) is not mu.ndarray: try: amax = a.max except AttributeError: return _methods._amax(a, axis=axis, out=out, keepdims=keepdims) # NOTE: Dropping the keepdims parameter return amax(axis=axis, out=out) else: return _methods._amax(a, axis=axis, out=out, keepdims=keepdims) def amin(a, axis=None, out=None, keepdims=False): """ Return the minimum of an array or minimum along an axis. Parameters ---------- a : array_like Input data. axis : None or int or tuple of ints, optional Axis or axes along which to operate. By default, flattened input is used. .. versionadded: 1.7.0 If this is a tuple of ints, the minimum is selected over multiple axes, instead of a single axis or all the axes as before. out : ndarray, optional Alternative output array in which to place the result. Must be of the same shape and buffer length as the expected output. See `doc.ufuncs` (Section "Output arguments") for more details. keepdims : bool, optional If this is set to True, the axes which are reduced are left in the result as dimensions with size one. With this option, the result will broadcast correctly against the original `arr`. Returns ------- amin : ndarray or scalar Minimum of `a`. If `axis` is None, the result is a scalar value. If `axis` is given, the result is an array of dimension ``a.ndim - 1``. See Also -------- amax : The maximum value of an array along a given axis, propagating any NaNs. nanmin : The minimum value of an array along a given axis, ignoring any NaNs. minimum : Element-wise minimum of two arrays, propagating any NaNs. fmin : Element-wise minimum of two arrays, ignoring any NaNs. argmin : Return the indices of the minimum values. nanmax, maximum, fmax Notes ----- NaN values are propagated, that is if at least one item is NaN, the corresponding min value will be NaN as well. To ignore NaN values (MATLAB behavior), please use nanmin. Don't use `amin` for element-wise comparison of 2 arrays; when ``a.shape[0]`` is 2, ``minimum(a[0], a[1])`` is faster than ``amin(a, axis=0)``. Examples -------- >>> a = np.arange(4).reshape((2,2)) >>> a array([[0, 1], [2, 3]]) >>> np.amin(a) # Minimum of the flattened array 0 >>> np.amin(a, axis=0) # Minima along the first axis array([0, 1]) >>> np.amin(a, axis=1) # Minima along the second axis array([0, 2]) >>> b = np.arange(5, dtype=np.float) >>> b[2] = np.NaN >>> np.amin(b) nan >>> np.nanmin(b) 0.0 """ if type(a) is not mu.ndarray: try: amin = a.min except AttributeError: return _methods._amin(a, axis=axis, out=out, keepdims=keepdims) # NOTE: Dropping the keepdims parameter return amin(axis=axis, out=out) else: return _methods._amin(a, axis=axis, out=out, keepdims=keepdims) def alen(a): """ Return the length of the first dimension of the input array. Parameters ---------- a : array_like Input array. Returns ------- alen : int Length of the first dimension of `a`. See Also -------- shape, size Examples -------- >>> a = np.zeros((7,4,5)) >>> a.shape[0] 7 >>> np.alen(a) 7 """ try: return len(a) except TypeError: return len(array(a, ndmin=1)) def prod(a, axis=None, dtype=None, out=None, keepdims=False): """ Return the product of array elements over a given axis. Parameters ---------- a : array_like Input data. axis : None or int or tuple of ints, optional Axis or axes along which a product is performed. The default (`axis` = `None`) is perform a product over all the dimensions of the input array. `axis` may be negative, in which case it counts from the last to the first axis. .. versionadded:: 1.7.0 If this is a tuple of ints, a product is performed on multiple axes, instead of a single axis or all the axes as before. dtype : data-type, optional The data-type of the returned array, as well as of the accumulator in which the elements are multiplied. By default, if `a` is of integer type, `dtype` is the default platform integer. (Note: if the type of `a` is unsigned, then so is `dtype`.) Otherwise, the dtype is the same as that of `a`. out : ndarray, optional Alternative output array in which to place the result. It must have the same shape as the expected output, but the type of the output values will be cast if necessary. keepdims : bool, optional If this is set to True, the axes which are reduced are left in the result as dimensions with size one. With this option, the result will broadcast correctly against the original `arr`. Returns ------- product_along_axis : ndarray, see `dtype` parameter above. An array shaped as `a` but with the specified axis removed. Returns a reference to `out` if specified. See Also -------- ndarray.prod : equivalent method numpy.doc.ufuncs : Section "Output arguments" Notes ----- Arithmetic is modular when using integer types, and no error is raised on overflow. That means that, on a 32-bit platform: >>> x = np.array([536870910, 536870910, 536870910, 536870910]) >>> np.prod(x) #random 16 The product of an empty array is the neutral element 1: >>> np.prod([]) 1.0 Examples -------- By default, calculate the product of all elements: >>> np.prod([1.,2.]) 2.0 Even when the input array is two-dimensional: >>> np.prod([[1.,2.],[3.,4.]]) 24.0 But we can also specify the axis over which to multiply: >>> np.prod([[1.,2.],[3.,4.]], axis=1) array([ 2., 12.]) If the type of `x` is unsigned, then the output type is the unsigned platform integer: >>> x = np.array([1, 2, 3], dtype=np.uint8) >>> np.prod(x).dtype == np.uint True If `x` is of a signed integer type, then the output type is the default platform integer: >>> x = np.array([1, 2, 3], dtype=np.int8) >>> np.prod(x).dtype == np.int True """ if type(a) is not mu.ndarray: try: prod = a.prod except AttributeError: return _methods._prod(a, axis=axis, dtype=dtype, out=out, keepdims=keepdims) return prod(axis=axis, dtype=dtype, out=out) else: return _methods._prod(a, axis=axis, dtype=dtype, out=out, keepdims=keepdims) def cumprod(a, axis=None, dtype=None, out=None): """ Return the cumulative product of elements along a given axis. Parameters ---------- a : array_like Input array. axis : int, optional Axis along which the cumulative product is computed. By default the input is flattened. dtype : dtype, optional Type of the returned array, as well as of the accumulator in which the elements are multiplied. If *dtype* is not specified, it defaults to the dtype of `a`, unless `a` has an integer dtype with a precision less than that of the default platform integer. In that case, the default platform integer is used instead. out : ndarray, optional Alternative output array in which to place the result. It must have the same shape and buffer length as the expected output but the type of the resulting values will be cast if necessary. Returns ------- cumprod : ndarray A new array holding the result is returned unless `out` is specified, in which case a reference to out is returned. See Also -------- numpy.doc.ufuncs : Section "Output arguments" Notes ----- Arithmetic is modular when using integer types, and no error is raised on overflow. Examples -------- >>> a = np.array([1,2,3]) >>> np.cumprod(a) # intermediate results 1, 1*2 ... # total product 1*2*3 = 6 array([1, 2, 6]) >>> a = np.array([[1, 2, 3], [4, 5, 6]]) >>> np.cumprod(a, dtype=float) # specify type of output array([ 1., 2., 6., 24., 120., 720.]) The cumulative product for each column (i.e., over the rows) of `a`: >>> np.cumprod(a, axis=0) array([[ 1, 2, 3], [ 4, 10, 18]]) The cumulative product for each row (i.e. over the columns) of `a`: >>> np.cumprod(a,axis=1) array([[ 1, 2, 6], [ 4, 20, 120]]) """ try: cumprod = a.cumprod except AttributeError: return _wrapit(a, 'cumprod', axis, dtype, out) return cumprod(axis, dtype, out) def ndim(a): """ Return the number of dimensions of an array. Parameters ---------- a : array_like Input array. If it is not already an ndarray, a conversion is attempted. Returns ------- number_of_dimensions : int The number of dimensions in `a`. Scalars are zero-dimensional. See Also -------- ndarray.ndim : equivalent method shape : dimensions of array ndarray.shape : dimensions of array Examples -------- >>> np.ndim([[1,2,3],[4,5,6]]) 2 >>> np.ndim(np.array([[1,2,3],[4,5,6]])) 2 >>> np.ndim(1) 0 """ try: return a.ndim except AttributeError: return asarray(a).ndim def rank(a): """ Return the number of dimensions of an array. If `a` is not already an array, a conversion is attempted. Scalars are zero dimensional. .. note:: This function is deprecated in NumPy 1.9 to avoid confusion with `numpy.linalg.matrix_rank`. The ``ndim`` attribute or function should be used instead. Parameters ---------- a : array_like Array whose number of dimensions is desired. If `a` is not an array, a conversion is attempted. Returns ------- number_of_dimensions : int The number of dimensions in the array. See Also -------- ndim : equivalent function ndarray.ndim : equivalent property shape : dimensions of array ndarray.shape : dimensions of array Notes ----- In the old Numeric package, `rank` was the term used for the number of dimensions, but in Numpy `ndim` is used instead. Examples -------- >>> np.rank([1,2,3]) 1 >>> np.rank(np.array([[1,2,3],[4,5,6]])) 2 >>> np.rank(1) 0 """ # 2014-04-12, 1.9 warnings.warn( "`rank` is deprecated; use the `ndim` attribute or function instead. " "To find the rank of a matrix see `numpy.linalg.matrix_rank`.", VisibleDeprecationWarning) try: return a.ndim except AttributeError: return asarray(a).ndim def size(a, axis=None): """ Return the number of elements along a given axis. Parameters ---------- a : array_like Input data. axis : int, optional Axis along which the elements are counted. By default, give the total number of elements. Returns ------- element_count : int Number of elements along the specified axis. See Also -------- shape : dimensions of array ndarray.shape : dimensions of array ndarray.size : number of elements in array Examples -------- >>> a = np.array([[1,2,3],[4,5,6]]) >>> np.size(a) 6 >>> np.size(a,1) 3 >>> np.size(a,0) 2 """ if axis is None: try: return a.size except AttributeError: return asarray(a).size else: try: return a.shape[axis] except AttributeError: return asarray(a).shape[axis] def around(a, decimals=0, out=None): """ Evenly round to the given number of decimals. Parameters ---------- a : array_like Input data. decimals : int, optional Number of decimal places to round to (default: 0). If decimals is negative, it specifies the number of positions to the left of the decimal point. out : ndarray, optional Alternative output array in which to place the result. It must have the same shape as the expected output, but the type of the output values will be cast if necessary. See `doc.ufuncs` (Section "Output arguments") for details. Returns ------- rounded_array : ndarray An array of the same type as `a`, containing the rounded values. Unless `out` was specified, a new array is created. A reference to the result is returned. The real and imaginary parts of complex numbers are rounded separately. The result of rounding a float is a float. See Also -------- ndarray.round : equivalent method ceil, fix, floor, rint, trunc Notes ----- For values exactly halfway between rounded decimal values, Numpy rounds to the nearest even value. Thus 1.5 and 2.5 round to 2.0, -0.5 and 0.5 round to 0.0, etc. Results may also be surprising due to the inexact representation of decimal fractions in the IEEE floating point standard [1]_ and errors introduced when scaling by powers of ten. References ---------- .. [1] "Lecture Notes on the Status of IEEE 754", William Kahan, http://www.cs.berkeley.edu/~wkahan/ieee754status/IEEE754.PDF .. [2] "How Futile are Mindless Assessments of Roundoff in Floating-Point Computation?", William Kahan, http://www.cs.berkeley.edu/~wkahan/Mindless.pdf Examples -------- >>> np.around([0.37, 1.64]) array([ 0., 2.]) >>> np.around([0.37, 1.64], decimals=1) array([ 0.4, 1.6]) >>> np.around([.5, 1.5, 2.5, 3.5, 4.5]) # rounds to nearest even value array([ 0., 2., 2., 4., 4.]) >>> np.around([1,2,3,11], decimals=1) # ndarray of ints is returned array([ 1, 2, 3, 11]) >>> np.around([1,2,3,11], decimals=-1) array([ 0, 0, 0, 10]) """ try: round = a.round except AttributeError: return _wrapit(a, 'round', decimals, out) return round(decimals, out) def round_(a, decimals=0, out=None): """ Round an array to the given number of decimals. Refer to `around` for full documentation. See Also -------- around : equivalent function """ try: round = a.round except AttributeError: return _wrapit(a, 'round', decimals, out) return round(decimals, out) def mean(a, axis=None, dtype=None, out=None, keepdims=False): """ Compute the arithmetic mean along the specified axis. Returns the average of the array elements. The average is taken over the flattened array by default, otherwise over the specified axis. `float64` intermediate and return values are used for integer inputs. Parameters ---------- a : array_like Array containing numbers whose mean is desired. If `a` is not an array, a conversion is attempted. axis : None or int or tuple of ints, optional Axis or axes along which the means are computed. The default is to compute the mean of the flattened array. .. versionadded: 1.7.0 If this is a tuple of ints, a mean is performed over multiple axes, instead of a single axis or all the axes as before. dtype : data-type, optional Type to use in computing the mean. For integer inputs, the default is `float64`; for floating point inputs, it is the same as the input dtype. out : ndarray, optional Alternate output array in which to place the result. The default is ``None``; if provided, it must have the same shape as the expected output, but the type will be cast if necessary. See `doc.ufuncs` for details. keepdims : bool, optional If this is set to True, the axes which are reduced are left in the result as dimensions with size one. With this option, the result will broadcast correctly against the original `arr`. Returns ------- m : ndarray, see dtype parameter above If `out=None`, returns a new array containing the mean values, otherwise a reference to the output array is returned. See Also -------- average : Weighted average std, var, nanmean, nanstd, nanvar Notes ----- The arithmetic mean is the sum of the elements along the axis divided by the number of elements. Note that for floating-point input, the mean is computed using the same precision the input has. Depending on the input data, this can cause the results to be inaccurate, especially for `float32` (see example below). Specifying a higher-precision accumulator using the `dtype` keyword can alleviate this issue. Examples -------- >>> a = np.array([[1, 2], [3, 4]]) >>> np.mean(a) 2.5 >>> np.mean(a, axis=0) array([ 2., 3.]) >>> np.mean(a, axis=1) array([ 1.5, 3.5]) In single precision, `mean` can be inaccurate: >>> a = np.zeros((2, 512*512), dtype=np.float32) >>> a[0, :] = 1.0 >>> a[1, :] = 0.1 >>> np.mean(a) 0.546875 Computing the mean in float64 is more accurate: >>> np.mean(a, dtype=np.float64) 0.55000000074505806 """ if type(a) is not mu.ndarray: try: mean = a.mean return mean(axis=axis, dtype=dtype, out=out) except AttributeError: pass return _methods._mean(a, axis=axis, dtype=dtype, out=out, keepdims=keepdims) def std(a, axis=None, dtype=None, out=None, ddof=0, keepdims=False): """ Compute the standard deviation along the specified axis. Returns the standard deviation, a measure of the spread of a distribution, of the array elements. The standard deviation is computed for the flattened array by default, otherwise over the specified axis. Parameters ---------- a : array_like Calculate the standard deviation of these values. axis : None or int or tuple of ints, optional Axis or axes along which the standard deviation is computed. The default is to compute the standard deviation of the flattened array. .. versionadded: 1.7.0 If this is a tuple of ints, a standard deviation is performed over multiple axes, instead of a single axis or all the axes as before. dtype : dtype, optional Type to use in computing the standard deviation. For arrays of integer type the default is float64, for arrays of float types it is the same as the array type. out : ndarray, optional Alternative output array in which to place the result. It must have the same shape as the expected output but the type (of the calculated values) will be cast if necessary. ddof : int, optional Means Delta Degrees of Freedom. The divisor used in calculations is ``N - ddof``, where ``N`` represents the number of elements. By default `ddof` is zero. keepdims : bool, optional If this is set to True, the axes which are reduced are left in the result as dimensions with size one. With this option, the result will broadcast correctly against the original `arr`. Returns ------- standard_deviation : ndarray, see dtype parameter above. If `out` is None, return a new array containing the standard deviation, otherwise return a reference to the output array. See Also -------- var, mean, nanmean, nanstd, nanvar numpy.doc.ufuncs : Section "Output arguments" Notes ----- The standard deviation is the square root of the average of the squared deviations from the mean, i.e., ``std = sqrt(mean(abs(x - x.mean())**2))``. The average squared deviation is normally calculated as ``x.sum() / N``, where ``N = len(x)``. If, however, `ddof` is specified, the divisor ``N - ddof`` is used instead. In standard statistical practice, ``ddof=1`` provides an unbiased estimator of the variance of the infinite population. ``ddof=0`` provides a maximum likelihood estimate of the variance for normally distributed variables. The standard deviation computed in this function is the square root of the estimated variance, so even with ``ddof=1``, it will not be an unbiased estimate of the standard deviation per se. Note that, for complex numbers, `std` takes the absolute value before squaring, so that the result is always real and nonnegative. For floating-point input, the *std* is computed using the same precision the input has. Depending on the input data, this can cause the results to be inaccurate, especially for float32 (see example below). Specifying a higher-accuracy accumulator using the `dtype` keyword can alleviate this issue. Examples -------- >>> a = np.array([[1, 2], [3, 4]]) >>> np.std(a) 1.1180339887498949 >>> np.std(a, axis=0) array([ 1., 1.]) >>> np.std(a, axis=1) array([ 0.5, 0.5]) In single precision, std() can be inaccurate: >>> a = np.zeros((2, 512*512), dtype=np.float32) >>> a[0, :] = 1.0 >>> a[1, :] = 0.1 >>> np.std(a) 0.45000005 Computing the standard deviation in float64 is more accurate: >>> np.std(a, dtype=np.float64) 0.44999999925494177 """ if type(a) is not mu.ndarray: try: std = a.std return std(axis=axis, dtype=dtype, out=out, ddof=ddof) except AttributeError: pass return _methods._std(a, axis=axis, dtype=dtype, out=out, ddof=ddof, keepdims=keepdims) def var(a, axis=None, dtype=None, out=None, ddof=0, keepdims=False): """ Compute the variance along the specified axis. Returns the variance of the array elements, a measure of the spread of a distribution. The variance is computed for the flattened array by default, otherwise over the specified axis. Parameters ---------- a : array_like Array containing numbers whose variance is desired. If `a` is not an array, a conversion is attempted. axis : None or int or tuple of ints, optional Axis or axes along which the variance is computed. The default is to compute the variance of the flattened array. .. versionadded: 1.7.0 If this is a tuple of ints, a variance is performed over multiple axes, instead of a single axis or all the axes as before. dtype : data-type, optional Type to use in computing the variance. For arrays of integer type the default is `float32`; for arrays of float types it is the same as the array type. out : ndarray, optional Alternate output array in which to place the result. It must have the same shape as the expected output, but the type is cast if necessary. ddof : int, optional "Delta Degrees of Freedom": the divisor used in the calculation is ``N - ddof``, where ``N`` represents the number of elements. By default `ddof` is zero. keepdims : bool, optional If this is set to True, the axes which are reduced are left in the result as dimensions with size one. With this option, the result will broadcast correctly against the original `arr`. Returns ------- variance : ndarray, see dtype parameter above If ``out=None``, returns a new array containing the variance; otherwise, a reference to the output array is returned. See Also -------- std , mean, nanmean, nanstd, nanvar numpy.doc.ufuncs : Section "Output arguments" Notes ----- The variance is the average of the squared deviations from the mean, i.e., ``var = mean(abs(x - x.mean())**2)``. The mean is normally calculated as ``x.sum() / N``, where ``N = len(x)``. If, however, `ddof` is specified, the divisor ``N - ddof`` is used instead. In standard statistical practice, ``ddof=1`` provides an unbiased estimator of the variance of a hypothetical infinite population. ``ddof=0`` provides a maximum likelihood estimate of the variance for normally distributed variables. Note that for complex numbers, the absolute value is taken before squaring, so that the result is always real and nonnegative. For floating-point input, the variance is computed using the same precision the input has. Depending on the input data, this can cause the results to be inaccurate, especially for `float32` (see example below). Specifying a higher-accuracy accumulator using the ``dtype`` keyword can alleviate this issue. Examples -------- >>> a = np.array([[1, 2], [3, 4]]) >>> np.var(a) 1.25 >>> np.var(a, axis=0) array([ 1., 1.]) >>> np.var(a, axis=1) array([ 0.25, 0.25]) In single precision, var() can be inaccurate: >>> a = np.zeros((2, 512*512), dtype=np.float32) >>> a[0, :] = 1.0 >>> a[1, :] = 0.1 >>> np.var(a) 0.20250003 Computing the variance in float64 is more accurate: >>> np.var(a, dtype=np.float64) 0.20249999932944759 >>> ((1-0.55)**2 + (0.1-0.55)**2)/2 0.2025 """ if type(a) is not mu.ndarray: try: var = a.var return var(axis=axis, dtype=dtype, out=out, ddof=ddof) except AttributeError: pass return _methods._var(a, axis=axis, dtype=dtype, out=out, ddof=ddof, keepdims=keepdims)
apache-2.0
JulienMcJay/eclock
windows/Python27/Lib/encodings/iso8859_14.py
593
13908
""" Python Character Mapping Codec iso8859_14 generated from 'MAPPINGS/ISO8859/8859-14.TXT' with gencodec.py. """#" import codecs ### Codec APIs class Codec(codecs.Codec): def encode(self,input,errors='strict'): return codecs.charmap_encode(input,errors,encoding_table) def decode(self,input,errors='strict'): return codecs.charmap_decode(input,errors,decoding_table) class IncrementalEncoder(codecs.IncrementalEncoder): def encode(self, input, final=False): return codecs.charmap_encode(input,self.errors,encoding_table)[0] class IncrementalDecoder(codecs.IncrementalDecoder): def decode(self, input, final=False): return codecs.charmap_decode(input,self.errors,decoding_table)[0] class StreamWriter(Codec,codecs.StreamWriter): pass class StreamReader(Codec,codecs.StreamReader): pass ### encodings module API def getregentry(): return codecs.CodecInfo( name='iso8859-14', encode=Codec().encode, decode=Codec().decode, incrementalencoder=IncrementalEncoder, incrementaldecoder=IncrementalDecoder, streamreader=StreamReader, streamwriter=StreamWriter, ) ### Decoding Table decoding_table = ( u'\x00' # 0x00 -> NULL u'\x01' # 0x01 -> START OF HEADING u'\x02' # 0x02 -> START OF TEXT u'\x03' # 0x03 -> END OF TEXT u'\x04' # 0x04 -> END OF TRANSMISSION u'\x05' # 0x05 -> ENQUIRY u'\x06' # 0x06 -> ACKNOWLEDGE u'\x07' # 0x07 -> BELL u'\x08' # 0x08 -> BACKSPACE u'\t' # 0x09 -> HORIZONTAL TABULATION u'\n' # 0x0A -> LINE FEED u'\x0b' # 0x0B -> VERTICAL TABULATION u'\x0c' # 0x0C -> FORM FEED u'\r' # 0x0D -> CARRIAGE RETURN u'\x0e' # 0x0E -> SHIFT OUT u'\x0f' # 0x0F -> SHIFT IN u'\x10' # 0x10 -> DATA LINK ESCAPE u'\x11' # 0x11 -> DEVICE CONTROL ONE u'\x12' # 0x12 -> DEVICE CONTROL TWO u'\x13' # 0x13 -> DEVICE CONTROL THREE u'\x14' # 0x14 -> DEVICE CONTROL FOUR u'\x15' # 0x15 -> NEGATIVE ACKNOWLEDGE u'\x16' # 0x16 -> SYNCHRONOUS IDLE u'\x17' # 0x17 -> END OF TRANSMISSION BLOCK u'\x18' # 0x18 -> CANCEL u'\x19' # 0x19 -> END OF MEDIUM u'\x1a' # 0x1A -> SUBSTITUTE u'\x1b' # 0x1B -> ESCAPE u'\x1c' # 0x1C -> FILE SEPARATOR u'\x1d' # 0x1D -> GROUP SEPARATOR u'\x1e' # 0x1E -> RECORD SEPARATOR u'\x1f' # 0x1F -> UNIT SEPARATOR u' ' # 0x20 -> SPACE u'!' # 0x21 -> EXCLAMATION MARK u'"' # 0x22 -> QUOTATION MARK u'#' # 0x23 -> NUMBER SIGN u'$' # 0x24 -> DOLLAR SIGN u'%' # 0x25 -> PERCENT SIGN u'&' # 0x26 -> AMPERSAND u"'" # 0x27 -> APOSTROPHE u'(' # 0x28 -> LEFT PARENTHESIS u')' # 0x29 -> RIGHT PARENTHESIS u'*' # 0x2A -> ASTERISK u'+' # 0x2B -> PLUS SIGN u',' # 0x2C -> COMMA u'-' # 0x2D -> HYPHEN-MINUS u'.' # 0x2E -> FULL STOP u'/' # 0x2F -> SOLIDUS u'0' # 0x30 -> DIGIT ZERO u'1' # 0x31 -> DIGIT ONE u'2' # 0x32 -> DIGIT TWO u'3' # 0x33 -> DIGIT THREE u'4' # 0x34 -> DIGIT FOUR u'5' # 0x35 -> DIGIT FIVE u'6' # 0x36 -> DIGIT SIX u'7' # 0x37 -> DIGIT SEVEN u'8' # 0x38 -> DIGIT EIGHT u'9' # 0x39 -> DIGIT NINE u':' # 0x3A -> COLON u';' # 0x3B -> SEMICOLON u'<' # 0x3C -> LESS-THAN SIGN u'=' # 0x3D -> EQUALS SIGN u'>' # 0x3E -> GREATER-THAN SIGN u'?' # 0x3F -> QUESTION MARK u'@' # 0x40 -> COMMERCIAL AT u'A' # 0x41 -> LATIN CAPITAL LETTER A u'B' # 0x42 -> LATIN CAPITAL LETTER B u'C' # 0x43 -> LATIN CAPITAL LETTER C u'D' # 0x44 -> LATIN CAPITAL LETTER D u'E' # 0x45 -> LATIN CAPITAL LETTER E u'F' # 0x46 -> LATIN CAPITAL LETTER F u'G' # 0x47 -> LATIN CAPITAL LETTER G u'H' # 0x48 -> LATIN CAPITAL LETTER H u'I' # 0x49 -> LATIN CAPITAL LETTER I u'J' # 0x4A -> LATIN CAPITAL LETTER J u'K' # 0x4B -> LATIN CAPITAL LETTER K u'L' # 0x4C -> LATIN CAPITAL LETTER L u'M' # 0x4D -> LATIN CAPITAL LETTER M u'N' # 0x4E -> LATIN CAPITAL LETTER N u'O' # 0x4F -> LATIN CAPITAL LETTER O u'P' # 0x50 -> LATIN CAPITAL LETTER P u'Q' # 0x51 -> LATIN CAPITAL LETTER Q u'R' # 0x52 -> LATIN CAPITAL LETTER R u'S' # 0x53 -> LATIN CAPITAL LETTER S u'T' # 0x54 -> LATIN CAPITAL LETTER T u'U' # 0x55 -> LATIN CAPITAL LETTER U u'V' # 0x56 -> LATIN CAPITAL LETTER V u'W' # 0x57 -> LATIN CAPITAL LETTER W u'X' # 0x58 -> LATIN CAPITAL LETTER X u'Y' # 0x59 -> LATIN CAPITAL LETTER Y u'Z' # 0x5A -> LATIN CAPITAL LETTER Z u'[' # 0x5B -> LEFT SQUARE BRACKET u'\\' # 0x5C -> REVERSE SOLIDUS u']' # 0x5D -> RIGHT SQUARE BRACKET u'^' # 0x5E -> CIRCUMFLEX ACCENT u'_' # 0x5F -> LOW LINE u'`' # 0x60 -> GRAVE ACCENT u'a' # 0x61 -> LATIN SMALL LETTER A u'b' # 0x62 -> LATIN SMALL LETTER B u'c' # 0x63 -> LATIN SMALL LETTER C u'd' # 0x64 -> LATIN SMALL LETTER D u'e' # 0x65 -> LATIN SMALL LETTER E u'f' # 0x66 -> LATIN SMALL LETTER F u'g' # 0x67 -> LATIN SMALL LETTER G u'h' # 0x68 -> LATIN SMALL LETTER H u'i' # 0x69 -> LATIN SMALL LETTER I u'j' # 0x6A -> LATIN SMALL LETTER J u'k' # 0x6B -> LATIN SMALL LETTER K u'l' # 0x6C -> LATIN SMALL LETTER L u'm' # 0x6D -> LATIN SMALL LETTER M u'n' # 0x6E -> LATIN SMALL LETTER N u'o' # 0x6F -> LATIN SMALL LETTER O u'p' # 0x70 -> LATIN SMALL LETTER P u'q' # 0x71 -> LATIN SMALL LETTER Q u'r' # 0x72 -> LATIN SMALL LETTER R u's' # 0x73 -> LATIN SMALL LETTER S u't' # 0x74 -> LATIN SMALL LETTER T u'u' # 0x75 -> LATIN SMALL LETTER U u'v' # 0x76 -> LATIN SMALL LETTER V u'w' # 0x77 -> LATIN SMALL LETTER W u'x' # 0x78 -> LATIN SMALL LETTER X u'y' # 0x79 -> LATIN SMALL LETTER Y u'z' # 0x7A -> LATIN SMALL LETTER Z u'{' # 0x7B -> LEFT CURLY BRACKET u'|' # 0x7C -> VERTICAL LINE u'}' # 0x7D -> RIGHT CURLY BRACKET u'~' # 0x7E -> TILDE u'\x7f' # 0x7F -> DELETE u'\x80' # 0x80 -> <control> u'\x81' # 0x81 -> <control> u'\x82' # 0x82 -> <control> u'\x83' # 0x83 -> <control> u'\x84' # 0x84 -> <control> u'\x85' # 0x85 -> <control> u'\x86' # 0x86 -> <control> u'\x87' # 0x87 -> <control> u'\x88' # 0x88 -> <control> u'\x89' # 0x89 -> <control> u'\x8a' # 0x8A -> <control> u'\x8b' # 0x8B -> <control> u'\x8c' # 0x8C -> <control> u'\x8d' # 0x8D -> <control> u'\x8e' # 0x8E -> <control> u'\x8f' # 0x8F -> <control> u'\x90' # 0x90 -> <control> u'\x91' # 0x91 -> <control> u'\x92' # 0x92 -> <control> u'\x93' # 0x93 -> <control> u'\x94' # 0x94 -> <control> u'\x95' # 0x95 -> <control> u'\x96' # 0x96 -> <control> u'\x97' # 0x97 -> <control> u'\x98' # 0x98 -> <control> u'\x99' # 0x99 -> <control> u'\x9a' # 0x9A -> <control> u'\x9b' # 0x9B -> <control> u'\x9c' # 0x9C -> <control> u'\x9d' # 0x9D -> <control> u'\x9e' # 0x9E -> <control> u'\x9f' # 0x9F -> <control> u'\xa0' # 0xA0 -> NO-BREAK SPACE u'\u1e02' # 0xA1 -> LATIN CAPITAL LETTER B WITH DOT ABOVE u'\u1e03' # 0xA2 -> LATIN SMALL LETTER B WITH DOT ABOVE u'\xa3' # 0xA3 -> POUND SIGN u'\u010a' # 0xA4 -> LATIN CAPITAL LETTER C WITH DOT ABOVE u'\u010b' # 0xA5 -> LATIN SMALL LETTER C WITH DOT ABOVE u'\u1e0a' # 0xA6 -> LATIN CAPITAL LETTER D WITH DOT ABOVE u'\xa7' # 0xA7 -> SECTION SIGN u'\u1e80' # 0xA8 -> LATIN CAPITAL LETTER W WITH GRAVE u'\xa9' # 0xA9 -> COPYRIGHT SIGN u'\u1e82' # 0xAA -> LATIN CAPITAL LETTER W WITH ACUTE u'\u1e0b' # 0xAB -> LATIN SMALL LETTER D WITH DOT ABOVE u'\u1ef2' # 0xAC -> LATIN CAPITAL LETTER Y WITH GRAVE u'\xad' # 0xAD -> SOFT HYPHEN u'\xae' # 0xAE -> REGISTERED SIGN u'\u0178' # 0xAF -> LATIN CAPITAL LETTER Y WITH DIAERESIS u'\u1e1e' # 0xB0 -> LATIN CAPITAL LETTER F WITH DOT ABOVE u'\u1e1f' # 0xB1 -> LATIN SMALL LETTER F WITH DOT ABOVE u'\u0120' # 0xB2 -> LATIN CAPITAL LETTER G WITH DOT ABOVE u'\u0121' # 0xB3 -> LATIN SMALL LETTER G WITH DOT ABOVE u'\u1e40' # 0xB4 -> LATIN CAPITAL LETTER M WITH DOT ABOVE u'\u1e41' # 0xB5 -> LATIN SMALL LETTER M WITH DOT ABOVE u'\xb6' # 0xB6 -> PILCROW SIGN u'\u1e56' # 0xB7 -> LATIN CAPITAL LETTER P WITH DOT ABOVE u'\u1e81' # 0xB8 -> LATIN SMALL LETTER W WITH GRAVE u'\u1e57' # 0xB9 -> LATIN SMALL LETTER P WITH DOT ABOVE u'\u1e83' # 0xBA -> LATIN SMALL LETTER W WITH ACUTE u'\u1e60' # 0xBB -> LATIN CAPITAL LETTER S WITH DOT ABOVE u'\u1ef3' # 0xBC -> LATIN SMALL LETTER Y WITH GRAVE u'\u1e84' # 0xBD -> LATIN CAPITAL LETTER W WITH DIAERESIS u'\u1e85' # 0xBE -> LATIN SMALL LETTER W WITH DIAERESIS u'\u1e61' # 0xBF -> LATIN SMALL LETTER S WITH DOT ABOVE u'\xc0' # 0xC0 -> LATIN CAPITAL LETTER A WITH GRAVE u'\xc1' # 0xC1 -> LATIN CAPITAL LETTER A WITH ACUTE u'\xc2' # 0xC2 -> LATIN CAPITAL LETTER A WITH CIRCUMFLEX u'\xc3' # 0xC3 -> LATIN CAPITAL LETTER A WITH TILDE u'\xc4' # 0xC4 -> LATIN CAPITAL LETTER A WITH DIAERESIS u'\xc5' # 0xC5 -> LATIN CAPITAL LETTER A WITH RING ABOVE u'\xc6' # 0xC6 -> LATIN CAPITAL LETTER AE u'\xc7' # 0xC7 -> LATIN CAPITAL LETTER C WITH CEDILLA u'\xc8' # 0xC8 -> LATIN CAPITAL LETTER E WITH GRAVE u'\xc9' # 0xC9 -> LATIN CAPITAL LETTER E WITH ACUTE u'\xca' # 0xCA -> LATIN CAPITAL LETTER E WITH CIRCUMFLEX u'\xcb' # 0xCB -> LATIN CAPITAL LETTER E WITH DIAERESIS u'\xcc' # 0xCC -> LATIN CAPITAL LETTER I WITH GRAVE u'\xcd' # 0xCD -> LATIN CAPITAL LETTER I WITH ACUTE u'\xce' # 0xCE -> LATIN CAPITAL LETTER I WITH CIRCUMFLEX u'\xcf' # 0xCF -> LATIN CAPITAL LETTER I WITH DIAERESIS u'\u0174' # 0xD0 -> LATIN CAPITAL LETTER W WITH CIRCUMFLEX u'\xd1' # 0xD1 -> LATIN CAPITAL LETTER N WITH TILDE u'\xd2' # 0xD2 -> LATIN CAPITAL LETTER O WITH GRAVE u'\xd3' # 0xD3 -> LATIN CAPITAL LETTER O WITH ACUTE u'\xd4' # 0xD4 -> LATIN CAPITAL LETTER O WITH CIRCUMFLEX u'\xd5' # 0xD5 -> LATIN CAPITAL LETTER O WITH TILDE u'\xd6' # 0xD6 -> LATIN CAPITAL LETTER O WITH DIAERESIS u'\u1e6a' # 0xD7 -> LATIN CAPITAL LETTER T WITH DOT ABOVE u'\xd8' # 0xD8 -> LATIN CAPITAL LETTER O WITH STROKE u'\xd9' # 0xD9 -> LATIN CAPITAL LETTER U WITH GRAVE u'\xda' # 0xDA -> LATIN CAPITAL LETTER U WITH ACUTE u'\xdb' # 0xDB -> LATIN CAPITAL LETTER U WITH CIRCUMFLEX u'\xdc' # 0xDC -> LATIN CAPITAL LETTER U WITH DIAERESIS u'\xdd' # 0xDD -> LATIN CAPITAL LETTER Y WITH ACUTE u'\u0176' # 0xDE -> LATIN CAPITAL LETTER Y WITH CIRCUMFLEX u'\xdf' # 0xDF -> LATIN SMALL LETTER SHARP S u'\xe0' # 0xE0 -> LATIN SMALL LETTER A WITH GRAVE u'\xe1' # 0xE1 -> LATIN SMALL LETTER A WITH ACUTE u'\xe2' # 0xE2 -> LATIN SMALL LETTER A WITH CIRCUMFLEX u'\xe3' # 0xE3 -> LATIN SMALL LETTER A WITH TILDE u'\xe4' # 0xE4 -> LATIN SMALL LETTER A WITH DIAERESIS u'\xe5' # 0xE5 -> LATIN SMALL LETTER A WITH RING ABOVE u'\xe6' # 0xE6 -> LATIN SMALL LETTER AE u'\xe7' # 0xE7 -> LATIN SMALL LETTER C WITH CEDILLA u'\xe8' # 0xE8 -> LATIN SMALL LETTER E WITH GRAVE u'\xe9' # 0xE9 -> LATIN SMALL LETTER E WITH ACUTE u'\xea' # 0xEA -> LATIN SMALL LETTER E WITH CIRCUMFLEX u'\xeb' # 0xEB -> LATIN SMALL LETTER E WITH DIAERESIS u'\xec' # 0xEC -> LATIN SMALL LETTER I WITH GRAVE u'\xed' # 0xED -> LATIN SMALL LETTER I WITH ACUTE u'\xee' # 0xEE -> LATIN SMALL LETTER I WITH CIRCUMFLEX u'\xef' # 0xEF -> LATIN SMALL LETTER I WITH DIAERESIS u'\u0175' # 0xF0 -> LATIN SMALL LETTER W WITH CIRCUMFLEX u'\xf1' # 0xF1 -> LATIN SMALL LETTER N WITH TILDE u'\xf2' # 0xF2 -> LATIN SMALL LETTER O WITH GRAVE u'\xf3' # 0xF3 -> LATIN SMALL LETTER O WITH ACUTE u'\xf4' # 0xF4 -> LATIN SMALL LETTER O WITH CIRCUMFLEX u'\xf5' # 0xF5 -> LATIN SMALL LETTER O WITH TILDE u'\xf6' # 0xF6 -> LATIN SMALL LETTER O WITH DIAERESIS u'\u1e6b' # 0xF7 -> LATIN SMALL LETTER T WITH DOT ABOVE u'\xf8' # 0xF8 -> LATIN SMALL LETTER O WITH STROKE u'\xf9' # 0xF9 -> LATIN SMALL LETTER U WITH GRAVE u'\xfa' # 0xFA -> LATIN SMALL LETTER U WITH ACUTE u'\xfb' # 0xFB -> LATIN SMALL LETTER U WITH CIRCUMFLEX u'\xfc' # 0xFC -> LATIN SMALL LETTER U WITH DIAERESIS u'\xfd' # 0xFD -> LATIN SMALL LETTER Y WITH ACUTE u'\u0177' # 0xFE -> LATIN SMALL LETTER Y WITH CIRCUMFLEX u'\xff' # 0xFF -> LATIN SMALL LETTER Y WITH DIAERESIS ) ### Encoding table encoding_table=codecs.charmap_build(decoding_table)
gpl-2.0
tensorflow/tensorboard
tensorboard/compat/proto/proto_test.py
1
6863
# Copyright 2017 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Proto match tests between `tensorboard.compat.proto` and TensorFlow. These tests verify that the local copy of TensorFlow protos are the same as those available directly from TensorFlow. Local protos are used to build `tensorboard-notf` without a TensorFlow dependency. """ import difflib import importlib import tensorflow as tf from google.protobuf import descriptor_pb2 # Keep this list synced with BUILD in current directory PROTO_IMPORTS = [ ( "tensorflow.core.framework.allocation_description_pb2", "tensorboard.compat.proto.allocation_description_pb2", ), ( "tensorflow.core.framework.api_def_pb2", "tensorboard.compat.proto.api_def_pb2", ), ( "tensorflow.core.framework.attr_value_pb2", "tensorboard.compat.proto.attr_value_pb2", ), ( "tensorflow.core.protobuf.cluster_pb2", "tensorboard.compat.proto.cluster_pb2", ), ( "tensorflow.core.protobuf.config_pb2", "tensorboard.compat.proto.config_pb2", ), ( "tensorflow.core.framework.cost_graph_pb2", "tensorboard.compat.proto.cost_graph_pb2", ), ( "tensorflow.python.framework.cpp_shape_inference_pb2", "tensorboard.compat.proto.cpp_shape_inference_pb2", ), ( "tensorflow.core.protobuf.debug_pb2", "tensorboard.compat.proto.debug_pb2", ), ("tensorflow.core.util.event_pb2", "tensorboard.compat.proto.event_pb2"), ( "tensorflow.core.framework.function_pb2", "tensorboard.compat.proto.function_pb2", ), ( "tensorflow.core.framework.graph_pb2", "tensorboard.compat.proto.graph_pb2", ), ( "tensorflow.core.protobuf.meta_graph_pb2", "tensorboard.compat.proto.meta_graph_pb2", ), ( "tensorflow.core.framework.node_def_pb2", "tensorboard.compat.proto.node_def_pb2", ), ( "tensorflow.core.framework.op_def_pb2", "tensorboard.compat.proto.op_def_pb2", ), ( "tensorflow.core.framework.resource_handle_pb2", "tensorboard.compat.proto.resource_handle_pb2", ), ( "tensorflow.core.protobuf.rewriter_config_pb2", "tensorboard.compat.proto.rewriter_config_pb2", ), ( "tensorflow.core.protobuf.saved_object_graph_pb2", "tensorboard.compat.proto.saved_object_graph_pb2", ), ( "tensorflow.core.protobuf.saver_pb2", "tensorboard.compat.proto.saver_pb2", ), ( "tensorflow.core.framework.step_stats_pb2", "tensorboard.compat.proto.step_stats_pb2", ), ( "tensorflow.core.protobuf.struct_pb2", "tensorboard.compat.proto.struct_pb2", ), ( "tensorflow.core.framework.summary_pb2", "tensorboard.compat.proto.summary_pb2", ), ( "tensorflow.core.framework.tensor_pb2", "tensorboard.compat.proto.tensor_pb2", ), ( "tensorflow.core.framework.tensor_description_pb2", "tensorboard.compat.proto.tensor_description_pb2", ), ( "tensorflow.core.framework.tensor_shape_pb2", "tensorboard.compat.proto.tensor_shape_pb2", ), ( "tensorflow.core.profiler.tfprof_log_pb2", "tensorboard.compat.proto.tfprof_log_pb2", ), ( "tensorflow.core.protobuf.trackable_object_graph_pb2", "tensorboard.compat.proto.trackable_object_graph_pb2", ), ( "tensorflow.core.framework.types_pb2", "tensorboard.compat.proto.types_pb2", ), ( "tensorflow.core.framework.variable_pb2", "tensorboard.compat.proto.variable_pb2", ), ( "tensorflow.core.framework.versions_pb2", "tensorboard.compat.proto.versions_pb2", ), ] PROTO_REPLACEMENTS = [ ("tensorflow/core/framework/", "tensorboard/compat/proto/"), ("tensorflow/core/protobuf/", "tensorboard/compat/proto/"), ("tensorflow/core/profiler/", "tensorboard/compat/proto/"), ("tensorflow/python/framework/", "tensorboard/compat/proto/"), ("tensorflow/core/util/", "tensorboard/compat/proto/"), ('package: "tensorflow.tfprof"', 'package: "tensorboard"'), ('package: "tensorflow"', 'package: "tensorboard"'), ('type_name: ".tensorflow.tfprof', 'type_name: ".tensorboard'), ('type_name: ".tensorflow', 'type_name: ".tensorboard'), ] MATCH_FAIL_MESSAGE_TEMPLATE = """ {} NOTE! ==== This is expected to happen when TensorFlow updates their proto definitions. We pin copies of the protos, but TensorFlow can freely update them at any time. The proper fix is: 1. In your TensorFlow clone, check out the version of TensorFlow whose protos you want to update (e.g., `git checkout v2.2.0-rc0`) 2. In your tensorboard repo, run: ./tensorboard/compat/proto/update.sh PATH_TO_TENSORFLOW_REPO 3. Review and commit any changes. """ class ProtoMatchTest(tf.test.TestCase): def test_each_proto_matches_tensorflow(self): failed_diffs = [] for tf_path, tb_path in PROTO_IMPORTS: tf_pb2 = importlib.import_module(tf_path) tb_pb2 = importlib.import_module(tb_path) tf_descriptor = descriptor_pb2.FileDescriptorProto() tb_descriptor = descriptor_pb2.FileDescriptorProto() tf_pb2.DESCRIPTOR.CopyToProto(tf_descriptor) tb_pb2.DESCRIPTOR.CopyToProto(tb_descriptor) # Convert expected to be actual since this matches the # replacements done in proto/update.sh tb_string = str(tb_descriptor) tf_string = str(tf_descriptor) for orig, repl in PROTO_REPLACEMENTS: tf_string = tf_string.replace(orig, repl) diff = difflib.unified_diff( tb_string.splitlines(1), tf_string.splitlines(1), fromfile=tb_path, tofile=tf_path, ) diff = "".join(diff) if diff: failed_diffs.append(diff) if failed_diffs: self.fail(MATCH_FAIL_MESSAGE_TEMPLATE.format("".join(failed_diffs))) if __name__ == "__main__": tf.test.main()
apache-2.0
pyjs/pyjs
pyjs/lib_trans/pycompiler/ast.py
6
38017
"""Python abstract syntax node definitions This file is automatically generated by Tools/compiler/astgen.py """ from pycompiler.consts import CO_VARARGS, CO_VARKEYWORDS def flatten(seq): l = [] for elt in seq: t = type(elt) if t is tuple or t is list: for elt2 in flatten(elt): l.append(elt2) else: l.append(elt) return l def flatten_nodes(seq): return [n for n in flatten(seq) if isinstance(n, Node)] nodes = {} class Node(object): """Abstract base class for ast nodes.""" def getChildren(self): pass # implemented by subclasses def __iter__(self): for n in self.getChildren(): yield n def asList(self): # for backwards compatibility return self.getChildren() def getChildNodes(self): pass # implemented by subclasses def _get_lineno(self): return self._lineno def _set_lineno(self, lineno): if lineno is not None and not isinstance(lineno, int): self._context = lineno self._lineno = lineno[1][0] else: self._lineno = lineno self._context = None lineno = property(_get_lineno, _set_lineno) def __str__(self): return repr(self) class EmptyNode(Node): pass class Expression(Node): # Expression is an artificial node class to support "eval" nodes["expression"] = "Expression" def __init__(self, node): Node.__init__(self) self.node = node def getChildren(self): return self.node, def getChildNodes(self): return self.node, def __repr__(self): return "Expression(%s)" % (repr(self.node)) class Add(Node): def __init__(self, left, right, lineno=None): self.left = left self.right = right self.lineno = lineno def getChildren(self): return self.left, self.right def getChildNodes(self): return self.left, self.right def __repr__(self): return "Add(%s, %s)" % (repr(self.left), repr(self.right)) class And(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "And(%s)" % (repr(self.nodes),) class AssAttr(Node): def __init__(self, expr, attrname, flags, lineno=None): self.expr = expr self.attrname = attrname self.flags = flags self.lineno = lineno def getChildren(self): return self.expr, self.attrname, self.flags def getChildNodes(self): return self.expr, def __repr__(self): return "AssAttr(%s, %s, %s)" % (repr(self.expr), repr(self.attrname), repr(self.flags)) class AssList(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "AssList(%s)" % (repr(self.nodes),) class AssName(Node): def __init__(self, name, flags, lineno=None): self.name = name self.flags = flags self.lineno = lineno def getChildren(self): return self.name, self.flags def getChildNodes(self): return () def __repr__(self): return "AssName(%s, %s)" % (repr(self.name), repr(self.flags)) class AssTuple(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "AssTuple(%s)" % (repr(self.nodes),) class Assert(Node): def __init__(self, test, fail, lineno=None): self.test = test self.fail = fail self.lineno = lineno def getChildren(self): children = [] children.append(self.test) children.append(self.fail) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.test) if self.fail is not None: nodelist.append(self.fail) return tuple(nodelist) def __repr__(self): return "Assert(%s, %s)" % (repr(self.test), repr(self.fail)) class Assign(Node): def __init__(self, nodes, expr, lineno=None): self.nodes = nodes self.expr = expr self.lineno = lineno def getChildren(self): children = [] children.extend(flatten(self.nodes)) children.append(self.expr) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) nodelist.append(self.expr) return tuple(nodelist) def __repr__(self): return "Assign(%s, %s)" % (repr(self.nodes), repr(self.expr)) class AugAssign(Node): def __init__(self, node, op, expr, lineno=None): self.node = node self.op = op self.expr = expr self.lineno = lineno def getChildren(self): return self.node, self.op, self.expr def getChildNodes(self): return self.node, self.expr def __repr__(self): return "AugAssign(%s, %s, %s)" % (repr(self.node), repr(self.op), repr(self.expr)) class Backquote(Node): def __init__(self, expr, lineno=None): self.expr = expr self.lineno = lineno def getChildren(self): return self.expr, def getChildNodes(self): return self.expr, def __repr__(self): return "Backquote(%s)" % (repr(self.expr),) class Bitand(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "Bitand(%s)" % (repr(self.nodes),) class Bitor(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "Bitor(%s)" % (repr(self.nodes),) class Bitxor(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "Bitxor(%s)" % (repr(self.nodes),) class Break(Node): def __init__(self, lineno=None): self.lineno = lineno def getChildren(self): return () def getChildNodes(self): return () def __repr__(self): return "Break()" class CallFunc(Node): def __init__(self, node, args, star_args, dstar_args, lineno=None): self.node = node self.args = args self.star_args = star_args self.dstar_args = dstar_args self.lineno = lineno def getChildren(self): children = [] children.append(self.node) children.extend(flatten(self.args)) children.append(self.star_args) children.append(self.dstar_args) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.node) nodelist.extend(flatten_nodes(self.args)) if self.star_args is not None: nodelist.append(self.star_args) if self.dstar_args is not None: nodelist.append(self.dstar_args) return tuple(nodelist) def __repr__(self): return "CallFunc(%s, %s, %s, %s)" % (repr(self.node), repr(self.args), repr(self.star_args), repr(self.dstar_args)) class Class(Node): def __init__(self, name, bases, doc, code, decorators, lineno=None): self.name = name self.bases = bases self.doc = doc self.code = code self.decorators = decorators self.lineno = lineno def getChildren(self): children = [] children.append(self.name) children.extend(flatten(self.bases)) children.append(self.doc) children.append(self.code) children.append(self.decorators) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.bases)) nodelist.append(self.code) if self.decorators is not None: nodelist.append(self.decorators) return tuple(nodelist) def __repr__(self): return "Class(%s, %s, %s, %s, %s)" % (repr(self.name), repr(self.bases), repr(self.doc), repr(self.code), repr(self.decorators)) class Compare(Node): def __init__(self, expr, ops, lineno=None): self.expr = expr self.ops = ops self.lineno = lineno def getChildren(self): children = [] children.append(self.expr) children.extend(flatten(self.ops)) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.expr) nodelist.extend(flatten_nodes(self.ops)) return tuple(nodelist) def __repr__(self): return "Compare(%s, %s)" % (repr(self.expr), repr(self.ops)) class Const(Node): def __init__(self, value, lineno=None): self.value = value self.lineno = lineno def getChildren(self): return self.value, def getChildNodes(self): return () def __repr__(self): return "Const(%s)" % (repr(self.value),) class Continue(Node): def __init__(self, lineno=None): self.lineno = lineno def getChildren(self): return () def getChildNodes(self): return () def __repr__(self): return "Continue()" class Decorators(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "Decorators(%s)" % (repr(self.nodes),) class Dict(Node): def __init__(self, items, lineno=None): self.items = items self.lineno = lineno def getChildren(self): return tuple(flatten(self.items)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.items)) return tuple(nodelist) def __repr__(self): return "Dict(%s)" % (repr(self.items),) class Discard(Node): def __init__(self, expr, lineno=None): self.expr = expr self.lineno = lineno def getChildren(self): return self.expr, def getChildNodes(self): return self.expr, def __repr__(self): return "Discard(%s)" % (repr(self.expr),) class Div(Node): def __init__(self, left, right, lineno=None): self.left = left self.right = right self.lineno = lineno def getChildren(self): return self.left, self.right def getChildNodes(self): return self.left, self.right def __repr__(self): return "Div(%s, %s)" % (repr(self.left), repr(self.right)) class Ellipsis(Node): def __init__(self, lineno=None): self.lineno = lineno def getChildren(self): return () def getChildNodes(self): return () def __repr__(self): return "Ellipsis()" class Exec(Node): def __init__(self, expr, locals, globals, lineno=None): self.expr = expr self.locals = locals self.globals = globals self.lineno = lineno def getChildren(self): children = [] children.append(self.expr) children.append(self.locals) children.append(self.globals) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.expr) if self.locals is not None: nodelist.append(self.locals) if self.globals is not None: nodelist.append(self.globals) return tuple(nodelist) def __repr__(self): return "Exec(%s, %s, %s)" % (repr(self.expr), repr(self.locals), repr(self.globals)) class FloorDiv(Node): def __init__(self, left, right, lineno=None): self.left = left self.right = right self.lineno = lineno def getChildren(self): return self.left, self.right def getChildNodes(self): return self.left, self.right def __repr__(self): return "FloorDiv(%s, %s)" % (repr(self.left), repr(self.right)) class For(Node): def __init__(self, assign, list, body, else_, lineno=None): self.assign = assign self.list = list self.body = body self.else_ = else_ self.lineno = lineno def getChildren(self): children = [] children.append(self.assign) children.append(self.list) children.append(self.body) children.append(self.else_) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.assign) nodelist.append(self.list) nodelist.append(self.body) if self.else_ is not None: nodelist.append(self.else_) return tuple(nodelist) def __repr__(self): return "For(%s, %s, %s, %s)" % (repr(self.assign), repr(self.list), repr(self.body), repr(self.else_)) class From(Node): def __init__(self, modname, names, level, lineno=None): self.modname = modname self.names = names self.level = level self.lineno = lineno def getChildren(self): return self.modname, self.names, self.level def getChildNodes(self): return () def __repr__(self): return "From(%s, %s, %s)" % (repr(self.modname), repr(self.names), repr(self.level)) class Function(Node): def __init__(self, decorators, name, argnames, defaults, varargs, kwargs, doc, code, lineno=None): self.decorators = decorators self.name = name self.argnames = argnames self.defaults = defaults self.varargs = varargs self.kwargs = kwargs self.doc = doc self.code = code self.lineno = lineno def getChildren(self): children = [] children.append(self.decorators) children.append(self.name) children.append(self.argnames) children.extend(flatten(self.defaults)) children.append(self.varargs) children.append(self.kwargs) children.append(self.doc) children.append(self.code) return tuple(children) def getChildNodes(self): nodelist = [] if self.decorators is not None: nodelist.append(self.decorators) nodelist.extend(flatten_nodes(self.defaults)) nodelist.append(self.varargs) nodelist.append(self.kwargs) nodelist.append(self.code) return tuple(nodelist) def __repr__(self): return "Function(%s, %s, %s, %s, %s, %s, %s, %s)" % (repr(self.decorators), repr(self.name), repr(self.argnames), repr(self.defaults), repr(self.varargs), repr(self.kwargs), repr(self.doc), repr(self.code)) _Function = Function class GenExpr(Node): def __init__(self, code, lineno=None): self.code = code self.lineno = lineno self.argnames = ['.0'] self.varargs = self.kwargs = None def getChildren(self): return self.code, def getChildNodes(self): return self.code, def __repr__(self): return "GenExpr(%s)" % (repr(self.code),) class GenExprFor(Node): def __init__(self, assign, iter, ifs, lineno=None): self.assign = assign self.iter = iter self.ifs = ifs self.lineno = lineno self.is_outmost = False def getChildren(self): children = [] children.append(self.assign) children.append(self.iter) children.extend(flatten(self.ifs)) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.assign) nodelist.append(self.iter) nodelist.extend(flatten_nodes(self.ifs)) return tuple(nodelist) def __repr__(self): return "GenExprFor(%s, %s, %s)" % (repr(self.assign), repr(self.iter), repr(self.ifs)) class GenExprIf(Node): def __init__(self, test, lineno=None): self.test = test self.lineno = lineno def getChildren(self): return self.test, def getChildNodes(self): return self.test, def __repr__(self): return "GenExprIf(%s)" % (repr(self.test),) class GenExprInner(Node): def __init__(self, expr, quals, lineno=None): self.expr = expr self.quals = quals self.lineno = lineno def getChildren(self): children = [] children.append(self.expr) children.extend(flatten(self.quals)) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.expr) nodelist.extend(flatten_nodes(self.quals)) return tuple(nodelist) def __repr__(self): return "GenExprInner(%s, %s)" % (repr(self.expr), repr(self.quals)) class Getattr(Node): def __init__(self, expr, attrname, lineno=None): self.expr = expr self.attrname = attrname self.lineno = lineno def getChildren(self): return self.expr, self.attrname def getChildNodes(self): return self.expr, def __repr__(self): return "Getattr(%s, %s)" % (repr(self.expr), repr(self.attrname)) class Global(Node): def __init__(self, names, lineno=None): self.names = names self.lineno = lineno def getChildren(self): return self.names, def getChildNodes(self): return () def __repr__(self): return "Global(%s)" % (repr(self.names),) class If(Node): def __init__(self, tests, else_, lineno=None): self.tests = tests self.else_ = else_ self.lineno = lineno def getChildren(self): children = [] children.extend(flatten(self.tests)) children.append(self.else_) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.tests)) if self.else_ is not None: nodelist.append(self.else_) return tuple(nodelist) def __repr__(self): return "If(%s, %s)" % (repr(self.tests), repr(self.else_)) class IfExp(Node): def __init__(self, test, then, else_, lineno=None): self.test = test self.then = then self.else_ = else_ self.lineno = lineno def getChildren(self): return self.test, self.then, self.else_ def getChildNodes(self): return self.test, self.then, self.else_ def __repr__(self): return "IfExp(%s, %s, %s)" % (repr(self.test), repr(self.then), repr(self.else_)) class Import(Node): def __init__(self, names, lineno=None): self.names = names self.lineno = lineno def getChildren(self): return self.names, def getChildNodes(self): return () def __repr__(self): return "Import(%s)" % (repr(self.names),) class Invert(Node): def __init__(self, expr, lineno=None): self.expr = expr self.lineno = lineno def getChildren(self): return self.expr, def getChildNodes(self): return self.expr, def __repr__(self): return "Invert(%s)" % (repr(self.expr),) class Keyword(Node): def __init__(self, name, expr, lineno=None): self.name = name self.expr = expr self.lineno = lineno def getChildren(self): return self.name, self.expr def getChildNodes(self): return self.expr, def __repr__(self): return "Keyword(%s, %s)" % (repr(self.name), repr(self.expr)) class Lambda(Node): def __init__(self, argnames, defaults, varargs, kwargs, code, lineno=None): self.argnames = argnames self.defaults = defaults self.varargs = varargs self.kwargs = kwargs self.code = code self.lineno = lineno def getChildren(self): children = [] children.append(self.argnames) children.extend(flatten(self.defaults)) children.append(self.varargs) children.append(self.kwargs) children.append(self.code) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.defaults)) nodelist.append(self.varargs) nodelist.append(self.kwargs) nodelist.append(self.code) return tuple(nodelist) def __repr__(self): return "Lambda(%s, %s, %s, %s, %s)" % (repr(self.argnames), repr(self.defaults), repr(self.varargs), repr(self.kwargs), repr(self.code)) class LeftShift(Node): def __init__(self, left, right, lineno=None): self.left = left self.right = right self.lineno = lineno def getChildren(self): return self.left, self.right def getChildNodes(self): return self.left, self.right def __repr__(self): return "LeftShift(%s, %s)" % (repr(self.left), repr(self.right)) class List(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "List(%s)" % (repr(self.nodes),) class CollComp(Node): pass class ListComp(CollComp): def __init__(self, expr, quals, lineno=None): self.expr = expr self.quals = quals self.lineno = lineno def getChildren(self): children = [] children.append(self.expr) children.extend(flatten(self.quals)) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.expr) nodelist.extend(flatten_nodes(self.quals)) return tuple(nodelist) def __repr__(self): return "ListComp(%s, %s)" % (repr(self.expr), repr(self.quals)) class ListCompFor(Node): def __init__(self, assign, list, ifs, lineno=None): self.assign = assign self.list = list self.ifs = ifs self.lineno = lineno def getChildren(self): children = [] children.append(self.assign) children.append(self.list) children.extend(flatten(self.ifs)) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.assign) nodelist.append(self.list) nodelist.extend(flatten_nodes(self.ifs)) return tuple(nodelist) def __repr__(self): return "ListCompFor(%s, %s, %s)" % (repr(self.assign), repr(self.list), repr(self.ifs)) class ListCompIf(Node): def __init__(self, test, lineno=None): self.test = test self.lineno = lineno def getChildren(self): return self.test, def getChildNodes(self): return self.test, def __repr__(self): return "ListCompIf(%s)" % (repr(self.test),) class SetComp(CollComp): def __init__(self, expr, quals, lineno=None): self.expr = expr self.quals = quals self.lineno = lineno def getChildren(self): children = [] children.append(self.expr) children.extend(flatten(self.quals)) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.expr) nodelist.extend(flatten_nodes(self.quals)) return tuple(nodelist) def __repr__(self): return "SetComp(%s, %s)" % (repr(self.expr), repr(self.quals)) class DictComp(CollComp): def __init__(self, key, value, quals, lineno=None): self.key = key self.value = value self.quals = quals self.lineno = lineno def getChildren(self): children = [] children.append(self.key) children.append(self.value) children.extend(flatten(self.quals)) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.key) nodelist.append(self.value) nodelist.extend(flatten_nodes(self.quals)) return tuple(nodelist) def __repr__(self): return "DictComp(%s, %s, %s)" % (repr(self.key), repr(self.value), repr(self.quals)) class Mod(Node): def __init__(self, left, right, lineno=None): self.left = left self.right = right self.lineno = lineno def getChildren(self): return self.left, self.right def getChildNodes(self): return self.left, self.right def __repr__(self): return "Mod(%s, %s)" % (repr(self.left), repr(self.right)) class Module(Node): def __init__(self, doc, node, lineno=None): self.doc = doc self.node = node self.lineno = lineno def getChildren(self): return self.doc, self.node def getChildNodes(self): return self.node, def __repr__(self): return "Module(%s, %s)" % (repr(self.doc), repr(self.node)) class Mul(Node): def __init__(self, left, right, lineno=None): self.left = left self.right = right self.lineno = lineno def getChildren(self): return self.left, self.right def getChildNodes(self): return self.left, self.right def __repr__(self): return "Mul(%s, %s)" % (repr(self.left), repr(self.right)) class Name(Node): def __init__(self, name, lineno=None): self.name = name self.lineno = lineno def getChildren(self): return self.name, def getChildNodes(self): return () def __repr__(self): return "Name(%s)" % (repr(self.name),) class Not(Node): def __init__(self, expr, lineno=None): self.expr = expr self.lineno = lineno def getChildren(self): return self.expr, def getChildNodes(self): return self.expr, def __repr__(self): return "Not(%s)" % (repr(self.expr),) class Or(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "Or(%s)" % (repr(self.nodes),) class Pass(Node): def __init__(self, lineno=None): self.lineno = lineno def getChildren(self): return () def getChildNodes(self): return () def __repr__(self): return "Pass()" class Power(Node): def __init__(self, left, right, lineno=None): self.left = left self.right = right self.lineno = lineno def getChildren(self): return self.left, self.right def getChildNodes(self): return self.left, self.right def __repr__(self): return "Power(%s, %s)" % (repr(self.left), repr(self.right)) class Print(Node): def __init__(self, nodes, dest, lineno=None): self.nodes = nodes self.dest = dest self.lineno = lineno def getChildren(self): children = [] children.extend(flatten(self.nodes)) children.append(self.dest) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) if self.dest is not None: nodelist.append(self.dest) return tuple(nodelist) def __repr__(self): return "Print(%s, %s)" % (repr(self.nodes), repr(self.dest)) class Printnl(Node): def __init__(self, nodes, dest, nl, lineno=None): self.nodes = nodes self.dest = dest self.nl = nl self.lineno = lineno def getChildren(self): children = [] children.extend(flatten(self.nodes)) children.append(self.dest) children.append(self.nl) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) if self.dest is not None: nodelist.append(self.dest) nodelist.append(self.nl) return tuple(nodelist) def __repr__(self): return "Printnl(%s, %s, %s)" % (repr(self.nodes), repr(self.dest), repr(self.nl)) class Raise(Node): def __init__(self, expr1, expr2, expr3, lineno=None): self.expr1 = expr1 self.expr2 = expr2 self.expr3 = expr3 self.lineno = lineno def getChildren(self): children = [] children.append(self.expr1) children.append(self.expr2) children.append(self.expr3) return tuple(children) def getChildNodes(self): nodelist = [] if self.expr1 is not None: nodelist.append(self.expr1) if self.expr2 is not None: nodelist.append(self.expr2) if self.expr3 is not None: nodelist.append(self.expr3) return tuple(nodelist) def __repr__(self): return "Raise(%s, %s, %s)" % (repr(self.expr1), repr(self.expr2), repr(self.expr3)) class Return(Node): def __init__(self, value, lineno=None): self.value = value self.lineno = lineno def getChildren(self): return self.value, def getChildNodes(self): return self.value, def __repr__(self): return "Return(%s)" % (repr(self.value),) class RightShift(Node): def __init__(self, left, right, lineno=None): self.left = left self.right = right self.lineno = lineno def getChildren(self): return self.left, self.right def getChildNodes(self): return self.left, self.right def __repr__(self): return "RightShift(%s, %s)" % (repr(self.left), repr(self.right)) class Set(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "Set(%s)" % (repr(self.nodes),) class Slice(Node): def __init__(self, expr, flags, lower, upper, lineno=None): self.expr = expr self.flags = flags self.lower = lower self.upper = upper self.lineno = lineno def getChildren(self): children = [] children.append(self.expr) children.append(self.flags) children.append(self.lower) children.append(self.upper) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.expr) if self.lower is not None: nodelist.append(self.lower) if self.upper is not None: nodelist.append(self.upper) return tuple(nodelist) def __repr__(self): return "Slice(%s, %s, %s, %s)" % (repr(self.expr), repr(self.flags), repr(self.lower), repr(self.upper)) class Sliceobj(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "Sliceobj(%s)" % (repr(self.nodes),) class Stmt(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "Stmt(%s)" % (repr(self.nodes),) class Sub(Node): def __init__(self, left, right, lineno=None): self.left = left self.right = right self.lineno = lineno def getChildren(self): return self.left, self.right def getChildNodes(self): return self.left, self.right def __repr__(self): return "Sub(%s, %s)" % (repr(self.left), repr(self.right)) class Subscript(Node): def __init__(self, expr, flags, subs, lineno=None): self.expr = expr self.flags = flags self.subs = subs self.lineno = lineno def getChildren(self): children = [] children.append(self.expr) children.append(self.flags) children.extend(flatten(self.subs)) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.expr) nodelist.extend(flatten_nodes(self.subs)) return tuple(nodelist) def __repr__(self): return "Subscript(%s, %s, %s)" % (repr(self.expr), repr(self.flags), repr(self.subs)) class TryExcept(Node): def __init__(self, body, handlers, else_, lineno=None): self.body = body self.handlers = handlers self.else_ = else_ self.lineno = lineno def getChildren(self): children = [] children.append(self.body) children.extend(flatten(self.handlers)) children.append(self.else_) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.body) nodelist.extend(flatten_nodes(self.handlers)) if self.else_ is not None: nodelist.append(self.else_) return tuple(nodelist) def __repr__(self): return "TryExcept(%s, %s, %s)" % (repr(self.body), repr(self.handlers), repr(self.else_)) class TryFinally(Node): def __init__(self, body, final_, lineno=None): self.body = body self.final_ = final_ self.lineno = lineno def getChildren(self): return self.body, self.final_ def getChildNodes(self): return self.body, self.final_ def __repr__(self): return "TryFinally(%s, %s)" % (repr(self.body), repr(self.final_)) class Tuple(Node): def __init__(self, nodes, lineno=None): self.nodes = nodes self.lineno = lineno def getChildren(self): return tuple(flatten(self.nodes)) def getChildNodes(self): nodelist = [] nodelist.extend(flatten_nodes(self.nodes)) return tuple(nodelist) def __repr__(self): return "Tuple(%s)" % (repr(self.nodes),) class UnaryAdd(Node): def __init__(self, expr, lineno=None): self.expr = expr self.lineno = lineno def getChildren(self): return self.expr, def getChildNodes(self): return self.expr, def __repr__(self): return "UnaryAdd(%s)" % (repr(self.expr),) class UnarySub(Node): def __init__(self, expr, lineno=None): self.expr = expr self.lineno = lineno def getChildren(self): return self.expr, def getChildNodes(self): return self.expr, def __repr__(self): return "UnarySub(%s)" % (repr(self.expr),) class While(Node): def __init__(self, test, body, else_, lineno=None): self.test = test self.body = body self.else_ = else_ self.lineno = lineno def getChildren(self): children = [] children.append(self.test) children.append(self.body) children.append(self.else_) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.test) nodelist.append(self.body) if self.else_ is not None: nodelist.append(self.else_) return tuple(nodelist) def __repr__(self): return "While(%s, %s, %s)" % (repr(self.test), repr(self.body), repr(self.else_)) class With(Node): def __init__(self, expr, vars, body, lineno=None): self.expr = expr self.vars = vars self.body = body self.lineno = lineno def getChildren(self): children = [] children.append(self.expr) children.append(self.vars) children.append(self.body) return tuple(children) def getChildNodes(self): nodelist = [] nodelist.append(self.expr) if self.vars is not None: nodelist.append(self.vars) nodelist.append(self.body) return tuple(nodelist) def __repr__(self): return "With(%s, %s, %s)" % (repr(self.expr), repr(self.vars), repr(self.body)) class Yield(Node): def __init__(self, value, lineno=None): self.value = value self.lineno = lineno def getChildren(self): return self.value, def getChildNodes(self): return self.value, def __repr__(self): return "Yield(%s)" % (repr(self.value),) for name, obj in list(globals().items()): if isinstance(obj, type) and issubclass(obj, Node): nodes[name.lower()] = obj
apache-2.0
samthetechie/pyFolia
venv/lib/python2.7/site-packages/requests/packages/urllib3/util/url.py
304
4273
from collections import namedtuple from ..exceptions import LocationParseError class Url(namedtuple('Url', ['scheme', 'auth', 'host', 'port', 'path', 'query', 'fragment'])): """ Datastructure for representing an HTTP URL. Used as a return value for :func:`parse_url`. """ slots = () def __new__(cls, scheme=None, auth=None, host=None, port=None, path=None, query=None, fragment=None): return super(Url, cls).__new__(cls, scheme, auth, host, port, path, query, fragment) @property def hostname(self): """For backwards-compatibility with urlparse. We're nice like that.""" return self.host @property def request_uri(self): """Absolute path including the query string.""" uri = self.path or '/' if self.query is not None: uri += '?' + self.query return uri @property def netloc(self): """Network location including host and port""" if self.port: return '%s:%d' % (self.host, self.port) return self.host def split_first(s, delims): """ Given a string and an iterable of delimiters, split on the first found delimiter. Return two split parts and the matched delimiter. If not found, then the first part is the full input string. Example: :: >>> split_first('foo/bar?baz', '?/=') ('foo', 'bar?baz', '/') >>> split_first('foo/bar?baz', '123') ('foo/bar?baz', '', None) Scales linearly with number of delims. Not ideal for large number of delims. """ min_idx = None min_delim = None for d in delims: idx = s.find(d) if idx < 0: continue if min_idx is None or idx < min_idx: min_idx = idx min_delim = d if min_idx is None or min_idx < 0: return s, '', None return s[:min_idx], s[min_idx+1:], min_delim def parse_url(url): """ Given a url, return a parsed :class:`.Url` namedtuple. Best-effort is performed to parse incomplete urls. Fields not provided will be None. Partly backwards-compatible with :mod:`urlparse`. Example: :: >>> parse_url('http://google.com/mail/') Url(scheme='http', host='google.com', port=None, path='/', ...) >>> parse_url('google.com:80') Url(scheme=None, host='google.com', port=80, path=None, ...) >>> parse_url('/foo?bar') Url(scheme=None, host=None, port=None, path='/foo', query='bar', ...) """ # While this code has overlap with stdlib's urlparse, it is much # simplified for our needs and less annoying. # Additionally, this implementations does silly things to be optimal # on CPython. scheme = None auth = None host = None port = None path = None fragment = None query = None # Scheme if '://' in url: scheme, url = url.split('://', 1) # Find the earliest Authority Terminator # (http://tools.ietf.org/html/rfc3986#section-3.2) url, path_, delim = split_first(url, ['/', '?', '#']) if delim: # Reassemble the path path = delim + path_ # Auth if '@' in url: # Last '@' denotes end of auth part auth, url = url.rsplit('@', 1) # IPv6 if url and url[0] == '[': host, url = url.split(']', 1) host += ']' # Port if ':' in url: _host, port = url.split(':', 1) if not host: host = _host if port: # If given, ports must be integers. if not port.isdigit(): raise LocationParseError(url) port = int(port) else: # Blank ports are cool, too. (rfc3986#section-3.2.3) port = None elif not host and url: host = url if not path: return Url(scheme, auth, host, port, path, query, fragment) # Fragment if '#' in path: path, fragment = path.split('#', 1) # Query if '?' in path: path, query = path.split('?', 1) return Url(scheme, auth, host, port, path, query, fragment) def get_host(url): """ Deprecated. Use :func:`.parse_url` instead. """ p = parse_url(url) return p.scheme or 'http', p.hostname, p.port
gpl-3.0
xzackli/isocurvature_2017
analysis/plot_derived_parameters/OLD_make_beta_plots.py
1
4054
import numpy as np import matplotlib.pyplot as plt import matplotlib.animation as manimation from scipy.stats import gaussian_kde from pprint import pprint import sys import os from astropy.io import ascii from astropy.table import vstack # chainfile = "/Users/zequnl/Installs/montepython_public/chains/example/2016-10-18_10000__1.txt" # CONFIGURATION ------------- # chainfile = "chains/CDI_2/2016-11-02_1000000__1.txt" # paramfile = "chains/CDI_2/2016-11-02_1000000_.paramnames" chainfile = "chains/CDI_2/2016-11-02_1000000__1.txt" paramfile = "chains/CDI_2/2016-11-02_1000000_.paramnames" xname = 'P_{II}^1' yname = 'P_{RI}^1' options = "" chainfolder = "chains/CDI_2/" if len(sys.argv) >= 3: chainfile = sys.argv[1] paramfile = sys.argv[2] print(paramfile) if len(sys.argv) >= 5: xname = sys.argv[3] yname = sys.argv[4] options = sys.argv[5:] elif len(sys.argv) == 2: if sys.argv[1] == "info": params = np.array(ascii.read('params', delimiter="\t", format="no_header")['col1']).tolist() print(params) sys.exit(0) # --------------------------- params = np.array(ascii.read(paramfile, delimiter="\t", format="no_header")['col1']) data_all = None for filename in os.listdir(chainfolder): if filename.startswith("201") and filename.endswith(".txt"): chainfile = os.path.join(chainfolder, filename) print(chainfile) data = (ascii.read(chainfile, delimiter="\s"))[300:] # set up column names (read in from param file) data['col1'].name = 'acceptance' data['col2'].name = 'likelihood' for i in range(3,len(params)+3): data['col' + str(i)].name = params[i-3] if data_all == None: data_all = data else: data_all = vstack( [data_all, data] ) print(len(data), len(data_all)) data = data_all print(len(data), "rows") x = data[xname] y = data[yname] t = np.array( range(len(x))) # we look for the -s option, and then find the number afterwards. # that's where we start if "-s" in options: s = int(sys.argv[sys.argv.index("-s")+1]) x = x[s:] y = y[s:] prr1 = data['P_{RR}^1']; pii1 = data['P_{II}^1']; pri1 = data['P_{RI}^1']; prr2 = data['P_{RR}^2']; pii2 = data['P_{II}^2']; pri2 = pri1 * np.sqrt(pii2 * prr2 / (pii1 * prr1)) # make density plot # sc(x,y) beta_iso1 = pii1 / (prr1 + pii1) beta_iso2 = pii2 / (prr2 + pii2) alpha = pri1 / np.sqrt( pii1 * prr1 ) # \frac{\log( P_{AB}^2 / P_{AB}^1 )}{\log ( k_2 / k_1 ) k1 = 0.002 # Mpc^{-1} k2 = 0.1 # Mpc^{-1} nRR = np.log(prr2/prr1) / np.log(k2/k1) nRI = np.log(pri2/pri1) / np.log(k2/k1) nII = np.log(pii2/pii1) / np.log(k2/k1) def denplot( list_data, ax, name="data", lower=0.0, upper=0.25, \ nbins=20, extend=False, extent=0.1, cov=0.2 ): """ plot a smoothed histogram """ x = np.linspace(lower, upper, 150) if extend: bools = list_data < extent new_list_data = np.hstack( (list_data,-list_data) ) new_weights = np.hstack( (data['acceptance'], (data['acceptance']) ) ) density = gaussian_kde(new_list_data) else: density = gaussian_kde( list_data ) density.covariance_factor = lambda : cov density._compute_covariance() ax.plot( x, density(x), "k--" ) counts, bins = np.histogram( list_data, bins=x, weights=data['acceptance'], density=True ) #ax.plot( x[:-1], counts, "r." ) ax.get_yaxis().set_ticks([]) # ax.set_ylim( 0.0, counts.max() ) ax.set_xlim( lower, upper ) ax.set_xlabel( name ) fig = plt.figure(figsize=(12,3)) ax1 = fig.add_subplot(141) ax2 = fig.add_subplot(142) ax3 = fig.add_subplot(143) ax4 = fig.add_subplot(144) denplot( beta_iso1, ax1, r"$\beta_{iso}(k_{low})$", 0.0, 0.25, extend=True ) denplot( beta_iso2, ax2, r"$\beta_{iso}(k_{high})$", 0.0, 0.8, extend=True) denplot( alpha, ax3, r"$\cos \Delta$", -0.5, 0.5 ) denplot( nII, ax4, r"$n_{II}$", -1.0, 2.8 ) plt.tight_layout() plt.savefig("../../figures/beta_planck.pdf") plt.show() ## TESTING
mit
CaptainTrunky/googletest
test/gtest_break_on_failure_unittest.py
2140
7339
#!/usr/bin/env python # # Copyright 2006, Google Inc. # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following disclaimer # in the documentation and/or other materials provided with the # distribution. # * Neither the name of Google Inc. nor the names of its # contributors may be used to endorse or promote products derived from # this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. """Unit test for Google Test's break-on-failure mode. A user can ask Google Test to seg-fault when an assertion fails, using either the GTEST_BREAK_ON_FAILURE environment variable or the --gtest_break_on_failure flag. This script tests such functionality by invoking gtest_break_on_failure_unittest_ (a program written with Google Test) with different environments and command line flags. """ __author__ = 'wan@google.com (Zhanyong Wan)' import gtest_test_utils import os import sys # Constants. IS_WINDOWS = os.name == 'nt' # The environment variable for enabling/disabling the break-on-failure mode. BREAK_ON_FAILURE_ENV_VAR = 'GTEST_BREAK_ON_FAILURE' # The command line flag for enabling/disabling the break-on-failure mode. BREAK_ON_FAILURE_FLAG = 'gtest_break_on_failure' # The environment variable for enabling/disabling the throw-on-failure mode. THROW_ON_FAILURE_ENV_VAR = 'GTEST_THROW_ON_FAILURE' # The environment variable for enabling/disabling the catch-exceptions mode. CATCH_EXCEPTIONS_ENV_VAR = 'GTEST_CATCH_EXCEPTIONS' # Path to the gtest_break_on_failure_unittest_ program. EXE_PATH = gtest_test_utils.GetTestExecutablePath( 'gtest_break_on_failure_unittest_') environ = gtest_test_utils.environ SetEnvVar = gtest_test_utils.SetEnvVar # Tests in this file run a Google-Test-based test program and expect it # to terminate prematurely. Therefore they are incompatible with # the premature-exit-file protocol by design. Unset the # premature-exit filepath to prevent Google Test from creating # the file. SetEnvVar(gtest_test_utils.PREMATURE_EXIT_FILE_ENV_VAR, None) def Run(command): """Runs a command; returns 1 if it was killed by a signal, or 0 otherwise.""" p = gtest_test_utils.Subprocess(command, env=environ) if p.terminated_by_signal: return 1 else: return 0 # The tests. class GTestBreakOnFailureUnitTest(gtest_test_utils.TestCase): """Tests using the GTEST_BREAK_ON_FAILURE environment variable or the --gtest_break_on_failure flag to turn assertion failures into segmentation faults. """ def RunAndVerify(self, env_var_value, flag_value, expect_seg_fault): """Runs gtest_break_on_failure_unittest_ and verifies that it does (or does not) have a seg-fault. Args: env_var_value: value of the GTEST_BREAK_ON_FAILURE environment variable; None if the variable should be unset. flag_value: value of the --gtest_break_on_failure flag; None if the flag should not be present. expect_seg_fault: 1 if the program is expected to generate a seg-fault; 0 otherwise. """ SetEnvVar(BREAK_ON_FAILURE_ENV_VAR, env_var_value) if env_var_value is None: env_var_value_msg = ' is not set' else: env_var_value_msg = '=' + env_var_value if flag_value is None: flag = '' elif flag_value == '0': flag = '--%s=0' % BREAK_ON_FAILURE_FLAG else: flag = '--%s' % BREAK_ON_FAILURE_FLAG command = [EXE_PATH] if flag: command.append(flag) if expect_seg_fault: should_or_not = 'should' else: should_or_not = 'should not' has_seg_fault = Run(command) SetEnvVar(BREAK_ON_FAILURE_ENV_VAR, None) msg = ('when %s%s, an assertion failure in "%s" %s cause a seg-fault.' % (BREAK_ON_FAILURE_ENV_VAR, env_var_value_msg, ' '.join(command), should_or_not)) self.assert_(has_seg_fault == expect_seg_fault, msg) def testDefaultBehavior(self): """Tests the behavior of the default mode.""" self.RunAndVerify(env_var_value=None, flag_value=None, expect_seg_fault=0) def testEnvVar(self): """Tests using the GTEST_BREAK_ON_FAILURE environment variable.""" self.RunAndVerify(env_var_value='0', flag_value=None, expect_seg_fault=0) self.RunAndVerify(env_var_value='1', flag_value=None, expect_seg_fault=1) def testFlag(self): """Tests using the --gtest_break_on_failure flag.""" self.RunAndVerify(env_var_value=None, flag_value='0', expect_seg_fault=0) self.RunAndVerify(env_var_value=None, flag_value='1', expect_seg_fault=1) def testFlagOverridesEnvVar(self): """Tests that the flag overrides the environment variable.""" self.RunAndVerify(env_var_value='0', flag_value='0', expect_seg_fault=0) self.RunAndVerify(env_var_value='0', flag_value='1', expect_seg_fault=1) self.RunAndVerify(env_var_value='1', flag_value='0', expect_seg_fault=0) self.RunAndVerify(env_var_value='1', flag_value='1', expect_seg_fault=1) def testBreakOnFailureOverridesThrowOnFailure(self): """Tests that gtest_break_on_failure overrides gtest_throw_on_failure.""" SetEnvVar(THROW_ON_FAILURE_ENV_VAR, '1') try: self.RunAndVerify(env_var_value=None, flag_value='1', expect_seg_fault=1) finally: SetEnvVar(THROW_ON_FAILURE_ENV_VAR, None) if IS_WINDOWS: def testCatchExceptionsDoesNotInterfere(self): """Tests that gtest_catch_exceptions doesn't interfere.""" SetEnvVar(CATCH_EXCEPTIONS_ENV_VAR, '1') try: self.RunAndVerify(env_var_value='1', flag_value='1', expect_seg_fault=1) finally: SetEnvVar(CATCH_EXCEPTIONS_ENV_VAR, None) if __name__ == '__main__': gtest_test_utils.Main()
bsd-3-clause
TheProjecter/igatools
source/basis_functions/multi_patch_space.inst.py
1
1764
#-+-------------------------------------------------------------------- # Igatools a general purpose Isogeometric analysis library. # Copyright (C) 2012-2015 by the igatools authors (see authors.txt). # # This file is part of the igatools library. # # The igatools library is free software: you can use it, redistribute # it and/or modify it under the terms of the GNU General Public # License as published by the Free Software Foundation, either # version 3 of the License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. #-+-------------------------------------------------------------------- from init_instantiation_data import * include_files = ['basis_functions/bspline_space.h', 'basis_functions/nurbs_space.h', 'geometry/push_forward.h', 'geometry/cartesian_grid_element_accessor.h', 'geometry/mapping_element_accessor.h', 'geometry/push_forward_element_accessor.h', 'basis_functions/bspline_element_accessor.h', 'basis_functions/nurbs_element_accessor.h', 'basis_functions/physical_space.h', 'basis_functions/physical_space_element_accessor.h'] data = Instantiation(include_files) (f, inst) = (data.file_output, data.inst) for space in inst.PhysSpaces_v2: f.write( 'template class MultiPatchSpace<%s>;\n' %space.name)
gpl-3.0
pedrobaeza/bank-payment
account_banking_payment_transfer/__openerp__.py
7
1900
# -*- coding: utf-8 -*- ############################################################################## # # Copyright (C) 2009 EduSense BV (<http://www.edusense.nl>). # (C) 2011 - 2013 Therp BV (<http://therp.nl>). # (C) 2014 ACSONE SA/NV (<http://acsone.eu>). # # All other contributions are (C) by their respective contributors # # All Rights Reserved # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## { 'name': 'Account Banking - Payments Transfer Account', 'version': '0.2', 'license': 'AGPL-3', 'author': "Banking addons community,Odoo Community Association (OCA)", 'website': 'https://github.com/OCA/banking', 'category': 'Banking addons', 'post_init_hook': 'set_date_sent', 'depends': [ 'account_banking_payment_export', ], 'data': [ 'view/payment_mode.xml', 'workflow/account_payment.xml', 'view/account_payment.xml', ], 'test': [ 'test/data.yml', 'test/test_payment_method.yml', 'test/test_partial_payment_refunded.yml', 'test/test_partial_payment_transfer.yml', ], 'auto_install': False, 'installable': True, }
agpl-3.0
ryangallen/django
django/contrib/gis/admin/options.py
379
5649
from django.contrib.admin import ModelAdmin from django.contrib.gis.admin.widgets import OpenLayersWidget from django.contrib.gis.db import models from django.contrib.gis.gdal import HAS_GDAL, OGRGeomType from django.core.exceptions import ImproperlyConfigured spherical_mercator_srid = 3857 class GeoModelAdmin(ModelAdmin): """ The administration options class for Geographic models. Map settings may be overloaded from their defaults to create custom maps. """ # The default map settings that may be overloaded -- still subject # to API changes. default_lon = 0 default_lat = 0 default_zoom = 4 display_wkt = False display_srid = False extra_js = [] num_zoom = 18 max_zoom = False min_zoom = False units = False max_resolution = False max_extent = False modifiable = True mouse_position = True scale_text = True layerswitcher = True scrollable = True map_width = 600 map_height = 400 map_srid = 4326 map_template = 'gis/admin/openlayers.html' openlayers_url = 'http://openlayers.org/api/2.13/OpenLayers.js' point_zoom = num_zoom - 6 wms_url = 'http://vmap0.tiles.osgeo.org/wms/vmap0' wms_layer = 'basic' wms_name = 'OpenLayers WMS' wms_options = {'format': 'image/jpeg'} debug = False widget = OpenLayersWidget @property def media(self): "Injects OpenLayers JavaScript into the admin." media = super(GeoModelAdmin, self).media media.add_js([self.openlayers_url]) media.add_js(self.extra_js) return media def formfield_for_dbfield(self, db_field, **kwargs): """ Overloaded from ModelAdmin so that an OpenLayersWidget is used for viewing/editing 2D GeometryFields (OpenLayers 2 does not support 3D editing). """ if isinstance(db_field, models.GeometryField) and db_field.dim < 3: kwargs.pop('request', None) # Setting the widget with the newly defined widget. kwargs['widget'] = self.get_map_widget(db_field) return db_field.formfield(**kwargs) else: return super(GeoModelAdmin, self).formfield_for_dbfield(db_field, **kwargs) def get_map_widget(self, db_field): """ Returns a subclass of the OpenLayersWidget (or whatever was specified in the `widget` attribute) using the settings from the attributes set in this class. """ is_collection = db_field.geom_type in ('MULTIPOINT', 'MULTILINESTRING', 'MULTIPOLYGON', 'GEOMETRYCOLLECTION') if is_collection: if db_field.geom_type == 'GEOMETRYCOLLECTION': collection_type = 'Any' else: collection_type = OGRGeomType(db_field.geom_type.replace('MULTI', '')) else: collection_type = 'None' class OLMap(self.widget): template = self.map_template geom_type = db_field.geom_type wms_options = '' if self.wms_options: wms_options = ["%s: '%s'" % pair for pair in self.wms_options.items()] wms_options = ', %s' % ', '.join(wms_options) params = {'default_lon': self.default_lon, 'default_lat': self.default_lat, 'default_zoom': self.default_zoom, 'display_wkt': self.debug or self.display_wkt, 'geom_type': OGRGeomType(db_field.geom_type), 'field_name': db_field.name, 'is_collection': is_collection, 'scrollable': self.scrollable, 'layerswitcher': self.layerswitcher, 'collection_type': collection_type, 'is_generic': db_field.geom_type == 'GEOMETRY', 'is_linestring': db_field.geom_type in ('LINESTRING', 'MULTILINESTRING'), 'is_polygon': db_field.geom_type in ('POLYGON', 'MULTIPOLYGON'), 'is_point': db_field.geom_type in ('POINT', 'MULTIPOINT'), 'num_zoom': self.num_zoom, 'max_zoom': self.max_zoom, 'min_zoom': self.min_zoom, 'units': self.units, # likely should get from object 'max_resolution': self.max_resolution, 'max_extent': self.max_extent, 'modifiable': self.modifiable, 'mouse_position': self.mouse_position, 'scale_text': self.scale_text, 'map_width': self.map_width, 'map_height': self.map_height, 'point_zoom': self.point_zoom, 'srid': self.map_srid, 'display_srid': self.display_srid, 'wms_url': self.wms_url, 'wms_layer': self.wms_layer, 'wms_name': self.wms_name, 'wms_options': wms_options, 'debug': self.debug, } return OLMap class OSMGeoAdmin(GeoModelAdmin): map_template = 'gis/admin/osm.html' num_zoom = 20 map_srid = spherical_mercator_srid max_extent = '-20037508,-20037508,20037508,20037508' max_resolution = '156543.0339' point_zoom = num_zoom - 6 units = 'm' def __init__(self, *args): if not HAS_GDAL: raise ImproperlyConfigured("OSMGeoAdmin is not usable without GDAL libs installed") super(OSMGeoAdmin, self).__init__(*args)
bsd-3-clause
graphite-project/graphite-web
webapp/tests/test_readers_whisper.py
4
7083
from .base import TestCase import os import mock import shutil import time from django.conf import settings import whisper import gzip from graphite.readers import WhisperReader, GzippedWhisperReader from graphite.wsgi import application # NOQA makes sure we have a working WSGI app class WhisperReadersTests(TestCase): start_ts = 0 # Create/wipe test whisper files hostcpu = os.path.join(settings.WHISPER_DIR, 'hosts/hostname/cpu.wsp') worker1 = hostcpu.replace('hostname', 'worker1') worker2 = hostcpu.replace('hostname', 'worker2') worker3 = hostcpu.replace('hostname', 'worker3') worker4 = hostcpu.replace('hostname', 'worker4') worker4 = worker4.replace('cpu.wsp', 'cpu.wsp.gz') def create_whisper_hosts(self): self.start_ts = int(time.time()) try: os.makedirs(self.worker1.replace('cpu.wsp', '')) os.makedirs(self.worker2.replace('cpu.wsp', '')) os.makedirs(self.worker3.replace('cpu.wsp', '')) os.makedirs(self.worker4.replace('cpu.wsp.gz', '')) except OSError: pass whisper.create(self.worker1, [(1, 60)]) whisper.create(self.worker2, [(1, 60)]) open(self.worker3, 'a').close() whisper.update(self.worker1, 1, self.start_ts) whisper.update(self.worker2, 2, self.start_ts) with open(self.worker1, 'rb') as f_in, gzip.open(self.worker4, 'wb') as f_out: shutil.copyfileobj(f_in, f_out) def wipe_whisper_hosts(self): try: os.remove(self.worker1) os.remove(self.worker2) os.remove(self.worker3) os.remove(self.worker4) shutil.rmtree(os.path.join(settings.WHISPER_DIR, 'hosts')) except OSError: pass # # GzippedWHisper Reader tests # # Confirm the reader object is not none def test_GzippedWhisperReader_init(self): self.create_whisper_hosts() self.addCleanup(self.wipe_whisper_hosts) reader = GzippedWhisperReader(self.worker4, 'hosts.worker4.cpu') self.assertIsNotNone(reader) # Confirm the intervals # Because the intervals returned from Whisper are subsecond, # we truncate to int for this comparison, otherwise it's impossible def test_GzippedWhisperReader_get_intervals(self): self.create_whisper_hosts() self.addCleanup(self.wipe_whisper_hosts) reader = GzippedWhisperReader(self.worker4, 'hosts.worker4.cpu') ts = int(time.time()) intervals = reader.get_intervals() for interval in intervals: self.assertEqual(int(interval.start), ts - 60) self.assertIn(int(interval.end), [ts, ts - 1]) # read it again to validate cache works intervals = reader.get_intervals() for interval in intervals: self.assertEqual(int(interval.start),ts - 60) self.assertIn(int(interval.end), [ts, ts - 1]) # Confirm fetch works. def test_GzippedWhisperReader_fetch(self): self.create_whisper_hosts() self.addCleanup(self.wipe_whisper_hosts) reader = GzippedWhisperReader(self.worker4, 'hosts.worker4.cpu') (_, values) = reader.fetch(self.start_ts-5, self.start_ts) self.assertEqual(values, [None, None, None, None, 1.0]) # # WHisper Reader tests # # Confirm the reader object is not none def test_WhisperReader_init(self): self.create_whisper_hosts() self.addCleanup(self.wipe_whisper_hosts) reader = WhisperReader(self.worker1, 'hosts.worker1.cpu') self.assertIsNotNone(reader) # Confirm the intervals # Because the intervals returned from Whisper are subsecond, # we truncate to int for this comparison, otherwise it's impossible def test_WhisperReader_get_intervals(self): self.create_whisper_hosts() self.addCleanup(self.wipe_whisper_hosts) reader = WhisperReader(self.worker1, 'hosts.worker1.cpu') ts = int(time.time()) intervals = reader.get_intervals() for interval in intervals: self.assertEqual(int(interval.start),ts - 60) self.assertIn(int(interval.end), [ts, ts - 1]) # read it again to validate cache works intervals = reader.get_intervals() for interval in intervals: self.assertEqual(int(interval.start),ts - 60) self.assertIn(int(interval.end), [ts, ts - 1]) # Confirm get_raw_step works def test_WhisperReader_get_raw_step(self): self.create_whisper_hosts() self.addCleanup(self.wipe_whisper_hosts) reader = WhisperReader(self.worker1, 'hosts.worker1.cpu') raw_step = reader.get_raw_step() self.assertEqual(int(raw_step),1) # read it again to validate cache works raw_step = reader.get_raw_step() self.assertEqual(int(raw_step),1) # Confirm fetch works. def test_WhisperReader_fetch(self): self.create_whisper_hosts() self.addCleanup(self.wipe_whisper_hosts) reader = WhisperReader(self.worker1, 'hosts.worker1.cpu') (_, values) = reader.fetch(self.start_ts-5, self.start_ts) self.assertEqual(values, [None, None, None, None, 1.0]) # Whisper Reader broken file @mock.patch('whisper.fetch') def test_WhisperReader_fetch_returns_no_data(self, whisper_fetch): self.create_whisper_hosts() self.addCleanup(self.wipe_whisper_hosts) reader = WhisperReader(self.worker1, 'hosts.worker1.cpu') whisper_fetch.return_value = None self.assertEqual(reader.fetch(self.start_ts-5, self.start_ts), None) # Whisper Reader broken file def test_WhisperReader_broken_file(self): self.create_whisper_hosts() self.addCleanup(self.wipe_whisper_hosts) # Test broken whisper file f = open(self.worker2, 'rb+') f.seek(10) f.write(b'Bad Data') f.close() reader = WhisperReader(self.worker2, 'hosts.worker2.cpu') with self.assertRaises(Exception): reader.fetch(self.start_ts-5, self.start_ts) # Whisper Reader missing file @mock.patch('graphite.logger.log.exception') def test_WhisperReader_missing_file(self, log_exception): path = 'missing/file.wsp' reader = WhisperReader(path, 'hosts.worker2.cpu') self.assertEqual(reader.fetch(self.start_ts-5, self.start_ts), None) log_exception.assert_called_with("Failed fetch of whisper file '%s'" % path) # Whisper Reader CarbonLink Query returns a dict @mock.patch('graphite.carbonlink.CarbonLinkPool.query') def test_WhisperReader_CarbonLinkQuery(self, carbonlink_query): self.create_whisper_hosts() self.addCleanup(self.wipe_whisper_hosts) carbonlink_query.return_value = {} reader = WhisperReader(self.worker1, 'hosts.worker1.cpu') (_, values) = reader.fetch(self.start_ts-5, self.start_ts) self.assertEqual(values, [None, None, None, None, 1.0])
apache-2.0
darmaa/odoo
addons/account/project/wizard/account_analytic_balance_report.py
378
2136
# -*- coding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2004-2010 Tiny SPRL (<http://tiny.be>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## import time from openerp.osv import fields, osv class account_analytic_balance(osv.osv_memory): _name = 'account.analytic.balance' _description = 'Account Analytic Balance' _columns = { 'date1': fields.date('Start of period', required=True), 'date2': fields.date('End of period', required=True), 'empty_acc': fields.boolean('Empty Accounts ? ', help='Check if you want to display Accounts with 0 balance too.'), } _defaults = { 'date1': lambda *a: time.strftime('%Y-01-01'), 'date2': lambda *a: time.strftime('%Y-%m-%d') } def check_report(self, cr, uid, ids, context=None): if context is None: context = {} data = self.read(cr, uid, ids)[0] datas = { 'ids': context.get('active_ids', []), 'model': 'account.analytic.account', 'form': data } datas['form']['active_ids'] = context.get('active_ids', False) return self.pool['report'].get_action(cr, uid, [], 'account.report_analyticbalance', data=datas, context=context) # vim:expandtab:smartindent:tabstop=4:softtabstop=4:shiftwidth=4:
agpl-3.0
suutari-ai/shoop
shuup/admin/error_handlers.py
2
1379
# -*- coding: utf-8 -*- # This file is part of Shuup. # # Copyright (c) 2012-2017, Shoop Commerce Ltd. All rights reserved. # # This source code is licensed under the OSL-3.0 license found in the # LICENSE file in the root directory of this source tree. from __future__ import unicode_literals from django.conf import settings from django.shortcuts import render from shuup.core.error_handling import ErrorPageHandler class AdminPageErrorHandler(ErrorPageHandler): """ Page Error handler for Shuup Admin """ @classmethod def can_handle_error(cls, request, error_status): # we can't handle 404 errors, neither static or media files # since 404 errors means no URL match, # how can we figure out, in a elegant way if we are in the Admin? if (error_status == 404 or request.path.startswith(settings.STATIC_URL) or request.path.startswith(settings.MEDIA_URL)): return False # we are in a view which belongs to the Admin elif request.resolver_match: from shuup.admin import ShuupAdminAppConfig return (request.resolver_match.app_name == ShuupAdminAppConfig.label) return False @classmethod def handle_error(cls, request, error_status): return render(request, "shuup/admin/errors/{}.jinja".format(error_status), status=error_status)
agpl-3.0
fastly/sshuttle
Documentation/md2man.py
20
7344
#!/usr/bin/env python import sys, os, markdown, re from BeautifulSoup import BeautifulSoup def _split_lines(s): return re.findall(r'([^\n]*\n?)', s) class Writer: def __init__(self): self.started = False self.indent = 0 self.last_wrote = '\n' def _write(self, s): if s: self.last_wrote = s sys.stdout.write(s) def writeln(self, s): if s: self.linebreak() self._write('%s\n' % s) def write(self, s): if s: self.para() for line in _split_lines(s): if line.startswith('.'): self._write('\\&' + line) else: self._write(line) def linebreak(self): if not self.last_wrote.endswith('\n'): self._write('\n') def para(self, bullet=None): if not self.started: if not bullet: bullet = ' ' if not self.indent: self.writeln(_macro('.PP')) else: assert(self.indent >= 2) prefix = ' '*(self.indent-2) + bullet + ' ' self.writeln('.IP "%s" %d' % (prefix, self.indent)) self.started = True def end_para(self): self.linebreak() self.started = False def start_bullet(self): self.indent += 3 self.para(bullet='\\[bu]') def end_bullet(self): self.indent -= 3 self.end_para() w = Writer() def _macro(name, *args): if not name.startswith('.'): raise ValueError('macro names must start with "."') fixargs = [] for i in args: i = str(i) i = i.replace('\\', '') i = i.replace('"', "'") if (' ' in i) or not i: i = '"%s"' % i fixargs.append(i) return ' '.join([name] + list(fixargs)) def macro(name, *args): w.writeln(_macro(name, *args)) def _force_string(owner, tag): if tag.string: return tag.string else: out = '' for i in tag: if not (i.string or i.name in ['a', 'br']): raise ValueError('"%s" tags must contain only strings: ' 'got %r: %r' % (owner.name, tag.name, tag)) out += _force_string(owner, i) return out def _clean(s): s = s.replace('\\', '\\\\') return s def _bitlist(tag): if getattr(tag, 'contents', None) == None: for i in _split_lines(str(tag)): yield None,_clean(i) else: for e in tag: name = getattr(e, 'name', None) if name in ['a', 'br']: name = None # just treat as simple text s = _force_string(tag, e) if name: yield name,_clean(s) else: for i in _split_lines(s): yield None,_clean(i) def _bitlist_simple(tag): for typ,text in _bitlist(tag): if typ and not typ in ['em', 'strong', 'code']: raise ValueError('unexpected tag %r inside %r' % (typ, tag.name)) yield text def _text(bitlist): out = '' for typ,text in bitlist: if not typ: out += text elif typ == 'em': out += '\\fI%s\\fR' % text elif typ in ['strong', 'code']: out += '\\fB%s\\fR' % text else: raise ValueError('unexpected tag %r inside %r' % (typ, tag.name)) out = out.strip() out = re.sub(re.compile(r'^\s+', re.M), '', out) return out def text(tag): w.write(_text(_bitlist(tag))) # This is needed because .BI (and .BR, .RB, etc) are weird little state # machines that alternate between two fonts. So if someone says something # like foo<b>chicken</b><b>wicken</b>dicken we have to convert that to # .BI foo chickenwicken dicken def _boldline(l): out = [''] last_bold = False for typ,text in l: nonzero = not not typ if nonzero != last_bold: last_bold = not last_bold out.append('') out[-1] += re.sub(r'\s+', ' ', text) macro('.BI', *out) def do_definition(tag): w.end_para() macro('.TP') w.started = True split = 0 pre = [] post = [] for typ,text in _bitlist(tag): if split: post.append((typ,text)) elif text.lstrip().startswith(': '): split = 1 post.append((typ,text.lstrip()[2:].lstrip())) else: pre.append((typ,text)) _boldline(pre) w.write(_text(post)) def do_list(tag): for i in tag: name = getattr(i, 'name', '').lower() if not name and not str(i).strip(): pass elif name != 'li': raise ValueError('only <li> is allowed inside <ul>: got %r' % i) else: w.start_bullet() for xi in i: do(xi) w.end_para() w.end_bullet() def do(tag): name = getattr(tag, 'name', '').lower() if not name: text(tag) elif name == 'h1': macro('.SH', _force_string(tag, tag).upper()) w.started = True elif name == 'h2': macro('.SS', _force_string(tag, tag)) w.started = True elif name.startswith('h') and len(name)==2: raise ValueError('%r invalid - man page headers must be h1 or h2' % name) elif name == 'pre': t = _force_string(tag.code, tag.code) if t.strip(): macro('.RS', '+4n') macro('.nf') w.write(_clean(t).rstrip()) macro('.fi') macro('.RE') w.end_para() elif name == 'p' or name == 'br': g = re.match(re.compile(r'([^\n]*)\n +: +(.*)', re.S), str(tag)) if g: # it's a definition list (which some versions of python-markdown # don't support, including the one in Debian-lenny, so we can't # enable that markdown extension). Fake it up. do_definition(tag) else: text(tag) w.end_para() elif name == 'ul': do_list(tag) else: raise ValueError('non-man-compatible html tag %r' % name) PROD='Untitled' VENDOR='Vendor Name' SECTION='9' GROUPNAME='User Commands' DATE='' AUTHOR='' lines = [] if len(sys.argv) > 1: for n in sys.argv[1:]: lines += open(n).read().decode('utf8').split('\n') else: lines += sys.stdin.read().decode('utf8').split('\n') # parse pandoc-style document headers (not part of markdown) g = re.match(r'^%\s+(.*?)\((.*?)\)\s+(.*)$', lines[0]) if g: PROD = g.group(1) SECTION = g.group(2) VENDOR = g.group(3) lines.pop(0) g = re.match(r'^%\s+(.*?)$', lines[0]) if g: AUTHOR = g.group(1) lines.pop(0) g = re.match(r'^%\s+(.*?)$', lines[0]) if g: DATE = g.group(1) lines.pop(0) g = re.match(r'^%\s+(.*?)$', lines[0]) if g: GROUPNAME = g.group(1) lines.pop(0) inp = '\n'.join(lines) if AUTHOR: inp += ('\n# AUTHOR\n\n%s\n' % AUTHOR).replace('<', '\\<') html = markdown.markdown(inp) soup = BeautifulSoup(html, convertEntities=BeautifulSoup.HTML_ENTITIES) macro('.TH', PROD.upper(), SECTION, DATE, VENDOR, GROUPNAME) macro('.ad', 'l') # left justified macro('.nh') # disable hyphenation for e in soup: do(e)
lgpl-2.1
flgiordano/netcash
+/google-cloud-sdk/lib/googlecloudsdk/calliope/backend.py
1
54356
# Copyright 2013 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Backend stuff for the calliope.cli module. Not to be used by mortals. """ import argparse import os import re import sys from googlecloudsdk.calliope import actions from googlecloudsdk.calliope import arg_parsers from googlecloudsdk.calliope import base from googlecloudsdk.calliope import display from googlecloudsdk.calliope import exceptions from googlecloudsdk.calliope import usage_text from googlecloudsdk.core import cli as core_cli from googlecloudsdk.core import log from googlecloudsdk.core import metrics from googlecloudsdk.core import remote_completion from googlecloudsdk.core.updater import update_manager from googlecloudsdk.core.util import pkg_resources class ArgumentException(Exception): """ArgumentException is for problems with the provided arguments.""" pass class LayoutException(Exception): """LayoutException is for problems with module directory structure.""" pass class CommandLoadFailure(Exception): """An exception for when a command or group module cannot be imported.""" def __init__(self, command, root_exception): self.command = command self.root_exception = root_exception super(CommandLoadFailure, self).__init__( 'Problem loading {command}: {issue}.'.format( command=command, issue=str(root_exception))) class ArgumentParser(argparse.ArgumentParser): """A custom subclass for arg parsing behavior. This overrides the default argparse parser. It only changes a few things, mostly around the printing of usage error messages. """ def __init__(self, *args, **kwargs): self._calliope_command = kwargs.pop('calliope_command') self._flag_collection = kwargs.pop('flag_collection') self._is_group = isinstance(self._calliope_command, CommandGroup) super(ArgumentParser, self).__init__(*args, **kwargs) # Assume we will never have a flag called ----calliope-internal... CIDP = '__calliope_internal_deepest_parser' def GetFlagCollection(self): return self._flag_collection def parse_known_args(self, args=None, namespace=None): """Override's argparse.ArgumentParser's .parse_known_args method.""" args, argv = super(ArgumentParser, self).parse_known_args(args, namespace) # Pass back a reference to the deepest parser used in the parse # as part of the returned args. if not hasattr(args, self.CIDP): setattr(args, self.CIDP, self) return (args, argv) def parse_args(self, args=None, namespace=None): """Override's argparse.ArgumentParser's .parse_args method.""" args, argv = self.parse_known_args(args, namespace) if not argv: return args if hasattr(args, 'implementation_args'): # Workaround for argparse total botch of posix '--'. An # 'implementation_args' positional signals that the current command # expects 0 or more positionals which may be separated from the explicit # flags and positionals by '--'. The first '--' is consumed here. The # extra positionals, if any, are stuffed in args.implementation_args. # This is still not 100% correct. Incredibly, argparse recognizes the # leftmost '--' and does not consume it, and in addition recognizes and # consumes all subsequent '--' args. This is exactly opposite of the # POSIX spec. We would have to intercept more argparse innards here to get # that right, and then take about 100 showers afterwards. It wouldn't be # worth doing that unless someone files a bug. One scenario where it # might pop up is using ssh to run a command that also needs '--' to work: # gcloud compute ssh my-instance -- some-ssh-like-command -- args # Currently the second '--' will not be seen by some-ssh-like-command. start = 1 if argv[0] == '--' else 0 args.implementation_args = argv[start:] return args # Content of these lines differs from argparser's parse_args(). deepest_parser = getattr(args, self.CIDP, self) # Add a message for each unknown argument. For each, try to come up with # a suggestion based on text distance. If one is close enough, print a # 'did you mean' message along with that argument. messages = [] suggester = usage_text.CommandChoiceSuggester() # pylint:disable=protected-access, This is an instance of this class. for flag in deepest_parser._calliope_command.GetAllAvailableFlags(): options = flag.option_strings if options: # This is a flag, add all its names as choices. suggester.AddChoices(options) # Add any aliases as choices as well, but suggest the primary name. aliases = getattr(flag, 'suggestion_aliases', None) if aliases: suggester.AddAliases(aliases, options[0]) for arg in argv: # Only do this for flag names. suggestion = suggester.GetSuggestion(arg) if arg.startswith('-') else None if suggestion: messages.append(arg + " (did you mean '{0}'?)".format(suggestion)) else: messages.append(arg) # If there is a single arg, put it on the same line. If there are multiple # add each on it's own line for better clarity. separator = '\n ' if len(messages) > 1 else ' ' deepest_parser.error('unrecognized arguments:{0}{1}'.format( separator, separator.join(messages))) def _check_value(self, action, value): """Override's argparse.ArgumentParser's ._check_value(action, value) method. Args: action: argparse.Action, The action being checked against this value. value: The command line argument provided that needs to correspond to this action. Raises: argparse.ArgumentError: If the action and value don't work together. """ is_subparser = isinstance(action, CloudSDKSubParsersAction) # When using tab completion, argcomplete monkey patches various parts of # argparse and interferes with the normal argument parsing flow. Here, we # need to set self._orig_class because argcomplete compares this # directly to argparse._SubParsersAction to see if it should recursively # patch this parser. It should really check to see if it is a subclass # but alas, it does not. If we don't set this, argcomplete will not patch, # our subparser and completions below this point wont work. Normally we # would just set this in action.IsValidChoice() but sometimes this # sub-element has already been loaded and is already in action.choices. In # either case, we still need argcomplete to patch this subparser so it # can compute completions below this point. if is_subparser and '_ARGCOMPLETE' in os.environ: # pylint:disable=protected-access, Required by argcomplete. action._orig_class = argparse._SubParsersAction # This is copied from this method in argparse's version of this method. if action.choices is None or value in action.choices: return # We add this to check if we can lazy load the element. if is_subparser and action.IsValidChoice(value): return # Not something we know, raise an error. # pylint:disable=protected-access cli_generator = self._calliope_command._cli_generator missing_components = cli_generator.ComponentsForMissingCommand( self._calliope_command.GetPath() + [value]) if missing_components: msg = ('You do not currently have this command group installed. Using ' 'it requires the installation of components: ' '[{missing_components}]'.format( missing_components=', '.join(missing_components))) update_manager.UpdateManager.EnsureInstalledAndRestart( missing_components, msg=msg) if is_subparser: # We are going to show the usage anyway, which requires loading # everything. Do this here so that choices gets populated. self._calliope_command.LoadAllSubElements() # Command is not valid, see what we can suggest as a fix... message = "Invalid choice: '{0}'.".format(value) # Determine if the requested command is available in another release track. existing_alternatives = self._ExistingAlternativeReleaseTracks(value) if existing_alternatives: message += ('\nThis command is available in one or more alternate ' 'release tracks. Try:\n ') message += '\n '.join(existing_alternatives) # See if the spelling was close to something else that exists here. else: choices = sorted(action.choices) suggester = usage_text.CommandChoiceSuggester(choices) suggester.AddSynonyms() suggestion = suggester.GetSuggestion(value) if suggestion: message += " Did you mean '{0}'?".format(suggestion) else: message += '\n\nValid choices are [{0}].'.format(', '.join(choices)) raise argparse.ArgumentError(action, message) def _ExistingAlternativeReleaseTracks(self, value): """Gets the path of alternatives for the command in other release tracks. Args: value: str, The value being parsed. Returns: [str]: The names of alternate commands that the user may have meant. """ existing_alternatives = [] # Get possible alternatives. # pylint:disable=protected-access cli_generator = self._calliope_command._cli_generator alternates = cli_generator.ReplicateCommandPathForAllOtherTracks( self._calliope_command.GetPath() + [value]) # See if the command is actually enabled in any of those alternative tracks. if alternates: top_element = self._calliope_command._TopCLIElement() # Sort by the release track prefix. for _, command_path in sorted(alternates.iteritems(), key=lambda x: x[0].prefix): if top_element.IsValidSubPath(command_path[1:]): existing_alternatives.append(' '.join(command_path)) return existing_alternatives def error(self, message): """Override's argparse.ArgumentParser's .error(message) method. Specifically, it avoids reprinting the program name and the string "error:". Args: message: str, The error message to print. """ if self._is_group: shorthelp = usage_text.ShortHelpText( self._calliope_command, self._calliope_command.ai) # pylint:disable=protected-access argparse._sys.stderr.write(shorthelp + '\n') else: self.usage = usage_text.GenerateUsage( self._calliope_command, self._calliope_command.ai) # pylint:disable=protected-access self.print_usage(argparse._sys.stderr) log.error('({prog}) {message}'.format(prog=self.prog, message=message)) self.exit(2) def _parse_optional(self, arg_string): """Override's argparse.ArgumentParser's ._parse_optional method. This allows the parser to have leading flags included in the grabbed arguments and stored in the namespace. Args: arg_string: str, The argument string. Returns: The normal return value of argparse.ArgumentParser._parse_optional. """ positional_actions = self._get_positional_actions() option_tuple = super(ArgumentParser, self)._parse_optional(arg_string) # If parse_optional finds an action for this arg_string, use that option. # Note: option_tuple = (action, option_string, explicit_arg) or None known_option = option_tuple and option_tuple[0] if (len(positional_actions) == 1 and positional_actions[0].nargs == argparse.REMAINDER and not known_option): return None return option_tuple def _get_values(self, action, arg_strings): """Override's argparse.ArgumentParser's ._get_values method. This override does not actually change any behavior. We use this hook to grab the flags and arguments that are actually seen at parse time. The resulting namespace has entries for every argument (some with defaults) so we can't know which the user actually typed. Args: action: Action, the action that is being processed. arg_strings: [str], The values provided for this action. Returns: Whatever the parent method returns. """ if action.dest != argparse.SUPPRESS: # Don't look at the action unless it is a real argument or flag. The # suppressed destination indicates that it is a SubParsers action. name = None if action.option_strings: # This is a flag, save the first declared name of the flag. name = action.option_strings[0] elif arg_strings: # This is a positional and there are arguments to consume. Optional # positionals will always get to this method, so we need to ignore the # ones for which a value was not actually provided. If it is provided, # save the metavar name or the destination name. name = action.metavar if action.metavar else action.dest if name: self._flag_collection.append(name) return super(ArgumentParser, self)._get_values(action, arg_strings) # pylint:disable=protected-access class CloudSDKSubParsersAction(argparse._SubParsersAction): """A custom subclass for arg parsing behavior. While the above ArgumentParser overrides behavior for parsing the flags associated with a specific group or command, this class overrides behavior for loading those sub parsers. We use this to intercept the parsing right before it needs to start parsing args for sub groups and we then load the specific sub group it needs. """ def __init__(self, *args, **kwargs): self._calliope_command = kwargs.pop('calliope_command') self._flag_collection = kwargs.pop('flag_collection') super(CloudSDKSubParsersAction, self).__init__(*args, **kwargs) def add_parser(self, name, **kwargs): # Pass the same flag collection down to any sub parsers that are created. kwargs['flag_collection'] = self._flag_collection return super(CloudSDKSubParsersAction, self).add_parser(name, **kwargs) def IsValidChoice(self, choice): """Determines if the given arg is a valid sub group or command. Args: choice: str, The name of the sub element to check. Returns: bool, True if the given item is a valid sub element, False otherwise. """ # When using tab completion, argcomplete monkey patches various parts of # argparse and interferes with the normal argument parsing flow. Usually # it is sufficient to check if the given choice is valid here, but delay # the loading until __call__ is invoked later during the parsing process. # During completion time, argcomplete tries to patch the subparser before # __call__ is called, so nothing has been loaded yet. We need to force # load things here so that there will be something loaded for it to patch. if '_ARGCOMPLETE' in os.environ: self._calliope_command.LoadSubElement(choice) return self._calliope_command.IsValidSubElement(choice) def __call__(self, parser, namespace, values, option_string=None): # This is the name of the arg that is the sub element that needs to be # loaded. parser_name = values[0] # Load that element if it's there. If it's not valid, nothing will be # loaded and normal error handling will take over. if self._calliope_command: self._calliope_command.LoadSubElement(parser_name) super(CloudSDKSubParsersAction, self).__call__( parser, namespace, values, option_string=option_string) class ArgumentInterceptor(object): """ArgumentInterceptor intercepts calls to argparse parsers. The argparse module provides no public way to access a complete list of all arguments, and we need to know these so we can do validation of arguments when this library is used in the python interpreter mode. Argparse itself does the validation when it is run from the command line. Attributes: parser: argparse.Parser, The parser whose methods are being intercepted. allow_positional: bool, Whether or not to allow positional arguments. defaults: {str:obj}, A dict of {dest: default} for all the arguments added. required: [str], A list of the dests for all required arguments. dests: [str], A list of the dests for all arguments. positional_args: [argparse.Action], A list of the positional arguments. flag_args: [argparse.Action], A list of the flag arguments. Raises: ArgumentException: if a positional argument is made when allow_positional is false. """ class ParserData(object): def __init__(self, command_name): self.command_name = command_name self.defaults = {} self.required = [] self.dests = [] self.mutex_groups = {} self.positional_args = [] self.flag_args = [] self.ancestor_flag_args = [] def __init__(self, parser, is_root, cli_generator, allow_positional, data=None, mutex_group_id=None): self.parser = parser self.is_root = is_root self.cli_generator = cli_generator self.allow_positional = allow_positional # If this is an argument group within a command, use the data from the # parser for the entire command. If it is the command itself, create a new # data object and extract the command name from the parser. if data: self.data = data else: self.data = ArgumentInterceptor.ParserData( command_name=self.parser._calliope_command.GetPath()) self.mutex_group_id = mutex_group_id @property def defaults(self): return self.data.defaults @property def required(self): return self.data.required @property def dests(self): return self.data.dests @property def mutex_groups(self): return self.data.mutex_groups @property def positional_args(self): return self.data.positional_args @property def flag_args(self): return self.data.flag_args @property def ancestor_flag_args(self): return self.data.ancestor_flag_args # pylint: disable=g-bad-name def add_argument(self, *args, **kwargs): """add_argument intercepts calls to the parser to track arguments.""" # TODO(user): do not allow short-options without long-options. # we will choose the first option as the name name = args[0] dest = kwargs.get('dest') if not dest: # this is exactly what happens in argparse dest = name.lstrip(self.parser.prefix_chars).replace('-', '_') default = kwargs.get('default') required = kwargs.get('required') # A flag that can only be supplied where it is defined and not propagated to # subcommands. do_not_propagate = kwargs.pop('do_not_propagate', False) # A global flag that is added at each level explicitly because each command # has a different behavior (like -h). is_replicated = kwargs.pop('is_replicated', False) # This is used for help printing. A flag is considered global if it is # added at the root of the CLI tree, or if it is explicitly added to every # command level. is_global = self.is_root or is_replicated # True if this should be marked as a commonly used flag. is_common = kwargs.pop('is_common', False) # Any alias this flag has for the purposes of the "did you mean" # suggestions. suggestion_aliases = kwargs.pop('suggestion_aliases', []) # The resource name for the purposes of doing remote completion. completion_resource = kwargs.pop('completion_resource', None) # An explicit command to run for remote completion instead of the default # for this resource type. list_command_path = kwargs.pop('list_command_path', None) positional = not name.startswith('-') if positional: if not self.allow_positional: # TODO(user): More informative error message here about which group # the problem is in. raise ArgumentException( 'Illegal positional argument [{0}] for command [{1}]'.format( name, self.data.command_name)) if '-' in name: raise ArgumentException( "Positional arguments cannot contain a '-'. Illegal argument [{0}] " 'for command [{1}]'.format(name, self.data.command_name)) if is_common: raise ArgumentException( 'Positional argument [{0}] cannot be marked as a common flag in ' 'command [{1}]'.format(name, self.data.command_name)) if suggestion_aliases: raise ArgumentException( 'Positional argument [{0}] cannot have suggestion aliases in ' 'command [{1}]'.format(name, self.data.command_name)) self.defaults[dest] = default if required: self.required.append(dest) self.dests.append(dest) if self.mutex_group_id: self.mutex_groups[dest] = self.mutex_group_id if positional and 'metavar' not in kwargs: kwargs['metavar'] = name.upper() added_argument = self.parser.add_argument(*args, **kwargs) self._AddRemoteCompleter(added_argument, completion_resource, list_command_path) if positional: self.positional_args.append(added_argument) else: added_argument.do_not_propagate = do_not_propagate added_argument.is_replicated = is_replicated added_argument.is_global = is_global added_argument.is_common = is_common added_argument.suggestion_aliases = suggestion_aliases self.flag_args.append(added_argument) inverted_flag = self._AddInvertedBooleanFlagIfNecessary( added_argument, name, dest, kwargs) if inverted_flag: inverted_flag.do_not_propagate = do_not_propagate inverted_flag.is_replicated = is_replicated inverted_flag.is_global = is_global inverted_flag.is_common = is_common # Don't add suggestion aliases for the inverted flag. It can only map # to one or the other. self.flag_args.append(inverted_flag) return added_argument # pylint: disable=redefined-builtin def register(self, registry_name, value, object): return self.parser.register(registry_name, value, object) def set_defaults(self, **kwargs): return self.parser.set_defaults(**kwargs) def get_default(self, dest): return self.parser.get_default(dest) def add_argument_group(self, *args, **kwargs): new_parser = self.parser.add_argument_group(*args, **kwargs) return ArgumentInterceptor(parser=new_parser, is_root=self.is_root, cli_generator=self.cli_generator, allow_positional=self.allow_positional, data=self.data) def add_mutually_exclusive_group(self, **kwargs): new_parser = self.parser.add_mutually_exclusive_group(**kwargs) return ArgumentInterceptor(parser=new_parser, is_root=self.is_root, cli_generator=self.cli_generator, allow_positional=self.allow_positional, data=self.data, mutex_group_id=id(new_parser)) def AddFlagActionFromAncestors(self, action): """Add a flag action to this parser, but segregate it from the others. Segregating the action allows automatically generated help text to ignore this flag. Args: action: argparse.Action, The action for the flag being added. """ # pylint:disable=protected-access, simply no other way to do this. self.parser._add_action(action) # explicitly do this second, in case ._add_action() fails. self.data.ancestor_flag_args.append(action) def _AddInvertedBooleanFlagIfNecessary(self, added_argument, name, dest, original_kwargs): """Determines whether to create the --no-* flag and adds it to the parser. Args: added_argument: The argparse argument that was previously created. name: str, The name of the flag. dest: str, The dest field of the flag. original_kwargs: {str: object}, The original set of kwargs passed to the ArgumentInterceptor. Returns: The new argument that was added to the parser or None, if it was not necessary to create a new argument. """ action = original_kwargs.get('action') # There are a few legitimate explicit --no-foo flags. should_invert, prop = self._ShouldInvertBooleanFlag(name, action) if not should_invert: return default = original_kwargs.get('default', False) help_str = original_kwargs.get('help') # Add hidden --no-foo for the --foo Boolean flag. The inverted flag will # have the same dest and mutually exclusive group as the original flag. inverted_name = '--no-' + name[2:] # Explicit default=None yields the 'Use to disable.' text. if prop or (default in (True, None) and help_str != argparse.SUPPRESS): if prop: inverted_help = (' Overrides the default *{0}* property value' ' for this command invocation. Use *{1}* to' ' disable.'.format(prop.name, inverted_name)) elif default: inverted_help = ' Enabled by default, use *{0}* to disable.'.format( inverted_name) else: inverted_help = ' Use *{0}* to disable.'.format(inverted_name) # calliope.markdown.MarkdownGenerator._Details() checks and appends # arg.inverted_help to the detailed help markdown. We can't do that # here because detailed_help may not have been set yet. setattr(added_argument, 'inverted_help', inverted_help) kwargs = dict(original_kwargs) if action == 'store_true': action = 'store_false' elif action == 'store_false': action = 'store_true' kwargs['action'] = action if not kwargs.get('dest'): kwargs['dest'] = dest kwargs['help'] = argparse.SUPPRESS return self.parser.add_argument(inverted_name, **kwargs) def _ShouldInvertBooleanFlag(self, name, action): """Checks if flag name with action is a Boolean flag to invert. Args: name: str, The flag name. action: argparse.Action, The argparse action. Returns: (False, None) if flag is not a Boolean flag or should not be inverted, (True, property) if flag is a Boolean flag associated with a property, otherwise (True, None) if flag is a pure Boolean flag. """ if not name.startswith('--'): return False, None if name.startswith('--no-'): # --no-no-* is a no no. return False, None if '--no-' + name[2:] in self.parser._option_string_actions: # Don't override explicit --no-* inverted flag. return False, None if action in ('store_true', 'store_false'): return True, None prop = getattr(action, 'boolean_property', None) if prop: return True, prop # Not a Boolean flag. return False, None def _AddRemoteCompleter(self, added_argument, completion_resource, list_command_path): """Adds a remote completer to the given argument if necessary. Args: added_argument: The argparse argument that was previously created. completion_resource: str, The name of the resource that this argument corresponds to. list_command_path: str, The explicit calliope command to run to get the completions if you want to override the default for the given resource type. """ if not completion_resource: return if not list_command_path: list_command_path = completion_resource # alpha and beta commands need to specify list_command_path if (list_command_path.startswith('alpha') or list_command_path.startswith('beta')): # if list_command_path not specified don't add the completer completion_resource = None else: list_command_path = self._LowerCaseWithDashes(completion_resource) if completion_resource: # add a remote completer added_argument.completer = ( remote_completion.RemoteCompletion.GetCompleterForResource( completion_resource, self.cli_generator.Generate, command_line=list_command_path)) added_argument.completion_resource = completion_resource def _LowerCaseWithDashes(self, name): # Uses two passes to handle all-upper initialisms, such as fooBARBaz s1 = re.sub('(.)([A-Z][a-z]+)', r'\1-\2', name) s2 = re.sub('([a-z0-9])([A-Z])', r'\1-\2', s1).lower() return s2 class ConfigHooks(object): """This class holds function hooks for context and config loading/saving.""" def __init__(self, load_context=None, context_filters=None): """Create a new object with the given hooks. Args: load_context: a function returns the context to be sent to commands. context_filters: a list of functions that take (contex, args), that will be called in order before a command is run. They are described in the README under the heading GROUP SPECIFICATION. """ self.load_context = load_context if load_context else lambda: {} self.context_filters = context_filters if context_filters else [] def OverrideWithBase(self, group_base): """Get a new ConfigHooks object with overridden functions based on module. If module defines any of the function, they will be used instead of what is in this object. Anything that is not defined will use the existing behavior. Args: group_base: The base.Group class corresponding to the group. Returns: A new ConfigHooks object updated with any newly found hooks """ def ContextFilter(context, http_func, args): group = group_base(http_func) group.Filter(context, args) return group # We want the new_context_filters to be a completely new list, if there is # a change. new_context_filters = self.context_filters + [ContextFilter] return ConfigHooks(load_context=self.load_context, context_filters=new_context_filters) class CommandCommon(object): """A base class for CommandGroup and Command. It is responsible for extracting arguments from the modules and does argument validation, since this is always the same for groups and commands. """ def __init__(self, common_type, path, release_track, cli_generator, config_hooks, parser_group, allow_positional_args, parent_group): """Create a new CommandCommon. Args: common_type: base._Command, The actual loaded user written command or group class. path: [str], Similar to module_path, but is the path to this command or group with respect to the CLI itself. This path should be used for things like error reporting when a specific element in the tree needs to be referenced. release_track: base.ReleaseTrack, The release track (ga, beta, alpha) that this command group is in. This will apply to all commands under it. cli_generator: cli.CLILoader, The builder used to generate this CLI. config_hooks: a ConfigHooks object to use for loading context. parser_group: argparse.Parser, The parser that this command or group will live in. allow_positional_args: bool, True if this command can have positional arguments. parent_group: CommandGroup, The parent of this command or group. None if at the root. """ self._config_hooks = config_hooks self._parent_group = parent_group self.name = path[-1] # For the purposes of argparse and the help, we should use dashes. self.cli_name = self.name.replace('_', '-') log.debug('Loaded Command Group: %s', path) path[-1] = self.cli_name self._path = path self.dotted_name = '.'.join(path) self._cli_generator = cli_generator self._common_type = common_type self._common_type._cli_generator = cli_generator self._common_type._release_track = release_track if parent_group: # Propagate down the hidden attribute. if parent_group.IsHidden(): self._common_type._is_hidden = True # TODO(user): This is going to go away once we remove the explicit # Alpha and Beta decorators for commands. Once the commands show up # under the correct track, the help will use the regular release track # for annotations (b/19406151). legacy_release_track = parent_group._common_type._legacy_release_track if legacy_release_track and not self._common_type._legacy_release_track: self._common_type._legacy_release_track = legacy_release_track self.detailed_help = getattr(self._common_type, 'detailed_help', {}) self._ExtractHelpStrings(self._common_type.__doc__) self._AssignParser( parser_group=parser_group, allow_positional_args=allow_positional_args) def ReleaseTrack(self, for_help=False): """Gets the release track of this command or group.""" return self._common_type.ReleaseTrack(for_help=for_help) def IsHidden(self): """Gets the hidden status of this command or group.""" return self._common_type.IsHidden() def IsRoot(self): """Returns True if this is the root element in the CLI tree.""" return not self._parent_group def _TopCLIElement(self): """Gets the top group of this CLI.""" if self.IsRoot(): return self return self._parent_group._TopCLIElement() def _ExtractHelpStrings(self, docstring): """Extracts short help, long help and man page index from a docstring. Sets self.short_help, self.long_help and self.index_help and adds release track tags if needed. Args: docstring: The docstring from which short and long help are to be taken """ self.short_help, self.long_help = usage_text.ExtractHelpStrings(docstring) if 'brief' in self.detailed_help: self.short_help = self.detailed_help['brief'] if self.short_help and not self.short_help.endswith('.'): self.short_help += '.' self.index_help = self.short_help if len(self.index_help) > 1: if self.index_help[0].isupper() and not self.index_help[1].isupper(): self.index_help = self.index_help[0].lower() + self.index_help[1:] if self.index_help[-1] == '.': self.index_help = self.index_help[:-1] # Add an annotation to the help strings to mark the release stage. tag = self.ReleaseTrack(for_help=True).help_tag if tag: self.short_help = tag + self.short_help self.long_help = tag + self.long_help # TODO(user):b/21208128: Drop these 4 lines. prefix = self.ReleaseTrack(for_help=True).prefix if len(self._path) < 2 or self._path[1] != prefix: self.index_help = tag + self.index_help def _AssignParser(self, parser_group, allow_positional_args): """Assign a parser group to model this Command or CommandGroup. Args: parser_group: argparse._ArgumentGroup, the group that will model this command or group's arguments. allow_positional_args: bool, Whether to allow positional args for this group or not. """ if not parser_group: # This is the root of the command tree, so we create the first parser. self._parser = ArgumentParser( description=self.long_help, add_help=False, prog=self.dotted_name, calliope_command=self, flag_collection=[]) else: # This is a normal sub group, so just add a new subparser to the existing # one. self._parser = parser_group.add_parser( self.cli_name, help=self.short_help, description=self.long_help, add_help=False, prog=self.dotted_name, calliope_command=self) self._sub_parser = None self.ai = ArgumentInterceptor( parser=self._parser, is_root=not parser_group, cli_generator=self._cli_generator, allow_positional=allow_positional_args) self.ai.add_argument( '-h', action=actions.ShortHelpAction(self), is_replicated=True, is_common=True, help='Print a summary help and exit.') self.ai.add_argument( '--help', action=actions.RenderDocumentAction(self, '--help'), is_replicated=True, is_common=True, help='Display detailed help.') self.ai.add_argument( '--document', action=actions.RenderDocumentAction(self), is_replicated=True, nargs=1, metavar='ATTRIBUTES', type=arg_parsers.ArgDict(), help=argparse.SUPPRESS) self._AcquireArgs() def IsValidSubPath(self, command_path): """Determines if the given sub command path is valid from this node. Args: command_path: [str], The pieces of the command path. Returns: True, if the given path parts exist under this command or group node. False, if the sub path does not lead to a valid command or group. """ current = self for part in command_path: current = current.LoadSubElement(part) if not current: return False return True def AllSubElements(self): """Gets all the sub elements of this group. Returns: set(str), The names of all sub groups or commands under this group. """ return [] def LoadAllSubElements(self, recursive=False): """Load all the sub groups and commands of this group.""" pass def LoadSubElement(self, name, allow_empty=False): """Load a specific sub group or command. Args: name: str, The name of the element to load. allow_empty: bool, True to allow creating this group as empty to start with. Returns: _CommandCommon, The loaded sub element, or None if it did not exist. """ pass def GetPath(self): return self._path def GetShortHelp(self): return usage_text.ShortHelpText(self, self.ai) def GetSubCommandHelps(self): return {} def GetSubGroupHelps(self): return {} def _GetModuleFromPath(self, module_dir, module_path, path, construction_id): """Import the module and dig into it to return the namespace we are after. Import the module relative to the top level directory. Then return the actual module corresponding to the last bit of the path. Args: module_dir: str, The path to the tools directory that this command or group lives within. module_path: [str], The command group names that brought us down to this command group or command from the top module directory. path: [str], The same as module_path but with the groups named as they will be in the CLI. construction_id: str, A unique identifier for the CLILoader that is being constructed. Returns: The imported module. """ # Make sure this module name never collides with any real module name. # Use the CLI naming path, so values are always unique. name_to_give = '__calliope__command__.{construction_id}.{name}'.format( construction_id=construction_id, name='.'.join(path).replace('-', '_')) try: return pkg_resources.GetModuleFromPath( name_to_give, os.path.join(module_dir, *module_path)) # pylint:disable=broad-except, We really do want to catch everything here, # because if any exceptions make it through for any single command or group # file, the whole CLI will not work. Instead, just log whatever it is. except Exception as e: _, _, exc_traceback = sys.exc_info() raise CommandLoadFailure('.'.join(path), e), None, exc_traceback def _AcquireArgs(self): """Calls the functions to register the arguments for this module.""" # A Command subclass can define a _Flags() method. self._common_type._Flags(self.ai) # A command implementation can optionally define an Args() method. self._common_type.Args(self.ai) if self._parent_group: # Add parent flags to children, if they aren't represented already for flag in self._parent_group.GetAllAvailableFlags(): if flag.is_replicated: # Each command or group gets its own unique help flags. continue if flag.do_not_propagate: # Don't propagate down flags that only apply to the group but not to # subcommands. continue if flag.required: # It is not easy to replicate required flags to subgroups and # subcommands, since then there would be two+ identical required # flags, and we'd want only one of them to be necessary. continue try: self.ai.AddFlagActionFromAncestors(flag) except argparse.ArgumentError: raise ArgumentException( 'repeated flag in {command}: {flag}'.format( command=self.dotted_name, flag=flag.option_strings)) def GetAllAvailableFlags(self): return self.ai.flag_args + self.ai.ancestor_flag_args def GetSpecificFlags(self): return self.ai.flag_args class CommandGroup(CommandCommon): """A class to encapsulate a group of commands.""" def __init__(self, module_dir, module_path, path, release_track, construction_id, cli_generator, parser_group, config_hooks, parent_group=None, allow_empty=False): """Create a new command group. Args: module_dir: always the root of the whole command tree module_path: a list of command group names that brought us down to this command group from the top module directory path: similar to module_path, but is the path to this command group with respect to the CLI itself. This path should be used for things like error reporting when a specific element in the tree needs to be referenced release_track: base.ReleaseTrack, The release track (ga, beta, alpha) that this command group is in. This will apply to all commands under it. construction_id: str, A unique identifier for the CLILoader that is being constructed. cli_generator: cli.CLILoader, The builder used to generate this CLI. parser_group: the current argparse parser, or None if this is the root command group. The root command group will allocate the initial top level argparse parser. config_hooks: a ConfigHooks object to use for loading context parent_group: CommandGroup, The parent of this group. None if at the root. allow_empty: bool, True to allow creating this group as empty to start with. Raises: LayoutException: if the module has no sub groups or commands """ # pylint:disable=protected-access, The base module is effectively an # extension of calliope, and we want to leave _Common private so people # don't extend it directly. common_type = base._Common.FromModule( self._GetModuleFromPath(module_dir, module_path, path, construction_id), release_track, is_command=False) super(CommandGroup, self).__init__( common_type, path=path, release_track=release_track, cli_generator=cli_generator, config_hooks=config_hooks, allow_positional_args=False, parser_group=parser_group, parent_group=parent_group) self._module_dir = module_dir self._module_path = module_path self._construction_id = construction_id self._config_hooks = self._config_hooks.OverrideWithBase(self._common_type) # find sub groups and commands self.groups = {} self.commands = {} self._groups_to_load = {} self._commands_to_load = {} self._unloadable_elements = set() self._FindSubElements() if (not allow_empty and not self._groups_to_load and not self._commands_to_load): raise LayoutException('Group %s has no subgroups or commands' % self.dotted_name) # Initialize the sub-parser so sub groups can be found. self.SubParser() def _FindSubElements(self): """Final all the sub groups and commands under this group. Raises: LayoutException: if there is a command or group with an illegal name. """ location = os.path.join(self._module_dir, *self._module_path) groups, commands = pkg_resources.ListPackage(location) for collection in [groups, commands]: for name in collection: if re.search('[A-Z]', name): raise LayoutException('Commands and groups cannot have capital ' 'letters: %s.' % name) for group_info in self._GetSubPathForNames(groups): self.AddSubGroup(group_info) for command_info in self._GetSubPathForNames(commands): self.AddSubCommand(command_info) def _GetSubPathForNames(self, names): """Gets a list of (module path, path) for the sub names. Args: names: [str], The names of the sub groups or commands the paths are for. Returns: A list of tuples of (module_dir, module_path, name, release_track) for the given names. These terms are that as used by the constructor of CommandGroup and Command. """ return [(self._module_dir, self._module_path + [name], name, self.ReleaseTrack(for_help=False)) for name in names] def AddSubGroup(self, group_info): """Merges another command group under this one. If we load command groups for alternate locations, this method is used to make those extra sub groups fall under this main group in the CLI. Args: group_info: A tuple of (module_dir, module_path, name, release_track). The arguments used by the LoadSubElement() method for lazy loading this group. """ name = group_info[2] self._groups_to_load[name] = group_info def AddSubCommand(self, command_info): """Merges another command group under this one. If we load commands for alternate locations, this method is used to make those extra sub commands fall under this main group in the CLI. Args: command_info: A tuple of (module_dir, module_path, name, release_track). The arguments used by the LoadSubElement() method for lazy loading this command. """ name = command_info[2] self._commands_to_load[name] = command_info def CopyAllSubElementsTo(self, other_group, ignore): """Copies all the sub groups and commands from this group to the other. Args: other_group: CommandGroup, The other group to populate. ignore: set(str), Names of elements not to copy. """ collections_to_update = [ (self._groups_to_load, other_group._groups_to_load), (self._commands_to_load, other_group._commands_to_load)] for src, dst in collections_to_update: for name, info in src.iteritems(): if name in ignore: continue (module_dir, module_path, name, unused_track) = info dst[name] = (module_dir, module_path, name, other_group.ReleaseTrack(for_help=False)) def SubParser(self): """Gets or creates the argparse sub parser for this group. Returns: The argparse subparser that children of this group should register with. If a sub parser has not been allocated, it is created now. """ if not self._sub_parser: self._sub_parser = self._parser.add_subparsers( action=CloudSDKSubParsersAction, calliope_command=self, flag_collection=self._parser._flag_collection) return self._sub_parser def AllSubElements(self): """Gets all the sub elements of this group. Returns: set(str), The names of all sub groups or commands under this group. """ return (set(self._groups_to_load.keys()) | set(self._commands_to_load.keys())) def IsValidSubElement(self, name): """Determines if the given name is a valid sub group or command. Args: name: str, The name of the possible sub element. Returns: bool, True if the name is a valid sub element of this group. """ return bool(self.LoadSubElement(name)) def LoadAllSubElements(self, recursive=False): """Load all the sub groups and commands of this group.""" for name in self.AllSubElements(): element = self.LoadSubElement(name) if element and recursive: element.LoadAllSubElements(recursive=recursive) def LoadSubElement(self, name, allow_empty=False): """Load a specific sub group or command. Args: name: str, The name of the element to load. allow_empty: bool, True to allow creating this group as empty to start with. Returns: _CommandCommon, The loaded sub element, or None if it did not exist. """ name = name.replace('-', '_') # See if this element has already been loaded. existing = self.groups.get(name, None) if not existing: existing = self.commands.get(name, None) if existing: return existing if name in self._unloadable_elements: return None element = None try: if name in self._groups_to_load: (module_dir, module_path, name, track) = self._groups_to_load[name] element = CommandGroup( module_dir, module_path, self._path + [name], track, self._construction_id, self._cli_generator, self.SubParser(), self._config_hooks, parent_group=self, allow_empty=allow_empty) self.groups[element.name] = element elif name in self._commands_to_load: (module_dir, module_path, name, track) = self._commands_to_load[name] element = Command( module_dir, module_path, self._path + [name], track, self._construction_id, self._cli_generator, self._config_hooks, self.SubParser(), parent_group=self) self.commands[element.name] = element except base.ReleaseTrackNotImplementedException as e: self._unloadable_elements.add(name) log.debug(e) return element def GetSubCommandHelps(self): return dict( (item.cli_name, usage_text.HelpInfo(help_text=item.short_help, is_hidden=item.IsHidden(), release_track=item.ReleaseTrack)) for item in self.commands.values()) def GetSubGroupHelps(self): return dict( (item.cli_name, usage_text.HelpInfo(help_text=item.short_help, is_hidden=item.IsHidden(), release_track=item.ReleaseTrack(for_help=True))) for item in self.groups.values()) class Command(CommandCommon): """A class that encapsulates the configuration for a single command.""" def __init__(self, module_dir, module_path, path, release_track, construction_id, cli_generator, config_hooks, parser_group, parent_group=None): """Create a new command. Args: module_dir: str, The root of the command tree. module_path: a list of command group names that brought us down to this command from the top module directory path: similar to module_path, but is the path to this command with respect to the CLI itself. This path should be used for things like error reporting when a specific element in the tree needs to be referenced. release_track: base.ReleaseTrack, The release track (ga, beta, alpha) that this command group is in. This will apply to all commands under it. construction_id: str, A unique identifier for the CLILoader that is being constructed. cli_generator: cli.CLILoader, The builder used to generate this CLI. config_hooks: a ConfigHooks object to use for loading context parser_group: argparse.Parser, The parser to be used for this command. parent_group: CommandGroup, The parent of this command. """ # pylint:disable=protected-access, The base module is effectively an # extension of calliope, and we want to leave _Common private so people # don't extend it directly. common_type = base._Common.FromModule( self._GetModuleFromPath(module_dir, module_path, path, construction_id), release_track, is_command=True) super(Command, self).__init__( common_type, path=path, release_track=release_track, cli_generator=cli_generator, config_hooks=config_hooks, allow_positional_args=True, parser_group=parser_group, parent_group=parent_group) self._parser.set_defaults(cmd_func=self.Run, command_path=self._path) def Run(self, cli, args): """Run this command with the given arguments. Args: cli: The cli.CLI object for this command line tool. args: The arguments for this command as a namespace. Returns: The object returned by the module's Run() function. Raises: exceptions.Error: if thrown by the Run() function. exceptions.ExitCodeNoError: if the command is returning with a non-zero exit code. """ metrics.Loaded() tool_context = self._config_hooks.load_context() last_group = None for context_filter in self._config_hooks.context_filters: last_group = context_filter(tool_context, core_cli.Http, args) command_instance = self._common_type( cli=cli, context=tool_context, group=last_group, http_func=core_cli.Http, format_string=args.format or 'yaml') log.debug('Running %s with %s.', self.dotted_name, args) resources = command_instance.Run(args) resources = display.Displayer(command_instance, args, resources).Display() metrics.Ran() if command_instance.exit_code != 0: raise exceptions.ExitCodeNoError(exit_code=command_instance.exit_code) return resources
bsd-3-clause
superdesk/superdesk-aap
server/aap/publish/formatters/aap_nitf_formatter.py
2
5094
# -*- coding: utf-8; -*- # # This file is part of Superdesk. # # Copyright 2013, 2014 Sourcefabric z.u. and contributors. # # For the full copyright and license information, please see the # AUTHORS and LICENSE files distributed with this source code, or # at https://www.sourcefabric.org/superdesk/license import superdesk from superdesk.publish.formatters.nitf_formatter import NITFFormatter from superdesk.errors import FormatterError from superdesk.metadata.item import ITEM_TYPE, CONTENT_TYPE, SIGN_OFF from lxml import etree as etree from lxml.etree import SubElement import re from .unicodetoascii import to_ascii from superdesk.etree import parse_html, to_string from superdesk.text_utils import get_text class AAPNITFFormatter(NITFFormatter): def format(self, article, subscriber, codes=None): try: pub_seq_num = superdesk.get_resource_service('subscribers').generate_sequence_number(subscriber) nitf = self.get_nitf(article, subscriber, pub_seq_num) return [{'published_seq_num': pub_seq_num, 'formatted_item': etree.tostring(nitf, encoding='ascii').decode('ascii'), 'item_encoding': 'ascii'}] except Exception as ex: raise FormatterError.nitfFormatterError(ex, subscriber) def can_format(self, format_type, article): return format_type == 'aap_nitf' and \ article[ITEM_TYPE] in (CONTENT_TYPE.TEXT, CONTENT_TYPE.PREFORMATTED) def _format_meta(self, article, head, destination, pub_seq_num): """ Appends <meta> elements to <head> """ super()._format_meta(article, head, destination, pub_seq_num) if 'anpa_category' in article and article['anpa_category'] is not None and len( article.get('anpa_category')) > 0: SubElement(head, 'meta', {'name': 'anpa-category', 'content': article.get('anpa_category')[0].get('qcode', '')}) SubElement(head, 'meta', {'name': 'anpa-sequence', 'content': str(pub_seq_num)}) SubElement(head, 'meta', {'name': 'anpa-keyword', 'content': self.append_legal(article)}) if article.get('anpa_take_key'): SubElement(head, 'meta', {'name': 'anpa-takekey', 'content': article.get('anpa_take_key', '')}) original_creator = superdesk.get_resource_service('users').find_one(req=None, _id=article.get('original_creator', '')) if original_creator: SubElement(head, 'meta', {'name': 'aap-original-creator', 'content': original_creator.get('username')}) version_creator = superdesk.get_resource_service('users').find_one(req=None, _id=article.get('version_creator', '')) if version_creator: SubElement(head, 'meta', {'name': 'aap-version-creator', 'content': version_creator.get('username')}) if article.get('task', {}).get('desk') is not None: desk = superdesk.get_resource_service('desks').find_one(_id=article.get('task', {}).get('desk'), req=None) SubElement(head, 'meta', {'name': 'aap-desk', 'content': desk.get('name', '')}) if article.get('task', {}).get('stage') is not None: stage = superdesk.get_resource_service('stages').find_one(_id=article.get('task', {}).get('stage'), req=None) if stage is not None: SubElement(head, 'meta', {'name': 'aap-stage', 'content': stage.get('name', '')}) SubElement(head, 'meta', {'name': 'aap-source', 'content': article.get('source', '')}) SubElement(head, 'meta', {'name': 'aap-original-source', 'content': article.get('original_source', '')}) if 'place' in article and article['place'] is not None and len(article.get('place', [])) > 0: SubElement(head, 'meta', {'name': 'aap-place', 'content': article.get('place')[0]['qcode']}) if SIGN_OFF in article: SubElement(head, 'meta', {'name': 'aap-signoff', 'content': article.get(SIGN_OFF, '') or ''}) def _format_meta_priority(self, article, head): if 'priority' in article: SubElement(head, 'meta', {'name': 'aap-priority', 'content': str(article['priority'])}) def map_html_to_xml(self, element, html): """ Map the html text tags to xml :param element: The xml element to populate :param html: the html to parse the text from :return: """ html = html.replace('<br>', '<br/>').replace('</br>', '') html = re.sub('[\x00-\x09\x0b\x0c\x0e-\x1f]', '', html) html = html.replace('\n', ' ') html = re.sub(r'\s\s+', ' ', html) parsed = parse_html(html, content='html') for tag in parsed.xpath('/html/div/child::*'): p = etree.Element('p') p.text = to_ascii(get_text(to_string(tag, method='html'), content='html')) element.append(p)
agpl-3.0
BayanGroup/sentry
src/sentry/migrations/0015_auto__add_field_message_project__add_field_messagecountbyminute_projec.py
36
14224
# encoding: utf-8 import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Removing unique constraint on 'GroupedMessage', fields ['checksum', 'logger', 'view'] db.delete_unique('sentry_groupedmessage', ['checksum', 'logger', 'view']) # Removing unique constraint on 'MessageFilterValue', fields ['group', 'value', 'key'] db.delete_unique('sentry_messagefiltervalue', ['group_id', 'value', 'key']) # Removing unique constraint on 'FilterValue', fields ['key', 'value'] db.delete_unique('sentry_filtervalue', ['key', 'value']) # Removing unique constraint on 'MessageCountByMinute', fields ['date', 'group'] db.delete_unique('sentry_messagecountbyminute', ['date', 'group_id']) # Adding field 'Message.project' db.add_column('sentry_message', 'project', self.gf('sentry.db.models.fields.FlexibleForeignKey')(to=orm['sentry.Project'], null=True), keep_default=False) # Adding field 'MessageCountByMinute.project' db.add_column('sentry_messagecountbyminute', 'project', self.gf('sentry.db.models.fields.FlexibleForeignKey')(to=orm['sentry.Project'], null=True), keep_default=False) # Adding unique constraint on 'MessageCountByMinute', fields ['project', 'date', 'group'] db.create_unique('sentry_messagecountbyminute', ['project_id', 'date', 'group_id']) # Adding field 'FilterValue.project' db.add_column('sentry_filtervalue', 'project', self.gf('sentry.db.models.fields.FlexibleForeignKey')(to=orm['sentry.Project'], null=True), keep_default=False) # Adding unique constraint on 'FilterValue', fields ['project', 'value', 'key'] db.create_unique('sentry_filtervalue', ['project_id', 'value', 'key']) # Adding field 'MessageFilterValue.project' db.add_column('sentry_messagefiltervalue', 'project', self.gf('sentry.db.models.fields.FlexibleForeignKey')(to=orm['sentry.Project'], null=True), keep_default=False) # Adding unique constraint on 'MessageFilterValue', fields ['project', 'group', 'value', 'key'] db.create_unique('sentry_messagefiltervalue', ['project_id', 'group_id', 'value', 'key']) # Adding field 'GroupedMessage.project' db.add_column('sentry_groupedmessage', 'project', self.gf('sentry.db.models.fields.FlexibleForeignKey')(to=orm['sentry.Project'], null=True), keep_default=False) # Adding unique constraint on 'GroupedMessage', fields ['project', 'checksum', 'logger', 'view'] db.create_unique('sentry_groupedmessage', ['project_id', 'checksum', 'logger', 'view']) def backwards(self, orm): # Removing unique constraint on 'GroupedMessage', fields ['project', 'checksum', 'logger', 'view'] db.delete_unique('sentry_groupedmessage', ['project_id', 'checksum', 'logger', 'view']) # Removing unique constraint on 'MessageFilterValue', fields ['project', 'group', 'value', 'key'] db.delete_unique('sentry_messagefiltervalue', ['project_id', 'group_id', 'value', 'key']) # Removing unique constraint on 'FilterValue', fields ['project', 'value', 'key'] db.delete_unique('sentry_filtervalue', ['project_id', 'value', 'key']) # Removing unique constraint on 'MessageCountByMinute', fields ['project', 'date', 'group'] db.delete_unique('sentry_messagecountbyminute', ['project_id', 'date', 'group_id']) # Deleting field 'Message.project' db.delete_column('sentry_message', 'project_id') # Deleting field 'MessageCountByMinute.project' db.delete_column('sentry_messagecountbyminute', 'project_id') # Adding unique constraint on 'MessageCountByMinute', fields ['date', 'group'] db.create_unique('sentry_messagecountbyminute', ['date', 'group_id']) # Deleting field 'FilterValue.project' db.delete_column('sentry_filtervalue', 'project_id') # Adding unique constraint on 'FilterValue', fields ['key', 'value'] db.create_unique('sentry_filtervalue', ['key', 'value']) # Deleting field 'MessageFilterValue.project' db.delete_column('sentry_messagefiltervalue', 'project_id') # Adding unique constraint on 'MessageFilterValue', fields ['group', 'value', 'key'] db.create_unique('sentry_messagefiltervalue', ['group_id', 'value', 'key']) # Deleting field 'GroupedMessage.project' db.delete_column('sentry_groupedmessage', 'project_id') # Adding unique constraint on 'GroupedMessage', fields ['checksum', 'logger', 'view'] db.create_unique('sentry_groupedmessage', ['checksum', 'logger', 'view']) models = { 'sentry.user': { 'Meta': {'object_name': 'User', 'db_table': "'auth_user'"}, 'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}) }, 'contenttypes.contenttype': { 'Meta': {'ordering': "('name',)", 'unique_together': "(('app_label', 'model'),)", 'object_name': 'ContentType', 'db_table': "'django_content_type'"}, 'app_label': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'model': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}) }, 'sentry.filtervalue': { 'Meta': {'unique_together': "(('project', 'key', 'value'),)", 'object_name': 'FilterValue'}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'project': ('sentry.db.models.fields.FlexibleForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '200'}) }, 'sentry.groupedmessage': { 'Meta': {'unique_together': "(('project', 'logger', 'view', 'checksum'),)", 'object_name': 'GroupedMessage'}, 'checksum': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'class_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '128', 'null': 'True', 'blank': 'True'}), 'data': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'first_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'last_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'level': ('django.db.models.fields.PositiveIntegerField', [], {'default': '40', 'db_index': 'True', 'blank': 'True'}), 'logger': ('django.db.models.fields.CharField', [], {'default': "'root'", 'max_length': '64', 'db_index': 'True', 'blank': 'True'}), 'message': ('django.db.models.fields.TextField', [], {}), 'project': ('sentry.db.models.fields.FlexibleForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'score': ('django.db.models.fields.IntegerField', [], {'default': '0'}), 'status': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0', 'db_index': 'True'}), 'times_seen': ('django.db.models.fields.PositiveIntegerField', [], {'default': '1', 'db_index': 'True'}), 'traceback': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'view': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}) }, 'sentry.message': { 'Meta': {'object_name': 'Message'}, 'checksum': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'class_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '128', 'null': 'True', 'blank': 'True'}), 'data': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'datetime': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'group': ('sentry.db.models.fields.FlexibleForeignKey', [], {'blank': 'True', 'related_name': "'message_set'", 'null': 'True', 'to': "orm['sentry.GroupedMessage']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'level': ('django.db.models.fields.PositiveIntegerField', [], {'default': '40', 'db_index': 'True', 'blank': 'True'}), 'logger': ('django.db.models.fields.CharField', [], {'default': "'root'", 'max_length': '64', 'db_index': 'True', 'blank': 'True'}), 'message': ('django.db.models.fields.TextField', [], {}), 'message_id': ('django.db.models.fields.CharField', [], {'max_length': '32', 'unique': 'True', 'null': 'True'}), 'project': ('sentry.db.models.fields.FlexibleForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'server_name': ('django.db.models.fields.CharField', [], {'max_length': '128', 'db_index': 'True'}), 'site': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True', 'db_index': 'True'}), 'traceback': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'url': ('django.db.models.fields.URLField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'view': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}) }, 'sentry.messagecountbyminute': { 'Meta': {'unique_together': "(('project', 'group', 'date'),)", 'object_name': 'MessageCountByMinute'}, 'date': ('django.db.models.fields.DateTimeField', [], {}), 'group': ('sentry.db.models.fields.FlexibleForeignKey', [], {'to': "orm['sentry.GroupedMessage']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project': ('sentry.db.models.fields.FlexibleForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'times_seen': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0'}) }, 'sentry.messagefiltervalue': { 'Meta': {'unique_together': "(('project', 'key', 'value', 'group'),)", 'object_name': 'MessageFilterValue'}, 'group': ('sentry.db.models.fields.FlexibleForeignKey', [], {'to': "orm['sentry.GroupedMessage']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'project': ('sentry.db.models.fields.FlexibleForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'times_seen': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0'}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '200'}) }, 'sentry.messageindex': { 'Meta': {'unique_together': "(('column', 'value', 'object_id'),)", 'object_name': 'MessageIndex'}, 'column': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'object_id': ('django.db.models.fields.PositiveIntegerField', [], {}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '128'}) }, 'sentry.project': { 'Meta': {'object_name': 'Project'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'owner': ('sentry.db.models.fields.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}), 'public': ('django.db.models.fields.BooleanField', [], {'default': 'False'}) }, 'sentry.projectmember': { 'Meta': {'unique_together': "(('project', 'user'),)", 'object_name': 'ProjectMember'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'permissions': ('django.db.models.fields.BigIntegerField', [], {}), 'project': ('sentry.db.models.fields.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'user': ('sentry.db.models.fields.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}) } } complete_apps = ['sentry']
bsd-3-clause
dan-blanchard/conda-build
conda_build/exceptions.py
8
1182
import textwrap SEPARATOR = "-" * 70 indent = lambda s: textwrap.fill(textwrap.dedent(s)) class CondaBuildException(Exception): pass class YamlParsingError(CondaBuildException): pass class UnableToParse(YamlParsingError): def __init__(self, original, *args, **kwargs): super(UnableToParse, self).__init__(*args, **kwargs) self.original = original def error_msg(self): return "\n".join([ SEPARATOR, self.error_body(), self.indented_exception(), ]) def error_body(self): return "\n".join([ "Unable to parse meta.yaml file\n", ]) def indented_exception(self): orig = str(self.original) indent = lambda s: s.replace("\n", "\n--> ") return "Error Message:\n--> {}\n\n".format(indent(orig)) class UnableToParseMissingJinja2(UnableToParse): def error_body(self): return "\n".join([ super(UnableToParseMissingJinja2, self).error_body(), indent("""\ It appears you are missing jinja2. Please install that package, then attempt to build. """), ])
bsd-3-clause
with-git/tensorflow
tensorflow/python/kernel_tests/benchmark_test.py
116
7664
# Copyright 2016 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Tests for tensorflow.python.framework.importer.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import json import os import random from tensorflow.core.util import test_log_pb2 from tensorflow.python.client import session from tensorflow.python.framework import constant_op from tensorflow.python.platform import benchmark from tensorflow.python.platform import gfile from tensorflow.python.platform import test # Used by SomeRandomBenchmark class below. _ran_somebenchmark_1 = [False] _ran_somebenchmark_2 = [False] _ran_somebenchmark_but_shouldnt = [False] class SomeRandomBenchmark(test.Benchmark): """This Benchmark should automatically be registered in the registry.""" def _dontRunThisBenchmark(self): _ran_somebenchmark_but_shouldnt[0] = True def notBenchmarkMethod(self): _ran_somebenchmark_but_shouldnt[0] = True def benchmark1(self): _ran_somebenchmark_1[0] = True def benchmark2(self): _ran_somebenchmark_2[0] = True class TestReportingBenchmark(test.Benchmark): """This benchmark (maybe) reports some stuff.""" def benchmarkReport1(self): self.report_benchmark(iters=1) def benchmarkReport2(self): self.report_benchmark( iters=2, name="custom_benchmark_name", extras={"number_key": 3, "other_key": "string"}) def benchmark_times_an_op(self): with session.Session() as sess: a = constant_op.constant(0.0) a_plus_a = a + a self.run_op_benchmark( sess, a_plus_a, min_iters=1000, store_trace=True, name="op_benchmark") class BenchmarkTest(test.TestCase): def testGlobalBenchmarkRegistry(self): registry = list(benchmark.GLOBAL_BENCHMARK_REGISTRY) self.assertEqual(len(registry), 2) self.assertTrue(SomeRandomBenchmark in registry) self.assertTrue(TestReportingBenchmark in registry) def testRunSomeRandomBenchmark(self): # Validate that SomeBenchmark has not run yet self.assertFalse(_ran_somebenchmark_1[0]) self.assertFalse(_ran_somebenchmark_2[0]) self.assertFalse(_ran_somebenchmark_but_shouldnt[0]) # Run other benchmarks, but this wont run the one we care about benchmark._run_benchmarks("unrelated") # Validate that SomeBenchmark has not run yet self.assertFalse(_ran_somebenchmark_1[0]) self.assertFalse(_ran_somebenchmark_2[0]) self.assertFalse(_ran_somebenchmark_but_shouldnt[0]) # Run all the benchmarks, avoid generating any reports if benchmark.TEST_REPORTER_TEST_ENV in os.environ: del os.environ[benchmark.TEST_REPORTER_TEST_ENV] benchmark._run_benchmarks("SomeRandom") # Validate that SomeRandomBenchmark ran correctly self.assertTrue(_ran_somebenchmark_1[0]) self.assertTrue(_ran_somebenchmark_2[0]) self.assertFalse(_ran_somebenchmark_but_shouldnt[0]) _ran_somebenchmark_1[0] = False _ran_somebenchmark_2[0] = False _ran_somebenchmark_but_shouldnt[0] = False # Test running a specific method of SomeRandomBenchmark if benchmark.TEST_REPORTER_TEST_ENV in os.environ: del os.environ[benchmark.TEST_REPORTER_TEST_ENV] benchmark._run_benchmarks("SomeRandom.*1$") self.assertTrue(_ran_somebenchmark_1[0]) self.assertFalse(_ran_somebenchmark_2[0]) self.assertFalse(_ran_somebenchmark_but_shouldnt[0]) def testReportingBenchmark(self): tempdir = test.get_temp_dir() try: gfile.MakeDirs(tempdir) except OSError as e: # It's OK if the directory already exists. if " exists:" not in str(e): raise e prefix = os.path.join(tempdir, "reporting_bench_%016x_" % random.getrandbits(64)) expected_output_file = "%s%s" % (prefix, "TestReportingBenchmark.benchmarkReport1") expected_output_file_2 = "%s%s" % ( prefix, "TestReportingBenchmark.custom_benchmark_name") expected_output_file_3 = "%s%s" % (prefix, "TestReportingBenchmark.op_benchmark") try: self.assertFalse(gfile.Exists(expected_output_file)) # Run benchmark but without env, shouldn't write anything if benchmark.TEST_REPORTER_TEST_ENV in os.environ: del os.environ[benchmark.TEST_REPORTER_TEST_ENV] reporting = TestReportingBenchmark() reporting.benchmarkReport1() # This should run without writing anything self.assertFalse(gfile.Exists(expected_output_file)) # Runbenchmark with env, should write os.environ[benchmark.TEST_REPORTER_TEST_ENV] = prefix reporting = TestReportingBenchmark() reporting.benchmarkReport1() # This should write reporting.benchmarkReport2() # This should write reporting.benchmark_times_an_op() # This should write # Check the files were written self.assertTrue(gfile.Exists(expected_output_file)) self.assertTrue(gfile.Exists(expected_output_file_2)) self.assertTrue(gfile.Exists(expected_output_file_3)) # Check the contents are correct expected_1 = test_log_pb2.BenchmarkEntry() expected_1.name = "TestReportingBenchmark.benchmarkReport1" expected_1.iters = 1 expected_2 = test_log_pb2.BenchmarkEntry() expected_2.name = "TestReportingBenchmark.custom_benchmark_name" expected_2.iters = 2 expected_2.extras["number_key"].double_value = 3 expected_2.extras["other_key"].string_value = "string" expected_3 = test_log_pb2.BenchmarkEntry() expected_3.name = "TestReportingBenchmark.op_benchmark" expected_3.iters = 1000 def read_benchmark_entry(f): s = gfile.GFile(f, "rb").read() entries = test_log_pb2.BenchmarkEntries.FromString(s) self.assertEquals(1, len(entries.entry)) return entries.entry[0] read_benchmark_1 = read_benchmark_entry(expected_output_file) self.assertProtoEquals(expected_1, read_benchmark_1) read_benchmark_2 = read_benchmark_entry(expected_output_file_2) self.assertProtoEquals(expected_2, read_benchmark_2) read_benchmark_3 = read_benchmark_entry(expected_output_file_3) self.assertEquals(expected_3.name, read_benchmark_3.name) self.assertEquals(expected_3.iters, read_benchmark_3.iters) self.assertGreater(read_benchmark_3.wall_time, 0) full_trace = read_benchmark_3.extras["full_trace_chrome_format"] json_trace = json.loads(full_trace.string_value) self.assertTrue(isinstance(json_trace, dict)) self.assertTrue("traceEvents" in json_trace.keys()) allocator_keys = [k for k in read_benchmark_3.extras.keys() if k.startswith("allocator_maximum_num_bytes_")] self.assertGreater(len(allocator_keys), 0) for k in allocator_keys: self.assertGreater(read_benchmark_3.extras[k].double_value, 0) finally: gfile.DeleteRecursively(tempdir) if __name__ == "__main__": test.main()
apache-2.0
swatilodha/coala
tests/parsing/ConfParserTest.py
26
5556
import os import tempfile import unittest from collections import OrderedDict from coalib.parsing.ConfParser import ConfParser from coalib.settings.Section import Section class ConfParserTest(unittest.TestCase): example_file = """to be ignored a_default, another = val TEST = tobeignored # do you know that thats a comment test = push t = escaped_\\=equal = escaped_\\#hash escaped_\\\\backslash = escaped_\\ space escaped_\\,comma = escaped_\\.dot [MakeFiles] j , another = a multiline value # just a omment # just a omment nokey. = value default.test = content makefiles.lastone = val [EMPTY_ELEM_STRIP] A = a, b, c B = a, ,, d C = ,,, """ def setUp(self): self.tempdir = tempfile.gettempdir() self.file = os.path.join(self.tempdir, ".coafile") self.nonexistentfile = os.path.join(self.tempdir, "e81k7bd98t") with open(self.file, "w") as file: file.write(self.example_file) self.uut = ConfParser() try: os.remove(self.nonexistentfile) except FileNotFoundError: pass self.sections = self.uut.parse(self.file) def tearDown(self): os.remove(self.file) def test_parse_nonexisting_file(self): self.assertRaises(FileNotFoundError, self.uut.parse, self.nonexistentfile) self.assertNotEqual(self.uut.parse(self.file, True), self.sections) def test_parse_nonexisting_section(self): self.assertRaises(IndexError, self.uut.get_section, "inexistent section") def test_parse_default_section(self): default_should = OrderedDict([ ('a_default', 'val'), ('another', 'val'), ('comment0', '# do you know that thats a comment'), ('test', 'content'), ('t', ''), ('escaped_=equal', 'escaped_#hash'), ('escaped_\\backslash', 'escaped_ space'), ('escaped_,comma', 'escaped_.dot')]) key, val = self.sections.popitem(last=False) self.assertTrue(isinstance(val, Section)) self.assertEqual(key, 'default') is_dict = OrderedDict() for k in val: is_dict[k] = str(val[k]) self.assertEqual(is_dict, default_should) def test_parse_makefiles_section(self): makefiles_should = OrderedDict([ ('j', 'a\nmultiline\nvalue'), ('another', 'a\nmultiline\nvalue'), ('comment1', '# just a omment'), ('comment2', '# just a omment'), ('lastone', 'val'), ('comment3', ''), ('a_default', 'val'), ('comment0', '# do you know that thats a comment'), ('test', 'content'), ('t', ''), ('escaped_=equal', 'escaped_#hash'), ('escaped_\\backslash', 'escaped_ space'), ('escaped_,comma', 'escaped_.dot')]) # Pop off the default section. self.sections.popitem(last=False) key, val = self.sections.popitem(last=False) self.assertTrue(isinstance(val, Section)) self.assertEqual(key, 'makefiles') is_dict = OrderedDict() for k in val: is_dict[k] = str(val[k]) self.assertEqual(is_dict, makefiles_should) self.assertEqual(val["comment1"].key, "comment1") def test_parse_empty_elem_strip_section(self): empty_elem_strip_should = OrderedDict([ ('a', 'a, b, c'), ('b', 'a, ,, d'), ('c', ',,,'), ('comment4', ''), ('a_default', 'val'), ('another', 'val'), ('comment0', '# do you know that thats a comment'), ('test', 'content'), ('t', ''), ('escaped_=equal', 'escaped_#hash'), ('escaped_\\backslash', 'escaped_ space'), ('escaped_,comma', 'escaped_.dot')]) # Pop off the default and makefiles section. self.sections.popitem(last=False) self.sections.popitem(last=False) key, val = self.sections.popitem(last=False) self.assertTrue(isinstance(val, Section)) self.assertEqual(key, 'empty_elem_strip') is_dict = OrderedDict() for k in val: is_dict[k] = str(val[k]) self.assertEqual(is_dict, empty_elem_strip_should) def test_remove_empty_iter_elements(self): # Test with empty-elem stripping. uut = ConfParser(remove_empty_iter_elements=True) uut.parse(self.file) self.assertEqual(list(uut.get_section("EMPTY_ELEM_STRIP")["A"]), ["a", "b", "c"]) self.assertEqual(list(uut.get_section("EMPTY_ELEM_STRIP")["B"]), ["a", "d"]) self.assertEqual(list(uut.get_section("EMPTY_ELEM_STRIP")["C"]), []) # Test without stripping. uut = ConfParser(remove_empty_iter_elements=False) uut.parse(self.file) self.assertEqual(list(uut.get_section("EMPTY_ELEM_STRIP")["A"]), ["a", "b", "c"]) self.assertEqual(list(uut.get_section("EMPTY_ELEM_STRIP")["B"]), ["a", "", "", "d"]) self.assertEqual(list(uut.get_section("EMPTY_ELEM_STRIP")["C"]), ["", "", "", ""]) def test_config_directory(self): self.uut.parse(self.tempdir)
agpl-3.0
PaddlePaddle/Paddle
python/paddle/fluid/tests/unittests/test_collective_barrier_api.py
2
1173
# Copyright (c) 2020 PaddlePaddle Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from __future__ import print_function import unittest import numpy as np import paddle from test_collective_api_base import TestDistBase paddle.enable_static() class TestCollectiveBarrierAPI(TestDistBase): def _setup_config(self): pass def test_barrier_nccl(self): self.check_with_place("collective_barrier_api.py", "barrier", "nccl") def test_barrier_gloo(self): self.check_with_place("collective_barrier_api.py", "barrier", "gloo", "5") if __name__ == '__main__': unittest.main()
apache-2.0
JPFrancoia/scikit-learn
sklearn/decomposition/online_lda.py
11
27161
""" ============================================================= Online Latent Dirichlet Allocation with variational inference ============================================================= This implementation is modified from Matthew D. Hoffman's onlineldavb code Link: http://matthewdhoffman.com/code/onlineldavb.tar """ # Author: Chyi-Kwei Yau # Author: Matthew D. Hoffman (original onlineldavb implementation) import numpy as np import scipy.sparse as sp from scipy.special import gammaln import warnings from ..base import BaseEstimator, TransformerMixin from ..utils import (check_random_state, check_array, gen_batches, gen_even_slices, _get_n_jobs) from ..utils.validation import check_non_negative from ..utils.extmath import logsumexp from ..externals.joblib import Parallel, delayed from ..externals.six.moves import xrange from ..exceptions import NotFittedError from ._online_lda import (mean_change, _dirichlet_expectation_1d, _dirichlet_expectation_2d) EPS = np.finfo(np.float).eps def _update_doc_distribution(X, exp_topic_word_distr, doc_topic_prior, max_iters, mean_change_tol, cal_sstats, random_state): """E-step: update document-topic distribution. Parameters ---------- X : array-like or sparse matrix, shape=(n_samples, n_features) Document word matrix. exp_topic_word_distr : dense matrix, shape=(n_topics, n_features) Exponential value of expection of log topic word distribution. In the literature, this is `exp(E[log(beta)])`. doc_topic_prior : float Prior of document topic distribution `theta`. max_iters : int Max number of iterations for updating document topic distribution in the E-step. mean_change_tol : float Stopping tolerance for updating document topic distribution in E-setp. cal_sstats : boolean Parameter that indicate to calculate sufficient statistics or not. Set `cal_sstats` to `True` when we need to run M-step. random_state : RandomState instance or None Parameter that indicate how to initialize document topic distribution. Set `random_state` to None will initialize document topic distribution to a constant number. Returns ------- (doc_topic_distr, suff_stats) : `doc_topic_distr` is unnormalized topic distribution for each document. In the literature, this is `gamma`. we can calculate `E[log(theta)]` from it. `suff_stats` is expected sufficient statistics for the M-step. When `cal_sstats == False`, this will be None. """ is_sparse_x = sp.issparse(X) n_samples, n_features = X.shape n_topics = exp_topic_word_distr.shape[0] if random_state: doc_topic_distr = random_state.gamma(100., 0.01, (n_samples, n_topics)) else: doc_topic_distr = np.ones((n_samples, n_topics)) # In the literature, this is `exp(E[log(theta)])` exp_doc_topic = np.exp(_dirichlet_expectation_2d(doc_topic_distr)) # diff on `component_` (only calculate it when `cal_diff` is True) suff_stats = np.zeros(exp_topic_word_distr.shape) if cal_sstats else None if is_sparse_x: X_data = X.data X_indices = X.indices X_indptr = X.indptr for idx_d in xrange(n_samples): if is_sparse_x: ids = X_indices[X_indptr[idx_d]:X_indptr[idx_d + 1]] cnts = X_data[X_indptr[idx_d]:X_indptr[idx_d + 1]] else: ids = np.nonzero(X[idx_d, :])[0] cnts = X[idx_d, ids] doc_topic_d = doc_topic_distr[idx_d, :] # The next one is a copy, since the inner loop overwrites it. exp_doc_topic_d = exp_doc_topic[idx_d, :].copy() exp_topic_word_d = exp_topic_word_distr[:, ids] # Iterate between `doc_topic_d` and `norm_phi` until convergence for _ in xrange(0, max_iters): last_d = doc_topic_d # The optimal phi_{dwk} is proportional to # exp(E[log(theta_{dk})]) * exp(E[log(beta_{dw})]). norm_phi = np.dot(exp_doc_topic_d, exp_topic_word_d) + EPS doc_topic_d = (exp_doc_topic_d * np.dot(cnts / norm_phi, exp_topic_word_d.T)) # Note: adds doc_topic_prior to doc_topic_d, in-place. _dirichlet_expectation_1d(doc_topic_d, doc_topic_prior, exp_doc_topic_d) if mean_change(last_d, doc_topic_d) < mean_change_tol: break doc_topic_distr[idx_d, :] = doc_topic_d # Contribution of document d to the expected sufficient # statistics for the M step. if cal_sstats: norm_phi = np.dot(exp_doc_topic_d, exp_topic_word_d) + EPS suff_stats[:, ids] += np.outer(exp_doc_topic_d, cnts / norm_phi) return (doc_topic_distr, suff_stats) class LatentDirichletAllocation(BaseEstimator, TransformerMixin): """Latent Dirichlet Allocation with online variational Bayes algorithm .. versionadded:: 0.17 Read more in the :ref:`User Guide <LatentDirichletAllocation>`. Parameters ---------- n_topics : int, optional (default=10) Number of topics. doc_topic_prior : float, optional (default=None) Prior of document topic distribution `theta`. If the value is None, defaults to `1 / n_topics`. In the literature, this is called `alpha`. topic_word_prior : float, optional (default=None) Prior of topic word distribution `beta`. If the value is None, defaults to `1 / n_topics`. In the literature, this is called `eta`. learning_method : 'batch' | 'online', default='online' Method used to update `_component`. Only used in `fit` method. In general, if the data size is large, the online update will be much faster than the batch update. The default learning method is going to be changed to 'batch' in the 0.20 release. Valid options:: 'batch': Batch variational Bayes method. Use all training data in each EM update. Old `components_` will be overwritten in each iteration. 'online': Online variational Bayes method. In each EM update, use mini-batch of training data to update the ``components_`` variable incrementally. The learning rate is controlled by the ``learning_decay`` and the ``learning_offset`` parameters. learning_decay : float, optional (default=0.7) It is a parameter that control learning rate in the online learning method. The value should be set between (0.5, 1.0] to guarantee asymptotic convergence. When the value is 0.0 and batch_size is ``n_samples``, the update method is same as batch learning. In the literature, this is called kappa. learning_offset : float, optional (default=10.) A (positive) parameter that downweights early iterations in online learning. It should be greater than 1.0. In the literature, this is called tau_0. max_iter : integer, optional (default=10) The maximum number of iterations. total_samples : int, optional (default=1e6) Total number of documents. Only used in the `partial_fit` method. batch_size : int, optional (default=128) Number of documents to use in each EM iteration. Only used in online learning. evaluate_every : int optional (default=0) How often to evaluate perplexity. Only used in `fit` method. set it to 0 or negative number to not evalute perplexity in training at all. Evaluating perplexity can help you check convergence in training process, but it will also increase total training time. Evaluating perplexity in every iteration might increase training time up to two-fold. perp_tol : float, optional (default=1e-1) Perplexity tolerance in batch learning. Only used when ``evaluate_every`` is greater than 0. mean_change_tol : float, optional (default=1e-3) Stopping tolerance for updating document topic distribution in E-step. max_doc_update_iter : int (default=100) Max number of iterations for updating document topic distribution in the E-step. n_jobs : int, optional (default=1) The number of jobs to use in the E-step. If -1, all CPUs are used. For ``n_jobs`` below -1, (n_cpus + 1 + n_jobs) are used. verbose : int, optional (default=0) Verbosity level. random_state : int or RandomState instance or None, optional (default=None) Pseudo-random number generator seed control. Attributes ---------- components_ : array, [n_topics, n_features] Topic word distribution. ``components_[i, j]`` represents word j in topic `i`. n_batch_iter_ : int Number of iterations of the EM step. n_iter_ : int Number of passes over the dataset. References ---------- [1] "Online Learning for Latent Dirichlet Allocation", Matthew D. Hoffman, David M. Blei, Francis Bach, 2010 [2] "Stochastic Variational Inference", Matthew D. Hoffman, David M. Blei, Chong Wang, John Paisley, 2013 [3] Matthew D. Hoffman's onlineldavb code. Link: http://matthewdhoffman.com//code/onlineldavb.tar """ def __init__(self, n_topics=10, doc_topic_prior=None, topic_word_prior=None, learning_method=None, learning_decay=.7, learning_offset=10., max_iter=10, batch_size=128, evaluate_every=-1, total_samples=1e6, perp_tol=1e-1, mean_change_tol=1e-3, max_doc_update_iter=100, n_jobs=1, verbose=0, random_state=None): self.n_topics = n_topics self.doc_topic_prior = doc_topic_prior self.topic_word_prior = topic_word_prior self.learning_method = learning_method self.learning_decay = learning_decay self.learning_offset = learning_offset self.max_iter = max_iter self.batch_size = batch_size self.evaluate_every = evaluate_every self.total_samples = total_samples self.perp_tol = perp_tol self.mean_change_tol = mean_change_tol self.max_doc_update_iter = max_doc_update_iter self.n_jobs = n_jobs self.verbose = verbose self.random_state = random_state def _check_params(self): """Check model parameters.""" if self.n_topics <= 0: raise ValueError("Invalid 'n_topics' parameter: %r" % self.n_topics) if self.total_samples <= 0: raise ValueError("Invalid 'total_samples' parameter: %r" % self.total_samples) if self.learning_offset < 0: raise ValueError("Invalid 'learning_offset' parameter: %r" % self.learning_offset) if self.learning_method not in ("batch", "online", None): raise ValueError("Invalid 'learning_method' parameter: %r" % self.learning_method) def _init_latent_vars(self, n_features): """Initialize latent variables.""" self.random_state_ = check_random_state(self.random_state) self.n_batch_iter_ = 1 self.n_iter_ = 0 if self.doc_topic_prior is None: self.doc_topic_prior_ = 1. / self.n_topics else: self.doc_topic_prior_ = self.doc_topic_prior if self.topic_word_prior is None: self.topic_word_prior_ = 1. / self.n_topics else: self.topic_word_prior_ = self.topic_word_prior init_gamma = 100. init_var = 1. / init_gamma # In the literature, this is called `lambda` self.components_ = self.random_state_.gamma( init_gamma, init_var, (self.n_topics, n_features)) # In the literature, this is `exp(E[log(beta)])` self.exp_dirichlet_component_ = np.exp( _dirichlet_expectation_2d(self.components_)) def _e_step(self, X, cal_sstats, random_init, parallel=None): """E-step in EM update. Parameters ---------- X : array-like or sparse matrix, shape=(n_samples, n_features) Document word matrix. cal_sstats : boolean Parameter that indicate whether to calculate sufficient statistics or not. Set ``cal_sstats`` to True when we need to run M-step. random_init : boolean Parameter that indicate whether to initialize document topic distribution randomly in the E-step. Set it to True in training steps. parallel : joblib.Parallel (optional) Pre-initialized instance of joblib.Parallel. Returns ------- (doc_topic_distr, suff_stats) : `doc_topic_distr` is unnormalized topic distribution for each document. In the literature, this is called `gamma`. `suff_stats` is expected sufficient statistics for the M-step. When `cal_sstats == False`, it will be None. """ # Run e-step in parallel random_state = self.random_state_ if random_init else None # TODO: make Parallel._effective_n_jobs public instead? n_jobs = _get_n_jobs(self.n_jobs) if parallel is None: parallel = Parallel(n_jobs=n_jobs, verbose=max(0, self.verbose - 1)) results = parallel( delayed(_update_doc_distribution)(X[idx_slice, :], self.exp_dirichlet_component_, self.doc_topic_prior_, self.max_doc_update_iter, self.mean_change_tol, cal_sstats, random_state) for idx_slice in gen_even_slices(X.shape[0], n_jobs)) # merge result doc_topics, sstats_list = zip(*results) doc_topic_distr = np.vstack(doc_topics) if cal_sstats: # This step finishes computing the sufficient statistics for the # M-step. suff_stats = np.zeros(self.components_.shape) for sstats in sstats_list: suff_stats += sstats suff_stats *= self.exp_dirichlet_component_ else: suff_stats = None return (doc_topic_distr, suff_stats) def _em_step(self, X, total_samples, batch_update, parallel=None): """EM update for 1 iteration. update `_component` by batch VB or online VB. Parameters ---------- X : array-like or sparse matrix, shape=(n_samples, n_features) Document word matrix. total_samples : integer Total umber of documents. It is only used when batch_update is `False`. batch_update : boolean Parameter that controls updating method. `True` for batch learning, `False` for online learning. parallel : joblib.Parallel Pre-initialized instance of joblib.Parallel Returns ------- doc_topic_distr : array, shape=(n_samples, n_topics) Unnormalized document topic distribution. """ # E-step _, suff_stats = self._e_step(X, cal_sstats=True, random_init=True, parallel=parallel) # M-step if batch_update: self.components_ = self.topic_word_prior_ + suff_stats else: # online update # In the literature, the weight is `rho` weight = np.power(self.learning_offset + self.n_batch_iter_, -self.learning_decay) doc_ratio = float(total_samples) / X.shape[0] self.components_ *= (1 - weight) self.components_ += (weight * (self.topic_word_prior_ + doc_ratio * suff_stats)) # update `component_` related variables self.exp_dirichlet_component_ = np.exp( _dirichlet_expectation_2d(self.components_)) self.n_batch_iter_ += 1 return def _check_non_neg_array(self, X, whom): """check X format check X format and make sure no negative value in X. Parameters ---------- X : array-like or sparse matrix """ X = check_array(X, accept_sparse='csr') check_non_negative(X, whom) return X def partial_fit(self, X, y=None): """Online VB with Mini-Batch update. Parameters ---------- X : array-like or sparse matrix, shape=(n_samples, n_features) Document word matrix. Returns ------- self """ self._check_params() X = self._check_non_neg_array(X, "LatentDirichletAllocation.partial_fit") n_samples, n_features = X.shape batch_size = self.batch_size # initialize parameters or check if not hasattr(self, 'components_'): self._init_latent_vars(n_features) if n_features != self.components_.shape[1]: raise ValueError( "The provided data has %d dimensions while " "the model was trained with feature size %d." % (n_features, self.components_.shape[1])) n_jobs = _get_n_jobs(self.n_jobs) with Parallel(n_jobs=n_jobs, verbose=max(0, self.verbose - 1)) as parallel: for idx_slice in gen_batches(n_samples, batch_size): self._em_step(X[idx_slice, :], total_samples=self.total_samples, batch_update=False, parallel=parallel) return self def fit(self, X, y=None): """Learn model for the data X with variational Bayes method. When `learning_method` is 'online', use mini-batch update. Otherwise, use batch update. Parameters ---------- X : array-like or sparse matrix, shape=(n_samples, n_features) Document word matrix. Returns ------- self """ self._check_params() X = self._check_non_neg_array(X, "LatentDirichletAllocation.fit") n_samples, n_features = X.shape max_iter = self.max_iter evaluate_every = self.evaluate_every learning_method = self.learning_method if learning_method == None: warnings.warn("The default value for 'learning_method' will be " "changed from 'online' to 'batch' in the release 0.20. " "This warning was introduced in 0.18.", DeprecationWarning) learning_method = 'online' batch_size = self.batch_size # initialize parameters self._init_latent_vars(n_features) # change to perplexity later last_bound = None n_jobs = _get_n_jobs(self.n_jobs) with Parallel(n_jobs=n_jobs, verbose=max(0, self.verbose - 1)) as parallel: for i in xrange(max_iter): if learning_method == 'online': for idx_slice in gen_batches(n_samples, batch_size): self._em_step(X[idx_slice, :], total_samples=n_samples, batch_update=False, parallel=parallel) else: # batch update self._em_step(X, total_samples=n_samples, batch_update=True, parallel=parallel) # check perplexity if evaluate_every > 0 and (i + 1) % evaluate_every == 0: doc_topics_distr, _ = self._e_step(X, cal_sstats=False, random_init=False, parallel=parallel) bound = self.perplexity(X, doc_topics_distr, sub_sampling=False) if self.verbose: print('iteration: %d, perplexity: %.4f' % (i + 1, bound)) if last_bound and abs(last_bound - bound) < self.perp_tol: break last_bound = bound self.n_iter_ += 1 return self def transform(self, X): """Transform data X according to the fitted model. Parameters ---------- X : array-like or sparse matrix, shape=(n_samples, n_features) Document word matrix. Returns ------- doc_topic_distr : shape=(n_samples, n_topics) Document topic distribution for X. """ if not hasattr(self, 'components_'): raise NotFittedError("no 'components_' attribute in model." " Please fit model first.") # make sure feature size is the same in fitted model and in X X = self._check_non_neg_array(X, "LatentDirichletAllocation.transform") n_samples, n_features = X.shape if n_features != self.components_.shape[1]: raise ValueError( "The provided data has %d dimensions while " "the model was trained with feature size %d." % (n_features, self.components_.shape[1])) doc_topic_distr, _ = self._e_step(X, cal_sstats=False, random_init=False) # normalize doc_topic_distr doc_topic_distr /= doc_topic_distr.sum(axis=1)[:, np.newaxis] return doc_topic_distr def _approx_bound(self, X, doc_topic_distr, sub_sampling): """Estimate the variational bound. Estimate the variational bound over "all documents" using only the documents passed in as X. Since log-likelihood of each word cannot be computed directly, we use this bound to estimate it. Parameters ---------- X : array-like or sparse matrix, shape=(n_samples, n_features) Document word matrix. doc_topic_distr : array, shape=(n_samples, n_topics) Document topic distribution. In the literature, this is called gamma. sub_sampling : boolean, optional, (default=False) Compensate for subsampling of documents. It is used in calculate bound in online learning. Returns ------- score : float """ def _loglikelihood(prior, distr, dirichlet_distr, size): # calculate log-likelihood score = np.sum((prior - distr) * dirichlet_distr) score += np.sum(gammaln(distr) - gammaln(prior)) score += np.sum(gammaln(prior * size) - gammaln(np.sum(distr, 1))) return score is_sparse_x = sp.issparse(X) n_samples, n_topics = doc_topic_distr.shape n_features = self.components_.shape[1] score = 0 dirichlet_doc_topic = _dirichlet_expectation_2d(doc_topic_distr) dirichlet_component_ = _dirichlet_expectation_2d(self.components_) doc_topic_prior = self.doc_topic_prior_ topic_word_prior = self.topic_word_prior_ if is_sparse_x: X_data = X.data X_indices = X.indices X_indptr = X.indptr # E[log p(docs | theta, beta)] for idx_d in xrange(0, n_samples): if is_sparse_x: ids = X_indices[X_indptr[idx_d]:X_indptr[idx_d + 1]] cnts = X_data[X_indptr[idx_d]:X_indptr[idx_d + 1]] else: ids = np.nonzero(X[idx_d, :])[0] cnts = X[idx_d, ids] temp = (dirichlet_doc_topic[idx_d, :, np.newaxis] + dirichlet_component_[:, ids]) norm_phi = logsumexp(temp) score += np.dot(cnts, norm_phi) # compute E[log p(theta | alpha) - log q(theta | gamma)] score += _loglikelihood(doc_topic_prior, doc_topic_distr, dirichlet_doc_topic, self.n_topics) # Compensate for the subsampling of the population of documents if sub_sampling: doc_ratio = float(self.total_samples) / n_samples score *= doc_ratio # E[log p(beta | eta) - log q (beta | lambda)] score += _loglikelihood(topic_word_prior, self.components_, dirichlet_component_, n_features) return score def score(self, X, y=None): """Calculate approximate log-likelihood as score. Parameters ---------- X : array-like or sparse matrix, shape=(n_samples, n_features) Document word matrix. Returns ------- score : float Use approximate bound as score. """ X = self._check_non_neg_array(X, "LatentDirichletAllocation.score") doc_topic_distr = self.transform(X) score = self._approx_bound(X, doc_topic_distr, sub_sampling=False) return score def perplexity(self, X, doc_topic_distr=None, sub_sampling=False): """Calculate approximate perplexity for data X. Perplexity is defined as exp(-1. * log-likelihood per word) Parameters ---------- X : array-like or sparse matrix, [n_samples, n_features] Document word matrix. doc_topic_distr : None or array, shape=(n_samples, n_topics) Document topic distribution. If it is None, it will be generated by applying transform on X. Returns ------- score : float Perplexity score. """ if not hasattr(self, 'components_'): raise NotFittedError("no 'components_' attribute in model." " Please fit model first.") X = self._check_non_neg_array(X, "LatentDirichletAllocation.perplexity") if doc_topic_distr is None: doc_topic_distr = self.transform(X) else: n_samples, n_topics = doc_topic_distr.shape if n_samples != X.shape[0]: raise ValueError("Number of samples in X and doc_topic_distr" " do not match.") if n_topics != self.n_topics: raise ValueError("Number of topics does not match.") current_samples = X.shape[0] bound = self._approx_bound(X, doc_topic_distr, sub_sampling) if sub_sampling: word_cnt = X.sum() * (float(self.total_samples) / current_samples) else: word_cnt = X.sum() perword_bound = bound / word_cnt return np.exp(-1.0 * perword_bound)
bsd-3-clause
sacsant/avocado-misc-tests
io/disk/ssd/ezfiotest.py
4
3108
#!/usr/bin/env python # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. # # See LICENSE for more details. # # Copyright: 2016 IBM # Author: Narasimhan V <sim@linux.vnet.ibm.com> """ This test script is intended to give a block-level based overview of SSD performance. """ import os from avocado import Test from avocado.utils import build from avocado.utils import process from avocado.utils import genio from avocado.utils.software_manager import SoftwareManager import avocado.utils.git as git class EzfioTest(Test): """ This test script is intended to give a block-level based overview of SSD performance. Uses FIO to perform the actual IO tests. Places the output files in avocado test's outputdir. :param device: Name of the ssd block device """ def setUp(self): """ Build 'fio and ezfio'. """ self.disk = self.params.get('disk', default='/dev/nvme0n1') cmd = 'ls %s' % self.disk if process.system(cmd, ignore_status=True) is not 0: self.cancel("%s does not exist" % self.disk) fio_path = os.path.join(self.teststmpdir, 'fio') fio_link = 'https://github.com/axboe/fio.git' git.get_repo(fio_link, destination_dir=fio_path) build.make(fio_path, make='./configure') build.make(fio_path) build.make(fio_path, extra_args='install') self.ezfio_path = os.path.join(self.teststmpdir, 'ezfio') ezfio_link = 'https://github.com/earlephilhower/ezfio.git' git.get_repo(ezfio_link, destination_dir=self.ezfio_path) self.utilization = self.params.get('utilization', default='100') # aio-max-nr is 65536 by default, and test fails if QD is 256 or above genio.write_file("/proc/sys/fs/aio-max-nr", "1048576") smm = SoftwareManager() # Not a package that must be installed, so not skipping. if not smm.check_installed("sdparm") and not smm.install("sdparm"): self.log.debug("Can not install sdparm") pkg_list = ['libaio', 'libaio-devel'] smm = SoftwareManager() for pkg in pkg_list: if pkg and not smm.check_installed(pkg) and not smm.install(pkg): self.cancel("Package %s is missing and could not be installed" % pkg) self.cwd = os.getcwd() def test(self): """ Performs ezfio test on the block device'. """ os.chdir(self.ezfio_path) cmd = './ezfio.py -d %s -o "%s" -u %s --yes' \ % (self.disk, self.outputdir, self.utilization) process.run(cmd, shell=True) def tearDown(self): """ Clean up """ os.chdir(self.cwd)
gpl-2.0
jeroanan/GameCollection
Tests/Interactors/Game/TestCountGamesInteractor.py
1
1595
# Copyright (c) David Wilson 2015 # Icarus is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # Icarus is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # You should have received a copy of the GNU General Public License # along with Icarus. If not, see <http://www.gnu.org/licenses/>. from Interactors.GameInteractors import CountGamesInteractor from Interactors.Interactor import Interactor from Tests.Interactors.InteractorTestBase import InteractorTestBase class TestCountGamesInteractor(InteractorTestBase): """Unit tests for the CountGamesInteractor class""" def setUp(self): """setUp function for all unit tests in this class""" super().setUp() self.__target = CountGamesInteractor() self.__target.persistence = self.persistence def test_is_interactor(self): """Test that CountGamesInteractor derives from Interactor""" self.assertIsInstance(self.__target, Interactor) def test_execute_calls_persistence_method(self): """Test that calling CountGamesInteractor.execute causes persistence.count_games to be called.""" user_id = "user_id" self.__target.execute(user_id) self.persistence.count_games.assert_called_with(user_id)
gpl-3.0
ravibhure/ansible
lib/ansible/plugins/action/sros_config.py
79
4193
# # Copyright 2016 Peter Sprygada <psprygada@ansible.com> # # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see <http://www.gnu.org/licenses/>. # from __future__ import (absolute_import, division, print_function) __metaclass__ = type import glob import os import re import time from ansible.module_utils.six.moves.urllib.parse import urlsplit from ansible.module_utils._text import to_text from ansible.plugins.action.sros import ActionModule as _ActionModule from ansible.utils.vars import merge_hash PRIVATE_KEYS_RE = re.compile('__.+__') class ActionModule(_ActionModule): def run(self, tmp=None, task_vars=None): if self._task.args.get('src'): try: self._handle_template() except ValueError as exc: return dict(failed=True, msg=exc.message) result = super(ActionModule, self).run(tmp, task_vars) if self._task.args.get('backup') and result.get('__backup__'): # User requested backup and no error occurred in module. # NOTE: If there is a parameter error, _backup key may not be in results. filepath = self._write_backup(task_vars['inventory_hostname'], result['__backup__']) result['backup_path'] = filepath # strip out any keys that have two leading and two trailing # underscore characters for key in result.keys(): if PRIVATE_KEYS_RE.match(key): del result[key] return result def _get_working_path(self): cwd = self._loader.get_basedir() if self._task._role is not None: cwd = self._task._role._role_path return cwd def _write_backup(self, host, contents): backup_path = self._get_working_path() + '/backup' if not os.path.exists(backup_path): os.mkdir(backup_path) for fn in glob.glob('%s/%s*' % (backup_path, host)): os.remove(fn) tstamp = time.strftime("%Y-%m-%d@%H:%M:%S", time.localtime(time.time())) filename = '%s/%s_config.%s' % (backup_path, host, tstamp) open(filename, 'w').write(contents) return filename def _handle_template(self): src = self._task.args.get('src') working_path = self._get_working_path() if os.path.isabs(src) or urlsplit('src').scheme: source = src else: source = self._loader.path_dwim_relative(working_path, 'templates', src) if not source: source = self._loader.path_dwim_relative(working_path, src) if not os.path.exists(source): raise ValueError('path specified in src not found') try: with open(source, 'r') as f: template_data = to_text(f.read()) except IOError: return dict(failed=True, msg='unable to load src file') # Create a template search path in the following order: # [working_path, self_role_path, dependent_role_paths, dirname(source)] searchpath = [working_path] if self._task._role is not None: searchpath.append(self._task._role._role_path) if hasattr(self._task, "_block:"): dep_chain = self._task._block.get_dep_chain() if dep_chain is not None: for role in dep_chain: searchpath.append(role._role_path) searchpath.append(os.path.dirname(source)) self._templar.environment.loader.searchpath = searchpath self._task.args['src'] = self._templar.template(template_data)
gpl-3.0
ekiwi/tinyos-1.x
contrib/handhelds/swtest/testSerialSetTime/shimmer_timesync.py
2
2462
#! /usr/bin/env python # # $Id: shimmer_timesync.py,v 1.1 2010/03/31 19:35:39 ayer1 Exp $ # # Copyright (c) 2007, Intel Corporation # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # # Redistributions of source code must retain the above copyright notice, # this list of conditions and the following disclaimer. # # Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # # Neither the name of the Intel Corporation nor the names of its contributors # may be used to endorse or promote products derived from this software # without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" # AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE # IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE # ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE # LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR # CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF # SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS # INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN # CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) # ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE # POSSIBILITY OF SUCH DAMAGE. # # Author: Jason Waterman # July, 2007 # truncated to shimmer_timesync by # Steve Ayer # March, 2010 import serial import struct import time import random import sys import shimmerUtil # Find the data serial port # this needs to find the real serial port port = shimmerUtil.find_data_port(True) if port == '': print 'Could not find SHIMMER data port port. Exiting.' sys.exit() speed = 115200 print 'Found SHIMMER data port on %s' % (port) ser = serial.Serial(port, speed, timeout = 1) ser.flushInput() print "Synchronizing clocks..." t1 = int(time.time()) for i in range(0, 4): t2 = (t1 >> 8 * (3-i)) & 0x000000ff time.sleep(random.random()) t2_str = struct.pack('B', t2) ser.write(t2_str) print "Wrote %d to shimmer. Done!" % t1 ser.close()
bsd-3-clause
kamalx/edx-platform
lms/djangoapps/commerce/tests/__init__.py
17
3178
# -*- coding: utf-8 -*- """ Commerce app tests package. """ import json from django.test import TestCase from django.test.utils import override_settings import httpretty import jwt import mock from commerce import ecommerce_api_client from student.tests.factories import UserFactory TEST_PUBLIC_URL_ROOT = 'http://www.example.com' TEST_API_URL = 'http://www-internal.example.com/api' TEST_API_SIGNING_KEY = 'edx' TEST_BASKET_ID = 7 TEST_ORDER_NUMBER = '100004' TEST_PAYMENT_DATA = { 'payment_processor_name': 'test-processor', 'payment_form_data': {}, 'payment_page_url': 'http://example.com/pay', } @override_settings(ECOMMERCE_API_SIGNING_KEY=TEST_API_SIGNING_KEY, ECOMMERCE_API_URL=TEST_API_URL) class EcommerceApiClientTest(TestCase): """ Tests to ensure the client is initialized properly. """ TEST_USER_EMAIL = 'test@example.com' TEST_CLIENT_ID = 'test-client-id' def setUp(self): super(EcommerceApiClientTest, self).setUp() self.user = UserFactory() self.user.email = self.TEST_USER_EMAIL self.user.save() # pylint: disable=no-member @httpretty.activate def test_tracking_context(self): """ Ensure the tracking context is set up in the api client correctly and automatically. """ # fake an ecommerce api request. httpretty.register_uri( httpretty.POST, '{}/baskets/1/'.format(TEST_API_URL), status=200, body='{}', adding_headers={'Content-Type': 'application/json'} ) mock_tracker = mock.Mock() mock_tracker.resolve_context = mock.Mock(return_value={'client_id': self.TEST_CLIENT_ID}) with mock.patch('commerce.tracker.get_tracker', return_value=mock_tracker): ecommerce_api_client(self.user).baskets(1).post() # make sure the request's JWT token payload included correct tracking context values. actual_header = httpretty.last_request().headers['Authorization'] expected_payload = { 'username': self.user.username, 'full_name': self.user.profile.name, 'email': self.user.email, 'tracking_context': { 'lms_user_id': self.user.id, # pylint: disable=no-member 'lms_client_id': self.TEST_CLIENT_ID, }, } expected_header = 'JWT {}'.format(jwt.encode(expected_payload, TEST_API_SIGNING_KEY)) self.assertEqual(actual_header, expected_header) @httpretty.activate def test_client_unicode(self): """ The client should handle json responses properly when they contain unicode character data. Regression test for ECOM-1606. """ expected_content = '{"result": "Préparatoire"}' httpretty.register_uri( httpretty.GET, '{}/baskets/1/order/'.format(TEST_API_URL), status=200, body=expected_content, adding_headers={'Content-Type': 'application/json'}, ) actual_object = ecommerce_api_client(self.user).baskets(1).order.get() self.assertEqual(actual_object, {u"result": u"Préparatoire"})
agpl-3.0
treejames/viewfinder
backend/op/viewfinder_op.py
13
17030
# Copyright 2013 Viewfinder Inc. All Rights Reserved. """Viewfinder base operation. ViewfinderOperation is the base class for all other Viewfinder operations. It contains code that is common across at least two derived operations. """ __authors__ = ['andy@emailscrubbed.com (Andy Kimball)'] from copy import deepcopy from tornado import gen from viewfinder.backend.base.exceptions import InvalidRequestError, PermissionError from viewfinder.backend.db.contact import Contact from viewfinder.backend.db.db_client import DBKey from viewfinder.backend.db.episode import Episode from viewfinder.backend.db.follower import Follower from viewfinder.backend.db.identity import Identity from viewfinder.backend.db.operation import Operation from viewfinder.backend.db.post import Post from viewfinder.backend.db.user import User class ViewfinderOperation(object): """Base class for other Viewfinder operations, containing common code.""" def __init__(self, client): self._client = client self._op = Operation.GetCurrent() @classmethod @gen.coroutine def _CheckEpisodePostAccess(cls, action, client, user_id, ep_ph_ids_list): """Ensures that given user has access to the set of episodes and photos in "ep_ph_ids_list", which is a list of (episode_id, photo_ids) tuples. Returns list of (episode, posts) tuples that corresponds to "ep_ph_ids_list". """ # Gather db keys for all source episodes and posts, and check for duplicate episodes and photos. episode_keys = [] post_keys = [] for episode_id, photo_ids in ep_ph_ids_list: episode_keys.append(DBKey(episode_id, None)) for photo_id in photo_ids: post_keys.append(DBKey(episode_id, photo_id)) # Query for all episodes and posts in parallel and in batches. episodes, posts = yield [gen.Task(Episode.BatchQuery, client, episode_keys, None, must_exist=False), gen.Task(Post.BatchQuery, client, post_keys, None, must_exist=False)] # Check that user has ability to access all source episodes and posts. ep_posts_list = [] posts_iter = iter(posts) for (episode_id, photo_ids), episode in zip(ep_ph_ids_list, episodes): if episode is None: raise InvalidRequestError('Episode "%s" does not exist.' % episode_id) posts_list = [] for photo_id in photo_ids: post = next(posts_iter) if post is None: raise InvalidRequestError('Photo "%s" does not exist or is not in episode "%s".' % (photo_id, episode_id)) # Do not raise error if removing a photo that has already been unshared or removed. if action != 'remove': if post.IsUnshared(): raise PermissionError('Cannot %s photo "%s", because it was unshared.' % (action, photo_id)) if post.IsRemoved(): raise PermissionError('Cannot %s photo "%s", because it was removed.' % (action, photo_id)) posts_list.append(post) ep_posts_list.append((episode, posts_list)) # Query for followers of all unique source viewpoints in parallel and in a batch. follower_keys = {episode.viewpoint_id: DBKey(user_id, episode.viewpoint_id) for episode in episodes} followers = yield gen.Task(Follower.BatchQuery, client, follower_keys.values(), None, must_exist=False) # Get set of all viewpoints that are accessible to this user. allowed_viewpoint_ids = set(follower.viewpoint_id for follower in followers if follower is not None and follower.CanViewContent()) # Check access permission to the source viewpoints. for episode in episodes: if episode.viewpoint_id not in allowed_viewpoint_ids: raise PermissionError('User %d does not have permission to %s episode "%s".' % (user_id, action, episode.episode_id)) raise gen.Return(ep_posts_list) @classmethod @gen.coroutine def _CheckCopySources(cls, action, client, user_id, source_ep_dicts): """Ensures that the sharer or saver has access to the source episodes and that the source photos are part of the source episodes. Caller is expected to check permission to add to the given viewpoint. Returns a list of the source episodes and posts in the form of (episode, posts) tuples. """ # Gather list of (episode_id, photo_ids) tuples and check for duplicate posts. unique_keys = set() ep_ph_ids_list = [] for ep_dict in source_ep_dicts: ph_ids = [] for photo_id in ep_dict['photo_ids']: db_key = (ep_dict['new_episode_id'], photo_id) if db_key in unique_keys: raise InvalidRequestError('Photo "%s" cannot be %sd into episode "%s" more than once in same request.' % (photo_id, action, ep_dict['new_episode_id'])) unique_keys.add(db_key) ph_ids.append(photo_id) ep_ph_ids_list.append((ep_dict['existing_episode_id'], ph_ids)) ep_posts_list = yield ViewfinderOperation._CheckEpisodePostAccess(action, client, user_id, ep_ph_ids_list) raise gen.Return(ep_posts_list) @classmethod @gen.coroutine def _AllocateTargetEpisodeIds(self, client, user_id, device_id, target_viewpoint_id, source_ep_ids): """For each episode listed in "source_ep_ids", determines if a child episode already exists in the given viewpoint. If not, allocates a new episode id using the user's asset id allocator. The same timestamp used to create the source episode id is used to create the target episode id. Returns the list of target episodes ids, including both existing ids and allocated ids. """ # First check whether each episode has already been shared/saved into the target viewpoint. tasks = [] for source_ep_id in source_ep_ids: query_expr = ('episode.parent_ep_id={id}', {'id': source_ep_id}) tasks.append(gen.Task(Episode.IndexQuery, client, query_expr, None)) target_ep_ids = [] allocate_ids_count = 0 target_episodes_list = yield tasks for target_episodes in target_episodes_list: found_match = False for episode in target_episodes: if episode.viewpoint_id == target_viewpoint_id: target_ep_ids.append(episode.episode_id) found_match = True break # If no matching child episode, then need to allocate an episode id. if not found_match: target_ep_ids.append(None) allocate_ids_count += 1 if allocate_ids_count > 0: # Allocate ids for any episodes which do not yet exist, and merge them into target_ep_ids. id = yield gen.Task(User.AllocateAssetIds, client, user_id, allocate_ids_count) for i, source_ep_id in enumerate(source_ep_ids): if target_ep_ids[i] is None: timestamp, _, _ = source_ep_id = Episode.DeconstructEpisodeId(source_ep_id) target_ep_ids[i] = Episode.ConstructEpisodeId(timestamp, device_id, id) id += 1 raise gen.Return(target_ep_ids) @classmethod def _CreateCopyTargetDicts(cls, timestamp, user_id, target_viewpoint_id, source_ep_posts_list, target_ep_ids): """Creates list of dicts which will be used to create episodes that are the target of a share or save operation. """ new_ep_dict_list = [] for (source_episode, posts), target_ep_id in zip(source_ep_posts_list, target_ep_ids): new_ep_dict = {'episode_id': target_ep_id, 'parent_ep_id': source_episode.episode_id, 'user_id': user_id, 'viewpoint_id': target_viewpoint_id, 'timestamp': source_episode.timestamp, 'publish_timestamp': timestamp, 'location': source_episode.location, 'placemark': source_episode.placemark, 'photo_ids': [post.photo_id for post in posts]} new_ep_dict_list.append(new_ep_dict) return new_ep_dict_list @classmethod @gen.coroutine def _CheckCopyTargets(cls, action, client, user_id, viewpoint_id, target_ep_dicts): """Compiles a list of target episode and post ids that do not exist or are removed. These episodes and posts will not be copied as part of the operation. Returns the set of target episode and post ids that will be (re)created by the caller. """ # Gather db keys for all target episodes and posts. episode_keys = [] post_keys = [] for ep_dict in target_ep_dicts: episode_keys.append(DBKey(ep_dict['episode_id'], None)) for photo_id in ep_dict['photo_ids']: post_keys.append(DBKey(ep_dict['episode_id'], photo_id)) # Query for all episodes and posts in parallel and in batches. episodes, posts = yield [gen.Task(Episode.BatchQuery, client, episode_keys, None, must_exist=False), gen.Task(Post.BatchQuery, client, post_keys, None, must_exist=False)] # If a viewable post already exists, don't add it to the set to copy. new_ids = set() post_iter = iter(posts) for ep_dict, episode in zip(target_ep_dicts, episodes): if episode is None: # Add the episode id to the set to copy. new_ids.add(ep_dict['episode_id']) else: # Only owner user should get this far, since we check that new episode id contains the user's device id. assert episode.user_id == user_id, (episode, user_id) # Enforce sharing *tree* - no sharing acyclic graph allowed! if episode.parent_ep_id != ep_dict['parent_ep_id']: raise InvalidRequestError('Cannot %s to episode "%s". It was created from a different parent episode.' % (action, ep_dict['episode_id'])) # Cannot share into episodes which are not in the target viewpoint. if episode.viewpoint_id != viewpoint_id: raise InvalidRequestError('Cannot %s to episode "%s". It is not in viewpoint "%s".' % (action, episode.episode_id, viewpoint_id)) for photo_id in ep_dict['photo_ids']: post = next(post_iter) # If the post does not exist or is removed, add it to the new list. if post is None or post.IsRemoved(): new_ids.add(Post.ConstructPostId(ep_dict['episode_id'], photo_id)) raise gen.Return(new_ids) @gen.coroutine def _CreateNewEpisodesAndPosts(self, new_ep_dicts, new_ids): """Creates new episodes and posts within those episodes based on a list returned by _CheckCopySources. If an episode or post id does not exist in "new_ids", it is not created. The "new_ids" set is created by _CheckCopyTargets. """ tasks = [] for new_ep_dict in deepcopy(new_ep_dicts): ep_id = new_ep_dict['episode_id'] ph_ids = [ph_id for ph_id in new_ep_dict.pop('photo_ids') if Post.ConstructPostId(ep_id, ph_id) in new_ids] if ep_id in new_ids: tasks.append(gen.Task(Episode.CreateNew, self._client, **new_ep_dict)) for ph_id in ph_ids: post = Post.CreateFromKeywords(episode_id=ep_id, photo_id=ph_id) post.labels.remove(Post.UNSHARED) post.labels.remove(Post.REMOVED) tasks.append(gen.Task(post.Update, self._client)) yield tasks @classmethod @gen.coroutine def _GetAllContactsWithDedup(cls, client, user_id): """Query for all contacts and split into a dictionary of deduped contacts which is keyed by contact_id and a list of contacts that can be deleted because they're unnecessary. Returns: tuple of (retained_contacts_dict, contacts_to_delete_list) """ contacts_to_delete = [] contacts_to_retain = dict() # Query all contacts for this user. # Set query limit to be max that we expect multiplied by 2 to allow for some duplicates (there shouldn't be many). existing_contacts = yield gen.Task(Contact.RangeQuery, client, hash_key=user_id, range_desc=None, limit=Contact.MAX_CONTACTS_LIMIT * 2, col_names=['contact_id', 'labels', 'contact_source'], scan_forward=True) for existing_contact in existing_contacts: older_existing_contact = contacts_to_retain.pop(existing_contact.contact_id, None) if older_existing_contact is not None: contacts_to_delete.append(older_existing_contact) contacts_to_retain[existing_contact.contact_id] = existing_contact raise gen.Return((contacts_to_retain, contacts_to_delete)) @classmethod def _GetRevivableFollowers(cls, followers): """Get subset of the given followers that have been removed but are still revivable.""" return [follower.user_id for follower in followers if follower.IsRemoved() and not follower.IsUnrevivable()] @gen.coroutine def _ResolveContactIds(self, contact_dicts): """Examines each contact in "contact_dicts" (in the CONTACT_METADATA format). Returns a list of the same length containing the (True, user_id, webapp_dev_id) of the contact if it is already a Viewfinder user, or allocates new user and web device ids, and returns the tuple (False, user_id, webapp_dev_id). Raises an InvalidRequestError if any of the user ids do not correspond to real users. """ # Get identity objects for all contacts for which no user_id is given. identity_keys = [DBKey(contact_dict['identity'], None) for contact_dict in contact_dicts if 'user_id' not in contact_dict] identities = yield gen.Task(Identity.BatchQuery, self._client, identity_keys, None, must_exist=False) # Get user objects for all contacts with a user_id given, or if identity is already bound. user_keys = [] ident_iter = iter(identities) for contact_dict in contact_dicts: if 'user_id' in contact_dict: user_keys.append(DBKey(contact_dict['user_id'], None)) else: identity = next(ident_iter) if identity is not None and identity.user_id is not None: user_keys.append(DBKey(identity.user_id, None)) users = yield gen.Task(User.BatchQuery, self._client, user_keys, None, must_exist=False) # Construct result tuples; if a user does not exist, allocate a user_id and webapp_dev_id. results = [] ident_iter = iter(identities) user_iter = iter(users) for contact_dict in contact_dicts: if 'user_id' not in contact_dict: identity = next(ident_iter) if identity is None or identity.user_id is None: # User doesn't yet exist, so allocate new user and web device ids. user_id, webapp_dev_id = yield User.AllocateUserAndWebDeviceIds(self._client) results.append((False, user_id, webapp_dev_id)) continue user = next(user_iter) if user is None: assert 'user_id' in contact_dict, contact_dict raise InvalidRequestError('A user with id %d cannot be found.' % contact_dict['user_id']) # User already exists. results.append((True, user.user_id, user.webapp_dev_id)) raise gen.Return(results) @gen.coroutine def _ResolveContacts(self, contact_dicts, contact_ids, reason=None): """Creates a prospective user account for any contacts that are not yet Viewfinder users. The "contact_ids" list should have been previously obtained by the caller via a call to _ResolveContactIds, and items in it must correspond to "contact_dicts". If specified, the "reason" string is passed to the CreateProspective op. This describes what caused the user to be created (see db/analytics.py for payload details). """ for contact_dict, (user_exists, user_id, webapp_dev_id) in zip(contact_dicts, contact_ids): if not user_exists: # Check if previous invocation of this operation already created the user. user = yield gen.Task(User.Query, self._client, user_id, None, must_exist=False) if user is None: # Create prospective user. request = {'user_id': user_id, 'webapp_dev_id': webapp_dev_id, 'identity_key': contact_dict['identity'], 'reason': reason} yield Operation.CreateNested(self._client, 'CreateProspectiveOperation.Execute', request)
apache-2.0
iABC2XYZ/abc
PIC/Twiss.py
5
3068
#!/usr/bin/env python2 # -*- coding: utf-8 -*- """ Created on Thu Oct 19 11:10:52 2017 @author: e """ import numpy as np from BetaGammaC import NP_Energy2BetaC_GammaC def GammaT(alphaT,betaT): gammaT=(1.+alphaT**2)/betaT return gammaT def SigmaT2D(alphaT,betaT): gammaT=GammaT(alphaT,betaT) sigmaT=np.array([[betaT,-alphaT],[-alphaT,gammaT]]) return sigmaT def SigmaT4D(alphaX,betaX,alphaY,betaY): xSigmaT,ySigmaT= SigmaT2D(alphaX,betaX), SigmaT2D(alphaY,betaY) O2=np.zeros((2,2)) sigmaT=np.vstack((np.hstack((xSigmaT,O2)),np.hstack((O2,ySigmaT)))) return sigmaT def SigmaT6D(alphaX,betaX,alphaY,betaY,alphaZ,betaZ): xSigmaT,ySigmaT,zSigmaT= SigmaT2D(alphaX,betaX), SigmaT2D(alphaY,betaY),SigmaT2D(alphaZ,betaZ) O2=np.zeros((2,2)) sigmaT=np.vstack((np.hstack((xSigmaT,O2,O2)),np.hstack((O2,ySigmaT,O2)),np.hstack((O2,O2,zSigmaT)))) return sigmaT def SigmaE2D(alphaT,betaT,emit): sigmaT=SigmaT2D(alphaT,betaT) sigmaE=sigmaT*emit return sigmaE def SigmaE4D(alphaX,alphaY,betaX,betaY,emitX,emitY): xSigmaT,ySigmaT= SigmaT2D(alphaX,betaX), SigmaT2D(alphaY,betaY) xSigmaE,ySigmaE=xSigmaT*emitX,ySigmaT*emitY O2=np.zeros((2,2)) sigmaE=np.vstack((np.hstack((xSigmaE,O2)),np.hstack((O2,ySigmaE)))) return sigmaE def SigmaE6D(alphaX,alphaY,alphaZ,betaX,betaY,betaZ,emitX,emitY,emitZ): xSigmaT,ySigmaT,zSigmaT= SigmaT2D(alphaX,betaX), SigmaT2D(alphaY,betaY),SigmaT2D(alphaZ,betaZ) xSigmaE,ySigmaE,zSigmaE=xSigmaT*emitX,ySigmaT*emitY,zSigmaT*emitZ O2=np.zeros((2,2)) sigmaE=np.vstack((np.hstack((xSigmaE,O2,O2)),np.hstack((O2,ySigmaE,O2)),np.hstack((O2,O2,zSigmaE)))) return sigmaE def Mu2D(muX,muXP): muT=np.array([muX,muXP]) return muT def Mu4D(muX,muXP,muY,muYP): muT=np.array([muX,muXP,muY,muYP]) return muT def Mu6D(muX,muXP,muY,muYP,muZ,muZP): muT=np.array([muX,muXP,muY,muYP,muZ,muZP]) return muT def Emit_Norm2Geo(emitNorm,energyMeV): emitGeo=np.empty_like(emitNorm) betaC,gammaC=NP_Energy2BetaC_GammaC(energyMeV) betaCgammaC=betaC*gammaC if len(emitNorm)==3: betaCgammaC3=betaC*gammaC**3 emitGeo[0]=emitNorm[0]/betaCgammaC emitGeo[1]=emitNorm[1]/betaCgammaC emitGeo[2]=emitNorm[2]/betaCgammaC3 elif len(emitNorm)==2: emitGeo[0]=emitNorm[0]/betaCgammaC emitGeo[1]=emitNorm[1]/betaCgammaC elif len(emitNorm)==1: emitGeo[0]=emitNorm[0]/betaCgammaC return emitGeo def Emit_Geo2Norm(emitGeo,energyMeV): emitNorm=np.empty_like(emitGeo) betaC,gammaC=NP_Energy2BetaC_GammaC(energyMeV) betaCgammaC=betaC*gammaC if len(emitGeo)==3: betaCgammaC3=betaC*gammaC**3 emitNorm[0]=emitGeo[0]*betaCgammaC emitNorm[1]=emitGeo[1]*betaCgammaC emitNorm[2]=emitGeo[2]*betaCgammaC3 elif len(emitNorm)==2: emitNorm[0]=emitGeo[0]*betaCgammaC emitNorm[1]=emitGeo[1]*betaCgammaC elif len(emitNorm)==1: emitNorm[0]=emitGeo[0]*betaCgammaC return emitNorm
gpl-3.0
danialbehzadi/Nokia-RM-1013-2.0.0.11
webkit/Tools/Scripts/webkitpy/layout_tests/port/http_server_base.py
15
3209
#!/usr/bin/env python # Copyright (C) 2010 Google Inc. All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following disclaimer # in the documentation and/or other materials provided with the # distribution. # * Neither the name of Google Inc. nor the names of its # contributors may be used to endorse or promote products derived from # this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. """Base class with common routines between the Apache and Lighttpd servers.""" import logging import os import time import urllib from webkitpy.common.system import filesystem _log = logging.getLogger("webkitpy.layout_tests.port.http_server_base") class HttpServerBase(object): def __init__(self, port_obj): self._port_obj = port_obj def wait_for_action(self, action): """Repeat the action for 20 seconds or until it succeeds. Returns whether it succeeded.""" start_time = time.time() while time.time() - start_time < 20: if action(): return True _log.debug("Waiting for action: %s" % action) time.sleep(1) return False def is_server_running_on_all_ports(self): """Returns whether the server is running on all the desired ports.""" for mapping in self.mappings: if 'sslcert' in mapping: http_suffix = 's' else: http_suffix = '' url = 'http%s://127.0.0.1:%d/' % (http_suffix, mapping['port']) try: response = urllib.urlopen(url, proxies={}) _log.debug("Server running at %s" % url) except IOError, e: _log.debug("Server NOT running at %s: %s" % (url, e)) return False return True def remove_log_files(self, folder, starts_with): files = os.listdir(folder) for file in files: if file.startswith(starts_with): full_path = os.path.join(folder, file) filesystem.FileSystem().remove(full_path)
gpl-3.0
TheTimmy/spack
var/spack/repos/builtin/packages/py-deeptools/package.py
3
2155
############################################################################## # Copyright (c) 2013-2017, Lawrence Livermore National Security, LLC. # Produced at the Lawrence Livermore National Laboratory. # # This file is part of Spack. # Created by Todd Gamblin, tgamblin@llnl.gov, All rights reserved. # LLNL-CODE-647188 # # For details, see https://github.com/llnl/spack # Please also see the NOTICE and LICENSE files for our notice and the LGPL. # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License (as # published by the Free Software Foundation) version 2.1, February 1999. # # This program is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the IMPLIED WARRANTY OF # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the terms and # conditions of the GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public # License along with this program; if not, write to the Free Software # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA ############################################################################## from spack import * class PyDeeptools(PythonPackage): """deepTools addresses the challenge of handling the large amounts of data that are now routinely generated from DNA sequencing centers.""" homepage = "https://pypi.io/packages/source/d/deepTools" url = "https://pypi.io/packages/source/d/deepTools/deepTools-2.5.2.tar.gz" version('2.5.2', 'ba8a44c128c6bb1ed4ebdb20bf9ae9c2') depends_on('python@2.7:', type=('build', 'run')) depends_on('py-setuptools', type='build') depends_on('py-numpy@1.9.0:', type=('build', 'run')) depends_on('py-scipy@0.17.0:', type=('build', 'run')) depends_on('py-py2bit@0.2.0:', type=('build', 'run')) depends_on('py-pybigwig@0.2.1:', type=('build', 'run')) depends_on('py-pysam@0.8.2:', type=('build', 'run')) depends_on('py-matplotlib@1.4.0:', type=('build', 'run')) depends_on('py-numpydoc@0.5:', type=('build', 'run'))
lgpl-2.1
camptocamp/ngo-addons-backport
addons/hr_holidays/__openerp__.py
52
3207
# -*- coding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2004-2010 Tiny SPRL (<http://tiny.be>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## { 'name': 'Leave Management', 'version': '1.5', 'author': 'OpenERP SA', 'category': 'Human Resources', 'sequence': 27, 'summary': 'Holidays, Allocation and Leave Requests', 'website': 'http://www.openerp.com', 'description': """ Manage leaves and allocation requests ===================================== This application controls the holiday schedule of your company. It allows employees to request holidays. Then, managers can review requests for holidays and approve or reject them. This way you can control the overall holiday planning for the company or department. You can configure several kinds of leaves (sickness, holidays, paid days, ...) and allocate leaves to an employee or department quickly using allocation requests. An employee can also make a request for more days off by making a new Allocation. It will increase the total of available days for that leave type (if the request is accepted). You can keep track of leaves in different ways by following reports: * Leaves Summary * Leaves by Department * Leaves Analysis A synchronization with an internal agenda (Meetings of the CRM module) is also possible in order to automatically create a meeting when a holiday request is accepted by setting up a type of meeting in Leave Type. """, 'images': ['images/hr_allocation_requests.jpeg', 'images/hr_leave_requests.jpeg', 'images/leaves_analysis.jpeg'], 'depends': ['hr', 'base_calendar', 'process', 'resource'], 'data': [ 'security/ir.model.access.csv', 'security/ir_rule.xml', 'hr_holidays_workflow.xml', 'hr_holidays_view.xml', 'hr_holidays_data.xml', 'hr_holidays_report.xml', 'report/hr_holidays_report_view.xml', 'report/available_holidays_view.xml', 'wizard/hr_holidays_summary_department_view.xml', 'wizard/hr_holidays_summary_employees_view.xml', 'board_hr_holidays_view.xml', ], 'demo': ['hr_holidays_demo.xml',], 'test': ['test/test_hr_holiday.yml', 'test/hr_holidays_report.yml', ], 'installable': True, 'application': True, 'auto_install': False, } # vim:expandtab:smartindent:tabstop=4:softtabstop=4:shiftwidth=4:
agpl-3.0
henrytao-me/openerp.positionq
openerp/addons/project_gtd/wizard/__init__.py
66
1105
# -*- coding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2004-2010 Tiny SPRL (<http://tiny.be>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## import project_gtd_empty import project_gtd_fill # vim:expandtab:smartindent:tabstop=4:softtabstop=4:shiftwidth=4:
agpl-3.0
dsc-team/dsc-team-kernel-project
tools/perf/scripts/python/Perf-Trace-Util/lib/Perf/Trace/Core.py
802
2710
# Core.py - Python extension for perf trace, core functions # # Copyright (C) 2010 by Tom Zanussi <tzanussi@gmail.com> # # This software may be distributed under the terms of the GNU General # Public License ("GPL") version 2 as published by the Free Software # Foundation. from collections import defaultdict def autodict(): return defaultdict(autodict) flag_fields = autodict() symbolic_fields = autodict() def define_flag_field(event_name, field_name, delim): flag_fields[event_name][field_name]['delim'] = delim def define_flag_value(event_name, field_name, value, field_str): flag_fields[event_name][field_name]['values'][value] = field_str def define_symbolic_field(event_name, field_name): # nothing to do, really pass def define_symbolic_value(event_name, field_name, value, field_str): symbolic_fields[event_name][field_name]['values'][value] = field_str def flag_str(event_name, field_name, value): string = "" if flag_fields[event_name][field_name]: print_delim = 0 keys = flag_fields[event_name][field_name]['values'].keys() keys.sort() for idx in keys: if not value and not idx: string += flag_fields[event_name][field_name]['values'][idx] break if idx and (value & idx) == idx: if print_delim and flag_fields[event_name][field_name]['delim']: string += " " + flag_fields[event_name][field_name]['delim'] + " " string += flag_fields[event_name][field_name]['values'][idx] print_delim = 1 value &= ~idx return string def symbol_str(event_name, field_name, value): string = "" if symbolic_fields[event_name][field_name]: keys = symbolic_fields[event_name][field_name]['values'].keys() keys.sort() for idx in keys: if not value and not idx: string = symbolic_fields[event_name][field_name]['values'][idx] break if (value == idx): string = symbolic_fields[event_name][field_name]['values'][idx] break return string trace_flags = { 0x00: "NONE", \ 0x01: "IRQS_OFF", \ 0x02: "IRQS_NOSUPPORT", \ 0x04: "NEED_RESCHED", \ 0x08: "HARDIRQ", \ 0x10: "SOFTIRQ" } def trace_flag_str(value): string = "" print_delim = 0 keys = trace_flags.keys() for idx in keys: if not value and not idx: string += "NONE" break if idx and (value & idx) == idx: if print_delim: string += " | "; string += trace_flags[idx] print_delim = 1 value &= ~idx return string
gpl-2.0
linuxmaniac/jenkins-job-builder
jenkins_jobs/registry.py
4
8240
#!/usr/bin/env python # Copyright (C) 2015 OpenStack, LLC. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. # Manage Jenkins plugin module registry. import logging import operator import pkg_resources import re from jenkins_jobs.errors import JenkinsJobsException from jenkins_jobs.formatter import deep_format logger = logging.getLogger(__name__) class ModuleRegistry(object): entry_points_cache = {} def __init__(self, config, plugins_list=None): self.modules = [] self.modules_by_component_type = {} self.handlers = {} self.global_config = config if plugins_list is None: self.plugins_dict = {} else: self.plugins_dict = self._get_plugins_info_dict(plugins_list) for entrypoint in pkg_resources.iter_entry_points( group='jenkins_jobs.modules'): Mod = entrypoint.load() mod = Mod(self) self.modules.append(mod) self.modules.sort(key=operator.attrgetter('sequence')) if mod.component_type is not None: self.modules_by_component_type[mod.component_type] = mod @staticmethod def _get_plugins_info_dict(plugins_list): def mutate_plugin_info(plugin_info): """ We perform mutations on a single member of plugin_info here, then return a dictionary with the longName and shortName of the plugin mapped to its plugin info dictionary. """ version = plugin_info.get('version', '0') plugin_info['version'] = re.sub(r'(.*)-(?:SNAPSHOT|BETA)', r'\g<1>.preview', version) aliases = [] for key in ['longName', 'shortName']: value = plugin_info.get(key, None) if value is not None: aliases.append(value) plugin_info_dict = {} for name in aliases: plugin_info_dict[name] = plugin_info return plugin_info_dict list_of_dicts = [mutate_plugin_info(v) for v in plugins_list] plugins_info_dict = {} for d in list_of_dicts: plugins_info_dict.update(d) return plugins_info_dict def get_plugin_info(self, plugin_name): """ This method is intended to provide information about plugins within a given module's implementation of Base.gen_xml. The return value is a dictionary with data obtained directly from a running Jenkins instance. This allows module authors to differentiate generated XML output based on information such as specific plugin versions. :arg string plugin_name: Either the shortName or longName of a plugin as see in a query that looks like: ``http://<jenkins-hostname>/pluginManager/api/json?pretty&depth=2`` During a 'test' run, it is possible to override JJB's query to a live Jenkins instance by passing it a path to a file containing a YAML list of dictionaries that mimics the plugin properties you want your test output to reflect:: jenkins-jobs test -p /path/to/plugins-info.yaml Below is example YAML that might be included in /path/to/plugins-info.yaml. .. literalinclude:: /../../tests/cmd/fixtures/plugins-info.yaml """ return self.plugins_dict.get(plugin_name, {}) def registerHandler(self, category, name, method): cat_dict = self.handlers.get(category, {}) if not cat_dict: self.handlers[category] = cat_dict cat_dict[name] = method def getHandler(self, category, name): return self.handlers[category][name] def dispatch(self, component_type, parser, xml_parent, component, template_data={}): """This is a method that you can call from your implementation of Base.gen_xml or component. It allows modules to define a type of component, and benefit from extensibility via Python entry points and Jenkins Job Builder :ref:`Macros <macro>`. :arg string component_type: the name of the component (e.g., `builder`) :arg YAMLParser parser: the global YAML Parser :arg Element xml_parent: the parent XML element :arg dict template_data: values that should be interpolated into the component definition See :py:class:`jenkins_jobs.modules.base.Base` for how to register components of a module. See the Publishers module for a simple example of how to use this method. """ if component_type not in self.modules_by_component_type: raise JenkinsJobsException("Unknown component type: " "'{0}'.".format(component_type)) component_list_type = self.modules_by_component_type[component_type] \ .component_list_type if isinstance(component, dict): # The component is a singleton dictionary of name: dict(args) name, component_data = next(iter(component.items())) if template_data: # Template data contains values that should be interpolated # into the component definition allow_empty_variables = self.global_config \ and self.global_config.has_section('job_builder') \ and self.global_config.has_option( 'job_builder', 'allow_empty_variables') \ and self.global_config.getboolean( 'job_builder', 'allow_empty_variables') component_data = deep_format( component_data, template_data, allow_empty_variables) else: # The component is a simple string name, eg "run-tests" name = component component_data = {} # Look for a component function defined in an entry point eps = ModuleRegistry.entry_points_cache.get(component_list_type) if eps is None: module_eps = list(pkg_resources.iter_entry_points( group='jenkins_jobs.{0}'.format(component_list_type))) eps = {} for module_ep in module_eps: if module_ep.name in eps: raise JenkinsJobsException( "Duplicate entry point found for component type: " "'{0}', '{0}'," "name: '{1}'".format(component_type, name)) eps[module_ep.name] = module_ep ModuleRegistry.entry_points_cache[component_list_type] = eps logger.debug("Cached entry point group %s = %s", component_list_type, eps) if name in eps: func = eps[name].load() func(parser, xml_parent, component_data) else: # Otherwise, see if it's defined as a macro component = parser.data.get(component_type, {}).get(name) if component: for b in component[component_list_type]: # Pass component_data in as template data to this function # so that if the macro is invoked with arguments, # the arguments are interpolated into the real defn. self.dispatch(component_type, parser, xml_parent, b, component_data) else: raise JenkinsJobsException("Unknown entry point or macro '{0}'" " for component type: '{1}'.". format(name, component_type))
apache-2.0
jonathan-beard/edx-platform
openedx/core/djangoapps/user_api/course_tag/tests/test_api.py
118
1348
""" Test the user course tag API. """ from django.test import TestCase from student.tests.factories import UserFactory from openedx.core.djangoapps.user_api.course_tag import api as course_tag_api from opaque_keys.edx.locations import SlashSeparatedCourseKey class TestCourseTagAPI(TestCase): """ Test the user service """ def setUp(self): super(TestCourseTagAPI, self).setUp() self.user = UserFactory.create() self.course_id = SlashSeparatedCourseKey('test_org', 'test_course_number', 'test_run') self.test_key = 'test_key' def test_get_set_course_tag(self): # get a tag that doesn't exist tag = course_tag_api.get_course_tag(self.user, self.course_id, self.test_key) self.assertIsNone(tag) # test setting a new key test_value = 'value' course_tag_api.set_course_tag(self.user, self.course_id, self.test_key, test_value) tag = course_tag_api.get_course_tag(self.user, self.course_id, self.test_key) self.assertEqual(tag, test_value) #test overwriting an existing key test_value = 'value2' course_tag_api.set_course_tag(self.user, self.course_id, self.test_key, test_value) tag = course_tag_api.get_course_tag(self.user, self.course_id, self.test_key) self.assertEqual(tag, test_value)
agpl-3.0
jorik041/phantomjs
src/qt/qtwebkit/Tools/Scripts/webkitpy/common/net/networktransaction.py
190
2926
# Copyright (C) 2010 Google Inc. All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following disclaimer # in the documentation and/or other materials provided with the # distribution. # * Neither the name of Google Inc. nor the names of its # contributors may be used to endorse or promote products derived from # this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. import logging import time import urllib2 _log = logging.getLogger(__name__) class NetworkTimeout(Exception): def __str__(self): return 'NetworkTimeout' class NetworkTransaction(object): def __init__(self, initial_backoff_seconds=10, grown_factor=1.5, timeout_seconds=(10 * 60), convert_404_to_None=False): self._initial_backoff_seconds = initial_backoff_seconds self._grown_factor = grown_factor self._timeout_seconds = timeout_seconds self._convert_404_to_None = convert_404_to_None def run(self, request): self._total_sleep = 0 self._backoff_seconds = self._initial_backoff_seconds while True: try: return request() except urllib2.HTTPError, e: if self._convert_404_to_None and e.code == 404: return None self._check_for_timeout() _log.warn("Received HTTP status %s loading \"%s\". Retrying in %s seconds..." % (e.code, e.filename, self._backoff_seconds)) self._sleep() def _check_for_timeout(self): if self._total_sleep + self._backoff_seconds > self._timeout_seconds: raise NetworkTimeout() def _sleep(self): time.sleep(self._backoff_seconds) self._total_sleep += self._backoff_seconds self._backoff_seconds *= self._grown_factor
bsd-3-clause
jhuapl-marti/marti
env-crits/lib/python2.7/site-packages/pkg_resources/tests/test_pkg_resources.py
242
3447
import sys import tempfile import os import zipfile import datetime import time import subprocess import pkg_resources try: unicode except NameError: unicode = str def timestamp(dt): """ Return a timestamp for a local, naive datetime instance. """ try: return dt.timestamp() except AttributeError: # Python 3.2 and earlier return time.mktime(dt.timetuple()) class EggRemover(unicode): def __call__(self): if self in sys.path: sys.path.remove(self) if os.path.exists(self): os.remove(self) class TestZipProvider(object): finalizers = [] ref_time = datetime.datetime(2013, 5, 12, 13, 25, 0) "A reference time for a file modification" @classmethod def setup_class(cls): "create a zip egg and add it to sys.path" egg = tempfile.NamedTemporaryFile(suffix='.egg', delete=False) zip_egg = zipfile.ZipFile(egg, 'w') zip_info = zipfile.ZipInfo() zip_info.filename = 'mod.py' zip_info.date_time = cls.ref_time.timetuple() zip_egg.writestr(zip_info, 'x = 3\n') zip_info = zipfile.ZipInfo() zip_info.filename = 'data.dat' zip_info.date_time = cls.ref_time.timetuple() zip_egg.writestr(zip_info, 'hello, world!') zip_egg.close() egg.close() sys.path.append(egg.name) cls.finalizers.append(EggRemover(egg.name)) @classmethod def teardown_class(cls): for finalizer in cls.finalizers: finalizer() def test_resource_filename_rewrites_on_change(self): """ If a previous call to get_resource_filename has saved the file, but the file has been subsequently mutated with different file of the same size and modification time, it should not be overwritten on a subsequent call to get_resource_filename. """ import mod manager = pkg_resources.ResourceManager() zp = pkg_resources.ZipProvider(mod) filename = zp.get_resource_filename(manager, 'data.dat') actual = datetime.datetime.fromtimestamp(os.stat(filename).st_mtime) assert actual == self.ref_time f = open(filename, 'w') f.write('hello, world?') f.close() ts = timestamp(self.ref_time) os.utime(filename, (ts, ts)) filename = zp.get_resource_filename(manager, 'data.dat') f = open(filename) assert f.read() == 'hello, world!' manager.cleanup_resources() class TestResourceManager(object): def test_get_cache_path(self): mgr = pkg_resources.ResourceManager() path = mgr.get_cache_path('foo') type_ = str(type(path)) message = "Unexpected type from get_cache_path: " + type_ assert isinstance(path, (unicode, str)), message class TestIndependence: """ Tests to ensure that pkg_resources runs independently from setuptools. """ def test_setuptools_not_imported(self): """ In a separate Python environment, import pkg_resources and assert that action doesn't cause setuptools to be imported. """ lines = ( 'import pkg_resources', 'import sys', 'assert "setuptools" not in sys.modules, ' '"setuptools was imported"', ) cmd = [sys.executable, '-c', '; '.join(lines)] subprocess.check_call(cmd)
mit
kod3r/pyNES
pynes/cartridge.py
28
2314
class Cartridge: def __init__(self): self.banks = {} self.bank_id = 0 self.pc = 0 self.inespgr = 1 self.ineschr = 1 self.inesmap = 1 self.inesmir = 1 self.rs = 0 self.path = '' def nes_id(self): # NES return [0x4e, 0x45, 0x53, 0x1a] def nes_get_header(self): id = self.nes_id() unused = [0, 0, 0, 0, 0, 0, 0, 0] header = [] header.extend(id) header.append(self.inespgr) header.append(self.ineschr) header.append(self.inesmir) header.append(self.inesmap) header.extend(unused) return header def set_iNES_prg(self, inespgr): self.inespgr = inespgr def set_iNES_chr(self, ineschr): self.ineschr = ineschr def set_iNES_map(self, inesmap): self.inesmap = inesmap def set_iNES_mir(self, inesmir): self.inesmir = inesmir def set_bank_id(self, id): if id not in self.banks: self.banks[id] = dict(code=[], start=None, size=(1024 * 8)) self.bank_id = id def set_org(self, org): if self.bank_id not in self.banks: self.set_bank_id(self.bank_id) if not self.banks[self.bank_id]['start']: self.banks[self.bank_id]['start'] = org self.pc = org else: while self.pc < org: self.append_code([0xff]) self.pc = org def append_code(self, code): if self.bank_id not in self.banks: self.set_bank_id(self.bank_id) for c in code: assert c <= 0xff self.banks[self.bank_id]['code'].extend(code) self.pc += len(code) def get_code(self): if self.bank_id not in self.banks: self.set_bank_id(self.bank_id) return self.banks[self.bank_id]['code'] def get_ines_code(self): if self.bank_id not in self.banks: self.set_bank_id(self.bank_id) bin = [] nes_header = self.nes_get_header() bin.extend(nes_header) for i in self.banks: for j in range(len(self.banks[i]['code']), self.banks[i]['size']): self.banks[i]['code'].append(0xff) bin.extend(self.banks[i]['code']) return bin
bsd-3-clause
toontownfunserver/Panda3D-1.9.0
python/Lib/email/mime/multipart.py
480
1573
# Copyright (C) 2002-2006 Python Software Foundation # Author: Barry Warsaw # Contact: email-sig@python.org """Base class for MIME multipart/* type messages.""" __all__ = ['MIMEMultipart'] from email.mime.base import MIMEBase class MIMEMultipart(MIMEBase): """Base class for MIME multipart/* type messages.""" def __init__(self, _subtype='mixed', boundary=None, _subparts=None, **_params): """Creates a multipart/* type message. By default, creates a multipart/mixed message, with proper Content-Type and MIME-Version headers. _subtype is the subtype of the multipart content type, defaulting to `mixed'. boundary is the multipart boundary string. By default it is calculated as needed. _subparts is a sequence of initial subparts for the payload. It must be an iterable object, such as a list. You can always attach new subparts to the message by using the attach() method. Additional parameters for the Content-Type header are taken from the keyword arguments (or passed into the _params argument). """ MIMEBase.__init__(self, 'multipart', _subtype, **_params) # Initialise _payload to an empty list as the Message superclass's # implementation of is_multipart assumes that _payload is a list for # multipart messages. self._payload = [] if _subparts: for p in _subparts: self.attach(p) if boundary: self.set_boundary(boundary)
bsd-3-clause
cristian99garcia/pilas-activity
pilas/video/video.py
7
3167
# -*- encoding: utf-8 -*- ''' import pilas try: import opencv from opencv import highgui except ImportError: opencv = None import os try: from PySFML import sf except ImportError: pass class MissingOpencv(Exception): def __init__(self): self.value = "Open CV no esta instalado, obtengalo en http://opencv.willowgarage.com" def __str__(self): return repr(self.value) def error(biblioteca, web): print "Error, no ecuentra la biblioteca '%s' (de %s)" %(biblioteca, web) def no_opencv(): from pilas.utils import esta_en_sesion_interactiva if esta_en_sesion_interactiva(): error('opencv', 'http://opencv.willowgarage.com') else: raise MissingOpencv() class DeCamara(pilas.actores.Actor): """ Nos permite poner en pantalla el video proveniente de la camara web. """ def __init__(self, ancho=640, alto=480): if opencv is None: no_opencv() return import webcam self.camara = webcam.CamaraWeb self.ultimo_numero_de_cuadro = 0 pilas.actores.Actor.__init__(self, 'fondos/pasto.png') pilas.mundo.agregar_tarea_siempre(0.15,self.actualizar_video) def actualizar_video(self): cuadro, numero_de_cuadro = self.camara.obtener_imagen(self.ultimo_numero_de_cuadro) self.ultimo_numero_de_cuadro = numero_de_cuadro self.imagen.LoadFromPixels(640, 480, cuadro) return True class VideoDeArchivo(object): def __init__(self, ruta): if opencv is None: no_opencv() return if not os.path.isfile(ruta): raise IOError('El archiyo no existe') self._camara = highgui.cvCreateFileCapture(ruta) self.fps = highgui.cvGetCaptureProperty(self._camara, highgui.CV_CAP_PROP_FPS) self.altura = highgui.cvGetCaptureProperty(self._camara, highgui.CV_CAP_PROP_FRAME_HEIGHT) self.ancho =highgui.cvGetCaptureProperty(self._camara, highgui.CV_CAP_PROP_FRAME_WIDTH) super(VideoDeArchivo, self).__init__() def obtener_imagen(self): imagen_ipl = highgui.cvQueryFrame(self._camara) imagen_ipl = opencv.cvGetMat(imagen_ipl) return opencv.adaptors.Ipl2PIL(imagen_ipl).convert('RGBA').tostring() class DePelicula(pilas.actores.Actor): """ Nos permite poner en pantalla un video desde un archivo. Toma como parametro la ruta del video. """ def __init__(self, path, ancho=640, alto=480): self._camara = VideoDeArchivo(path) pilas.actores.Actor.__init__(self) self._altura_cuadro = self._camara.altura self._ancho_cuadro = self._camara.ancho subrect = self._actor.GetSubRect() subrect.Right = self._ancho_cuadro subrect.Bottom = self._altura_cuadro self._actor.SetSubRect(subrect) self.centro = ('centro', 'centro') pilas.mundo.agregar_tarea_siempre(1/self._camara.fps,self.actualizar_video) def actualizar_video(self): self.imagen.LoadFromPixels(self._ancho_cuadro, self._altura_cuadro, self._camara.obtener_imagen()) return True '''
gpl-3.0
labcodes/django
django/db/models/options.py
6
34598
import copy import warnings from bisect import bisect from collections import OrderedDict, defaultdict from itertools import chain from django.apps import apps from django.conf import settings from django.core.exceptions import FieldDoesNotExist, ImproperlyConfigured from django.db import connections from django.db.models import Manager from django.db.models.fields import AutoField from django.db.models.fields.proxy import OrderWrt from django.db.models.query_utils import PathInfo from django.utils.datastructures import ImmutableList, OrderedSet from django.utils.deprecation import RemovedInDjango21Warning from django.utils.functional import cached_property from django.utils.text import camel_case_to_spaces, format_lazy from django.utils.translation import override PROXY_PARENTS = object() EMPTY_RELATION_TREE = tuple() IMMUTABLE_WARNING = ( "The return type of '%s' should never be mutated. If you want to manipulate this list " "for your own use, make a copy first." ) DEFAULT_NAMES = ( 'verbose_name', 'verbose_name_plural', 'db_table', 'ordering', 'unique_together', 'permissions', 'get_latest_by', 'order_with_respect_to', 'app_label', 'db_tablespace', 'abstract', 'managed', 'proxy', 'swappable', 'auto_created', 'index_together', 'apps', 'default_permissions', 'select_on_save', 'default_related_name', 'required_db_features', 'required_db_vendor', 'base_manager_name', 'default_manager_name', 'indexes', ) def normalize_together(option_together): """ option_together can be either a tuple of tuples, or a single tuple of two strings. Normalize it to a tuple of tuples, so that calling code can uniformly expect that. """ try: if not option_together: return () if not isinstance(option_together, (tuple, list)): raise TypeError first_element = next(iter(option_together)) if not isinstance(first_element, (tuple, list)): option_together = (option_together,) # Normalize everything to tuples return tuple(tuple(ot) for ot in option_together) except TypeError: # If the value of option_together isn't valid, return it # verbatim; this will be picked up by the check framework later. return option_together def make_immutable_fields_list(name, data): return ImmutableList(data, warning=IMMUTABLE_WARNING % name) class Options: FORWARD_PROPERTIES = { 'fields', 'many_to_many', 'concrete_fields', 'local_concrete_fields', '_forward_fields_map', 'managers', 'managers_map', 'base_manager', 'default_manager', } REVERSE_PROPERTIES = {'related_objects', 'fields_map', '_relation_tree'} default_apps = apps def __init__(self, meta, app_label=None): self._get_fields_cache = {} self.local_fields = [] self.local_many_to_many = [] self.private_fields = [] self.local_managers = [] self.base_manager_name = None self.default_manager_name = None self.model_name = None self.verbose_name = None self.verbose_name_plural = None self.db_table = '' self.ordering = [] self._ordering_clash = False self.indexes = [] self.unique_together = [] self.index_together = [] self.select_on_save = False self.default_permissions = ('add', 'change', 'delete') self.permissions = [] self.object_name = None self.app_label = app_label self.get_latest_by = None self.order_with_respect_to = None self.db_tablespace = settings.DEFAULT_TABLESPACE self.required_db_features = [] self.required_db_vendor = None self.meta = meta self.pk = None self.auto_field = None self.abstract = False self.managed = True self.proxy = False # For any class that is a proxy (including automatically created # classes for deferred object loading), proxy_for_model tells us # which class this model is proxying. Note that proxy_for_model # can create a chain of proxy models. For non-proxy models, the # variable is always None. self.proxy_for_model = None # For any non-abstract class, the concrete class is the model # in the end of the proxy_for_model chain. In particular, for # concrete models, the concrete_model is always the class itself. self.concrete_model = None self.swappable = None self.parents = OrderedDict() self.auto_created = False # List of all lookups defined in ForeignKey 'limit_choices_to' options # from *other* models. Needed for some admin checks. Internal use only. self.related_fkey_lookups = [] # A custom app registry to use, if you're making a separate model set. self.apps = self.default_apps self.default_related_name = None @property def label(self): return '%s.%s' % (self.app_label, self.object_name) @property def label_lower(self): return '%s.%s' % (self.app_label, self.model_name) @property def app_config(self): # Don't go through get_app_config to avoid triggering imports. return self.apps.app_configs.get(self.app_label) @property def installed(self): return self.app_config is not None def contribute_to_class(self, cls, name): from django.db import connection from django.db.backends.utils import truncate_name cls._meta = self self.model = cls # First, construct the default values for these options. self.object_name = cls.__name__ self.model_name = self.object_name.lower() self.verbose_name = camel_case_to_spaces(self.object_name) # Store the original user-defined values for each option, # for use when serializing the model definition self.original_attrs = {} # Next, apply any overridden values from 'class Meta'. if self.meta: meta_attrs = self.meta.__dict__.copy() for name in self.meta.__dict__: # Ignore any private attributes that Django doesn't care about. # NOTE: We can't modify a dictionary's contents while looping # over it, so we loop over the *original* dictionary instead. if name.startswith('_'): del meta_attrs[name] for attr_name in DEFAULT_NAMES: if attr_name in meta_attrs: setattr(self, attr_name, meta_attrs.pop(attr_name)) self.original_attrs[attr_name] = getattr(self, attr_name) elif hasattr(self.meta, attr_name): setattr(self, attr_name, getattr(self.meta, attr_name)) self.original_attrs[attr_name] = getattr(self, attr_name) self.unique_together = normalize_together(self.unique_together) self.index_together = normalize_together(self.index_together) # verbose_name_plural is a special case because it uses a 's' # by default. if self.verbose_name_plural is None: self.verbose_name_plural = format_lazy('{}s', self.verbose_name) # order_with_respect_and ordering are mutually exclusive. self._ordering_clash = bool(self.ordering and self.order_with_respect_to) # Any leftover attributes must be invalid. if meta_attrs != {}: raise TypeError("'class Meta' got invalid attribute(s): %s" % ','.join(meta_attrs.keys())) else: self.verbose_name_plural = format_lazy('{}s', self.verbose_name) del self.meta # If the db_table wasn't provided, use the app_label + model_name. if not self.db_table: self.db_table = "%s_%s" % (self.app_label, self.model_name) self.db_table = truncate_name(self.db_table, connection.ops.max_name_length()) def _prepare(self, model): if self.order_with_respect_to: # The app registry will not be ready at this point, so we cannot # use get_field(). query = self.order_with_respect_to try: self.order_with_respect_to = next( f for f in self._get_fields(reverse=False) if f.name == query or f.attname == query ) except StopIteration: raise FieldDoesNotExist("%s has no field named '%s'" % (self.object_name, query)) self.ordering = ('_order',) if not any(isinstance(field, OrderWrt) for field in model._meta.local_fields): model.add_to_class('_order', OrderWrt()) else: self.order_with_respect_to = None if self.pk is None: if self.parents: # Promote the first parent link in lieu of adding yet another # field. field = next(iter(self.parents.values())) # Look for a local field with the same name as the # first parent link. If a local field has already been # created, use it instead of promoting the parent already_created = [fld for fld in self.local_fields if fld.name == field.name] if already_created: field = already_created[0] field.primary_key = True self.setup_pk(field) if not field.remote_field.parent_link: raise ImproperlyConfigured( 'Add parent_link=True to %s.' % field, ) else: auto = AutoField(verbose_name='ID', primary_key=True, auto_created=True) model.add_to_class('id', auto) def add_manager(self, manager): self.local_managers.append(manager) self._expire_cache() def add_field(self, field, private=False): # Insert the given field in the order in which it was created, using # the "creation_counter" attribute of the field. # Move many-to-many related fields from self.fields into # self.many_to_many. if private: self.private_fields.append(field) elif field.is_relation and field.many_to_many: self.local_many_to_many.insert(bisect(self.local_many_to_many, field), field) else: self.local_fields.insert(bisect(self.local_fields, field), field) self.setup_pk(field) # If the field being added is a relation to another known field, # expire the cache on this field and the forward cache on the field # being referenced, because there will be new relationships in the # cache. Otherwise, expire the cache of references *to* this field. # The mechanism for getting at the related model is slightly odd - # ideally, we'd just ask for field.related_model. However, related_model # is a cached property, and all the models haven't been loaded yet, so # we need to make sure we don't cache a string reference. if field.is_relation and hasattr(field.remote_field, 'model') and field.remote_field.model: try: field.remote_field.model._meta._expire_cache(forward=False) except AttributeError: pass self._expire_cache() else: self._expire_cache(reverse=False) def setup_pk(self, field): if not self.pk and field.primary_key: self.pk = field field.serialize = False def setup_proxy(self, target): """ Do the internal setup so that the current model is a proxy for "target". """ self.pk = target._meta.pk self.proxy_for_model = target self.db_table = target._meta.db_table def __repr__(self): return '<Options for %s>' % self.object_name def __str__(self): return "%s.%s" % (self.app_label, self.model_name) def can_migrate(self, connection): """ Return True if the model can/should be migrated on the `connection`. `connection` can be either a real connection or a connection alias. """ if self.proxy or self.swapped or not self.managed: return False if isinstance(connection, str): connection = connections[connection] if self.required_db_vendor: return self.required_db_vendor == connection.vendor if self.required_db_features: return all(getattr(connection.features, feat, False) for feat in self.required_db_features) return True @property def verbose_name_raw(self): """Return the untranslated verbose name.""" with override(None): return str(self.verbose_name) @property def swapped(self): """ Has this model been swapped out for another? If so, return the model name of the replacement; otherwise, return None. For historical reasons, model name lookups using get_model() are case insensitive, so we make sure we are case insensitive here. """ if self.swappable: swapped_for = getattr(settings, self.swappable, None) if swapped_for: try: swapped_label, swapped_object = swapped_for.split('.') except ValueError: # setting not in the format app_label.model_name # raising ImproperlyConfigured here causes problems with # test cleanup code - instead it is raised in get_user_model # or as part of validation. return swapped_for if '%s.%s' % (swapped_label, swapped_object.lower()) != self.label_lower: return swapped_for return None @cached_property def managers(self): managers = [] seen_managers = set() bases = (b for b in self.model.mro() if hasattr(b, '_meta')) for depth, base in enumerate(bases): for manager in base._meta.local_managers: if manager.name in seen_managers: continue manager = copy.copy(manager) manager.model = self.model seen_managers.add(manager.name) managers.append((depth, manager.creation_counter, manager)) return make_immutable_fields_list( "managers", (m[2] for m in sorted(managers)), ) @cached_property def managers_map(self): return {manager.name: manager for manager in self.managers} @cached_property def base_manager(self): base_manager_name = self.base_manager_name if not base_manager_name: # Get the first parent's base_manager_name if there's one. for parent in self.model.mro()[1:]: if hasattr(parent, '_meta'): if parent._base_manager.name != '_base_manager': base_manager_name = parent._base_manager.name break if base_manager_name: try: return self.managers_map[base_manager_name] except KeyError: raise ValueError( "%s has no manager named %r" % ( self.object_name, base_manager_name, ) ) manager = Manager() manager.name = '_base_manager' manager.model = self.model manager.auto_created = True return manager @cached_property def default_manager(self): default_manager_name = self.default_manager_name if not default_manager_name and not self.local_managers: # Get the first parent's default_manager_name if there's one. for parent in self.model.mro()[1:]: if hasattr(parent, '_meta'): default_manager_name = parent._meta.default_manager_name break if default_manager_name: try: return self.managers_map[default_manager_name] except KeyError: raise ValueError( "%s has no manager named %r" % ( self.object_name, default_manager_name, ) ) if self.managers: return self.managers[0] @cached_property def fields(self): """ Return a list of all forward fields on the model and its parents, excluding ManyToManyFields. Private API intended only to be used by Django itself; get_fields() combined with filtering of field properties is the public API for obtaining this field list. """ # For legacy reasons, the fields property should only contain forward # fields that are not private or with a m2m cardinality. Therefore we # pass these three filters as filters to the generator. # The third lambda is a longwinded way of checking f.related_model - we don't # use that property directly because related_model is a cached property, # and all the models may not have been loaded yet; we don't want to cache # the string reference to the related_model. def is_not_an_m2m_field(f): return not (f.is_relation and f.many_to_many) def is_not_a_generic_relation(f): return not (f.is_relation and f.one_to_many) def is_not_a_generic_foreign_key(f): return not ( f.is_relation and f.many_to_one and not (hasattr(f.remote_field, 'model') and f.remote_field.model) ) return make_immutable_fields_list( "fields", (f for f in self._get_fields(reverse=False) if is_not_an_m2m_field(f) and is_not_a_generic_relation(f) and is_not_a_generic_foreign_key(f)) ) @cached_property def concrete_fields(self): """ Return a list of all concrete fields on the model and its parents. Private API intended only to be used by Django itself; get_fields() combined with filtering of field properties is the public API for obtaining this field list. """ return make_immutable_fields_list( "concrete_fields", (f for f in self.fields if f.concrete) ) @cached_property def local_concrete_fields(self): """ Return a list of all concrete fields on the model. Private API intended only to be used by Django itself; get_fields() combined with filtering of field properties is the public API for obtaining this field list. """ return make_immutable_fields_list( "local_concrete_fields", (f for f in self.local_fields if f.concrete) ) @cached_property def many_to_many(self): """ Return a list of all many to many fields on the model and its parents. Private API intended only to be used by Django itself; get_fields() combined with filtering of field properties is the public API for obtaining this list. """ return make_immutable_fields_list( "many_to_many", (f for f in self._get_fields(reverse=False) if f.is_relation and f.many_to_many) ) @cached_property def related_objects(self): """ Return all related objects pointing to the current model. The related objects can come from a one-to-one, one-to-many, or many-to-many field relation type. Private API intended only to be used by Django itself; get_fields() combined with filtering of field properties is the public API for obtaining this field list. """ all_related_fields = self._get_fields(forward=False, reverse=True, include_hidden=True) return make_immutable_fields_list( "related_objects", (obj for obj in all_related_fields if not obj.hidden or obj.field.many_to_many) ) @cached_property def _forward_fields_map(self): res = {} fields = self._get_fields(reverse=False) for field in fields: res[field.name] = field # Due to the way Django's internals work, get_field() should also # be able to fetch a field by attname. In the case of a concrete # field with relation, includes the *_id name too try: res[field.attname] = field except AttributeError: pass return res @cached_property def fields_map(self): res = {} fields = self._get_fields(forward=False, include_hidden=True) for field in fields: res[field.name] = field # Due to the way Django's internals work, get_field() should also # be able to fetch a field by attname. In the case of a concrete # field with relation, includes the *_id name too try: res[field.attname] = field except AttributeError: pass return res def get_field(self, field_name): """ Return a field instance given the name of a forward or reverse field. """ try: # In order to avoid premature loading of the relation tree # (expensive) we prefer checking if the field is a forward field. return self._forward_fields_map[field_name] except KeyError: # If the app registry is not ready, reverse fields are # unavailable, therefore we throw a FieldDoesNotExist exception. if not self.apps.models_ready: raise FieldDoesNotExist( "%s has no field named '%s'. The app cache isn't ready yet, " "so if this is an auto-created related field, it won't " "be available yet." % (self.object_name, field_name) ) try: # Retrieve field instance by name from cached or just-computed # field map. return self.fields_map[field_name] except KeyError: raise FieldDoesNotExist("%s has no field named '%s'" % (self.object_name, field_name)) def get_base_chain(self, model): """ Return a list of parent classes leading to `model` (ordered from closest to most distant ancestor). This has to handle the case where `model` is a grandparent or even more distant relation. """ if not self.parents: return [] if model in self.parents: return [model] for parent in self.parents: res = parent._meta.get_base_chain(model) if res: res.insert(0, parent) return res return [] def get_parent_list(self): """ Return all the ancestors of this model as a list ordered by MRO. Useful for determining if something is an ancestor, regardless of lineage. """ result = OrderedSet(self.parents) for parent in self.parents: for ancestor in parent._meta.get_parent_list(): result.add(ancestor) return list(result) def get_ancestor_link(self, ancestor): """ Return the field on the current model which points to the given "ancestor". This is possible an indirect link (a pointer to a parent model, which points, eventually, to the ancestor). Used when constructing table joins for model inheritance. Return None if the model isn't an ancestor of this one. """ if ancestor in self.parents: return self.parents[ancestor] for parent in self.parents: # Tries to get a link field from the immediate parent parent_link = parent._meta.get_ancestor_link(ancestor) if parent_link: # In case of a proxied model, the first link # of the chain to the ancestor is that parent # links return self.parents[parent] or parent_link def get_path_to_parent(self, parent): """ Return a list of PathInfos containing the path from the current model to the parent model, or an empty list if parent is not a parent of the current model. """ if self.model is parent: return [] # Skip the chain of proxy to the concrete proxied model. proxied_model = self.concrete_model path = [] opts = self for int_model in self.get_base_chain(parent): if int_model is proxied_model: opts = int_model._meta else: final_field = opts.parents[int_model] targets = (final_field.remote_field.get_related_field(),) opts = int_model._meta path.append(PathInfo(final_field.model._meta, opts, targets, final_field, False, True)) return path def get_path_from_parent(self, parent): """ Return a list of PathInfos containing the path from the parent model to the current model, or an empty list if parent is not a parent of the current model. """ if self.model is parent: return [] model = self.concrete_model # Get a reversed base chain including both the current and parent # models. chain = model._meta.get_base_chain(parent) chain.reverse() chain.append(model) # Construct a list of the PathInfos between models in chain. path = [] for i, ancestor in enumerate(chain[:-1]): child = chain[i + 1] link = child._meta.get_ancestor_link(ancestor) path.extend(link.get_reverse_path_info()) return path def _populate_directed_relation_graph(self): """ This method is used by each model to find its reverse objects. As this method is very expensive and is accessed frequently (it looks up every field in a model, in every app), it is computed on first access and then is set as a property on every model. """ related_objects_graph = defaultdict(list) all_models = self.apps.get_models(include_auto_created=True) for model in all_models: opts = model._meta # Abstract model's fields are copied to child models, hence we will # see the fields from the child models. if opts.abstract: continue fields_with_relations = ( f for f in opts._get_fields(reverse=False, include_parents=False) if f.is_relation and f.related_model is not None ) for f in fields_with_relations: if not isinstance(f.remote_field.model, str): related_objects_graph[f.remote_field.model._meta.concrete_model._meta].append(f) for model in all_models: # Set the relation_tree using the internal __dict__. In this way # we avoid calling the cached property. In attribute lookup, # __dict__ takes precedence over a data descriptor (such as # @cached_property). This means that the _meta._relation_tree is # only called if related_objects is not in __dict__. related_objects = related_objects_graph[model._meta.concrete_model._meta] model._meta.__dict__['_relation_tree'] = related_objects # It seems it is possible that self is not in all_models, so guard # against that with default for get(). return self.__dict__.get('_relation_tree', EMPTY_RELATION_TREE) @cached_property def _relation_tree(self): return self._populate_directed_relation_graph() def _expire_cache(self, forward=True, reverse=True): # This method is usually called by apps.cache_clear(), when the # registry is finalized, or when a new field is added. if forward: for cache_key in self.FORWARD_PROPERTIES: if cache_key in self.__dict__: delattr(self, cache_key) if reverse and not self.abstract: for cache_key in self.REVERSE_PROPERTIES: if cache_key in self.__dict__: delattr(self, cache_key) self._get_fields_cache = {} def get_fields(self, include_parents=True, include_hidden=False): """ Return a list of fields associated to the model. By default, include forward and reverse fields, fields derived from inheritance, but not hidden fields. The returned fields can be changed using the parameters: - include_parents: include fields derived from inheritance - include_hidden: include fields that have a related_name that starts with a "+" """ if include_parents is False: include_parents = PROXY_PARENTS return self._get_fields(include_parents=include_parents, include_hidden=include_hidden) def _get_fields(self, forward=True, reverse=True, include_parents=True, include_hidden=False, seen_models=None): """ Internal helper function to return fields of the model. * If forward=True, then fields defined on this model are returned. * If reverse=True, then relations pointing to this model are returned. * If include_hidden=True, then fields with is_hidden=True are returned. * The include_parents argument toggles if fields from parent models should be included. It has three values: True, False, and PROXY_PARENTS. When set to PROXY_PARENTS, the call will return all fields defined for the current model or any of its parents in the parent chain to the model's concrete model. """ if include_parents not in (True, False, PROXY_PARENTS): raise TypeError("Invalid argument for include_parents: %s" % (include_parents,)) # This helper function is used to allow recursion in ``get_fields()`` # implementation and to provide a fast way for Django's internals to # access specific subsets of fields. # We must keep track of which models we have already seen. Otherwise we # could include the same field multiple times from different models. topmost_call = False if seen_models is None: seen_models = set() topmost_call = True seen_models.add(self.model) # Creates a cache key composed of all arguments cache_key = (forward, reverse, include_parents, include_hidden, topmost_call) try: # In order to avoid list manipulation. Always return a shallow copy # of the results. return self._get_fields_cache[cache_key] except KeyError: pass fields = [] # Recursively call _get_fields() on each parent, with the same # options provided in this call. if include_parents is not False: for parent in self.parents: # In diamond inheritance it is possible that we see the same # model from two different routes. In that case, avoid adding # fields from the same parent again. if parent in seen_models: continue if (parent._meta.concrete_model != self.concrete_model and include_parents == PROXY_PARENTS): continue for obj in parent._meta._get_fields( forward=forward, reverse=reverse, include_parents=include_parents, include_hidden=include_hidden, seen_models=seen_models): if getattr(obj, 'parent_link', False) and obj.model != self.concrete_model: continue fields.append(obj) if reverse and not self.proxy: # Tree is computed once and cached until the app cache is expired. # It is composed of a list of fields pointing to the current model # from other models. all_fields = self._relation_tree for field in all_fields: # If hidden fields should be included or the relation is not # intentionally hidden, add to the fields dict. if include_hidden or not field.remote_field.hidden: fields.append(field.remote_field) if forward: fields.extend( field for field in chain(self.local_fields, self.local_many_to_many) ) # Private fields are recopied to each child model, and they get a # different model as field.model in each child. Hence we have to # add the private fields separately from the topmost call. If we # did this recursively similar to local_fields, we would get field # instances with field.model != self.model. if topmost_call: fields.extend( f for f in self.private_fields ) # In order to avoid list manipulation. Always # return a shallow copy of the results fields = make_immutable_fields_list("get_fields()", fields) # Store result into cache for later access self._get_fields_cache[cache_key] = fields return fields @property def has_auto_field(self): warnings.warn( 'Model._meta.has_auto_field is deprecated in favor of checking if ' 'Model._meta.auto_field is not None.', RemovedInDjango21Warning, stacklevel=2 ) return self.auto_field is not None @has_auto_field.setter def has_auto_field(self, value): pass @cached_property def _property_names(self): """ Return a set of the names of the properties defined on the model. Internal helper for model initialization. """ return frozenset({ attr for attr in dir(self.model) if isinstance(getattr(self.model, attr), property) })
bsd-3-clause
GrimDerp/httpie
tests/test_sessions.py
42
6319
# coding=utf-8 import os import shutil import sys import pytest from httpie.plugins.builtin import HTTPBasicAuth from utils import TestEnvironment, mk_config_dir, http, HTTP_OK, \ no_content_type from fixtures import UNICODE class SessionTestBase(object): def start_session(self, httpbin): """Create and reuse a unique config dir for each test.""" self.config_dir = mk_config_dir() def teardown_method(self, method): shutil.rmtree(self.config_dir) def env(self): """ Return an environment. Each environment created withing a test method will share the same config_dir. It is necessary for session files being reused. """ return TestEnvironment(config_dir=self.config_dir) class TestSessionFlow(SessionTestBase): """ These tests start with an existing session created in `setup_method()`. """ def start_session(self, httpbin): """ Start a full-blown session with a custom request header, authorization, and response cookies. """ super(TestSessionFlow, self).start_session(httpbin) r1 = http('--follow', '--session=test', '--auth=username:password', 'GET', httpbin.url + '/cookies/set?hello=world', 'Hello:World', env=self.env()) assert HTTP_OK in r1 def test_session_created_and_reused(self, httpbin): self.start_session(httpbin) # Verify that the session created in setup_method() has been used. r2 = http('--session=test', 'GET', httpbin.url + '/get', env=self.env()) assert HTTP_OK in r2 assert r2.json['headers']['Hello'] == 'World' assert r2.json['headers']['Cookie'] == 'hello=world' assert 'Basic ' in r2.json['headers']['Authorization'] def test_session_update(self, httpbin): self.start_session(httpbin) # Get a response to a request from the original session. r2 = http('--session=test', 'GET', httpbin.url + '/get', env=self.env()) assert HTTP_OK in r2 # Make a request modifying the session data. r3 = http('--follow', '--session=test', '--auth=username:password2', 'GET', httpbin.url + '/cookies/set?hello=world2', 'Hello:World2', env=self.env()) assert HTTP_OK in r3 # Get a response to a request from the updated session. r4 = http('--session=test', 'GET', httpbin.url + '/get', env=self.env()) assert HTTP_OK in r4 assert r4.json['headers']['Hello'] == 'World2' assert r4.json['headers']['Cookie'] == 'hello=world2' assert (r2.json['headers']['Authorization'] != r4.json['headers']['Authorization']) def test_session_read_only(self, httpbin): self.start_session(httpbin) # Get a response from the original session. r2 = http('--session=test', 'GET', httpbin.url + '/get', env=self.env()) assert HTTP_OK in r2 # Make a request modifying the session data but # with --session-read-only. r3 = http('--follow', '--session-read-only=test', '--auth=username:password2', 'GET', httpbin.url + '/cookies/set?hello=world2', 'Hello:World2', env=self.env()) assert HTTP_OK in r3 # Get a response from the updated session. r4 = http('--session=test', 'GET', httpbin.url + '/get', env=self.env()) assert HTTP_OK in r4 # Origin can differ on Travis. del r2.json['origin'], r4.json['origin'] # Different for each request. # Should be the same as before r3. assert r2.json == r4.json class TestSession(SessionTestBase): """Stand-alone session tests.""" def test_session_ignored_header_prefixes(self, httpbin): self.start_session(httpbin) r1 = http('--session=test', 'GET', httpbin.url + '/get', 'Content-Type: text/plain', 'If-Unmodified-Since: Sat, 29 Oct 1994 19:43:31 GMT', env=self.env()) assert HTTP_OK in r1 r2 = http('--session=test', 'GET', httpbin.url + '/get', env=self.env()) assert HTTP_OK in r2 assert no_content_type(r2.json['headers']) assert 'If-Unmodified-Since' not in r2.json['headers'] def test_session_by_path(self, httpbin): self.start_session(httpbin) session_path = os.path.join(self.config_dir, 'session-by-path.json') r1 = http('--session=' + session_path, 'GET', httpbin.url + '/get', 'Foo:Bar', env=self.env()) assert HTTP_OK in r1 r2 = http('--session=' + session_path, 'GET', httpbin.url + '/get', env=self.env()) assert HTTP_OK in r2 assert r2.json['headers']['Foo'] == 'Bar' @pytest.mark.skipif( sys.version_info >= (3,), reason="This test fails intermittently on Python 3 - " "see https://github.com/jkbrzt/httpie/issues/282") def test_session_unicode(self, httpbin): self.start_session(httpbin) r1 = http('--session=test', u'--auth=test:' + UNICODE, 'GET', httpbin.url + '/get', u'Test:%s' % UNICODE, env=self.env()) assert HTTP_OK in r1 r2 = http('--session=test', '--verbose', 'GET', httpbin.url + '/get', env=self.env()) assert HTTP_OK in r2 # FIXME: Authorization *sometimes* is not present on Python3 assert (r2.json['headers']['Authorization'] == HTTPBasicAuth.make_header(u'test', UNICODE)) # httpbin doesn't interpret utf8 headers assert UNICODE in r2 def test_session_default_header_value_overwritten(self, httpbin): self.start_session(httpbin) # https://github.com/jkbrzt/httpie/issues/180 r1 = http('--session=test', httpbin.url + '/headers', 'User-Agent:custom', env=self.env()) assert HTTP_OK in r1 assert r1.json['headers']['User-Agent'] == 'custom' r2 = http('--session=test', httpbin.url + '/headers', env=self.env()) assert HTTP_OK in r2 assert r2.json['headers']['User-Agent'] == 'custom'
bsd-3-clause
vebin/Wox
PythonHome/Lib/site-packages/pip/vcs/subversion.py
473
10640
import os import re from pip.backwardcompat import urlparse from pip.index import Link from pip.util import rmtree, display_path, call_subprocess from pip.log import logger from pip.vcs import vcs, VersionControl _svn_xml_url_re = re.compile('url="([^"]+)"') _svn_rev_re = re.compile('committed-rev="(\d+)"') _svn_url_re = re.compile(r'URL: (.+)') _svn_revision_re = re.compile(r'Revision: (.+)') _svn_info_xml_rev_re = re.compile(r'\s*revision="(\d+)"') _svn_info_xml_url_re = re.compile(r'<url>(.*)</url>') class Subversion(VersionControl): name = 'svn' dirname = '.svn' repo_name = 'checkout' schemes = ('svn', 'svn+ssh', 'svn+http', 'svn+https', 'svn+svn') bundle_file = 'svn-checkout.txt' guide = ('# This was an svn checkout; to make it a checkout again run:\n' 'svn checkout --force -r %(rev)s %(url)s .\n') def get_info(self, location): """Returns (url, revision), where both are strings""" assert not location.rstrip('/').endswith(self.dirname), 'Bad directory: %s' % location output = call_subprocess( [self.cmd, 'info', location], show_stdout=False, extra_environ={'LANG': 'C'}) match = _svn_url_re.search(output) if not match: logger.warn('Cannot determine URL of svn checkout %s' % display_path(location)) logger.info('Output that cannot be parsed: \n%s' % output) return None, None url = match.group(1).strip() match = _svn_revision_re.search(output) if not match: logger.warn('Cannot determine revision of svn checkout %s' % display_path(location)) logger.info('Output that cannot be parsed: \n%s' % output) return url, None return url, match.group(1) def parse_vcs_bundle_file(self, content): for line in content.splitlines(): if not line.strip() or line.strip().startswith('#'): continue match = re.search(r'^-r\s*([^ ])?', line) if not match: return None, None rev = match.group(1) rest = line[match.end():].strip().split(None, 1)[0] return rest, rev return None, None def export(self, location): """Export the svn repository at the url to the destination location""" url, rev = self.get_url_rev() rev_options = get_rev_options(url, rev) logger.notify('Exporting svn repository %s to %s' % (url, location)) logger.indent += 2 try: if os.path.exists(location): # Subversion doesn't like to check out over an existing directory # --force fixes this, but was only added in svn 1.5 rmtree(location) call_subprocess( [self.cmd, 'export'] + rev_options + [url, location], filter_stdout=self._filter, show_stdout=False) finally: logger.indent -= 2 def switch(self, dest, url, rev_options): call_subprocess( [self.cmd, 'switch'] + rev_options + [url, dest]) def update(self, dest, rev_options): call_subprocess( [self.cmd, 'update'] + rev_options + [dest]) def obtain(self, dest): url, rev = self.get_url_rev() rev_options = get_rev_options(url, rev) if rev: rev_display = ' (to revision %s)' % rev else: rev_display = '' if self.check_destination(dest, url, rev_options, rev_display): logger.notify('Checking out %s%s to %s' % (url, rev_display, display_path(dest))) call_subprocess( [self.cmd, 'checkout', '-q'] + rev_options + [url, dest]) def get_location(self, dist, dependency_links): for url in dependency_links: egg_fragment = Link(url).egg_fragment if not egg_fragment: continue if '-' in egg_fragment: ## FIXME: will this work when a package has - in the name? key = '-'.join(egg_fragment.split('-')[:-1]).lower() else: key = egg_fragment if key == dist.key: return url.split('#', 1)[0] return None def get_revision(self, location): """ Return the maximum revision for all files under a given location """ # Note: taken from setuptools.command.egg_info revision = 0 for base, dirs, files in os.walk(location): if self.dirname not in dirs: dirs[:] = [] continue # no sense walking uncontrolled subdirs dirs.remove(self.dirname) entries_fn = os.path.join(base, self.dirname, 'entries') if not os.path.exists(entries_fn): ## FIXME: should we warn? continue dirurl, localrev = self._get_svn_url_rev(base) if base == location: base_url = dirurl + '/' # save the root url elif not dirurl or not dirurl.startswith(base_url): dirs[:] = [] continue # not part of the same svn tree, skip it revision = max(revision, localrev) return revision def get_url_rev(self): # hotfix the URL scheme after removing svn+ from svn+ssh:// readd it url, rev = super(Subversion, self).get_url_rev() if url.startswith('ssh://'): url = 'svn+' + url return url, rev def get_url(self, location): # In cases where the source is in a subdirectory, not alongside setup.py # we have to look up in the location until we find a real setup.py orig_location = location while not os.path.exists(os.path.join(location, 'setup.py')): last_location = location location = os.path.dirname(location) if location == last_location: # We've traversed up to the root of the filesystem without finding setup.py logger.warn("Could not find setup.py for directory %s (tried all parent directories)" % orig_location) return None return self._get_svn_url_rev(location)[0] def _get_svn_url_rev(self, location): from pip.exceptions import InstallationError f = open(os.path.join(location, self.dirname, 'entries')) data = f.read() f.close() if data.startswith('8') or data.startswith('9') or data.startswith('10'): data = list(map(str.splitlines, data.split('\n\x0c\n'))) del data[0][0] # get rid of the '8' url = data[0][3] revs = [int(d[9]) for d in data if len(d) > 9 and d[9]] + [0] elif data.startswith('<?xml'): match = _svn_xml_url_re.search(data) if not match: raise ValueError('Badly formatted data: %r' % data) url = match.group(1) # get repository URL revs = [int(m.group(1)) for m in _svn_rev_re.finditer(data)] + [0] else: try: # subversion >= 1.7 xml = call_subprocess([self.cmd, 'info', '--xml', location], show_stdout=False) url = _svn_info_xml_url_re.search(xml).group(1) revs = [int(m.group(1)) for m in _svn_info_xml_rev_re.finditer(xml)] except InstallationError: url, revs = None, [] if revs: rev = max(revs) else: rev = 0 return url, rev def get_tag_revs(self, svn_tag_url): stdout = call_subprocess( [self.cmd, 'ls', '-v', svn_tag_url], show_stdout=False) results = [] for line in stdout.splitlines(): parts = line.split() rev = int(parts[0]) tag = parts[-1].strip('/') results.append((tag, rev)) return results def find_tag_match(self, rev, tag_revs): best_match_rev = None best_tag = None for tag, tag_rev in tag_revs: if (tag_rev > rev and (best_match_rev is None or best_match_rev > tag_rev)): # FIXME: Is best_match > tag_rev really possible? # or is it a sign something is wacky? best_match_rev = tag_rev best_tag = tag return best_tag def get_src_requirement(self, dist, location, find_tags=False): repo = self.get_url(location) if repo is None: return None parts = repo.split('/') ## FIXME: why not project name? egg_project_name = dist.egg_name().split('-', 1)[0] rev = self.get_revision(location) if parts[-2] in ('tags', 'tag'): # It's a tag, perfect! full_egg_name = '%s-%s' % (egg_project_name, parts[-1]) elif parts[-2] in ('branches', 'branch'): # It's a branch :( full_egg_name = '%s-%s-r%s' % (dist.egg_name(), parts[-1], rev) elif parts[-1] == 'trunk': # Trunk :-/ full_egg_name = '%s-dev_r%s' % (dist.egg_name(), rev) if find_tags: tag_url = '/'.join(parts[:-1]) + '/tags' tag_revs = self.get_tag_revs(tag_url) match = self.find_tag_match(rev, tag_revs) if match: logger.notify('trunk checkout %s seems to be equivalent to tag %s' % match) repo = '%s/%s' % (tag_url, match) full_egg_name = '%s-%s' % (egg_project_name, match) else: # Don't know what it is logger.warn('svn URL does not fit normal structure (tags/branches/trunk): %s' % repo) full_egg_name = '%s-dev_r%s' % (egg_project_name, rev) return 'svn+%s@%s#egg=%s' % (repo, rev, full_egg_name) def get_rev_options(url, rev): if rev: rev_options = ['-r', rev] else: rev_options = [] r = urlparse.urlsplit(url) if hasattr(r, 'username'): # >= Python-2.5 username, password = r.username, r.password else: netloc = r[1] if '@' in netloc: auth = netloc.split('@')[0] if ':' in auth: username, password = auth.split(':', 1) else: username, password = auth, None else: username, password = None, None if username: rev_options += ['--username', username] if password: rev_options += ['--password', password] return rev_options vcs.register(Subversion)
mit
0x0all/scikit-learn
sklearn/ensemble/tests/test_gradient_boosting_loss_functions.py
23
5540
""" Testing for the gradient boosting loss functions and initial estimators. """ import numpy as np from numpy.testing import assert_array_equal from numpy.testing import assert_almost_equal from numpy.testing import assert_equal from nose.tools import assert_raises from sklearn.utils import check_random_state from sklearn.ensemble.gradient_boosting import BinomialDeviance from sklearn.ensemble.gradient_boosting import LogOddsEstimator from sklearn.ensemble.gradient_boosting import LeastSquaresError from sklearn.ensemble.gradient_boosting import RegressionLossFunction from sklearn.ensemble.gradient_boosting import LOSS_FUNCTIONS from sklearn.ensemble.gradient_boosting import _weighted_percentile def test_binomial_deviance(): """Check binomial deviance loss. Check against alternative definitions in ESLII. """ bd = BinomialDeviance(2) # pred has the same BD for y in {0, 1} assert_equal(bd(np.array([0.0]), np.array([0.0])), bd(np.array([1.0]), np.array([0.0]))) assert_almost_equal(bd(np.array([1.0, 1.0, 1.0]), np.array([100.0, 100.0, 100.0])), 0.0) assert_almost_equal(bd(np.array([1.0, 0.0, 0.0]), np.array([100.0, -100.0, -100.0])), 0) # check if same results as alternative definition of deviance (from ESLII) alt_dev = lambda y, pred: np.mean(np.logaddexp(0.0, -2.0 * (2.0 * y - 1) * pred)) test_data = [(np.array([1.0, 1.0, 1.0]), np.array([100.0, 100.0, 100.0])), (np.array([0.0, 0.0, 0.0]), np.array([100.0, 100.0, 100.0])), (np.array([0.0, 0.0, 0.0]), np.array([-100.0, -100.0, -100.0])), (np.array([1.0, 1.0, 1.0]), np.array([-100.0, -100.0, -100.0]))] for datum in test_data: assert_almost_equal(bd(*datum), alt_dev(*datum)) # check the gradient against the alt_ng = lambda y, pred: (2 * y - 1) / (1 + np.exp(2 * (2 * y - 1) * pred)) for datum in test_data: assert_almost_equal(bd.negative_gradient(*datum), alt_ng(*datum)) def test_log_odds_estimator(): """Check log odds estimator. """ est = LogOddsEstimator() assert_raises(ValueError, est.fit, None, np.array([1])) est.fit(None, np.array([1.0, 0.0])) assert_equal(est.prior, 0.0) assert_array_equal(est.predict(np.array([[1.0], [1.0]])), np.array([[0.0], [0.0]])) def test_sample_weight_smoke(): rng = check_random_state(13) y = rng.rand(100) pred = rng.rand(100) # least squares loss = LeastSquaresError(1) loss_wo_sw = loss(y, pred) loss_w_sw = loss(y, pred, np.ones(pred.shape[0], dtype=np.float32)) assert_almost_equal(loss_wo_sw, loss_w_sw) def test_sample_weight_init_estimators(): """Smoke test for init estimators with sample weights. """ rng = check_random_state(13) X = rng.rand(100, 2) sample_weight = np.ones(100) reg_y = rng.rand(100) clf_y = rng.randint(0, 2, size=100) for Loss in LOSS_FUNCTIONS.values(): if Loss is None: continue if issubclass(Loss, RegressionLossFunction): k = 1 y = reg_y else: k = 2 y = clf_y if Loss.is_multi_class: # skip multiclass continue loss = Loss(k) init_est = loss.init_estimator() init_est.fit(X, y) out = init_est.predict(X) assert_equal(out.shape, (y.shape[0], 1)) sw_init_est = loss.init_estimator() sw_init_est.fit(X, y, sample_weight=sample_weight) sw_out = init_est.predict(X) assert_equal(sw_out.shape, (y.shape[0], 1)) # check if predictions match assert_array_equal(out, sw_out) def test_weighted_percentile(): y = np.empty(102, dtype=np.float) y[:50] = 0 y[-51:] = 2 y[-1] = 100000 y[50] = 1 sw = np.ones(102, dtype=np.float) sw[-1] = 0.0 score = _weighted_percentile(y, sw, 50) assert score == 1 def test_weighted_percentile_equal(): y = np.empty(102, dtype=np.float) y.fill(0.0) sw = np.ones(102, dtype=np.float) sw[-1] = 0.0 score = _weighted_percentile(y, sw, 50) assert score == 0 def test_weighted_percentile_zero_weight(): y = np.empty(102, dtype=np.float) y.fill(1.0) sw = np.ones(102, dtype=np.float) sw.fill(0.0) score = _weighted_percentile(y, sw, 50) assert score == 1.0 def test_sample_weight_deviance(): """Test if deviance supports sample weights. """ rng = check_random_state(13) X = rng.rand(100, 2) sample_weight = np.ones(100) reg_y = rng.rand(100) clf_y = rng.randint(0, 2, size=100) mclf_y = rng.randint(0, 3, size=100) for Loss in LOSS_FUNCTIONS.values(): if Loss is None: continue if issubclass(Loss, RegressionLossFunction): k = 1 y = reg_y p = reg_y else: k = 2 y = clf_y p = clf_y if Loss.is_multi_class: k = 3 y = mclf_y # one-hot encoding p = np.zeros((y.shape[0], k), dtype=np.float64) for i in range(k): p[:, i] = y == i loss = Loss(k) deviance_w_w = loss(y, p, sample_weight) deviance_wo_w = loss(y, p) assert deviance_wo_w == deviance_w_w
bsd-3-clause
brandonPurvis/osf.io
api/users/views.py
3
19716
from rest_framework import generics from rest_framework import permissions as drf_permissions from rest_framework.exceptions import NotAuthenticated from django.contrib.auth.models import AnonymousUser from modularodm import Q from framework.auth.core import Auth from framework.auth.oauth_scopes import CoreScopes from website.models import User, Node from api.base import permissions as base_permissions from api.base.utils import get_object_or_error from api.base.exceptions import Conflict from api.base.views import JSONAPIBaseView from api.base.filters import ODMFilterMixin from api.base.parsers import JSONAPIRelationshipParser, JSONAPIRelationshipParserForRegularJSON from api.nodes.serializers import NodeSerializer from api.institutions.serializers import InstitutionSerializer from api.registrations.serializers import RegistrationSerializer from .serializers import UserSerializer, UserDetailSerializer, UserInstitutionsRelationshipSerializer from .permissions import ReadOnlyOrCurrentUser, ReadOnlyOrCurrentUserRelationship class UserMixin(object): """Mixin with convenience methods for retrieving the current node based on the current URL. By default, fetches the user based on the user_id kwarg. """ serializer_class = UserSerializer user_lookup_url_kwarg = 'user_id' def get_user(self, check_permissions=True): key = self.kwargs[self.user_lookup_url_kwarg] current_user = self.request.user if key == 'me': if isinstance(current_user, AnonymousUser): raise NotAuthenticated else: return self.request.user obj = get_object_or_error(User, key, 'user') if check_permissions: # May raise a permission denied self.check_object_permissions(self.request, obj) return obj class UserList(JSONAPIBaseView, generics.ListAPIView, ODMFilterMixin): """List of users registered on the OSF. *Read-only*. Paginated list of users ordered by the date they registered. Each resource contains the full representation of the user, meaning additional requests to an individual user's detail view are not necessary. Note that if an anonymous view_only key is being used, user information will not be serialized, and the id will be an empty string. Relationships to a user object will not show in this case, either. The subroute [`/me/`](me/) is a special endpoint that always points to the currently logged-in user. ##User Attributes <!--- Copied Attributes From UserDetail --> OSF User entities have the "users" `type`. name type description ---------------------------------------------------------------------------------------- full_name string full name of the user; used for display given_name string given name of the user; for bibliographic citations middle_names string middle name of user; for bibliographic citations family_name string family name of user; for bibliographic citations suffix string suffix of user's name for bibliographic citations date_registered iso8601 timestamp timestamp when the user's account was created ##Links See the [JSON-API spec regarding pagination](http://jsonapi.org/format/1.0/#fetching-pagination). ##Actions *None*. ##Query Params + `page=<Int>` -- page number of results to view, default 1 + `filter[<fieldname>]=<Str>` -- fields and values to filter the search results on. Users may be filtered by their `id`, `full_name`, `given_name`, `middle_names`, or `family_name`. + `profile_image_size=<Int>` -- Modifies `/links/profile_image_url` of the user entities so that it points to the user's profile image scaled to the given size in pixels. If left blank, the size depends on the image provider. #This Request/Response """ permission_classes = ( drf_permissions.IsAuthenticatedOrReadOnly, base_permissions.TokenHasScope, ) required_read_scopes = [CoreScopes.USERS_READ] required_write_scopes = [CoreScopes.USERS_WRITE] serializer_class = UserSerializer ordering = ('-date_registered') view_category = 'users' view_name = 'user-list' # overrides ODMFilterMixin def get_default_odm_query(self): return ( Q('is_registered', 'eq', True) & Q('is_merged', 'ne', True) & Q('date_disabled', 'eq', None) ) # overrides ListAPIView def get_queryset(self): # TODO: sort query = self.get_query_from_request() return User.find(query) class UserDetail(JSONAPIBaseView, generics.RetrieveUpdateAPIView, UserMixin): """Details about a specific user. *Writeable*. The User Detail endpoint retrieves information about the user whose id is the final part of the path. If `me` is given as the id, the record of the currently logged-in user will be returned. The returned information includes the user's bibliographic information and the date the user registered. Note that if an anonymous view_only key is being used, user information will not be serialized, and the id will be an empty string. Relationships to a user object will not show in this case, either. ##Attributes OSF User entities have the "users" `type`. name type description ---------------------------------------------------------------------------------------- full_name string full name of the user; used for display given_name string given name of the user; for bibliographic citations middle_names string middle name of user; for bibliographic citations family_name string family name of user; for bibliographic citations suffix string suffix of user's name for bibliographic citations date_registered iso8601 timestamp timestamp when the user's account was created ##Relationships ###Nodes A list of all nodes the user has contributed to. If the user id in the path is the same as the logged-in user, all nodes will be visible. Otherwise, you will only be able to see the other user's publicly-visible nodes. ##Links self: the canonical api endpoint of this user html: this user's page on the OSF website profile_image_url: a url to the user's profile image ##Actions ###Update Method: PUT / PATCH URL: /links/self Query Params: <none> Body (JSON): { "data": { "type": "users", # required "id": {user_id}, # required "attributes": { "full_name": {full_name}, # mandatory "given_name": {given_name}, # optional "middle_names": {middle_names}, # optional "family_name": {family_name}, # optional "suffix": {suffix} # optional } } } Success: 200 OK + node representation To update your user profile, issue a PUT request to either the canonical URL of your user resource (as given in `/links/self`) or to `/users/me/`. Only the `full_name` attribute is required. Unlike at signup, the given, middle, and family names will not be inferred from the `full_name`. Currently, only `full_name`, `given_name`, `middle_names`, `family_name`, and `suffix` are updateable. A PATCH request issued to this endpoint will behave the same as a PUT request, but does not require `full_name` to be set. **NB:** If you PUT/PATCH to the `/users/me/` endpoint, you must still provide your full user id in the `id` field of the request. We do not support using the `me` alias in request bodies at this time. ##Query Params + `profile_image_size=<Int>` -- Modifies `/links/profile_image_url` so that it points the image scaled to the given size in pixels. If left blank, the size depends on the image provider. #This Request/Response """ permission_classes = ( drf_permissions.IsAuthenticatedOrReadOnly, ReadOnlyOrCurrentUser, base_permissions.TokenHasScope, ) required_read_scopes = [CoreScopes.USERS_READ] required_write_scopes = [CoreScopes.USERS_WRITE] view_category = 'users' view_name = 'user-detail' serializer_class = UserDetailSerializer # overrides RetrieveAPIView def get_object(self): return self.get_user() # overrides RetrieveUpdateAPIView def get_serializer_context(self): # Serializer needs the request in order to make an update to privacy context = JSONAPIBaseView.get_serializer_context(self) context['request'] = self.request return context class UserNodes(JSONAPIBaseView, generics.ListAPIView, UserMixin, ODMFilterMixin): """List of nodes that the user contributes to. *Read-only*. Paginated list of nodes that the user contributes to. Each resource contains the full representation of the node, meaning additional requests to an individual node's detail view are not necessary. If the user id in the path is the same as the logged-in user, all nodes will be visible. Otherwise, you will only be able to see the other user's publicly-visible nodes. The special user id `me` can be used to represent the currently logged-in user. ##Node Attributes <!--- Copied Attributes from NodeDetail --> OSF Node entities have the "nodes" `type`. name type description --------------------------------------------------------------------------------- title string title of project or component description string description of the node category string node category, must be one of the allowed values date_created iso8601 timestamp timestamp that the node was created date_modified iso8601 timestamp timestamp when the node was last updated tags array of strings list of tags that describe the node fork boolean is this project a fork? registration boolean has this project been registered? fork boolean is this node a fork of another node? dashboard boolean is this node visible on the user dashboard? public boolean has this node been made publicly-visible? ##Links See the [JSON-API spec regarding pagination](http://jsonapi.org/format/1.0/#fetching-pagination). ##Actions *None*. ##Query Params + `page=<Int>` -- page number of results to view, default 1 + `filter[<fieldname>]=<Str>` -- fields and values to filter the search results on. <!--- Copied Query Params from NodeList --> Nodes may be filtered by their `title`, `category`, `description`, `public`, `registration`, or `tags`. `title`, `description`, and `category` are string fields and will be filtered using simple substring matching. `public` and `registration` are booleans, and can be filtered using truthy values, such as `true`, `false`, `0`, or `1`. Note that quoting `true` or `false` in the query will cause the match to fail regardless. `tags` is an array of simple strings. #This Request/Response """ permission_classes = ( drf_permissions.IsAuthenticatedOrReadOnly, base_permissions.TokenHasScope, ) required_read_scopes = [CoreScopes.USERS_READ, CoreScopes.NODE_BASE_READ] required_write_scopes = [CoreScopes.USERS_WRITE, CoreScopes.NODE_BASE_WRITE] serializer_class = NodeSerializer view_category = 'users' view_name = 'user-nodes' # overrides ODMFilterMixin def get_default_odm_query(self): user = self.get_user() return ( Q('contributors', 'eq', user) & Q('is_folder', 'ne', True) & Q('is_deleted', 'ne', True) ) # overrides ListAPIView def get_queryset(self): current_user = self.request.user if current_user.is_anonymous(): auth = Auth(None) else: auth = Auth(current_user) query = self.get_query_from_request() raw_nodes = Node.find(self.get_default_odm_query() & query) nodes = [each for each in raw_nodes if each.is_public or each.can_view(auth)] return nodes class UserInstitutions(JSONAPIBaseView, generics.ListAPIView, UserMixin): permission_classes = ( drf_permissions.IsAuthenticatedOrReadOnly, base_permissions.TokenHasScope, ) required_read_scopes = [CoreScopes.USERS_READ, CoreScopes.INSTITUTION_READ] required_write_scopes = [CoreScopes.NULL] serializer_class = InstitutionSerializer view_category = 'users' view_name = 'user-institutions' def get_default_odm_query(self): return None def get_queryset(self): user = self.get_user() return user.affiliated_institutions class UserRegistrations(UserNodes): """List of registrations that the user contributes to. *Read-only*. Paginated list of registrations that the user contributes to. Each resource contains the full representation of the registration, meaning additional requests to an individual registration's detail view are not necessary. If the user id in the path is the same as the logged-in user, all nodes will be visible. Otherwise, you will only be able to see the other user's publicly-visible nodes. The special user id `me` can be used to represent the currently logged-in user. Retracted registrations will display a limited number of fields, namely, title, description, date_created, registration, retracted, date_registered, retraction_justification, and registration supplement. ##Registration Attributes <!--- Copied Attributes from RegistrationList --> Registrations have the "registrations" `type`. name type description ------------------------------------------------------------------------------------------------------- title string title of the registered project or component description string description of the registered node category string node category, must be one of the allowed values date_created iso8601 timestamp timestamp that the node was created date_modified iso8601 timestamp timestamp when the node was last updated tags array of strings list of tags that describe the registered node fork boolean is this project a fork? registration boolean has this project been registered? dashboard boolean is this registered node visible on the user dashboard? public boolean has this registration been made publicly-visible? retracted boolean has this registration been retracted? date_registered iso8601 timestamp timestamp that the registration was created retraction_justification string reasons for retracting the registration pending_retraction boolean is this registration pending retraction? pending_registration_approval boolean is this registration pending approval? pending_embargo boolean is this registration pending an embargo? registered_meta dictionary registration supplementary information registration_supplement string registration template ##Relationships ###Registered from The registration is branched from this node. ###Registered by The registration was initiated by this user. ###Other Relationships See documentation on registered_from detail view. A registration has many of the same properties as a node. ##Links See the [JSON-API spec regarding pagination](http://jsonapi.org/format/1.0/#fetching-pagination). ##Actions *None*. ##Query Params + `page=<Int>` -- page number of results to view, default 1 + `filter[<fieldname>]=<Str>` -- fields and values to filter the search results on. <!--- Copied Query Params from NodeList --> Registrations may be filtered by their `title`, `category`, `description`, `public`, or `tags`. `title`, `description`, and `category` are string fields and will be filtered using simple substring matching. `public` is a boolean and can be filtered using truthy values, such as `true`, `false`, `0`, or `1`. Note that quoting `true` or `false` in the query will cause the match to fail regardless. `tags` is an array of simple strings. #This Request/Response """ required_read_scopes = [CoreScopes.USERS_READ, CoreScopes.NODE_REGISTRATIONS_READ] required_write_scopes = [CoreScopes.USERS_WRITE, CoreScopes.NODE_REGISTRATIONS_WRITE] serializer_class = RegistrationSerializer view_category = 'users' view_name = 'user-registrations' # overrides ODMFilterMixin def get_default_odm_query(self): user = self.get_user() return ( Q('contributors', 'eq', user) & Q('is_folder', 'ne', True) & Q('is_deleted', 'ne', True) & Q('is_registration', 'eq', True) ) class UserInstitutionsRelationship(JSONAPIBaseView, generics.RetrieveDestroyAPIView, UserMixin): permission_classes = ( drf_permissions.IsAuthenticatedOrReadOnly, base_permissions.TokenHasScope, ReadOnlyOrCurrentUserRelationship ) required_read_scopes = [CoreScopes.USERS_READ] required_write_scopes = [CoreScopes.USERS_WRITE] serializer_class = UserInstitutionsRelationshipSerializer parser_classes = (JSONAPIRelationshipParser, JSONAPIRelationshipParserForRegularJSON, ) view_category = 'users' view_name = 'user-institutions-relationship' def get_object(self): user = self.get_user(check_permissions=False) obj = { 'data': user.affiliated_institutions, 'self': user } self.check_object_permissions(self.request, obj) return obj def perform_destroy(self, instance): data = self.request.data['data'] user = self.request.user current_institutions = {inst._id for inst in user.affiliated_institutions} # DELETEs normally dont get type checked # not the best way to do it, should be enforced everywhere, maybe write a test for it for val in data: if val['type'] != self.serializer_class.Meta.type_: raise Conflict() for val in data: if val['id'] in current_institutions: user.remove_institution(val['id']) user.save()
apache-2.0
MrSenko/Kiwi
tcms/testcases/migrations/0001_initial.py
2
22715
# -*- coding: utf-8 -*- from django.conf import settings from django.db import migrations, models import tcms.core.models.base test_case_statuss = ["PROPOSED", "CONFIRMED", "DISABLED", "NEED_UPDATE"] CASE_STATUS_ID_COLUMN = "case_status_id" CATEGORY_ID_COLUMN = "category_id" if settings.DATABASES["default"]["ENGINE"].find("sqlite") > -1: CASE_STATUS_ID_COLUMN = "" CATEGORY_ID_COLUMN = "" def forwards_add_initial_data(apps, schema_editor): bug_system_model = apps.get_model("testcases", "BugSystem") bug_system_model.objects.bulk_create( [ bug_system_model( name="Bugzilla", description="1-7 digit, e.g. 1001234", url_reg_exp="https://bugzilla.example.com/show_bug.cgi?id=%s", validate_reg_exp=r"^\d{1,7}$", ), bug_system_model( name="JIRA", description="e.g. KIWI-222", url_reg_exp="https://jira.example.com/browse/%s", validate_reg_exp=r"^[A-Z0-9]+-\d+$", ), ] ) test_case_status_model = apps.get_model("testcases", "TestCaseStatus") test_case_status_model.objects.bulk_create( [ test_case_status_model(name=name, description="") for name in test_case_statuss ] ) def reverse_add_initial_data(apps, schema_editor): bug_system_model = apps.get_model("testcases", "BugSystem") bug_system_model.objects.filter(name__in=["Bugzilla", "JIRA"]).delete() test_case_status_model = apps.get_model("testcases", "TestCaseStatus") test_case_status_model.objects.filter(name__in=test_case_statuss).delete() class Migration(migrations.Migration): dependencies = [ ("management", "0003_squashed"), ("testplans", "0005_squashed"), migrations.swappable_dependency(settings.AUTH_USER_MODEL), ] operations = [ migrations.CreateModel( name="TestCaseStatus", fields=[ ( "id", models.AutoField( max_length=6, serialize=False, primary_key=True, db_column=CASE_STATUS_ID_COLUMN, ), ), ("name", models.CharField(max_length=255)), ("description", models.TextField(null=True, blank=True)), ], options={ "verbose_name": "Test case status", "verbose_name_plural": "Test case statuses", }, bases=(models.Model, tcms.core.models.base.UrlMixin), ), migrations.CreateModel( name="Category", fields=[ ( "id", models.AutoField( serialize=False, primary_key=True, db_column=CATEGORY_ID_COLUMN ), ), ("name", models.CharField(max_length=255)), ("description", models.TextField(blank=True)), ( "product", models.ForeignKey( related_name="category", to="management.Product", on_delete=models.CASCADE, ), ), ], options={ "verbose_name_plural": "test case categories", }, bases=(models.Model, tcms.core.models.base.UrlMixin), ), migrations.CreateModel( name="TestCase", fields=[ ("case_id", models.AutoField(serialize=False, primary_key=True)), ( "create_date", models.DateTimeField(auto_now_add=True, db_column="creation_date"), ), ( "is_automated", models.IntegerField(default=0, db_column="isautomated"), ), ("is_automated_proposed", models.BooleanField(default=False)), ("script", models.TextField(blank=True, null=True)), ("arguments", models.TextField(blank=True, null=True)), ( "extra_link", models.CharField( default=None, max_length=1024, null=True, blank=True ), ), ("summary", models.CharField(max_length=255)), ( "requirement", models.CharField(max_length=255, blank=True, null=True), ), ("alias", models.CharField(max_length=255, blank=True)), ("notes", models.TextField(blank=True, null=True)), ], bases=(models.Model, tcms.core.models.base.UrlMixin), ), migrations.AddField( model_name="testcase", name="author", field=models.ForeignKey( on_delete=models.deletion.CASCADE, related_name="cases_as_author", to=settings.AUTH_USER_MODEL, ), ), migrations.AddField( model_name="testcase", name="case_status", field=models.ForeignKey( on_delete=models.deletion.CASCADE, to="testcases.TestCaseStatus" ), ), migrations.AddField( model_name="testcase", name="category", field=models.ForeignKey( on_delete=models.deletion.CASCADE, related_name="category_case", to="testcases.Category", ), ), migrations.CreateModel( name="TestCaseComponent", fields=[ ( "id", models.AutoField( verbose_name="ID", serialize=False, auto_created=True, primary_key=True, ), ), ( "case", models.ForeignKey( to="testcases.TestCase", on_delete=models.CASCADE ), ), ( "component", models.ForeignKey( to="management.Component", on_delete=models.CASCADE ), ), ], ), migrations.AddField( model_name="testcase", name="component", field=models.ManyToManyField( related_name="cases", through="testcases.TestCaseComponent", to="management.Component", ), ), migrations.AddField( model_name="testcase", name="default_tester", field=models.ForeignKey( blank=True, null=True, on_delete=models.deletion.CASCADE, related_name="cases_as_default_tester", to=settings.AUTH_USER_MODEL, ), ), migrations.CreateModel( name="TestCasePlan", fields=[ ( "id", models.AutoField( verbose_name="ID", serialize=False, auto_created=True, primary_key=True, ), ), ("sortkey", models.IntegerField(null=True, blank=True)), ( "case", models.ForeignKey( to="testcases.TestCase", on_delete=models.CASCADE ), ), ( "plan", models.ForeignKey( to="testplans.TestPlan", on_delete=models.CASCADE ), ), ], ), migrations.AddField( model_name="testcase", name="plan", field=models.ManyToManyField( related_name="case", through="testcases.TestCasePlan", to="testplans.TestPlan", ), ), migrations.AddField( model_name="testcase", name="priority", field=models.ForeignKey( on_delete=models.deletion.CASCADE, related_name="priority_case", to="management.Priority", ), ), migrations.AddField( model_name="testcase", name="reviewer", field=models.ForeignKey( null=True, on_delete=models.deletion.CASCADE, related_name="cases_as_reviewer", to=settings.AUTH_USER_MODEL, ), ), migrations.CreateModel( name="TestCaseTag", fields=[ ( "id", models.AutoField( verbose_name="ID", serialize=False, auto_created=True, primary_key=True, ), ), ( "case", models.ForeignKey( to="testcases.TestCase", on_delete=models.CASCADE ), ), ( "tag", models.ForeignKey(to="management.Tag", on_delete=models.CASCADE), ), ], ), migrations.AddField( model_name="testcase", name="tag", field=models.ManyToManyField( related_name="case", through="testcases.TestCaseTag", to="management.Tag", ), ), migrations.CreateModel( name="HistoricalTestCase", fields=[ ("case_id", models.IntegerField(blank=True, db_index=True)), ( "create_date", models.DateTimeField( blank=True, db_column="creation_date", editable=False ), ), ( "is_automated", models.IntegerField(db_column="isautomated", default=0), ), ("is_automated_proposed", models.BooleanField(default=False)), ("script", models.TextField(blank=True, null=True)), ("arguments", models.TextField(blank=True, null=True)), ( "extra_link", models.CharField( blank=True, default=None, max_length=1024, null=True ), ), ("summary", models.CharField(max_length=255)), ( "requirement", models.CharField(blank=True, max_length=255, null=True), ), ("alias", models.CharField(blank=True, max_length=255)), ("notes", models.TextField(blank=True, null=True)), ("history_id", models.AutoField(primary_key=True, serialize=False)), ("history_change_reason", models.TextField(null=True)), ("history_date", models.DateTimeField()), ( "history_type", models.CharField( choices=[("+", "Created"), ("~", "Changed"), ("-", "Deleted")], max_length=1, ), ), ( "author", models.ForeignKey( blank=True, db_constraint=False, null=True, on_delete=models.deletion.DO_NOTHING, related_name="+", to=settings.AUTH_USER_MODEL, ), ), ( "case_status", models.ForeignKey( blank=True, db_constraint=False, null=True, on_delete=models.deletion.DO_NOTHING, related_name="+", to="testcases.TestCaseStatus", ), ), ( "category", models.ForeignKey( blank=True, db_constraint=False, null=True, on_delete=models.deletion.DO_NOTHING, related_name="+", to="testcases.Category", ), ), ( "default_tester", models.ForeignKey( blank=True, db_constraint=False, null=True, on_delete=models.deletion.DO_NOTHING, related_name="+", to=settings.AUTH_USER_MODEL, ), ), ( "history_user", models.ForeignKey( null=True, on_delete=models.deletion.SET_NULL, related_name="+", to=settings.AUTH_USER_MODEL, ), ), ( "priority", models.ForeignKey( blank=True, db_constraint=False, null=True, on_delete=models.deletion.DO_NOTHING, related_name="+", to="management.Priority", ), ), ( "reviewer", models.ForeignKey( blank=True, db_constraint=False, null=True, on_delete=models.deletion.DO_NOTHING, related_name="+", to=settings.AUTH_USER_MODEL, ), ), ], options={ "verbose_name": "historical test case", "ordering": ("-history_date", "-history_id"), "get_latest_by": "history_date", }, ), migrations.CreateModel( name="Bug", fields=[ ( "id", models.AutoField( verbose_name="ID", serialize=False, auto_created=True, primary_key=True, ), ), ("bug_id", models.CharField(max_length=25)), ("summary", models.CharField(max_length=255, null=True, blank=True)), ("description", models.TextField(null=True, blank=True)), ( "case", models.ForeignKey( related_name="case_bug", to="testcases.TestCase", on_delete=models.CASCADE, ), ), ], bases=(models.Model, tcms.core.models.base.UrlMixin), ), migrations.CreateModel( name="BugSystem", fields=[ ( "id", models.AutoField( verbose_name="ID", serialize=False, auto_created=True, primary_key=True, ), ), ("name", models.CharField(max_length=255, unique=True)), ("description", models.TextField(blank=True)), ( "url_reg_exp", models.CharField( max_length=8192, help_text="A valid Python format string such as " "http://bugs.example.com/%s", verbose_name="URL format string", ), ), ( "validate_reg_exp", models.CharField( max_length=128, help_text="A valid JavaScript regular " "expression such as ^\\d$", verbose_name="RegExp for ID validation", ), ), ( "api_url", models.CharField( blank=True, max_length=1024, null=True, verbose_name="API URL", help_text="This is the URL to which API requests " "will be sent. Leave empty to disable!", ), ), ( "api_password", models.CharField( blank=True, max_length=256, null=True, verbose_name="API password or token", ), ), ( "api_username", models.CharField( blank=True, max_length=256, null=True, verbose_name="API username", ), ), ( "tracker_type", models.CharField( default="IssueTrackerType", max_length=128, help_text="This determines how Kiwi TCMS " "integrates with the IT system", verbose_name="Type", ), ), ( "base_url", models.CharField( max_length=1024, null=True, blank=True, verbose_name="Base URL", help_text="""Base URL, for example\ <strong>https://bugzilla.example.com</strong>! Leave empty to disable! """, ), ), ], options={ "verbose_name": "Bug tracker", "verbose_name_plural": "Bug trackers", }, bases=(models.Model, tcms.core.models.base.UrlMixin), ), migrations.AddField( model_name="bug", name="bug_system", field=models.ForeignKey( default=1, to="testcases.BugSystem", on_delete=models.CASCADE ), ), migrations.CreateModel( name="TestCaseEmailSettings", fields=[ ( "id", models.AutoField( verbose_name="ID", serialize=False, auto_created=True, primary_key=True, ), ), ("notify_on_case_update", models.BooleanField(default=False)), ("notify_on_case_delete", models.BooleanField(default=False)), ("auto_to_case_author", models.BooleanField(default=False)), ("auto_to_case_tester", models.BooleanField(default=False)), ("auto_to_run_manager", models.BooleanField(default=False)), ("auto_to_run_tester", models.BooleanField(default=False)), ("auto_to_case_run_assignee", models.BooleanField(default=False)), ( "case", models.OneToOneField( related_name="email_settings", to="testcases.TestCase", on_delete=models.CASCADE, ), ), ("cc_list", models.TextField(default="")), ], ), migrations.CreateModel( name="TestCaseText", fields=[ ( "id", models.AutoField( verbose_name="ID", serialize=False, auto_created=True, primary_key=True, ), ), ("case_text_version", models.IntegerField()), ( "create_date", models.DateTimeField(auto_now_add=True, db_column="creation_ts"), ), ("action", models.TextField(blank=True)), ("effect", models.TextField(blank=True)), ("setup", models.TextField(blank=True)), ("breakdown", models.TextField(blank=True)), ( "author", models.ForeignKey( to=settings.AUTH_USER_MODEL, db_column="who", on_delete=models.CASCADE, ), ), ( "case", models.ForeignKey( related_name="text", to="testcases.TestCase", on_delete=models.CASCADE, ), ), ], options={ "ordering": ["case", "-case_text_version"], }, bases=(models.Model, tcms.core.models.base.UrlMixin), ), migrations.AlterUniqueTogether( name="testcasetext", unique_together={("case", "case_text_version")}, ), migrations.AlterUniqueTogether( name="testcaseplan", unique_together={("plan", "case")}, ), migrations.AlterUniqueTogether( name="category", unique_together={("product", "name")}, ), migrations.RunPython(forwards_add_initial_data, reverse_add_initial_data), ]
gpl-2.0
cogeorg/BlackRhino
networkx/algorithms/approximation/dominating_set.py
7
4402
# -*- coding: utf-8 -*- # Copyright (C) 2011-2012 by # Nicholas Mancuso <nick.mancuso@gmail.com> # All rights reserved. # BSD license. """Functions for finding node and edge dominating sets. A *`dominating set`_[1] for an undirected graph *G* with vertex set *V* and edge set *E* is a subset *D* of *V* such that every vertex not in *D* is adjacent to at least one member of *D*. An *`edge dominating set`_[2] is a subset *F* of *E* such that every edge not in *F* is incident to an endpoint of at least one edge in *F*. .. [1] dominating set: https://en.wikipedia.org/wiki/Dominating_set .. [2] edge dominating set: https://en.wikipedia.org/wiki/Edge_dominating_set """ from __future__ import division from ..matching import maximal_matching from ...utils import not_implemented_for __all__ = ["min_weighted_dominating_set", "min_edge_dominating_set"] __author__ = """Nicholas Mancuso (nick.mancuso@gmail.com)""" # TODO Why doesn't this algorithm work for directed graphs? @not_implemented_for('directed') def min_weighted_dominating_set(G, weight=None): """Returns a dominating set that approximates the minimum weight node dominating set. Parameters ---------- G : NetworkX graph Undirected graph. weight : string The node attribute storing the weight of an edge. If provided, the node attribute with this key must be a number for each node. If not provided, each node is assumed to have weight one. Returns ------- min_weight_dominating_set : set A set of nodes, the sum of whose weights is no more than `(\log w(V)) w(V^*)`, where `w(V)` denotes the sum of the weights of each node in the graph and `w(V^*)` denotes the sum of the weights of each node in the minimum weight dominating set. Notes ----- This algorithm computes an approximate minimum weighted dominating set for the graph `G`. The returned solution has weight `(\log w(V)) w(V^*)`, where `w(V)` denotes the sum of the weights of each node in the graph and `w(V^*)` denotes the sum of the weights of each node in the minimum weight dominating set for the graph. This implementation of the algorithm runs in `O(m)` time, where `m` is the number of edges in the graph. References ---------- .. [1] Vazirani, Vijay V. *Approximation Algorithms*. Springer Science & Business Media, 2001. """ # The unique dominating set for the null graph is the empty set. if len(G) == 0: return set() # This is the dominating set that will eventually be returned. dom_set = set() def _cost(node_and_neighborhood): """Returns the cost-effectiveness of greedily choosing the given node. `node_and_neighborhood` is a two-tuple comprising a node and its closed neighborhood. """ v, neighborhood = node_and_neighborhood return G.node[v].get(weight, 1) / len(neighborhood - dom_set) # This is a set of all vertices not already covered by the # dominating set. vertices = set(G) # This is a dictionary mapping each node to the closed neighborhood # of that node. neighborhoods = {v: {v} | set(G[v]) for v in G} # Continue until all vertices are adjacent to some node in the # dominating set. while vertices: # Find the most cost-effective node to add, along with its # closed neighborhood. dom_node, min_set = min(neighborhoods.items(), key=_cost) # Add the node to the dominating set and reduce the remaining # set of nodes to cover. dom_set.add(dom_node) del neighborhoods[dom_node] vertices -= min_set return dom_set def min_edge_dominating_set(G): r"""Return minimum cardinality edge dominating set. Parameters ---------- G : NetworkX graph Undirected graph Returns ------- min_edge_dominating_set : set Returns a set of dominating edges whose size is no more than 2 * OPT. Notes ----- The algorithm computes an approximate solution to the edge dominating set problem. The result is no more than 2 * OPT in terms of size of the set. Runtime of the algorithm is `O(|E|)`. """ if not G: raise ValueError("Expected non-empty NetworkX graph!") return maximal_matching(G)
gpl-3.0
JavierGarciaD/AlgoRepo
quants/mac.py
1
3528
import datetime import numpy as np from backtest import Backtest from data import HistoricCSVDataHandler from event import SignalEvent from execution import SimulatedExecutionHandler from portfolio import Portfolio from strategy import Strategy class MovingAverageCrossStrategy(Strategy): """ Carries out a basic Moving Average Crossover strategy with a short/long simple weighted moving average. Default short/long windows are 100/400 periods respectively. """ def __init__(self, bars, events, short_window=100, long_window=400): """ Initialises the buy and hold strategy. Parameters: bars - The DataHandler object that provides bar information events - The Event Queue object. short_window - The short moving average lookback. long_window - The long moving average lookback. """ self.bars = bars self.symbol_list = self.bars.symbol_list self.events = events self.short_window = short_window self.long_window = long_window # Set to True if a symbol is in the market self.bought = self._calculate_initial_bought() def _calculate_initial_bought(self): """ Adds keys to the bought dictionary for all symbols and sets them to 'OUT'. """ bought = {} for s in self.symbol_list: bought[s] = 'OUT' return bought def calculate_signals(self, event): """ Generates a new set of signals based on the MAC SMA with the short window crossing the long window meaning a long entry and vice versa for a short entry. Parameters event - A MarketEvent object. """ if event.type == 'MARKET': for symbol in self.symbol_list: bars = self.bars.get_latest_bars_values(symbol, "close", N=self.long_window) if bars is not None and bars != []: short_sma = np.mean(bars[-self.short_window:]) long_sma = np.mean(bars[-self.long_window:]) dt = self.bars.get_latest_bar_datetime(symbol) sig_dir = "" strength = 1.0 strategy_id = 1 if short_sma > long_sma and self.bought[symbol] == "OUT": sig_dir = 'LONG' signal = SignalEvent(strategy_id, symbol, dt, sig_dir, strength) self.events.put(signal) self.bought[symbol] = 'LONG' elif short_sma < long_sma and self.bought[symbol] == "LONG": sig_dir = 'EXIT' signal = SignalEvent(strategy_id, symbol, dt, sig_dir, strength) self.events.put(signal) self.bought[symbol] = 'OUT' if __name__ == "__main__": csv_dir = 'C:/Users/javgar119/Documents/Python/Data/' symbol_list = ['AAPL'] initial_capital = 100000.0 start_date = datetime.datetime(1990,1,1,0,0,0) heartbeat = 0.0 backtest = Backtest(csv_dir, symbol_list, initial_capital, heartbeat, start_date, HistoricCSVDataHandler, SimulatedExecutionHandler, Portfolio, MovingAverageCrossStrategy) backtest.simulate_trading()
apache-2.0
citrix-openstack-build/nova
nova/tests/scheduler/test_rpcapi.py
10
3484
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2012, Red Hat, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ Unit Tests for nova.scheduler.rpcapi """ from oslo.config import cfg from nova import context from nova.openstack.common import rpc from nova.scheduler import rpcapi as scheduler_rpcapi from nova import test CONF = cfg.CONF class SchedulerRpcAPITestCase(test.NoDBTestCase): def _test_scheduler_api(self, method, rpc_method, **kwargs): ctxt = context.RequestContext('fake_user', 'fake_project') rpcapi = scheduler_rpcapi.SchedulerAPI() expected_retval = 'foo' if method == 'call' else None expected_version = kwargs.pop('version', rpcapi.BASE_RPC_API_VERSION) expected_msg = rpcapi.make_msg(method, **kwargs) expected_msg['version'] = expected_version self.fake_args = None self.fake_kwargs = None def _fake_rpc_method(*args, **kwargs): self.fake_args = args self.fake_kwargs = kwargs if expected_retval: return expected_retval self.stubs.Set(rpc, rpc_method, _fake_rpc_method) retval = getattr(rpcapi, method)(ctxt, **kwargs) self.assertEqual(retval, expected_retval) expected_args = [ctxt, CONF.scheduler_topic, expected_msg] for arg, expected_arg in zip(self.fake_args, expected_args): self.assertEqual(arg, expected_arg) def test_run_instance(self): self._test_scheduler_api('run_instance', rpc_method='cast', request_spec='fake_request_spec', admin_password='pw', injected_files='fake_injected_files', requested_networks='fake_requested_networks', is_first_time=True, filter_properties='fake_filter_properties', legacy_bdm_in_spec=False, version='2.9') def test_prep_resize(self): self._test_scheduler_api('prep_resize', rpc_method='cast', instance='fake_instance', instance_type='fake_type', image='fake_image', request_spec='fake_request_spec', filter_properties='fake_props', reservations=list('fake_res')) def test_update_service_capabilities(self): self._test_scheduler_api('update_service_capabilities', rpc_method='fanout_cast', service_name='fake_name', host='fake_host', capabilities='fake_capabilities', version='2.4') def test_select_hosts(self): self._test_scheduler_api('select_hosts', rpc_method='call', request_spec='fake_request_spec', filter_properties='fake_prop', version='2.6') def test_select_destinations(self): self._test_scheduler_api('select_destinations', rpc_method='call', request_spec='fake_request_spec', filter_properties='fake_prop', version='2.7')
apache-2.0
alma-siwon/Solid_Kernel-GPROJ
Documentation/target/tcm_mod_builder.py
4981
41422
#!/usr/bin/python # The TCM v4 multi-protocol fabric module generation script for drivers/target/$NEW_MOD # # Copyright (c) 2010 Rising Tide Systems # Copyright (c) 2010 Linux-iSCSI.org # # Author: nab@kernel.org # import os, sys import subprocess as sub import string import re import optparse tcm_dir = "" fabric_ops = [] fabric_mod_dir = "" fabric_mod_port = "" fabric_mod_init_port = "" def tcm_mod_err(msg): print msg sys.exit(1) def tcm_mod_create_module_subdir(fabric_mod_dir_var): if os.path.isdir(fabric_mod_dir_var) == True: return 1 print "Creating fabric_mod_dir: " + fabric_mod_dir_var ret = os.mkdir(fabric_mod_dir_var) if ret: tcm_mod_err("Unable to mkdir " + fabric_mod_dir_var) return def tcm_mod_build_FC_include(fabric_mod_dir_var, fabric_mod_name): global fabric_mod_port global fabric_mod_init_port buf = "" f = fabric_mod_dir_var + "/" + fabric_mod_name + "_base.h" print "Writing file: " + f p = open(f, 'w'); if not p: tcm_mod_err("Unable to open file: " + f) buf = "#define " + fabric_mod_name.upper() + "_VERSION \"v0.1\"\n" buf += "#define " + fabric_mod_name.upper() + "_NAMELEN 32\n" buf += "\n" buf += "struct " + fabric_mod_name + "_nacl {\n" buf += " /* Binary World Wide unique Port Name for FC Initiator Nport */\n" buf += " u64 nport_wwpn;\n" buf += " /* ASCII formatted WWPN for FC Initiator Nport */\n" buf += " char nport_name[" + fabric_mod_name.upper() + "_NAMELEN];\n" buf += " /* Returned by " + fabric_mod_name + "_make_nodeacl() */\n" buf += " struct se_node_acl se_node_acl;\n" buf += "};\n" buf += "\n" buf += "struct " + fabric_mod_name + "_tpg {\n" buf += " /* FC lport target portal group tag for TCM */\n" buf += " u16 lport_tpgt;\n" buf += " /* Pointer back to " + fabric_mod_name + "_lport */\n" buf += " struct " + fabric_mod_name + "_lport *lport;\n" buf += " /* Returned by " + fabric_mod_name + "_make_tpg() */\n" buf += " struct se_portal_group se_tpg;\n" buf += "};\n" buf += "\n" buf += "struct " + fabric_mod_name + "_lport {\n" buf += " /* SCSI protocol the lport is providing */\n" buf += " u8 lport_proto_id;\n" buf += " /* Binary World Wide unique Port Name for FC Target Lport */\n" buf += " u64 lport_wwpn;\n" buf += " /* ASCII formatted WWPN for FC Target Lport */\n" buf += " char lport_name[" + fabric_mod_name.upper() + "_NAMELEN];\n" buf += " /* Returned by " + fabric_mod_name + "_make_lport() */\n" buf += " struct se_wwn lport_wwn;\n" buf += "};\n" ret = p.write(buf) if ret: tcm_mod_err("Unable to write f: " + f) p.close() fabric_mod_port = "lport" fabric_mod_init_port = "nport" return def tcm_mod_build_SAS_include(fabric_mod_dir_var, fabric_mod_name): global fabric_mod_port global fabric_mod_init_port buf = "" f = fabric_mod_dir_var + "/" + fabric_mod_name + "_base.h" print "Writing file: " + f p = open(f, 'w'); if not p: tcm_mod_err("Unable to open file: " + f) buf = "#define " + fabric_mod_name.upper() + "_VERSION \"v0.1\"\n" buf += "#define " + fabric_mod_name.upper() + "_NAMELEN 32\n" buf += "\n" buf += "struct " + fabric_mod_name + "_nacl {\n" buf += " /* Binary World Wide unique Port Name for SAS Initiator port */\n" buf += " u64 iport_wwpn;\n" buf += " /* ASCII formatted WWPN for Sas Initiator port */\n" buf += " char iport_name[" + fabric_mod_name.upper() + "_NAMELEN];\n" buf += " /* Returned by " + fabric_mod_name + "_make_nodeacl() */\n" buf += " struct se_node_acl se_node_acl;\n" buf += "};\n\n" buf += "struct " + fabric_mod_name + "_tpg {\n" buf += " /* SAS port target portal group tag for TCM */\n" buf += " u16 tport_tpgt;\n" buf += " /* Pointer back to " + fabric_mod_name + "_tport */\n" buf += " struct " + fabric_mod_name + "_tport *tport;\n" buf += " /* Returned by " + fabric_mod_name + "_make_tpg() */\n" buf += " struct se_portal_group se_tpg;\n" buf += "};\n\n" buf += "struct " + fabric_mod_name + "_tport {\n" buf += " /* SCSI protocol the tport is providing */\n" buf += " u8 tport_proto_id;\n" buf += " /* Binary World Wide unique Port Name for SAS Target port */\n" buf += " u64 tport_wwpn;\n" buf += " /* ASCII formatted WWPN for SAS Target port */\n" buf += " char tport_name[" + fabric_mod_name.upper() + "_NAMELEN];\n" buf += " /* Returned by " + fabric_mod_name + "_make_tport() */\n" buf += " struct se_wwn tport_wwn;\n" buf += "};\n" ret = p.write(buf) if ret: tcm_mod_err("Unable to write f: " + f) p.close() fabric_mod_port = "tport" fabric_mod_init_port = "iport" return def tcm_mod_build_iSCSI_include(fabric_mod_dir_var, fabric_mod_name): global fabric_mod_port global fabric_mod_init_port buf = "" f = fabric_mod_dir_var + "/" + fabric_mod_name + "_base.h" print "Writing file: " + f p = open(f, 'w'); if not p: tcm_mod_err("Unable to open file: " + f) buf = "#define " + fabric_mod_name.upper() + "_VERSION \"v0.1\"\n" buf += "#define " + fabric_mod_name.upper() + "_NAMELEN 32\n" buf += "\n" buf += "struct " + fabric_mod_name + "_nacl {\n" buf += " /* ASCII formatted InitiatorName */\n" buf += " char iport_name[" + fabric_mod_name.upper() + "_NAMELEN];\n" buf += " /* Returned by " + fabric_mod_name + "_make_nodeacl() */\n" buf += " struct se_node_acl se_node_acl;\n" buf += "};\n\n" buf += "struct " + fabric_mod_name + "_tpg {\n" buf += " /* iSCSI target portal group tag for TCM */\n" buf += " u16 tport_tpgt;\n" buf += " /* Pointer back to " + fabric_mod_name + "_tport */\n" buf += " struct " + fabric_mod_name + "_tport *tport;\n" buf += " /* Returned by " + fabric_mod_name + "_make_tpg() */\n" buf += " struct se_portal_group se_tpg;\n" buf += "};\n\n" buf += "struct " + fabric_mod_name + "_tport {\n" buf += " /* SCSI protocol the tport is providing */\n" buf += " u8 tport_proto_id;\n" buf += " /* ASCII formatted TargetName for IQN */\n" buf += " char tport_name[" + fabric_mod_name.upper() + "_NAMELEN];\n" buf += " /* Returned by " + fabric_mod_name + "_make_tport() */\n" buf += " struct se_wwn tport_wwn;\n" buf += "};\n" ret = p.write(buf) if ret: tcm_mod_err("Unable to write f: " + f) p.close() fabric_mod_port = "tport" fabric_mod_init_port = "iport" return def tcm_mod_build_base_includes(proto_ident, fabric_mod_dir_val, fabric_mod_name): if proto_ident == "FC": tcm_mod_build_FC_include(fabric_mod_dir_val, fabric_mod_name) elif proto_ident == "SAS": tcm_mod_build_SAS_include(fabric_mod_dir_val, fabric_mod_name) elif proto_ident == "iSCSI": tcm_mod_build_iSCSI_include(fabric_mod_dir_val, fabric_mod_name) else: print "Unsupported proto_ident: " + proto_ident sys.exit(1) return def tcm_mod_build_configfs(proto_ident, fabric_mod_dir_var, fabric_mod_name): buf = "" f = fabric_mod_dir_var + "/" + fabric_mod_name + "_configfs.c" print "Writing file: " + f p = open(f, 'w'); if not p: tcm_mod_err("Unable to open file: " + f) buf = "#include <linux/module.h>\n" buf += "#include <linux/moduleparam.h>\n" buf += "#include <linux/version.h>\n" buf += "#include <generated/utsrelease.h>\n" buf += "#include <linux/utsname.h>\n" buf += "#include <linux/init.h>\n" buf += "#include <linux/slab.h>\n" buf += "#include <linux/kthread.h>\n" buf += "#include <linux/types.h>\n" buf += "#include <linux/string.h>\n" buf += "#include <linux/configfs.h>\n" buf += "#include <linux/ctype.h>\n" buf += "#include <asm/unaligned.h>\n\n" buf += "#include <target/target_core_base.h>\n" buf += "#include <target/target_core_fabric.h>\n" buf += "#include <target/target_core_fabric_configfs.h>\n" buf += "#include <target/target_core_configfs.h>\n" buf += "#include <target/configfs_macros.h>\n\n" buf += "#include \"" + fabric_mod_name + "_base.h\"\n" buf += "#include \"" + fabric_mod_name + "_fabric.h\"\n\n" buf += "/* Local pointer to allocated TCM configfs fabric module */\n" buf += "struct target_fabric_configfs *" + fabric_mod_name + "_fabric_configfs;\n\n" buf += "static struct se_node_acl *" + fabric_mod_name + "_make_nodeacl(\n" buf += " struct se_portal_group *se_tpg,\n" buf += " struct config_group *group,\n" buf += " const char *name)\n" buf += "{\n" buf += " struct se_node_acl *se_nacl, *se_nacl_new;\n" buf += " struct " + fabric_mod_name + "_nacl *nacl;\n" if proto_ident == "FC" or proto_ident == "SAS": buf += " u64 wwpn = 0;\n" buf += " u32 nexus_depth;\n\n" buf += " /* " + fabric_mod_name + "_parse_wwn(name, &wwpn, 1) < 0)\n" buf += " return ERR_PTR(-EINVAL); */\n" buf += " se_nacl_new = " + fabric_mod_name + "_alloc_fabric_acl(se_tpg);\n" buf += " if (!se_nacl_new)\n" buf += " return ERR_PTR(-ENOMEM);\n" buf += "//#warning FIXME: Hardcoded nexus depth in " + fabric_mod_name + "_make_nodeacl()\n" buf += " nexus_depth = 1;\n" buf += " /*\n" buf += " * se_nacl_new may be released by core_tpg_add_initiator_node_acl()\n" buf += " * when converting a NodeACL from demo mode -> explict\n" buf += " */\n" buf += " se_nacl = core_tpg_add_initiator_node_acl(se_tpg, se_nacl_new,\n" buf += " name, nexus_depth);\n" buf += " if (IS_ERR(se_nacl)) {\n" buf += " " + fabric_mod_name + "_release_fabric_acl(se_tpg, se_nacl_new);\n" buf += " return se_nacl;\n" buf += " }\n" buf += " /*\n" buf += " * Locate our struct " + fabric_mod_name + "_nacl and set the FC Nport WWPN\n" buf += " */\n" buf += " nacl = container_of(se_nacl, struct " + fabric_mod_name + "_nacl, se_node_acl);\n" if proto_ident == "FC" or proto_ident == "SAS": buf += " nacl->" + fabric_mod_init_port + "_wwpn = wwpn;\n" buf += " /* " + fabric_mod_name + "_format_wwn(&nacl->" + fabric_mod_init_port + "_name[0], " + fabric_mod_name.upper() + "_NAMELEN, wwpn); */\n\n" buf += " return se_nacl;\n" buf += "}\n\n" buf += "static void " + fabric_mod_name + "_drop_nodeacl(struct se_node_acl *se_acl)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_nacl *nacl = container_of(se_acl,\n" buf += " struct " + fabric_mod_name + "_nacl, se_node_acl);\n" buf += " core_tpg_del_initiator_node_acl(se_acl->se_tpg, se_acl, 1);\n" buf += " kfree(nacl);\n" buf += "}\n\n" buf += "static struct se_portal_group *" + fabric_mod_name + "_make_tpg(\n" buf += " struct se_wwn *wwn,\n" buf += " struct config_group *group,\n" buf += " const char *name)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_" + fabric_mod_port + "*" + fabric_mod_port + " = container_of(wwn,\n" buf += " struct " + fabric_mod_name + "_" + fabric_mod_port + ", " + fabric_mod_port + "_wwn);\n\n" buf += " struct " + fabric_mod_name + "_tpg *tpg;\n" buf += " unsigned long tpgt;\n" buf += " int ret;\n\n" buf += " if (strstr(name, \"tpgt_\") != name)\n" buf += " return ERR_PTR(-EINVAL);\n" buf += " if (strict_strtoul(name + 5, 10, &tpgt) || tpgt > UINT_MAX)\n" buf += " return ERR_PTR(-EINVAL);\n\n" buf += " tpg = kzalloc(sizeof(struct " + fabric_mod_name + "_tpg), GFP_KERNEL);\n" buf += " if (!tpg) {\n" buf += " printk(KERN_ERR \"Unable to allocate struct " + fabric_mod_name + "_tpg\");\n" buf += " return ERR_PTR(-ENOMEM);\n" buf += " }\n" buf += " tpg->" + fabric_mod_port + " = " + fabric_mod_port + ";\n" buf += " tpg->" + fabric_mod_port + "_tpgt = tpgt;\n\n" buf += " ret = core_tpg_register(&" + fabric_mod_name + "_fabric_configfs->tf_ops, wwn,\n" buf += " &tpg->se_tpg, (void *)tpg,\n" buf += " TRANSPORT_TPG_TYPE_NORMAL);\n" buf += " if (ret < 0) {\n" buf += " kfree(tpg);\n" buf += " return NULL;\n" buf += " }\n" buf += " return &tpg->se_tpg;\n" buf += "}\n\n" buf += "static void " + fabric_mod_name + "_drop_tpg(struct se_portal_group *se_tpg)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_tpg *tpg = container_of(se_tpg,\n" buf += " struct " + fabric_mod_name + "_tpg, se_tpg);\n\n" buf += " core_tpg_deregister(se_tpg);\n" buf += " kfree(tpg);\n" buf += "}\n\n" buf += "static struct se_wwn *" + fabric_mod_name + "_make_" + fabric_mod_port + "(\n" buf += " struct target_fabric_configfs *tf,\n" buf += " struct config_group *group,\n" buf += " const char *name)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_" + fabric_mod_port + " *" + fabric_mod_port + ";\n" if proto_ident == "FC" or proto_ident == "SAS": buf += " u64 wwpn = 0;\n\n" buf += " /* if (" + fabric_mod_name + "_parse_wwn(name, &wwpn, 1) < 0)\n" buf += " return ERR_PTR(-EINVAL); */\n\n" buf += " " + fabric_mod_port + " = kzalloc(sizeof(struct " + fabric_mod_name + "_" + fabric_mod_port + "), GFP_KERNEL);\n" buf += " if (!" + fabric_mod_port + ") {\n" buf += " printk(KERN_ERR \"Unable to allocate struct " + fabric_mod_name + "_" + fabric_mod_port + "\");\n" buf += " return ERR_PTR(-ENOMEM);\n" buf += " }\n" if proto_ident == "FC" or proto_ident == "SAS": buf += " " + fabric_mod_port + "->" + fabric_mod_port + "_wwpn = wwpn;\n" buf += " /* " + fabric_mod_name + "_format_wwn(&" + fabric_mod_port + "->" + fabric_mod_port + "_name[0], " + fabric_mod_name.upper() + "_NAMELEN, wwpn); */\n\n" buf += " return &" + fabric_mod_port + "->" + fabric_mod_port + "_wwn;\n" buf += "}\n\n" buf += "static void " + fabric_mod_name + "_drop_" + fabric_mod_port + "(struct se_wwn *wwn)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_" + fabric_mod_port + " *" + fabric_mod_port + " = container_of(wwn,\n" buf += " struct " + fabric_mod_name + "_" + fabric_mod_port + ", " + fabric_mod_port + "_wwn);\n" buf += " kfree(" + fabric_mod_port + ");\n" buf += "}\n\n" buf += "static ssize_t " + fabric_mod_name + "_wwn_show_attr_version(\n" buf += " struct target_fabric_configfs *tf,\n" buf += " char *page)\n" buf += "{\n" buf += " return sprintf(page, \"" + fabric_mod_name.upper() + " fabric module %s on %s/%s\"\n" buf += " \"on \"UTS_RELEASE\"\\n\", " + fabric_mod_name.upper() + "_VERSION, utsname()->sysname,\n" buf += " utsname()->machine);\n" buf += "}\n\n" buf += "TF_WWN_ATTR_RO(" + fabric_mod_name + ", version);\n\n" buf += "static struct configfs_attribute *" + fabric_mod_name + "_wwn_attrs[] = {\n" buf += " &" + fabric_mod_name + "_wwn_version.attr,\n" buf += " NULL,\n" buf += "};\n\n" buf += "static struct target_core_fabric_ops " + fabric_mod_name + "_ops = {\n" buf += " .get_fabric_name = " + fabric_mod_name + "_get_fabric_name,\n" buf += " .get_fabric_proto_ident = " + fabric_mod_name + "_get_fabric_proto_ident,\n" buf += " .tpg_get_wwn = " + fabric_mod_name + "_get_fabric_wwn,\n" buf += " .tpg_get_tag = " + fabric_mod_name + "_get_tag,\n" buf += " .tpg_get_default_depth = " + fabric_mod_name + "_get_default_depth,\n" buf += " .tpg_get_pr_transport_id = " + fabric_mod_name + "_get_pr_transport_id,\n" buf += " .tpg_get_pr_transport_id_len = " + fabric_mod_name + "_get_pr_transport_id_len,\n" buf += " .tpg_parse_pr_out_transport_id = " + fabric_mod_name + "_parse_pr_out_transport_id,\n" buf += " .tpg_check_demo_mode = " + fabric_mod_name + "_check_false,\n" buf += " .tpg_check_demo_mode_cache = " + fabric_mod_name + "_check_true,\n" buf += " .tpg_check_demo_mode_write_protect = " + fabric_mod_name + "_check_true,\n" buf += " .tpg_check_prod_mode_write_protect = " + fabric_mod_name + "_check_false,\n" buf += " .tpg_alloc_fabric_acl = " + fabric_mod_name + "_alloc_fabric_acl,\n" buf += " .tpg_release_fabric_acl = " + fabric_mod_name + "_release_fabric_acl,\n" buf += " .tpg_get_inst_index = " + fabric_mod_name + "_tpg_get_inst_index,\n" buf += " .release_cmd = " + fabric_mod_name + "_release_cmd,\n" buf += " .shutdown_session = " + fabric_mod_name + "_shutdown_session,\n" buf += " .close_session = " + fabric_mod_name + "_close_session,\n" buf += " .stop_session = " + fabric_mod_name + "_stop_session,\n" buf += " .fall_back_to_erl0 = " + fabric_mod_name + "_reset_nexus,\n" buf += " .sess_logged_in = " + fabric_mod_name + "_sess_logged_in,\n" buf += " .sess_get_index = " + fabric_mod_name + "_sess_get_index,\n" buf += " .sess_get_initiator_sid = NULL,\n" buf += " .write_pending = " + fabric_mod_name + "_write_pending,\n" buf += " .write_pending_status = " + fabric_mod_name + "_write_pending_status,\n" buf += " .set_default_node_attributes = " + fabric_mod_name + "_set_default_node_attrs,\n" buf += " .get_task_tag = " + fabric_mod_name + "_get_task_tag,\n" buf += " .get_cmd_state = " + fabric_mod_name + "_get_cmd_state,\n" buf += " .queue_data_in = " + fabric_mod_name + "_queue_data_in,\n" buf += " .queue_status = " + fabric_mod_name + "_queue_status,\n" buf += " .queue_tm_rsp = " + fabric_mod_name + "_queue_tm_rsp,\n" buf += " .get_fabric_sense_len = " + fabric_mod_name + "_get_fabric_sense_len,\n" buf += " .set_fabric_sense_len = " + fabric_mod_name + "_set_fabric_sense_len,\n" buf += " .is_state_remove = " + fabric_mod_name + "_is_state_remove,\n" buf += " /*\n" buf += " * Setup function pointers for generic logic in target_core_fabric_configfs.c\n" buf += " */\n" buf += " .fabric_make_wwn = " + fabric_mod_name + "_make_" + fabric_mod_port + ",\n" buf += " .fabric_drop_wwn = " + fabric_mod_name + "_drop_" + fabric_mod_port + ",\n" buf += " .fabric_make_tpg = " + fabric_mod_name + "_make_tpg,\n" buf += " .fabric_drop_tpg = " + fabric_mod_name + "_drop_tpg,\n" buf += " .fabric_post_link = NULL,\n" buf += " .fabric_pre_unlink = NULL,\n" buf += " .fabric_make_np = NULL,\n" buf += " .fabric_drop_np = NULL,\n" buf += " .fabric_make_nodeacl = " + fabric_mod_name + "_make_nodeacl,\n" buf += " .fabric_drop_nodeacl = " + fabric_mod_name + "_drop_nodeacl,\n" buf += "};\n\n" buf += "static int " + fabric_mod_name + "_register_configfs(void)\n" buf += "{\n" buf += " struct target_fabric_configfs *fabric;\n" buf += " int ret;\n\n" buf += " printk(KERN_INFO \"" + fabric_mod_name.upper() + " fabric module %s on %s/%s\"\n" buf += " \" on \"UTS_RELEASE\"\\n\"," + fabric_mod_name.upper() + "_VERSION, utsname()->sysname,\n" buf += " utsname()->machine);\n" buf += " /*\n" buf += " * Register the top level struct config_item_type with TCM core\n" buf += " */\n" buf += " fabric = target_fabric_configfs_init(THIS_MODULE, \"" + fabric_mod_name[4:] + "\");\n" buf += " if (IS_ERR(fabric)) {\n" buf += " printk(KERN_ERR \"target_fabric_configfs_init() failed\\n\");\n" buf += " return PTR_ERR(fabric);\n" buf += " }\n" buf += " /*\n" buf += " * Setup fabric->tf_ops from our local " + fabric_mod_name + "_ops\n" buf += " */\n" buf += " fabric->tf_ops = " + fabric_mod_name + "_ops;\n" buf += " /*\n" buf += " * Setup default attribute lists for various fabric->tf_cit_tmpl\n" buf += " */\n" buf += " TF_CIT_TMPL(fabric)->tfc_wwn_cit.ct_attrs = " + fabric_mod_name + "_wwn_attrs;\n" buf += " TF_CIT_TMPL(fabric)->tfc_tpg_base_cit.ct_attrs = NULL;\n" buf += " TF_CIT_TMPL(fabric)->tfc_tpg_attrib_cit.ct_attrs = NULL;\n" buf += " TF_CIT_TMPL(fabric)->tfc_tpg_param_cit.ct_attrs = NULL;\n" buf += " TF_CIT_TMPL(fabric)->tfc_tpg_np_base_cit.ct_attrs = NULL;\n" buf += " TF_CIT_TMPL(fabric)->tfc_tpg_nacl_base_cit.ct_attrs = NULL;\n" buf += " TF_CIT_TMPL(fabric)->tfc_tpg_nacl_attrib_cit.ct_attrs = NULL;\n" buf += " TF_CIT_TMPL(fabric)->tfc_tpg_nacl_auth_cit.ct_attrs = NULL;\n" buf += " TF_CIT_TMPL(fabric)->tfc_tpg_nacl_param_cit.ct_attrs = NULL;\n" buf += " /*\n" buf += " * Register the fabric for use within TCM\n" buf += " */\n" buf += " ret = target_fabric_configfs_register(fabric);\n" buf += " if (ret < 0) {\n" buf += " printk(KERN_ERR \"target_fabric_configfs_register() failed\"\n" buf += " \" for " + fabric_mod_name.upper() + "\\n\");\n" buf += " return ret;\n" buf += " }\n" buf += " /*\n" buf += " * Setup our local pointer to *fabric\n" buf += " */\n" buf += " " + fabric_mod_name + "_fabric_configfs = fabric;\n" buf += " printk(KERN_INFO \"" + fabric_mod_name.upper() + "[0] - Set fabric -> " + fabric_mod_name + "_fabric_configfs\\n\");\n" buf += " return 0;\n" buf += "};\n\n" buf += "static void __exit " + fabric_mod_name + "_deregister_configfs(void)\n" buf += "{\n" buf += " if (!" + fabric_mod_name + "_fabric_configfs)\n" buf += " return;\n\n" buf += " target_fabric_configfs_deregister(" + fabric_mod_name + "_fabric_configfs);\n" buf += " " + fabric_mod_name + "_fabric_configfs = NULL;\n" buf += " printk(KERN_INFO \"" + fabric_mod_name.upper() + "[0] - Cleared " + fabric_mod_name + "_fabric_configfs\\n\");\n" buf += "};\n\n" buf += "static int __init " + fabric_mod_name + "_init(void)\n" buf += "{\n" buf += " int ret;\n\n" buf += " ret = " + fabric_mod_name + "_register_configfs();\n" buf += " if (ret < 0)\n" buf += " return ret;\n\n" buf += " return 0;\n" buf += "};\n\n" buf += "static void __exit " + fabric_mod_name + "_exit(void)\n" buf += "{\n" buf += " " + fabric_mod_name + "_deregister_configfs();\n" buf += "};\n\n" buf += "MODULE_DESCRIPTION(\"" + fabric_mod_name.upper() + " series fabric driver\");\n" buf += "MODULE_LICENSE(\"GPL\");\n" buf += "module_init(" + fabric_mod_name + "_init);\n" buf += "module_exit(" + fabric_mod_name + "_exit);\n" ret = p.write(buf) if ret: tcm_mod_err("Unable to write f: " + f) p.close() return def tcm_mod_scan_fabric_ops(tcm_dir): fabric_ops_api = tcm_dir + "include/target/target_core_fabric.h" print "Using tcm_mod_scan_fabric_ops: " + fabric_ops_api process_fo = 0; p = open(fabric_ops_api, 'r') line = p.readline() while line: if process_fo == 0 and re.search('struct target_core_fabric_ops {', line): line = p.readline() continue if process_fo == 0: process_fo = 1; line = p.readline() # Search for function pointer if not re.search('\(\*', line): continue fabric_ops.append(line.rstrip()) continue line = p.readline() # Search for function pointer if not re.search('\(\*', line): continue fabric_ops.append(line.rstrip()) p.close() return def tcm_mod_dump_fabric_ops(proto_ident, fabric_mod_dir_var, fabric_mod_name): buf = "" bufi = "" f = fabric_mod_dir_var + "/" + fabric_mod_name + "_fabric.c" print "Writing file: " + f p = open(f, 'w') if not p: tcm_mod_err("Unable to open file: " + f) fi = fabric_mod_dir_var + "/" + fabric_mod_name + "_fabric.h" print "Writing file: " + fi pi = open(fi, 'w') if not pi: tcm_mod_err("Unable to open file: " + fi) buf = "#include <linux/slab.h>\n" buf += "#include <linux/kthread.h>\n" buf += "#include <linux/types.h>\n" buf += "#include <linux/list.h>\n" buf += "#include <linux/types.h>\n" buf += "#include <linux/string.h>\n" buf += "#include <linux/ctype.h>\n" buf += "#include <asm/unaligned.h>\n" buf += "#include <scsi/scsi.h>\n" buf += "#include <scsi/scsi_host.h>\n" buf += "#include <scsi/scsi_device.h>\n" buf += "#include <scsi/scsi_cmnd.h>\n" buf += "#include <scsi/libfc.h>\n\n" buf += "#include <target/target_core_base.h>\n" buf += "#include <target/target_core_fabric.h>\n" buf += "#include <target/target_core_configfs.h>\n\n" buf += "#include \"" + fabric_mod_name + "_base.h\"\n" buf += "#include \"" + fabric_mod_name + "_fabric.h\"\n\n" buf += "int " + fabric_mod_name + "_check_true(struct se_portal_group *se_tpg)\n" buf += "{\n" buf += " return 1;\n" buf += "}\n\n" bufi += "int " + fabric_mod_name + "_check_true(struct se_portal_group *);\n" buf += "int " + fabric_mod_name + "_check_false(struct se_portal_group *se_tpg)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "int " + fabric_mod_name + "_check_false(struct se_portal_group *);\n" total_fabric_ops = len(fabric_ops) i = 0 while i < total_fabric_ops: fo = fabric_ops[i] i += 1 # print "fabric_ops: " + fo if re.search('get_fabric_name', fo): buf += "char *" + fabric_mod_name + "_get_fabric_name(void)\n" buf += "{\n" buf += " return \"" + fabric_mod_name[4:] + "\";\n" buf += "}\n\n" bufi += "char *" + fabric_mod_name + "_get_fabric_name(void);\n" continue if re.search('get_fabric_proto_ident', fo): buf += "u8 " + fabric_mod_name + "_get_fabric_proto_ident(struct se_portal_group *se_tpg)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_tpg *tpg = container_of(se_tpg,\n" buf += " struct " + fabric_mod_name + "_tpg, se_tpg);\n" buf += " struct " + fabric_mod_name + "_" + fabric_mod_port + " *" + fabric_mod_port + " = tpg->" + fabric_mod_port + ";\n" buf += " u8 proto_id;\n\n" buf += " switch (" + fabric_mod_port + "->" + fabric_mod_port + "_proto_id) {\n" if proto_ident == "FC": buf += " case SCSI_PROTOCOL_FCP:\n" buf += " default:\n" buf += " proto_id = fc_get_fabric_proto_ident(se_tpg);\n" buf += " break;\n" elif proto_ident == "SAS": buf += " case SCSI_PROTOCOL_SAS:\n" buf += " default:\n" buf += " proto_id = sas_get_fabric_proto_ident(se_tpg);\n" buf += " break;\n" elif proto_ident == "iSCSI": buf += " case SCSI_PROTOCOL_ISCSI:\n" buf += " default:\n" buf += " proto_id = iscsi_get_fabric_proto_ident(se_tpg);\n" buf += " break;\n" buf += " }\n\n" buf += " return proto_id;\n" buf += "}\n\n" bufi += "u8 " + fabric_mod_name + "_get_fabric_proto_ident(struct se_portal_group *);\n" if re.search('get_wwn', fo): buf += "char *" + fabric_mod_name + "_get_fabric_wwn(struct se_portal_group *se_tpg)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_tpg *tpg = container_of(se_tpg,\n" buf += " struct " + fabric_mod_name + "_tpg, se_tpg);\n" buf += " struct " + fabric_mod_name + "_" + fabric_mod_port + " *" + fabric_mod_port + " = tpg->" + fabric_mod_port + ";\n\n" buf += " return &" + fabric_mod_port + "->" + fabric_mod_port + "_name[0];\n" buf += "}\n\n" bufi += "char *" + fabric_mod_name + "_get_fabric_wwn(struct se_portal_group *);\n" if re.search('get_tag', fo): buf += "u16 " + fabric_mod_name + "_get_tag(struct se_portal_group *se_tpg)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_tpg *tpg = container_of(se_tpg,\n" buf += " struct " + fabric_mod_name + "_tpg, se_tpg);\n" buf += " return tpg->" + fabric_mod_port + "_tpgt;\n" buf += "}\n\n" bufi += "u16 " + fabric_mod_name + "_get_tag(struct se_portal_group *);\n" if re.search('get_default_depth', fo): buf += "u32 " + fabric_mod_name + "_get_default_depth(struct se_portal_group *se_tpg)\n" buf += "{\n" buf += " return 1;\n" buf += "}\n\n" bufi += "u32 " + fabric_mod_name + "_get_default_depth(struct se_portal_group *);\n" if re.search('get_pr_transport_id\)\(', fo): buf += "u32 " + fabric_mod_name + "_get_pr_transport_id(\n" buf += " struct se_portal_group *se_tpg,\n" buf += " struct se_node_acl *se_nacl,\n" buf += " struct t10_pr_registration *pr_reg,\n" buf += " int *format_code,\n" buf += " unsigned char *buf)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_tpg *tpg = container_of(se_tpg,\n" buf += " struct " + fabric_mod_name + "_tpg, se_tpg);\n" buf += " struct " + fabric_mod_name + "_" + fabric_mod_port + " *" + fabric_mod_port + " = tpg->" + fabric_mod_port + ";\n" buf += " int ret = 0;\n\n" buf += " switch (" + fabric_mod_port + "->" + fabric_mod_port + "_proto_id) {\n" if proto_ident == "FC": buf += " case SCSI_PROTOCOL_FCP:\n" buf += " default:\n" buf += " ret = fc_get_pr_transport_id(se_tpg, se_nacl, pr_reg,\n" buf += " format_code, buf);\n" buf += " break;\n" elif proto_ident == "SAS": buf += " case SCSI_PROTOCOL_SAS:\n" buf += " default:\n" buf += " ret = sas_get_pr_transport_id(se_tpg, se_nacl, pr_reg,\n" buf += " format_code, buf);\n" buf += " break;\n" elif proto_ident == "iSCSI": buf += " case SCSI_PROTOCOL_ISCSI:\n" buf += " default:\n" buf += " ret = iscsi_get_pr_transport_id(se_tpg, se_nacl, pr_reg,\n" buf += " format_code, buf);\n" buf += " break;\n" buf += " }\n\n" buf += " return ret;\n" buf += "}\n\n" bufi += "u32 " + fabric_mod_name + "_get_pr_transport_id(struct se_portal_group *,\n" bufi += " struct se_node_acl *, struct t10_pr_registration *,\n" bufi += " int *, unsigned char *);\n" if re.search('get_pr_transport_id_len\)\(', fo): buf += "u32 " + fabric_mod_name + "_get_pr_transport_id_len(\n" buf += " struct se_portal_group *se_tpg,\n" buf += " struct se_node_acl *se_nacl,\n" buf += " struct t10_pr_registration *pr_reg,\n" buf += " int *format_code)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_tpg *tpg = container_of(se_tpg,\n" buf += " struct " + fabric_mod_name + "_tpg, se_tpg);\n" buf += " struct " + fabric_mod_name + "_" + fabric_mod_port + " *" + fabric_mod_port + " = tpg->" + fabric_mod_port + ";\n" buf += " int ret = 0;\n\n" buf += " switch (" + fabric_mod_port + "->" + fabric_mod_port + "_proto_id) {\n" if proto_ident == "FC": buf += " case SCSI_PROTOCOL_FCP:\n" buf += " default:\n" buf += " ret = fc_get_pr_transport_id_len(se_tpg, se_nacl, pr_reg,\n" buf += " format_code);\n" buf += " break;\n" elif proto_ident == "SAS": buf += " case SCSI_PROTOCOL_SAS:\n" buf += " default:\n" buf += " ret = sas_get_pr_transport_id_len(se_tpg, se_nacl, pr_reg,\n" buf += " format_code);\n" buf += " break;\n" elif proto_ident == "iSCSI": buf += " case SCSI_PROTOCOL_ISCSI:\n" buf += " default:\n" buf += " ret = iscsi_get_pr_transport_id_len(se_tpg, se_nacl, pr_reg,\n" buf += " format_code);\n" buf += " break;\n" buf += " }\n\n" buf += " return ret;\n" buf += "}\n\n" bufi += "u32 " + fabric_mod_name + "_get_pr_transport_id_len(struct se_portal_group *,\n" bufi += " struct se_node_acl *, struct t10_pr_registration *,\n" bufi += " int *);\n" if re.search('parse_pr_out_transport_id\)\(', fo): buf += "char *" + fabric_mod_name + "_parse_pr_out_transport_id(\n" buf += " struct se_portal_group *se_tpg,\n" buf += " const char *buf,\n" buf += " u32 *out_tid_len,\n" buf += " char **port_nexus_ptr)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_tpg *tpg = container_of(se_tpg,\n" buf += " struct " + fabric_mod_name + "_tpg, se_tpg);\n" buf += " struct " + fabric_mod_name + "_" + fabric_mod_port + " *" + fabric_mod_port + " = tpg->" + fabric_mod_port + ";\n" buf += " char *tid = NULL;\n\n" buf += " switch (" + fabric_mod_port + "->" + fabric_mod_port + "_proto_id) {\n" if proto_ident == "FC": buf += " case SCSI_PROTOCOL_FCP:\n" buf += " default:\n" buf += " tid = fc_parse_pr_out_transport_id(se_tpg, buf, out_tid_len,\n" buf += " port_nexus_ptr);\n" elif proto_ident == "SAS": buf += " case SCSI_PROTOCOL_SAS:\n" buf += " default:\n" buf += " tid = sas_parse_pr_out_transport_id(se_tpg, buf, out_tid_len,\n" buf += " port_nexus_ptr);\n" elif proto_ident == "iSCSI": buf += " case SCSI_PROTOCOL_ISCSI:\n" buf += " default:\n" buf += " tid = iscsi_parse_pr_out_transport_id(se_tpg, buf, out_tid_len,\n" buf += " port_nexus_ptr);\n" buf += " }\n\n" buf += " return tid;\n" buf += "}\n\n" bufi += "char *" + fabric_mod_name + "_parse_pr_out_transport_id(struct se_portal_group *,\n" bufi += " const char *, u32 *, char **);\n" if re.search('alloc_fabric_acl\)\(', fo): buf += "struct se_node_acl *" + fabric_mod_name + "_alloc_fabric_acl(struct se_portal_group *se_tpg)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_nacl *nacl;\n\n" buf += " nacl = kzalloc(sizeof(struct " + fabric_mod_name + "_nacl), GFP_KERNEL);\n" buf += " if (!nacl) {\n" buf += " printk(KERN_ERR \"Unable to allocate struct " + fabric_mod_name + "_nacl\\n\");\n" buf += " return NULL;\n" buf += " }\n\n" buf += " return &nacl->se_node_acl;\n" buf += "}\n\n" bufi += "struct se_node_acl *" + fabric_mod_name + "_alloc_fabric_acl(struct se_portal_group *);\n" if re.search('release_fabric_acl\)\(', fo): buf += "void " + fabric_mod_name + "_release_fabric_acl(\n" buf += " struct se_portal_group *se_tpg,\n" buf += " struct se_node_acl *se_nacl)\n" buf += "{\n" buf += " struct " + fabric_mod_name + "_nacl *nacl = container_of(se_nacl,\n" buf += " struct " + fabric_mod_name + "_nacl, se_node_acl);\n" buf += " kfree(nacl);\n" buf += "}\n\n" bufi += "void " + fabric_mod_name + "_release_fabric_acl(struct se_portal_group *,\n" bufi += " struct se_node_acl *);\n" if re.search('tpg_get_inst_index\)\(', fo): buf += "u32 " + fabric_mod_name + "_tpg_get_inst_index(struct se_portal_group *se_tpg)\n" buf += "{\n" buf += " return 1;\n" buf += "}\n\n" bufi += "u32 " + fabric_mod_name + "_tpg_get_inst_index(struct se_portal_group *);\n" if re.search('\*release_cmd\)\(', fo): buf += "void " + fabric_mod_name + "_release_cmd(struct se_cmd *se_cmd)\n" buf += "{\n" buf += " return;\n" buf += "}\n\n" bufi += "void " + fabric_mod_name + "_release_cmd(struct se_cmd *);\n" if re.search('shutdown_session\)\(', fo): buf += "int " + fabric_mod_name + "_shutdown_session(struct se_session *se_sess)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "int " + fabric_mod_name + "_shutdown_session(struct se_session *);\n" if re.search('close_session\)\(', fo): buf += "void " + fabric_mod_name + "_close_session(struct se_session *se_sess)\n" buf += "{\n" buf += " return;\n" buf += "}\n\n" bufi += "void " + fabric_mod_name + "_close_session(struct se_session *);\n" if re.search('stop_session\)\(', fo): buf += "void " + fabric_mod_name + "_stop_session(struct se_session *se_sess, int sess_sleep , int conn_sleep)\n" buf += "{\n" buf += " return;\n" buf += "}\n\n" bufi += "void " + fabric_mod_name + "_stop_session(struct se_session *, int, int);\n" if re.search('fall_back_to_erl0\)\(', fo): buf += "void " + fabric_mod_name + "_reset_nexus(struct se_session *se_sess)\n" buf += "{\n" buf += " return;\n" buf += "}\n\n" bufi += "void " + fabric_mod_name + "_reset_nexus(struct se_session *);\n" if re.search('sess_logged_in\)\(', fo): buf += "int " + fabric_mod_name + "_sess_logged_in(struct se_session *se_sess)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "int " + fabric_mod_name + "_sess_logged_in(struct se_session *);\n" if re.search('sess_get_index\)\(', fo): buf += "u32 " + fabric_mod_name + "_sess_get_index(struct se_session *se_sess)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "u32 " + fabric_mod_name + "_sess_get_index(struct se_session *);\n" if re.search('write_pending\)\(', fo): buf += "int " + fabric_mod_name + "_write_pending(struct se_cmd *se_cmd)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "int " + fabric_mod_name + "_write_pending(struct se_cmd *);\n" if re.search('write_pending_status\)\(', fo): buf += "int " + fabric_mod_name + "_write_pending_status(struct se_cmd *se_cmd)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "int " + fabric_mod_name + "_write_pending_status(struct se_cmd *);\n" if re.search('set_default_node_attributes\)\(', fo): buf += "void " + fabric_mod_name + "_set_default_node_attrs(struct se_node_acl *nacl)\n" buf += "{\n" buf += " return;\n" buf += "}\n\n" bufi += "void " + fabric_mod_name + "_set_default_node_attrs(struct se_node_acl *);\n" if re.search('get_task_tag\)\(', fo): buf += "u32 " + fabric_mod_name + "_get_task_tag(struct se_cmd *se_cmd)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "u32 " + fabric_mod_name + "_get_task_tag(struct se_cmd *);\n" if re.search('get_cmd_state\)\(', fo): buf += "int " + fabric_mod_name + "_get_cmd_state(struct se_cmd *se_cmd)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "int " + fabric_mod_name + "_get_cmd_state(struct se_cmd *);\n" if re.search('queue_data_in\)\(', fo): buf += "int " + fabric_mod_name + "_queue_data_in(struct se_cmd *se_cmd)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "int " + fabric_mod_name + "_queue_data_in(struct se_cmd *);\n" if re.search('queue_status\)\(', fo): buf += "int " + fabric_mod_name + "_queue_status(struct se_cmd *se_cmd)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "int " + fabric_mod_name + "_queue_status(struct se_cmd *);\n" if re.search('queue_tm_rsp\)\(', fo): buf += "int " + fabric_mod_name + "_queue_tm_rsp(struct se_cmd *se_cmd)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "int " + fabric_mod_name + "_queue_tm_rsp(struct se_cmd *);\n" if re.search('get_fabric_sense_len\)\(', fo): buf += "u16 " + fabric_mod_name + "_get_fabric_sense_len(void)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "u16 " + fabric_mod_name + "_get_fabric_sense_len(void);\n" if re.search('set_fabric_sense_len\)\(', fo): buf += "u16 " + fabric_mod_name + "_set_fabric_sense_len(struct se_cmd *se_cmd, u32 sense_length)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "u16 " + fabric_mod_name + "_set_fabric_sense_len(struct se_cmd *, u32);\n" if re.search('is_state_remove\)\(', fo): buf += "int " + fabric_mod_name + "_is_state_remove(struct se_cmd *se_cmd)\n" buf += "{\n" buf += " return 0;\n" buf += "}\n\n" bufi += "int " + fabric_mod_name + "_is_state_remove(struct se_cmd *);\n" ret = p.write(buf) if ret: tcm_mod_err("Unable to write f: " + f) p.close() ret = pi.write(bufi) if ret: tcm_mod_err("Unable to write fi: " + fi) pi.close() return def tcm_mod_build_kbuild(fabric_mod_dir_var, fabric_mod_name): buf = "" f = fabric_mod_dir_var + "/Makefile" print "Writing file: " + f p = open(f, 'w') if not p: tcm_mod_err("Unable to open file: " + f) buf += fabric_mod_name + "-objs := " + fabric_mod_name + "_fabric.o \\\n" buf += " " + fabric_mod_name + "_configfs.o\n" buf += "obj-$(CONFIG_" + fabric_mod_name.upper() + ") += " + fabric_mod_name + ".o\n" ret = p.write(buf) if ret: tcm_mod_err("Unable to write f: " + f) p.close() return def tcm_mod_build_kconfig(fabric_mod_dir_var, fabric_mod_name): buf = "" f = fabric_mod_dir_var + "/Kconfig" print "Writing file: " + f p = open(f, 'w') if not p: tcm_mod_err("Unable to open file: " + f) buf = "config " + fabric_mod_name.upper() + "\n" buf += " tristate \"" + fabric_mod_name.upper() + " fabric module\"\n" buf += " depends on TARGET_CORE && CONFIGFS_FS\n" buf += " default n\n" buf += " ---help---\n" buf += " Say Y here to enable the " + fabric_mod_name.upper() + " fabric module\n" ret = p.write(buf) if ret: tcm_mod_err("Unable to write f: " + f) p.close() return def tcm_mod_add_kbuild(tcm_dir, fabric_mod_name): buf = "obj-$(CONFIG_" + fabric_mod_name.upper() + ") += " + fabric_mod_name.lower() + "/\n" kbuild = tcm_dir + "/drivers/target/Makefile" f = open(kbuild, 'a') f.write(buf) f.close() return def tcm_mod_add_kconfig(tcm_dir, fabric_mod_name): buf = "source \"drivers/target/" + fabric_mod_name.lower() + "/Kconfig\"\n" kconfig = tcm_dir + "/drivers/target/Kconfig" f = open(kconfig, 'a') f.write(buf) f.close() return def main(modname, proto_ident): # proto_ident = "FC" # proto_ident = "SAS" # proto_ident = "iSCSI" tcm_dir = os.getcwd(); tcm_dir += "/../../" print "tcm_dir: " + tcm_dir fabric_mod_name = modname fabric_mod_dir = tcm_dir + "drivers/target/" + fabric_mod_name print "Set fabric_mod_name: " + fabric_mod_name print "Set fabric_mod_dir: " + fabric_mod_dir print "Using proto_ident: " + proto_ident if proto_ident != "FC" and proto_ident != "SAS" and proto_ident != "iSCSI": print "Unsupported proto_ident: " + proto_ident sys.exit(1) ret = tcm_mod_create_module_subdir(fabric_mod_dir) if ret: print "tcm_mod_create_module_subdir() failed because module already exists!" sys.exit(1) tcm_mod_build_base_includes(proto_ident, fabric_mod_dir, fabric_mod_name) tcm_mod_scan_fabric_ops(tcm_dir) tcm_mod_dump_fabric_ops(proto_ident, fabric_mod_dir, fabric_mod_name) tcm_mod_build_configfs(proto_ident, fabric_mod_dir, fabric_mod_name) tcm_mod_build_kbuild(fabric_mod_dir, fabric_mod_name) tcm_mod_build_kconfig(fabric_mod_dir, fabric_mod_name) input = raw_input("Would you like to add " + fabric_mod_name + "to drivers/target/Makefile..? [yes,no]: ") if input == "yes" or input == "y": tcm_mod_add_kbuild(tcm_dir, fabric_mod_name) input = raw_input("Would you like to add " + fabric_mod_name + "to drivers/target/Kconfig..? [yes,no]: ") if input == "yes" or input == "y": tcm_mod_add_kconfig(tcm_dir, fabric_mod_name) return parser = optparse.OptionParser() parser.add_option('-m', '--modulename', help='Module name', dest='modname', action='store', nargs=1, type='string') parser.add_option('-p', '--protoident', help='Protocol Ident', dest='protoident', action='store', nargs=1, type='string') (opts, args) = parser.parse_args() mandatories = ['modname', 'protoident'] for m in mandatories: if not opts.__dict__[m]: print "mandatory option is missing\n" parser.print_help() exit(-1) if __name__ == "__main__": main(str(opts.modname), opts.protoident)
gpl-2.0
ZuluPro/moto
tests/test_swf/responses/test_activity_tasks.py
7
8550
from boto.swf.exceptions import SWFResponseError from freezegun import freeze_time from moto import mock_swf_deprecated from moto.swf import swf_backend from ..utils import setup_workflow, SCHEDULE_ACTIVITY_TASK_DECISION # PollForActivityTask endpoint @mock_swf_deprecated def test_poll_for_activity_task_when_one(): conn = setup_workflow() decision_token = conn.poll_for_decision_task( "test-domain", "queue")["taskToken"] conn.respond_decision_task_completed(decision_token, decisions=[ SCHEDULE_ACTIVITY_TASK_DECISION ]) resp = conn.poll_for_activity_task( "test-domain", "activity-task-list", identity="surprise") resp["activityId"].should.equal("my-activity-001") resp["taskToken"].should_not.be.none resp = conn.get_workflow_execution_history( "test-domain", conn.run_id, "uid-abcd1234") resp["events"][-1]["eventType"].should.equal("ActivityTaskStarted") resp["events"][-1]["activityTaskStartedEventAttributes"].should.equal( {"identity": "surprise", "scheduledEventId": 5} ) @mock_swf_deprecated def test_poll_for_activity_task_when_none(): conn = setup_workflow() resp = conn.poll_for_activity_task("test-domain", "activity-task-list") resp.should.equal({"startedEventId": 0}) @mock_swf_deprecated def test_poll_for_activity_task_on_non_existent_queue(): conn = setup_workflow() resp = conn.poll_for_activity_task("test-domain", "non-existent-queue") resp.should.equal({"startedEventId": 0}) # CountPendingActivityTasks endpoint @mock_swf_deprecated def test_count_pending_activity_tasks(): conn = setup_workflow() decision_token = conn.poll_for_decision_task( "test-domain", "queue")["taskToken"] conn.respond_decision_task_completed(decision_token, decisions=[ SCHEDULE_ACTIVITY_TASK_DECISION ]) resp = conn.count_pending_activity_tasks( "test-domain", "activity-task-list") resp.should.equal({"count": 1, "truncated": False}) @mock_swf_deprecated def test_count_pending_decision_tasks_on_non_existent_task_list(): conn = setup_workflow() resp = conn.count_pending_activity_tasks("test-domain", "non-existent") resp.should.equal({"count": 0, "truncated": False}) # RespondActivityTaskCompleted endpoint @mock_swf_deprecated def test_respond_activity_task_completed(): conn = setup_workflow() decision_token = conn.poll_for_decision_task( "test-domain", "queue")["taskToken"] conn.respond_decision_task_completed(decision_token, decisions=[ SCHEDULE_ACTIVITY_TASK_DECISION ]) activity_token = conn.poll_for_activity_task( "test-domain", "activity-task-list")["taskToken"] resp = conn.respond_activity_task_completed( activity_token, result="result of the task") resp.should.be.none resp = conn.get_workflow_execution_history( "test-domain", conn.run_id, "uid-abcd1234") resp["events"][-2]["eventType"].should.equal("ActivityTaskCompleted") resp["events"][-2]["activityTaskCompletedEventAttributes"].should.equal( {"result": "result of the task", "scheduledEventId": 5, "startedEventId": 6} ) @mock_swf_deprecated def test_respond_activity_task_completed_on_closed_workflow_execution(): conn = setup_workflow() decision_token = conn.poll_for_decision_task( "test-domain", "queue")["taskToken"] conn.respond_decision_task_completed(decision_token, decisions=[ SCHEDULE_ACTIVITY_TASK_DECISION ]) activity_token = conn.poll_for_activity_task( "test-domain", "activity-task-list")["taskToken"] # bad: we're closing workflow execution manually, but endpoints are not # coded for now.. wfe = swf_backend.domains[0].workflow_executions[-1] wfe.execution_status = "CLOSED" # /bad conn.respond_activity_task_completed.when.called_with( activity_token ).should.throw(SWFResponseError, "WorkflowExecution=") @mock_swf_deprecated def test_respond_activity_task_completed_with_task_already_completed(): conn = setup_workflow() decision_token = conn.poll_for_decision_task( "test-domain", "queue")["taskToken"] conn.respond_decision_task_completed(decision_token, decisions=[ SCHEDULE_ACTIVITY_TASK_DECISION ]) activity_token = conn.poll_for_activity_task( "test-domain", "activity-task-list")["taskToken"] conn.respond_activity_task_completed(activity_token) conn.respond_activity_task_completed.when.called_with( activity_token ).should.throw(SWFResponseError, "Unknown activity, scheduledEventId = 5") # RespondActivityTaskFailed endpoint @mock_swf_deprecated def test_respond_activity_task_failed(): conn = setup_workflow() decision_token = conn.poll_for_decision_task( "test-domain", "queue")["taskToken"] conn.respond_decision_task_completed(decision_token, decisions=[ SCHEDULE_ACTIVITY_TASK_DECISION ]) activity_token = conn.poll_for_activity_task( "test-domain", "activity-task-list")["taskToken"] resp = conn.respond_activity_task_failed(activity_token, reason="short reason", details="long details") resp.should.be.none resp = conn.get_workflow_execution_history( "test-domain", conn.run_id, "uid-abcd1234") resp["events"][-2]["eventType"].should.equal("ActivityTaskFailed") resp["events"][-2]["activityTaskFailedEventAttributes"].should.equal( {"reason": "short reason", "details": "long details", "scheduledEventId": 5, "startedEventId": 6} ) @mock_swf_deprecated def test_respond_activity_task_completed_with_wrong_token(): # NB: we just test ONE failure case for RespondActivityTaskFailed # because the safeguards are shared with RespondActivityTaskCompleted, so # no need to retest everything end-to-end. conn = setup_workflow() decision_token = conn.poll_for_decision_task( "test-domain", "queue")["taskToken"] conn.respond_decision_task_completed(decision_token, decisions=[ SCHEDULE_ACTIVITY_TASK_DECISION ]) conn.poll_for_activity_task("test-domain", "activity-task-list") conn.respond_activity_task_failed.when.called_with( "not-a-correct-token" ).should.throw(SWFResponseError, "Invalid token") # RecordActivityTaskHeartbeat endpoint @mock_swf_deprecated def test_record_activity_task_heartbeat(): conn = setup_workflow() decision_token = conn.poll_for_decision_task( "test-domain", "queue")["taskToken"] conn.respond_decision_task_completed(decision_token, decisions=[ SCHEDULE_ACTIVITY_TASK_DECISION ]) activity_token = conn.poll_for_activity_task( "test-domain", "activity-task-list")["taskToken"] resp = conn.record_activity_task_heartbeat(activity_token) resp.should.equal({"cancelRequested": False}) @mock_swf_deprecated def test_record_activity_task_heartbeat_with_wrong_token(): conn = setup_workflow() decision_token = conn.poll_for_decision_task( "test-domain", "queue")["taskToken"] conn.respond_decision_task_completed(decision_token, decisions=[ SCHEDULE_ACTIVITY_TASK_DECISION ]) conn.poll_for_activity_task( "test-domain", "activity-task-list")["taskToken"] conn.record_activity_task_heartbeat.when.called_with( "bad-token", details="some progress details" ).should.throw(SWFResponseError) @mock_swf_deprecated def test_record_activity_task_heartbeat_sets_details_in_case_of_timeout(): conn = setup_workflow() decision_token = conn.poll_for_decision_task( "test-domain", "queue")["taskToken"] conn.respond_decision_task_completed(decision_token, decisions=[ SCHEDULE_ACTIVITY_TASK_DECISION ]) with freeze_time("2015-01-01 12:00:00"): activity_token = conn.poll_for_activity_task( "test-domain", "activity-task-list")["taskToken"] conn.record_activity_task_heartbeat( activity_token, details="some progress details") with freeze_time("2015-01-01 12:05:30"): # => Activity Task Heartbeat timeout reached!! resp = conn.get_workflow_execution_history( "test-domain", conn.run_id, "uid-abcd1234") resp["events"][-2]["eventType"].should.equal("ActivityTaskTimedOut") attrs = resp["events"][-2]["activityTaskTimedOutEventAttributes"] attrs["details"].should.equal("some progress details")
apache-2.0
lepistone/server-tools
fetchmail_attach_from_folder/match_algorithm/openerp_standard.py
51
2133
# -*- encoding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # This module copyright (C) 2013 Therp BV (<http://therp.nl>) # All Rights Reserved # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## from .base import base class openerp_standard(base): '''No search at all. Use OpenERP's standard mechanism to attach mails to mail.thread objects. Note that this algorithm always matches.''' name = 'Odoo standard' readonly_fields = [ 'model_field', 'mail_field', 'match_first', 'domain', 'model_order', 'flag_nonmatching', ] def search_matches(self, cr, uid, conf, mail_message, mail_message_org): '''Always match. Duplicates will be fished out by message_id''' return [True] def handle_match( self, cr, uid, connection, object_id, folder, mail_message, mail_message_org, msgid, context): result = folder.pool.get('mail.thread').message_process( cr, uid, folder.model_id.model, mail_message_org, save_original=folder.server_id.original, strip_attachments=(not folder.server_id.attach), context=context ) if folder.delete_matching: connection.store(msgid, '+FLAGS', '\\DELETED') return [result]
agpl-3.0
TRox1972/youtube-dl
youtube_dl/extractor/azubu.py
4
5200
from __future__ import unicode_literals import json from .common import InfoExtractor from ..utils import ( ExtractorError, float_or_none, sanitized_Request, ) class AzubuIE(InfoExtractor): _VALID_URL = r'https?://(?:www\.)?azubu\.(?:tv|uol.com.br)/[^/]+#!/play/(?P<id>\d+)' _TESTS = [ { 'url': 'http://www.azubu.tv/GSL#!/play/15575/2014-hot6-cup-last-big-match-ro8-day-1', 'md5': 'a88b42fcf844f29ad6035054bd9ecaf4', 'info_dict': { 'id': '15575', 'ext': 'mp4', 'title': '2014 HOT6 CUP LAST BIG MATCH Ro8 Day 1', 'description': 'md5:d06bdea27b8cc4388a90ad35b5c66c01', 'thumbnail': 're:^https?://.*\.jpe?g', 'timestamp': 1417523507.334, 'upload_date': '20141202', 'duration': 9988.7, 'uploader': 'GSL', 'uploader_id': 414310, 'view_count': int, }, }, { 'url': 'http://www.azubu.tv/FnaticTV#!/play/9344/-fnatic-at-worlds-2014:-toyz---%22i-love-rekkles,-he-has-amazing-mechanics%22-', 'md5': 'b72a871fe1d9f70bd7673769cdb3b925', 'info_dict': { 'id': '9344', 'ext': 'mp4', 'title': 'Fnatic at Worlds 2014: Toyz - "I love Rekkles, he has amazing mechanics"', 'description': 'md5:4a649737b5f6c8b5c5be543e88dc62af', 'thumbnail': 're:^https?://.*\.jpe?g', 'timestamp': 1410530893.320, 'upload_date': '20140912', 'duration': 172.385, 'uploader': 'FnaticTV', 'uploader_id': 272749, 'view_count': int, }, 'skip': 'Channel offline', }, ] def _real_extract(self, url): video_id = self._match_id(url) data = self._download_json( 'http://www.azubu.tv/api/video/%s' % video_id, video_id)['data'] title = data['title'].strip() description = data.get('description') thumbnail = data.get('thumbnail') view_count = data.get('view_count') user = data.get('user', {}) uploader = user.get('username') uploader_id = user.get('id') stream_params = json.loads(data['stream_params']) timestamp = float_or_none(stream_params.get('creationDate'), 1000) duration = float_or_none(stream_params.get('length'), 1000) renditions = stream_params.get('renditions') or [] video = stream_params.get('FLVFullLength') or stream_params.get('videoFullLength') if video: renditions.append(video) if not renditions and not user.get('channel', {}).get('is_live', True): raise ExtractorError('%s said: channel is offline.' % self.IE_NAME, expected=True) formats = [{ 'url': fmt['url'], 'width': fmt['frameWidth'], 'height': fmt['frameHeight'], 'vbr': float_or_none(fmt['encodingRate'], 1000), 'filesize': fmt['size'], 'vcodec': fmt['videoCodec'], 'container': fmt['videoContainer'], } for fmt in renditions if fmt['url']] self._sort_formats(formats) return { 'id': video_id, 'title': title, 'description': description, 'thumbnail': thumbnail, 'timestamp': timestamp, 'duration': duration, 'uploader': uploader, 'uploader_id': uploader_id, 'view_count': view_count, 'formats': formats, } class AzubuLiveIE(InfoExtractor): _VALID_URL = r'https?://(?:www\.)?azubu\.(?:tv|uol.com.br)/(?P<id>[^/]+)$' _TESTS = [{ 'url': 'http://www.azubu.tv/MarsTVMDLen', 'only_matching': True, }, { 'url': 'http://azubu.uol.com.br/adolfz', 'only_matching': True, }] def _real_extract(self, url): user = self._match_id(url) info = self._download_json( 'http://api.azubu.tv/public/modules/last-video/{0}/info'.format(user), user)['data'] if info['type'] != 'STREAM': raise ExtractorError('{0} is not streaming live'.format(user), expected=True) req = sanitized_Request( 'https://edge-elb.api.brightcove.com/playback/v1/accounts/3361910549001/videos/ref:' + info['reference_id']) req.add_header('Accept', 'application/json;pk=BCpkADawqM1gvI0oGWg8dxQHlgT8HkdE2LnAlWAZkOlznO39bSZX726u4JqnDsK3MDXcO01JxXK2tZtJbgQChxgaFzEVdHRjaDoxaOu8hHOO8NYhwdxw9BzvgkvLUlpbDNUuDoc4E4wxDToV') bc_info = self._download_json(req, user) m3u8_url = next(source['src'] for source in bc_info['sources'] if source['container'] == 'M2TS') formats = self._extract_m3u8_formats(m3u8_url, user, ext='mp4') self._sort_formats(formats) return { 'id': info['id'], 'title': self._live_title(info['title']), 'uploader_id': user, 'formats': formats, 'is_live': True, 'thumbnail': bc_info['poster'], }
unlicense
andela-cmutembei/tubuy
api/serializers.py
1
2298
from api.models.user import User from api.models.commodity import Commodity from api.models.contribution import Contribution from rest_framework import serializers class UserSerializer(serializers.ModelSerializer): """Serializer for user model """ uuid = serializers.UUIDField(read_only=True, format='hex') password = serializers.CharField( style={'input_type': 'password'}, write_only=True, required=True ) class Meta: model = User fields = ( 'url', 'uuid', 'username', 'password', 'phone_number', 'email', ) extra_kwargs = { 'url': {'lookup_field': 'uuid'} } def create(self, validated_data): """creates a user """ user = User(**validated_data) user.set_password(validated_data['password']) user.save() return user class CommoditySerializer(serializers.ModelSerializer): """Serializer for commodity model """ uuid = serializers.UUIDField(read_only=True, format='hex') requestor = serializers.ReadOnlyField(source='requestor.username') price = serializers.DecimalField(max_digits=8, decimal_places=2) commodity_qr = serializers.ImageField(use_url=True, read_only=True) funded = serializers.BooleanField(read_only=True) remaining_amount = serializers.DecimalField( max_digits=8, decimal_places=2, read_only=True ) class Meta: model = Commodity fields = ( 'url', 'commodity_qr', 'uuid', 'name', 'description', 'requestor', 'funded', 'price', 'remaining_amount' ) extra_kwargs = { 'url': {'lookup_field': 'uuid'} } class ContributionSerializer(serializers.ModelSerializer): """Serializer for contribution model """ contributer = serializers.ReadOnlyField(source='contributer.username') contributing_to = serializers.SlugRelatedField( queryset=Commodity.objects.all(), slug_field='name' ) class Meta: model = Contribution fields = ('amount', 'contributer', 'contributing_to')
mit
westerncapelabs/promopuffin-core
web/test_promopuffin-core.py
1
16697
import unittest from promopuffincore import main, accounts, campaigns, codes import test_data import json class PromoPuffinCoreTestCase(unittest.TestCase): def setUp(self): # db_conf = { # 'name': '', # 'engine': 'SqliteDatabase', # 'check_same_thread': False, # } # self.db_fd, db_conf["name"] = tempfile.mkstemp() # main.app.config['DATABASE'] = db_conf main.app.config['TESTING'] = True accounts.accounts_data = dict(test_data.data_accounts_data) campaigns.campaigns_data = dict(test_data.data_campaigns_data) codes.codes_data = dict(test_data.data_campaigns_codes_data) self.app = main.app.test_client() def tearDown(self): pass # os.close(self.db_fd) # os.unlink(main.app.config['DATABASE']['name']) """ general tests """ def test_404_render(self): rv = self.app.get('/kldjfljsdlkfjsdlkjfdslkj') # Should never validate! assert '404' in rv.data # Should be the <title> of the page def test_hello_world(self): rv = self.app.get('/heartbeat') assert 'Hello World!' in rv.data # Should be the <title> of the page """ Accounts Tests """ def test_accounts_account_login_success(self): rv = self.app.post("/accounts?auth=somekey", data=test_data.data_accounts_login_good) account_data = json.loads(rv.data) data = test_data.data_accounts_login_good data['account_id'] = account_data['account_id'] rv = self.app.post('/accounts/login', data=data) assert rv.status_code == 201 def test_accounts_account_login_fail(self): rv = self.app.post("/accounts?auth=somekey", data=test_data.data_accounts_login_good) account_data = json.loads(rv.data) data = test_data.data_accounts_login_bad data['account_id'] = account_data['account_id'] rv = self.app.post('/accounts/login', data=data) assert rv.status_code == 401 assert "Unauthorized: Incorrect username and password match" in rv.data def test_accounts_account_login_no_data(self): rv = self.app.post("/accounts?auth=somekey", data=test_data.data_accounts_login_good) account_data = json.loads(rv.data) data = { 'account_id': account_data['account_id'], } rv = self.app.post('/accounts/login', data=data) assert rv.status_code == 400 def test_accounts_list(self): rv = self.app.get('/accounts?auth=somekey') assert "user1@example.com" in rv.data def test_accounts_add_new(self): rv = self.app.post("/accounts?auth=somekey", data=test_data.data_accounts_post_good) assert "mike+testpromopuffin@westerncapelabs.com" in rv.data def test_accounts_account_found(self): rv = self.app.get('/accounts/uuid_1?auth=somekey') assert rv.status_code == 200 assert "user1@example.com" in rv.data def test_accounts_account_not_found(self): rv = self.app.get('/accounts/uuid_90j0j0j?auth=somekey') assert rv.status_code == 404 def test_accounts_account_delete_found(self): rv = self.app.delete('/accounts/uuid_1?auth=somekey') assert rv.status_code == 204 rv = self.app.get('/accounts/uuid_1?auth=somekey') assert rv.status_code == 404 def test_accounts_account_delete_not_found(self): rv = self.app.delete('/accounts/uuid_342fhdjs41?auth=somekey') assert rv.status_code == 404 def test_accounts_account_put_found(self): rv = self.app.put('/accounts/uuid_1?auth=somekey', data=test_data.data_accounts_put_good) assert rv.status_code == 201 rv = self.app.get('/accounts/uuid_1?auth=somekey') assert rv.status_code == 200 assert "user1@example.com" in rv.data def test_accounts_account_put_not_found(self): rv = self.app.put('/accounts/uuid_4234jhkjhk4?auth=somekey', data=test_data.data_accounts_put_good) assert rv.status_code == 404 def test_accounts_list_not_authenticated(self): rv = self.app.get('/accounts?auth=some3424gegkey') assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_accounts_account_post_not_authenticated(self): rv = self.app.post('/accounts?auth=somedskfjslf', data=test_data.data_accounts_post_good) assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_accounts_account_post_no_data(self): rv = self.app.post('/accounts?auth=somekey', data="") assert rv.status_code == 400 def test_accounts_account_get_not_authenticated(self): rv = self.app.get('/accounts/uuid_1?auth=somedskfjslf') assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_accounts_account_put_not_authenticated(self): rv = self.app.put('/accounts/uuid_1?auth=somedskfjslf', data=test_data.data_accounts_put_good) assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_accounts_account_delete_not_authenticated(self): rv = self.app.delete('/accounts/uuid_1?auth=somedskfjslf') assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_accounts_account_put_no_data(self): rv = self.app.put('/accounts/uuid_1?auth=thisandthat', data="") assert rv.status_code == 400 """ Campaigns Tests """ def test_campaigns_list(self): rv = self.app.get('/campaigns?auth=somekey') assert "Campaign3" in rv.data def test_campaigns_add_new(self): rv = self.app.post("/campaigns?auth=somekey", data=test_data.data_campaigns_post_good) assert "OneTheWayCampaign" in rv.data def test_campaigns_campaign_not_found(self): rv = self.app.get('/campaigns/uuid_66hj768?auth=somekey') assert rv.status_code == 404 def test_campaigns_campaign_found(self): rv = self.app.get('/campaigns/uuid_1?auth=somekey') assert rv.status_code == 200 assert "Campaign1" in rv.data def test_campaigns_campaign_delete_found(self): rv = self.app.delete('/campaigns/uuid_1?auth=somekey') assert rv.status_code == 204 rv = self.app.get('/campaigns/uuid_1?auth=somekey') assert rv.status_code == 404 def test_campaigns_campaign_delete_not_found(self): rv = self.app.delete('/campaigns/uuid_342jh4khk231?auth=somekey') assert rv.status_code == 404 def test_campaigns_campaign_put_found(self): rv = self.app.put('/campaigns/uuid_1?auth=somekey', data=test_data.data_campaigns_put_good) assert rv.status_code == 201 assert "2013-06-21T19:12:04.781462" in rv.data rv = self.app.get('/campaigns/uuid_1?auth=somekey') assert rv.status_code == 200 assert "OneTheWayCampaign" in rv.data def test_campaigns_campaign_put_not_found(self): rv = self.app.put('/campaigns/uuid_43420jkds21?auth=somekey', data=test_data.data_campaigns_put_good) assert rv.status_code == 404 def test_campaigns_campaign_status_list_found(self): rv = self.app.get('/campaigns/uuid_2/status?auth=somekey') assert rv.status_code == 200 assert "running" in rv.data def test_campaigns_campaign_status_list_not_found(self): rv = self.app.get('/campaigns/uuid_3423jh2k1/status?auth=somekey') assert rv.status_code == 404 def test_campaigns_campaign_status_update_found(self): rv = self.app.post('/campaigns/uuid_1/status?auth=somekey', data=test_data.data_campaigns_status_post_good) assert rv.status_code == 201 assert "halted" in rv.data def test_campaigns_campaign_status_update_not_found(self): rv = self.app.post('/campaigns/uuid_3429kjkj31/status?auth=somekey', data=test_data.data_campaigns_status_post_good) assert rv.status_code == 404 def test_campaigns_list_not_authenticated(self): rv = self.app.get('/campaigns?auth=some3424gegkey') assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_post_not_authenticated(self): rv = self.app.post('/campaigns?auth=somedskfjslf', data=test_data.data_campaigns_post_good) assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_post_no_data(self): rv = self.app.post('/campaigns?auth=somekey', data="") assert rv.status_code == 400 def test_campaigns_campaign_get_not_authenticated(self): rv = self.app.get('/campaigns/uuid_1?auth=somedskfjslf') assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_put_not_authenticated(self): rv = self.app.put('/campaigns/uuid_1?auth=somedskfjslf', data=test_data.data_campaigns_put_good) assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_no_campaign_id(self): rv = self.app.put('/campaigns?auth=somekey', data=test_data.data_campaigns_put_good) assert rv.status_code == 405 def test_campaigns_campaign_put_no_data(self): rv = self.app.put('/campaigns/uuid_1?auth=somekey', data="") assert rv.status_code == 400 def test_campaigns_campaign_delete_not_authenticated(self): rv = self.app.delete('/campaigns/uuid_1?auth=somedskfjslf') assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_status_not_authenticated(self): rv = self.app.get('/campaigns/uuid_1/status?auth=some3432423f22key') assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_status_post_not_authenticated(self): rv = self.app.post('/campaigns/uuid_1/status?auth=some3432423f22key', data=test_data.data_campaigns_status_post_good) assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_status_no_data(self): rv = self.app.post('/campaigns/uuid_1/status?auth=somekey', data="") assert rv.status_code == 400 def test_campaigns_campaign_status_no_campaign_id(self): rv = self.app.post('/campaigns/status?auth=somekey', data=test_data.data_campaigns_status_post_good) assert rv.status_code == 405 # method not allowed def test_campaigns_campaign_put_bad(self): rv = self.app.put('/campaigns/uuid_1?auth=somekey', data=test_data.data_campaigns_put_bad) assert "Start datetime starts after end datetime" in rv.data """ Codes Tests """ def test_campaigns_campaign_codes_list(self): rv = self.app.get('/campaigns/uuid_3/codes?auth=thisandthat') assert "QWZ-EMD-ABCDEF" in rv.data def test_campaigns_campaign_codes_list_not_authenticated(self): rv = self.app.post('/campaigns/uuid_1/codes?auth=some3432423f22key') assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_codes_add_new(self): rv = self.app.post('/campaigns/uuid_1/codes?auth=somekey', data=test_data.data_campaigns_codes_post_good) assert rv.status_code == 201 assert "ABC-DEF-GIJKLM" in rv.data def test_campaigns_campaign_codes_code_post_no_data(self): rv = self.app.post('campaigns/uuid_1/codes?auth=somekey', data="") assert rv.status_code == 400 def test_campaigns_campaign_codes_post_not_authenticated(self): rv = self.app.post('/campaigns/uuid_1/codes?auth=some3432423f22key', data=test_data.data_campaigns_codes_post_good) assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_codes_code_found(self): rv = self.app.get('/campaigns/uuid_1/codes/uuid_1?auth=somekey') assert rv.status_code == 200 assert "ACT-EKL-ABCDEF" in rv.data def test_campaigns_campaign_codes_code_found_not_authenticated(self): rv = self.app.get('/campaigns/uuid_1/codes/uuid_1?auth=some3432423f22ke') assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_codes_code_not_found(self): rv = self.app.get('/campaigns/uuid_1/codes/uuid_34532errwr?auth=somekey') assert rv.status_code == 404 def test_campaigns_campaign_codes_code_delete_found(self): rv = self.app.delete('/campaigns/uuid_1/codes/uuid_1?auth=somekey') assert rv.status_code == 204 rv = self.app.get('/campaigns/uuid_1/codes/uuid_1?auth=somekey') assert rv.status_code == 404 def test_campaigns_campaign_codes_code_delete_not_authenticated(self): rv = self.app.delete('/campaigns/uuid_1/codes/uuid_1?auth=some3432423f22key') assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_codes_code_delete_not_found(self): rv = self.app.delete('/campaigns/uuid_1/codes/uuid_342dfs1?auth=somekey') assert rv.status_code == 404 def test_campaigns_campaign_codes_code_put_found(self): rv = self.app.put('/campaigns/uuid_1/codes/uuid_1?auth=somekey', data=test_data.data_campaigns_codes_put_good) assert rv.status_code == 201 rv = self.app.get('/campaigns/uuid_1/codes/uuid_1?auth=somekey') assert rv.status_code == 200 assert "redeemed" in rv.data def test_campaigns_campaign_codes_code_put_not_authenticated(self): rv = self.app.put('/campaigns/uuid_1/codes/uuid_1', data=test_data.data_campaigns_codes_put_good) assert "Unauthorized" in rv.data assert rv.status_code == 401 def test_campaigns_campaign_codes_code_put_not_found(self): rv = self.app.put('/campaigns/uuid_1/codes/uuid_432dfs341?auth=somekey', data=test_data.data_campaigns_codes_put_good) assert rv.status_code == 404 def test_campaigns_campaign_codes_put_no_data(self): rv = self.app.put('/campaigns/uuid_1/codes/uuid_1?auth=somekey', data="") assert rv.status_code == 400 def test_campaigns_campaign_codes_no_campaign_id(self): rv = self.app.put('/campaigns/codes/uuid_1?auth=thisandthat', data=test_data.data_campaigns_codes_put_good) assert rv.status_code == 404 """ Validation Tests """ def test_validate_success_percentage(self): rv = self.app.post('/validate', data=test_data.data_validation_post_percentage_good) assert rv.status_code == 201 assert "true" in rv.data def test_validate_success_fixed(self): rv = self.app.post('/validate', data=test_data.data_validation_post_fixed_good) assert rv.status_code == 201 assert "true" in rv.data def test_validate_fail(self): rv = self.app.post('/validate', data=test_data.data_validation_post_bad) assert rv.status_code == 400 assert "false" in rv.data def test_validate_no_data(self): rv = self.app.post('/validate', data="") assert "Code None doesn't exist" in rv.data assert rv.status_code == 404 """ Redeemed Tests """ def test_redeem_percentage_success(self): rv = self.app.post('/redeem/uuid_3?auth=thisandthat', data=test_data.data_redeem_percentage_good) assert rv.status_code == 201 assert "true" in rv.data def test_redeem_percentage_success_admin_auth(self): rv = self.app.post('/redeem/uuid_3?auth=somekey', data=test_data.data_redeem_percentage_good) assert rv.status_code == 201 assert "true" in rv.data def test_redeem_percentage_fail(self): rv = self.app.post('/redeem/uuid_2?auth=thisandthat', data=test_data.data_redeem_percentage_bad) assert rv.status_code == 400 assert "false" in rv.data def test_redeem_fixed_success(self): rv = self.app.post('/redeem/uuid_3?auth=thisandthat', data=test_data.data_redeem_fixed_good) assert rv.status_code == 201 assert "true" in rv.data def test_redeem_auth_fail(self): rv = self.app.post('/redeem/uuid_1?auth=dskfsld9', data=test_data.data_redeem_percentage_good) assert rv.status_code == 401 assert "Unauthorized" in rv.data def test_redeem_no_data(self): rv = self.app.post('/redeem/uuid_1?auth=somekey', data="") assert "Code None doesn't exist" in rv.data assert rv.status_code == 404 def test_redeem_no_campaign_id(self): rv = self.app.post('/redeem?auth=somekey', data=test_data.data_redeem_percentage_good) assert rv.status_code == 404 if __name__ == '__main__': unittest.main()
bsd-3-clause