repo_name
stringlengths
5
100
path
stringlengths
4
294
copies
stringclasses
990 values
size
stringlengths
4
7
content
stringlengths
666
1M
license
stringclasses
15 values
VirtueSecurity/aws-extender
BappModules/boto/awslambda/__init__.py
22
1753
# Copyright (c) 2015 Amazon.com, Inc. or its affiliates. All Rights Reserved # # Permission is hereby granted, free of charge, to any person obtaining a # copy of this software and associated documentation files (the # "Software"), to deal in the Software without restriction, including # without limitation the rights to use, copy, modify, merge, publish, dis- # tribute, sublicense, and/or sell copies of the Software, and to permit # persons to whom the Software is furnished to do so, subject to the fol- # lowing conditions: # # The above copyright notice and this permission notice shall be included # in all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS # OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABIL- # ITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT # SHALL THE AUTHOR BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, # WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS # IN THE SOFTWARE. # from boto.regioninfo import RegionInfo, get_regions from boto.regioninfo import connect def regions(): """ Get all available regions for the AWS Lambda service. :rtype: list :return: A list of :class:`boto.regioninfo.RegionInfo` """ from boto.awslambda.layer1 import AWSLambdaConnection return get_regions('awslambda', connection_cls=AWSLambdaConnection) def connect_to_region(region_name, **kw_params): from boto.awslambda.layer1 import AWSLambdaConnection return connect('awslambda', region_name, connection_cls=AWSLambdaConnection, **kw_params)
mit
hasadna/django
django/core/context_processors.py
232
2269
""" A set of request processors that return dictionaries to be merged into a template context. Each function takes the request object as its only parameter and returns a dictionary to add to the context. These are referenced from the setting TEMPLATE_CONTEXT_PROCESSORS and used by RequestContext. """ from __future__ import unicode_literals from django.conf import settings from django.middleware.csrf import get_token from django.utils import six from django.utils.encoding import smart_text from django.utils.functional import lazy def csrf(request): """ Context processor that provides a CSRF token, or the string 'NOTPROVIDED' if it has not been provided by either a view decorator or the middleware """ def _get_val(): token = get_token(request) if token is None: # In order to be able to provide debugging info in the # case of misconfiguration, we use a sentinel value # instead of returning an empty dict. return 'NOTPROVIDED' else: return smart_text(token) _get_val = lazy(_get_val, six.text_type) return {'csrf_token': _get_val() } def debug(request): "Returns context variables helpful for debugging." context_extras = {} if settings.DEBUG and request.META.get('REMOTE_ADDR') in settings.INTERNAL_IPS: context_extras['debug'] = True from django.db import connection context_extras['sql_queries'] = connection.queries return context_extras def i18n(request): from django.utils import translation context_extras = {} context_extras['LANGUAGES'] = settings.LANGUAGES context_extras['LANGUAGE_CODE'] = translation.get_language() context_extras['LANGUAGE_BIDI'] = translation.get_language_bidi() return context_extras def tz(request): from django.utils import timezone return {'TIME_ZONE': timezone.get_current_timezone_name()} def static(request): """ Adds static-related context variables to the context. """ return {'STATIC_URL': settings.STATIC_URL} def media(request): """ Adds media-related context variables to the context. """ return {'MEDIA_URL': settings.MEDIA_URL} def request(request): return {'request': request}
bsd-3-clause
mtconley/turntable
test/lib/python2.7/site-packages/scipy/sparse/linalg/isolve/utils.py
21
3830
from __future__ import division, print_function, absolute_import __docformat__ = "restructuredtext en" __all__ = [] from warnings import warn from numpy import asanyarray, asarray, asmatrix, array, matrix, zeros from scipy.sparse.linalg.interface import aslinearoperator, LinearOperator, \ IdentityOperator _coerce_rules = {('f','f'):'f', ('f','d'):'d', ('f','F'):'F', ('f','D'):'D', ('d','f'):'d', ('d','d'):'d', ('d','F'):'D', ('d','D'):'D', ('F','f'):'F', ('F','d'):'D', ('F','F'):'F', ('F','D'):'D', ('D','f'):'D', ('D','d'):'D', ('D','F'):'D', ('D','D'):'D'} def coerce(x,y): if x not in 'fdFD': x = 'd' if y not in 'fdFD': y = 'd' return _coerce_rules[x,y] def id(x): return x def make_system(A, M, x0, b, xtype=None): """Make a linear system Ax=b Parameters ---------- A : LinearOperator sparse or dense matrix (or any valid input to aslinearoperator) M : {LinearOperator, Nones} preconditioner sparse or dense matrix (or any valid input to aslinearoperator) x0 : {array_like, None} initial guess to iterative method b : array_like right hand side xtype : {'f', 'd', 'F', 'D', None} dtype of the x vector Returns ------- (A, M, x, b, postprocess) A : LinearOperator matrix of the linear system M : LinearOperator preconditioner x : rank 1 ndarray initial guess b : rank 1 ndarray right hand side postprocess : function converts the solution vector to the appropriate type and dimensions (e.g. (N,1) matrix) """ A_ = A A = aslinearoperator(A) if A.shape[0] != A.shape[1]: raise ValueError('expected square matrix, but got shape=%s' % (A.shape,)) N = A.shape[0] b = asanyarray(b) if not (b.shape == (N,1) or b.shape == (N,)): raise ValueError('A and b have incompatible dimensions') if b.dtype.char not in 'fdFD': b = b.astype('d') # upcast non-FP types to double def postprocess(x): if isinstance(b,matrix): x = asmatrix(x) return x.reshape(b.shape) if xtype is None: if hasattr(A,'dtype'): xtype = A.dtype.char else: xtype = A.matvec(b).dtype.char xtype = coerce(xtype, b.dtype.char) else: warn('Use of xtype argument is deprecated. ' 'Use LinearOperator( ... , dtype=xtype) instead.', DeprecationWarning) if xtype == 0: xtype = b.dtype.char else: if xtype not in 'fdFD': raise ValueError("xtype must be 'f', 'd', 'F', or 'D'") b = asarray(b,dtype=xtype) # make b the same type as x b = b.ravel() if x0 is None: x = zeros(N, dtype=xtype) else: x = array(x0, dtype=xtype) if not (x.shape == (N,1) or x.shape == (N,)): raise ValueError('A and x have incompatible dimensions') x = x.ravel() # process preconditioner if M is None: if hasattr(A_,'psolve'): psolve = A_.psolve else: psolve = id if hasattr(A_,'rpsolve'): rpsolve = A_.rpsolve else: rpsolve = id if psolve is id and rpsolve is id: M = IdentityOperator(shape=A.shape, dtype=A.dtype) else: M = LinearOperator(A.shape, matvec=psolve, rmatvec=rpsolve, dtype=A.dtype) else: M = aslinearoperator(M) if A.shape != M.shape: raise ValueError('matrix and preconditioner have different shapes') return A, M, x, b, postprocess
mit
indictranstech/trufil-erpnext
erpnext/hooks.py
1
5037
from __future__ import unicode_literals from frappe import _ app_name = "erpnext" app_title = "ERPNext" app_publisher = "Frappe Technologies Pvt. Ltd." app_description = """ERP made simple""" app_icon = "icon-th" app_color = "#e74c3c" app_version = "6.10.2" app_email = "info@erpnext.com" app_license = "GNU General Public License (v3)" source_link = "https://github.com/frappe/erpnext" error_report_email = "support@erpnext.com" app_include_js = "assets/js/erpnext.min.js" app_include_css = "assets/css/erpnext.css" web_include_js = "assets/js/erpnext-web.min.js" web_include_css = "assets/erpnext/css/website.css" # setup wizard setup_wizard_requires = "assets/erpnext/js/setup_wizard.js" setup_wizard_complete = "erpnext.setup.setup_wizard.setup_wizard.setup_complete" after_install = "erpnext.setup.install.after_install" boot_session = "erpnext.startup.boot.boot_session" notification_config = "erpnext.startup.notifications.get_notification_config" on_session_creation = "erpnext.shopping_cart.utils.set_cart_count" on_logout = "erpnext.shopping_cart.utils.clear_cart_count" # website update_website_context = "erpnext.shopping_cart.utils.update_website_context" my_account_context = "erpnext.shopping_cart.utils.update_my_account_context" email_append_to = ["Job Applicant", "Opportunity", "Issue"] calendars = ["Task", "Production Order", "Time Log", "Leave Application", "Sales Order", "Holiday List"] website_generators = ["Item Group", "Item", "Sales Partner"] website_context = { "favicon": "/assets/erpnext/images/favicon.png", "splash_image": "/assets/erpnext/images/splash.png" } website_route_rules = [ {"from_route": "/orders", "to_route": "Sales Order"}, {"from_route": "/orders/<path:name>", "to_route": "order", "defaults": { "doctype": "Sales Order", "parents": [{"title": _("Orders"), "name": "orders"}] } }, {"from_route": "/invoices", "to_route": "Sales Invoice"}, {"from_route": "/invoices/<path:name>", "to_route": "order", "defaults": { "doctype": "Sales Invoice", "parents": [{"title": _("Invoices"), "name": "invoices"}] } }, {"from_route": "/shipments", "to_route": "Delivery Note"}, {"from_route": "/shipments/<path:name>", "to_route": "order", "defaults": { "doctype": "Delivery Notes", "parents": [{"title": _("Shipments"), "name": "shipments"}] } } ] has_website_permission = { "Sales Order": "erpnext.controllers.website_list_for_contact.has_website_permission", "Sales Invoice": "erpnext.controllers.website_list_for_contact.has_website_permission", "Delivery Note": "erpnext.controllers.website_list_for_contact.has_website_permission", "Issue": "erpnext.support.doctype.issue.issue.has_website_permission", "Address": "erpnext.utilities.doctype.address.address.has_website_permission" } permission_query_conditions = { "Contact": "erpnext.utilities.address_and_contact.get_permission_query_conditions_for_contact", "Address": "erpnext.utilities.address_and_contact.get_permission_query_conditions_for_address" } has_permission = { "Contact": "erpnext.utilities.address_and_contact.has_permission", "Address": "erpnext.utilities.address_and_contact.has_permission" } dump_report_map = "erpnext.startup.report_data_map.data_map" before_tests = "erpnext.setup.utils.before_tests" standard_queries = { "Customer": "erpnext.selling.doctype.customer.customer.get_customer_list" } doc_events = { "Stock Entry": { "on_submit": "erpnext.stock.doctype.material_request.material_request.update_completed_and_requested_qty", "on_cancel": "erpnext.stock.doctype.material_request.material_request.update_completed_and_requested_qty" }, "User": { "validate": "erpnext.hr.doctype.employee.employee.validate_employee_role", "on_update": "erpnext.hr.doctype.employee.employee.update_user_permissions" }, "Sales Taxes and Charges Template": { "on_update": "erpnext.shopping_cart.doctype.shopping_cart_settings.shopping_cart_settings.validate_cart_settings" }, "Price List": { "on_update": "erpnext.shopping_cart.doctype.shopping_cart_settings.shopping_cart_settings.validate_cart_settings" }, "Contact": { "validate": "erpnext.crm.doctype.crm_module_customization.generate_contact_code" }, "Address": { "validate": "erpnext.crm.doctype.crm_module_customization.generate_address_code" } } scheduler_events = { "hourly": [ "erpnext.controllers.recurring_document.create_recurring_documents" ], "daily": [ "erpnext.stock.reorder_item.reorder_item", "erpnext.setup.doctype.email_digest.email_digest.send", "erpnext.support.doctype.issue.issue.auto_close_tickets", "erpnext.accounts.doctype.fiscal_year.fiscal_year.auto_create_fiscal_year", "erpnext.hr.doctype.employee.employee.send_birthday_reminders" ] } default_mail_footer = """<div style="text-align: center;"> <a href="https://erpnext.com?source=via_email_footer" target="_blank" style="color: #8d99a6;"> Sent via ERPNext </a> </div>""" get_translated_dict = { ("doctype", "Global Defaults"): "frappe.geo.country_info.get_translated_dict" }
agpl-3.0
cloew/KaoFlaskAuth
kao_flask_auth/kao_auth.py
1
1714
from .auth_route_decorator import AuthRouteDecorator from .Controllers import GetAuthJsonController, GetCurrentUserController, GetLoginController, GetRegisterController, GetUpdateUserController from kao_decorators import proxy_for, lazy_property @proxy_for('authRouteDecorator', ['requires_auth']) class KaoAuth: """ Helper class to use to generate the Auth funcitonality based on a provided User class """ def __init__(self, userCls, usernameField="username"): """ Initialize with the User Class to use """ self.userCls = userCls self.usernameField = usernameField self.authRouteDecorator = AuthRouteDecorator(self.userCls) @lazy_property def JSONController(self): """ Return the Auth JSON Controller class for the User model """ return GetAuthJsonController(self.requires_auth) @lazy_property def CurrentUserController(self): """ Return the Current User Controller class for the User model """ return GetCurrentUserController(self.JSONController) @lazy_property def LoginController(self): """ Return the Login Controller class for the User model """ return GetLoginController(self.userCls, self.usernameField) @lazy_property def RegisterController(self): """ Return the Register Controller class for the User model """ return GetRegisterController(self.userCls, self.LoginController) @lazy_property def UpdateUserController(self): """ Return the Update User Controller class for the User model """ return GetUpdateUserController(self.userCls, self.requires_auth)
mit
Suranjandas7/SketchPad
RedditComments/redditcomments.py
1
6472
import sqlite3 import praw from wordcloud import WordCloud import matplotlib.pyplot as plt import configparser class work(): def __init__(self, limitP, limitC, database_name, r_name, c_type): self.title = '' self.list_of_comments = [] self.limitP = limitP self.limitC = limitC self.post_id = '' self.tags = '' self.database_name = str(database_name) self.r_name = str(r_name) self.c_type = str(c_type) def data_count(self): def control(mode): def shortcut(data): container = [] for lines in data: container.append(lines) return len(container) conn = sqlite3.connect(self.database_name) c = conn.cursor() data = c.execute("SELECT DISTINCT * from {}".format(mode)) count = shortcut(data) c.close() conn.close() return count no_of_comments = control('Comments') no_of_posts = control('Posts') print 'No of Posts - {}\nNo of comments - {}'.format( no_of_posts, no_of_comments) def make_wordcloud(self, w, h): conn = sqlite3.connect(self.database_name) c = conn.cursor() lines = c.execute("SELECT DISTINCT * from Comments") all_text = [] s = '' for l in lines: all_text.append(l[0].encode('utf-8')) for at in all_text: s = s+at wordcloud = WordCloud( width=w, height=h, ).generate(s) c.close() conn.close() plt.imshow(wordcloud) plt.axis('off') plt.show() def read(self): f = open('output.txt', 'w') conn = sqlite3.connect(self.database_name) c = conn.cursor() post_dict = {} list_of_unique_posts = c.execute( "SELECT DISTINCT Title, PostID from Posts" ) for post in list_of_unique_posts: post_dict[post[1]] = post[0] for key in post_dict: current_parent_id = (key,) f.write('\n\n[Title : {}]\n\n'.format(post_dict[key].encode('utf-8'))) list_of_unique_comments = c.execute( "SELECT DISTINCT * from Comments WHERE ParentId=?", current_parent_id ) for comment in list_of_unique_comments: f.write('\n{}'.format(comment[0].encode('utf-8'))) f.write('\n---END COMMENT---\n') f.close() c.close() conn.close() def create_database(self): conn = sqlite3.connect(str(self.database_name)+'.db') c = conn.cursor() c.execute('''CREATE TABLE Posts (Title text, PostId text)''' ) c.execute('''CREATE TABLE Comments (Content text, ParentId text, CommentId text)''' ) conn.commit() c.close() conn.close() def process(self): def addtodb(post_title, post_id, list_of_comments): conn = sqlite3.connect(self.database_name) c = conn.cursor() post_insert = ( post_title, post_id, ) c.execute("INSERT INTO Posts VALUES (?,?)", post_insert) for comment in list_of_comments: comment_insert = ( comment[0], post_id, comment[1], ) c.execute("INSERT INTO comments VALUES (?,?,?)", comment_insert) conn.commit() c.close() conn.close() reddit = praw.Reddit('bot1') subreddit = reddit.subreddit(self.r_name) counter = 0 for s in subreddit.hot(limit=self.limitP): submission = s submission.comment_sort = self.c_type self.title = submission.title self.post_id = submission.id comments = s.comments i=0 for comment in comments: w_o_a = comment.body comment_id = comment.id if w_o_a == '[deleted]' or w_o_a == '[removed]': continue else: output = [w_o_a, comment_id] self.list_of_comments.append(output) i+=1 if i == self.limitC: break #display(self.title, self.list_of_comments, self.post_id) counter +=1 print '[Writing to database]\t {} out of {}'.format( str(counter), str(self.limitP)) addtodb(self.title, self.post_id, self.list_of_comments) self.title = '' self.list_of_comments = [] self.tags = '' def main(): reader = configparser.ConfigParser() reader.read('config.ini') flag = False while flag==False: choice = str(raw_input(''' 1 - Read 2 - Catch 3 - WordCloud 4 - DataCount 5 - Create Database 'Exit' - Exit Enter Your Choice : ''')) if choice == '1': name_of_db = str(raw_input('Enter name of db : ')) sd = work(0,0, name_of_db, 'NA', 'NA') sd.read() elif choice == '2': name_of_db = str(raw_input('Enter name of db : ')) subreddit_name = reader.get(name_of_db, 'subreddit') comment_type = reader.get(name_of_db, 'comments') sd = work(15,45, name_of_db, subreddit_name, comment_type) sd.process() elif choice == '3': name_of_db = str(raw_input('Enter name of db : ')) sd = work(0,0, name_of_db, 'NA', 'NA') sd.make_wordcloud(1920,1080) elif choice == '4': name_of_db = str(raw_input('Enter name of db : ')) sd = work(0,0, name_of_db, 'NA', 'NA') sd.data_count() elif choice == '5': name_of_db = str(raw_input('Enter name of database: ')) sd = work(0,0,name_of_db, 'NA', 'NA') sd.create_database() elif choice == 'Exit': flag = True else: print 'INVALID OPTIOEN' if __name__ == '__main__': main()
lgpl-3.0
lucafavatella/intellij-community
python/lib/Lib/telnetlib.py
80
21665
"""TELNET client class. Based on RFC 854: TELNET Protocol Specification, by J. Postel and J. Reynolds Example: >>> from telnetlib import Telnet >>> tn = Telnet('www.python.org', 79) # connect to finger port >>> tn.write('guido\r\n') >>> print tn.read_all() Login Name TTY Idle When Where guido Guido van Rossum pts/2 <Dec 2 11:10> snag.cnri.reston.. >>> Note that read_all() won't read until eof -- it just reads some data -- but it guarantees to read at least one byte unless EOF is hit. It is possible to pass a Telnet object to select.select() in order to wait until more data is available. Note that in this case, read_eager() may return '' even if there was data on the socket, because the protocol negotiation may have eaten the data. This is why EOFError is needed in some cases to distinguish between "no data" and "connection closed" (since the socket also appears ready for reading when it is closed). To do: - option negotiation - timeout should be intrinsic to the connection object instead of an option on one of the read calls only """ # Imported modules import sys import socket import os if os.name == 'java': from select import cpython_compatible_select as select else: from select import select del os __all__ = ["Telnet"] # Tunable parameters DEBUGLEVEL = 0 # Telnet protocol defaults TELNET_PORT = 23 # Telnet protocol characters (don't change) IAC = chr(255) # "Interpret As Command" DONT = chr(254) DO = chr(253) WONT = chr(252) WILL = chr(251) theNULL = chr(0) SE = chr(240) # Subnegotiation End NOP = chr(241) # No Operation DM = chr(242) # Data Mark BRK = chr(243) # Break IP = chr(244) # Interrupt process AO = chr(245) # Abort output AYT = chr(246) # Are You There EC = chr(247) # Erase Character EL = chr(248) # Erase Line GA = chr(249) # Go Ahead SB = chr(250) # Subnegotiation Begin # Telnet protocol options code (don't change) # These ones all come from arpa/telnet.h BINARY = chr(0) # 8-bit data path ECHO = chr(1) # echo RCP = chr(2) # prepare to reconnect SGA = chr(3) # suppress go ahead NAMS = chr(4) # approximate message size STATUS = chr(5) # give status TM = chr(6) # timing mark RCTE = chr(7) # remote controlled transmission and echo NAOL = chr(8) # negotiate about output line width NAOP = chr(9) # negotiate about output page size NAOCRD = chr(10) # negotiate about CR disposition NAOHTS = chr(11) # negotiate about horizontal tabstops NAOHTD = chr(12) # negotiate about horizontal tab disposition NAOFFD = chr(13) # negotiate about formfeed disposition NAOVTS = chr(14) # negotiate about vertical tab stops NAOVTD = chr(15) # negotiate about vertical tab disposition NAOLFD = chr(16) # negotiate about output LF disposition XASCII = chr(17) # extended ascii character set LOGOUT = chr(18) # force logout BM = chr(19) # byte macro DET = chr(20) # data entry terminal SUPDUP = chr(21) # supdup protocol SUPDUPOUTPUT = chr(22) # supdup output SNDLOC = chr(23) # send location TTYPE = chr(24) # terminal type EOR = chr(25) # end or record TUID = chr(26) # TACACS user identification OUTMRK = chr(27) # output marking TTYLOC = chr(28) # terminal location number VT3270REGIME = chr(29) # 3270 regime X3PAD = chr(30) # X.3 PAD NAWS = chr(31) # window size TSPEED = chr(32) # terminal speed LFLOW = chr(33) # remote flow control LINEMODE = chr(34) # Linemode option XDISPLOC = chr(35) # X Display Location OLD_ENVIRON = chr(36) # Old - Environment variables AUTHENTICATION = chr(37) # Authenticate ENCRYPT = chr(38) # Encryption option NEW_ENVIRON = chr(39) # New - Environment variables # the following ones come from # http://www.iana.org/assignments/telnet-options # Unfortunately, that document does not assign identifiers # to all of them, so we are making them up TN3270E = chr(40) # TN3270E XAUTH = chr(41) # XAUTH CHARSET = chr(42) # CHARSET RSP = chr(43) # Telnet Remote Serial Port COM_PORT_OPTION = chr(44) # Com Port Control Option SUPPRESS_LOCAL_ECHO = chr(45) # Telnet Suppress Local Echo TLS = chr(46) # Telnet Start TLS KERMIT = chr(47) # KERMIT SEND_URL = chr(48) # SEND-URL FORWARD_X = chr(49) # FORWARD_X PRAGMA_LOGON = chr(138) # TELOPT PRAGMA LOGON SSPI_LOGON = chr(139) # TELOPT SSPI LOGON PRAGMA_HEARTBEAT = chr(140) # TELOPT PRAGMA HEARTBEAT EXOPL = chr(255) # Extended-Options-List NOOPT = chr(0) class Telnet: """Telnet interface class. An instance of this class represents a connection to a telnet server. The instance is initially not connected; the open() method must be used to establish a connection. Alternatively, the host name and optional port number can be passed to the constructor, too. Don't try to reopen an already connected instance. This class has many read_*() methods. Note that some of them raise EOFError when the end of the connection is read, because they can return an empty string for other reasons. See the individual doc strings. read_until(expected, [timeout]) Read until the expected string has been seen, or a timeout is hit (default is no timeout); may block. read_all() Read all data until EOF; may block. read_some() Read at least one byte or EOF; may block. read_very_eager() Read all data available already queued or on the socket, without blocking. read_eager() Read either data already queued or some data available on the socket, without blocking. read_lazy() Read all data in the raw queue (processing it first), without doing any socket I/O. read_very_lazy() Reads all data in the cooked queue, without doing any socket I/O. read_sb_data() Reads available data between SB ... SE sequence. Don't block. set_option_negotiation_callback(callback) Each time a telnet option is read on the input flow, this callback (if set) is called with the following parameters : callback(telnet socket, command, option) option will be chr(0) when there is no option. No other action is done afterwards by telnetlib. """ def __init__(self, host=None, port=0): """Constructor. When called without arguments, create an unconnected instance. With a hostname argument, it connects the instance; a port number is optional. """ self.debuglevel = DEBUGLEVEL self.host = host self.port = port self.sock = None self.rawq = '' self.irawq = 0 self.cookedq = '' self.eof = 0 self.iacseq = '' # Buffer for IAC sequence. self.sb = 0 # flag for SB and SE sequence. self.sbdataq = '' self.option_callback = None if host is not None: self.open(host, port) def open(self, host, port=0): """Connect to a host. The optional second argument is the port number, which defaults to the standard telnet port (23). Don't try to reopen an already connected instance. """ self.eof = 0 if not port: port = TELNET_PORT self.host = host self.port = port msg = "getaddrinfo returns an empty list" for res in socket.getaddrinfo(host, port, 0, socket.SOCK_STREAM): af, socktype, proto, canonname, sa = res try: self.sock = socket.socket(af, socktype, proto) self.sock.connect(sa) except socket.error, msg: if self.sock: self.sock.close() self.sock = None continue break if not self.sock: raise socket.error, msg def __del__(self): """Destructor -- close the connection.""" self.close() def msg(self, msg, *args): """Print a debug message, when the debug level is > 0. If extra arguments are present, they are substituted in the message using the standard string formatting operator. """ if self.debuglevel > 0: print 'Telnet(%s,%d):' % (self.host, self.port), if args: print msg % args else: print msg def set_debuglevel(self, debuglevel): """Set the debug level. The higher it is, the more debug output you get (on sys.stdout). """ self.debuglevel = debuglevel def close(self): """Close the connection.""" if self.sock: self.sock.close() self.sock = 0 self.eof = 1 self.iacseq = '' self.sb = 0 def get_socket(self): """Return the socket object used internally.""" return self.sock def fileno(self): """Return the fileno() of the socket object used internally.""" return self.sock.fileno() def write(self, buffer): """Write a string to the socket, doubling any IAC characters. Can block if the connection is blocked. May raise socket.error if the connection is closed. """ if IAC in buffer: buffer = buffer.replace(IAC, IAC+IAC) self.msg("send %s", `buffer`) self.sock.sendall(buffer) def read_until(self, match, timeout=None): """Read until a given string is encountered or until timeout. When no match is found, return whatever is available instead, possibly the empty string. Raise EOFError if the connection is closed and no cooked data is available. """ n = len(match) self.process_rawq() i = self.cookedq.find(match) if i >= 0: i = i+n buf = self.cookedq[:i] self.cookedq = self.cookedq[i:] return buf s_reply = ([self], [], []) s_args = s_reply if timeout is not None: s_args = s_args + (timeout,) while not self.eof and select(*s_args) == s_reply: i = max(0, len(self.cookedq)-n) self.fill_rawq() self.process_rawq() i = self.cookedq.find(match, i) if i >= 0: i = i+n buf = self.cookedq[:i] self.cookedq = self.cookedq[i:] return buf return self.read_very_lazy() def read_all(self): """Read all data until EOF; block until connection closed.""" self.process_rawq() while not self.eof: self.fill_rawq() self.process_rawq() buf = self.cookedq self.cookedq = '' return buf def read_some(self): """Read at least one byte of cooked data unless EOF is hit. Return '' if EOF is hit. Block if no data is immediately available. """ self.process_rawq() while not self.cookedq and not self.eof: self.fill_rawq() self.process_rawq() buf = self.cookedq self.cookedq = '' return buf def read_very_eager(self): """Read everything that's possible without blocking in I/O (eager). Raise EOFError if connection closed and no cooked data available. Return '' if no cooked data available otherwise. Don't block unless in the midst of an IAC sequence. """ self.process_rawq() while not self.eof and self.sock_avail(): self.fill_rawq() self.process_rawq() return self.read_very_lazy() def read_eager(self): """Read readily available data. Raise EOFError if connection closed and no cooked data available. Return '' if no cooked data available otherwise. Don't block unless in the midst of an IAC sequence. """ self.process_rawq() while not self.cookedq and not self.eof and self.sock_avail(): self.fill_rawq() self.process_rawq() return self.read_very_lazy() def read_lazy(self): """Process and return data that's already in the queues (lazy). Raise EOFError if connection closed and no data available. Return '' if no cooked data available otherwise. Don't block unless in the midst of an IAC sequence. """ self.process_rawq() return self.read_very_lazy() def read_very_lazy(self): """Return any data available in the cooked queue (very lazy). Raise EOFError if connection closed and no data available. Return '' if no cooked data available otherwise. Don't block. """ buf = self.cookedq self.cookedq = '' if not buf and self.eof and not self.rawq: raise EOFError, 'telnet connection closed' return buf def read_sb_data(self): """Return any data available in the SB ... SE queue. Return '' if no SB ... SE available. Should only be called after seeing a SB or SE command. When a new SB command is found, old unread SB data will be discarded. Don't block. """ buf = self.sbdataq self.sbdataq = '' return buf def set_option_negotiation_callback(self, callback): """Provide a callback function called after each receipt of a telnet option.""" self.option_callback = callback def process_rawq(self): """Transfer from raw queue to cooked queue. Set self.eof when connection is closed. Don't block unless in the midst of an IAC sequence. """ buf = ['', ''] try: while self.rawq: c = self.rawq_getchar() if not self.iacseq: if c == theNULL: continue if c == "\021": continue if c != IAC: buf[self.sb] = buf[self.sb] + c continue else: self.iacseq += c elif len(self.iacseq) == 1: 'IAC: IAC CMD [OPTION only for WILL/WONT/DO/DONT]' if c in (DO, DONT, WILL, WONT): self.iacseq += c continue self.iacseq = '' if c == IAC: buf[self.sb] = buf[self.sb] + c else: if c == SB: # SB ... SE start. self.sb = 1 self.sbdataq = '' elif c == SE: self.sb = 0 self.sbdataq = self.sbdataq + buf[1] buf[1] = '' if self.option_callback: # Callback is supposed to look into # the sbdataq self.option_callback(self.sock, c, NOOPT) else: # We can't offer automatic processing of # suboptions. Alas, we should not get any # unless we did a WILL/DO before. self.msg('IAC %d not recognized' % ord(c)) elif len(self.iacseq) == 2: cmd = self.iacseq[1] self.iacseq = '' opt = c if cmd in (DO, DONT): self.msg('IAC %s %d', cmd == DO and 'DO' or 'DONT', ord(opt)) if self.option_callback: self.option_callback(self.sock, cmd, opt) else: self.sock.sendall(IAC + WONT + opt) elif cmd in (WILL, WONT): self.msg('IAC %s %d', cmd == WILL and 'WILL' or 'WONT', ord(opt)) if self.option_callback: self.option_callback(self.sock, cmd, opt) else: self.sock.sendall(IAC + DONT + opt) except EOFError: # raised by self.rawq_getchar() self.iacseq = '' # Reset on EOF self.sb = 0 pass self.cookedq = self.cookedq + buf[0] self.sbdataq = self.sbdataq + buf[1] def rawq_getchar(self): """Get next char from raw queue. Block if no data is immediately available. Raise EOFError when connection is closed. """ if not self.rawq: self.fill_rawq() if self.eof: raise EOFError c = self.rawq[self.irawq] self.irawq = self.irawq + 1 if self.irawq >= len(self.rawq): self.rawq = '' self.irawq = 0 return c def fill_rawq(self): """Fill raw queue from exactly one recv() system call. Block if no data is immediately available. Set self.eof when connection is closed. """ if self.irawq >= len(self.rawq): self.rawq = '' self.irawq = 0 # The buffer size should be fairly small so as to avoid quadratic # behavior in process_rawq() above buf = self.sock.recv(50) self.msg("recv %s", `buf`) self.eof = (not buf) self.rawq = self.rawq + buf def sock_avail(self): """Test whether data is available on the socket.""" return select([self], [], [], 0) == ([self], [], []) def interact(self): """Interaction function, emulates a very dumb telnet client.""" if sys.platform == "win32": self.mt_interact() return while 1: rfd, wfd, xfd = select([self, sys.stdin], [], []) if self in rfd: try: text = self.read_eager() except EOFError: print '*** Connection closed by remote host ***' break if text: sys.stdout.write(text) sys.stdout.flush() if sys.stdin in rfd: line = sys.stdin.readline() if not line: break self.write(line) def mt_interact(self): """Multithreaded version of interact().""" import thread thread.start_new_thread(self.listener, ()) while 1: line = sys.stdin.readline() if not line: break self.write(line) def listener(self): """Helper for mt_interact() -- this executes in the other thread.""" while 1: try: data = self.read_eager() except EOFError: print '*** Connection closed by remote host ***' return if data: sys.stdout.write(data) else: sys.stdout.flush() def expect(self, list, timeout=None): """Read until one from a list of a regular expressions matches. The first argument is a list of regular expressions, either compiled (re.RegexObject instances) or uncompiled (strings). The optional second argument is a timeout, in seconds; default is no timeout. Return a tuple of three items: the index in the list of the first regular expression that matches; the match object returned; and the text read up till and including the match. If EOF is read and no text was read, raise EOFError. Otherwise, when nothing matches, return (-1, None, text) where text is the text received so far (may be the empty string if a timeout happened). If a regular expression ends with a greedy match (e.g. '.*') or if more than one expression can match the same input, the results are undeterministic, and may depend on the I/O timing. """ re = None list = list[:] indices = range(len(list)) for i in indices: if not hasattr(list[i], "search"): if not re: import re list[i] = re.compile(list[i]) while 1: self.process_rawq() for i in indices: m = list[i].search(self.cookedq) if m: e = m.end() text = self.cookedq[:e] self.cookedq = self.cookedq[e:] return (i, m, text) if self.eof: break if timeout is not None: r, w, x = select([self.fileno()], [], [], timeout) if not r: break self.fill_rawq() text = self.read_very_lazy() if not text and self.eof: raise EOFError return (-1, None, text) def test(): """Test program for telnetlib. Usage: python telnetlib.py [-d] ... [host [port]] Default host is localhost; default port is 23. """ debuglevel = 0 while sys.argv[1:] and sys.argv[1] == '-d': debuglevel = debuglevel+1 del sys.argv[1] host = 'localhost' if sys.argv[1:]: host = sys.argv[1] port = 0 if sys.argv[2:]: portstr = sys.argv[2] try: port = int(portstr) except ValueError: port = socket.getservbyname(portstr, 'tcp') tn = Telnet() tn.set_debuglevel(debuglevel) tn.open(host, port) tn.interact() tn.close() if __name__ == '__main__': test()
apache-2.0
simonwydooghe/ansible
test/units/modules/cloud/xenserver/FakeXenAPI.py
94
1996
# -*- coding: utf-8 -*- # # Copyright: (c) 2019, Bojan Vitnik <bvitnik@mainstream.rs> # GNU General Public License v3.0+ (see COPYING or https://www.gnu.org/licenses/gpl-3.0.txt) FAKE_API_VERSION = "1.1" class Failure(Exception): def __init__(self, details): self.details = details def __str__(self): return str(self.details) class Session(object): def __init__(self, uri, transport=None, encoding=None, verbose=0, allow_none=1, ignore_ssl=False): self.transport = transport self._session = None self.last_login_method = None self.last_login_params = None self.API_version = FAKE_API_VERSION def _get_api_version(self): return FAKE_API_VERSION def _login(self, method, params): self._session = "OpaqueRef:fake-xenapi-session-ref" self.last_login_method = method self.last_login_params = params self.API_version = self._get_api_version() def _logout(self): self._session = None self.last_login_method = None self.last_login_params = None self.API_version = FAKE_API_VERSION def xenapi_request(self, methodname, params): if methodname.startswith('login'): self._login(methodname, params) return None elif methodname == 'logout' or methodname == 'session.logout': self._logout() return None else: # Should be patched with mocker.patch(). return None def __getattr__(self, name): if name == 'handle': return self._session elif name == 'xenapi': # Should be patched with mocker.patch(). return None elif name.startswith('login') or name.startswith('slave_local'): return lambda *params: self._login(name, params) elif name == 'logout': return self._logout def xapi_local(): return Session("http://_var_lib_xcp_xapi/")
gpl-3.0
rhndg/openedx
common/djangoapps/util/tests/test_db.py
109
4539
"""Tests for util.db module.""" import ddt import threading import time import unittest from django.contrib.auth.models import User from django.db import connection, IntegrityError from django.db.transaction import commit_on_success, TransactionManagementError from django.test import TestCase, TransactionTestCase from util.db import commit_on_success_with_read_committed, generate_int_id @ddt.ddt class TransactionIsolationLevelsTestCase(TransactionTestCase): """ Tests the effects of changing transaction isolation level to READ COMMITTED instead of REPEATABLE READ. Note: This TestCase only works with MySQL. To run it on devstack: 1. Add TEST_RUNNER = 'django_nose.NoseTestSuiteRunner' to envs/devstack.py 2. Run "./manage.py lms --settings=devstack test util.tests.test_db" """ @ddt.data( (commit_on_success, IntegrityError, None, True), (commit_on_success_with_read_committed, type(None), False, True), ) @ddt.unpack def test_concurrent_requests(self, transaction_decorator, exception_class, created_in_1, created_in_2): """ Test that when isolation level is set to READ COMMITTED get_or_create() for the same row in concurrent requests does not raise an IntegrityError. """ if connection.vendor != 'mysql': raise unittest.SkipTest('Only works on MySQL.') class RequestThread(threading.Thread): """ A thread which runs a dummy view.""" def __init__(self, delay, **kwargs): super(RequestThread, self).__init__(**kwargs) self.delay = delay self.status = {} @transaction_decorator def run(self): """A dummy view.""" try: try: User.objects.get(username='student', email='student@edx.org') except User.DoesNotExist: pass else: raise AssertionError('Did not raise User.DoesNotExist.') if self.delay > 0: time.sleep(self.delay) __, created = User.objects.get_or_create(username='student', email='student@edx.org') except Exception as exception: # pylint: disable=broad-except self.status['exception'] = exception else: self.status['created'] = created thread1 = RequestThread(delay=1) thread2 = RequestThread(delay=0) thread1.start() thread2.start() thread2.join() thread1.join() self.assertIsInstance(thread1.status.get('exception'), exception_class) self.assertEqual(thread1.status.get('created'), created_in_1) self.assertIsNone(thread2.status.get('exception')) self.assertEqual(thread2.status.get('created'), created_in_2) def test_transaction_nesting(self): """Test that the decorator raises an error if there are already more than 1 levels of nested transactions.""" if connection.vendor != 'mysql': raise unittest.SkipTest('Only works on MySQL.') def do_nothing(): """Just return.""" return commit_on_success_with_read_committed(do_nothing)() with commit_on_success(): commit_on_success_with_read_committed(do_nothing)() with self.assertRaises(TransactionManagementError): with commit_on_success(): with commit_on_success(): commit_on_success_with_read_committed(do_nothing)() @ddt.ddt class GenerateIntIdTestCase(TestCase): """Tests for `generate_int_id`""" @ddt.data(10) def test_no_used_ids(self, times): """ Verify that we get a random integer within the specified range when there are no used ids. """ minimum = 1 maximum = times for i in range(times): self.assertIn(generate_int_id(minimum, maximum), range(minimum, maximum + 1)) @ddt.data(10) def test_used_ids(self, times): """ Verify that we get a random integer within the specified range but not in a list of used ids. """ minimum = 1 maximum = times used_ids = {2, 4, 6, 8} for i in range(times): int_id = generate_int_id(minimum, maximum, used_ids) self.assertIn(int_id, list(set(range(minimum, maximum + 1)) - used_ids))
agpl-3.0
AdaEne/CATMAID
django/applications/catmaid/management/commands/catmaid_check_db_integrity.py
2
3831
import sys from django.core.management.base import BaseCommand, CommandError from django.db import connection from catmaid.models import Project class Command(BaseCommand): args = '<project_id> <project_id> ...' help = ''' Tests the integrity of the specified projects with several sanity checks ''' def handle(self, *args, **options): if not len(args): project_ids = Project.objects.all().values_list('id', flat=True) else: project_ids = map(int, args) passed = True for project_id in project_ids: passed = passed and self.check_project(project_id) if not passed: sys.exit(1) def check_project(self, project_id): if not Project.objects.filter(id=project_id).exists(): raise CommandError('Project with id %s does not exist.' % project_id) project_passed = True self.stdout.write('Checking integrity of project %s' % project_id) self.stdout.write('Check that no connected treenodes are in different skeletons...', ending='') cursor = connection.cursor() cursor.execute(''' SELECT tn1.id, tn2.id FROM treenode tn1, treenode tn2 WHERE tn2.id = tn1.parent_id AND tn1.skeleton_id <> tn2.skeleton_id AND tn1.project_id = %s ''', (project_id,)) if cursor.rowcount == 0: self.stdout.write('OK') else: project_passed = False self.stdout.write('') self.stdout.write('FAILED: found %s rows (should be 0)' % cursor.rowcount) self.stdout.write('Check that each skeleton has exactly one root node...', ending='') cursor.execute(''' SELECT t.skeleton_id, count(*) FROM treenode t WHERE t.parent_id IS NULL AND t.project_id = %s GROUP BY t.skeleton_id HAVING count(*) <> 1 ''', (project_id,)) if cursor.rowcount == 0: self.stdout.write('OK') else: project_passed = False self.stdout.write('') self.stdout.write('FAILED: found %s rows (should be 0)' % cursor.rowcount) self.stdout.write('Check that all treenodes in a skeleton are connected to the root node...', ending='') cursor.execute(''' SELECT DISTINCT skeleton_id FROM treenode WHERE project_id = %s ''', (project_id,)) skeleton_ids = cursor.fetchall() test_passed = True for skeleton_id in skeleton_ids: cursor.execute(''' WITH RECURSIVE nodes (id) AS ( SELECT t.id FROM treenode t WHERE t.parent_id IS NULL AND t.skeleton_id = %s UNION ALL SELECT t.id FROM treenode t JOIN nodes p ON t.parent_id = p.id) SELECT t.id, t.skeleton_id FROM treenode t WHERE t.skeleton_id = %s AND NOT EXISTS (SELECT n.id FROM nodes n WHERE n.id = t.id); ''', (skeleton_id, skeleton_id)) if cursor.rowcount: if test_passed: self.stdout.write('') test_passed = False project_passed = False row = cursor.fetchone() self.stdout.write('FAILED: node %s is skeleton %s has no path to root' % row) if test_passed: self.stdout.write('OK') self.stdout.write('') return project_passed
gpl-3.0
flyballlabs/threatdetectionservice
api/venv/lib/python2.7/site-packages/pip/_vendor/packaging/_structures.py
1152
1416
# This file is dual licensed under the terms of the Apache License, Version # 2.0, and the BSD License. See the LICENSE file in the root of this repository # for complete details. from __future__ import absolute_import, division, print_function class Infinity(object): def __repr__(self): return "Infinity" def __hash__(self): return hash(repr(self)) def __lt__(self, other): return False def __le__(self, other): return False def __eq__(self, other): return isinstance(other, self.__class__) def __ne__(self, other): return not isinstance(other, self.__class__) def __gt__(self, other): return True def __ge__(self, other): return True def __neg__(self): return NegativeInfinity Infinity = Infinity() class NegativeInfinity(object): def __repr__(self): return "-Infinity" def __hash__(self): return hash(repr(self)) def __lt__(self, other): return True def __le__(self, other): return True def __eq__(self, other): return isinstance(other, self.__class__) def __ne__(self, other): return not isinstance(other, self.__class__) def __gt__(self, other): return False def __ge__(self, other): return False def __neg__(self): return Infinity NegativeInfinity = NegativeInfinity()
apache-2.0
kapil-malik/airflow
airflow/hooks/hive_hooks.py
11
15954
from __future__ import print_function from builtins import zip from past.builtins import basestring import csv import logging import re import subprocess from tempfile import NamedTemporaryFile from thrift.transport import TSocket from thrift.transport import TTransport from thrift.protocol import TBinaryProtocol from hive_service import ThriftHive import pyhs2 from airflow.utils import AirflowException from airflow.hooks.base_hook import BaseHook from airflow.utils import TemporaryDirectory class HiveCliHook(BaseHook): """ Simple wrapper around the hive CLI. It also supports the ``beeline`` a lighter CLI that runs JDBC and is replacing the heavier traditional CLI. To enable ``beeline``, set the use_beeline param in the extra field of your connection as in ``{ "use_beeline": true }`` Note that you can also set default hive CLI parameters using the ``hive_cli_params`` to be used in your connection as in ``{"hive_cli_params": "-hiveconf mapred.job.tracker=some.jobtracker:444"}`` """ def __init__( self, hive_cli_conn_id="hive_cli_default"): conn = self.get_connection(hive_cli_conn_id) self.hive_cli_params = conn.extra_dejson.get('hive_cli_params', '') self.use_beeline = conn.extra_dejson.get('use_beeline', False) self.conn = conn def run_cli(self, hql, schema=None, verbose=True): """ Run an hql statement using the hive cli >>> hh = HiveCliHook() >>> result = hh.run_cli("USE airflow;") >>> ("OK" in result) True """ conn = self.conn schema = schema or conn.schema if schema: hql = "USE {schema};\n{hql}".format(**locals()) with TemporaryDirectory(prefix='airflow_hiveop_') as tmp_dir: with NamedTemporaryFile(dir=tmp_dir) as f: f.write(hql) f.flush() fname = f.name hive_bin = 'hive' cmd_extra = [] if self.use_beeline: hive_bin = 'beeline' jdbc_url = ( "jdbc:hive2://" "{0}:{1}/{2}" ";auth=noSasl" ).format(conn.host, conn.port, conn.schema) cmd_extra += ['-u', jdbc_url] if conn.login: cmd_extra += ['-n', conn.login] if conn.password: cmd_extra += ['-p', conn.password] cmd_extra += ['-p', conn.login] hive_cmd = [hive_bin, '-f', fname] + cmd_extra if self.hive_cli_params: hive_params_list = self.hive_cli_params.split() hive_cmd.extend(hive_params_list) if verbose: logging.info(" ".join(hive_cmd)) sp = subprocess.Popen( hive_cmd, stdout=subprocess.PIPE, stderr=subprocess.STDOUT, cwd=tmp_dir) self.sp = sp stdout = '' for line in iter(sp.stdout.readline, ''): stdout += line if verbose: logging.info(line.strip()) sp.wait() if sp.returncode: raise AirflowException(stdout) return stdout def test_hql(self, hql): """ Test an hql statement using the hive cli and EXPLAIN """ create, insert, other = [], [], [] for query in hql.split(';'): # naive query_original = query query = query.lower().strip() if query.startswith('create table'): create.append(query_original) elif query.startswith(('set ', 'add jar ', 'create temporary function')): other.append(query_original) elif query.startswith('insert'): insert.append(query_original) other = ';'.join(other) for query_set in [create, insert]: for query in query_set: query_preview = ' '.join(query.split())[:50] logging.info("Testing HQL [{0} (...)]".format(query_preview)) if query_set == insert: query = other + '; explain ' + query else: query = 'explain ' + query try: self.run_cli(query, verbose=False) except AirflowException as e: message = e.args[0].split('\n')[-2] logging.info(message) error_loc = re.search('(\d+):(\d+)', message) if error_loc and error_loc.group(1).isdigit(): l = int(error_loc.group(1)) begin = max(l-2, 0) end = min(l+3, len(query.split('\n'))) context = '\n'.join(query.split('\n')[begin:end]) logging.info("Context :\n {0}".format(context)) else: logging.info("SUCCESS") def load_file( self, filepath, table, delimiter=",", field_dict=None, create=True, overwrite=True, partition=None, recreate=False): """ Loads a local file into Hive Note that the table generated in Hive uses ``STORED AS textfile`` which isn't the most efficient serialization format. If a large amount of data is loaded and/or if the tables gets queried considerably, you may want to use this operator only to stage the data into a temporary table before loading it into its final destination using a ``HiveOperator``. :param table: target Hive table, use dot notation to target a specific database :type table: str :param create: whether to create the table if it doesn't exist :type create: bool :param recreate: whether to drop and recreate the table at every execution :type recreate: bool :param partition: target partition as a dict of partition columns and values :type partition: dict :param delimiter: field delimiter in the file :type delimiter: str """ hql = '' if recreate: hql += "DROP TABLE IF EXISTS {table};\n" if create or recreate: fields = ",\n ".join( [k + ' ' + v for k, v in field_dict.items()]) hql += "CREATE TABLE IF NOT EXISTS {table} (\n{fields})\n" if partition: pfields = ",\n ".join( [p + " STRING" for p in partition]) hql += "PARTITIONED BY ({pfields})\n" hql += "ROW FORMAT DELIMITED\n" hql += "FIELDS TERMINATED BY '{delimiter}'\n" hql += "STORED AS textfile;" hql = hql.format(**locals()) logging.info(hql) self.run_cli(hql) hql = "LOAD DATA LOCAL INPATH '{filepath}' " if overwrite: hql += "OVERWRITE " hql += "INTO TABLE {table} " if partition: pvals = ", ".join( ["{0}='{1}'".format(k, v) for k, v in partition.items()]) hql += "PARTITION ({pvals});" hql = hql.format(**locals()) logging.info(hql) self.run_cli(hql) def kill(self): if hasattr(self, 'sp'): if self.sp.poll() is None: print("Killing the Hive job") self.sp.kill() class HiveMetastoreHook(BaseHook): ''' Wrapper to interact with the Hive Metastore ''' def __init__(self, metastore_conn_id='metastore_default'): self.metastore_conn = self.get_connection(metastore_conn_id) self.metastore = self.get_metastore_client() def __getstate__(self): # This is for pickling to work despite the thirft hive client not # being pickable d = dict(self.__dict__) del d['metastore'] return d def __setstate__(self, d): self.__dict__.update(d) self.__dict__['metastore'] = self.get_metastore_client() def get_metastore_client(self): ''' Returns a Hive thrift client. ''' ms = self.metastore_conn transport = TSocket.TSocket(ms.host, ms.port) transport = TTransport.TBufferedTransport(transport) protocol = TBinaryProtocol.TBinaryProtocol(transport) return ThriftHive.Client(protocol) def get_conn(self): return self.metastore def check_for_partition(self, schema, table, partition): ''' Checks whether a partition exists >>> hh = HiveMetastoreHook() >>> t = 'static_babynames_partitioned' >>> hh.check_for_partition('airflow', t, "ds='2015-01-01'") True ''' self.metastore._oprot.trans.open() partitions = self.metastore.get_partitions_by_filter( schema, table, partition, 1) self.metastore._oprot.trans.close() if partitions: return True else: return False def get_table(self, table_name, db='default'): ''' Get a metastore table object >>> hh = HiveMetastoreHook() >>> t = hh.get_table(db='airflow', table_name='static_babynames') >>> t.tableName 'static_babynames' >>> [col.name for col in t.sd.cols] ['state', 'year', 'name', 'gender', 'num'] ''' self.metastore._oprot.trans.open() if db == 'default' and '.' in table_name: db, table_name = table_name.split('.')[:2] table = self.metastore.get_table(dbname=db, tbl_name=table_name) self.metastore._oprot.trans.close() return table def get_tables(self, db, pattern='*'): ''' Get a metastore table object ''' self.metastore._oprot.trans.open() tables = self.metastore.get_tables(db_name=db, pattern=pattern) objs = self.metastore.get_table_objects_by_name(db, tables) self.metastore._oprot.trans.close() return objs def get_databases(self, pattern='*'): ''' Get a metastore table object ''' self.metastore._oprot.trans.open() dbs = self.metastore.get_databases(pattern) self.metastore._oprot.trans.close() return dbs def get_partitions( self, schema, table_name, filter=None): ''' Returns a list of all partitions in a table. Works only for tables with less than 32767 (java short max val). For subpartitioned table, the number might easily exceed this. >>> hh = HiveMetastoreHook() >>> t = 'static_babynames_partitioned' >>> parts = hh.get_partitions(schema='airflow', table_name=t) >>> len(parts) 1 >>> parts [{'ds': '2015-01-01'}] ''' self.metastore._oprot.trans.open() table = self.metastore.get_table(dbname=schema, tbl_name=table_name) if len(table.partitionKeys) == 0: raise AirflowException("The table isn't partitioned") else: if filter: parts = self.metastore.get_partitions_by_filter( db_name=schema, tbl_name=table_name, filter=filter, max_parts=32767) else: parts = self.metastore.get_partitions( db_name=schema, tbl_name=table_name, max_parts=32767) self.metastore._oprot.trans.close() pnames = [p.name for p in table.partitionKeys] return [dict(zip(pnames, p.values)) for p in parts] def max_partition(self, schema, table_name, field=None, filter=None): ''' Returns the maximum value for all partitions in a table. Works only for tables that have a single partition key. For subpartitioned table, we recommend using signal tables. >>> hh = HiveMetastoreHook() >>> t = 'static_babynames_partitioned' >>> hh.max_partition(schema='airflow', table_name=t) '2015-01-01' ''' parts = self.get_partitions(schema, table_name, filter) if not parts: return None elif len(parts[0]) == 1: field = list(parts[0].keys())[0] elif not field: raise AirflowException( "Please specify the field you want the max " "value for") return max([p[field] for p in parts]) class HiveServer2Hook(BaseHook): ''' Wrapper around the pyhs2 library Note that the default authMechanism is NOSASL, to override it you can specify it in the ``extra`` of your connection in the UI as in ``{"authMechanism": "PLAIN"}``. Refer to the pyhs2 for more details. ''' def __init__(self, hiveserver2_conn_id='hiveserver2_default'): self.hiveserver2_conn_id = hiveserver2_conn_id def get_conn(self): db = self.get_connection(self.hiveserver2_conn_id) return pyhs2.connect( host=db.host, port=db.port, authMechanism=db.extra_dejson.get('authMechanism', 'NOSASL'), user=db.login, database=db.schema or 'default') def get_results(self, hql, schema='default', arraysize=1000): with self.get_conn() as conn: if isinstance(hql, basestring): hql = [hql] results = { 'data': [], 'header': [], } for statement in hql: with conn.cursor() as cur: cur.execute(statement) records = cur.fetchall() if records: results = { 'data': records, 'header': cur.getSchema(), } return results def to_csv(self, hql, csv_filepath, schema='default'): schema = schema or 'default' with self.get_conn() as conn: with conn.cursor() as cur: logging.info("Running query: " + hql) cur.execute(hql) schema = cur.getSchema() with open(csv_filepath, 'w') as f: writer = csv.writer(f) writer.writerow([c['columnName'] for c in cur.getSchema()]) i = 0 while cur.hasMoreRows: rows = [row for row in cur.fetchmany() if row] writer.writerows(rows) i += len(rows) logging.info("Written {0} rows so far.".format(i)) logging.info("Done. Loaded a total of {0} rows.".format(i)) def get_records(self, hql, schema='default'): ''' Get a set of records from a Hive query. >>> hh = HiveServer2Hook() >>> sql = "SELECT * FROM airflow.static_babynames LIMIT 100" >>> len(hh.get_records(sql)) 100 ''' return self.get_results(hql, schema=schema)['data'] def get_pandas_df(self, hql, schema='default'): ''' Get a pandas dataframe from a Hive query >>> hh = HiveServer2Hook() >>> sql = "SELECT * FROM airflow.static_babynames LIMIT 100" >>> df = hh.get_pandas_df(sql) >>> len(df.index) 100 ''' import pandas as pd res = self.get_results(hql, schema=schema) df = pd.DataFrame(res['data']) df.columns = [c['columnName'] for c in res['header']] return df
apache-2.0
dfang/odoo
addons/mrp/tests/test_multicompany.py
22
1397
# -*- coding: utf-8 -*- # Part of Odoo. See LICENSE file for full copyright and licensing details. from odoo.tests import common class TestMrpMulticompany(common.TransactionCase): def setUp(self): super(TestMrpMulticompany, self).setUp() group_user = self.env.ref('base.group_user') group_stock_manager = self.env.ref('stock.group_stock_manager') company_2 = self.env.ref('stock.res_company_1') self.multicompany_user_id = self.env['res.users'].create({ 'name': 'multicomp', 'login': 'multicomp', 'groups_id': [(6, 0, [group_user.id, group_stock_manager.id])], 'company_id': company_2.id, 'company_ids': [(6, 0, [company_2.id])] }) def test_00_multicompany_user(self): """check no error on getting default mrp.production values in multicompany setting""" StockLocation = self.env['stock.location'].sudo(self.multicompany_user_id) fields = ['location_src_id', 'location_dest_id'] defaults = StockLocation.default_get(['location_id', 'location_dest_id', 'type']) for field in fields: if defaults.get(field): try: StockLocation.check_access_rule([defaults[field]], 'read') except Exception, exc: assert False, "unreadable location %s: %s" % (field, exc)
agpl-3.0
xpansa/stock-logistics-workflow
picking_dispatch/stock.py
17
8202
# -*- coding: utf-8 -*- ############################################################################## # # Author: Alexandre Fayolle # Copyright 2012-2014 Camptocamp SA # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## import logging from openerp.osv import orm, fields _logger = logging.getLogger(__name__) class StockMove(orm.Model): _inherit = 'stock.move' _columns = { 'dispatch_id': fields.many2one( 'picking.dispatch', 'Dispatch', select=True, help='who this move is dispatched to'), } def copy_data(self, cr, uid, id, default=None, context=None): if default is None: default = {} default = default.copy() default['dispatch_id'] = False return super(StockMove, self).\ copy_data(cr, uid, id, default=default, context=context) def do_partial(self, cr, uid, ids, partial_datas, context=None): """ in addition to what the original method does, create backorder picking.dispatches and set the state of picing.dispatch according to the state of moves state """ move_obj = self.pool.get('stock.move') dispatch_obj = self.pool.get('picking.dispatch') _logger.debug('partial stock.moves %s %s', ids, partial_datas) complete_move_ids = super(StockMove, self).do_partial(cr, uid, ids, partial_datas, context) # in complete_move_ids, we have: # * moves that were fully processed # * newly created moves (the processed part of partially processed # moves) belonging to the same dispatch as the original move # so the difference between the original set of moves and the # complete_moves is the set of unprocessed moves unprocessed_move_ids = set(ids) - set(complete_move_ids) _logger.debug( 'partial stock.moves: complete_move_ids %s, ' 'unprocessed_move_ids %s', complete_move_ids, unprocessed_move_ids) # unprocessed moves are still linked to the dispatch : this dispatch # must not be marked as Done unfinished_dispatch_ids = {} for move in move_obj.browse(cr, uid, list(unprocessed_move_ids), context=context): if not move.dispatch_id: continue # value will be set later to a new dispatch unfinished_dispatch_ids[move.dispatch_id.id] = None maybe_finished_dispatches = {} for move in move_obj.browse(cr, uid, complete_move_ids, context=context): if not move.dispatch_id: continue dispatch_id = move.dispatch_id.id if dispatch_id in unfinished_dispatch_ids: # the dispatch was partially processed: we need to link the # move to a new dispatch containing only fully processed moves if unfinished_dispatch_ids[dispatch_id] is None: # create a new dispatch, and record its id _logger.debug( 'create backorder picking.dispatch of %s', dispatch_id) new_dispatch_id = dispatch_obj.copy(cr, uid, dispatch_id, { 'backorder_id': dispatch_id, }) unfinished_dispatch_ids[dispatch_id] = new_dispatch_id dispatch_id = unfinished_dispatch_ids[dispatch_id] maybe_finished_dispatches.setdefault( dispatch_id, []).append(move.id) for dispatch_id, move_ids in maybe_finished_dispatches.iteritems(): move_obj.write(cr, uid, move_ids, {'dispatch_id': dispatch_id}) dispatch_obj.check_finished( cr, uid, list(maybe_finished_dispatches), context) dispatch_obj.write( cr, uid, list(unfinished_dispatch_ids), {'state': 'assigned'}) return complete_move_ids def action_cancel(self, cr, uid, ids, context=None): """ in addition to what the method in the parent class does, cancel the dispatches for which all moves where cancelled """ _logger.debug('cancel stock.moves %s', ids) status = super(StockMove, self).action_cancel(cr, uid, ids, context) if not ids: return True dispatch_obj = self.pool.get('picking.dispatch') dispatches = set() for move in self.browse(cr, uid, ids, context=context): if move.dispatch_id: dispatches.add(move.dispatch_id.id) for dispatch in dispatch_obj.browse(cr, uid, list(dispatches), context=context): if any(move.state != 'cancel' for move in dispatch.move_ids): dispatches.remove(dispatch.id) if dispatches: _logger.debug( 'set state to cancel for picking.dispatch %s', list(dispatches)) dispatch_obj.write( cr, uid, list(dispatches), {'state': 'cancel'}, context) return status def action_done(self, cr, uid, ids, context=None): """ in addition to the parent method does, set the dispatch done if all moves are done or canceled """ _logger.debug('done stock.moves %s', ids) status = super(StockMove, self).action_done(cr, uid, ids, context) if not ids: return True dispatch_obj = self.pool.get('picking.dispatch') dispatches = set() for move in self.browse(cr, uid, ids, context=context): if move.dispatch_id: dispatches.add(move.dispatch_id.id) dispatch_obj.check_finished(cr, uid, list(dispatches), context) return status class StockPicking(orm.Model): _inherit = "stock.picking" def _get_related_dispatch(self, cr, uid, ids, field_names, arg=None, context=None): result = {} if not ids: return result for pick_id in ids: result[pick_id] = [] sql = ("SELECT DISTINCT sm.picking_id, sm.dispatch_id " "FROM stock_move sm " "WHERE sm.picking_id in %s AND sm.dispatch_id is NOT NULL") cr.execute(sql, (tuple(ids),)) res = cr.fetchall() for picking_id, dispatch_id in res: result[picking_id].append(dispatch_id) return result def _search_dispatch_pickings(self, cr, uid, obj, name, args, context=None): if not len(args): return [] picking_ids = set() for field, symbol, value in args: move_obj = self.pool['stock.move'] move_ids = move_obj.search(cr, uid, [('dispatch_id', symbol, value)], context=context) for move in move_obj.browse(cr, uid, move_ids, context=context): picking_ids.add(move.picking_id.id) return [('id', 'in', list(picking_ids))] _columns = { 'related_dispatch_ids': fields.function( _get_related_dispatch, fnct_search=_search_dispatch_pickings, type='one2many', relation='picking.dispatch', string='Related Dispatch Picking'), }
agpl-3.0
noironetworks/neutron
neutron/tests/unit/plugins/ml2/drivers/test_helpers.py
3
5946
# Copyright (c) 2014 Thales Services SAS # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import mock from neutron_lib import context from oslo_db import exception as exc from sqlalchemy.orm import query from neutron.plugins.ml2.drivers import type_vlan from neutron.tests.unit import testlib_api TENANT_NET = 'phys_net2' VLAN_MIN = 200 VLAN_MAX = 209 VLAN_OUTSIDE = 100 NETWORK_VLAN_RANGES = { TENANT_NET: [(VLAN_MIN, VLAN_MAX)], } class HelpersTest(testlib_api.SqlTestCase): def setUp(self): super(HelpersTest, self).setUp() self.driver = type_vlan.VlanTypeDriver() self.driver.network_vlan_ranges = NETWORK_VLAN_RANGES self.driver._sync_vlan_allocations() self.context = context.get_admin_context() def check_raw_segment(self, expected, observed): for key, value in expected.items(): self.assertEqual(value, observed[key]) def test_primary_keys(self): self.assertEqual(set(['physical_network', 'vlan_id']), self.driver.primary_keys) def test_allocate_specific_unallocated_segment_in_pools(self): expected = dict(physical_network=TENANT_NET, vlan_id=VLAN_MIN) observed = self.driver.allocate_fully_specified_segment(self.context, **expected) self.check_raw_segment(expected, observed) def test_allocate_specific_allocated_segment_in_pools(self): raw_segment = dict(physical_network=TENANT_NET, vlan_id=VLAN_MIN) self.driver.allocate_fully_specified_segment(self.context, **raw_segment) observed = self.driver.allocate_fully_specified_segment(self.context, **raw_segment) self.assertIsNone(observed) def test_allocate_specific_finally_allocated_segment_in_pools(self): # Test case: allocate a specific unallocated segment in pools but # the segment is allocated concurrently between select and update raw_segment = dict(physical_network=TENANT_NET, vlan_id=VLAN_MIN) with mock.patch.object(query.Query, 'update', return_value=0): observed = self.driver.allocate_fully_specified_segment( self.context, **raw_segment) self.assertIsNone(observed) def test_allocate_specific_unallocated_segment_outside_pools(self): expected = dict(physical_network=TENANT_NET, vlan_id=VLAN_OUTSIDE) observed = self.driver.allocate_fully_specified_segment(self.context, **expected) self.check_raw_segment(expected, observed) def test_allocate_specific_allocated_segment_outside_pools(self): raw_segment = dict(physical_network=TENANT_NET, vlan_id=VLAN_OUTSIDE) self.driver.allocate_fully_specified_segment(self.context, **raw_segment) observed = self.driver.allocate_fully_specified_segment(self.context, **raw_segment) self.assertIsNone(observed) def test_allocate_specific_finally_unallocated_segment_outside_pools(self): # Test case: allocate a specific allocated segment in pools but # the segment is concurrently unallocated after select or update expected = dict(physical_network=TENANT_NET, vlan_id=VLAN_MIN) with mock.patch.object(self.driver.model, 'save'): observed = self.driver.allocate_fully_specified_segment( self.context, **expected) self.check_raw_segment(expected, observed) def test_allocate_partial_segment_without_filters(self): expected = dict(physical_network=TENANT_NET) observed = self.driver.allocate_partially_specified_segment( self.context) self.check_raw_segment(expected, observed) def test_allocate_partial_segment_with_filter(self): expected = dict(physical_network=TENANT_NET) observed = self.driver.allocate_partially_specified_segment( self.context, **expected) self.check_raw_segment(expected, observed) def test_allocate_partial_segment_no_resource_available(self): for i in range(VLAN_MIN, VLAN_MAX + 1): self.driver.allocate_partially_specified_segment(self.context) observed = self.driver.allocate_partially_specified_segment( self.context) self.assertIsNone(observed) def test_allocate_partial_segment_outside_pools(self): raw_segment = dict(physical_network='other_phys_net') observed = self.driver.allocate_partially_specified_segment( self.context, **raw_segment) self.assertIsNone(observed) def test_allocate_partial_segment_first_attempt_fails(self): expected = dict(physical_network=TENANT_NET) with mock.patch.object(query.Query, 'update', side_effect=[0, 1]): self.assertRaises( exc.RetryRequest, self.driver.allocate_partially_specified_segment, self.context, **expected) observed = self.driver.allocate_partially_specified_segment( self.context, **expected) self.check_raw_segment(expected, observed)
apache-2.0
sgruszka/iwlegacy
tools/perf/scripts/python/syscall-counts-by-pid.py
11180
1927
# system call counts, by pid # (c) 2010, Tom Zanussi <tzanussi@gmail.com> # Licensed under the terms of the GNU GPL License version 2 # # Displays system-wide system call totals, broken down by syscall. # If a [comm] arg is specified, only syscalls called by [comm] are displayed. import os, sys sys.path.append(os.environ['PERF_EXEC_PATH'] + \ '/scripts/python/Perf-Trace-Util/lib/Perf/Trace') from perf_trace_context import * from Core import * from Util import syscall_name usage = "perf script -s syscall-counts-by-pid.py [comm]\n"; for_comm = None for_pid = None if len(sys.argv) > 2: sys.exit(usage) if len(sys.argv) > 1: try: for_pid = int(sys.argv[1]) except: for_comm = sys.argv[1] syscalls = autodict() def trace_begin(): print "Press control+C to stop and show the summary" def trace_end(): print_syscall_totals() def raw_syscalls__sys_enter(event_name, context, common_cpu, common_secs, common_nsecs, common_pid, common_comm, id, args): if (for_comm and common_comm != for_comm) or \ (for_pid and common_pid != for_pid ): return try: syscalls[common_comm][common_pid][id] += 1 except TypeError: syscalls[common_comm][common_pid][id] = 1 def print_syscall_totals(): if for_comm is not None: print "\nsyscall events for %s:\n\n" % (for_comm), else: print "\nsyscall events by comm/pid:\n\n", print "%-40s %10s\n" % ("comm [pid]/syscalls", "count"), print "%-40s %10s\n" % ("----------------------------------------", \ "----------"), comm_keys = syscalls.keys() for comm in comm_keys: pid_keys = syscalls[comm].keys() for pid in pid_keys: print "\n%s [%d]\n" % (comm, pid), id_keys = syscalls[comm][pid].keys() for id, val in sorted(syscalls[comm][pid].iteritems(), \ key = lambda(k, v): (v, k), reverse = True): print " %-38s %10d\n" % (syscall_name(id), val),
gpl-2.0
ant1b/Planets4X
pythonanywhere_app/static/Brython3.0.0-20141104-210332/Lib/unittest/test/test_loader.py
738
49593
import sys import types import unittest class Test_TestLoader(unittest.TestCase): ### Tests for TestLoader.loadTestsFromTestCase ################################################################ # "Return a suite of all tests cases contained in the TestCase-derived # class testCaseClass" def test_loadTestsFromTestCase(self): class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass def foo_bar(self): pass tests = unittest.TestSuite([Foo('test_1'), Foo('test_2')]) loader = unittest.TestLoader() self.assertEqual(loader.loadTestsFromTestCase(Foo), tests) # "Return a suite of all tests cases contained in the TestCase-derived # class testCaseClass" # # Make sure it does the right thing even if no tests were found def test_loadTestsFromTestCase__no_matches(self): class Foo(unittest.TestCase): def foo_bar(self): pass empty_suite = unittest.TestSuite() loader = unittest.TestLoader() self.assertEqual(loader.loadTestsFromTestCase(Foo), empty_suite) # "Return a suite of all tests cases contained in the TestCase-derived # class testCaseClass" # # What happens if loadTestsFromTestCase() is given an object # that isn't a subclass of TestCase? Specifically, what happens # if testCaseClass is a subclass of TestSuite? # # This is checked for specifically in the code, so we better add a # test for it. def test_loadTestsFromTestCase__TestSuite_subclass(self): class NotATestCase(unittest.TestSuite): pass loader = unittest.TestLoader() try: loader.loadTestsFromTestCase(NotATestCase) except TypeError: pass else: self.fail('Should raise TypeError') # "Return a suite of all tests cases contained in the TestCase-derived # class testCaseClass" # # Make sure loadTestsFromTestCase() picks up the default test method # name (as specified by TestCase), even though the method name does # not match the default TestLoader.testMethodPrefix string def test_loadTestsFromTestCase__default_method_name(self): class Foo(unittest.TestCase): def runTest(self): pass loader = unittest.TestLoader() # This has to be false for the test to succeed self.assertFalse('runTest'.startswith(loader.testMethodPrefix)) suite = loader.loadTestsFromTestCase(Foo) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), [Foo('runTest')]) ################################################################ ### /Tests for TestLoader.loadTestsFromTestCase ### Tests for TestLoader.loadTestsFromModule ################################################################ # "This method searches `module` for classes derived from TestCase" def test_loadTestsFromModule__TestCase_subclass(self): m = types.ModuleType('m') class MyTestCase(unittest.TestCase): def test(self): pass m.testcase_1 = MyTestCase loader = unittest.TestLoader() suite = loader.loadTestsFromModule(m) self.assertIsInstance(suite, loader.suiteClass) expected = [loader.suiteClass([MyTestCase('test')])] self.assertEqual(list(suite), expected) # "This method searches `module` for classes derived from TestCase" # # What happens if no tests are found (no TestCase instances)? def test_loadTestsFromModule__no_TestCase_instances(self): m = types.ModuleType('m') loader = unittest.TestLoader() suite = loader.loadTestsFromModule(m) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), []) # "This method searches `module` for classes derived from TestCase" # # What happens if no tests are found (TestCases instances, but no tests)? def test_loadTestsFromModule__no_TestCase_tests(self): m = types.ModuleType('m') class MyTestCase(unittest.TestCase): pass m.testcase_1 = MyTestCase loader = unittest.TestLoader() suite = loader.loadTestsFromModule(m) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), [loader.suiteClass()]) # "This method searches `module` for classes derived from TestCase"s # # What happens if loadTestsFromModule() is given something other # than a module? # # XXX Currently, it succeeds anyway. This flexibility # should either be documented or loadTestsFromModule() should # raise a TypeError # # XXX Certain people are using this behaviour. We'll add a test for it def test_loadTestsFromModule__not_a_module(self): class MyTestCase(unittest.TestCase): def test(self): pass class NotAModule(object): test_2 = MyTestCase loader = unittest.TestLoader() suite = loader.loadTestsFromModule(NotAModule) reference = [unittest.TestSuite([MyTestCase('test')])] self.assertEqual(list(suite), reference) # Check that loadTestsFromModule honors (or not) a module # with a load_tests function. def test_loadTestsFromModule__load_tests(self): m = types.ModuleType('m') class MyTestCase(unittest.TestCase): def test(self): pass m.testcase_1 = MyTestCase load_tests_args = [] def load_tests(loader, tests, pattern): self.assertIsInstance(tests, unittest.TestSuite) load_tests_args.extend((loader, tests, pattern)) return tests m.load_tests = load_tests loader = unittest.TestLoader() suite = loader.loadTestsFromModule(m) self.assertIsInstance(suite, unittest.TestSuite) self.assertEqual(load_tests_args, [loader, suite, None]) load_tests_args = [] suite = loader.loadTestsFromModule(m, use_load_tests=False) self.assertEqual(load_tests_args, []) def test_loadTestsFromModule__faulty_load_tests(self): m = types.ModuleType('m') def load_tests(loader, tests, pattern): raise TypeError('some failure') m.load_tests = load_tests loader = unittest.TestLoader() suite = loader.loadTestsFromModule(m) self.assertIsInstance(suite, unittest.TestSuite) self.assertEqual(suite.countTestCases(), 1) test = list(suite)[0] self.assertRaisesRegex(TypeError, "some failure", test.m) ################################################################ ### /Tests for TestLoader.loadTestsFromModule() ### Tests for TestLoader.loadTestsFromName() ################################################################ # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # # Is ValueError raised in response to an empty name? def test_loadTestsFromName__empty_name(self): loader = unittest.TestLoader() try: loader.loadTestsFromName('') except ValueError as e: self.assertEqual(str(e), "Empty module name") else: self.fail("TestLoader.loadTestsFromName failed to raise ValueError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # # What happens when the name contains invalid characters? def test_loadTestsFromName__malformed_name(self): loader = unittest.TestLoader() # XXX Should this raise ValueError or ImportError? try: loader.loadTestsFromName('abc () //') except ValueError: pass except ImportError: pass else: self.fail("TestLoader.loadTestsFromName failed to raise ValueError") # "The specifier name is a ``dotted name'' that may resolve ... to a # module" # # What happens when a module by that name can't be found? def test_loadTestsFromName__unknown_module_name(self): loader = unittest.TestLoader() try: loader.loadTestsFromName('sdasfasfasdf') except ImportError as e: self.assertEqual(str(e), "No module named 'sdasfasfasdf'") else: self.fail("TestLoader.loadTestsFromName failed to raise ImportError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # # What happens when the module is found, but the attribute can't? def test_loadTestsFromName__unknown_attr_name(self): loader = unittest.TestLoader() try: loader.loadTestsFromName('unittest.sdasfasfasdf') except AttributeError as e: self.assertEqual(str(e), "'module' object has no attribute 'sdasfasfasdf'") else: self.fail("TestLoader.loadTestsFromName failed to raise AttributeError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # # What happens when we provide the module, but the attribute can't be # found? def test_loadTestsFromName__relative_unknown_name(self): loader = unittest.TestLoader() try: loader.loadTestsFromName('sdasfasfasdf', unittest) except AttributeError as e: self.assertEqual(str(e), "'module' object has no attribute 'sdasfasfasdf'") else: self.fail("TestLoader.loadTestsFromName failed to raise AttributeError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # ... # "The method optionally resolves name relative to the given module" # # Does loadTestsFromName raise ValueError when passed an empty # name relative to a provided module? # # XXX Should probably raise a ValueError instead of an AttributeError def test_loadTestsFromName__relative_empty_name(self): loader = unittest.TestLoader() try: loader.loadTestsFromName('', unittest) except AttributeError as e: pass else: self.fail("Failed to raise AttributeError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # ... # "The method optionally resolves name relative to the given module" # # What happens when an impossible name is given, relative to the provided # `module`? def test_loadTestsFromName__relative_malformed_name(self): loader = unittest.TestLoader() # XXX Should this raise AttributeError or ValueError? try: loader.loadTestsFromName('abc () //', unittest) except ValueError: pass except AttributeError: pass else: self.fail("TestLoader.loadTestsFromName failed to raise ValueError") # "The method optionally resolves name relative to the given module" # # Does loadTestsFromName raise TypeError when the `module` argument # isn't a module object? # # XXX Accepts the not-a-module object, ignorning the object's type # This should raise an exception or the method name should be changed # # XXX Some people are relying on this, so keep it for now def test_loadTestsFromName__relative_not_a_module(self): class MyTestCase(unittest.TestCase): def test(self): pass class NotAModule(object): test_2 = MyTestCase loader = unittest.TestLoader() suite = loader.loadTestsFromName('test_2', NotAModule) reference = [MyTestCase('test')] self.assertEqual(list(suite), reference) # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # # Does it raise an exception if the name resolves to an invalid # object? def test_loadTestsFromName__relative_bad_object(self): m = types.ModuleType('m') m.testcase_1 = object() loader = unittest.TestLoader() try: loader.loadTestsFromName('testcase_1', m) except TypeError: pass else: self.fail("Should have raised TypeError") # "The specifier name is a ``dotted name'' that may # resolve either to ... a test case class" def test_loadTestsFromName__relative_TestCase_subclass(self): m = types.ModuleType('m') class MyTestCase(unittest.TestCase): def test(self): pass m.testcase_1 = MyTestCase loader = unittest.TestLoader() suite = loader.loadTestsFromName('testcase_1', m) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), [MyTestCase('test')]) # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." def test_loadTestsFromName__relative_TestSuite(self): m = types.ModuleType('m') class MyTestCase(unittest.TestCase): def test(self): pass m.testsuite = unittest.TestSuite([MyTestCase('test')]) loader = unittest.TestLoader() suite = loader.loadTestsFromName('testsuite', m) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), [MyTestCase('test')]) # "The specifier name is a ``dotted name'' that may resolve ... to # ... a test method within a test case class" def test_loadTestsFromName__relative_testmethod(self): m = types.ModuleType('m') class MyTestCase(unittest.TestCase): def test(self): pass m.testcase_1 = MyTestCase loader = unittest.TestLoader() suite = loader.loadTestsFromName('testcase_1.test', m) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), [MyTestCase('test')]) # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # # Does loadTestsFromName() raise the proper exception when trying to # resolve "a test method within a test case class" that doesn't exist # for the given name (relative to a provided module)? def test_loadTestsFromName__relative_invalid_testmethod(self): m = types.ModuleType('m') class MyTestCase(unittest.TestCase): def test(self): pass m.testcase_1 = MyTestCase loader = unittest.TestLoader() try: loader.loadTestsFromName('testcase_1.testfoo', m) except AttributeError as e: self.assertEqual(str(e), "type object 'MyTestCase' has no attribute 'testfoo'") else: self.fail("Failed to raise AttributeError") # "The specifier name is a ``dotted name'' that may resolve ... to # ... a callable object which returns a ... TestSuite instance" def test_loadTestsFromName__callable__TestSuite(self): m = types.ModuleType('m') testcase_1 = unittest.FunctionTestCase(lambda: None) testcase_2 = unittest.FunctionTestCase(lambda: None) def return_TestSuite(): return unittest.TestSuite([testcase_1, testcase_2]) m.return_TestSuite = return_TestSuite loader = unittest.TestLoader() suite = loader.loadTestsFromName('return_TestSuite', m) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), [testcase_1, testcase_2]) # "The specifier name is a ``dotted name'' that may resolve ... to # ... a callable object which returns a TestCase ... instance" def test_loadTestsFromName__callable__TestCase_instance(self): m = types.ModuleType('m') testcase_1 = unittest.FunctionTestCase(lambda: None) def return_TestCase(): return testcase_1 m.return_TestCase = return_TestCase loader = unittest.TestLoader() suite = loader.loadTestsFromName('return_TestCase', m) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), [testcase_1]) # "The specifier name is a ``dotted name'' that may resolve ... to # ... a callable object which returns a TestCase ... instance" #***************************************************************** #Override the suiteClass attribute to ensure that the suiteClass #attribute is used def test_loadTestsFromName__callable__TestCase_instance_ProperSuiteClass(self): class SubTestSuite(unittest.TestSuite): pass m = types.ModuleType('m') testcase_1 = unittest.FunctionTestCase(lambda: None) def return_TestCase(): return testcase_1 m.return_TestCase = return_TestCase loader = unittest.TestLoader() loader.suiteClass = SubTestSuite suite = loader.loadTestsFromName('return_TestCase', m) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), [testcase_1]) # "The specifier name is a ``dotted name'' that may resolve ... to # ... a test method within a test case class" #***************************************************************** #Override the suiteClass attribute to ensure that the suiteClass #attribute is used def test_loadTestsFromName__relative_testmethod_ProperSuiteClass(self): class SubTestSuite(unittest.TestSuite): pass m = types.ModuleType('m') class MyTestCase(unittest.TestCase): def test(self): pass m.testcase_1 = MyTestCase loader = unittest.TestLoader() loader.suiteClass=SubTestSuite suite = loader.loadTestsFromName('testcase_1.test', m) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), [MyTestCase('test')]) # "The specifier name is a ``dotted name'' that may resolve ... to # ... a callable object which returns a TestCase or TestSuite instance" # # What happens if the callable returns something else? def test_loadTestsFromName__callable__wrong_type(self): m = types.ModuleType('m') def return_wrong(): return 6 m.return_wrong = return_wrong loader = unittest.TestLoader() try: suite = loader.loadTestsFromName('return_wrong', m) except TypeError: pass else: self.fail("TestLoader.loadTestsFromName failed to raise TypeError") # "The specifier can refer to modules and packages which have not been # imported; they will be imported as a side-effect" def test_loadTestsFromName__module_not_loaded(self): # We're going to try to load this module as a side-effect, so it # better not be loaded before we try. # module_name = 'unittest.test.dummy' sys.modules.pop(module_name, None) loader = unittest.TestLoader() try: suite = loader.loadTestsFromName(module_name) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), []) # module should now be loaded, thanks to loadTestsFromName() self.assertIn(module_name, sys.modules) finally: if module_name in sys.modules: del sys.modules[module_name] ################################################################ ### Tests for TestLoader.loadTestsFromName() ### Tests for TestLoader.loadTestsFromNames() ################################################################ # "Similar to loadTestsFromName(), but takes a sequence of names rather # than a single name." # # What happens if that sequence of names is empty? def test_loadTestsFromNames__empty_name_list(self): loader = unittest.TestLoader() suite = loader.loadTestsFromNames([]) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), []) # "Similar to loadTestsFromName(), but takes a sequence of names rather # than a single name." # ... # "The method optionally resolves name relative to the given module" # # What happens if that sequence of names is empty? # # XXX Should this raise a ValueError or just return an empty TestSuite? def test_loadTestsFromNames__relative_empty_name_list(self): loader = unittest.TestLoader() suite = loader.loadTestsFromNames([], unittest) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), []) # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # # Is ValueError raised in response to an empty name? def test_loadTestsFromNames__empty_name(self): loader = unittest.TestLoader() try: loader.loadTestsFromNames(['']) except ValueError as e: self.assertEqual(str(e), "Empty module name") else: self.fail("TestLoader.loadTestsFromNames failed to raise ValueError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # # What happens when presented with an impossible module name? def test_loadTestsFromNames__malformed_name(self): loader = unittest.TestLoader() # XXX Should this raise ValueError or ImportError? try: loader.loadTestsFromNames(['abc () //']) except ValueError: pass except ImportError: pass else: self.fail("TestLoader.loadTestsFromNames failed to raise ValueError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # # What happens when no module can be found for the given name? def test_loadTestsFromNames__unknown_module_name(self): loader = unittest.TestLoader() try: loader.loadTestsFromNames(['sdasfasfasdf']) except ImportError as e: self.assertEqual(str(e), "No module named 'sdasfasfasdf'") else: self.fail("TestLoader.loadTestsFromNames failed to raise ImportError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # # What happens when the module can be found, but not the attribute? def test_loadTestsFromNames__unknown_attr_name(self): loader = unittest.TestLoader() try: loader.loadTestsFromNames(['unittest.sdasfasfasdf', 'unittest']) except AttributeError as e: self.assertEqual(str(e), "'module' object has no attribute 'sdasfasfasdf'") else: self.fail("TestLoader.loadTestsFromNames failed to raise AttributeError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # ... # "The method optionally resolves name relative to the given module" # # What happens when given an unknown attribute on a specified `module` # argument? def test_loadTestsFromNames__unknown_name_relative_1(self): loader = unittest.TestLoader() try: loader.loadTestsFromNames(['sdasfasfasdf'], unittest) except AttributeError as e: self.assertEqual(str(e), "'module' object has no attribute 'sdasfasfasdf'") else: self.fail("TestLoader.loadTestsFromName failed to raise AttributeError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # ... # "The method optionally resolves name relative to the given module" # # Do unknown attributes (relative to a provided module) still raise an # exception even in the presence of valid attribute names? def test_loadTestsFromNames__unknown_name_relative_2(self): loader = unittest.TestLoader() try: loader.loadTestsFromNames(['TestCase', 'sdasfasfasdf'], unittest) except AttributeError as e: self.assertEqual(str(e), "'module' object has no attribute 'sdasfasfasdf'") else: self.fail("TestLoader.loadTestsFromName failed to raise AttributeError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # ... # "The method optionally resolves name relative to the given module" # # What happens when faced with the empty string? # # XXX This currently raises AttributeError, though ValueError is probably # more appropriate def test_loadTestsFromNames__relative_empty_name(self): loader = unittest.TestLoader() try: loader.loadTestsFromNames([''], unittest) except AttributeError: pass else: self.fail("Failed to raise ValueError") # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # ... # "The method optionally resolves name relative to the given module" # # What happens when presented with an impossible attribute name? def test_loadTestsFromNames__relative_malformed_name(self): loader = unittest.TestLoader() # XXX Should this raise AttributeError or ValueError? try: loader.loadTestsFromNames(['abc () //'], unittest) except AttributeError: pass except ValueError: pass else: self.fail("TestLoader.loadTestsFromNames failed to raise ValueError") # "The method optionally resolves name relative to the given module" # # Does loadTestsFromNames() make sure the provided `module` is in fact # a module? # # XXX This validation is currently not done. This flexibility should # either be documented or a TypeError should be raised. def test_loadTestsFromNames__relative_not_a_module(self): class MyTestCase(unittest.TestCase): def test(self): pass class NotAModule(object): test_2 = MyTestCase loader = unittest.TestLoader() suite = loader.loadTestsFromNames(['test_2'], NotAModule) reference = [unittest.TestSuite([MyTestCase('test')])] self.assertEqual(list(suite), reference) # "The specifier name is a ``dotted name'' that may resolve either to # a module, a test case class, a TestSuite instance, a test method # within a test case class, or a callable object which returns a # TestCase or TestSuite instance." # # Does it raise an exception if the name resolves to an invalid # object? def test_loadTestsFromNames__relative_bad_object(self): m = types.ModuleType('m') m.testcase_1 = object() loader = unittest.TestLoader() try: loader.loadTestsFromNames(['testcase_1'], m) except TypeError: pass else: self.fail("Should have raised TypeError") # "The specifier name is a ``dotted name'' that may resolve ... to # ... a test case class" def test_loadTestsFromNames__relative_TestCase_subclass(self): m = types.ModuleType('m') class MyTestCase(unittest.TestCase): def test(self): pass m.testcase_1 = MyTestCase loader = unittest.TestLoader() suite = loader.loadTestsFromNames(['testcase_1'], m) self.assertIsInstance(suite, loader.suiteClass) expected = loader.suiteClass([MyTestCase('test')]) self.assertEqual(list(suite), [expected]) # "The specifier name is a ``dotted name'' that may resolve ... to # ... a TestSuite instance" def test_loadTestsFromNames__relative_TestSuite(self): m = types.ModuleType('m') class MyTestCase(unittest.TestCase): def test(self): pass m.testsuite = unittest.TestSuite([MyTestCase('test')]) loader = unittest.TestLoader() suite = loader.loadTestsFromNames(['testsuite'], m) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), [m.testsuite]) # "The specifier name is a ``dotted name'' that may resolve ... to ... a # test method within a test case class" def test_loadTestsFromNames__relative_testmethod(self): m = types.ModuleType('m') class MyTestCase(unittest.TestCase): def test(self): pass m.testcase_1 = MyTestCase loader = unittest.TestLoader() suite = loader.loadTestsFromNames(['testcase_1.test'], m) self.assertIsInstance(suite, loader.suiteClass) ref_suite = unittest.TestSuite([MyTestCase('test')]) self.assertEqual(list(suite), [ref_suite]) # "The specifier name is a ``dotted name'' that may resolve ... to ... a # test method within a test case class" # # Does the method gracefully handle names that initially look like they # resolve to "a test method within a test case class" but don't? def test_loadTestsFromNames__relative_invalid_testmethod(self): m = types.ModuleType('m') class MyTestCase(unittest.TestCase): def test(self): pass m.testcase_1 = MyTestCase loader = unittest.TestLoader() try: loader.loadTestsFromNames(['testcase_1.testfoo'], m) except AttributeError as e: self.assertEqual(str(e), "type object 'MyTestCase' has no attribute 'testfoo'") else: self.fail("Failed to raise AttributeError") # "The specifier name is a ``dotted name'' that may resolve ... to # ... a callable object which returns a ... TestSuite instance" def test_loadTestsFromNames__callable__TestSuite(self): m = types.ModuleType('m') testcase_1 = unittest.FunctionTestCase(lambda: None) testcase_2 = unittest.FunctionTestCase(lambda: None) def return_TestSuite(): return unittest.TestSuite([testcase_1, testcase_2]) m.return_TestSuite = return_TestSuite loader = unittest.TestLoader() suite = loader.loadTestsFromNames(['return_TestSuite'], m) self.assertIsInstance(suite, loader.suiteClass) expected = unittest.TestSuite([testcase_1, testcase_2]) self.assertEqual(list(suite), [expected]) # "The specifier name is a ``dotted name'' that may resolve ... to # ... a callable object which returns a TestCase ... instance" def test_loadTestsFromNames__callable__TestCase_instance(self): m = types.ModuleType('m') testcase_1 = unittest.FunctionTestCase(lambda: None) def return_TestCase(): return testcase_1 m.return_TestCase = return_TestCase loader = unittest.TestLoader() suite = loader.loadTestsFromNames(['return_TestCase'], m) self.assertIsInstance(suite, loader.suiteClass) ref_suite = unittest.TestSuite([testcase_1]) self.assertEqual(list(suite), [ref_suite]) # "The specifier name is a ``dotted name'' that may resolve ... to # ... a callable object which returns a TestCase or TestSuite instance" # # Are staticmethods handled correctly? def test_loadTestsFromNames__callable__call_staticmethod(self): m = types.ModuleType('m') class Test1(unittest.TestCase): def test(self): pass testcase_1 = Test1('test') class Foo(unittest.TestCase): @staticmethod def foo(): return testcase_1 m.Foo = Foo loader = unittest.TestLoader() suite = loader.loadTestsFromNames(['Foo.foo'], m) self.assertIsInstance(suite, loader.suiteClass) ref_suite = unittest.TestSuite([testcase_1]) self.assertEqual(list(suite), [ref_suite]) # "The specifier name is a ``dotted name'' that may resolve ... to # ... a callable object which returns a TestCase or TestSuite instance" # # What happens when the callable returns something else? def test_loadTestsFromNames__callable__wrong_type(self): m = types.ModuleType('m') def return_wrong(): return 6 m.return_wrong = return_wrong loader = unittest.TestLoader() try: suite = loader.loadTestsFromNames(['return_wrong'], m) except TypeError: pass else: self.fail("TestLoader.loadTestsFromNames failed to raise TypeError") # "The specifier can refer to modules and packages which have not been # imported; they will be imported as a side-effect" def test_loadTestsFromNames__module_not_loaded(self): # We're going to try to load this module as a side-effect, so it # better not be loaded before we try. # module_name = 'unittest.test.dummy' sys.modules.pop(module_name, None) loader = unittest.TestLoader() try: suite = loader.loadTestsFromNames([module_name]) self.assertIsInstance(suite, loader.suiteClass) self.assertEqual(list(suite), [unittest.TestSuite()]) # module should now be loaded, thanks to loadTestsFromName() self.assertIn(module_name, sys.modules) finally: if module_name in sys.modules: del sys.modules[module_name] ################################################################ ### /Tests for TestLoader.loadTestsFromNames() ### Tests for TestLoader.getTestCaseNames() ################################################################ # "Return a sorted sequence of method names found within testCaseClass" # # Test.foobar is defined to make sure getTestCaseNames() respects # loader.testMethodPrefix def test_getTestCaseNames(self): class Test(unittest.TestCase): def test_1(self): pass def test_2(self): pass def foobar(self): pass loader = unittest.TestLoader() self.assertEqual(loader.getTestCaseNames(Test), ['test_1', 'test_2']) # "Return a sorted sequence of method names found within testCaseClass" # # Does getTestCaseNames() behave appropriately if no tests are found? def test_getTestCaseNames__no_tests(self): class Test(unittest.TestCase): def foobar(self): pass loader = unittest.TestLoader() self.assertEqual(loader.getTestCaseNames(Test), []) # "Return a sorted sequence of method names found within testCaseClass" # # Are not-TestCases handled gracefully? # # XXX This should raise a TypeError, not return a list # # XXX It's too late in the 2.5 release cycle to fix this, but it should # probably be revisited for 2.6 def test_getTestCaseNames__not_a_TestCase(self): class BadCase(int): def test_foo(self): pass loader = unittest.TestLoader() names = loader.getTestCaseNames(BadCase) self.assertEqual(names, ['test_foo']) # "Return a sorted sequence of method names found within testCaseClass" # # Make sure inherited names are handled. # # TestP.foobar is defined to make sure getTestCaseNames() respects # loader.testMethodPrefix def test_getTestCaseNames__inheritance(self): class TestP(unittest.TestCase): def test_1(self): pass def test_2(self): pass def foobar(self): pass class TestC(TestP): def test_1(self): pass def test_3(self): pass loader = unittest.TestLoader() names = ['test_1', 'test_2', 'test_3'] self.assertEqual(loader.getTestCaseNames(TestC), names) ################################################################ ### /Tests for TestLoader.getTestCaseNames() ### Tests for TestLoader.testMethodPrefix ################################################################ # "String giving the prefix of method names which will be interpreted as # test methods" # # Implicit in the documentation is that testMethodPrefix is respected by # all loadTestsFrom* methods. def test_testMethodPrefix__loadTestsFromTestCase(self): class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass def foo_bar(self): pass tests_1 = unittest.TestSuite([Foo('foo_bar')]) tests_2 = unittest.TestSuite([Foo('test_1'), Foo('test_2')]) loader = unittest.TestLoader() loader.testMethodPrefix = 'foo' self.assertEqual(loader.loadTestsFromTestCase(Foo), tests_1) loader.testMethodPrefix = 'test' self.assertEqual(loader.loadTestsFromTestCase(Foo), tests_2) # "String giving the prefix of method names which will be interpreted as # test methods" # # Implicit in the documentation is that testMethodPrefix is respected by # all loadTestsFrom* methods. def test_testMethodPrefix__loadTestsFromModule(self): m = types.ModuleType('m') class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass def foo_bar(self): pass m.Foo = Foo tests_1 = [unittest.TestSuite([Foo('foo_bar')])] tests_2 = [unittest.TestSuite([Foo('test_1'), Foo('test_2')])] loader = unittest.TestLoader() loader.testMethodPrefix = 'foo' self.assertEqual(list(loader.loadTestsFromModule(m)), tests_1) loader.testMethodPrefix = 'test' self.assertEqual(list(loader.loadTestsFromModule(m)), tests_2) # "String giving the prefix of method names which will be interpreted as # test methods" # # Implicit in the documentation is that testMethodPrefix is respected by # all loadTestsFrom* methods. def test_testMethodPrefix__loadTestsFromName(self): m = types.ModuleType('m') class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass def foo_bar(self): pass m.Foo = Foo tests_1 = unittest.TestSuite([Foo('foo_bar')]) tests_2 = unittest.TestSuite([Foo('test_1'), Foo('test_2')]) loader = unittest.TestLoader() loader.testMethodPrefix = 'foo' self.assertEqual(loader.loadTestsFromName('Foo', m), tests_1) loader.testMethodPrefix = 'test' self.assertEqual(loader.loadTestsFromName('Foo', m), tests_2) # "String giving the prefix of method names which will be interpreted as # test methods" # # Implicit in the documentation is that testMethodPrefix is respected by # all loadTestsFrom* methods. def test_testMethodPrefix__loadTestsFromNames(self): m = types.ModuleType('m') class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass def foo_bar(self): pass m.Foo = Foo tests_1 = unittest.TestSuite([unittest.TestSuite([Foo('foo_bar')])]) tests_2 = unittest.TestSuite([Foo('test_1'), Foo('test_2')]) tests_2 = unittest.TestSuite([tests_2]) loader = unittest.TestLoader() loader.testMethodPrefix = 'foo' self.assertEqual(loader.loadTestsFromNames(['Foo'], m), tests_1) loader.testMethodPrefix = 'test' self.assertEqual(loader.loadTestsFromNames(['Foo'], m), tests_2) # "The default value is 'test'" def test_testMethodPrefix__default_value(self): loader = unittest.TestLoader() self.assertEqual(loader.testMethodPrefix, 'test') ################################################################ ### /Tests for TestLoader.testMethodPrefix ### Tests for TestLoader.sortTestMethodsUsing ################################################################ # "Function to be used to compare method names when sorting them in # getTestCaseNames() and all the loadTestsFromX() methods" def test_sortTestMethodsUsing__loadTestsFromTestCase(self): def reversed_cmp(x, y): return -((x > y) - (x < y)) class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass loader = unittest.TestLoader() loader.sortTestMethodsUsing = reversed_cmp tests = loader.suiteClass([Foo('test_2'), Foo('test_1')]) self.assertEqual(loader.loadTestsFromTestCase(Foo), tests) # "Function to be used to compare method names when sorting them in # getTestCaseNames() and all the loadTestsFromX() methods" def test_sortTestMethodsUsing__loadTestsFromModule(self): def reversed_cmp(x, y): return -((x > y) - (x < y)) m = types.ModuleType('m') class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass m.Foo = Foo loader = unittest.TestLoader() loader.sortTestMethodsUsing = reversed_cmp tests = [loader.suiteClass([Foo('test_2'), Foo('test_1')])] self.assertEqual(list(loader.loadTestsFromModule(m)), tests) # "Function to be used to compare method names when sorting them in # getTestCaseNames() and all the loadTestsFromX() methods" def test_sortTestMethodsUsing__loadTestsFromName(self): def reversed_cmp(x, y): return -((x > y) - (x < y)) m = types.ModuleType('m') class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass m.Foo = Foo loader = unittest.TestLoader() loader.sortTestMethodsUsing = reversed_cmp tests = loader.suiteClass([Foo('test_2'), Foo('test_1')]) self.assertEqual(loader.loadTestsFromName('Foo', m), tests) # "Function to be used to compare method names when sorting them in # getTestCaseNames() and all the loadTestsFromX() methods" def test_sortTestMethodsUsing__loadTestsFromNames(self): def reversed_cmp(x, y): return -((x > y) - (x < y)) m = types.ModuleType('m') class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass m.Foo = Foo loader = unittest.TestLoader() loader.sortTestMethodsUsing = reversed_cmp tests = [loader.suiteClass([Foo('test_2'), Foo('test_1')])] self.assertEqual(list(loader.loadTestsFromNames(['Foo'], m)), tests) # "Function to be used to compare method names when sorting them in # getTestCaseNames()" # # Does it actually affect getTestCaseNames()? def test_sortTestMethodsUsing__getTestCaseNames(self): def reversed_cmp(x, y): return -((x > y) - (x < y)) class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass loader = unittest.TestLoader() loader.sortTestMethodsUsing = reversed_cmp test_names = ['test_2', 'test_1'] self.assertEqual(loader.getTestCaseNames(Foo), test_names) # "The default value is the built-in cmp() function" # Since cmp is now defunct, we simply verify that the results # occur in the same order as they would with the default sort. def test_sortTestMethodsUsing__default_value(self): loader = unittest.TestLoader() class Foo(unittest.TestCase): def test_2(self): pass def test_3(self): pass def test_1(self): pass test_names = ['test_2', 'test_3', 'test_1'] self.assertEqual(loader.getTestCaseNames(Foo), sorted(test_names)) # "it can be set to None to disable the sort." # # XXX How is this different from reassigning cmp? Are the tests returned # in a random order or something? This behaviour should die def test_sortTestMethodsUsing__None(self): class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass loader = unittest.TestLoader() loader.sortTestMethodsUsing = None test_names = ['test_2', 'test_1'] self.assertEqual(set(loader.getTestCaseNames(Foo)), set(test_names)) ################################################################ ### /Tests for TestLoader.sortTestMethodsUsing ### Tests for TestLoader.suiteClass ################################################################ # "Callable object that constructs a test suite from a list of tests." def test_suiteClass__loadTestsFromTestCase(self): class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass def foo_bar(self): pass tests = [Foo('test_1'), Foo('test_2')] loader = unittest.TestLoader() loader.suiteClass = list self.assertEqual(loader.loadTestsFromTestCase(Foo), tests) # It is implicit in the documentation for TestLoader.suiteClass that # all TestLoader.loadTestsFrom* methods respect it. Let's make sure def test_suiteClass__loadTestsFromModule(self): m = types.ModuleType('m') class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass def foo_bar(self): pass m.Foo = Foo tests = [[Foo('test_1'), Foo('test_2')]] loader = unittest.TestLoader() loader.suiteClass = list self.assertEqual(loader.loadTestsFromModule(m), tests) # It is implicit in the documentation for TestLoader.suiteClass that # all TestLoader.loadTestsFrom* methods respect it. Let's make sure def test_suiteClass__loadTestsFromName(self): m = types.ModuleType('m') class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass def foo_bar(self): pass m.Foo = Foo tests = [Foo('test_1'), Foo('test_2')] loader = unittest.TestLoader() loader.suiteClass = list self.assertEqual(loader.loadTestsFromName('Foo', m), tests) # It is implicit in the documentation for TestLoader.suiteClass that # all TestLoader.loadTestsFrom* methods respect it. Let's make sure def test_suiteClass__loadTestsFromNames(self): m = types.ModuleType('m') class Foo(unittest.TestCase): def test_1(self): pass def test_2(self): pass def foo_bar(self): pass m.Foo = Foo tests = [[Foo('test_1'), Foo('test_2')]] loader = unittest.TestLoader() loader.suiteClass = list self.assertEqual(loader.loadTestsFromNames(['Foo'], m), tests) # "The default value is the TestSuite class" def test_suiteClass__default_value(self): loader = unittest.TestLoader() self.assertTrue(loader.suiteClass is unittest.TestSuite)
mit
blakeboswell/valence
setup.py
1
1919
#!/usr/bin/env python import os from setuptools import setup from pyvalence import __version__ PKG_NAME = 'pyvalence' PKG_AUTHOR = 'Audere Labs' PKG_LICENSE = 'BSD' AUTHOR_EMAIL = 'audere.labs@gmail.com' MAINTAINER_EMAIL = '' # google group / forum URL = 'https://audere.github.com/valence' DOWNLOAD_URL = '' DESCRIPTION = 'Package for processing analytical chemistry data.' # Get the long description from the README file LONG_DESCRIPTION = 'pyvalence is a python package for processing data generated from analytical chemistry. pyvalence reads analytical data from native formats into readily accessible pandas DataFrames and supports common analysis techniques (e.g. standard curves regression and utilization) to reduce manual, one-off data processing. Analysis conducted with pyvalence allows researchers to spend less time processing data and more time interpreting results.' options = { 'version': __version__, 'name': PKG_NAME, 'author': PKG_AUTHOR, 'license': PKG_LICENSE, 'author_email': AUTHOR_EMAIL, 'maintainer_email': MAINTAINER_EMAIL, 'url': URL, 'download_url': DOWNLOAD_URL, 'description': DESCRIPTION, 'long_description': LONG_DESCRIPTION, 'platforms': ['Any'], 'classifiers': [ 'Development Status :: 1 - Planning', 'Environment :: Console', 'Intended Audience :: Science/Research', 'Operating System :: OS Independent', 'Programming Language :: Python :: 3.3', 'Programming Language :: Python :: 3.4', 'Programming Language :: Python :: 3.5', 'Programming Language :: Python :: 3.6', 'Topic :: Scientific/Engineering :: Chemistry' ], 'packages': [ 'pyvalence', 'pyvalence.build', 'pyvalence.analyze' ], 'package_data': {'pyvalence': []}, 'include_package_data': True, 'install_requires': ['numpy', 'scipy', 'pandas'] } setup(**options)
bsd-3-clause
pixbuffer/django-cms
cms/templatetags/cms_tags.py
3
17870
# -*- coding: utf-8 -*- from itertools import chain from classytags.arguments import Argument, MultiValueArgument from classytags.core import Options, Tag from classytags.helpers import InclusionTag, AsTag from classytags.parser import Parser from cms.models import Page, Placeholder as PlaceholderModel from cms.plugin_rendering import render_placeholder from cms.plugins.utils import get_plugins, assign_plugins from cms.utils import get_language_from_request, get_cms_setting from cms.utils.page_resolver import get_page_queryset, use_draft from cms.utils.placeholder import validate_placeholder_name from django import template from django.conf import settings from django.contrib.sites.models import Site from django.core.cache import cache from django.core.mail import mail_managers from django.utils.html import escape from django.utils.safestring import mark_safe from django.utils.translation import ugettext_lazy as _, get_language import re from sekizai.helpers import Watcher, get_varname register = template.Library() def get_site_id(site): if site: if isinstance(site, Site): site_id = site.id elif isinstance(site, int) or (isinstance(site, basestring) and site.isdigit()): site_id = int(site) else: site_id = settings.SITE_ID else: site_id = settings.SITE_ID return site_id def has_permission(page, request): return page.has_change_permission(request) register.filter(has_permission) CLEAN_KEY_PATTERN = re.compile(r'[^a-zA-Z0-9_-]') def _clean_key(key): return CLEAN_KEY_PATTERN.sub('-', key) def _get_cache_key(name, page_lookup, lang, site_id): if isinstance(page_lookup, Page): page_key = str(page_lookup.pk) else: page_key = str(page_lookup) page_key = _clean_key(page_key) return name + '__page_lookup:' + page_key + '_site:' + str(site_id) + '_lang:' + str(lang) def _get_page_by_untyped_arg(page_lookup, request, site_id): """ The `page_lookup` argument can be of any of the following types: - Integer: interpreted as `pk` of the desired page - String: interpreted as `reverse_id` of the desired page - `dict`: a dictionary containing keyword arguments to find the desired page (for instance: `{'pk': 1}`) - `Page`: you can also pass a Page object directly, in which case there will be no database lookup. - `None`: the current page will be used """ if page_lookup is None: return request.current_page if isinstance(page_lookup, Page): return page_lookup if isinstance(page_lookup, basestring): page_lookup = {'reverse_id': page_lookup} elif isinstance(page_lookup, (int, long)): page_lookup = {'pk': page_lookup} elif not isinstance(page_lookup, dict): raise TypeError('The page_lookup argument can be either a Dictionary, Integer, Page, or String.') page_lookup.update({'site': site_id}) try: if 'pk' in page_lookup: page = Page.objects.all().get(**page_lookup) if request and use_draft(request): if page.publisher_is_draft: return page else: return page.publisher_draft else: if page.publisher_is_draft: return page.publisher_public else: return page else: return get_page_queryset(request).get(**page_lookup) except Page.DoesNotExist: site = Site.objects.get_current() subject = _('Page not found on %(domain)s') % {'domain': site.domain} body = _("A template tag couldn't find the page with lookup arguments `%(page_lookup)s\n`. " "The URL of the request was: http://%(host)s%(path)s") \ % {'page_lookup': repr(page_lookup), 'host': site.domain, 'path': request.path} if settings.DEBUG: raise Page.DoesNotExist(body) else: if settings.SEND_BROKEN_LINK_EMAILS: mail_managers(subject, body, fail_silently=True) return None class PageUrl(InclusionTag): template = 'cms/content.html' name = 'page_url' options = Options( Argument('page_lookup'), Argument('lang', required=False, default=None), Argument('site', required=False, default=None), ) def get_context(self, context, page_lookup, lang, site): site_id = get_site_id(site) request = context.get('request', False) if not request: return {'content': ''} if request.current_page == "dummy": return {'content': ''} if lang is None: lang = get_language_from_request(request) cache_key = _get_cache_key('page_url', page_lookup, lang, site_id) + '_type:absolute_url' url = cache.get(cache_key) if not url: page = _get_page_by_untyped_arg(page_lookup, request, site_id) if page: url = page.get_absolute_url(language=lang) cache.set(cache_key, url, get_cms_setting('CACHE_DURATIONS')['content']) if url: return {'content': url} return {'content': ''} register.tag(PageUrl) register.tag('page_id_url', PageUrl) def _get_placeholder(current_page, page, context, name): from cms.utils.plugins import get_placeholders placeholder_cache = getattr(current_page, '_tmp_placeholders_cache', {}) if page.pk in placeholder_cache: return placeholder_cache[page.pk].get(name, None) placeholder_cache[page.pk] = {} slots = get_placeholders(page.get_template()) placeholders = page.placeholders.filter(slot__in=slots) assign_plugins(context['request'], placeholders, get_language()) for placeholder in placeholders: placeholder_cache[page.pk][placeholder.slot] = placeholder placeholder.page = page current_page._tmp_placeholders_cache = placeholder_cache return placeholder_cache[page.pk].get(name, None) def get_placeholder_content(context, request, current_page, name, inherit): edit_mode = getattr(request, 'toolbar', None) and getattr(request.toolbar, 'edit_mode') pages = [current_page] # don't display inherited plugins in edit mode, so that the user doesn't # mistakenly edit/delete them. This is a fix for issue #1303. See the discussion # there for possible enhancements if inherit and not edit_mode: pages = chain([current_page], current_page.get_cached_ancestors(ascending=True)) for page in pages: placeholder = _get_placeholder(current_page, page, context, name) if placeholder is None: continue if not get_plugins(request, placeholder): continue content = render_placeholder(placeholder, context, name) if content: return content # if we reach this point, we have an empty or non-existant placeholder # call _get_placeholder again to get the placeholder properly rendered # in frontend editing placeholder = _get_placeholder(current_page, current_page, context, name) return render_placeholder(placeholder, context, name) class PlaceholderParser(Parser): def parse_blocks(self): for bit in getattr(self.kwargs['extra_bits'], 'value', self.kwargs['extra_bits']): if getattr(bit, 'value', bit.var.value) == 'or': return super(PlaceholderParser, self).parse_blocks() return class PlaceholderOptions(Options): def get_parser_class(self): return PlaceholderParser class Placeholder(Tag): """ This template node is used to output page content and is also used in the admin to dynamically generate input fields. eg: {% placeholder "placeholder_name" %} {% placeholder "sidebar" inherit %} {% placeholder "footer" inherit or %} <a href="/about/">About us</a> {% endplaceholder %} Keyword arguments: name -- the name of the placeholder width -- additional width attribute (integer) which gets added to the plugin context (deprecated, use `{% with 320 as width %}{% placeholder "foo"}{% endwith %}`) inherit -- optional argument which if given will result in inheriting the content of the placeholder with the same name on parent pages or -- optional argument which if given will make the template tag a block tag whose content is shown if the placeholder is empty """ name = 'placeholder' options = PlaceholderOptions( Argument('name', resolve=False), MultiValueArgument('extra_bits', required=False, resolve=False), blocks=[ ('endplaceholder', 'nodelist'), ] ) def render_tag(self, context, name, extra_bits, nodelist=None): validate_placeholder_name(name) width = None inherit = False for bit in extra_bits: if bit == 'inherit': inherit = True elif bit.isdigit(): width = int(bit) import warnings warnings.warn( "The width parameter for the placeholder tag is deprecated.", DeprecationWarning ) if not 'request' in context: return '' request = context['request'] if width: context.update({'width': width}) page = request.current_page if not page or page == 'dummy': if nodelist: return nodelist.render(context) return '' content = get_placeholder_content(context, request, page, name, inherit) if not content and nodelist: return nodelist.render(context) return content def get_name(self): return self.kwargs['name'].var.value.strip('"').strip("'") register.tag(Placeholder) class RenderPlugin(InclusionTag): template = 'cms/content.html' name = 'render_plugin' options = Options( Argument('plugin') ) def get_context(self, context, plugin): # Prepend frontedit toolbar output if applicable edit = False request = context['request'] toolbar = getattr(request, 'toolbar', None) page = request.current_page if toolbar.edit_mode and (not page or page.has_change_permission(request)): edit = True if edit: from cms.middleware.toolbar import toolbar_plugin_processor processors = (toolbar_plugin_processor,) else: processors = None return {'content': plugin.render_plugin(context, processors=processors)} register.tag(RenderPlugin) class PageAttribute(AsTag): """ This template node is used to output attribute from a page such as its title or slug. Synopsis {% page_attribute "field-name" %} {% page_attribute "field-name" as varname %} {% page_attribute "field-name" page_lookup %} {% page_attribute "field-name" page_lookup as varname %} Example {# Output current page's page_title attribute: #} {% page_attribute "page_title" %} {# Output page_title attribute of the page with reverse_id "the_page": #} {% page_attribute "page_title" "the_page" %} {# Output slug attribute of the page with pk 10: #} {% page_attribute "slug" 10 %} {# Assign page_title attribute to a variable: #} {% page_attribute "page_title" as title %} Keyword arguments: field-name -- the name of the field to output. Use one of: - title - menu_title - page_title - slug - meta_description - meta_keywords page_lookup -- lookup argument for Page, if omitted field-name of current page is returned. See _get_page_by_untyped_arg() for detailed information on the allowed types and their interpretation for the page_lookup argument. varname -- context variable name. Output will be added to template context as this variable. This argument is required to follow the 'as' keyword. """ name = 'page_attribute' options = Options( Argument('name', resolve=False), Argument('page_lookup', required=False, default=None), 'as', Argument('varname', required=False, resolve=False) ) valid_attributes = [ "title", "slug", "meta_description", "meta_keywords", "page_title", "menu_title" ] def get_value(self, context, name, page_lookup): if not 'request' in context: return '' name = name.lower() request = context['request'] lang = get_language_from_request(request) page = _get_page_by_untyped_arg(page_lookup, request, get_site_id(None)) if page == "dummy": return '' if page and name in self.valid_attributes: func = getattr(page, "get_%s" % name) return escape(func(language=lang, fallback=True)) return '' register.tag(PageAttribute) class CleanAdminListFilter(InclusionTag): template = 'admin/filter.html' name = 'clean_admin_list_filter' options = Options( Argument('cl'), Argument('spec'), ) def get_context(self, context, cl, spec): choices = sorted(list(spec.choices(cl)), key=lambda k: k['query_string']) query_string = None unique_choices = [] for choice in choices: if choice['query_string'] != query_string: unique_choices.append(choice) query_string = choice['query_string'] return {'title': spec.title(), 'choices': unique_choices} def _restore_sekizai(context, changes): varname = get_varname() sekizai_container = context[varname] for key, values in changes.items(): sekizai_namespace = sekizai_container[key] for value in values: sekizai_namespace.append(value) def _show_placeholder_for_page(context, placeholder_name, page_lookup, lang=None, site=None, cache_result=True): """ Shows the content of a page with a placeholder name and given lookup arguments in the given language. This is useful if you want to have some more or less static content that is shared among many pages, such as a footer. See _get_page_by_untyped_arg() for detailed information on the allowed types and their interpretation for the page_lookup argument. """ validate_placeholder_name(placeholder_name) request = context.get('request', False) site_id = get_site_id(site) if not request: return {'content': ''} if lang is None: lang = get_language_from_request(request) if cache_result: base_key = _get_cache_key('_show_placeholder_for_page', page_lookup, lang, site_id) cache_key = _clean_key('%s_placeholder:%s' % (base_key, placeholder_name)) cached_value = cache.get(cache_key) if isinstance(cached_value, dict): # new style _restore_sekizai(context, cached_value['sekizai']) return {'content': mark_safe(cached_value['content'])} elif isinstance(cached_value, basestring): # old style return {'content': mark_safe(cached_value)} page = _get_page_by_untyped_arg(page_lookup, request, site_id) if not page: return {'content': ''} try: placeholder = page.placeholders.get(slot=placeholder_name) except PlaceholderModel.DoesNotExist: if settings.DEBUG: raise return {'content': ''} watcher = Watcher(context) content = render_placeholder(placeholder, context, placeholder_name) changes = watcher.get_changes() if cache_result: cache.set(cache_key, {'content': content, 'sekizai': changes}, get_cms_setting('CACHE_DURATIONS')['content']) if content: return {'content': mark_safe(content)} return {'content': ''} class ShowPlaceholderById(InclusionTag): template = 'cms/content.html' name = 'show_placeholder_by_id' options = Options( Argument('placeholder_name'), Argument('reverse_id'), Argument('lang', required=False, default=None), Argument('site', required=False, default=None), ) def get_context(self, *args, **kwargs): return _show_placeholder_for_page(**self.get_kwargs(*args, **kwargs)) def get_kwargs(self, context, placeholder_name, reverse_id, lang, site): return { 'context': context, 'placeholder_name': placeholder_name, 'page_lookup': reverse_id, 'lang': lang, 'site': site } register.tag(ShowPlaceholderById) register.tag('show_placeholder', ShowPlaceholderById) class ShowUncachedPlaceholderById(ShowPlaceholderById): name = 'show_uncached_placeholder_by_id' def get_kwargs(self, *args, **kwargs): kwargs = super(ShowUncachedPlaceholderById, self).get_kwargs(*args, **kwargs) kwargs['cache_result'] = False return kwargs register.tag(ShowUncachedPlaceholderById) register.tag('show_uncached_placeholder', ShowUncachedPlaceholderById) class CMSToolbar(InclusionTag): template = 'cms/toolbar/toolbar.html' name = 'cms_toolbar' def render(self, context): request = context.get('request', None) if not request: return '' toolbar = getattr(request, 'toolbar', None) if not toolbar: return '' if not toolbar.show_toolbar: return '' return super(CMSToolbar, self).render(context) def get_context(self, context): context['CMS_TOOLBAR_CONFIG'] = context['request'].toolbar.as_json(context) return context register.tag(CMSToolbar)
bsd-3-clause
fxfitz/ansible
test/units/modules/network/enos/test_enos_config.py
45
5146
# # (c) 2016 Red Hat Inc. # # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see <http://www.gnu.org/licenses/>. # Make coding more python3-ish from __future__ import (absolute_import, division, print_function) __metaclass__ = type import json from ansible.compat.tests.mock import patch from ansible.modules.network.enos import enos_config from .enos_module import TestEnosModule, load_fixture, set_module_args class TestEnosConfigModule(TestEnosModule): module = enos_config def setUp(self): self.patcher_get_config = patch('ansible.modules.network.enos.enos_config.get_config') self.mock_get_config = self.patcher_get_config.start() self.patcher_exec_command = patch('ansible.modules.network.enos.enos_config.load_config') self.mock_exec_command = self.patcher_exec_command.start() def tearDown(self): self.patcher_get_config.stop() self.patcher_exec_command.stop() def load_fixtures(self, commands=None): config_file = 'enos_config_config.cfg' self.mock_get_config.return_value = load_fixture(config_file) self.mock_exec_command.return_value = 'dummy diff' def test_enos_config_unchanged(self): src = load_fixture('enos_config_config.cfg') set_module_args(dict(src=src)) self.execute_module() def test_enos_config_src(self): src = load_fixture('enos_config_src.cfg') set_module_args(dict(src=src)) commands = ['hostname foo', 'interface ip 13', 'no ip ospf enable'] self.execute_module(changed=True, commands=commands) def test_enos_config_backup(self): set_module_args(dict(backup=True)) result = self.execute_module() self.assertIn('__backup__', result) def test_enos_config_lines_wo_parents(self): set_module_args(dict(lines=['hostname foo'])) commands = ['hostname foo'] self.execute_module(changed=True, commands=commands) def test_enos_config_lines_w_parents(self): set_module_args(dict(lines=['shutdown'], parents=['interface ip 13'])) commands = ['interface ip 13', 'shutdown'] self.execute_module(changed=True, commands=commands) def test_enos_config_before(self): set_module_args(dict(lines=['hostname foo'], before=['test1', 'test2'])) commands = ['test1', 'test2', 'hostname foo'] self.execute_module(changed=True, commands=commands, sort=False) def test_enos_config_after(self): set_module_args(dict(lines=['hostname foo'], after=['test1', 'test2'])) commands = ['hostname foo', 'test1', 'test2'] self.execute_module(changed=True, commands=commands, sort=False) def test_enos_config_before_after_no_change(self): set_module_args(dict(lines=['hostname router'], before=['test1', 'test2'], after=['test3', 'test4'])) self.execute_module() def test_enos_config_config(self): config = 'hostname localhost' set_module_args(dict(lines=['hostname router'], config=config)) commands = ['hostname router'] self.execute_module(changed=True, commands=commands) def test_enos_config_replace_block(self): lines = ['description test string', 'test string'] parents = ['interface ip 13'] set_module_args(dict(lines=lines, replace='block', parents=parents)) commands = parents + lines self.execute_module(changed=True, commands=commands) def test_enos_config_match_none(self): lines = ['ip address 1.2.3.4 255.255.255.0', 'description test string'] parents = ['interface ip 13'] set_module_args(dict(lines=lines, parents=parents, match='none')) commands = parents + lines self.execute_module(changed=True, commands=commands, sort=False) def test_enos_config_match_strict(self): lines = ['ip address 1.2.3.4 255.255.255.0', 'exit'] parents = ['interface ip 13'] set_module_args(dict(lines=lines, parents=parents, match='strict')) commands = parents + ['exit'] self.execute_module(changed=True, commands=commands, sort=False) def test_enos_config_match_exact(self): lines = ['ip address 1.2.3.4 255.255.255.0', 'description test string', 'shutdown'] parents = ['interface ip 13'] set_module_args(dict(lines=lines, parents=parents, match='exact')) commands = parents + lines self.execute_module(changed=True, commands=commands, sort=False)
gpl-3.0
ctb/cvxpy
examples/advanced/test.py
12
2380
from cvxpy import * import cvxopt import numpy as np # # Problem data. # m = 100 # n = 30 # A = cvxopt.normal(m,n) # b = cvxopt.normal(m) # import cProfile # # Construct the problem. # x = Variable(n) # u = m*[[1]] # t = Variable(m,m) # # objective = Minimize( sum(t) ) # # constraints = [0 <= t, t <= 1] # # p = Problem(objective, constraints) # # The optimal objective is returned by p.solve(). # cProfile.run(""" # sum(t) # """) # # The optimal value for x is stored in x.value. # #print x.value # # The optimal Lagrange multiplier for a constraint # # is stored in constraint.dual_value. # #print constraints[0].dual_value class MyMeta(type): def __getitem__(self, key): print key return 2 def __len__(self): return 1 def __contains__(self, obj): print "hello" return 0 class Exp(object): def __add__(self, other): return 0 def __radd__(self, other): return 1 def __rmul__(self, other): print 1 __array_priority__ = 100 import numpy as np a = np.random.random((2,2)) class Bar1(object): __metaclass__ = MyMeta def __add__(self, rhs): return 0 def __radd__(self, rhs): return 1 def __lt__(self, rhs): return 0 def __le__(self, rhs): return 1 def __eq__(self, rhs): return 2 def __ne__(self, rhs): return 3 def __gt__(self, rhs): return 4 def __ge__(self, rhs): return 5 def __array_prepare__(self): print "hello" return self def __array_wrap__(self): return self def __array__(self): print "Afafaf" arr = np.array([self], dtype="object") return arr __array_priority__ = 100 def override(name): if name == "equal": def ufunc(x, y): print y if isinstance(y, Bar1) or \ isinstance(y, np.ndarray) and isinstance(y[0], Bar1): return NotImplemented return getattr(np, name)(x, y) return ufunc else: def ufunc(x, y): print y if isinstance(y, Bar1): return NotImplemented return getattr(np, name)(x, y) return ufunc np.set_numeric_ops( ** { ufunc : override(ufunc) for ufunc in ( "less_equal", "equal", "greater_equal" ) } ) b = Bar1() print a == b print a <= b print a + b
gpl-3.0
duramato/SickRage
sickbeard/providers/binsearch.py
2
3923
# Author: moparisthebest <admin@moparisthebest.com> # # This file is part of Sick Beard. # # Sick Beard is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Sick Beard is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Sick Beard. If not, see <http://www.gnu.org/licenses/>. import urllib import re import generic from sickbeard import logger from sickbeard import tvcache class BinSearchProvider(generic.NZBProvider): def __init__(self): generic.NZBProvider.__init__(self, "BinSearch") self.enabled = False self.public = True self.cache = BinSearchCache(self) self.urls = {'base_url': 'https://www.binsearch.info/'} self.url = self.urls['base_url'] def isEnabled(self): return self.enabled class BinSearchCache(tvcache.TVCache): def __init__(self, provider): tvcache.TVCache.__init__(self, provider) # only poll Binsearch every 30 minutes max self.minTime = 30 # compile and save our regular expressions # this pulls the title from the URL in the description self.descTitleStart = re.compile('^.*https?://www\.binsearch\.info/.b=') self.descTitleEnd = re.compile('&amp;.*$') # these clean up the horrible mess of a title if the above fail self.titleCleaners = [ re.compile('.?yEnc.?\(\d+/\d+\)$'), re.compile(' \[\d+/\d+\] '), ] def _get_title_and_url(self, item): """ Retrieves the title and URL data from the item XML node item: An elementtree.ElementTree element representing the <item> tag of the RSS feed Returns: A tuple containing two strings representing title and URL respectively """ title = item.get('description') if title: title = u'' + title if self.descTitleStart.match(title): title = self.descTitleStart.sub('', title) title = self.descTitleEnd.sub('', title) title = title.replace('+', '.') else: # just use the entire title, looks hard/impossible to parse title = item.get('title') if title: for titleCleaner in self.titleCleaners: title = titleCleaner.sub('', title) url = item.get('link') if url: url = url.replace('&amp;', '&') return (title, url) def updateCache(self): # check if we should update if not self.shouldUpdate(): return # clear cache self._clearCache() # set updated self.setLastUpdate() cl = [] for group in ['alt.binaries.boneless','alt.binaries.misc','alt.binaries.hdtv','alt.binaries.hdtv.x264','alt.binaries.tv','alt.binaries.tvseries','alt.binaries.teevee']: url = self.provider.url + 'rss.php?' urlArgs = {'max': 1000,'g': group} url += urllib.urlencode(urlArgs) logger.log(u"Cache update URL: %s " % url, logger.DEBUG) for item in self.getRSSFeed(url)['entries'] or []: ci = self._parseItem(item) if ci is not None: cl.append(ci) if len(cl) > 0: myDB = self._getDB() myDB.mass_action(cl) def _checkAuth(self, data): return data if data['feed'] and data['feed']['title'] != 'Invalid Link' else None provider = BinSearchProvider()
gpl-3.0
rspavel/spack
var/spack/repos/builtin/packages/turbomole/package.py
5
6080
# Copyright 2013-2020 Lawrence Livermore National Security, LLC and other # Spack Project Developers. See the top-level COPYRIGHT file for details. # # SPDX-License-Identifier: (Apache-2.0 OR MIT) from spack import * import os import subprocess class Turbomole(Package): """TURBOMOLE: Program Package for ab initio Electronic Structure Calculations. Note: Turbomole requires purchase of a license to download. Go to the Turbomole home page, http://www.turbomole-gmbh.com, for details. Spack will search the current directory for this file. It is probably best to add this file to a Spack mirror so that it can be found from anywhere. For information on setting up a Spack mirror see http://spack.readthedocs.io/en/latest/mirrors.html""" homepage = "http://www.turbomole-gmbh.com/" manual_download = True version('7.0.2', '92b97e1e52e8dcf02a4d9ac0147c09d6', url="file://%s/turbolinux702.tar.gz" % os.getcwd()) variant('mpi', default=True, description='Set up MPI environment') variant('smp', default=False, description='Set up SMP environment') # Turbomole's install is odd. There are three variants # - serial # - parallel, MPI # - parallel, SMP # # Only one of these can be active at a time. MPI and SMP are set as # variants so there could be up to 3 installs per version. Switching # between them would be accomplished with `module swap` commands. def do_fetch(self, mirror_only=True): if '+mpi' in self.spec and '+smp' in self.spec: raise InstallError('Can not have both SMP and MPI enabled in the ' 'same build.') super(Turbomole, self).do_fetch(mirror_only) def get_tm_arch(self): if 'TURBOMOLE' in os.getcwd(): tm_sysname = Executable('./scripts/sysname') tm_arch = tm_sysname(output=str) return tm_arch.rstrip('\n') else: return def install(self, spec, prefix): calculate_version = 'calculate_2.4_linux64' molecontrol_version = 'MoleControl_2.5' tm_arch = self.get_tm_arch() tar = which('tar') dst = join_path(prefix, 'TURBOMOLE') tar('-x', '-z', '-f', 'thermocalc.tar.gz') with working_dir('thermocalc'): subprocess.call('./install<<<y', shell=True) install_tree('basen', join_path(dst, 'basen')) install_tree('cabasen', join_path(dst, 'cabasen')) install_tree(calculate_version, join_path(dst, calculate_version)) install_tree('cbasen', join_path(dst, 'cbasen')) install_tree('DOC', join_path(dst, 'DOC')) install_tree('jbasen', join_path(dst, 'jbasen')) install_tree('jkbasen', join_path(dst, 'jkbasen')) install_tree(molecontrol_version, join_path(dst, molecontrol_version)) install_tree('parameter', join_path(dst, 'parameter')) install_tree('perlmodules', join_path(dst, 'perlmodules')) install_tree('scripts', join_path(dst, 'scripts')) install_tree('smprun_scripts', join_path(dst, 'smprun_scripts')) install_tree('structures', join_path(dst, 'structures')) install_tree('thermocalc', join_path(dst, 'thermocalc')) install_tree('TURBOTEST', join_path(dst, 'TURBOTEST')) install_tree('xbasen', join_path(dst, 'xbasen')) install('Config_turbo_env', dst) install('Config_turbo_env.tcsh', dst) install('README', dst) install('README_LICENSES', dst) install('TURBOMOLE_702_LinuxPC', dst) if '+mpi' in spec: install_tree('bin/%s_mpi' % tm_arch, join_path(dst, 'bin', '%s_mpi' % tm_arch)) install_tree('libso/%s_mpi' % tm_arch, join_path(dst, 'libso', '%s_mpi' % tm_arch)) install_tree('mpirun_scripts/%s_mpi' % tm_arch, join_path(dst, 'mpirun_scripts', '%s_mpi' % tm_arch)) elif '+smp' in spec: install_tree('bin/%s_smp' % tm_arch, join_path(dst, 'bin', '%s_smp' % tm_arch)) install_tree('libso/%s_smp' % tm_arch, join_path(dst, 'libso', '%s_smp' % tm_arch)) install_tree('mpirun_scripts/%s_smp' % tm_arch, join_path(dst, 'mpirun_scripts', '%s_smp' % tm_arch)) else: install_tree('bin/%s' % tm_arch, join_path(dst, 'bin', tm_arch)) if '+mpi' in spec or '+smp' in spec: install('mpirun_scripts/ccsdf12', join_path(dst, 'mpirun_scripts')) install('mpirun_scripts/dscf', join_path(dst, 'mpirun_scripts')) install('mpirun_scripts/grad', join_path(dst, 'mpirun_scripts')) install('mpirun_scripts/mpgrad', join_path(dst, 'mpirun_scripts')) install('mpirun_scripts/pnoccsd', join_path(dst, 'mpirun_scripts')) install('mpirun_scripts/rdgrad', join_path(dst, 'mpirun_scripts')) install('mpirun_scripts/ricc2', join_path(dst, 'mpirun_scripts')) install('mpirun_scripts/ridft', join_path(dst, 'mpirun_scripts')) def setup_run_environment(self, env): molecontrol_version = 'MoleControl_2.5' tm_arch = self.get_tm_arch() env.set('TURBODIR', self.prefix.TURBOMOLE) env.set('MOLE_CONTROL', join_path(self.prefix, 'TURBOMOLE', molecontrol_version)) env.prepend_path('PATH', self.prefix.TURBOMOLE.thermocalc) env.prepend_path('PATH', self.prefix.TURBOMOLE.scripts) if '+mpi' in self.spec: env.set('PARA_ARCH', 'MPI') env.prepend_path('PATH', join_path( self.prefix, 'TURBOMOLE', 'bin', '%s_mpi' % tm_arch)) elif '+smp' in self.spec: env.set('PARA_ARCH', 'SMP') env.prepend_path('PATH', join_path( self.prefix, 'TURBOMOLE', 'bin', '%s_smp' % tm_arch)) else: env.prepend_path('PATH', join_path( self.prefix, 'TURBOMOLE', 'bin', tm_arch))
lgpl-2.1
GEMScienceTools/catalogue_toolkit
eqcat/parsers/converters.py
2
8002
# -*- coding: utf-8 -*- # vim: tabstop=4 shiftwidth=4 softtabstop=4 # # LICENSE # # Copyright (c) 2015 GEM Foundation # # The Catalogue Toolkit is free software: you can redistribute # it and/or modify it under the terms of the GNU Affero General Public # License as published by the Free Software Foundation, either version # 3 of the License, or (at your option) any later version. # # You should have received a copy of the GNU Affero General Public License # with this download. If not, see <http://www.gnu.org/licenses/> #!/usr/bin/env/python ''' Parser for generic catalogue into either ISFCatalogue format or GCMT catalogue format ''' import csv import datetime import numpy as np import eqcat.gcmt_utils as utils from math import floor from eqcat.parsers.base import _to_int, _to_str, _to_float from eqcat.parsers.generic_catalogue import GeneralCsvCatalogue from eqcat.isf_catalogue import (ISFCatalogue, Magnitude, Origin, Location, Event) from eqcat.parsers.gcmt_ndk_parser import ParseNDKtoGCMT def _header_check(input_keys, catalogue_keys): valid_key_list = [] for element in input_keys: if element in catalogue_keys: valid_key_list.append(element) else: print('Catalogue Attribute %s is not a recognised '\ 'catalogue key' % element) return valid_key_list def _float_check(attribute_array, value): """ Checks if value is valid float, appends to array if valid, appends nan if not """ value = value.strip(' ') if value: attribute_array = np.hstack([attribute_array, float(value)]) else: attribute_array = np.hstack([attribute_array, np.nan]) return attribute_array def _int_check(attribute_array, value): """ Checks if value is valid integer, appends to array if valid, appends nan if not """ value = value.strip(' ') if value: attribute_array = np.hstack([attribute_array, int(value)]) else: attribute_array = np.hstack([attribute_array, np.nan]) return attribute_array class GenericCataloguetoISFParser(object): ''' Reads the generic csv catalogue file to return an instance of the ISFCatalogue class ''' def __init__(self, filename): ''' ''' self.filename = filename self.catalogue = GeneralCsvCatalogue() def parse(self, cat_id, cat_name): ''' Opens the raw file parses the catalogue then exports ''' filedata = open(self.filename, 'rU') #self.catalogue = GeneralCsvCatalogue() # Reading the data file data = csv.DictReader(filedata) # Parsing the data content for irow, row in enumerate(data): if irow == 0: valid_key_list = _header_check(list(row.keys()), self.catalogue.TOTAL_ATTRIBUTE_LIST) for key in valid_key_list: if key in self.catalogue.FLOAT_ATTRIBUTE_LIST: self.catalogue.data[key] = _float_check( self.catalogue.data[key], row[key]) elif key in self.catalogue.INT_ATTRIBUTE_LIST: self.catalogue.data[key] = _int_check( self.catalogue.data[key], row[key]) else: self.catalogue.data[key].append(row[key]) output_cat = self.export(cat_id, cat_name) return output_cat def export(self, cat_id=None, cat_name=None): """ Exports the catalogue to ISF Format """ return self.catalogue.write_to_isf_catalogue(cat_id, cat_name) class GenericCataloguetoGCMT(GenericCataloguetoISFParser): ''' Reads the generic csv catalogue file to return an instance of the GCMT class class ''' def export(self, cat_id=None, cat_name=None): """ Exports the catalogue to GCMT format """ return catalogue.write_to_gcmt_class() class GCMTtoISFParser(object): ''' Read in a file in GCMT NDK format and parse to ISF Catalogue ''' def __init__(self, gcmt_file=None): ''' ''' if gcmt_file: self.filename = gcmt_file parser = ParseNDKtoGCMT(self.filename) self.catalogue = parser.read_file() else: self.filename = None self.catalogue = None @classmethod def from_catalogue(cls, catalogue, cat_id, cat_name): """ If a different parser has been used just instantiate the class """ self = cls() self.catalogue = catalogue if not len(self.catalogue): print("No events in catalogue - returning None") return None return self.parse(cat_id, cat_name) def parse(self, cat_id="GCMT", cat_name="GCMT"): ''' Returns the catalogue as an instance of an ISFCatalogue An ISF catalogue will have two origins: The hypocentre solution and the centroid ''' isf_cat = ISFCatalogue(cat_id, cat_name) n_cmts = self.catalogue.number_events() base_id = cat_id + '_' counter = 1 for gcmt in self.catalogue.gcmts: # Get IDs event_id = base_id + ("%06d" % counter) counter += 1 origin_id = gcmt.identifier.strip(' ') # Two origins - 1 hypocentre (mb, Ms, Mw), 2 - centroid (Mw) origin_mags = [] if gcmt.hypocentre.m_b: origin_mags.append(Magnitude(event_id, origin_id, gcmt.hypocentre.m_b, gcmt.hypocentre.source, scale='mb')) if gcmt.hypocentre.m_s: origin_mags.append(Magnitude(event_id, origin_id, gcmt.hypocentre.m_s, gcmt.hypocentre.source, scale='Ms')) m_w = Magnitude(event_id, origin_id + "-C", gcmt.magnitude, cat_id, scale='Mw') #origin_mags.append(m_w) # Get locations hypo_loc = Location(origin_id, gcmt.hypocentre.longitude, gcmt.hypocentre.latitude, gcmt.hypocentre.depth) centroid_loc = Location(origin_id + "-C", gcmt.centroid.longitude, gcmt.centroid.latitude, gcmt.centroid.depth, depth_error=gcmt.centroid.depth_error) # Get origins hypo = Origin(origin_id, gcmt.hypocentre.date, gcmt.hypocentre.time, hypo_loc, gcmt.hypocentre.source, is_prime=True) hypo.magnitudes = origin_mags # Get centroids centroid = Origin(origin_id + "-C", gcmt.centroid.date, gcmt.centroid.time, centroid_loc, cat_id, is_centroid=True, time_error=gcmt.centroid.time_error) centroid.magnitudes = [m_w] event = Event(event_id, [hypo, centroid], hypo.magnitudes + centroid.magnitudes, gcmt.hypocentre.location) setattr(event, 'tensor', gcmt.moment_tensor) isf_cat.events.append(event) return isf_cat
agpl-3.0
nzavagli/UnrealPy
UnrealPyEmbed/Source/Python/Lib/python27/encodings/cp861.py
593
34889
""" Python Character Mapping Codec generated from 'VENDORS/MICSFT/PC/CP861.TXT' with gencodec.py. """#" import codecs ### Codec APIs class Codec(codecs.Codec): def encode(self,input,errors='strict'): return codecs.charmap_encode(input,errors,encoding_map) def decode(self,input,errors='strict'): return codecs.charmap_decode(input,errors,decoding_table) class IncrementalEncoder(codecs.IncrementalEncoder): def encode(self, input, final=False): return codecs.charmap_encode(input,self.errors,encoding_map)[0] class IncrementalDecoder(codecs.IncrementalDecoder): def decode(self, input, final=False): return codecs.charmap_decode(input,self.errors,decoding_table)[0] class StreamWriter(Codec,codecs.StreamWriter): pass class StreamReader(Codec,codecs.StreamReader): pass ### encodings module API def getregentry(): return codecs.CodecInfo( name='cp861', encode=Codec().encode, decode=Codec().decode, incrementalencoder=IncrementalEncoder, incrementaldecoder=IncrementalDecoder, streamreader=StreamReader, streamwriter=StreamWriter, ) ### Decoding Map decoding_map = codecs.make_identity_dict(range(256)) decoding_map.update({ 0x0080: 0x00c7, # LATIN CAPITAL LETTER C WITH CEDILLA 0x0081: 0x00fc, # LATIN SMALL LETTER U WITH DIAERESIS 0x0082: 0x00e9, # LATIN SMALL LETTER E WITH ACUTE 0x0083: 0x00e2, # LATIN SMALL LETTER A WITH CIRCUMFLEX 0x0084: 0x00e4, # LATIN SMALL LETTER A WITH DIAERESIS 0x0085: 0x00e0, # LATIN SMALL LETTER A WITH GRAVE 0x0086: 0x00e5, # LATIN SMALL LETTER A WITH RING ABOVE 0x0087: 0x00e7, # LATIN SMALL LETTER C WITH CEDILLA 0x0088: 0x00ea, # LATIN SMALL LETTER E WITH CIRCUMFLEX 0x0089: 0x00eb, # LATIN SMALL LETTER E WITH DIAERESIS 0x008a: 0x00e8, # LATIN SMALL LETTER E WITH GRAVE 0x008b: 0x00d0, # LATIN CAPITAL LETTER ETH 0x008c: 0x00f0, # LATIN SMALL LETTER ETH 0x008d: 0x00de, # LATIN CAPITAL LETTER THORN 0x008e: 0x00c4, # LATIN CAPITAL LETTER A WITH DIAERESIS 0x008f: 0x00c5, # LATIN CAPITAL LETTER A WITH RING ABOVE 0x0090: 0x00c9, # LATIN CAPITAL LETTER E WITH ACUTE 0x0091: 0x00e6, # LATIN SMALL LIGATURE AE 0x0092: 0x00c6, # LATIN CAPITAL LIGATURE AE 0x0093: 0x00f4, # LATIN SMALL LETTER O WITH CIRCUMFLEX 0x0094: 0x00f6, # LATIN SMALL LETTER O WITH DIAERESIS 0x0095: 0x00fe, # LATIN SMALL LETTER THORN 0x0096: 0x00fb, # LATIN SMALL LETTER U WITH CIRCUMFLEX 0x0097: 0x00dd, # LATIN CAPITAL LETTER Y WITH ACUTE 0x0098: 0x00fd, # LATIN SMALL LETTER Y WITH ACUTE 0x0099: 0x00d6, # LATIN CAPITAL LETTER O WITH DIAERESIS 0x009a: 0x00dc, # LATIN CAPITAL LETTER U WITH DIAERESIS 0x009b: 0x00f8, # LATIN SMALL LETTER O WITH STROKE 0x009c: 0x00a3, # POUND SIGN 0x009d: 0x00d8, # LATIN CAPITAL LETTER O WITH STROKE 0x009e: 0x20a7, # PESETA SIGN 0x009f: 0x0192, # LATIN SMALL LETTER F WITH HOOK 0x00a0: 0x00e1, # LATIN SMALL LETTER A WITH ACUTE 0x00a1: 0x00ed, # LATIN SMALL LETTER I WITH ACUTE 0x00a2: 0x00f3, # LATIN SMALL LETTER O WITH ACUTE 0x00a3: 0x00fa, # LATIN SMALL LETTER U WITH ACUTE 0x00a4: 0x00c1, # LATIN CAPITAL LETTER A WITH ACUTE 0x00a5: 0x00cd, # LATIN CAPITAL LETTER I WITH ACUTE 0x00a6: 0x00d3, # LATIN CAPITAL LETTER O WITH ACUTE 0x00a7: 0x00da, # LATIN CAPITAL LETTER U WITH ACUTE 0x00a8: 0x00bf, # INVERTED QUESTION MARK 0x00a9: 0x2310, # REVERSED NOT SIGN 0x00aa: 0x00ac, # NOT SIGN 0x00ab: 0x00bd, # VULGAR FRACTION ONE HALF 0x00ac: 0x00bc, # VULGAR FRACTION ONE QUARTER 0x00ad: 0x00a1, # INVERTED EXCLAMATION MARK 0x00ae: 0x00ab, # LEFT-POINTING DOUBLE ANGLE QUOTATION MARK 0x00af: 0x00bb, # RIGHT-POINTING DOUBLE ANGLE QUOTATION MARK 0x00b0: 0x2591, # LIGHT SHADE 0x00b1: 0x2592, # MEDIUM SHADE 0x00b2: 0x2593, # DARK SHADE 0x00b3: 0x2502, # BOX DRAWINGS LIGHT VERTICAL 0x00b4: 0x2524, # BOX DRAWINGS LIGHT VERTICAL AND LEFT 0x00b5: 0x2561, # BOX DRAWINGS VERTICAL SINGLE AND LEFT DOUBLE 0x00b6: 0x2562, # BOX DRAWINGS VERTICAL DOUBLE AND LEFT SINGLE 0x00b7: 0x2556, # BOX DRAWINGS DOWN DOUBLE AND LEFT SINGLE 0x00b8: 0x2555, # BOX DRAWINGS DOWN SINGLE AND LEFT DOUBLE 0x00b9: 0x2563, # BOX DRAWINGS DOUBLE VERTICAL AND LEFT 0x00ba: 0x2551, # BOX DRAWINGS DOUBLE VERTICAL 0x00bb: 0x2557, # BOX DRAWINGS DOUBLE DOWN AND LEFT 0x00bc: 0x255d, # BOX DRAWINGS DOUBLE UP AND LEFT 0x00bd: 0x255c, # BOX DRAWINGS UP DOUBLE AND LEFT SINGLE 0x00be: 0x255b, # BOX DRAWINGS UP SINGLE AND LEFT DOUBLE 0x00bf: 0x2510, # BOX DRAWINGS LIGHT DOWN AND LEFT 0x00c0: 0x2514, # BOX DRAWINGS LIGHT UP AND RIGHT 0x00c1: 0x2534, # BOX DRAWINGS LIGHT UP AND HORIZONTAL 0x00c2: 0x252c, # BOX DRAWINGS LIGHT DOWN AND HORIZONTAL 0x00c3: 0x251c, # BOX DRAWINGS LIGHT VERTICAL AND RIGHT 0x00c4: 0x2500, # BOX DRAWINGS LIGHT HORIZONTAL 0x00c5: 0x253c, # BOX DRAWINGS LIGHT VERTICAL AND HORIZONTAL 0x00c6: 0x255e, # BOX DRAWINGS VERTICAL SINGLE AND RIGHT DOUBLE 0x00c7: 0x255f, # BOX DRAWINGS VERTICAL DOUBLE AND RIGHT SINGLE 0x00c8: 0x255a, # BOX DRAWINGS DOUBLE UP AND RIGHT 0x00c9: 0x2554, # BOX DRAWINGS DOUBLE DOWN AND RIGHT 0x00ca: 0x2569, # BOX DRAWINGS DOUBLE UP AND HORIZONTAL 0x00cb: 0x2566, # BOX DRAWINGS DOUBLE DOWN AND HORIZONTAL 0x00cc: 0x2560, # BOX DRAWINGS DOUBLE VERTICAL AND RIGHT 0x00cd: 0x2550, # BOX DRAWINGS DOUBLE HORIZONTAL 0x00ce: 0x256c, # BOX DRAWINGS DOUBLE VERTICAL AND HORIZONTAL 0x00cf: 0x2567, # BOX DRAWINGS UP SINGLE AND HORIZONTAL DOUBLE 0x00d0: 0x2568, # BOX DRAWINGS UP DOUBLE AND HORIZONTAL SINGLE 0x00d1: 0x2564, # BOX DRAWINGS DOWN SINGLE AND HORIZONTAL DOUBLE 0x00d2: 0x2565, # BOX DRAWINGS DOWN DOUBLE AND HORIZONTAL SINGLE 0x00d3: 0x2559, # BOX DRAWINGS UP DOUBLE AND RIGHT SINGLE 0x00d4: 0x2558, # BOX DRAWINGS UP SINGLE AND RIGHT DOUBLE 0x00d5: 0x2552, # BOX DRAWINGS DOWN SINGLE AND RIGHT DOUBLE 0x00d6: 0x2553, # BOX DRAWINGS DOWN DOUBLE AND RIGHT SINGLE 0x00d7: 0x256b, # BOX DRAWINGS VERTICAL DOUBLE AND HORIZONTAL SINGLE 0x00d8: 0x256a, # BOX DRAWINGS VERTICAL SINGLE AND HORIZONTAL DOUBLE 0x00d9: 0x2518, # BOX DRAWINGS LIGHT UP AND LEFT 0x00da: 0x250c, # BOX DRAWINGS LIGHT DOWN AND RIGHT 0x00db: 0x2588, # FULL BLOCK 0x00dc: 0x2584, # LOWER HALF BLOCK 0x00dd: 0x258c, # LEFT HALF BLOCK 0x00de: 0x2590, # RIGHT HALF BLOCK 0x00df: 0x2580, # UPPER HALF BLOCK 0x00e0: 0x03b1, # GREEK SMALL LETTER ALPHA 0x00e1: 0x00df, # LATIN SMALL LETTER SHARP S 0x00e2: 0x0393, # GREEK CAPITAL LETTER GAMMA 0x00e3: 0x03c0, # GREEK SMALL LETTER PI 0x00e4: 0x03a3, # GREEK CAPITAL LETTER SIGMA 0x00e5: 0x03c3, # GREEK SMALL LETTER SIGMA 0x00e6: 0x00b5, # MICRO SIGN 0x00e7: 0x03c4, # GREEK SMALL LETTER TAU 0x00e8: 0x03a6, # GREEK CAPITAL LETTER PHI 0x00e9: 0x0398, # GREEK CAPITAL LETTER THETA 0x00ea: 0x03a9, # GREEK CAPITAL LETTER OMEGA 0x00eb: 0x03b4, # GREEK SMALL LETTER DELTA 0x00ec: 0x221e, # INFINITY 0x00ed: 0x03c6, # GREEK SMALL LETTER PHI 0x00ee: 0x03b5, # GREEK SMALL LETTER EPSILON 0x00ef: 0x2229, # INTERSECTION 0x00f0: 0x2261, # IDENTICAL TO 0x00f1: 0x00b1, # PLUS-MINUS SIGN 0x00f2: 0x2265, # GREATER-THAN OR EQUAL TO 0x00f3: 0x2264, # LESS-THAN OR EQUAL TO 0x00f4: 0x2320, # TOP HALF INTEGRAL 0x00f5: 0x2321, # BOTTOM HALF INTEGRAL 0x00f6: 0x00f7, # DIVISION SIGN 0x00f7: 0x2248, # ALMOST EQUAL TO 0x00f8: 0x00b0, # DEGREE SIGN 0x00f9: 0x2219, # BULLET OPERATOR 0x00fa: 0x00b7, # MIDDLE DOT 0x00fb: 0x221a, # SQUARE ROOT 0x00fc: 0x207f, # SUPERSCRIPT LATIN SMALL LETTER N 0x00fd: 0x00b2, # SUPERSCRIPT TWO 0x00fe: 0x25a0, # BLACK SQUARE 0x00ff: 0x00a0, # NO-BREAK SPACE }) ### Decoding Table decoding_table = ( u'\x00' # 0x0000 -> NULL u'\x01' # 0x0001 -> START OF HEADING u'\x02' # 0x0002 -> START OF TEXT u'\x03' # 0x0003 -> END OF TEXT u'\x04' # 0x0004 -> END OF TRANSMISSION u'\x05' # 0x0005 -> ENQUIRY u'\x06' # 0x0006 -> ACKNOWLEDGE u'\x07' # 0x0007 -> BELL u'\x08' # 0x0008 -> BACKSPACE u'\t' # 0x0009 -> HORIZONTAL TABULATION u'\n' # 0x000a -> LINE FEED u'\x0b' # 0x000b -> VERTICAL TABULATION u'\x0c' # 0x000c -> FORM FEED u'\r' # 0x000d -> CARRIAGE RETURN u'\x0e' # 0x000e -> SHIFT OUT u'\x0f' # 0x000f -> SHIFT IN u'\x10' # 0x0010 -> DATA LINK ESCAPE u'\x11' # 0x0011 -> DEVICE CONTROL ONE u'\x12' # 0x0012 -> DEVICE CONTROL TWO u'\x13' # 0x0013 -> DEVICE CONTROL THREE u'\x14' # 0x0014 -> DEVICE CONTROL FOUR u'\x15' # 0x0015 -> NEGATIVE ACKNOWLEDGE u'\x16' # 0x0016 -> SYNCHRONOUS IDLE u'\x17' # 0x0017 -> END OF TRANSMISSION BLOCK u'\x18' # 0x0018 -> CANCEL u'\x19' # 0x0019 -> END OF MEDIUM u'\x1a' # 0x001a -> SUBSTITUTE u'\x1b' # 0x001b -> ESCAPE u'\x1c' # 0x001c -> FILE SEPARATOR u'\x1d' # 0x001d -> GROUP SEPARATOR u'\x1e' # 0x001e -> RECORD SEPARATOR u'\x1f' # 0x001f -> UNIT SEPARATOR u' ' # 0x0020 -> SPACE u'!' # 0x0021 -> EXCLAMATION MARK u'"' # 0x0022 -> QUOTATION MARK u'#' # 0x0023 -> NUMBER SIGN u'$' # 0x0024 -> DOLLAR SIGN u'%' # 0x0025 -> PERCENT SIGN u'&' # 0x0026 -> AMPERSAND u"'" # 0x0027 -> APOSTROPHE u'(' # 0x0028 -> LEFT PARENTHESIS u')' # 0x0029 -> RIGHT PARENTHESIS u'*' # 0x002a -> ASTERISK u'+' # 0x002b -> PLUS SIGN u',' # 0x002c -> COMMA u'-' # 0x002d -> HYPHEN-MINUS u'.' # 0x002e -> FULL STOP u'/' # 0x002f -> SOLIDUS u'0' # 0x0030 -> DIGIT ZERO u'1' # 0x0031 -> DIGIT ONE u'2' # 0x0032 -> DIGIT TWO u'3' # 0x0033 -> DIGIT THREE u'4' # 0x0034 -> DIGIT FOUR u'5' # 0x0035 -> DIGIT FIVE u'6' # 0x0036 -> DIGIT SIX u'7' # 0x0037 -> DIGIT SEVEN u'8' # 0x0038 -> DIGIT EIGHT u'9' # 0x0039 -> DIGIT NINE u':' # 0x003a -> COLON u';' # 0x003b -> SEMICOLON u'<' # 0x003c -> LESS-THAN SIGN u'=' # 0x003d -> EQUALS SIGN u'>' # 0x003e -> GREATER-THAN SIGN u'?' # 0x003f -> QUESTION MARK u'@' # 0x0040 -> COMMERCIAL AT u'A' # 0x0041 -> LATIN CAPITAL LETTER A u'B' # 0x0042 -> LATIN CAPITAL LETTER B u'C' # 0x0043 -> LATIN CAPITAL LETTER C u'D' # 0x0044 -> LATIN CAPITAL LETTER D u'E' # 0x0045 -> LATIN CAPITAL LETTER E u'F' # 0x0046 -> LATIN CAPITAL LETTER F u'G' # 0x0047 -> LATIN CAPITAL LETTER G u'H' # 0x0048 -> LATIN CAPITAL LETTER H u'I' # 0x0049 -> LATIN CAPITAL LETTER I u'J' # 0x004a -> LATIN CAPITAL LETTER J u'K' # 0x004b -> LATIN CAPITAL LETTER K u'L' # 0x004c -> LATIN CAPITAL LETTER L u'M' # 0x004d -> LATIN CAPITAL LETTER M u'N' # 0x004e -> LATIN CAPITAL LETTER N u'O' # 0x004f -> LATIN CAPITAL LETTER O u'P' # 0x0050 -> LATIN CAPITAL LETTER P u'Q' # 0x0051 -> LATIN CAPITAL LETTER Q u'R' # 0x0052 -> LATIN CAPITAL LETTER R u'S' # 0x0053 -> LATIN CAPITAL LETTER S u'T' # 0x0054 -> LATIN CAPITAL LETTER T u'U' # 0x0055 -> LATIN CAPITAL LETTER U u'V' # 0x0056 -> LATIN CAPITAL LETTER V u'W' # 0x0057 -> LATIN CAPITAL LETTER W u'X' # 0x0058 -> LATIN CAPITAL LETTER X u'Y' # 0x0059 -> LATIN CAPITAL LETTER Y u'Z' # 0x005a -> LATIN CAPITAL LETTER Z u'[' # 0x005b -> LEFT SQUARE BRACKET u'\\' # 0x005c -> REVERSE SOLIDUS u']' # 0x005d -> RIGHT SQUARE BRACKET u'^' # 0x005e -> CIRCUMFLEX ACCENT u'_' # 0x005f -> LOW LINE u'`' # 0x0060 -> GRAVE ACCENT u'a' # 0x0061 -> LATIN SMALL LETTER A u'b' # 0x0062 -> LATIN SMALL LETTER B u'c' # 0x0063 -> LATIN SMALL LETTER C u'd' # 0x0064 -> LATIN SMALL LETTER D u'e' # 0x0065 -> LATIN SMALL LETTER E u'f' # 0x0066 -> LATIN SMALL LETTER F u'g' # 0x0067 -> LATIN SMALL LETTER G u'h' # 0x0068 -> LATIN SMALL LETTER H u'i' # 0x0069 -> LATIN SMALL LETTER I u'j' # 0x006a -> LATIN SMALL LETTER J u'k' # 0x006b -> LATIN SMALL LETTER K u'l' # 0x006c -> LATIN SMALL LETTER L u'm' # 0x006d -> LATIN SMALL LETTER M u'n' # 0x006e -> LATIN SMALL LETTER N u'o' # 0x006f -> LATIN SMALL LETTER O u'p' # 0x0070 -> LATIN SMALL LETTER P u'q' # 0x0071 -> LATIN SMALL LETTER Q u'r' # 0x0072 -> LATIN SMALL LETTER R u's' # 0x0073 -> LATIN SMALL LETTER S u't' # 0x0074 -> LATIN SMALL LETTER T u'u' # 0x0075 -> LATIN SMALL LETTER U u'v' # 0x0076 -> LATIN SMALL LETTER V u'w' # 0x0077 -> LATIN SMALL LETTER W u'x' # 0x0078 -> LATIN SMALL LETTER X u'y' # 0x0079 -> LATIN SMALL LETTER Y u'z' # 0x007a -> LATIN SMALL LETTER Z u'{' # 0x007b -> LEFT CURLY BRACKET u'|' # 0x007c -> VERTICAL LINE u'}' # 0x007d -> RIGHT CURLY BRACKET u'~' # 0x007e -> TILDE u'\x7f' # 0x007f -> DELETE u'\xc7' # 0x0080 -> LATIN CAPITAL LETTER C WITH CEDILLA u'\xfc' # 0x0081 -> LATIN SMALL LETTER U WITH DIAERESIS u'\xe9' # 0x0082 -> LATIN SMALL LETTER E WITH ACUTE u'\xe2' # 0x0083 -> LATIN SMALL LETTER A WITH CIRCUMFLEX u'\xe4' # 0x0084 -> LATIN SMALL LETTER A WITH DIAERESIS u'\xe0' # 0x0085 -> LATIN SMALL LETTER A WITH GRAVE u'\xe5' # 0x0086 -> LATIN SMALL LETTER A WITH RING ABOVE u'\xe7' # 0x0087 -> LATIN SMALL LETTER C WITH CEDILLA u'\xea' # 0x0088 -> LATIN SMALL LETTER E WITH CIRCUMFLEX u'\xeb' # 0x0089 -> LATIN SMALL LETTER E WITH DIAERESIS u'\xe8' # 0x008a -> LATIN SMALL LETTER E WITH GRAVE u'\xd0' # 0x008b -> LATIN CAPITAL LETTER ETH u'\xf0' # 0x008c -> LATIN SMALL LETTER ETH u'\xde' # 0x008d -> LATIN CAPITAL LETTER THORN u'\xc4' # 0x008e -> LATIN CAPITAL LETTER A WITH DIAERESIS u'\xc5' # 0x008f -> LATIN CAPITAL LETTER A WITH RING ABOVE u'\xc9' # 0x0090 -> LATIN CAPITAL LETTER E WITH ACUTE u'\xe6' # 0x0091 -> LATIN SMALL LIGATURE AE u'\xc6' # 0x0092 -> LATIN CAPITAL LIGATURE AE u'\xf4' # 0x0093 -> LATIN SMALL LETTER O WITH CIRCUMFLEX u'\xf6' # 0x0094 -> LATIN SMALL LETTER O WITH DIAERESIS u'\xfe' # 0x0095 -> LATIN SMALL LETTER THORN u'\xfb' # 0x0096 -> LATIN SMALL LETTER U WITH CIRCUMFLEX u'\xdd' # 0x0097 -> LATIN CAPITAL LETTER Y WITH ACUTE u'\xfd' # 0x0098 -> LATIN SMALL LETTER Y WITH ACUTE u'\xd6' # 0x0099 -> LATIN CAPITAL LETTER O WITH DIAERESIS u'\xdc' # 0x009a -> LATIN CAPITAL LETTER U WITH DIAERESIS u'\xf8' # 0x009b -> LATIN SMALL LETTER O WITH STROKE u'\xa3' # 0x009c -> POUND SIGN u'\xd8' # 0x009d -> LATIN CAPITAL LETTER O WITH STROKE u'\u20a7' # 0x009e -> PESETA SIGN u'\u0192' # 0x009f -> LATIN SMALL LETTER F WITH HOOK u'\xe1' # 0x00a0 -> LATIN SMALL LETTER A WITH ACUTE u'\xed' # 0x00a1 -> LATIN SMALL LETTER I WITH ACUTE u'\xf3' # 0x00a2 -> LATIN SMALL LETTER O WITH ACUTE u'\xfa' # 0x00a3 -> LATIN SMALL LETTER U WITH ACUTE u'\xc1' # 0x00a4 -> LATIN CAPITAL LETTER A WITH ACUTE u'\xcd' # 0x00a5 -> LATIN CAPITAL LETTER I WITH ACUTE u'\xd3' # 0x00a6 -> LATIN CAPITAL LETTER O WITH ACUTE u'\xda' # 0x00a7 -> LATIN CAPITAL LETTER U WITH ACUTE u'\xbf' # 0x00a8 -> INVERTED QUESTION MARK u'\u2310' # 0x00a9 -> REVERSED NOT SIGN u'\xac' # 0x00aa -> NOT SIGN u'\xbd' # 0x00ab -> VULGAR FRACTION ONE HALF u'\xbc' # 0x00ac -> VULGAR FRACTION ONE QUARTER u'\xa1' # 0x00ad -> INVERTED EXCLAMATION MARK u'\xab' # 0x00ae -> LEFT-POINTING DOUBLE ANGLE QUOTATION MARK u'\xbb' # 0x00af -> RIGHT-POINTING DOUBLE ANGLE QUOTATION MARK u'\u2591' # 0x00b0 -> LIGHT SHADE u'\u2592' # 0x00b1 -> MEDIUM SHADE u'\u2593' # 0x00b2 -> DARK SHADE u'\u2502' # 0x00b3 -> BOX DRAWINGS LIGHT VERTICAL u'\u2524' # 0x00b4 -> BOX DRAWINGS LIGHT VERTICAL AND LEFT u'\u2561' # 0x00b5 -> BOX DRAWINGS VERTICAL SINGLE AND LEFT DOUBLE u'\u2562' # 0x00b6 -> BOX DRAWINGS VERTICAL DOUBLE AND LEFT SINGLE u'\u2556' # 0x00b7 -> BOX DRAWINGS DOWN DOUBLE AND LEFT SINGLE u'\u2555' # 0x00b8 -> BOX DRAWINGS DOWN SINGLE AND LEFT DOUBLE u'\u2563' # 0x00b9 -> BOX DRAWINGS DOUBLE VERTICAL AND LEFT u'\u2551' # 0x00ba -> BOX DRAWINGS DOUBLE VERTICAL u'\u2557' # 0x00bb -> BOX DRAWINGS DOUBLE DOWN AND LEFT u'\u255d' # 0x00bc -> BOX DRAWINGS DOUBLE UP AND LEFT u'\u255c' # 0x00bd -> BOX DRAWINGS UP DOUBLE AND LEFT SINGLE u'\u255b' # 0x00be -> BOX DRAWINGS UP SINGLE AND LEFT DOUBLE u'\u2510' # 0x00bf -> BOX DRAWINGS LIGHT DOWN AND LEFT u'\u2514' # 0x00c0 -> BOX DRAWINGS LIGHT UP AND RIGHT u'\u2534' # 0x00c1 -> BOX DRAWINGS LIGHT UP AND HORIZONTAL u'\u252c' # 0x00c2 -> BOX DRAWINGS LIGHT DOWN AND HORIZONTAL u'\u251c' # 0x00c3 -> BOX DRAWINGS LIGHT VERTICAL AND RIGHT u'\u2500' # 0x00c4 -> BOX DRAWINGS LIGHT HORIZONTAL u'\u253c' # 0x00c5 -> BOX DRAWINGS LIGHT VERTICAL AND HORIZONTAL u'\u255e' # 0x00c6 -> BOX DRAWINGS VERTICAL SINGLE AND RIGHT DOUBLE u'\u255f' # 0x00c7 -> BOX DRAWINGS VERTICAL DOUBLE AND RIGHT SINGLE u'\u255a' # 0x00c8 -> BOX DRAWINGS DOUBLE UP AND RIGHT u'\u2554' # 0x00c9 -> BOX DRAWINGS DOUBLE DOWN AND RIGHT u'\u2569' # 0x00ca -> BOX DRAWINGS DOUBLE UP AND HORIZONTAL u'\u2566' # 0x00cb -> BOX DRAWINGS DOUBLE DOWN AND HORIZONTAL u'\u2560' # 0x00cc -> BOX DRAWINGS DOUBLE VERTICAL AND RIGHT u'\u2550' # 0x00cd -> BOX DRAWINGS DOUBLE HORIZONTAL u'\u256c' # 0x00ce -> BOX DRAWINGS DOUBLE VERTICAL AND HORIZONTAL u'\u2567' # 0x00cf -> BOX DRAWINGS UP SINGLE AND HORIZONTAL DOUBLE u'\u2568' # 0x00d0 -> BOX DRAWINGS UP DOUBLE AND HORIZONTAL SINGLE u'\u2564' # 0x00d1 -> BOX DRAWINGS DOWN SINGLE AND HORIZONTAL DOUBLE u'\u2565' # 0x00d2 -> BOX DRAWINGS DOWN DOUBLE AND HORIZONTAL SINGLE u'\u2559' # 0x00d3 -> BOX DRAWINGS UP DOUBLE AND RIGHT SINGLE u'\u2558' # 0x00d4 -> BOX DRAWINGS UP SINGLE AND RIGHT DOUBLE u'\u2552' # 0x00d5 -> BOX DRAWINGS DOWN SINGLE AND RIGHT DOUBLE u'\u2553' # 0x00d6 -> BOX DRAWINGS DOWN DOUBLE AND RIGHT SINGLE u'\u256b' # 0x00d7 -> BOX DRAWINGS VERTICAL DOUBLE AND HORIZONTAL SINGLE u'\u256a' # 0x00d8 -> BOX DRAWINGS VERTICAL SINGLE AND HORIZONTAL DOUBLE u'\u2518' # 0x00d9 -> BOX DRAWINGS LIGHT UP AND LEFT u'\u250c' # 0x00da -> BOX DRAWINGS LIGHT DOWN AND RIGHT u'\u2588' # 0x00db -> FULL BLOCK u'\u2584' # 0x00dc -> LOWER HALF BLOCK u'\u258c' # 0x00dd -> LEFT HALF BLOCK u'\u2590' # 0x00de -> RIGHT HALF BLOCK u'\u2580' # 0x00df -> UPPER HALF BLOCK u'\u03b1' # 0x00e0 -> GREEK SMALL LETTER ALPHA u'\xdf' # 0x00e1 -> LATIN SMALL LETTER SHARP S u'\u0393' # 0x00e2 -> GREEK CAPITAL LETTER GAMMA u'\u03c0' # 0x00e3 -> GREEK SMALL LETTER PI u'\u03a3' # 0x00e4 -> GREEK CAPITAL LETTER SIGMA u'\u03c3' # 0x00e5 -> GREEK SMALL LETTER SIGMA u'\xb5' # 0x00e6 -> MICRO SIGN u'\u03c4' # 0x00e7 -> GREEK SMALL LETTER TAU u'\u03a6' # 0x00e8 -> GREEK CAPITAL LETTER PHI u'\u0398' # 0x00e9 -> GREEK CAPITAL LETTER THETA u'\u03a9' # 0x00ea -> GREEK CAPITAL LETTER OMEGA u'\u03b4' # 0x00eb -> GREEK SMALL LETTER DELTA u'\u221e' # 0x00ec -> INFINITY u'\u03c6' # 0x00ed -> GREEK SMALL LETTER PHI u'\u03b5' # 0x00ee -> GREEK SMALL LETTER EPSILON u'\u2229' # 0x00ef -> INTERSECTION u'\u2261' # 0x00f0 -> IDENTICAL TO u'\xb1' # 0x00f1 -> PLUS-MINUS SIGN u'\u2265' # 0x00f2 -> GREATER-THAN OR EQUAL TO u'\u2264' # 0x00f3 -> LESS-THAN OR EQUAL TO u'\u2320' # 0x00f4 -> TOP HALF INTEGRAL u'\u2321' # 0x00f5 -> BOTTOM HALF INTEGRAL u'\xf7' # 0x00f6 -> DIVISION SIGN u'\u2248' # 0x00f7 -> ALMOST EQUAL TO u'\xb0' # 0x00f8 -> DEGREE SIGN u'\u2219' # 0x00f9 -> BULLET OPERATOR u'\xb7' # 0x00fa -> MIDDLE DOT u'\u221a' # 0x00fb -> SQUARE ROOT u'\u207f' # 0x00fc -> SUPERSCRIPT LATIN SMALL LETTER N u'\xb2' # 0x00fd -> SUPERSCRIPT TWO u'\u25a0' # 0x00fe -> BLACK SQUARE u'\xa0' # 0x00ff -> NO-BREAK SPACE ) ### Encoding Map encoding_map = { 0x0000: 0x0000, # NULL 0x0001: 0x0001, # START OF HEADING 0x0002: 0x0002, # START OF TEXT 0x0003: 0x0003, # END OF TEXT 0x0004: 0x0004, # END OF TRANSMISSION 0x0005: 0x0005, # ENQUIRY 0x0006: 0x0006, # ACKNOWLEDGE 0x0007: 0x0007, # BELL 0x0008: 0x0008, # BACKSPACE 0x0009: 0x0009, # HORIZONTAL TABULATION 0x000a: 0x000a, # LINE FEED 0x000b: 0x000b, # VERTICAL TABULATION 0x000c: 0x000c, # FORM FEED 0x000d: 0x000d, # CARRIAGE RETURN 0x000e: 0x000e, # SHIFT OUT 0x000f: 0x000f, # SHIFT IN 0x0010: 0x0010, # DATA LINK ESCAPE 0x0011: 0x0011, # DEVICE CONTROL ONE 0x0012: 0x0012, # DEVICE CONTROL TWO 0x0013: 0x0013, # DEVICE CONTROL THREE 0x0014: 0x0014, # DEVICE CONTROL FOUR 0x0015: 0x0015, # NEGATIVE ACKNOWLEDGE 0x0016: 0x0016, # SYNCHRONOUS IDLE 0x0017: 0x0017, # END OF TRANSMISSION BLOCK 0x0018: 0x0018, # CANCEL 0x0019: 0x0019, # END OF MEDIUM 0x001a: 0x001a, # SUBSTITUTE 0x001b: 0x001b, # ESCAPE 0x001c: 0x001c, # FILE SEPARATOR 0x001d: 0x001d, # GROUP SEPARATOR 0x001e: 0x001e, # RECORD SEPARATOR 0x001f: 0x001f, # UNIT SEPARATOR 0x0020: 0x0020, # SPACE 0x0021: 0x0021, # EXCLAMATION MARK 0x0022: 0x0022, # QUOTATION MARK 0x0023: 0x0023, # NUMBER SIGN 0x0024: 0x0024, # DOLLAR SIGN 0x0025: 0x0025, # PERCENT SIGN 0x0026: 0x0026, # AMPERSAND 0x0027: 0x0027, # APOSTROPHE 0x0028: 0x0028, # LEFT PARENTHESIS 0x0029: 0x0029, # RIGHT PARENTHESIS 0x002a: 0x002a, # ASTERISK 0x002b: 0x002b, # PLUS SIGN 0x002c: 0x002c, # COMMA 0x002d: 0x002d, # HYPHEN-MINUS 0x002e: 0x002e, # FULL STOP 0x002f: 0x002f, # SOLIDUS 0x0030: 0x0030, # DIGIT ZERO 0x0031: 0x0031, # DIGIT ONE 0x0032: 0x0032, # DIGIT TWO 0x0033: 0x0033, # DIGIT THREE 0x0034: 0x0034, # DIGIT FOUR 0x0035: 0x0035, # DIGIT FIVE 0x0036: 0x0036, # DIGIT SIX 0x0037: 0x0037, # DIGIT SEVEN 0x0038: 0x0038, # DIGIT EIGHT 0x0039: 0x0039, # DIGIT NINE 0x003a: 0x003a, # COLON 0x003b: 0x003b, # SEMICOLON 0x003c: 0x003c, # LESS-THAN SIGN 0x003d: 0x003d, # EQUALS SIGN 0x003e: 0x003e, # GREATER-THAN SIGN 0x003f: 0x003f, # QUESTION MARK 0x0040: 0x0040, # COMMERCIAL AT 0x0041: 0x0041, # LATIN CAPITAL LETTER A 0x0042: 0x0042, # LATIN CAPITAL LETTER B 0x0043: 0x0043, # LATIN CAPITAL LETTER C 0x0044: 0x0044, # LATIN CAPITAL LETTER D 0x0045: 0x0045, # LATIN CAPITAL LETTER E 0x0046: 0x0046, # LATIN CAPITAL LETTER F 0x0047: 0x0047, # LATIN CAPITAL LETTER G 0x0048: 0x0048, # LATIN CAPITAL LETTER H 0x0049: 0x0049, # LATIN CAPITAL LETTER I 0x004a: 0x004a, # LATIN CAPITAL LETTER J 0x004b: 0x004b, # LATIN CAPITAL LETTER K 0x004c: 0x004c, # LATIN CAPITAL LETTER L 0x004d: 0x004d, # LATIN CAPITAL LETTER M 0x004e: 0x004e, # LATIN CAPITAL LETTER N 0x004f: 0x004f, # LATIN CAPITAL LETTER O 0x0050: 0x0050, # LATIN CAPITAL LETTER P 0x0051: 0x0051, # LATIN CAPITAL LETTER Q 0x0052: 0x0052, # LATIN CAPITAL LETTER R 0x0053: 0x0053, # LATIN CAPITAL LETTER S 0x0054: 0x0054, # LATIN CAPITAL LETTER T 0x0055: 0x0055, # LATIN CAPITAL LETTER U 0x0056: 0x0056, # LATIN CAPITAL LETTER V 0x0057: 0x0057, # LATIN CAPITAL LETTER W 0x0058: 0x0058, # LATIN CAPITAL LETTER X 0x0059: 0x0059, # LATIN CAPITAL LETTER Y 0x005a: 0x005a, # LATIN CAPITAL LETTER Z 0x005b: 0x005b, # LEFT SQUARE BRACKET 0x005c: 0x005c, # REVERSE SOLIDUS 0x005d: 0x005d, # RIGHT SQUARE BRACKET 0x005e: 0x005e, # CIRCUMFLEX ACCENT 0x005f: 0x005f, # LOW LINE 0x0060: 0x0060, # GRAVE ACCENT 0x0061: 0x0061, # LATIN SMALL LETTER A 0x0062: 0x0062, # LATIN SMALL LETTER B 0x0063: 0x0063, # LATIN SMALL LETTER C 0x0064: 0x0064, # LATIN SMALL LETTER D 0x0065: 0x0065, # LATIN SMALL LETTER E 0x0066: 0x0066, # LATIN SMALL LETTER F 0x0067: 0x0067, # LATIN SMALL LETTER G 0x0068: 0x0068, # LATIN SMALL LETTER H 0x0069: 0x0069, # LATIN SMALL LETTER I 0x006a: 0x006a, # LATIN SMALL LETTER J 0x006b: 0x006b, # LATIN SMALL LETTER K 0x006c: 0x006c, # LATIN SMALL LETTER L 0x006d: 0x006d, # LATIN SMALL LETTER M 0x006e: 0x006e, # LATIN SMALL LETTER N 0x006f: 0x006f, # LATIN SMALL LETTER O 0x0070: 0x0070, # LATIN SMALL LETTER P 0x0071: 0x0071, # LATIN SMALL LETTER Q 0x0072: 0x0072, # LATIN SMALL LETTER R 0x0073: 0x0073, # LATIN SMALL LETTER S 0x0074: 0x0074, # LATIN SMALL LETTER T 0x0075: 0x0075, # LATIN SMALL LETTER U 0x0076: 0x0076, # LATIN SMALL LETTER V 0x0077: 0x0077, # LATIN SMALL LETTER W 0x0078: 0x0078, # LATIN SMALL LETTER X 0x0079: 0x0079, # LATIN SMALL LETTER Y 0x007a: 0x007a, # LATIN SMALL LETTER Z 0x007b: 0x007b, # LEFT CURLY BRACKET 0x007c: 0x007c, # VERTICAL LINE 0x007d: 0x007d, # RIGHT CURLY BRACKET 0x007e: 0x007e, # TILDE 0x007f: 0x007f, # DELETE 0x00a0: 0x00ff, # NO-BREAK SPACE 0x00a1: 0x00ad, # INVERTED EXCLAMATION MARK 0x00a3: 0x009c, # POUND SIGN 0x00ab: 0x00ae, # LEFT-POINTING DOUBLE ANGLE QUOTATION MARK 0x00ac: 0x00aa, # NOT SIGN 0x00b0: 0x00f8, # DEGREE SIGN 0x00b1: 0x00f1, # PLUS-MINUS SIGN 0x00b2: 0x00fd, # SUPERSCRIPT TWO 0x00b5: 0x00e6, # MICRO SIGN 0x00b7: 0x00fa, # MIDDLE DOT 0x00bb: 0x00af, # RIGHT-POINTING DOUBLE ANGLE QUOTATION MARK 0x00bc: 0x00ac, # VULGAR FRACTION ONE QUARTER 0x00bd: 0x00ab, # VULGAR FRACTION ONE HALF 0x00bf: 0x00a8, # INVERTED QUESTION MARK 0x00c1: 0x00a4, # LATIN CAPITAL LETTER A WITH ACUTE 0x00c4: 0x008e, # LATIN CAPITAL LETTER A WITH DIAERESIS 0x00c5: 0x008f, # LATIN CAPITAL LETTER A WITH RING ABOVE 0x00c6: 0x0092, # LATIN CAPITAL LIGATURE AE 0x00c7: 0x0080, # LATIN CAPITAL LETTER C WITH CEDILLA 0x00c9: 0x0090, # LATIN CAPITAL LETTER E WITH ACUTE 0x00cd: 0x00a5, # LATIN CAPITAL LETTER I WITH ACUTE 0x00d0: 0x008b, # LATIN CAPITAL LETTER ETH 0x00d3: 0x00a6, # LATIN CAPITAL LETTER O WITH ACUTE 0x00d6: 0x0099, # LATIN CAPITAL LETTER O WITH DIAERESIS 0x00d8: 0x009d, # LATIN CAPITAL LETTER O WITH STROKE 0x00da: 0x00a7, # LATIN CAPITAL LETTER U WITH ACUTE 0x00dc: 0x009a, # LATIN CAPITAL LETTER U WITH DIAERESIS 0x00dd: 0x0097, # LATIN CAPITAL LETTER Y WITH ACUTE 0x00de: 0x008d, # LATIN CAPITAL LETTER THORN 0x00df: 0x00e1, # LATIN SMALL LETTER SHARP S 0x00e0: 0x0085, # LATIN SMALL LETTER A WITH GRAVE 0x00e1: 0x00a0, # LATIN SMALL LETTER A WITH ACUTE 0x00e2: 0x0083, # LATIN SMALL LETTER A WITH CIRCUMFLEX 0x00e4: 0x0084, # LATIN SMALL LETTER A WITH DIAERESIS 0x00e5: 0x0086, # LATIN SMALL LETTER A WITH RING ABOVE 0x00e6: 0x0091, # LATIN SMALL LIGATURE AE 0x00e7: 0x0087, # LATIN SMALL LETTER C WITH CEDILLA 0x00e8: 0x008a, # LATIN SMALL LETTER E WITH GRAVE 0x00e9: 0x0082, # LATIN SMALL LETTER E WITH ACUTE 0x00ea: 0x0088, # LATIN SMALL LETTER E WITH CIRCUMFLEX 0x00eb: 0x0089, # LATIN SMALL LETTER E WITH DIAERESIS 0x00ed: 0x00a1, # LATIN SMALL LETTER I WITH ACUTE 0x00f0: 0x008c, # LATIN SMALL LETTER ETH 0x00f3: 0x00a2, # LATIN SMALL LETTER O WITH ACUTE 0x00f4: 0x0093, # LATIN SMALL LETTER O WITH CIRCUMFLEX 0x00f6: 0x0094, # LATIN SMALL LETTER O WITH DIAERESIS 0x00f7: 0x00f6, # DIVISION SIGN 0x00f8: 0x009b, # LATIN SMALL LETTER O WITH STROKE 0x00fa: 0x00a3, # LATIN SMALL LETTER U WITH ACUTE 0x00fb: 0x0096, # LATIN SMALL LETTER U WITH CIRCUMFLEX 0x00fc: 0x0081, # LATIN SMALL LETTER U WITH DIAERESIS 0x00fd: 0x0098, # LATIN SMALL LETTER Y WITH ACUTE 0x00fe: 0x0095, # LATIN SMALL LETTER THORN 0x0192: 0x009f, # LATIN SMALL LETTER F WITH HOOK 0x0393: 0x00e2, # GREEK CAPITAL LETTER GAMMA 0x0398: 0x00e9, # GREEK CAPITAL LETTER THETA 0x03a3: 0x00e4, # GREEK CAPITAL LETTER SIGMA 0x03a6: 0x00e8, # GREEK CAPITAL LETTER PHI 0x03a9: 0x00ea, # GREEK CAPITAL LETTER OMEGA 0x03b1: 0x00e0, # GREEK SMALL LETTER ALPHA 0x03b4: 0x00eb, # GREEK SMALL LETTER DELTA 0x03b5: 0x00ee, # GREEK SMALL LETTER EPSILON 0x03c0: 0x00e3, # GREEK SMALL LETTER PI 0x03c3: 0x00e5, # GREEK SMALL LETTER SIGMA 0x03c4: 0x00e7, # GREEK SMALL LETTER TAU 0x03c6: 0x00ed, # GREEK SMALL LETTER PHI 0x207f: 0x00fc, # SUPERSCRIPT LATIN SMALL LETTER N 0x20a7: 0x009e, # PESETA SIGN 0x2219: 0x00f9, # BULLET OPERATOR 0x221a: 0x00fb, # SQUARE ROOT 0x221e: 0x00ec, # INFINITY 0x2229: 0x00ef, # INTERSECTION 0x2248: 0x00f7, # ALMOST EQUAL TO 0x2261: 0x00f0, # IDENTICAL TO 0x2264: 0x00f3, # LESS-THAN OR EQUAL TO 0x2265: 0x00f2, # GREATER-THAN OR EQUAL TO 0x2310: 0x00a9, # REVERSED NOT SIGN 0x2320: 0x00f4, # TOP HALF INTEGRAL 0x2321: 0x00f5, # BOTTOM HALF INTEGRAL 0x2500: 0x00c4, # BOX DRAWINGS LIGHT HORIZONTAL 0x2502: 0x00b3, # BOX DRAWINGS LIGHT VERTICAL 0x250c: 0x00da, # BOX DRAWINGS LIGHT DOWN AND RIGHT 0x2510: 0x00bf, # BOX DRAWINGS LIGHT DOWN AND LEFT 0x2514: 0x00c0, # BOX DRAWINGS LIGHT UP AND RIGHT 0x2518: 0x00d9, # BOX DRAWINGS LIGHT UP AND LEFT 0x251c: 0x00c3, # BOX DRAWINGS LIGHT VERTICAL AND RIGHT 0x2524: 0x00b4, # BOX DRAWINGS LIGHT VERTICAL AND LEFT 0x252c: 0x00c2, # BOX DRAWINGS LIGHT DOWN AND HORIZONTAL 0x2534: 0x00c1, # BOX DRAWINGS LIGHT UP AND HORIZONTAL 0x253c: 0x00c5, # BOX DRAWINGS LIGHT VERTICAL AND HORIZONTAL 0x2550: 0x00cd, # BOX DRAWINGS DOUBLE HORIZONTAL 0x2551: 0x00ba, # BOX DRAWINGS DOUBLE VERTICAL 0x2552: 0x00d5, # BOX DRAWINGS DOWN SINGLE AND RIGHT DOUBLE 0x2553: 0x00d6, # BOX DRAWINGS DOWN DOUBLE AND RIGHT SINGLE 0x2554: 0x00c9, # BOX DRAWINGS DOUBLE DOWN AND RIGHT 0x2555: 0x00b8, # BOX DRAWINGS DOWN SINGLE AND LEFT DOUBLE 0x2556: 0x00b7, # BOX DRAWINGS DOWN DOUBLE AND LEFT SINGLE 0x2557: 0x00bb, # BOX DRAWINGS DOUBLE DOWN AND LEFT 0x2558: 0x00d4, # BOX DRAWINGS UP SINGLE AND RIGHT DOUBLE 0x2559: 0x00d3, # BOX DRAWINGS UP DOUBLE AND RIGHT SINGLE 0x255a: 0x00c8, # BOX DRAWINGS DOUBLE UP AND RIGHT 0x255b: 0x00be, # BOX DRAWINGS UP SINGLE AND LEFT DOUBLE 0x255c: 0x00bd, # BOX DRAWINGS UP DOUBLE AND LEFT SINGLE 0x255d: 0x00bc, # BOX DRAWINGS DOUBLE UP AND LEFT 0x255e: 0x00c6, # BOX DRAWINGS VERTICAL SINGLE AND RIGHT DOUBLE 0x255f: 0x00c7, # BOX DRAWINGS VERTICAL DOUBLE AND RIGHT SINGLE 0x2560: 0x00cc, # BOX DRAWINGS DOUBLE VERTICAL AND RIGHT 0x2561: 0x00b5, # BOX DRAWINGS VERTICAL SINGLE AND LEFT DOUBLE 0x2562: 0x00b6, # BOX DRAWINGS VERTICAL DOUBLE AND LEFT SINGLE 0x2563: 0x00b9, # BOX DRAWINGS DOUBLE VERTICAL AND LEFT 0x2564: 0x00d1, # BOX DRAWINGS DOWN SINGLE AND HORIZONTAL DOUBLE 0x2565: 0x00d2, # BOX DRAWINGS DOWN DOUBLE AND HORIZONTAL SINGLE 0x2566: 0x00cb, # BOX DRAWINGS DOUBLE DOWN AND HORIZONTAL 0x2567: 0x00cf, # BOX DRAWINGS UP SINGLE AND HORIZONTAL DOUBLE 0x2568: 0x00d0, # BOX DRAWINGS UP DOUBLE AND HORIZONTAL SINGLE 0x2569: 0x00ca, # BOX DRAWINGS DOUBLE UP AND HORIZONTAL 0x256a: 0x00d8, # BOX DRAWINGS VERTICAL SINGLE AND HORIZONTAL DOUBLE 0x256b: 0x00d7, # BOX DRAWINGS VERTICAL DOUBLE AND HORIZONTAL SINGLE 0x256c: 0x00ce, # BOX DRAWINGS DOUBLE VERTICAL AND HORIZONTAL 0x2580: 0x00df, # UPPER HALF BLOCK 0x2584: 0x00dc, # LOWER HALF BLOCK 0x2588: 0x00db, # FULL BLOCK 0x258c: 0x00dd, # LEFT HALF BLOCK 0x2590: 0x00de, # RIGHT HALF BLOCK 0x2591: 0x00b0, # LIGHT SHADE 0x2592: 0x00b1, # MEDIUM SHADE 0x2593: 0x00b2, # DARK SHADE 0x25a0: 0x00fe, # BLACK SQUARE }
mit
digris/openbroadcast.org
website/apps/exporter/views.py
2
3128
import logging from django.views.generic import ListView, UpdateView, CreateView, DeleteView, View from django.views.generic.detail import TemplateResponseMixin from django.views.generic.edit import FormMixin, ProcessFormView from django.shortcuts import get_object_or_404 from django.http import HttpResponseRedirect, HttpResponseForbidden, HttpResponse from django.core.exceptions import PermissionDenied from django.contrib.auth.decorators import login_required from django.core.urlresolvers import reverse from django.utils.functional import lazy from django import http import json from braces.views import PermissionRequiredMixin, LoginRequiredMixin from sendfile import sendfile from exporter.models import Export log = logging.getLogger(__name__) class JSONResponseMixin(object): def render_to_response(self, context): "Returns a JSON response containing 'context' as payload" return self.get_json_response(self.convert_context_to_json(context)) def get_json_response(self, content, **httpresponse_kwargs): "Construct an `HttpResponse` object." return http.HttpResponse( content, content_type="application/json", **httpresponse_kwargs ) def convert_context_to_json(self, context): return json.dumps(context["result"]) class ExportListView(PermissionRequiredMixin, LoginRequiredMixin, ListView): model = Export permission_required = "exporter.add_export" raise_exception = True def get_queryset(self): kwargs = {} return Export.objects.filter(user=self.request.user) class ExportDeleteView(PermissionRequiredMixin, LoginRequiredMixin, DeleteView): model = Export success_url = lazy(reverse, str)("exporter-export-list-legacy") permission_required = "exporter.delete_export" raise_exception = True def get_queryset(self): kwargs = {} return Export.objects.filter(user=self.request.user) class ExportDeleteAllView(PermissionRequiredMixin, LoginRequiredMixin, View): model = Export success_url = lazy(reverse, str)("exporter-export-list-legacy") permission_required = "exporter.delete_export" raise_exception = True def get_queryset(self): kwargs = {} return Export.objects.filter(user=self.request.user) def get(self, *args, **kwargs): Export.objects.filter(user=self.request.user).delete() return HttpResponseRedirect(reverse("exporter-export-list-legacy")) @login_required def export_download(request, uuid, token): log = logging.getLogger("exporter.views.export_download") log.info("Download Request by: %s" % (request.user.username)) export = get_object_or_404(Export, uuid=uuid) download_permission = False if request.user == export.user and token == export.token: download_permission = True if not download_permission: return HttpResponseForbidden("forbidden") filename = "%s.%s" % (export.filename, "zip") export.set_downloaded() return sendfile( request, export.file.path, attachment=True, attachment_filename=filename )
gpl-3.0
julianwang/cinder
cinder/tests/unit/api/contrib/test_snapshot_actions.py
2
2791
# Copyright 2013, Red Hat, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from oslo_serialization import jsonutils import webob from cinder import db from cinder import test from cinder.tests.unit.api import fakes from cinder.tests.unit.api.v2 import stubs class SnapshotActionsTest(test.TestCase): def setUp(self): super(SnapshotActionsTest, self).setUp() def test_update_snapshot_status(self): self.stubs.Set(db, 'snapshot_get', stub_snapshot_get) self.stubs.Set(db, 'snapshot_update', stub_snapshot_update) body = {'os-update_snapshot_status': {'status': 'available'}} req = webob.Request.blank('/v2/fake/snapshots/1/action') req.method = "POST" req.body = jsonutils.dumps(body) req.headers["content-type"] = "application/json" res = req.get_response(fakes.wsgi_app()) self.assertEqual(res.status_int, 202) def test_update_snapshot_status_invalid_status(self): self.stubs.Set(db, 'snapshot_get', stub_snapshot_get) body = {'os-update_snapshot_status': {'status': 'in-use'}} req = webob.Request.blank('/v2/fake/snapshots/1/action') req.method = "POST" req.body = jsonutils.dumps(body) req.headers["content-type"] = "application/json" res = req.get_response(fakes.wsgi_app()) self.assertEqual(res.status_int, 400) def test_update_snapshot_status_without_status(self): self.stubs.Set(db, 'snapshot_get', stub_snapshot_get) body = {'os-update_snapshot_status': {}} req = webob.Request.blank('/v2/fake/snapshots/1/action') req.method = "POST" req.body = jsonutils.dumps(body) req.headers["content-type"] = "application/json" res = req.get_response(fakes.wsgi_app()) self.assertEqual(res.status_int, 400) def stub_snapshot_get(context, snapshot_id): snapshot = stubs.stub_snapshot(snapshot_id) if snapshot_id == 3: snapshot['status'] = 'error' elif snapshot_id == 1: snapshot['status'] = 'creating' elif snapshot_id == 7: snapshot['status'] = 'available' else: snapshot['status'] = 'creating' return snapshot def stub_snapshot_update(self, context, id, **kwargs): pass
apache-2.0
ooici/pyon
pyon/ion/conversation_log.py
1
2865
#!/usr/bin/env python """Conversation Log""" __author__ = 'Prashant Kediyal' from pyon.core import bootstrap from pyon.core.exception import BadRequest from pyon.datastore.datastore import DataStore from pyon.net.endpoint import Subscriber from pyon.util.async import spawn from pyon.util.log import log from interface.objects import ConversationMessage # @TODO: configurable CONV_DS_NAME = 'conversations' class ConvSubscriber(Subscriber): def __init__(self, callback=None, pattern='#', *args, **kwargs): """ Note: a ConversationSubscriber needs to be closed to free broker resources """ self._cbthread = None self.binding = pattern log.debug("ConversationSubscriber pattern %s", self.binding) Subscriber.__init__(self, binding=self.binding, callback=callback, **kwargs) def start(self): """ Pass in a subscriber here, this will make it listen in a background greenlet. """ assert not self._cbthread, "start called twice on ConversationSubscriber" gl = spawn(self.listen) self._cbthread = gl self._ready_event.wait(timeout=5) log.info("ConversationSubscriber started; pattern=%s" % self.binding) return gl def stop(self): self.close() self._cbthread.join(timeout=5) self._cbthread.kill() self._cbthread = None log.info("ConversationSubscriber stopped. Conversation pattern=%s" % self.binding) def __str__(self): return "ConversationSubscriber callback: %s" % str(self._callback) class ConvRepository(object): """ Class that uses a data store to provide a persistent repository for ION events. """ def __init__(self, datastore_manager=None): # Get an instance of datastore configured as directory. # May be persistent or mock, forced clean, with indexes datastore_manager = datastore_manager or bootstrap.container_instance.datastore_manager self.conv_store = datastore_manager.get_datastore(DataStore.DS_CONVERSATIONS, DataStore.DS_PROFILE.CONV) def close(self): """ Pass-through method to close the underlying datastore. """ self.conv_store.close() def put_conv(self, conv): log.debug("Store %s conversation persistently") if not isinstance(conv, ConversationMessage): raise BadRequest("conv must be type ConversationMessage, not %s" % type(conv)) return self.conv_store.create(conv) def put_convs(self, convs): log.debug("Store %s conversation persistently", len(convs)) if convs: if type(convs) is not list: raise BadRequest("Conversation must be type list, not %s" % type(convs)) return self.conv_store.create_mult(convs) else: return None
bsd-2-clause
ivanhorvath/openshift-tools
ansible/roles/lib_openshift_3.2/build/ansible/oc_edit.py
13
3158
# pylint: skip-file def main(): ''' ansible oc module for editing objects ''' module = AnsibleModule( argument_spec=dict( kubeconfig=dict(default='/etc/origin/master/admin.kubeconfig', type='str'), state=dict(default='present', type='str', choices=['present']), debug=dict(default=False, type='bool'), namespace=dict(default='default', type='str'), name=dict(default=None, required=True, type='str'), kind=dict(required=True, type='str', choices=['dc', 'deploymentconfig', 'rc', 'replicationcontroller', 'svc', 'service', 'scc', 'securitycontextconstraints', 'ns', 'namespace', 'project', 'projects', 'is', 'imagestream', 'istag', 'imagestreamtag', 'bc', 'buildconfig', 'routes', 'node', 'secret', 'pv', 'persistentvolume', ]), file_name=dict(default=None, type='str'), file_format=dict(default='yaml', type='str'), content=dict(default=None, required=True, type='dict'), force=dict(default=False, type='bool'), separator=dict(default='.', type='str'), ), supports_check_mode=True, ) ocedit = Edit(module.params['kind'], module.params['namespace'], module.params['name'], kubeconfig=module.params['kubeconfig'], separator=module.params['separator'], verbose=module.params['debug']) state = module.params['state'] api_rval = ocedit.get() ######## # Create ######## if not Utils.exists(api_rval['results'], module.params['name']): module.fail_json(msg=api_rval) ######## # Update ######## api_rval = ocedit.update(module.params['file_name'], module.params['content'], module.params['force'], module.params['file_format']) if api_rval['returncode'] != 0: module.fail_json(msg=api_rval) if api_rval.has_key('updated') and not api_rval['updated']: module.exit_json(changed=False, results=api_rval, state="present") # return the created object api_rval = ocedit.get() if api_rval['returncode'] != 0: module.fail_json(msg=api_rval) module.exit_json(changed=True, results=api_rval, state="present") module.exit_json(failed=True, changed=False, results='Unknown state passed. %s' % state, state="unknown") # pylint: disable=redefined-builtin, unused-wildcard-import, wildcard-import, locally-disabled # import module snippets. This are required from ansible.module_utils.basic import * main()
apache-2.0
battlemidget/conjure-up
test/test_controllers_summary_gui.py
1
2092
#!/usr/bin/env python # # tests controllers/summary/gui.py # # Copyright 2016 Canonical, Ltd. import unittest from unittest.mock import MagicMock, call, patch, sentinel from conjureup.controllers.summary.gui import SummaryController class SummaryGUIRenderTestCase(unittest.TestCase): def setUp(self): self.finish_patcher = patch( 'conjureup.controllers.summary.gui.SummaryController.finish') self.mock_finish = self.finish_patcher.start() self.view_patcher = patch( 'conjureup.controllers.summary.gui.SummaryView') self.view_patcher.start() self.app_patcher = patch( 'conjureup.controllers.summary.gui.app') mock_app = self.app_patcher.start() mock_app.ui = MagicMock(name="app.ui") self.controller = SummaryController() self.controller.save_path = sentinel.savepath def tearDown(self): self.finish_patcher.stop() self.view_patcher.stop() self.app_patcher.stop() def test_render_empty(self): "call render with no results" with patch("conjureup.controllers.summary.gui.common") as m_c: self.controller.render({}) m_c.write_results.assert_called_once_with({}, sentinel.savepath) class SummaryGUIFinishTestCase(unittest.TestCase): def setUp(self): self.render_patcher = patch( 'conjureup.controllers.summary.gui.SummaryController.render') self.mock_render = self.render_patcher.start() self.app_patcher = patch( 'conjureup.controllers.summary.gui.app') self.mock_app = self.app_patcher.start() self.mock_app.ui = MagicMock(name="app.ui") self.controller = SummaryController() def tearDown(self): self.render_patcher.stop() self.app_patcher.stop() def test_finish(self): "finish should stop event loop" with patch("conjureup.controllers.summary.gui.EventLoop") as m_ev: self.controller.finish() m_ev.assert_has_calls([call.remove_alarms(), call.exit(0)])
mit
deadblue/baidupan_shell
pyasn1/codec/ber/encoder.py
185
13626
# BER encoder from pyasn1.type import base, tag, univ, char, useful from pyasn1.codec.ber import eoo from pyasn1.compat.octets import int2oct, oct2int, ints2octs, null, str2octs from pyasn1 import debug, error class Error(Exception): pass class AbstractItemEncoder: supportIndefLenMode = 1 def encodeTag(self, t, isConstructed): tagClass, tagFormat, tagId = t.asTuple() # this is a hotspot v = tagClass | tagFormat if isConstructed: v = v|tag.tagFormatConstructed if tagId < 31: return int2oct(v|tagId) else: s = int2oct(tagId&0x7f) tagId = tagId >> 7 while tagId: s = int2oct(0x80|(tagId&0x7f)) + s tagId = tagId >> 7 return int2oct(v|0x1F) + s def encodeLength(self, length, defMode): if not defMode and self.supportIndefLenMode: return int2oct(0x80) if length < 0x80: return int2oct(length) else: substrate = null while length: substrate = int2oct(length&0xff) + substrate length = length >> 8 substrateLen = len(substrate) if substrateLen > 126: raise Error('Length octets overflow (%d)' % substrateLen) return int2oct(0x80 | substrateLen) + substrate def encodeValue(self, encodeFun, value, defMode, maxChunkSize): raise Error('Not implemented') def _encodeEndOfOctets(self, encodeFun, defMode): if defMode or not self.supportIndefLenMode: return null else: return encodeFun(eoo.endOfOctets, defMode) def encode(self, encodeFun, value, defMode, maxChunkSize): substrate, isConstructed = self.encodeValue( encodeFun, value, defMode, maxChunkSize ) tagSet = value.getTagSet() if tagSet: if not isConstructed: # primitive form implies definite mode defMode = 1 return self.encodeTag( tagSet[-1], isConstructed ) + self.encodeLength( len(substrate), defMode ) + substrate + self._encodeEndOfOctets(encodeFun, defMode) else: return substrate # untagged value class EndOfOctetsEncoder(AbstractItemEncoder): def encodeValue(self, encodeFun, value, defMode, maxChunkSize): return null, 0 class ExplicitlyTaggedItemEncoder(AbstractItemEncoder): def encodeValue(self, encodeFun, value, defMode, maxChunkSize): if isinstance(value, base.AbstractConstructedAsn1Item): value = value.clone(tagSet=value.getTagSet()[:-1], cloneValueFlag=1) else: value = value.clone(tagSet=value.getTagSet()[:-1]) return encodeFun(value, defMode, maxChunkSize), 1 explicitlyTaggedItemEncoder = ExplicitlyTaggedItemEncoder() class BooleanEncoder(AbstractItemEncoder): supportIndefLenMode = 0 _true = ints2octs((1,)) _false = ints2octs((0,)) def encodeValue(self, encodeFun, value, defMode, maxChunkSize): return value and self._true or self._false, 0 class IntegerEncoder(AbstractItemEncoder): supportIndefLenMode = 0 supportCompactZero = False def encodeValue(self, encodeFun, value, defMode, maxChunkSize): if value == 0: # shortcut for zero value if self.supportCompactZero: # this seems to be a correct way for encoding zeros return null, 0 else: # this seems to be a widespread way for encoding zeros return ints2octs((0,)), 0 octets = [] value = int(value) # to save on ops on asn1 type while 1: octets.insert(0, value & 0xff) if value == 0 or value == -1: break value = value >> 8 if value == 0 and octets[0] & 0x80: octets.insert(0, 0) while len(octets) > 1 and \ (octets[0] == 0 and octets[1] & 0x80 == 0 or \ octets[0] == 0xff and octets[1] & 0x80 != 0): del octets[0] return ints2octs(octets), 0 class BitStringEncoder(AbstractItemEncoder): def encodeValue(self, encodeFun, value, defMode, maxChunkSize): if not maxChunkSize or len(value) <= maxChunkSize*8: r = {}; l = len(value); p = 0; j = 7 while p < l: i, j = divmod(p, 8) r[i] = r.get(i,0) | value[p]<<(7-j) p = p + 1 keys = list(r); keys.sort() return int2oct(7-j) + ints2octs([r[k] for k in keys]), 0 else: pos = 0; substrate = null while 1: # count in octets v = value.clone(value[pos*8:pos*8+maxChunkSize*8]) if not v: break substrate = substrate + encodeFun(v, defMode, maxChunkSize) pos = pos + maxChunkSize return substrate, 1 class OctetStringEncoder(AbstractItemEncoder): def encodeValue(self, encodeFun, value, defMode, maxChunkSize): if not maxChunkSize or len(value) <= maxChunkSize: return value.asOctets(), 0 else: pos = 0; substrate = null while 1: v = value.clone(value[pos:pos+maxChunkSize]) if not v: break substrate = substrate + encodeFun(v, defMode, maxChunkSize) pos = pos + maxChunkSize return substrate, 1 class NullEncoder(AbstractItemEncoder): supportIndefLenMode = 0 def encodeValue(self, encodeFun, value, defMode, maxChunkSize): return null, 0 class ObjectIdentifierEncoder(AbstractItemEncoder): supportIndefLenMode = 0 precomputedValues = { (1, 3, 6, 1, 2): (43, 6, 1, 2), (1, 3, 6, 1, 4): (43, 6, 1, 4) } def encodeValue(self, encodeFun, value, defMode, maxChunkSize): oid = value.asTuple() if oid[:5] in self.precomputedValues: octets = self.precomputedValues[oid[:5]] index = 5 else: if len(oid) < 2: raise error.PyAsn1Error('Short OID %s' % (value,)) # Build the first twos if oid[0] > 6 or oid[1] > 39 or oid[0] == 6 and oid[1] > 15: raise error.PyAsn1Error( 'Initial sub-ID overflow %s in OID %s' % (oid[:2], value) ) octets = (oid[0] * 40 + oid[1],) index = 2 # Cycle through subids for subid in oid[index:]: if subid > -1 and subid < 128: # Optimize for the common case octets = octets + (subid & 0x7f,) elif subid < 0 or subid > 0xFFFFFFFF: raise error.PyAsn1Error( 'SubId overflow %s in %s' % (subid, value) ) else: # Pack large Sub-Object IDs res = (subid & 0x7f,) subid = subid >> 7 while subid > 0: res = (0x80 | (subid & 0x7f),) + res subid = subid >> 7 # Add packed Sub-Object ID to resulted Object ID octets += res return ints2octs(octets), 0 class RealEncoder(AbstractItemEncoder): supportIndefLenMode = 0 def encodeValue(self, encodeFun, value, defMode, maxChunkSize): if value.isPlusInfinity(): return int2oct(0x40), 0 if value.isMinusInfinity(): return int2oct(0x41), 0 m, b, e = value if not m: return null, 0 if b == 10: return str2octs('\x03%dE%s%d' % (m, e == 0 and '+' or '', e)), 0 elif b == 2: fo = 0x80 # binary enoding if m < 0: fo = fo | 0x40 # sign bit m = -m while int(m) != m: # drop floating point m *= 2 e -= 1 while m & 0x1 == 0: # mantissa normalization m >>= 1 e += 1 eo = null while e not in (0, -1): eo = int2oct(e&0xff) + eo e >>= 8 if e == 0 and eo and oct2int(eo[0]) & 0x80: eo = int2oct(0) + eo n = len(eo) if n > 0xff: raise error.PyAsn1Error('Real exponent overflow') if n == 1: pass elif n == 2: fo |= 1 elif n == 3: fo |= 2 else: fo |= 3 eo = int2oct(n//0xff+1) + eo po = null while m: po = int2oct(m&0xff) + po m >>= 8 substrate = int2oct(fo) + eo + po return substrate, 0 else: raise error.PyAsn1Error('Prohibited Real base %s' % b) class SequenceEncoder(AbstractItemEncoder): def encodeValue(self, encodeFun, value, defMode, maxChunkSize): value.setDefaultComponents() value.verifySizeSpec() substrate = null; idx = len(value) while idx > 0: idx = idx - 1 if value[idx] is None: # Optional component continue component = value.getDefaultComponentByPosition(idx) if component is not None and component == value[idx]: continue substrate = encodeFun( value[idx], defMode, maxChunkSize ) + substrate return substrate, 1 class SequenceOfEncoder(AbstractItemEncoder): def encodeValue(self, encodeFun, value, defMode, maxChunkSize): value.verifySizeSpec() substrate = null; idx = len(value) while idx > 0: idx = idx - 1 substrate = encodeFun( value[idx], defMode, maxChunkSize ) + substrate return substrate, 1 class ChoiceEncoder(AbstractItemEncoder): def encodeValue(self, encodeFun, value, defMode, maxChunkSize): return encodeFun(value.getComponent(), defMode, maxChunkSize), 1 class AnyEncoder(OctetStringEncoder): def encodeValue(self, encodeFun, value, defMode, maxChunkSize): return value.asOctets(), defMode == 0 tagMap = { eoo.endOfOctets.tagSet: EndOfOctetsEncoder(), univ.Boolean.tagSet: BooleanEncoder(), univ.Integer.tagSet: IntegerEncoder(), univ.BitString.tagSet: BitStringEncoder(), univ.OctetString.tagSet: OctetStringEncoder(), univ.Null.tagSet: NullEncoder(), univ.ObjectIdentifier.tagSet: ObjectIdentifierEncoder(), univ.Enumerated.tagSet: IntegerEncoder(), univ.Real.tagSet: RealEncoder(), # Sequence & Set have same tags as SequenceOf & SetOf univ.SequenceOf.tagSet: SequenceOfEncoder(), univ.SetOf.tagSet: SequenceOfEncoder(), univ.Choice.tagSet: ChoiceEncoder(), # character string types char.UTF8String.tagSet: OctetStringEncoder(), char.NumericString.tagSet: OctetStringEncoder(), char.PrintableString.tagSet: OctetStringEncoder(), char.TeletexString.tagSet: OctetStringEncoder(), char.VideotexString.tagSet: OctetStringEncoder(), char.IA5String.tagSet: OctetStringEncoder(), char.GraphicString.tagSet: OctetStringEncoder(), char.VisibleString.tagSet: OctetStringEncoder(), char.GeneralString.tagSet: OctetStringEncoder(), char.UniversalString.tagSet: OctetStringEncoder(), char.BMPString.tagSet: OctetStringEncoder(), # useful types useful.GeneralizedTime.tagSet: OctetStringEncoder(), useful.UTCTime.tagSet: OctetStringEncoder() } # Type-to-codec map for ambiguous ASN.1 types typeMap = { univ.Set.typeId: SequenceEncoder(), univ.SetOf.typeId: SequenceOfEncoder(), univ.Sequence.typeId: SequenceEncoder(), univ.SequenceOf.typeId: SequenceOfEncoder(), univ.Choice.typeId: ChoiceEncoder(), univ.Any.typeId: AnyEncoder() } class Encoder: def __init__(self, tagMap, typeMap={}): self.__tagMap = tagMap self.__typeMap = typeMap def __call__(self, value, defMode=1, maxChunkSize=0): debug.logger & debug.flagEncoder and debug.logger('encoder called in %sdef mode, chunk size %s for type %s, value:\n%s' % (not defMode and 'in' or '', maxChunkSize, value.__class__.__name__, value.prettyPrint())) tagSet = value.getTagSet() if len(tagSet) > 1: concreteEncoder = explicitlyTaggedItemEncoder else: if value.typeId is not None and value.typeId in self.__typeMap: concreteEncoder = self.__typeMap[value.typeId] elif tagSet in self.__tagMap: concreteEncoder = self.__tagMap[tagSet] else: tagSet = value.baseTagSet if tagSet in self.__tagMap: concreteEncoder = self.__tagMap[tagSet] else: raise Error('No encoder for %s' % (value,)) debug.logger & debug.flagEncoder and debug.logger('using value codec %s chosen by %r' % (concreteEncoder.__class__.__name__, tagSet)) substrate = concreteEncoder.encode( self, value, defMode, maxChunkSize ) debug.logger & debug.flagEncoder and debug.logger('built %s octets of substrate: %s\nencoder completed' % (len(substrate), debug.hexdump(substrate))) return substrate encode = Encoder(tagMap, typeMap)
gpl-2.0
keerts/home-assistant
homeassistant/util/async.py
22
5833
"""Asyncio backports for Python 3.4.3 compatibility.""" import concurrent.futures import threading import logging from asyncio import coroutines from asyncio.futures import Future try: # pylint: disable=ungrouped-imports from asyncio import ensure_future except ImportError: # Python 3.4.3 and earlier has this as async # pylint: disable=unused-import from asyncio import async ensure_future = async _LOGGER = logging.getLogger(__name__) def _set_result_unless_cancelled(fut, result): """Helper setting the result only if the future was not cancelled.""" if fut.cancelled(): return fut.set_result(result) def _set_concurrent_future_state(concurr, source): """Copy state from a future to a concurrent.futures.Future.""" assert source.done() if source.cancelled(): concurr.cancel() if not concurr.set_running_or_notify_cancel(): return exception = source.exception() if exception is not None: concurr.set_exception(exception) else: result = source.result() concurr.set_result(result) def _copy_future_state(source, dest): """Internal helper to copy state from another Future. The other Future may be a concurrent.futures.Future. """ assert source.done() if dest.cancelled(): return assert not dest.done() if source.cancelled(): dest.cancel() else: exception = source.exception() if exception is not None: dest.set_exception(exception) else: result = source.result() dest.set_result(result) def _chain_future(source, destination): """Chain two futures so that when one completes, so does the other. The result (or exception) of source will be copied to destination. If destination is cancelled, source gets cancelled too. Compatible with both asyncio.Future and concurrent.futures.Future. """ if not isinstance(source, (Future, concurrent.futures.Future)): raise TypeError('A future is required for source argument') if not isinstance(destination, (Future, concurrent.futures.Future)): raise TypeError('A future is required for destination argument') # pylint: disable=protected-access source_loop = source._loop if isinstance(source, Future) else None dest_loop = destination._loop if isinstance(destination, Future) else None def _set_state(future, other): if isinstance(future, Future): _copy_future_state(other, future) else: _set_concurrent_future_state(future, other) def _call_check_cancel(destination): if destination.cancelled(): if source_loop is None or source_loop is dest_loop: source.cancel() else: source_loop.call_soon_threadsafe(source.cancel) def _call_set_state(source): if dest_loop is None or dest_loop is source_loop: _set_state(destination, source) else: dest_loop.call_soon_threadsafe(_set_state, destination, source) destination.add_done_callback(_call_check_cancel) source.add_done_callback(_call_set_state) def run_coroutine_threadsafe(coro, loop): """Submit a coroutine object to a given event loop. Return a concurrent.futures.Future to access the result. """ ident = loop.__dict__.get("_thread_ident") if ident is not None and ident == threading.get_ident(): raise RuntimeError('Cannot be called from within the event loop') if not coroutines.iscoroutine(coro): raise TypeError('A coroutine object is required') future = concurrent.futures.Future() def callback(): """Callback to call the coroutine.""" try: # pylint: disable=deprecated-method _chain_future(ensure_future(coro, loop=loop), future) # pylint: disable=broad-except except Exception as exc: if future.set_running_or_notify_cancel(): future.set_exception(exc) else: _LOGGER.warning("Exception on lost future: ", exc_info=True) loop.call_soon_threadsafe(callback) return future def fire_coroutine_threadsafe(coro, loop): """Submit a coroutine object to a given event loop. This method does not provide a way to retrieve the result and is intended for fire-and-forget use. This reduces the work involved to fire the function on the loop. """ ident = loop.__dict__.get("_thread_ident") if ident is not None and ident == threading.get_ident(): raise RuntimeError('Cannot be called from within the event loop') if not coroutines.iscoroutine(coro): raise TypeError('A coroutine object is required: %s' % coro) def callback(): """Callback to fire coroutine.""" # pylint: disable=deprecated-method ensure_future(coro, loop=loop) loop.call_soon_threadsafe(callback) return def run_callback_threadsafe(loop, callback, *args): """Submit a callback object to a given event loop. Return a concurrent.futures.Future to access the result. """ ident = loop.__dict__.get("_thread_ident") if ident is not None and ident == threading.get_ident(): raise RuntimeError('Cannot be called from within the event loop') future = concurrent.futures.Future() def run_callback(): """Run callback and store result.""" try: future.set_result(callback(*args)) # pylint: disable=broad-except except Exception as exc: if future.set_running_or_notify_cancel(): future.set_exception(exc) else: _LOGGER.warning("Exception on lost future: ", exc_info=True) loop.call_soon_threadsafe(run_callback) return future
apache-2.0
NewCaliforniaWaterAtlas/ca-freshwater-species-backend
wkg/data_loader.py
1
11204
#!/usr/bin/env python # # Run this from the top level as # # honcho run python wkg/data_loader.py 'subdirectory' # import os import psycopg2 from petl import * import argparse # get the subdirectory containing the .csv files from the command line and check that it exists. # parser = argparse.ArgumentParser(description='Import .csv files for the Freshwater Species Database.') parser.add_argument('subdir', help="name of the database subdirectory (expected to be in 'wkg/')") args = parser.parse_args() if not os.path.exists(os.path.join('wkg', args.subdir)): print('Error: ' + args.subdir + " does not exist as a subdirectory of 'wkg/'.") exit() # Set up the database connection # connection = psycopg2.connect( database=os.environ['DB'], user=os.environ['DB_USER'], password=os.environ['DB_PASSWORD'], host=os.environ['DB_HOST'], ) cursor = connection.cursor() # Origin: create, map, and load # cursor.execute(""" DROP TABLE IF EXISTS origins CASCADE; CREATE TABLE origins ( id BIGSERIAL NOT NULL UNIQUE PRIMARY KEY, org_id INTEGER NOT NULL UNIQUE, org_name VARCHAR(32) NOT NULL ); """) f = fromcsv(os.path.join('wkg', args.subdir, 'Origin.csv')) f = cutout(f, 'OBJECTID') f = rename(f, { 'Org_ID': 'org_id', 'Org_Name': 'org_name', }) f = convertnumbers(f) todb(f, connection, 'origins') # ObservationType: create, map, and load # cursor.execute(""" DROP TABLE IF EXISTS observation_types CASCADE; CREATE TABLE observation_types ( id BIGSERIAL NOT NULL UNIQUE PRIMARY KEY, obs_typ_id INTEGER UNIQUE, obs_typ_name VARCHAR(64) NOT NULL UNIQUE, range_obs VARCHAR(32), current_other VARCHAR(32), group_ VARCHAR(32) ); """) f = fromcsv(os.path.join('wkg', args.subdir, 'ObservationType.csv')) f = cutout(f, 'OBJECTID') f = rename(f, { 'ObsTyp_ID': 'obs_typ_id', 'ObsTyp_Name': 'obs_typ_name', 'Range_Obs': 'range_obs', 'Current_Other': 'current_other', 'Group_': 'group_', }) f = convertnumbers(f) todb(f, connection, 'observation_types') # Source: create, map, and load # # @todo source_name should be UNIQUE. cursor.execute(""" DROP TABLE IF EXISTS sources CASCADE; CREATE TABLE sources ( id BIGSERIAL NOT NULL UNIQUE PRIMARY KEY, source_id INTEGER NOT NULL UNIQUE, source_name VARCHAR(256), sourcegrp_name VARCHAR(64), use_agree TEXT, permission_request_needed VARCHAR(64), permission_contact_name VARCHAR(32), permission_contact_email VARCHAR(64), permission_status TEXT, permission VARCHAR(32), comment_id INTEGER, citation TEXT, weblink VARCHAR(128), pre_release_review VARCHAR(8), aggregator VARCHAR(32), count_huc12s INTEGER, count_elm_ids INTEGER ); CREATE INDEX ON sources (source_id); """) f = fromcsv(os.path.join('wkg', args.subdir, 'Source.csv')) f = cutout(f, 'OBJECTID') f = rename(f, { 'Source_ID': 'source_id', 'Source_Name': 'source_name', 'SourceGrp_Name': 'sourcegrp_name', 'Use_agree': 'use_agree', 'Permission_request_needed': 'permission_request_needed', 'Permission_contact_name': 'permission_contact_name', 'Permission_contact_email': 'permission_contact_email', 'Permission_status': 'permission_status', 'Permission': 'permission', 'Comment_ID': 'comment_id', 'Citation': 'citation', 'Weblink': 'weblink', 'Pre_release_review': 'pre_release_review', 'Aggregator': 'aggregator', 'Count_HUC12s': 'count_huc12s', 'Count_Elm_IDs': 'count_elm_ids' }) f = convertnumbers(f) f = convert(f, ( 'source_id', 'comment_id', 'count_huc12s', 'count_elm_ids', ), lambda v: int(v)) todb(f, connection, 'sources') # HabitatUsage: create, map, and load # cursor.execute(""" DROP TABLE IF EXISTS habitat_usages CASCADE; CREATE TABLE habitat_usages ( id BIGSERIAL NOT NULL UNIQUE PRIMARY KEY, hab_usage_id INTEGER UNIQUE, hab_usage_name VARCHAR(32) UNIQUE ); """) f = fromcsv(os.path.join('wkg', args.subdir, 'HabitatUsage.csv')) f = cutout(f, 'OBJECTID') f = rename(f, { 'HabU_ID': 'hab_usage_id', 'HabU_Name': 'hab_usage_name', }) f = convertnumbers(f) todb(f, connection, 'habitat_usages') # Element: create, map, and load # cursor.execute(""" DROP TABLE IF EXISTS elements CASCADE; CREATE TABLE elements ( id BIGSERIAL NOT NULL UNIQUE PRIMARY KEY, elm_scinam VARCHAR(64), elm_comnam VARCHAR(64), group_ VARCHAR(32) NOT NULL, fwa_v1 INTEGER, tax_list VARCHAR(32), g_rank VARCHAR(16), s_rank VARCHAR(32), elm_scin_1 VARCHAR(64), elm_scin_2 VARCHAR(64), elm_scin_3 VARCHAR(64), elm_scin_4 VARCHAR(64), kingdom VARCHAR(32), phylum VARCHAR(32), tax_class VARCHAR(32), tax_order VARCHAR(32), family VARCHAR(32), genus VARCHAR(32), species VARCHAR(32), subsp_var VARCHAR(32), kingdom_id VARCHAR(5), phylum_id VARCHAR(5), tax_class_i VARCHAR(5), tax_order_i VARCHAR(5), family_id VARCHAR(5), genus_id VARCHAR(5), species_id VARCHAR(5), elm_id INTEGER NOT NULL UNIQUE, other_id VARCHAR(5), sensitive_fam VARCHAR(32), ns_endemic INTEGER, safit_endemic INTEGER, other_endemic INTEGER, endemism_comment TEXT, fed_list VARCHAR(64), state_list VARCHAR(64), other_list VARCHAR(64), mgtag_list VARCHAR(32), listed BOOLEAN, vulnerable BOOLEAN, endemic BOOLEAN, common BOOLEAN, not_evaluated BOOLEAN, extinct BOOLEAN, status VARCHAR(32) ); CREATE INDEX ON elements (elm_id); CREATE INDEX ON elements (group_); """) f = fromcsv(os.path.join('wkg', args.subdir, 'Elements.csv')) f = cutout(f, 'OBJECTID') f = rename(f, { 'ELM_SCINAM': 'elm_scinam', 'ELM_COMNAM': 'elm_comnam', 'GROUP_': 'group_', 'FWA_v1': 'fwa_v1', 'TAX_LIST': 'tax_list', 'G_Rank': 'g_rank', 'S_Rank': 's_rank', 'ELM_SCIN_1': 'elm_scin_1', 'ELM_SCIN_2': 'elm_scin_2', 'ELM_SCIN_3': 'elm_scin_3', 'ELM_SCIN_4': 'elm_scin_4', 'Kingdom': 'kingdom', 'Phylum': 'phylum', 'TaxClass': 'tax_class', 'TaxOrder': 'tax_order', 'Family': 'family', 'Genus': 'genus', 'Species': 'species', 'Subsp_Var': 'subsp_var', 'Kingdom_ID': 'kingdom_id', 'Phylum_ID': 'phylum_id', 'TaxClass_I': 'tax_class_i', 'TaxOrder_I': 'tax_order_i', 'Family_ID': 'family_id', 'Genus_ID': 'genus_id', 'Species_ID': 'species_id', 'ELM_ID': 'elm_id', 'Other_ID': 'other_id', 'Sensitive_Fam': 'sensitive_fam', 'NS_endemic': 'ns_endemic', 'SAFIT_endemic': 'safit_endemic', 'Other_endemic': 'other_endemic', 'Endemism_comment': 'endemism_comment', 'Fed_list': 'fed_list', 'State_list': 'state_list', 'Other_list': 'other_list', 'MgtAg_list': 'mgtag_list', 'Listed': 'listed', 'Vulnerable': 'vulnerable', 'Endemic': 'endemic', 'Common': 'common', 'Not_evaluated': 'not_evaluated', 'Extinct': 'extinct', 'Status': 'status', }) # @todo resolve this hack: Deal with the mussels (multiple rows having elm_id = 81077) f = selectnotin(f, 'elm_scinam', [ 'Anodonta californiensis', 'Anodonta dejecta', 'Anodonta oregonensis', ]) # Attempt to pull the comma-as-thousands separator out. f = sub(f, ( 'fwa_v1', 'kingdom_id', 'phylum_id', 'tax_class_i', 'tax_order_i', 'family_id', 'genus_id', 'species_id', 'elm_id', 'other_id', ), ',', '') # Convert the new values to integers; this can handle nulls. f = convert(f, ( 'fwa_v1', 'elm_id', ), lambda v: int(v)) # Don't really have to do this, but seems cleaner. f = convert(f, ( 'listed', 'vulnerable', 'endemic', 'common', 'not_evaluated', 'extinct', ), { 0: False, 1 : True }) todb(f, connection, 'elements') # AU_v_elm: create, map, and load # cursor.execute(""" DROP TABLE IF EXISTS au_v_elms CASCADE; CREATE TABLE au_v_elms ( id BIGSERIAL NOT NULL UNIQUE PRIMARY KEY, elm_id INTEGER REFERENCES elements (elm_id), huc_12 VARCHAR(12), obs_typ_id INTEGER REFERENCES observation_types (obs_typ_id), source_id INTEGER REFERENCES sources (source_id), frequency DOUBLE PRECISION, sum_amount DOUBLE PRECISION ); """) f = fromcsv(os.path.join('wkg', args.subdir, 'AU_v_Elm_sum.csv')) f = cutout(f, 'OID_') f = rename(f, { 'Elm_ID': 'elm_id', 'HUC_12': 'huc_12', 'ObsTyp_ID': 'obs_typ_id', 'Source_ID': 'source_id', 'FREQUENCY': 'frequency', 'SUM_Amount': 'sum_amount', }) f = sub(f, ( 'elm_id', 'source_id', 'sum_amount', ), ',', '') f = convert(f, ('elm_id', 'source_id'), lambda v: int(float(v))) f = convert(f, ('sum_amount'), lambda v: float(v)) todb(f, connection, 'au_v_elms') # Persist and be tidy connection.commit() cursor.close() connection.close()
mit
JioCloud/nova
nova/tests/unit/scheduler/test_filter_scheduler.py
20
14276
# Copyright 2011 OpenStack Foundation # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ Tests For Filter Scheduler. """ import mock from nova import exception from nova.scheduler import filter_scheduler from nova.scheduler import host_manager from nova.scheduler import utils as scheduler_utils from nova.scheduler import weights from nova.tests.unit.scheduler import fakes from nova.tests.unit.scheduler import test_scheduler def fake_get_filtered_hosts(hosts, filter_properties, index): return list(hosts) class FilterSchedulerTestCase(test_scheduler.SchedulerTestCase): """Test case for Filter Scheduler.""" driver_cls = filter_scheduler.FilterScheduler @mock.patch('nova.objects.ServiceList.get_by_binary', return_value=fakes.SERVICES) @mock.patch('nova.objects.InstanceList.get_by_host') @mock.patch('nova.objects.ComputeNodeList.get_all', return_value=fakes.COMPUTE_NODES) @mock.patch('nova.db.instance_extra_get_by_instance_uuid', return_value={'numa_topology': None, 'pci_requests': None}) def test_schedule_happy_day(self, mock_get_extra, mock_get_all, mock_by_host, mock_get_by_binary): """Make sure there's nothing glaringly wrong with _schedule() by doing a happy day pass through. """ self.next_weight = 1.0 def _fake_weigh_objects(_self, functions, hosts, options): self.next_weight += 2.0 host_state = hosts[0] return [weights.WeighedHost(host_state, self.next_weight)] self.stubs.Set(self.driver.host_manager, 'get_filtered_hosts', fake_get_filtered_hosts) self.stubs.Set(weights.HostWeightHandler, 'get_weighed_objects', _fake_weigh_objects) request_spec = {'num_instances': 10, 'instance_type': {'memory_mb': 512, 'root_gb': 512, 'ephemeral_gb': 0, 'vcpus': 1}, 'instance_properties': {'project_id': 1, 'root_gb': 512, 'memory_mb': 512, 'ephemeral_gb': 0, 'vcpus': 1, 'os_type': 'Linux', 'uuid': 'fake-uuid'}} self.mox.ReplayAll() weighed_hosts = self.driver._schedule(self.context, request_spec, {}) self.assertEqual(len(weighed_hosts), 10) for weighed_host in weighed_hosts: self.assertIsNotNone(weighed_host.obj) def test_max_attempts(self): self.flags(scheduler_max_attempts=4) self.assertEqual(4, scheduler_utils._max_attempts()) def test_invalid_max_attempts(self): self.flags(scheduler_max_attempts=0) self.assertRaises(exception.NovaException, scheduler_utils._max_attempts) def test_add_retry_host(self): retry = dict(num_attempts=1, hosts=[]) filter_properties = dict(retry=retry) host = "fakehost" node = "fakenode" scheduler_utils._add_retry_host(filter_properties, host, node) hosts = filter_properties['retry']['hosts'] self.assertEqual(1, len(hosts)) self.assertEqual([host, node], hosts[0]) def test_post_select_populate(self): # Test addition of certain filter props after a node is selected. retry = {'hosts': [], 'num_attempts': 1} filter_properties = {'retry': retry} host_state = host_manager.HostState('host', 'node') host_state.limits['vcpus'] = 5 scheduler_utils.populate_filter_properties(filter_properties, host_state) self.assertEqual(['host', 'node'], filter_properties['retry']['hosts'][0]) self.assertEqual({'vcpus': 5}, host_state.limits) @mock.patch('nova.objects.ServiceList.get_by_binary', return_value=fakes.SERVICES) @mock.patch('nova.objects.InstanceList.get_by_host') @mock.patch('nova.objects.ComputeNodeList.get_all', return_value=fakes.COMPUTE_NODES) @mock.patch('nova.db.instance_extra_get_by_instance_uuid', return_value={'numa_topology': None, 'pci_requests': None}) def test_schedule_host_pool(self, mock_get_extra, mock_get_all, mock_by_host, mock_get_by_binary): """Make sure the scheduler_host_subset_size property works properly.""" self.flags(scheduler_host_subset_size=2) self.stubs.Set(self.driver.host_manager, 'get_filtered_hosts', fake_get_filtered_hosts) instance_properties = {'project_id': 1, 'root_gb': 512, 'memory_mb': 512, 'ephemeral_gb': 0, 'vcpus': 1, 'os_type': 'Linux', 'uuid': 'fake-uuid'} request_spec = dict(instance_properties=instance_properties, instance_type={}) filter_properties = {} self.mox.ReplayAll() hosts = self.driver._schedule(self.context, request_spec, filter_properties=filter_properties) # one host should be chosen self.assertEqual(len(hosts), 1) @mock.patch('nova.objects.ServiceList.get_by_binary', return_value=fakes.SERVICES) @mock.patch('nova.objects.InstanceList.get_by_host') @mock.patch('nova.objects.ComputeNodeList.get_all', return_value=fakes.COMPUTE_NODES) @mock.patch('nova.db.instance_extra_get_by_instance_uuid', return_value={'numa_topology': None, 'pci_requests': None}) def test_schedule_large_host_pool(self, mock_get_extra, mock_get_all, mock_by_host, mock_get_by_binary): """Hosts should still be chosen if pool size is larger than number of filtered hosts. """ self.flags(scheduler_host_subset_size=20) self.stubs.Set(self.driver.host_manager, 'get_filtered_hosts', fake_get_filtered_hosts) instance_properties = {'project_id': 1, 'root_gb': 512, 'memory_mb': 512, 'ephemeral_gb': 0, 'vcpus': 1, 'os_type': 'Linux', 'uuid': 'fake-uuid'} request_spec = dict(instance_properties=instance_properties, instance_type={}) filter_properties = {} self.mox.ReplayAll() hosts = self.driver._schedule(self.context, request_spec, filter_properties=filter_properties) # one host should be chose self.assertEqual(len(hosts), 1) @mock.patch('nova.scheduler.host_manager.HostManager._add_instance_info') @mock.patch('nova.objects.ServiceList.get_by_binary', return_value=fakes.SERVICES) @mock.patch('nova.objects.ComputeNodeList.get_all', return_value=fakes.COMPUTE_NODES) @mock.patch('nova.db.instance_extra_get_by_instance_uuid', return_value={'numa_topology': None, 'pci_requests': None}) def test_schedule_chooses_best_host(self, mock_get_extra, mock_cn_get_all, mock_get_by_binary, mock_add_inst_info): """If scheduler_host_subset_size is 1, the largest host with greatest weight should be returned. """ self.flags(scheduler_host_subset_size=1) self.stubs.Set(self.driver.host_manager, 'get_filtered_hosts', fake_get_filtered_hosts) self.next_weight = 50 def _fake_weigh_objects(_self, functions, hosts, options): this_weight = self.next_weight self.next_weight = 0 host_state = hosts[0] return [weights.WeighedHost(host_state, this_weight)] instance_properties = {'project_id': 1, 'root_gb': 512, 'memory_mb': 512, 'ephemeral_gb': 0, 'vcpus': 1, 'os_type': 'Linux', 'uuid': 'fake-uuid'} request_spec = dict(instance_properties=instance_properties, instance_type={}) self.stubs.Set(weights.HostWeightHandler, 'get_weighed_objects', _fake_weigh_objects) filter_properties = {} self.mox.ReplayAll() hosts = self.driver._schedule(self.context, request_spec, filter_properties=filter_properties) # one host should be chosen self.assertEqual(1, len(hosts)) self.assertEqual(50, hosts[0].weight) @mock.patch('nova.objects.ServiceList.get_by_binary', return_value=fakes.SERVICES) @mock.patch('nova.objects.InstanceList.get_by_host') @mock.patch('nova.objects.ComputeNodeList.get_all', return_value=fakes.COMPUTE_NODES) @mock.patch('nova.db.instance_extra_get_by_instance_uuid', return_value={'numa_topology': None, 'pci_requests': None}) def test_select_destinations(self, mock_get_extra, mock_get_all, mock_by_host, mock_get_by_binary): """select_destinations is basically a wrapper around _schedule(). Similar to the _schedule tests, this just does a happy path test to ensure there is nothing glaringly wrong. """ self.next_weight = 1.0 selected_hosts = [] selected_nodes = [] def _fake_weigh_objects(_self, functions, hosts, options): self.next_weight += 2.0 host_state = hosts[0] selected_hosts.append(host_state.host) selected_nodes.append(host_state.nodename) return [weights.WeighedHost(host_state, self.next_weight)] self.stubs.Set(self.driver.host_manager, 'get_filtered_hosts', fake_get_filtered_hosts) self.stubs.Set(weights.HostWeightHandler, 'get_weighed_objects', _fake_weigh_objects) request_spec = {'instance_type': {'memory_mb': 512, 'root_gb': 512, 'ephemeral_gb': 0, 'vcpus': 1}, 'instance_properties': {'project_id': 1, 'root_gb': 512, 'memory_mb': 512, 'ephemeral_gb': 0, 'vcpus': 1, 'os_type': 'Linux', 'uuid': 'fake-uuid'}, 'num_instances': 1} self.mox.ReplayAll() dests = self.driver.select_destinations(self.context, request_spec, {}) (host, node) = (dests[0]['host'], dests[0]['nodename']) self.assertEqual(host, selected_hosts[0]) self.assertEqual(node, selected_nodes[0]) @mock.patch.object(filter_scheduler.FilterScheduler, '_schedule') def test_select_destinations_notifications(self, mock_schedule): mock_schedule.return_value = [mock.Mock()] with mock.patch.object(self.driver.notifier, 'info') as mock_info: request_spec = {'num_instances': 1} self.driver.select_destinations(self.context, request_spec, {}) expected = [ mock.call(self.context, 'scheduler.select_destinations.start', dict(request_spec=request_spec)), mock.call(self.context, 'scheduler.select_destinations.end', dict(request_spec=request_spec))] self.assertEqual(expected, mock_info.call_args_list) def test_select_destinations_no_valid_host(self): def _return_no_host(*args, **kwargs): return [] self.stubs.Set(self.driver, '_schedule', _return_no_host) self.assertRaises(exception.NoValidHost, self.driver.select_destinations, self.context, {'num_instances': 1}, {}) def test_select_destinations_no_valid_host_not_enough(self): # Tests that we have fewer hosts available than number of instances # requested to build. consumed_hosts = [mock.MagicMock(), mock.MagicMock()] with mock.patch.object(self.driver, '_schedule', return_value=consumed_hosts): try: self.driver.select_destinations( self.context, {'num_instances': 3}, {}) self.fail('Expected NoValidHost to be raised.') except exception.NoValidHost as e: # Make sure that we provided a reason why NoValidHost. self.assertIn('reason', e.kwargs) self.assertTrue(len(e.kwargs['reason']) > 0) # Make sure that the consumed hosts have chance to be reverted. for host in consumed_hosts: self.assertIsNone(host.obj.updated)
apache-2.0
BT-ojossen/odoo
openerp/service/report.py
324
5148
# -*- coding: utf-8 -*- import base64 import logging import sys import threading import openerp import openerp.report from openerp import tools import security _logger = logging.getLogger(__name__) # TODO: set a maximum report number per user to avoid DOS attacks # # Report state: # False -> True self_reports = {} self_id = 0 self_id_protect = threading.Semaphore() def dispatch(method, params): (db, uid, passwd ) = params[0:3] threading.current_thread().uid = uid params = params[3:] if method not in ['report', 'report_get', 'render_report']: raise KeyError("Method not supported %s" % method) security.check(db,uid,passwd) openerp.modules.registry.RegistryManager.check_registry_signaling(db) fn = globals()['exp_' + method] res = fn(db, uid, *params) openerp.modules.registry.RegistryManager.signal_caches_change(db) return res def exp_render_report(db, uid, object, ids, datas=None, context=None): if not datas: datas={} if not context: context={} self_id_protect.acquire() global self_id self_id += 1 id = self_id self_id_protect.release() self_reports[id] = {'uid': uid, 'result': False, 'state': False, 'exception': None} cr = openerp.registry(db).cursor() try: result, format = openerp.report.render_report(cr, uid, ids, object, datas, context) if not result: tb = sys.exc_info() self_reports[id]['exception'] = openerp.exceptions.DeferredException('RML is not available at specified location or not enough data to print!', tb) self_reports[id]['result'] = result self_reports[id]['format'] = format self_reports[id]['state'] = True except Exception, exception: _logger.exception('Exception: %s\n', exception) if hasattr(exception, 'name') and hasattr(exception, 'value'): self_reports[id]['exception'] = openerp.exceptions.DeferredException(tools.ustr(exception.name), tools.ustr(exception.value)) else: tb = sys.exc_info() self_reports[id]['exception'] = openerp.exceptions.DeferredException(tools.exception_to_unicode(exception), tb) self_reports[id]['state'] = True cr.commit() cr.close() return _check_report(id) def exp_report(db, uid, object, ids, datas=None, context=None): if not datas: datas={} if not context: context={} self_id_protect.acquire() global self_id self_id += 1 id = self_id self_id_protect.release() self_reports[id] = {'uid': uid, 'result': False, 'state': False, 'exception': None} def go(id, uid, ids, datas, context): with openerp.api.Environment.manage(): cr = openerp.registry(db).cursor() try: result, format = openerp.report.render_report(cr, uid, ids, object, datas, context) if not result: tb = sys.exc_info() self_reports[id]['exception'] = openerp.exceptions.DeferredException('RML is not available at specified location or not enough data to print!', tb) self_reports[id]['result'] = result self_reports[id]['format'] = format self_reports[id]['state'] = True except Exception, exception: _logger.exception('Exception: %s\n', exception) if hasattr(exception, 'name') and hasattr(exception, 'value'): self_reports[id]['exception'] = openerp.exceptions.DeferredException(tools.ustr(exception.name), tools.ustr(exception.value)) else: tb = sys.exc_info() self_reports[id]['exception'] = openerp.exceptions.DeferredException(tools.exception_to_unicode(exception), tb) self_reports[id]['state'] = True cr.commit() cr.close() return True threading.Thread(target=go, args=(id, uid, ids, datas, context)).start() return id def _check_report(report_id): result = self_reports[report_id] exc = result['exception'] if exc: raise openerp.osv.orm.except_orm(exc.message, exc.traceback) res = {'state': result['state']} if res['state']: if tools.config['reportgz']: import zlib res2 = zlib.compress(result['result']) res['code'] = 'zlib' else: #CHECKME: why is this needed??? if isinstance(result['result'], unicode): res2 = result['result'].encode('latin1', 'replace') else: res2 = result['result'] if res2: res['result'] = base64.encodestring(res2) res['format'] = result['format'] del self_reports[report_id] return res def exp_report_get(db, uid, report_id): if report_id in self_reports: if self_reports[report_id]['uid'] == uid: return _check_report(report_id) else: raise Exception, 'AccessDenied' else: raise Exception, 'ReportNotFound' # vim:expandtab:smartindent:tabstop=4:softtabstop=4:shiftwidth=4:
agpl-3.0
trishnaguha/ansible
lib/ansible/plugins/callback/cgroup_memory_recap.py
95
4266
# -*- coding: utf-8 -*- # (c) 2018 Matt Martz <matt@sivel.net> # GNU General Public License v3.0+ (see COPYING or https://www.gnu.org/licenses/gpl-3.0.txt) # Make coding more python3-ish from __future__ import (absolute_import, division, print_function) __metaclass__ = type ANSIBLE_METADATA = {'metadata_version': '1.1', 'status': ['preview'], 'supported_by': 'community'} DOCUMENTATION = ''' callback: cgroup_memory_recap callback_type: aggregate requirements: - whitelist in configuration - cgroups short_description: Profiles maximum memory usage of tasks and full execution using cgroups version_added: "2.6" description: - This is an ansible callback plugin that profiles maximum memory usage of ansible and individual tasks, and displays a recap at the end using cgroups notes: - Requires ansible to be run from within a cgroup, such as with C(cgexec -g memory:ansible_profile ansible-playbook ...) - This cgroup should only be used by ansible to get accurate results - To create the cgroup, first use a command such as C(sudo cgcreate -a ec2-user:ec2-user -t ec2-user:ec2-user -g memory:ansible_profile) options: max_mem_file: required: True description: Path to cgroups C(memory.max_usage_in_bytes) file. Example C(/sys/fs/cgroup/memory/ansible_profile/memory.max_usage_in_bytes) env: - name: CGROUP_MAX_MEM_FILE ini: - section: callback_cgroupmemrecap key: max_mem_file cur_mem_file: required: True description: Path to C(memory.usage_in_bytes) file. Example C(/sys/fs/cgroup/memory/ansible_profile/memory.usage_in_bytes) env: - name: CGROUP_CUR_MEM_FILE ini: - section: callback_cgroupmemrecap key: cur_mem_file ''' import time import threading from ansible.plugins.callback import CallbackBase class MemProf(threading.Thread): """Python thread for recording memory usage""" def __init__(self, path, obj=None): threading.Thread.__init__(self) self.obj = obj self.path = path self.results = [] self.running = True def run(self): while self.running: with open(self.path) as f: val = f.read() self.results.append(int(val.strip()) / 1024 / 1024) time.sleep(0.001) class CallbackModule(CallbackBase): CALLBACK_VERSION = 2.0 CALLBACK_TYPE = 'aggregate' CALLBACK_NAME = 'cgroup_memory_recap' CALLBACK_NEEDS_WHITELIST = True def __init__(self, display=None): super(CallbackModule, self).__init__(display) self._task_memprof = None self.task_results = [] def set_options(self, task_keys=None, var_options=None, direct=None): super(CallbackModule, self).set_options(task_keys=task_keys, var_options=var_options, direct=direct) self.cgroup_max_file = self.get_option('max_mem_file') self.cgroup_current_file = self.get_option('cur_mem_file') with open(self.cgroup_max_file, 'w+') as f: f.write('0') def _profile_memory(self, obj=None): prev_task = None results = None try: self._task_memprof.running = False results = self._task_memprof.results prev_task = self._task_memprof.obj except AttributeError: pass if obj is not None: self._task_memprof = MemProf(self.cgroup_current_file, obj=obj) self._task_memprof.start() if results is not None: self.task_results.append((prev_task, max(results))) def v2_playbook_on_task_start(self, task, is_conditional): self._profile_memory(task) def v2_playbook_on_stats(self, stats): self._profile_memory() with open(self.cgroup_max_file) as f: max_results = int(f.read().strip()) / 1024 / 1024 self._display.banner('CGROUP MEMORY RECAP') self._display.display('Execution Maximum: %0.2fMB\n\n' % max_results) for task, memory in self.task_results: self._display.display('%s (%s): %0.2fMB' % (task.get_name(), task._uuid, memory))
gpl-3.0
kaarl/pyload
module/plugins/hoster/MegaCoNz.py
1
14728
# -*- coding: utf-8 -*- import base64 import os import random import re import struct import Crypto.Cipher.AES import Crypto.Util.Counter from module.network.HTTPRequest import BadHeader from module.plugins.internal.Hoster import Hoster from module.plugins.internal.misc import decode, encode, exists, fsjoin, json ############################ General errors ################################### # EINTERNAL (-1): An internal error has occurred. Please submit a bug report, detailing the exact circumstances in which this error occurred # EARGS (-2): You have passed invalid arguments to this command # EAGAIN (-3): (always at the request level) A temporary congestion or server malfunction prevented your request from being processed. No data was altered. Retry. Retries must be spaced with exponential backoff # ERATELIMIT (-4): You have exceeded your command weight per time quota. Please wait a few seconds, then try again (this should never happen in sane real-life applications) # ############################ Upload errors #################################### # EFAILED (-5): The upload failed. Please restart it from scratch # ETOOMANY (-6): Too many concurrent IP addresses are accessing this upload target URL # ERANGE (-7): The upload file packet is out of range or not starting and ending on a chunk boundary # EEXPIRED (-8): The upload target URL you are trying to access has expired. Please request a fresh one # ############################ Stream/System errors ############################# # ENOENT (-9): Object (typically, node or user) not found # ECIRCULAR (-10): Circular linkage attempted # EACCESS (-11): Access violation (e.g., trying to write to a read-only share) # EEXIST (-12): Trying to create an object that already exists # EINCOMPLETE (-13): Trying to access an incomplete resource # EKEY (-14): A decryption operation failed (never returned by the API) # ESID (-15): Invalid or expired user session, please relogin # EBLOCKED (-16): User blocked # EOVERQUOTA (-17): Request over quota # ETEMPUNAVAIL (-18): Resource temporarily not available, please try again later # ETOOMANYCONNECTIONS (-19): Too many connections on this resource # EWRITE (-20): Write failed # EREAD (-21): Read failed # EAPPKEY (-22): Invalid application key; request not processed class MegaCrypto(object): @staticmethod def base64_decode(data): data += '=' * (-len(data) % 4) #: Add padding, we need a string with a length multiple of 4 return base64.b64decode(str(data), "-_") @staticmethod def base64_encode(data): return base64.b64encode(data, "-_") @staticmethod def a32_to_str(a): return struct.pack(">%dI" % len(a), *a) #: big-endian, unsigned int @staticmethod def str_to_a32(s): s += '\0' * (-len(s) % 4) # Add padding, we need a string with a length multiple of 4 return struct.unpack(">%dI" % (len(s) / 4), s) #: big-endian, unsigned int @staticmethod def base64_to_a32(s): return MegaCrypto.str_to_a32(MegaCrypto.base64_decode(s)) @staticmethod def cbc_decrypt(data, key): cbc = Crypto.Cipher.AES.new(MegaCrypto.a32_to_str(key), Crypto.Cipher.AES.MODE_CBC, "\0" * 16) return cbc.decrypt(data) @staticmethod def cbc_encrypt(data, key): cbc = Crypto.Cipher.AES.new(MegaCrypto.a32_to_str(key), Crypto.Cipher.AES.MODE_CBC, "\0" * 16) return cbc.encrypt(data) @staticmethod def get_cipher_key(key): """ Construct the cipher key from the given data """ k = (key[0] ^ key[4], key[1] ^ key[5], key[2] ^ key[6], key[3] ^ key[7]) iv = key[4:6] + (0, 0) meta_mac = key[6:8] return k, iv, meta_mac @staticmethod def decrypt_attr(data, key): """ Decrypt an encrypted attribute (usually 'a' or 'at' member of a node) """ data = MegaCrypto.base64_decode(data) k, iv, meta_mac = MegaCrypto.get_cipher_key(key) attr = MegaCrypto.cbc_decrypt(data, k) #: Data is padded, 0-bytes must be stripped return json.loads(re.search(r'{.+?}', attr).group(0)) if attr[:6] == 'MEGA{"' else False @staticmethod def decrypt_key(data, key): """ Decrypt an encrypted key ('k' member of a node) """ data = MegaCrypto.base64_decode(data) return sum((MegaCrypto.str_to_a32(MegaCrypto.cbc_decrypt(data[_i:_i + 16], key)) for _i in xrange(0, len(data), 16)), ()) @staticmethod def get_chunks(size): """ Calculate chunks for a given encrypted file size """ chunk_start = 0 chunk_size = 0x20000 while chunk_start + chunk_size < size: yield (chunk_start, chunk_size) chunk_start += chunk_size if chunk_size < 0x100000: chunk_size += 0x20000 if chunk_start < size: yield (chunk_start, size - chunk_start) class Checksum(object): """ interface for checking CBC-MAC checksum """ def __init__(self, key): k, iv, meta_mac = MegaCrypto.get_cipher_key(key) self.hash = '\0' * 16 self.key = MegaCrypto.a32_to_str(k) self.iv = MegaCrypto.a32_to_str(iv[0:2] * 2) self.AES = Crypto.Cipher.AES.new(self.key, mode=Crypto.Cipher.AES.MODE_CBC, IV=self.hash) def update(self, chunk): cbc = Crypto.Cipher.AES.new(self.key, mode=Crypto.Cipher.AES.MODE_CBC, IV=self.iv) for j in xrange(0, len(chunk), 16): block = chunk[j:j + 16].ljust(16, '\0') hash = cbc.encrypt(block) self.hash = self.AES.encrypt(hash) def digest(self): """ Return the **binary** (non-printable) CBC-MAC of the message that has been authenticated so far. """ d = MegaCrypto.str_to_a32(self.hash) return (d[0] ^ d[1], d[2] ^ d[3]) def hexdigest(self): """ Return the **printable** CBC-MAC of the message that has been authenticated so far. """ return "".join(["%02x" % ord(x) for x in MegaCrypto.a32_to_str(self.digest())]) @staticmethod def new(key): return MegaCrypto.Checksum(key) class MegaClient(object): API_URL = "https://eu.api.mega.co.nz/cs" def __init__(self, plugin, node_id): self.plugin = plugin self.node_id = node_id def api_response(self, **kwargs): """ Dispatch a call to the api, see https://mega.co.nz/#developers """ uid = random.randint(10 << 9, 10 ** 10) #: Generate a session id, no idea where to obtain elsewhere try: res = self.plugin.load(self.API_URL, get={'id': uid, 'n': self.node_id}, post=json.dumps([kwargs])) except BadHeader, e: if e.code == 500: self.plugin.retry(wait_time=60, reason=_("Server busy")) else: raise self.plugin.log_debug(_("Api Response: ") + res) return json.loads(res) def check_error(self, code): ecode = abs(code) if ecode in (9, 16, 21): self.plugin.offline() elif ecode in (3, 13, 17, 18, 19): self.plugin.temp_offline() elif ecode in (1, 4, 6, 10, 15, 21): self.plugin.retry(max_tries=5, wait_time=30, reason=_("Error code: [%s]") % -ecode) else: self.plugin.fail(_("Error code: [%s]") % -ecode) class MegaCoNz(Hoster): __name__ = "MegaCoNz" __type__ = "hoster" __version__ = "0.46" __status__ = "testing" __pattern__ = r'(https?://(?:www\.)?mega(\.co)?\.nz/|mega:|chrome:.+?)#(?P<TYPE>N|)!(?P<ID>[\w^_]+)!(?P<KEY>[\w\-,=]+)(?:###n=(?P<OWNER>[\w^_]+))?' __config__ = [("activated", "bool", "Activated", True)] __description__ = """Mega.co.nz hoster plugin""" __license__ = "GPLv3" __authors__ = [("RaNaN", "ranan@pyload.org" ), ("Walter Purcaro", "vuolter@gmail.com" ), ("GammaC0de", "nitzo2001[AT}yahoo[DOT]com")] FILE_SUFFIX = ".crypted" def decrypt_file(self, key): """ Decrypts and verifies checksum to the file at 'last_download' """ k, iv, meta_mac = MegaCrypto.get_cipher_key(key) ctr = Crypto.Util.Counter.new(128, initial_value = ((iv[0] << 32) + iv[1]) << 64) cipher = Crypto.Cipher.AES.new(MegaCrypto.a32_to_str(k), Crypto.Cipher.AES.MODE_CTR, counter=ctr) self.pyfile.setStatus("decrypting") self.pyfile.setProgress(0) file_crypted = encode(self.last_download) file_decrypted = file_crypted.rsplit(self.FILE_SUFFIX)[0] try: f = open(file_crypted, "rb") df = open(file_decrypted, "wb") except IOError, e: self.fail(e.message) encrypted_size = os.path.getsize(file_crypted) checksum_activated = self.config.get("activated", default=False, plugin="Checksum") check_checksum = self.config.get("check_checksum", default=True, plugin="Checksum") cbc_mac = MegaCrypto.Checksum(key) if checksum_activated and check_checksum else None progress = 0 for chunk_start, chunk_size in MegaCrypto.get_chunks(encrypted_size): buf = f.read(chunk_size) if not buf: break chunk = cipher.decrypt(buf) df.write(chunk) progress += chunk_size self.pyfile.setProgress(int((100.0 / encrypted_size) * progress)) if checksum_activated and check_checksum: cbc_mac.update(chunk) self.pyfile.setProgress(100) f.close() df.close() self.log_info(_("File decrypted")) os.remove(file_crypted) if checksum_activated and check_checksum: file_mac = cbc_mac.digest() if file_mac == meta_mac: self.log_info(_('File integrity of "%s" verified by CBC-MAC checksum (%s)') % (self.pyfile.name.rsplit(self.FILE_SUFFIX)[0], meta_mac)) else: self.log_warning(_('CBC-MAC checksum for file "%s" does not match (%s != %s)') % (self.pyfile.name.rsplit(self.FILE_SUFFIX)[0], file_mac, meta_mac)) self.checksum_failed(file_decrypted, _("Checksums do not match")) self.last_download = decode(file_decrypted) def checksum_failed(self, local_file, msg): check_action = self.config.get("check_action", default="retry", plugin="Checksum") if check_action == "retry": max_tries = self.config.get("max_tries", default=2, plugin="Checksum") retry_action = self.config.get("retry_action", default="fail", plugin="Checksum") if all(_r < max_tries for _id, _r in self.retries.items()): os.remove(local_file) wait_time = self.config.get("wait_time", default=1, plugin="Checksum") self.retry(max_tries, wait_time, msg) elif retry_action == "nothing": return elif check_action == "nothing": return os.remove(local_file) self.fail(msg) def check_exists(self, name): """ Because of Mega downloads a temporary encrypted file with the extension of '.crypted', pyLoad cannot correctly detect if the file exists before downloading. This function corrects this. Raises Skip() if file exists and 'skip_existing' configuration option is set to True. """ if self.pyload.config.get("download", "skip_existing"): download_folder = self.pyload.config.get('general', 'download_folder') dest_file = fsjoin(download_folder, self.pyfile.package().folder if self.pyload.config.get("general", "folder_per_package") else "", name) if exists(dest_file): self.pyfile.name = name self.skip(_("File exists.")) def process(self, pyfile): id = self.info['pattern']['ID'] key = self.info['pattern']['KEY'] public = self.info['pattern']['TYPE'] == "" owner = self.info['pattern']['OWNER'] if not public and not owner: self.log_error(_("Missing owner in URL")) self.fail(_("Missing owner in URL")) self.log_debug(_("ID: %s") % id, _("Key: %s") % key, _("Type: %s") % ("public" if public else "node"), _("Owner: %s") % owner) key = MegaCrypto.base64_to_a32(key) if len(key) != 8: self.log_error(_("Invalid key length")) self.fail(_("Invalid key length")) mega = MegaClient(self, self.info['pattern']['OWNER'] or self.info['pattern']['ID']) #: G is for requesting a download url #: This is similar to the calls in the mega js app, documentation is very bad if public: res = mega.api_response(a="g", g=1, p=id, ssl=1) else: res = mega.api_response(a="g", g=1, n=id, ssl=1) if isinstance(res, int): mega.check_error(res) elif isinstance(res, list): res = res[0] if "e" in res: mega.check_error(res['e']) attr = MegaCrypto.decrypt_attr(res['at'], key) if not attr: self.fail(_("Decryption failed")) self.log_debug(_("Decrypted Attr: %s") % decode(attr)) name = attr['n'] self.check_exists(name) pyfile.name = name + self.FILE_SUFFIX pyfile.size = res['s'] time_left = res.get('tl', 0) if time_left: self.log_warning(_("Free download limit reached")) self.retry(wait=time_left, msg=_("Free download limit reached")) # self.req.http.c.setopt(pycurl.SSL_CIPHER_LIST, "RC4-MD5:DEFAULT") self.download(res['g']) self.decrypt_file(key) #: Everything is finished and final name can be set pyfile.name = name
gpl-3.0
xiachufang/ImageServer
imageserver/app.py
1
3888
from flask import request, jsonify, Response from .lib.dbclient import WriteFailedError from .lib.image import ImageWrapper, OpenImageException from .init import app, beans from .tasks import async_upload_to_cloud @app.after_request def after_request(resp): resp.headers['Access-Control-Allow-Origin'] = '*' resp.headers['Access-Control-Allow-Methods'] = 'GET,OPTIONS,PUT,POST' return resp @app.route('/upload', methods=['POST']) def upload(): '''size=100x50,200x200,300x0,150x<100''' size_str = request.form.get('sizes', '').strip() image = request.files.get('image') sizes = [xy.split('x') for xy in size_str.split(',') if xy] ident = request.form.get('ident', '').strip() callback = request.form.get('callback', '').strip() sync = request.form.get('sync', 'true').strip() app.logger.debug('callback %s', callback) try: im = ImageWrapper(image) except OpenImageException as e: return error(str(e)) if ident: # Data contained in the key might be huge, so get the corresponing meta data. if beans.get('?%s' % ident): # if uploading to a specified ident, check wheather the ident has data in it first. return error('Can not replace existing data') else: # generate an unique ident ident = beans.gen_ident() try: beans.set_image(ident, im, sizes) except WriteFailedError as e: return error('Save to beansdb error: %s' % e) app.logger.debug('sync: %s', sync) if sync == 'true': async_upload_to_cloud.delay(ident, sizes, callback=callback) return ok({'ident': ident, 'sizes': sizes}) @app.route('/image/<ident>.jpg', methods=['POST']) @app.route('/resize/<ident>.jpg', methods=['POST']) def resize_image(ident): size_str = request.form.get('sizes', '').strip() sizes = [xy.split('x') for xy in size_str.split(',') if xy] callback = request.form.get('callback', '').strip() sync = request.form.get('sync', 'true').strip() app.logger.debug('callback %s', callback) try: beans.resize_image(ident, sizes) except (WriteFailedError, OpenImageException) as e: return error('Resize image error: %r' % e) if sync == 'true': async_upload_to_cloud.delay(ident, sizes, callback=callback) return ok({'ident': ident, 'sizes': sizes}) @app.route('/sync/<ident>.jpg', methods=['POST']) def sync_image(ident): size_str = request.form.get('sizes', '').strip() sizes = [xy.split('x') for xy in size_str.split(',') if xy] callback = request.form.get('callback', '').strip() app.logger.debug('callback %s', callback) async_upload_to_cloud.delay(ident, sizes, callback=callback) return ok({'ident': ident, 'sizes': sizes}) @app.route('/image/<width>/<height>/<ident>.jpg') def pic_show(width, height, ident): ident_ = beans.compute_ident(ident, width, height) if not ident_: return error('Image corresponding to %s@%sx%s doesn\'t exist!' % (ident, width, height), status_code=404) app.logger.debug('Beans get: %s', ident_) image_binary = beans.get(ident_) if not image_binary: return error('Image corresponding to %s@%sx%s doesn\'t exist!' % (ident, width, height), status_code=404) return Response(image_binary, mimetype='image/jpeg') @app.route('/image/<width>/<ident>.jpg') def pic_show3(width, ident): return pic_show(width, None, ident) @app.route('/image/<ident>.jpg') def pic_shows(ident): '''width and height are in query parameters''' width = request.args.get('width') height = request.args.get('height') return pic_show(width, height, ident) def ok(res): return jsonify({ 'status': 'ok', 'content': res, }) def error(res, status_code=400): return jsonify({ 'status': 'error', 'content': res, }), status_code
mit
JeffAbrahamson/UNA_compta
ffa_qif.py
1
4576
#!/usr/bin/python3 """Convert FFA downloads (CSV) to QIF for import to gnucash. """ import argparse import dateutil.parser as dp import pandas as pd import sys import base64 def piece_comptable(row): """Create the accounting ID in the format I want. """ xact_date_raw = row['DATE ECR'] # Remove time part of date, everything after the first space; also # remove '/'. xact_date = xact_date_raw[:xact_date_raw.find(' ')].replace('/','') xact_id = base64.urlsafe_b64encode(xact_date.encode('ascii')).decode() return 'FFA-{date}-{id}'.format(date=xact_date, id=xact_id) def entry_remark(row): """Create the value for the entry's remark field. """ this_fullname = row['LIBELLE'] return '{d})'.format(d=this_fullname) def get_data(infile): """Read dataframe from CSV file and return view. """ data = pd.read_csv( infile, sep=';', ) data['amount'] = pd.Series( [float(s.replace(',', '.')) for s in data['DEBIT']]) data['transaction_date_yyyy_mm_dd'] = pd.Series( [dp.parse(val, dayfirst=True) for val in data['DATE ECR']]) data['transaction_date_qif'] = pd.Series([ '{d:0>2d}/{m:0>2d}/{y:0>4d}'.format(y=val.year, m=val.month, d=val.day) for val in data.transaction_date_yyyy_mm_dd]) data['transaction_yyyymmdd'] = pd.Series([ '{y:0>4d}{m:0>2d}{d:0>2d}'.format(y=val.year, m=val.month, d=val.day) for val in data.transaction_date_yyyy_mm_dd]) data['description'] = pd.Series( [val.strip() for val in data.LIBELLE]) data['type'] = pd.Series( [val.strip() for val in data['TYPE ECR']]) data['piece-comptable'] = data.apply(piece_comptable, axis=1) data_view = data[['transaction_date_yyyy_mm_dd', 'transaction_date_qif', 'description', 'type', 'piece-comptable', 'amount']] return data_view.sort_values(by=['transaction_date_yyyy_mm_dd']) def make_qif(data_view): """Build qif file from dataframe. The dataframe should have columns as provided by get_data(), above. We want a qif so that we can construct splits. Cf. https://en.wikipedia.org/wiki/Quicken_Interchange_Format """ qif_data_view = data_view[['transaction_date_qif', 'piece-comptable', 'description', 'type', 'amount']] qif = '!Account\n' qif += 'N401_FFA licences\n' qif += '^\n' qif += '!Type:Bank\n' def qif_entry(row): """Create a single QIF file entry. """ this_transaction_date = row['transaction_date_qif'] this_piece_comptable = row['piece-comptable'] this_description = row['description'] this_type = row['type'] this_amount = -row['amount'] # D is the date. It may be required to be in English "dd mmmm # yyyy" format. # T is the amount of the transaction. # N is the id number (pièce comptable). # P is the payee (which quicken thinks of as the comment, not the account) # M is a memo entry = 'D{date}\nT{total}\nN{pc}\nP{payee}\nM{memo}\n'.format( date=this_transaction_date, total=this_amount, pc=this_piece_comptable, payee=this_description, memo=this_type) # S is the split category (account number on split line). # $ is the amount of the split entry. # E is the split memo. split_line = 'S{cpty}\n${amt}\nE{memo}\n' entry += split_line.format( cpty='6075_FFA licences', amt=-this_amount, memo='') return entry rows = qif_data_view.to_dict('records') transactions = [] for row in rows: if row['amount'] != 0: transactions.append(qif_entry(row)) qif += '\n^\n'.join(transactions) + '\n^\n' return qif def main(): """Do what we do. """ parser = argparse.ArgumentParser() parser.add_argument('--infile', type=str, required=True, help='Name of file to read') parser.add_argument('--outfile', type=str, required=False, help='Name of file to write') args = parser.parse_args() data_view = get_data(args.infile) qif = make_qif(data_view) if args.outfile: with open(args.outfile, 'w') as f_ptr: f_ptr.write(qif) else: print(qif) return 0 if __name__ == '__main__': retval = main() sys.exit(retval)
gpl-3.0
mattvonrocketstein/smash
smashlib/ipy3x/utils/importstring.py
1
1485
# encoding: utf-8 """ A simple utility to import something by its string name. Authors: * Brian Granger """ #----------------------------------------------------------------------------- # Copyright (C) 2008-2011 The IPython Development Team # # Distributed under the terms of the BSD License. The full license is in # the file COPYING, distributed as part of this software. #----------------------------------------------------------------------------- #----------------------------------------------------------------------------- # Functions and classes #----------------------------------------------------------------------------- def import_item(name): """Import and return ``bar`` given the string ``foo.bar``. Calling ``bar = import_item("foo.bar")`` is the functional equivalent of executing the code ``from foo import bar``. Parameters ---------- name : string The fully qualified name of the module/package being imported. Returns ------- mod : module object The module that was imported. """ parts = name.rsplit('.', 1) if len(parts) == 2: # called with 'foo.bar....' package, obj = parts module = __import__(package, fromlist=[obj]) try: pak = module.__dict__[obj] except KeyError: raise ImportError('No module named %s' % obj) return pak else: # called with un-dotted string return __import__(parts[0])
mit
samj1912/picard
picard/const/countries.py
8
6400
# -*- coding: utf-8 -*- # Automatically generated - don't edit. # Use `python setup.py update_constants` to update it. RELEASE_COUNTRIES = { 'AD': 'Andorra', 'AE': 'United Arab Emirates', 'AF': 'Afghanistan', 'AG': 'Antigua and Barbuda', 'AI': 'Anguilla', 'AL': 'Albania', 'AM': 'Armenia', 'AN': 'Netherlands Antilles', 'AO': 'Angola', 'AQ': 'Antarctica', 'AR': 'Argentina', 'AS': 'American Samoa', 'AT': 'Austria', 'AU': 'Australia', 'AW': 'Aruba', 'AX': 'Åland Islands', 'AZ': 'Azerbaijan', 'BA': 'Bosnia and Herzegovina', 'BB': 'Barbados', 'BD': 'Bangladesh', 'BE': 'Belgium', 'BF': 'Burkina Faso', 'BG': 'Bulgaria', 'BH': 'Bahrain', 'BI': 'Burundi', 'BJ': 'Benin', 'BL': 'Saint Barthélemy', 'BM': 'Bermuda', 'BN': 'Brunei', 'BO': 'Bolivia', 'BQ': 'Bonaire, Sint Eustatius and Saba', 'BR': 'Brazil', 'BS': 'Bahamas', 'BT': 'Bhutan', 'BV': 'Bouvet Island', 'BW': 'Botswana', 'BY': 'Belarus', 'BZ': 'Belize', 'CA': 'Canada', 'CC': 'Cocos (Keeling) Islands', 'CD': 'Democratic Republic of the Congo', 'CF': 'Central African Republic', 'CG': 'Congo', 'CH': 'Switzerland', 'CI': 'Côte d\'Ivoire', 'CK': 'Cook Islands', 'CL': 'Chile', 'CM': 'Cameroon', 'CN': 'China', 'CO': 'Colombia', 'CR': 'Costa Rica', 'CS': 'Serbia and Montenegro', 'CU': 'Cuba', 'CV': 'Cape Verde', 'CW': 'Curaçao', 'CX': 'Christmas Island', 'CY': 'Cyprus', 'CZ': 'Czech Republic', 'DE': 'Germany', 'DJ': 'Djibouti', 'DK': 'Denmark', 'DM': 'Dominica', 'DO': 'Dominican Republic', 'DZ': 'Algeria', 'EC': 'Ecuador', 'EE': 'Estonia', 'EG': 'Egypt', 'EH': 'Western Sahara', 'ER': 'Eritrea', 'ES': 'Spain', 'ET': 'Ethiopia', 'FI': 'Finland', 'FJ': 'Fiji', 'FK': 'Falkland Islands', 'FM': 'Federated States of Micronesia', 'FO': 'Faroe Islands', 'FR': 'France', 'GA': 'Gabon', 'GB': 'United Kingdom', 'GD': 'Grenada', 'GE': 'Georgia', 'GF': 'French Guiana', 'GG': 'Guernsey', 'GH': 'Ghana', 'GI': 'Gibraltar', 'GL': 'Greenland', 'GM': 'Gambia', 'GN': 'Guinea', 'GP': 'Guadeloupe', 'GQ': 'Equatorial Guinea', 'GR': 'Greece', 'GS': 'South Georgia and the South Sandwich Islands', 'GT': 'Guatemala', 'GU': 'Guam', 'GW': 'Guinea-Bissau', 'GY': 'Guyana', 'HK': 'Hong Kong', 'HM': 'Heard Island and McDonald Islands', 'HN': 'Honduras', 'HR': 'Croatia', 'HT': 'Haiti', 'HU': 'Hungary', 'ID': 'Indonesia', 'IE': 'Ireland', 'IL': 'Israel', 'IM': 'Isle of Man', 'IN': 'India', 'IO': 'British Indian Ocean Territory', 'IQ': 'Iraq', 'IR': 'Iran', 'IS': 'Iceland', 'IT': 'Italy', 'JE': 'Jersey', 'JM': 'Jamaica', 'JO': 'Jordan', 'JP': 'Japan', 'KE': 'Kenya', 'KG': 'Kyrgyzstan', 'KH': 'Cambodia', 'KI': 'Kiribati', 'KM': 'Comoros', 'KN': 'Saint Kitts and Nevis', 'KP': 'North Korea', 'KR': 'South Korea', 'KW': 'Kuwait', 'KY': 'Cayman Islands', 'KZ': 'Kazakhstan', 'LA': 'Laos', 'LB': 'Lebanon', 'LC': 'Saint Lucia', 'LI': 'Liechtenstein', 'LK': 'Sri Lanka', 'LR': 'Liberia', 'LS': 'Lesotho', 'LT': 'Lithuania', 'LU': 'Luxembourg', 'LV': 'Latvia', 'LY': 'Libya', 'MA': 'Morocco', 'MC': 'Monaco', 'MD': 'Moldova', 'ME': 'Montenegro', 'MF': 'Saint Martin (French part)', 'MG': 'Madagascar', 'MH': 'Marshall Islands', 'MK': 'Macedonia', 'ML': 'Mali', 'MM': 'Myanmar', 'MN': 'Mongolia', 'MO': 'Macao', 'MP': 'Northern Mariana Islands', 'MQ': 'Martinique', 'MR': 'Mauritania', 'MS': 'Montserrat', 'MT': 'Malta', 'MU': 'Mauritius', 'MV': 'Maldives', 'MW': 'Malawi', 'MX': 'Mexico', 'MY': 'Malaysia', 'MZ': 'Mozambique', 'NA': 'Namibia', 'NC': 'New Caledonia', 'NE': 'Niger', 'NF': 'Norfolk Island', 'NG': 'Nigeria', 'NI': 'Nicaragua', 'NL': 'Netherlands', 'NO': 'Norway', 'NP': 'Nepal', 'NR': 'Nauru', 'NU': 'Niue', 'NZ': 'New Zealand', 'OM': 'Oman', 'PA': 'Panama', 'PE': 'Peru', 'PF': 'French Polynesia', 'PG': 'Papua New Guinea', 'PH': 'Philippines', 'PK': 'Pakistan', 'PL': 'Poland', 'PM': 'Saint Pierre and Miquelon', 'PN': 'Pitcairn', 'PR': 'Puerto Rico', 'PS': 'Palestine', 'PT': 'Portugal', 'PW': 'Palau', 'PY': 'Paraguay', 'QA': 'Qatar', 'RE': 'Réunion', 'RO': 'Romania', 'RS': 'Serbia', 'RU': 'Russia', 'RW': 'Rwanda', 'SA': 'Saudi Arabia', 'SB': 'Solomon Islands', 'SC': 'Seychelles', 'SD': 'Sudan', 'SE': 'Sweden', 'SG': 'Singapore', 'SH': 'Saint Helena, Ascension and Tristan da Cunha', 'SI': 'Slovenia', 'SJ': 'Svalbard and Jan Mayen', 'SK': 'Slovakia', 'SL': 'Sierra Leone', 'SM': 'San Marino', 'SN': 'Senegal', 'SO': 'Somalia', 'SR': 'Suriname', 'SS': 'South Sudan', 'ST': 'Sao Tome and Principe', 'SU': 'Soviet Union', 'SV': 'El Salvador', 'SX': 'Sint Maarten (Dutch part)', 'SY': 'Syria', 'SZ': 'Swaziland', 'TC': 'Turks and Caicos Islands', 'TD': 'Chad', 'TF': 'French Southern Territories', 'TG': 'Togo', 'TH': 'Thailand', 'TJ': 'Tajikistan', 'TK': 'Tokelau', 'TL': 'Timor-Leste', 'TM': 'Turkmenistan', 'TN': 'Tunisia', 'TO': 'Tonga', 'TR': 'Turkey', 'TT': 'Trinidad and Tobago', 'TV': 'Tuvalu', 'TW': 'Taiwan', 'TZ': 'Tanzania', 'UA': 'Ukraine', 'UG': 'Uganda', 'UM': 'United States Minor Outlying Islands', 'US': 'United States', 'UY': 'Uruguay', 'UZ': 'Uzbekistan', 'VA': 'Vatican City', 'VC': 'Saint Vincent and The Grenadines', 'VE': 'Venezuela', 'VG': 'British Virgin Islands', 'VI': 'U.S. Virgin Islands', 'VN': 'Vietnam', 'VU': 'Vanuatu', 'WF': 'Wallis and Futuna', 'WS': 'Samoa', 'XC': 'Czechoslovakia', 'XE': 'Europe', 'XG': 'East Germany', 'XK': 'Kosovo', 'XW': '[Worldwide]', 'YE': 'Yemen', 'YT': 'Mayotte', 'YU': 'Yugoslavia', 'ZA': 'South Africa', 'ZM': 'Zambia', 'ZW': 'Zimbabwe', }
gpl-2.0
edry/edx-platform
common/test/acceptance/tests/video/test_video_handout.py
136
6655
# -*- coding: utf-8 -*- """ Acceptance tests for CMS Video Handout. """ from nose.plugins.attrib import attr from .test_studio_video_module import CMSVideoBaseTest @attr('shard_5') class VideoHandoutTest(CMSVideoBaseTest): """ CMS Video Handout Test Class """ def setUp(self): super(VideoHandoutTest, self).setUp() def _create_course_unit_with_handout(self, handout_filename, save_settings=True): """ Create a course with unit and also upload handout Arguments: handout_filename (str): handout file name to be uploaded save_settings (bool): save settings or not """ self.navigate_to_course_unit() self.edit_component() self.open_advanced_tab() self.video.upload_handout(handout_filename) if save_settings: self.save_unit_settings() def test_handout_uploads_correctly(self): """ Scenario: Handout uploading works correctly Given I have created a Video component with handout file "textbook.pdf" Then I can see video button "handout" And I can download handout file with mime type "application/pdf" """ self._create_course_unit_with_handout('textbook.pdf') self.assertTrue(self.video.is_handout_button_visible) self.assertEqual(self.video.download_handout('application/pdf'), (True, True)) def test_handout_download_works_with_save(self): """ Scenario: Handout downloading works correctly w/ preliminary saving Given I have created a Video component with handout file "textbook.pdf" And I save changes And I edit the component And I open tab "Advanced" And I can download handout file in editor with mime type "application/pdf" """ self._create_course_unit_with_handout('textbook.pdf') self.edit_component() self.open_advanced_tab() self.assertEqual(self.video.download_handout('application/pdf', is_editor=True), (True, True)) def test_handout_download_works_wo_save(self): """ Scenario: Handout downloading works correctly w/o preliminary saving Given I have created a Video component with handout file "textbook.pdf" And I can download handout file in editor with mime type "application/pdf" """ self._create_course_unit_with_handout('textbook.pdf', save_settings=False) self.assertEqual(self.video.download_handout('application/pdf', is_editor=True), (True, True)) def test_handout_clearing_works_w_save(self): """ Scenario: Handout clearing works correctly w/ preliminary saving Given I have created a Video component with handout file "textbook.pdf" And I save changes And I can download handout file with mime type "application/pdf" And I edit the component And I open tab "Advanced" And I clear handout And I save changes Then I do not see video button "handout" """ self._create_course_unit_with_handout('textbook.pdf') self.assertEqual(self.video.download_handout('application/pdf'), (True, True)) self.edit_component() self.open_advanced_tab() self.video.clear_handout() self.save_unit_settings() self.assertFalse(self.video.is_handout_button_visible) def test_handout_clearing_works_wo_save(self): """ Scenario: Handout clearing works correctly w/o preliminary saving Given I have created a Video component with handout file "asset.html" And I clear handout And I save changes Then I do not see video button "handout" """ self._create_course_unit_with_handout('asset.html', save_settings=False) self.video.clear_handout() self.save_unit_settings() self.assertFalse(self.video.is_handout_button_visible) def test_handout_replace_w_save(self): """ Scenario: User can easy replace the handout by another one w/ preliminary saving Given I have created a Video component with handout file "asset.html" And I save changes Then I can see video button "handout" And I can download handout file with mime type "text/html" And I edit the component And I open tab "Advanced" And I replace handout file by "textbook.pdf" And I save changes Then I can see video button "handout" And I can download handout file with mime type "application/pdf" """ self._create_course_unit_with_handout('asset.html') self.assertTrue(self.video.is_handout_button_visible) self.assertEqual(self.video.download_handout('text/html'), (True, True)) self.edit_component() self.open_advanced_tab() self.video.upload_handout('textbook.pdf') self.save_unit_settings() self.assertTrue(self.video.is_handout_button_visible) self.assertEqual(self.video.download_handout('application/pdf'), (True, True)) def test_handout_replace_wo_save(self): """ Scenario: User can easy replace the handout by another one w/o preliminary saving Given I have created a Video component with handout file "asset.html" And I replace handout file by "textbook.pdf" And I save changes Then I can see video button "handout" And I can download handout file with mime type "application/pdf" """ self._create_course_unit_with_handout('asset.html', save_settings=False) self.video.upload_handout('textbook.pdf') self.save_unit_settings() self.assertTrue(self.video.is_handout_button_visible) self.assertEqual(self.video.download_handout('application/pdf'), (True, True)) def test_handout_upload_and_clear_works(self): """ Scenario: Upload file "A" -> Remove it -> Upload file "B" Given I have created a Video component with handout file "asset.html" And I clear handout And I upload handout file "textbook.pdf" And I save changes Then I can see video button "handout" And I can download handout file with mime type "application/pdf" """ self._create_course_unit_with_handout('asset.html', save_settings=False) self.video.clear_handout() self.video.upload_handout('textbook.pdf') self.save_unit_settings() self.assertTrue(self.video.is_handout_button_visible) self.assertEqual(self.video.download_handout('application/pdf'), (True, True))
agpl-3.0
garyjyao1/ansible
lib/ansible/modules/core/packaging/os/yum.py
5
35069
#!/usr/bin/python -tt # -*- coding: utf-8 -*- # (c) 2012, Red Hat, Inc # Written by Seth Vidal <skvidal at fedoraproject.org> # (c) 2014, Epic Games, Inc. # # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see <http://www.gnu.org/licenses/>. # import traceback import os import yum import rpm import platform import tempfile import shutil from distutils.version import LooseVersion try: from yum.misc import find_unfinished_transactions, find_ts_remaining from rpmUtils.miscutils import splitFilename transaction_helpers = True except: transaction_helpers = False DOCUMENTATION = ''' --- module: yum version_added: historical short_description: Manages packages with the I(yum) package manager description: - Installs, upgrade, removes, and lists packages and groups with the I(yum) package manager. options: name: description: - "Package name, or package specifier with version, like C(name-1.0). When using state=latest, this can be '*' which means run: yum -y update. You can also pass a url or a local path to a rpm file. To operate on several packages this can accept a comma separated list of packages or (as of 2.0) a list of packages." required: true default: null aliases: [] exclude: description: - "Package name(s) to exclude when state=present, or latest" required: false version_added: "2.0" default: null list: description: - Various (non-idempotent) commands for usage with C(/usr/bin/ansible) and I(not) playbooks. See examples. required: false default: null state: description: - Whether to install (C(present), C(latest)), or remove (C(absent)) a package. required: false choices: [ "present", "latest", "absent" ] default: "present" enablerepo: description: - I(Repoid) of repositories to enable for the install/update operation. These repos will not persist beyond the transaction. When specifying multiple repos, separate them with a ",". required: false version_added: "0.9" default: null aliases: [] disablerepo: description: - I(Repoid) of repositories to disable for the install/update operation. These repos will not persist beyond the transaction. When specifying multiple repos, separate them with a ",". required: false version_added: "0.9" default: null aliases: [] conf_file: description: - The remote yum configuration file to use for the transaction. required: false version_added: "0.6" default: null aliases: [] disable_gpg_check: description: - Whether to disable the GPG checking of signatures of packages being installed. Has an effect only if state is I(present) or I(latest). required: false version_added: "1.2" default: "no" choices: ["yes", "no"] aliases: [] update_cache: description: - Force updating the cache. Has an effect only if state is I(present) or I(latest). required: false version_added: "1.9" default: "no" choices: ["yes", "no"] aliases: [] notes: - When used with a loop of package names in a playbook, ansible optimizes the call to the yum module. Instead of calling the module with a single package each time through the loop, ansible calls the module once with all of the package names from the loop. - In versions prior to 1.9.2 this module installed and removed each package given to the yum module separately. This caused problems when packages specified by filename or url had to be installed or removed together. In 1.9.2 this was fixed so that packages are installed in one yum transaction. However, if one of the packages adds a new yum repository that the other packages come from (such as epel-release) then that package needs to be installed in a separate task. This mimics yum's command line behaviour. # informational: requirements for nodes requirements: [ yum ] author: - "Ansible Core Team" - "Seth Vidal" ''' EXAMPLES = ''' - name: install the latest version of Apache yum: name=httpd state=latest - name: remove the Apache package yum: name=httpd state=absent - name: install the latest version of Apache from the testing repo yum: name=httpd enablerepo=testing state=present - name: install one specific version of Apache yum: name=httpd-2.2.29-1.4.amzn1 state=present - name: upgrade all packages yum: name=* state=latest - name: install the nginx rpm from a remote repo yum: name=http://nginx.org/packages/centos/6/noarch/RPMS/nginx-release-centos-6-0.el6.ngx.noarch.rpm state=present - name: install nginx rpm from a local file yum: name=/usr/local/src/nginx-release-centos-6-0.el6.ngx.noarch.rpm state=present - name: install the 'Development tools' package group yum: name="@Development tools" state=present ''' # 64k. Number of bytes to read at a time when manually downloading pkgs via a url BUFSIZE = 65536 def_qf = "%{name}-%{version}-%{release}.%{arch}" def yum_base(conf_file=None): my = yum.YumBase() my.preconf.debuglevel=0 my.preconf.errorlevel=0 if conf_file and os.path.exists(conf_file): my.preconf.fn = conf_file if os.geteuid() != 0: if hasattr(my, 'setCacheDir'): my.setCacheDir() else: cachedir = yum.misc.getCacheDir() my.repos.setCacheDir(cachedir) my.conf.cache = 0 return my def ensure_yum_utils(module): repoquerybin = module.get_bin_path('repoquery', required=False) if module.params['install_repoquery'] and not repoquerybin and not module.check_mode: yum_path = module.get_bin_path('yum') if yum_path: rc, so, se = module.run_command('%s -y install yum-utils' % yum_path) repoquerybin = module.get_bin_path('repoquery', required=False) return repoquerybin def po_to_nevra(po): if hasattr(po, 'ui_nevra'): return po.ui_nevra else: return '%s-%s-%s.%s' % (po.name, po.version, po.release, po.arch) def is_installed(module, repoq, pkgspec, conf_file, qf=def_qf, en_repos=None, dis_repos=None, is_pkg=False): if en_repos is None: en_repos = [] if dis_repos is None: dis_repos = [] if not repoq: pkgs = [] try: my = yum_base(conf_file) for rid in dis_repos: my.repos.disableRepo(rid) for rid in en_repos: my.repos.enableRepo(rid) e, m, u = my.rpmdb.matchPackageNames([pkgspec]) pkgs = e + m if not pkgs: pkgs.extend(my.returnInstalledPackagesByDep(pkgspec)) except Exception, e: module.fail_json(msg="Failure talking to yum: %s" % e) return [ po_to_nevra(p) for p in pkgs ] else: cmd = repoq + ["--disablerepo=*", "--pkgnarrow=installed", "--qf", qf, pkgspec] rc, out, err = module.run_command(cmd) if not is_pkg: cmd = repoq + ["--disablerepo=*", "--pkgnarrow=installed", "--qf", qf, "--whatprovides", pkgspec] rc2, out2, err2 = module.run_command(cmd) else: rc2, out2, err2 = (0, '', '') if rc == 0 and rc2 == 0: out += out2 return [p for p in out.split('\n') if p.strip()] else: module.fail_json(msg='Error from repoquery: %s: %s' % (cmd, err + err2)) return [] def is_available(module, repoq, pkgspec, conf_file, qf=def_qf, en_repos=None, dis_repos=None): if en_repos is None: en_repos = [] if dis_repos is None: dis_repos = [] if not repoq: pkgs = [] try: my = yum_base(conf_file) for rid in dis_repos: my.repos.disableRepo(rid) for rid in en_repos: my.repos.enableRepo(rid) e,m,u = my.pkgSack.matchPackageNames([pkgspec]) pkgs = e + m if not pkgs: pkgs.extend(my.returnPackagesByDep(pkgspec)) except Exception, e: module.fail_json(msg="Failure talking to yum: %s" % e) return [ po_to_nevra(p) for p in pkgs ] else: myrepoq = list(repoq) r_cmd = ['--disablerepo', ','.join(dis_repos)] myrepoq.extend(r_cmd) r_cmd = ['--enablerepo', ','.join(en_repos)] myrepoq.extend(r_cmd) cmd = myrepoq + ["--qf", qf, pkgspec] rc,out,err = module.run_command(cmd) if rc == 0: return [ p for p in out.split('\n') if p.strip() ] else: module.fail_json(msg='Error from repoquery: %s: %s' % (cmd, err)) return [] def is_update(module, repoq, pkgspec, conf_file, qf=def_qf, en_repos=None, dis_repos=None): if en_repos is None: en_repos = [] if dis_repos is None: dis_repos = [] if not repoq: retpkgs = [] pkgs = [] updates = [] try: my = yum_base(conf_file) for rid in dis_repos: my.repos.disableRepo(rid) for rid in en_repos: my.repos.enableRepo(rid) pkgs = my.returnPackagesByDep(pkgspec) + my.returnInstalledPackagesByDep(pkgspec) if not pkgs: e,m,u = my.pkgSack.matchPackageNames([pkgspec]) pkgs = e + m updates = my.doPackageLists(pkgnarrow='updates').updates except Exception, e: module.fail_json(msg="Failure talking to yum: %s" % e) for pkg in pkgs: if pkg in updates: retpkgs.append(pkg) return set([ po_to_nevra(p) for p in retpkgs ]) else: myrepoq = list(repoq) r_cmd = ['--disablerepo', ','.join(dis_repos)] myrepoq.extend(r_cmd) r_cmd = ['--enablerepo', ','.join(en_repos)] myrepoq.extend(r_cmd) cmd = myrepoq + ["--pkgnarrow=updates", "--qf", qf, pkgspec] rc,out,err = module.run_command(cmd) if rc == 0: return set([ p for p in out.split('\n') if p.strip() ]) else: module.fail_json(msg='Error from repoquery: %s: %s' % (cmd, err)) return set() def what_provides(module, repoq, req_spec, conf_file, qf=def_qf, en_repos=None, dis_repos=None): if en_repos is None: en_repos = [] if dis_repos is None: dis_repos = [] if not repoq: pkgs = [] try: my = yum_base(conf_file) for rid in dis_repos: my.repos.disableRepo(rid) for rid in en_repos: my.repos.enableRepo(rid) pkgs = my.returnPackagesByDep(req_spec) + my.returnInstalledPackagesByDep(req_spec) if not pkgs: e,m,u = my.pkgSack.matchPackageNames([req_spec]) pkgs.extend(e) pkgs.extend(m) e,m,u = my.rpmdb.matchPackageNames([req_spec]) pkgs.extend(e) pkgs.extend(m) except Exception, e: module.fail_json(msg="Failure talking to yum: %s" % e) return set([ po_to_nevra(p) for p in pkgs ]) else: myrepoq = list(repoq) r_cmd = ['--disablerepo', ','.join(dis_repos)] myrepoq.extend(r_cmd) r_cmd = ['--enablerepo', ','.join(en_repos)] myrepoq.extend(r_cmd) cmd = myrepoq + ["--qf", qf, "--whatprovides", req_spec] rc,out,err = module.run_command(cmd) cmd = myrepoq + ["--qf", qf, req_spec] rc2,out2,err2 = module.run_command(cmd) if rc == 0 and rc2 == 0: out += out2 pkgs = set([ p for p in out.split('\n') if p.strip() ]) if not pkgs: pkgs = is_installed(module, repoq, req_spec, conf_file, qf=qf) return pkgs else: module.fail_json(msg='Error from repoquery: %s: %s' % (cmd, err + err2)) return set() def transaction_exists(pkglist): """ checks the package list to see if any packages are involved in an incomplete transaction """ conflicts = [] if not transaction_helpers: return conflicts # first, we create a list of the package 'nvreas' # so we can compare the pieces later more easily pkglist_nvreas = [] for pkg in pkglist: pkglist_nvreas.append(splitFilename(pkg)) # next, we build the list of packages that are # contained within an unfinished transaction unfinished_transactions = find_unfinished_transactions() for trans in unfinished_transactions: steps = find_ts_remaining(trans) for step in steps: # the action is install/erase/etc., but we only # care about the package spec contained in the step (action, step_spec) = step (n,v,r,e,a) = splitFilename(step_spec) # and see if that spec is in the list of packages # requested for installation/updating for pkg in pkglist_nvreas: # if the name and arch match, we're going to assume # this package is part of a pending transaction # the label is just for display purposes label = "%s-%s" % (n,a) if n == pkg[0] and a == pkg[4]: if label not in conflicts: conflicts.append("%s-%s" % (n,a)) break return conflicts def local_nvra(module, path): """return nvra of a local rpm passed in""" ts = rpm.TransactionSet() ts.setVSFlags(rpm._RPMVSF_NOSIGNATURES) fd = os.open(path, os.O_RDONLY) try: header = ts.hdrFromFdno(fd) finally: os.close(fd) return '%s-%s-%s.%s' % (header[rpm.RPMTAG_NAME], header[rpm.RPMTAG_VERSION], header[rpm.RPMTAG_RELEASE], header[rpm.RPMTAG_ARCH]) def pkg_to_dict(pkgstr): if pkgstr.strip(): n,e,v,r,a,repo = pkgstr.split('|') else: return {'error_parsing': pkgstr} d = { 'name':n, 'arch':a, 'epoch':e, 'release':r, 'version':v, 'repo':repo, 'nevra': '%s:%s-%s-%s.%s' % (e,n,v,r,a) } if repo == 'installed': d['yumstate'] = 'installed' else: d['yumstate'] = 'available' return d def repolist(module, repoq, qf="%{repoid}"): cmd = repoq + ["--qf", qf, "-a"] rc,out,err = module.run_command(cmd) ret = [] if rc == 0: ret = set([ p for p in out.split('\n') if p.strip() ]) return ret def list_stuff(module, repoquerybin, conf_file, stuff): qf = "%{name}|%{epoch}|%{version}|%{release}|%{arch}|%{repoid}" repoq = [repoquerybin, '--show-duplicates', '--plugins', '--quiet'] if conf_file and os.path.exists(conf_file): repoq += ['-c', conf_file] if stuff == 'installed': return [ pkg_to_dict(p) for p in is_installed(module, repoq, '-a', conf_file, qf=qf) if p.strip() ] elif stuff == 'updates': return [ pkg_to_dict(p) for p in is_update(module, repoq, '-a', conf_file, qf=qf) if p.strip() ] elif stuff == 'available': return [ pkg_to_dict(p) for p in is_available(module, repoq, '-a', conf_file, qf=qf) if p.strip() ] elif stuff == 'repos': return [ dict(repoid=name, state='enabled') for name in repolist(module, repoq) if name.strip() ] else: return [ pkg_to_dict(p) for p in is_installed(module, repoq, stuff, conf_file, qf=qf) + is_available(module, repoq, stuff, conf_file, qf=qf) if p.strip() ] def install(module, items, repoq, yum_basecmd, conf_file, en_repos, dis_repos): pkgs = [] res = {} res['results'] = [] res['msg'] = '' res['rc'] = 0 res['changed'] = False tempdir = tempfile.mkdtemp() for spec in items: pkg = None # check if pkgspec is installed (if possible for idempotence) # localpkg if spec.endswith('.rpm') and '://' not in spec: # get the pkg name-v-r.arch if not os.path.exists(spec): res['msg'] += "No Package file matching '%s' found on system" % spec module.fail_json(**res) nvra = local_nvra(module, spec) # look for them in the rpmdb if is_installed(module, repoq, nvra, conf_file, en_repos=en_repos, dis_repos=dis_repos): # if they are there, skip it continue pkg = spec # URL elif '://' in spec: pkg = spec # Check if Enterprise Linux 5 or less, as yum on those versions do not support installing via url distribution_version = get_distribution_version() distribution = platform.dist() if distribution[0] == "redhat" and LooseVersion(distribution_version) < LooseVersion("6"): package = os.path.join(tempdir, str(pkg.rsplit('/', 1)[1])) try: rsp, info = fetch_url(module, pkg) f = open(package, 'w') data = rsp.read(BUFSIZE) while data: f.write(data) data = rsp.read(BUFSIZE) f.close() pkg = package except Exception, e: shutil.rmtree(tempdir) module.fail_json(msg="Failure downloading %s, %s" % (spec, e)) #groups :( elif spec.startswith('@'): # complete wild ass guess b/c it's a group pkg = spec # range requires or file-requires or pkgname :( else: # most common case is the pkg is already installed and done # short circuit all the bs - and search for it as a pkg in is_installed # if you find it then we're done if not set(['*','?']).intersection(set(spec)): installed_pkgs = is_installed(module, repoq, spec, conf_file, en_repos=en_repos, dis_repos=dis_repos, is_pkg=True) if installed_pkgs: res['results'].append('%s providing %s is already installed' % (installed_pkgs[0], spec)) continue # look up what pkgs provide this pkglist = what_provides(module, repoq, spec, conf_file, en_repos=en_repos, dis_repos=dis_repos) if not pkglist: res['msg'] += "No Package matching '%s' found available, installed or updated" % spec module.fail_json(**res) # if any of the packages are involved in a transaction, fail now # so that we don't hang on the yum operation later conflicts = transaction_exists(pkglist) if len(conflicts) > 0: res['msg'] += "The following packages have pending transactions: %s" % ", ".join(conflicts) module.fail_json(**res) # if any of them are installed # then nothing to do found = False for this in pkglist: if is_installed(module, repoq, this, conf_file, en_repos=en_repos, dis_repos=dis_repos, is_pkg=True): found = True res['results'].append('%s providing %s is already installed' % (this, spec)) break # if the version of the pkg you have installed is not in ANY repo, but there are # other versions in the repos (both higher and lower) then the previous checks won't work. # so we check one more time. This really only works for pkgname - not for file provides or virt provides # but virt provides should be all caught in what_provides on its own. # highly irritating if not found: if is_installed(module, repoq, spec, conf_file, en_repos=en_repos, dis_repos=dis_repos): found = True res['results'].append('package providing %s is already installed' % (spec)) if found: continue # if not - then pass in the spec as what to install # we could get here if nothing provides it but that's not # the error we're catching here pkg = spec pkgs.append(pkg) if pkgs: cmd = yum_basecmd + ['install'] + pkgs if module.check_mode: # Remove rpms downloaded for EL5 via url try: shutil.rmtree(tempdir) except Exception, e: module.fail_json(msg="Failure deleting temp directory %s, %s" % (tempdir, e)) module.exit_json(changed=True, results=res['results'], changes=dict(installed=pkgs)) changed = True rc, out, err = module.run_command(cmd) if (rc == 1): for spec in items: # Fail on invalid urls: if ('://' in spec and ('No package %s available.' % spec in out or 'Cannot open: %s. Skipping.' % spec in err)): err = 'Package at %s could not be installed' % spec module.fail_json(changed=False,msg=err,rc=1) if (rc != 0 and 'Nothing to do' in err) or 'Nothing to do' in out: # avoid failing in the 'Nothing To Do' case # this may happen with an URL spec. # for an already installed group, # we get rc = 0 and 'Nothing to do' in out, not in err. rc = 0 err = '' out = '%s: Nothing to do' % spec changed = False res['rc'] = rc res['results'].append(out) res['msg'] += err # FIXME - if we did an install - go and check the rpmdb to see if it actually installed # look for each pkg in rpmdb # look for each pkg via obsoletes # Record change res['changed'] = changed # Remove rpms downloaded for EL5 via url try: shutil.rmtree(tempdir) except Exception, e: module.fail_json(msg="Failure deleting temp directory %s, %s" % (tempdir, e)) return res def remove(module, items, repoq, yum_basecmd, conf_file, en_repos, dis_repos): pkgs = [] res = {} res['results'] = [] res['msg'] = '' res['changed'] = False res['rc'] = 0 for pkg in items: is_group = False # group remove - this is doom on a stick if pkg.startswith('@'): is_group = True else: if not is_installed(module, repoq, pkg, conf_file, en_repos=en_repos, dis_repos=dis_repos): res['results'].append('%s is not installed' % pkg) continue pkgs.append(pkg) if pkgs: # run an actual yum transaction cmd = yum_basecmd + ["remove"] + pkgs if module.check_mode: module.exit_json(changed=True, results=res['results'], changes=dict(removed=pkgs)) rc, out, err = module.run_command(cmd) res['rc'] = rc res['results'].append(out) res['msg'] = err # compile the results into one batch. If anything is changed # then mark changed # at the end - if we've end up failed then fail out of the rest # of the process # at this point we should check to see if the pkg is no longer present for pkg in pkgs: if not pkg.startswith('@'): # we can't sensibly check for a group being uninstalled reliably # look to see if the pkg shows up from is_installed. If it doesn't if not is_installed(module, repoq, pkg, conf_file, en_repos=en_repos, dis_repos=dis_repos): res['changed'] = True else: module.fail_json(**res) if rc != 0: module.fail_json(**res) return res def latest(module, items, repoq, yum_basecmd, conf_file, en_repos, dis_repos): res = {} res['results'] = [] res['msg'] = '' res['changed'] = False res['rc'] = 0 pkgs = {} pkgs['update'] = [] pkgs['install'] = [] updates = {} update_all = False cmd = None # determine if we're doing an update all if '*' in items: update_all = True # run check-update to see if we have packages pending rc, out, err = module.run_command(yum_basecmd + ['check-update']) if rc == 0 and update_all: res['results'].append('Nothing to do here, all packages are up to date') return res elif rc == 100: available_updates = out.split('\n') # build update dictionary for line in available_updates: line = line.split() # ignore irrelevant lines # FIXME... revisit for something less kludgy if '*' in line or len(line) != 3 or '.' not in line[0]: continue else: pkg, version, repo = line name, dist = pkg.rsplit('.', 1) updates.update({name: {'version': version, 'dist': dist, 'repo': repo}}) elif rc == 1: res['msg'] = err res['rc'] = rc module.fail_json(**res) if update_all: cmd = yum_basecmd + ['update'] else: for spec in items: # some guess work involved with groups. update @<group> will install the group if missing if spec.startswith('@'): pkgs['update'].append(spec) continue # dep/pkgname - find it else: if is_installed(module, repoq, spec, conf_file, en_repos=en_repos, dis_repos=dis_repos): pkgs['update'].append(spec) else: pkgs['install'].append(spec) pkglist = what_provides(module, repoq, spec, conf_file, en_repos=en_repos, dis_repos=dis_repos) # FIXME..? may not be desirable to throw an exception here if a single package is missing if not pkglist: res['msg'] += "No Package matching '%s' found available, installed or updated" % spec module.fail_json(**res) nothing_to_do = True for this in pkglist: if spec in pkgs['install'] and is_available(module, repoq, this, conf_file, en_repos=en_repos, dis_repos=dis_repos): nothing_to_do = False break if spec in pkgs['update'] and spec in updates.keys(): nothing_to_do = False if nothing_to_do: res['results'].append("All packages providing %s are up to date" % spec) continue # if any of the packages are involved in a transaction, fail now # so that we don't hang on the yum operation later conflicts = transaction_exists(pkglist) if len(conflicts) > 0: res['msg'] += "The following packages have pending transactions: %s" % ", ".join(conflicts) module.fail_json(**res) # list of package updates if update_all: will_update = updates.keys() else: will_update = [u for u in pkgs['update'] if u in updates.keys() or u.startswith('@')] # check_mode output if module.check_mode: to_update = [] for w in will_update: if w.startswith('@'): to_update.append((w, None)) msg = '%s will be updated' % w else: to_update.append((w, '%s.%s from %s' % (updates[w]['version'], updates[w]['dist'], updates[w]['repo']))) res['changes'] = dict(installed=pkgs['install'], updated=to_update) if len(will_update) > 0 or len(pkgs['install']) > 0: res['changed'] = True return res # run commands if cmd: # update all rc, out, err = module.run_command(cmd) res['changed'] = True else: if len(pkgs['install']) > 0: # install missing cmd = yum_basecmd + ['install'] + pkgs['install'] rc, out, err = module.run_command(cmd) res['changed'] = True else: rc, out, err = [0, '', ''] if len(will_update) > 0: # update present cmd = yum_basecmd + ['update'] + pkgs['update'] rc2, out2, err2 = module.run_command(cmd) res['changed'] = True else: rc2, out2, err2 = [0, '', ''] if not update_all: rc += rc2 out += out2 err += err2 res['rc'] += rc res['msg'] += err res['results'].append(out) if rc: res['failed'] = True return res def ensure(module, state, pkgs, conf_file, enablerepo, disablerepo, disable_gpg_check, exclude, repoq): yumbin = module.get_bin_path('yum') # need debug level 2 to get 'Nothing to do' for groupinstall. yum_basecmd = [yumbin, '-d', '2', '-y'] if conf_file and os.path.exists(conf_file): yum_basecmd += ['-c', conf_file] if repoq: repoq += ['-c', conf_file] dis_repos =[] en_repos = [] if disablerepo: dis_repos = disablerepo.split(',') r_cmd = ['--disablerepo=%s' % disablerepo] yum_basecmd.extend(r_cmd) if enablerepo: en_repos = enablerepo.split(',') r_cmd = ['--enablerepo=%s' % enablerepo] yum_basecmd.extend(r_cmd) if exclude: e_cmd = ['--exclude=%s' % exclude] yum_basecmd.extend(e_cmd) if state in ['installed', 'present', 'latest']: if module.params.get('update_cache'): module.run_command(yum_basecmd + ['makecache']) my = yum_base(conf_file) try: if disablerepo: my.repos.disableRepo(disablerepo) current_repos = my.repos.repos.keys() if enablerepo: try: my.repos.enableRepo(enablerepo) new_repos = my.repos.repos.keys() for i in new_repos: if not i in current_repos: rid = my.repos.getRepo(i) a = rid.repoXML.repoid current_repos = new_repos except yum.Errors.YumBaseError, e: module.fail_json(msg="Error setting/accessing repos: %s" % (e)) except yum.Errors.YumBaseError, e: module.fail_json(msg="Error accessing repos: %s" % e) if state in ['installed', 'present']: if disable_gpg_check: yum_basecmd.append('--nogpgcheck') res = install(module, pkgs, repoq, yum_basecmd, conf_file, en_repos, dis_repos) elif state in ['removed', 'absent']: res = remove(module, pkgs, repoq, yum_basecmd, conf_file, en_repos, dis_repos) elif state == 'latest': if disable_gpg_check: yum_basecmd.append('--nogpgcheck') res = latest(module, pkgs, repoq, yum_basecmd, conf_file, en_repos, dis_repos) else: # should be caught by AnsibleModule argument_spec module.fail_json(msg="we should never get here unless this all" " failed", changed=False, results='', errors='unepected state') return res def main(): # state=installed name=pkgspec # state=removed name=pkgspec # state=latest name=pkgspec # # informational commands: # list=installed # list=updates # list=available # list=repos # list=pkgspec module = AnsibleModule( argument_spec = dict( name=dict(aliases=['pkg'], type="list"), exclude=dict(required=False, default=None), # removed==absent, installed==present, these are accepted as aliases state=dict(default='installed', choices=['absent','present','installed','removed','latest']), enablerepo=dict(), disablerepo=dict(), list=dict(), conf_file=dict(default=None), disable_gpg_check=dict(required=False, default="no", type='bool'), update_cache=dict(required=False, default="no", type='bool'), # this should not be needed, but exists as a failsafe install_repoquery=dict(required=False, default="yes", type='bool'), ), required_one_of = [['name','list']], mutually_exclusive = [['name','list']], supports_check_mode = True ) params = module.params if params['list']: repoquerybin = ensure_yum_utils(module) if not repoquerybin: module.fail_json(msg="repoquery is required to use list= with this module. Please install the yum-utils package.") results = dict(results=list_stuff(module, repoquerybin, params['conf_file'], params['list'])) else: # If rhn-plugin is installed and no rhn-certificate is available on # the system then users will see an error message using the yum API. # Use repoquery in those cases. my = yum_base(params['conf_file']) # A sideeffect of accessing conf is that the configuration is # loaded and plugins are discovered my.conf repoquery = None try: yum_plugins = my.plugins._plugins except AttributeError: pass else: if 'rhnplugin' in yum_plugins: repoquerybin = ensure_yum_utils(module) if repoquerybin: repoquery = [repoquerybin, '--show-duplicates', '--plugins', '--quiet'] pkg = [ p.strip() for p in params['name']] exclude = params['exclude'] state = params['state'] enablerepo = params.get('enablerepo', '') disablerepo = params.get('disablerepo', '') disable_gpg_check = params['disable_gpg_check'] results = ensure(module, state, pkg, params['conf_file'], enablerepo, disablerepo, disable_gpg_check, exclude, repoquery) if repoquery: results['msg'] = '%s %s' % (results.get('msg',''), 'Warning: Due to potential bad behaviour with rhnplugin and certificates, used slower repoquery calls instead of Yum API.') module.exit_json(**results) # import module snippets from ansible.module_utils.basic import * from ansible.module_utils.urls import * if __name__ == '__main__': main()
gpl-3.0
ptphp/PyLib
src/devs/trevp-tlslite-cac0c81/tlslite/integration/httptlsconnection.py
1
4457
# Authors: # Trevor Perrin # Kees Bos - Added ignoreAbruptClose parameter # Dimitris Moraitis - Anon ciphersuites # # See the LICENSE file for legal information regarding use of this file. """TLS Lite + httplib.""" import socket import httplib from tlslite.tlsconnection import TLSConnection from tlslite.integration.clienthelper import ClientHelper class HTTPTLSConnection(httplib.HTTPConnection, ClientHelper): """This class extends L{httplib.HTTPConnection} to support TLS.""" def __init__(self, host, port=None, strict=None, timeout=socket._GLOBAL_DEFAULT_TIMEOUT, source_address=None, username=None, password=None, certChain=None, privateKey=None, x509Fingerprint=None, tackID=None, hardTack=None, settings=None, ignoreAbruptClose=False, anon=False): """Create a new HTTPTLSConnection. For client authentication, use one of these argument combinations: - username, password (SRP) - certChain, privateKey (certificate) For server authentication, you can either rely on the implicit mutual authentication performed by SRP or you can do certificate-based server authentication with one of these argument combinations: - x509Fingerprint Certificate-based server authentication is compatible with SRP or certificate-based client authentication. The constructor does not perform the TLS handshake itself, but simply stores these arguments for later. The handshake is performed only when this class needs to connect with the server. Thus you should be prepared to handle TLS-specific exceptions when calling methods inherited from L{httplib.HTTPConnection} such as request(), connect(), and send(). See the client handshake functions in L{tlslite.TLSConnection.TLSConnection} for details on which exceptions might be raised. @type host: str @param host: Server to connect to. @type port: int @param port: Port to connect to. @type username: str @param username: SRP username. Requires the 'password' argument. @type password: str @param password: SRP password for mutual authentication. Requires the 'username' argument. @type certChain: L{tlslite.x509certchain.X509CertChain} or @param certChain: Certificate chain for client authentication. Requires the 'privateKey' argument. Excludes the SRP arguments. @type privateKey: L{tlslite.utils.rsakey.RSAKey} @param privateKey: Private key for client authentication. Requires the 'certChain' argument. Excludes the SRP arguments. @type x509Fingerprint: str @param x509Fingerprint: Hex-encoded X.509 fingerprint for server authentication. @type tackID: str @param tackID: TACK ID for server authentication. @type hardTack: bool @param hardTack: Whether to raise TackBreakSigError on TACK Break. @type settings: L{tlslite.handshakesettings.HandshakeSettings} @param settings: Various settings which can be used to control the ciphersuites, certificate types, and SSL/TLS versions offered by the client. @type ignoreAbruptClose: bool @param ignoreAbruptClose: ignore the TLSAbruptCloseError on unexpected hangup. """ if source_address: httplib.HTTPConnection.__init__(self, host, port, strict, timeout, source_address) if not source_address: httplib.HTTPConnection.__init__(self, host, port, strict, timeout) self.ignoreAbruptClose = ignoreAbruptClose ClientHelper.__init__(self, username, password, certChain, privateKey, x509Fingerprint, tackID, hardTack, settings, anon) def connect(self): httplib.HTTPConnection.connect(self) self.sock = TLSConnection(self.sock) self.sock.ignoreAbruptClose = self.ignoreAbruptClose ClientHelper._handshake(self, self.sock)
apache-2.0
Zac-HD/home-assistant
homeassistant/components/switch/insteon_local.py
6
5416
""" Support for Insteon switch devices via local hub support. For more details about this component, please refer to the documentation at https://home-assistant.io/components/switch.insteon_local/ """ import json import logging import os from datetime import timedelta from homeassistant.components.switch import SwitchDevice from homeassistant.loader import get_component import homeassistant.util as util _CONFIGURING = {} _LOGGER = logging.getLogger(__name__) DEPENDENCIES = ['insteon_local'] DOMAIN = 'switch' INSTEON_LOCAL_SWITCH_CONF = 'insteon_local_switch.conf' MIN_TIME_BETWEEN_FORCED_SCANS = timedelta(milliseconds=100) MIN_TIME_BETWEEN_SCANS = timedelta(seconds=10) def setup_platform(hass, config, add_devices, discovery_info=None): """Set up the Insteon local switch platform.""" insteonhub = hass.data['insteon_local'] conf_switches = config_from_file(hass.config.path( INSTEON_LOCAL_SWITCH_CONF)) if len(conf_switches): for device_id in conf_switches: setup_switch( device_id, conf_switches[device_id], insteonhub, hass, add_devices) else: linked = insteonhub.get_linked() for device_id in linked: if linked[device_id]['cat_type'] == 'switch'\ and device_id not in conf_switches: request_configuration(device_id, insteonhub, linked[device_id]['model_name'] + ' ' + linked[device_id]['sku'], hass, add_devices) def request_configuration(device_id, insteonhub, model, hass, add_devices_callback): """Request configuration steps from the user.""" configurator = get_component('configurator') # We got an error if this method is called while we are configuring if device_id in _CONFIGURING: configurator.notify_errors( _CONFIGURING[device_id], 'Failed to register, please try again.') return def insteon_switch_config_callback(data): """The actions to do when our configuration callback is called.""" setup_switch(device_id, data.get('name'), insteonhub, hass, add_devices_callback) _CONFIGURING[device_id] = configurator.request_config( hass, 'Insteon Switch ' + model + ' addr: ' + device_id, insteon_switch_config_callback, description=('Enter a name for ' + model + ' addr: ' + device_id), entity_picture='/static/images/config_insteon.png', submit_caption='Confirm', fields=[{'id': 'name', 'name': 'Name', 'type': ''}] ) def setup_switch(device_id, name, insteonhub, hass, add_devices_callback): """Set up the switch.""" if device_id in _CONFIGURING: request_id = _CONFIGURING.pop(device_id) configurator = get_component('configurator') configurator.request_done(request_id) _LOGGER.info("Device configuration done!") conf_switch = config_from_file(hass.config.path(INSTEON_LOCAL_SWITCH_CONF)) if device_id not in conf_switch: conf_switch[device_id] = name if not config_from_file( hass.config.path(INSTEON_LOCAL_SWITCH_CONF), conf_switch): _LOGGER.error("Failed to save configuration file") device = insteonhub.switch(device_id) add_devices_callback([InsteonLocalSwitchDevice(device, name)]) def config_from_file(filename, config=None): """Small configuration file management function.""" if config: # We're writing configuration try: with open(filename, 'w') as fdesc: fdesc.write(json.dumps(config)) except IOError as error: _LOGGER.error("Saving configuration file failed: %s", error) return False return True else: # We're reading config if os.path.isfile(filename): try: with open(filename, 'r') as fdesc: return json.loads(fdesc.read()) except IOError as error: _LOGGER.error("Reading config file failed: %s", error) # This won't work yet return False else: return {} class InsteonLocalSwitchDevice(SwitchDevice): """An abstract Class for an Insteon node.""" def __init__(self, node, name): """Initialize the device.""" self.node = node self.node.deviceName = name self._state = False @property def name(self): """Return the the name of the node.""" return self.node.deviceName @property def unique_id(self): """Return the ID of this Insteon node.""" return 'insteon_local_{}'.format(self.node.device_id) @util.Throttle(MIN_TIME_BETWEEN_SCANS, MIN_TIME_BETWEEN_FORCED_SCANS) def update(self): """Get the updated status of the switch.""" resp = self.node.status(0) if 'cmd2' in resp: self._state = int(resp['cmd2'], 16) > 0 @property def is_on(self): """Return the boolean response if the node is on.""" return self._state def turn_on(self, **kwargs): """Turn device on.""" self.node.on() self._state = True def turn_off(self, **kwargs): """Turn device off.""" self.node.off() self._state = False
apache-2.0
samnazarko/osmc
package/mediacenter-eventclients-common-osmc/files/usr/share/pyshared/xbmc/ps3/sixpair.py
208
2903
#!/usr/bin/python # -*- coding: utf-8 -*- import sys import usb vendor = 0x054c product = 0x0268 timeout = 5000 passed_value = 0x03f5 def find_sixaxes(): res = [] for bus in usb.busses(): for dev in bus.devices: if dev.idVendor == vendor and dev.idProduct == product: res.append(dev) return res def find_interface(dev): for cfg in dev.configurations: for itf in cfg.interfaces: for alt in itf: if alt.interfaceClass == 3: return alt raise Exception("Unable to find interface") def mac_to_string(mac): return "%02x:%02x:%02x:%02x:%02x:%02x" % (mac[0], mac[1], mac[2], mac[3], mac[4], mac[5]) def set_pair_filename(dirname, filename, mac): for bus in usb.busses(): if int(bus.dirname) == int(dirname): for dev in bus.devices: if int(dev.filename) == int(filename): if dev.idVendor == vendor and dev.idProduct == product: update_pair(dev, mac) return else: raise Exception("Device is not a sixaxis") raise Exception("Device not found") def set_pair(dev, mac): itf = find_interface(dev) handle = dev.open() msg = (0x01, 0x00) + mac; try: handle.detachKernelDriver(itf.interfaceNumber) except usb.USBError: pass handle.claimInterface(itf.interfaceNumber) try: handle.controlMsg(usb.ENDPOINT_OUT | usb.TYPE_CLASS | usb.RECIP_INTERFACE , usb.REQ_SET_CONFIGURATION, msg, passed_value, itf.interfaceNumber, timeout) finally: handle.releaseInterface() def get_pair(dev): itf = find_interface(dev) handle = dev.open() try: handle.detachKernelDriver(itf.interfaceNumber) except usb.USBError: pass handle.claimInterface(itf.interfaceNumber) try: msg = handle.controlMsg(usb.ENDPOINT_IN | usb.TYPE_CLASS | usb.RECIP_INTERFACE , usb.REQ_CLEAR_FEATURE, 8, passed_value, itf.interfaceNumber, timeout) finally: handle.releaseInterface() return msg[2:8] def set_pair_all(mac): devs = find_sixaxes() for dev in devs: update_pair(dev, mac) def update_pair(dev, mac): old = get_pair(dev) if old != mac: print "Reparing sixaxis from:" + mac_to_string(old) + " to:" + mac_to_string(mac) set_pair(dev, mac) if __name__=="__main__": devs = find_sixaxes() mac = None if len(sys.argv) > 1: try: mac = sys.argv[1].split(':') mac = tuple([int(x, 16) for x in mac]) if len(mac) != 6: print "Invalid length of HCI address, should be 6 parts" mac = None except: print "Failed to parse HCI address" mac = None for dev in devs: if mac: update_pair(dev, mac) else: print "Found sixaxis paired to: " + mac_to_string(get_pair(dev))
gpl-2.0
zduputel/wphase
bin/make_cwp.py
1
7164
#!/usr/bin/env python # *-* coding: iso-8859-1 *-* ############################################################################ # # W phase source inversion package # ------------- # # Main authors: Zacharie Duputel, Luis Rivera and Hiroo Kanamori # # (c) California Institute of Technology and Universite de Strasbourg / CNRS # April 2013 # # Neither the name of the California Institute of Technology (Caltech) # nor the names of its contributors may be used to endorse or promote # products derived from this software without specific prior written # permission # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################ # CONCATENATED W PHASE TRACES from Arguments import * #Customizing matplotlib import matplotlib matplotlib.use('PDF') # Import external modules import os,sys,re import getopt as go import numpy as np import matplotlib.pyplot as plt # Import internal modules import sacpy # Internal functions def usage(cmd): print('usage: %s [chan1 chan2 (default: LHZ LHN LHE LH1 LH2)] [option] (for help see %s -h)'%(cmd,cmd)) # All done return; def disphelp(cmd): print('Make CWP traces\n') usage(cmd) print('\nAll parameters are optional:') print('\n -i, --ifort15 input fort.15 file (e.g. fort.15, ts_fort.15, xy_fort.15)') print('\n -n, --noref no reference solution') print('\n -h, --help display this help and exit') print('\nReport bugs to: <zacharie.duputel@eost.u-strasbg.fr>') # All done return; def main(argv): # Input parameters try: opts, args = go.gnu_getopt(argv[1:],'i:nh',["ifort15=","noref","help"]) except getopt.GetoptError as err: raise o_wpfile = O_WPINVERSION predfile = '' isref = 1 CHAN = ['LHZ', 'LHN', 'LHE', 'LH1', 'LH2'] for o, a in opts: if o == '-h' or o == '--help': disphelp(sys.argv[0]) sys.exit(0) if o == '-i' or o == '--ifort15': predfile = a if o == '-n' or o == '--noref': isref = 0 if len(args): CHAN = args if not os.path.exists(o_wpfile): sys.stderr.write('Error: file %s not available\n'%(o_wpfile)) if len(predfile) and not os.path.exists(predfile): raise IOError('No fort.15 file named %s\n'%(predfile)) if not len(predfile): predfile = 'xy_fort.15' if not os.path.exists(predfile): predfile = 'ts_fort.15' if not os.path.exists(predfile): predfile = 'fort.15' if not os.path.exists(predfile): raise IOError('No fort.15 file found\n') sys.stdout.write('Input fort.15 file: %s\n'%predfile) count = 0 sys.stdout.write('Input channels are: ') for chan in CHAN: if not os.path.exists('%s_%s'%(predfile,chan)): continue else: count += 1 sys.stdout.write('%5s'%chan) if not count: ErrMsg = 'Error: No fort.15_ file for' for chan in CHAN: ErrMsg += '%5s'%(chan) raise IOError(ErrMsg) sys.stdout.write('\nRead %s ...\n%s pages:\n'%(o_wpfile,count)) # Main loop sac = sacpy.sac() L = open(o_wpfile).readlines() ppW = matplotlib.backends.backend_pdf.PdfPages('CWP_W.pdf') sys.stdout.write('CWP_W.pdf\n') if isref: ppR = matplotlib.backends.backend_pdf.PdfPages('CWP_R.pdf') sys.stdout.write('CWP_R.pdf') for chan in CHAN: cb = 0.0 stat_label = [] stat_posit = [] # Read o_wpinversion for l in L: items = l.strip().split() sac.rsac(items[0]) if sac.kcmpnm[2] != chan[2]: continue stat_label.append(sac.kstnm) i1 = int(items[3]) i2 = int(items[4]) npts = float(i2-i1) stat_posit.append(cb+npts/2.0) cb += npts if not len(stat_label): sys.stderr.write('WARNING: No channel %s in %s\n'%(chan,o_wpfile)) continue # Read predfile ifile = predfile+'_'+chan L2 = open(ifile).readlines() ncol = len(L2[0].strip().split()) if ncol < 3 and isref: print('Warning No ref solution in %s'%ifile) isref = 0 else: Wref = [] Wdat = [] Wsyn = [] for l in L2: items = l.strip().split() Wdat.append(float(items[0])*1000.0) Wsyn.append(float(items[1])*1000.0) if isref: if len(items)<3: raise IOError('ERROR: error reading %s\n'%(ifile)) Wref.append(float(items[2])*1000.0) t = np.arange(0,len(Wdat),dtype='float') # Display fig=plt.figure(figsize=CWP_FIGSIZE) fig.subplots_adjust(left=0.08,bottom=0.12,right=0.96,top=0.88,wspace=0.2,hspace=0.2) plt.plot(t,Wdat,'k') plt.plot(t,Wsyn,'r') ymin = 1.1*min(Wdat) ymax = 1.1*max(Wdat) for stnm,x in zip(stat_label,stat_posit): plt.text(x,ymax*0.6,stnm,rotation=90,fontsize=16,fontstyle='italic') plt.ylim([ymin,ymax]) plt.xlim([0,t[-1]]) plt.xlabel('time, sec') plt.ylabel('displacement, mm') plt.title('Data fit, W Phase solution, %s'%chan[2]) ppW.savefig(papertype='a4',orientation='landscape') plt.close() if isref: fig = plt.figure(figsize=CWP_FIGSIZE) fig.subplots_adjust(left=0.08,bottom=0.12,right=0.96,top=0.88,wspace=0.2,hspace=0.2) plt.plot(t,Wdat,'k') plt.plot(t,Wref,'r') ymin = 1.1*min(Wdat) ymax = 1.1*max(Wdat) for stnm,x in zip(stat_label,stat_posit): plt.text(x,ymax*0.6,stnm,rotation=90,fontsize=16,fontstyle='italic') plt.ylim([ymin,ymax]) plt.xlim([0,t[-1]]) plt.xlabel('time, sec') plt.ylabel('displacement, mm') plt.title('Data fit, Reference solution, %s'%chan[2]) ppR.savefig(papertype='a4',orientation='landscape') plt.close() sys.stdout.write('\n') ppW.close() if isref: ppR.close() if __name__=='__main__': main(sys.argv)
gpl-3.0
llhe/tensorflow
tensorflow/contrib/tensor_forest/python/kernel_tests/best_splits_op_test.py
80
4532
# Copyright 2016 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Tests for tf.contrib.tensor_forest.ops.best_splits_op.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import tensorflow # pylint: disable=unused-import from tensorflow.contrib.tensor_forest.python.ops import tensor_forest_ops from tensorflow.python.framework import test_util from tensorflow.python.platform import googletest class BestSplitsClassificationTests(test_util.TensorFlowTestCase): def setUp(self): self.finished = [3, 5] self.node_map = [-1, -1, -1, 0, -1, 3, -1, -1, -1] self.candidate_counts = [[[153., 50., 60., 40., 3.], [200., 70., 30., 70., 30.]], [[0., 0., 0., 0., 0.], [0., 0., 0., 0., 0.]], [[0., 0., 0., 0., 0.], [0., 0., 0., 0., 0.]], [[40., 10., 10., 10., 10.], [30., 10., 5., 5., 10.]]] self.total_counts = [[400., 100., 100., 100., 100.], [0., 0., 0., 0., 0.], [0., 0., 0., 0., 0.], [400., 100., 100., 100., 100.]] self.squares = [] def testSimple(self): with self.test_session(): split_indices = tensor_forest_ops.best_splits( self.finished, self.node_map, self.candidate_counts, self.squares, self.total_counts, self.squares, regression=False) self.assertAllEqual([0, 1], split_indices.eval()) def testNoFinished(self): with self.test_session(): split_indices = tensor_forest_ops.best_splits( [], self.node_map, self.candidate_counts, self.squares, self.total_counts, self.squares, regression=False) self.assertAllEqual([], split_indices.eval()) def testBadInput(self): del self.total_counts[1] with self.test_session(): with self.assertRaisesOpError( 'Number of accumulators should be the same in split_sums ' 'and accumulator_sums.'): tensor_forest_ops.best_splits( self.finished, self.node_map, self.candidate_counts, self.squares, self.total_counts, self.squares, regression=False).eval() class BestSplitsRegressionTests(test_util.TensorFlowTestCase): def setUp(self): self.finished = [3, 5] self.node_map = [-1, -1, -1, 0, -1, 3, -1, -1, -1] self.candidate_sums = [[[5., 8., 8., 8.], [5., 10., 10., 10.]], [[0., 0., 0., 0.], [0., 0., 0., 0.]], [[0., 0., 0., 0.], [0., 0., 0., 0.]], [[10., 10., 20., 10.], [10., 5., 5., 5.]]] self.candidate_squares = [[[5., 50., 50., 50.], [5., 50., 50., 50.]], [[0., 0., 0., 0.], [0., 0., 0., 0.]], [[0., 0., 0., 0.], [0., 0., 0., 0.]], [[10., 40., 50., 60.], [10., 40., 40., 40.]]] self.total_sums = [[15., 10., 10., 10.], [0., 0., 0., 0.], [0., 0., 0., 0.], [20., 20., 20., 20.]] self.total_squares = [[15., 50., 50., 50.], [0., 0., 0., 0.], [0., 0., 0., 0.], [20., 60., 60., 60.]] def testSimple(self): with self.test_session(): split_indices = tensor_forest_ops.best_splits( self.finished, self.node_map, self.candidate_sums, self.candidate_squares, self.total_sums, self.total_squares, regression=True) self.assertAllEqual([1, 0], split_indices.eval()) if __name__ == '__main__': googletest.main()
apache-2.0
xuleiboy1234/autoTitle
tensorflow/tensorflow/contrib/opt/python/training/lazy_adam_optimizer.py
86
3881
# Copyright 2017 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Variant of the Adam optimizer that handles sparse updates more efficiently. Compared with the original Adam optimizer, the one in this file can provide a large improvement in model training throughput for some applications. However, it provides slightly different semantics than the original Adam algorithm, and may lead to different empirical results. """ from __future__ import absolute_import from __future__ import division from __future__ import print_function from tensorflow.python.ops import array_ops from tensorflow.python.ops import control_flow_ops from tensorflow.python.ops import math_ops from tensorflow.python.ops import state_ops from tensorflow.python.training import adam class LazyAdamOptimizer(adam.AdamOptimizer): """Variant of the Adam optimizer that handles sparse updates more efficiently. The original Adam algorithm maintains two moving-average accumulators for each trainable variable; the accumulators are updated at every step. This class provides lazier handling of gradient updates for sparse variables. It only updates moving-average accumulators for sparse variable indices that appear in the current batch, rather than updating the accumulators for all indices. Compared with the original Adam optimizer, it can provide large improvements in model training throughput for some applications. However, it provides slightly different semantics than the original Adam algorithm, and may lead to different empirical results. """ def _apply_sparse(self, grad, var): beta1_power = math_ops.cast(self._beta1_power, var.dtype.base_dtype) beta2_power = math_ops.cast(self._beta2_power, var.dtype.base_dtype) lr_t = math_ops.cast(self._lr_t, var.dtype.base_dtype) beta1_t = math_ops.cast(self._beta1_t, var.dtype.base_dtype) beta2_t = math_ops.cast(self._beta2_t, var.dtype.base_dtype) epsilon_t = math_ops.cast(self._epsilon_t, var.dtype.base_dtype) lr = (lr_t * math_ops.sqrt(1 - beta2_power) / (1 - beta1_power)) # m := beta1 * m + (1 - beta1) * g_t m = self.get_slot(var, "m") m_t = state_ops.scatter_update(m, grad.indices, beta1_t * array_ops.gather(m, grad.indices) + (1 - beta1_t) * grad.values, use_locking=self._use_locking) # v := beta2 * v + (1 - beta2) * (g_t * g_t) v = self.get_slot(var, "v") v_t = state_ops.scatter_update(v, grad.indices, beta2_t * array_ops.gather(v, grad.indices) + (1 - beta2_t) * math_ops.square(grad.values), use_locking=self._use_locking) # variable -= learning_rate * m_t / (epsilon_t + sqrt(v_t)) m_t_slice = array_ops.gather(m_t, grad.indices) v_t_slice = array_ops.gather(v_t, grad.indices) denominator_slice = math_ops.sqrt(v_t_slice) + epsilon_t var_update = state_ops.scatter_sub(var, grad.indices, lr * m_t_slice / denominator_slice, use_locking=self._use_locking) return control_flow_ops.group(var_update, m_t, v_t)
mit
ryfeus/lambda-packs
Tensorflow_OpenCV_Nightly/source/tensorflow/tensorboard/backend/event_processing/event_file_loader.py
68
2971
# Copyright 2015 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Functionality for loading events from a record file.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function from tensorflow.core.util import event_pb2 from tensorflow.python import pywrap_tensorflow from tensorflow.python.framework import errors from tensorflow.python.platform import app from tensorflow.python.platform import resource_loader from tensorflow.python.platform import tf_logging as logging from tensorflow.python.util import compat class EventFileLoader(object): """An EventLoader is an iterator that yields Event protos.""" def __init__(self, file_path): if file_path is None: raise ValueError('A file path is required') file_path = resource_loader.readahead_file_path(file_path) logging.debug('Opening a record reader pointing at %s', file_path) with errors.raise_exception_on_not_ok_status() as status: self._reader = pywrap_tensorflow.PyRecordReader_New( compat.as_bytes(file_path), 0, compat.as_bytes(''), status) # Store it for logging purposes. self._file_path = file_path if not self._reader: raise IOError('Failed to open a record reader pointing to %s' % file_path) def Load(self): """Loads all new values from disk. Calling Load multiple times in a row will not 'drop' events as long as the return value is not iterated over. Yields: All values that were written to disk that have not been yielded yet. """ while True: try: with errors.raise_exception_on_not_ok_status() as status: self._reader.GetNext(status) except (errors.DataLossError, errors.OutOfRangeError): # We ignore partial read exceptions, because a record may be truncated. # PyRecordReader holds the offset prior to the failed read, so retrying # will succeed. break event = event_pb2.Event() event.ParseFromString(self._reader.record()) yield event logging.debug('No more events in %s', self._file_path) def main(argv): if len(argv) != 2: print('Usage: event_file_loader <path-to-the-recordio-file>') return 1 loader = EventFileLoader(argv[1]) for event in loader.Load(): print(event) if __name__ == '__main__': app.run()
mit
Karaage-Cluster/karaage-debian
karaage/legacy/projects/south_migrations/0014_move_projects.py
3
13986
# -*- coding: utf-8 -*- from south.v2 import DataMigration class Migration(DataMigration): def forwards(self, orm): "Write your forwards methods here." for src in orm.Project.objects.iterator(): try: dst = orm.ProjectTmp.objects.get(pid=src.pid) except orm.ProjectTmp.DoesNotExist: dst = orm.ProjectTmp(pid=src.pid) dst.name = src.name dst.group = src.group dst.institute = src.institute dst.description = src.description dst.is_approved = src.is_approved dst.start_date = src.start_date dst.end_date = src.end_date dst.additional_req = src.additional_req dst.is_active = src.is_active dst.approved_by = src.approved_by dst.date_approved = src.date_approved dst.deleted_by = src.deleted_by dst.date_deleted = src.date_deleted dst.last_usage = src.last_usage dst.save() dst.leaders = src.leaders.iterator() for pq in orm.ProjectQuota.objects.iterator(): try: src = pq.project dst = orm.ProjectTmp.objects.get(pid=src.pid) pq.project_tmp = dst pq.save() except orm.Project.DoesNotExist: pq.delete() def backwards(self, orm): "Write your backwards methods here." for src in orm.ProjectTmp.objects.iterator(): try: dst = orm.Project.objects.get(pid=src.pid) except orm.Project.DoesNotExist: dst = orm.Project(pid=src.pid) dst.name = src.name dst.group = src.group dst.institute = src.institute dst.description = src.description dst.is_approved = src.is_approved dst.start_date = src.start_date dst.end_date = src.end_date dst.additional_req = src.additional_req dst.is_active = src.is_active dst.approved_by = src.approved_by dst.date_approved = src.date_approved dst.deleted_by = src.deleted_by dst.date_deleted = src.date_deleted dst.last_usage = src.last_usage dst.save() dst.leaders = src.leaders.iterator() for pq in orm.ProjectQuota.objects.iterator(): src = pq.project_tmp dst = orm.Project.objects.get(pid=src.pid) pq.project = dst pq.save() models = { 'institutes.institute': { 'Meta': {'ordering': "['name']", 'object_name': 'Institute', 'db_table': "'institute'"}, 'delegates': ('django.db.models.fields.related.ManyToManyField', [], {'related_name': "'delegate'", 'to': "orm['people.Person']", 'through': "orm['institutes.InstituteDelegate']", 'blank': 'True', 'symmetrical': 'False', 'null': 'True'}), 'group': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['people.Group']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '100'}), 'saml_entityid': ('django.db.models.fields.CharField', [], {'max_length': '200', 'unique': 'True', 'null': 'True', 'blank': 'True'}) }, 'institutes.institutedelegate': { 'Meta': {'object_name': 'InstituteDelegate', 'db_table': "'institutedelegate'"}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'institute': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['institutes.Institute']"}), 'person': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['people.Person']"}), 'send_email': ('django.db.models.fields.BooleanField', [], {'default': 'False'}) }, 'machines.machinecategory': { 'Meta': {'object_name': 'MachineCategory', 'db_table': "'machine_category'"}, 'datastore': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}) }, 'people.group': { 'Meta': {'ordering': "['name']", 'object_name': 'Group'}, 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'members': ('django.db.models.fields.related.ManyToManyField', [], {'related_name': "'groups'", 'symmetrical': 'False', 'to': "orm['people.Person']"}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '100'}) }, 'people.person': { 'Meta': {'ordering': "['full_name', 'short_name']", 'object_name': 'Person', 'db_table': "'person'"}, 'address': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'approved_by': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'user_approver'", 'null': 'True', 'to': "orm['people.Person']"}), 'city': ('django.db.models.fields.CharField', [], {'max_length': '100', 'null': 'True', 'blank': 'True'}), 'comment': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'country': ('django.db.models.fields.CharField', [], {'max_length': '2', 'null': 'True', 'blank': 'True'}), 'date_approved': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'date_deleted': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'deleted_by': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'user_deletor'", 'null': 'True', 'to': "orm['people.Person']"}), 'department': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'null': 'True', 'db_index': 'True'}), 'expires': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'fax': ('django.db.models.fields.CharField', [], {'max_length': '50', 'null': 'True', 'blank': 'True'}), 'full_name': ('django.db.models.fields.CharField', [], {'max_length': '60'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'institute': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['institutes.Institute']"}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_admin': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_systemuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_usage': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'legacy_ldap_password': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True', 'blank': 'True'}), 'login_enabled': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'mobile': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'position': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'postcode': ('django.db.models.fields.CharField', [], {'max_length': '8', 'null': 'True', 'blank': 'True'}), 'saml_id': ('django.db.models.fields.CharField', [], {'max_length': '200', 'unique': 'True', 'null': 'True', 'blank': 'True'}), 'short_name': ('django.db.models.fields.CharField', [], {'max_length': '30'}), 'state': ('django.db.models.fields.CharField', [], {'max_length': '4', 'null': 'True', 'blank': 'True'}), 'supervisor': ('django.db.models.fields.CharField', [], {'max_length': '100', 'null': 'True', 'blank': 'True'}), 'telephone': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '10', 'null': 'True', 'blank': 'True'}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}), 'website': ('django.db.models.fields.URLField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}) }, 'projects.project': { 'Meta': {'ordering': "['pid']", 'object_name': 'Project', 'db_table': "'project'"}, 'additional_req': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'approved_by': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'project_approver'", 'null': 'True', 'to': "orm['people.Person']"}), 'date_approved': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'date_deleted': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'deleted_by': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'project_deletor'", 'null': 'True', 'to': "orm['people.Person']"}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'end_date': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'group': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['people.Group']"}), 'institute': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['institutes.Institute']"}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_approved': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_usage': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'leaders': ('django.db.models.fields.related.ManyToManyField', [], {'related_name': "'leaders'", 'symmetrical': 'False', 'to': "orm['people.Person']"}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'pid': ('django.db.models.fields.CharField', [], {'max_length': '50', 'primary_key': 'True'}), 'start_date': ('django.db.models.fields.DateField', [], {'default': 'datetime.datetime(2013, 9, 17, 0, 0)'}) }, 'projects.projectquota': { 'Meta': {'unique_together': "(('project', 'machine_category'),)", 'object_name': 'ProjectQuota', 'db_table': "'project_quota'"}, 'cap': ('django.db.models.fields.IntegerField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'machine_category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['machines.MachineCategory']"}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['projects.Project']"}), 'project_tmp': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['projects.ProjectTmp']", 'null': 'True'}) }, 'projects.projecttmp': { 'Meta': {'object_name': 'ProjectTmp'}, 'additional_req': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'approved_by': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'project_approver_tmp'", 'null': 'True', 'to': "orm['people.Person']"}), 'date_approved': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'date_deleted': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'deleted_by': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'project_deletor_tmp'", 'null': 'True', 'to': "orm['people.Person']"}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'end_date': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'group': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['people.Group']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'institute': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'project_tmp'", 'to': "orm['institutes.Institute']"}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_approved': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_usage': ('django.db.models.fields.DateField', [], {'null': 'True', 'blank': 'True'}), 'leaders': ('django.db.models.fields.related.ManyToManyField', [], {'related_name': "'leaders_tmp'", 'symmetrical': 'False', 'to': "orm['people.Person']"}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'pid': ('django.db.models.fields.CharField', [], {'max_length': '50'}), 'start_date': ('django.db.models.fields.DateField', [], {'default': 'datetime.datetime(2013, 9, 17, 0, 0)'}) } } complete_apps = ['projects'] symmetrical = True
gpl-3.0
martinbede/second-sight
tensorflow/contrib/util/__init__.py
7
1356
# Copyright 2015 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Utilities for dealing with Tensors. ## Miscellaneous Utility Functions @@constant_value @@make_tensor_proto @@make_ndarray @@stripped_op_list_for_graph """ from __future__ import absolute_import from __future__ import division from __future__ import print_function # pylint: disable=unused-import from tensorflow.python.framework.tensor_util import constant_value from tensorflow.python.framework.tensor_util import make_tensor_proto from tensorflow.python.framework.tensor_util import MakeNdarray as make_ndarray from tensorflow.python.training.saver import stripped_op_list_for_graph from tensorflow.python.util.all_util import make_all __all__ = make_all(__name__)
apache-2.0
MortimerGoro/servo
tests/wpt/web-platform-tests/tools/webdriver/webdriver/__init__.py
149
1055
# This Source Code Form is subject to the terms of the Mozilla Public # License, v. 2.0. If a copy of the MPL was not distributed with this file, # You can obtain one at http://mozilla.org/MPL/2.0/. from client import Cookies, Element, Find, Session, Timeouts, Window from error import ( ElementNotSelectableException, ElementNotVisibleException, InvalidArgumentException, InvalidCookieDomainException, InvalidElementCoordinatesException, InvalidElementStateException, InvalidSelectorException, InvalidSessionIdException, JavascriptErrorException, MoveTargetOutOfBoundsException, NoSuchAlertException, NoSuchElementException, NoSuchFrameException, NoSuchWindowException, ScriptTimeoutException, SessionNotCreatedException, StaleElementReferenceException, TimeoutException, UnableToSetCookieException, UnexpectedAlertOpenException, UnknownCommandException, UnknownErrorException, UnknownMethodException, UnsupportedOperationException, WebDriverException)
mpl-2.0
kevinljw/ntulive_web
node_modules/node-gyp/gyp/pylib/gyp/MSVSSettings_test.py
1446
65937
#!/usr/bin/env python # Copyright (c) 2012 Google Inc. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """Unit tests for the MSVSSettings.py file.""" import StringIO import unittest import gyp.MSVSSettings as MSVSSettings class TestSequenceFunctions(unittest.TestCase): def setUp(self): self.stderr = StringIO.StringIO() def _ExpectedWarnings(self, expected): """Compares recorded lines to expected warnings.""" self.stderr.seek(0) actual = self.stderr.read().split('\n') actual = [line for line in actual if line] self.assertEqual(sorted(expected), sorted(actual)) def testValidateMSVSSettings_tool_names(self): """Tests that only MSVS tool names are allowed.""" MSVSSettings.ValidateMSVSSettings( {'VCCLCompilerTool': {}, 'VCLinkerTool': {}, 'VCMIDLTool': {}, 'foo': {}, 'VCResourceCompilerTool': {}, 'VCLibrarianTool': {}, 'VCManifestTool': {}, 'ClCompile': {}}, self.stderr) self._ExpectedWarnings([ 'Warning: unrecognized tool foo', 'Warning: unrecognized tool ClCompile']) def testValidateMSVSSettings_settings(self): """Tests that for invalid MSVS settings.""" MSVSSettings.ValidateMSVSSettings( {'VCCLCompilerTool': { 'AdditionalIncludeDirectories': 'folder1;folder2', 'AdditionalOptions': ['string1', 'string2'], 'AdditionalUsingDirectories': 'folder1;folder2', 'AssemblerListingLocation': 'a_file_name', 'AssemblerOutput': '0', 'BasicRuntimeChecks': '5', 'BrowseInformation': 'fdkslj', 'BrowseInformationFile': 'a_file_name', 'BufferSecurityCheck': 'true', 'CallingConvention': '-1', 'CompileAs': '1', 'DebugInformationFormat': '2', 'DefaultCharIsUnsigned': 'true', 'Detect64BitPortabilityProblems': 'true', 'DisableLanguageExtensions': 'true', 'DisableSpecificWarnings': 'string1;string2', 'EnableEnhancedInstructionSet': '1', 'EnableFiberSafeOptimizations': 'true', 'EnableFunctionLevelLinking': 'true', 'EnableIntrinsicFunctions': 'true', 'EnablePREfast': 'true', 'Enableprefast': 'bogus', 'ErrorReporting': '1', 'ExceptionHandling': '1', 'ExpandAttributedSource': 'true', 'FavorSizeOrSpeed': '1', 'FloatingPointExceptions': 'true', 'FloatingPointModel': '1', 'ForceConformanceInForLoopScope': 'true', 'ForcedIncludeFiles': 'file1;file2', 'ForcedUsingFiles': 'file1;file2', 'GeneratePreprocessedFile': '1', 'GenerateXMLDocumentationFiles': 'true', 'IgnoreStandardIncludePath': 'true', 'InlineFunctionExpansion': '1', 'KeepComments': 'true', 'MinimalRebuild': 'true', 'ObjectFile': 'a_file_name', 'OmitDefaultLibName': 'true', 'OmitFramePointers': 'true', 'OpenMP': 'true', 'Optimization': '1', 'PrecompiledHeaderFile': 'a_file_name', 'PrecompiledHeaderThrough': 'a_file_name', 'PreprocessorDefinitions': 'string1;string2', 'ProgramDataBaseFileName': 'a_file_name', 'RuntimeLibrary': '1', 'RuntimeTypeInfo': 'true', 'ShowIncludes': 'true', 'SmallerTypeCheck': 'true', 'StringPooling': 'true', 'StructMemberAlignment': '1', 'SuppressStartupBanner': 'true', 'TreatWChar_tAsBuiltInType': 'true', 'UndefineAllPreprocessorDefinitions': 'true', 'UndefinePreprocessorDefinitions': 'string1;string2', 'UseFullPaths': 'true', 'UsePrecompiledHeader': '1', 'UseUnicodeResponseFiles': 'true', 'WarnAsError': 'true', 'WarningLevel': '1', 'WholeProgramOptimization': 'true', 'XMLDocumentationFileName': 'a_file_name', 'ZZXYZ': 'bogus'}, 'VCLinkerTool': { 'AdditionalDependencies': 'file1;file2', 'AdditionalDependencies_excluded': 'file3', 'AdditionalLibraryDirectories': 'folder1;folder2', 'AdditionalManifestDependencies': 'file1;file2', 'AdditionalOptions': 'a string1', 'AddModuleNamesToAssembly': 'file1;file2', 'AllowIsolation': 'true', 'AssemblyDebug': '2', 'AssemblyLinkResource': 'file1;file2', 'BaseAddress': 'a string1', 'CLRImageType': '2', 'CLRThreadAttribute': '2', 'CLRUnmanagedCodeCheck': 'true', 'DataExecutionPrevention': '2', 'DelayLoadDLLs': 'file1;file2', 'DelaySign': 'true', 'Driver': '2', 'EmbedManagedResourceFile': 'file1;file2', 'EnableCOMDATFolding': '2', 'EnableUAC': 'true', 'EntryPointSymbol': 'a string1', 'ErrorReporting': '2', 'FixedBaseAddress': '2', 'ForceSymbolReferences': 'file1;file2', 'FunctionOrder': 'a_file_name', 'GenerateDebugInformation': 'true', 'GenerateManifest': 'true', 'GenerateMapFile': 'true', 'HeapCommitSize': 'a string1', 'HeapReserveSize': 'a string1', 'IgnoreAllDefaultLibraries': 'true', 'IgnoreDefaultLibraryNames': 'file1;file2', 'IgnoreEmbeddedIDL': 'true', 'IgnoreImportLibrary': 'true', 'ImportLibrary': 'a_file_name', 'KeyContainer': 'a_file_name', 'KeyFile': 'a_file_name', 'LargeAddressAware': '2', 'LinkIncremental': '2', 'LinkLibraryDependencies': 'true', 'LinkTimeCodeGeneration': '2', 'ManifestFile': 'a_file_name', 'MapExports': 'true', 'MapFileName': 'a_file_name', 'MergedIDLBaseFileName': 'a_file_name', 'MergeSections': 'a string1', 'MidlCommandFile': 'a_file_name', 'ModuleDefinitionFile': 'a_file_name', 'OptimizeForWindows98': '1', 'OptimizeReferences': '2', 'OutputFile': 'a_file_name', 'PerUserRedirection': 'true', 'Profile': 'true', 'ProfileGuidedDatabase': 'a_file_name', 'ProgramDatabaseFile': 'a_file_name', 'RandomizedBaseAddress': '2', 'RegisterOutput': 'true', 'ResourceOnlyDLL': 'true', 'SetChecksum': 'true', 'ShowProgress': '2', 'StackCommitSize': 'a string1', 'StackReserveSize': 'a string1', 'StripPrivateSymbols': 'a_file_name', 'SubSystem': '2', 'SupportUnloadOfDelayLoadedDLL': 'true', 'SuppressStartupBanner': 'true', 'SwapRunFromCD': 'true', 'SwapRunFromNet': 'true', 'TargetMachine': '2', 'TerminalServerAware': '2', 'TurnOffAssemblyGeneration': 'true', 'TypeLibraryFile': 'a_file_name', 'TypeLibraryResourceID': '33', 'UACExecutionLevel': '2', 'UACUIAccess': 'true', 'UseLibraryDependencyInputs': 'true', 'UseUnicodeResponseFiles': 'true', 'Version': 'a string1'}, 'VCMIDLTool': { 'AdditionalIncludeDirectories': 'folder1;folder2', 'AdditionalOptions': 'a string1', 'CPreprocessOptions': 'a string1', 'DefaultCharType': '1', 'DLLDataFileName': 'a_file_name', 'EnableErrorChecks': '1', 'ErrorCheckAllocations': 'true', 'ErrorCheckBounds': 'true', 'ErrorCheckEnumRange': 'true', 'ErrorCheckRefPointers': 'true', 'ErrorCheckStubData': 'true', 'GenerateStublessProxies': 'true', 'GenerateTypeLibrary': 'true', 'HeaderFileName': 'a_file_name', 'IgnoreStandardIncludePath': 'true', 'InterfaceIdentifierFileName': 'a_file_name', 'MkTypLibCompatible': 'true', 'notgood': 'bogus', 'OutputDirectory': 'a string1', 'PreprocessorDefinitions': 'string1;string2', 'ProxyFileName': 'a_file_name', 'RedirectOutputAndErrors': 'a_file_name', 'StructMemberAlignment': '1', 'SuppressStartupBanner': 'true', 'TargetEnvironment': '1', 'TypeLibraryName': 'a_file_name', 'UndefinePreprocessorDefinitions': 'string1;string2', 'ValidateParameters': 'true', 'WarnAsError': 'true', 'WarningLevel': '1'}, 'VCResourceCompilerTool': { 'AdditionalOptions': 'a string1', 'AdditionalIncludeDirectories': 'folder1;folder2', 'Culture': '1003', 'IgnoreStandardIncludePath': 'true', 'notgood2': 'bogus', 'PreprocessorDefinitions': 'string1;string2', 'ResourceOutputFileName': 'a string1', 'ShowProgress': 'true', 'SuppressStartupBanner': 'true', 'UndefinePreprocessorDefinitions': 'string1;string2'}, 'VCLibrarianTool': { 'AdditionalDependencies': 'file1;file2', 'AdditionalLibraryDirectories': 'folder1;folder2', 'AdditionalOptions': 'a string1', 'ExportNamedFunctions': 'string1;string2', 'ForceSymbolReferences': 'a string1', 'IgnoreAllDefaultLibraries': 'true', 'IgnoreSpecificDefaultLibraries': 'file1;file2', 'LinkLibraryDependencies': 'true', 'ModuleDefinitionFile': 'a_file_name', 'OutputFile': 'a_file_name', 'SuppressStartupBanner': 'true', 'UseUnicodeResponseFiles': 'true'}, 'VCManifestTool': { 'AdditionalManifestFiles': 'file1;file2', 'AdditionalOptions': 'a string1', 'AssemblyIdentity': 'a string1', 'ComponentFileName': 'a_file_name', 'DependencyInformationFile': 'a_file_name', 'GenerateCatalogFiles': 'true', 'InputResourceManifests': 'a string1', 'ManifestResourceFile': 'a_file_name', 'OutputManifestFile': 'a_file_name', 'RegistrarScriptFile': 'a_file_name', 'ReplacementsFile': 'a_file_name', 'SuppressStartupBanner': 'true', 'TypeLibraryFile': 'a_file_name', 'UpdateFileHashes': 'truel', 'UpdateFileHashesSearchPath': 'a_file_name', 'UseFAT32Workaround': 'true', 'UseUnicodeResponseFiles': 'true', 'VerboseOutput': 'true'}}, self.stderr) self._ExpectedWarnings([ 'Warning: for VCCLCompilerTool/BasicRuntimeChecks, ' 'index value (5) not in expected range [0, 4)', 'Warning: for VCCLCompilerTool/BrowseInformation, ' "invalid literal for int() with base 10: 'fdkslj'", 'Warning: for VCCLCompilerTool/CallingConvention, ' 'index value (-1) not in expected range [0, 4)', 'Warning: for VCCLCompilerTool/DebugInformationFormat, ' 'converted value for 2 not specified.', 'Warning: unrecognized setting VCCLCompilerTool/Enableprefast', 'Warning: unrecognized setting VCCLCompilerTool/ZZXYZ', 'Warning: for VCLinkerTool/TargetMachine, ' 'converted value for 2 not specified.', 'Warning: unrecognized setting VCMIDLTool/notgood', 'Warning: unrecognized setting VCResourceCompilerTool/notgood2', 'Warning: for VCManifestTool/UpdateFileHashes, ' "expected bool; got 'truel'" '']) def testValidateMSBuildSettings_settings(self): """Tests that for invalid MSBuild settings.""" MSVSSettings.ValidateMSBuildSettings( {'ClCompile': { 'AdditionalIncludeDirectories': 'folder1;folder2', 'AdditionalOptions': ['string1', 'string2'], 'AdditionalUsingDirectories': 'folder1;folder2', 'AssemblerListingLocation': 'a_file_name', 'AssemblerOutput': 'NoListing', 'BasicRuntimeChecks': 'StackFrameRuntimeCheck', 'BrowseInformation': 'false', 'BrowseInformationFile': 'a_file_name', 'BufferSecurityCheck': 'true', 'BuildingInIDE': 'true', 'CallingConvention': 'Cdecl', 'CompileAs': 'CompileAsC', 'CompileAsManaged': 'true', 'CreateHotpatchableImage': 'true', 'DebugInformationFormat': 'ProgramDatabase', 'DisableLanguageExtensions': 'true', 'DisableSpecificWarnings': 'string1;string2', 'EnableEnhancedInstructionSet': 'StreamingSIMDExtensions', 'EnableFiberSafeOptimizations': 'true', 'EnablePREfast': 'true', 'Enableprefast': 'bogus', 'ErrorReporting': 'Prompt', 'ExceptionHandling': 'SyncCThrow', 'ExpandAttributedSource': 'true', 'FavorSizeOrSpeed': 'Neither', 'FloatingPointExceptions': 'true', 'FloatingPointModel': 'Precise', 'ForceConformanceInForLoopScope': 'true', 'ForcedIncludeFiles': 'file1;file2', 'ForcedUsingFiles': 'file1;file2', 'FunctionLevelLinking': 'false', 'GenerateXMLDocumentationFiles': 'true', 'IgnoreStandardIncludePath': 'true', 'InlineFunctionExpansion': 'OnlyExplicitInline', 'IntrinsicFunctions': 'false', 'MinimalRebuild': 'true', 'MultiProcessorCompilation': 'true', 'ObjectFileName': 'a_file_name', 'OmitDefaultLibName': 'true', 'OmitFramePointers': 'true', 'OpenMPSupport': 'true', 'Optimization': 'Disabled', 'PrecompiledHeader': 'NotUsing', 'PrecompiledHeaderFile': 'a_file_name', 'PrecompiledHeaderOutputFile': 'a_file_name', 'PreprocessKeepComments': 'true', 'PreprocessorDefinitions': 'string1;string2', 'PreprocessOutputPath': 'a string1', 'PreprocessSuppressLineNumbers': 'false', 'PreprocessToFile': 'false', 'ProcessorNumber': '33', 'ProgramDataBaseFileName': 'a_file_name', 'RuntimeLibrary': 'MultiThreaded', 'RuntimeTypeInfo': 'true', 'ShowIncludes': 'true', 'SmallerTypeCheck': 'true', 'StringPooling': 'true', 'StructMemberAlignment': '1Byte', 'SuppressStartupBanner': 'true', 'TrackerLogDirectory': 'a_folder', 'TreatSpecificWarningsAsErrors': 'string1;string2', 'TreatWarningAsError': 'true', 'TreatWChar_tAsBuiltInType': 'true', 'UndefineAllPreprocessorDefinitions': 'true', 'UndefinePreprocessorDefinitions': 'string1;string2', 'UseFullPaths': 'true', 'UseUnicodeForAssemblerListing': 'true', 'WarningLevel': 'TurnOffAllWarnings', 'WholeProgramOptimization': 'true', 'XMLDocumentationFileName': 'a_file_name', 'ZZXYZ': 'bogus'}, 'Link': { 'AdditionalDependencies': 'file1;file2', 'AdditionalLibraryDirectories': 'folder1;folder2', 'AdditionalManifestDependencies': 'file1;file2', 'AdditionalOptions': 'a string1', 'AddModuleNamesToAssembly': 'file1;file2', 'AllowIsolation': 'true', 'AssemblyDebug': '', 'AssemblyLinkResource': 'file1;file2', 'BaseAddress': 'a string1', 'BuildingInIDE': 'true', 'CLRImageType': 'ForceIJWImage', 'CLRSupportLastError': 'Enabled', 'CLRThreadAttribute': 'MTAThreadingAttribute', 'CLRUnmanagedCodeCheck': 'true', 'CreateHotPatchableImage': 'X86Image', 'DataExecutionPrevention': 'false', 'DelayLoadDLLs': 'file1;file2', 'DelaySign': 'true', 'Driver': 'NotSet', 'EmbedManagedResourceFile': 'file1;file2', 'EnableCOMDATFolding': 'false', 'EnableUAC': 'true', 'EntryPointSymbol': 'a string1', 'FixedBaseAddress': 'false', 'ForceFileOutput': 'Enabled', 'ForceSymbolReferences': 'file1;file2', 'FunctionOrder': 'a_file_name', 'GenerateDebugInformation': 'true', 'GenerateMapFile': 'true', 'HeapCommitSize': 'a string1', 'HeapReserveSize': 'a string1', 'IgnoreAllDefaultLibraries': 'true', 'IgnoreEmbeddedIDL': 'true', 'IgnoreSpecificDefaultLibraries': 'a_file_list', 'ImageHasSafeExceptionHandlers': 'true', 'ImportLibrary': 'a_file_name', 'KeyContainer': 'a_file_name', 'KeyFile': 'a_file_name', 'LargeAddressAware': 'false', 'LinkDLL': 'true', 'LinkErrorReporting': 'SendErrorReport', 'LinkStatus': 'true', 'LinkTimeCodeGeneration': 'UseLinkTimeCodeGeneration', 'ManifestFile': 'a_file_name', 'MapExports': 'true', 'MapFileName': 'a_file_name', 'MergedIDLBaseFileName': 'a_file_name', 'MergeSections': 'a string1', 'MidlCommandFile': 'a_file_name', 'MinimumRequiredVersion': 'a string1', 'ModuleDefinitionFile': 'a_file_name', 'MSDOSStubFileName': 'a_file_name', 'NoEntryPoint': 'true', 'OptimizeReferences': 'false', 'OutputFile': 'a_file_name', 'PerUserRedirection': 'true', 'PreventDllBinding': 'true', 'Profile': 'true', 'ProfileGuidedDatabase': 'a_file_name', 'ProgramDatabaseFile': 'a_file_name', 'RandomizedBaseAddress': 'false', 'RegisterOutput': 'true', 'SectionAlignment': '33', 'SetChecksum': 'true', 'ShowProgress': 'LinkVerboseREF', 'SpecifySectionAttributes': 'a string1', 'StackCommitSize': 'a string1', 'StackReserveSize': 'a string1', 'StripPrivateSymbols': 'a_file_name', 'SubSystem': 'Console', 'SupportNobindOfDelayLoadedDLL': 'true', 'SupportUnloadOfDelayLoadedDLL': 'true', 'SuppressStartupBanner': 'true', 'SwapRunFromCD': 'true', 'SwapRunFromNET': 'true', 'TargetMachine': 'MachineX86', 'TerminalServerAware': 'false', 'TrackerLogDirectory': 'a_folder', 'TreatLinkerWarningAsErrors': 'true', 'TurnOffAssemblyGeneration': 'true', 'TypeLibraryFile': 'a_file_name', 'TypeLibraryResourceID': '33', 'UACExecutionLevel': 'AsInvoker', 'UACUIAccess': 'true', 'Version': 'a string1'}, 'ResourceCompile': { 'AdditionalIncludeDirectories': 'folder1;folder2', 'AdditionalOptions': 'a string1', 'Culture': '0x236', 'IgnoreStandardIncludePath': 'true', 'NullTerminateStrings': 'true', 'PreprocessorDefinitions': 'string1;string2', 'ResourceOutputFileName': 'a string1', 'ShowProgress': 'true', 'SuppressStartupBanner': 'true', 'TrackerLogDirectory': 'a_folder', 'UndefinePreprocessorDefinitions': 'string1;string2'}, 'Midl': { 'AdditionalIncludeDirectories': 'folder1;folder2', 'AdditionalOptions': 'a string1', 'ApplicationConfigurationMode': 'true', 'ClientStubFile': 'a_file_name', 'CPreprocessOptions': 'a string1', 'DefaultCharType': 'Signed', 'DllDataFileName': 'a_file_name', 'EnableErrorChecks': 'EnableCustom', 'ErrorCheckAllocations': 'true', 'ErrorCheckBounds': 'true', 'ErrorCheckEnumRange': 'true', 'ErrorCheckRefPointers': 'true', 'ErrorCheckStubData': 'true', 'GenerateClientFiles': 'Stub', 'GenerateServerFiles': 'None', 'GenerateStublessProxies': 'true', 'GenerateTypeLibrary': 'true', 'HeaderFileName': 'a_file_name', 'IgnoreStandardIncludePath': 'true', 'InterfaceIdentifierFileName': 'a_file_name', 'LocaleID': '33', 'MkTypLibCompatible': 'true', 'OutputDirectory': 'a string1', 'PreprocessorDefinitions': 'string1;string2', 'ProxyFileName': 'a_file_name', 'RedirectOutputAndErrors': 'a_file_name', 'ServerStubFile': 'a_file_name', 'StructMemberAlignment': 'NotSet', 'SuppressCompilerWarnings': 'true', 'SuppressStartupBanner': 'true', 'TargetEnvironment': 'Itanium', 'TrackerLogDirectory': 'a_folder', 'TypeLibFormat': 'NewFormat', 'TypeLibraryName': 'a_file_name', 'UndefinePreprocessorDefinitions': 'string1;string2', 'ValidateAllParameters': 'true', 'WarnAsError': 'true', 'WarningLevel': '1'}, 'Lib': { 'AdditionalDependencies': 'file1;file2', 'AdditionalLibraryDirectories': 'folder1;folder2', 'AdditionalOptions': 'a string1', 'DisplayLibrary': 'a string1', 'ErrorReporting': 'PromptImmediately', 'ExportNamedFunctions': 'string1;string2', 'ForceSymbolReferences': 'a string1', 'IgnoreAllDefaultLibraries': 'true', 'IgnoreSpecificDefaultLibraries': 'file1;file2', 'LinkTimeCodeGeneration': 'true', 'MinimumRequiredVersion': 'a string1', 'ModuleDefinitionFile': 'a_file_name', 'Name': 'a_file_name', 'OutputFile': 'a_file_name', 'RemoveObjects': 'file1;file2', 'SubSystem': 'Console', 'SuppressStartupBanner': 'true', 'TargetMachine': 'MachineX86i', 'TrackerLogDirectory': 'a_folder', 'TreatLibWarningAsErrors': 'true', 'UseUnicodeResponseFiles': 'true', 'Verbose': 'true'}, 'Manifest': { 'AdditionalManifestFiles': 'file1;file2', 'AdditionalOptions': 'a string1', 'AssemblyIdentity': 'a string1', 'ComponentFileName': 'a_file_name', 'EnableDPIAwareness': 'fal', 'GenerateCatalogFiles': 'truel', 'GenerateCategoryTags': 'true', 'InputResourceManifests': 'a string1', 'ManifestFromManagedAssembly': 'a_file_name', 'notgood3': 'bogus', 'OutputManifestFile': 'a_file_name', 'OutputResourceManifests': 'a string1', 'RegistrarScriptFile': 'a_file_name', 'ReplacementsFile': 'a_file_name', 'SuppressDependencyElement': 'true', 'SuppressStartupBanner': 'true', 'TrackerLogDirectory': 'a_folder', 'TypeLibraryFile': 'a_file_name', 'UpdateFileHashes': 'true', 'UpdateFileHashesSearchPath': 'a_file_name', 'VerboseOutput': 'true'}, 'ProjectReference': { 'LinkLibraryDependencies': 'true', 'UseLibraryDependencyInputs': 'true'}, 'ManifestResourceCompile': { 'ResourceOutputFileName': 'a_file_name'}, '': { 'EmbedManifest': 'true', 'GenerateManifest': 'true', 'IgnoreImportLibrary': 'true', 'LinkIncremental': 'false'}}, self.stderr) self._ExpectedWarnings([ 'Warning: unrecognized setting ClCompile/Enableprefast', 'Warning: unrecognized setting ClCompile/ZZXYZ', 'Warning: unrecognized setting Manifest/notgood3', 'Warning: for Manifest/GenerateCatalogFiles, ' "expected bool; got 'truel'", 'Warning: for Lib/TargetMachine, unrecognized enumerated value ' 'MachineX86i', "Warning: for Manifest/EnableDPIAwareness, expected bool; got 'fal'"]) def testConvertToMSBuildSettings_empty(self): """Tests an empty conversion.""" msvs_settings = {} expected_msbuild_settings = {} actual_msbuild_settings = MSVSSettings.ConvertToMSBuildSettings( msvs_settings, self.stderr) self.assertEqual(expected_msbuild_settings, actual_msbuild_settings) self._ExpectedWarnings([]) def testConvertToMSBuildSettings_minimal(self): """Tests a minimal conversion.""" msvs_settings = { 'VCCLCompilerTool': { 'AdditionalIncludeDirectories': 'dir1', 'AdditionalOptions': '/foo', 'BasicRuntimeChecks': '0', }, 'VCLinkerTool': { 'LinkTimeCodeGeneration': '1', 'ErrorReporting': '1', 'DataExecutionPrevention': '2', }, } expected_msbuild_settings = { 'ClCompile': { 'AdditionalIncludeDirectories': 'dir1', 'AdditionalOptions': '/foo', 'BasicRuntimeChecks': 'Default', }, 'Link': { 'LinkTimeCodeGeneration': 'UseLinkTimeCodeGeneration', 'LinkErrorReporting': 'PromptImmediately', 'DataExecutionPrevention': 'true', }, } actual_msbuild_settings = MSVSSettings.ConvertToMSBuildSettings( msvs_settings, self.stderr) self.assertEqual(expected_msbuild_settings, actual_msbuild_settings) self._ExpectedWarnings([]) def testConvertToMSBuildSettings_warnings(self): """Tests conversion that generates warnings.""" msvs_settings = { 'VCCLCompilerTool': { 'AdditionalIncludeDirectories': '1', 'AdditionalOptions': '2', # These are incorrect values: 'BasicRuntimeChecks': '12', 'BrowseInformation': '21', 'UsePrecompiledHeader': '13', 'GeneratePreprocessedFile': '14'}, 'VCLinkerTool': { # These are incorrect values: 'Driver': '10', 'LinkTimeCodeGeneration': '31', 'ErrorReporting': '21', 'FixedBaseAddress': '6'}, 'VCResourceCompilerTool': { # Custom 'Culture': '1003'}} expected_msbuild_settings = { 'ClCompile': { 'AdditionalIncludeDirectories': '1', 'AdditionalOptions': '2'}, 'Link': {}, 'ResourceCompile': { # Custom 'Culture': '0x03eb'}} actual_msbuild_settings = MSVSSettings.ConvertToMSBuildSettings( msvs_settings, self.stderr) self.assertEqual(expected_msbuild_settings, actual_msbuild_settings) self._ExpectedWarnings([ 'Warning: while converting VCCLCompilerTool/BasicRuntimeChecks to ' 'MSBuild, index value (12) not in expected range [0, 4)', 'Warning: while converting VCCLCompilerTool/BrowseInformation to ' 'MSBuild, index value (21) not in expected range [0, 3)', 'Warning: while converting VCCLCompilerTool/UsePrecompiledHeader to ' 'MSBuild, index value (13) not in expected range [0, 3)', 'Warning: while converting VCCLCompilerTool/GeneratePreprocessedFile to ' 'MSBuild, value must be one of [0, 1, 2]; got 14', 'Warning: while converting VCLinkerTool/Driver to ' 'MSBuild, index value (10) not in expected range [0, 4)', 'Warning: while converting VCLinkerTool/LinkTimeCodeGeneration to ' 'MSBuild, index value (31) not in expected range [0, 5)', 'Warning: while converting VCLinkerTool/ErrorReporting to ' 'MSBuild, index value (21) not in expected range [0, 3)', 'Warning: while converting VCLinkerTool/FixedBaseAddress to ' 'MSBuild, index value (6) not in expected range [0, 3)', ]) def testConvertToMSBuildSettings_full_synthetic(self): """Tests conversion of all the MSBuild settings.""" msvs_settings = { 'VCCLCompilerTool': { 'AdditionalIncludeDirectories': 'folder1;folder2;folder3', 'AdditionalOptions': 'a_string', 'AdditionalUsingDirectories': 'folder1;folder2;folder3', 'AssemblerListingLocation': 'a_file_name', 'AssemblerOutput': '0', 'BasicRuntimeChecks': '1', 'BrowseInformation': '2', 'BrowseInformationFile': 'a_file_name', 'BufferSecurityCheck': 'true', 'CallingConvention': '0', 'CompileAs': '1', 'DebugInformationFormat': '4', 'DefaultCharIsUnsigned': 'true', 'Detect64BitPortabilityProblems': 'true', 'DisableLanguageExtensions': 'true', 'DisableSpecificWarnings': 'd1;d2;d3', 'EnableEnhancedInstructionSet': '0', 'EnableFiberSafeOptimizations': 'true', 'EnableFunctionLevelLinking': 'true', 'EnableIntrinsicFunctions': 'true', 'EnablePREfast': 'true', 'ErrorReporting': '1', 'ExceptionHandling': '2', 'ExpandAttributedSource': 'true', 'FavorSizeOrSpeed': '0', 'FloatingPointExceptions': 'true', 'FloatingPointModel': '1', 'ForceConformanceInForLoopScope': 'true', 'ForcedIncludeFiles': 'file1;file2;file3', 'ForcedUsingFiles': 'file1;file2;file3', 'GeneratePreprocessedFile': '1', 'GenerateXMLDocumentationFiles': 'true', 'IgnoreStandardIncludePath': 'true', 'InlineFunctionExpansion': '2', 'KeepComments': 'true', 'MinimalRebuild': 'true', 'ObjectFile': 'a_file_name', 'OmitDefaultLibName': 'true', 'OmitFramePointers': 'true', 'OpenMP': 'true', 'Optimization': '3', 'PrecompiledHeaderFile': 'a_file_name', 'PrecompiledHeaderThrough': 'a_file_name', 'PreprocessorDefinitions': 'd1;d2;d3', 'ProgramDataBaseFileName': 'a_file_name', 'RuntimeLibrary': '0', 'RuntimeTypeInfo': 'true', 'ShowIncludes': 'true', 'SmallerTypeCheck': 'true', 'StringPooling': 'true', 'StructMemberAlignment': '1', 'SuppressStartupBanner': 'true', 'TreatWChar_tAsBuiltInType': 'true', 'UndefineAllPreprocessorDefinitions': 'true', 'UndefinePreprocessorDefinitions': 'd1;d2;d3', 'UseFullPaths': 'true', 'UsePrecompiledHeader': '1', 'UseUnicodeResponseFiles': 'true', 'WarnAsError': 'true', 'WarningLevel': '2', 'WholeProgramOptimization': 'true', 'XMLDocumentationFileName': 'a_file_name'}, 'VCLinkerTool': { 'AdditionalDependencies': 'file1;file2;file3', 'AdditionalLibraryDirectories': 'folder1;folder2;folder3', 'AdditionalLibraryDirectories_excluded': 'folder1;folder2;folder3', 'AdditionalManifestDependencies': 'file1;file2;file3', 'AdditionalOptions': 'a_string', 'AddModuleNamesToAssembly': 'file1;file2;file3', 'AllowIsolation': 'true', 'AssemblyDebug': '0', 'AssemblyLinkResource': 'file1;file2;file3', 'BaseAddress': 'a_string', 'CLRImageType': '1', 'CLRThreadAttribute': '2', 'CLRUnmanagedCodeCheck': 'true', 'DataExecutionPrevention': '0', 'DelayLoadDLLs': 'file1;file2;file3', 'DelaySign': 'true', 'Driver': '1', 'EmbedManagedResourceFile': 'file1;file2;file3', 'EnableCOMDATFolding': '0', 'EnableUAC': 'true', 'EntryPointSymbol': 'a_string', 'ErrorReporting': '0', 'FixedBaseAddress': '1', 'ForceSymbolReferences': 'file1;file2;file3', 'FunctionOrder': 'a_file_name', 'GenerateDebugInformation': 'true', 'GenerateManifest': 'true', 'GenerateMapFile': 'true', 'HeapCommitSize': 'a_string', 'HeapReserveSize': 'a_string', 'IgnoreAllDefaultLibraries': 'true', 'IgnoreDefaultLibraryNames': 'file1;file2;file3', 'IgnoreEmbeddedIDL': 'true', 'IgnoreImportLibrary': 'true', 'ImportLibrary': 'a_file_name', 'KeyContainer': 'a_file_name', 'KeyFile': 'a_file_name', 'LargeAddressAware': '2', 'LinkIncremental': '1', 'LinkLibraryDependencies': 'true', 'LinkTimeCodeGeneration': '2', 'ManifestFile': 'a_file_name', 'MapExports': 'true', 'MapFileName': 'a_file_name', 'MergedIDLBaseFileName': 'a_file_name', 'MergeSections': 'a_string', 'MidlCommandFile': 'a_file_name', 'ModuleDefinitionFile': 'a_file_name', 'OptimizeForWindows98': '1', 'OptimizeReferences': '0', 'OutputFile': 'a_file_name', 'PerUserRedirection': 'true', 'Profile': 'true', 'ProfileGuidedDatabase': 'a_file_name', 'ProgramDatabaseFile': 'a_file_name', 'RandomizedBaseAddress': '1', 'RegisterOutput': 'true', 'ResourceOnlyDLL': 'true', 'SetChecksum': 'true', 'ShowProgress': '0', 'StackCommitSize': 'a_string', 'StackReserveSize': 'a_string', 'StripPrivateSymbols': 'a_file_name', 'SubSystem': '2', 'SupportUnloadOfDelayLoadedDLL': 'true', 'SuppressStartupBanner': 'true', 'SwapRunFromCD': 'true', 'SwapRunFromNet': 'true', 'TargetMachine': '3', 'TerminalServerAware': '2', 'TurnOffAssemblyGeneration': 'true', 'TypeLibraryFile': 'a_file_name', 'TypeLibraryResourceID': '33', 'UACExecutionLevel': '1', 'UACUIAccess': 'true', 'UseLibraryDependencyInputs': 'false', 'UseUnicodeResponseFiles': 'true', 'Version': 'a_string'}, 'VCResourceCompilerTool': { 'AdditionalIncludeDirectories': 'folder1;folder2;folder3', 'AdditionalOptions': 'a_string', 'Culture': '1003', 'IgnoreStandardIncludePath': 'true', 'PreprocessorDefinitions': 'd1;d2;d3', 'ResourceOutputFileName': 'a_string', 'ShowProgress': 'true', 'SuppressStartupBanner': 'true', 'UndefinePreprocessorDefinitions': 'd1;d2;d3'}, 'VCMIDLTool': { 'AdditionalIncludeDirectories': 'folder1;folder2;folder3', 'AdditionalOptions': 'a_string', 'CPreprocessOptions': 'a_string', 'DefaultCharType': '0', 'DLLDataFileName': 'a_file_name', 'EnableErrorChecks': '2', 'ErrorCheckAllocations': 'true', 'ErrorCheckBounds': 'true', 'ErrorCheckEnumRange': 'true', 'ErrorCheckRefPointers': 'true', 'ErrorCheckStubData': 'true', 'GenerateStublessProxies': 'true', 'GenerateTypeLibrary': 'true', 'HeaderFileName': 'a_file_name', 'IgnoreStandardIncludePath': 'true', 'InterfaceIdentifierFileName': 'a_file_name', 'MkTypLibCompatible': 'true', 'OutputDirectory': 'a_string', 'PreprocessorDefinitions': 'd1;d2;d3', 'ProxyFileName': 'a_file_name', 'RedirectOutputAndErrors': 'a_file_name', 'StructMemberAlignment': '3', 'SuppressStartupBanner': 'true', 'TargetEnvironment': '1', 'TypeLibraryName': 'a_file_name', 'UndefinePreprocessorDefinitions': 'd1;d2;d3', 'ValidateParameters': 'true', 'WarnAsError': 'true', 'WarningLevel': '4'}, 'VCLibrarianTool': { 'AdditionalDependencies': 'file1;file2;file3', 'AdditionalLibraryDirectories': 'folder1;folder2;folder3', 'AdditionalLibraryDirectories_excluded': 'folder1;folder2;folder3', 'AdditionalOptions': 'a_string', 'ExportNamedFunctions': 'd1;d2;d3', 'ForceSymbolReferences': 'a_string', 'IgnoreAllDefaultLibraries': 'true', 'IgnoreSpecificDefaultLibraries': 'file1;file2;file3', 'LinkLibraryDependencies': 'true', 'ModuleDefinitionFile': 'a_file_name', 'OutputFile': 'a_file_name', 'SuppressStartupBanner': 'true', 'UseUnicodeResponseFiles': 'true'}, 'VCManifestTool': { 'AdditionalManifestFiles': 'file1;file2;file3', 'AdditionalOptions': 'a_string', 'AssemblyIdentity': 'a_string', 'ComponentFileName': 'a_file_name', 'DependencyInformationFile': 'a_file_name', 'EmbedManifest': 'true', 'GenerateCatalogFiles': 'true', 'InputResourceManifests': 'a_string', 'ManifestResourceFile': 'my_name', 'OutputManifestFile': 'a_file_name', 'RegistrarScriptFile': 'a_file_name', 'ReplacementsFile': 'a_file_name', 'SuppressStartupBanner': 'true', 'TypeLibraryFile': 'a_file_name', 'UpdateFileHashes': 'true', 'UpdateFileHashesSearchPath': 'a_file_name', 'UseFAT32Workaround': 'true', 'UseUnicodeResponseFiles': 'true', 'VerboseOutput': 'true'}} expected_msbuild_settings = { 'ClCompile': { 'AdditionalIncludeDirectories': 'folder1;folder2;folder3', 'AdditionalOptions': 'a_string /J', 'AdditionalUsingDirectories': 'folder1;folder2;folder3', 'AssemblerListingLocation': 'a_file_name', 'AssemblerOutput': 'NoListing', 'BasicRuntimeChecks': 'StackFrameRuntimeCheck', 'BrowseInformation': 'true', 'BrowseInformationFile': 'a_file_name', 'BufferSecurityCheck': 'true', 'CallingConvention': 'Cdecl', 'CompileAs': 'CompileAsC', 'DebugInformationFormat': 'EditAndContinue', 'DisableLanguageExtensions': 'true', 'DisableSpecificWarnings': 'd1;d2;d3', 'EnableEnhancedInstructionSet': 'NotSet', 'EnableFiberSafeOptimizations': 'true', 'EnablePREfast': 'true', 'ErrorReporting': 'Prompt', 'ExceptionHandling': 'Async', 'ExpandAttributedSource': 'true', 'FavorSizeOrSpeed': 'Neither', 'FloatingPointExceptions': 'true', 'FloatingPointModel': 'Strict', 'ForceConformanceInForLoopScope': 'true', 'ForcedIncludeFiles': 'file1;file2;file3', 'ForcedUsingFiles': 'file1;file2;file3', 'FunctionLevelLinking': 'true', 'GenerateXMLDocumentationFiles': 'true', 'IgnoreStandardIncludePath': 'true', 'InlineFunctionExpansion': 'AnySuitable', 'IntrinsicFunctions': 'true', 'MinimalRebuild': 'true', 'ObjectFileName': 'a_file_name', 'OmitDefaultLibName': 'true', 'OmitFramePointers': 'true', 'OpenMPSupport': 'true', 'Optimization': 'Full', 'PrecompiledHeader': 'Create', 'PrecompiledHeaderFile': 'a_file_name', 'PrecompiledHeaderOutputFile': 'a_file_name', 'PreprocessKeepComments': 'true', 'PreprocessorDefinitions': 'd1;d2;d3', 'PreprocessSuppressLineNumbers': 'false', 'PreprocessToFile': 'true', 'ProgramDataBaseFileName': 'a_file_name', 'RuntimeLibrary': 'MultiThreaded', 'RuntimeTypeInfo': 'true', 'ShowIncludes': 'true', 'SmallerTypeCheck': 'true', 'StringPooling': 'true', 'StructMemberAlignment': '1Byte', 'SuppressStartupBanner': 'true', 'TreatWarningAsError': 'true', 'TreatWChar_tAsBuiltInType': 'true', 'UndefineAllPreprocessorDefinitions': 'true', 'UndefinePreprocessorDefinitions': 'd1;d2;d3', 'UseFullPaths': 'true', 'WarningLevel': 'Level2', 'WholeProgramOptimization': 'true', 'XMLDocumentationFileName': 'a_file_name'}, 'Link': { 'AdditionalDependencies': 'file1;file2;file3', 'AdditionalLibraryDirectories': 'folder1;folder2;folder3', 'AdditionalManifestDependencies': 'file1;file2;file3', 'AdditionalOptions': 'a_string', 'AddModuleNamesToAssembly': 'file1;file2;file3', 'AllowIsolation': 'true', 'AssemblyDebug': '', 'AssemblyLinkResource': 'file1;file2;file3', 'BaseAddress': 'a_string', 'CLRImageType': 'ForceIJWImage', 'CLRThreadAttribute': 'STAThreadingAttribute', 'CLRUnmanagedCodeCheck': 'true', 'DataExecutionPrevention': '', 'DelayLoadDLLs': 'file1;file2;file3', 'DelaySign': 'true', 'Driver': 'Driver', 'EmbedManagedResourceFile': 'file1;file2;file3', 'EnableCOMDATFolding': '', 'EnableUAC': 'true', 'EntryPointSymbol': 'a_string', 'FixedBaseAddress': 'false', 'ForceSymbolReferences': 'file1;file2;file3', 'FunctionOrder': 'a_file_name', 'GenerateDebugInformation': 'true', 'GenerateMapFile': 'true', 'HeapCommitSize': 'a_string', 'HeapReserveSize': 'a_string', 'IgnoreAllDefaultLibraries': 'true', 'IgnoreEmbeddedIDL': 'true', 'IgnoreSpecificDefaultLibraries': 'file1;file2;file3', 'ImportLibrary': 'a_file_name', 'KeyContainer': 'a_file_name', 'KeyFile': 'a_file_name', 'LargeAddressAware': 'true', 'LinkErrorReporting': 'NoErrorReport', 'LinkTimeCodeGeneration': 'PGInstrument', 'ManifestFile': 'a_file_name', 'MapExports': 'true', 'MapFileName': 'a_file_name', 'MergedIDLBaseFileName': 'a_file_name', 'MergeSections': 'a_string', 'MidlCommandFile': 'a_file_name', 'ModuleDefinitionFile': 'a_file_name', 'NoEntryPoint': 'true', 'OptimizeReferences': '', 'OutputFile': 'a_file_name', 'PerUserRedirection': 'true', 'Profile': 'true', 'ProfileGuidedDatabase': 'a_file_name', 'ProgramDatabaseFile': 'a_file_name', 'RandomizedBaseAddress': 'false', 'RegisterOutput': 'true', 'SetChecksum': 'true', 'ShowProgress': 'NotSet', 'StackCommitSize': 'a_string', 'StackReserveSize': 'a_string', 'StripPrivateSymbols': 'a_file_name', 'SubSystem': 'Windows', 'SupportUnloadOfDelayLoadedDLL': 'true', 'SuppressStartupBanner': 'true', 'SwapRunFromCD': 'true', 'SwapRunFromNET': 'true', 'TargetMachine': 'MachineARM', 'TerminalServerAware': 'true', 'TurnOffAssemblyGeneration': 'true', 'TypeLibraryFile': 'a_file_name', 'TypeLibraryResourceID': '33', 'UACExecutionLevel': 'HighestAvailable', 'UACUIAccess': 'true', 'Version': 'a_string'}, 'ResourceCompile': { 'AdditionalIncludeDirectories': 'folder1;folder2;folder3', 'AdditionalOptions': 'a_string', 'Culture': '0x03eb', 'IgnoreStandardIncludePath': 'true', 'PreprocessorDefinitions': 'd1;d2;d3', 'ResourceOutputFileName': 'a_string', 'ShowProgress': 'true', 'SuppressStartupBanner': 'true', 'UndefinePreprocessorDefinitions': 'd1;d2;d3'}, 'Midl': { 'AdditionalIncludeDirectories': 'folder1;folder2;folder3', 'AdditionalOptions': 'a_string', 'CPreprocessOptions': 'a_string', 'DefaultCharType': 'Unsigned', 'DllDataFileName': 'a_file_name', 'EnableErrorChecks': 'All', 'ErrorCheckAllocations': 'true', 'ErrorCheckBounds': 'true', 'ErrorCheckEnumRange': 'true', 'ErrorCheckRefPointers': 'true', 'ErrorCheckStubData': 'true', 'GenerateStublessProxies': 'true', 'GenerateTypeLibrary': 'true', 'HeaderFileName': 'a_file_name', 'IgnoreStandardIncludePath': 'true', 'InterfaceIdentifierFileName': 'a_file_name', 'MkTypLibCompatible': 'true', 'OutputDirectory': 'a_string', 'PreprocessorDefinitions': 'd1;d2;d3', 'ProxyFileName': 'a_file_name', 'RedirectOutputAndErrors': 'a_file_name', 'StructMemberAlignment': '4', 'SuppressStartupBanner': 'true', 'TargetEnvironment': 'Win32', 'TypeLibraryName': 'a_file_name', 'UndefinePreprocessorDefinitions': 'd1;d2;d3', 'ValidateAllParameters': 'true', 'WarnAsError': 'true', 'WarningLevel': '4'}, 'Lib': { 'AdditionalDependencies': 'file1;file2;file3', 'AdditionalLibraryDirectories': 'folder1;folder2;folder3', 'AdditionalOptions': 'a_string', 'ExportNamedFunctions': 'd1;d2;d3', 'ForceSymbolReferences': 'a_string', 'IgnoreAllDefaultLibraries': 'true', 'IgnoreSpecificDefaultLibraries': 'file1;file2;file3', 'ModuleDefinitionFile': 'a_file_name', 'OutputFile': 'a_file_name', 'SuppressStartupBanner': 'true', 'UseUnicodeResponseFiles': 'true'}, 'Manifest': { 'AdditionalManifestFiles': 'file1;file2;file3', 'AdditionalOptions': 'a_string', 'AssemblyIdentity': 'a_string', 'ComponentFileName': 'a_file_name', 'GenerateCatalogFiles': 'true', 'InputResourceManifests': 'a_string', 'OutputManifestFile': 'a_file_name', 'RegistrarScriptFile': 'a_file_name', 'ReplacementsFile': 'a_file_name', 'SuppressStartupBanner': 'true', 'TypeLibraryFile': 'a_file_name', 'UpdateFileHashes': 'true', 'UpdateFileHashesSearchPath': 'a_file_name', 'VerboseOutput': 'true'}, 'ManifestResourceCompile': { 'ResourceOutputFileName': 'my_name'}, 'ProjectReference': { 'LinkLibraryDependencies': 'true', 'UseLibraryDependencyInputs': 'false'}, '': { 'EmbedManifest': 'true', 'GenerateManifest': 'true', 'IgnoreImportLibrary': 'true', 'LinkIncremental': 'false'}} actual_msbuild_settings = MSVSSettings.ConvertToMSBuildSettings( msvs_settings, self.stderr) self.assertEqual(expected_msbuild_settings, actual_msbuild_settings) self._ExpectedWarnings([]) def testConvertToMSBuildSettings_actual(self): """Tests the conversion of an actual project. A VS2008 project with most of the options defined was created through the VS2008 IDE. It was then converted to VS2010. The tool settings found in the .vcproj and .vcxproj files were converted to the two dictionaries msvs_settings and expected_msbuild_settings. Note that for many settings, the VS2010 converter adds macros like %(AdditionalIncludeDirectories) to make sure than inherited values are included. Since the Gyp projects we generate do not use inheritance, we removed these macros. They were: ClCompile: AdditionalIncludeDirectories: ';%(AdditionalIncludeDirectories)' AdditionalOptions: ' %(AdditionalOptions)' AdditionalUsingDirectories: ';%(AdditionalUsingDirectories)' DisableSpecificWarnings: ';%(DisableSpecificWarnings)', ForcedIncludeFiles: ';%(ForcedIncludeFiles)', ForcedUsingFiles: ';%(ForcedUsingFiles)', PreprocessorDefinitions: ';%(PreprocessorDefinitions)', UndefinePreprocessorDefinitions: ';%(UndefinePreprocessorDefinitions)', Link: AdditionalDependencies: ';%(AdditionalDependencies)', AdditionalLibraryDirectories: ';%(AdditionalLibraryDirectories)', AdditionalManifestDependencies: ';%(AdditionalManifestDependencies)', AdditionalOptions: ' %(AdditionalOptions)', AddModuleNamesToAssembly: ';%(AddModuleNamesToAssembly)', AssemblyLinkResource: ';%(AssemblyLinkResource)', DelayLoadDLLs: ';%(DelayLoadDLLs)', EmbedManagedResourceFile: ';%(EmbedManagedResourceFile)', ForceSymbolReferences: ';%(ForceSymbolReferences)', IgnoreSpecificDefaultLibraries: ';%(IgnoreSpecificDefaultLibraries)', ResourceCompile: AdditionalIncludeDirectories: ';%(AdditionalIncludeDirectories)', AdditionalOptions: ' %(AdditionalOptions)', PreprocessorDefinitions: ';%(PreprocessorDefinitions)', Manifest: AdditionalManifestFiles: ';%(AdditionalManifestFiles)', AdditionalOptions: ' %(AdditionalOptions)', InputResourceManifests: ';%(InputResourceManifests)', """ msvs_settings = { 'VCCLCompilerTool': { 'AdditionalIncludeDirectories': 'dir1', 'AdditionalOptions': '/more', 'AdditionalUsingDirectories': 'test', 'AssemblerListingLocation': '$(IntDir)\\a', 'AssemblerOutput': '1', 'BasicRuntimeChecks': '3', 'BrowseInformation': '1', 'BrowseInformationFile': '$(IntDir)\\e', 'BufferSecurityCheck': 'false', 'CallingConvention': '1', 'CompileAs': '1', 'DebugInformationFormat': '4', 'DefaultCharIsUnsigned': 'true', 'Detect64BitPortabilityProblems': 'true', 'DisableLanguageExtensions': 'true', 'DisableSpecificWarnings': 'abc', 'EnableEnhancedInstructionSet': '1', 'EnableFiberSafeOptimizations': 'true', 'EnableFunctionLevelLinking': 'true', 'EnableIntrinsicFunctions': 'true', 'EnablePREfast': 'true', 'ErrorReporting': '2', 'ExceptionHandling': '2', 'ExpandAttributedSource': 'true', 'FavorSizeOrSpeed': '2', 'FloatingPointExceptions': 'true', 'FloatingPointModel': '1', 'ForceConformanceInForLoopScope': 'false', 'ForcedIncludeFiles': 'def', 'ForcedUsingFiles': 'ge', 'GeneratePreprocessedFile': '2', 'GenerateXMLDocumentationFiles': 'true', 'IgnoreStandardIncludePath': 'true', 'InlineFunctionExpansion': '1', 'KeepComments': 'true', 'MinimalRebuild': 'true', 'ObjectFile': '$(IntDir)\\b', 'OmitDefaultLibName': 'true', 'OmitFramePointers': 'true', 'OpenMP': 'true', 'Optimization': '3', 'PrecompiledHeaderFile': '$(IntDir)\\$(TargetName).pche', 'PrecompiledHeaderThrough': 'StdAfx.hd', 'PreprocessorDefinitions': 'WIN32;_DEBUG;_CONSOLE', 'ProgramDataBaseFileName': '$(IntDir)\\vc90b.pdb', 'RuntimeLibrary': '3', 'RuntimeTypeInfo': 'false', 'ShowIncludes': 'true', 'SmallerTypeCheck': 'true', 'StringPooling': 'true', 'StructMemberAlignment': '3', 'SuppressStartupBanner': 'false', 'TreatWChar_tAsBuiltInType': 'false', 'UndefineAllPreprocessorDefinitions': 'true', 'UndefinePreprocessorDefinitions': 'wer', 'UseFullPaths': 'true', 'UsePrecompiledHeader': '0', 'UseUnicodeResponseFiles': 'false', 'WarnAsError': 'true', 'WarningLevel': '3', 'WholeProgramOptimization': 'true', 'XMLDocumentationFileName': '$(IntDir)\\c'}, 'VCLinkerTool': { 'AdditionalDependencies': 'zx', 'AdditionalLibraryDirectories': 'asd', 'AdditionalManifestDependencies': 's2', 'AdditionalOptions': '/mor2', 'AddModuleNamesToAssembly': 'd1', 'AllowIsolation': 'false', 'AssemblyDebug': '1', 'AssemblyLinkResource': 'd5', 'BaseAddress': '23423', 'CLRImageType': '3', 'CLRThreadAttribute': '1', 'CLRUnmanagedCodeCheck': 'true', 'DataExecutionPrevention': '0', 'DelayLoadDLLs': 'd4', 'DelaySign': 'true', 'Driver': '2', 'EmbedManagedResourceFile': 'd2', 'EnableCOMDATFolding': '1', 'EnableUAC': 'false', 'EntryPointSymbol': 'f5', 'ErrorReporting': '2', 'FixedBaseAddress': '1', 'ForceSymbolReferences': 'd3', 'FunctionOrder': 'fssdfsd', 'GenerateDebugInformation': 'true', 'GenerateManifest': 'false', 'GenerateMapFile': 'true', 'HeapCommitSize': '13', 'HeapReserveSize': '12', 'IgnoreAllDefaultLibraries': 'true', 'IgnoreDefaultLibraryNames': 'flob;flok', 'IgnoreEmbeddedIDL': 'true', 'IgnoreImportLibrary': 'true', 'ImportLibrary': 'f4', 'KeyContainer': 'f7', 'KeyFile': 'f6', 'LargeAddressAware': '2', 'LinkIncremental': '0', 'LinkLibraryDependencies': 'false', 'LinkTimeCodeGeneration': '1', 'ManifestFile': '$(IntDir)\\$(TargetFileName).2intermediate.manifest', 'MapExports': 'true', 'MapFileName': 'd5', 'MergedIDLBaseFileName': 'f2', 'MergeSections': 'f5', 'MidlCommandFile': 'f1', 'ModuleDefinitionFile': 'sdsd', 'OptimizeForWindows98': '2', 'OptimizeReferences': '2', 'OutputFile': '$(OutDir)\\$(ProjectName)2.exe', 'PerUserRedirection': 'true', 'Profile': 'true', 'ProfileGuidedDatabase': '$(TargetDir)$(TargetName).pgdd', 'ProgramDatabaseFile': 'Flob.pdb', 'RandomizedBaseAddress': '1', 'RegisterOutput': 'true', 'ResourceOnlyDLL': 'true', 'SetChecksum': 'false', 'ShowProgress': '1', 'StackCommitSize': '15', 'StackReserveSize': '14', 'StripPrivateSymbols': 'd3', 'SubSystem': '1', 'SupportUnloadOfDelayLoadedDLL': 'true', 'SuppressStartupBanner': 'false', 'SwapRunFromCD': 'true', 'SwapRunFromNet': 'true', 'TargetMachine': '1', 'TerminalServerAware': '1', 'TurnOffAssemblyGeneration': 'true', 'TypeLibraryFile': 'f3', 'TypeLibraryResourceID': '12', 'UACExecutionLevel': '2', 'UACUIAccess': 'true', 'UseLibraryDependencyInputs': 'true', 'UseUnicodeResponseFiles': 'false', 'Version': '333'}, 'VCResourceCompilerTool': { 'AdditionalIncludeDirectories': 'f3', 'AdditionalOptions': '/more3', 'Culture': '3084', 'IgnoreStandardIncludePath': 'true', 'PreprocessorDefinitions': '_UNICODE;UNICODE2', 'ResourceOutputFileName': '$(IntDir)/$(InputName)3.res', 'ShowProgress': 'true'}, 'VCManifestTool': { 'AdditionalManifestFiles': 'sfsdfsd', 'AdditionalOptions': 'afdsdafsd', 'AssemblyIdentity': 'sddfdsadfsa', 'ComponentFileName': 'fsdfds', 'DependencyInformationFile': '$(IntDir)\\mt.depdfd', 'EmbedManifest': 'false', 'GenerateCatalogFiles': 'true', 'InputResourceManifests': 'asfsfdafs', 'ManifestResourceFile': '$(IntDir)\\$(TargetFileName).embed.manifest.resfdsf', 'OutputManifestFile': '$(TargetPath).manifestdfs', 'RegistrarScriptFile': 'sdfsfd', 'ReplacementsFile': 'sdffsd', 'SuppressStartupBanner': 'false', 'TypeLibraryFile': 'sfsd', 'UpdateFileHashes': 'true', 'UpdateFileHashesSearchPath': 'sfsd', 'UseFAT32Workaround': 'true', 'UseUnicodeResponseFiles': 'false', 'VerboseOutput': 'true'}} expected_msbuild_settings = { 'ClCompile': { 'AdditionalIncludeDirectories': 'dir1', 'AdditionalOptions': '/more /J', 'AdditionalUsingDirectories': 'test', 'AssemblerListingLocation': '$(IntDir)a', 'AssemblerOutput': 'AssemblyCode', 'BasicRuntimeChecks': 'EnableFastChecks', 'BrowseInformation': 'true', 'BrowseInformationFile': '$(IntDir)e', 'BufferSecurityCheck': 'false', 'CallingConvention': 'FastCall', 'CompileAs': 'CompileAsC', 'DebugInformationFormat': 'EditAndContinue', 'DisableLanguageExtensions': 'true', 'DisableSpecificWarnings': 'abc', 'EnableEnhancedInstructionSet': 'StreamingSIMDExtensions', 'EnableFiberSafeOptimizations': 'true', 'EnablePREfast': 'true', 'ErrorReporting': 'Queue', 'ExceptionHandling': 'Async', 'ExpandAttributedSource': 'true', 'FavorSizeOrSpeed': 'Size', 'FloatingPointExceptions': 'true', 'FloatingPointModel': 'Strict', 'ForceConformanceInForLoopScope': 'false', 'ForcedIncludeFiles': 'def', 'ForcedUsingFiles': 'ge', 'FunctionLevelLinking': 'true', 'GenerateXMLDocumentationFiles': 'true', 'IgnoreStandardIncludePath': 'true', 'InlineFunctionExpansion': 'OnlyExplicitInline', 'IntrinsicFunctions': 'true', 'MinimalRebuild': 'true', 'ObjectFileName': '$(IntDir)b', 'OmitDefaultLibName': 'true', 'OmitFramePointers': 'true', 'OpenMPSupport': 'true', 'Optimization': 'Full', 'PrecompiledHeader': 'NotUsing', # Actual conversion gives '' 'PrecompiledHeaderFile': 'StdAfx.hd', 'PrecompiledHeaderOutputFile': '$(IntDir)$(TargetName).pche', 'PreprocessKeepComments': 'true', 'PreprocessorDefinitions': 'WIN32;_DEBUG;_CONSOLE', 'PreprocessSuppressLineNumbers': 'true', 'PreprocessToFile': 'true', 'ProgramDataBaseFileName': '$(IntDir)vc90b.pdb', 'RuntimeLibrary': 'MultiThreadedDebugDLL', 'RuntimeTypeInfo': 'false', 'ShowIncludes': 'true', 'SmallerTypeCheck': 'true', 'StringPooling': 'true', 'StructMemberAlignment': '4Bytes', 'SuppressStartupBanner': 'false', 'TreatWarningAsError': 'true', 'TreatWChar_tAsBuiltInType': 'false', 'UndefineAllPreprocessorDefinitions': 'true', 'UndefinePreprocessorDefinitions': 'wer', 'UseFullPaths': 'true', 'WarningLevel': 'Level3', 'WholeProgramOptimization': 'true', 'XMLDocumentationFileName': '$(IntDir)c'}, 'Link': { 'AdditionalDependencies': 'zx', 'AdditionalLibraryDirectories': 'asd', 'AdditionalManifestDependencies': 's2', 'AdditionalOptions': '/mor2', 'AddModuleNamesToAssembly': 'd1', 'AllowIsolation': 'false', 'AssemblyDebug': 'true', 'AssemblyLinkResource': 'd5', 'BaseAddress': '23423', 'CLRImageType': 'ForceSafeILImage', 'CLRThreadAttribute': 'MTAThreadingAttribute', 'CLRUnmanagedCodeCheck': 'true', 'DataExecutionPrevention': '', 'DelayLoadDLLs': 'd4', 'DelaySign': 'true', 'Driver': 'UpOnly', 'EmbedManagedResourceFile': 'd2', 'EnableCOMDATFolding': 'false', 'EnableUAC': 'false', 'EntryPointSymbol': 'f5', 'FixedBaseAddress': 'false', 'ForceSymbolReferences': 'd3', 'FunctionOrder': 'fssdfsd', 'GenerateDebugInformation': 'true', 'GenerateMapFile': 'true', 'HeapCommitSize': '13', 'HeapReserveSize': '12', 'IgnoreAllDefaultLibraries': 'true', 'IgnoreEmbeddedIDL': 'true', 'IgnoreSpecificDefaultLibraries': 'flob;flok', 'ImportLibrary': 'f4', 'KeyContainer': 'f7', 'KeyFile': 'f6', 'LargeAddressAware': 'true', 'LinkErrorReporting': 'QueueForNextLogin', 'LinkTimeCodeGeneration': 'UseLinkTimeCodeGeneration', 'ManifestFile': '$(IntDir)$(TargetFileName).2intermediate.manifest', 'MapExports': 'true', 'MapFileName': 'd5', 'MergedIDLBaseFileName': 'f2', 'MergeSections': 'f5', 'MidlCommandFile': 'f1', 'ModuleDefinitionFile': 'sdsd', 'NoEntryPoint': 'true', 'OptimizeReferences': 'true', 'OutputFile': '$(OutDir)$(ProjectName)2.exe', 'PerUserRedirection': 'true', 'Profile': 'true', 'ProfileGuidedDatabase': '$(TargetDir)$(TargetName).pgdd', 'ProgramDatabaseFile': 'Flob.pdb', 'RandomizedBaseAddress': 'false', 'RegisterOutput': 'true', 'SetChecksum': 'false', 'ShowProgress': 'LinkVerbose', 'StackCommitSize': '15', 'StackReserveSize': '14', 'StripPrivateSymbols': 'd3', 'SubSystem': 'Console', 'SupportUnloadOfDelayLoadedDLL': 'true', 'SuppressStartupBanner': 'false', 'SwapRunFromCD': 'true', 'SwapRunFromNET': 'true', 'TargetMachine': 'MachineX86', 'TerminalServerAware': 'false', 'TurnOffAssemblyGeneration': 'true', 'TypeLibraryFile': 'f3', 'TypeLibraryResourceID': '12', 'UACExecutionLevel': 'RequireAdministrator', 'UACUIAccess': 'true', 'Version': '333'}, 'ResourceCompile': { 'AdditionalIncludeDirectories': 'f3', 'AdditionalOptions': '/more3', 'Culture': '0x0c0c', 'IgnoreStandardIncludePath': 'true', 'PreprocessorDefinitions': '_UNICODE;UNICODE2', 'ResourceOutputFileName': '$(IntDir)%(Filename)3.res', 'ShowProgress': 'true'}, 'Manifest': { 'AdditionalManifestFiles': 'sfsdfsd', 'AdditionalOptions': 'afdsdafsd', 'AssemblyIdentity': 'sddfdsadfsa', 'ComponentFileName': 'fsdfds', 'GenerateCatalogFiles': 'true', 'InputResourceManifests': 'asfsfdafs', 'OutputManifestFile': '$(TargetPath).manifestdfs', 'RegistrarScriptFile': 'sdfsfd', 'ReplacementsFile': 'sdffsd', 'SuppressStartupBanner': 'false', 'TypeLibraryFile': 'sfsd', 'UpdateFileHashes': 'true', 'UpdateFileHashesSearchPath': 'sfsd', 'VerboseOutput': 'true'}, 'ProjectReference': { 'LinkLibraryDependencies': 'false', 'UseLibraryDependencyInputs': 'true'}, '': { 'EmbedManifest': 'false', 'GenerateManifest': 'false', 'IgnoreImportLibrary': 'true', 'LinkIncremental': '' }, 'ManifestResourceCompile': { 'ResourceOutputFileName': '$(IntDir)$(TargetFileName).embed.manifest.resfdsf'} } actual_msbuild_settings = MSVSSettings.ConvertToMSBuildSettings( msvs_settings, self.stderr) self.assertEqual(expected_msbuild_settings, actual_msbuild_settings) self._ExpectedWarnings([]) if __name__ == '__main__': unittest.main()
mit
RichDijk/eXe
twisted/spread/refpath.py
20
2880
# Copyright (c) 2001-2004 Twisted Matrix Laboratories. # See LICENSE for details. __version__ = "$Revision: 1.17 $"[11:-2] """ Path-based references for PB, and other reference-based protocols. Maintainer: U{Glyph Lefkowitz<mailto:glyph@twistedmatrix.com>} Stability: semi-stable Future Plans: None at this point besides a final overview and finalization pass. """ from twisted.python import log from flavors import Referenceable, Viewable from copy import copy import os ### "Server"-side objects class PathReferenceContext: def __init__(self, path, root): self.metadata = {} self.path = path self.root = root def __setitem__(self, key, item): self.metadata[key] = item def __getitem__(self, key): return self.metadata[key] def getObject(self): o = self.root for p in self.path: o = o.getChild(p, self) return o class PathReference: def __init__(self): self.children = {} def getChild(self, child, ctx): return self.children[child] class PathReferenceDirectory(Referenceable): def __init__(self, root, prefix="remote"): self.root = root self.prefix = prefix def remote_callPath(self, path, name, *args, **kw): ctx = PathReferenceContext(path, self) obj = ctx.getObject() return apply(getattr(obj, "%s_%s" % (self.prefix, name)), args, kw) class PathReferenceContextDirectory(Referenceable): def __init__(self, root, prefix="remote"): self.root = root self.prefix = prefix def remote_callPath(self, path, name, *args, **kw): ctx = PathReferenceContext(path, self) obj = ctx.getObject() return apply(getattr(obj, "%s_%s" % (self.prefix, name)), (ctx,)+args, kw) class PathViewDirectory(Viewable): def __init__(self, root, prefix="view"): self.root = root self.prefix = prefix def view_callPath(self, perspective, path, name, *args, **kw): ctx = PathReferenceContext(path, self) obj = ctx.getObject() return apply(getattr(obj, "%s_%s" % (self.prefix, name)), (perspective,)+args, kw) class PathViewContextDirectory(Viewable): def __init__(self, root, prefix="view"): self.root = root self.prefix = prefix def view_callPath(self, perspective, path, name, *args, **kw): ctx = PathReferenceContext(path, self) obj = ctx.getObject() return apply(getattr(obj, "%s_%s" % (self.prefix, name)), (perspective,ctx)+args, kw) ### "Client"-side objects class RemotePathReference: def __init__(self, ref, path): self.ref = ref self.path = path def callRemote(self, name, *args, **kw): apply(self.ref.callRemote, ("callPath", self.path, name)+args, kw)
gpl-2.0
badbear1727/E120LKERNEL
tools/perf/scripts/python/Perf-Trace-Util/lib/Perf/Trace/SchedGui.py
12980
5411
# SchedGui.py - Python extension for perf script, basic GUI code for # traces drawing and overview. # # Copyright (C) 2010 by Frederic Weisbecker <fweisbec@gmail.com> # # This software is distributed under the terms of the GNU General # Public License ("GPL") version 2 as published by the Free Software # Foundation. try: import wx except ImportError: raise ImportError, "You need to install the wxpython lib for this script" class RootFrame(wx.Frame): Y_OFFSET = 100 RECT_HEIGHT = 100 RECT_SPACE = 50 EVENT_MARKING_WIDTH = 5 def __init__(self, sched_tracer, title, parent = None, id = -1): wx.Frame.__init__(self, parent, id, title) (self.screen_width, self.screen_height) = wx.GetDisplaySize() self.screen_width -= 10 self.screen_height -= 10 self.zoom = 0.5 self.scroll_scale = 20 self.sched_tracer = sched_tracer self.sched_tracer.set_root_win(self) (self.ts_start, self.ts_end) = sched_tracer.interval() self.update_width_virtual() self.nr_rects = sched_tracer.nr_rectangles() + 1 self.height_virtual = RootFrame.Y_OFFSET + (self.nr_rects * (RootFrame.RECT_HEIGHT + RootFrame.RECT_SPACE)) # whole window panel self.panel = wx.Panel(self, size=(self.screen_width, self.screen_height)) # scrollable container self.scroll = wx.ScrolledWindow(self.panel) self.scroll.SetScrollbars(self.scroll_scale, self.scroll_scale, self.width_virtual / self.scroll_scale, self.height_virtual / self.scroll_scale) self.scroll.EnableScrolling(True, True) self.scroll.SetFocus() # scrollable drawing area self.scroll_panel = wx.Panel(self.scroll, size=(self.screen_width - 15, self.screen_height / 2)) self.scroll_panel.Bind(wx.EVT_PAINT, self.on_paint) self.scroll_panel.Bind(wx.EVT_KEY_DOWN, self.on_key_press) self.scroll_panel.Bind(wx.EVT_LEFT_DOWN, self.on_mouse_down) self.scroll.Bind(wx.EVT_PAINT, self.on_paint) self.scroll.Bind(wx.EVT_KEY_DOWN, self.on_key_press) self.scroll.Bind(wx.EVT_LEFT_DOWN, self.on_mouse_down) self.scroll.Fit() self.Fit() self.scroll_panel.SetDimensions(-1, -1, self.width_virtual, self.height_virtual, wx.SIZE_USE_EXISTING) self.txt = None self.Show(True) def us_to_px(self, val): return val / (10 ** 3) * self.zoom def px_to_us(self, val): return (val / self.zoom) * (10 ** 3) def scroll_start(self): (x, y) = self.scroll.GetViewStart() return (x * self.scroll_scale, y * self.scroll_scale) def scroll_start_us(self): (x, y) = self.scroll_start() return self.px_to_us(x) def paint_rectangle_zone(self, nr, color, top_color, start, end): offset_px = self.us_to_px(start - self.ts_start) width_px = self.us_to_px(end - self.ts_start) offset_py = RootFrame.Y_OFFSET + (nr * (RootFrame.RECT_HEIGHT + RootFrame.RECT_SPACE)) width_py = RootFrame.RECT_HEIGHT dc = self.dc if top_color is not None: (r, g, b) = top_color top_color = wx.Colour(r, g, b) brush = wx.Brush(top_color, wx.SOLID) dc.SetBrush(brush) dc.DrawRectangle(offset_px, offset_py, width_px, RootFrame.EVENT_MARKING_WIDTH) width_py -= RootFrame.EVENT_MARKING_WIDTH offset_py += RootFrame.EVENT_MARKING_WIDTH (r ,g, b) = color color = wx.Colour(r, g, b) brush = wx.Brush(color, wx.SOLID) dc.SetBrush(brush) dc.DrawRectangle(offset_px, offset_py, width_px, width_py) def update_rectangles(self, dc, start, end): start += self.ts_start end += self.ts_start self.sched_tracer.fill_zone(start, end) def on_paint(self, event): dc = wx.PaintDC(self.scroll_panel) self.dc = dc width = min(self.width_virtual, self.screen_width) (x, y) = self.scroll_start() start = self.px_to_us(x) end = self.px_to_us(x + width) self.update_rectangles(dc, start, end) def rect_from_ypixel(self, y): y -= RootFrame.Y_OFFSET rect = y / (RootFrame.RECT_HEIGHT + RootFrame.RECT_SPACE) height = y % (RootFrame.RECT_HEIGHT + RootFrame.RECT_SPACE) if rect < 0 or rect > self.nr_rects - 1 or height > RootFrame.RECT_HEIGHT: return -1 return rect def update_summary(self, txt): if self.txt: self.txt.Destroy() self.txt = wx.StaticText(self.panel, -1, txt, (0, (self.screen_height / 2) + 50)) def on_mouse_down(self, event): (x, y) = event.GetPositionTuple() rect = self.rect_from_ypixel(y) if rect == -1: return t = self.px_to_us(x) + self.ts_start self.sched_tracer.mouse_down(rect, t) def update_width_virtual(self): self.width_virtual = self.us_to_px(self.ts_end - self.ts_start) def __zoom(self, x): self.update_width_virtual() (xpos, ypos) = self.scroll.GetViewStart() xpos = self.us_to_px(x) / self.scroll_scale self.scroll.SetScrollbars(self.scroll_scale, self.scroll_scale, self.width_virtual / self.scroll_scale, self.height_virtual / self.scroll_scale, xpos, ypos) self.Refresh() def zoom_in(self): x = self.scroll_start_us() self.zoom *= 2 self.__zoom(x) def zoom_out(self): x = self.scroll_start_us() self.zoom /= 2 self.__zoom(x) def on_key_press(self, event): key = event.GetRawKeyCode() if key == ord("+"): self.zoom_in() return if key == ord("-"): self.zoom_out() return key = event.GetKeyCode() (x, y) = self.scroll.GetViewStart() if key == wx.WXK_RIGHT: self.scroll.Scroll(x + 1, y) elif key == wx.WXK_LEFT: self.scroll.Scroll(x - 1, y) elif key == wx.WXK_DOWN: self.scroll.Scroll(x, y + 1) elif key == wx.WXK_UP: self.scroll.Scroll(x, y - 1)
gpl-2.0
elkingtonmcb/django
tests/template_tests/filter_tests/test_urlize.py
109
14303
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.template.defaultfilters import urlize from django.test import SimpleTestCase from django.utils.safestring import mark_safe from ..utils import setup class UrlizeTests(SimpleTestCase): @setup({'urlize01': '{% autoescape off %}{{ a|urlize }} {{ b|urlize }}{% endautoescape %}'}) def test_urlize01(self): output = self.engine.render_to_string( 'urlize01', {'a': 'http://example.com/?x=&y=', 'b': mark_safe('http://example.com?x=&amp;y=&lt;2&gt;')}, ) self.assertEqual( output, '<a href="http://example.com/?x=&amp;y=" rel="nofollow">http://example.com/?x=&y=</a> ' '<a href="http://example.com?x=&amp;y=%3C2%3E" rel="nofollow">http://example.com?x=&amp;y=&lt;2&gt;</a>' ) @setup({'urlize02': '{{ a|urlize }} {{ b|urlize }}'}) def test_urlize02(self): output = self.engine.render_to_string( 'urlize02', {'a': "http://example.com/?x=&y=", 'b': mark_safe("http://example.com?x=&amp;y=")}, ) self.assertEqual( output, '<a href="http://example.com/?x=&amp;y=" rel="nofollow">http://example.com/?x=&amp;y=</a> ' '<a href="http://example.com?x=&amp;y=" rel="nofollow">http://example.com?x=&amp;y=</a>' ) @setup({'urlize03': '{% autoescape off %}{{ a|urlize }}{% endautoescape %}'}) def test_urlize03(self): output = self.engine.render_to_string('urlize03', {'a': mark_safe("a &amp; b")}) self.assertEqual(output, 'a &amp; b') @setup({'urlize04': '{{ a|urlize }}'}) def test_urlize04(self): output = self.engine.render_to_string('urlize04', {'a': mark_safe("a &amp; b")}) self.assertEqual(output, 'a &amp; b') # This will lead to a nonsense result, but at least it won't be # exploitable for XSS purposes when auto-escaping is on. @setup({'urlize05': '{% autoescape off %}{{ a|urlize }}{% endautoescape %}'}) def test_urlize05(self): output = self.engine.render_to_string('urlize05', {'a': "<script>alert('foo')</script>"}) self.assertEqual(output, "<script>alert('foo')</script>") @setup({'urlize06': '{{ a|urlize }}'}) def test_urlize06(self): output = self.engine.render_to_string('urlize06', {'a': "<script>alert('foo')</script>"}) self.assertEqual(output, '&lt;script&gt;alert(&#39;foo&#39;)&lt;/script&gt;') # mailto: testing for urlize @setup({'urlize07': '{{ a|urlize }}'}) def test_urlize07(self): output = self.engine.render_to_string('urlize07', {'a': "Email me at me@example.com"}) self.assertEqual( output, 'Email me at <a href="mailto:me@example.com">me@example.com</a>', ) @setup({'urlize08': '{{ a|urlize }}'}) def test_urlize08(self): output = self.engine.render_to_string('urlize08', {'a': "Email me at <me@example.com>"}) self.assertEqual( output, 'Email me at &lt;<a href="mailto:me@example.com">me@example.com</a>&gt;', ) @setup({'urlize09': '{% autoescape off %}{{ a|urlize }}{% endautoescape %}'}) def test_urlize09(self): output = self.engine.render_to_string('urlize09', {'a': "http://example.com/?x=&amp;y=&lt;2&gt;"}) self.assertEqual( output, '<a href="http://example.com/?x=&amp;y=%3C2%3E" rel="nofollow">http://example.com/?x=&amp;y=&lt;2&gt;</a>', ) class FunctionTests(SimpleTestCase): def test_urls(self): self.assertEqual( urlize('http://google.com'), '<a href="http://google.com" rel="nofollow">http://google.com</a>', ) self.assertEqual( urlize('http://google.com/'), '<a href="http://google.com/" rel="nofollow">http://google.com/</a>', ) self.assertEqual( urlize('www.google.com'), '<a href="http://www.google.com" rel="nofollow">www.google.com</a>', ) self.assertEqual( urlize('djangoproject.org'), '<a href="http://djangoproject.org" rel="nofollow">djangoproject.org</a>', ) self.assertEqual( urlize('djangoproject.org/'), '<a href="http://djangoproject.org/" rel="nofollow">djangoproject.org/</a>', ) def test_url_split_chars(self): # Quotes (single and double) and angle brackets shouldn't be considered # part of URLs. self.assertEqual( urlize('www.server.com"abc'), '<a href="http://www.server.com" rel="nofollow">www.server.com</a>&quot;abc', ) self.assertEqual( urlize('www.server.com\'abc'), '<a href="http://www.server.com" rel="nofollow">www.server.com</a>&#39;abc', ) self.assertEqual( urlize('www.server.com<abc'), '<a href="http://www.server.com" rel="nofollow">www.server.com</a>&lt;abc', ) self.assertEqual( urlize('www.server.com>abc'), '<a href="http://www.server.com" rel="nofollow">www.server.com</a>&gt;abc', ) def test_email(self): self.assertEqual( urlize('info@djangoproject.org'), '<a href="mailto:info@djangoproject.org">info@djangoproject.org</a>', ) def test_word_with_dot(self): self.assertEqual(urlize('some.organization'), 'some.organization'), def test_https(self): self.assertEqual( urlize('https://google.com'), '<a href="https://google.com" rel="nofollow">https://google.com</a>', ) def test_quoting(self): """ #9655 - Check urlize doesn't overquote already quoted urls. The teststring is the urlquoted version of 'http://hi.baidu.com/重新开始' """ self.assertEqual( urlize('http://hi.baidu.com/%E9%87%8D%E6%96%B0%E5%BC%80%E5%A7%8B'), '<a href="http://hi.baidu.com/%E9%87%8D%E6%96%B0%E5%BC%80%E5%A7%8B" rel="nofollow">' 'http://hi.baidu.com/%E9%87%8D%E6%96%B0%E5%BC%80%E5%A7%8B</a>', ) def test_urlencoded(self): self.assertEqual( urlize('www.mystore.com/30%OffCoupons!'), '<a href="http://www.mystore.com/30%25OffCoupons" rel="nofollow">' 'www.mystore.com/30%OffCoupons</a>!', ) self.assertEqual( urlize('https://en.wikipedia.org/wiki/Caf%C3%A9'), '<a href="https://en.wikipedia.org/wiki/Caf%C3%A9" rel="nofollow">' 'https://en.wikipedia.org/wiki/Caf%C3%A9</a>', ) def test_unicode(self): self.assertEqual( urlize('https://en.wikipedia.org/wiki/Café'), '<a href="https://en.wikipedia.org/wiki/Caf%C3%A9" rel="nofollow">' 'https://en.wikipedia.org/wiki/Café</a>', ) def test_parenthesis(self): """ #11911 - Check urlize keeps balanced parentheses """ self.assertEqual( urlize('https://en.wikipedia.org/wiki/Django_(web_framework)'), '<a href="https://en.wikipedia.org/wiki/Django_(web_framework)" rel="nofollow">' 'https://en.wikipedia.org/wiki/Django_(web_framework)</a>', ) self.assertEqual( urlize('(see https://en.wikipedia.org/wiki/Django_(web_framework))'), '(see <a href="https://en.wikipedia.org/wiki/Django_(web_framework)" rel="nofollow">' 'https://en.wikipedia.org/wiki/Django_(web_framework)</a>)', ) def test_nofollow(self): """ #12183 - Check urlize adds nofollow properly - see #12183 """ self.assertEqual( urlize('foo@bar.com or www.bar.com'), '<a href="mailto:foo@bar.com">foo@bar.com</a> or ' '<a href="http://www.bar.com" rel="nofollow">www.bar.com</a>', ) def test_idn(self): """ #13704 - Check urlize handles IDN correctly """ self.assertEqual(urlize('http://c✶.ws'), '<a href="http://xn--c-lgq.ws" rel="nofollow">http://c✶.ws</a>') self.assertEqual(urlize('www.c✶.ws'), '<a href="http://www.xn--c-lgq.ws" rel="nofollow">www.c✶.ws</a>') self.assertEqual(urlize('c✶.org'), '<a href="http://xn--c-lgq.org" rel="nofollow">c✶.org</a>') self.assertEqual(urlize('info@c✶.org'), '<a href="mailto:info@xn--c-lgq.org">info@c✶.org</a>') def test_malformed(self): """ #16395 - Check urlize doesn't highlight malformed URIs """ self.assertEqual(urlize('http:///www.google.com'), 'http:///www.google.com') self.assertEqual(urlize('http://.google.com'), 'http://.google.com') self.assertEqual(urlize('http://@foo.com'), 'http://@foo.com') def test_tlds(self): """ #16656 - Check urlize accepts more TLDs """ self.assertEqual(urlize('usa.gov'), '<a href="http://usa.gov" rel="nofollow">usa.gov</a>') def test_invalid_email(self): """ #17592 - Check urlize don't crash on invalid email with dot-starting domain """ self.assertEqual(urlize('email@.stream.ru'), 'email@.stream.ru') def test_uppercase(self): """ #18071 - Check urlize accepts uppercased URL schemes """ self.assertEqual( urlize('HTTPS://github.com/'), '<a href="https://github.com/" rel="nofollow">HTTPS://github.com/</a>', ) def test_trailing_period(self): """ #18644 - Check urlize trims trailing period when followed by parenthesis """ self.assertEqual( urlize('(Go to http://www.example.com/foo.)'), '(Go to <a href="http://www.example.com/foo" rel="nofollow">http://www.example.com/foo</a>.)', ) def test_brackets(self): """ #19070 - Check urlize handles brackets properly """ self.assertEqual( urlize('[see www.example.com]'), '[see <a href="http://www.example.com" rel="nofollow">www.example.com</a>]', ) self.assertEqual( urlize('see test[at[example.com'), 'see <a href="http://test[at[example.com" rel="nofollow">test[at[example.com</a>', ) self.assertEqual( urlize('[http://168.192.0.1](http://168.192.0.1)'), '[<a href="http://168.192.0.1](http://168.192.0.1)" rel="nofollow">' 'http://168.192.0.1](http://168.192.0.1)</a>', ) def test_ipv4(self): self.assertEqual( urlize('http://192.168.0.15/api/9'), '<a href="http://192.168.0.15/api/9" rel="nofollow">http://192.168.0.15/api/9</a>', ) def test_ipv6(self): self.assertEqual( urlize('http://[2001:db8:cafe::2]/api/9'), '<a href="http://[2001:db8:cafe::2]/api/9" rel="nofollow">http://[2001:db8:cafe::2]/api/9</a>', ) def test_quotation_marks(self): """ #20364 - Check urlize correctly include quotation marks in links """ self.assertEqual( urlize('before "hi@example.com" afterwards', autoescape=False), 'before "<a href="mailto:hi@example.com">hi@example.com</a>" afterwards', ) self.assertEqual( urlize('before hi@example.com" afterwards', autoescape=False), 'before <a href="mailto:hi@example.com">hi@example.com</a>" afterwards', ) self.assertEqual( urlize('before "hi@example.com afterwards', autoescape=False), 'before "<a href="mailto:hi@example.com">hi@example.com</a> afterwards', ) self.assertEqual( urlize('before \'hi@example.com\' afterwards', autoescape=False), 'before \'<a href="mailto:hi@example.com">hi@example.com</a>\' afterwards', ) self.assertEqual( urlize('before hi@example.com\' afterwards', autoescape=False), 'before <a href="mailto:hi@example.com">hi@example.com</a>\' afterwards', ) self.assertEqual( urlize('before \'hi@example.com afterwards', autoescape=False), 'before \'<a href="mailto:hi@example.com">hi@example.com</a> afterwards', ) def test_quote_commas(self): """ #20364 - Check urlize copes with commas following URLs in quotes """ self.assertEqual( urlize('Email us at "hi@example.com", or phone us at +xx.yy', autoescape=False), 'Email us at "<a href="mailto:hi@example.com">hi@example.com</a>", or phone us at +xx.yy', ) def test_exclamation_marks(self): """ #23715 - Check urlize correctly handles exclamation marks after TLDs or query string """ self.assertEqual( urlize('Go to djangoproject.com! and enjoy.'), 'Go to <a href="http://djangoproject.com" rel="nofollow">djangoproject.com</a>! and enjoy.', ) self.assertEqual( urlize('Search for google.com/?q=! and see.'), 'Search for <a href="http://google.com/?q=" rel="nofollow">google.com/?q=</a>! and see.', ) self.assertEqual( urlize('Search for google.com/?q=dj!`? and see.'), 'Search for <a href="http://google.com/?q=dj%21%60%3F" rel="nofollow">google.com/?q=dj!`?</a> and see.', ) self.assertEqual( urlize('Search for google.com/?q=dj!`?! and see.'), 'Search for <a href="http://google.com/?q=dj%21%60%3F" rel="nofollow">google.com/?q=dj!`?</a>! and see.', ) def test_non_string_input(self): self.assertEqual(urlize(123), '123') def test_autoescape(self): self.assertEqual( urlize('foo<a href=" google.com ">bar</a>buz'), 'foo&lt;a href=&quot; <a href="http://google.com" rel="nofollow">google.com</a> &quot;&gt;bar&lt;/a&gt;buz' ) def test_autoescape_off(self): self.assertEqual( urlize('foo<a href=" google.com ">bar</a>buz', autoescape=False), 'foo<a href=" <a href="http://google.com" rel="nofollow">google.com</a> ">bar</a>buz', )
bsd-3-clause
jhseu/tensorflow
tensorflow/lite/python/tflite_convert_test.py
4
14396
# Copyright 2019 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Tests for tflite_convert.py.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import os import numpy as np from tensorflow.lite.python import tflite_convert from tensorflow.python import keras from tensorflow.python import tf2 from tensorflow.python.client import session from tensorflow.python.eager import def_function from tensorflow.python.framework import constant_op from tensorflow.python.framework import dtypes from tensorflow.python.framework import ops from tensorflow.python.framework import test_util from tensorflow.python.ops import array_ops from tensorflow.python.ops import random_ops from tensorflow.python.platform import gfile from tensorflow.python.platform import resource_loader from tensorflow.python.platform import test from tensorflow.python.saved_model import saved_model from tensorflow.python.saved_model.save import save from tensorflow.python.training.tracking import tracking from tensorflow.python.training.training_util import write_graph class TestModels(test_util.TensorFlowTestCase): def _getFilepath(self, filename): return os.path.join(self.get_temp_dir(), filename) def _run(self, flags_str, should_succeed): output_file = os.path.join(self.get_temp_dir(), 'model.tflite') tflite_bin = resource_loader.get_path_to_datafile('tflite_convert') cmdline = '{0} --output_file={1} {2}'.format(tflite_bin, output_file, flags_str) exitcode = os.system(cmdline) if exitcode == 0: with gfile.Open(output_file, 'rb') as model_file: content = model_file.read() self.assertEqual(content is not None, should_succeed) os.remove(output_file) else: self.assertFalse(should_succeed) def _getKerasModelFile(self): x = np.array([[1.], [2.]]) y = np.array([[2.], [4.]]) model = keras.models.Sequential([ keras.layers.Dropout(0.2, input_shape=(1,)), keras.layers.Dense(1), ]) model.compile(optimizer='sgd', loss='mean_squared_error') model.fit(x, y, epochs=1) keras_file = self._getFilepath('model.h5') keras.models.save_model(model, keras_file) return keras_file class TfLiteConvertV1Test(TestModels): def _run(self, flags_str, should_succeed): if tf2.enabled(): flags_str += ' --enable_v1_converter' super(TfLiteConvertV1Test, self)._run(flags_str, should_succeed) def testFrozenGraphDef(self): with ops.Graph().as_default(): in_tensor = array_ops.placeholder( shape=[1, 16, 16, 3], dtype=dtypes.float32) _ = in_tensor + in_tensor sess = session.Session() # Write graph to file. graph_def_file = self._getFilepath('model.pb') write_graph(sess.graph_def, '', graph_def_file, False) sess.close() flags_str = ('--graph_def_file={0} --input_arrays={1} ' '--output_arrays={2}'.format(graph_def_file, 'Placeholder', 'add')) self._run(flags_str, should_succeed=True) os.remove(graph_def_file) # Run `tflite_convert` explicitly with the legacy converter. # Before the new converter is enabled by default, this flag has no real # effects. def testFrozenGraphDefWithLegacyConverter(self): with ops.Graph().as_default(): in_tensor = array_ops.placeholder( shape=[1, 16, 16, 3], dtype=dtypes.float32) _ = in_tensor + in_tensor sess = session.Session() # Write graph to file. graph_def_file = self._getFilepath('model.pb') write_graph(sess.graph_def, '', graph_def_file, False) sess.close() flags_str = ( '--graph_def_file={0} --input_arrays={1} ' '--output_arrays={2} --experimental_new_converter=false'.format( graph_def_file, 'Placeholder', 'add')) self._run(flags_str, should_succeed=True) os.remove(graph_def_file) def testFrozenGraphDefNonPlaceholder(self): with ops.Graph().as_default(): in_tensor = random_ops.random_normal(shape=[1, 16, 16, 3], name='random') _ = in_tensor + in_tensor sess = session.Session() # Write graph to file. graph_def_file = self._getFilepath('model.pb') write_graph(sess.graph_def, '', graph_def_file, False) sess.close() flags_str = ('--graph_def_file={0} --input_arrays={1} ' '--output_arrays={2}'.format(graph_def_file, 'random', 'add')) self._run(flags_str, should_succeed=True) os.remove(graph_def_file) def testSavedModel(self): saved_model_dir = self._getFilepath('model') with ops.Graph().as_default(): with session.Session() as sess: in_tensor = array_ops.placeholder( shape=[1, 16, 16, 3], dtype=dtypes.float32, name='inputB') out_tensor = in_tensor + in_tensor inputs = {'x': in_tensor} outputs = {'z': out_tensor} saved_model.simple_save(sess, saved_model_dir, inputs, outputs) flags_str = '--saved_model_dir={}'.format(saved_model_dir) self._run(flags_str, should_succeed=True) def testKerasFile(self): keras_file = self._getKerasModelFile() flags_str = '--keras_model_file={}'.format(keras_file) self._run(flags_str, should_succeed=True) os.remove(keras_file) def testKerasFileMLIR(self): keras_file = self._getKerasModelFile() flags_str = ('--keras_model_file={} --experimental_new_converter' .format(keras_file)) self._run(flags_str, should_succeed=True) os.remove(keras_file) def testConversionSummary(self): keras_file = self._getKerasModelFile() log_dir = self.get_temp_dir() flags_str = ('--keras_model_file={} --experimental_new_converter ' '--conversion_summary_dir={}'.format(keras_file, log_dir)) self._run(flags_str, should_succeed=True) os.remove(keras_file) num_items_conversion_summary = len(os.listdir(log_dir)) self.assertTrue(num_items_conversion_summary) def testConversionSummaryWithOldConverter(self): keras_file = self._getKerasModelFile() log_dir = self.get_temp_dir() flags_str = ('--keras_model_file={} --experimental_new_converter=false ' '--conversion_summary_dir={}'.format(keras_file, log_dir)) self._run(flags_str, should_succeed=True) os.remove(keras_file) num_items_conversion_summary = len(os.listdir(log_dir)) self.assertEqual(num_items_conversion_summary, 0) def _initObjectDetectionArgs(self): # Initializes the arguments required for the object detection model. # Looks for the model file which is saved in a different location internally # and externally. filename = resource_loader.get_path_to_datafile('testdata/tflite_graph.pb') if not os.path.exists(filename): filename = os.path.join( resource_loader.get_root_dir_with_all_resources(), '../tflite_mobilenet_ssd_quant_protobuf/tflite_graph.pb') if not os.path.exists(filename): raise IOError("File '{0}' does not exist.".format(filename)) self._graph_def_file = filename self._input_arrays = 'normalized_input_image_tensor' self._output_arrays = ( 'TFLite_Detection_PostProcess,TFLite_Detection_PostProcess:1,' 'TFLite_Detection_PostProcess:2,TFLite_Detection_PostProcess:3') self._input_shapes = '1,300,300,3' def testObjectDetection(self): """Tests object detection model through TOCO.""" self._initObjectDetectionArgs() flags_str = ('--graph_def_file={0} --input_arrays={1} ' '--output_arrays={2} --input_shapes={3} ' '--allow_custom_ops'.format(self._graph_def_file, self._input_arrays, self._output_arrays, self._input_shapes)) self._run(flags_str, should_succeed=True) def testObjectDetectionMLIR(self): """Tests object detection model through MLIR converter.""" self._initObjectDetectionArgs() custom_opdefs_str = ( 'name: \'TFLite_Detection_PostProcess\' ' 'input_arg: { name: \'raw_outputs/box_encodings\' type: DT_FLOAT } ' 'input_arg: { name: \'raw_outputs/class_predictions\' type: DT_FLOAT } ' 'input_arg: { name: \'anchors\' type: DT_FLOAT } ' 'output_arg: { name: \'TFLite_Detection_PostProcess\' type: DT_FLOAT } ' 'output_arg: { name: \'TFLite_Detection_PostProcess:1\' ' 'type: DT_FLOAT } ' 'output_arg: { name: \'TFLite_Detection_PostProcess:2\' ' 'type: DT_FLOAT } ' 'output_arg: { name: \'TFLite_Detection_PostProcess:3\' ' 'type: DT_FLOAT } ' 'attr : { name: \'h_scale\' type: \'float\'} ' 'attr : { name: \'max_classes_per_detection\' type: \'int\'} ' 'attr : { name: \'max_detections\' type: \'int\'} ' 'attr : { name: \'nms_iou_threshold\' type: \'float\'} ' 'attr : { name: \'nms_score_threshold\' type: \'float\'} ' 'attr : { name: \'num_classes\' type: \'int\'} ' 'attr : { name: \'w_scale\' type: \'int\'} ' 'attr : { name: \'x_scale\' type: \'int\'} ' 'attr : { name: \'y_scale\' type: \'int\'}') flags_str = ('--graph_def_file={0} --input_arrays={1} ' '--output_arrays={2} --input_shapes={3} ' '--custom_opdefs="{4}"'.format(self._graph_def_file, self._input_arrays, self._output_arrays, self._input_shapes, custom_opdefs_str)) # Ensure --experimental_new_converter. flags_str_final = ('{} --allow_custom_ops').format(flags_str) self._run(flags_str_final, should_succeed=False) # Ensure --allow_custom_ops. flags_str_final = ('{} --experimental_new_converter').format(flags_str) self._run(flags_str_final, should_succeed=False) # Valid conversion. flags_str_final = ('{} --allow_custom_ops ' '--experimental_new_converter').format(flags_str) self._run(flags_str_final, should_succeed=True) class TfLiteConvertV2Test(TestModels): @test_util.run_v2_only def testSavedModel(self): input_data = constant_op.constant(1., shape=[1]) root = tracking.AutoTrackable() root.f = def_function.function(lambda x: 2. * x) to_save = root.f.get_concrete_function(input_data) saved_model_dir = self._getFilepath('model') save(root, saved_model_dir, to_save) flags_str = '--saved_model_dir={}'.format(saved_model_dir) self._run(flags_str, should_succeed=True) @test_util.run_v2_only def testKerasFile(self): keras_file = self._getKerasModelFile() flags_str = '--keras_model_file={}'.format(keras_file) self._run(flags_str, should_succeed=True) os.remove(keras_file) @test_util.run_v2_only def testKerasFileMLIR(self): keras_file = self._getKerasModelFile() flags_str = ('--keras_model_file={} --experimental_new_converter' .format(keras_file)) self._run(flags_str, should_succeed=True) os.remove(keras_file) def testMissingRequired(self): self._run('--invalid_args', should_succeed=False) def testMutuallyExclusive(self): self._run( '--keras_model_file=model.h5 --saved_model_dir=/tmp/', should_succeed=False) class ArgParserTest(test_util.TensorFlowTestCase): def test_without_experimental_new_converter(self): args = [ '--saved_model_dir=/tmp/saved_model/', '--output_file=/tmp/output.tflite', ] # V1 parser. parser = tflite_convert._get_parser(False) parsed_args = parser.parse_args(args) self.assertFalse(parsed_args.experimental_new_converter) # V2 parser. parser = tflite_convert._get_parser(True) parsed_args = parser.parse_args(args) self.assertFalse(parsed_args.experimental_new_converter) def test_experimental_new_converter(self): args = [ '--saved_model_dir=/tmp/saved_model/', '--output_file=/tmp/output.tflite', '--experimental_new_converter', ] # V1 parser. parser = tflite_convert._get_parser(False) parsed_args = parser.parse_args(args) self.assertTrue(parsed_args.experimental_new_converter) # V2 parser. parser = tflite_convert._get_parser(True) parsed_args = parser.parse_args(args) self.assertTrue(parsed_args.experimental_new_converter) def test_experimental_new_converter_true(self): args = [ '--saved_model_dir=/tmp/saved_model/', '--output_file=/tmp/output.tflite', '--experimental_new_converter=true', ] # V1 parser. parser = tflite_convert._get_parser(False) parsed_args = parser.parse_args(args) self.assertTrue(parsed_args.experimental_new_converter) # V2 parser. parser = tflite_convert._get_parser(True) parsed_args = parser.parse_args(args) self.assertTrue(parsed_args.experimental_new_converter) def test_experimental_new_converter_false(self): args = [ '--saved_model_dir=/tmp/saved_model/', '--output_file=/tmp/output.tflite', '--experimental_new_converter=false', ] # V1 parser. parser = tflite_convert._get_parser(False) parsed_args = parser.parse_args(args) self.assertFalse(parsed_args.experimental_new_converter) # V2 parser. parser = tflite_convert._get_parser(True) parsed_args = parser.parse_args(args) self.assertFalse(parsed_args.experimental_new_converter) if __name__ == '__main__': test.main()
apache-2.0
barbarubra/Don-t-know-What-i-m-doing.
python/src/Demo/sockets/telnet.py
47
3010
#! /usr/bin/env python # Minimal interface to the Internet telnet protocol. # # It refuses all telnet options and does not recognize any of the other # telnet commands, but can still be used to connect in line-by-line mode. # It's also useful to play with a number of other services, # like time, finger, smtp and even ftp. # # Usage: telnet host [port] # # The port may be a service name or a decimal port number; # it defaults to 'telnet'. import sys, posix, time from socket import * BUFSIZE = 1024 # Telnet protocol characters IAC = chr(255) # Interpret as command DONT = chr(254) DO = chr(253) WONT = chr(252) WILL = chr(251) def main(): host = sys.argv[1] try: hostaddr = gethostbyname(host) except error: sys.stderr.write(sys.argv[1] + ': bad host name\n') sys.exit(2) # if len(sys.argv) > 2: servname = sys.argv[2] else: servname = 'telnet' # if '0' <= servname[:1] <= '9': port = eval(servname) else: try: port = getservbyname(servname, 'tcp') except error: sys.stderr.write(servname + ': bad tcp service name\n') sys.exit(2) # s = socket(AF_INET, SOCK_STREAM) # try: s.connect((host, port)) except error, msg: sys.stderr.write('connect failed: ' + repr(msg) + '\n') sys.exit(1) # pid = posix.fork() # if pid == 0: # child -- read stdin, write socket while 1: line = sys.stdin.readline() s.send(line) else: # parent -- read socket, write stdout iac = 0 # Interpret next char as command opt = '' # Interpret next char as option while 1: data = s.recv(BUFSIZE) if not data: # EOF; kill child and exit sys.stderr.write( '(Closed by remote host)\n') posix.kill(pid, 9) sys.exit(1) cleandata = '' for c in data: if opt: print ord(c) s.send(opt + c) opt = '' elif iac: iac = 0 if c == IAC: cleandata = cleandata + c elif c in (DO, DONT): if c == DO: print '(DO)', else: print '(DONT)', opt = IAC + WONT elif c in (WILL, WONT): if c == WILL: print '(WILL)', else: print '(WONT)', opt = IAC + DONT else: print '(command)', ord(c) elif c == IAC: iac = 1 print '(IAC)', else: cleandata = cleandata + c sys.stdout.write(cleandata) sys.stdout.flush() try: main() except KeyboardInterrupt: pass
apache-2.0
solashirai/edx-platform
common/lib/capa/capa/tests/test_correctmap.py
107
7116
""" Tests to verify that CorrectMap behaves correctly """ import unittest from capa.correctmap import CorrectMap import datetime class CorrectMapTest(unittest.TestCase): """ Tests to verify that CorrectMap behaves correctly """ def setUp(self): super(CorrectMapTest, self).setUp() self.cmap = CorrectMap() def test_set_input_properties(self): # Set the correctmap properties for three inputs self.cmap.set( answer_id='1_2_1', correctness='correct', npoints=5, msg='Test message', hint='Test hint', hintmode='always', queuestate={ 'key': 'secretstring', 'time': '20130228100026' } ) self.cmap.set( answer_id='2_2_1', correctness='incorrect', npoints=None, msg=None, hint=None, hintmode=None, queuestate=None ) self.cmap.set( answer_id='3_2_1', correctness='partially-correct', npoints=3, msg=None, hint=None, hintmode=None, queuestate=None ) # Assert that each input has the expected properties self.assertTrue(self.cmap.is_correct('1_2_1')) self.assertFalse(self.cmap.is_correct('2_2_1')) self.assertTrue(self.cmap.is_correct('3_2_1')) self.assertTrue(self.cmap.is_partially_correct('3_2_1')) self.assertFalse(self.cmap.is_partially_correct('2_2_1')) # Intentionally testing an item that's not in cmap. self.assertFalse(self.cmap.is_partially_correct('9_2_1')) self.assertEqual(self.cmap.get_correctness('1_2_1'), 'correct') self.assertEqual(self.cmap.get_correctness('2_2_1'), 'incorrect') self.assertEqual(self.cmap.get_correctness('3_2_1'), 'partially-correct') self.assertEqual(self.cmap.get_npoints('1_2_1'), 5) self.assertEqual(self.cmap.get_npoints('2_2_1'), 0) self.assertEqual(self.cmap.get_npoints('3_2_1'), 3) self.assertEqual(self.cmap.get_msg('1_2_1'), 'Test message') self.assertEqual(self.cmap.get_msg('2_2_1'), None) self.assertEqual(self.cmap.get_hint('1_2_1'), 'Test hint') self.assertEqual(self.cmap.get_hint('2_2_1'), None) self.assertEqual(self.cmap.get_hintmode('1_2_1'), 'always') self.assertEqual(self.cmap.get_hintmode('2_2_1'), None) self.assertTrue(self.cmap.is_queued('1_2_1')) self.assertFalse(self.cmap.is_queued('2_2_1')) self.assertEqual(self.cmap.get_queuetime_str('1_2_1'), '20130228100026') self.assertEqual(self.cmap.get_queuetime_str('2_2_1'), None) self.assertTrue(self.cmap.is_right_queuekey('1_2_1', 'secretstring')) self.assertFalse(self.cmap.is_right_queuekey('1_2_1', 'invalidstr')) self.assertFalse(self.cmap.is_right_queuekey('1_2_1', '')) self.assertFalse(self.cmap.is_right_queuekey('1_2_1', None)) self.assertFalse(self.cmap.is_right_queuekey('2_2_1', 'secretstring')) self.assertFalse(self.cmap.is_right_queuekey('2_2_1', 'invalidstr')) self.assertFalse(self.cmap.is_right_queuekey('2_2_1', '')) self.assertFalse(self.cmap.is_right_queuekey('2_2_1', None)) def test_get_npoints(self): # Set the correctmap properties for 4 inputs # 1) correct, 5 points # 2) correct, None points # 3) incorrect, 5 points # 4) incorrect, None points # 5) correct, 0 points # 4) partially correct, 2.5 points # 5) partially correct, None points self.cmap.set( answer_id='1_2_1', correctness='correct', npoints=5.3 ) self.cmap.set( answer_id='2_2_1', correctness='correct', npoints=None ) self.cmap.set( answer_id='3_2_1', correctness='incorrect', npoints=5 ) self.cmap.set( answer_id='4_2_1', correctness='incorrect', npoints=None ) self.cmap.set( answer_id='5_2_1', correctness='correct', npoints=0 ) self.cmap.set( answer_id='6_2_1', correctness='partially-correct', npoints=2.5 ) self.cmap.set( answer_id='7_2_1', correctness='partially-correct', npoints=None ) # Assert that we get the expected points # If points assigned --> npoints # If no points assigned and correct --> 1 point # If no points assigned and partially correct --> 1 point # If no points assigned and incorrect --> 0 points self.assertEqual(self.cmap.get_npoints('1_2_1'), 5.3) self.assertEqual(self.cmap.get_npoints('2_2_1'), 1) self.assertEqual(self.cmap.get_npoints('3_2_1'), 5) self.assertEqual(self.cmap.get_npoints('4_2_1'), 0) self.assertEqual(self.cmap.get_npoints('5_2_1'), 0) self.assertEqual(self.cmap.get_npoints('6_2_1'), 2.5) self.assertEqual(self.cmap.get_npoints('7_2_1'), 1) def test_set_overall_message(self): # Default is an empty string string self.assertEqual(self.cmap.get_overall_message(), "") # Set a message that applies to the whole question self.cmap.set_overall_message("Test message") # Retrieve the message self.assertEqual(self.cmap.get_overall_message(), "Test message") # Setting the message to None --> empty string self.cmap.set_overall_message(None) self.assertEqual(self.cmap.get_overall_message(), "") def test_update_from_correctmap(self): # Initialize a CorrectMap with some properties self.cmap.set( answer_id='1_2_1', correctness='correct', npoints=5, msg='Test message', hint='Test hint', hintmode='always', queuestate={ 'key': 'secretstring', 'time': '20130228100026' } ) self.cmap.set_overall_message("Test message") # Create a second cmap, then update it to have the same properties # as the first cmap other_cmap = CorrectMap() other_cmap.update(self.cmap) # Assert that it has all the same properties self.assertEqual( other_cmap.get_overall_message(), self.cmap.get_overall_message() ) self.assertEqual( other_cmap.get_dict(), self.cmap.get_dict() ) def test_update_from_invalid(self): # Should get an exception if we try to update() a CorrectMap # with a non-CorrectMap value invalid_list = [None, "string", 5, datetime.datetime.today()] for invalid in invalid_list: with self.assertRaises(Exception): self.cmap.update(invalid)
agpl-3.0
ccdale/cristel
lib/python/dvbsession.py
1
12533
# Copyright (c) 2015 Chris Allison chris.allison@hotmail.com # # This file is part of cristel. # # cristel is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # cristel is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with cristel. If not, see <http://www.gnu.org/licenses/>. """ Module to extend (and fix) the dvbstreamer Session class """ import time import logging import logging.handlers from dvbstreamer.session import Session from dvbstreamer.info import * # log=logging.getLogger(__name__) # # log.setLevel(logging.DEBUG) # handler=logging.handlers.SysLogHandler(address = '/dev/log', facility=logging.handlers.SysLogHandler.LOG_DAEMON) # log.addHandler(handler) log=None class DvbSession(Session): """Class represents an instance of a dvbstreamer server""" def __init__(self, host, adaptor, username='dvbstreamer', password='control',logg=None): global log log=logg Session.__init__(self,host,adaptor,username,password) def execute_command(self, command, authenticate=True): """ Executes the specified command on the server. @param command: The command to execute. @param authenticate: Whether the connection needs to be authenticated before running the command. """ log.debug("attempting command: %s" % command) conn = self._get_connection(authenticate) try: result = conn.execute_command(command) finally: self.connections.append(conn) return result def get_service_filters(self): """ retrieve a list of active service filters @returns: a list of ServiceFilterInfo objects """ error_message, lines = self.execute_command('lssfs') sfs = [] if len(lines): for sname in lines: emsg, svc = self.execute_command('getsf %s' % sname) if len(svc): service=svc[0].split(" : ",1) junk=service[1].split('"') svc=junk[1] emsg, url = self.execute_command('getsfmrl %s' % sname) mrl=None if len(url): mrl=url[0] sfs.append(ServiceFilterInfo(sname,mrl,svc)) return sfs def find_free_sf(self): """finds the first free service filter""" freesf=-1 count=-1 # print "in find_free_sf" sfs=self.get_service_filters() for sf in sfs: count=count+1 # print "checking sf %d" % count # print "testing sf.mrl: %s" % sf.mrl if sf.mrl is None: freesf=count break if sf.mrl == 'null://': freesf=count break if freesf==-1: count=count+1 newsf=self.add_sf(count) if newsf == count: freesf=newsf return freesf def add_sf(self,sfnum): """ adds a service filter name dvb<sfnum> sfnum cannot be zero @returns: the requested sf number or 0 """ res=0 if (sfnum > -1) & (sfnum > 0): emsg, res = self.execute_command('addsf dvb%d null://' % sfnum) if emsg == "OK": log.debug("Added filter dvb%d" % sfnum) return sfnum else: log.warning("Failed to add filter dvb%d" % sfnum) log.error("filter number: <%s> out of bounds" % sfnum) return res def set_sf(self,sfnum,service): """sets the service (channel) for the numbered service filter""" if (sfnum == 0): cmd='select "%s"' % service else: cmd='setsf dvb%d "%s"' % (sfnum,service) emsg,res=self.execute_command(cmd) if emsg == "OK": if self.waitfortune(): log.debug("Tuned to %s for filter %d" % (service,sfnum)) return res else: log.error("Failed to tune to %s for filter %d" % (service,sfnum)) return False else: log.error("Failed to select service %s for filter %d" % (service,sfnum)) return False def set_mrl_sf(self,sfnum,mrl): """sets the output for the numbered service filter""" if sfnum == 0: cmd='setmrl %s' % mrl else: cmd='setsfmrl dvb%d %s' % (sfnum,mrl) emsg,res=self.execute_command(cmd) if emsg == "OK": log.debug("set output for filter %d to %s" % (sfnum,mrl)) return 1 else: log.error("failed to set output for filter %d to %s" % (sfnum,mrl)) return 0 def clean_sf(self): """cleans up unused service filters""" canclean=1 while canclean: sfs=self.get_service_filters() nsfs=len(sfs) # start at the last service filter if nsfs > 1: nsfs=nsfs-1 if sfs[nsfs].mrl == "null://": log.debug("removing filter dvb%d" % nsfs) emsg,res=self.execute_command("rmsf dvb%d" % nsfs) if emsg!="OK": log.warning("Failed to remove filter dvb%d" % nsfs) # filter failed to remove, so stop canclean=0 else: # the last service filter in the list is still in use, so stop canclean=0 else: log.debug("Nothing left to clean") # there are no service filters other than <Primary> canclean=0 def safe_to_record(self,channel): """checks that it is safe to tune to channel on a free service filter""" freesf=self.find_free_sf() # print "found %d as freesf" % freesf if freesf > -1: if freesf > 0: # <Primary> is in use so check what mux it is using sfs=self.get_service_filters() # print "checking %s" % sfs[0].service si=self.get_service_info(sfs[0].service) nsi=self.get_service_info(channel) if nsi.mux_uid != si.mux_uid: log.warning("It is not safe to tune to %s at this time" % channel) log.warning("Primary is tuned to %s and is in use" % sfs[0].service) freesf=-1 else: log.debug("Safe to tune to %s on free filter %d" % (channel,freesf)) else: log.error("Not safe as no free filter is available") return freesf def get_service_info(self, service): """ Retrieve information about the specified service. @param service: The service to retrieve information for. This can either be a string descibing the name or id of the service or a Service object. @returns: A ServiceInfo object. """ # print "getting service info: %s" % service error_message, lines = self.execute_command('serviceinfo "%s"' % service) return ServiceInfo(lines) def recordprogramme(self,channel,filename): """makes a recording into the named file of the named channel""" freesf=self.safe_to_record(channel) if freesf > -1: test=self.set_sf(freesf,channel) if test: test=self.set_mrl_sf(freesf,"file://%s" % filename) if test: log.debug("Recording %s into %s" % (channel,filename)) return 1 log.warning("Recording not starting for %s into %s" % (channel,filename)) return 0 def stoprecording(self,sfnum=None,filename=None): """stops a current recording either supply the service filter number or the recording filename both cannot be null @returns: int: true if service filter was updated, false otherwise """ if sfnum==None: if filename==None: log.warning("Nothing to stop, no parameters supplied") return 0 sfs=self.get_service_filters() if sfnum > -1: log.debug("stopping by filter number: %d" % sfnum) res=self.set_mrl_sf(sfnum,"null://") return res count=0 for sf in sfs: if ("file://%s" % filename)==sf.mrl: log.debug("found filter for file: %s" % filename) res=self.set_mrl_sf(count,"null://") return res count=count+1 return 0 def getstatus(self): """returns the front end status as a list""" emsg,res=self.execute_command("festatus") tmp=res[0].split("[") t2=tmp[1].split("]") s1=t2[0].split(",") status=[] for ss in s1: status.append(ss.strip()) return status def waitfortune(self,timeout=10): count=0 status=self.getstatus() while len(status)<5: time.sleep(1) count=count + 1 if count > timeout: break; status=self.getstatus() if len(status)>4: if status[4] == "Sync": log.debug("Status: Sync") return True else: log.error(status) return False def logicalchannels(self): """returns the logical channel ids (freeview channel numbers) as a dict""" emsg,res=self.execute_command("lslcn") lcn={} for line in res: tmp=line.split(":") cn=tmp[0].strip() name=tmp[1].strip() lcn[cn]=name return lcn def logicalnames(self): """returns the logical channel ids (freeview channel numbers) as a dict keyed by name""" emsg,res=self.execute_command("lslcn") lcnames={} for line in res: tmp=line.split(":") cn=tmp[0].strip() name=tmp[1].strip() lcnames[name]=cn return lcnames def lsmuxes(self): """returns a list of muxes""" emsg,res=self.execute_command("lsmuxes") muxes=[] for line in res: muxes.append(line.strip()) return muxes def servicesformux(self,mux): """returns a list of services for the supplied muxid""" emsg,res=self.execute_command("lsservices %s" % mux) svcs=[] for line in res: svcs.append(line.strip()) return svcs def lsservices(self): """returns the complete list of services available""" emsg,res=self.execute_command("lsservices") svcs=[] for line in res: svcs.append(line.strip()) return svcs def serviceinfo(self,service): """returns a hash of the service info for a service""" emsg,res=self.execute_command("serviceinfo '%s'" % service) si={} # for line in res.splitlines(): for line in res: x=line.partition(':') n=x[0].strip(" \"\t\r\n") v=x[2].strip(" \"\t\r\n") si[n]=v return si def canscan(self): """waits until no scan is running scanning a non-existent mux will cause a generic command error the error message tells you whether a scan is currently running """ while 1: try: emsg,res=self.execute_command("scan junk") except GenericCommandError as e: log.debug(e.msg) if e.msg.strip() == "Scan in progress!": time.sleep(10) else: log.debug("Scanning completed") break def scannet(self,net): """scans a net for services""" self.canscan() log.info("scanning: %s" % net) emsg,res=self.execute_command("scan net '"+net+"'") self.canscan() log.info("Completed scan of %s" % net)
gpl-3.0
benlaurie/certificate-transparency
python/demo/vdb/verifiable_log.py
30
2096
import hashlib, base64 # Basic verifiable log, for demo purposes only class VerifiableLog: def __init__(self): self._entries = [] self._cache = {} def append(self, val): self._entries.append(val) def get_entries(self, start, end): return self._entries[start:end + 1] def get_tree_head(self, seq=None): if seq is None: seq = len(self._entries) if seq > len(self._entries): raise return { 'tree_size': seq, 'sha256_root_hash': base64.b64encode(self._calc_mth(0, seq)) if seq else None, } def consistency_proof(self, first, second): return [base64.b64encode(self._calc_mth(a, b)) for a, b in self._subproof(first, 0, second, True)] def inclusion_proof(self, m, n): return [base64.b64encode(self._calc_mth(a, b)) for a, b in self._path(m, 0, n)] def _calc_mth(self, start, end): k = '%i-%i' % (start, end) rv = self._cache.get(k, None) if not rv: stack = [] tree_size = end - start for idx, leaf in enumerate(self._entries[start:end]): stack.append(hashlib.sha256(chr(0) + leaf).digest()) for _ in range(bin(idx).replace('b', '')[::-1].index('0') if idx + 1 < tree_size else len(stack) - 1): stack[-2:] = [hashlib.sha256(chr(1) + stack[-2] + stack[-1]).digest()] rv = stack[0] self._cache[k] = rv return rv def _subproof(self, m, start_n, end_n, b): n = end_n - start_n if m == n: if b: return [] else: return [(start_n, end_n)] else: k = 1 << (len(bin(n - 1)) - 3) if m <= k: return self._subproof(m, start_n, start_n + k, b) + [(start_n + k, end_n)] else: return self._subproof(m - k, start_n + k, end_n, False) + [(start_n, start_n + k)] def _path(self, m, start_n, end_n): n = end_n - start_n if n == 1: return [] else: k = 1 << (len(bin(n - 1)) - 3) if m < k: return self._path(m, start_n, start_n + k) + [(start_n + k, end_n)] else: return self._path(m - k, start_n + k, end_n) + [(start_n, start_n + k)]
apache-2.0
gacarrillor/QGIS
tests/src/python/test_qgsserver_apicontext.py
18
1891
# -*- coding: utf-8 -*- """QGIS Unit tests for QgsServerApiContext class. From build dir, run: ctest -R PyQgsServerApiContext -V .. note:: This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. """ __author__ = 'Alessandro Pasotti' __date__ = '11/07/2019' __copyright__ = 'Copyright 2019, The QGIS Project' # This will get replaced with a git SHA1 when you do a git archive __revision__ = '$Format:%H$' import os import json import re # Deterministic XML os.environ['QT_HASH_SEED'] = '1' from qgis.server import ( QgsBufferServerRequest, QgsBufferServerResponse, QgsServerApiContext ) from qgis.testing import unittest from utilities import unitTestDataPath from urllib import parse import tempfile from test_qgsserver import QgsServerTestBase class QgsServerApiContextsTest(QgsServerTestBase): """ QGIS Server API context tests""" def testMatchedPath(self): """Test path extraction""" response = QgsBufferServerResponse() request = QgsBufferServerRequest("http://www.qgis.org/services/wfs3") context = QgsServerApiContext("/wfs3", request, response, None, None) self.assertEqual(context.matchedPath(), "/services/wfs3") request = QgsBufferServerRequest("http://www.qgis.org/services/wfs3/collections.hml") context = QgsServerApiContext("/wfs3", request, response, None, None) self.assertEqual(context.matchedPath(), "/services/wfs3") request = QgsBufferServerRequest("http://www.qgis.org/services/wfs3/collections.hml") context = QgsServerApiContext("/wfs4", request, response, None, None) self.assertEqual(context.matchedPath(), "") if __name__ == '__main__': unittest.main()
gpl-2.0
ChristinaZografou/sympy
sympy/solvers/ode.py
3
330808
r""" This module contains :py:meth:`~sympy.solvers.ode.dsolve` and different helper functions that it uses. :py:meth:`~sympy.solvers.ode.dsolve` solves ordinary differential equations. See the docstring on the various functions for their uses. Note that partial differential equations support is in ``pde.py``. Note that hint functions have docstrings describing their various methods, but they are intended for internal use. Use ``dsolve(ode, func, hint=hint)`` to solve an ODE using a specific hint. See also the docstring on :py:meth:`~sympy.solvers.ode.dsolve`. **Functions in this module** These are the user functions in this module: - :py:meth:`~sympy.solvers.ode.dsolve` - Solves ODEs. - :py:meth:`~sympy.solvers.ode.classify_ode` - Classifies ODEs into possible hints for :py:meth:`~sympy.solvers.ode.dsolve`. - :py:meth:`~sympy.solvers.ode.checkodesol` - Checks if an equation is the solution to an ODE. - :py:meth:`~sympy.solvers.ode.homogeneous_order` - Returns the homogeneous order of an expression. - :py:meth:`~sympy.solvers.ode.infinitesimals` - Returns the infinitesimals of the Lie group of point transformations of an ODE, such that it is invariant. - :py:meth:`~sympy.solvers.ode_checkinfsol` - Checks if the given infinitesimals are the actual infinitesimals of a first order ODE. These are the non-solver helper functions that are for internal use. The user should use the various options to :py:meth:`~sympy.solvers.ode.dsolve` to obtain the functionality provided by these functions: - :py:meth:`~sympy.solvers.ode.odesimp` - Does all forms of ODE simplification. - :py:meth:`~sympy.solvers.ode.ode_sol_simplicity` - A key function for comparing solutions by simplicity. - :py:meth:`~sympy.solvers.ode.constantsimp` - Simplifies arbitrary constants. - :py:meth:`~sympy.solvers.ode.constant_renumber` - Renumber arbitrary constants. - :py:meth:`~sympy.solvers.ode._handle_Integral` - Evaluate unevaluated Integrals. See also the docstrings of these functions. **Currently implemented solver methods** The following methods are implemented for solving ordinary differential equations. See the docstrings of the various hint functions for more information on each (run ``help(ode)``): - 1st order separable differential equations. - 1st order differential equations whose coefficients or `dx` and `dy` are functions homogeneous of the same order. - 1st order exact differential equations. - 1st order linear differential equations. - 1st order Bernoulli differential equations. - Power series solutions for first order differential equations. - Lie Group method of solving first order differential equations. - 2nd order Liouville differential equations. - Power series solutions for second order differential equations at ordinary and regular singular points. - `n`\th order linear homogeneous differential equation with constant coefficients. - `n`\th order linear inhomogeneous differential equation with constant coefficients using the method of undetermined coefficients. - `n`\th order linear inhomogeneous differential equation with constant coefficients using the method of variation of parameters. **Philosophy behind this module** This module is designed to make it easy to add new ODE solving methods without having to mess with the solving code for other methods. The idea is that there is a :py:meth:`~sympy.solvers.ode.classify_ode` function, which takes in an ODE and tells you what hints, if any, will solve the ODE. It does this without attempting to solve the ODE, so it is fast. Each solving method is a hint, and it has its own function, named ``ode_<hint>``. That function takes in the ODE and any match expression gathered by :py:meth:`~sympy.solvers.ode.classify_ode` and returns a solved result. If this result has any integrals in it, the hint function will return an unevaluated :py:class:`~sympy.integrals.Integral` class. :py:meth:`~sympy.solvers.ode.dsolve`, which is the user wrapper function around all of this, will then call :py:meth:`~sympy.solvers.ode.odesimp` on the result, which, among other things, will attempt to solve the equation for the dependent variable (the function we are solving for), simplify the arbitrary constants in the expression, and evaluate any integrals, if the hint allows it. **How to add new solution methods** If you have an ODE that you want :py:meth:`~sympy.solvers.ode.dsolve` to be able to solve, try to avoid adding special case code here. Instead, try finding a general method that will solve your ODE, as well as others. This way, the :py:mod:`~sympy.solvers.ode` module will become more robust, and unhindered by special case hacks. WolphramAlpha and Maple's DETools[odeadvisor] function are two resources you can use to classify a specific ODE. It is also better for a method to work with an `n`\th order ODE instead of only with specific orders, if possible. To add a new method, there are a few things that you need to do. First, you need a hint name for your method. Try to name your hint so that it is unambiguous with all other methods, including ones that may not be implemented yet. If your method uses integrals, also include a ``hint_Integral`` hint. If there is more than one way to solve ODEs with your method, include a hint for each one, as well as a ``<hint>_best`` hint. Your ``ode_<hint>_best()`` function should choose the best using min with ``ode_sol_simplicity`` as the key argument. See :py:meth:`~sympy.solvers.ode.ode_1st_homogeneous_coeff_best`, for example. The function that uses your method will be called ``ode_<hint>()``, so the hint must only use characters that are allowed in a Python function name (alphanumeric characters and the underscore '``_``' character). Include a function for every hint, except for ``_Integral`` hints (:py:meth:`~sympy.solvers.ode.dsolve` takes care of those automatically). Hint names should be all lowercase, unless a word is commonly capitalized (such as Integral or Bernoulli). If you have a hint that you do not want to run with ``all_Integral`` that doesn't have an ``_Integral`` counterpart (such as a best hint that would defeat the purpose of ``all_Integral``), you will need to remove it manually in the :py:meth:`~sympy.solvers.ode.dsolve` code. See also the :py:meth:`~sympy.solvers.ode.classify_ode` docstring for guidelines on writing a hint name. Determine *in general* how the solutions returned by your method compare with other methods that can potentially solve the same ODEs. Then, put your hints in the :py:data:`~sympy.solvers.ode.allhints` tuple in the order that they should be called. The ordering of this tuple determines which hints are default. Note that exceptions are ok, because it is easy for the user to choose individual hints with :py:meth:`~sympy.solvers.ode.dsolve`. In general, ``_Integral`` variants should go at the end of the list, and ``_best`` variants should go before the various hints they apply to. For example, the ``undetermined_coefficients`` hint comes before the ``variation_of_parameters`` hint because, even though variation of parameters is more general than undetermined coefficients, undetermined coefficients generally returns cleaner results for the ODEs that it can solve than variation of parameters does, and it does not require integration, so it is much faster. Next, you need to have a match expression or a function that matches the type of the ODE, which you should put in :py:meth:`~sympy.solvers.ode.classify_ode` (if the match function is more than just a few lines, like :py:meth:`~sympy.solvers.ode._undetermined_coefficients_match`, it should go outside of :py:meth:`~sympy.solvers.ode.classify_ode`). It should match the ODE without solving for it as much as possible, so that :py:meth:`~sympy.solvers.ode.classify_ode` remains fast and is not hindered by bugs in solving code. Be sure to consider corner cases. For example, if your solution method involves dividing by something, make sure you exclude the case where that division will be 0. In most cases, the matching of the ODE will also give you the various parts that you need to solve it. You should put that in a dictionary (``.match()`` will do this for you), and add that as ``matching_hints['hint'] = matchdict`` in the relevant part of :py:meth:`~sympy.solvers.ode.classify_ode`. :py:meth:`~sympy.solvers.ode.classify_ode` will then send this to :py:meth:`~sympy.solvers.ode.dsolve`, which will send it to your function as the ``match`` argument. Your function should be named ``ode_<hint>(eq, func, order, match)`. If you need to send more information, put it in the ``match`` dictionary. For example, if you had to substitute in a dummy variable in :py:meth:`~sympy.solvers.ode.classify_ode` to match the ODE, you will need to pass it to your function using the `match` dict to access it. You can access the independent variable using ``func.args[0]``, and the dependent variable (the function you are trying to solve for) as ``func.func``. If, while trying to solve the ODE, you find that you cannot, raise ``NotImplementedError``. :py:meth:`~sympy.solvers.ode.dsolve` will catch this error with the ``all`` meta-hint, rather than causing the whole routine to fail. Add a docstring to your function that describes the method employed. Like with anything else in SymPy, you will need to add a doctest to the docstring, in addition to real tests in ``test_ode.py``. Try to maintain consistency with the other hint functions' docstrings. Add your method to the list at the top of this docstring. Also, add your method to ``ode.rst`` in the ``docs/src`` directory, so that the Sphinx docs will pull its docstring into the main SymPy documentation. Be sure to make the Sphinx documentation by running ``make html`` from within the doc directory to verify that the docstring formats correctly. If your solution method involves integrating, use :py:meth:`Integral() <sympy.integrals.integrals.Integral>` instead of :py:meth:`~sympy.core.expr.Expr.integrate`. This allows the user to bypass hard/slow integration by using the ``_Integral`` variant of your hint. In most cases, calling :py:meth:`sympy.core.basic.Basic.doit` will integrate your solution. If this is not the case, you will need to write special code in :py:meth:`~sympy.solvers.ode._handle_Integral`. Arbitrary constants should be symbols named ``C1``, ``C2``, and so on. All solution methods should return an equality instance. If you need an arbitrary number of arbitrary constants, you can use ``constants = numbered_symbols(prefix='C', cls=Symbol, start=1)``. If it is possible to solve for the dependent function in a general way, do so. Otherwise, do as best as you can, but do not call solve in your ``ode_<hint>()`` function. :py:meth:`~sympy.solvers.ode.odesimp` will attempt to solve the solution for you, so you do not need to do that. Lastly, if your ODE has a common simplification that can be applied to your solutions, you can add a special case in :py:meth:`~sympy.solvers.ode.odesimp` for it. For example, solutions returned from the ``1st_homogeneous_coeff`` hints often have many :py:meth:`~sympy.functions.log` terms, so :py:meth:`~sympy.solvers.ode.odesimp` calls :py:meth:`~sympy.simplify.simplify.logcombine` on them (it also helps to write the arbitrary constant as ``log(C1)`` instead of ``C1`` in this case). Also consider common ways that you can rearrange your solution to have :py:meth:`~sympy.solvers.ode.constantsimp` take better advantage of it. It is better to put simplification in :py:meth:`~sympy.solvers.ode.odesimp` than in your method, because it can then be turned off with the simplify flag in :py:meth:`~sympy.solvers.ode.dsolve`. If you have any extraneous simplification in your function, be sure to only run it using ``if match.get('simplify', True):``, especially if it can be slow or if it can reduce the domain of the solution. Finally, as with every contribution to SymPy, your method will need to be tested. Add a test for each method in ``test_ode.py``. Follow the conventions there, i.e., test the solver using ``dsolve(eq, f(x), hint=your_hint)``, and also test the solution using :py:meth:`~sympy.solvers.ode.checkodesol` (you can put these in a separate tests and skip/XFAIL if it runs too slow/doesn't work). Be sure to call your hint specifically in :py:meth:`~sympy.solvers.ode.dsolve`, that way the test won't be broken simply by the introduction of another matching hint. If your method works for higher order (>1) ODEs, you will need to run ``sol = constant_renumber(sol, 'C', 1, order)`` for each solution, where ``order`` is the order of the ODE. This is because ``constant_renumber`` renumbers the arbitrary constants by printing order, which is platform dependent. Try to test every corner case of your solver, including a range of orders if it is a `n`\th order solver, but if your solver is slow, such as if it involves hard integration, try to keep the test run time down. Feel free to refactor existing hints to avoid duplicating code or creating inconsistencies. If you can show that your method exactly duplicates an existing method, including in the simplicity and speed of obtaining the solutions, then you can remove the old, less general method. The existing code is tested extensively in ``test_ode.py``, so if anything is broken, one of those tests will surely fail. """ from __future__ import print_function, division from collections import defaultdict from itertools import islice from sympy.core import Add, S, Mul, Pow, oo from sympy.core.compatibility import ordered, iterable, is_sequence, range from sympy.core.containers import Tuple from sympy.core.exprtools import factor_terms from sympy.core.expr import AtomicExpr, Expr from sympy.core.function import (Function, Derivative, AppliedUndef, diff, expand, expand_mul, Subs, _mexpand) from sympy.core.multidimensional import vectorize from sympy.core.numbers import NaN, zoo, I, Number from sympy.core.relational import Equality, Eq from sympy.core.symbol import Symbol, Wild, Dummy, symbols from sympy.core.sympify import sympify from sympy.logic.boolalg import BooleanAtom from sympy.functions import cos, exp, im, log, re, sin, tan, sqrt, \ atan2, conjugate from sympy.functions.combinatorial.factorials import factorial from sympy.integrals.integrals import Integral, integrate from sympy.matrices import wronskian, Matrix, eye, zeros from sympy.polys import (Poly, RootOf, rootof, terms_gcd, PolynomialError, lcm) from sympy.polys.polyroots import roots_quartic from sympy.polys.polytools import cancel, degree, div from sympy.series import Order from sympy.series.series import series from sympy.simplify import collect, logcombine, powsimp, separatevars, \ simplify, trigsimp, denom, posify, cse from sympy.simplify.powsimp import powdenest from sympy.simplify.radsimp import collect_const from sympy.solvers import solve from sympy.solvers.pde import pdsolve from sympy.utilities import numbered_symbols, default_sort_key, sift from sympy.solvers.deutils import _preprocess, ode_order, _desolve #: This is a list of hints in the order that they should be preferred by #: :py:meth:`~sympy.solvers.ode.classify_ode`. In general, hints earlier in the #: list should produce simpler solutions than those later in the list (for #: ODEs that fit both). For now, the order of this list is based on empirical #: observations by the developers of SymPy. #: #: The hint used by :py:meth:`~sympy.solvers.ode.dsolve` for a specific ODE #: can be overridden (see the docstring). #: #: In general, ``_Integral`` hints are grouped at the end of the list, unless #: there is a method that returns an unevaluable integral most of the time #: (which go near the end of the list anyway). ``default``, ``all``, #: ``best``, and ``all_Integral`` meta-hints should not be included in this #: list, but ``_best`` and ``_Integral`` hints should be included. allhints = ( "separable", "1st_exact", "1st_linear", "Bernoulli", "Riccati_special_minus2", "1st_homogeneous_coeff_best", "1st_homogeneous_coeff_subs_indep_div_dep", "1st_homogeneous_coeff_subs_dep_div_indep", "almost_linear", "linear_coefficients", "separable_reduced", "1st_power_series", "lie_group", "nth_linear_constant_coeff_homogeneous", "nth_linear_euler_eq_homogeneous", "nth_linear_constant_coeff_undetermined_coefficients", "nth_linear_euler_eq_nonhomogeneous_undetermined_coefficients", "nth_linear_constant_coeff_variation_of_parameters", "nth_linear_euler_eq_nonhomogeneous_variation_of_parameters", "Liouville", "2nd_power_series_ordinary", "2nd_power_series_regular", "separable_Integral", "1st_exact_Integral", "1st_linear_Integral", "Bernoulli_Integral", "1st_homogeneous_coeff_subs_indep_div_dep_Integral", "1st_homogeneous_coeff_subs_dep_div_indep_Integral", "almost_linear_Integral", "linear_coefficients_Integral", "separable_reduced_Integral", "nth_linear_constant_coeff_variation_of_parameters_Integral", "nth_linear_euler_eq_nonhomogeneous_variation_of_parameters_Integral", "Liouville_Integral", ) lie_heuristics = ( "abaco1_simple", "abaco1_product", "abaco2_similar", "abaco2_unique_unknown", "abaco2_unique_general", "linear", "function_sum", "bivariate", "chi" ) def sub_func_doit(eq, func, new): r""" When replacing the func with something else, we usually want the derivative evaluated, so this function helps in making that happen. To keep subs from having to look through all derivatives, we mask them off with dummy variables, do the func sub, and then replace masked-off derivatives with their doit values. Examples ======== >>> from sympy import Derivative, symbols, Function >>> from sympy.solvers.ode import sub_func_doit >>> x, z = symbols('x, z') >>> y = Function('y') >>> sub_func_doit(3*Derivative(y(x), x) - 1, y(x), x) 2 >>> sub_func_doit(x*Derivative(y(x), x) - y(x)**2 + y(x), y(x), ... 1/(x*(z + 1/x))) x*(-1/(x**2*(z + 1/x)) + 1/(x**3*(z + 1/x)**2)) + 1/(x*(z + 1/x)) ...- 1/(x**2*(z + 1/x)**2) """ reps = {} repu = {} for d in eq.atoms(Derivative): u = Dummy('u') repu[u] = d.subs(func, new).doit() reps[d] = u return eq.subs(reps).subs(func, new).subs(repu) def get_numbered_constants(eq, num=1, start=1, prefix='C'): """ Returns a list of constants that do not occur in eq already. """ if isinstance(eq, Expr): eq = [eq] elif not iterable(eq): raise ValueError("Expected Expr or iterable but got %s" % eq) atom_set = set().union(*[i.free_symbols for i in eq]) ncs = numbered_symbols(start=start, prefix=prefix, exclude=atom_set) Cs = [next(ncs) for i in range(num)] return (Cs[0] if num == 1 else tuple(Cs)) def dsolve(eq, func=None, hint="default", simplify=True, ics= None, xi=None, eta=None, x0=0, n=6, **kwargs): r""" Solves any (supported) kind of ordinary differential equation and system of ordinary differential equations. For single ordinary differential equation ========================================= It is classified under this when number of equation in ``eq`` is one. **Usage** ``dsolve(eq, f(x), hint)`` -> Solve ordinary differential equation ``eq`` for function ``f(x)``, using method ``hint``. **Details** ``eq`` can be any supported ordinary differential equation (see the :py:mod:`~sympy.solvers.ode` docstring for supported methods). This can either be an :py:class:`~sympy.core.relational.Equality`, or an expression, which is assumed to be equal to ``0``. ``f(x)`` is a function of one variable whose derivatives in that variable make up the ordinary differential equation ``eq``. In many cases it is not necessary to provide this; it will be autodetected (and an error raised if it couldn't be detected). ``hint`` is the solving method that you want dsolve to use. Use ``classify_ode(eq, f(x))`` to get all of the possible hints for an ODE. The default hint, ``default``, will use whatever hint is returned first by :py:meth:`~sympy.solvers.ode.classify_ode`. See Hints below for more options that you can use for hint. ``simplify`` enables simplification by :py:meth:`~sympy.solvers.ode.odesimp`. See its docstring for more information. Turn this off, for example, to disable solving of solutions for ``func`` or simplification of arbitrary constants. It will still integrate with this hint. Note that the solution may contain more arbitrary constants than the order of the ODE with this option enabled. ``xi`` and ``eta`` are the infinitesimal functions of an ordinary differential equation. They are the infinitesimals of the Lie group of point transformations for which the differential equation is invariant. The user can specify values for the infinitesimals. If nothing is specified, ``xi`` and ``eta`` are calculated using :py:meth:`~sympy.solvers.ode.infinitesimals` with the help of various heuristics. ``ics`` is the set of boundary conditions for the differential equation. It should be given in the form of ``{f(x0): x1, f(x).diff(x).subs(x, x2): x3}`` and so on. For now initial conditions are implemented only for power series solutions of first-order differential equations which should be given in the form of ``{f(x0): x1}`` (See issue 4720). If nothing is specified for this case ``f(0)`` is assumed to be ``C0`` and the power series solution is calculated about 0. ``x0`` is the point about which the power series solution of a differential equation is to be evaluated. ``n`` gives the exponent of the dependent variable up to which the power series solution of a differential equation is to be evaluated. **Hints** Aside from the various solving methods, there are also some meta-hints that you can pass to :py:meth:`~sympy.solvers.ode.dsolve`: ``default``: This uses whatever hint is returned first by :py:meth:`~sympy.solvers.ode.classify_ode`. This is the default argument to :py:meth:`~sympy.solvers.ode.dsolve`. ``all``: To make :py:meth:`~sympy.solvers.ode.dsolve` apply all relevant classification hints, use ``dsolve(ODE, func, hint="all")``. This will return a dictionary of ``hint:solution`` terms. If a hint causes dsolve to raise the ``NotImplementedError``, value of that hint's key will be the exception object raised. The dictionary will also include some special keys: - ``order``: The order of the ODE. See also :py:meth:`~sympy.solvers.deutils.ode_order` in ``deutils.py``. - ``best``: The simplest hint; what would be returned by ``best`` below. - ``best_hint``: The hint that would produce the solution given by ``best``. If more than one hint produces the best solution, the first one in the tuple returned by :py:meth:`~sympy.solvers.ode.classify_ode` is chosen. - ``default``: The solution that would be returned by default. This is the one produced by the hint that appears first in the tuple returned by :py:meth:`~sympy.solvers.ode.classify_ode`. ``all_Integral``: This is the same as ``all``, except if a hint also has a corresponding ``_Integral`` hint, it only returns the ``_Integral`` hint. This is useful if ``all`` causes :py:meth:`~sympy.solvers.ode.dsolve` to hang because of a difficult or impossible integral. This meta-hint will also be much faster than ``all``, because :py:meth:`~sympy.core.expr.Expr.integrate` is an expensive routine. ``best``: To have :py:meth:`~sympy.solvers.ode.dsolve` try all methods and return the simplest one. This takes into account whether the solution is solvable in the function, whether it contains any Integral classes (i.e. unevaluatable integrals), and which one is the shortest in size. See also the :py:meth:`~sympy.solvers.ode.classify_ode` docstring for more info on hints, and the :py:mod:`~sympy.solvers.ode` docstring for a list of all supported hints. **Tips** - You can declare the derivative of an unknown function this way: >>> from sympy import Function, Derivative >>> from sympy.abc import x # x is the independent variable >>> f = Function("f")(x) # f is a function of x >>> # f_ will be the derivative of f with respect to x >>> f_ = Derivative(f, x) - See ``test_ode.py`` for many tests, which serves also as a set of examples for how to use :py:meth:`~sympy.solvers.ode.dsolve`. - :py:meth:`~sympy.solvers.ode.dsolve` always returns an :py:class:`~sympy.core.relational.Equality` class (except for the case when the hint is ``all`` or ``all_Integral``). If possible, it solves the solution explicitly for the function being solved for. Otherwise, it returns an implicit solution. - Arbitrary constants are symbols named ``C1``, ``C2``, and so on. - Because all solutions should be mathematically equivalent, some hints may return the exact same result for an ODE. Often, though, two different hints will return the same solution formatted differently. The two should be equivalent. Also note that sometimes the values of the arbitrary constants in two different solutions may not be the same, because one constant may have "absorbed" other constants into it. - Do ``help(ode.ode_<hintname>)`` to get help more information on a specific hint, where ``<hintname>`` is the name of a hint without ``_Integral``. For system of ordinary differential equations ============================================= **Usage** ``dsolve(eq, func)`` -> Solve a system of ordinary differential equations ``eq`` for ``func`` being list of functions including `x(t)`, `y(t)`, `z(t)` where number of functions in the list depends upon the number of equations provided in ``eq``. **Details** ``eq`` can be any supported system of ordinary differential equations This can either be an :py:class:`~sympy.core.relational.Equality`, or an expression, which is assumed to be equal to ``0``. ``func`` holds ``x(t)`` and ``y(t)`` being functions of one variable which together with some of their derivatives make up the system of ordinary differential equation ``eq``. It is not necessary to provide this; it will be autodetected (and an error raised if it couldn't be detected). **Hints** The hints are formed by parameters returned by classify_sysode, combining them give hints name used later for forming method name. Examples ======== >>> from sympy import Function, dsolve, Eq, Derivative, sin, cos, symbols >>> from sympy.abc import x >>> f = Function('f') >>> dsolve(Derivative(f(x), x, x) + 9*f(x), f(x)) Eq(f(x), C1*sin(3*x) + C2*cos(3*x)) >>> eq = sin(x)*cos(f(x)) + cos(x)*sin(f(x))*f(x).diff(x) >>> dsolve(eq, hint='1st_exact') [Eq(f(x), -acos(C1/cos(x)) + 2*pi), Eq(f(x), acos(C1/cos(x)))] >>> dsolve(eq, hint='almost_linear') [Eq(f(x), -acos(C1/sqrt(-cos(x)**2)) + 2*pi), Eq(f(x), acos(C1/sqrt(-cos(x)**2)))] >>> t = symbols('t') >>> x, y = symbols('x, y', function=True) >>> eq = (Eq(Derivative(x(t),t), 12*t*x(t) + 8*y(t)), Eq(Derivative(y(t),t), 21*x(t) + 7*t*y(t))) >>> dsolve(eq) [Eq(x(t), C1*x0 + C2*x0*Integral(8*exp(Integral(7*t, t))*exp(Integral(12*t, t))/x0**2, t)), Eq(y(t), C1*y0 + C2(y0*Integral(8*exp(Integral(7*t, t))*exp(Integral(12*t, t))/x0**2, t) + exp(Integral(7*t, t))*exp(Integral(12*t, t))/x0))] >>> eq = (Eq(Derivative(x(t),t),x(t)*y(t)*sin(t)), Eq(Derivative(y(t),t),y(t)**2*sin(t))) >>> dsolve(eq) set([Eq(x(t), -exp(C1)/(C2*exp(C1) - cos(t))), Eq(y(t), -1/(C1 - cos(t)))]) """ if iterable(eq): match = classify_sysode(eq, func) eq = match['eq'] order = match['order'] func = match['func'] t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] # keep highest order term coefficient positive for i in range(len(eq)): for func_ in func: if isinstance(func_, list): pass else: if eq[i].coeff(diff(func[i],t,ode_order(eq[i], func[i]))).is_negative: eq[i] = -eq[i] match['eq'] = eq if len(set(order.values()))!=1: raise ValueError("It solves only those systems of equations whose orders are equal") match['order'] = list(order.values())[0] def recur_len(l): return sum(recur_len(item) if isinstance(item,list) else 1 for item in l) if recur_len(func) != len(eq): raise ValueError("dsolve() and classify_sysode() work with " "number of functions being equal to number of equations") if match['type_of_equation'] is None: raise NotImplementedError else: if match['is_linear'] == True: if match['no_of_equation'] > 3: solvefunc = globals()['sysode_linear_neq_order%(order)s' % match] else: solvefunc = globals()['sysode_linear_%(no_of_equation)seq_order%(order)s' % match] else: solvefunc = globals()['sysode_nonlinear_%(no_of_equation)seq_order%(order)s' % match] sols = solvefunc(match) return sols else: given_hint = hint # hint given by the user # See the docstring of _desolve for more details. hints = _desolve(eq, func=func, hint=hint, simplify=True, xi=xi, eta=eta, type='ode', ics=ics, x0=x0, n=n, **kwargs) eq = hints.pop('eq', eq) all_ = hints.pop('all', False) if all_: retdict = {} failed_hints = {} gethints = classify_ode(eq, dict=True) orderedhints = gethints['ordered_hints'] for hint in hints: try: rv = _helper_simplify(eq, hint, hints[hint], simplify) except NotImplementedError as detail: failed_hints[hint] = detail else: retdict[hint] = rv func = hints[hint]['func'] retdict['best'] = min(list(retdict.values()), key=lambda x: ode_sol_simplicity(x, func, trysolving=not simplify)) if given_hint == 'best': return retdict['best'] for i in orderedhints: if retdict['best'] == retdict.get(i, None): retdict['best_hint'] = i break retdict['default'] = gethints['default'] retdict['order'] = gethints['order'] retdict.update(failed_hints) return retdict else: # The key 'hint' stores the hint needed to be solved for. hint = hints['hint'] return _helper_simplify(eq, hint, hints, simplify) def _helper_simplify(eq, hint, match, simplify=True, **kwargs): r""" Helper function of dsolve that calls the respective :py:mod:`~sympy.solvers.ode` functions to solve for the ordinary differential equations. This minimises the computation in calling :py:meth:`~sympy.solvers.deutils._desolve` multiple times. """ r = match if hint.endswith('_Integral'): solvefunc = globals()['ode_' + hint[:-len('_Integral')]] else: solvefunc = globals()['ode_' + hint] func = r['func'] order = r['order'] match = r[hint] if simplify: # odesimp() will attempt to integrate, if necessary, apply constantsimp(), # attempt to solve for func, and apply any other hint specific # simplifications sols = solvefunc(eq, func, order, match) free = eq.free_symbols cons = lambda s: s.free_symbols.difference(free) if isinstance(sols, Expr): return odesimp(sols, func, order, cons(sols), hint) return [odesimp(s, func, order, cons(s), hint) for s in sols] else: # We still want to integrate (you can disable it separately with the hint) match['simplify'] = False # Some hints can take advantage of this option rv = _handle_Integral(solvefunc(eq, func, order, match), func, order, hint) return rv def classify_ode(eq, func=None, dict=False, ics=None, **kwargs): r""" Returns a tuple of possible :py:meth:`~sympy.solvers.ode.dsolve` classifications for an ODE. The tuple is ordered so that first item is the classification that :py:meth:`~sympy.solvers.ode.dsolve` uses to solve the ODE by default. In general, classifications at the near the beginning of the list will produce better solutions faster than those near the end, thought there are always exceptions. To make :py:meth:`~sympy.solvers.ode.dsolve` use a different classification, use ``dsolve(ODE, func, hint=<classification>)``. See also the :py:meth:`~sympy.solvers.ode.dsolve` docstring for different meta-hints you can use. If ``dict`` is true, :py:meth:`~sympy.solvers.ode.classify_ode` will return a dictionary of ``hint:match`` expression terms. This is intended for internal use by :py:meth:`~sympy.solvers.ode.dsolve`. Note that because dictionaries are ordered arbitrarily, this will most likely not be in the same order as the tuple. You can get help on different hints by executing ``help(ode.ode_hintname)``, where ``hintname`` is the name of the hint without ``_Integral``. See :py:data:`~sympy.solvers.ode.allhints` or the :py:mod:`~sympy.solvers.ode` docstring for a list of all supported hints that can be returned from :py:meth:`~sympy.solvers.ode.classify_ode`. Notes ===== These are remarks on hint names. ``_Integral`` If a classification has ``_Integral`` at the end, it will return the expression with an unevaluated :py:class:`~sympy.integrals.Integral` class in it. Note that a hint may do this anyway if :py:meth:`~sympy.core.expr.Expr.integrate` cannot do the integral, though just using an ``_Integral`` will do so much faster. Indeed, an ``_Integral`` hint will always be faster than its corresponding hint without ``_Integral`` because :py:meth:`~sympy.core.expr.Expr.integrate` is an expensive routine. If :py:meth:`~sympy.solvers.ode.dsolve` hangs, it is probably because :py:meth:`~sympy.core.expr.Expr.integrate` is hanging on a tough or impossible integral. Try using an ``_Integral`` hint or ``all_Integral`` to get it return something. Note that some hints do not have ``_Integral`` counterparts. This is because :py:meth:`~sympy.solvers.ode.integrate` is not used in solving the ODE for those method. For example, `n`\th order linear homogeneous ODEs with constant coefficients do not require integration to solve, so there is no ``nth_linear_homogeneous_constant_coeff_Integrate`` hint. You can easily evaluate any unevaluated :py:class:`~sympy.integrals.Integral`\s in an expression by doing ``expr.doit()``. Ordinals Some hints contain an ordinal such as ``1st_linear``. This is to help differentiate them from other hints, as well as from other methods that may not be implemented yet. If a hint has ``nth`` in it, such as the ``nth_linear`` hints, this means that the method used to applies to ODEs of any order. ``indep`` and ``dep`` Some hints contain the words ``indep`` or ``dep``. These reference the independent variable and the dependent function, respectively. For example, if an ODE is in terms of `f(x)`, then ``indep`` will refer to `x` and ``dep`` will refer to `f`. ``subs`` If a hints has the word ``subs`` in it, it means the the ODE is solved by substituting the expression given after the word ``subs`` for a single dummy variable. This is usually in terms of ``indep`` and ``dep`` as above. The substituted expression will be written only in characters allowed for names of Python objects, meaning operators will be spelled out. For example, ``indep``/``dep`` will be written as ``indep_div_dep``. ``coeff`` The word ``coeff`` in a hint refers to the coefficients of something in the ODE, usually of the derivative terms. See the docstring for the individual methods for more info (``help(ode)``). This is contrast to ``coefficients``, as in ``undetermined_coefficients``, which refers to the common name of a method. ``_best`` Methods that have more than one fundamental way to solve will have a hint for each sub-method and a ``_best`` meta-classification. This will evaluate all hints and return the best, using the same considerations as the normal ``best`` meta-hint. Examples ======== >>> from sympy import Function, classify_ode, Eq >>> from sympy.abc import x >>> f = Function('f') >>> classify_ode(Eq(f(x).diff(x), 0), f(x)) ('separable', '1st_linear', '1st_homogeneous_coeff_best', '1st_homogeneous_coeff_subs_indep_div_dep', '1st_homogeneous_coeff_subs_dep_div_indep', '1st_power_series', 'lie_group', 'nth_linear_constant_coeff_homogeneous', 'separable_Integral', '1st_linear_Integral', '1st_homogeneous_coeff_subs_indep_div_dep_Integral', '1st_homogeneous_coeff_subs_dep_div_indep_Integral') >>> classify_ode(f(x).diff(x, 2) + 3*f(x).diff(x) + 2*f(x) - 4) ('nth_linear_constant_coeff_undetermined_coefficients', 'nth_linear_constant_coeff_variation_of_parameters', 'nth_linear_constant_coeff_variation_of_parameters_Integral') """ prep = kwargs.pop('prep', True) if func and len(func.args) != 1: raise ValueError("dsolve() and classify_ode() only " "work with functions of one variable, not %s" % func) if prep or func is None: eq, func_ = _preprocess(eq, func) if func is None: func = func_ x = func.args[0] f = func.func y = Dummy('y') xi = kwargs.get('xi') eta = kwargs.get('eta') terms = kwargs.get('n') if isinstance(eq, Equality): if eq.rhs != 0: return classify_ode(eq.lhs - eq.rhs, func, ics=ics, xi=xi, n=terms, eta=eta, prep=False) eq = eq.lhs order = ode_order(eq, f(x)) # hint:matchdict or hint:(tuple of matchdicts) # Also will contain "default":<default hint> and "order":order items. matching_hints = {"order": order} if not order: if dict: matching_hints["default"] = None return matching_hints else: return () df = f(x).diff(x) a = Wild('a', exclude=[f(x)]) b = Wild('b', exclude=[f(x)]) c = Wild('c', exclude=[f(x)]) d = Wild('d', exclude=[df, f(x).diff(x, 2)]) e = Wild('e', exclude=[df]) k = Wild('k', exclude=[df]) n = Wild('n', exclude=[f(x)]) c1 = Wild('c1', exclude=[x]) a2 = Wild('a2', exclude=[x, f(x), df]) b2 = Wild('b2', exclude=[x, f(x), df]) c2 = Wild('c2', exclude=[x, f(x), df]) d2 = Wild('d2', exclude=[x, f(x), df]) a3 = Wild('a3', exclude=[f(x), df, f(x).diff(x, 2)]) b3 = Wild('b3', exclude=[f(x), df, f(x).diff(x, 2)]) c3 = Wild('c3', exclude=[f(x), df, f(x).diff(x, 2)]) r3 = {'xi': xi, 'eta': eta} # Used for the lie_group hint boundary = {} # Used to extract initial conditions C1 = Symbol("C1") eq = expand(eq) # Preprocessing to get the initial conditions out if ics is not None: for funcarg in ics: # Separating derivatives if isinstance(funcarg, Subs): deriv = funcarg.expr old = funcarg.variables[0] new = funcarg.point[0] if isinstance(deriv, Derivative) and isinstance(deriv.args[0], AppliedUndef) and deriv.args[0].func == f and old == x and not new.has(x): dorder = ode_order(deriv, x) temp = 'f' + str(dorder) boundary.update({temp: new, temp + 'val': ics[funcarg]}) else: raise ValueError("Enter valid boundary conditions for Derivatives") # Separating functions elif isinstance(funcarg, AppliedUndef): if funcarg.func == f and len(funcarg.args) == 1 and \ not funcarg.args[0].has(x): boundary.update({'f0': funcarg.args[0], 'f0val': ics[funcarg]}) else: raise ValueError("Enter valid boundary conditions for Function") else: raise ValueError("Enter boundary conditions of the form ics " " = {f(point}: value, f(point).diff(point, order).subs(arg, point) " ":value") # Precondition to try remove f(x) from highest order derivative reduced_eq = None if eq.is_Add: deriv_coef = eq.coeff(f(x).diff(x, order)) if deriv_coef not in (1, 0): r = deriv_coef.match(a*f(x)**c1) if r and r[c1]: den = f(x)**r[c1] reduced_eq = Add(*[arg/den for arg in eq.args]) if not reduced_eq: reduced_eq = eq if order == 1: ## Linear case: a(x)*y'+b(x)*y+c(x) == 0 if eq.is_Add: ind, dep = reduced_eq.as_independent(f) else: u = Dummy('u') ind, dep = (reduced_eq + u).as_independent(f) ind, dep = [tmp.subs(u, 0) for tmp in [ind, dep]] r = {a: dep.coeff(df), b: dep.coeff(f(x)), c: ind} # double check f[a] since the preconditioning may have failed if not r[a].has(f) and not r[b].has(f) and ( r[a]*df + r[b]*f(x) + r[c]).expand() - reduced_eq == 0: r['a'] = a r['b'] = b r['c'] = c matching_hints["1st_linear"] = r matching_hints["1st_linear_Integral"] = r ## Bernoulli case: a(x)*y'+b(x)*y+c(x)*y**n == 0 r = collect( reduced_eq, f(x), exact=True).match(a*df + b*f(x) + c*f(x)**n) if r and r[c] != 0 and r[n] != 1: # See issue 4676 r['a'] = a r['b'] = b r['c'] = c r['n'] = n matching_hints["Bernoulli"] = r matching_hints["Bernoulli_Integral"] = r ## Riccati special n == -2 case: a2*y'+b2*y**2+c2*y/x+d2/x**2 == 0 r = collect(reduced_eq, f(x), exact=True).match(a2*df + b2*f(x)**2 + c2*f(x)/x + d2/x**2) if r and r[b2] != 0 and (r[c2] != 0 or r[d2] != 0): r['a2'] = a2 r['b2'] = b2 r['c2'] = c2 r['d2'] = d2 matching_hints["Riccati_special_minus2"] = r # NON-REDUCED FORM OF EQUATION matches r = collect(eq, df, exact=True).match(d + e * df) if r: r['d'] = d r['e'] = e r['y'] = y r[d] = r[d].subs(f(x), y) r[e] = r[e].subs(f(x), y) # FIRST ORDER POWER SERIES WHICH NEEDS INITIAL CONDITIONS # TODO: Hint first order series should match only if d/e is analytic. # For now, only d/e and (d/e).diff(arg) is checked for existence at # at a given point. # This is currently done internally in ode_1st_power_series. point = boundary.get('f0', 0) value = boundary.get('f0val', C1) check = cancel(r[d]/r[e]) check1 = check.subs({x: point, y: value}) if not check1.has(oo) and not check1.has(zoo) and \ not check1.has(NaN) and not check1.has(-oo): check2 = (check1.diff(x)).subs({x: point, y: value}) if not check2.has(oo) and not check2.has(zoo) and \ not check2.has(NaN) and not check2.has(-oo): rseries = r.copy() rseries.update({'terms': terms, 'f0': point, 'f0val': value}) matching_hints["1st_power_series"] = rseries r3.update(r) ## Exact Differential Equation: P(x, y) + Q(x, y)*y' = 0 where # dP/dy == dQ/dx try: if r[d] != 0: numerator = simplify(r[d].diff(y) - r[e].diff(x)) # The following few conditions try to convert a non-exact # differential equation into an exact one. # References : Differential equations with applications # and historical notes - George E. Simmons if numerator: # If (dP/dy - dQ/dx) / Q = f(x) # then exp(integral(f(x))*equation becomes exact factor = simplify(numerator/r[e]) variables = factor.free_symbols if len(variables) == 1 and x == variables.pop(): factor = exp(Integral(factor).doit()) r[d] *= factor r[e] *= factor matching_hints["1st_exact"] = r matching_hints["1st_exact_Integral"] = r else: # If (dP/dy - dQ/dx) / -P = f(y) # then exp(integral(f(y))*equation becomes exact factor = simplify(-numerator/r[d]) variables = factor.free_symbols if len(variables) == 1 and y == variables.pop(): factor = exp(Integral(factor).doit()) r[d] *= factor r[e] *= factor matching_hints["1st_exact"] = r matching_hints["1st_exact_Integral"] = r else: matching_hints["1st_exact"] = r matching_hints["1st_exact_Integral"] = r except NotImplementedError: # Differentiating the coefficients might fail because of things # like f(2*x).diff(x). See issue 4624 and issue 4719. pass # Any first order ODE can be ideally solved by the Lie Group # method matching_hints["lie_group"] = r3 # This match is used for several cases below; we now collect on # f(x) so the matching works. r = collect(reduced_eq, df, exact=True).match(d + e*df) if r: # Using r[d] and r[e] without any modification for hints # linear-coefficients and separable-reduced. num, den = r[d], r[e] # ODE = d/e + df r['d'] = d r['e'] = e r['y'] = y r[d] = num.subs(f(x), y) r[e] = den.subs(f(x), y) ## Separable Case: y' == P(y)*Q(x) r[d] = separatevars(r[d]) r[e] = separatevars(r[e]) # m1[coeff]*m1[x]*m1[y] + m2[coeff]*m2[x]*m2[y]*y' m1 = separatevars(r[d], dict=True, symbols=(x, y)) m2 = separatevars(r[e], dict=True, symbols=(x, y)) if m1 and m2: r1 = {'m1': m1, 'm2': m2, 'y': y} matching_hints["separable"] = r1 matching_hints["separable_Integral"] = r1 ## First order equation with homogeneous coefficients: # dy/dx == F(y/x) or dy/dx == F(x/y) ordera = homogeneous_order(r[d], x, y) if ordera is not None: orderb = homogeneous_order(r[e], x, y) if ordera == orderb: # u1=y/x and u2=x/y u1 = Dummy('u1') u2 = Dummy('u2') s = "1st_homogeneous_coeff_subs" s1 = s + "_dep_div_indep" s2 = s + "_indep_div_dep" if simplify((r[d] + u1*r[e]).subs({x: 1, y: u1})) != 0: matching_hints[s1] = r matching_hints[s1 + "_Integral"] = r if simplify((r[e] + u2*r[d]).subs({x: u2, y: 1})) != 0: matching_hints[s2] = r matching_hints[s2 + "_Integral"] = r if s1 in matching_hints and s2 in matching_hints: matching_hints["1st_homogeneous_coeff_best"] = r ## Linear coefficients of the form # y'+ F((a*x + b*y + c)/(a'*x + b'y + c')) = 0 # that can be reduced to homogeneous form. F = num/den params = _linear_coeff_match(F, func) if params: xarg, yarg = params u = Dummy('u') t = Dummy('t') # Dummy substitution for df and f(x). dummy_eq = reduced_eq.subs(((df, t), (f(x), u))) reps = ((x, x + xarg), (u, u + yarg), (t, df), (u, f(x))) dummy_eq = simplify(dummy_eq.subs(reps)) # get the re-cast values for e and d r2 = collect(expand(dummy_eq), [df, f(x)]).match(e*df + d) if r2: orderd = homogeneous_order(r2[d], x, f(x)) if orderd is not None: ordere = homogeneous_order(r2[e], x, f(x)) if orderd == ordere: # Match arguments are passed in such a way that it # is coherent with the already existing homogeneous # functions. r2[d] = r2[d].subs(f(x), y) r2[e] = r2[e].subs(f(x), y) r2.update({'xarg': xarg, 'yarg': yarg, 'd': d, 'e': e, 'y': y}) matching_hints["linear_coefficients"] = r2 matching_hints["linear_coefficients_Integral"] = r2 ## Equation of the form y' + (y/x)*H(x^n*y) = 0 # that can be reduced to separable form factor = simplify(x/f(x)*num/den) # Try representing factor in terms of x^n*y # where n is lowest power of x in factor; # first remove terms like sqrt(2)*3 from factor.atoms(Mul) u = None for mul in ordered(factor.atoms(Mul)): if mul.has(x): _, u = mul.as_independent(x, f(x)) break if u and u.has(f(x)): h = x**(degree(Poly(u.subs(f(x), y), gen=x)))*f(x) p = Wild('p') if (u/h == 1) or ((u/h).simplify().match(x**p)): t = Dummy('t') r2 = {'t': t} xpart, ypart = u.as_independent(f(x)) test = factor.subs(((u, t), (1/u, 1/t))) free = test.free_symbols if len(free) == 1 and free.pop() == t: r2.update({'power': xpart.as_base_exp()[1], 'u': test}) matching_hints["separable_reduced"] = r2 matching_hints["separable_reduced_Integral"] = r2 ## Almost-linear equation of the form f(x)*g(y)*y' + k(x)*l(y) + m(x) = 0 r = collect(eq, [df, f(x)]).match(e*df + d) if r: r2 = r.copy() r2[c] = S.Zero if r2[d].is_Add: # Separate the terms having f(x) to r[d] and # remaining to r[c] no_f, r2[d] = r2[d].as_independent(f(x)) r2[c] += no_f factor = simplify(r2[d].diff(f(x))/r[e]) if factor and not factor.has(f(x)): r2[d] = factor_terms(r2[d]) u = r2[d].as_independent(f(x), as_Add=False)[1] r2.update({'a': e, 'b': d, 'c': c, 'u': u}) r2[d] /= u r2[e] /= u.diff(f(x)) matching_hints["almost_linear"] = r2 matching_hints["almost_linear_Integral"] = r2 elif order == 2: # Liouville ODE in the form # f(x).diff(x, 2) + g(f(x))*(f(x).diff(x))**2 + h(x)*f(x).diff(x) # See Goldstein and Braun, "Advanced Methods for the Solution of # Differential Equations", pg. 98 s = d*f(x).diff(x, 2) + e*df**2 + k*df r = reduced_eq.match(s) if r and r[d] != 0: y = Dummy('y') g = simplify(r[e]/r[d]).subs(f(x), y) h = simplify(r[k]/r[d]) if h.has(f(x)) or g.has(x): pass else: r = {'g': g, 'h': h, 'y': y} matching_hints["Liouville"] = r matching_hints["Liouville_Integral"] = r # Homogeneous second order differential equation of the form # a3*f(x).diff(x, 2) + b3*f(x).diff(x) + c3, where # for simplicity, a3, b3 and c3 are assumed to be polynomials. # It has a definite power series solution at point x0 if, b3/a3 and c3/a3 # are analytic at x0. deq = a3*(f(x).diff(x, 2)) + b3*df + c3*f(x) r = collect(reduced_eq, [f(x).diff(x, 2), f(x).diff(x), f(x)]).match(deq) ordinary = False if r and r[a3] != 0: if all([r[key].is_polynomial() for key in r]): p = cancel(r[b3]/r[a3]) # Used below q = cancel(r[c3]/r[a3]) # Used below point = kwargs.get('x0', 0) check = p.subs(x, point) if not check.has(oo) and not check.has(NaN) and \ not check.has(zoo) and not check.has(-oo): check = q.subs(x, point) if not check.has(oo) and not check.has(NaN) and \ not check.has(zoo) and not check.has(-oo): ordinary = True r.update({'a3': a3, 'b3': b3, 'c3': c3, 'x0': point, 'terms': terms}) matching_hints["2nd_power_series_ordinary"] = r # Checking if the differential equation has a regular singular point # at x0. It has a regular singular point at x0, if (b3/a3)*(x - x0) # and (c3/a3)*((x - x0)**2) are analytic at x0. if not ordinary: p = cancel((x - point)*p) check = p.subs(x, point) if not check.has(oo) and not check.has(NaN) and \ not check.has(zoo) and not check.has(-oo): q = cancel(((x - point)**2)*q) check = q.subs(x, point) if not check.has(oo) and not check.has(NaN) and \ not check.has(zoo) and not check.has(-oo): coeff_dict = {'p': p, 'q': q, 'x0': point, 'terms': terms} matching_hints["2nd_power_series_regular"] = coeff_dict if order > 0: # nth order linear ODE # a_n(x)y^(n) + ... + a_1(x)y' + a_0(x)y = F(x) = b r = _nth_linear_match(reduced_eq, func, order) # Constant coefficient case (a_i is constant for all i) if r and not any(r[i].has(x) for i in r if i >= 0): # Inhomogeneous case: F(x) is not identically 0 if r[-1]: undetcoeff = _undetermined_coefficients_match(r[-1], x) s = "nth_linear_constant_coeff_variation_of_parameters" matching_hints[s] = r matching_hints[s + "_Integral"] = r if undetcoeff['test']: r['trialset'] = undetcoeff['trialset'] matching_hints[ "nth_linear_constant_coeff_undetermined_coefficients" ] = r # Homogeneous case: F(x) is identically 0 else: matching_hints["nth_linear_constant_coeff_homogeneous"] = r # nth order Euler equation a_n*x**n*y^(n) + ... + a_1*x*y' + a_0*y = F(x) #In case of Homogeneous euler equation F(x) = 0 def _test_term(coeff, order): r""" Linear Euler ODEs have the form K*x**order*diff(y(x),x,order) = F(x), where K is independent of x and y(x), order>= 0. So we need to check that for each term, coeff == K*x**order from some K. We have a few cases, since coeff may have several different types. """ if order < 0: raise ValueError("order should be greater than 0") if coeff == 0: return True if order == 0: if x in coeff.free_symbols: return False return True if coeff.is_Mul: if coeff.has(f(x)): return False return x**order in coeff.args elif coeff.is_Pow: return coeff.as_base_exp() == (x, order) elif order == 1: return x == coeff return False if r and not any(not _test_term(r[i], i) for i in r if i >= 0): if not r[-1]: matching_hints["nth_linear_euler_eq_homogeneous"] = r else: matching_hints["nth_linear_euler_eq_nonhomogeneous_variation_of_parameters"] = r matching_hints["nth_linear_euler_eq_nonhomogeneous_variation_of_parameters_Integral"] = r e, re = posify(r[-1].subs(x, exp(x))) undetcoeff = _undetermined_coefficients_match(e.subs(re), x) if undetcoeff['test']: r['trialset'] = undetcoeff['trialset'] matching_hints["nth_linear_euler_eq_nonhomogeneous_undetermined_coefficients"] = r # Order keys based on allhints. retlist = [i for i in allhints if i in matching_hints] if dict: # Dictionaries are ordered arbitrarily, so make note of which # hint would come first for dsolve(). Use an ordered dict in Py 3. matching_hints["default"] = retlist[0] if retlist else None matching_hints["ordered_hints"] = tuple(retlist) return matching_hints else: return tuple(retlist) def classify_sysode(eq, funcs=None, **kwargs): r""" Returns a dictionary of parameter names and values that define the system of ordinary differential equations in ``eq``. The parameters are further used in :py:meth:`~sympy.solvers.ode.dsolve` for solving that system. The parameter names and values are: 'is_linear' (boolean), which tells whether the given system is linear. Note that "linear" here refers to the operator: terms such as ``x*diff(x,t)`` are nonlinear, whereas terms like ``sin(t)*diff(x,t)`` are still linear operators. 'func' (list) contains the :py:class:`~sympy.core.function.Function`s that appear with a derivative in the ODE, i.e. those that we are trying to solve the ODE for. 'order' (dict) with the maximum derivative for each element of the 'func' parameter. 'func_coeff' (dict) with the coefficient for each triple ``(equation number, function, order)```. The coefficients are those subexpressions that do not appear in 'func', and hence can be considered constant for purposes of ODE solving. 'eq' (list) with the equations from ``eq``, sympified and transformed into expressions (we are solving for these expressions to be zero). 'no_of_equations' (int) is the number of equations (same as ``len(eq)``). 'type_of_equation' (string) is an internal classification of the type of ODE. References ========== -http://eqworld.ipmnet.ru/en/solutions/sysode/sode-toc1.htm -A. D. Polyanin and A. V. Manzhirov, Handbook of Mathematics for Engineers and Scientists Examples ======== >>> from sympy import Function, Eq, symbols, diff >>> from sympy.solvers.ode import classify_sysode >>> from sympy.abc import t >>> f, x, y = symbols('f, x, y', function=True) >>> k, l, m, n = symbols('k, l, m, n', Integer=True) >>> x1 = diff(x(t), t) ; y1 = diff(y(t), t) >>> x2 = diff(x(t), t, t) ; y2 = diff(y(t), t, t) >>> eq = (Eq(5*x1, 12*x(t) - 6*y(t)), Eq(2*y1, 11*x(t) + 3*y(t))) >>> classify_sysode(eq) {'eq': [-12*x(t) + 6*y(t) + 5*Derivative(x(t), t), -11*x(t) - 3*y(t) + 2*Derivative(y(t), t)], 'func': [x(t), y(t)], 'func_coeff': {(0, x(t), 0): -12, (0, x(t), 1): 5, (0, y(t), 0): 6, (0, y(t), 1): 0, (1, x(t), 0): -11, (1, x(t), 1): 0, (1, y(t), 0): -3, (1, y(t), 1): 2}, 'is_linear': True, 'no_of_equation': 2, 'order': {x(t): 1, y(t): 1}, 'type_of_equation': 'type1'} >>> eq = (Eq(diff(x(t),t), 5*t*x(t) + t**2*y(t)), Eq(diff(y(t),t), -t**2*x(t) + 5*t*y(t))) >>> classify_sysode(eq) {'eq': [-t**2*y(t) - 5*t*x(t) + Derivative(x(t), t), t**2*x(t) - 5*t*y(t) + Derivative(y(t), t)], 'func': [x(t), y(t)], 'func_coeff': {(0, x(t), 0): -5*t, (0, x(t), 1): 1, (0, y(t), 0): -t**2, (0, y(t), 1): 0, (1, x(t), 0): t**2, (1, x(t), 1): 0, (1, y(t), 0): -5*t, (1, y(t), 1): 1}, 'is_linear': True, 'no_of_equation': 2, 'order': {x(t): 1, y(t): 1}, 'type_of_equation': 'type4'} """ # Sympify equations and convert iterables of equations into # a list of equations def _sympify(eq): return list(map(sympify, eq if iterable(eq) else [eq])) eq, funcs = (_sympify(w) for w in [eq, funcs]) for i, fi in enumerate(eq): if isinstance(fi, Equality): eq[i] = fi.lhs - fi.rhs matching_hints = {"no_of_equation":i+1} matching_hints['eq'] = eq if i==0: raise ValueError("classify_sysode() works for systems of ODEs. " "For scalar ODEs, classify_ode should be used") t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] # find all the functions if not given order = dict() if funcs==[None]: funcs = [] for eqs in eq: derivs = eqs.atoms(Derivative) func = set().union(*[d.atoms(AppliedUndef) for d in derivs]) for func_ in func: order[func_] = 0 funcs.append(func_) funcs = list(set(funcs)) if len(funcs) < len(eq): raise ValueError("Number of functions given is less than number of equations %s" % funcs) func_dict = dict() for func in funcs: if not order[func]: max_order = 0 for i, eqs_ in enumerate(eq): order_ = ode_order(eqs_,func) if max_order < order_: max_order = order_ eq_no = i if eq_no in func_dict: list_func = [] list_func.append(func_dict[eq_no]) list_func.append(func) func_dict[eq_no] = list_func else: func_dict[eq_no] = func order[func] = max_order funcs = [func_dict[i] for i in range(len(func_dict))] matching_hints['func'] = funcs for func in funcs: if isinstance(func, list): for func_elem in func: if len(func_elem.args) != 1: raise ValueError("dsolve() and classify_sysode() work with " "functions of one variable only, not %s" % func) else: if func and len(func.args) != 1: raise ValueError("dsolve() and classify_sysode() work with " "functions of one variable only, not %s" % func) # find the order of all equation in system of odes matching_hints["order"] = order # find coefficients of terms f(t), diff(f(t),t) and higher derivatives # and similarly for other functions g(t), diff(g(t),t) in all equations. # Here j denotes the equation number, funcs[l] denotes the function about # which we are talking about and k denotes the order of function funcs[l] # whose coefficient we are calculating. def linearity_check(eqs, j, func, is_linear_): for k in range(order[func]+1): func_coef[j,func,k] = collect(eqs.expand(),[diff(func,t,k)]).coeff(diff(func,t,k)) if is_linear_ == True: if func_coef[j,func,k]==0: if k==0: coef = eqs.as_independent(func)[1] for xr in range(1, ode_order(eqs,func)+1): coef -= eqs.as_independent(diff(func,t,xr))[1] if coef != 0: is_linear_ = False else: if eqs.as_independent(diff(func,t,k))[1]: is_linear_ = False else: for func_ in funcs: if isinstance(func_, list): for elem_func_ in func_: dep = func_coef[j,func,k].as_independent(elem_func_)[1] if dep!=1 and dep!=0: is_linear_ = False else: dep = func_coef[j,func,k].as_independent(func_)[1] if dep!=1 and dep!=0: is_linear_ = False return is_linear_ func_coef = {} is_linear = True for j, eqs in enumerate(eq): for func in funcs: if isinstance(func, list): for func_elem in func: is_linear = linearity_check(eqs, j, func_elem, is_linear) else: is_linear = linearity_check(eqs, j, func, is_linear) matching_hints['func_coeff'] = func_coef matching_hints['is_linear'] = is_linear if len(set(order.values()))==1: order_eq = list(matching_hints['order'].values())[0] if matching_hints['is_linear'] == True: if matching_hints['no_of_equation'] == 2: if order_eq == 1: type_of_equation = check_linear_2eq_order1(eq, funcs, func_coef) elif order_eq == 2: type_of_equation = check_linear_2eq_order2(eq, funcs, func_coef) else: type_of_equation = None elif matching_hints['no_of_equation'] == 3: if order_eq == 1: type_of_equation = check_linear_3eq_order1(eq, funcs, func_coef) if type_of_equation==None: type_of_equation = check_linear_neq_order1(eq, funcs, func_coef) else: type_of_equation = None else: if order_eq == 1: type_of_equation = check_linear_neq_order1(eq, funcs, func_coef) else: type_of_equation = None else: if matching_hints['no_of_equation'] == 2: if order_eq == 1: type_of_equation = check_nonlinear_2eq_order1(eq, funcs, func_coef) else: type_of_equation = None elif matching_hints['no_of_equation'] == 3: if order_eq == 1: type_of_equation = check_nonlinear_3eq_order1(eq, funcs, func_coef) else: type_of_equation = None else: type_of_equation = None else: type_of_equation = None matching_hints['type_of_equation'] = type_of_equation return matching_hints def check_linear_2eq_order1(eq, func, func_coef): x = func[0].func y = func[1].func fc = func_coef t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] r = dict() # for equations Eq(a1*diff(x(t),t), b1*x(t) + c1*y(t) + d1) # and Eq(a2*diff(y(t),t), b2*x(t) + c2*y(t) + d2) r['a1'] = fc[0,x(t),1] ; r['a2'] = fc[1,y(t),1] r['b1'] = -fc[0,x(t),0]/fc[0,x(t),1] ; r['b2'] = -fc[1,x(t),0]/fc[1,y(t),1] r['c1'] = -fc[0,y(t),0]/fc[0,x(t),1] ; r['c2'] = -fc[1,y(t),0]/fc[1,y(t),1] forcing = [S(0),S(0)] for i in range(2): for j in Add.make_args(eq[i]): if not j.has(x(t), y(t)): forcing[i] += j if not (forcing[0].has(t) or forcing[1].has(t)): # We can handle homogeneous case and simple constant forcings r['d1'] = forcing[0] r['d2'] = forcing[1] else: # Issue #9244: nonhomogeneous linear systems are not supported return None # Conditions to check for type 6 whose equations are Eq(diff(x(t),t), f(t)*x(t) + g(t)*y(t)) and # Eq(diff(y(t),t), a*[f(t) + a*h(t)]x(t) + a*[g(t) - h(t)]*y(t)) p = 0 q = 0 p1 = cancel(r['b2']/(cancel(r['b2']/r['c2']).as_numer_denom()[0])) p2 = cancel(r['b1']/(cancel(r['b1']/r['c1']).as_numer_denom()[0])) for n, i in enumerate([p1, p2]): for j in Mul.make_args(collect_const(i)): if not j.has(t): q = j if q and n==0: if ((r['b2']/j - r['b1'])/(r['c1'] - r['c2']/j)) == j: p = 1 elif q and n==1: if ((r['b1']/j - r['b2'])/(r['c2'] - r['c1']/j)) == j: p = 2 # End of condition for type 6 if r['d1']!=0 or r['d2']!=0: if not r['d1'].has(t) and not r['d2'].has(t): if all(not r[k].has(t) for k in 'a1 a2 b1 b2 c1 c2'.split()): # Equations for type 2 are Eq(a1*diff(x(t),t),b1*x(t)+c1*y(t)+d1) and Eq(a2*diff(y(t),t),b2*x(t)+c2*y(t)+d2) return "type2" else: return None else: if all(not r[k].has(t) for k in 'a1 a2 b1 b2 c1 c2'.split()): # Equations for type 1 are Eq(a1*diff(x(t),t),b1*x(t)+c1*y(t)) and Eq(a2*diff(y(t),t),b2*x(t)+c2*y(t)) return "type1" else: r['b1'] = r['b1']/r['a1'] ; r['b2'] = r['b2']/r['a2'] r['c1'] = r['c1']/r['a1'] ; r['c2'] = r['c2']/r['a2'] if (r['b1'] == r['c2']) and (r['c1'] == r['b2']): # Equation for type 3 are Eq(diff(x(t),t), f(t)*x(t) + g(t)*y(t)) and Eq(diff(y(t),t), g(t)*x(t) + f(t)*y(t)) return "type3" elif (r['b1'] == r['c2']) and (r['c1'] == -r['b2']) or (r['b1'] == -r['c2']) and (r['c1'] == r['b2']): # Equation for type 4 are Eq(diff(x(t),t), f(t)*x(t) + g(t)*y(t)) and Eq(diff(y(t),t), -g(t)*x(t) + f(t)*y(t)) return "type4" elif (not cancel(r['b2']/r['c1']).has(t) and not cancel((r['c2']-r['b1'])/r['c1']).has(t)) \ or (not cancel(r['b1']/r['c2']).has(t) and not cancel((r['c1']-r['b2'])/r['c2']).has(t)): # Equations for type 5 are Eq(diff(x(t),t), f(t)*x(t) + g(t)*y(t)) and Eq(diff(y(t),t), a*g(t)*x(t) + [f(t) + b*g(t)]*y(t) return "type5" elif p: return "type6" else: # Equations for type 7 are Eq(diff(x(t),t), f(t)*x(t) + g(t)*y(t)) and Eq(diff(y(t),t), h(t)*x(t) + p(t)*y(t)) return "type7" def check_linear_2eq_order2(eq, func, func_coef): x = func[0].func y = func[1].func fc = func_coef t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] r = dict() a = Wild('a', exclude=[1/t]) b = Wild('b', exclude=[1/t**2]) u = Wild('u', exclude=[t, t**2]) v = Wild('v', exclude=[t, t**2]) w = Wild('w', exclude=[t, t**2]) p = Wild('p', exclude=[t, t**2]) r['a1'] = fc[0,x(t),2] ; r['a2'] = fc[1,y(t),2] r['b1'] = fc[0,x(t),1] ; r['b2'] = fc[1,x(t),1] r['c1'] = fc[0,y(t),1] ; r['c2'] = fc[1,y(t),1] r['d1'] = fc[0,x(t),0] ; r['d2'] = fc[1,x(t),0] r['e1'] = fc[0,y(t),0] ; r['e2'] = fc[1,y(t),0] const = [S(0), S(0)] for i in range(2): for j in Add.make_args(eq[i]): if not (j.has(x(t)) or j.has(y(t))): const[i] += j r['f1'] = const[0] r['f2'] = const[1] if r['f1']!=0 or r['f2']!=0: if all(not r[k].has(t) for k in 'a1 a2 d1 d2 e1 e2 f1 f2'.split()) \ and r['b1']==r['c1']==r['b2']==r['c2']==0: return "type2" elif all(not r[k].has(t) for k in 'a1 a2 b1 b2 c1 c2 d1 d2 e1 e1'.split()): p = [S(0), S(0)] ; q = [S(0), S(0)] for n, e in enumerate([r['f1'], r['f2']]): if e.has(t): tpart = e.as_independent(t, Mul)[1] for i in Mul.make_args(tpart): if i.has(exp): b, e = i.as_base_exp() co = e.coeff(t) if co and not co.has(t) and co.has(I): p[n] = 1 else: q[n] = 1 else: q[n] = 1 else: q[n] = 1 if p[0]==1 and p[1]==1 and q[0]==0 and q[1]==0: return "type4" else: return None else: return None else: if r['b1']==r['b2']==r['c1']==r['c2']==0 and all(not r[k].has(t) \ for k in 'a1 a2 d1 d2 e1 e2'.split()): return "type1" elif r['b1']==r['e1']==r['c2']==r['d2']==0 and all(not r[k].has(t) \ for k in 'a1 a2 b2 c1 d1 e2'.split()) and r['c1'] == -r['b2'] and \ r['d1'] == r['e2']: return "type3" elif cancel(-r['b2']/r['d2'])==t and cancel(-r['c1']/r['e1'])==t and not \ (r['d2']/r['a2']).has(t) and not (r['e1']/r['a1']).has(t) and \ r['b1']==r['d1']==r['c2']==r['e2']==0: return "type5" elif ((r['a1']/r['d1']).expand()).match((p*(u*t**2+v*t+w)**2).expand()) and not \ (cancel(r['a1']*r['d2']/(r['a2']*r['d1']))).has(t) and not (r['d1']/r['e1']).has(t) and not \ (r['d2']/r['e2']).has(t) and r['b1'] == r['b2'] == r['c1'] == r['c2'] == 0: return "type10" elif not cancel(r['d1']/r['e1']).has(t) and not cancel(r['d2']/r['e2']).has(t) and not \ cancel(r['d1']*r['a2']/(r['d2']*r['a1'])).has(t) and r['b1']==r['b2']==r['c1']==r['c2']==0: return "type6" elif not cancel(r['b1']/r['c1']).has(t) and not cancel(r['b2']/r['c2']).has(t) and not \ cancel(r['b1']*r['a2']/(r['b2']*r['a1'])).has(t) and r['d1']==r['d2']==r['e1']==r['e2']==0: return "type7" elif cancel(-r['b2']/r['d2'])==t and cancel(-r['c1']/r['e1'])==t and not \ cancel(r['e1']*r['a2']/(r['d2']*r['a1'])).has(t) and r['e1'].has(t) \ and r['b1']==r['d1']==r['c2']==r['e2']==0: return "type8" elif (r['b1']/r['a1']).match(a/t) and (r['b2']/r['a2']).match(a/t) and not \ (r['b1']/r['c1']).has(t) and not (r['b2']/r['c2']).has(t) and \ (r['d1']/r['a1']).match(b/t**2) and (r['d2']/r['a2']).match(b/t**2) \ and not (r['d1']/r['e1']).has(t) and not (r['d2']/r['e2']).has(t): return "type9" elif -r['b1']/r['d1']==-r['c1']/r['e1']==-r['b2']/r['d2']==-r['c2']/r['e2']==t: return "type11" else: return None def check_linear_3eq_order1(eq, func, func_coef): x = func[0].func y = func[1].func z = func[2].func fc = func_coef t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] r = dict() r['a1'] = fc[0,x(t),1]; r['a2'] = fc[1,y(t),1]; r['a3'] = fc[2,z(t),1] r['b1'] = fc[0,x(t),0]; r['b2'] = fc[1,x(t),0]; r['b3'] = fc[2,x(t),0] r['c1'] = fc[0,y(t),0]; r['c2'] = fc[1,y(t),0]; r['c3'] = fc[2,y(t),0] r['d1'] = fc[0,z(t),0]; r['d2'] = fc[1,z(t),0]; r['d3'] = fc[2,z(t),0] forcing = [S(0), S(0), S(0)] for i in range(3): for j in Add.make_args(eq[i]): if not j.has(x(t), y(t), z(t)): forcing[i] += j if forcing[0].has(t) or forcing[1].has(t) or forcing[2].has(t): # We can handle homogeneous case and simple constant forcings. # Issue #9244: nonhomogeneous linear systems are not supported return None if all(not r[k].has(t) for k in 'a1 a2 a3 b1 b2 b3 c1 c2 c3 d1 d2 d3'.split()): if r['c1']==r['d1']==r['d2']==0: return 'type1' elif r['c1'] == -r['b2'] and r['d1'] == -r['b3'] and r['d2'] == -r['c3'] \ and r['b1'] == r['c2'] == r['d3'] == 0: return 'type2' elif r['b1'] == r['c2'] == r['d3'] == 0 and r['c1']/r['a1'] == -r['d1']/r['a1'] \ and r['d2']/r['a2'] == -r['b2']/r['a2'] and r['b3']/r['a3'] == -r['c3']/r['a3']: return 'type3' else: return None else: for k1 in 'c1 d1 b2 d2 b3 c3'.split(): if r[k1] == 0: continue else: if all(not cancel(r[k1]/r[k]).has(t) for k in 'd1 b2 d2 b3 c3'.split() if r[k]!=0) \ and all(not cancel(r[k1]/(r['b1'] - r[k])).has(t) for k in 'b1 c2 d3'.split() if r['b1']!=r[k]): return 'type4' else: break return None def check_linear_neq_order1(eq, func, func_coef): x = func[0].func y = func[1].func z = func[2].func fc = func_coef t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] r = dict() n = len(eq) for i in range(n): for j in range(n): if (fc[i,func[j],0]/fc[i,func[i],1]).has(t): return None if len(eq)==3: return 'type6' return 'type1' def check_nonlinear_2eq_order1(eq, func, func_coef): t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] f = Wild('f') g = Wild('g') u, v = symbols('u, v', cls=Dummy) def check_type(x, y): r1 = eq[0].match(t*diff(x(t),t) - x(t) + f) r2 = eq[1].match(t*diff(y(t),t) - y(t) + g) if not (r1 and r2): r1 = eq[0].match(diff(x(t),t) - x(t)/t + f/t) r2 = eq[1].match(diff(y(t),t) - y(t)/t + g/t) if not (r1 and r2): r1 = (-eq[0]).match(t*diff(x(t),t) - x(t) + f) r2 = (-eq[1]).match(t*diff(y(t),t) - y(t) + g) if not (r1 and r2): r1 = (-eq[0]).match(diff(x(t),t) - x(t)/t + f/t) r2 = (-eq[1]).match(diff(y(t),t) - y(t)/t + g/t) if r1 and r2 and not (r1[f].subs(diff(x(t),t),u).subs(diff(y(t),t),v).has(t) \ or r2[g].subs(diff(x(t),t),u).subs(diff(y(t),t),v).has(t)): return 'type5' else: return None for func_ in func: if isinstance(func_, list): x = func[0][0].func y = func[0][1].func eq_type = check_type(x, y) if not eq_type: eq_type = check_type(y, x) return eq_type x = func[0].func y = func[1].func fc = func_coef n = Wild('n', exclude=[x(t),y(t)]) f1 = Wild('f1', exclude=[v,t]) f2 = Wild('f2', exclude=[v,t]) g1 = Wild('g1', exclude=[u,t]) g2 = Wild('g2', exclude=[u,t]) for i in range(2): eqs = 0 for terms in Add.make_args(eq[i]): eqs += terms/fc[i,func[i],1] eq[i] = eqs r = eq[0].match(diff(x(t),t) - x(t)**n*f) if r: g = (diff(y(t),t) - eq[1])/r[f] if r and not (g.has(x(t)) or g.subs(y(t),v).has(t) or r[f].subs(x(t),u).subs(y(t),v).has(t)): return 'type1' r = eq[0].match(diff(x(t),t) - exp(n*x(t))*f) if r: g = (diff(y(t),t) - eq[1])/r[f] if r and not (g.has(x(t)) or g.subs(y(t),v).has(t) or r[f].subs(x(t),u).subs(y(t),v).has(t)): return 'type2' g = Wild('g') r1 = eq[0].match(diff(x(t),t) - f) r2 = eq[1].match(diff(y(t),t) - g) if r1 and r2 and not (r1[f].subs(x(t),u).subs(y(t),v).has(t) or \ r2[g].subs(x(t),u).subs(y(t),v).has(t)): return 'type3' r1 = eq[0].match(diff(x(t),t) - f) r2 = eq[1].match(diff(y(t),t) - g) num, den = ( (r1[f].subs(x(t),u).subs(y(t),v))/ (r2[g].subs(x(t),u).subs(y(t),v))).as_numer_denom() R1 = num.match(f1*g1) R2 = den.match(f2*g2) phi = (r1[f].subs(x(t),u).subs(y(t),v))/num if R1 and R2: return 'type4' return None def check_nonlinear_2eq_order2(eq, func, func_coef): return None def check_nonlinear_3eq_order1(eq, func, func_coef): x = func[0].func y = func[1].func z = func[2].func fc = func_coef t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] u, v, w = symbols('u, v, w', cls=Dummy) a = Wild('a', exclude=[x(t), y(t), z(t), t]) b = Wild('b', exclude=[x(t), y(t), z(t), t]) c = Wild('c', exclude=[x(t), y(t), z(t), t]) f = Wild('f') F1 = Wild('F1') F2 = Wild('F2') F3 = Wild('F3') for i in range(3): eqs = 0 for terms in Add.make_args(eq[i]): eqs += terms/fc[i,func[i],1] eq[i] = eqs r1 = eq[0].match(diff(x(t),t) - a*y(t)*z(t)) r2 = eq[1].match(diff(y(t),t) - b*z(t)*x(t)) r3 = eq[2].match(diff(z(t),t) - c*x(t)*y(t)) if r1 and r2 and r3: num1, den1 = r1[a].as_numer_denom() num2, den2 = r2[b].as_numer_denom() num3, den3 = r3[c].as_numer_denom() if solve([num1*u-den1*(v-w), num2*v-den2*(w-u), num3*w-den3*(u-v)],[u, v]): return 'type1' r = eq[0].match(diff(x(t),t) - y(t)*z(t)*f) if r: r1 = collect_const(r[f]).match(a*f) r2 = ((diff(y(t),t) - eq[1])/r1[f]).match(b*z(t)*x(t)) r3 = ((diff(z(t),t) - eq[2])/r1[f]).match(c*x(t)*y(t)) if r1 and r2 and r3: num1, den1 = r1[a].as_numer_denom() num2, den2 = r2[b].as_numer_denom() num3, den3 = r3[c].as_numer_denom() if solve([num1*u-den1*(v-w), num2*v-den2*(w-u), num3*w-den3*(u-v)],[u, v]): return 'type2' r = eq[0].match(diff(x(t),t) - (F2-F3)) if r: r1 = collect_const(r[F2]).match(c*F2) r1.update(collect_const(r[F3]).match(b*F3)) if r1: if eq[1].has(r1[F2]) and not eq[1].has(r1[F3]): r1[F2], r1[F3] = r1[F3], r1[F2] r1[c], r1[b] = -r1[b], -r1[c] r2 = eq[1].match(diff(y(t),t) - a*r1[F3] + r1[c]*F1) if r2: r3 = (eq[2] == diff(z(t),t) - r1[b]*r2[F1] + r2[a]*r1[F2]) if r1 and r2 and r3: return 'type3' r = eq[0].match(diff(x(t),t) - z(t)*F2 + y(t)*F3) if r: r1 = collect_const(r[F2]).match(c*F2) r1.update(collect_const(r[F3]).match(b*F3)) if r1: if eq[1].has(r1[F2]) and not eq[1].has(r1[F3]): r1[F2], r1[F3] = r1[F3], r1[F2] r1[c], r1[b] = -r1[b], -r1[c] r2 = (diff(y(t),t) - eq[1]).match(a*x(t)*r1[F3] - r1[c]*z(t)*F1) if r2: r3 = (diff(z(t),t) - eq[2] == r1[b]*y(t)*r2[F1] - r2[a]*x(t)*r1[F2]) if r1 and r2 and r3: return 'type4' r = (diff(x(t),t) - eq[0]).match(x(t)*(F2 - F3)) if r: r1 = collect_const(r[F2]).match(c*F2) r1.update(collect_const(r[F3]).match(b*F3)) if r1: if eq[1].has(r1[F2]) and not eq[1].has(r1[F3]): r1[F2], r1[F3] = r1[F3], r1[F2] r1[c], r1[b] = -r1[b], -r1[c] r2 = (diff(y(t),t) - eq[1]).match(y(t)*(a*r1[F3] - r1[c]*F1)) if r2: r3 = (diff(z(t),t) - eq[2] == z(t)*(r1[b]*r2[F1] - r2[a]*r1[F2])) if r1 and r2 and r3: return 'type5' return None def check_nonlinear_3eq_order2(eq, func, func_coef): return None def checksysodesol(eqs, sols, func=None): r""" Substitutes corresponding ``sols`` for each functions into each ``eqs`` and checks that the result of substitutions for each equation is ``0``. The equations and solutions passed can be any iterable. This only works when each ``sols`` have one function only, like `x(t)` or `y(t)`. For each function, ``sols`` can have a single solution or a list of solutions. In most cases it will not be necessary to explicitly identify the function, but if the function cannot be inferred from the original equation it can be supplied through the ``func`` argument. When a sequence of equations is passed, the same sequence is used to return the result for each equation with each function substitued with corresponding solutions. It tries the following method to find zero equivalence for each equation: Substitute the solutions for functions, like `x(t)` and `y(t)` into the original equations containing those functions. This function returns a tuple. The first item in the tuple is ``True`` if the substitution results for each equation is ``0``, and ``False`` otherwise. The second item in the tuple is what the substitution results in. Each element of the ``list`` should always be ``0`` corresponding to each equation if the first item is ``True``. Note that sometimes this function may return ``False``, but with an expression that is identically equal to ``0``, instead of returning ``True``. This is because :py:meth:`~sympy.simplify.simplify.simplify` cannot reduce the expression to ``0``. If an expression returned by each function vanishes identically, then ``sols`` really is a solution to ``eqs``. If this function seems to hang, it is probably because of a difficult simplification. Examples ======== >>> from sympy import Eq, diff, symbols, sin, cos, exp, sqrt, S >>> from sympy.solvers.ode import checksysodesol >>> C1, C2 = symbols('C1:3') >>> t = symbols('t') >>> x, y = symbols('x, y', function=True) >>> eq = (Eq(diff(x(t),t), x(t) + y(t) + 17), Eq(diff(y(t),t), -2*x(t) + y(t) + 12)) >>> sol = [Eq(x(t), (C1*sin(sqrt(2)*t) + C2*cos(sqrt(2)*t))*exp(t) - S(5)/3), ... Eq(y(t), (sqrt(2)*C1*cos(sqrt(2)*t) - sqrt(2)*C2*sin(sqrt(2)*t))*exp(t) - S(46)/3)] >>> checksysodesol(eq, sol) (True, [0, 0]) >>> eq = (Eq(diff(x(t),t),x(t)*y(t)**4), Eq(diff(y(t),t),y(t)**3)) >>> sol = [Eq(x(t), C1*exp(-1/(4*(C2 + t)))), Eq(y(t), -sqrt(2)*sqrt(-1/(C2 + t))/2), ... Eq(x(t), C1*exp(-1/(4*(C2 + t)))), Eq(y(t), sqrt(2)*sqrt(-1/(C2 + t))/2)] >>> checksysodesol(eq, sol) (True, [0, 0]) """ def _sympify(eq): return list(map(sympify, eq if iterable(eq) else [eq])) eqs = _sympify(eqs) for i in range(len(eqs)): if isinstance(eqs[i], Equality): eqs[i] = eqs[i].lhs - eqs[i].rhs if func is None: funcs = [] for eq in eqs: derivs = eq.atoms(Derivative) func = set().union(*[d.atoms(AppliedUndef) for d in derivs]) for func_ in func: funcs.append(func_) funcs = list(set(funcs)) if not all(isinstance(func, AppliedUndef) and len(func.args) == 1 for func in funcs)\ and len({func.args for func in funcs})!=1: raise ValueError("func must be a function of one variable, not %s" % func) for sol in sols: if len(sol.atoms(AppliedUndef)) != 1: raise ValueError("solutions should have one function only") if len(funcs) != len({sol.lhs for sol in sols}): raise ValueError("number of solutions provided does not match the number of equations") t = funcs[0].args[0] dictsol = dict() for sol in sols: func = list(sol.atoms(AppliedUndef))[0] if sol.rhs == func: sol = sol.reversed solved = sol.lhs == func and not sol.rhs.has(func) if not solved: rhs = solve(sol, func) if not rhs: raise NotImplementedError else: rhs = sol.rhs dictsol[func] = rhs checkeq = [] for eq in eqs: for func in funcs: eq = sub_func_doit(eq, func, dictsol[func]) ss = simplify(eq) if ss != 0: eq = ss.expand(force=True) else: eq = 0 checkeq.append(eq) if len(set(checkeq)) == 1 and list(set(checkeq))[0] == 0: return (True, checkeq) else: return (False, checkeq) @vectorize(0) def odesimp(eq, func, order, constants, hint): r""" Simplifies ODEs, including trying to solve for ``func`` and running :py:meth:`~sympy.solvers.ode.constantsimp`. It may use knowledge of the type of solution that the hint returns to apply additional simplifications. It also attempts to integrate any :py:class:`~sympy.integrals.Integral`\s in the expression, if the hint is not an ``_Integral`` hint. This function should have no effect on expressions returned by :py:meth:`~sympy.solvers.ode.dsolve`, as :py:meth:`~sympy.solvers.ode.dsolve` already calls :py:meth:`~sympy.solvers.ode.odesimp`, but the individual hint functions do not call :py:meth:`~sympy.solvers.ode.odesimp` (because the :py:meth:`~sympy.solvers.ode.dsolve` wrapper does). Therefore, this function is designed for mainly internal use. Examples ======== >>> from sympy import sin, symbols, dsolve, pprint, Function >>> from sympy.solvers.ode import odesimp >>> x , u2, C1= symbols('x,u2,C1') >>> f = Function('f') >>> eq = dsolve(x*f(x).diff(x) - f(x) - x*sin(f(x)/x), f(x), ... hint='1st_homogeneous_coeff_subs_indep_div_dep_Integral', ... simplify=False) >>> pprint(eq, wrap_line=False) x ---- f(x) / | | / 1 \ | -|u2 + -------| | | /1 \| | | sin|--|| | \ \u2// log(f(x)) = log(C1) + | ---------------- d(u2) | 2 | u2 | / >>> pprint(odesimp(eq, f(x), 1, set([C1]), ... hint='1st_homogeneous_coeff_subs_indep_div_dep' ... )) #doctest: +SKIP x --------- = C1 /f(x)\ tan|----| \2*x / """ x = func.args[0] f = func.func C1 = get_numbered_constants(eq, num=1) # First, integrate if the hint allows it. eq = _handle_Integral(eq, func, order, hint) if hint.startswith("nth_linear_euler_eq_nonhomogeneous"): eq = simplify(eq) if not isinstance(eq, Equality): raise TypeError("eq should be an instance of Equality") # Second, clean up the arbitrary constants. # Right now, nth linear hints can put as many as 2*order constants in an # expression. If that number grows with another hint, the third argument # here should be raised accordingly, or constantsimp() rewritten to handle # an arbitrary number of constants. eq = constantsimp(eq, constants) # Lastly, now that we have cleaned up the expression, try solving for func. # When CRootOf is implemented in solve(), we will want to return a CRootOf # everytime instead of an Equality. # Get the f(x) on the left if possible. if eq.rhs == func and not eq.lhs.has(func): eq = [Eq(eq.rhs, eq.lhs)] # make sure we are working with lists of solutions in simplified form. if eq.lhs == func and not eq.rhs.has(func): # The solution is already solved eq = [eq] # special simplification of the rhs if hint.startswith("nth_linear_constant_coeff"): # Collect terms to make the solution look nice. # This is also necessary for constantsimp to remove unnecessary # terms from the particular solution from variation of parameters # # Collect is not behaving reliably here. The results for # some linear constant-coefficient equations with repeated # roots do not properly simplify all constants sometimes. # 'collectterms' gives different orders sometimes, and results # differ in collect based on that order. The # sort-reverse trick fixes things, but may fail in the # future. In addition, collect is splitting exponentials with # rational powers for no reason. We have to do a match # to fix this using Wilds. global collectterms try: collectterms.sort(key=default_sort_key) collectterms.reverse() except Exception: pass assert len(eq) == 1 and eq[0].lhs == f(x) sol = eq[0].rhs sol = expand_mul(sol) for i, reroot, imroot in collectterms: sol = collect(sol, x**i*exp(reroot*x)*sin(abs(imroot)*x)) sol = collect(sol, x**i*exp(reroot*x)*cos(imroot*x)) for i, reroot, imroot in collectterms: sol = collect(sol, x**i*exp(reroot*x)) del collectterms # Collect is splitting exponentials with rational powers for # no reason. We call powsimp to fix. sol = powsimp(sol) eq[0] = Eq(f(x), sol) else: # The solution is not solved, so try to solve it try: floats = any(i.is_Float for i in eq.atoms(Number)) eqsol = solve(eq, func, force=True, rational=False if floats else None) if not eqsol: raise NotImplementedError except (NotImplementedError, PolynomialError): eq = [eq] else: def _expand(expr): numer, denom = expr.as_numer_denom() if denom.is_Add: return expr else: return powsimp(expr.expand(), combine='exp', deep=True) # XXX: the rest of odesimp() expects each ``t`` to be in a # specific normal form: rational expression with numerator # expanded, but with combined exponential functions (at # least in this setup all tests pass). eq = [Eq(f(x), _expand(t)) for t in eqsol] # special simplification of the lhs. if hint.startswith("1st_homogeneous_coeff"): for j, eqi in enumerate(eq): newi = logcombine(eqi, force=True) if newi.lhs.func is log and newi.rhs == 0: newi = Eq(newi.lhs.args[0]/C1, C1) eq[j] = newi # We cleaned up the constants before solving to help the solve engine with # a simpler expression, but the solved expression could have introduced # things like -C1, so rerun constantsimp() one last time before returning. for i, eqi in enumerate(eq): eq[i] = constantsimp(eqi, constants) eq[i] = constant_renumber(eq[i], 'C', 1, 2*order) # If there is only 1 solution, return it; # otherwise return the list of solutions. if len(eq) == 1: eq = eq[0] return eq def checkodesol(ode, sol, func=None, order='auto', solve_for_func=True): r""" Substitutes ``sol`` into ``ode`` and checks that the result is ``0``. This only works when ``func`` is one function, like `f(x)`. ``sol`` can be a single solution or a list of solutions. Each solution may be an :py:class:`~sympy.core.relational.Equality` that the solution satisfies, e.g. ``Eq(f(x), C1), Eq(f(x) + C1, 0)``; or simply an :py:class:`~sympy.core.expr.Expr`, e.g. ``f(x) - C1``. In most cases it will not be necessary to explicitly identify the function, but if the function cannot be inferred from the original equation it can be supplied through the ``func`` argument. If a sequence of solutions is passed, the same sort of container will be used to return the result for each solution. It tries the following methods, in order, until it finds zero equivalence: 1. Substitute the solution for `f` in the original equation. This only works if ``ode`` is solved for `f`. It will attempt to solve it first unless ``solve_for_func == False``. 2. Take `n` derivatives of the solution, where `n` is the order of ``ode``, and check to see if that is equal to the solution. This only works on exact ODEs. 3. Take the 1st, 2nd, ..., `n`\th derivatives of the solution, each time solving for the derivative of `f` of that order (this will always be possible because `f` is a linear operator). Then back substitute each derivative into ``ode`` in reverse order. This function returns a tuple. The first item in the tuple is ``True`` if the substitution results in ``0``, and ``False`` otherwise. The second item in the tuple is what the substitution results in. It should always be ``0`` if the first item is ``True``. Note that sometimes this function will ``False``, but with an expression that is identically equal to ``0``, instead of returning ``True``. This is because :py:meth:`~sympy.simplify.simplify.simplify` cannot reduce the expression to ``0``. If an expression returned by this function vanishes identically, then ``sol`` really is a solution to ``ode``. If this function seems to hang, it is probably because of a hard simplification. To use this function to test, test the first item of the tuple. Examples ======== >>> from sympy import Eq, Function, checkodesol, symbols >>> x, C1 = symbols('x,C1') >>> f = Function('f') >>> checkodesol(f(x).diff(x), Eq(f(x), C1)) (True, 0) >>> assert checkodesol(f(x).diff(x), C1)[0] >>> assert not checkodesol(f(x).diff(x), x)[0] >>> checkodesol(f(x).diff(x, 2), x**2) (False, 2) """ if not isinstance(ode, Equality): ode = Eq(ode, 0) if func is None: try: _, func = _preprocess(ode.lhs) except ValueError: funcs = [s.atoms(AppliedUndef) for s in ( sol if is_sequence(sol, set) else [sol])] funcs = set().union(*funcs) if len(funcs) != 1: raise ValueError( 'must pass func arg to checkodesol for this case.') func = funcs.pop() if not isinstance(func, AppliedUndef) or len(func.args) != 1: raise ValueError( "func must be a function of one variable, not %s" % func) if is_sequence(sol, set): return type(sol)([checkodesol(ode, i, order=order, solve_for_func=solve_for_func) for i in sol]) if not isinstance(sol, Equality): sol = Eq(func, sol) elif sol.rhs == func: sol = sol.reversed if order == 'auto': order = ode_order(ode, func) solved = sol.lhs == func and not sol.rhs.has(func) if solve_for_func and not solved: rhs = solve(sol, func) if rhs: eqs = [Eq(func, t) for t in rhs] if len(rhs) == 1: eqs = eqs[0] return checkodesol(ode, eqs, order=order, solve_for_func=False) s = True testnum = 0 x = func.args[0] while s: if testnum == 0: # First pass, try substituting a solved solution directly into the # ODE. This has the highest chance of succeeding. ode_diff = ode.lhs - ode.rhs if sol.lhs == func: s = sub_func_doit(ode_diff, func, sol.rhs) else: testnum += 1 continue ss = simplify(s) if ss: # with the new numer_denom in power.py, if we do a simple # expansion then testnum == 0 verifies all solutions. s = ss.expand(force=True) else: s = 0 testnum += 1 elif testnum == 1: # Second pass. If we cannot substitute f, try seeing if the nth # derivative is equal, this will only work for odes that are exact, # by definition. s = simplify( trigsimp(diff(sol.lhs, x, order) - diff(sol.rhs, x, order)) - trigsimp(ode.lhs) + trigsimp(ode.rhs)) # s2 = simplify( # diff(sol.lhs, x, order) - diff(sol.rhs, x, order) - \ # ode.lhs + ode.rhs) testnum += 1 elif testnum == 2: # Third pass. Try solving for df/dx and substituting that into the # ODE. Thanks to Chris Smith for suggesting this method. Many of # the comments below are his, too. # The method: # - Take each of 1..n derivatives of the solution. # - Solve each nth derivative for d^(n)f/dx^(n) # (the differential of that order) # - Back substitute into the ODE in decreasing order # (i.e., n, n-1, ...) # - Check the result for zero equivalence if sol.lhs == func and not sol.rhs.has(func): diffsols = {0: sol.rhs} elif sol.rhs == func and not sol.lhs.has(func): diffsols = {0: sol.lhs} else: diffsols = {} sol = sol.lhs - sol.rhs for i in range(1, order + 1): # Differentiation is a linear operator, so there should always # be 1 solution. Nonetheless, we test just to make sure. # We only need to solve once. After that, we automatically # have the solution to the differential in the order we want. if i == 1: ds = sol.diff(x) try: sdf = solve(ds, func.diff(x, i)) if not sdf: raise NotImplementedError except NotImplementedError: testnum += 1 break else: diffsols[i] = sdf[0] else: # This is what the solution says df/dx should be. diffsols[i] = diffsols[i - 1].diff(x) # Make sure the above didn't fail. if testnum > 2: continue else: # Substitute it into ODE to check for self consistency. lhs, rhs = ode.lhs, ode.rhs for i in range(order, -1, -1): if i == 0 and 0 not in diffsols: # We can only substitute f(x) if the solution was # solved for f(x). break lhs = sub_func_doit(lhs, func.diff(x, i), diffsols[i]) rhs = sub_func_doit(rhs, func.diff(x, i), diffsols[i]) ode_or_bool = Eq(lhs, rhs) ode_or_bool = simplify(ode_or_bool) if isinstance(ode_or_bool, (bool, BooleanAtom)): if ode_or_bool: lhs = rhs = S.Zero else: lhs = ode_or_bool.lhs rhs = ode_or_bool.rhs # No sense in overworking simplify -- just prove that the # numerator goes to zero num = trigsimp((lhs - rhs).as_numer_denom()[0]) # since solutions are obtained using force=True we test # using the same level of assumptions ## replace function with dummy so assumptions will work _func = Dummy('func') num = num.subs(func, _func) ## posify the expression num, reps = posify(num) s = simplify(num).xreplace(reps).xreplace({_func: func}) testnum += 1 else: break if not s: return (True, s) elif s is True: # The code above never was able to change s raise NotImplementedError("Unable to test if " + str(sol) + " is a solution to " + str(ode) + ".") else: return (False, s) def ode_sol_simplicity(sol, func, trysolving=True): r""" Returns an extended integer representing how simple a solution to an ODE is. The following things are considered, in order from most simple to least: - ``sol`` is solved for ``func``. - ``sol`` is not solved for ``func``, but can be if passed to solve (e.g., a solution returned by ``dsolve(ode, func, simplify=False``). - If ``sol`` is not solved for ``func``, then base the result on the length of ``sol``, as computed by ``len(str(sol))``. - If ``sol`` has any unevaluated :py:class:`~sympy.integrals.Integral`\s, this will automatically be considered less simple than any of the above. This function returns an integer such that if solution A is simpler than solution B by above metric, then ``ode_sol_simplicity(sola, func) < ode_sol_simplicity(solb, func)``. Currently, the following are the numbers returned, but if the heuristic is ever improved, this may change. Only the ordering is guaranteed. +----------------------------------------------+-------------------+ | Simplicity | Return | +==============================================+===================+ | ``sol`` solved for ``func`` | ``-2`` | +----------------------------------------------+-------------------+ | ``sol`` not solved for ``func`` but can be | ``-1`` | +----------------------------------------------+-------------------+ | ``sol`` is not solved nor solvable for | ``len(str(sol))`` | | ``func`` | | +----------------------------------------------+-------------------+ | ``sol`` contains an | ``oo`` | | :py:class:`~sympy.integrals.Integral` | | +----------------------------------------------+-------------------+ ``oo`` here means the SymPy infinity, which should compare greater than any integer. If you already know :py:meth:`~sympy.solvers.solvers.solve` cannot solve ``sol``, you can use ``trysolving=False`` to skip that step, which is the only potentially slow step. For example, :py:meth:`~sympy.solvers.ode.dsolve` with the ``simplify=False`` flag should do this. If ``sol`` is a list of solutions, if the worst solution in the list returns ``oo`` it returns that, otherwise it returns ``len(str(sol))``, that is, the length of the string representation of the whole list. Examples ======== This function is designed to be passed to ``min`` as the key argument, such as ``min(listofsolutions, key=lambda i: ode_sol_simplicity(i, f(x)))``. >>> from sympy import symbols, Function, Eq, tan, cos, sqrt, Integral >>> from sympy.solvers.ode import ode_sol_simplicity >>> x, C1, C2 = symbols('x, C1, C2') >>> f = Function('f') >>> ode_sol_simplicity(Eq(f(x), C1*x**2), f(x)) -2 >>> ode_sol_simplicity(Eq(x**2 + f(x), C1), f(x)) -1 >>> ode_sol_simplicity(Eq(f(x), C1*Integral(2*x, x)), f(x)) oo >>> eq1 = Eq(f(x)/tan(f(x)/(2*x)), C1) >>> eq2 = Eq(f(x)/tan(f(x)/(2*x) + f(x)), C2) >>> [ode_sol_simplicity(eq, f(x)) for eq in [eq1, eq2]] [28, 35] >>> min([eq1, eq2], key=lambda i: ode_sol_simplicity(i, f(x))) Eq(f(x)/tan(f(x)/(2*x)), C1) """ # TODO: if two solutions are solved for f(x), we still want to be # able to get the simpler of the two # See the docstring for the coercion rules. We check easier (faster) # things here first, to save time. if iterable(sol): # See if there are Integrals for i in sol: if ode_sol_simplicity(i, func, trysolving=trysolving) == oo: return oo return len(str(sol)) if sol.has(Integral): return oo # Next, try to solve for func. This code will change slightly when CRootOf # is implemented in solve(). Probably a CRootOf solution should fall # somewhere between a normal solution and an unsolvable expression. # First, see if they are already solved if sol.lhs == func and not sol.rhs.has(func) or \ sol.rhs == func and not sol.lhs.has(func): return -2 # We are not so lucky, try solving manually if trysolving: try: sols = solve(sol, func) if not sols: raise NotImplementedError except NotImplementedError: pass else: return -1 # Finally, a naive computation based on the length of the string version # of the expression. This may favor combined fractions because they # will not have duplicate denominators, and may slightly favor expressions # with fewer additions and subtractions, as those are separated by spaces # by the printer. # Additional ideas for simplicity heuristics are welcome, like maybe # checking if a equation has a larger domain, or if constantsimp has # introduced arbitrary constants numbered higher than the order of a # given ODE that sol is a solution of. return len(str(sol)) def _get_constant_subexpressions(expr, Cs): Cs = set(Cs) Ces = [] def _recursive_walk(expr): expr_syms = expr.free_symbols if len(expr_syms) > 0 and expr_syms.issubset(Cs): Ces.append(expr) else: if expr.func == exp: expr = expr.expand(mul=True) if expr.func in (Add, Mul): d = sift(expr.args, lambda i : i.free_symbols.issubset(Cs)) if len(d[True]) > 1: x = expr.func(*d[True]) if not x.is_number: Ces.append(x) elif isinstance(expr, Integral): if expr.free_symbols.issubset(Cs) and \ all(len(x) == 3 for x in expr.limits): Ces.append(expr) for i in expr.args: _recursive_walk(i) return _recursive_walk(expr) return Ces def __remove_linear_redundancies(expr, Cs): cnts = {i: expr.count(i) for i in Cs} Cs = [i for i in Cs if cnts[i] > 0] def _linear(expr): if expr.func is Add: xs = [i for i in Cs if expr.count(i)==cnts[i] \ and 0 == expr.diff(i, 2)] d = {} for x in xs: y = expr.diff(x) if y not in d: d[y]=[] d[y].append(x) for y in d: if len(d[y]) > 1: d[y].sort(key=str) for x in d[y][1:]: expr = expr.subs(x, 0) return expr def _recursive_walk(expr): if len(expr.args) != 0: expr = expr.func(*[_recursive_walk(i) for i in expr.args]) expr = _linear(expr) return expr if expr.func is Equality: lhs, rhs = [_recursive_walk(i) for i in expr.args] f = lambda i: isinstance(i, Number) or i in Cs if lhs.func is Symbol and lhs in Cs: rhs, lhs = lhs, rhs if lhs.func in (Add, Symbol) and rhs.func in (Add, Symbol): dlhs = sift([lhs] if isinstance(lhs, AtomicExpr) else lhs.args, f) drhs = sift([rhs] if isinstance(rhs, AtomicExpr) else rhs.args, f) for i in [True, False]: for hs in [dlhs, drhs]: if i not in hs: hs[i] = [0] # this calculation can be simplified lhs = Add(*dlhs[False]) - Add(*drhs[False]) rhs = Add(*drhs[True]) - Add(*dlhs[True]) elif lhs.func in (Mul, Symbol) and rhs.func in (Mul, Symbol): dlhs = sift([lhs] if isinstance(lhs, AtomicExpr) else lhs.args, f) if True in dlhs: if False not in dlhs: dlhs[False] = [1] lhs = Mul(*dlhs[False]) rhs = rhs/Mul(*dlhs[True]) return Eq(lhs, rhs) else: return _recursive_walk(expr) @vectorize(0) def constantsimp(expr, constants): r""" Simplifies an expression with arbitrary constants in it. This function is written specifically to work with :py:meth:`~sympy.solvers.ode.dsolve`, and is not intended for general use. Simplification is done by "absorbing" the arbitrary constants into other arbitrary constants, numbers, and symbols that they are not independent of. The symbols must all have the same name with numbers after it, for example, ``C1``, ``C2``, ``C3``. The ``symbolname`` here would be '``C``', the ``startnumber`` would be 1, and the ``endnumber`` would be 3. If the arbitrary constants are independent of the variable ``x``, then the independent symbol would be ``x``. There is no need to specify the dependent function, such as ``f(x)``, because it already has the independent symbol, ``x``, in it. Because terms are "absorbed" into arbitrary constants and because constants are renumbered after simplifying, the arbitrary constants in expr are not necessarily equal to the ones of the same name in the returned result. If two or more arbitrary constants are added, multiplied, or raised to the power of each other, they are first absorbed together into a single arbitrary constant. Then the new constant is combined into other terms if necessary. Absorption of constants is done with limited assistance: 1. terms of :py:class:`~sympy.core.add.Add`\s are collected to try join constants so `e^x (C_1 \cos(x) + C_2 \cos(x))` will simplify to `e^x C_1 \cos(x)`; 2. powers with exponents that are :py:class:`~sympy.core.add.Add`\s are expanded so `e^{C_1 + x}` will be simplified to `C_1 e^x`. Use :py:meth:`~sympy.solvers.ode.constant_renumber` to renumber constants after simplification or else arbitrary numbers on constants may appear, e.g. `C_1 + C_3 x`. In rare cases, a single constant can be "simplified" into two constants. Every differential equation solution should have as many arbitrary constants as the order of the differential equation. The result here will be technically correct, but it may, for example, have `C_1` and `C_2` in an expression, when `C_1` is actually equal to `C_2`. Use your discretion in such situations, and also take advantage of the ability to use hints in :py:meth:`~sympy.solvers.ode.dsolve`. Examples ======== >>> from sympy import symbols >>> from sympy.solvers.ode import constantsimp >>> C1, C2, C3, x, y = symbols('C1, C2, C3, x, y') >>> constantsimp(2*C1*x, set([C1, C2, C3])) C1*x >>> constantsimp(C1 + 2 + x, set([C1, C2, C3])) C1 + x >>> constantsimp(C1*C2 + 2 + C2 + C3*x, set([C1, C2, C3])) C1 + C3*x """ # This function works recursively. The idea is that, for Mul, # Add, Pow, and Function, if the class has a constant in it, then # we can simplify it, which we do by recursing down and # simplifying up. Otherwise, we can skip that part of the # expression. Cs = constants orig_expr = expr constant_subexprs = _get_constant_subexpressions(expr, Cs) for xe in constant_subexprs: xes = list(xe.free_symbols) if not xes: continue if all([expr.count(c) == xe.count(c) for c in xes]): xes.sort(key=str) expr = expr.subs(xe, xes[0]) # try to perform common sub-expression elimination of constant terms try: commons, rexpr = cse(expr) commons.reverse() rexpr = rexpr[0] for s in commons: cs = list(s[1].atoms(Symbol)) if len(cs) == 1 and cs[0] in Cs: rexpr = rexpr.subs(s[0], cs[0]) else: rexpr = rexpr.subs(*s) expr = rexpr except Exception: pass expr = __remove_linear_redundancies(expr, Cs) def _conditional_term_factoring(expr): new_expr = terms_gcd(expr, clear=False, deep=True, expand=False) # we do not want to factor exponentials, so handle this separately if new_expr.is_Mul: infac = False asfac = False for m in new_expr.args: if m.func is exp: asfac = True elif m.is_Add: infac = any(fi.func is exp for t in m.args for fi in Mul.make_args(t)) if asfac and infac: new_expr = expr break return new_expr expr = _conditional_term_factoring(expr) # call recursively if more simplification is possible if orig_expr != expr: return constantsimp(expr, Cs) return expr def constant_renumber(expr, symbolname, startnumber, endnumber): r""" Renumber arbitrary constants in ``expr`` to have numbers 1 through `N` where `N` is ``endnumber - startnumber + 1`` at most. In the process, this reorders expression terms in a standard way. This is a simple function that goes through and renumbers any :py:class:`~sympy.core.symbol.Symbol` with a name in the form ``symbolname + num`` where ``num`` is in the range from ``startnumber`` to ``endnumber``. Symbols are renumbered based on ``.sort_key()``, so they should be numbered roughly in the order that they appear in the final, printed expression. Note that this ordering is based in part on hashes, so it can produce different results on different machines. The structure of this function is very similar to that of :py:meth:`~sympy.solvers.ode.constantsimp`. Examples ======== >>> from sympy import symbols, Eq, pprint >>> from sympy.solvers.ode import constant_renumber >>> x, C0, C1, C2, C3, C4 = symbols('x,C:5') Only constants in the given range (inclusive) are renumbered; the renumbering always starts from 1: >>> constant_renumber(C1 + C3 + C4, 'C', 1, 3) C1 + C2 + C4 >>> constant_renumber(C0 + C1 + C3 + C4, 'C', 2, 4) C0 + 2*C1 + C2 >>> constant_renumber(C0 + 2*C1 + C2, 'C', 0, 1) C1 + 3*C2 >>> pprint(C2 + C1*x + C3*x**2) 2 C1*x + C2 + C3*x >>> pprint(constant_renumber(C2 + C1*x + C3*x**2, 'C', 1, 3)) 2 C1 + C2*x + C3*x """ if type(expr) in (set, list, tuple): return type(expr)( [constant_renumber(i, symbolname=symbolname, startnumber=startnumber, endnumber=endnumber) for i in expr] ) global newstartnumber newstartnumber = 1 constants_found = [None]*(endnumber + 2) constantsymbols = [Symbol( symbolname + "%d" % t) for t in range(startnumber, endnumber + 1)] # make a mapping to send all constantsymbols to S.One and use # that to make sure that term ordering is not dependent on # the indexed value of C C_1 = [(ci, S.One) for ci in constantsymbols] sort_key=lambda arg: default_sort_key(arg.subs(C_1)) def _constant_renumber(expr): r""" We need to have an internal recursive function so that newstartnumber maintains its values throughout recursive calls. """ global newstartnumber if isinstance(expr, Equality): return Eq( _constant_renumber(expr.lhs), _constant_renumber(expr.rhs)) if type(expr) not in (Mul, Add, Pow) and not expr.is_Function and \ not expr.has(*constantsymbols): # Base case, as above. Hope there aren't constants inside # of some other class, because they won't be renumbered. return expr elif expr.is_Piecewise: return expr elif expr in constantsymbols: if expr not in constants_found: constants_found[newstartnumber] = expr newstartnumber += 1 return expr elif expr.is_Function or expr.is_Pow or isinstance(expr, Tuple): return expr.func( *[_constant_renumber(x) for x in expr.args]) else: sortedargs = list(expr.args) sortedargs.sort(key=sort_key) return expr.func(*[_constant_renumber(x) for x in sortedargs]) expr = _constant_renumber(expr) # Renumbering happens here newconsts = symbols('C1:%d' % newstartnumber) expr = expr.subs(zip(constants_found[1:], newconsts), simultaneous=True) return expr def _handle_Integral(expr, func, order, hint): r""" Converts a solution with Integrals in it into an actual solution. For most hints, this simply runs ``expr.doit()``. """ global y x = func.args[0] f = func.func if hint == "1st_exact": sol = (expr.doit()).subs(y, f(x)) del y elif hint == "1st_exact_Integral": sol = expr.subs(y, f(x)) del y elif hint == "nth_linear_constant_coeff_homogeneous": sol = expr elif not hint.endswith("_Integral"): sol = expr.doit() else: sol = expr return sol # FIXME: replace the general solution in the docstring with # dsolve(equation, hint='1st_exact_Integral'). You will need to be able # to have assumptions on P and Q that dP/dy = dQ/dx. def ode_1st_exact(eq, func, order, match): r""" Solves 1st order exact ordinary differential equations. A 1st order differential equation is called exact if it is the total differential of a function. That is, the differential equation .. math:: P(x, y) \,\partial{}x + Q(x, y) \,\partial{}y = 0 is exact if there is some function `F(x, y)` such that `P(x, y) = \partial{}F/\partial{}x` and `Q(x, y) = \partial{}F/\partial{}y`. It can be shown that a necessary and sufficient condition for a first order ODE to be exact is that `\partial{}P/\partial{}y = \partial{}Q/\partial{}x`. Then, the solution will be as given below:: >>> from sympy import Function, Eq, Integral, symbols, pprint >>> x, y, t, x0, y0, C1= symbols('x,y,t,x0,y0,C1') >>> P, Q, F= map(Function, ['P', 'Q', 'F']) >>> pprint(Eq(Eq(F(x, y), Integral(P(t, y), (t, x0, x)) + ... Integral(Q(x0, t), (t, y0, y))), C1)) x y / / | | F(x, y) = | P(t, y) dt + | Q(x0, t) dt = C1 | | / / x0 y0 Where the first partials of `P` and `Q` exist and are continuous in a simply connected region. A note: SymPy currently has no way to represent inert substitution on an expression, so the hint ``1st_exact_Integral`` will return an integral with `dy`. This is supposed to represent the function that you are solving for. Examples ======== >>> from sympy import Function, dsolve, cos, sin >>> from sympy.abc import x >>> f = Function('f') >>> dsolve(cos(f(x)) - (x*sin(f(x)) - f(x)**2)*f(x).diff(x), ... f(x), hint='1st_exact') Eq(x*cos(f(x)) + f(x)**3/3, C1) References ========== - http://en.wikipedia.org/wiki/Exact_differential_equation - M. Tenenbaum & H. Pollard, "Ordinary Differential Equations", Dover 1963, pp. 73 # indirect doctest """ x = func.args[0] f = func.func r = match # d+e*diff(f(x),x) e = r[r['e']] d = r[r['d']] global y # This is the only way to pass dummy y to _handle_Integral y = r['y'] C1 = get_numbered_constants(eq, num=1) # Refer Joel Moses, "Symbolic Integration - The Stormy Decade", # Communications of the ACM, Volume 14, Number 8, August 1971, pp. 558 # which gives the method to solve an exact differential equation. sol = Integral(d, x) + Integral((e - (Integral(d, x).diff(y))), y) return Eq(sol, C1) def ode_1st_homogeneous_coeff_best(eq, func, order, match): r""" Returns the best solution to an ODE from the two hints ``1st_homogeneous_coeff_subs_dep_div_indep`` and ``1st_homogeneous_coeff_subs_indep_div_dep``. This is as determined by :py:meth:`~sympy.solvers.ode.ode_sol_simplicity`. See the :py:meth:`~sympy.solvers.ode.ode_1st_homogeneous_coeff_subs_indep_div_dep` and :py:meth:`~sympy.solvers.ode.ode_1st_homogeneous_coeff_subs_dep_div_indep` docstrings for more information on these hints. Note that there is no ``ode_1st_homogeneous_coeff_best_Integral`` hint. Examples ======== >>> from sympy import Function, dsolve, pprint >>> from sympy.abc import x >>> f = Function('f') >>> pprint(dsolve(2*x*f(x) + (x**2 + f(x)**2)*f(x).diff(x), f(x), ... hint='1st_homogeneous_coeff_best', simplify=False)) / 2 \ | 3*x | log|----- + 1| | 2 | \f (x) / log(f(x)) = log(C1) - -------------- 3 References ========== - http://en.wikipedia.org/wiki/Homogeneous_differential_equation - M. Tenenbaum & H. Pollard, "Ordinary Differential Equations", Dover 1963, pp. 59 # indirect doctest """ # There are two substitutions that solve the equation, u1=y/x and u2=x/y # They produce different integrals, so try them both and see which # one is easier. sol1 = ode_1st_homogeneous_coeff_subs_indep_div_dep(eq, func, order, match) sol2 = ode_1st_homogeneous_coeff_subs_dep_div_indep(eq, func, order, match) simplify = match.get('simplify', True) if simplify: # why is odesimp called here? Should it be at the usual spot? constants = sol1.free_symbols.difference(eq.free_symbols) sol1 = odesimp( sol1, func, order, constants, "1st_homogeneous_coeff_subs_indep_div_dep") constants = sol2.free_symbols.difference(eq.free_symbols) sol2 = odesimp( sol2, func, order, constants, "1st_homogeneous_coeff_subs_dep_div_indep") return min([sol1, sol2], key=lambda x: ode_sol_simplicity(x, func, trysolving=not simplify)) def ode_1st_homogeneous_coeff_subs_dep_div_indep(eq, func, order, match): r""" Solves a 1st order differential equation with homogeneous coefficients using the substitution `u_1 = \frac{\text{<dependent variable>}}{\text{<independent variable>}}`. This is a differential equation .. math:: P(x, y) + Q(x, y) dy/dx = 0 such that `P` and `Q` are homogeneous and of the same order. A function `F(x, y)` is homogeneous of order `n` if `F(x t, y t) = t^n F(x, y)`. Equivalently, `F(x, y)` can be rewritten as `G(y/x)` or `H(x/y)`. See also the docstring of :py:meth:`~sympy.solvers.ode.homogeneous_order`. If the coefficients `P` and `Q` in the differential equation above are homogeneous functions of the same order, then it can be shown that the substitution `y = u_1 x` (i.e. `u_1 = y/x`) will turn the differential equation into an equation separable in the variables `x` and `u`. If `h(u_1)` is the function that results from making the substitution `u_1 = f(x)/x` on `P(x, f(x))` and `g(u_2)` is the function that results from the substitution on `Q(x, f(x))` in the differential equation `P(x, f(x)) + Q(x, f(x)) f'(x) = 0`, then the general solution is:: >>> from sympy import Function, dsolve, pprint >>> from sympy.abc import x >>> f, g, h = map(Function, ['f', 'g', 'h']) >>> genform = g(f(x)/x) + h(f(x)/x)*f(x).diff(x) >>> pprint(genform) /f(x)\ /f(x)\ d g|----| + h|----|*--(f(x)) \ x / \ x / dx >>> pprint(dsolve(genform, f(x), ... hint='1st_homogeneous_coeff_subs_dep_div_indep_Integral')) f(x) ---- x / | | -h(u1) log(x) = C1 + | ---------------- d(u1) | u1*h(u1) + g(u1) | / Where `u_1 h(u_1) + g(u_1) \ne 0` and `x \ne 0`. See also the docstrings of :py:meth:`~sympy.solvers.ode.ode_1st_homogeneous_coeff_best` and :py:meth:`~sympy.solvers.ode.ode_1st_homogeneous_coeff_subs_indep_div_dep`. Examples ======== >>> from sympy import Function, dsolve >>> from sympy.abc import x >>> f = Function('f') >>> pprint(dsolve(2*x*f(x) + (x**2 + f(x)**2)*f(x).diff(x), f(x), ... hint='1st_homogeneous_coeff_subs_dep_div_indep', simplify=False)) / 3 \ |3*f(x) f (x)| log|------ + -----| | x 3 | \ x / log(x) = log(C1) - ------------------- 3 References ========== - http://en.wikipedia.org/wiki/Homogeneous_differential_equation - M. Tenenbaum & H. Pollard, "Ordinary Differential Equations", Dover 1963, pp. 59 # indirect doctest """ x = func.args[0] f = func.func u = Dummy('u') u1 = Dummy('u1') # u1 == f(x)/x r = match # d+e*diff(f(x),x) C1 = get_numbered_constants(eq, num=1) xarg = match.get('xarg', 0) yarg = match.get('yarg', 0) int = Integral( (-r[r['e']]/(r[r['d']] + u1*r[r['e']])).subs({x: 1, r['y']: u1}), (u1, None, f(x)/x)) sol = logcombine(Eq(log(x), int + log(C1)), force=True) sol = sol.subs(f(x), u).subs(((u, u - yarg), (x, x - xarg), (u, f(x)))) return sol def ode_1st_homogeneous_coeff_subs_indep_div_dep(eq, func, order, match): r""" Solves a 1st order differential equation with homogeneous coefficients using the substitution `u_2 = \frac{\text{<independent variable>}}{\text{<dependent variable>}}`. This is a differential equation .. math:: P(x, y) + Q(x, y) dy/dx = 0 such that `P` and `Q` are homogeneous and of the same order. A function `F(x, y)` is homogeneous of order `n` if `F(x t, y t) = t^n F(x, y)`. Equivalently, `F(x, y)` can be rewritten as `G(y/x)` or `H(x/y)`. See also the docstring of :py:meth:`~sympy.solvers.ode.homogeneous_order`. If the coefficients `P` and `Q` in the differential equation above are homogeneous functions of the same order, then it can be shown that the substitution `x = u_2 y` (i.e. `u_2 = x/y`) will turn the differential equation into an equation separable in the variables `y` and `u_2`. If `h(u_2)` is the function that results from making the substitution `u_2 = x/f(x)` on `P(x, f(x))` and `g(u_2)` is the function that results from the substitution on `Q(x, f(x))` in the differential equation `P(x, f(x)) + Q(x, f(x)) f'(x) = 0`, then the general solution is: >>> from sympy import Function, dsolve, pprint >>> from sympy.abc import x >>> f, g, h = map(Function, ['f', 'g', 'h']) >>> genform = g(x/f(x)) + h(x/f(x))*f(x).diff(x) >>> pprint(genform) / x \ / x \ d g|----| + h|----|*--(f(x)) \f(x)/ \f(x)/ dx >>> pprint(dsolve(genform, f(x), ... hint='1st_homogeneous_coeff_subs_indep_div_dep_Integral')) x ---- f(x) / | | -g(u2) | ---------------- d(u2) | u2*g(u2) + h(u2) | / <BLANKLINE> f(x) = C1*e Where `u_2 g(u_2) + h(u_2) \ne 0` and `f(x) \ne 0`. See also the docstrings of :py:meth:`~sympy.solvers.ode.ode_1st_homogeneous_coeff_best` and :py:meth:`~sympy.solvers.ode.ode_1st_homogeneous_coeff_subs_dep_div_indep`. Examples ======== >>> from sympy import Function, pprint, dsolve >>> from sympy.abc import x >>> f = Function('f') >>> pprint(dsolve(2*x*f(x) + (x**2 + f(x)**2)*f(x).diff(x), f(x), ... hint='1st_homogeneous_coeff_subs_indep_div_dep', ... simplify=False)) / 2 \ | 3*x | log|----- + 1| | 2 | \f (x) / log(f(x)) = log(C1) - -------------- 3 References ========== - http://en.wikipedia.org/wiki/Homogeneous_differential_equation - M. Tenenbaum & H. Pollard, "Ordinary Differential Equations", Dover 1963, pp. 59 # indirect doctest """ x = func.args[0] f = func.func u = Dummy('u') u2 = Dummy('u2') # u2 == x/f(x) r = match # d+e*diff(f(x),x) C1 = get_numbered_constants(eq, num=1) xarg = match.get('xarg', 0) # If xarg present take xarg, else zero yarg = match.get('yarg', 0) # If yarg present take yarg, else zero int = Integral( simplify( (-r[r['d']]/(r[r['e']] + u2*r[r['d']])).subs({x: u2, r['y']: 1})), (u2, None, x/f(x))) sol = logcombine(Eq(log(f(x)), int + log(C1)), force=True) sol = sol.subs(f(x), u).subs(((u, u - yarg), (x, x - xarg), (u, f(x)))) return sol # XXX: Should this function maybe go somewhere else? def homogeneous_order(eq, *symbols): r""" Returns the order `n` if `g` is homogeneous and ``None`` if it is not homogeneous. Determines if a function is homogeneous and if so of what order. A function `f(x, y, \cdots)` is homogeneous of order `n` if `f(t x, t y, \cdots) = t^n f(x, y, \cdots)`. If the function is of two variables, `F(x, y)`, then `f` being homogeneous of any order is equivalent to being able to rewrite `F(x, y)` as `G(x/y)` or `H(y/x)`. This fact is used to solve 1st order ordinary differential equations whose coefficients are homogeneous of the same order (see the docstrings of :py:meth:`~solvers.ode.ode_1st_homogeneous_coeff_subs_dep_div_indep` and :py:meth:`~solvers.ode.ode_1st_homogeneous_coeff_subs_indep_div_dep`). Symbols can be functions, but every argument of the function must be a symbol, and the arguments of the function that appear in the expression must match those given in the list of symbols. If a declared function appears with different arguments than given in the list of symbols, ``None`` is returned. Examples ======== >>> from sympy import Function, homogeneous_order, sqrt >>> from sympy.abc import x, y >>> f = Function('f') >>> homogeneous_order(f(x), f(x)) is None True >>> homogeneous_order(f(x,y), f(y, x), x, y) is None True >>> homogeneous_order(f(x), f(x), x) 1 >>> homogeneous_order(x**2*f(x)/sqrt(x**2+f(x)**2), x, f(x)) 2 >>> homogeneous_order(x**2+f(x), x, f(x)) is None True """ if not symbols: raise ValueError("homogeneous_order: no symbols were given.") symset = set(symbols) eq = sympify(eq) # The following are not supported if eq.has(Order, Derivative): return None # These are all constants if (eq.is_Number or eq.is_NumberSymbol or eq.is_number ): return S.Zero # Replace all functions with dummy variables dum = numbered_symbols(prefix='d', cls=Dummy) newsyms = set() for i in [j for j in symset if getattr(j, 'is_Function')]: iargs = set(i.args) if iargs.difference(symset): return None else: dummyvar = next(dum) eq = eq.subs(i, dummyvar) symset.remove(i) newsyms.add(dummyvar) symset.update(newsyms) if not eq.free_symbols & symset: return None # assuming order of a nested function can only be equal to zero if isinstance(eq, Function): return None if homogeneous_order( eq.args[0], *tuple(symset)) != 0 else S.Zero # make the replacement of x with x*t and see if t can be factored out t = Dummy('t', positive=True) # It is sufficient that t > 0 eqs = separatevars(eq.subs([(i, t*i) for i in symset]), [t], dict=True)[t] if eqs is S.One: return S.Zero # there was no term with only t i, d = eqs.as_independent(t, as_Add=False) b, e = d.as_base_exp() if b == t: return e def ode_1st_linear(eq, func, order, match): r""" Solves 1st order linear differential equations. These are differential equations of the form .. math:: dy/dx + P(x) y = Q(x)\text{.} These kinds of differential equations can be solved in a general way. The integrating factor `e^{\int P(x) \,dx}` will turn the equation into a separable equation. The general solution is:: >>> from sympy import Function, dsolve, Eq, pprint, diff, sin >>> from sympy.abc import x >>> f, P, Q = map(Function, ['f', 'P', 'Q']) >>> genform = Eq(f(x).diff(x) + P(x)*f(x), Q(x)) >>> pprint(genform) d P(x)*f(x) + --(f(x)) = Q(x) dx >>> pprint(dsolve(genform, f(x), hint='1st_linear_Integral')) / / \ | | | | | / | / | | | | | | | | P(x) dx | - | P(x) dx | | | | | | | / | / f(x) = |C1 + | Q(x)*e dx|*e | | | \ / / Examples ======== >>> f = Function('f') >>> pprint(dsolve(Eq(x*diff(f(x), x) - f(x), x**2*sin(x)), ... f(x), '1st_linear')) f(x) = x*(C1 - cos(x)) References ========== - http://en.wikipedia.org/wiki/Linear_differential_equation#First_order_equation - M. Tenenbaum & H. Pollard, "Ordinary Differential Equations", Dover 1963, pp. 92 # indirect doctest """ x = func.args[0] f = func.func r = match # a*diff(f(x),x) + b*f(x) + c C1 = get_numbered_constants(eq, num=1) t = exp(Integral(r[r['b']]/r[r['a']], x)) tt = Integral(t*(-r[r['c']]/r[r['a']]), x) f = match.get('u', f(x)) # take almost-linear u if present, else f(x) return Eq(f, (tt + C1)/t) def ode_Bernoulli(eq, func, order, match): r""" Solves Bernoulli differential equations. These are equations of the form .. math:: dy/dx + P(x) y = Q(x) y^n\text{, }n \ne 1`\text{.} The substitution `w = 1/y^{1-n}` will transform an equation of this form into one that is linear (see the docstring of :py:meth:`~sympy.solvers.ode.ode_1st_linear`). The general solution is:: >>> from sympy import Function, dsolve, Eq, pprint >>> from sympy.abc import x, n >>> f, P, Q = map(Function, ['f', 'P', 'Q']) >>> genform = Eq(f(x).diff(x) + P(x)*f(x), Q(x)*f(x)**n) >>> pprint(genform) d n P(x)*f(x) + --(f(x)) = Q(x)*f (x) dx >>> pprint(dsolve(genform, f(x), hint='Bernoulli_Integral')) #doctest: +SKIP 1 ---- 1 - n // / \ \ || | | | || | / | / | || | | | | | || | (1 - n)* | P(x) dx | (-1 + n)* | P(x) dx| || | | | | | || | / | / | f(x) = ||C1 + (-1 + n)* | -Q(x)*e dx|*e | || | | | \\ / / / Note that the equation is separable when `n = 1` (see the docstring of :py:meth:`~sympy.solvers.ode.ode_separable`). >>> pprint(dsolve(Eq(f(x).diff(x) + P(x)*f(x), Q(x)*f(x)), f(x), ... hint='separable_Integral')) f(x) / | / | 1 | | - dy = C1 + | (-P(x) + Q(x)) dx | y | | / / Examples ======== >>> from sympy import Function, dsolve, Eq, pprint, log >>> from sympy.abc import x >>> f = Function('f') >>> pprint(dsolve(Eq(x*f(x).diff(x) + f(x), log(x)*f(x)**2), ... f(x), hint='Bernoulli')) 1 f(x) = ------------------- / log(x) 1\ x*|C1 + ------ + -| \ x x/ References ========== - http://en.wikipedia.org/wiki/Bernoulli_differential_equation - M. Tenenbaum & H. Pollard, "Ordinary Differential Equations", Dover 1963, pp. 95 # indirect doctest """ x = func.args[0] f = func.func r = match # a*diff(f(x),x) + b*f(x) + c*f(x)**n, n != 1 C1 = get_numbered_constants(eq, num=1) t = exp((1 - r[r['n']])*Integral(r[r['b']]/r[r['a']], x)) tt = (r[r['n']] - 1)*Integral(t*r[r['c']]/r[r['a']], x) return Eq(f(x), ((tt + C1)/t)**(1/(1 - r[r['n']]))) def ode_Riccati_special_minus2(eq, func, order, match): r""" The general Riccati equation has the form .. math:: dy/dx = f(x) y^2 + g(x) y + h(x)\text{.} While it does not have a general solution [1], the "special" form, `dy/dx = a y^2 - b x^c`, does have solutions in many cases [2]. This routine returns a solution for `a(dy/dx) = b y^2 + c y/x + d/x^2` that is obtained by using a suitable change of variables to reduce it to the special form and is valid when neither `a` nor `b` are zero and either `c` or `d` is zero. >>> from sympy.abc import x, y, a, b, c, d >>> from sympy.solvers.ode import dsolve, checkodesol >>> from sympy import pprint, Function >>> f = Function('f') >>> y = f(x) >>> genform = a*y.diff(x) - (b*y**2 + c*y/x + d/x**2) >>> sol = dsolve(genform, y) >>> pprint(sol, wrap_line=False) / / __________________ \\ | __________________ | / 2 || | / 2 | \/ 4*b*d - (a + c) *log(x)|| -|a + c - \/ 4*b*d - (a + c) *tan|C1 + ----------------------------|| \ \ 2*a // f(x) = ------------------------------------------------------------------------ 2*b*x >>> checkodesol(genform, sol, order=1)[0] True References ========== 1. http://www.maplesoft.com/support/help/Maple/view.aspx?path=odeadvisor/Riccati 2. http://eqworld.ipmnet.ru/en/solutions/ode/ode0106.pdf - http://eqworld.ipmnet.ru/en/solutions/ode/ode0123.pdf """ x = func.args[0] f = func.func r = match # a2*diff(f(x),x) + b2*f(x) + c2*f(x)/x + d2/x**2 a2, b2, c2, d2 = [r[r[s]] for s in 'a2 b2 c2 d2'.split()] C1 = get_numbered_constants(eq, num=1) mu = sqrt(4*d2*b2 - (a2 - c2)**2) return Eq(f(x), (a2 - c2 - mu*tan(mu/(2*a2)*log(x) + C1))/(2*b2*x)) def ode_Liouville(eq, func, order, match): r""" Solves 2nd order Liouville differential equations. The general form of a Liouville ODE is .. math:: \frac{d^2 y}{dx^2} + g(y) \left(\! \frac{dy}{dx}\!\right)^2 + h(x) \frac{dy}{dx}\text{.} The general solution is: >>> from sympy import Function, dsolve, Eq, pprint, diff >>> from sympy.abc import x >>> f, g, h = map(Function, ['f', 'g', 'h']) >>> genform = Eq(diff(f(x),x,x) + g(f(x))*diff(f(x),x)**2 + ... h(x)*diff(f(x),x), 0) >>> pprint(genform) 2 2 /d \ d d g(f(x))*|--(f(x))| + h(x)*--(f(x)) + ---(f(x)) = 0 \dx / dx 2 dx >>> pprint(dsolve(genform, f(x), hint='Liouville_Integral')) f(x) / / | | | / | / | | | | | - | h(x) dx | | g(y) dy | | | | | / | / C1 + C2* | e dx + | e dy = 0 | | / / Examples ======== >>> from sympy import Function, dsolve, Eq, pprint >>> from sympy.abc import x >>> f = Function('f') >>> pprint(dsolve(diff(f(x), x, x) + diff(f(x), x)**2/f(x) + ... diff(f(x), x)/x, f(x), hint='Liouville')) ________________ ________________ [f(x) = -\/ C1 + C2*log(x) , f(x) = \/ C1 + C2*log(x) ] References ========== - Goldstein and Braun, "Advanced Methods for the Solution of Differential Equations", pp. 98 - http://www.maplesoft.com/support/help/Maple/view.aspx?path=odeadvisor/Liouville # indirect doctest """ # Liouville ODE: # f(x).diff(x, 2) + g(f(x))*(f(x).diff(x, 2))**2 + h(x)*f(x).diff(x) # See Goldstein and Braun, "Advanced Methods for the Solution of # Differential Equations", pg. 98, as well as # http://www.maplesoft.com/support/help/view.aspx?path=odeadvisor/Liouville x = func.args[0] f = func.func r = match # f(x).diff(x, 2) + g*f(x).diff(x)**2 + h*f(x).diff(x) y = r['y'] C1, C2 = get_numbered_constants(eq, num=2) int = Integral(exp(Integral(r['g'], y)), (y, None, f(x))) sol = Eq(int + C1*Integral(exp(-Integral(r['h'], x)), x) + C2, 0) return sol def ode_2nd_power_series_ordinary(eq, func, order, match): r""" Gives a power series solution to a second order homogeneous differential equation with polynomial coefficients at an ordinary point. A homogenous differential equation is of the form .. math :: P(x)\frac{d^2y}{dx^2} + Q(x)\frac{dy}{dx} + R(x) = 0 For simplicity it is assumed that `P(x)`, `Q(x)` and `R(x)` are polynomials, it is sufficient that `\frac{Q(x)}{P(x)}` and `\frac{R(x)}{P(x)}` exists at `x_{0}`. A recurrence relation is obtained by substituting `y` as `\sum_{n=0}^\infty a_{n}x^{n}`, in the differential equation, and equating the nth term. Using this relation various terms can be generated. Examples ======== >>> from sympy import dsolve, Function, pprint >>> from sympy.abc import x, y >>> f = Function("f") >>> eq = f(x).diff(x, 2) + f(x) >>> pprint(dsolve(eq, hint='2nd_power_series_ordinary')) / 4 2 \ / 2 \ |x x | | x | / 6\ f(x) = C2*|-- - -- + 1| + C1*x*|- -- + 1| + O\x / \24 2 / \ 6 / References ========== - http://tutorial.math.lamar.edu/Classes/DE/SeriesSolutions.aspx - George E. Simmons, "Differential Equations with Applications and Historical Notes", p.p 176 - 184 """ x = func.args[0] f = func.func C0, C1 = get_numbered_constants(eq, num=2) n = Dummy("n", integer=True) s = Wild("s") k = Wild("k", exclude=[x]) x0 = match.get('x0') terms = match.get('terms', 5) p = match[match['a3']] q = match[match['b3']] r = match[match['c3']] seriesdict = {} recurr = Function("r") # Generating the recurrence relation which works this way: # for the second order term the summation begins at n = 2. The coefficients # p is multiplied with an*(n - 1)*(n - 2)*x**n-2 and a substitution is made such that # the exponent of x becomes n. # For example, if p is x, then the second degree recurrence term is # an*(n - 1)*(n - 2)*x**n-1, substituting (n - 1) as n, it transforms to # an+1*n*(n - 1)*x**n. # A similar process is done with the first order and zeroth order term. coefflist = [(recurr(n), r), (n*recurr(n), q), (n*(n - 1)*recurr(n), p)] for index, coeff in enumerate(coefflist): if coeff[1]: f2 = powsimp(expand((coeff[1]*(x - x0)**(n - index)).subs(x, x + x0))) if f2.is_Add: addargs = f2.args else: addargs = [f2] for arg in addargs: powm = arg.match(s*x**k) term = coeff[0]*powm[s] if not powm[k].is_Symbol: term = term.subs(n, n - powm[k].as_independent(n)[0]) startind = powm[k].subs(n, index) # Seeing if the startterm can be reduced further. # If it vanishes for n lesser than startind, it is # equal to summation from n. if startind: for i in reversed(range(startind)): if not term.subs(n, i): seriesdict[term] = i else: seriesdict[term] = i + 1 break else: seriesdict[term] = S(0) # Stripping of terms so that the sum starts with the same number. teq = S(0) suminit = seriesdict.values() rkeys = seriesdict.keys() req = Add(*rkeys) if any(suminit): maxval = max(suminit) for term in seriesdict: val = seriesdict[term] if val != maxval: for i in range(val, maxval): teq += term.subs(n, val) finaldict = {} if teq: fargs = teq.atoms(AppliedUndef) if len(fargs) == 1: finaldict[fargs.pop()] = 0 else: maxf = max(fargs, key = lambda x: x.args[0]) sol = solve(teq, maxf) if isinstance(sol, list): sol = sol[0] finaldict[maxf] = sol # Finding the recurrence relation in terms of the largest term. fargs = req.atoms(AppliedUndef) maxf = max(fargs, key = lambda x: x.args[0]) minf = min(fargs, key = lambda x: x.args[0]) if minf.args[0].is_Symbol: startiter = 0 else: startiter = -minf.args[0].as_independent(n)[0] lhs = maxf rhs = solve(req, maxf) if isinstance(rhs, list): rhs = rhs[0] # Checking how many values are already present tcounter = len([t for t in finaldict.values() if t]) for _ in range(tcounter, terms - 3): # Assuming c0 and c1 to be arbitrary check = rhs.subs(n, startiter) nlhs = lhs.subs(n, startiter) nrhs = check.subs(finaldict) finaldict[nlhs] = nrhs startiter += 1 # Post processing series = C0 + C1*(x - x0) for term in finaldict: if finaldict[term]: fact = term.args[0] series += (finaldict[term].subs([(recurr(0), C0), (recurr(1), C1)])*( x - x0)**fact) series = collect(expand_mul(series), [C0, C1]) + Order(x**terms) return Eq(f(x), series) def ode_2nd_power_series_regular(eq, func, order, match): r""" Gives a power series solution to a second order homogeneous differential equation with polynomial coefficients at a regular point. A second order homogenous differential equation is of the form .. math :: P(x)\frac{d^2y}{dx^2} + Q(x)\frac{dy}{dx} + R(x) = 0 A point is said to regular singular at `x0` if `x - x0\frac{Q(x)}{P(x)}` and `(x - x0)^{2}\frac{R(x)}{P(x)}` are analytic at `x0`. For simplicity `P(x)`, `Q(x)` and `R(x)` are assumed to be polynomials. The algorithm for finding the power series solutions is: 1. Try expressing `(x - x0)P(x)` and `((x - x0)^{2})Q(x)` as power series solutions about x0. Find `p0` and `q0` which are the constants of the power series expansions. 2. Solve the indicial equation `f(m) = m(m - 1) + m*p0 + q0`, to obtain the roots `m1` and `m2` of the indicial equation. 3. If `m1 - m2` is a non integer there exists two series solutions. If `m1 = m2`, there exists only one solution. If `m1 - m2` is an integer, then the existence of one solution is confirmed. The other solution may or may not exist. The power series solution is of the form `x^{m}\sum_{n=0}^\infty a_{n}x^{n}`. The coefficients are determined by the following recurrence relation. `a_{n} = -\frac{\sum_{k=0}^{n-1} q_{n-k} + (m + k)p_{n-k}}{f(m + n)}`. For the case in which `m1 - m2` is an integer, it can be seen from the recurrence relation that for the lower root `m`, when `n` equals the difference of both the roots, the denominator becomes zero. So if the numerator is not equal to zero, a second series solution exists. Examples ======== >>> from sympy import dsolve, Function, pprint >>> from sympy.abc import x, y >>> f = Function("f") >>> eq = x*(f(x).diff(x, 2)) + 2*(f(x).diff(x)) + x*f(x) >>> pprint(dsolve(eq)) / 6 4 2 \ | x x x | / 4 2 \ C1*|- --- + -- - -- + 1| | x x | \ 720 24 2 / / 6\ f(x) = C2*|--- - -- + 1| + ------------------------ + O\x / \120 6 / x References ========== - George E. Simmons, "Differential Equations with Applications and Historical Notes", p.p 176 - 184 """ x = func.args[0] f = func.func C0, C1 = get_numbered_constants(eq, num=2) n = Dummy("n") m = Dummy("m") # for solving the indicial equation s = Wild("s") k = Wild("k", exclude=[x]) x0 = match.get('x0') terms = match.get('terms', 5) p = match['p'] q = match['q'] # Generating the indicial equation indicial = [] for term in [p, q]: if not term.has(x): indicial.append(term) else: term = series(term, n=1, x0=x0) if isinstance(term, Order): indicial.append(S(0)) else: for arg in term.args: if not arg.has(x): indicial.append(arg) break p0, q0 = indicial sollist = solve(m*(m - 1) + m*p0 + q0, m) if sollist and isinstance(sollist, list) and all( [sol.is_real for sol in sollist]): serdict1 = {} serdict2 = {} if len(sollist) == 1: # Only one series solution exists in this case. m1 = m2 = sollist.pop() if terms-m1-1 <= 0: return Eq(f(x), Order(terms)) serdict1 = _frobenius(terms-m1-1, m1, p0, q0, p, q, x0, x, C0) else: m1 = sollist[0] m2 = sollist[1] if m1 < m2: m1, m2 = m2, m1 # Irrespective of whether m1 - m2 is an integer or not, one # Frobenius series solution exists. serdict1 = _frobenius(terms-m1-1, m1, p0, q0, p, q, x0, x, C0) if not (m1 - m2).is_integer: # Second frobenius series solution exists. serdict2 = _frobenius(terms-m2-1, m2, p0, q0, p, q, x0, x, C1) else: # Check if second frobenius series solution exists. serdict2 = _frobenius(terms-m2-1, m2, p0, q0, p, q, x0, x, C1, check=m1) if serdict1: finalseries1 = C0 for key in serdict1: power = int(key.name[1:]) finalseries1 += serdict1[key]*(x - x0)**power finalseries1 = (x - x0)**m1*finalseries1 finalseries2 = S(0) if serdict2: for key in serdict2: power = int(key.name[1:]) finalseries2 += serdict2[key]*(x - x0)**power finalseries2 += C1 finalseries2 = (x - x0)**m2*finalseries2 return Eq(f(x), collect(finalseries1 + finalseries2, [C0, C1]) + Order(x**terms)) def _frobenius(n, m, p0, q0, p, q, x0, x, c, check=None): r""" Returns a dict with keys as coefficients and values as their values in terms of C0 """ n = int(n) # In cases where m1 - m2 is not an integer m2 = check d = Dummy("d") numsyms = numbered_symbols("C", start=0) numsyms = [next(numsyms) for i in range(n + 1)] C0 = Symbol("C0") serlist = [] for ser in [p, q]: # Order term not present if ser.is_polynomial(x) and Poly(ser, x).degree() <= n: if x0: ser = ser.subs(x, x + x0) dict_ = Poly(ser, x).as_dict() # Order term present else: tseries = series(ser, x=x0, n=n+1) # Removing order dict_ = Poly(list(ordered(tseries.args))[: -1], x).as_dict() # Fill in with zeros, if coefficients are zero. for i in range(n + 1): if (i,) not in dict_: dict_[(i,)] = S(0) serlist.append(dict_) pseries = serlist[0] qseries = serlist[1] indicial = d*(d - 1) + d*p0 + q0 frobdict = {} for i in range(1, n + 1): num = c*(m*pseries[(i,)] + qseries[(i,)]) for j in range(1, i): sym = Symbol("C" + str(j)) num += frobdict[sym]*((m + j)*pseries[(i - j,)] + qseries[(i - j,)]) # Checking for cases when m1 - m2 is an integer. If num equals zero # then a second Frobenius series solution cannot be found. If num is not zero # then set constant as zero and proceed. if m2 is not None and i == m2 - m: if num: return False else: frobdict[numsyms[i]] = S(0) else: frobdict[numsyms[i]] = -num/(indicial.subs(d, m+i)) return frobdict def _nth_linear_match(eq, func, order): r""" Matches a differential equation to the linear form: .. math:: a_n(x) y^{(n)} + \cdots + a_1(x)y' + a_0(x) y + B(x) = 0 Returns a dict of order:coeff terms, where order is the order of the derivative on each term, and coeff is the coefficient of that derivative. The key ``-1`` holds the function `B(x)`. Returns ``None`` if the ODE is not linear. This function assumes that ``func`` has already been checked to be good. Examples ======== >>> from sympy import Function, cos, sin >>> from sympy.abc import x >>> from sympy.solvers.ode import _nth_linear_match >>> f = Function('f') >>> _nth_linear_match(f(x).diff(x, 3) + 2*f(x).diff(x) + ... x*f(x).diff(x, 2) + cos(x)*f(x).diff(x) + x - f(x) - ... sin(x), f(x), 3) {-1: x - sin(x), 0: -1, 1: cos(x) + 2, 2: x, 3: 1} >>> _nth_linear_match(f(x).diff(x, 3) + 2*f(x).diff(x) + ... x*f(x).diff(x, 2) + cos(x)*f(x).diff(x) + x - f(x) - ... sin(f(x)), f(x), 3) == None True """ x = func.args[0] one_x = {x} terms = {i: S.Zero for i in range(-1, order + 1)} for i in Add.make_args(eq): if not i.has(func): terms[-1] += i else: c, f = i.as_independent(func) if not ((isinstance(f, Derivative) and set(f.variables) == one_x) \ or f == func): return None else: terms[len(f.args[1:])] += c return terms def ode_nth_linear_euler_eq_homogeneous(eq, func, order, match, returns='sol'): r""" Solves an `n`\th order linear homogeneous variable-coefficient Cauchy-Euler equidimensional ordinary differential equation. This is an equation with form `0 = a_0 f(x) + a_1 x f'(x) + a_2 x^2 f''(x) \cdots`. These equations can be solved in a general manner, by substituting solutions of the form `f(x) = x^r`, and deriving a characteristic equation for `r`. When there are repeated roots, we include extra terms of the form `C_{r k} \ln^k(x) x^r`, where `C_{r k}` is an arbitrary integration constant, `r` is a root of the characteristic equation, and `k` ranges over the multiplicity of `r`. In the cases where the roots are complex, solutions of the form `C_1 x^a \sin(b \log(x)) + C_2 x^a \cos(b \log(x))` are returned, based on expansions with Eulers formula. The general solution is the sum of the terms found. If SymPy cannot find exact roots to the characteristic equation, a :py:class:`~sympy.polys.rootoftools.CRootOf` instance will be returned instead. >>> from sympy import Function, dsolve, Eq >>> from sympy.abc import x >>> f = Function('f') >>> dsolve(4*x**2*f(x).diff(x, 2) + f(x), f(x), ... hint='nth_linear_euler_eq_homogeneous') ... # doctest: +NORMALIZE_WHITESPACE Eq(f(x), sqrt(x)*(C1 + C2*log(x))) Note that because this method does not involve integration, there is no ``nth_linear_euler_eq_homogeneous_Integral`` hint. The following is for internal use: - ``returns = 'sol'`` returns the solution to the ODE. - ``returns = 'list'`` returns a list of linearly independent solutions, corresponding to the fundamental solution set, for use with non homogeneous solution methods like variation of parameters and undetermined coefficients. Note that, though the solutions should be linearly independent, this function does not explicitly check that. You can do ``assert simplify(wronskian(sollist)) != 0`` to check for linear independence. Also, ``assert len(sollist) == order`` will need to pass. - ``returns = 'both'``, return a dictionary ``{'sol': <solution to ODE>, 'list': <list of linearly independent solutions>}``. Examples ======== >>> from sympy import Function, dsolve, pprint >>> from sympy.abc import x >>> f = Function('f') >>> eq = f(x).diff(x, 2)*x**2 - 4*f(x).diff(x)*x + 6*f(x) >>> pprint(dsolve(eq, f(x), ... hint='nth_linear_euler_eq_homogeneous')) 2 f(x) = x *(C1 + C2*x) References ========== - http://en.wikipedia.org/wiki/Cauchy%E2%80%93Euler_equation - C. Bender & S. Orszag, "Advanced Mathematical Methods for Scientists and Engineers", Springer 1999, pp. 12 # indirect doctest """ global collectterms collectterms = [] x = func.args[0] f = func.func r = match # First, set up characteristic equation. chareq, symbol = S.Zero, Dummy('x') for i in r.keys(): if not isinstance(i, str) and i >= 0: chareq += (r[i]*diff(x**symbol, x, i)*x**-symbol).expand() chareq = Poly(chareq, symbol) chareqroots = [rootof(chareq, k) for k in range(chareq.degree())] # A generator of constants constants = list(get_numbered_constants(eq, num=chareq.degree()*2)) constants.reverse() # Create a dict root: multiplicity or charroots charroots = defaultdict(int) for root in chareqroots: charroots[root] += 1 gsol = S(0) # We need keep track of terms so we can run collect() at the end. # This is necessary for constantsimp to work properly. ln = log for root, multiplicity in charroots.items(): for i in range(multiplicity): if isinstance(root, RootOf): gsol += (x**root) * constants.pop() if multiplicity != 1: raise ValueError("Value should be 1") collectterms = [(0, root, 0)] + collectterms elif root.is_real: gsol += ln(x)**i*(x**root) * constants.pop() collectterms = [(i, root, 0)] + collectterms else: reroot = re(root) imroot = im(root) gsol += ln(x)**i * (x**reroot) * ( constants.pop() * sin(abs(imroot)*ln(x)) + constants.pop() * cos(imroot*ln(x))) # Preserve ordering (multiplicity, real part, imaginary part) # It will be assumed implicitly when constructing # fundamental solution sets. collectterms = [(i, reroot, imroot)] + collectterms if returns == 'sol': return Eq(f(x), gsol) elif returns in ('list' 'both'): # HOW TO TEST THIS CODE? (dsolve does not pass 'returns' through) # Create a list of (hopefully) linearly independent solutions gensols = [] # Keep track of when to use sin or cos for nonzero imroot for i, reroot, imroot in collectterms: if imroot == 0: gensols.append(ln(x)**i*x**reroot) else: sin_form = ln(x)**i*x**reroot*sin(abs(imroot)*ln(x)) if sin_form in gensols: cos_form = ln(x)**i*x**reroot*cos(imroot*ln(x)) gensols.append(cos_form) else: gensols.append(sin_form) if returns == 'list': return gensols else: return {'sol': Eq(f(x), gsol), 'list': gensols} else: raise ValueError('Unknown value for key "returns".') def ode_nth_linear_euler_eq_nonhomogeneous_undetermined_coefficients(eq, func, order, match, returns='sol'): r""" Solves an `n`\th order linear non homogeneous Cauchy-Euler equidimensional ordinary differential equation using undetermined coefficients. This is an equation with form `g(x) = a_0 f(x) + a_1 x f'(x) + a_2 x^2 f''(x) \cdots`. These equations can be solved in a general manner, by substituting solutions of the form `x = exp(t)`, and deriving a characteristic equation of form `g(exp(t)) = b_0 f(t) + b_1 f'(t) + b_2 f''(t) \cdots` which can be then solved by nth_linear_constant_coeff_undetermined_coefficients if g(exp(t)) has finite number of lineary independent derivatives. Functions that fit this requirement are finite sums functions of the form `a x^i e^{b x} \sin(c x + d)` or `a x^i e^{b x} \cos(c x + d)`, where `i` is a non-negative integer and `a`, `b`, `c`, and `d` are constants. For example any polynomial in `x`, functions like `x^2 e^{2 x}`, `x \sin(x)`, and `e^x \cos(x)` can all be used. Products of `\sin`'s and `\cos`'s have a finite number of derivatives, because they can be expanded into `\sin(a x)` and `\cos(b x)` terms. However, SymPy currently cannot do that expansion, so you will need to manually rewrite the expression in terms of the above to use this method. So, for example, you will need to manually convert `\sin^2(x)` into `(1 + \cos(2 x))/2` to properly apply the method of undetermined coefficients on it. After replacement of x by exp(t), this method works by creating a trial function from the expression and all of its linear independent derivatives and substituting them into the original ODE. The coefficients for each term will be a system of linear equations, which are be solved for and substituted, giving the solution. If any of the trial functions are linearly dependent on the solution to the homogeneous equation, they are multiplied by sufficient `x` to make them linearly independent. Examples ======== >>> from sympy import dsolve, Function, Derivative, log >>> from sympy.abc import x >>> f = Function('f') >>> eq = x**2*Derivative(f(x), x, x) - 2*x*Derivative(f(x), x) + 2*f(x) - log(x) >>> dsolve(eq, f(x), ... hint='nth_linear_euler_eq_nonhomogeneous_undetermined_coefficients').expand() Eq(f(x), C1*x + C2*x**2 + log(x)/2 + 3/4) """ x = func.args[0] f = func.func r = match chareq, eq, symbol = S.Zero, S.Zero, Dummy('x') for i in r.keys(): if not isinstance(i, str) and i >= 0: chareq += (r[i]*diff(x**symbol, x, i)*x**-symbol).expand() for i in range(1,degree(Poly(chareq, symbol))+1): eq += chareq.coeff(symbol**i)*diff(f(x), x, i) if chareq.as_coeff_add(symbol)[0]: eq += chareq.as_coeff_add(symbol)[0]*f(x) e, re = posify(r[-1].subs(x, exp(x))) eq += e.subs(re) match = _nth_linear_match(eq, f(x), ode_order(eq, f(x))) match['trialset'] = r['trialset'] return ode_nth_linear_constant_coeff_undetermined_coefficients(eq, func, order, match).subs(x, log(x)).subs(f(log(x)), f(x)).expand() def ode_nth_linear_euler_eq_nonhomogeneous_variation_of_parameters(eq, func, order, match, returns='sol'): r""" Solves an `n`\th order linear non homogeneous Cauchy-Euler equidimensional ordinary differential equation using variation of parameters. This is an equation with form `g(x) = a_0 f(x) + a_1 x f'(x) + a_2 x^2 f''(x) \cdots`. This method works by assuming that the particular solution takes the form .. math:: \sum_{x=1}^{n} c_i(x) y_i(x) {a_n} {x^n} \text{,} where `y_i` is the `i`\th solution to the homogeneous equation. The solution is then solved using Wronskian's and Cramer's Rule. The particular solution is given by multiplying eq given below with `a_n x^{n}` .. math:: \sum_{x=1}^n \left( \int \frac{W_i(x)}{W(x)} \,dx \right) y_i(x) \text{,} where `W(x)` is the Wronskian of the fundamental system (the system of `n` linearly independent solutions to the homogeneous equation), and `W_i(x)` is the Wronskian of the fundamental system with the `i`\th column replaced with `[0, 0, \cdots, 0, \frac{x^{- n}}{a_n} g{\left (x \right )}]`. This method is general enough to solve any `n`\th order inhomogeneous linear differential equation, but sometimes SymPy cannot simplify the Wronskian well enough to integrate it. If this method hangs, try using the ``nth_linear_constant_coeff_variation_of_parameters_Integral`` hint and simplifying the integrals manually. Also, prefer using ``nth_linear_constant_coeff_undetermined_coefficients`` when it applies, because it doesn't use integration, making it faster and more reliable. Warning, using simplify=False with 'nth_linear_constant_coeff_variation_of_parameters' in :py:meth:`~sympy.solvers.ode.dsolve` may cause it to hang, because it will not attempt to simplify the Wronskian before integrating. It is recommended that you only use simplify=False with 'nth_linear_constant_coeff_variation_of_parameters_Integral' for this method, especially if the solution to the homogeneous equation has trigonometric functions in it. Examples ======== >>> from sympy import Function, dsolve, Derivative >>> from sympy.abc import x >>> f = Function('f') >>> eq = x**2*Derivative(f(x), x, x) - 2*x*Derivative(f(x), x) + 2*f(x) - x**4 >>> dsolve(eq, f(x), ... hint='nth_linear_euler_eq_nonhomogeneous_variation_of_parameters').expand() Eq(f(x), C1*x + C2*x**2 + x**4/6) """ x = func.args[0] f = func.func r = match gensol = ode_nth_linear_euler_eq_homogeneous(eq, func, order, match, returns='both') match.update(gensol) r[-1] = r[-1]/r[ode_order(eq, f(x))] sol = _solve_variation_of_parameters(eq, func, order, match) return Eq(f(x), r['sol'].rhs + (sol.rhs - r['sol'].rhs)*r[ode_order(eq, f(x))]) def ode_almost_linear(eq, func, order, match): r""" Solves an almost-linear differential equation. The general form of an almost linear differential equation is .. math:: f(x) g(y) y + k(x) l(y) + m(x) = 0 \text{where} l'(y) = g(y)\text{.} This can be solved by substituting `l(y) = u(y)`. Making the given substitution reduces it to a linear differential equation of the form `u' + P(x) u + Q(x) = 0`. The general solution is >>> from sympy import Function, dsolve, Eq, pprint >>> from sympy.abc import x, y, n >>> f, g, k, l = map(Function, ['f', 'g', 'k', 'l']) >>> genform = Eq(f(x)*(l(y).diff(y)) + k(x)*l(y) + g(x)) >>> pprint(genform) d f(x)*--(l(y)) + g(x) + k(x)*l(y) = 0 dy >>> pprint(dsolve(genform, hint = 'almost_linear')) / // -y*g(x) \\ | || -------- for k(x) = 0|| | || f(x) || -y*k(x) | || || -------- | || y*k(x) || f(x) l(y) = |C1 + |< ------ ||*e | || f(x) || | ||-g(x)*e || | ||-------------- otherwise || | || k(x) || \ \\ // See Also ======== :meth:`sympy.solvers.ode.ode_1st_linear` Examples ======== >>> from sympy import Function, Derivative, pprint >>> from sympy.solvers.ode import dsolve, classify_ode >>> from sympy.abc import x >>> f = Function('f') >>> d = f(x).diff(x) >>> eq = x*d + x*f(x) + 1 >>> dsolve(eq, f(x), hint='almost_linear') Eq(f(x), (C1 - Ei(x))*exp(-x)) >>> pprint(dsolve(eq, f(x), hint='almost_linear')) -x f(x) = (C1 - Ei(x))*e References ========== - Joel Moses, "Symbolic Integration - The Stormy Decade", Communications of the ACM, Volume 14, Number 8, August 1971, pp. 558 """ # Since ode_1st_linear has already been implemented, and the # coefficients have been modified to the required form in # classify_ode, just passing eq, func, order and match to # ode_1st_linear will give the required output. return ode_1st_linear(eq, func, order, match) def _linear_coeff_match(expr, func): r""" Helper function to match hint ``linear_coefficients``. Matches the expression to the form `(a_1 x + b_1 f(x) + c_1)/(a_2 x + b_2 f(x) + c_2)` where the following conditions hold: 1. `a_1`, `b_1`, `c_1`, `a_2`, `b_2`, `c_2` are Rationals; 2. `c_1` or `c_2` are not equal to zero; 3. `a_2 b_1 - a_1 b_2` is not equal to zero. Return ``xarg``, ``yarg`` where 1. ``xarg`` = `(b_2 c_1 - b_1 c_2)/(a_2 b_1 - a_1 b_2)` 2. ``yarg`` = `(a_1 c_2 - a_2 c_1)/(a_2 b_1 - a_1 b_2)` Examples ======== >>> from sympy import Function >>> from sympy.abc import x >>> from sympy.solvers.ode import _linear_coeff_match >>> from sympy.functions.elementary.trigonometric import sin >>> f = Function('f') >>> _linear_coeff_match(( ... (-25*f(x) - 8*x + 62)/(4*f(x) + 11*x - 11)), f(x)) (1/9, 22/9) >>> _linear_coeff_match( ... sin((-5*f(x) - 8*x + 6)/(4*f(x) + x - 1)), f(x)) (19/27, 2/27) >>> _linear_coeff_match(sin(f(x)/x), f(x)) """ f = func.func x = func.args[0] def abc(eq): r''' Internal function of _linear_coeff_match that returns Rationals a, b, c if eq is a*x + b*f(x) + c, else None. ''' eq = _mexpand(eq) c = eq.as_independent(x, f(x), as_Add=True)[0] if not c.is_Rational: return a = eq.coeff(x) if not a.is_Rational: return b = eq.coeff(f(x)) if not b.is_Rational: return if eq == a*x + b*f(x) + c: return a, b, c def match(arg): r''' Internal function of _linear_coeff_match that returns Rationals a1, b1, c1, a2, b2, c2 and a2*b1 - a1*b2 of the expression (a1*x + b1*f(x) + c1)/(a2*x + b2*f(x) + c2) if one of c1 or c2 and a2*b1 - a1*b2 is non-zero, else None. ''' n, d = arg.together().as_numer_denom() m = abc(n) if m is not None: a1, b1, c1 = m m = abc(d) if m is not None: a2, b2, c2 = m d = a2*b1 - a1*b2 if (c1 or c2) and d: return a1, b1, c1, a2, b2, c2, d m = [fi.args[0] for fi in expr.atoms(Function) if fi.func != f and len(fi.args) == 1 and not fi.args[0].is_Function] or {expr} m1 = match(m.pop()) if m1 and all(match(mi) == m1 for mi in m): a1, b1, c1, a2, b2, c2, denom = m1 return (b2*c1 - b1*c2)/denom, (a1*c2 - a2*c1)/denom def ode_linear_coefficients(eq, func, order, match): r""" Solves a differential equation with linear coefficients. The general form of a differential equation with linear coefficients is .. math:: y' + F\left(\!\frac{a_1 x + b_1 y + c_1}{a_2 x + b_2 y + c_2}\!\right) = 0\text{,} where `a_1`, `b_1`, `c_1`, `a_2`, `b_2`, `c_2` are constants and `a_1 b_2 - a_2 b_1 \ne 0`. This can be solved by substituting: .. math:: x = x' + \frac{b_2 c_1 - b_1 c_2}{a_2 b_1 - a_1 b_2} y = y' + \frac{a_1 c_2 - a_2 c_1}{a_2 b_1 - a_1 b_2}\text{.} This substitution reduces the equation to a homogeneous differential equation. See Also ======== :meth:`sympy.solvers.ode.ode_1st_homogeneous_coeff_best` :meth:`sympy.solvers.ode.ode_1st_homogeneous_coeff_subs_indep_div_dep` :meth:`sympy.solvers.ode.ode_1st_homogeneous_coeff_subs_dep_div_indep` Examples ======== >>> from sympy import Function, Derivative, pprint >>> from sympy.solvers.ode import dsolve, classify_ode >>> from sympy.abc import x >>> f = Function('f') >>> df = f(x).diff(x) >>> eq = (x + f(x) + 1)*df + (f(x) - 6*x + 1) >>> dsolve(eq, hint='linear_coefficients') [Eq(f(x), -x - sqrt(C1 + 7*x**2) - 1), Eq(f(x), -x + sqrt(C1 + 7*x**2) - 1)] >>> pprint(dsolve(eq, hint='linear_coefficients')) ___________ ___________ / 2 / 2 [f(x) = -x - \/ C1 + 7*x - 1, f(x) = -x + \/ C1 + 7*x - 1] References ========== - Joel Moses, "Symbolic Integration - The Stormy Decade", Communications of the ACM, Volume 14, Number 8, August 1971, pp. 558 """ return ode_1st_homogeneous_coeff_best(eq, func, order, match) def ode_separable_reduced(eq, func, order, match): r""" Solves a differential equation that can be reduced to the separable form. The general form of this equation is .. math:: y' + (y/x) H(x^n y) = 0\text{}. This can be solved by substituting `u(y) = x^n y`. The equation then reduces to the separable form `\frac{u'}{u (\mathrm{power} - H(u))} - \frac{1}{x} = 0`. The general solution is: >>> from sympy import Function, dsolve, Eq, pprint >>> from sympy.abc import x, n >>> f, g = map(Function, ['f', 'g']) >>> genform = f(x).diff(x) + (f(x)/x)*g(x**n*f(x)) >>> pprint(genform) / n \ d f(x)*g\x *f(x)/ --(f(x)) + --------------- dx x >>> pprint(dsolve(genform, hint='separable_reduced')) n x *f(x) / | | 1 | ------------ dy = C1 + log(x) | y*(n - g(y)) | / See Also ======== :meth:`sympy.solvers.ode.ode_separable` Examples ======== >>> from sympy import Function, Derivative, pprint >>> from sympy.solvers.ode import dsolve, classify_ode >>> from sympy.abc import x >>> f = Function('f') >>> d = f(x).diff(x) >>> eq = (x - x**2*f(x))*d - f(x) >>> dsolve(eq, hint='separable_reduced') [Eq(f(x), (-sqrt(C1*x**2 + 1) + 1)/x), Eq(f(x), (sqrt(C1*x**2 + 1) + 1)/x)] >>> pprint(dsolve(eq, hint='separable_reduced')) ___________ ___________ / 2 / 2 - \/ C1*x + 1 + 1 \/ C1*x + 1 + 1 [f(x) = --------------------, f(x) = ------------------] x x References ========== - Joel Moses, "Symbolic Integration - The Stormy Decade", Communications of the ACM, Volume 14, Number 8, August 1971, pp. 558 """ # Arguments are passed in a way so that they are coherent with the # ode_separable function x = func.args[0] f = func.func y = Dummy('y') u = match['u'].subs(match['t'], y) ycoeff = 1/(y*(match['power'] - u)) m1 = {y: 1, x: -1/x, 'coeff': 1} m2 = {y: ycoeff, x: 1, 'coeff': 1} r = {'m1': m1, 'm2': m2, 'y': y, 'hint': x**match['power']*f(x)} return ode_separable(eq, func, order, r) def ode_1st_power_series(eq, func, order, match): r""" The power series solution is a method which gives the Taylor series expansion to the solution of a differential equation. For a first order differential equation `\frac{dy}{dx} = h(x, y)`, a power series solution exists at a point `x = x_{0}` if `h(x, y)` is analytic at `x_{0}`. The solution is given by .. math:: y(x) = y(x_{0}) + \sum_{n = 1}^{\infty} \frac{F_{n}(x_{0},b)(x - x_{0})^n}{n!}, where `y(x_{0}) = b` is the value of y at the initial value of `x_{0}`. To compute the values of the `F_{n}(x_{0},b)` the following algorithm is followed, until the required number of terms are generated. 1. `F_1 = h(x_{0}, b)` 2. `F_{n+1} = \frac{\partial F_{n}}{\partial x} + \frac{\partial F_{n}}{\partial y}F_{1}` Examples ======== >>> from sympy import Function, Derivative, pprint, exp >>> from sympy.solvers.ode import dsolve >>> from sympy.abc import x >>> f = Function('f') >>> eq = exp(x)*(f(x).diff(x)) - f(x) >>> pprint(dsolve(eq, hint='1st_power_series')) 3 4 5 C1*x C1*x C1*x / 6\ f(x) = C1 + C1*x - ----- + ----- + ----- + O\x / 6 24 60 References ========== - Travis W. Walker, Analytic power series technique for solving first-order differential equations, p.p 17, 18 """ x = func.args[0] y = match['y'] f = func.func h = -match[match['d']]/match[match['e']] point = match.get('f0') value = match.get('f0val') terms = match.get('terms') # First term F = h if not h: return Eq(f(x), value) # Initialisation series = value if terms > 1: hc = h.subs({x: point, y: value}) if hc.has(oo) or hc.has(NaN) or hc.has(zoo): # Derivative does not exist, not analytic return Eq(f(x), oo) elif hc: series += hc*(x - point) for factcount in range(2, terms): Fnew = F.diff(x) + F.diff(y)*h Fnewc = Fnew.subs({x: point, y: value}) # Same logic as above if Fnewc.has(oo) or Fnewc.has(NaN) or Fnewc.has(-oo) or Fnewc.has(zoo): return Eq(f(x), oo) series += Fnewc*((x - point)**factcount)/factorial(factcount) F = Fnew series += Order(x**terms) return Eq(f(x), series) def ode_nth_linear_constant_coeff_homogeneous(eq, func, order, match, returns='sol'): r""" Solves an `n`\th order linear homogeneous differential equation with constant coefficients. This is an equation of the form .. math:: a_n f^{(n)}(x) + a_{n-1} f^{(n-1)}(x) + \cdots + a_1 f'(x) + a_0 f(x) = 0\text{.} These equations can be solved in a general manner, by taking the roots of the characteristic equation `a_n m^n + a_{n-1} m^{n-1} + \cdots + a_1 m + a_0 = 0`. The solution will then be the sum of `C_n x^i e^{r x}` terms, for each where `C_n` is an arbitrary constant, `r` is a root of the characteristic equation and `i` is one of each from 0 to the multiplicity of the root - 1 (for example, a root 3 of multiplicity 2 would create the terms `C_1 e^{3 x} + C_2 x e^{3 x}`). The exponential is usually expanded for complex roots using Euler's equation `e^{I x} = \cos(x) + I \sin(x)`. Complex roots always come in conjugate pairs in polynomials with real coefficients, so the two roots will be represented (after simplifying the constants) as `e^{a x} \left(C_1 \cos(b x) + C_2 \sin(b x)\right)`. If SymPy cannot find exact roots to the characteristic equation, a :py:class:`~sympy.polys.rootoftools.CRootOf` instance will be return instead. >>> from sympy import Function, dsolve, Eq >>> from sympy.abc import x >>> f = Function('f') >>> dsolve(f(x).diff(x, 5) + 10*f(x).diff(x) - 2*f(x), f(x), ... hint='nth_linear_constant_coeff_homogeneous') ... # doctest: +NORMALIZE_WHITESPACE Eq(f(x), C1*exp(x*CRootOf(_x**5 + 10*_x - 2, 0)) + C2*exp(x*CRootOf(_x**5 + 10*_x - 2, 1)) + C3*exp(x*CRootOf(_x**5 + 10*_x - 2, 2)) + C4*exp(x*CRootOf(_x**5 + 10*_x - 2, 3)) + C5*exp(x*CRootOf(_x**5 + 10*_x - 2, 4))) Note that because this method does not involve integration, there is no ``nth_linear_constant_coeff_homogeneous_Integral`` hint. The following is for internal use: - ``returns = 'sol'`` returns the solution to the ODE. - ``returns = 'list'`` returns a list of linearly independent solutions, for use with non homogeneous solution methods like variation of parameters and undetermined coefficients. Note that, though the solutions should be linearly independent, this function does not explicitly check that. You can do ``assert simplify(wronskian(sollist)) != 0`` to check for linear independence. Also, ``assert len(sollist) == order`` will need to pass. - ``returns = 'both'``, return a dictionary ``{'sol': <solution to ODE>, 'list': <list of linearly independent solutions>}``. Examples ======== >>> from sympy import Function, dsolve, pprint >>> from sympy.abc import x >>> f = Function('f') >>> pprint(dsolve(f(x).diff(x, 4) + 2*f(x).diff(x, 3) - ... 2*f(x).diff(x, 2) - 6*f(x).diff(x) + 5*f(x), f(x), ... hint='nth_linear_constant_coeff_homogeneous')) x -2*x f(x) = (C1 + C2*x)*e + (C3*sin(x) + C4*cos(x))*e References ========== - http://en.wikipedia.org/wiki/Linear_differential_equation section: Nonhomogeneous_equation_with_constant_coefficients - M. Tenenbaum & H. Pollard, "Ordinary Differential Equations", Dover 1963, pp. 211 # indirect doctest """ x = func.args[0] f = func.func r = match # First, set up characteristic equation. chareq, symbol = S.Zero, Dummy('x') for i in r.keys(): if type(i) == str or i < 0: pass else: chareq += r[i]*symbol**i chareq = Poly(chareq, symbol) chareqroots = [rootof(chareq, k) for k in range(chareq.degree())] chareq_is_complex = not all([i.is_real for i in chareq.all_coeffs()]) # A generator of constants constants = list(get_numbered_constants(eq, num=chareq.degree()*2)) # Create a dict root: multiplicity or charroots charroots = defaultdict(int) for root in chareqroots: charroots[root] += 1 gsol = S(0) # We need to keep track of terms so we can run collect() at the end. # This is necessary for constantsimp to work properly. global collectterms collectterms = [] gensols = [] conjugate_roots = [] # used to prevent double-use of conjugate roots for root, multiplicity in charroots.items(): for i in range(multiplicity): if isinstance(root, RootOf): gensols.append(exp(root*x)) if multiplicity != 1: raise ValueError("Value should be 1") # This ordering is important collectterms = [(0, root, 0)] + collectterms else: if chareq_is_complex: gensols.append(x**i*exp(root*x)) collectterms = [(i, root, 0)] + collectterms continue reroot = re(root) imroot = im(root) if imroot.has(atan2) and reroot.has(atan2): # Remove this condition when re and im stop returning # circular atan2 usages. gensols.append(x**i*exp(root*x)) collectterms = [(i, root, 0)] + collectterms else: if root in conjugate_roots: collectterms = [(i, reroot, imroot)] + collectterms continue if imroot == 0: gensols.append(x**i*exp(reroot*x)) collectterms = [(i, reroot, 0)] + collectterms continue conjugate_roots.append(conjugate(root)) gensols.append(x**i*exp(reroot*x) * sin(abs(imroot) * x)) gensols.append(x**i*exp(reroot*x) * cos( imroot * x)) # This ordering is important collectterms = [(i, reroot, imroot)] + collectterms if returns == 'list': return gensols elif returns in ('sol' 'both'): gsol = Add(*[i*j for (i,j) in zip(constants, gensols)]) if returns == 'sol': return Eq(f(x), gsol) else: return {'sol': Eq(f(x), gsol), 'list': gensols} else: raise ValueError('Unknown value for key "returns".') def ode_nth_linear_constant_coeff_undetermined_coefficients(eq, func, order, match): r""" Solves an `n`\th order linear differential equation with constant coefficients using the method of undetermined coefficients. This method works on differential equations of the form .. math:: a_n f^{(n)}(x) + a_{n-1} f^{(n-1)}(x) + \cdots + a_1 f'(x) + a_0 f(x) = P(x)\text{,} where `P(x)` is a function that has a finite number of linearly independent derivatives. Functions that fit this requirement are finite sums functions of the form `a x^i e^{b x} \sin(c x + d)` or `a x^i e^{b x} \cos(c x + d)`, where `i` is a non-negative integer and `a`, `b`, `c`, and `d` are constants. For example any polynomial in `x`, functions like `x^2 e^{2 x}`, `x \sin(x)`, and `e^x \cos(x)` can all be used. Products of `\sin`'s and `\cos`'s have a finite number of derivatives, because they can be expanded into `\sin(a x)` and `\cos(b x)` terms. However, SymPy currently cannot do that expansion, so you will need to manually rewrite the expression in terms of the above to use this method. So, for example, you will need to manually convert `\sin^2(x)` into `(1 + \cos(2 x))/2` to properly apply the method of undetermined coefficients on it. This method works by creating a trial function from the expression and all of its linear independent derivatives and substituting them into the original ODE. The coefficients for each term will be a system of linear equations, which are be solved for and substituted, giving the solution. If any of the trial functions are linearly dependent on the solution to the homogeneous equation, they are multiplied by sufficient `x` to make them linearly independent. Examples ======== >>> from sympy import Function, dsolve, pprint, exp, cos >>> from sympy.abc import x >>> f = Function('f') >>> pprint(dsolve(f(x).diff(x, 2) + 2*f(x).diff(x) + f(x) - ... 4*exp(-x)*x**2 + cos(2*x), f(x), ... hint='nth_linear_constant_coeff_undetermined_coefficients')) / 4\ | x | -x 4*sin(2*x) 3*cos(2*x) f(x) = |C1 + C2*x + --|*e - ---------- + ---------- \ 3 / 25 25 References ========== - http://en.wikipedia.org/wiki/Method_of_undetermined_coefficients - M. Tenenbaum & H. Pollard, "Ordinary Differential Equations", Dover 1963, pp. 221 # indirect doctest """ gensol = ode_nth_linear_constant_coeff_homogeneous(eq, func, order, match, returns='both') match.update(gensol) return _solve_undetermined_coefficients(eq, func, order, match) def _solve_undetermined_coefficients(eq, func, order, match): r""" Helper function for the method of undetermined coefficients. See the :py:meth:`~sympy.solvers.ode.ode_nth_linear_constant_coeff_undetermined_coefficients` docstring for more information on this method. The parameter ``match`` should be a dictionary that has the following keys: ``list`` A list of solutions to the homogeneous equation, such as the list returned by ``ode_nth_linear_constant_coeff_homogeneous(returns='list')``. ``sol`` The general solution, such as the solution returned by ``ode_nth_linear_constant_coeff_homogeneous(returns='sol')``. ``trialset`` The set of trial functions as returned by ``_undetermined_coefficients_match()['trialset']``. """ x = func.args[0] f = func.func r = match coeffs = numbered_symbols('a', cls=Dummy) coefflist = [] gensols = r['list'] gsol = r['sol'] trialset = r['trialset'] notneedset = set([]) newtrialset = set([]) global collectterms if len(gensols) != order: raise NotImplementedError("Cannot find " + str(order) + " solutions to the homogeneous equation necessary to apply" + " undetermined coefficients to " + str(eq) + " (number of terms != order)") usedsin = set([]) mult = 0 # The multiplicity of the root getmult = True for i, reroot, imroot in collectterms: if getmult: mult = i + 1 getmult = False if i == 0: getmult = True if imroot: # Alternate between sin and cos if (i, reroot) in usedsin: check = x**i*exp(reroot*x)*cos(imroot*x) else: check = x**i*exp(reroot*x)*sin(abs(imroot)*x) usedsin.add((i, reroot)) else: check = x**i*exp(reroot*x) if check in trialset: # If an element of the trial function is already part of the # homogeneous solution, we need to multiply by sufficient x to # make it linearly independent. We also don't need to bother # checking for the coefficients on those elements, since we # already know it will be 0. while True: if check*x**mult in trialset: mult += 1 else: break trialset.add(check*x**mult) notneedset.add(check) newtrialset = trialset - notneedset trialfunc = 0 for i in newtrialset: c = next(coeffs) coefflist.append(c) trialfunc += c*i eqs = sub_func_doit(eq, f(x), trialfunc) coeffsdict = dict(list(zip(trialset, [0]*(len(trialset) + 1)))) eqs = _mexpand(eqs) for i in Add.make_args(eqs): s = separatevars(i, dict=True, symbols=[x]) coeffsdict[s[x]] += s['coeff'] coeffvals = solve(list(coeffsdict.values()), coefflist) if not coeffvals: raise NotImplementedError( "Could not solve `%s` using the " "method of undetermined coefficients " "(unable to solve for coefficients)." % eq) psol = trialfunc.subs(coeffvals) return Eq(f(x), gsol.rhs + psol) def _undetermined_coefficients_match(expr, x): r""" Returns a trial function match if undetermined coefficients can be applied to ``expr``, and ``None`` otherwise. A trial expression can be found for an expression for use with the method of undetermined coefficients if the expression is an additive/multiplicative combination of constants, polynomials in `x` (the independent variable of expr), `\sin(a x + b)`, `\cos(a x + b)`, and `e^{a x}` terms (in other words, it has a finite number of linearly independent derivatives). Note that you may still need to multiply each term returned here by sufficient `x` to make it linearly independent with the solutions to the homogeneous equation. This is intended for internal use by ``undetermined_coefficients`` hints. SymPy currently has no way to convert `\sin^n(x) \cos^m(y)` into a sum of only `\sin(a x)` and `\cos(b x)` terms, so these are not implemented. So, for example, you will need to manually convert `\sin^2(x)` into `[1 + \cos(2 x)]/2` to properly apply the method of undetermined coefficients on it. Examples ======== >>> from sympy import log, exp >>> from sympy.solvers.ode import _undetermined_coefficients_match >>> from sympy.abc import x >>> _undetermined_coefficients_match(9*x*exp(x) + exp(-x), x) {'test': True, 'trialset': set([x*exp(x), exp(-x), exp(x)])} >>> _undetermined_coefficients_match(log(x), x) {'test': False} """ a = Wild('a', exclude=[x]) b = Wild('b', exclude=[x]) expr = powsimp(expr, combine='exp') # exp(x)*exp(2*x + 1) => exp(3*x + 1) retdict = {} def _test_term(expr, x): r""" Test if ``expr`` fits the proper form for undetermined coefficients. """ if expr.is_Add: return all(_test_term(i, x) for i in expr.args) elif expr.is_Mul: if expr.has(sin, cos): foundtrig = False # Make sure that there is only one trig function in the args. # See the docstring. for i in expr.args: if i.has(sin, cos): if foundtrig: return False else: foundtrig = True return all(_test_term(i, x) for i in expr.args) elif expr.is_Function: if expr.func in (sin, cos, exp): if expr.args[0].match(a*x + b): return True else: return False else: return False elif expr.is_Pow and expr.base.is_Symbol and expr.exp.is_Integer and \ expr.exp >= 0: return True elif expr.is_Pow and expr.base.is_number: if expr.exp.match(a*x + b): return True else: return False elif expr.is_Symbol or expr.is_number: return True else: return False def _get_trial_set(expr, x, exprs=set([])): r""" Returns a set of trial terms for undetermined coefficients. The idea behind undetermined coefficients is that the terms expression repeat themselves after a finite number of derivatives, except for the coefficients (they are linearly dependent). So if we collect these, we should have the terms of our trial function. """ def _remove_coefficient(expr, x): r""" Returns the expression without a coefficient. Similar to expr.as_independent(x)[1], except it only works multiplicatively. """ term = S.One if expr.is_Mul: for i in expr.args: if i.has(x): term *= i elif expr.has(x): term = expr return term expr = expand_mul(expr) if expr.is_Add: for term in expr.args: if _remove_coefficient(term, x) in exprs: pass else: exprs.add(_remove_coefficient(term, x)) exprs = exprs.union(_get_trial_set(term, x, exprs)) else: term = _remove_coefficient(expr, x) tmpset = exprs.union({term}) oldset = set([]) while tmpset != oldset: # If you get stuck in this loop, then _test_term is probably # broken oldset = tmpset.copy() expr = expr.diff(x) term = _remove_coefficient(expr, x) if term.is_Add: tmpset = tmpset.union(_get_trial_set(term, x, tmpset)) else: tmpset.add(term) exprs = tmpset return exprs retdict['test'] = _test_term(expr, x) if retdict['test']: # Try to generate a list of trial solutions that will have the # undetermined coefficients. Note that if any of these are not linearly # independent with any of the solutions to the homogeneous equation, # then they will need to be multiplied by sufficient x to make them so. # This function DOES NOT do that (it doesn't even look at the # homogeneous equation). retdict['trialset'] = _get_trial_set(expr, x) return retdict def ode_nth_linear_constant_coeff_variation_of_parameters(eq, func, order, match): r""" Solves an `n`\th order linear differential equation with constant coefficients using the method of variation of parameters. This method works on any differential equations of the form .. math:: f^{(n)}(x) + a_{n-1} f^{(n-1)}(x) + \cdots + a_1 f'(x) + a_0 f(x) = P(x)\text{.} This method works by assuming that the particular solution takes the form .. math:: \sum_{x=1}^{n} c_i(x) y_i(x)\text{,} where `y_i` is the `i`\th solution to the homogeneous equation. The solution is then solved using Wronskian's and Cramer's Rule. The particular solution is given by .. math:: \sum_{x=1}^n \left( \int \frac{W_i(x)}{W(x)} \,dx \right) y_i(x) \text{,} where `W(x)` is the Wronskian of the fundamental system (the system of `n` linearly independent solutions to the homogeneous equation), and `W_i(x)` is the Wronskian of the fundamental system with the `i`\th column replaced with `[0, 0, \cdots, 0, P(x)]`. This method is general enough to solve any `n`\th order inhomogeneous linear differential equation with constant coefficients, but sometimes SymPy cannot simplify the Wronskian well enough to integrate it. If this method hangs, try using the ``nth_linear_constant_coeff_variation_of_parameters_Integral`` hint and simplifying the integrals manually. Also, prefer using ``nth_linear_constant_coeff_undetermined_coefficients`` when it applies, because it doesn't use integration, making it faster and more reliable. Warning, using simplify=False with 'nth_linear_constant_coeff_variation_of_parameters' in :py:meth:`~sympy.solvers.ode.dsolve` may cause it to hang, because it will not attempt to simplify the Wronskian before integrating. It is recommended that you only use simplify=False with 'nth_linear_constant_coeff_variation_of_parameters_Integral' for this method, especially if the solution to the homogeneous equation has trigonometric functions in it. Examples ======== >>> from sympy import Function, dsolve, pprint, exp, log >>> from sympy.abc import x >>> f = Function('f') >>> pprint(dsolve(f(x).diff(x, 3) - 3*f(x).diff(x, 2) + ... 3*f(x).diff(x) - f(x) - exp(x)*log(x), f(x), ... hint='nth_linear_constant_coeff_variation_of_parameters')) / 3 \ | 2 x *(6*log(x) - 11)| x f(x) = |C1 + C2*x + C3*x + ------------------|*e \ 36 / References ========== - http://en.wikipedia.org/wiki/Variation_of_parameters - http://planetmath.org/VariationOfParameters - M. Tenenbaum & H. Pollard, "Ordinary Differential Equations", Dover 1963, pp. 233 # indirect doctest """ gensol = ode_nth_linear_constant_coeff_homogeneous(eq, func, order, match, returns='both') match.update(gensol) return _solve_variation_of_parameters(eq, func, order, match) def _solve_variation_of_parameters(eq, func, order, match): r""" Helper function for the method of variation of parameters and nonhomogeneous euler eq. See the :py:meth:`~sympy.solvers.ode.ode_nth_linear_constant_coeff_variation_of_parameters` docstring for more information on this method. The parameter ``match`` should be a dictionary that has the following keys: ``list`` A list of solutions to the homogeneous equation, such as the list returned by ``ode_nth_linear_constant_coeff_homogeneous(returns='list')``. ``sol`` The general solution, such as the solution returned by ``ode_nth_linear_constant_coeff_homogeneous(returns='sol')``. """ x = func.args[0] f = func.func r = match psol = 0 gensols = r['list'] gsol = r['sol'] wr = wronskian(gensols, x) if r.get('simplify', True): wr = simplify(wr) # We need much better simplification for # some ODEs. See issue 4662, for example. # To reduce commonly occuring sin(x)**2 + cos(x)**2 to 1 wr = trigsimp(wr, deep=True, recursive=True) if not wr: # The wronskian will be 0 iff the solutions are not linearly # independent. raise NotImplementedError("Cannot find " + str(order) + " solutions to the homogeneous equation nessesary to apply " + "variation of parameters to " + str(eq) + " (Wronskian == 0)") if len(gensols) != order: raise NotImplementedError("Cannot find " + str(order) + " solutions to the homogeneous equation nessesary to apply " + "variation of parameters to " + str(eq) + " (number of terms != order)") negoneterm = (-1)**(order) for i in gensols: psol += negoneterm*Integral(wronskian([sol for sol in gensols if sol != i], x)*r[-1]/wr, x)*i/r[order] negoneterm *= -1 if r.get('simplify', True): psol = simplify(psol) psol = trigsimp(psol, deep=True) return Eq(f(x), gsol.rhs + psol) def ode_separable(eq, func, order, match): r""" Solves separable 1st order differential equations. This is any differential equation that can be written as `P(y) \tfrac{dy}{dx} = Q(x)`. The solution can then just be found by rearranging terms and integrating: `\int P(y) \,dy = \int Q(x) \,dx`. This hint uses :py:meth:`sympy.simplify.simplify.separatevars` as its back end, so if a separable equation is not caught by this solver, it is most likely the fault of that function. :py:meth:`~sympy.simplify.simplify.separatevars` is smart enough to do most expansion and factoring necessary to convert a separable equation `F(x, y)` into the proper form `P(x)\cdot{}Q(y)`. The general solution is:: >>> from sympy import Function, dsolve, Eq, pprint >>> from sympy.abc import x >>> a, b, c, d, f = map(Function, ['a', 'b', 'c', 'd', 'f']) >>> genform = Eq(a(x)*b(f(x))*f(x).diff(x), c(x)*d(f(x))) >>> pprint(genform) d a(x)*b(f(x))*--(f(x)) = c(x)*d(f(x)) dx >>> pprint(dsolve(genform, f(x), hint='separable_Integral')) f(x) / / | | | b(y) | c(x) | ---- dy = C1 + | ---- dx | d(y) | a(x) | | / / Examples ======== >>> from sympy import Function, dsolve, Eq >>> from sympy.abc import x >>> f = Function('f') >>> pprint(dsolve(Eq(f(x)*f(x).diff(x) + x, 3*x*f(x)**2), f(x), ... hint='separable', simplify=False)) / 2 \ 2 log\3*f (x) - 1/ x ---------------- = C1 + -- 6 2 References ========== - M. Tenenbaum & H. Pollard, "Ordinary Differential Equations", Dover 1963, pp. 52 # indirect doctest """ x = func.args[0] f = func.func C1 = get_numbered_constants(eq, num=1) r = match # {'m1':m1, 'm2':m2, 'y':y} u = r.get('hint', f(x)) # get u from separable_reduced else get f(x) return Eq(Integral(r['m2']['coeff']*r['m2'][r['y']]/r['m1'][r['y']], (r['y'], None, u)), Integral(-r['m1']['coeff']*r['m1'][x]/ r['m2'][x], x) + C1) def checkinfsol(eq, infinitesimals, func=None, order=None): r""" This function is used to check if the given infinitesimals are the actual infinitesimals of the given first order differential equation. This method is specific to the Lie Group Solver of ODEs. As of now, it simply checks, by substituting the infinitesimals in the partial differential equation. .. math:: \frac{\partial \eta}{\partial x} + \left(\frac{\partial \eta}{\partial y} - \frac{\partial \xi}{\partial x}\right)*h - \frac{\partial \xi}{\partial y}*h^{2} - \xi\frac{\partial h}{\partial x} - \eta\frac{\partial h}{\partial y} = 0 where `\eta`, and `\xi` are the infinitesimals and `h(x,y) = \frac{dy}{dx}` The infinitesimals should be given in the form of a list of dicts ``[{xi(x, y): inf, eta(x, y): inf}]``, corresponding to the output of the function infinitesimals. It returns a list of values of the form ``[(True/False, sol)]`` where ``sol`` is the value obtained after substituting the infinitesimals in the PDE. If it is ``True``, then ``sol`` would be 0. """ if isinstance(eq, Equality): eq = eq.lhs - eq.rhs if not func: eq, func = _preprocess(eq) variables = func.args if len(variables) != 1: raise ValueError("ODE's have only one independent variable") else: x = variables[0] if not order: order = ode_order(eq, func) if order != 1: raise NotImplementedError("Lie groups solver has been implemented " "only for first order differential equations") else: df = func.diff(x) a = Wild('a', exclude = [df]) b = Wild('b', exclude = [df]) match = collect(expand(eq), df).match(a*df + b) if match: h = -simplify(match[b]/match[a]) else: try: sol = solve(eq, df) except NotImplementedError: raise NotImplementedError("Infinitesimals for the " "first order ODE could not be found") else: h = sol[0] # Find infinitesimals for one solution y = Dummy('y') h = h.subs(func, y) xi = Function('xi')(x, y) eta = Function('eta')(x, y) dxi = Function('xi')(x, func) deta = Function('eta')(x, func) pde = (eta.diff(x) + (eta.diff(y) - xi.diff(x))*h - (xi.diff(y))*h**2 - xi*(h.diff(x)) - eta*(h.diff(y))) soltup = [] for sol in infinitesimals: tsol = {xi: S(sol[dxi]).subs(func, y), eta: S(sol[deta]).subs(func, y)} sol = simplify(pde.subs(tsol).doit()) if sol: soltup.append((False, sol.subs(y, func))) else: soltup.append((True, 0)) return soltup def ode_lie_group(eq, func, order, match): r""" This hint implements the Lie group method of solving first order differential equations. The aim is to convert the given differential equation from the given coordinate given system into another coordinate system where it becomes invariant under the one-parameter Lie group of translations. The converted ODE is quadrature and can be solved easily. It makes use of the :py:meth:`sympy.solvers.ode.infinitesimals` function which returns the infinitesimals of the transformation. The coordinates `r` and `s` can be found by solving the following Partial Differential Equations. .. math :: \xi\frac{\partial r}{\partial x} + \eta\frac{\partial r}{\partial y} = 0 .. math :: \xi\frac{\partial s}{\partial x} + \eta\frac{\partial s}{\partial y} = 1 The differential equation becomes separable in the new coordinate system .. math :: \frac{ds}{dr} = \frac{\frac{\partial s}{\partial x} + h(x, y)\frac{\partial s}{\partial y}}{ \frac{\partial r}{\partial x} + h(x, y)\frac{\partial r}{\partial y}} After finding the solution by integration, it is then converted back to the original coordinate system by subsituting `r` and `s` in terms of `x` and `y` again. Examples ======== >>> from sympy import Function, dsolve, Eq, exp, pprint >>> from sympy.abc import x >>> f = Function('f') >>> pprint(dsolve(f(x).diff(x) + 2*x*f(x) - x*exp(-x**2), f(x), ... hint='lie_group')) / 2\ 2 | x | -x f(x) = |C1 + --|*e \ 2 / References ========== - Solving differential equations by Symmetry Groups, John Starrett, pp. 1 - pp. 14 """ heuristics = lie_heuristics inf = {} f = func.func x = func.args[0] df = func.diff(x) xi = Function("xi") eta = Function("eta") a = Wild('a', exclude = [df]) b = Wild('b', exclude = [df]) xis = match.pop('xi') etas = match.pop('eta') if match: h = -simplify(match[match['d']]/match[match['e']]) y = match['y'] else: try: sol = solve(eq, df) except NotImplementedError: raise NotImplementedError("Unable to solve the differential equation " + str(eq) + " by the lie group method") else: y = Dummy("y") h = sol[0].subs(func, y) if xis is not None and etas is not None: inf = [{xi(x, f(x)): S(xis), eta(x, f(x)): S(etas)}] if not checkinfsol(eq, inf, func=f(x), order=1)[0][0]: raise ValueError("The given infinitesimals xi and eta" " are not the infinitesimals to the given equation") else: heuristics = ["user_defined"] match = {'h': h, 'y': y} # This is done so that if: # a] solve raises a NotImplementedError. # b] any heuristic raises a ValueError # another heuristic can be used. tempsol = [] # Used by solve below for heuristic in heuristics: try: if not inf: inf = infinitesimals(eq, hint=heuristic, func=func, order=1, match=match) except ValueError: continue else: for infsim in inf: xiinf = (infsim[xi(x, func)]).subs(func, y) etainf = (infsim[eta(x, func)]).subs(func, y) # This condition creates recursion while using pdsolve. # Since the first step while solving a PDE of form # a*(f(x, y).diff(x)) + b*(f(x, y).diff(y)) + c = 0 # is to solve the ODE dy/dx = b/a if simplify(etainf/xiinf) == h: continue rpde = f(x, y).diff(x)*xiinf + f(x, y).diff(y)*etainf r = pdsolve(rpde, func=f(x, y)).rhs s = pdsolve(rpde - 1, func=f(x, y)).rhs newcoord = [_lie_group_remove(coord) for coord in [r, s]] r = Dummy("r") s = Dummy("s") C1 = Symbol("C1") rcoord = newcoord[0] scoord = newcoord[-1] try: sol = solve([r - rcoord, s - scoord], x, y, dict=True) except NotImplementedError: continue else: sol = sol[0] xsub = sol[x] ysub = sol[y] num = simplify(scoord.diff(x) + scoord.diff(y)*h) denom = simplify(rcoord.diff(x) + rcoord.diff(y)*h) if num and denom: diffeq = simplify((num/denom).subs([(x, xsub), (y, ysub)])) sep = separatevars(diffeq, symbols=[r, s], dict=True) if sep: # Trying to separate, r and s coordinates deq = integrate((1/sep[s]), s) + C1 - integrate(sep['coeff']*sep[r], r) # Substituting and reverting back to original coordinates deq = deq.subs([(r, rcoord), (s, scoord)]) try: sdeq = solve(deq, y) except NotImplementedError: tempsol.append(deq) else: if len(sdeq) == 1: return Eq(f(x), sdeq.pop()) else: return [Eq(f(x), sol) for sol in sdeq] elif denom: # (ds/dr) is zero which means s is constant return Eq(f(x), solve(scoord - C1, y)[0]) elif num: # (dr/ds) is zero which means r is constant return Eq(f(x), solve(rcoord - C1, y)[0]) # If nothing works, return solution as it is, without solving for y if tempsol: if len(tempsol) == 1: return Eq(tempsol.pop().subs(y, f(x)), 0) else: return [Eq(sol.subs(y, f(x)), 0) for sol in tempsol] raise NotImplementedError("The given ODE " + str(eq) + " cannot be solved by" + " the lie group method") def _lie_group_remove(coords): r""" This function is strictly meant for internal use by the Lie group ODE solving method. It replaces arbitrary functions returned by pdsolve with either 0 or 1 or the args of the arbitrary function. The algorithm used is: 1] If coords is an instance of an Undefined Function, then the args are returned 2] If the arbitrary function is present in an Add object, it is replaced by zero. 3] If the arbitrary function is present in an Mul object, it is replaced by one. 4] If coords has no Undefined Function, it is returned as it is. Examples ======== >>> from sympy.solvers.ode import _lie_group_remove >>> from sympy import Function >>> from sympy.abc import x, y >>> F = Function("F") >>> eq = x**2*y >>> _lie_group_remove(eq) x**2*y >>> eq = F(x**2*y) >>> _lie_group_remove(eq) x**2*y >>> eq = y**2*x + F(x**3) >>> _lie_group_remove(eq) x*y**2 >>> eq = (F(x**3) + y)*x**4 >>> _lie_group_remove(eq) x**4*y """ if isinstance(coords, AppliedUndef): return coords.args[0] elif coords.is_Add: subfunc = coords.atoms(AppliedUndef) if subfunc: for func in subfunc: coords = coords.subs(func, 0) return coords elif coords.is_Pow: base, expr = coords.as_base_exp() base = _lie_group_remove(base) expr = _lie_group_remove(expr) return base**expr elif coords.is_Mul: mulargs = [] coordargs = coords.args for arg in coordargs: if not isinstance(coords, AppliedUndef): mulargs.append(_lie_group_remove(arg)) return Mul(*mulargs) return coords def infinitesimals(eq, func=None, order=None, hint='default', match=None): r""" The infinitesimal functions of an ordinary differential equation, `\xi(x,y)` and `\eta(x,y)`, are the infinitesimals of the Lie group of point transformations for which the differential equation is invariant. So, the ODE `y'=f(x,y)` would admit a Lie group `x^*=X(x,y;\varepsilon)=x+\varepsilon\xi(x,y)`, `y^*=Y(x,y;\varepsilon)=y+\varepsilon\eta(x,y)` such that `(y^*)'=f(x^*, y^*)`. A change of coordinates, to `r(x,y)` and `s(x,y)`, can be performed so this Lie group becomes the translation group, `r^*=r` and `s^*=s+\varepsilon`. They are tangents to the coordinate curves of the new system. Consider the transformation `(x, y) \to (X, Y)` such that the differential equation remains invariant. `\xi` and `\eta` are the tangents to the transformed coordinates `X` and `Y`, at `\varepsilon=0`. .. math:: \left(\frac{\partial X(x,y;\varepsilon)}{\partial\varepsilon }\right)|_{\varepsilon=0} = \xi, \left(\frac{\partial Y(x,y;\varepsilon)}{\partial\varepsilon }\right)|_{\varepsilon=0} = \eta, The infinitesimals can be found by solving the following PDE: >>> from sympy import Function, diff, Eq, pprint >>> from sympy.abc import x, y >>> xi, eta, h = map(Function, ['xi', 'eta', 'h']) >>> h = h(x, y) # dy/dx = h >>> eta = eta(x, y) >>> xi = xi(x, y) >>> genform = Eq(eta.diff(x) + (eta.diff(y) - xi.diff(x))*h ... - (xi.diff(y))*h**2 - xi*(h.diff(x)) - eta*(h.diff(y)), 0) >>> pprint(genform) /d d \ d 2 d |--(eta(x, y)) - --(xi(x, y))|*h(x, y) - eta(x, y)*--(h(x, y)) - h (x, y)*--(x \dy dx / dy dy <BLANKLINE> d d i(x, y)) - xi(x, y)*--(h(x, y)) + --(eta(x, y)) = 0 dx dx Solving the above mentioned PDE is not trivial, and can be solved only by making intelligent assumptions for `\xi` and `\eta` (heuristics). Once an infinitesimal is found, the attempt to find more heuristics stops. This is done to optimise the speed of solving the differential equation. If a list of all the infinitesimals is needed, ``hint`` should be flagged as ``all``, which gives the complete list of infinitesimals. If the infinitesimals for a particular heuristic needs to be found, it can be passed as a flag to ``hint``. Examples ======== >>> from sympy import Function, diff >>> from sympy.solvers.ode import infinitesimals >>> from sympy.abc import x >>> f = Function('f') >>> eq = f(x).diff(x) - x**2*f(x) >>> infinitesimals(eq) [{eta(x, f(x)): exp(x**3/3), xi(x, f(x)): 0}] References ========== - Solving differential equations by Symmetry Groups, John Starrett, pp. 1 - pp. 14 """ if isinstance(eq, Equality): eq = eq.lhs - eq.rhs if not func: eq, func = _preprocess(eq) variables = func.args if len(variables) != 1: raise ValueError("ODE's have only one independent variable") else: x = variables[0] if not order: order = ode_order(eq, func) if order != 1: raise NotImplementedError("Infinitesimals for only " "first order ODE's have been implemented") else: df = func.diff(x) # Matching differential equation of the form a*df + b a = Wild('a', exclude = [df]) b = Wild('b', exclude = [df]) if match: # Used by lie_group hint h = match['h'] y = match['y'] else: match = collect(expand(eq), df).match(a*df + b) if match: h = -simplify(match[b]/match[a]) else: try: sol = solve(eq, df) except NotImplementedError: raise NotImplementedError("Infinitesimals for the " "first order ODE could not be found") else: h = sol[0] # Find infinitesimals for one solution y = Dummy("y") h = h.subs(func, y) u = Dummy("u") hx = h.diff(x) hy = h.diff(y) hinv = ((1/h).subs([(x, u), (y, x)])).subs(u, y) # Inverse ODE match = {'h': h, 'func': func, 'hx': hx, 'hy': hy, 'y': y, 'hinv': hinv} if hint == 'all': xieta = [] for heuristic in lie_heuristics: function = globals()['lie_heuristic_' + heuristic] inflist = function(match, comp=True) if inflist: xieta.extend([inf for inf in inflist if inf not in xieta]) if xieta: return xieta else: raise NotImplementedError("Infinitesimals could not be found for " "the given ODE") elif hint == 'default': for heuristic in lie_heuristics: function = globals()['lie_heuristic_' + heuristic] xieta = function(match, comp=False) if xieta: return xieta raise NotImplementedError("Infinitesimals could not be found for" " the given ODE") elif hint not in lie_heuristics: raise ValueError("Heuristic not recognized: " + hint) else: function = globals()['lie_heuristic_' + hint] xieta = function(match, comp=True) if xieta: return xieta else: raise ValueError("Infinitesimals could not be found using the" " given heuristic") def lie_heuristic_abaco1_simple(match, comp=False): r""" The first heuristic uses the following four sets of assumptions on `\xi` and `\eta` .. math:: \xi = 0, \eta = f(x) .. math:: \xi = 0, \eta = f(y) .. math:: \xi = f(x), \eta = 0 .. math:: \xi = f(y), \eta = 0 The success of this heuristic is determined by algebraic factorisation. For the first assumption `\xi = 0` and `\eta` to be a function of `x`, the PDE .. math:: \frac{\partial \eta}{\partial x} + (\frac{\partial \eta}{\partial y} - \frac{\partial \xi}{\partial x})*h - \frac{\partial \xi}{\partial y}*h^{2} - \xi*\frac{\partial h}{\partial x} - \eta*\frac{\partial h}{\partial y} = 0 reduces to `f'(x) - f\frac{\partial h}{\partial y} = 0` If `\frac{\partial h}{\partial y}` is a function of `x`, then this can usually be integrated easily. A similar idea is applied to the other 3 assumptions as well. References ========== - E.S Cheb-Terrab, L.G.S Duarte and L.A,C.P da Mota, Computer Algebra Solving of First Order ODEs Using Symmetry Methods, pp. 8 """ xieta = [] y = match['y'] h = match['h'] func = match['func'] x = func.args[0] hx = match['hx'] hy = match['hy'] xi = Function('xi')(x, func) eta = Function('eta')(x, func) hysym = hy.free_symbols if y not in hysym: try: fx = exp(integrate(hy, x)) except NotImplementedError: pass else: inf = {xi: S(0), eta: fx} if not comp: return [inf] if comp and inf not in xieta: xieta.append(inf) factor = hy/h facsym = factor.free_symbols if x not in facsym: try: fy = exp(integrate(factor, y)) except NotImplementedError: pass else: inf = {xi: S(0), eta: fy.subs(y, func)} if not comp: return [inf] if comp and inf not in xieta: xieta.append(inf) factor = -hx/h facsym = factor.free_symbols if y not in facsym: try: fx = exp(integrate(factor, x)) except NotImplementedError: pass else: inf = {xi: fx, eta: S(0)} if not comp: return [inf] if comp and inf not in xieta: xieta.append(inf) factor = -hx/(h**2) facsym = factor.free_symbols if x not in facsym: try: fy = exp(integrate(factor, y)) except NotImplementedError: pass else: inf = {xi: fy.subs(y, func), eta: S(0)} if not comp: return [inf] if comp and inf not in xieta: xieta.append(inf) if xieta: return xieta def lie_heuristic_abaco1_product(match, comp=False): r""" The second heuristic uses the following two assumptions on `\xi` and `\eta` .. math:: \eta = 0, \xi = f(x)*g(y) .. math:: \eta = f(x)*g(y), \xi = 0 The first assumption of this heuristic holds good if `\frac{1}{h^{2}}\frac{\partial^2}{\partial x \partial y}\log(h)` is separable in `x` and `y`, then the separated factors containing `x` is `f(x)`, and `g(y)` is obtained by .. math:: e^{\int f\frac{\partial}{\partial x}\left(\frac{1}{f*h}\right)\,dy} provided `f\frac{\partial}{\partial x}\left(\frac{1}{f*h}\right)` is a function of `y` only. The second assumption holds good if `\frac{dy}{dx} = h(x, y)` is rewritten as `\frac{dy}{dx} = \frac{1}{h(y, x)}` and the same properties of the first assumption satisifes. After obtaining `f(x)` and `g(y)`, the coordinates are again interchanged, to get `\eta` as `f(x)*g(y)` References ========== - E.S. Cheb-Terrab, A.D. Roche, Symmetries and First Order ODE Patterns, pp. 7 - pp. 8 """ xieta = [] y = match['y'] h = match['h'] hinv = match['hinv'] func = match['func'] x = func.args[0] xi = Function('xi')(x, func) eta = Function('eta')(x, func) inf = separatevars(((log(h).diff(y)).diff(x))/h**2, dict=True, symbols=[x, y]) if inf and inf['coeff']: fx = inf[x] gy = simplify(fx*((1/(fx*h)).diff(x))) gysyms = gy.free_symbols if x not in gysyms: gy = exp(integrate(gy, y)) inf = {eta: S(0), xi: (fx*gy).subs(y, func)} if not comp: return [inf] if comp and inf not in xieta: xieta.append(inf) u1 = Dummy("u1") inf = separatevars(((log(hinv).diff(y)).diff(x))/hinv**2, dict=True, symbols=[x, y]) if inf and inf['coeff']: fx = inf[x] gy = simplify(fx*((1/(fx*hinv)).diff(x))) gysyms = gy.free_symbols if x not in gysyms: gy = exp(integrate(gy, y)) etaval = fx*gy etaval = (etaval.subs([(x, u1), (y, x)])).subs(u1, y) inf = {eta: etaval.subs(y, func), xi: S(0)} if not comp: return [inf] if comp and inf not in xieta: xieta.append(inf) if xieta: return xieta def lie_heuristic_bivariate(match, comp=False): r""" The third heuristic assumes the infinitesimals `\xi` and `\eta` to be bi-variate polynomials in `x` and `y`. The assumption made here for the logic below is that `h` is a rational function in `x` and `y` though that may not be necessary for the infinitesimals to be bivariate polynomials. The coefficients of the infinitesimals are found out by substituting them in the PDE and grouping similar terms that are polynomials and since they form a linear system, solve and check for non trivial solutions. The degree of the assumed bivariates are increased till a certain maximum value. References ========== - Lie Groups and Differential Equations pp. 327 - pp. 329 """ h = match['h'] hx = match['hx'] hy = match['hy'] func = match['func'] x = func.args[0] y = match['y'] xi = Function('xi')(x, func) eta = Function('eta')(x, func) if h.is_rational_function(): # The maximum degree that the infinitesimals can take is # calculated by this technique. etax, etay, etad, xix, xiy, xid = symbols("etax etay etad xix xiy xid") ipde = etax + (etay - xix)*h - xiy*h**2 - xid*hx - etad*hy num, denom = cancel(ipde).as_numer_denom() deg = Poly(num, x, y).total_degree() deta = Function('deta')(x, y) dxi = Function('dxi')(x, y) ipde = (deta.diff(x) + (deta.diff(y) - dxi.diff(x))*h - (dxi.diff(y))*h**2 - dxi*hx - deta*hy) xieq = Symbol("xi0") etaeq = Symbol("eta0") for i in range(deg + 1): if i: xieq += Add(*[ Symbol("xi_" + str(power) + "_" + str(i - power))*x**power*y**(i - power) for power in range(i + 1)]) etaeq += Add(*[ Symbol("eta_" + str(power) + "_" + str(i - power))*x**power*y**(i - power) for power in range(i + 1)]) pden, denom = (ipde.subs({dxi: xieq, deta: etaeq}).doit()).as_numer_denom() pden = expand(pden) # If the individual terms are monomials, the coefficients # are grouped if pden.is_polynomial(x, y) and pden.is_Add: polyy = Poly(pden, x, y).as_dict() if polyy: symset = xieq.free_symbols.union(etaeq.free_symbols) - {x, y} soldict = solve(polyy.values(), *symset) if isinstance(soldict, list): soldict = soldict[0] if any(x for x in soldict.values()): xired = xieq.subs(soldict) etared = etaeq.subs(soldict) # Scaling is done by substituting one for the parameters # This can be any number except zero. dict_ = dict((sym, 1) for sym in symset) inf = {eta: etared.subs(dict_).subs(y, func), xi: xired.subs(dict_).subs(y, func)} return [inf] def lie_heuristic_chi(match, comp=False): r""" The aim of the fourth heuristic is to find the function `\chi(x, y)` that satisifies the PDE `\frac{d\chi}{dx} + h\frac{d\chi}{dx} - \frac{\partial h}{\partial y}\chi = 0`. This assumes `\chi` to be a bivariate polynomial in `x` and `y`. By intution, `h` should be a rational function in `x` and `y`. The method used here is to substitute a general binomial for `\chi` up to a certain maximum degree is reached. The coefficients of the polynomials, are calculated by by collecting terms of the same order in `x` and `y`. After finding `\chi`, the next step is to use `\eta = \xi*h + \chi`, to determine `\xi` and `\eta`. This can be done by dividing `\chi` by `h` which would give `-\xi` as the quotient and `\eta` as the remainder. References ========== - E.S Cheb-Terrab, L.G.S Duarte and L.A,C.P da Mota, Computer Algebra Solving of First Order ODEs Using Symmetry Methods, pp. 8 """ h = match['h'] hx = match['hx'] hy = match['hy'] func = match['func'] x = func.args[0] y = match['y'] xi = Function('xi')(x, func) eta = Function('eta')(x, func) if h.is_rational_function(): schi, schix, schiy = symbols("schi, schix, schiy") cpde = schix + h*schiy - hy*schi num, denom = cancel(cpde).as_numer_denom() deg = Poly(num, x, y).total_degree() chi = Function('chi')(x, y) chix = chi.diff(x) chiy = chi.diff(y) cpde = chix + h*chiy - hy*chi chieq = Symbol("chi") for i in range(1, deg + 1): chieq += Add(*[ Symbol("chi_" + str(power) + "_" + str(i - power))*x**power*y**(i - power) for power in range(i + 1)]) cnum, cden = cancel(cpde.subs({chi : chieq}).doit()).as_numer_denom() cnum = expand(cnum) if cnum.is_polynomial(x, y) and cnum.is_Add: cpoly = Poly(cnum, x, y).as_dict() if cpoly: solsyms = chieq.free_symbols - {x, y} soldict = solve(cpoly.values(), *solsyms) if isinstance(soldict, list): soldict = soldict[0] if any(x for x in soldict.values()): chieq = chieq.subs(soldict) dict_ = dict((sym, 1) for sym in solsyms) chieq = chieq.subs(dict_) # After finding chi, the main aim is to find out # eta, xi by the equation eta = xi*h + chi # One method to set xi, would be rearranging it to # (eta/h) - xi = (chi/h). This would mean dividing # chi by h would give -xi as the quotient and eta # as the remainder. Thanks to Sean Vig for suggesting # this method. xic, etac = div(chieq, h) inf = {eta: etac.subs(y, func), xi: -xic.subs(y, func)} return [inf] def lie_heuristic_function_sum(match, comp=False): r""" This heuristic uses the following two assumptions on `\xi` and `\eta` .. math:: \eta = 0, \xi = f(x) + g(y) .. math:: \eta = f(x) + g(y), \xi = 0 The first assumption of this heuristic holds good if .. math:: \frac{\partial}{\partial y}[(h\frac{\partial^{2}}{ \partial x^{2}}(h^{-1}))^{-1}] is separable in `x` and `y`, 1. The separated factors containing `y` is `\frac{\partial g}{\partial y}`. From this `g(y)` can be determined. 2. The separated factors containing `x` is `f''(x)`. 3. `h\frac{\partial^{2}}{\partial x^{2}}(h^{-1})` equals `\frac{f''(x)}{f(x) + g(y)}`. From this `f(x)` can be determined. The second assumption holds good if `\frac{dy}{dx} = h(x, y)` is rewritten as `\frac{dy}{dx} = \frac{1}{h(y, x)}` and the same properties of the first assumption satisifes. After obtaining `f(x)` and `g(y)`, the coordinates are again interchanged, to get `\eta` as `f(x) + g(y)`. For both assumptions, the constant factors are separated among `g(y)` and `f''(x)`, such that `f''(x)` obtained from 3] is the same as that obtained from 2]. If not possible, then this heuristic fails. References ========== - E.S. Cheb-Terrab, A.D. Roche, Symmetries and First Order ODE Patterns, pp. 7 - pp. 8 """ xieta = [] h = match['h'] hx = match['hx'] hy = match['hy'] func = match['func'] hinv = match['hinv'] x = func.args[0] y = match['y'] xi = Function('xi')(x, func) eta = Function('eta')(x, func) for odefac in [h, hinv]: factor = odefac*((1/odefac).diff(x, 2)) sep = separatevars((1/factor).diff(y), dict=True, symbols=[x, y]) if sep and sep['coeff'] and sep[x].has(x) and sep[y].has(y): k = Dummy("k") try: gy = k*integrate(sep[y], y) except NotImplementedError: pass else: fdd = 1/(k*sep[x]*sep['coeff']) fx = simplify(fdd/factor - gy) check = simplify(fx.diff(x, 2) - fdd) if fx: if not check: fx = fx.subs(k, 1) gy = (gy/k) else: sol = solve(check, k) if sol: sol = sol[0] fx = fx.subs(k, sol) gy = (gy/k)*sol else: continue if odefac == hinv: # Inverse ODE fx = fx.subs(x, y) gy = gy.subs(y, x) etaval = factor_terms(fx + gy) if etaval.is_Mul: etaval = Mul(*[arg for arg in etaval.args if arg.has(x, y)]) if odefac == hinv: # Inverse ODE inf = {eta: etaval.subs(y, func), xi : S(0)} else: inf = {xi: etaval.subs(y, func), eta : S(0)} if not comp: return [inf] else: xieta.append(inf) if xieta: return xieta def lie_heuristic_abaco2_similar(match, comp=False): r""" This heuristic uses the following two assumptions on `\xi` and `\eta` .. math:: \eta = g(x), \xi = f(x) .. math:: \eta = f(y), \xi = g(y) For the first assumption, 1. First `\frac{\frac{\partial h}{\partial y}}{\frac{\partial^{2} h}{ \partial yy}}` is calculated. Let us say this value is A 2. If this is constant, then `h` is matched to the form `A(x) + B(x)e^{ \frac{y}{C}}` then, `\frac{e^{\int \frac{A(x)}{C} \,dx}}{B(x)}` gives `f(x)` and `A(x)*f(x)` gives `g(x)` 3. Otherwise `\frac{\frac{\partial A}{\partial X}}{\frac{\partial A}{ \partial Y}} = \gamma` is calculated. If a] `\gamma` is a function of `x` alone b] `\frac{\gamma\frac{\partial h}{\partial y} - \gamma'(x) - \frac{ \partial h}{\partial x}}{h + \gamma} = G` is a function of `x` alone. then, `e^{\int G \,dx}` gives `f(x)` and `-\gamma*f(x)` gives `g(x)` The second assumption holds good if `\frac{dy}{dx} = h(x, y)` is rewritten as `\frac{dy}{dx} = \frac{1}{h(y, x)}` and the same properties of the first assumption satisifes. After obtaining `f(x)` and `g(x)`, the coordinates are again interchanged, to get `\xi` as `f(x^*)` and `\eta` as `g(y^*)` References ========== - E.S. Cheb-Terrab, A.D. Roche, Symmetries and First Order ODE Patterns, pp. 10 - pp. 12 """ xieta = [] h = match['h'] hx = match['hx'] hy = match['hy'] func = match['func'] hinv = match['hinv'] x = func.args[0] y = match['y'] xi = Function('xi')(x, func) eta = Function('eta')(x, func) factor = cancel(h.diff(y)/h.diff(y, 2)) factorx = factor.diff(x) factory = factor.diff(y) if not factor.has(x) and not factor.has(y): A = Wild('A', exclude=[y]) B = Wild('B', exclude=[y]) C = Wild('C', exclude=[x, y]) match = h.match(A + B*exp(y/C)) try: tau = exp(-integrate(match[A]/match[C]), x)/match[B] except NotImplementedError: pass else: gx = match[A]*tau return [{xi: tau, eta: gx}] else: gamma = cancel(factorx/factory) if not gamma.has(y): tauint = cancel((gamma*hy - gamma.diff(x) - hx)/(h + gamma)) if not tauint.has(y): try: tau = exp(integrate(tauint, x)) except NotImplementedError: pass else: gx = -tau*gamma return [{xi: tau, eta: gx}] factor = cancel(hinv.diff(y)/hinv.diff(y, 2)) factorx = factor.diff(x) factory = factor.diff(y) if not factor.has(x) and not factor.has(y): A = Wild('A', exclude=[y]) B = Wild('B', exclude=[y]) C = Wild('C', exclude=[x, y]) match = h.match(A + B*exp(y/C)) try: tau = exp(-integrate(match[A]/match[C]), x)/match[B] except NotImplementedError: pass else: gx = match[A]*tau return [{eta: tau.subs(x, func), xi: gx.subs(x, func)}] else: gamma = cancel(factorx/factory) if not gamma.has(y): tauint = cancel((gamma*hinv.diff(y) - gamma.diff(x) - hinv.diff(x))/( hinv + gamma)) if not tauint.has(y): try: tau = exp(integrate(tauint, x)) except NotImplementedError: pass else: gx = -tau*gamma return [{eta: tau.subs(x, func), xi: gx.subs(x, func)}] def lie_heuristic_abaco2_unique_unknown(match, comp=False): r""" This heuristic assumes the presence of unknown functions or known functions with non-integer powers. 1. A list of all functions and non-integer powers containing x and y 2. Loop over each element `f` in the list, find `\frac{\frac{\partial f}{\partial x}}{ \frac{\partial f}{\partial x}} = R` If it is separable in `x` and `y`, let `X` be the factors containing `x`. Then a] Check if `\xi = X` and `\eta = -\frac{X}{R}` satisfy the PDE. If yes, then return `\xi` and `\eta` b] Check if `\xi = \frac{-R}{X}` and `\eta = -\frac{1}{X}` satisfy the PDE. If yes, then return `\xi` and `\eta` If not, then check if a] :math:`\xi = -R,\eta = 1` b] :math:`\xi = 1, \eta = -\frac{1}{R}` are solutions. References ========== - E.S. Cheb-Terrab, A.D. Roche, Symmetries and First Order ODE Patterns, pp. 10 - pp. 12 """ xieta = [] h = match['h'] hx = match['hx'] hy = match['hy'] func = match['func'] hinv = match['hinv'] x = func.args[0] y = match['y'] xi = Function('xi')(x, func) eta = Function('eta')(x, func) funclist = [] for atom in h.atoms(Pow): base, exp = atom.as_base_exp() if base.has(x) and base.has(y): if not exp.is_Integer: funclist.append(atom) for function in h.atoms(AppliedUndef): syms = function.free_symbols if x in syms and y in syms: funclist.append(function) for f in funclist: frac = cancel(f.diff(y)/f.diff(x)) sep = separatevars(frac, dict=True, symbols=[x, y]) if sep and sep['coeff']: xitry1 = sep[x] etatry1 = -1/(sep[y]*sep['coeff']) pde1 = etatry1.diff(y)*h - xitry1.diff(x)*h - xitry1*hx - etatry1*hy if not simplify(pde1): return [{xi: xitry1, eta: etatry1.subs(y, func)}] xitry2 = 1/etatry1 etatry2 = 1/xitry1 pde2 = etatry2.diff(x) - (xitry2.diff(y))*h**2 - xitry2*hx - etatry2*hy if not simplify(expand(pde2)): return [{xi: xitry2.subs(y, func), eta: etatry2}] else: etatry = -1/frac pde = etatry.diff(x) + etatry.diff(y)*h - hx - etatry*hy if not simplify(pde): return [{xi: S(1), eta: etatry.subs(y, func)}] xitry = -frac pde = -xitry.diff(x)*h -xitry.diff(y)*h**2 - xitry*hx -hy if not simplify(expand(pde)): return [{xi: xitry.subs(y, func), eta: S(1)}] def lie_heuristic_abaco2_unique_general(match, comp=False): r""" This heuristic finds if infinitesimals of the form `\eta = f(x)`, `\xi = g(y)` without making any assumptions on `h`. The complete sequence of steps is given in the paper mentioned below. References ========== - E.S. Cheb-Terrab, A.D. Roche, Symmetries and First Order ODE Patterns, pp. 10 - pp. 12 """ xieta = [] h = match['h'] hx = match['hx'] hy = match['hy'] func = match['func'] hinv = match['hinv'] x = func.args[0] y = match['y'] xi = Function('xi')(x, func) eta = Function('eta')(x, func) C = S(0) A = hx.diff(y) B = hy.diff(y) + hy**2 C = hx.diff(x) - hx**2 if not (A and B and C): return Ax = A.diff(x) Ay = A.diff(y) Axy = Ax.diff(y) Axx = Ax.diff(x) Ayy = Ay.diff(y) D = simplify(2*Axy + hx*Ay - Ax*hy + (hx*hy + 2*A)*A)*A - 3*Ax*Ay if not D: E1 = simplify(3*Ax**2 + ((hx**2 + 2*C)*A - 2*Axx)*A) if E1: E2 = simplify((2*Ayy + (2*B - hy**2)*A)*A - 3*Ay**2) if not E2: E3 = simplify( E1*((28*Ax + 4*hx*A)*A**3 - E1*(hy*A + Ay)) - E1.diff(x)*8*A**4) if not E3: etaval = cancel((4*A**3*(Ax - hx*A) + E1*(hy*A - Ay))/(S(2)*A*E1)) if x not in etaval: try: etaval = exp(integrate(etaval, y)) except NotImplementedError: pass else: xival = -4*A**3*etaval/E1 if y not in xival: return [{xi: xival, eta: etaval.subs(y, func)}] else: E1 = simplify((2*Ayy + (2*B - hy**2)*A)*A - 3*Ay**2) if E1: E2 = simplify( 4*A**3*D - D**2 + E1*((2*Axx - (hx**2 + 2*C)*A)*A - 3*Ax**2)) if not E2: E3 = simplify( -(A*D)*E1.diff(y) + ((E1.diff(x) - hy*D)*A + 3*Ay*D + (A*hx - 3*Ax)*E1)*E1) if not E3: etaval = cancel(((A*hx - Ax)*E1 - (Ay + A*hy)*D)/(S(2)*A*D)) if x not in etaval: try: etaval = exp(integrate(etaval, y)) except NotImplementedError: pass else: xival = -E1*etaval/D if y not in xival: return [{xi: xival, eta: etaval.subs(y, func)}] def lie_heuristic_linear(match, comp=False): r""" This heuristic assumes 1. `\xi = ax + by + c` and 2. `\eta = fx + gy + h` After substituting the following assumptions in the determining PDE, it reduces to .. math:: f + (g - a)h - bh^{2} - (ax + by + c)\frac{\partial h}{\partial x} - (fx + gy + c)\frac{\partial h}{\partial y} Solving the reduced PDE obtained, using the method of characteristics, becomes impractical. The method followed is grouping similar terms and solving the system of linear equations obtained. The difference between the bivariate heuristic is that `h` need not be a rational function in this case. References ========== - E.S. Cheb-Terrab, A.D. Roche, Symmetries and First Order ODE Patterns, pp. 10 - pp. 12 """ xieta = [] h = match['h'] hx = match['hx'] hy = match['hy'] func = match['func'] hinv = match['hinv'] x = func.args[0] y = match['y'] xi = Function('xi')(x, func) eta = Function('eta')(x, func) coeffdict = {} symbols = numbered_symbols("c", cls=Dummy) symlist = [next(symbols) for i in islice(symbols, 6)] C0, C1, C2, C3, C4, C5 = symlist pde = C3 + (C4 - C0)*h -(C0*x + C1*y + C2)*hx - (C3*x + C4*y + C5)*hy - C1*h**2 pde, denom = pde.as_numer_denom() pde = powsimp(expand(pde)) if pde.is_Add: terms = pde.args for term in terms: if term.is_Mul: rem = Mul(*[m for m in term.args if not m.has(x, y)]) xypart = term/rem if xypart not in coeffdict: coeffdict[xypart] = rem else: coeffdict[xypart] += rem else: if term not in coeffdict: coeffdict[term] = S(1) else: coeffdict[term] += S(1) sollist = coeffdict.values() soldict = solve(sollist, symlist) if soldict: if isinstance(soldict, list): soldict = soldict[0] subval = soldict.values() if any(t for t in subval): onedict = dict(zip(symlist, [1]*6)) xival = C0*x + C1*func + C2 etaval = C3*x + C4*func + C5 xival = xival.subs(soldict) etaval = etaval.subs(soldict) xival = xival.subs(onedict) etaval = etaval.subs(onedict) return [{xi: xival, eta: etaval}] def sysode_linear_2eq_order1(match_): x = match_['func'][0].func y = match_['func'][1].func func = match_['func'] fc = match_['func_coeff'] eq = match_['eq'] C1, C2, C3, C4 = get_numbered_constants(eq, num=4) r = dict() t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] for i in range(2): eqs = 0 for terms in Add.make_args(eq[i]): eqs += terms/fc[i,func[i],1] eq[i] = eqs # for equations Eq(a1*diff(x(t),t), a*x(t) + b*y(t) + k1) # and Eq(a2*diff(x(t),t), c*x(t) + d*y(t) + k2) r['a'] = -fc[0,x(t),0]/fc[0,x(t),1] r['c'] = -fc[1,x(t),0]/fc[1,y(t),1] r['b'] = -fc[0,y(t),0]/fc[0,x(t),1] r['d'] = -fc[1,y(t),0]/fc[1,y(t),1] forcing = [S(0),S(0)] for i in range(2): for j in Add.make_args(eq[i]): if not j.has(x(t), y(t)): forcing[i] += j if not (forcing[0].has(t) or forcing[1].has(t)): r['k1'] = forcing[0] r['k2'] = forcing[1] else: raise NotImplementedError("Only homogeneous problems are supported" + " (and constant inhomogeneity)") if match_['type_of_equation'] == 'type1': sol = _linear_2eq_order1_type1(x, y, t, r, eq) if match_['type_of_equation'] == 'type2': gsol = _linear_2eq_order1_type1(x, y, t, r, eq) psol = _linear_2eq_order1_type2(x, y, t, r, eq) sol = [Eq(x(t), gsol[0].rhs+psol[0]), Eq(y(t), gsol[1].rhs+psol[1])] if match_['type_of_equation'] == 'type3': sol = _linear_2eq_order1_type3(x, y, t, r, eq) if match_['type_of_equation'] == 'type4': sol = _linear_2eq_order1_type4(x, y, t, r, eq) if match_['type_of_equation'] == 'type5': sol = _linear_2eq_order1_type5(x, y, t, r, eq) if match_['type_of_equation'] == 'type6': sol = _linear_2eq_order1_type6(x, y, t, r, eq) if match_['type_of_equation'] == 'type7': sol = _linear_2eq_order1_type7(x, y, t, r, eq) return sol def _linear_2eq_order1_type1(x, y, t, r, eq): r""" It is classified under system of two linear homogeneous first-order constant-coefficient ordinary differential equations. The equations which come under this type are .. math:: x' = ax + by, .. math:: y' = cx + dy The characteristics equation is written as .. math:: \lambda^{2} + (a+d) \lambda + ad - bc = 0 and its discriminant is `D = (a-d)^{2} + 4bc`. There are several cases 1. Case when `ad - bc \neq 0`. The origin of coordinates, `x = y = 0`, is the only stationary point; it is - a node if `D = 0` - a node if `D > 0` and `ad - bc > 0` - a saddle if `D > 0` and `ad - bc < 0` - a focus if `D < 0` and `a + d \neq 0` - a centre if `D < 0` and `a + d \neq 0`. 1.1. If `D > 0`. The characteristic equation has two distinct real roots `\lambda_1` and `\lambda_ 2` . The general solution of the system in question is expressed as .. math:: x = C_1 b e^{\lambda_1 t} + C_2 b e^{\lambda_2 t} .. math:: y = C_1 (\lambda_1 - a) e^{\lambda_1 t} + C_2 (\lambda_2 - a) e^{\lambda_2 t} where `C_1` and `C_2` being arbitary constants 1.2. If `D < 0`. The characteristics equation has two conjugate roots, `\lambda_1 = \sigma + i \beta` and `\lambda_2 = \sigma - i \beta`. The general solution of the system is given by .. math:: x = b e^{\sigma t} (C_1 \sin(\beta t) + C_2 \cos(\beta t)) .. math:: y = e^{\sigma t} ([(\sigma - a) C_1 - \beta C_2] \sin(\beta t) + [\beta C_1 + (\sigma - a) C_2 \cos(\beta t)]) 1.3. If `D = 0` and `a \neq d`. The characteristic equation has two equal roots, `\lambda_1 = \lambda_2`. The general solution of the system is written as .. math:: x = 2b (C_1 + \frac{C_2}{a-d} + C_2 t) e^{\frac{a+d}{2} t} .. math:: y = [(d - a) C_1 + C_2 + (d - a) C_2 t] e^{\frac{a+d}{2} t} 1.4. If `D = 0` and `a = d \neq 0` and `b = 0` .. math:: x = C_1 e^{a t} , y = (c C_1 t + C_2) e^{a t} 1.5. If `D = 0` and `a = d \neq 0` and `c = 0` .. math:: x = (b C_1 t + C_2) e^{a t} , y = C_1 e^{a t} 2. Case when `ad - bc = 0` and `a^{2} + b^{2} > 0`. The whole straight line `ax + by = 0` consists of singular points. The orginal system of differential equaitons can be rewritten as .. math:: x' = ax + by , y' = k (ax + by) 2.1 If `a + bk \neq 0`, solution will be .. math:: x = b C_1 + C_2 e^{(a + bk) t} , y = -a C_1 + k C_2 e^{(a + bk) t} 2.2 If `a + bk = 0`, solution will be .. math:: x = C_1 (bk t - 1) + b C_2 t , y = k^{2} b C_1 t + (b k^{2} t + 1) C_2 """ # FIXME: at least some of these can fail to give two linearly # independent solutions e.g., because they make assumptions about # zero/nonzero of certain coefficients. I've "fixed" one and # raised NotImplementedError in another. I think this should probably # just be re-written in terms of eigenvectors... l = Dummy('l') C1, C2, C3, C4 = get_numbered_constants(eq, num=4) l1 = rootof(l**2 - (r['a']+r['d'])*l + r['a']*r['d'] - r['b']*r['c'], l, 0) l2 = rootof(l**2 - (r['a']+r['d'])*l + r['a']*r['d'] - r['b']*r['c'], l, 1) D = (r['a'] - r['d'])**2 + 4*r['b']*r['c'] if (r['a']*r['d'] - r['b']*r['c']) != 0: if D > 0: if r['b'].is_zero: # tempting to use this in all cases, but does not guarantee linearly independent eigenvectors gsol1 = C1*(l1 - r['d'] + r['b'])*exp(l1*t) + C2*(l2 - r['d'] + r['b'])*exp(l2*t) gsol2 = C1*(l1 - r['a'] + r['c'])*exp(l1*t) + C2*(l2 - r['a'] + r['c'])*exp(l2*t) else: gsol1 = C1*r['b']*exp(l1*t) + C2*r['b']*exp(l2*t) gsol2 = C1*(l1 - r['a'])*exp(l1*t) + C2*(l2 - r['a'])*exp(l2*t) if D < 0: sigma = re(l1) if im(l1).is_positive: beta = im(l1) else: beta = im(l2) if r['b'].is_zero: raise NotImplementedError('b == 0 case not implemented') gsol1 = r['b']*exp(sigma*t)*(C1*sin(beta*t)+C2*cos(beta*t)) gsol2 = exp(sigma*t)*(((C1*(sigma-r['a'])-C2*beta)*sin(beta*t)+(C1*beta+(sigma-r['a'])*C2)*cos(beta*t))) if D == 0: if r['a']!=r['d']: gsol1 = 2*r['b']*(C1 + C2/(r['a']-r['d'])+C2*t)*exp((r['a']+r['d'])*t/2) gsol2 = ((r['d']-r['a'])*C1+C2+(r['d']-r['a'])*C2*t)*exp((r['a']+r['d'])*t/2) if r['a']==r['d'] and r['a']!=0 and r['b']==0: gsol1 = C1*exp(r['a']*t) gsol2 = (r['c']*C1*t+C2)*exp(r['a']*t) if r['a']==r['d'] and r['a']!=0 and r['c']==0: gsol1 = (r['b']*C1*t+C2)*exp(r['a']*t) gsol2 = C1*exp(r['a']*t) elif (r['a']*r['d'] - r['b']*r['c']) == 0 and (r['a']**2+r['b']**2) > 0: k = r['c']/r['a'] if r['a']+r['b']*k != 0: gsol1 = r['b']*C1 + C2*exp((r['a']+r['b']*k)*t) gsol2 = -r['a']*C1 + k*C2*exp((r['a']+r['b']*k)*t) else: gsol1 = C1*(r['b']*k*t-1)+r['b']*C2*t gsol2 = k**2*r['b']*C1*t+(r['b']*k**2*t+1)*C2 return [Eq(x(t), gsol1), Eq(y(t), gsol2)] def _linear_2eq_order1_type2(x, y, t, r, eq): r""" The equations of this type are .. math:: x' = ax + by + k1 , y' = cx + dy + k2 The general solution of this system is given by sum of its particular solution and the general solution of the corresponding homogeneous system is obtained from type1. 1. When `ad - bc \neq 0`. The particular solution will be `x = x_0` and `y = y_0` where `x_0` and `y_0` are determined by solving linear system of equations .. math:: a x_0 + b y_0 + k1 = 0 , c x_0 + d y_0 + k2 = 0 2. When `ad - bc = 0` and `a^{2} + b^{2} > 0`. In this case, the system of equation becomes .. math:: x' = ax + by + k_1 , y' = k (ax + by) + k_2 2.1 If `\sigma = a + bk \neq 0`, particular solution is given by .. math:: x = b \sigma^{-1} (c_1 k - c_2) t - \sigma^{-2} (a c_1 + b c_2) .. math:: y = kx + (c_2 - c_1 k) t 2.2 If `\sigma = a + bk = 0`, particular solution is given by .. math:: x = \frac{1}{2} b (c_2 - c_1 k) t^{2} + c_1 t .. math:: y = kx + (c_2 - c_1 k) t """ r['k1'] = -r['k1']; r['k2'] = -r['k2'] if (r['a']*r['d'] - r['b']*r['c']) != 0: x0, y0 = symbols('x0, y0', cls=Dummy) sol = solve((r['a']*x0+r['b']*y0+r['k1'], r['c']*x0+r['d']*y0+r['k2']), x0, y0) psol = [sol[x0], sol[y0]] elif (r['a']*r['d'] - r['b']*r['c']) == 0 and (r['a']**2+r['b']**2) > 0: k = r['c']/r['a'] sigma = r['a'] + r['b']*k if sigma != 0: sol1 = r['b']*sigma**-1*(r['k1']*k-r['k2'])*t - sigma**-2*(r['a']*r['k1']+r['b']*r['k2']) sol2 = k*sol1 + (r['k2']-r['k1']*k)*t else: # FIXME: a previous typo fix shows this is not covered by tests sol1 = r['b']*(r['k2']-r['k1']*k)*t**2 + r['k1']*t sol2 = k*sol1 + (r['k2']-r['k1']*k)*t psol = [sol1, sol2] return psol def _linear_2eq_order1_type3(x, y, t, r, eq): r""" The equations of this type of ode are .. math:: x' = f(t) x + g(t) y .. math:: y' = g(t) x + f(t) y The solution of such equations is given by .. math:: x = e^{F} (C_1 e^{G} + C_2 e^{-G}) , y = e^{F} (C_1 e^{G} - C_2 e^{-G}) where `C_1` and `C_2` are arbitary constants, and .. math:: F = \int f(t) \,dt , G = \int g(t) \,dt """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) F = Integral(r['a'], t) G = Integral(r['b'], t) sol1 = exp(F)*(C1*exp(G) + C2*exp(-G)) sol2 = exp(F)*(C1*exp(G) - C2*exp(-G)) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order1_type4(x, y, t, r, eq): r""" The equations of this type of ode are . .. math:: x' = f(t) x + g(t) y .. math:: y' = -g(t) x + f(t) y The solution is given by .. math:: x = F (C_1 \cos(G) + C_2 \sin(G)), y = F (-C_1 \sin(G) + C_2 \cos(G)) where `C_1` and `C_2` are arbitary constants, and .. math:: F = \int f(t) \,dt , G = \int g(t) \,dt """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) if r['b'] == -r['c']: F = exp(Integral(r['a'], t)) G = Integral(r['b'], t) sol1 = F*(C1*cos(G) + C2*sin(G)) sol2 = F*(-C1*sin(G) + C2*cos(G)) elif r['d'] == -r['a']: F = exp(Integral(r['c'], t)) G = Integral(r['d'], t) sol1 = F*(-C1*sin(G) + C2*cos(G)) sol2 = F*(C1*cos(G) + C2*sin(G)) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order1_type5(x, y, t, r, eq): r""" The equations of this type of ode are . .. math:: x' = f(t) x + g(t) y .. math:: y' = a g(t) x + [f(t) + b g(t)] y The transformation of .. math:: x = e^{\int f(t) \,dt} u , y = e^{\int f(t) \,dt} v , T = \int g(t) \,dt leads to a system of constant coefficient linear differential equations .. math:: u'(T) = v , v'(T) = au + bv """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) u, v = symbols('u, v', function=True) T = Symbol('T') if not cancel(r['c']/r['b']).has(t): p = cancel(r['c']/r['b']) q = cancel((r['d']-r['a'])/r['b']) eq = (Eq(diff(u(T),T), v(T)), Eq(diff(v(T),T), p*u(T)+q*v(T))) sol = dsolve(eq) sol1 = exp(Integral(r['a'], t))*sol[0].rhs.subs(T, Integral(r['b'],t)) sol2 = exp(Integral(r['a'], t))*sol[1].rhs.subs(T, Integral(r['b'],t)) if not cancel(r['a']/r['d']).has(t): p = cancel(r['a']/r['d']) q = cancel((r['b']-r['c'])/r['d']) sol = dsolve(Eq(diff(u(T),T), v(T)), Eq(diff(v(T),T), p*u(T)+q*v(T))) sol1 = exp(Integral(r['c'], t))*sol[1].rhs.subs(T, Integral(r['d'],t)) sol2 = exp(Integral(r['c'], t))*sol[0].rhs.subs(T, Integral(r['d'],t)) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order1_type6(x, y, t, r, eq): r""" The equations of this type of ode are . .. math:: x' = f(t) x + g(t) y .. math:: y' = a [f(t) + a h(t)] x + a [g(t) - h(t)] y This is solved by first multiplying the first equation by `-a` and adding it to the second equation to obtain .. math:: y' - a x' = -a h(t) (y - a x) Setting `U = y - ax` and integrating the equation we arrive at .. math:: y - ax = C_1 e^{-a \int h(t) \,dt} and on substituing the value of y in first equation give rise to first order ODEs. After solving for `x`, we can obtain `y` by substituting the value of `x` in second equation. """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) p = 0 q = 0 p1 = cancel(r['c']/cancel(r['c']/r['d']).as_numer_denom()[0]) p2 = cancel(r['a']/cancel(r['a']/r['b']).as_numer_denom()[0]) for n, i in enumerate([p1, p2]): for j in Mul.make_args(collect_const(i)): if not j.has(t): q = j if q!=0 and n==0: if ((r['c']/j - r['a'])/(r['b'] - r['d']/j)) == j: p = 1 s = j break if q!=0 and n==1: if ((r['a']/j - r['c'])/(r['d'] - r['b']/j)) == j: p = 2 s = j break if p == 1: equ = diff(x(t),t) - r['a']*x(t) - r['b']*(s*x(t) + C1*exp(-s*Integral(r['b'] - r['d']/s, t))) hint1 = classify_ode(equ)[1] sol1 = dsolve(equ, hint=hint1+'_Integral').rhs sol2 = s*sol1 + C1*exp(-s*Integral(r['b'] - r['d']/s, t)) elif p ==2: equ = diff(y(t),t) - r['c']*y(t) - r['d']*s*y(t) + C1*exp(-s*Integral(r['d'] - r['b']/s, t)) hint1 = classify_ode(equ)[1] sol2 = dsolve(equ, hint=hint1+'_Integral').rhs sol1 = s*sol2 + C1*exp(-s*Integral(r['d'] - r['b']/s, t)) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order1_type7(x, y, t, r, eq): r""" The equations of this type of ode are . .. math:: x' = f(t) x + g(t) y .. math:: y' = h(t) x + p(t) y Differentiating the first equation and substituting the value of `y` from second equation will give a second-order linear equation .. math:: g x'' - (fg + gp + g') x' + (fgp - g^{2} h + f g' - f' g) x = 0 This above equation can be easily integrated if following conditions are satisfied. 1. `fgp - g^{2} h + f g' - f' g = 0` 2. `fgp - g^{2} h + f g' - f' g = ag, fg + gp + g' = bg` If first condition is satisfied then it is solved by current dsolve solver and in second case it becomes a constant cofficient differential equation which is also solved by current solver. Otherwise if the above condition fails then, a particular solution is assumed as `x = x_0(t)` and `y = y_0(t)` Then the general solution is expressed as .. math:: x = C_1 x_0(t) + C_2 x_0(t) \int \frac{g(t) F(t) P(t)}{x_0^{2}(t)} \,dt .. math:: y = C_1 y_0(t) + C_2 [\frac{F(t) P(t)}{x_0(t)} + y_0(t) \int \frac{g(t) F(t) P(t)}{x_0^{2}(t)} \,dt] where C1 and C2 are arbitary constants and .. math:: F(t) = e^{\int f(t) \,dt} , P(t) = e^{\int p(t) \,dt} """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) e1 = r['a']*r['b']*r['c'] - r['b']**2*r['c'] + r['a']*diff(r['b'],t) - diff(r['a'],t)*r['b'] e2 = r['a']*r['c']*r['d'] - r['b']*r['c']**2 + diff(r['c'],t)*r['d'] - r['c']*diff(r['d'],t) m1 = r['a']*r['b'] + r['b']*r['d'] + diff(r['b'],t) m2 = r['a']*r['c'] + r['c']*r['d'] + diff(r['c'],t) if e1 == 0: sol1 = dsolve(r['b']*diff(x(t),t,t) - m1*diff(x(t),t)).rhs sol2 = dsolve(diff(y(t),t) - r['c']*sol1 - r['d']*y(t)).rhs elif e2 == 0: sol2 = dsolve(r['c']*diff(y(t),t,t) - m2*diff(y(t),t)).rhs sol1 = dsolve(diff(x(t),t) - r['a']*x(t) - r['b']*sol2).rhs elif not (e1/r['b']).has(t) and not (m1/r['b']).has(t): sol1 = dsolve(diff(x(t),t,t) - (m1/r['b'])*diff(x(t),t) - (e1/r['b'])*x(t)).rhs sol2 = dsolve(diff(y(t),t) - r['c']*sol1 - r['d']*y(t)).rhs elif not (e2/r['c']).has(t) and not (m2/r['c']).has(t): sol2 = dsolve(diff(y(t),t,t) - (m2/r['c'])*diff(y(t),t) - (e2/r['c'])*y(t)).rhs sol1 = dsolve(diff(x(t),t) - r['a']*x(t) - r['b']*sol2).rhs else: x0, y0 = symbols('x0, y0') #x0 and y0 being particular solutions F = exp(Integral(r['a'],t)) P = exp(Integral(r['d'],t)) sol1 = C1*x0 + C2*x0*Integral(r['b']*F*P/x0**2, t) sol2 = C1*y0 + C2(F*P/x0 + y0*Integral(r['b']*F*P/x0**2, t)) return [Eq(x(t), sol1), Eq(y(t), sol2)] def sysode_linear_2eq_order2(match_): x = match_['func'][0].func y = match_['func'][1].func func = match_['func'] fc = match_['func_coeff'] eq = match_['eq'] C1, C2, C3, C4 = get_numbered_constants(eq, num=4) r = dict() t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] for i in range(2): eqs = [] for terms in Add.make_args(eq[i]): eqs.append(terms/fc[i,func[i],2]) eq[i] = Add(*eqs) # for equations Eq(diff(x(t),t,t), a1*diff(x(t),t)+b1*diff(y(t),t)+c1*x(t)+d1*y(t)+e1) # and Eq(a2*diff(y(t),t,t), a2*diff(x(t),t)+b2*diff(y(t),t)+c2*x(t)+d2*y(t)+e2) r['a1'] = -fc[0,x(t),1]/fc[0,x(t),2] ; r['a2'] = -fc[1,x(t),1]/fc[1,y(t),2] r['b1'] = -fc[0,y(t),1]/fc[0,x(t),2] ; r['b2'] = -fc[1,y(t),1]/fc[1,y(t),2] r['c1'] = -fc[0,x(t),0]/fc[0,x(t),2] ; r['c2'] = -fc[1,x(t),0]/fc[1,y(t),2] r['d1'] = -fc[0,y(t),0]/fc[0,x(t),2] ; r['d2'] = -fc[1,y(t),0]/fc[1,y(t),2] const = [S(0), S(0)] for i in range(2): for j in Add.make_args(eq[i]): if not (j.has(x(t)) or j.has(y(t))): const[i] += j r['e1'] = -const[0] r['e2'] = -const[1] if match_['type_of_equation'] == 'type1': sol = _linear_2eq_order2_type1(x, y, t, r, eq) elif match_['type_of_equation'] == 'type2': gsol = _linear_2eq_order2_type1(x, y, t, r, eq) psol = _linear_2eq_order2_type2(x, y, t, r, eq) sol = [Eq(x(t), gsol[0].rhs+psol[0]), Eq(y(t), gsol[1].rhs+psol[1])] elif match_['type_of_equation'] == 'type3': sol = _linear_2eq_order2_type3(x, y, t, r, eq) elif match_['type_of_equation'] == 'type4': sol = _linear_2eq_order2_type4(x, y, t, r, eq) elif match_['type_of_equation'] == 'type5': sol = _linear_2eq_order2_type5(x, y, t, r, eq) elif match_['type_of_equation'] == 'type6': sol = _linear_2eq_order2_type6(x, y, t, r, eq) elif match_['type_of_equation'] == 'type7': sol = _linear_2eq_order2_type7(x, y, t, r, eq) elif match_['type_of_equation'] == 'type8': sol = _linear_2eq_order2_type8(x, y, t, r, eq) elif match_['type_of_equation'] == 'type9': sol = _linear_2eq_order2_type9(x, y, t, r, eq) elif match_['type_of_equation'] == 'type10': sol = _linear_2eq_order2_type10(x, y, t, r, eq) elif match_['type_of_equation'] == 'type11': sol = _linear_2eq_order2_type11(x, y, t, r, eq) return sol def _linear_2eq_order2_type1(x, y, t, r, eq): r""" System of two constant-coefficient second-order linear homogeneous differential equations .. math:: x'' = ax + by .. math:: y'' = cx + dy The charecteristic equation for above equations .. math:: \lambda^4 - (a + d) \lambda^2 + ad - bc = 0 whose discriminant is `D = (a - d)^2 + 4bc \neq 0` 1. When `ad - bc \neq 0` 1.1. If `D \neq 0`. The characteristic equation has four distict roots, `\lambda_1, \lambda_2, \lambda_3, \lambda_4`. The general solution of the system is .. math:: x = C_1 b e^{\lambda_1 t} + C_2 b e^{\lambda_2 t} + C_3 b e^{\lambda_3 t} + C_4 b e^{\lambda_4 t} .. math:: y = C_1 (\lambda_1^{2} - a) e^{\lambda_1 t} + C_2 (\lambda_2^{2} - a) e^{\lambda_2 t} + C_3 (\lambda_3^{2} - a) e^{\lambda_3 t} + C_4 (\lambda_4^{2} - a) e^{\lambda_4 t} where `C_1,..., C_4` are arbitary constants. 1.2. If `D = 0` and `a \neq d`: .. math:: x = 2 C_1 (bt + \frac{2bk}{a - d}) e^{\frac{kt}{2}} + 2 C_2 (bt + \frac{2bk}{a - d}) e^{\frac{-kt}{2}} + 2b C_3 t e^{\frac{kt}{2}} + 2b C_4 t e^{\frac{-kt}{2}} .. math:: y = C_1 (d - a) t e^{\frac{kt}{2}} + C_2 (d - a) t e^{\frac{-kt}{2}} + C_3 [(d - a) t + 2k] e^{\frac{kt}{2}} + C_4 [(d - a) t - 2k] e^{\frac{-kt}{2}} where `C_1,..., C_4` are arbitary constants and `k = \sqrt{2 (a + d)}` 1.3. If `D = 0` and `a = d \neq 0` and `b = 0`: .. math:: x = 2 \sqrt{a} C_1 e^{\sqrt{a} t} + 2 \sqrt{a} C_2 e^{-\sqrt{a} t} .. math:: y = c C_1 t e^{\sqrt{a} t} - c C_2 t e^{-\sqrt{a} t} + C_3 e^{\sqrt{a} t} + C_4 e^{-\sqrt{a} t} 1.4. If `D = 0` and `a = d \neq 0` and `c = 0`: .. math:: x = b C_1 t e^{\sqrt{a} t} - b C_2 t e^{-\sqrt{a} t} + C_3 e^{\sqrt{a} t} + C_4 e^{-\sqrt{a} t} .. math:: y = 2 \sqrt{a} C_1 e^{\sqrt{a} t} + 2 \sqrt{a} C_2 e^{-\sqrt{a} t} 2. When `ad - bc = 0` and `a^2 + b^2 > 0`. Then the original system becomes .. math:: x'' = ax + by .. math:: y'' = k (ax + by) 2.1. If `a + bk \neq 0`: .. math:: x = C_1 e^{t \sqrt{a + bk}} + C_2 e^{-t \sqrt{a + bk}} + C_3 bt + C_4 b .. math:: y = C_1 k e^{t \sqrt{a + bk}} + C_2 k e^{-t \sqrt{a + bk}} - C_3 at - C_4 a 2.2. If `a + bk = 0`: .. math:: x = C_1 b t^3 + C_2 b t^2 + C_3 t + C_4 .. math:: y = kx + 6 C_1 t + 2 C_2 """ r['a'] = r['c1'] r['b'] = r['d1'] r['c'] = r['c2'] r['d'] = r['d2'] l = Symbol('l') C1, C2, C3, C4 = get_numbered_constants(eq, num=4) chara_eq = l**4 - (r['a']+r['d'])*l**2 + r['a']*r['d'] - r['b']*r['c'] l1 = rootof(chara_eq, 0) l2 = rootof(chara_eq, 1) l3 = rootof(chara_eq, 2) l4 = rootof(chara_eq, 3) D = (r['a'] - r['d'])**2 + 4*r['b']*r['c'] if (r['a']*r['d'] - r['b']*r['c']) != 0: if D != 0: gsol1 = C1*r['b']*exp(l1*t) + C2*r['b']*exp(l2*t) + C3*r['b']*exp(l3*t) \ + C4*r['b']*exp(l4*t) gsol2 = C1*(l1**2-r['a'])*exp(l1*t) + C2*(l2**2-r['a'])*exp(l2*t) + \ C3*(l3**2-r['a'])*exp(l3*t) + C4*(l4**2-r['a'])*exp(l4*t) else: if r['a'] != r['d']: k = sqrt(2*(r['a']+r['d'])) mid = r['b']*t+2*r['b']*k/(r['a']-r['d']) gsol1 = 2*C1*mid*exp(k*t/2) + 2*C2*mid*exp(-k*t/2) + \ 2*r['b']*C3*t*exp(k*t/2) + 2*r['b']*C4*t*exp(-k*t/2) gsol2 = C1*(r['d']-r['a'])*t*exp(k*t/2) + C2*(r['d']-r['a'])*t*exp(-k*t/2) + \ C3*((r['d']-r['a'])*t+2*k)*exp(k*t/2) + C4*((r['d']-r['a'])*t-2*k)*exp(-k*t/2) elif r['a'] == r['d'] != 0 and r['b'] == 0: sa = sqrt(r['a']) gsol1 = 2*sa*C1*exp(sa*t) + 2*sa*C2*exp(-sa*t) gsol2 = r['c']*C1*t*exp(sa*t)-r['c']*C2*t*exp(-sa*t)+C3*exp(sa*t)+C4*exp(-sa*t) elif r['a'] == r['d'] != 0 and r['c'] == 0: sa = sqrt(r['a']) gsol1 = r['b']*C1*t*exp(sa*t)-r['b']*C2*t*exp(-sa*t)+C3*exp(sa*t)+C4*exp(-sa*t) gsol2 = 2*sa*C1*exp(sa*t) + 2*sa*C2*exp(-sa*t) elif (r['a']*r['d'] - r['b']*r['c']) == 0 and (r['a']**2 + r['b']**2) > 0: k = r['c']/r['a'] if r['a'] + r['b']*k != 0: mid = sqrt(r['a'] + r['b']*k) gsol1 = C1*exp(mid*t) + C2*exp(-mid*t) + C3*r['b']*t + C4*r['b'] gsol2 = C1*k*exp(mid*t) + C2*k*exp(-mid*t) - C3*r['a']*t - C4*r['a'] else: gsol1 = C1*r['b']*t**3 + C2*r['b']*t**2 + C3*t + C4 gsol2 = k*gsol1 + 6*C1*t + 2*C2 return [Eq(x(t), gsol1), Eq(y(t), gsol2)] def _linear_2eq_order2_type2(x, y, t, r, eq): r""" The equations in this type are .. math:: x'' = a_1 x + b_1 y + c_1 .. math:: y'' = a_2 x + b_2 y + c_2 The general solution of this system is given by the sum of its particular solution and the general solution of the homogeneous system. The general solution is given by the linear system of 2 equation of order 2 and type 1 1. If `a_1 b_2 - a_2 b_1 \neq 0`. A particular solution will be `x = x_0` and `y = y_0` where the constants `x_0` and `y_0` are determined by solving the linear algebraic system .. math:: a_1 x_0 + b_1 y_0 + c_1 = 0, a_2 x_0 + b_2 y_0 + c_2 = 0 2. If `a_1 b_2 - a_2 b_1 = 0` and `a_1^2 + b_1^2 > 0`. In this case, the system in question becomes .. math:: x'' = ax + by + c_1, y'' = k (ax + by) + c_2 2.1. If `\sigma = a + bk \neq 0`, the particular solution will be .. math:: x = \frac{1}{2} b \sigma^{-1} (c_1 k - c_2) t^2 - \sigma^{-2} (a c_1 + b c_2) .. math:: y = kx + \frac{1}{2} (c_2 - c_1 k) t^2 2.2. If `\sigma = a + bk = 0`, the particular solution will be .. math:: x = \frac{1}{24} b (c_2 - c_1 k) t^4 + \frac{1}{2} c_1 t^2 .. math:: y = kx + \frac{1}{2} (c_2 - c_1 k) t^2 """ x0, y0 = symbols('x0, y0') if r['c1']*r['d2'] - r['c2']*r['d1'] != 0: sol = solve((r['c1']*x0+r['d1']*y0+r['e1'], r['c2']*x0+r['d2']*y0+r['e2']), x0, y0) psol = [sol[x0], sol[y0]] elif r['c1']*r['d2'] - r['c2']*r['d1'] == 0 and (r['c1']**2 + r['d1']**2) > 0: k = r['c2']/r['c1'] sig = r['c1'] + r['d1']*k if sig != 0: psol1 = r['d1']*sig**-1*(r['e1']*k-r['e2'])*t**2/2 - \ sig**-2*(r['c1']*r['e1']+r['d1']*r['e2']) psol2 = k*psol1 + (r['e2'] - r['e1']*k)*t**2/2 psol = [psol1, psol2] else: psol1 = r['d1']*(r['e2']-r['e1']*k)*t**4/24 + r['e1']*t**2/2 psol2 = k*psol1 + (r['e2']-r['e1']*k)*t**2/2 psol = [psol1, psol2] return psol def _linear_2eq_order2_type3(x, y, t, r, eq): r""" These type of equation is used for describing the horizontal motion of a pendulum taking into account the Earth rotation. The solution is given with `a^2 + 4b > 0`: .. math:: x = C_1 \cos(\alpha t) + C_2 \sin(\alpha t) + C_3 \cos(\beta t) + C_4 \sin(\beta t) .. math:: y = -C_1 \sin(\alpha t) + C_2 \cos(\alpha t) - C_3 \sin(\beta t) + C_4 \cos(\beta t) where `C_1,...,C_4` and .. math:: \alpha = \frac{1}{2} a + \frac{1}{2} \sqrt{a^2 + 4b}, \beta = \frac{1}{2} a - \frac{1}{2} \sqrt{a^2 + 4b} """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) if r['b1']**2 - 4*r['c1'] > 0: r['a'] = r['b1'] ; r['b'] = -r['c1'] alpha = r['a']/2 + sqrt(r['a']**2 + 4*r['b'])/2 beta = r['a']/2 - sqrt(r['a']**2 + 4*r['b'])/2 sol1 = C1*cos(alpha*t) + C2*sin(alpha*t) + C3*cos(beta*t) + C4*sin(beta*t) sol2 = -C1*sin(alpha*t) + C2*cos(alpha*t) - C3*sin(beta*t) + C4*cos(beta*t) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order2_type4(x, y, t, r, eq): r""" These equations are found in the theory of oscillations .. math:: x'' + a_1 x' + b_1 y' + c_1 x + d_1 y = k_1 e^{i \omega t} .. math:: y'' + a_2 x' + b_2 y' + c_2 x + d_2 y = k_2 e^{i \omega t} The general solution of this linear nonhomogeneous system of constant-coefficient differential equations is given by the sum of its particular solution and the general solution of the corresponding homogeneous system (with `k_1 = k_2 = 0`) 1. A particular solution is obtained by the method of undetermined coefficients: .. math:: x = A_* e^{i \omega t}, y = B_* e^{i \omega t} On substituting these expressions into the original system of differential equations, one arrive at a linear nonhomogeneous system of algebraic equations for the coefficients `A` and `B`. 2. The general solution of the homogeneous system of differential equations is determined by a linear combination of linearly independent particular solutions determined by the method of undetermined coefficients in the form of exponentials: .. math:: x = A e^{\lambda t}, y = B e^{\lambda t} On substituting these expressions into the original system and colleting the coefficients of the unknown `A` and `B`, one obtains .. math:: (\lambda^{2} + a_1 \lambda + c_1) A + (b_1 \lambda + d_1) B = 0 .. math:: (a_2 \lambda + c_2) A + (\lambda^{2} + b_2 \lambda + d_2) B = 0 The determinant of this system must vanish for nontrivial solutions A, B to exist. This requirement results in the following characteristic equation for `\lambda` .. math:: (\lambda^2 + a_1 \lambda + c_1) (\lambda^2 + b_2 \lambda + d_2) - (b_1 \lambda + d_1) (a_2 \lambda + c_2) = 0 If all roots `k_1,...,k_4` of this equation are distict, the general solution of the original system of the differential equations has the form .. math:: x = C_1 (b_1 \lambda_1 + d_1) e^{\lambda_1 t} - C_2 (b_1 \lambda_2 + d_1) e^{\lambda_2 t} - C_3 (b_1 \lambda_3 + d_1) e^{\lambda_3 t} - C_4 (b_1 \lambda_4 + d_1) e^{\lambda_4 t} .. math:: y = C_1 (\lambda_1^{2} + a_1 \lambda_1 + c_1) e^{\lambda_1 t} + C_2 (\lambda_2^{2} + a_1 \lambda_2 + c_1) e^{\lambda_2 t} + C_3 (\lambda_3^{2} + a_1 \lambda_3 + c_1) e^{\lambda_3 t} + C_4 (\lambda_4^{2} + a_1 \lambda_4 + c_1) e^{\lambda_4 t} """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) k = Symbol('k') Ra, Ca, Rb, Cb = symbols('Ra, Ca, Rb, Cb') a1 = r['a1'] ; a2 = r['a2'] b1 = r['b1'] ; b2 = r['b2'] c1 = r['c1'] ; c2 = r['c2'] d1 = r['d1'] ; d2 = r['d2'] k1 = r['e1'].expand().as_independent(t)[0] k2 = r['e2'].expand().as_independent(t)[0] ew1 = r['e1'].expand().as_independent(t)[1] ew2 = powdenest(ew1).as_base_exp()[1] ew3 = collect(ew2, t).coeff(t) w = cancel(ew3/I) # The particular solution is assumed to be (Ra+I*Ca)*exp(I*w*t) and # (Rb+I*Cb)*exp(I*w*t) for x(t) and y(t) respectively peq1 = (-w**2+c1)*Ra - a1*w*Ca + d1*Rb - b1*w*Cb - k1 peq2 = a1*w*Ra + (-w**2+c1)*Ca + b1*w*Rb + d1*Cb peq3 = c2*Ra - a2*w*Ca + (-w**2+d2)*Rb - b2*w*Cb - k2 peq4 = a2*w*Ra + c2*Ca + b2*w*Rb + (-w**2+d2)*Cb # FIXME: solve for what in what? Ra, Rb, etc I guess # but then psol not used for anything? psol = solve([peq1, peq2, peq3, peq4]) chareq = (k**2+a1*k+c1)*(k**2+b2*k+d2) - (b1*k+d1)*(a2*k+c2) [k1, k2, k3, k4] = roots_quartic(Poly(chareq)) sol1 = -C1*(b1*k1+d1)*exp(k1*t) - C2*(b1*k2+d1)*exp(k2*t) - \ C3*(b1*k3+d1)*exp(k3*t) - C4*(b1*k4+d1)*exp(k4*t) + (Ra+I*Ca)*exp(I*w*t) a1_ = (a1-1) sol2 = C1*(k1**2+a1_*k1+c1)*exp(k1*t) + C2*(k2**2+a1_*k2+c1)*exp(k2*t) + \ C3*(k3**2+a1_*k3+c1)*exp(k3*t) + C4*(k4**2+a1_*k4+c1)*exp(k4*t) + (Rb+I*Cb)*exp(I*w*t) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order2_type5(x, y, t, r, eq): r""" The equation which come under this catagory are .. math:: x'' = a (t y' - y) .. math:: y'' = b (t x' - x) The transformation .. math:: u = t x' - x, b = t y' - y leads to the first-order system .. math:: u' = atv, v' = btu The general solution of this system is given by If `ab > 0`: .. math:: u = C_1 a e^{\frac{1}{2} \sqrt{ab} t^2} + C_2 a e^{-\frac{1}{2} \sqrt{ab} t^2} .. math:: v = C_1 \sqrt{ab} e^{\frac{1}{2} \sqrt{ab} t^2} - C_2 \sqrt{ab} e^{-\frac{1}{2} \sqrt{ab} t^2} If `ab < 0`: .. math:: u = C_1 a \cos(\frac{1}{2} \sqrt{\left|ab\right|} t^2) + C_2 a \sin(-\frac{1}{2} \sqrt{\left|ab\right|} t^2) .. math:: v = C_1 \sqrt{\left|ab\right|} \sin(\frac{1}{2} \sqrt{\left|ab\right|} t^2) + C_2 \sqrt{\left|ab\right|} \cos(-\frac{1}{2} \sqrt{\left|ab\right|} t^2) where `C_1` and `C_2` are arbitary constants. On substituting the value of `u` and `v` in above equations and integrating the resulting expressions, the general solution will become .. math:: x = C_3 t + t \int \frac{u}{t^2} \,dt, y = C_4 t + t \int \frac{u}{t^2} \,dt where `C_3` and `C_4` are arbitrary constants. """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) r['a'] = -r['d1'] ; r['b'] = -r['c2'] mul = sqrt(abs(r['a']*r['b'])) if r['a']*r['b'] > 0: u = C1*r['a']*exp(mul*t**2/2) + C2*r['a']*exp(-mul*t**2/2) v = C1*mul*exp(mul*t**2/2) - C2*mul*exp(-mul*t**2/2) else: u = C1*r['a']*cos(mul*t**2/2) + C2*r['a']*sin(mul*t**2/2) v = -C1*mul*sin(mul*t**2/2) + C2*mul*cos(mul*t**2/2) sol1 = C3*t + t*Integral(u/t**2, t) sol2 = C4*t + t*Integral(v/t**2, t) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order2_type6(x, y, t, r, eq): r""" The equations are .. math:: x'' = f(t) (a_1 x + b_1 y) .. math:: y'' = f(t) (a_2 x + b_2 y) If `k_1` and `k_2` are roots of the quadratic equation .. math:: k^2 - (a_1 + b_2) k + a_1 b_2 - a_2 b_1 = 0 Then by multiplying appropriate constants and adding together original equations we obtain two independent equations: .. math:: z_1'' = k_1 f(t) z_1, z_1 = a_2 x + (k_1 - a_1) y .. math:: z_2'' = k_2 f(t) z_2, z_2 = a_2 x + (k_2 - a_1) y Solving the equations will give the values of `x` and `y` after obtaining the value of `z_1` and `z_2` by solving the differential equation and substuting the result. """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) k = Symbol('k') z = Function('z') num, den = cancel( (r['c1']*x(t) + r['d1']*y(t))/ (r['c2']*x(t) + r['d2']*y(t))).as_numer_denom() f = r['c1']/num.coeff(x(t)) a1 = num.coeff(x(t)) b1 = num.coeff(y(t)) a2 = den.coeff(x(t)) b2 = den.coeff(y(t)) chareq = k**2 - (a1 + b2)*k + a1*b2 - a2*b1 k1, k2 = [rootof(chareq, k) for k in range(Poly(chareq).degree())] z1 = dsolve(diff(z(t),t,t) - k1*f*z(t)).rhs z2 = dsolve(diff(z(t),t,t) - k2*f*z(t)).rhs sol1 = (k1*z2 - k2*z1 + a1*(z1 - z2))/(a2*(k1-k2)) sol2 = (z1 - z2)/(k1 - k2) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order2_type7(x, y, t, r, eq): r""" The equations are given as .. math:: x'' = f(t) (a_1 x' + b_1 y') .. math:: y'' = f(t) (a_2 x' + b_2 y') If `k_1` and 'k_2` are roots of the quadratic equation .. math:: k^2 - (a_1 + b_2) k + a_1 b_2 - a_2 b_1 = 0 Then the system can be reduced by adding together the two equations multiplied by appropriate constants give following two independent equations: .. math:: z_1'' = k_1 f(t) z_1', z_1 = a_2 x + (k_1 - a_1) y .. math:: z_2'' = k_2 f(t) z_2', z_2 = a_2 x + (k_2 - a_1) y Integrating these and returning to the original variables, one arrives at a linear algebraic system for the unknowns `x` and `y`: .. math:: a_2 x + (k_1 - a_1) y = C_1 \int e^{k_1 F(t)} \,dt + C_2 .. math:: a_2 x + (k_2 - a_1) y = C_3 \int e^{k_2 F(t)} \,dt + C_4 where `C_1,...,C_4` are arbitrary constants and `F(t) = \int f(t) \,dt` """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) k = Symbol('k') num, den = cancel( (r['a1']*x(t) + r['b1']*y(t))/ (r['a2']*x(t) + r['b2']*y(t))).as_numer_denom() f = r['a1']/num.coeff(x(t)) a1 = num.coeff(x(t)) b1 = num.coeff(y(t)) a2 = den.coeff(x(t)) b2 = den.coeff(y(t)) chareq = k**2 - (a1 + b2)*k + a1*b2 - a2*b1 [k1, k2] = [rootof(chareq, k) for k in range(Poly(chareq).degree())] F = Integral(f, t) z1 = C1*Integral(exp(k1*F), t) + C2 z2 = C3*Integral(exp(k2*F), t) + C4 sol1 = (k1*z2 - k2*z1 + a1*(z1 - z2))/(a2*(k1-k2)) sol2 = (z1 - z2)/(k1 - k2) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order2_type8(x, y, t, r, eq): r""" The equation of this catagory are .. math:: x'' = a f(t) (t y' - y) .. math:: y'' = b f(t) (t x' - x) The transformation .. math:: u = t x' - x, v = t y' - y leads to the system of first-order equations .. math:: u' = a t f(t) v, v' = b t f(t) u The general solution of this system has the form If `ab > 0`: .. math:: u = C_1 a e^{\sqrt{ab} \int t f(t) \,dt} + C_2 a e^{-\sqrt{ab} \int t f(t) \,dt} .. math:: v = C_1 \sqrt{ab} e^{\sqrt{ab} \int t f(t) \,dt} - C_2 \sqrt{ab} e^{-\sqrt{ab} \int t f(t) \,dt} If `ab < 0`: .. math:: u = C_1 a \cos(\sqrt{\left|ab\right|} \int t f(t) \,dt) + C_2 a \sin(-\sqrt{\left|ab\right|} \int t f(t) \,dt) .. math:: v = C_1 \sqrt{\left|ab\right|} \sin(\sqrt{\left|ab\right|} \int t f(t) \,dt) + C_2 \sqrt{\left|ab\right|} \cos(-\sqrt{\left|ab\right|} \int t f(t) \,dt) where `C_1` and `C_2` are arbitary constants. On substituting the value of `u` and `v` in above equations and integrating the resulting expressions, the general solution will become .. math:: x = C_3 t + t \int \frac{u}{t^2} \,dt, y = C_4 t + t \int \frac{u}{t^2} \,dt where `C_3` and `C_4` are arbitrary constants. """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) num, den = cancel(r['d1']/r['c2']).as_numer_denom() f = -r['d1']/num a = num b = den mul = sqrt(abs(a*b)) Igral = Integral(t*f, t) if a*b > 0: u = C1*a*exp(mul*Igral) + C2*a*exp(-mul*Igral) v = C1*mul*exp(mul*Igral) - C2*mul*exp(-mul*Igral) else: u = C1*a*cos(mul*Igral) + C2*a*sin(mul*Igral) v = -C1*mul*sin(mul*Igral) + C2*mul*cos(mul*Igral) sol1 = C3*t + t*Integral(u/t**2, t) sol2 = C4*t + t*Integral(v/t**2, t) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order2_type9(x, y, t, r, eq): r""" .. math:: t^2 x'' + a_1 t x' + b_1 t y' + c_1 x + d_1 y = 0 .. math:: t^2 y'' + a_2 t x' + b_2 t y' + c_2 x + d_2 y = 0 These system of equations are euler type. The substitution of `t = \sigma e^{\tau} (\sigma \neq 0)` leads to the system of constant coefficient linear differential equations .. math:: x'' + (a_1 - 1) x' + b_1 y' + c_1 x + d_1 y = 0 .. math:: y'' + a_2 x' + (b_2 - 1) y' + c_2 x + d_2 y = 0 The general solution of the homogeneous system of differential equations is determined by a linear combination of linearly independent particular solutions determined by the method of undetermined coefficients in the form of exponentials .. math:: x = A e^{\lambda t}, y = B e^{\lambda t} On substituting these expressions into the original system and colleting the coefficients of the unknown `A` and `B`, one obtains .. math:: (\lambda^{2} + (a_1 - 1) \lambda + c_1) A + (b_1 \lambda + d_1) B = 0 .. math:: (a_2 \lambda + c_2) A + (\lambda^{2} + (b_2 - 1) \lambda + d_2) B = 0 The determinant of this system must vanish for nontrivial solutions A, B to exist. This requirement results in the following characteristic equation for `\lambda` .. math:: (\lambda^2 + (a_1 - 1) \lambda + c_1) (\lambda^2 + (b_2 - 1) \lambda + d_2) - (b_1 \lambda + d_1) (a_2 \lambda + c_2) = 0 If all roots `k_1,...,k_4` of this equation are distict, the general solution of the original system of the differential equations has the form .. math:: x = C_1 (b_1 \lambda_1 + d_1) e^{\lambda_1 t} - C_2 (b_1 \lambda_2 + d_1) e^{\lambda_2 t} - C_3 (b_1 \lambda_3 + d_1) e^{\lambda_3 t} - C_4 (b_1 \lambda_4 + d_1) e^{\lambda_4 t} .. math:: y = C_1 (\lambda_1^{2} + (a_1 - 1) \lambda_1 + c_1) e^{\lambda_1 t} + C_2 (\lambda_2^{2} + (a_1 - 1) \lambda_2 + c_1) e^{\lambda_2 t} + C_3 (\lambda_3^{2} + (a_1 - 1) \lambda_3 + c_1) e^{\lambda_3 t} + C_4 (\lambda_4^{2} + (a_1 - 1) \lambda_4 + c_1) e^{\lambda_4 t} """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) k = Symbol('k') a1 = -r['a1']*t; a2 = -r['a2']*t b1 = -r['b1']*t; b2 = -r['b2']*t c1 = -r['c1']*t**2; c2 = -r['c2']*t**2 d1 = -r['d1']*t**2; d2 = -r['d2']*t**2 eq = (k**2+(a1-1)*k+c1)*(k**2+(b2-1)*k+d2)-(b1*k+d1)*(a2*k+c2) [k1, k2, k3, k4] = roots_quartic(Poly(eq)) sol1 = -C1*(b1*k1+d1)*exp(k1*log(t)) - C2*(b1*k2+d1)*exp(k2*log(t)) - \ C3*(b1*k3+d1)*exp(k3*log(t)) - C4*(b1*k4+d1)*exp(k4*log(t)) a1_ = (a1-1) sol2 = C1*(k1**2+a1_*k1+c1)*exp(k1*log(t)) + C2*(k2**2+a1_*k2+c1)*exp(k2*log(t)) \ + C3*(k3**2+a1_*k3+c1)*exp(k3*log(t)) + C4*(k4**2+a1_*k4+c1)*exp(k4*log(t)) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order2_type10(x, y, t, r, eq): r""" The equation of this catagory are .. math:: (\alpha t^2 + \beta t + \gamma)^{2} x'' = ax + by .. math:: (\alpha t^2 + \beta t + \gamma)^{2} y'' = cx + dy The transformation .. math:: \tau = \int \frac{1}{\alpha t^2 + \beta t + \gamma} \,dt , u = \frac{x}{\sqrt{\left|\alpha t^2 + \beta t + \gamma\right|}} , v = \frac{y}{\sqrt{\left|\alpha t^2 + \beta t + \gamma\right|}} leads to a constant coefficient linear system of equations .. math:: u'' = (a - \alpha \gamma + \frac{1}{4} \beta^{2}) u + b v .. math:: v'' = c u + (d - \alpha \gamma + \frac{1}{4} \beta^{2}) v These system of equations obtained can be solved by type1 of System of two constant-coefficient second-order linear homogeneous differential equations. """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) u, v = symbols('u, v', function=True) T = Symbol('T') p = Wild('p', exclude=[t, t**2]) q = Wild('q', exclude=[t, t**2]) s = Wild('s', exclude=[t, t**2]) n = Wild('n', exclude=[t, t**2]) num, den = r['c1'].as_numer_denom() dic = den.match((n*(p*t**2+q*t+s)**2).expand()) eqz = dic[p]*t**2 + dic[q]*t + dic[s] a = num/dic[n] b = cancel(r['d1']*eqz**2) c = cancel(r['c2']*eqz**2) d = cancel(r['d2']*eqz**2) [msol1, msol2] = dsolve([Eq(diff(u(t), t, t), (a - dic[p]*dic[s] + dic[q]**2/4)*u(t) \ + b*v(t)), Eq(diff(v(t),t,t), c*u(t) + (d - dic[p]*dic[s] + dic[q]**2/4)*v(t))]) sol1 = (msol1.rhs*sqrt(abs(eqz))).subs(t, Integral(1/eqz, t)) sol2 = (msol2.rhs*sqrt(abs(eqz))).subs(t, Integral(1/eqz, t)) return [Eq(x(t), sol1), Eq(y(t), sol2)] def _linear_2eq_order2_type11(x, y, t, r, eq): r""" The equations which comes under this type are .. math:: x'' = f(t) (t x' - x) + g(t) (t y' - y) .. math:: y'' = h(t) (t x' - x) + p(t) (t y' - y) The transformation .. math:: u = t x' - x, v = t y' - y leads to the linear system of first-order equations .. math:: u' = t f(t) u + t g(t) v, v' = t h(t) u + t p(t) v On substituting the value of `u` and `v` in transformed equation gives value of `x` and `y` as .. math:: x = C_3 t + t \int \frac{u}{t^2} \,dt , y = C_4 t + t \int \frac{v}{t^2} \,dt. where `C_3` and `C_4` are arbitrary constants. """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) u, v = symbols('u, v', function=True) f = -r['c1'] ; g = -r['d1'] h = -r['c2'] ; p = -r['d2'] [msol1, msol2] = dsolve([Eq(diff(u(t),t), t*f*u(t) + t*g*v(t)), Eq(diff(v(t),t), t*h*u(t) + t*p*v(t))]) sol1 = C3*t + t*Integral(msol1.rhs/t**2, t) sol2 = C4*t + t*Integral(msol2.rhs/t**2, t) return [Eq(x(t), sol1), Eq(y(t), sol2)] def sysode_linear_3eq_order1(match_): x = match_['func'][0].func y = match_['func'][1].func z = match_['func'][2].func func = match_['func'] fc = match_['func_coeff'] eq = match_['eq'] C1, C2, C3, C4 = get_numbered_constants(eq, num=4) r = dict() t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] for i in range(3): eqs = 0 for terms in Add.make_args(eq[i]): eqs += terms/fc[i,func[i],1] eq[i] = eqs # for equations: # Eq(g1*diff(x(t),t), a1*x(t)+b1*y(t)+c1*z(t)+d1), # Eq(g2*diff(y(t),t), a2*x(t)+b2*y(t)+c2*z(t)+d2), and # Eq(g3*diff(z(t),t), a3*x(t)+b3*y(t)+c3*z(t)+d3) r['a1'] = fc[0,x(t),0]/fc[0,x(t),1]; r['a2'] = fc[1,x(t),0]/fc[1,y(t),1]; r['a3'] = fc[2,x(t),0]/fc[2,z(t),1] r['b1'] = fc[0,y(t),0]/fc[0,x(t),1]; r['b2'] = fc[1,y(t),0]/fc[1,y(t),1]; r['b3'] = fc[2,y(t),0]/fc[2,z(t),1] r['c1'] = fc[0,z(t),0]/fc[0,x(t),1]; r['c2'] = fc[1,z(t),0]/fc[1,y(t),1]; r['c3'] = fc[2,z(t),0]/fc[2,z(t),1] for i in range(3): for j in Add.make_args(eq[i]): if not j.has(x(t), y(t), z(t)): raise NotImplementedError("Only homogeneous problems are supported, non-homogenous are not supported currently.") if match_['type_of_equation'] == 'type1': sol = _linear_3eq_order1_type1(x, y, z, t, r, eq) if match_['type_of_equation'] == 'type2': sol = _linear_3eq_order1_type2(x, y, z, t, r, eq) if match_['type_of_equation'] == 'type3': sol = _linear_3eq_order1_type3(x, y, z, t, r, eq) if match_['type_of_equation'] == 'type4': sol = _linear_3eq_order1_type4(x, y, z, t, r, eq) if match_['type_of_equation'] == 'type6': sol = _linear_neq_order1_type1(match_) return sol def _linear_3eq_order1_type1(x, y, z, t, r, eq): r""" .. math:: x' = ax .. math:: y' = bx + cy .. math:: z' = dx + ky + pz Solution of such equations are forward substitution. Solving first equations gives the value of `x`, substituting it in second and third equation and solving second equation gives `y` and similarly substituting `y` in third equation give `z`. .. math:: x = C_1 e^{at} .. math:: y = \frac{b C_1}{a - c} e^{at} + C_2 e^{ct} .. math:: z = \frac{C_1}{a - p} (d + \frac{bk}{a - c}) e^{at} + \frac{k C_2}{c - p} e^{ct} + C_3 e^{pt} where `C_1, C_2` and `C_3` are arbitrary constants. """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) a = -r['a1']; b = -r['a2']; c = -r['b2'] d = -r['a3']; k = -r['b3']; p = -r['c3'] sol1 = C1*exp(a*t) sol2 = b*C1*exp(a*t)/(a-c) + C2*exp(c*t) sol3 = C1*(d+b*k/(a-c))*exp(a*t)/(a-p) + k*C2*exp(c*t)/(c-p) + C3*exp(p*t) return [Eq(x(t), sol1), Eq(y(t), sol2), Eq(z(t), sol3)] def _linear_3eq_order1_type2(x, y, z, t, r, eq): r""" The equations of this type are .. math:: x' = cy - bz .. math:: y' = az - cx .. math:: z' = bx - ay 1. First integral: .. math:: ax + by + cz = A \qquad - (1) .. math:: x^2 + y^2 + z^2 = B^2 \qquad - (2) where `A` and `B` are arbitrary constants. It follows from these integrals that the integral lines are circles formed by the intersection of the planes `(1)` and sphere `(2)` 2. Solution: .. math:: x = a C_0 + k C_1 \cos(kt) + (c C_2 - b C_3) \sin(kt) .. math:: y = b C_0 + k C_2 \cos(kt) + (a C_2 - c C_3) \sin(kt) .. math:: z = c C_0 + k C_3 \cos(kt) + (b C_2 - a C_3) \sin(kt) where `k = \sqrt{a^2 + b^2 + c^2}` and the four constants of integration, `C_1,...,C_4` are constrained by a single relation, .. math:: a C_1 + b C_2 + c C_3 = 0 """ C0, C1, C2, C3 = get_numbered_constants(eq, num=4, start=0) a = -r['c2']; b = -r['a3']; c = -r['b1'] k = sqrt(a**2 + b**2 + c**2) C3 = (-a*C1 - b*C2)/c sol1 = a*C0 + k*C1*cos(k*t) + (c*C2-b*C3)*sin(k*t) sol2 = b*C0 + k*C2*cos(k*t) + (a*C3-c*C1)*sin(k*t) sol3 = c*C0 + k*C3*cos(k*t) + (b*C1-a*C2)*sin(k*t) return [Eq(x(t), sol1), Eq(y(t), sol2), Eq(z(t), sol3)] def _linear_3eq_order1_type3(x, y, z, t, r, eq): r""" Equations of this system of ODEs .. math:: a x' = bc (y - z) .. math:: b y' = ac (z - x) .. math:: c z' = ab (x - y) 1. First integral: .. math:: a^2 x + b^2 y + c^2 z = A where A is an arbitary constant. It follows that the integral lines are plane curves. 2. Solution: .. math:: x = C_0 + k C_1 \cos(kt) + a^{-1} bc (C_2 - C_3) \sin(kt) .. math:: y = C_0 + k C_2 \cos(kt) + a b^{-1} c (C_3 - C_1) \sin(kt) .. math:: z = C_0 + k C_3 \cos(kt) + ab c^{-1} (C_1 - C_2) \sin(kt) where `k = \sqrt{a^2 + b^2 + c^2}` and the four constants of integration, `C_1,...,C_4` are constrained by a single relation .. math:: a^2 C_1 + b^2 C_2 + c^2 C_3 = 0 """ C0, C1, C2, C3 = get_numbered_constants(eq, num=4, start=0) c = sqrt(r['b1']*r['c2']) b = sqrt(r['b1']*r['a3']) a = sqrt(r['c2']*r['a3']) C3 = (-a**2*C1-b**2*C2)/c**2 k = sqrt(a**2 + b**2 + c**2) sol1 = C0 + k*C1*cos(k*t) + a**-1*b*c*(C2-C3)*sin(k*t) sol2 = C0 + k*C2*cos(k*t) + a*b**-1*c*(C3-C1)*sin(k*t) sol3 = C0 + k*C3*cos(k*t) + a*b*c**-1*(C1-C2)*sin(k*t) return [Eq(x(t), sol1), Eq(y(t), sol2), Eq(z(t), sol3)] def _linear_3eq_order1_type4(x, y, z, t, r, eq): r""" Equations: .. math:: x' = (a_1 f(t) + g(t)) x + a_2 f(t) y + a_3 f(t) z .. math:: y' = b_1 f(t) x + (b_2 f(t) + g(t)) y + b_3 f(t) z .. math:: z' = c_1 f(t) x + c_2 f(t) y + (c_3 f(t) + g(t)) z The transformation .. math:: x = e^{\int g(t) \,dt} u, y = e^{\int g(t) \,dt} v, z = e^{\int g(t) \,dt} w, \tau = \int f(t) \,dt leads to the system of constant coefficient linear differential equations .. math:: u' = a_1 u + a_2 v + a_3 w .. math:: v' = b_1 u + b_2 v + b_3 w .. math:: w' = c_1 u + c_2 v + c_3 w These system of equations are solved by homogeneous linear system of constant coefficients of `n` equations of first order. Then substituting the value of `u, v` and `w` in transformed equation gives value of `x, y` and `z`. """ u, v, w = symbols('u, v, w', function=True) a2, a3 = cancel(r['b1']/r['c1']).as_numer_denom() f = cancel(r['b1']/a2) b1 = cancel(r['a2']/f); b3 = cancel(r['c2']/f) c1 = cancel(r['a3']/f); c2 = cancel(r['b3']/f) a1, g = div(r['a1'],f) b2 = div(r['b2'],f)[0] c3 = div(r['c3'],f)[0] trans_eq = (diff(u(t),t)-a1*u(t)-a2*v(t)-a3*w(t), diff(v(t),t)-b1*u(t)-\ b2*v(t)-b3*w(t), diff(w(t),t)-c1*u(t)-c2*v(t)-c3*w(t)) sol = dsolve(trans_eq) sol1 = exp(Integral(g,t))*((sol[0].rhs).subs(t, Integral(f,t))) sol2 = exp(Integral(g,t))*((sol[1].rhs).subs(t, Integral(f,t))) sol3 = exp(Integral(g,t))*((sol[2].rhs).subs(t, Integral(f,t))) return [Eq(x(t), sol1), Eq(y(t), sol2), Eq(z(t), sol3)] def sysode_linear_neq_order1(match_): sol = _linear_neq_order1_type1(match_) def _linear_neq_order1_type1(match_): r""" System of n first-order constant-coefficient linear nonhomogeneous differential equation .. math:: y'_k = a_{k1} y_1 + a_{k2} y_2 +...+ a_{kn} y_n; k = 1,2,...,n or that can be written as `\vec{y'} = A . \vec{y}` where `\vec{y}` is matrix of `y_k` for `k = 1,2,...n` and `A` is a `n \times n` matrix. Since these equations are equivalent to a first order homogeneous linear differential equation. So the general solution will contain `n` linearly independent parts and solution will consist some type of exponential functions. Assuming `y = \vec{v} e^{rt}` is a solution of the system where `\vec{v}` is a vector of coefficients of `y_1,...,y_n`. Substituting `y` and `y' = r v e^{r t}` into the equation `\vec{y'} = A . \vec{y}`, we get .. math:: r \vec{v} e^{rt} = A \vec{v} e^{rt} .. math:: r \vec{v} = A \vec{v} where `r` comes out to be eigenvalue of `A` and vector `\vec{v}` is the eigenvector of `A` corresponding to `r`. There are three possiblities of eigenvalues of `A` - `n` distinct real eigenvalues - complex conjugate eigenvalues - eigenvalues with multiplicity `k` 1. When all eigenvalues `r_1,..,r_n` are distinct with `n` different eigenvectors `v_1,...v_n` then the solution is given by .. math:: \vec{y} = C_1 e^{r_1 t} \vec{v_1} + C_2 e^{r_2 t} \vec{v_2} +...+ C_n e^{r_n t} \vec{v_n} where `C_1,C_2,...,C_n` are arbitrary constants. 2. When some eigenvalues are complex then in order to make the solution real, we take a llinear combination: if `r = a + bi` has an eigenvector `\vec{v} = \vec{w_1} + i \vec{w_2}` then to obtain real-valued solutions to the system, replace the complex-valued solutions `e^{rx} \vec{v}` with real-valued solution `e^{ax} (\vec{w_1} \cos(bx) - \vec{w_2} \sin(bx))` and for `r = a - bi` replace the solution `e^{-r x} \vec{v}` with `e^{ax} (\vec{w_1} \sin(bx) + \vec{w_2} \cos(bx))` 3. If some eigenvalues are repeated. Then we get fewer than `n` linearly independent eigenvectors, we miss some of the solutions and need to construct the missing ones. We do this via generalized eigenvectors, vectors which are not eigenvectors but are close enough that we can use to write down the remaining solutions. For a eigenvalue `r` with eigenvector `\vec{w}` we obtain `\vec{w_2},...,\vec{w_k}` using .. math:: (A - r I) . \vec{w_2} = \vec{w} .. math:: (A - r I) . \vec{w_3} = \vec{w_2} .. math:: \vdots .. math:: (A - r I) . \vec{w_k} = \vec{w_{k-1}} Then the solutions to the system for the eigenspace are `e^{rt} [\vec{w}], e^{rt} [t \vec{w} + \vec{w_2}], e^{rt} [\frac{t^2}{2} \vec{w} + t \vec{w_2} + \vec{w_3}], ...,e^{rt} [\frac{t^{k-1}}{(k-1)!} \vec{w} + \frac{t^{k-2}}{(k-2)!} \vec{w_2} +...+ t \vec{w_{k-1}} + \vec{w_k}]` So, If `\vec{y_1},...,\vec{y_n}` are `n` solution of obtained from three categories of `A`, then general solution to the system `\vec{y'} = A . \vec{y}` .. math:: \vec{y} = C_1 \vec{y_1} + C_2 \vec{y_2} + \cdots + C_n \vec{y_n} """ eq = match_['eq'] func = match_['func'] fc = match_['func_coeff'] n = len(eq) t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] constants = numbered_symbols(prefix='C', cls=Symbol, start=1) M = Matrix(n,n,lambda i,j:-fc[i,func[j],0]) evector = M.eigenvects(simplify=True) def is_complex(mat, root): return Matrix(n, 1, lambda i,j: re(mat[i])*cos(im(root)*t) - im(mat[i])*sin(im(root)*t)) def is_complex_conjugate(mat, root): return Matrix(n, 1, lambda i,j: re(mat[i])*sin(abs(im(root))*t) + im(mat[i])*cos(im(root)*t)*abs(im(root))/im(root)) conjugate_root = [] e_vector = zeros(n,1) for evects in evector: if evects[0] not in conjugate_root: # If number of column of an eigenvector is not equal to the multiplicity # of its eigenvalue then the legt eigenvectors are calculated if len(evects[2])!=evects[1]: var_mat = Matrix(n, 1, lambda i,j: Symbol('x'+str(i))) Mnew = (M - evects[0]*eye(evects[2][-1].rows))*var_mat w = [0 for i in range(evects[1])] w[0] = evects[2][-1] for r in range(1, evects[1]): w_ = Mnew - w[r-1] sol_dict = solve(list(w_), var_mat[1:]) sol_dict[var_mat[0]] = var_mat[0] for key, value in sol_dict.items(): sol_dict[key] = value.subs(var_mat[0],1) w[r] = Matrix(n, 1, lambda i,j: sol_dict[var_mat[i]]) evects[2].append(w[r]) for i in range(evects[1]): C = next(constants) for j in range(i+1): if evects[0].has(I): evects[2][j] = simplify(evects[2][j]) e_vector += C*is_complex(evects[2][j], evects[0])*t**(i-j)*exp(re(evects[0])*t)/factorial(i-j) C = next(constants) e_vector += C*is_complex_conjugate(evects[2][j], evects[0])*t**(i-j)*exp(re(evects[0])*t)/factorial(i-j) else: e_vector += C*evects[2][j]*t**(i-j)*exp(evects[0]*t)/factorial(i-j) if evects[0].has(I): conjugate_root.append(conjugate(evects[0])) sol = [] for i in range(len(eq)): sol.append(Eq(func[i],e_vector[i])) return sol def sysode_nonlinear_2eq_order1(match_): func = match_['func'] eq = match_['eq'] fc = match_['func_coeff'] t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] if match_['type_of_equation'] == 'type5': sol = _nonlinear_2eq_order1_type5(func, t, eq) return sol x = func[0].func y = func[1].func for i in range(2): eqs = 0 for terms in Add.make_args(eq[i]): eqs += terms/fc[i,func[i],1] eq[i] = eqs if match_['type_of_equation'] == 'type1': sol = _nonlinear_2eq_order1_type1(x, y, t, eq) elif match_['type_of_equation'] == 'type2': sol = _nonlinear_2eq_order1_type2(x, y, t, eq) elif match_['type_of_equation'] == 'type3': sol = _nonlinear_2eq_order1_type3(x, y, t, eq) elif match_['type_of_equation'] == 'type4': sol = _nonlinear_2eq_order1_type4(x, y, t, eq) return sol def _nonlinear_2eq_order1_type1(x, y, t, eq): r""" Equations: .. math:: x' = x^n F(x,y) .. math:: y' = g(y) F(x,y) Solution: .. math:: x = \varphi(y), \int \frac{1}{g(y) F(\varphi(y),y)} \,dy = t + C_2 where if `n \neq 1` .. math:: \varphi = [C_1 + (1-n) \int \frac{1}{g(y)} \,dy]^{\frac{1}{1-n}} if `n = 1` .. math:: \varphi = C_1 e^{\int \frac{1}{g(y)} \,dy} where `C_1` and `C_2` are arbitrary constants. """ C1, C2 = get_numbered_constants(eq, num=2) n = Wild('n', exclude=[x(t),y(t)]) f = Wild('f') u, v, phi = symbols('u, v, phi', function=True) r = eq[0].match(diff(x(t),t) - x(t)**n*f) g = ((diff(y(t),t) - eq[1])/r[f]).subs(y(t),v) F = r[f].subs(x(t),u).subs(y(t),v) n = r[n] if n!=1: phi = (C1 + (1-n)*Integral(1/g, v))**(1/(1-n)) else: phi = C1*exp(Integral(1/g, v)) phi = phi.doit() sol2 = solve(Integral(1/(g*F.subs(u,phi)), v).doit() - t - C2, v) sol = [] for sols in sol2: sol.append(Eq(x(t),phi.subs(v, sols))) sol.append(Eq(y(t), sols)) return sol def _nonlinear_2eq_order1_type2(x, y, t, eq): r""" Equations: .. math:: x' = e^{\lambda x} F(x,y) .. math:: y' = g(y) F(x,y) Solution: .. math:: x = \varphi(y), \int \frac{1}{g(y) F(\varphi(y),y)} \,dy = t + C_2 where if `\lambda \neq 0` .. math:: \varphi = -\frac{1}{\lambda} log(C_1 - \lambda \int \frac{1}{g(y)} \,dy) if `\lambda = 0` .. math:: \varphi = C_1 + \int \frac{1}{g(y)} \,dy where `C_1` and `C_2` are arbitrary constants. """ C1, C2 = get_numbered_constants(eq, num=2) n = Wild('n', exclude=[x(t),y(t)]) f = Wild('f') u, v, phi = symbols('u, v, phi', function=True) r = eq[0].match(diff(x(t),t) - exp(n*x(t))*f) g = ((diff(y(t),t) - eq[1])/r[f]).subs(y(t),v) F = r[f].subs(x(t),u).subs(y(t),v) n = r[n] if n: phi = -1/n*log(C1 - n*Integral(1/g, v)) else: phi = C1 + Integral(1/g, v) phi = phi.doit() sol2 = solve(Integral(1/(g*F.subs(u,phi)), v).doit() - t - C2, v) sol = [] for sols in sol2: sol.append(Eq(x(t),phi.subs(v, sols))) sol.append(Eq(y(t), sols)) return sol def _nonlinear_2eq_order1_type3(x, y, t, eq): r""" Autonomous system of general form .. math:: x' = F(x,y) .. math:: y' = G(x,y) Assuming `y = y(x, C_1)` where `C_1` is an arbitrary constant is the general solution of the first-order equation .. math:: F(x,y) y'_x = G(x,y) Then the general solution of the original system of equations has the form .. math:: \int \frac{1}{F(x,y(x,C_1))} \,dx = t + C_1 """ C1, C2, C3, C4 = get_numbered_constants(eq, num=4) u, v = symbols('u, v', function=True) f = Wild('f') g = Wild('g') r1 = eq[0].match(diff(x(t),t) - f) r2 = eq[1].match(diff(y(t),t) - g) F = r1[f].subs(x(t),u).subs(y(t),v) G = r2[g].subs(x(t),u).subs(y(t),v) sol2r = dsolve(Eq(diff(v(u),u), G.subs(v,v(u))/F.subs(v,v(u)))) for sol2s in sol2r: sol1 = solve(Integral(1/F.subs(v, sol2s.rhs), u).doit() - t - C2, u) sol = [] for sols in sol1: sol.append(Eq(x(t), sols)) sol.append(Eq(y(t), (sol2s.rhs).subs(u, sols))) return sol def _nonlinear_2eq_order1_type4(x, y, t, eq): r""" Equation: .. math:: x' = f_1(x) g_1(y) \phi(x,y,t) .. math:: y' = f_2(x) g_2(y) \phi(x,y,t) First integral: .. math:: \int \frac{f_2(x)}{f_1(x)} \,dx - \int \frac{g_1(y)}{g_2(y)} \,dy = C where `C` is an arbitrary constant. On solving the first integral for `x` (resp., `y` ) and on substituting the resulting expression into either equation of the original solution, one arrives at a firs-order equation for determining `y` (resp., `x` ). """ C1, C2 = get_numbered_constants(eq, num=2) u, v = symbols('u, v') f = Wild('f') g = Wild('g') f1 = Wild('f1', exclude=[v,t]) f2 = Wild('f2', exclude=[v,t]) g1 = Wild('g1', exclude=[u,t]) g2 = Wild('g2', exclude=[u,t]) r1 = eq[0].match(diff(x(t),t) - f) r2 = eq[1].match(diff(y(t),t) - g) num, den = ( (r1[f].subs(x(t),u).subs(y(t),v))/ (r2[g].subs(x(t),u).subs(y(t),v))).as_numer_denom() R1 = num.match(f1*g1) R2 = den.match(f2*g2) phi = (r1[f].subs(x(t),u).subs(y(t),v))/num F1 = R1[f1]; F2 = R2[f2] G1 = R1[g1]; G2 = R2[g2] sol1r = solve(Integral(F2/F1, u).doit() - Integral(G1/G2,v).doit() - C1, u) sol2r = solve(Integral(F2/F1, u).doit() - Integral(G1/G2,v).doit() - C1, v) sol = [] for sols in sol1r: sol.append(Eq(y(t), dsolve(diff(v(t),t) - F2.subs(u,sols).subs(v,v(t))*G2.subs(v,v(t))*phi.subs(u,sols).subs(v,v(t))).rhs)) for sols in sol2r: sol.append(Eq(x(t), dsolve(diff(u(t),t) - F1.subs(u,u(t))*G1.subs(v,sols).subs(u,u(t))*phi.subs(v,sols).subs(u,u(t))).rhs)) return set(sol) def _nonlinear_2eq_order1_type5(func, t, eq): r""" Clairaut system of ODEs .. math:: x = t x' + F(x',y') .. math:: y = t y' + G(x',y') The following are solutions of the system `(i)` straight lines: .. math:: x = C_1 t + F(C_1, C_2), y = C_2 t + G(C_1, C_2) where `C_1` and `C_2` are arbitrary constants; `(ii)` envelopes of the above lines; `(iii)` continuously differentiable lines made up from segments of the lines `(i)` and `(ii)`. """ C1, C2 = get_numbered_constants(eq, num=2) f = Wild('f') g = Wild('g') def check_type(x, y): r1 = eq[0].match(t*diff(x(t),t) - x(t) + f) r2 = eq[1].match(t*diff(y(t),t) - y(t) + g) if not (r1 and r2): r1 = eq[0].match(diff(x(t),t) - x(t)/t + f/t) r2 = eq[1].match(diff(y(t),t) - y(t)/t + g/t) if not (r1 and r2): r1 = (-eq[0]).match(t*diff(x(t),t) - x(t) + f) r2 = (-eq[1]).match(t*diff(y(t),t) - y(t) + g) if not (r1 and r2): r1 = (-eq[0]).match(diff(x(t),t) - x(t)/t + f/t) r2 = (-eq[1]).match(diff(y(t),t) - y(t)/t + g/t) return [r1, r2] for func_ in func: if isinstance(func_, list): x = func[0][0].func y = func[0][1].func [r1, r2] = check_type(x, y) if not (r1 and r2): [r1, r2] = check_type(y, x) x, y = y, x x1 = diff(x(t),t); y1 = diff(y(t),t) return {Eq(x(t), C1*t + r1[f].subs(x1,C1).subs(y1,C2)), Eq(y(t), C2*t + r2[g].subs(x1,C1).subs(y1,C2))} def sysode_nonlinear_3eq_order1(match_): x = match_['func'][0].func y = match_['func'][1].func z = match_['func'][2].func eq = match_['eq'] fc = match_['func_coeff'] func = match_['func'] t = list(list(eq[0].atoms(Derivative))[0].atoms(Symbol))[0] if match_['type_of_equation'] == 'type1': sol = _nonlinear_3eq_order1_type1(x, y, z, t, eq) if match_['type_of_equation'] == 'type2': sol = _nonlinear_3eq_order1_type2(x, y, z, t, eq) if match_['type_of_equation'] == 'type3': sol = _nonlinear_3eq_order1_type3(x, y, z, t, eq) if match_['type_of_equation'] == 'type4': sol = _nonlinear_3eq_order1_type4(x, y, z, t, eq) if match_['type_of_equation'] == 'type5': sol = _nonlinear_3eq_order1_type5(x, y, z, t, eq) return sol def _nonlinear_3eq_order1_type1(x, y, z, t, eq): r""" Equations: .. math:: a x' = (b - c) y z, \enspace b y' = (c - a) z x, \enspace c z' = (a - b) x y First Integrals: .. math:: a x^{2} + b y^{2} + c z^{2} = C_1 .. math:: a^{2} x^{2} + b^{2} y^{2} + c^{2} z^{2} = C_2 where `C_1` and `C_2` are arbitrary constants. On solving the integrals for `y` and `z` and on substituting the resulting expressions into the first equation of the system, we arrives at a separable first-order equation on `x`. Similarly doing that for other two equations, we will arrive at first order equation on `y` and `z` too. References ========== -http://eqworld.ipmnet.ru/en/solutions/sysode/sode0401.pdf """ C1, C2 = get_numbered_constants(eq, num=2) u, v, w = symbols('u, v, w') p = Wild('p', exclude=[x(t), y(t), z(t), t]) q = Wild('q', exclude=[x(t), y(t), z(t), t]) s = Wild('s', exclude=[x(t), y(t), z(t), t]) r = (diff(x(t),t) - eq[0]).match(p*y(t)*z(t)) r.update((diff(y(t),t) - eq[1]).match(q*z(t)*x(t))) r.update((diff(z(t),t) - eq[2]).match(s*x(t)*y(t))) n1, d1 = r[p].as_numer_denom() n2, d2 = r[q].as_numer_denom() n3, d3 = r[s].as_numer_denom() val = solve([n1*u-d1*v+d1*w, d2*u+n2*v-d2*w, d3*u-d3*v-n3*w],[u,v]) vals = [val[v], val[u]] c = lcm(vals[0].as_numer_denom()[1], vals[1].as_numer_denom()[1]) b = vals[0].subs(w,c) a = vals[1].subs(w,c) y_x = sqrt(((c*C1-C2) - a*(c-a)*x(t)**2)/(b*(c-b))) z_x = sqrt(((b*C1-C2) - a*(b-a)*x(t)**2)/(c*(b-c))) z_y = sqrt(((a*C1-C2) - b*(a-b)*y(t)**2)/(c*(a-c))) x_y = sqrt(((c*C1-C2) - b*(c-b)*y(t)**2)/(a*(c-a))) x_z = sqrt(((b*C1-C2) - c*(b-c)*z(t)**2)/(a*(b-a))) y_z = sqrt(((a*C1-C2) - c*(a-c)*z(t)**2)/(b*(a-b))) try: sol1 = dsolve(a*diff(x(t),t) - (b-c)*y_x*z_x).rhs except: sol1 = dsolve(a*diff(x(t),t) - (b-c)*y_x*z_x, hint='separable_Integral') try: sol2 = dsolve(b*diff(y(t),t) - (c-a)*z_y*x_y).rhs except: sol2 = dsolve(b*diff(y(t),t) - (c-a)*z_y*x_y, hint='separable_Integral') try: sol3 = dsolve(c*diff(z(t),t) - (a-b)*x_z*y_z).rhs except: sol3 = dsolve(c*diff(z(t),t) - (a-b)*x_z*y_z, hint='separable_Integral') return [Eq(x(t), sol1), Eq(y(t), sol2), Eq(z(t), sol3)] def _nonlinear_3eq_order1_type2(x, y, z, t, eq): r""" Equations: .. math:: a x' = (b - c) y z f(x, y, z, t) .. math:: b y' = (c - a) z x f(x, y, z, t) .. math:: c z' = (a - b) x y f(x, y, z, t) First Integrals: .. math:: a x^{2} + b y^{2} + c z^{2} = C_1 .. math:: a^{2} x^{2} + b^{2} y^{2} + c^{2} z^{2} = C_2 where `C_1` and `C_2` are arbitrary constants. On solving the integrals for `y` and `z` and on substituting the resulting expressions into the first equation of the system, we arrives at a first-order differential equations on `x`. Similarly doing that for other two equations we will arrive at first order equation on `y` and `z`. References ========== -http://eqworld.ipmnet.ru/en/solutions/sysode/sode0402.pdf """ C1, C2 = get_numbered_constants(eq, num=2) u, v, w = symbols('u, v, w') p = Wild('p', exclude=[x(t), y(t), z(t), t]) q = Wild('q', exclude=[x(t), y(t), z(t), t]) s = Wild('s', exclude=[x(t), y(t), z(t), t]) f = Wild('f') r1 = (diff(x(t),t) - eq[0]).match(y(t)*z(t)*f) r = collect_const(r1[f]).match(p*f) r.update(((diff(y(t),t) - eq[1])/r[f]).match(q*z(t)*x(t))) r.update(((diff(z(t),t) - eq[2])/r[f]).match(s*x(t)*y(t))) n1, d1 = r[p].as_numer_denom() n2, d2 = r[q].as_numer_denom() n3, d3 = r[s].as_numer_denom() val = solve([n1*u-d1*v+d1*w, d2*u+n2*v-d2*w, -d3*u+d3*v+n3*w],[u,v]) vals = [val[v], val[u]] c = lcm(vals[0].as_numer_denom()[1], vals[1].as_numer_denom()[1]) a = vals[0].subs(w,c) b = vals[1].subs(w,c) y_x = sqrt(((c*C1-C2) - a*(c-a)*x(t)**2)/(b*(c-b))) z_x = sqrt(((b*C1-C2) - a*(b-a)*x(t)**2)/(c*(b-c))) z_y = sqrt(((a*C1-C2) - b*(a-b)*y(t)**2)/(c*(a-c))) x_y = sqrt(((c*C1-C2) - b*(c-b)*y(t)**2)/(a*(c-a))) x_z = sqrt(((b*C1-C2) - c*(b-c)*z(t)**2)/(a*(b-a))) y_z = sqrt(((a*C1-C2) - c*(a-c)*z(t)**2)/(b*(a-b))) try: sol1 = dsolve(a*diff(x(t),t) - (b-c)*y_x*z_x*r[f]).rhs except: sol1 = dsolve(a*diff(x(t),t) - (b-c)*y_x*z_x*r[f], hint='separable_Integral') try: sol2 = dsolve(b*diff(y(t),t) - (c-a)*z_y*x_y*r[f]).rhs except: sol2 = dsolve(b*diff(y(t),t) - (c-a)*z_y*x_y*r[f], hint='separable_Integral') try: sol3 = dsolve(c*diff(z(t),t) - (a-b)*x_z*y_z*r[f]).rhs except: sol3 = dsolve(c*diff(z(t),t) - (a-b)*x_z*y_z*r[f], hint='separable_Integral') return [Eq(x(t), sol1), Eq(y(t), sol2), Eq(z(t), sol3)] def _nonlinear_3eq_order1_type3(x, y, z, t, eq): r""" Equations: .. math:: x' = c F_2 - b F_3, \enspace y' = a F_3 - c F_1, \enspace z' = b F_1 - a F_2 where `F_n = F_n(x, y, z, t)`. 1. First Integral: .. math:: a x + b y + c z = C_1, where C is an arbitrary constant. 2. If we assume function `F_n` to be independent of `t`,i.e, `F_n` = `F_n (x, y, z)` Then, on eliminating `t` and `z` from the first two equation of the system, one arrives at the first-order equation .. math:: \frac{dy}{dx} = \frac{a F_3 (x, y, z) - c F_1 (x, y, z)}{c F_2 (x, y, z) - b F_3 (x, y, z)} where `z = \frac{1}{c} (C_1 - a x - b y)` References ========== -http://eqworld.ipmnet.ru/en/solutions/sysode/sode0404.pdf """ C1 = get_numbered_constants(eq, num=1) u, v, w = symbols('u, v, w') p = Wild('p', exclude=[x(t), y(t), z(t), t]) q = Wild('q', exclude=[x(t), y(t), z(t), t]) s = Wild('s', exclude=[x(t), y(t), z(t), t]) F1, F2, F3 = symbols('F1, F2, F3', cls=Wild) r1 = (diff(x(t),t) - eq[0]).match(F2-F3) r = collect_const(r1[F2]).match(s*F2) r.update(collect_const(r1[F3]).match(q*F3)) if eq[1].has(r[F2]) and not eq[1].has(r[F3]): r[F2], r[F3] = r[F3], r[F2] r[s], r[q] = -r[q], -r[s] r.update((diff(y(t),t) - eq[1]).match(p*r[F3] - r[s]*F1)) a = r[p]; b = r[q]; c = r[s] F1 = r[F1].subs(x(t),u).subs(y(t),v).subs(z(t),w) F2 = r[F2].subs(x(t),u).subs(y(t),v).subs(z(t),w) F3 = r[F3].subs(x(t),u).subs(y(t),v).subs(z(t),w) z_xy = (C1-a*u-b*v)/c y_zx = (C1-a*u-c*w)/b x_yz = (C1-b*v-c*w)/a y_x = dsolve(diff(v(u),u) - ((a*F3-c*F1)/(c*F2-b*F3)).subs(w,z_xy).subs(v,v(u))).rhs z_x = dsolve(diff(w(u),u) - ((b*F1-a*F2)/(c*F2-b*F3)).subs(v,y_zx).subs(w,w(u))).rhs z_y = dsolve(diff(w(v),v) - ((b*F1-a*F2)/(a*F3-c*F1)).subs(u,x_yz).subs(w,w(v))).rhs x_y = dsolve(diff(u(v),v) - ((c*F2-b*F3)/(a*F3-c*F1)).subs(w,z_xy).subs(u,u(v))).rhs y_z = dsolve(diff(v(w),w) - ((a*F3-c*F1)/(b*F1-a*F2)).subs(u,x_yz).subs(v,v(w))).rhs x_z = dsolve(diff(u(w),w) - ((c*F2-b*F3)/(b*F1-a*F2)).subs(v,y_zx).subs(u,u(w))).rhs sol1 = dsolve(diff(u(t),t) - (c*F2 - b*F3).subs(v,y_x).subs(w,z_x).subs(u,u(t))).rhs sol2 = dsolve(diff(v(t),t) - (a*F3 - c*F1).subs(u,x_y).subs(w,z_y).subs(v,v(t))).rhs sol3 = dsolve(diff(w(t),t) - (b*F1 - a*F2).subs(u,x_z).subs(v,y_z).subs(w,w(t))).rhs return [Eq(x(t), sol1), Eq(y(t), sol2), Eq(z(t), sol3)] def _nonlinear_3eq_order1_type4(x, y, z, t, eq): r""" Equations: .. math:: x' = c z F_2 - b y F_3, \enspace y' = a x F_3 - c z F_1, \enspace z' = b y F_1 - a x F_2 where `F_n = F_n (x, y, z, t)` 1. First integral: .. math:: a x^{2} + b y^{2} + c z^{2} = C_1 where `C` is an arbitrary constant. 2. Assuming the function `F_n` is independent of `t`: `F_n = F_n (x, y, z)`. Then on eliminating `t` and `z` from the first two equations of the system, one arrives at the first-order equation .. math:: \frac{dy}{dx} = \frac{a x F_3 (x, y, z) - c z F_1 (x, y, z)} {c z F_2 (x, y, z) - b y F_3 (x, y, z)} where `z = \pm \sqrt{\frac{1}{c} (C_1 - a x^{2} - b y^{2})}` References ========== -http://eqworld.ipmnet.ru/en/solutions/sysode/sode0405.pdf """ C1 = get_numbered_constants(eq, num=1) u, v, w = symbols('u, v, w') p = Wild('p', exclude=[x(t), y(t), z(t), t]) q = Wild('q', exclude=[x(t), y(t), z(t), t]) s = Wild('s', exclude=[x(t), y(t), z(t), t]) F1, F2, F3 = symbols('F1, F2, F3', cls=Wild) r1 = eq[0].match(diff(x(t),t) - z(t)*F2 + y(t)*F3) r = collect_const(r1[F2]).match(s*F2) r.update(collect_const(r1[F3]).match(q*F3)) if eq[1].has(r[F2]) and not eq[1].has(r[F3]): r[F2], r[F3] = r[F3], r[F2] r[s], r[q] = -r[q], -r[s] r.update((diff(y(t),t) - eq[1]).match(p*x(t)*r[F3] - r[s]*z(t)*F1)) a = r[p]; b = r[q]; c = r[s] F1 = r[F1].subs(x(t),u).subs(y(t),v).subs(z(t),w) F2 = r[F2].subs(x(t),u).subs(y(t),v).subs(z(t),w) F3 = r[F3].subs(x(t),u).subs(y(t),v).subs(z(t),w) x_yz = sqrt((C1 - b*v**2 - c*w**2)/a) y_zx = sqrt((C1 - c*w**2 - a*u**2)/b) z_xy = sqrt((C1 - a*u**2 - b*v**2)/c) y_x = dsolve(diff(v(u),u) - ((a*u*F3-c*w*F1)/(c*w*F2-b*v*F3)).subs(w,z_xy).subs(v,v(u))).rhs z_x = dsolve(diff(w(u),u) - ((b*v*F1-a*u*F2)/(c*w*F2-b*v*F3)).subs(v,y_zx).subs(w,w(u))).rhs z_y = dsolve(diff(w(v),v) - ((b*v*F1-a*u*F2)/(a*u*F3-c*w*F1)).subs(u,x_yz).subs(w,w(v))).rhs x_y = dsolve(diff(u(v),v) - ((c*w*F2-b*v*F3)/(a*u*F3-c*w*F1)).subs(w,z_xy).subs(u,u(v))).rhs y_z = dsolve(diff(v(w),w) - ((a*u*F3-c*w*F1)/(b*v*F1-a*u*F2)).subs(u,x_yz).subs(v,v(w))).rhs x_z = dsolve(diff(u(w),w) - ((c*w*F2-b*v*F3)/(b*v*F1-a*u*F2)).subs(v,y_zx).subs(u,u(w))).rhs sol1 = dsolve(diff(u(t),t) - (c*w*F2 - b*v*F3).subs(v,y_x).subs(w,z_x).subs(u,u(t))).rhs sol2 = dsolve(diff(v(t),t) - (a*u*F3 - c*w*F1).subs(u,x_y).subs(w,z_y).subs(v,v(t))).rhs sol3 = dsolve(diff(w(t),t) - (b*v*F1 - a*u*F2).subs(u,x_z).subs(v,y_z).subs(w,w(t))).rhs return [Eq(x(t), sol1), Eq(y(t), sol2), Eq(z(t), sol3)] def _nonlinear_3eq_order1_type5(x, y, t, eq): r""" .. math:: x' = x (c F_2 - b F_3), \enspace y' = y (a F_3 - c F_1), \enspace z' = z (b F_1 - a F_2) where `F_n = F_n (x, y, z, t)` and are arbitrary functions. First Integral: .. math:: \left|x\right|^{a} \left|y\right|^{b} \left|z\right|^{c} = C_1 where `C` is an arbitrary constant. If the function `F_n` is independent of `t`, then, by eliminating `t` and `z` from the first two equations of the system, one arrives at a first-order equation. References ========== -http://eqworld.ipmnet.ru/en/solutions/sysode/sode0406.pdf """ C1 = get_numbered_constants(eq, num=1) u, v, w = symbols('u, v, w') p = Wild('p', exclude=[x(t), y(t), z(t), t]) q = Wild('q', exclude=[x(t), y(t), z(t), t]) s = Wild('s', exclude=[x(t), y(t), z(t), t]) F1, F2, F3 = symbols('F1, F2, F3', cls=Wild) r1 = eq[0].match(diff(x(t),t) - x(t)*(F2 - F3)) r = collect_const(r1[F2]).match(s*F2) r.update(collect_const(r1[F3]).match(q*F3)) if eq[1].has(r[F2]) and not eq[1].has(r[F3]): r[F2], r[F3] = r[F3], r[F2] r[s], r[q] = -r[q], -r[s] r.update((diff(y(t),t) - eq[1]).match(y(t)*(a*r[F3] - r[c]*F1))) a = r[p]; b = r[q]; c = r[s] F1 = r[F1].subs(x(t),u).subs(y(t),v).subs(z(t),w) F2 = r[F2].subs(x(t),u).subs(y(t),v).subs(z(t),w) F3 = r[F3].subs(x(t),u).subs(y(t),v).subs(z(t),w) x_yz = (C1*v**-b*w**-c)**-a y_zx = (C1*w**-c*u**-a)**-b z_xy = (C1*u**-a*v**-b)**-c y_x = dsolve(diff(v(u),u) - ((v*(a*F3-c*F1))/(u*(c*F2-b*F3))).subs(w,z_xy).subs(v,v(u))).rhs z_x = dsolve(diff(w(u),u) - ((w*(b*F1-a*F2))/(u*(c*F2-b*F3))).subs(v,y_zx).subs(w,w(u))).rhs z_y = dsolve(diff(w(v),v) - ((w*(b*F1-a*F2))/(v*(a*F3-c*F1))).subs(u,x_yz).subs(w,w(v))).rhs x_y = dsolve(diff(u(v),v) - ((u*(c*F2-b*F3))/(v*(a*F3-c*F1))).subs(w,z_xy).subs(u,u(v))).rhs y_z = dsolve(diff(v(w),w) - ((v*(a*F3-c*F1))/(w*(b*F1-a*F2))).subs(u,x_yz).subs(v,v(w))).rhs x_z = dsolve(diff(u(w),w) - ((u*(c*F2-b*F3))/(w*(b*F1-a*F2))).subs(v,y_zx).subs(u,u(w))).rhs sol1 = dsolve(diff(u(t),t) - (u*(c*F2-b*F3)).subs(v,y_x).subs(w,z_x).subs(u,u(t))).rhs sol2 = dsolve(diff(v(t),t) - (v*(a*F3-c*F1)).subs(u,x_y).subs(w,z_y).subs(v,v(t))).rhs sol3 = dsolve(diff(w(t),t) - (w*(b*F1-a*F2)).subs(u,x_z).subs(v,y_z).subs(w,w(t))).rhs return [Eq(x(t), sol1), Eq(y(t), sol2), Eq(z(t), sol3)]
bsd-3-clause
t00m/KB4IT
setup.py
1
2639
#!/usr/bin/python3 # -*- coding: utf-8 -*- """ Setup KB4IT project. # File: setup.py. # Author: Tomás Vírseda # License: GPL v3 # Description: setup.py tells you that the module/package you are about # to install has been packaged and distributed with Distutils, which is # the standard for distributing Python Modules. """ import os import glob from setuptools import setup from kb4it.core.env import APP with open('pypi/README.rst', 'r') as f: LONG_DESCRIPTION = f.read() def add_data(root_data): """Add data files from a given directory.""" dir_files = [] resdirs = set() for root, dirs, files in os.walk(root_data): resdirs.add(os.path.realpath(root)) resdirs.remove(os.path.realpath(root_data)) for directory in resdirs: files = glob.glob(directory+'/*') relfiles = [] for thisfile in files: if not os.path.isdir(thisfile): relfiles.append(os.path.relpath(thisfile)) num_files = len(files) if num_files > 0: dir_files.append((os.path.relpath(directory), relfiles)) return dir_files DATA_FILES = add_data('kb4it/resources') setup( name=APP['shortname'], version=APP['version'], author=APP['author'], author_email=APP['author_email'], url=APP['website'], description='A static website generator based on Asciidoctor sources.', long_description=LONG_DESCRIPTION, download_url='https://github.com/t00m/KB4IT/archive/master.zip', license=APP['license'], packages=['kb4it', 'kb4it.core', 'kb4it.services'], # distutils does not support install_requires, but pip needs it to be # able to automatically install dependencies install_requires=['mako==1.1.3'], include_package_data=True, data_files=DATA_FILES, zip_safe=False, platforms='any', classifiers=[ 'Development Status :: 4 - Beta', 'Environment :: Console', 'Environment :: Web Environment', 'Intended Audience :: Developers', 'Intended Audience :: Information Technology', 'Intended Audience :: System Administrators', 'Intended Audience :: Other Audience', 'License :: OSI Approved :: GNU General Public License v3 or later (GPLv3+)', 'Natural Language :: English', 'Operating System :: POSIX :: Linux', 'Programming Language :: Python :: 3', 'Topic :: Documentation', 'Topic :: Software Development :: Documentation', 'Topic :: Utilities' ], entry_points={ 'console_scripts': [ 'kb4it = kb4it.kb4it:main', ], }, )
gpl-3.0
sarantapichos/faircoop-market
addons/purchase/partner.py
210
2566
# -*- coding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2004-2010 Tiny SPRL (<http://tiny.be>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## from openerp.osv import fields, osv class res_partner(osv.osv): _name = 'res.partner' _inherit = 'res.partner' def _purchase_invoice_count(self, cr, uid, ids, field_name, arg, context=None): PurchaseOrder = self.pool['purchase.order'] Invoice = self.pool['account.invoice'] return { partner_id: { 'purchase_order_count': PurchaseOrder.search_count(cr,uid, [('partner_id', 'child_of', partner_id)], context=context), 'supplier_invoice_count': Invoice.search_count(cr,uid, [('partner_id', 'child_of', partner_id), ('type','=','in_invoice')], context=context) } for partner_id in ids } def _commercial_fields(self, cr, uid, context=None): return super(res_partner, self)._commercial_fields(cr, uid, context=context) + ['property_product_pricelist_purchase'] _columns = { 'property_product_pricelist_purchase': fields.property( type='many2one', relation='product.pricelist', domain=[('type','=','purchase')], string="Purchase Pricelist", help="This pricelist will be used, instead of the default one, for purchases from the current partner"), 'purchase_order_count': fields.function(_purchase_invoice_count, string='# of Purchase Order', type='integer', multi="count"), 'supplier_invoice_count': fields.function(_purchase_invoice_count, string='# Supplier Invoices', type='integer', multi="count"), } # vim:expandtab:smartindent:tabstop=4:softtabstop=4:shiftwidth=4:
agpl-3.0
bnoi/scikit-tracker
sktracker/detection/tests/test_nuclei_detector.py
1
2695
# -*- coding: utf-8 -*- from __future__ import unicode_literals from __future__ import division from __future__ import absolute_import from __future__ import print_function import os from sktracker import data from sktracker.io import StackIO from sktracker.detection import nuclei_detector from nose import with_setup def setup(): global stack_iter global metadata image_path_list = data.stack_list() metadata = {"PhysicalSizeX": 0.42, "PhysicalSizeY": 0.42, "PhysicalSizeZ": 1.5, "TimeIncrement": 3, "FileName": '', "Shape": [1, 1, 512, 512], "DimensionOrder": "TZYX"} metadata['FileName'] = image_path_list[0] stack_io = StackIO(image_path_list=image_path_list, metadata=metadata) im0 = stack_io.get_tif().asarray() correct_metadata = {'FileName': os.path.basename(image_path_list[0]), 'SizeX': im0.shape[2], 'SizeY': im0.shape[1], 'SizeZ': im0.shape[0], 'SizeT': len(image_path_list), 'Shape': (len(image_path_list), im0.shape[2], im0.shape[1], im0.shape[0])} stack_io.metadata.update(correct_metadata) metadata = stack_io.metadata stack_iter = stack_io.list_iterator() @with_setup(setup) def test_nuclei_detector_naive(): parameters = {'segment_method': 'naive', 'correction': 0.1, 'nuc_distance': 2., 'min_z_size': 0.} cell_positions = nuclei_detector(stack_iter(), metadata=metadata, parameters=parameters) assert cell_positions.shape == (11, 6) @with_setup(setup) def test_nuclei_detector_otsu(): parameters = {'segment_method': 'otsu', 'correction': 0.7, 'nuc_distance': 2., 'min_z_size': 0.} cell_positions = nuclei_detector(stack_iter(), metadata=metadata, parameters=parameters) assert cell_positions.shape == (9, 6) @with_setup(setup) def test_nuclei_detector_none(): parameters = {'segment_method': 'naive', 'correction': 1., 'min_z_size': 100} cell_positions = nuclei_detector(stack_iter(), metadata=metadata, parameters=parameters) assert cell_positions.empty is True
bsd-3-clause
anbangr/trusted-nova
nova/scheduler/host_manager.py
7
13254
# Copyright (c) 2011 OpenStack, LLC. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ Manage hosts in the current zone. """ import datetime import UserDict from nova import db from nova import exception from nova import flags from nova import log as logging from nova.openstack.common import cfg from nova.scheduler import filters from nova import utils host_manager_opts = [ cfg.IntOpt('reserved_host_disk_mb', default=0, help='Amount of disk in MB to reserve for host/dom0'), cfg.IntOpt('reserved_host_memory_mb', default=512, help='Amount of memory in MB to reserve for host/dom0'), cfg.MultiStrOpt('scheduler_available_filters', default=['nova.scheduler.filters.standard_filters'], help='Filter classes available to the scheduler which may ' 'be specified more than once. An entry of ' '"nova.scheduler.filters.standard_filters" ' 'maps to all filters included with nova.'), cfg.ListOpt('scheduler_default_filters', default=[ 'AvailabilityZoneFilter', 'RamFilter', 'ComputeFilter' ], help='Which filter class names to use for filtering hosts ' 'when not specified in the request.'), ] FLAGS = flags.FLAGS FLAGS.register_opts(host_manager_opts) LOG = logging.getLogger(__name__) class ReadOnlyDict(UserDict.IterableUserDict): """A read-only dict.""" def __init__(self, source=None): self.data = {} self.update(source) def __setitem__(self, key, item): raise TypeError def __delitem__(self, key): raise TypeError def clear(self): raise TypeError def pop(self, key, *args): raise TypeError def popitem(self): raise TypeError def update(self, source=None): if source is None: return elif isinstance(source, UserDict.UserDict): self.data = source.data elif isinstance(source, type({})): self.data = source else: raise TypeError class HostState(object): """Mutable and immutable information tracked for a host. This is an attempt to remove the ad-hoc data structures previously used and lock down access. """ def __init__(self, host, topic, capabilities=None, service=None): self.host = host self.topic = topic # Read-only capability dicts if capabilities is None: capabilities = {} self.capabilities = ReadOnlyDict(capabilities.get(topic, None)) if service is None: service = {} self.service = ReadOnlyDict(service) # Mutable available resources. # These will change as resources are virtually "consumed". self.free_ram_mb = 0 self.free_disk_mb = 0 self.vcpus_total = 0 self.vcpus_used = 0 def update_from_compute_node(self, compute): """Update information about a host from its compute_node info.""" all_disk_mb = compute['local_gb'] * 1024 all_ram_mb = compute['memory_mb'] vcpus_total = compute['vcpus'] if FLAGS.reserved_host_disk_mb > 0: all_disk_mb -= FLAGS.reserved_host_disk_mb if FLAGS.reserved_host_memory_mb > 0: all_ram_mb -= FLAGS.reserved_host_memory_mb self.free_ram_mb = all_ram_mb self.free_disk_mb = all_disk_mb self.vcpus_total = vcpus_total def consume_from_instance(self, instance): """Update information about a host from instance info.""" disk_mb = (instance['root_gb'] + instance['ephemeral_gb']) * 1024 ram_mb = instance['memory_mb'] vcpus = instance['vcpus'] self.free_ram_mb -= ram_mb self.free_disk_mb -= disk_mb self.vcpus_used += vcpus def passes_filters(self, filter_fns, filter_properties): """Return whether or not this host passes filters.""" if self.host in filter_properties.get('ignore_hosts', []): LOG.debug(_('Host filter fails for ignored host %(host)s'), {'host': self.host}) return False force_hosts = filter_properties.get('force_hosts', []) if force_hosts: if not self.host in force_hosts: LOG.debug(_('Host filter fails for non-forced host %(host)s'), {'host': self.host}) return self.host in force_hosts for filter_fn in filter_fns: if not filter_fn(self, filter_properties): LOG.debug(_('Host filter function %(func)s failed for ' '%(host)s'), {'func': repr(filter_fn), 'host': self.host}) return False LOG.debug(_('Host filter passes for %(host)s'), {'host': self.host}) return True def __repr__(self): return ("host '%s': free_ram_mb:%s free_disk_mb:%s" % (self.host, self.free_ram_mb, self.free_disk_mb)) class HostManager(object): """Base HostManager class.""" # Can be overriden in a subclass host_state_cls = HostState def __init__(self): self.service_states = {} # { <host> : { <service> : { cap k : v }}} self.filter_classes = filters.get_filter_classes( FLAGS.scheduler_available_filters) def _choose_host_filters(self, filters): """Since the caller may specify which filters to use we need to have an authoritative list of what is permissible. This function checks the filter names against a predefined set of acceptable filters. """ if filters is None: filters = FLAGS.scheduler_default_filters if not isinstance(filters, (list, tuple)): filters = [filters] good_filters = [] bad_filters = [] for filter_name in filters: found_class = False for cls in self.filter_classes: if cls.__name__ == filter_name: found_class = True filter_instance = cls() # Get the filter function filter_func = getattr(filter_instance, 'host_passes', None) if filter_func: good_filters.append(filter_func) break if not found_class: bad_filters.append(filter_name) if bad_filters: msg = ", ".join(bad_filters) raise exception.SchedulerHostFilterNotFound(filter_name=msg) return good_filters def filter_hosts(self, hosts, filter_properties, filters=None): """Filter hosts and return only ones passing all filters""" filtered_hosts = [] filter_fns = self._choose_host_filters(filters) for host in hosts: if host.passes_filters(filter_fns, filter_properties): filtered_hosts.append(host) return filtered_hosts def get_host_list(self): """Returns a list of dicts for each host that the Zone Manager knows about. Each dict contains the host_name and the service for that host. """ all_hosts = self.service_states.keys() ret = [] for host in self.service_states: for svc in self.service_states[host]: ret.append({"service": svc, "host_name": host}) return ret def get_service_capabilities(self): """Roll up all the individual host info to generic 'service' capabilities. Each capability is aggregated into <cap>_min and <cap>_max values.""" hosts_dict = self.service_states # TODO(sandy) - be smarter about fabricating this structure. # But it's likely to change once we understand what the Best-Match # code will need better. combined = {} # { <service>_<cap> : (min, max), ... } stale_host_services = {} # { host1 : [svc1, svc2], host2 :[svc1]} for host, host_dict in hosts_dict.iteritems(): for service_name, service_dict in host_dict.iteritems(): if not service_dict.get("enabled", True): # Service is disabled; do no include it continue # Check if the service capabilities became stale if self.host_service_caps_stale(host, service_name): if host not in stale_host_services: stale_host_services[host] = [] # Adding host key once stale_host_services[host].append(service_name) continue for cap, value in service_dict.iteritems(): if cap == "timestamp": # Timestamp is not needed continue key = "%s_%s" % (service_name, cap) min_value, max_value = combined.get(key, (value, value)) min_value = min(min_value, value) max_value = max(max_value, value) combined[key] = (min_value, max_value) # Delete the expired host services self.delete_expired_host_services(stale_host_services) return combined def update_service_capabilities(self, service_name, host, capabilities): """Update the per-service capabilities based on this notification.""" LOG.debug(_("Received %(service_name)s service update from " "%(host)s.") % locals()) service_caps = self.service_states.get(host, {}) # Copy the capabilities, so we don't modify the original dict capab_copy = dict(capabilities) capab_copy["timestamp"] = utils.utcnow() # Reported time service_caps[service_name] = capab_copy self.service_states[host] = service_caps def host_service_caps_stale(self, host, service): """Check if host service capabilites are not recent enough.""" allowed_time_diff = FLAGS.periodic_interval * 3 caps = self.service_states[host][service] if ((utils.utcnow() - caps["timestamp"]) <= datetime.timedelta(seconds=allowed_time_diff)): return False return True def delete_expired_host_services(self, host_services_dict): """Delete all the inactive host services information.""" for host, services in host_services_dict.iteritems(): service_caps = self.service_states[host] for service in services: del service_caps[service] if len(service_caps) == 0: # Delete host if no services del self.service_states[host] def get_all_host_states(self, context, topic): """Returns a dict of all the hosts the HostManager knows about. Also, each of the consumable resources in HostState are pre-populated and adjusted based on data in the db. For example: {'192.168.1.100': HostState(), ...} Note: this can be very slow with a lot of instances. InstanceType table isn't required since a copy is stored with the instance (in case the InstanceType changed since the instance was created).""" if topic != 'compute': raise NotImplementedError(_( "host_manager only implemented for 'compute'")) host_state_map = {} # Make a compute node dict with the bare essential metrics. compute_nodes = db.compute_node_get_all(context) for compute in compute_nodes: service = compute['service'] if not service: LOG.warn(_("No service for compute ID %s") % compute['id']) continue host = service['host'] capabilities = self.service_states.get(host, None) host_state = self.host_state_cls(host, topic, capabilities=capabilities, service=dict(service.iteritems())) host_state.update_from_compute_node(compute) host_state_map[host] = host_state # "Consume" resources from the host the instance resides on. instances = db.instance_get_all(context) for instance in instances: host = instance['host'] if not host: continue host_state = host_state_map.get(host, None) if not host_state: continue host_state.consume_from_instance(instance) return host_state_map
apache-2.0
zhujzhuo/Sahara
sahara/service/edp/binary_retrievers/internal_swift.py
10
3423
# Copyright (c) 2013 Mirantis Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or # implied. # See the License for the specific language governing permissions and # limitations under the License. import functools from oslo_config import cfg import six import swiftclient import sahara.context as context import sahara.exceptions as ex from sahara.i18n import _ from sahara.swift import utils as su from sahara.utils.openstack import swift as sw CONF = cfg.CONF def _get_names_from_url(url): parse = six.moves.urllib.parse.urlparse(url) return (parse.netloc + parse.path).split('/', 1) def _get_raw_data(job_binary, conn): names = _get_names_from_url(job_binary.url) container, obj = names # if container name has '.sahara' suffix we need to strip it if container.endswith(su.SWIFT_URL_SUFFIX): container = container[:-len(su.SWIFT_URL_SUFFIX)] try: # First check the size headers = conn.head_object(container, obj) total_KB = int(headers.get('content-length', 0)) / 1024.0 if total_KB > CONF.job_binary_max_KB: raise ex.DataTooBigException( round(total_KB, 1), CONF.job_binary_max_KB, _("Size of swift object (%(size)sKB) is greater " "than maximum (%(maximum)sKB)")) headers, body = conn.get_object(container, obj) except swiftclient.ClientException as e: raise ex.SwiftClientException(six.text_type(e)) return body def _validate_job_binary_url(f): @functools.wraps(f) def wrapper(job_binary, *args, **kwargs): if not (job_binary.url.startswith(su.SWIFT_INTERNAL_PREFIX)): # This should have been guaranteed already, # but we'll check just in case. raise ex.BadJobBinaryException( _("Url for binary in internal swift must start with %s") % su.SWIFT_INTERNAL_PREFIX) names = _get_names_from_url(job_binary.url) if len(names) == 1: # a container has been requested, this is currently unsupported raise ex.BadJobBinaryException( _('Url for binary in internal swift must specify an object ' 'not a container')) return f(job_binary, *args, **kwargs) return wrapper @_validate_job_binary_url def get_raw_data(job_binary, proxy_configs=None): conn_kwargs = {} if proxy_configs: conn_kwargs.update(username=proxy_configs.get('proxy_username'), password=proxy_configs.get('proxy_password'), trust_id=proxy_configs.get('proxy_trust_id')) else: conn_kwargs.update(username=job_binary.extra.get('user'), password=job_binary.extra.get('password')) conn = sw.client(**conn_kwargs) return _get_raw_data(job_binary, conn) @_validate_job_binary_url def get_raw_data_with_context(job_binary): conn = sw.client_from_token(context.ctx().auth_token) return _get_raw_data(job_binary, conn)
apache-2.0
leki75/ansible
lib/ansible/module_utils/database.py
108
5859
# This code is part of Ansible, but is an independent component. # This particular file snippet, and this file snippet only, is BSD licensed. # Modules you write using this snippet, which is embedded dynamically by Ansible # still belong to the author of the module, and may assign their own license # to the complete work. # # Copyright (c) 2014, Toshio Kuratomi <tkuratomi@ansible.com> # All rights reserved. # # Redistribution and use in source and binary forms, with or without modification, # are permitted provided that the following conditions are met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND # ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED # WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. # IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, # INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, # PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS # INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT # LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE # USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. class SQLParseError(Exception): pass class UnclosedQuoteError(SQLParseError): pass # maps a type of identifier to the maximum number of dot levels that are # allowed to specify that identifier. For example, a database column can be # specified by up to 4 levels: database.schema.table.column _PG_IDENTIFIER_TO_DOT_LEVEL = dict(database=1, schema=2, table=3, column=4, role=1) _MYSQL_IDENTIFIER_TO_DOT_LEVEL = dict(database=1, table=2, column=3, role=1, vars=1) def _find_end_quote(identifier, quote_char): accumulate = 0 while True: try: quote = identifier.index(quote_char) except ValueError: raise UnclosedQuoteError accumulate = accumulate + quote try: next_char = identifier[quote + 1] except IndexError: return accumulate if next_char == quote_char: try: identifier = identifier[quote + 2:] accumulate = accumulate + 2 except IndexError: raise UnclosedQuoteError else: return accumulate def _identifier_parse(identifier, quote_char): if not identifier: raise SQLParseError('Identifier name unspecified or unquoted trailing dot') already_quoted = False if identifier.startswith(quote_char): already_quoted = True try: end_quote = _find_end_quote(identifier[1:], quote_char=quote_char) + 1 except UnclosedQuoteError: already_quoted = False else: if end_quote < len(identifier) - 1: if identifier[end_quote + 1] == '.': dot = end_quote + 1 first_identifier = identifier[:dot] next_identifier = identifier[dot + 1:] further_identifiers = _identifier_parse(next_identifier, quote_char) further_identifiers.insert(0, first_identifier) else: raise SQLParseError('User escaped identifiers must escape extra quotes') else: further_identifiers = [identifier] if not already_quoted: try: dot = identifier.index('.') except ValueError: identifier = identifier.replace(quote_char, quote_char * 2) identifier = ''.join((quote_char, identifier, quote_char)) further_identifiers = [identifier] else: if dot == 0 or dot >= len(identifier) - 1: identifier = identifier.replace(quote_char, quote_char * 2) identifier = ''.join((quote_char, identifier, quote_char)) further_identifiers = [identifier] else: first_identifier = identifier[:dot] next_identifier = identifier[dot + 1:] further_identifiers = _identifier_parse(next_identifier, quote_char) first_identifier = first_identifier.replace(quote_char, quote_char * 2) first_identifier = ''.join((quote_char, first_identifier, quote_char)) further_identifiers.insert(0, first_identifier) return further_identifiers def pg_quote_identifier(identifier, id_type): identifier_fragments = _identifier_parse(identifier, quote_char='"') if len(identifier_fragments) > _PG_IDENTIFIER_TO_DOT_LEVEL[id_type]: raise SQLParseError('PostgreSQL does not support %s with more than %i dots' % (id_type, _PG_IDENTIFIER_TO_DOT_LEVEL[id_type])) return '.'.join(identifier_fragments) def mysql_quote_identifier(identifier, id_type): identifier_fragments = _identifier_parse(identifier, quote_char='`') if len(identifier_fragments) > _MYSQL_IDENTIFIER_TO_DOT_LEVEL[id_type]: raise SQLParseError('MySQL does not support %s with more than %i dots' % (id_type, _MYSQL_IDENTIFIER_TO_DOT_LEVEL[id_type])) special_cased_fragments = [] for fragment in identifier_fragments: if fragment == '`*`': special_cased_fragments.append('*') else: special_cased_fragments.append(fragment) return '.'.join(special_cased_fragments)
gpl-3.0
aam-at/tensorflow
tensorflow/python/eager/def_function_xla_jit_test.py
2
22355
# Copyright 2019 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== from __future__ import absolute_import from __future__ import division from __future__ import print_function from tensorflow.compiler.tests import xla_test from tensorflow.python.eager import backprop from tensorflow.python.eager import context from tensorflow.python.eager import def_function from tensorflow.python.framework import constant_op from tensorflow.python.framework import dtypes from tensorflow.python.framework import errors from tensorflow.python.framework import ops from tensorflow.python.framework import test_util from tensorflow.python.ops import array_ops from tensorflow.python.ops import control_flow_ops from tensorflow.python.ops import control_flow_util from tensorflow.python.ops import math_ops from tensorflow.python.ops import random_ops from tensorflow.python.ops import resource_variable_ops from tensorflow.python.ops import tensor_array_ops from tensorflow.python.ops import variables from tensorflow.python.platform import test class DefFunctionTest(xla_test.XLATestCase): def testAutoclusteringWithTfFunction(self): if 'tpu' in self.device.lower(): self.skipTest('Autoclustering does not run on TPU') with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=False) def outer(a, b, c): return a * inner(b, c) + c @def_function.function(experimental_compile=True) def inner(b, c): return b + c * b i1 = constant_op.constant([1.0, 2.0, 3.0, 4.0, 5.0]) i2 = constant_op.constant([1.0, 2.0, 3.0, 4.0, 5.0]) i3 = constant_op.constant([1.0, 2.0, 3.0, 4.0, 5.0]) with context.collect_graphs(optimized=True) as graphs: outer(i1, i2, i3) if test_util.is_xla_enabled(): self.assertIn('_XlaRun', [n.op for n in graphs[0].node]) else: self.assertNotIn('_XlaRun', [n.op for n in graphs[0].node]) def testBasic(self): with ops.device('device:{}:0'.format(self.device)): def fn(x, a): return x + a func = def_function.function(fn, experimental_compile=False) xla_func = def_function.function(fn, experimental_compile=True) inputs = constant_op.constant([1, 2, 2, 3, 3]) self.assertAllClose([2, 3, 3, 4, 4], func(inputs, 1)) self.assertAllClose([2, 3, 3, 4, 4], xla_func(inputs, 1)) def testBasicInt32(self): with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def fn(x, a): return x + a inputs = constant_op.constant([1, 2, 2, 3, 3], dtype=dtypes.int32) self.assertAllClose([2, 3, 3, 4, 4], fn(inputs, 1)) def testDerivative(self): with ops.device('device:{}:0'.format(self.device)): def fn(x, a): return 2 * x + a xla_func = def_function.function(fn, experimental_compile=True) with backprop.GradientTape() as tape: inputs = constant_op.constant([1., 2., 2., 3., 3.]) tape.watch(inputs) outputs = xla_func(inputs, 1) self.assertAllClose([2, 2, 2, 2, 2], tape.gradient(outputs, inputs)) # pylint: disable=protected-access (forward, backward) = xla_func.get_concrete_function( inputs, 1)._delayed_rewrite_functions.forward_backward() # Check that the must-compile attribute gets correctly propagated to the # created derivatives. self.assertTrue(backward.function_def.attr['_XlaMustCompile']) self.assertTrue(forward.definition.attr['_XlaMustCompile']) # Calling function with experimental_compile=True from # experimental_compile=False should compile the inner func. def testNestedCall(self): if 'tpu' in self.device.lower(): self.skipTest('b/162800687: Inner function runs on host') with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def fn(x, a): return x + a @def_function.function(experimental_compile=False) def fn2(x, a): return fn(x, a) inputs = constant_op.constant([1, 2, 2, 3, 3]) self.assertAllClose([2, 3, 3, 4, 4], fn2(inputs, 1)) @test_util.disable_mlir_bridge('TODO(b/162272821): MLIR bridge returns' ' wrong status type') def testNestedCallUnsupportedOps(self): with ops.device('device:{}:0'.format(self.device)): def fn(x): return array_ops.unique(x).y xla_func = def_function.function(fn, experimental_compile=True) def fn2(x): return xla_func(x) func = def_function.function(fn2, experimental_compile=False) inputs = constant_op.constant([1, 2, 2, 3, 3]) with self.assertRaisesRegex(errors.InvalidArgumentError, 'not compilable'): func(inputs) @test_util.disable_mlir_bridge('TODO(b/162272821): MLIR bridge returns' ' wrong status type') def testUnsupportedOps(self): with ops.device('device:{}:0'.format(self.device)): def fn(x): return array_ops.unique(x).y # Unique is not supported by XLA func = def_function.function(fn, experimental_compile=False) xla_func = def_function.function(fn, experimental_compile=True) inputs = constant_op.constant([1, 2, 2, 3, 3]) self.assertAllClose([1, 2, 3], func(inputs)) with self.assertRaisesRegex(errors.InvalidArgumentError, 'not compilable'): xla_func(inputs) def testFunctionGradient(self): with ops.device('device:{}:0'.format(self.device)): v = resource_variable_ops.ResourceVariable(2.0) def fn(x): return v * x func = def_function.function(fn, experimental_compile=False) xla_func = def_function.function(fn, experimental_compile=True) def run_and_check(test_func): x = constant_op.constant(3.0) with backprop.GradientTape() as tape: y = test_func(x) dy = tape.gradient(y, v) self.assertAllClose(6.0, y) self.assertAllClose(3.0, dy) run_and_check(func) run_and_check(xla_func) @test_util.disable_mlir_bridge('TODO(b/162521846): MLIR bridge fails' ' msan, function library not found') def testControlFlow(self): with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def f(x): assert control_flow_util.GraphOrParentsInXlaContext( ops.get_default_graph()) x = ops.convert_to_tensor(x) def body(i, a): return i + 1, control_flow_ops.cond(i > 2, lambda: a + (x**2), lambda: a + 3) return control_flow_ops.while_loop( lambda i, *_: i < 10, body, (constant_op.constant(0), constant_op.constant(3.)), maximum_iterations=10)[1] @def_function.function(experimental_compile=True) def g(x): x = ops.convert_to_tensor(x) with backprop.GradientTape() as tape: tape.watch(x) y = f(x) return y, tape.gradient(y, x) # Test that XLA context gets correctly propagated. g._get_concrete_function_garbage_collected(2.0)(2.0) self.assertAllClose(40.0, f(2.0)) self.assertAllClose([40.0, 28.0], g(2.0)) self.assertAllClose(40.0, f.get_concrete_function(2.0)(2.0)) self.assertAllClose([40.0, 28.0], g.get_concrete_function(2.0)(2.0)) def testMethodCompilation(self): with ops.device('device:{}:0'.format(self.device)): class C(object): @def_function.function(experimental_compile=True) def f1(self, x, a): return x + a inputs = constant_op.constant([1, 2, 2, 3, 3]) c = C() self.assertAllClose([2, 3, 3, 4, 4], c.f1(inputs, 1)) @test_util.disable_mlir_bridge('TODO(b/162272821): MLIR bridge returns ' ' wrong status type') def testMethodCompilationUnsupportedFunc(self): with ops.device('device:{}:0'.format(self.device)): class C(object): @def_function.function(experimental_compile=True) def f1(self, x): return array_ops.unique(x).y inputs = constant_op.constant([1, 2, 2, 3, 3]) c = C() with self.assertRaisesRegex(errors.InvalidArgumentError, 'not compilable'): c.f1(inputs) def testMustBeConstantPropagation(self): if 'tpu' in self.device.lower(): self.skipTest('b/162799319: Cannot resolve constant on TPU') with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def f(): return constant_op.constant([0, 2, 1], dtype=dtypes.int32) @def_function.function(experimental_compile=True) def g(a, b): return array_ops.transpose(a, b) @def_function.function def z(): return g(array_ops.ones([3, 4, 3], dtype=dtypes.float32), f()) z() @test_util.disable_mlir_bridge('TODO(b/162271237): argmax gives different' ' results in MLIR-based bridge') def testArgMinMax(self): with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def argmax(x): return math_ops.argmax(x) @def_function.function(experimental_compile=True) def argmin(x): return math_ops.argmin(x) self.assertAllClose(0, argmax(array_ops.ones([10], dtype=dtypes.float32))) self.assertAllClose(0, argmax(array_ops.ones([10]))) self.assertAllClose(0, argmin(array_ops.ones([10], dtype=dtypes.float32))) self.assertAllClose(0, argmin(array_ops.ones([10]))) @test_util.disable_mlir_bridge('TensorArray support not implemented') def testErrorMessagePassingTensorArray(self): with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def f(x): ta = tensor_array_ops.TensorArray( dtype=dtypes.float32, size=1, element_shape=[]) ta = ta.write(0, 2 * x) y = ta.read(0) return y x = constant_op.constant(3.14) with backprop.GradientTape() as tape: tape.watch(x) with self.assertRaisesRegex(errors.UnimplementedError, 'TensorList crossing the XLA/TF boundary'): y = f(x) tape.gradient(y, x) @test_util.disable_mlir_bridge('TODO(b/162281863): MLIR bridge errors out' ' lowering TensorListConcatV2') def testTensorListConcatV2(self): with ops.device('device:{}:0'.format(self.device)): def f(x): ta = tensor_array_ops.TensorArray( dtype=dtypes.float32, size=2, element_shape=[3]) ta = ta.write(0, 2 * x) ta = ta.write(1, 3 * x) return ta.concat() compiled_f = def_function.function(experimental_compile=True)(f) inputs = constant_op.constant([3.14, 2.68, 7.69]) self.assertAllClose([6.28, 5.36, 15.38, 9.42, 8.04, 23.07], f(inputs)) self.assertAllClose(compiled_f(inputs), f(inputs)) @test_util.disable_mlir_bridge('TODO(b/162281863): MLIR bridge errors out' ' lowering TensorListConcatV2') def testTensorListConcatV2Multidim(self): with ops.device('device:{}:0'.format(self.device)): def f(x): ta = tensor_array_ops.TensorArray( dtype=dtypes.float32, size=2, element_shape=[3, 2]) ta = ta.write(0, 2 * x) ta = ta.write(1, 3 * x) return ta.concat() compiled_f = def_function.function(experimental_compile=True)(f) inputs = constant_op.constant([[3.14, 21.1], [2.68, 22.2], [7.69, 23.3]]) self.assertAllClose(f(inputs), compiled_f(inputs)) @test_util.disable_mlir_bridge('TODO(b/162281863): MLIR bridge errors out' ' lowering TensorListConcatV2') def testTensorListConcatV2Scalars(self): with ops.device('device:{}:0'.format(self.device)): def f(x): ta = tensor_array_ops.TensorArray( dtype=dtypes.float32, size=2, element_shape=[1]) ta = ta.write(0, 2 * x) ta = ta.write(1, 3 * x) return ta.concat() compiled_f = def_function.function(experimental_compile=True)(f) inputs = constant_op.constant([3.14]) self.assertAllClose(f(inputs), compiled_f(inputs)) @test_util.disable_mlir_bridge('TODO(b/162281863): MLIR bridge errors out' ' lowering TensorListConcatV2') def testTensorListConcatGrad(self): with ops.device('device:{}:0'.format(self.device)): def f(x): ta = tensor_array_ops.TensorArray( dtype=dtypes.float32, size=2, element_shape=[3]) ta = ta.write(0, 2 * x) ta = ta.write(1, 3 * x) return ta.concat() def g(): x = constant_op.constant([3.14, 2.68, 7.69]) with backprop.GradientTape() as tape: tape.watch(x) y = f(x) return tape.gradient(y, x) compiled_g = def_function.function(experimental_compile=True)(g) self.assertAllClose([5.0, 5.0, 5.0], g()) self.assertAllClose(compiled_g(), g()) @test_util.disable_mlir_bridge('TODO(b/162281863): MLIR bridge errors out' ' lowering TensorListConcatV2') def testTensorListConcatGradNestedCompile(self): with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def f(x): ta = tensor_array_ops.TensorArray( dtype=dtypes.float32, size=2, element_shape=[3]) ta = ta.write(0, 2 * x) ta = ta.write(1, 3 * x) return ta.concat() @def_function.function(experimental_compile=True) def g(): x = constant_op.constant([3.14, 2.68, 7.69]) with backprop.GradientTape() as tape: tape.watch(x) y = f(x) out = tape.gradient(y, x) return out self.assertAllClose([5.0, 5.0, 5.0], g()) def testCumsum(self): if 'tpu' in self.device.lower(): self.skipTest('b/162771302: 64bit rewrite of cumsum not supported') with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def f(x): return math_ops.cumsum(x) f64_input = constant_op.constant([1.1, 2.2, 3.3], dtype=dtypes.float64) self.assertAllClose([1.1, 3.3, 6.6], f(f64_input)) def testNoExcessiveRetracing(self): with ops.device('device:{}:0'.format(self.device)): inner_retracings = 0 @def_function.function(experimental_compile=True) def inner(a, b): nonlocal inner_retracings inner_retracings += 1 return a * b + a def outer(a, b): return inner(a, b) func_input = random_ops.random_normal([10, 10]) for _ in range(2): def_function.function(outer)(func_input, func_input) self.assertEqual(inner_retracings, 1) def testUpdateVariable(self): with ops.device('device:{}:0'.format(self.device)): on_gpu = 'gpu' in self.device.lower() v = variables.Variable([3.1, 3.2]) @def_function.function(experimental_compile=True) def update_var(a, b): v.assign_add(a * b) arg1 = random_ops.random_normal([2]) arg2 = random_ops.random_normal([2]) initial_usage = context.context().get_total_memory_usage( v.device) if on_gpu else 0 update_var(arg1, arg2) final_usage = context.context().get_total_memory_usage( v.device) if on_gpu else 0 self.assertEqual(initial_usage, final_usage) @test_util.disable_mlir_bridge('TODO(b/162381930): MLIR bridge renames ' ' functions') def testUpdateVariableInClass(self): with ops.device('device:{}:0'.format(self.device)): class C(object): @def_function.function(experimental_compile=True) def update_var(self, a, b): if not hasattr(self, 'v'): self.v = variables.Variable(3.1) self.v.assign_add(a * b) c = C() @def_function.function def outer(): c.update_var(constant_op.constant(0.7), constant_op.constant(0.6)) outer() self.assertAllClose(c.v, 3.52) @test_util.disable_mlir_bridge('TODO(b/162801728): MLIR bridge causes ' ' invalid free on TPUs') def testUpdateVariableMultipleOutputs(self): with ops.device('device:{}:0'.format(self.device)): v = variables.Variable(3.1) @def_function.function(experimental_compile=True) def update_var(a, b): v.assign_add(a * b) return a * b + v out = update_var(constant_op.constant(0.7), constant_op.constant(0.6)) self.assertAllClose(v, 3.52) self.assertAllClose(out, 3.94) def testReturnIdentity(self): with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def f(a, b): return (a, b) a = random_ops.random_normal([10, 10]) b = random_ops.random_normal([10, 10]) on_gpu = 'gpu' in self.device.lower() initial_usage = context.context().get_total_memory_usage( b.backing_device) if on_gpu else 0 f(a, b) final_usage = context.context().get_total_memory_usage( b.backing_device) if on_gpu else 0 self.assertEqual(initial_usage, final_usage) def testGetCompilerIrConstants(self): if 'tpu' in self.device.lower(): self.skipTest('TPU generates different HLO') with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def f(a, b): return array_ops.transpose(a, b) a = array_ops.ones([3, 4, 3], dtype=dtypes.float32) b = constant_op.constant([0, 2, 1], dtype=dtypes.int32) self.assertIn('{1,2,0}', f.experimental_get_compiler_ir(a, b)(stage='optimized_hlo')) @test_util.disable_mlir_bridge('TODO(b/168732524): MLIR bridge does not ' ' optimize single-element tuples to scalars') def testGetCompilerIrResourceVars(self): with ops.device('device:{}:0'.format(self.device)): v = variables.Variable([3.1, 3.2]) @def_function.function(experimental_compile=True) def f(a, b): v.assign_add(a * b) a = random_ops.random_normal([2]) b = random_ops.random_normal([2]) self.assertIn('input_output_alias={ {}: (2, {}, may-alias) }', f.experimental_get_compiler_ir(a, b)('optimized_hlo')) def testGetCompilerIrNotCompiled(self): with ops.device('device:{}:0'.format(self.device)): @def_function.function def f(x): return x + 1 a = random_ops.random_normal([10, 10]) with self.assertRaisesRegex(ValueError, 'marked with experimental_compile'): f.experimental_get_compiler_ir(a)() def testGetCompilerIrNested(self): with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def fn(x, a): return x + a @def_function.function(experimental_compile=False) def fn2(x, a): fn.experimental_get_compiler_ir(x, a)() return fn(x, a) inputs = constant_op.constant([1, 2, 2, 3, 3]) with self.assertRaisesRegex(TypeError, '"Graph" tensor'): fn2(inputs, 1) def testGetCompilerIrKwargs(self): with ops.device('device:{}:0'.format(self.device)): v = variables.Variable([0.1, 0.1]) @def_function.function(experimental_compile=True) def f(a, b): return (a + b) * v a = constant_op.constant([1.1, 1.1]) b = constant_op.constant([2.2, 2.2]) self.assertIn('multiply', f.experimental_get_compiler_ir(b=a, a=b)(stage='hlo')) def testGetCompilerIrDot(self): with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def f(a, b): return a + b a = constant_op.constant([1.1, 1.1]) b = constant_op.constant([2.2, 2.2]) self.assertIn( 'label', f.experimental_get_compiler_ir(a, b)(stage='optimized_hlo_dot')) def testGetCompilerIrNoDevicePlacement(self): if 'gpu' not in self.device.lower(): self.skipTest('Testing get_compiler_ir on GPUs without placement') @def_function.function(experimental_compile=True) def f(a, b): return a + b a = constant_op.constant([1.1, 1.1]) b = constant_op.constant([2.2, 2.2]) self.assertIn( 'label', f.experimental_get_compiler_ir(a, b)(stage='optimized_hlo_dot')) def testGetCompilerIrNonTensors(self): with ops.device('device:{}:0'.format(self.device)): @def_function.function(experimental_compile=True) def f(l): return l[0] + l[1] l = [constant_op.constant(1.1), constant_op.constant(2.2)] self.assertIn('tuple', f.experimental_get_compiler_ir(l)()) def testConstantOnWrongDevice(self): with ops.device('device:{}:0'.format(self.device)): s = random_ops.random_uniform([2], 1, 10, dtypes.int32) l = random_ops.random_normal([s[0] * s[1]]) @def_function.function(experimental_compile=True) def f(l): return array_ops.reshape(l, s) self.assertIn('tuple', f.experimental_get_compiler_ir(l)()) if __name__ == '__main__': ops.enable_eager_execution() test.main()
apache-2.0
RAtechntukan/Sick-Beard
sickbeard/history.py
35
2768
# Author: Nic Wolfe <nic@wolfeden.ca> # URL: http://code.google.com/p/sickbeard/ # # This file is part of Sick Beard. # # Sick Beard is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Sick Beard is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Sick Beard. If not, see <http://www.gnu.org/licenses/>. import db import datetime from sickbeard.common import SNATCHED, SUBTITLED, Quality dateFormat = "%Y%m%d%H%M%S" def _logHistoryItem(action, showid, season, episode, quality, resource, provider): logDate = datetime.datetime.today().strftime(dateFormat) myDB = db.DBConnection() myDB.action("INSERT INTO history (action, date, showid, season, episode, quality, resource, provider) VALUES (?,?,?,?,?,?,?,?)", [action, logDate, showid, season, episode, quality, resource, provider]) def logSnatch(searchResult): for curEpObj in searchResult.episodes: showid = int(curEpObj.show.tvdbid) season = int(curEpObj.season) episode = int(curEpObj.episode) quality = searchResult.quality providerClass = searchResult.provider if providerClass != None: provider = providerClass.name else: provider = "unknown" action = Quality.compositeStatus(SNATCHED, searchResult.quality) resource = searchResult.name _logHistoryItem(action, showid, season, episode, quality, resource, provider) def logDownload(episode, filename, new_ep_quality, release_group=None): showid = int(episode.show.tvdbid) season = int(episode.season) epNum = int(episode.episode) quality = new_ep_quality # store the release group as the provider if possible if release_group: provider = release_group else: provider = -1 action = episode.status _logHistoryItem(action, showid, season, epNum, quality, filename, provider) def logSubtitle(showid, season, episode, status, subtitleResult): resource = subtitleResult.path provider = subtitleResult.service status, quality = Quality.splitCompositeStatus(status) action = Quality.compositeStatus(SUBTITLED, quality) _logHistoryItem(action, showid, season, episode, quality, resource, provider)
gpl-3.0
noscripter/edgessh
paramiko/message.py
21
8547
# Copyright (C) 2003-2007 Robey Pointer <robeypointer@gmail.com> # # This file is part of paramiko. # # Paramiko is free software; you can redistribute it and/or modify it under the # terms of the GNU Lesser General Public License as published by the Free # Software Foundation; either version 2.1 of the License, or (at your option) # any later version. # # Paramiko is distrubuted in the hope that it will be useful, but WITHOUT ANY # WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR # A PARTICULAR PURPOSE. See the GNU Lesser General Public License for more # details. # # You should have received a copy of the GNU Lesser General Public License # along with Paramiko; if not, write to the Free Software Foundation, Inc., # 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA. """ Implementation of an SSH2 "message". """ import struct import cStringIO from paramiko import util class Message (object): """ An SSH2 I{Message} is a stream of bytes that encodes some combination of strings, integers, bools, and infinite-precision integers (known in python as I{long}s). This class builds or breaks down such a byte stream. Normally you don't need to deal with anything this low-level, but it's exposed for people implementing custom extensions, or features that paramiko doesn't support yet. """ def __init__(self, content=None): """ Create a new SSH2 Message. @param content: the byte stream to use as the Message content (passed in only when decomposing a Message). @type content: string """ if content != None: self.packet = cStringIO.StringIO(content) else: self.packet = cStringIO.StringIO() def __str__(self): """ Return the byte stream content of this Message, as a string. @return: the contents of this Message. @rtype: string """ return self.packet.getvalue() def __repr__(self): """ Returns a string representation of this object, for debugging. @rtype: string """ return 'paramiko.Message(' + repr(self.packet.getvalue()) + ')' def rewind(self): """ Rewind the message to the beginning as if no items had been parsed out of it yet. """ self.packet.seek(0) def get_remainder(self): """ Return the bytes of this Message that haven't already been parsed and returned. @return: a string of the bytes not parsed yet. @rtype: string """ position = self.packet.tell() remainder = self.packet.read() self.packet.seek(position) return remainder def get_so_far(self): """ Returns the bytes of this Message that have been parsed and returned. The string passed into a Message's constructor can be regenerated by concatenating C{get_so_far} and L{get_remainder}. @return: a string of the bytes parsed so far. @rtype: string """ position = self.packet.tell() self.rewind() return self.packet.read(position) def get_bytes(self, n): """ Return the next C{n} bytes of the Message, without decomposing into an int, string, etc. Just the raw bytes are returned. @return: a string of the next C{n} bytes of the Message, or a string of C{n} zero bytes, if there aren't C{n} bytes remaining. @rtype: string """ b = self.packet.read(n) if len(b) < n: return b + '\x00' * (n - len(b)) return b def get_byte(self): """ Return the next byte of the Message, without decomposing it. This is equivalent to L{get_bytes(1)<get_bytes>}. @return: the next byte of the Message, or C{'\000'} if there aren't any bytes remaining. @rtype: string """ return self.get_bytes(1) def get_boolean(self): """ Fetch a boolean from the stream. @return: C{True} or C{False} (from the Message). @rtype: bool """ b = self.get_bytes(1) return b != '\x00' def get_int(self): """ Fetch an int from the stream. @return: a 32-bit unsigned integer. @rtype: int """ return struct.unpack('>I', self.get_bytes(4))[0] def get_int64(self): """ Fetch a 64-bit int from the stream. @return: a 64-bit unsigned integer. @rtype: long """ return struct.unpack('>Q', self.get_bytes(8))[0] def get_mpint(self): """ Fetch a long int (mpint) from the stream. @return: an arbitrary-length integer. @rtype: long """ return util.inflate_long(self.get_string()) def get_string(self): """ Fetch a string from the stream. This could be a byte string and may contain unprintable characters. (It's not unheard of for a string to contain another byte-stream Message.) @return: a string. @rtype: string """ return self.get_bytes(self.get_int()) def get_list(self): """ Fetch a list of strings from the stream. These are trivially encoded as comma-separated values in a string. @return: a list of strings. @rtype: list of strings """ return self.get_string().split(',') def add_bytes(self, b): """ Write bytes to the stream, without any formatting. @param b: bytes to add @type b: str """ self.packet.write(b) return self def add_byte(self, b): """ Write a single byte to the stream, without any formatting. @param b: byte to add @type b: str """ self.packet.write(b) return self def add_boolean(self, b): """ Add a boolean value to the stream. @param b: boolean value to add @type b: bool """ if b: self.add_byte('\x01') else: self.add_byte('\x00') return self def add_int(self, n): """ Add an integer to the stream. @param n: integer to add @type n: int """ self.packet.write(struct.pack('>I', n)) return self def add_int64(self, n): """ Add a 64-bit int to the stream. @param n: long int to add @type n: long """ self.packet.write(struct.pack('>Q', n)) return self def add_mpint(self, z): """ Add a long int to the stream, encoded as an infinite-precision integer. This method only works on positive numbers. @param z: long int to add @type z: long """ self.add_string(util.deflate_long(z)) return self def add_string(self, s): """ Add a string to the stream. @param s: string to add @type s: str """ self.add_int(len(s)) self.packet.write(s) return self def add_list(self, l): """ Add a list of strings to the stream. They are encoded identically to a single string of values separated by commas. (Yes, really, that's how SSH2 does it.) @param l: list of strings to add @type l: list(str) """ self.add_string(','.join(l)) return self def _add(self, i): if type(i) is str: return self.add_string(i) elif type(i) is int: return self.add_int(i) elif type(i) is long: if i > 0xffffffffL: return self.add_mpint(i) else: return self.add_int(i) elif type(i) is bool: return self.add_boolean(i) elif type(i) is list: return self.add_list(i) else: raise Exception('Unknown type') def add(self, *seq): """ Add a sequence of items to the stream. The values are encoded based on their type: str, int, bool, list, or long. @param seq: the sequence of items @type seq: sequence @bug: longs are encoded non-deterministically. Don't use this method. """ for item in seq: self._add(item)
gpl-2.0
flit/pyOCD
pyocd/target/builtin/target_CC3220SF.py
2
6891
# pyOCD debugger # Copyright (c) 2018-2019 Arm Limited # Copyright (c) 2021 Chris Reed # SPDX-License-Identifier: Apache-2.0 # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import logging import time from ...flash.flash import Flash from ...coresight.coresight_target import CoreSightTarget from ...core.memory_map import (RomRegion, FlashRegion, RamRegion, MemoryMap) LOG = logging.getLogger(__name__) FLASH_ALGO = { 'load_address' : 0x20000000, 'instructions' : [ 0xE00ABE00, 0x062D780D, 0x24084068, 0xD3000040, 0x1E644058, 0x1C49D1FA, 0x2A001E52, 0x4770D1F2, 0xd1fd3801, 0x49964770, 0x6e48b418, 0x0000f440, 0x4b946648, 0xf241681a, 0x380140d5, 0xf042d1fd, 0x60180010, 0x40d5f241, 0xd1fd3801, 0xf8d24a8e, 0xf040016c, 0xf8c2003c, 0x4b8c016c, 0xf0406c98, 0x64980001, 0x6480f44f, 0x6cd86820, 0x0001f040, 0xf04f64d8, 0xf8cd0c00, 0x9800c000, 0x90001c40, 0xd3fa2810, 0xf0206cd8, 0x64d80001, 0xf0206c98, 0x64980001, 0x68c0487e, 0x0ffff010, 0x487dd106, 0xc000f8c0, 0x40d5f241, 0xd1fd3801, 0x00c8f8d1, 0x2802b2c0, 0xf8d2d113, 0xf0200110, 0xf420000f, 0xf0406040, 0xf8c20002, 0xf8d20110, 0xf0200114, 0xf420000f, 0xf0406040, 0xf8c20002, 0xf8d20114, 0xf0400184, 0xf8c20002, 0x486b0184, 0xf3c06800, 0x280e5083, 0x00b0f8d1, 0x007cf420, 0xf440bf0c, 0xf4400048, 0xf8c10024, 0x486400b0, 0xf0236803, 0x60035380, 0xb2806820, 0xd2062802, 0x00a8f8d1, 0x0004f040, 0x00a8f8c1, 0x6820e022, 0xd01f0c00, 0x0188f8d2, 0x00e1f040, 0x0188f8c2, 0x68034858, 0x0f01f013, 0x6803d014, 0x0301f023, 0xf8d26003, 0xf4400188, 0xf8c27000, 0x48520188, 0xf0226802, 0x60020201, 0xf8c01d00, 0x1d00c000, 0xc000f8c0, 0x6800484d, 0xf3c00f02, 0x2a036003, 0xd22cd00f, 0x6800484a, 0x1080f3c0, 0x6a88b158, 0x0080f020, 0x69086288, 0x4070f020, 0x5080f040, 0xb9e0e01c, 0x6a48e7ee, 0x000ff020, 0x6070f420, 0x30c0f420, 0x0001f040, 0x60a0f440, 0x3080f440, 0x6a886248, 0x0080f020, 0x4070f020, 0x007ff420, 0x104cf440, 0x69086288, 0x4070f020, 0xbc186108, 0x0000f04f, 0x20004770, 0x48324770, 0x2201f640, 0x49316142, 0x68816081, 0x0f04f011, 0x68c0d1fb, 0xbf184010, 0x47702001, 0x2201f640, 0x614a4929, 0x482a6008, 0x68886088, 0x0f02f010, 0x68c8d1fb, 0xbf184010, 0x47702001, 0xf242b430, 0x4b216c01, 0xc014f8c3, 0xbf182900, 0xc084f8df, 0xf020d01e, 0x601c047f, 0xf000e00b, 0xf105057c, 0xf5054580, 0xf852257d, 0xf8c54b04, 0x1d004100, 0xf0101f09, 0xd1010f7c, 0xb90c6b1c, 0xd1ec2900, 0xc020f8c3, 0xf0146a1c, 0xd1fb0f01, 0xd1e02900, 0x2000bc30, 0x00004770, 0x4402f000, 0x4402fc18, 0x4402e000, 0x44025000, 0x4402d000, 0x4402f804, 0x4402dc78, 0x4402fc74, 0x4402fc20, 0x4402f818, 0x4402dc80, 0x4402f840, 0x400fd000, 0xa4420004, 0xa4420002, 0xa4420001, 0x00000004, 0x00000008, 0x00000014, 0x00000018, 0x00000024, 0x00000028, 0x00000030, 0x00000034, 0x00000040, 0x00000044, 0x00000048, 0x0000004c, 0x00000050, 0x00000054, 0x00000058, 0x0000005c, 0x00000060, 0x00000064, 0x00000068, 0x0000006c, 0x00000070, 0x00000074, 0x00000078, 0x0000007c, 0x00000080, 0x00000084, 0x00000088, 0x0000008c, 0x00000090, 0x00000094, 0x00000098, 0x0000009c, 0x000000a0, 0x000000a4, 0x000000a8, 0x000000ac, 0x000000b8, 0x000000bc, 0x000000c8, 0x000000cc, 0x000000d8, 0x000000dc, 0x00000000, ], 'pc_init' : 0x20000027, 'pc_eraseAll' : 0x200001e7, 'pc_erase_sector' : 0x20000205, 'pc_program_page' : 0x20000225, 'begin_data' : 0x20002000, # Analyzer uses a max of 1 KB data (256 pages * 4 bytes / page) 'page_buffers' : [0x20002000, 0x20004000], # Enable double buffering 'begin_stack' : 0x20000800, 'static_base' : 0x20000368, 'min_program_length' : 4, 'analyzer_supported' : False, 'analyzer_address' : 0x20003000 # Analyzer 0x20003000..0x20003600 } class Flash_cc3220sf(Flash): def __init__(self, target): super(Flash_cc3220sf, self).__init__(target, FLASH_ALGO) def init(self): """ Download the flash algorithm in RAM """ self.target.halt() self.target.reset_and_halt() # update core register to execute the init subroutine result = self._call_function_and_wait(self.flash_algo['pc_init'], init=True) # check the return code if result != 0: LOG.error('init error: %i', result) # erase the cookie which take up one page self.erase_sector(0x01000000) time.sleep(.5) #do a hardware reset which will put the pc looping in rom self.target.dp.reset() time.sleep(1.3) # reconnect to the board self.target.dp.connect() self.target.halt() self.target.reset_and_halt() # update core register to execute the init subroutine result = self._call_function_and_wait(self.flash_algo['pc_init'], init=True) # check the return code if result != 0: LOG.error('init error: %i', result) class CC3220SF(CoreSightTarget): VENDOR = "Texas Instruments" MEMORY_MAP = MemoryMap( RomRegion(start=0x00000000, length=0x00080000), FlashRegion(start=0x01000000, length=0x00100000, blocksize=0x800, is_boot_memory=True, flash_class=Flash_cc3220sf), RamRegion(start=0x20000000, length=0x40000) ) def __init__(self, session): super(CC3220SF, self).__init__(session, self.MEMORY_MAP) def post_connect_hook(self): self.cores[0].default_reset_type = self.ResetType.SW_VECTRESET
apache-2.0
martynovp/edx-platform
common/lib/xmodule/xmodule/tests/test_lti20_unit.py
174
17021
# -*- coding: utf-8 -*- """Tests for LTI Xmodule LTIv2.0 functional logic.""" import datetime import textwrap from django.utils.timezone import UTC from mock import Mock from xmodule.lti_module import LTIDescriptor from xmodule.lti_2_util import LTIError from . import LogicTest class LTI20RESTResultServiceTest(LogicTest): """Logic tests for LTI module. LTI2.0 REST ResultService""" descriptor_class = LTIDescriptor def setUp(self): super(LTI20RESTResultServiceTest, self).setUp() self.environ = {'wsgi.url_scheme': 'http', 'REQUEST_METHOD': 'POST'} self.system.get_real_user = Mock() self.system.publish = Mock() self.system.rebind_noauth_module_to_user = Mock() self.user_id = self.xmodule.runtime.anonymous_student_id self.lti_id = self.xmodule.lti_id self.xmodule.due = None self.xmodule.graceperiod = None def test_sanitize_get_context(self): """Tests that the get_context function does basic sanitization""" # get_context, unfortunately, requires a lot of mocking machinery mocked_course = Mock(name='mocked_course', lti_passports=['lti_id:test_client:test_secret']) modulestore = Mock(name='modulestore') modulestore.get_course.return_value = mocked_course runtime = Mock(name='runtime', modulestore=modulestore) self.xmodule.descriptor.runtime = runtime self.xmodule.lti_id = "lti_id" test_cases = ( # (before sanitize, after sanitize) (u"plaintext", u"plaintext"), (u"a <script>alert(3)</script>", u"a &lt;script&gt;alert(3)&lt;/script&gt;"), # encodes scripts (u"<b>bold 包</b>", u"<b>bold 包</b>"), # unicode, and <b> tags pass through ) for case in test_cases: self.xmodule.score_comment = case[0] self.assertEqual( case[1], self.xmodule.get_context()['comment'] ) def test_lti20_rest_bad_contenttype(self): """ Input with bad content type """ with self.assertRaisesRegexp(LTIError, "Content-Type must be"): request = Mock(headers={u'Content-Type': u'Non-existent'}) self.xmodule.verify_lti_2_0_result_rest_headers(request) def test_lti20_rest_failed_oauth_body_verify(self): """ Input with bad oauth body hash verification """ err_msg = "OAuth body verification failed" self.xmodule.verify_oauth_body_sign = Mock(side_effect=LTIError(err_msg)) with self.assertRaisesRegexp(LTIError, err_msg): request = Mock(headers={u'Content-Type': u'application/vnd.ims.lis.v2.result+json'}) self.xmodule.verify_lti_2_0_result_rest_headers(request) def test_lti20_rest_good_headers(self): """ Input with good oauth body hash verification """ self.xmodule.verify_oauth_body_sign = Mock(return_value=True) request = Mock(headers={u'Content-Type': u'application/vnd.ims.lis.v2.result+json'}) self.xmodule.verify_lti_2_0_result_rest_headers(request) # We just want the above call to complete without exceptions, and to have called verify_oauth_body_sign self.assertTrue(self.xmodule.verify_oauth_body_sign.called) BAD_DISPATCH_INPUTS = [ None, u"", u"abcd" u"notuser/abcd" u"user/" u"user//" u"user/gbere/" u"user/gbere/xsdf" u"user/ಠ益ಠ" # not alphanumeric ] def test_lti20_rest_bad_dispatch(self): """ Test the error cases for the "dispatch" argument to the LTI 2.0 handler. Anything that doesn't fit the form user/<anon_id> """ for einput in self.BAD_DISPATCH_INPUTS: with self.assertRaisesRegexp(LTIError, "No valid user id found in endpoint URL"): self.xmodule.parse_lti_2_0_handler_suffix(einput) GOOD_DISPATCH_INPUTS = [ (u"user/abcd3", u"abcd3"), (u"user/Äbcdè2", u"Äbcdè2"), # unicode, just to make sure ] def test_lti20_rest_good_dispatch(self): """ Test the good cases for the "dispatch" argument to the LTI 2.0 handler. Anything that does fit the form user/<anon_id> """ for ginput, expected in self.GOOD_DISPATCH_INPUTS: self.assertEquals(self.xmodule.parse_lti_2_0_handler_suffix(ginput), expected) BAD_JSON_INPUTS = [ # (bad inputs, error message expected) ([ u"kk", # ValueError u"{{}", # ValueError u"{}}", # ValueError 3, # TypeError {}, # TypeError ], u"Supplied JSON string in request body could not be decoded"), ([ u"3", # valid json, not array or object u"[]", # valid json, array too small u"[3, {}]", # valid json, 1st element not an object ], u"Supplied JSON string is a list that does not contain an object as the first element"), ([ u'{"@type": "NOTResult"}', # @type key must have value 'Result' ], u"JSON object does not contain correct @type attribute"), ([ # @context missing u'{"@type": "Result", "resultScore": 0.1}', ], u"JSON object does not contain required key"), ([ u''' {"@type": "Result", "@context": "http://purl.imsglobal.org/ctx/lis/v2/Result", "resultScore": 100}''' # score out of range ], u"score value outside the permitted range of 0-1."), ([ u''' {"@type": "Result", "@context": "http://purl.imsglobal.org/ctx/lis/v2/Result", "resultScore": "1b"}''', # score ValueError u''' {"@type": "Result", "@context": "http://purl.imsglobal.org/ctx/lis/v2/Result", "resultScore": {}}''', # score TypeError ], u"Could not convert resultScore to float"), ] def test_lti20_bad_json(self): """ Test that bad json_str to parse_lti_2_0_result_json inputs raise appropriate LTI Error """ for error_inputs, error_message in self.BAD_JSON_INPUTS: for einput in error_inputs: with self.assertRaisesRegexp(LTIError, error_message): self.xmodule.parse_lti_2_0_result_json(einput) GOOD_JSON_INPUTS = [ (u''' {"@type": "Result", "@context": "http://purl.imsglobal.org/ctx/lis/v2/Result", "resultScore": 0.1}''', u""), # no comment means we expect "" (u''' [{"@type": "Result", "@context": "http://purl.imsglobal.org/ctx/lis/v2/Result", "@id": "anon_id:abcdef0123456789", "resultScore": 0.1}]''', u""), # OK to have array of objects -- just take the first. @id is okay too (u''' {"@type": "Result", "@context": "http://purl.imsglobal.org/ctx/lis/v2/Result", "resultScore": 0.1, "comment": "ಠ益ಠ"}''', u"ಠ益ಠ"), # unicode comment ] def test_lti20_good_json(self): """ Test the parsing of good comments """ for json_str, expected_comment in self.GOOD_JSON_INPUTS: score, comment = self.xmodule.parse_lti_2_0_result_json(json_str) self.assertEqual(score, 0.1) self.assertEqual(comment, expected_comment) GOOD_JSON_PUT = textwrap.dedent(u""" {"@type": "Result", "@context": "http://purl.imsglobal.org/ctx/lis/v2/Result", "@id": "anon_id:abcdef0123456789", "resultScore": 0.1, "comment": "ಠ益ಠ"} """).encode('utf-8') GOOD_JSON_PUT_LIKE_DELETE = textwrap.dedent(u""" {"@type": "Result", "@context": "http://purl.imsglobal.org/ctx/lis/v2/Result", "@id": "anon_id:abcdef0123456789", "comment": "ಠ益ಠ"} """).encode('utf-8') def get_signed_lti20_mock_request(self, body, method=u'PUT'): """ Example of signed from LTI 2.0 Provider. Signatures and hashes are example only and won't verify """ mock_request = Mock() mock_request.headers = { 'Content-Type': 'application/vnd.ims.lis.v2.result+json', 'Authorization': ( u'OAuth oauth_nonce="135685044251684026041377608307", ' u'oauth_timestamp="1234567890", oauth_version="1.0", ' u'oauth_signature_method="HMAC-SHA1", ' u'oauth_consumer_key="test_client_key", ' u'oauth_signature="my_signature%3D", ' u'oauth_body_hash="gz+PeJZuF2//n9hNUnDj2v5kN70="' ) } mock_request.url = u'http://testurl' mock_request.http_method = method mock_request.method = method mock_request.body = body return mock_request USER_STANDIN = Mock() USER_STANDIN.id = 999 def setup_system_xmodule_mocks_for_lti20_request_test(self): """ Helper fn to set up mocking for lti 2.0 request test """ self.system.get_real_user = Mock(return_value=self.USER_STANDIN) self.xmodule.max_score = Mock(return_value=1.0) self.xmodule.get_client_key_secret = Mock(return_value=('test_client_key', u'test_client_secret')) self.xmodule.verify_oauth_body_sign = Mock() def test_lti20_put_like_delete_success(self): """ The happy path for LTI 2.0 PUT that acts like a delete """ self.setup_system_xmodule_mocks_for_lti20_request_test() SCORE = 0.55 # pylint: disable=invalid-name COMMENT = u"ಠ益ಠ" # pylint: disable=invalid-name self.xmodule.module_score = SCORE self.xmodule.score_comment = COMMENT mock_request = self.get_signed_lti20_mock_request(self.GOOD_JSON_PUT_LIKE_DELETE) # Now call the handler response = self.xmodule.lti_2_0_result_rest_handler(mock_request, "user/abcd") # Now assert there's no score self.assertEqual(response.status_code, 200) self.assertIsNone(self.xmodule.module_score) self.assertEqual(self.xmodule.score_comment, u"") (_, evt_type, called_grade_obj), _ = self.system.publish.call_args self.assertEqual(called_grade_obj, {'user_id': self.USER_STANDIN.id, 'value': None, 'max_value': None}) self.assertEqual(evt_type, 'grade') def test_lti20_delete_success(self): """ The happy path for LTI 2.0 DELETE """ self.setup_system_xmodule_mocks_for_lti20_request_test() SCORE = 0.55 # pylint: disable=invalid-name COMMENT = u"ಠ益ಠ" # pylint: disable=invalid-name self.xmodule.module_score = SCORE self.xmodule.score_comment = COMMENT mock_request = self.get_signed_lti20_mock_request("", method=u'DELETE') # Now call the handler response = self.xmodule.lti_2_0_result_rest_handler(mock_request, "user/abcd") # Now assert there's no score self.assertEqual(response.status_code, 200) self.assertIsNone(self.xmodule.module_score) self.assertEqual(self.xmodule.score_comment, u"") (_, evt_type, called_grade_obj), _ = self.system.publish.call_args self.assertEqual(called_grade_obj, {'user_id': self.USER_STANDIN.id, 'value': None, 'max_value': None}) self.assertEqual(evt_type, 'grade') def test_lti20_put_set_score_success(self): """ The happy path for LTI 2.0 PUT that sets a score """ self.setup_system_xmodule_mocks_for_lti20_request_test() mock_request = self.get_signed_lti20_mock_request(self.GOOD_JSON_PUT) # Now call the handler response = self.xmodule.lti_2_0_result_rest_handler(mock_request, "user/abcd") # Now assert self.assertEqual(response.status_code, 200) self.assertEqual(self.xmodule.module_score, 0.1) self.assertEqual(self.xmodule.score_comment, u"ಠ益ಠ") (_, evt_type, called_grade_obj), _ = self.system.publish.call_args self.assertEqual(evt_type, 'grade') self.assertEqual(called_grade_obj, {'user_id': self.USER_STANDIN.id, 'value': 0.1, 'max_value': 1.0}) def test_lti20_get_no_score_success(self): """ The happy path for LTI 2.0 GET when there's no score """ self.setup_system_xmodule_mocks_for_lti20_request_test() mock_request = self.get_signed_lti20_mock_request("", method=u'GET') # Now call the handler response = self.xmodule.lti_2_0_result_rest_handler(mock_request, "user/abcd") # Now assert self.assertEqual(response.status_code, 200) self.assertEqual(response.json, {"@context": "http://purl.imsglobal.org/ctx/lis/v2/Result", "@type": "Result"}) def test_lti20_get_with_score_success(self): """ The happy path for LTI 2.0 GET when there is a score """ self.setup_system_xmodule_mocks_for_lti20_request_test() SCORE = 0.55 # pylint: disable=invalid-name COMMENT = u"ಠ益ಠ" # pylint: disable=invalid-name self.xmodule.module_score = SCORE self.xmodule.score_comment = COMMENT mock_request = self.get_signed_lti20_mock_request("", method=u'GET') # Now call the handler response = self.xmodule.lti_2_0_result_rest_handler(mock_request, "user/abcd") # Now assert self.assertEqual(response.status_code, 200) self.assertEqual(response.json, {"@context": "http://purl.imsglobal.org/ctx/lis/v2/Result", "@type": "Result", "resultScore": SCORE, "comment": COMMENT}) UNSUPPORTED_HTTP_METHODS = ["OPTIONS", "HEAD", "POST", "TRACE", "CONNECT"] def test_lti20_unsupported_method_error(self): """ Test we get a 404 when we don't GET or PUT """ self.setup_system_xmodule_mocks_for_lti20_request_test() mock_request = self.get_signed_lti20_mock_request(self.GOOD_JSON_PUT) for bad_method in self.UNSUPPORTED_HTTP_METHODS: mock_request.method = bad_method response = self.xmodule.lti_2_0_result_rest_handler(mock_request, "user/abcd") self.assertEqual(response.status_code, 404) def test_lti20_request_handler_bad_headers(self): """ Test that we get a 401 when header verification fails """ self.setup_system_xmodule_mocks_for_lti20_request_test() self.xmodule.verify_lti_2_0_result_rest_headers = Mock(side_effect=LTIError()) mock_request = self.get_signed_lti20_mock_request(self.GOOD_JSON_PUT) response = self.xmodule.lti_2_0_result_rest_handler(mock_request, "user/abcd") self.assertEqual(response.status_code, 401) def test_lti20_request_handler_bad_dispatch_user(self): """ Test that we get a 404 when there's no (or badly formatted) user specified in the url """ self.setup_system_xmodule_mocks_for_lti20_request_test() mock_request = self.get_signed_lti20_mock_request(self.GOOD_JSON_PUT) response = self.xmodule.lti_2_0_result_rest_handler(mock_request, None) self.assertEqual(response.status_code, 404) def test_lti20_request_handler_bad_json(self): """ Test that we get a 404 when json verification fails """ self.setup_system_xmodule_mocks_for_lti20_request_test() self.xmodule.parse_lti_2_0_result_json = Mock(side_effect=LTIError()) mock_request = self.get_signed_lti20_mock_request(self.GOOD_JSON_PUT) response = self.xmodule.lti_2_0_result_rest_handler(mock_request, "user/abcd") self.assertEqual(response.status_code, 404) def test_lti20_request_handler_bad_user(self): """ Test that we get a 404 when the supplied user does not exist """ self.setup_system_xmodule_mocks_for_lti20_request_test() self.system.get_real_user = Mock(return_value=None) mock_request = self.get_signed_lti20_mock_request(self.GOOD_JSON_PUT) response = self.xmodule.lti_2_0_result_rest_handler(mock_request, "user/abcd") self.assertEqual(response.status_code, 404) def test_lti20_request_handler_grade_past_due(self): """ Test that we get a 404 when accept_grades_past_due is False and it is past due """ self.setup_system_xmodule_mocks_for_lti20_request_test() self.xmodule.due = datetime.datetime.now(UTC()) self.xmodule.accept_grades_past_due = False mock_request = self.get_signed_lti20_mock_request(self.GOOD_JSON_PUT) response = self.xmodule.lti_2_0_result_rest_handler(mock_request, "user/abcd") self.assertEqual(response.status_code, 404)
agpl-3.0
dpad/sumatra
sumatra/publishing/sphinxext/sumatra_rst.py
5
7340
""" idea for an "smtimage" directive (and "smtfigure" similarly) which would be used like .. smtimage:: 20120907-153528 demo_cx05_N=500b_LTS_d274f9660531.png :project: Destexhe_JCNS_2009 :record_store: /path/to/recordstore/file or http://smt.andrewdavison.info/records :digest: DIGEST_GOES_HERE_FOR_CHECKING (optional) This would query the recordstore, make a copy of the image file in a temporary directory, and preferably clean up the temporary directory later (use "pending" node?). If using a MirroredFileSystemDataStore could just use URL The project name and recordstore directive are optional if rst2xxxx is used in a Sumatra project directory :copyright: Copyright 2006-2015 by the Sumatra team, see doc/authors.txt :license: BSD 2-clause, see LICENSE for details. """ from __future__ import unicode_literals from docutils.parsers.rst import directives, states from docutils.parsers.rst.directives.images import Image from docutils.parsers.rst.roles import set_classes from docutils.parsers.rst import roles from docutils import nodes, utils from sumatra.publishing.utils import determine_project, determine_record_store, \ determine_project_name, record_link_url, \ get_image, get_record_label_and_image_path import os.path LOCAL_IMAGE_CACHE = "smt_images" # should use tempfile? def smt_link_role(role, rawtext, text, lineno, inliner, options={}, content=[]): label = text settings = inliner.document.settings ref = "%s/%s/%s/" % (settings.sumatra_record_store, settings.sumatra_project, label) set_classes(options) node = nodes.reference(rawtext, '', refuri=ref, **options) node += nodes.image(uri=settings.sumatra_link_icon, alt='smt:' + utils.unescape(text)) return [node], [] roles.register_local_role('smtlink', smt_link_role) def build_options(global_settings, local_options): if hasattr(global_settings, 'env'): # using sphinx config = global_settings.env.config else: config = global_settings # using plain docutils # convert config into dict, and strip "sumatra_" prefix combined_options = {} for name in ("record_store", "project", "link_icon"): full_name = "sumatra_" + name if hasattr(config, full_name): combined_options[name] = getattr(config, full_name) combined_options.update(local_options) return combined_options class SumatraImage(Image): required_arguments = 1 # Sumatra label optional_arguments = 1 # path to image file. Not required if record has only a single image file as output final_argument_whitespace = False option_spec = {'alt': directives.unchanged, 'height': directives.length_or_unitless, 'width': directives.length_or_percentage_or_unitless, 'scale': directives.percentage, 'align': lambda argument: directives.choice(argument, Image.align_values), 'name': directives.unchanged, 'target': directives.unchanged_required, 'class': directives.class_option, 'project': directives.unchanged, 'record_store': directives.unchanged, 'digest': directives.unchanged, } def run(self): if 'align' in self.options: if isinstance(self.state, states.SubstitutionDef): # Check for align_v_values. if self.options['align'] not in self.align_v_values: raise self.error( 'Error in "%s" directive: "%s" is not a valid value ' 'for the "align" option within a substitution ' 'definition. Valid values for "align" are: "%s".' % (self.name, self.options['align'], '", "'.join(self.align_v_values))) elif self.options['align'] not in self.align_h_values: raise self.error( 'Error in "%s" directive: "%s" is not a valid value for ' 'the "align" option. Valid values for "align" are: "%s".' % (self.name, self.options['align'], '", "'.join(self.align_h_values))) messages = [] # previous code from Image.run() # -------------------------------------------------------------------- sumatra_options = build_options(self.state.document.settings, self.options) # determine which record store to use prj = determine_project(sumatra_options) record_store = determine_record_store(prj, sumatra_options, self.error) # determine the project (short) name project_name = determine_project_name(prj, sumatra_options, self.error) record_label, image_path = get_record_label_and_image_path(self.arguments[0]) record = record_store.get(project_name, record_label) image = get_image(record, image_path, self.options, self.error) # automatically checks digest if hasattr(image, "url"): reference = image.url else: if not os.path.exists(LOCAL_IMAGE_CACHE): os.makedirs(LOCAL_IMAGE_CACHE) reference = image.save_copy(LOCAL_IMAGE_CACHE) # set values for alt and target, if they have not been specified if not 'target' in self.options and hasattr(record_store, 'server_url'): self.options['target'] = record_link_url(record_store.server_url, project_name, record_label) if not 'alt' in self.options: self.options['alt'] = "Data file generated by computation %s" % record_label # -------------------------------------------------------------------- # following code from Image.run() self.options['uri'] = reference reference_node = None if 'target' in self.options: block = states.escape2null( self.options['target']).splitlines() block = [line for line in block] target_type, data = self.state.parse_target( block, self.block_text, self.lineno) if target_type == 'refuri': reference_node = nodes.reference(refuri=data) elif target_type == 'refname': reference_node = nodes.reference( refname=fully_normalize_name(data), name=whitespace_normalize_name(data)) reference_node.indirect_reference_name = data self.state.document.note_refname(reference_node) else: # malformed target messages.append(data) # data is a system message del self.options['target'] set_classes(self.options) image_node = nodes.image(self.block_text, **self.options) self.add_name(image_node) if reference_node: reference_node += image_node return messages + [reference_node] else: return messages + [image_node] directives.register_directive("smtimage", SumatraImage) # possible glyphicons for links to record store # icon-search # icon-file # icon-bookmark # icon-info-sign # icon-comment # icon-book
bsd-2-clause
jelugbo/ddi
cms/djangoapps/contentstore/tests/test_core_caching.py
31
1702
from cache_toolbox.core import get_cached_content, set_cached_content, del_cached_content from opaque_keys.edx.locations import Location from django.test import TestCase class Content: def __init__(self, location, content): self.location = location self.content = content def get_id(self): return self.location.to_deprecated_son() class CachingTestCase(TestCase): # Tests for https://edx.lighthouseapp.com/projects/102637/tickets/112-updating-asset-does-not-refresh-the-cached-copy unicodeLocation = Location(u'c4x', u'mitX', u'800', u'run', u'thumbnail', u'monsters.jpg') # Note that some of the parts are strings instead of unicode strings nonUnicodeLocation = Location('c4x', u'mitX', u'800', u'run', 'thumbnail', 'monsters.jpg') mockAsset = Content(unicodeLocation, 'my content') def test_put_and_get(self): set_cached_content(self.mockAsset) self.assertEqual(self.mockAsset.content, get_cached_content(self.unicodeLocation).content, 'should be stored in cache with unicodeLocation') self.assertEqual(self.mockAsset.content, get_cached_content(self.nonUnicodeLocation).content, 'should be stored in cache with nonUnicodeLocation') def test_delete(self): set_cached_content(self.mockAsset) del_cached_content(self.nonUnicodeLocation) self.assertEqual(None, get_cached_content(self.unicodeLocation), 'should not be stored in cache with unicodeLocation') self.assertEqual(None, get_cached_content(self.nonUnicodeLocation), 'should not be stored in cache with nonUnicodeLocation')
agpl-3.0
yatinkumbhare/openstack-nova
nova/api/openstack/compute/plugins/v3/migrations.py
29
2283
# Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from nova.api.openstack import extensions from nova.api.openstack import wsgi from nova import compute from nova.objects import base as obj_base ALIAS = "os-migrations" def authorize(context, action_name): extensions.os_compute_authorizer(ALIAS)(context, action=action_name) def output(migrations_obj): """Returns the desired output of the API from an object. From a MigrationsList's object this method returns a list of primitive objects with the only necessary fields. """ objects = obj_base.obj_to_primitive(migrations_obj) objects = [x for x in objects if not x['hidden']] for obj in objects: del obj['deleted'] del obj['deleted_at'] del obj['migration_type'] del obj['hidden'] return objects class MigrationsController(wsgi.Controller): """Controller for accessing migrations in OpenStack API.""" def __init__(self): self.compute_api = compute.API() @extensions.expected_errors(()) def index(self, req): """Return all migrations in progress.""" context = req.environ['nova.context'] authorize(context, "index") migrations = self.compute_api.get_migrations(context, req.GET) return {'migrations': output(migrations)} class Migrations(extensions.V3APIExtensionBase): """Provide data on migrations.""" name = "Migrations" alias = ALIAS version = 1 def get_resources(self): resources = [] resource = extensions.ResourceExtension(ALIAS, MigrationsController()) resources.append(resource) return resources def get_controller_extensions(self): return []
apache-2.0
tynn/numpy
numpy/distutils/line_endings.py
256
2053
""" Functions for converting from DOS to UNIX line endings """ from __future__ import division, absolute_import, print_function import sys, re, os def dos2unix(file): "Replace CRLF with LF in argument files. Print names of changed files." if os.path.isdir(file): print(file, "Directory!") return data = open(file, "rb").read() if '\0' in data: print(file, "Binary!") return newdata = re.sub("\r\n", "\n", data) if newdata != data: print('dos2unix:', file) f = open(file, "wb") f.write(newdata) f.close() return file else: print(file, 'ok') def dos2unix_one_dir(modified_files, dir_name, file_names): for file in file_names: full_path = os.path.join(dir_name, file) file = dos2unix(full_path) if file is not None: modified_files.append(file) def dos2unix_dir(dir_name): modified_files = [] os.path.walk(dir_name, dos2unix_one_dir, modified_files) return modified_files #---------------------------------- def unix2dos(file): "Replace LF with CRLF in argument files. Print names of changed files." if os.path.isdir(file): print(file, "Directory!") return data = open(file, "rb").read() if '\0' in data: print(file, "Binary!") return newdata = re.sub("\r\n", "\n", data) newdata = re.sub("\n", "\r\n", newdata) if newdata != data: print('unix2dos:', file) f = open(file, "wb") f.write(newdata) f.close() return file else: print(file, 'ok') def unix2dos_one_dir(modified_files, dir_name, file_names): for file in file_names: full_path = os.path.join(dir_name, file) unix2dos(full_path) if file is not None: modified_files.append(file) def unix2dos_dir(dir_name): modified_files = [] os.path.walk(dir_name, unix2dos_one_dir, modified_files) return modified_files if __name__ == "__main__": dos2unix_dir(sys.argv[1])
bsd-3-clause
PyMamba/mamba-storm
storm/django/middleware.py
4
3107
# # Copyright (c) 2008 Canonical # # Written by James Henstridge <jamesh@canonical.com> # # This file is part of Storm Object Relational Mapper. # # Storm is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License as # published by the Free Software Foundation; either version 2.1 of # the License, or (at your option) any later version. # # Storm is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # """Django middleware support for the Zope transaction manager. Adding storm.django.middleware.ZopeTransactionMiddleware to L{MIDDLEWARE_CLASSES} in the application's settings module will cause a Zope transaction to be run for each request. """ __all__ = ['ZopeTransactionMiddleware'] from django.conf import settings import transaction class ZopeTransactionMiddleware(object): """Zope Transaction middleware for Django. If this is enabled, a Zope transaction will be run to cover each request. """ def __init__(self): self.commit_safe_methods = getattr( settings, 'STORM_COMMIT_SAFE_METHODS', True) def process_request(self, request): """Begin a transaction on request start..""" from django.db import transaction as django_transaction django_transaction.enter_transaction_management() django_transaction.managed(True) transaction.begin() def process_exception(self, request, exception): """Abort the transaction on errors.""" from django.db import transaction as django_transaction transaction.abort() django_transaction.set_clean() django_transaction.leave_transaction_management() def process_response(self, request, response): """Commit or abort the transaction after processing the response. On successful completion of the request, the transaction will be committed. As an exception to this, if the L{STORM_COMMIT_SAFE_METHODS} setting is False, and the request used either of the GET and HEAD methods, the transaction will be aborted. """ from django.db import transaction as django_transaction # If process_exception() has been called, then we'll no longer # be in managed transaction mode. if django_transaction.is_managed(): if self.commit_safe_methods or ( request.method not in ['HEAD', 'GET']): try: transaction.commit() except Exception: transaction.abort() raise else: transaction.abort() django_transaction.set_clean() django_transaction.leave_transaction_management() return response
lgpl-2.1
xavierwu/scikit-learn
sklearn/cluster/setup.py
263
1449
# Author: Alexandre Gramfort <alexandre.gramfort@inria.fr> # License: BSD 3 clause import os from os.path import join import numpy from sklearn._build_utils import get_blas_info def configuration(parent_package='', top_path=None): from numpy.distutils.misc_util import Configuration cblas_libs, blas_info = get_blas_info() libraries = [] if os.name == 'posix': cblas_libs.append('m') libraries.append('m') config = Configuration('cluster', parent_package, top_path) config.add_extension('_dbscan_inner', sources=['_dbscan_inner.cpp'], include_dirs=[numpy.get_include()], language="c++") config.add_extension('_hierarchical', sources=['_hierarchical.cpp'], language="c++", include_dirs=[numpy.get_include()], libraries=libraries) config.add_extension( '_k_means', libraries=cblas_libs, sources=['_k_means.c'], include_dirs=[join('..', 'src', 'cblas'), numpy.get_include(), blas_info.pop('include_dirs', [])], extra_compile_args=blas_info.pop('extra_compile_args', []), **blas_info ) return config if __name__ == '__main__': from numpy.distutils.core import setup setup(**configuration(top_path='').todict())
bsd-3-clause
dan-cristian/haiot
cloud/graph_plotly/__init__.py
1
12450
__author__ = 'dcristian' import os from main.logger_helper import L from common import Constant, utils from storage.sqalc import model_helper, models from main import thread_pool #fixme: make it work without plotly try: import plotly.plotly as py from plotly import graph_objs from plotly.exceptions import PlotlyAccountError import graph_plotly_run except Exception, ex: pass initialised = False # updated plotly cache on all hosts to allow grid update in case mastership changes def record_update(obj): source_host_name = utils.get_object_field_value(obj, Constant.JSON_PUBLISH_SOURCE_HOST) if source_host_name != Constant.HOST_NAME: # Log.logger.info("Received plotly cache update from {}".format(source_host_name)) models.PlotlyCache().save_changed_fields_from_json_object(json_object=obj, notify_transport_enabled=False, save_to_graph=False) # uploads data directly to a graph object in plotly # not very reliable since plotly changed the API def upload_data(obj): try: L.l.debug('Trying to upload plotly obj {}'.format(obj)) if Constant.JSON_PUBLISH_GRAPH_X in obj: axis_x_field = obj[Constant.JSON_PUBLISH_GRAPH_X] graph_id_field = obj[Constant.JSON_PUBLISH_GRAPH_ID] graph_legend_field = obj[Constant.JSON_PUBLISH_GRAPH_LEGEND] graph_shape_fields = obj[Constant.JSON_PUBLISH_GRAPH_SHAPE] graph_y_fields = obj[Constant.JSON_PUBLISH_GRAPH_Y] changed_fields = obj[Constant.JSON_PUBLISH_FIELDS_CHANGED] # intersect lists and get only graphable fields that had values changed list_axis_y = list(set(graph_y_fields) & set(changed_fields)) if len(list_axis_y) == 0: L.l.debug('Ignoring graph upload graph={} changed={} obj={}'.format(graph_y_fields, changed_fields, obj)) L.l.debug('Trying to upload y axis {}'.format(list_axis_y)) if axis_x_field in obj and graph_id_field in obj: table = obj[Constant.JSON_PUBLISH_TABLE] trace_unique_id = obj[graph_id_field] # unique record/trace identifier x_val = obj[axis_x_field] graph_legend_item_name = obj[graph_legend_field] # unique key for legend x_val = utils.parse_to_date(x_val) x = [x_val] index = 0 for axis_y in list_axis_y: if axis_y in obj: trace_list = [] y = [obj[axis_y]] # shape visual type for this trace shape = graph_shape_fields[index] # unique name used for graph on upload graph_base_name = str(table + ' ' + axis_y) # full name and path to enable archiving graph_unique_name = graph_plotly_run.get_graph_full_name_path(graph_base_name) if not graph_plotly_run.graph_url_exists_in_memory(graph_unique_name): # download series order list to ensure graph consistency, usually done at app start # or when trace is created graph_plotly_run.download_trace_id_list(graph_unique_name=graph_unique_name, shape_type=shape) if graph_unique_name in graph_plotly_run.g_trace_id_list_per_graph: trace_unique_id_pattern = graph_plotly_run.g_trace_id_list_per_graph[graph_unique_name] else: L.l.warning('Unable to get a reference pattern, graph {}'.format(graph_unique_name)) known_graph_url = graph_plotly_run.get_graph_url_from_memory(graph_unique_name) if trace_unique_id in trace_unique_id_pattern: trace_list = graph_plotly_run.populate_trace_for_extend(x=x, y=y, graph_legend_item_name=graph_legend_item_name, trace_unique_id=trace_unique_id, trace_unique_id_pattern=trace_unique_id_pattern, shape_type=shape) L.l.debug('Extending graph {}'.format(graph_unique_name, shape)) fileopt = 'extend' else: trace_list = graph_plotly_run.populate_trace_for_append(x=x, y=y, graph_legend_item_name=graph_legend_item_name, trace_unique_id=trace_unique_id, shape_type=shape) L.l.debug('Appending graph {}'.format(graph_unique_name)) fileopt = 'append' data = graph_objs.Data(trace_list) try: if known_graph_url is None: L.l.warning('Graph {} is setting up, dropping data'.format(graph_unique_name)) else: graph_plotly_run.add_graph_data(data=data, graph_unique_name=graph_unique_name, trace_unique_id=trace_unique_id, file_opt=fileopt) except PlotlyAccountError, ex: L.l.warning('Unable to plot graph, err {}'.format(ex)) index += 1 else: L.l.critical( 'Graphable object missing axis_x [{}], graph_id [{}], in obj {}'.format(axis_x_field, graph_id_field, obj)) else: L.l.critical('Graphable object missing axis X field {}'.format(Constant.JSON_PUBLISH_GRAPH_X)) except Exception, ex: L.l.exception('General error saving graph, err {} obj={}'.format(ex, obj)) ''' #upload data to a grid object in plotly. grid will be used as main source to generate graphs def upload_data_to_grid(obj): try: Log.logger.debug('Trying to upload plotly grid record {}'.format(obj)) if Constant.JSON_PUBLISH_GRAPH_X in obj: #name of x field axis_x_field = obj[Constant.JSON_PUBLISH_GRAPH_X] graph_id_field = obj[Constant.JSON_PUBLISH_GRAPH_ID] graph_legend_field = obj[Constant.JSON_PUBLISH_GRAPH_LEGEND] graph_shape_fields = obj[Constant.JSON_PUBLISH_GRAPH_SHAPE] graph_y_fields = obj[Constant.JSON_PUBLISH_GRAPH_Y] #names of fields that have value changed to record smallest amount of data changed_fields = obj[Constant.JSON_PUBLISH_FIELDS_CHANGED] #intersect lists and get only graphable fields that had values changed list_axis_y = list(set(graph_y_fields) & set(changed_fields)) if len(list_axis_y)==0: Log.logger.debug('Ignoring graph upload graph={} changed fields={} obj={}'.format(graph_y_fields, changed_fields, obj)) else: Log.logger.debug('Trying to upload y axis {}'.format(list_axis_y)) if axis_x_field in obj and graph_id_field in obj: table = obj[Constant.JSON_PUBLISH_TABLE] trace_unique_id = obj[graph_id_field] #unique record/trace identifier x_val = obj[axis_x_field] graph_legend_item_name = obj[graph_legend_field] #unique key for legend x_val = utils.parse_to_date(x_val) x = x_val index = 0 for axis_y in list_axis_y: if axis_y in obj: trace_list = [] y=obj[axis_y] #shape visual type for this trace shape = graph_shape_fields[index] #unique name used for grid on upload grid_base_name = str(table) graph_plotly_run.add_grid_data(grid_unique_name=grid_base_name, x=x, y=y, axis_x_name=axis_x_field, axis_y_name=axis_y, record_unique_id_name=graph_legend_field, record_unique_id_value=graph_legend_item_name) index += 1 else: Log.logger.critical('Graphable object missing axis_x [{}], graph_id [{}], in obj {}'.format(axis_x_field, graph_id_field, obj)) else: Log.logger.critical('Graphable object missing axis X field {}'.format(Constant.JSON_PUBLISH_GRAPH_X)) except Exception, ex: Log.logger.exception('General error saving graph, err {} obj={}'.format(ex, obj)) ''' def unload(): global initialised thread_pool.remove_callable(graph_plotly_run.thread_run) initialised = False def init(): # use auto setup as described here: https://plot.ly/python/getting-started/ to avoid passwords in code # or less secure sign_in code below # py.sign_in(model_helper.get_param(constant.P_PLOTLY_USERNAME),model_helper.get_param(constant.P_PLOTLY_APIKEY)) username = "" if py.get_credentials()['username'] == '' or py.get_credentials()['api_key'] == '': env_var = 'PLOTLY_CREDENTIALS_PATH' alt_path = os.environ.get(env_var) if not alt_path: L.l.info('Plotly config not in environment var: {}'.format(env_var)) env_var = 'OPENSHIFT_REPO_DIR' alt_path = os.environ.get(env_var) if alt_path is None: L.l.info('Plotly config not in environment var: {}'.format(env_var)) credential_file = model_helper.get_param(Constant.P_PLOTLY_ALTERNATE_CONFIG) alt_path = os.getcwd() + '/' + credential_file else: L.l.info('Plotly config found in environment var: {}, path={}'.format(env_var, alt_path)) alt_path = str(alt_path) + '/../data/.plotly.credentials' L.l.info("Plotly standard config empty, trying alt_path={}".format(alt_path)) try: with open(alt_path, 'r') as cred_file: data = cred_file.read().replace('\n', '') if len(data) > 0: cred_obj = utils.json2obj(data) username = cred_obj['username'] api_key = cred_obj['api_key'] if username and api_key: py.sign_in(username, api_key) global initialised initialised = True # else: # Log.logger.info("Plotly init from db folder config {}{} not ok, trying with db data".format(os.getcwd(), # credential_file)) # #alternate way if reading data from DB # py.sign_in(model_helper.get_param(constant.P_PLOTLY_USERNAME), # model_helper.get_param(constant.P_PLOTLY_APIKEY)) except Exception, ex: L.l.warning("error reading plotly credentials {}".format(ex)) else: L.l.info("Plotly standard config found with username {}".format(py.get_credentials()['username'])) initialised = True if initialised: L.l.info('Plotly is connected with username={}'.format(username)) thread_pool.add_interval_callable(graph_plotly_run.thread_run, run_interval_second=60)
gpl-2.0
aggiedefenders/aggiedefenders.github.io
node_modules/node-forge/tests/policyserver.py
171
3551
#!/usr/bin/env python """ Flash Socket Policy Server. - Starts Flash socket policy file server. - Defaults to port 843. - NOTE: Most operating systems require administrative privileges to use ports under 1024. $ ./policyserver.py [options] """ """ Also consider Adobe's solutions: http://www.adobe.com/devnet/flashplayer/articles/socket_policy_files.html """ from multiprocessing import Process from optparse import OptionParser import SocketServer import logging # Set address reuse for all TCPServers SocketServer.TCPServer.allow_reuse_address = True # Static socket policy file string. # NOTE: This format is very strict. Edit with care. socket_policy_file = """\ <?xml version="1.0"?>\ <!DOCTYPE cross-domain-policy\ SYSTEM "http://www.adobe.com/xml/dtds/cross-domain-policy.dtd">\ <cross-domain-policy>\ <allow-access-from domain="*" to-ports="*"/>\ </cross-domain-policy>\0""" class PolicyHandler(SocketServer.BaseRequestHandler): """ The RequestHandler class for our server. Returns a policy file when requested. """ def handle(self): """Send policy string if proper request string is received.""" # get some data # TODO: make this more robust (while loop, etc) self.data = self.request.recv(1024).rstrip('\0') logging.debug("%s wrote:%s" % (self.client_address[0], repr(self.data))) # if policy file request, send the file. if self.data == "<policy-file-request/>": logging.info("Policy server request from %s." % (self.client_address[0])) self.request.send(socket_policy_file) else: logging.info("Policy server received junk from %s: \"%s\"" % \ (self.client_address[0], repr(self.data))) class ThreadedTCPServer(SocketServer.ThreadingMixIn, SocketServer.TCPServer): def serve_forever(self): """Handle one request at a time until shutdown or keyboard interrupt.""" try: SocketServer.BaseServer.serve_forever(self) except KeyboardInterrupt: return def main(): """Run socket policy file servers.""" usage = "Usage: %prog [options]" parser = OptionParser(usage=usage) parser.add_option("", "--host", dest="host", metavar="HOST", default="localhost", help="bind to HOST") parser.add_option("-p", "--port", dest="port", metavar="PORT", default=843, type="int", help="serve on PORT") parser.add_option("-d", "--debug", dest="debug", action="store_true", default=False, help="debugging output") parser.add_option("-v", "--verbose", dest="verbose", action="store_true", default=False, help="verbose output") (options, args) = parser.parse_args() # setup logging if options.debug: lvl = logging.DEBUG elif options.verbose: lvl = logging.INFO else: lvl = logging.WARNING logging.basicConfig(level=lvl, format="%(levelname)-8s %(message)s") # log basic info logging.info("Flash Socket Policy Server. Use ctrl-c to exit.") # create policy server logging.info("Socket policy serving on %s:%d." % (options.host, options.port)) policyd = ThreadedTCPServer((options.host, options.port), PolicyHandler) # start server policy_p = Process(target=policyd.serve_forever) policy_p.start() while policy_p.is_alive(): try: policy_p.join(1) except KeyboardInterrupt: logging.info("Stopping test server...") if __name__ == "__main__": main()
mit
pabulumm/neighbors
lib/python3.4/site-packages/django/contrib/postgres/operations.py
374
1377
from django.contrib.postgres.signals import register_hstore_handler from django.db.migrations.operations.base import Operation class CreateExtension(Operation): reversible = True def __init__(self, name): self.name = name def state_forwards(self, app_label, state): pass def database_forwards(self, app_label, schema_editor, from_state, to_state): if schema_editor.connection.vendor != 'postgresql': return schema_editor.execute("CREATE EXTENSION IF NOT EXISTS %s" % self.name) def database_backwards(self, app_label, schema_editor, from_state, to_state): schema_editor.execute("DROP EXTENSION %s" % self.name) def describe(self): return "Creates extension %s" % self.name class HStoreExtension(CreateExtension): def __init__(self): self.name = 'hstore' def database_forwards(self, app_label, schema_editor, from_state, to_state): super(HStoreExtension, self).database_forwards(app_label, schema_editor, from_state, to_state) # Register hstore straight away as it cannot be done before the # extension is installed, a subsequent data migration would use the # same connection register_hstore_handler(schema_editor.connection) class UnaccentExtension(CreateExtension): def __init__(self): self.name = 'unaccent'
bsd-3-clause
greggian/TapdIn
django/contrib/gis/gdal/error.py
13
1559
""" This module houses the OGR & SRS Exception objects, and the check_err() routine which checks the status code returned by OGR methods. """ #### OGR & SRS Exceptions #### class GDALException(Exception): pass class OGRException(Exception): pass class SRSException(Exception): pass class OGRIndexError(OGRException, KeyError): """ This exception is raised when an invalid index is encountered, and has the 'silent_variable_feature' attribute set to true. This ensures that django's templates proceed to use the next lookup type gracefully when an Exception is raised. Fixes ticket #4740. """ silent_variable_failure = True #### OGR error checking codes and routine #### # OGR Error Codes OGRERR_DICT = { 1 : (OGRException, 'Not enough data.'), 2 : (OGRException, 'Not enough memory.'), 3 : (OGRException, 'Unsupported geometry type.'), 4 : (OGRException, 'Unsupported operation.'), 5 : (OGRException, 'Corrupt data.'), 6 : (OGRException, 'OGR failure.'), 7 : (SRSException, 'Unsupported SRS.'), 8 : (OGRException, 'Invalid handle.'), } OGRERR_NONE = 0 def check_err(code): "Checks the given OGRERR, and raises an exception where appropriate." if code == OGRERR_NONE: return elif code in OGRERR_DICT: e, msg = OGRERR_DICT[code] raise e, msg else: raise OGRException('Unknown error code: "%s"' % code)
apache-2.0
WebArchivCZ/WA-KAT
src/wa_kat/templates/static/js/Lib/site-packages/components/author_picker.py
1
7164
#! /usr/bin/env python # -*- coding: utf-8 -*- # # Interpreter version: brython (http://brython.info) (like python3) # """ Module with interface for picking authors from authority base in NK's Aleph. """ # # Imports ===================================================================== import json from os.path import join from browser import html from browser import alert from browser import document from .shared import make_request from .shared import func_on_enter from .log_view2 import LogView from .progressbar import AuthorBar from .author_switcher import SWITCHER_EL from .overlay_controller import BlackOverlay # virtual filesystem / modules provided by REST API from virtual_fs import settings # Functions & classes ========================================================= class AuthorPicker(object): """ This component is responsible for generating the interface for picking authors from Aleph. """ original_author_el = document["author"] div_el = document["author_picker"] # whole <div> input_el = document["author_input"] # <input> for author's name search_btn_el = document["search_author"] # trigger the search of author select_el = document["author_select"] # <select> element with authors storno_btn_el = document["storno_author"] # used to storno the picking pick_btn_el = document["pick_author"] # used to accept the selected author overlay = BlackOverlay() code_to_data = {} # this is used to translate select back to data selected_code = None @classmethod def show(cls): """ Show the author picker. """ cls.div_el.style.display = "block" cls.hide_errors() cls.overlay.show() cls.overlay.el.bind("click", lambda x: cls.hide()) @classmethod def hide(cls): """ Hide the author picker. """ cls.overlay.hide() cls.div_el.style.display = "none" @classmethod def hide_errors(cls): """ Hide errors shown by validators. """ cls.select_el.style.border = "0" cls.input_el.style.border = "0" @classmethod def _pick_selected_option(cls): """ Select handler for authors. """ for option in cls.select_el: # if the select is empty if not hasattr(option, "selected"): return None if option.selected: return option.value return None @classmethod def on_pick_button_pressed(cls, ev): """ Callback called when the user press the button for accepting the picked author. This element calls validations, before accepting the choice. """ cls.hide_errors() selected_code = cls._pick_selected_option() if not selected_code: cls.select_el.style.border = "2px solid red" return cls.selected_code = selected_code cls.code = str(selected_code) cls.original_author_el.value = cls.code_to_data[selected_code].get( "alt_name", str(cls.code_to_data[selected_code]) ) cls.hide() @classmethod def set_select(cls, authors): """ Put data into ``<select>`` element. Args: authors (dict): Dictionary with author informations returned from aleph REST API. Format: ``{"name": .., "code": .., "linked_forms": ["..",]}``. """ cls.select_el.html = "" if not authors: cls.select_el.disabled = True cls.select_el <= html.OPTION("Nic nenalezeno!") return cls.select_el.disabled = False for author_dict in authors: name = author_dict.get("name") code = author_dict.get("code") alt_name = author_dict.get("alt_name", name) if not (name and code): continue cls.code_to_data[code] = author_dict cls.select_el <= html.OPTION(alt_name, value=code) @classmethod def bind(cls): """ Bind the callbacks to the buttons. """ document["show_author_picker"].bind("click", lambda x: cls.show()) cls.storno_btn_el.bind("click", lambda x: cls.hide()) cls.pick_btn_el.bind("click", cls.on_pick_button_pressed) @classmethod def __get__(cls, obj, objtype): if not SWITCHER_EL.checked: return None return cls.code_to_data[cls.selected_code] @classmethod def __set__(cls, obj, value): # called by reset() if not value: cls.selected_code = None cls.original_author_el.value = "" return if type(value) in [list, tuple]: value = value[0] code = value["code"] cls.code_to_data[code] = value cls.selected_code = code cls.original_author_el.value = cls.code_to_data[code].get( "alt_name", str(cls.code_to_data[code]) ) @classmethod def validate(cls): """ Validate required elements. """ if not SWITCHER_EL.checked: return True if not cls.selected_code: cls.original_author_el.style.border = "2px solid red" return False cls.original_author_el.style.border = "0" return True class AuthorPickerAdapter(AuthorPicker): """ Adapter of the :class:`AuthorPicker` to aleph REST API. This adapter is mapped to the key / button press. It then launches querying of the REST API in periodic interval, updating the progress bar and so on. """ @classmethod def on_complete(cls, req): """ Callback called when the request was received. """ # handle http errors if not (req.status == 200 or req.status == 0): alert("Couldn't connect to authority base.") LogView.add( "Error when calling Aleph authority base: %s" % req.text ) AuthorBar.hide() return AuthorBar.hide() cls.set_select(json.loads(req.text)) @classmethod def start(cls, ev): """ Event handler which starts the request to REST API. """ # somehow the first call doesn't stop the propagation ev.stopPropagation() ev.preventDefault() # make sure, that `author` was filled author = cls.input_el.value.strip() if not author: cls.input_el.style.border = "2px solid red" return cls.hide_errors() AuthorBar.show(50) make_request( url=join(settings.API_PATH, "aleph/authors_by_name"), data={"name": author}, on_complete=cls.on_complete ) @classmethod def bind(cls): """ Bind the buttons to adapter's event handler. """ super(cls, cls).bind() cls.search_btn_el.bind("click", cls.start) cls.input_el.bind("keypress", func_on_enter(cls.start)) AuthorPickerAdapter.bind()
mit
CivicKnowledge/metaeditor
editor/migrations/0006_auto_20150309_0945.py
1
6631
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import models, migrations import mptt.fields from django.conf import settings class Migration(migrations.Migration): dependencies = [ ('editor', '0005_auto_20150222_0508'), ] operations = [ migrations.RemoveField( model_name='dataset', name='coverage_name', ), migrations.RemoveField( model_name='dataset', name='coverage_type', ), migrations.AddField( model_name='dataset', name='coverage', field=models.CharField(default='?', max_length=50, choices=[(b'national', b'National'), (b'state', b'State'), (b'county', b'County'), (b'sub-county', b'Sub county')]), preserve_default=False, ), migrations.AddField( model_name='dataset', name='region', field=models.CharField(default='?', max_length=100, choices=[(b'state', b'State'), (b'state_and_county', b'State and county')]), preserve_default=False, ), migrations.AlterField( model_name='category', name='name', field=models.CharField(help_text=b'The name of the category', max_length=100), preserve_default=True, ), migrations.AlterField( model_name='category', name='parent', field=mptt.fields.TreeForeignKey(blank=True, to='editor.Category', help_text=b'A link to another category', null=True), preserve_default=True, ), migrations.AlterField( model_name='dataset', name='categories', field=models.ManyToManyField(help_text=b'Multiple links to names of categories.', to='editor.Category'), preserve_default=True, ), migrations.AlterField( model_name='dataset', name='contacts', field=models.TextField(help_text=b'Freeform text of people to email or call about the dataset. '), preserve_default=True, ), migrations.AlterField( model_name='dataset', name='download_page', field=models.URLField(help_text=b'URL of a web page where dataset files can be downloaded.'), preserve_default=True, ), migrations.AlterField( model_name='dataset', name='end_year', field=models.IntegerField(help_text=b'The last year for which the dataset has data.'), preserve_default=True, ), migrations.AlterField( model_name='dataset', name='entry_time_minutes', field=models.IntegerField(help_text=b'A record of how long the user spent creating the record.'), preserve_default=True, ), migrations.AlterField( model_name='dataset', name='formats', field=models.ManyToManyField(help_text=b'Collection of Formats associated with this dataset.', to='editor.Format'), preserve_default=True, ), migrations.AlterField( model_name='dataset', name='page', field=models.URLField(help_text=b'URL of a web page about the dataset.'), preserve_default=True, ), migrations.AlterField( model_name='dataset', name='start_year', field=models.IntegerField(help_text=b'The first year for which the dataset has data.'), preserve_default=True, ), migrations.AlterField( model_name='dataset', name='title', field=models.CharField(help_text=b'The title of the dataset.', max_length=200), preserve_default=True, ), migrations.AlterField( model_name='dataset', name='user', field=models.ForeignKey(help_text=b'Link to the user that edited this dataset. ', to=settings.AUTH_USER_MODEL), preserve_default=True, ), migrations.AlterField( model_name='dataset', name='variant', field=models.CharField(help_text=b'Distinguished this dataset from similar datasets.', max_length=100), preserve_default=True, ), migrations.AlterField( model_name='format', name='name', field=models.CharField(help_text=b'The name of the format.', max_length=100), preserve_default=True, ), migrations.AlterField( model_name='format', name='parent', field=mptt.fields.TreeForeignKey(blank=True, to='editor.Format', help_text=b'A link to another format.', null=True), preserve_default=True, ), migrations.AlterField( model_name='source', name='abbreviation', field=models.CharField(help_text=b'A common abbreviation for the name of the source, such as "HHS".', max_length=50), preserve_default=True, ), migrations.AlterField( model_name='source', name='about', field=models.TextField(help_text=b'Freeform text, paragraph length.'), preserve_default=True, ), migrations.AlterField( model_name='source', name='categories', field=models.ManyToManyField(help_text=b'Multiple links to names of categories.', to='editor.Category'), preserve_default=True, ), migrations.AlterField( model_name='source', name='domain', field=models.CharField(help_text=b'A short string, by default derived from the Home page url.', max_length=50), preserve_default=True, ), migrations.AlterField( model_name='source', name='homepage', field=models.URLField(help_text=b'URL of the home page for the organization.'), preserve_default=True, ), migrations.AlterField( model_name='source', name='name', field=models.CharField(help_text=b'Formal name of the source. such as "Department of Health and Human Services".', max_length=200), preserve_default=True, ), migrations.AlterField( model_name='source', name='parent', field=mptt.fields.TreeForeignKey(blank=True, to='editor.Source', help_text=b'A link to another source.', null=True), preserve_default=True, ), ]
mit
xiangke/pycopia
mibs/pycopia/mibs/HPR_MIB.py
1
21285
# python # This file is generated by a program (mib2py). Any edits will be lost. from pycopia.aid import Enum import pycopia.SMI.Basetypes Range = pycopia.SMI.Basetypes.Range Ranges = pycopia.SMI.Basetypes.Ranges from pycopia.SMI.Objects import ColumnObject, MacroObject, NotificationObject, RowObject, ScalarObject, NodeObject, ModuleObject, GroupObject # imports from SNMPv2_SMI import Counter32, Gauge32, Unsigned32, TimeTicks, OBJECT_TYPE, MODULE_IDENTITY from SNMPv2_CONF import MODULE_COMPLIANCE, OBJECT_GROUP from SNA_NAU_MIB import snanauMIB from SNMPv2_TC import DisplayString, DateAndTime, TimeStamp, TEXTUAL_CONVENTION from APPN_MIB import SnaControlPointName class HPR_MIB(ModuleObject): path = '/usr/share/snmp/mibs/ietf/HPR-MIB' conformance = 3 name = 'HPR-MIB' language = 2 description = 'This is the MIB module for objects used to\nmanage network devices with HPR capabilities.' # nodes class hprMIB(NodeObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6]) name = 'hprMIB' class hprObjects(NodeObject): OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1]) name = 'hprObjects' class hprGlobal(NodeObject): OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 1]) name = 'hprGlobal' class hprAnrRouting(NodeObject): OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 2]) name = 'hprAnrRouting' class hprTransportUser(NodeObject): OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 3]) name = 'hprTransportUser' class hprRtp(NodeObject): OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4]) name = 'hprRtp' class hprRtpGlobe(NodeObject): OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 1]) name = 'hprRtpGlobe' class hprConformance(NodeObject): OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 2]) name = 'hprConformance' class hprCompliances(NodeObject): OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 2, 1]) name = 'hprCompliances' class hprGroups(NodeObject): OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 2, 2]) name = 'hprGroups' # macros # types class HprNceTypes(pycopia.SMI.Basetypes.BITS): status = 1 enumerations = [Enum(0, 'controlPoint'), Enum(1, 'logicalUnit'), Enum(2, 'boundaryFunction'), Enum(3, 'routeSetup')] class HprRtpCounter(pycopia.SMI.Basetypes.Counter32): status = 1 # scalars class hprNodeCpName(ScalarObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 1, 1]) syntaxobject = SnaControlPointName class hprOperatorPathSwitchSupport(ScalarObject): status = 1 access = 4 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 1, 2]) syntaxobject = pycopia.SMI.Basetypes.Enumeration enumerations = [Enum(1, 'notSupported'), Enum(2, 'switchTriggerSupported'), Enum(3, 'switchToPathSupported')] class hprAnrsAssigned(ScalarObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 2, 1]) syntaxobject = pycopia.SMI.Basetypes.Counter32 access = 4 units = 'ANR labels' class hprAnrCounterState(ScalarObject): status = 1 access = 5 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 2, 2]) syntaxobject = pycopia.SMI.Basetypes.Enumeration enumerations = [Enum(1, 'notActive'), Enum(2, 'active')] class hprAnrCounterStateTime(ScalarObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 2, 3]) syntaxobject = pycopia.SMI.Basetypes.DateAndTime class hprRtpGlobeConnSetups(ScalarObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 1, 1]) syntaxobject = pycopia.SMI.Basetypes.Counter32 access = 4 units = 'RTP connection setups' class hprRtpGlobeCtrState(ScalarObject): status = 1 access = 5 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 1, 2]) syntaxobject = pycopia.SMI.Basetypes.Enumeration enumerations = [Enum(1, 'notActive'), Enum(2, 'active')] class hprRtpGlobeCtrStateTime(ScalarObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 1, 3]) syntaxobject = pycopia.SMI.Basetypes.DateAndTime # columns class hprAnrLabel(ColumnObject): access = 2 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 2, 4, 1, 1]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprAnrType(ColumnObject): status = 1 access = 4 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 2, 4, 1, 2]) syntaxobject = pycopia.SMI.Basetypes.Enumeration enumerations = [Enum(1, 'nce'), Enum(2, 'tg')] class hprAnrOutTgDest(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 2, 4, 1, 3]) syntaxobject = pycopia.SMI.Basetypes.DisplayString class hprAnrOutTgNum(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 2, 4, 1, 4]) syntaxobject = pycopia.SMI.Basetypes.Integer32 class hprAnrPacketsReceived(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 2, 4, 1, 5]) syntaxobject = pycopia.SMI.Basetypes.Counter32 access = 4 units = 'ANR packets' class hprAnrCounterDisconTime(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 2, 4, 1, 6]) syntaxobject = pycopia.SMI.Basetypes.TimeStamp class hprNceId(ColumnObject): access = 2 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 3, 1, 1, 1]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprNceType(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 3, 1, 1, 2]) syntaxobject = HprNceTypes class hprNceDefault(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 3, 1, 1, 3]) syntaxobject = HprNceTypes class hprNceInstanceId(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 3, 1, 1, 4]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpLocNceId(ColumnObject): access = 2 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 1]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpLocTcid(ColumnObject): access = 2 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 2]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpRemCpName(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 3]) syntaxobject = SnaControlPointName class hprRtpRemNceId(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 4]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpRemTcid(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 5]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpPathSwitchTrigger(ColumnObject): status = 1 access = 5 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 6]) syntaxobject = pycopia.SMI.Basetypes.Enumeration enumerations = [Enum(1, 'ready'), Enum(2, 'switchPathNow')] class hprRtpRscv(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 7]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpTopic(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 8]) syntaxobject = pycopia.SMI.Basetypes.DisplayString class hprRtpState(ColumnObject): status = 1 access = 4 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 9]) syntaxobject = pycopia.SMI.Basetypes.Enumeration enumerations = [Enum(1, 'rtpListening'), Enum(2, 'rtpCalling'), Enum(3, 'rtpConnected'), Enum(4, 'rtpPathSwitching'), Enum(5, 'rtpDisconnecting'), Enum(99, 'other')] class hprRtpUpTime(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 10]) syntaxobject = pycopia.SMI.Basetypes.TimeTicks access = 4 units = '1/100ths of a second' class hprRtpLivenessTimer(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 11]) syntaxobject = pycopia.SMI.Basetypes.Unsigned32 access = 4 units = '1/100ths of a second' class hprRtpShortReqTimer(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 12]) syntaxobject = pycopia.SMI.Basetypes.Unsigned32 access = 4 units = '1/100ths of a second' class hprRtpPathSwTimer(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 13]) syntaxobject = pycopia.SMI.Basetypes.Unsigned32 access = 4 units = '1/100ths of a second' class hprRtpLivenessTimeouts(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 14]) syntaxobject = HprRtpCounter access = 4 units = 'liveness timeouts' class hprRtpShortReqTimeouts(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 15]) syntaxobject = HprRtpCounter access = 4 units = 'short request timeouts' class hprRtpMaxSendRate(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 16]) syntaxobject = pycopia.SMI.Basetypes.Gauge32 access = 4 units = 'bytes per second' class hprRtpMinSendRate(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 17]) syntaxobject = pycopia.SMI.Basetypes.Gauge32 access = 4 units = 'bytes per second' class hprRtpCurSendRate(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 18]) syntaxobject = pycopia.SMI.Basetypes.Gauge32 access = 4 units = 'bytes per second' class hprRtpSmRdTripDelay(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 19]) syntaxobject = pycopia.SMI.Basetypes.Gauge32 access = 4 units = '1/1000ths of a second' class hprRtpSendPackets(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 20]) syntaxobject = HprRtpCounter access = 4 units = 'RTP packets' class hprRtpRecvPackets(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 21]) syntaxobject = HprRtpCounter access = 4 units = 'RTP packets' class hprRtpSendBytes(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 22]) syntaxobject = HprRtpCounter access = 4 units = 'bytes' class hprRtpRecvBytes(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 23]) syntaxobject = HprRtpCounter access = 4 units = 'bytes' class hprRtpRetrPackets(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 24]) syntaxobject = HprRtpCounter access = 4 units = 'RTP packets' class hprRtpPacketsDiscarded(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 25]) syntaxobject = HprRtpCounter access = 4 units = 'RTP packets' class hprRtpDetectGaps(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 26]) syntaxobject = HprRtpCounter access = 4 units = 'gaps' class hprRtpRateReqSends(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 27]) syntaxobject = HprRtpCounter access = 4 units = 'rate requests' class hprRtpOkErrPathSws(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 28]) syntaxobject = HprRtpCounter access = 4 units = 'path switch attempts' class hprRtpBadErrPathSws(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 29]) syntaxobject = HprRtpCounter access = 4 units = 'path switch attempts' class hprRtpOkOpPathSws(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 30]) syntaxobject = HprRtpCounter access = 4 units = 'path switches' class hprRtpBadOpPathSws(ColumnObject): status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 31]) syntaxobject = HprRtpCounter access = 4 units = 'path switches' class hprRtpCounterDisconTime(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1, 32]) syntaxobject = pycopia.SMI.Basetypes.TimeStamp class hprRtpStatusLocNceId(ColumnObject): access = 2 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 1]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpStatusLocTcid(ColumnObject): access = 2 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 2]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpStatusIndex(ColumnObject): access = 2 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 3]) syntaxobject = pycopia.SMI.Basetypes.Unsigned32 class hprRtpStatusStartTime(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 4]) syntaxobject = pycopia.SMI.Basetypes.DateAndTime class hprRtpStatusEndTime(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 5]) syntaxobject = pycopia.SMI.Basetypes.DateAndTime class hprRtpStatusRemCpName(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 6]) syntaxobject = SnaControlPointName class hprRtpStatusRemNceId(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 7]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpStatusRemTcid(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 8]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpStatusNewRscv(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 9]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpStatusOldRscv(ColumnObject): access = 4 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 10]) syntaxobject = pycopia.SMI.Basetypes.OctetString class hprRtpStatusCause(ColumnObject): status = 1 access = 4 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 11]) syntaxobject = pycopia.SMI.Basetypes.Enumeration enumerations = [Enum(1, 'other'), Enum(2, 'rtpConnFail'), Enum(3, 'locLinkFail'), Enum(4, 'remLinkFail'), Enum(5, 'operRequest')] class hprRtpStatusLastAttemptResult(ColumnObject): status = 1 access = 4 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1, 12]) syntaxobject = pycopia.SMI.Basetypes.Enumeration enumerations = [Enum(1, 'successful'), Enum(2, 'initiatorMoving'), Enum(3, 'directorySearchFailed'), Enum(4, 'rscvCalculationFailed'), Enum(5, 'negativeRouteSetupReply'), Enum(6, 'backoutRouteSetupReply'), Enum(7, 'timeoutDuringFirstAttempt'), Enum(8, 'otherUnsuccessful')] # rows class hprAnrRoutingEntry(RowObject): status = 1 index = pycopia.SMI.Objects.IndexObjects([hprAnrLabel], False) OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 2, 4, 1]) access = 2 columns = {'hprAnrLabel': hprAnrLabel, 'hprAnrType': hprAnrType, 'hprAnrOutTgDest': hprAnrOutTgDest, 'hprAnrOutTgNum': hprAnrOutTgNum, 'hprAnrPacketsReceived': hprAnrPacketsReceived, 'hprAnrCounterDisconTime': hprAnrCounterDisconTime} class hprNceEntry(RowObject): status = 1 index = pycopia.SMI.Objects.IndexObjects([hprNceId], False) OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 3, 1, 1]) access = 2 columns = {'hprNceId': hprNceId, 'hprNceType': hprNceType, 'hprNceDefault': hprNceDefault, 'hprNceInstanceId': hprNceInstanceId} class hprRtpEntry(RowObject): status = 1 index = pycopia.SMI.Objects.IndexObjects([hprRtpLocNceId, hprRtpLocTcid], False) OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 2, 1]) access = 2 columns = {'hprRtpLocNceId': hprRtpLocNceId, 'hprRtpLocTcid': hprRtpLocTcid, 'hprRtpRemCpName': hprRtpRemCpName, 'hprRtpRemNceId': hprRtpRemNceId, 'hprRtpRemTcid': hprRtpRemTcid, 'hprRtpPathSwitchTrigger': hprRtpPathSwitchTrigger, 'hprRtpRscv': hprRtpRscv, 'hprRtpTopic': hprRtpTopic, 'hprRtpState': hprRtpState, 'hprRtpUpTime': hprRtpUpTime, 'hprRtpLivenessTimer': hprRtpLivenessTimer, 'hprRtpShortReqTimer': hprRtpShortReqTimer, 'hprRtpPathSwTimer': hprRtpPathSwTimer, 'hprRtpLivenessTimeouts': hprRtpLivenessTimeouts, 'hprRtpShortReqTimeouts': hprRtpShortReqTimeouts, 'hprRtpMaxSendRate': hprRtpMaxSendRate, 'hprRtpMinSendRate': hprRtpMinSendRate, 'hprRtpCurSendRate': hprRtpCurSendRate, 'hprRtpSmRdTripDelay': hprRtpSmRdTripDelay, 'hprRtpSendPackets': hprRtpSendPackets, 'hprRtpRecvPackets': hprRtpRecvPackets, 'hprRtpSendBytes': hprRtpSendBytes, 'hprRtpRecvBytes': hprRtpRecvBytes, 'hprRtpRetrPackets': hprRtpRetrPackets, 'hprRtpPacketsDiscarded': hprRtpPacketsDiscarded, 'hprRtpDetectGaps': hprRtpDetectGaps, 'hprRtpRateReqSends': hprRtpRateReqSends, 'hprRtpOkErrPathSws': hprRtpOkErrPathSws, 'hprRtpBadErrPathSws': hprRtpBadErrPathSws, 'hprRtpOkOpPathSws': hprRtpOkOpPathSws, 'hprRtpBadOpPathSws': hprRtpBadOpPathSws, 'hprRtpCounterDisconTime': hprRtpCounterDisconTime} class hprRtpStatusEntry(RowObject): status = 1 index = pycopia.SMI.Objects.IndexObjects([hprRtpStatusLocNceId, hprRtpStatusLocTcid, hprRtpStatusIndex], False) OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 1, 4, 3, 1]) access = 2 columns = {'hprRtpStatusLocNceId': hprRtpStatusLocNceId, 'hprRtpStatusLocTcid': hprRtpStatusLocTcid, 'hprRtpStatusIndex': hprRtpStatusIndex, 'hprRtpStatusStartTime': hprRtpStatusStartTime, 'hprRtpStatusEndTime': hprRtpStatusEndTime, 'hprRtpStatusRemCpName': hprRtpStatusRemCpName, 'hprRtpStatusRemNceId': hprRtpStatusRemNceId, 'hprRtpStatusRemTcid': hprRtpStatusRemTcid, 'hprRtpStatusNewRscv': hprRtpStatusNewRscv, 'hprRtpStatusOldRscv': hprRtpStatusOldRscv, 'hprRtpStatusCause': hprRtpStatusCause, 'hprRtpStatusLastAttemptResult': hprRtpStatusLastAttemptResult} # notifications (traps) # groups class hprGlobalConfGroup(GroupObject): access = 2 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 2, 2, 1]) group = [hprNodeCpName, hprOperatorPathSwitchSupport] class hprAnrRoutingConfGroup(GroupObject): access = 2 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 2, 2, 2]) group = [hprAnrsAssigned, hprAnrCounterState, hprAnrCounterStateTime, hprAnrType, hprAnrOutTgDest, hprAnrOutTgNum, hprAnrPacketsReceived, hprAnrCounterDisconTime] class hprTransportUserConfGroup(GroupObject): access = 2 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 2, 2, 3]) group = [hprNceType, hprNceDefault, hprNceInstanceId] class hprRtpConfGroup(GroupObject): access = 2 status = 1 OID = pycopia.SMI.Basetypes.ObjectIdentifier([1, 3, 6, 1, 2, 1, 34, 6, 2, 2, 4]) group = [hprRtpGlobeConnSetups, hprRtpGlobeCtrState, hprRtpGlobeCtrStateTime, hprRtpRemCpName, hprRtpRemNceId, hprRtpRemTcid, hprRtpPathSwitchTrigger, hprRtpRscv, hprRtpTopic, hprRtpState, hprRtpUpTime, hprRtpLivenessTimer, hprRtpShortReqTimer, hprRtpPathSwTimer, hprRtpLivenessTimeouts, hprRtpShortReqTimeouts, hprRtpMaxSendRate, hprRtpMinSendRate, hprRtpCurSendRate, hprRtpSmRdTripDelay, hprRtpSendPackets, hprRtpRecvPackets, hprRtpSendBytes, hprRtpRecvBytes, hprRtpRetrPackets, hprRtpPacketsDiscarded, hprRtpDetectGaps, hprRtpRateReqSends, hprRtpOkErrPathSws, hprRtpBadErrPathSws, hprRtpOkOpPathSws, hprRtpBadOpPathSws, hprRtpCounterDisconTime, hprRtpStatusStartTime, hprRtpStatusEndTime, hprRtpStatusRemNceId, hprRtpStatusRemTcid, hprRtpStatusRemCpName, hprRtpStatusNewRscv, hprRtpStatusOldRscv, hprRtpStatusCause, hprRtpStatusLastAttemptResult] # capabilities # special additions # Add to master OIDMAP. from pycopia import SMI SMI.update_oidmap(__name__)
lgpl-2.1
xiaolvmu/flounder-kernel
tools/perf/scripts/python/syscall-counts-by-pid.py
11180
1927
# system call counts, by pid # (c) 2010, Tom Zanussi <tzanussi@gmail.com> # Licensed under the terms of the GNU GPL License version 2 # # Displays system-wide system call totals, broken down by syscall. # If a [comm] arg is specified, only syscalls called by [comm] are displayed. import os, sys sys.path.append(os.environ['PERF_EXEC_PATH'] + \ '/scripts/python/Perf-Trace-Util/lib/Perf/Trace') from perf_trace_context import * from Core import * from Util import syscall_name usage = "perf script -s syscall-counts-by-pid.py [comm]\n"; for_comm = None for_pid = None if len(sys.argv) > 2: sys.exit(usage) if len(sys.argv) > 1: try: for_pid = int(sys.argv[1]) except: for_comm = sys.argv[1] syscalls = autodict() def trace_begin(): print "Press control+C to stop and show the summary" def trace_end(): print_syscall_totals() def raw_syscalls__sys_enter(event_name, context, common_cpu, common_secs, common_nsecs, common_pid, common_comm, id, args): if (for_comm and common_comm != for_comm) or \ (for_pid and common_pid != for_pid ): return try: syscalls[common_comm][common_pid][id] += 1 except TypeError: syscalls[common_comm][common_pid][id] = 1 def print_syscall_totals(): if for_comm is not None: print "\nsyscall events for %s:\n\n" % (for_comm), else: print "\nsyscall events by comm/pid:\n\n", print "%-40s %10s\n" % ("comm [pid]/syscalls", "count"), print "%-40s %10s\n" % ("----------------------------------------", \ "----------"), comm_keys = syscalls.keys() for comm in comm_keys: pid_keys = syscalls[comm].keys() for pid in pid_keys: print "\n%s [%d]\n" % (comm, pid), id_keys = syscalls[comm][pid].keys() for id, val in sorted(syscalls[comm][pid].iteritems(), \ key = lambda(k, v): (v, k), reverse = True): print " %-38s %10d\n" % (syscall_name(id), val),
gpl-2.0
lfrdm/medpy
bin/others/registration/register_via_basepoints.py
2
10705
#!/usr/bin/python "Register two binary 3D RV volumes via there base-points." # build-in modules import argparse import logging # third-party modules import scipy from scipy.ndimage.morphology import binary_erosion from scipy.spatial.distance import pdist, squareform # path changes # own modules from medpy.core import Logger from medpy.io import load, header from medpy.core.exceptions import ArgumentError from geometry import line_from_points,\ split_line_to_sections, perpendicular_line, find_nearest, distance,\ shiftp, angle_between_vectors import math # information __author__ = "Oskar Maier" __version__ = "r0.1.0, 2012-07-27" __email__ = "oskar.maier@googlemail.com" __status__ = "Release" __description__ = """ Register two binary 3D RV volumes via there base-points. Prints a 'elastix'/'transformix'-ready transformation to the stdout. Returned transformation is from moving to fixed image. """ # SOME NOTES ON 'ELASTIX' # 1. 'elastix' performs shifting before rotation! # 2. 'elastix' works on the real world coordinates (i.e. with voxel spacing of 0) # 3. for the angle calculation, the voxel spacing is not relevant # code def main(): args = getArguments(getParser()) # prepare logger logger = Logger.getInstance() if args.debug: logger.setLevel(logging.DEBUG) elif args.verbose: logger.setLevel(logging.INFO) # load input images data_fixed, header_fixed = load(args.fixed) data_moving, header_moving = load(args.moving) # convert to binary arrays data_fixed = data_fixed.astype(scipy.bool_) data_moving = data_moving.astype(scipy.bool_) # check that they are 3D volumes and contain an object if not 3 == data_fixed.ndim: raise ArgumentError('The fixed image has {} instead of the expected 3 dimensions.'.format(data_fixed.ndim)) if not 3 == data_moving.ndim: raise ArgumentError('The moving image has {} instead of the expected 3 dimensions.'.format(data_moving.ndim)) if not scipy.any(data_fixed): raise ArgumentError('The fixed image contains no binary object.') if not scipy.any(data_moving): raise ArgumentError('The moving image contains no binary object.') # get voxel spacing of fixed image fixed_spacing = header.get_pixel_spacing(header_fixed) # extract the first basal slices form both RV objects basal_fixed, basal_fixed_spacing = extract_basal_slice(data_fixed, header_fixed) basal_moving, basal_moving_spacing = extract_basal_slice(data_moving, header_moving) logger.debug('Extracted basal slices fixed: {} and moving: {} with voxel spacing {} resp. {}.'.format(basal_fixed.shape, basal_moving.shape, basal_fixed_spacing, basal_moving_spacing)) # get points of interest fixed_basep, fixed_otherp = get_points_of_interest(basal_fixed) moving_basep, moving_otherp = get_points_of_interest(basal_moving) logger.debug('Points of interest found are fixed: {} / {} and moving: {} / {}.'.format(fixed_basep, fixed_otherp, moving_basep, moving_otherp)) # translate all points of interest to physical coordinate system fixed_basep = [x * y for x, y in zip(fixed_basep, basal_fixed_spacing)] fixed_otherp = [x * y for x, y in zip(fixed_otherp, basal_fixed_spacing)] moving_basep = [x * y for x, y in zip(moving_basep, basal_moving_spacing)] moving_otherp = [x * y for x, y in zip(moving_otherp, basal_moving_spacing)] logger.debug('Points of interest translated to real-world coordinates are fixed: {} / {} and moving: {} / {}.'.format(fixed_basep, fixed_otherp, moving_basep, moving_otherp)) # determine shift to unite the two base-points shift = (fixed_basep[0] - moving_basep[0], fixed_basep[1] - moving_basep[1]) logger.debug('Shift to unite base-point is {}.'.format(shift)) # shift the vector end-point of the moving object's vector so that it shares the # same base as the fixed vector moving_otherp = shiftp(moving_otherp, shift) logger.debug('Shifted vector end-point of moving image is {}.'.format(moving_otherp)) # assure correctness of shift if not scipy.all([x == y for x, y in zip(fixed_basep, shiftp(moving_basep, shift))]): raise ArgumentError('Aligning base-point through shifting failed due to unknown reason: {} does not equal {}.'.format(shiftp(moving_basep, shift), fixed_basep)) # shift both vector end-points to origin base fixed_otherp = shiftp(fixed_otherp, map(lambda x: -1. * x, fixed_basep)) moving_otherp = shiftp(moving_otherp, map(lambda x: -1. * x, fixed_basep)) # determine angle angle = angle_between_vectors(fixed_otherp, moving_otherp) logger.debug('Angle set to {} degree in radians.'.format(math.degrees(angle))) # determine angle turn point turn_point = fixed_basep logger.debug('Turn point set to {} in real-world coordinates.'.format(turn_point)) # reverse shift to fit into the 'elastix' view shift = [-1. * x for x in shift] # print results print '// {}'.format(math.degrees(angle)) print """ //# SOME NOTES ON 'ELASTIX' //# 1. 'elastix' performs shifting before rotation! //# 2. 'elastix' works on the real world coordinates (i.e. with voxel spacing of 0) """ print transform_string(data_fixed.shape, fixed_spacing, [0] + list(shift), [angle, 0, 0], [0] + list(turn_point)) logger.info("Successfully terminated.") def get_points_of_interest(arr): """ Expects a binary object in the array. FInds the two contour points that are the farthest apart, then determines which of them is the base point of the RV and returns this first and the other as second return value. """ ######### # 1: Find points in objects contour with the largest distance between them. ######### # extract only outer contour arr = arr - binary_erosion(arr) # extract all positions of the objects contour points = scipy.asarray(arr.nonzero()).T # compute pairwise distances distances = squareform(pdist(points, 'euclidean')) # get positon of largest distance position = scipy.unravel_index(scipy.argmax(distances), (len(points), len(points))) # recompute between which points the largest distance was found first = points[position[0]] second = points[position[1]] #logger.debug('Longest distance found between {} and {}.'.format(first, second)) ######### # 2: Determine which of these is the base point ######### # go along perpendicular lines, find intersections with contours and keep longest only intersection = False longest_length = 0 longest_line = line_from_points(first, second) segment_points = split_line_to_sections(5, first, second) for sp in segment_points: sline = perpendicular_line(longest_line, sp) nearest = find_nearest(sline, points, 10) if distance(nearest[0], nearest[1]) > longest_length: longest_length = distance(nearest[0], nearest[1]) intersection = sp # determine which of the first two points are nearest to the longest line and return them if distance(intersection, first) < distance(intersection, second): return (first, second) else: return (second, first) def extract_basal_slice(arr, head): """ Takes a 3D array, iterates over the first dimension and returns the first 2D plane which contains any non-zero values as we as its voxel spacing. """ for plane in arr: if scipy.any(plane): # get voxel spacing spacing = list(header.get_pixel_spacing(head)) spacing = spacing[1:3] # return plane and spacing return (plane, spacing) raise ArgumentError('The supplied array does not contain any object.') def getArguments(parser): "Provides additional validation of the arguments collected by argparse." return parser.parse_args() def getParser(): "Creates and returns the argparse parser object." parser = argparse.ArgumentParser(description=__description__) parser.add_argument('fixed', help='The fixed image.') parser.add_argument('moving', help='The moving image.') parser.add_argument('-v', dest='verbose', action='store_true', help='Display more information.') parser.add_argument('-d', dest='debug', action='store_true', help='Display debug information.') return parser def transform_string(shape, spacing, shift, angles, turn_point): """Returns a finished transformation file string.""" # NOTE: # - the transformation file requires real-world coordinates, the points and shifts have therefore to be multiplied with the voxel spacing base = """ (Transform "EulerTransform") (NumberOfParameters 6) (TransformParameters {xangle:.10f} {yangle:.10f} {zangle:.10f} {xshift:.10f} {yshift:.10f} {zshift:.10f}) (InitialTransformParametersFileName "NoInitialTransform") (HowToCombineTransforms "Compose") // Image specific (FixedImageDimension 3) (MovingImageDimension 3) (FixedInternalImagePixelType "float") (MovingInternalImagePixelType "float") (Size {xsize:d} {ysize:d} {zsize:d}) (Index 0 0 0) (Spacing {xspacing:.10f} {yspacing:.10f} {zspacing:.10f}) (Origin 0.0000000000 0.0000000000 0.0000000000) //(Direction 1.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000) // !TODO: Compute/read this! (UseDirectionCosines "true") // EulerTransform specific (CenterOfRotationPoint {xturn_point} {yturn_point} {zturn_point}) (ComputeZYX "false") // ResampleInterpolator specific (ResampleInterpolator "FinalBSplineInterpolator") (FinalBSplineInterpolationOrder 0) // Resampler specific (Resampler "DefaultResampler") (DefaultPixelValue 0.000000) (ResultImageFormat "nii") (ResultImagePixelType "short") (CompressResultImage "false") """ shape = map(int, shape) spacing = map(float, spacing) angles = map(float, angles) turn_point = map(float, turn_point) return base.format(xsize=shape[0], ysize=shape[1], zsize=shape[2], xspacing=spacing[0], yspacing=spacing[1], zspacing=spacing[2], xangle=angles[0], yangle=angles[1], zangle=angles[2], xshift=shift[0], yshift=shift[1], zshift=shift[2], xturn_point=turn_point[0], yturn_point=turn_point[1], zturn_point=turn_point[2]) if __name__ == "__main__": main()
gpl-3.0
pfmooney/dd-agent
checks.d/cacti.py
34
8177
# stdlib from collections import namedtuple from fnmatch import fnmatch import os import time # 3rd party try: import rrdtool except ImportError: rrdtool = None import pymysql # project from checks import AgentCheck CFUNC_TO_AGGR = { 'AVERAGE': 'avg', 'MAXIMUM': 'max', 'MINIMUM': 'min' } CACTI_TO_DD = { 'hdd_free': 'system.disk.free', 'hdd_used': 'system.disk.used', 'swap_free': 'system.swap.free', 'load_1min': 'system.load.1', 'load_5min': 'system.load.5', 'load_15min': 'system.load.15', 'mem_buffers': 'system.mem.buffered', 'proc': 'system.proc.running', 'users': 'system.users.current', 'mem_swap': 'system.swap.free', 'ping': 'system.ping.latency' } class Cacti(AgentCheck): def __init__(self, name, init_config, agentConfig): AgentCheck.__init__(self, name, init_config, agentConfig) self.last_ts = {} def get_library_versions(self): if rrdtool is not None: return {"rrdtool": rrdtool.__version__} return {"rrdtool": "Not Found"} def check(self, instance): if rrdtool is None: raise Exception("Unable to import python rrdtool module") # Load the instance config config = self._get_config(instance) connection = pymysql.connect(config.host, config.user, config.password, config.db) self.log.debug("Connected to MySQL to fetch Cacti metadata") # Get whitelist patterns, if available patterns = self._get_whitelist_patterns(config.whitelist) # Fetch the RRD metadata from MySQL rrd_meta = self._fetch_rrd_meta(connection, config.rrd_path, patterns, config.field_names) # Load the metrics from each RRD, tracking the count as we go metric_count = 0 for hostname, device_name, rrd_path in rrd_meta: m_count = self._read_rrd(rrd_path, hostname, device_name) metric_count += m_count self.gauge('cacti.metrics.count', metric_count) def _get_whitelist_patterns(self, whitelist): patterns = [] if whitelist: if not os.path.isfile(whitelist) or not os.access(whitelist, os.R_OK): # Don't run the check if the whitelist is unavailable self.log.exception("Unable to read whitelist file at %s" % (whitelist)) wl = open(whitelist) for line in wl: patterns.append(line.strip()) wl.close() return patterns def _get_config(self, instance): required = ['mysql_host', 'mysql_user', 'rrd_path'] for param in required: if not instance.get(param): raise Exception("Cacti instance missing %s. Skipping." % (param)) host = instance.get('mysql_host') user = instance.get('mysql_user') password = instance.get('mysql_password', '') or '' db = instance.get('mysql_db', 'cacti') rrd_path = instance.get('rrd_path') whitelist = instance.get('rrd_whitelist') field_names = instance.get('field_names', ['ifName', 'dskDevice']) Config = namedtuple('Config', [ 'host', 'user', 'password', 'db', 'rrd_path', 'whitelist', 'field_names'] ) return Config(host, user, password, db, rrd_path, whitelist, field_names) def _read_rrd(self, rrd_path, hostname, device_name): ''' Main metric fetching method ''' metric_count = 0 try: info = rrdtool.info(rrd_path) except Exception: # Unable to read RRD file, ignore it self.log.exception("Unable to read RRD file at %s" % rrd_path) return metric_count # Find the consolidation functions for the RRD metrics c_funcs = set([v for k,v in info.items() if k.endswith('.cf')]) for c in list(c_funcs): last_ts_key = '%s.%s' % (rrd_path, c) if last_ts_key not in self.last_ts: self.last_ts[last_ts_key] = int(time.time()) continue start = self.last_ts[last_ts_key] last_ts = start try: fetched = rrdtool.fetch(rrd_path, c, '--start', str(start)) except rrdtool.error: # Start time was out of range, skip this RRD self.log.warn("Time %s out of range for %s" % (rrd_path, start)) return metric_count # Extract the data (start_ts, end_ts, interval) = fetched[0] metric_names = fetched[1] points = fetched[2] for k, m_name in enumerate(metric_names): m_name = self._format_metric_name(m_name, c) for i, p in enumerate(points): ts = start_ts + (i * interval) if p[k] is None: continue # Save this metric as a gauge val = self._transform_metric(m_name, p[k]) self.gauge(m_name, val, hostname=hostname, device_name=device_name, timestamp=ts) metric_count += 1 last_ts = (ts + interval) # Update the last timestamp based on the last valid metric self.last_ts[last_ts_key] = last_ts return metric_count def _fetch_rrd_meta(self, connection, rrd_path_root, whitelist, field_names): ''' Fetch metadata about each RRD in this Cacti DB, returning a list of tuples of (hostname, device_name, rrd_path) ''' def _in_whitelist(rrd): path = rrd.replace('<path_rra>/','') for p in whitelist: if fnmatch(path, p): return True return False c = connection.cursor() and_parameters = " OR ".join(["hsc.field_name = '%s'" % field_name for field_name in field_names]) # Check for the existence of the `host_snmp_cache` table rrd_query = """ SELECT h.hostname as hostname, hsc.field_value as device_name, dt.data_source_path as rrd_path FROM data_local dl JOIN host h on dl.host_id = h.id JOIN data_template_data dt on dt.local_data_id = dl.id LEFT JOIN host_snmp_cache hsc on h.id = hsc.host_id AND dl.snmp_index = hsc.snmp_index WHERE dt.data_source_path IS NOT NULL AND dt.data_source_path != '' AND (%s OR hsc.field_name is NULL) """ % and_parameters c.execute(rrd_query) res = [] for hostname, device_name, rrd_path in c.fetchall(): if not whitelist or _in_whitelist(rrd_path): if hostname in ('localhost', '127.0.0.1'): hostname = self.hostname rrd_path = rrd_path.replace('<path_rra>', rrd_path_root) device_name = device_name or None res.append((hostname, device_name, rrd_path)) # Collect stats num_hosts = len(set([r[0] for r in res])) self.gauge('cacti.rrd.count', len(res)) self.gauge('cacti.hosts.count', num_hosts) return res def _format_metric_name(self, m_name, cfunc): ''' Format a cacti metric name into a Datadog-friendly name ''' try: aggr = CFUNC_TO_AGGR[cfunc] except KeyError: aggr = cfunc.lower() try: m_name = CACTI_TO_DD[m_name] if aggr != 'avg': m_name += '.%s' % (aggr) return m_name except KeyError: return "cacti.%s.%s" % (m_name.lower(), aggr) def _transform_metric(self, m_name, val): ''' Add any special case transformations here ''' # Report memory in MB if m_name[0:11] in ('system.mem.', 'system.disk'): return val / 1024 return val ''' For backwards compatability with pre-checks.d configuration. Convert old-style config to new-style config. '''
bsd-3-clause
Alwnikrotikz/l5rcm
models/katamodel.py
3
4173
# Copyright (C) 2011 Daniele Simonetti # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 675 Mass Ave, Cambridge, MA 02139, USA. from PySide import QtGui, QtCore import dal.query class KataItemModel(object): def __init__(self): self.name = '' self.mastery = '' self.element = '' self.id = False self.adv = None self.text = [] def __str__(self): return self.name class KataTableViewModel(QtCore.QAbstractTableModel): def __init__(self, dstore, parent = None): super(KataTableViewModel, self).__init__(parent) self.items = [] self.headers = ['Name', 'Mastery', 'Element'] self.text_color = QtGui.QBrush(QtGui.QColor(0x15, 0x15, 0x15)) self.bg_color = [ QtGui.QBrush(QtGui.QColor(0xFF, 0xEB, 0x82)), QtGui.QBrush(QtGui.QColor(0xEB, 0xFF, 0x82)) ] self.item_size = QtCore.QSize(28, 28) self.dstore = dstore def rowCount(self, parent = QtCore.QModelIndex()): return len(self.items) def columnCount(self, parent = QtCore.QModelIndex()): return len(self.headers) def headerData(self, section, orientation, role = QtCore.Qt.ItemDataRole.DisplayRole): if orientation != QtCore.Qt.Orientation.Horizontal: return None if role == QtCore.Qt.DisplayRole: return self.headers[section] return None def data(self, index, role = QtCore.Qt.UserRole): if not index.isValid() or index.row() >= len(self.items): return None item = self.items[index.row()] if role == QtCore.Qt.DisplayRole: if index.column() == 0: return item.name if index.column() == 1: return item.mastery if index.column() == 2: return item.element elif role == QtCore.Qt.ForegroundRole: return self.text_color elif role == QtCore.Qt.BackgroundRole: return self.bg_color[ index.row() % 2 ] elif role == QtCore.Qt.SizeHintRole: return self.item_size elif role == QtCore.Qt.UserRole: return item return None def flags(self, index): if not index.isValid(): return QtCore.Qt.ItemIsDropEnabled flags = QtCore.Qt.ItemIsSelectable | QtCore.Qt.ItemIsEnabled return flags def add_item(self, item): row = self.rowCount() self.beginInsertRows(QtCore.QModelIndex(), row, row) self.items.append(item) self.endInsertRows() def clean(self): self.beginResetModel() self.items = [] self.endResetModel() def build_item_model(self, ka_id): itm = KataItemModel() ka = dal.query.get_kata(self.dstore, ka_id) if ka: itm.id = ka.id itm.adv = ka_id itm.name = ka.name itm.mastery = ka.mastery #itm.element = ka.element itm.element = dal.query.get_ring(self.dstore, ka.element).text itm.text = ka.desc else: print('cannot find kata: {0}'.format(ka_id)) # TODO: translate element return itm def update_from_model(self, model): kata = model.get_kata() self.clean() for s in kata: itm = self.build_item_model(s) self.add_item(itm)
gpl-3.0
SynBioDex/pySBOL
Linux_64_2/sbol/CRISPR_example.py
9
21557
from __future__ import print_function from sbol import * setHomespace('http://sbols.org/CRISPR_Example') Config.setOption('sbol_typed_uris', False) version = '1.0.0' doc = Document() cas9_generic = ComponentDefinition('cas9_generic', BIOPAX_PROTEIN, version) doc.addComponentDefinition(cas9_generic) gRNA_generic = ComponentDefinition('gRNA_generic', BIOPAX_RNA, version) gRNA_generic.roles = [SO_SGRNA] doc.addComponentDefinition(gRNA_generic) cas9_gRNA_complex = ComponentDefinition('cas9_gRNA_complex', BIOPAX_COMPLEX, version) doc.addComponentDefinition(cas9_gRNA_complex) target_gene = ComponentDefinition('target_gene', BIOPAX_DNA, version) target_gene.roles = [SO_PROMOTER] doc.addComponentDefinition(target_gene) target = ComponentDefinition('target', BIOPAX_PROTEIN, version) doc.addComponentDefinition(target) CRISPR_Template = ModuleDefinition('CRISPR_Template', version) doc.addModuleDefinition(CRISPR_Template) Cas9Complex_Formation = CRISPR_Template.interactions.create('cas9_complex_formation') Cas9Complex_Formation.types = [SBO_NONCOVALENT_BINDING] cas9_generic_fc = CRISPR_Template.functionalComponents.create('cas9_generic') cas9_generic_fc.definition = cas9_generic.persistentIdentity cas9_generic_fc.access = SBOL_ACCESS_PUBLIC cas9_generic_fc.direction = SBOL_DIRECTION_IN_OUT cas9_generic_fc.version = version cas9_generic_participation = Cas9Complex_Formation.participations.create('cas9_generic') cas9_generic_participation.roles = [SBO_REACTANT] cas9_generic_participation.participant = cas9_generic_fc.identity gRNA_generic_fc = CRISPR_Template.functionalComponents.create('gRNA_generic') gRNA_generic_fc.definition = gRNA_generic.persistentIdentity gRNA_generic_fc.access = SBOL_ACCESS_PUBLIC gRNA_generic_fc.direction = SBOL_DIRECTION_IN_OUT gRNA_generic_fc.version = version gRNA_generic_participation = Cas9Complex_Formation.participations.create('gRNA_generic') gRNA_generic_participation.roles = [SBO_REACTANT] gRNA_generic_participation.participant = gRNA_generic_fc.identity cas9_gRNA_complex_fc = CRISPR_Template.functionalComponents.create('cas9_gRNA_complex') cas9_gRNA_complex_fc.definition = cas9_gRNA_complex.persistentIdentity cas9_gRNA_complex_fc.access = SBOL_ACCESS_PUBLIC cas9_gRNA_complex_fc.direction = SBOL_DIRECTION_IN_OUT cas9_gRNA_complex_fc.version = version cas9_gRNA_complex_participation = Cas9Complex_Formation.participations.create('cas9_gRNA_complex') cas9_gRNA_complex_participation.roles = [SBO_PRODUCT] cas9_gRNA_complex_participation.participant = cas9_gRNA_complex_fc.identity EYFP_production = CRISPR_Template.interactions.create('target_production') EYFP_production.types = [SBO_GENETIC_PRODUCTION] target_gene_fc = CRISPR_Template.functionalComponents.create('target_gene') target_gene_fc.definition = target_gene.persistentIdentity target_gene_fc.access = SBOL_ACCESS_PUBLIC target_gene_fc.direction = SBOL_DIRECTION_IN_OUT target_gene_fc.version = version target_gene_participation = EYFP_production.participations.create('target_gene') target_gene_participation.roles = [SBO_PROMOTER] target_gene_participation.participant = target_gene_fc.identity target_fc = CRISPR_Template.functionalComponents.create('target') target_fc.definition = target.persistentIdentity target_fc.access = SBOL_ACCESS_PUBLIC target_fc.direction = SBOL_DIRECTION_IN_OUT target_fc.version = version target_participation = EYFP_production.participations.create('target') target_participation.roles = [SBO_PRODUCT] target_participation.participant = target_fc.identity target_generic_gene_inhibition = CRISPR_Template.interactions.create('target_gene_inhibition') target_generic_gene_inhibition.types = [SBO_INHIBITION] cas9_gRNA_complex_participation1 = target_generic_gene_inhibition.participations.create('cas9_gRNA_complex') cas9_gRNA_complex_participation1.roles = [SBO_INHIBITOR] cas9_gRNA_complex_participation1.participant = cas9_gRNA_complex_fc.identity target_gene_participation2 = target_generic_gene_inhibition.participations.create('target_gene') target_gene_participation2.roles = [SBO_PROMOTER] target_gene_participation2.participant = target_gene_fc.identity CRa_U6_seq_elements = ('GGTTTACCGAGCTCTTATTGGTTTTCAAACTTCATTGACTGTGCC' 'AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATAT' 'TTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAAT' 'TTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGA' 'AAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTT' 'AAAATGGACTATCATATGCTTACCGTAACTTGAAATATAGAACCG' 'ATCCTCCCATTGGTATATATTATAGAACCGATCCTCCCATTGGCT' 'TGTGGAAAGGACGAAACACCGTACCTCATCAGGAACATGTGTTTA' 'AGAGCTATGCTGGAAACAGCAGAAATAGCAAGTTTAAATAAGGCT' 'AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTT' 'TTGGTGCGTTTTTATGCTTGTAGTATTGTATAATGTTTTT') CRa_U6_seq = Sequence('CRa_U6_seq', CRa_U6_seq_elements, SBOL_ENCODING_IUPAC, version) doc.addSequence(CRa_U6_seq) gRNA_b_elements = ('AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATAT' 'TTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAAT' 'TTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGA' 'AAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTT' 'AAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGAT' 'TTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTACCT' 'CATCAGGAACATGTGTTTAAGAGCTATGCTGGAAACAGCAGAAAT' 'AGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGG' 'CACCGAGTCGGTGCTTTTTTT') gRNA_b_seq = Sequence('gRNA_b_seq', gRNA_b_elements, SBOL_ENCODING_IUPAC, version) doc.addSequence(gRNA_b_seq) mKate_seq_elements = ('TCTAAGGGCGAAGAGCTGATTAAGGAGAACATGCACATGAAGCTG' 'TACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCC' 'GAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATC' 'AAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTG' 'GCTACCAGCTTCATGTACGGCAGCAAAACCTTCATCAACCACACC' 'CAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCTGAGGTAAGT' 'GGTCCTACCTCATCAGGAACATGTGTTTTAGAGCTAGAAATAGCA' 'AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACC' 'GAGTCGGTGCTACTAACTCTCGAGTCTTCTTTTTTTTTTTCACAG' 'GGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTG' 'CTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATC' 'TACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCT' 'GTGATGCAGAAGAAAACACTCGGCTGGGAGGCCTCCACCGAGATG' 'CTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAAGCGACATGGCC' 'CTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAACTTGAAGACC' 'ACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGC' 'GTCTACTATGTGGACAGAAGACTGGAAAGAATCAAGGAGGCCGAC' 'AAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGATAC' 'TGCG') mKate_seq = Sequence('mKate_seq', mKate_seq_elements, SBOL_ENCODING_IUPAC, version) doc.addSequence(mKate_seq) CRP_b_seq_elements = ('GCTCCGAATTTCTCGACAGATCTCATGTGATTACGCCAAGCTACG' 'GGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAG' 'TACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTTCTGTC' 'CTCCGAGCGGAGACTCTAGATACCTCATCAGGAACATGTTGGAAT' 'TCTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTA' 'GTGAACCGTCAGATCGCCTCGAGTACCTCATCAGGAACATGTTGG' 'ATCCAATTCGACC') CRP_b_seq = Sequence('CRP_b_seq', CRP_b_seq_elements, SBOL_ENCODING_IUPAC, version) doc.addSequence(CRP_b_seq) pConst = ComponentDefinition('pConst', BIOPAX_DNA, version) pConst.roles = [SO_PROMOTER] doc.addComponentDefinition(pConst) cas9m_BFP_cds = ComponentDefinition('cas9m_BFP_cds', BIOPAX_DNA, version) cas9m_BFP_cds.roles = [SO_CDS] doc.addComponentDefinition(cas9m_BFP_cds) cas9m_BFP_gene = ComponentDefinition('cas9m_BFP_gene', BIOPAX_DNA, version) cas9m_BFP_gene.roles = [SO_PROMOTER] doc.addComponentDefinition(cas9m_BFP_gene) pConst_c2 = cas9m_BFP_gene.components.create('pConst') pConst_c2.definition = pConst.persistentIdentity pConst_c2.access = SBOL_ACCESS_PUBLIC pConst_c2.version = version cas9m_BFP_cds_c = cas9m_BFP_gene.components.create('cas9m_BFP_cds') cas9m_BFP_cds_c.definition = cas9m_BFP_cds.persistentIdentity cas9m_BFP_cds_c.access = SBOL_ACCESS_PUBLIC cas9m_BFP_cds_c.version = version cas9m_BFP_gene_constraint = cas9m_BFP_gene.sequenceConstraints.create('cas9m_BFP_gene_constraint') cas9m_BFP_gene_constraint.subject = pConst_c2.identity cas9m_BFP_gene_constraint.object = cas9m_BFP_cds_c.identity cas9m_BFP_gene_constraint.restriction = SBOL_RESTRICTION_PRECEDES cas9m_BFP = ComponentDefinition('cas9m_BFP', BIOPAX_PROTEIN, version) doc.addComponentDefinition(cas9m_BFP) CRa_U6 = ComponentDefinition('CRa_U6', BIOPAX_DNA, version) CRa_U6.sequences.append(CRa_U6_seq.persistentIdentity) CRa_U6.roles = [SO_PROMOTER] doc.addComponentDefinition(CRa_U6) gRNA_b_nc = ComponentDefinition('gRNA_b_nc', BIOPAX_DNA, version) gRNA_b_nc.roles = [SO_CDS] gRNA_b_nc.sequences.append(gRNA_b_seq.persistentIdentity) doc.addComponentDefinition(gRNA_b_nc) gRNA_b_terminator = ComponentDefinition('gRNA_b_terminator', BIOPAX_DNA, version) gRNA_b_terminator.roles = [SO_TERMINATOR] doc.addComponentDefinition(gRNA_b_terminator) gRNA_b_gene = ComponentDefinition('gRNA_b_gene', BIOPAX_DNA, version) gRNA_b_gene.roles = [SO_PROMOTER] doc.addComponentDefinition(gRNA_b_gene) CRa_U6_c = gRNA_b_gene.components.create('CRa_U6') CRa_U6_c.definition = CRa_U6.persistentIdentity CRa_U6_c.access = SBOL_ACCESS_PUBLIC CRa_U6_c.version = version gRNA_b_nc_c = gRNA_b_gene.components.create('gRNA_b_nc') gRNA_b_nc_c.definition = gRNA_b_nc.persistentIdentity gRNA_b_nc_c.access = SBOL_ACCESS_PUBLIC gRNA_b_nc_c.version = version gRNA_b_terminator_c = gRNA_b_gene.components.create('gRNA_b_terminator') gRNA_b_terminator_c.definition = gRNA_b_terminator.persistentIdentity gRNA_b_terminator_c.access = SBOL_ACCESS_PUBLIC gRNA_b_terminator_c.version = version gRNA_gene_constraint1 = gRNA_b_gene.sequenceConstraints.create('gRNA_b_gene_constraint1') gRNA_gene_constraint1.subject = CRa_U6_c.identity gRNA_gene_constraint1.object = gRNA_b_nc_c.identity gRNA_gene_constraint1.restriction = SBOL_RESTRICTION_PRECEDES gRNA_gene_constraint2 = gRNA_b_gene.sequenceConstraints.create('gRNA_b_gene_constraint2') gRNA_gene_constraint2.subject = gRNA_b_nc_c.identity gRNA_gene_constraint2.object = gRNA_b_terminator_c.identity gRNA_gene_constraint2.restriction = SBOL_RESTRICTION_PRECEDES gRNA_b = ComponentDefinition('gRNA_b', BIOPAX_RNA, version) gRNA_b.roles = [SO_SGRNA] doc.addComponentDefinition(gRNA_b) cas9m_BFP_gRNA_b = ComponentDefinition('cas9m_BFP_gRNA_b', BIOPAX_COMPLEX, version) doc.addComponentDefinition(cas9m_BFP_gRNA_b) mKate_cds = ComponentDefinition('mKate_cds', BIOPAX_DNA, version) mKate_cds.roles = [SO_CDS] mKate_cds.sequences.append(mKate_seq.persistentIdentity) doc.addComponentDefinition(mKate_cds) mKate_gene = ComponentDefinition('mKate_gene', BIOPAX_DNA, version) mKate_gene.roles = [SO_PROMOTER] doc.addComponentDefinition(mKate_gene) pConst_c = mKate_gene.components.create('pConst') pConst_c.definition = pConst.persistentIdentity pConst_c.access = SBOL_ACCESS_PUBLIC pConst_c.version = version mKate_cds_c = mKate_gene.components.create('mKate_cds') mKate_cds_c.definition = mKate_cds.persistentIdentity mKate_cds_c.access = SBOL_ACCESS_PUBLIC mKate_cds_c.version = version mKate_gene_constraint = mKate_gene.sequenceConstraints.create('mKate_gene_constraint') mKate_gene_constraint.subject = pConst_c.identity mKate_gene_constraint.object = mKate_cds_c.identity mKate_gene_constraint.restriction = SBOL_RESTRICTION_PRECEDES mKate = ComponentDefinition('mKate', BIOPAX_PROTEIN, version) doc.addComponentDefinition(mKate) Gal4VP16_cds = ComponentDefinition('Gal4VP16_cds', BIOPAX_DNA, version) Gal4VP16_cds.roles = [SO_CDS] doc.addComponentDefinition(Gal4VP16_cds) Gal4VP16_gene = ComponentDefinition('Gal4VP16_gene', BIOPAX_DNA, version) Gal4VP16_gene.roles = [SO_PROMOTER] doc.addComponentDefinition(Gal4VP16_gene) pConst_c3 = Gal4VP16_gene.components.create('pConst') pConst_c3.definition = pConst.persistentIdentity pConst_c3.access = SBOL_ACCESS_PUBLIC pConst_c3.version = version Gal4VP16_cds_c = Gal4VP16_gene.components.create('Gal4VP16_cds') Gal4VP16_cds_c.definition = Gal4VP16_cds.persistentIdentity Gal4VP16_cds_c.access = SBOL_ACCESS_PUBLIC Gal4VP16_cds_c.version = version GAL4VP16_gene_constraint = Gal4VP16_gene.sequenceConstraints.create('GAL4VP16_gene_constraint') GAL4VP16_gene_constraint.subject = pConst_c3.identity GAL4VP16_gene_constraint.object = Gal4VP16_cds_c.identity GAL4VP16_gene_constraint.restriction = SBOL_RESTRICTION_PRECEDES Gal4VP16 = ComponentDefinition('Gal4VP16', BIOPAX_PROTEIN, version) doc.addComponentDefinition(Gal4VP16) CRP_b = ComponentDefinition('CRP_b', BIOPAX_DNA, version) CRP_b.roles = [SO_PROMOTER] CRP_b.sequences.append(CRP_b_seq.persistentIdentity) doc.addComponentDefinition(CRP_b) EYFP_cds = ComponentDefinition('EYFP_cds', BIOPAX_DNA, version) EYFP_cds.roles = [SO_CDS] doc.addComponentDefinition(EYFP_cds) EYFP_gene = ComponentDefinition('EYFP_gene', BIOPAX_DNA, version) EYFP_gene.roles = [SO_PROMOTER] doc.addComponentDefinition(EYFP_gene) CRP_b_c = EYFP_gene.components.create('CRP_b') CRP_b_c.definition = CRP_b.persistentIdentity CRP_b_c.access = SBOL_ACCESS_PUBLIC CRP_b_c.version = version EYFP_cds_c = EYFP_gene.components.create('EYFP_cds') EYFP_cds_c.definition = EYFP_cds.persistentIdentity EYFP_cds_c.access = SBOL_ACCESS_PUBLIC EYFP_cds_c.version = version EYFP_gene_constraint = EYFP_gene.sequenceConstraints.create('EYFP_gene_constraint') EYFP_gene_constraint.subject = CRP_b_c.identity EYFP_gene_constraint.object = EYFP_cds_c.identity EYFP_gene_constraint.restriction = SBOL_RESTRICTION_PRECEDES EYFP = ComponentDefinition('EYFP', BIOPAX_PROTEIN, version) doc.addComponentDefinition(EYFP) CRPb_circuit = ModuleDefinition('CRPb_characterization_Circuit', version) doc.addModuleDefinition(CRPb_circuit) cas9m_BFP_fc = CRPb_circuit.functionalComponents.create('cas9m_BFP') cas9m_BFP_fc.definition = cas9m_BFP.identity cas9m_BFP_fc.access = SBOL_ACCESS_PRIVATE cas9m_BFP_fc.direction = SBOL_DIRECTION_NONE cas9m_BFP_fc.version = version cas9m_BFP_gene_fc = CRPb_circuit.functionalComponents.create('cas9m_BFP_gene') cas9m_BFP_gene_fc.definition = cas9m_BFP_gene.identity cas9m_BFP_gene_fc.access = SBOL_ACCESS_PRIVATE cas9m_BFP_gene_fc.direction = SBOL_DIRECTION_NONE cas9m_BFP_gene_fc.version = version gRNA_b_fc = CRPb_circuit.functionalComponents.create('gRNA_b') gRNA_b_fc.definition = gRNA_b.identity gRNA_b_fc.access = SBOL_ACCESS_PRIVATE gRNA_b_fc.direction = SBOL_DIRECTION_NONE gRNA_b_fc.version = version gRNA_b_gene_fc = CRPb_circuit.functionalComponents.create('gRNA_b_gene') gRNA_b_gene_fc.definition = gRNA_b_gene.identity gRNA_b_gene_fc.access = SBOL_ACCESS_PRIVATE gRNA_b_gene_fc.direction = SBOL_DIRECTION_NONE gRNA_b_gene_fc.version = version mKate_fc = CRPb_circuit.functionalComponents.create('mKate') mKate_fc.definition = mKate.identity mKate_fc.access = SBOL_ACCESS_PRIVATE mKate_fc.direction = SBOL_DIRECTION_NONE mKate_fc.version = version mKate_gene_fc = CRPb_circuit.functionalComponents.create('mKate_gene') mKate_gene_fc.definition = mKate_gene.identity mKate_gene_fc.access = SBOL_ACCESS_PRIVATE mKate_gene_fc.direction = SBOL_DIRECTION_NONE mKate_gene_fc.version = version Gal4VP16_fc = CRPb_circuit.functionalComponents.create('Gal4VP16') Gal4VP16_fc.definition = Gal4VP16.identity Gal4VP16_fc.access = SBOL_ACCESS_PRIVATE Gal4VP16_fc.direction = SBOL_DIRECTION_NONE Gal4VP16_fc.version = version Gal4VP16_gene_fc = CRPb_circuit.functionalComponents.create('Gal4VP16_gene') Gal4VP16_gene_fc.definition = Gal4VP16_gene.identity Gal4VP16_gene_fc.access = SBOL_ACCESS_PRIVATE Gal4VP16_gene_fc.direction = SBOL_DIRECTION_NONE Gal4VP16_gene_fc.version = version EYFP_fc = CRPb_circuit.functionalComponents.create('EYFP') EYFP_fc.definition = EYFP.identity EYFP_fc.access = SBOL_ACCESS_PRIVATE EYFP_fc.direction = SBOL_DIRECTION_NONE EYFP_fc.version = version EYFP_gene_fc = CRPb_circuit.functionalComponents.create('EYFP_gene') EYFP_gene_fc.definition = EYFP_gene.identity EYFP_gene_fc.access = SBOL_ACCESS_PRIVATE EYFP_gene_fc.direction = SBOL_DIRECTION_NONE EYFP_gene_fc.version = version cas9m_BFP_gRNA_b_fc = CRPb_circuit.functionalComponents.create('cas9m_BFP_gRNA_b') cas9m_BFP_gRNA_b_fc.definition = cas9m_BFP_gRNA_b.identity cas9m_BFP_gRNA_b_fc.access = SBOL_ACCESS_PRIVATE cas9m_BFP_gRNA_b_fc.direction = SBOL_DIRECTION_NONE cas9m_BFP_gRNA_b_fc.version = version mKate_production = CRPb_circuit.interactions.create('mKate_production') mKate_production.types = [SBO_GENETIC_PRODUCTION] mKate_participation = mKate_production.participations.create('mKate') mKate_participation.roles = [SBO_PRODUCT] mKate_participation.participant = mKate_fc.identity mKate_gene_participation = mKate_production.participations.create('mKate_gene') mKate_gene_participation.roles = [SBO_PROMOTER] mKate_gene_participation.participant = mKate_gene_fc.identity GAL4VP16_production = CRPb_circuit.interactions.create('Gal4VP16_production') GAL4VP16_production.types = [SBO_GENETIC_PRODUCTION] Gal4VP16_gene_participation = GAL4VP16_production.participations.create('Gal4VP16_gene') Gal4VP16_gene_participation.roles = [SBO_PROMOTER] Gal4VP16_gene_participation.participant = Gal4VP16_gene_fc.identity Gal4VP16_participation1 = GAL4VP16_production.participations.create('Gal4VP16') Gal4VP16_participation1.roles = [SBO_PRODUCT] Gal4VP16_participation1.participant = Gal4VP16_fc.identity cas9m_BFP_production = CRPb_circuit.interactions.create('cas9m_BFP_production') cas9m_BFP_production.types = [SBO_GENETIC_PRODUCTION] cas9m_BFP_gene_participation = cas9m_BFP_production.participations.create('cas9m_BFP_gene') cas9m_BFP_gene_participation.roles = [SBO_PROMOTER] cas9m_BFP_gene_participation.participant = cas9m_BFP_gene_fc.identity cas9m_BFP_participation = cas9m_BFP_production.participations.create('cas9m_BFP') cas9m_BFP_participation.roles = [SBO_PRODUCT] cas9m_BFP_participation.participant = cas9m_BFP_fc.identity gRNA_b_production = CRPb_circuit.interactions.create('gRNA_b_production') gRNA_b_production.types = [SBO_GENETIC_PRODUCTION] gRNA_b_gene_participation = gRNA_b_production.participations.create('gRNA_b_gene') gRNA_b_gene_participation.roles = [SBO_PROMOTER] gRNA_b_gene_participation.participant = gRNA_b_gene_fc.identity gRNA_b_participation = gRNA_b_production.participations.create('gRNA_b') gRNA_b_participation.roles = [SBO_PRODUCT] gRNA_b_participation.participant = gRNA_b_fc.identity EYFP_Activation = CRPb_circuit.interactions.create('EYFP_Activation') EYFP_Activation.types = [SBO_STIMULATION] #%% Gal4VP16_participation = EYFP_Activation.participations.create('Gal4VP16') Gal4VP16_participation.roles = [SBO_STIMULATOR] Gal4VP16_participation.participant = Gal4VP16_fc.identity EYFP_gene_participation = EYFP_Activation.participations.create('EYFP_gene') EYFP_gene_participation.roles = [SBO_PROMOTER] EYFP_gene_participation.participant = EYFP_gene_fc.identity mKate_deg = CRPb_circuit.interactions.create('mKate_deg') mKate_deg.types = [SBO_DEGRADATION] mKate_participation1 = mKate_deg.participations.create('mKate') mKate_participation1.roles = [SBO_REACTANT] mKate_participation1.participant = mKate_fc.identity GAL4VP16_deg = CRPb_circuit.interactions.create('Gal4VP16_deg') GAL4VP16_deg.types = [SBO_DEGRADATION] Gal4VP16_participation2 = GAL4VP16_deg.participations.create('Gal4VP16') Gal4VP16_participation2.roles = [SBO_REACTANT] Gal4VP16_participation2.participant = Gal4VP16_fc.identity cas9m_BFP_deg = CRPb_circuit.interactions.create('cas9m_BFP_deg') cas9m_BFP_deg.types = [SBO_DEGRADATION] cas9m_BFP_participation1 = cas9m_BFP_deg.participations.create('cas9m_BFP') cas9m_BFP_participation1.roles = [SBO_REACTANT] cas9m_BFP_participation1.participant = cas9m_BFP_fc.identity gRNA_b_deg = CRPb_circuit.interactions.create('gRNA_b_deg') gRNA_b_deg.types = [SBO_DEGRADATION] gRNA_b_participation1 = gRNA_b_deg.participations.create('gRNA_b') gRNA_b_participation1.roles = [SBO_REACTANT] gRNA_b_participation1.participant = gRNA_b_fc.identity EYFP_deg = CRPb_circuit.interactions.create('EYFP_deg') EYFP_deg.types = [SBO_DEGRADATION] EYFP_participation = EYFP_deg.participations.create('EYFP') EYFP_participation.roles = [SBO_REACTANT] EYFP_participation.participant = EYFP_fc.identity cas9m_BFP_gRNA_b_deg = CRPb_circuit.interactions.create('cas9m_BFP_gRNA_b_deg') cas9m_BFP_gRNA_b_deg.types = [SBO_DEGRADATION] cas9m_BFP_gRNA_b_participation = cas9m_BFP_gRNA_b_deg.participations.create('cas9m_BFP_gRNA_b') cas9m_BFP_gRNA_b_participation.roles = [SBO_REACTANT] cas9m_BFP_gRNA_b_participation.participant = cas9m_BFP_gRNA_b_fc.identity Template_Module = CRPb_circuit.modules.create('CRISPR_Template') Template_Module.definition = CRISPR_Template.identity cas9m_BFP_map = Template_Module.mapsTos.create('cas9m_BFP_map') cas9m_BFP_map.refinement = SBOL_REFINEMENT_USE_LOCAL cas9m_BFP_map.local = cas9m_BFP_fc.identity cas9m_BFP_map.remote = cas9_generic_fc.identity gRNA_b_map = Template_Module.mapsTos.create('gRNA_b_map') gRNA_b_map.refinement = SBOL_REFINEMENT_USE_LOCAL gRNA_b_map.local = gRNA_b_fc.identity gRNA_b_map.remote = gRNA_generic_fc.identity cas9m_BFP_gRNA_map = Template_Module.mapsTos.create('cas9m_BFP_gRNA_map') cas9m_BFP_gRNA_map.refinement = SBOL_REFINEMENT_USE_LOCAL cas9m_BFP_gRNA_map.local = cas9m_BFP_gRNA_b_fc.identity cas9m_BFP_gRNA_map.remote = cas9_gRNA_complex_fc.identity EYFP_map = Template_Module.mapsTos.create('EYFP_map') EYFP_map.refinement = SBOL_REFINEMENT_USE_LOCAL EYFP_map.local = EYFP_fc.identity EYFP_map.remote = target_fc.identity EYFP_gene_map = Template_Module.mapsTos.create('EYFP_gene_map') EYFP_gene_map.refinement = SBOL_REFINEMENT_USE_LOCAL EYFP_gene_map.local = EYFP_gene_fc.identity EYFP_gene_map.remote = target_gene_fc.identity doc.write('crispr_example.xml')
apache-2.0
BizShuk/env_setup
pkg/sublime/MarkdownEditing/switch_list_bullet_type.py
1
1312
import sublime_plugin import re class SwitchListBulletTypeCommand(sublime_plugin.TextCommand): def run(self, edit): todo = [] for region in self.view.sel(): lines = self.view.line(region) lines = self.view.split_by_newlines(lines) for line in lines: line_content = self.view.substr(line) print(line_content) m = re.match(r"^(\s*(?:>\s*)?)[*+\-](\s+.*)$", line_content) if m: # Transform the bullet to numbered bullet type new_line = m.group(1) + "1." + m.group(2) # Insert the new item todo.append([line, new_line]) else: m = re.match(r"^(\s*(?:>\s*)?)[0-9]+\.(\s+.*)$", line_content) if m: # Transform the bullet to unnumbered bullet type new_line = m.group(1) + "-" + m.group(2) # Insert the new item todo.append([line, new_line]) while len(todo) > 0: j = todo.pop() self.view.replace(edit, j[0], j[1]) def is_enabled(self): return bool(self.view.score_selector(self.view.sel()[0].a, "text.html.markdown"))
gpl-3.0
clulab/twitter4food
src/main/python/org/clulab/twitter4food/format.py
2
1458
# input file full = open("/data/nlp/corpora/twitter4food/overweightData/overweightDataFull.txt", 'r') # UNCOMMENT THESE AND THE LINES AT THE END TO WRITE TO THE FILES trainFile = open("overweightTrain.txt", 'w') # devFile = open("overweightDev.txt", 'w') testFile = open("overweightTest.txt", 'w') overweight = [] notOverweight = [] isFirst = True toAdd = "" for line in full: if line == "Overweight\n" or line == "Not overweight\n": if not isFirst: if line == "Overweight\n": overweight.append(toAdd) elif line == "Not overweight\n": notOverweight.append(toAdd) else: isFirst = False toAdd = line else: toAdd += line first = int(len(overweight) * 0.6) second = (len(overweight) - first) / 2 firstN = int(len(notOverweight) * 0.6) secondN = (len(notOverweight) - firstN) / 2 print str(len(overweight)) print str(len(notOverweight)) train = overweight[0:first] dev = overweight[first:first+second] test = overweight[first+second:] print str(len(train)) print str(len(dev)) print str(len(test)) print train += notOverweight[0:firstN] dev += notOverweight[firstN:firstN+secondN] test += notOverweight[firstN+secondN:] print str(len(train)) print str(len(dev)) print str(len(test)) # for account in train: # trainFile.write(account) # for account in dev: # devFile.write(account) # for account in test: # testFile.write(account)
apache-2.0
pasqualguerrero/django
tests/select_related/models.py
99
3320
""" Tests for select_related() ``select_related()`` follows all relationships and pre-caches any foreign key values so that complex trees can be fetched in a single query. However, this isn't always a good idea, so the ``depth`` argument control how many "levels" the select-related behavior will traverse. """ from django.contrib.contenttypes.fields import ( GenericForeignKey, GenericRelation, ) from django.contrib.contenttypes.models import ContentType from django.db import models from django.utils.encoding import python_2_unicode_compatible # Who remembers high school biology? @python_2_unicode_compatible class Domain(models.Model): name = models.CharField(max_length=50) def __str__(self): return self.name @python_2_unicode_compatible class Kingdom(models.Model): name = models.CharField(max_length=50) domain = models.ForeignKey(Domain) def __str__(self): return self.name @python_2_unicode_compatible class Phylum(models.Model): name = models.CharField(max_length=50) kingdom = models.ForeignKey(Kingdom) def __str__(self): return self.name @python_2_unicode_compatible class Klass(models.Model): name = models.CharField(max_length=50) phylum = models.ForeignKey(Phylum) def __str__(self): return self.name @python_2_unicode_compatible class Order(models.Model): name = models.CharField(max_length=50) klass = models.ForeignKey(Klass) def __str__(self): return self.name @python_2_unicode_compatible class Family(models.Model): name = models.CharField(max_length=50) order = models.ForeignKey(Order) def __str__(self): return self.name @python_2_unicode_compatible class Genus(models.Model): name = models.CharField(max_length=50) family = models.ForeignKey(Family) def __str__(self): return self.name @python_2_unicode_compatible class Species(models.Model): name = models.CharField(max_length=50) genus = models.ForeignKey(Genus) def __str__(self): return self.name # and we'll invent a new thing so we have a model with two foreign keys @python_2_unicode_compatible class HybridSpecies(models.Model): name = models.CharField(max_length=50) parent_1 = models.ForeignKey(Species, related_name='child_1') parent_2 = models.ForeignKey(Species, related_name='child_2') def __str__(self): return self.name @python_2_unicode_compatible class Topping(models.Model): name = models.CharField(max_length=30) def __str__(self): return self.name @python_2_unicode_compatible class Pizza(models.Model): name = models.CharField(max_length=100) toppings = models.ManyToManyField(Topping) def __str__(self): return self.name @python_2_unicode_compatible class TaggedItem(models.Model): tag = models.CharField(max_length=30) content_type = models.ForeignKey(ContentType, related_name='select_related_tagged_items') object_id = models.PositiveIntegerField() content_object = GenericForeignKey('content_type', 'object_id') def __str__(self): return self.tag @python_2_unicode_compatible class Bookmark(models.Model): url = models.URLField() tags = GenericRelation(TaggedItem) def __str__(self): return self.url
bsd-3-clause
leorochael/odoo
odoo.py
257
5618
#!/usr/bin/env python #---------------------------------------------------------- # odoo cli # # To install your odoo development environement type: # # wget -O- https://raw.githubusercontent.com/odoo/odoo/8.0/odoo.py | python # # The setup_* subcommands used to boostrap odoo are defined here inline and may # only depends on the python 2.7 stdlib # # The rest of subcommands are defined in odoo/cli or in <module>/cli by # subclassing the Command object # #---------------------------------------------------------- import os import re import sys import subprocess GIT_HOOKS_PRE_PUSH = """ #!/usr/bin/env python2 import re import sys if re.search('github.com[:/]odoo/odoo.git$', sys.argv[2]): print "Pushing to /odoo/odoo.git is forbidden, please push to odoo-dev, use --no-verify to override" sys.exit(1) """ def printf(f,*l): print "odoo:" + f % l def run(*l): if isinstance(l[0], list): l = l[0] printf("running %s", " ".join(l)) subprocess.check_call(l) def git_locate(): # Locate git dir # TODO add support for os.environ.get('GIT_DIR') # check for an odoo child if os.path.isfile('odoo/.git/config'): os.chdir('odoo') path = os.getcwd() while path != os.path.abspath(os.sep): gitconfig_path = os.path.join(path, '.git/config') if os.path.isfile(gitconfig_path): release_py = os.path.join(path, 'openerp/release.py') if os.path.isfile(release_py): break path = os.path.dirname(path) if path == os.path.abspath(os.sep): path = None return path def cmd_setup_git(): git_dir = git_locate() if git_dir: printf('git repo found at %s',git_dir) else: run("git", "init", "odoo") os.chdir('odoo') git_dir = os.getcwd() if git_dir: # push sane config for git < 2.0, and hooks #run('git','config','push.default','simple') # alias run('git','config','alias.st','status') # merge bzr style run('git','config','merge.commit','no') # pull let me choose between merge or rebase only works in git > 2.0, use an alias for 1 run('git','config','pull.ff','only') run('git','config','alias.pl','pull --ff-only') pre_push_path = os.path.join(git_dir, '.git/hooks/pre-push') open(pre_push_path,'w').write(GIT_HOOKS_PRE_PUSH.strip()) os.chmod(pre_push_path, 0755) # setup odoo remote run('git','config','remote.odoo.url','https://github.com/odoo/odoo.git') run('git','config','remote.odoo.pushurl','git@github.com:odoo/odoo.git') run('git','config','--add','remote.odoo.fetch','dummy') run('git','config','--unset-all','remote.odoo.fetch') run('git','config','--add','remote.odoo.fetch','+refs/heads/*:refs/remotes/odoo/*') # setup odoo-dev remote run('git','config','remote.odoo-dev.url','https://github.com/odoo-dev/odoo.git') run('git','config','remote.odoo-dev.pushurl','git@github.com:odoo-dev/odoo.git') run('git','remote','update') # setup 8.0 branch run('git','config','branch.8.0.remote','odoo') run('git','config','branch.8.0.merge','refs/heads/8.0') run('git','checkout','8.0') else: printf('no git repo found') def cmd_setup_git_dev(): git_dir = git_locate() if git_dir: # setup odoo-dev remote run('git','config','--add','remote.odoo-dev.fetch','dummy') run('git','config','--unset-all','remote.odoo-dev.fetch') run('git','config','--add','remote.odoo-dev.fetch','+refs/heads/*:refs/remotes/odoo-dev/*') run('git','config','--add','remote.odoo-dev.fetch','+refs/pull/*:refs/remotes/odoo-dev/pull/*') run('git','remote','update') def cmd_setup_git_review(): git_dir = git_locate() if git_dir: # setup odoo-dev remote run('git','config','--add','remote.odoo.fetch','dummy') run('git','config','--unset-all','remote.odoo.fetch') run('git','config','--add','remote.odoo.fetch','+refs/heads/*:refs/remotes/odoo/*') run('git','config','--add','remote.odoo.fetch','+refs/tags/*:refs/remotes/odoo/tags/*') run('git','config','--add','remote.odoo.fetch','+refs/pull/*:refs/remotes/odoo/pull/*') def setup_deps_debian(git_dir): debian_control_path = os.path.join(git_dir, 'debian/control') debian_control = open(debian_control_path).read() debs = re.findall('python-[0-9a-z]+',debian_control) debs += ["postgresql"] proc = subprocess.Popen(['sudo','apt-get','install'] + debs, stdin=open('/dev/tty')) proc.communicate() def cmd_setup_deps(): git_dir = git_locate() if git_dir: if os.path.isfile('/etc/debian_version'): setup_deps_debian(git_dir) def setup_pg_debian(git_dir): cmd = ['sudo','su','-','postgres','-c','createuser -s %s' % os.environ['USER']] subprocess.call(cmd) def cmd_setup_pg(): git_dir = git_locate() if git_dir: if os.path.isfile('/etc/debian_version'): setup_pg_debian(git_dir) def cmd_setup(): cmd_setup_git() cmd_setup_deps() cmd_setup_pg() def main(): # regsitry of commands g = globals() cmds = dict([(i[4:],g[i]) for i in g if i.startswith('cmd_')]) # if curl URL | python2 then use command setup if len(sys.argv) == 1 and __file__ == '<stdin>': cmd_setup() elif len(sys.argv) == 2 and sys.argv[1] in cmds: cmds[sys.argv[1]]() else: import openerp openerp.cli.main() if __name__ == "__main__": main()
agpl-3.0
Azure/azure-sdk-for-python
sdk/applicationinsights/azure-mgmt-applicationinsights/azure/mgmt/applicationinsights/v2020_02_02_preview/_configuration.py
1
3315
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for license information. # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may cause incorrect behavior and will be lost if the code is regenerated. # -------------------------------------------------------------------------- from typing import TYPE_CHECKING from azure.core.configuration import Configuration from azure.core.pipeline import policies from azure.mgmt.core.policies import ARMHttpLoggingPolicy if TYPE_CHECKING: # pylint: disable=unused-import,ungrouped-imports from typing import Any from azure.core.credentials import TokenCredential VERSION = "unknown" class ApplicationInsightsManagementClientConfiguration(Configuration): """Configuration for ApplicationInsightsManagementClient. Note that all parameters used to create this instance are saved as instance attributes. :param credential: Credential needed for the client to connect to Azure. :type credential: ~azure.core.credentials.TokenCredential :param subscription_id: The ID of the target subscription. :type subscription_id: str """ def __init__( self, credential, # type: "TokenCredential" subscription_id, # type: str **kwargs # type: Any ): # type: (...) -> None if credential is None: raise ValueError("Parameter 'credential' must not be None.") if subscription_id is None: raise ValueError("Parameter 'subscription_id' must not be None.") super(ApplicationInsightsManagementClientConfiguration, self).__init__(**kwargs) self.credential = credential self.subscription_id = subscription_id self.api_version = "2020-02-02-preview" self.credential_scopes = kwargs.pop('credential_scopes', ['https://management.azure.com/.default']) kwargs.setdefault('sdk_moniker', 'mgmt-applicationinsights/{}'.format(VERSION)) self._configure(**kwargs) def _configure( self, **kwargs # type: Any ): # type: (...) -> None self.user_agent_policy = kwargs.get('user_agent_policy') or policies.UserAgentPolicy(**kwargs) self.headers_policy = kwargs.get('headers_policy') or policies.HeadersPolicy(**kwargs) self.proxy_policy = kwargs.get('proxy_policy') or policies.ProxyPolicy(**kwargs) self.logging_policy = kwargs.get('logging_policy') or policies.NetworkTraceLoggingPolicy(**kwargs) self.http_logging_policy = kwargs.get('http_logging_policy') or ARMHttpLoggingPolicy(**kwargs) self.retry_policy = kwargs.get('retry_policy') or policies.RetryPolicy(**kwargs) self.custom_hook_policy = kwargs.get('custom_hook_policy') or policies.CustomHookPolicy(**kwargs) self.redirect_policy = kwargs.get('redirect_policy') or policies.RedirectPolicy(**kwargs) self.authentication_policy = kwargs.get('authentication_policy') if self.credential and not self.authentication_policy: self.authentication_policy = policies.BearerTokenCredentialPolicy(self.credential, *self.credential_scopes, **kwargs)
mit
Cito/sqlalchemy
lib/sqlalchemy/testing/assertsql.py
78
10607
# testing/assertsql.py # Copyright (C) 2005-2014 the SQLAlchemy authors and contributors <see AUTHORS file> # # This module is part of SQLAlchemy and is released under # the MIT License: http://www.opensource.org/licenses/mit-license.php from ..engine.default import DefaultDialect from .. import util import re class AssertRule(object): def process_execute(self, clauseelement, *multiparams, **params): pass def process_cursor_execute(self, statement, parameters, context, executemany): pass def is_consumed(self): """Return True if this rule has been consumed, False if not. Should raise an AssertionError if this rule's condition has definitely failed. """ raise NotImplementedError() def rule_passed(self): """Return True if the last test of this rule passed, False if failed, None if no test was applied.""" raise NotImplementedError() def consume_final(self): """Return True if this rule has been consumed. Should raise an AssertionError if this rule's condition has not been consumed or has failed. """ if self._result is None: assert False, 'Rule has not been consumed' return self.is_consumed() class SQLMatchRule(AssertRule): def __init__(self): self._result = None self._errmsg = "" def rule_passed(self): return self._result def is_consumed(self): if self._result is None: return False assert self._result, self._errmsg return True class ExactSQL(SQLMatchRule): def __init__(self, sql, params=None): SQLMatchRule.__init__(self) self.sql = sql self.params = params def process_cursor_execute(self, statement, parameters, context, executemany): if not context: return _received_statement = \ _process_engine_statement(context.unicode_statement, context) _received_parameters = context.compiled_parameters # TODO: remove this step once all unit tests are migrated, as # ExactSQL should really be *exact* SQL sql = _process_assertion_statement(self.sql, context) equivalent = _received_statement == sql if self.params: if util.callable(self.params): params = self.params(context) else: params = self.params if not isinstance(params, list): params = [params] equivalent = equivalent and params \ == context.compiled_parameters else: params = {} self._result = equivalent if not self._result: self._errmsg = \ 'Testing for exact statement %r exact params %r, '\ 'received %r with params %r' % (sql, params, _received_statement, _received_parameters) class RegexSQL(SQLMatchRule): def __init__(self, regex, params=None): SQLMatchRule.__init__(self) self.regex = re.compile(regex) self.orig_regex = regex self.params = params def process_cursor_execute(self, statement, parameters, context, executemany): if not context: return _received_statement = \ _process_engine_statement(context.unicode_statement, context) _received_parameters = context.compiled_parameters equivalent = bool(self.regex.match(_received_statement)) if self.params: if util.callable(self.params): params = self.params(context) else: params = self.params if not isinstance(params, list): params = [params] # do a positive compare only for param, received in zip(params, _received_parameters): for k, v in param.items(): if k not in received or received[k] != v: equivalent = False break else: params = {} self._result = equivalent if not self._result: self._errmsg = \ 'Testing for regex %r partial params %r, received %r '\ 'with params %r' % (self.orig_regex, params, _received_statement, _received_parameters) class CompiledSQL(SQLMatchRule): def __init__(self, statement, params=None): SQLMatchRule.__init__(self) self.statement = statement self.params = params def process_cursor_execute(self, statement, parameters, context, executemany): if not context: return from sqlalchemy.schema import _DDLCompiles _received_parameters = list(context.compiled_parameters) # recompile from the context, using the default dialect if isinstance(context.compiled.statement, _DDLCompiles): compiled = \ context.compiled.statement.compile(dialect=DefaultDialect()) else: compiled = \ context.compiled.statement.compile(dialect=DefaultDialect(), column_keys=context.compiled.column_keys) _received_statement = re.sub(r'[\n\t]', '', str(compiled)) equivalent = self.statement == _received_statement if self.params: if util.callable(self.params): params = self.params(context) else: params = self.params if not isinstance(params, list): params = [params] else: params = list(params) all_params = list(params) all_received = list(_received_parameters) while params: param = dict(params.pop(0)) for k, v in context.compiled.params.items(): param.setdefault(k, v) if param not in _received_parameters: equivalent = False break else: _received_parameters.remove(param) if _received_parameters: equivalent = False else: params = {} all_params = {} all_received = [] self._result = equivalent if not self._result: print('Testing for compiled statement %r partial params '\ '%r, received %r with params %r' % (self.statement, all_params, _received_statement, all_received)) self._errmsg = \ 'Testing for compiled statement %r partial params %r, '\ 'received %r with params %r' % (self.statement, all_params, _received_statement, all_received) # print self._errmsg class CountStatements(AssertRule): def __init__(self, count): self.count = count self._statement_count = 0 def process_execute(self, clauseelement, *multiparams, **params): self._statement_count += 1 def process_cursor_execute(self, statement, parameters, context, executemany): pass def is_consumed(self): return False def consume_final(self): assert self.count == self._statement_count, \ 'desired statement count %d does not match %d' \ % (self.count, self._statement_count) return True class AllOf(AssertRule): def __init__(self, *rules): self.rules = set(rules) def process_execute(self, clauseelement, *multiparams, **params): for rule in self.rules: rule.process_execute(clauseelement, *multiparams, **params) def process_cursor_execute(self, statement, parameters, context, executemany): for rule in self.rules: rule.process_cursor_execute(statement, parameters, context, executemany) def is_consumed(self): if not self.rules: return True for rule in list(self.rules): if rule.rule_passed(): # a rule passed, move on self.rules.remove(rule) return len(self.rules) == 0 assert False, 'No assertion rules were satisfied for statement' def consume_final(self): return len(self.rules) == 0 def _process_engine_statement(query, context): if util.jython: # oracle+zxjdbc passes a PyStatement when returning into query = str(query) if context.engine.name == 'mssql' \ and query.endswith('; select scope_identity()'): query = query[:-25] query = re.sub(r'\n', '', query) return query def _process_assertion_statement(query, context): paramstyle = context.dialect.paramstyle if paramstyle == 'named': pass elif paramstyle == 'pyformat': query = re.sub(r':([\w_]+)', r"%(\1)s", query) else: # positional params repl = None if paramstyle == 'qmark': repl = "?" elif paramstyle == 'format': repl = r"%s" elif paramstyle == 'numeric': repl = None query = re.sub(r':([\w_]+)', repl, query) return query class SQLAssert(object): rules = None def add_rules(self, rules): self.rules = list(rules) def statement_complete(self): for rule in self.rules: if not rule.consume_final(): assert False, \ 'All statements are complete, but pending '\ 'assertion rules remain' def clear_rules(self): del self.rules def execute(self, conn, clauseelement, multiparams, params, result): if self.rules is not None: if not self.rules: assert False, \ 'All rules have been exhausted, but further '\ 'statements remain' rule = self.rules[0] rule.process_execute(clauseelement, *multiparams, **params) if rule.is_consumed(): self.rules.pop(0) def cursor_execute(self, conn, cursor, statement, parameters, context, executemany): if self.rules: rule = self.rules[0] rule.process_cursor_execute(statement, parameters, context, executemany) asserter = SQLAssert()
mit
pkilambi/python-gnocchiclient
gnocchiclient/common/http.py
1
9455
# Copyright 2012 OpenStack LLC. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import copy import httplib import logging import os import socket import StringIO import urlparse try: import ssl except ImportError: #TODO(bcwaldon): Handle this failure more gracefully pass try: import json except ImportError: import simplejson as json # Python 2.5 compat fix if not hasattr(urlparse, 'parse_qsl'): import cgi urlparse.parse_qsl = cgi.parse_qsl from gnocchiclient import exc LOG = logging.getLogger(__name__) USER_AGENT = 'python-gnocchiclient' CHUNKSIZE = 1024 * 64 # 64kB class HTTPClient(object): def __init__(self, endpoint, **kwargs): self.endpoint = endpoint self.auth_token = kwargs.get('token') self.connection_params = self.get_connection_params(endpoint, **kwargs) @staticmethod def get_connection_params(endpoint, **kwargs): parts = urlparse.urlparse(endpoint) _args = (parts.hostname, parts.port, parts.path) _kwargs = {'timeout': float(kwargs.get('timeout', 600))} if parts.scheme == 'https': _class = VerifiedHTTPSConnection _kwargs['ca_file'] = kwargs.get('ca_file', None) _kwargs['cert_file'] = kwargs.get('cert_file', None) _kwargs['key_file'] = kwargs.get('key_file', None) _kwargs['insecure'] = kwargs.get('insecure', False) elif parts.scheme == 'http': _class = httplib.HTTPConnection else: msg = 'Unsupported scheme: %s' % parts.scheme raise exc.InvalidEndpoint(msg) return (_class, _args, _kwargs) def get_connection(self): _class = self.connection_params[0] try: return _class(*self.connection_params[1], **self.connection_params[2]) except httplib.InvalidURL: raise exc.InvalidEndpoint() def log_curl_request(self, method, url, kwargs): curl = ['curl -i -X %s' % method] for (key, value) in kwargs['headers'].items(): header = '-H \'%s: %s\'' % (key, value) curl.append(header) conn_params_fmt = [ ('key_file', '--key %s'), ('cert_file', '--cert %s'), ('ca_file', '--cacert %s'), ] for (key, fmt) in conn_params_fmt: value = self.connection_params[2].get(key) if value: curl.append(fmt % value) if self.connection_params[2].get('insecure'): curl.append('-k') if 'body' in kwargs: curl.append('-d \'%s\'' % kwargs['body']) curl.append('%s%s' % (self.endpoint, url)) LOG.debug(' '.join(curl)) @staticmethod def log_http_response(resp, body=None): status = (resp.version / 10.0, resp.status, resp.reason) dump = ['\nHTTP/%.1f %s %s' % status] dump.extend(['%s: %s' % (k, v) for k, v in resp.getheaders()]) dump.append('') if body: dump.extend([body, '']) LOG.debug('\n'.join(dump)) def _http_request(self, url, method, **kwargs): """ Send an http request with the specified characteristics. Wrapper around httplib.HTTP(S)Connection.request to handle tasks such as setting headers and error handling. """ # Copy the kwargs so we can reuse the original in case of redirects kwargs['headers'] = copy.deepcopy(kwargs.get('headers', {})) kwargs['headers'].setdefault('User-Agent', USER_AGENT) if self.auth_token: kwargs['headers'].setdefault('X-Auth-Token', self.auth_token) self.log_curl_request(method, url, kwargs) conn = self.get_connection() try: conn_params = self.connection_params[1][2] conn_url = os.path.normpath('%s/%s' % (conn_params, url)) conn.request(method, conn_url, **kwargs) resp = conn.getresponse() except socket.gaierror as e: message = "Error finding address for %(url)s: %(e)s" % locals() raise exc.InvalidEndpoint(message=message) except (socket.error, socket.timeout) as e: endpoint = self.endpoint message = "Error communicating with %(endpoint)s %(e)s" % locals() raise exc.CommunicationError(message=message) body_iter = ResponseBodyIterator(resp) # Read body into string if it isn't obviously image data if resp.getheader('content-type', None) != 'application/octet-stream': body_str = ''.join([chunk for chunk in body_iter]) self.log_http_response(resp, body_str) body_iter = StringIO.StringIO(body_str) else: self.log_http_response(resp) if 400 <= resp.status < 600: LOG.warn("Request returned failure status.") raise exc.from_response(resp) elif resp.status in (301, 302, 305): # Redirected. Reissue the request to the new location. return self._http_request(resp['location'], method, **kwargs) elif resp.status == 300: raise exc.from_response(resp) return resp, body_iter def json_request(self, method, url, **kwargs): kwargs.setdefault('headers', {}) kwargs['headers'].setdefault('Content-Type', 'application/json') kwargs['headers'].setdefault('Accept', 'application/json') if 'body' in kwargs: kwargs['body'] = json.dumps(kwargs['body']) resp, body_iter = self._http_request(url, method, **kwargs) if 'application/json' in resp.getheader('content-type', None): body = ''.join([chunk for chunk in body_iter]) try: body = json.loads(body) except ValueError: LOG.error('Could not decode response body as JSON') else: body = None return resp, body def raw_request(self, method, url, **kwargs): kwargs.setdefault('headers', {}) kwargs['headers'].setdefault('Content-Type', 'application/octet-stream') return self._http_request(url, method, **kwargs) class VerifiedHTTPSConnection(httplib.HTTPSConnection): """httplib-compatibile connection using client-side SSL authentication :see http://code.activestate.com/recipes/ 577548-https-httplib-client-connection-with-certificate-v/ """ def __init__(self, host, port, key_file=None, cert_file=None, ca_file=None, timeout=None, insecure=False): httplib.HTTPSConnection.__init__(self, host, port, key_file=key_file, cert_file=cert_file) self.key_file = key_file self.cert_file = cert_file if ca_file is not None: self.ca_file = ca_file else: self.ca_file = self.get_system_ca_file() self.timeout = timeout self.insecure = insecure def connect(self): """ Connect to a host on a given (SSL) port. If ca_file is pointing somewhere, use it to check Server Certificate. Redefined/copied and extended from httplib.py:1105 (Python 2.6.x). This is needed to pass cert_reqs=ssl.CERT_REQUIRED as parameter to ssl.wrap_socket(), which forces SSL to check server certificate against our client certificate. """ sock = socket.create_connection((self.host, self.port), self.timeout) if self._tunnel_host: self.sock = sock self._tunnel() if self.insecure is True: kwargs = {'cert_reqs': ssl.CERT_NONE} else: kwargs = {'cert_reqs': ssl.CERT_REQUIRED, 'ca_certs': self.ca_file} if self.cert_file: kwargs['certfile'] = self.cert_file if self.key_file: kwargs['keyfile'] = self.key_file self.sock = ssl.wrap_socket(sock, **kwargs) @staticmethod def get_system_ca_file(): """"Return path to system default CA file""" # Standard CA file locations for Debian/Ubuntu, RedHat/Fedora, # Suse, FreeBSD/OpenBSD ca_path = ['/etc/ssl/certs/ca-certificates.crt', '/etc/pki/tls/certs/ca-bundle.crt', '/etc/ssl/ca-bundle.pem', '/etc/ssl/cert.pem'] for ca in ca_path: if os.path.exists(ca): return ca return None class ResponseBodyIterator(object): """A class that acts as an iterator over an HTTP response.""" def __init__(self, resp): self.resp = resp def __iter__(self): while True: yield self.next() def next(self): chunk = self.resp.read(CHUNKSIZE) if chunk: return chunk else: raise StopIteration()
apache-2.0