repo_name
stringlengths
7
104
file_path
stringlengths
13
198
context
stringlengths
67
7.15k
import_statement
stringlengths
16
4.43k
code
stringlengths
40
6.98k
prompt
stringlengths
227
8.27k
next_line
stringlengths
8
795
lvonasek/Open4speed
src/com/lvonasek/o4s/game/GameLoop.java
// Path: src/com/lvonasek/o4s/media/Settings.java // public class Settings { // // public static final int MUSIC_VOLUME = 0; // public static final int SOUND_VOLUME = 1; // public static final int VISUAL_QUALITY = 2; // public static final int RACE_EVENT = 3; // // public static final String RACE_CUSTOM_EVENT = "O4SCFG"; // // private static int[] DEFAULT_VALUES = {100, 100, 100, 0}; // // public static void init(Activity instance) { // Display display = instance.getWindowManager().getDefaultDisplay(); // Point size = new Point(); // display.getSize(size); // int level = 25 + (int) ((Math.max(size.x, size.y) - 800) / 6.4f); // level = Math.max(0, Math.min(level, 100)); // DEFAULT_VALUES[VISUAL_QUALITY] = level; // Log.v("Open4speed", "Default visual quality=" + level); // } // // public static int getConfig(Context c, int index) { // SharedPreferences pref = c.getSharedPreferences("MyPref", Context.MODE_PRIVATE); // return pref.getInt("IntCFG" + index, DEFAULT_VALUES[index]); // } // // public static void setConfig(Context c, int index, int value) { // SharedPreferences pref = c.getSharedPreferences("MyPref", Context.MODE_PRIVATE); // SharedPreferences.Editor edit = pref.edit(); // edit.putInt("IntCFG" + index, value); // edit.commit(); // } // // public static String getConfig(Context c, String str) { // SharedPreferences pref = c.getSharedPreferences("MyPref", Context.MODE_PRIVATE); // return pref.getString(str, ""); // } // // public static void setConfig(Context c, String str, String value) { // SharedPreferences pref = c.getSharedPreferences("MyPref", Context.MODE_PRIVATE); // SharedPreferences.Editor edit = pref.edit(); // edit.putString(str, value); // edit.commit(); // } // } // // Path: src/com/lvonasek/o4s/media/Sound.java // public class Sound { // // public static SoundPool snd = new SoundPool(16, AudioManager.STREAM_MUSIC, 0); // // public static float globalVolume = 1; // // int id; // boolean loop; // boolean playing; // float rate; // float volume; // // public Sound(String filename, boolean loop) { // //unzip file(Android java access) // try { // AssetFileDescriptor afd = GameActivity.instance.getAssets().openFd(filename); // id = snd.load(afd, 1); // } catch (IOException e) { // e.printStackTrace(); // this.id = -1; // } // this.loop = loop; // this.rate = 1; // this.volume = 0; // playing = false; // } // // public void play() { // if (GameLoop.paused == 0) { // //play sound // if (playing) // snd.pause(id); // snd.play(id, volume, volume, 1, loop ? -1 : 1, rate); // playing = true; // } // } // // /** // * Change frequency of sound(engine, n2o) // * @param speed is play rate(from 0.5 to 2.0) // */ // public void setFreq(float speed) { // //clamp rate speed // rate = speed; // if (speed < 0.5) { // rate = 0.5f; // } // if (speed > 2.0) { // rate = 2.0f; // } // } // // /** // * Set sound volume // * @param volume is sound volume(from 0 to 1) // */ // public void setVolume(float volume) { // //audio clip // if (GameLoop.paused == 0) { // volume *= 0.25f; // this.volume = volume * globalVolume; // } // } // // /** // * Stops playing sound // */ // public void stop() { // //audio clip // if ((GameLoop.paused == 0) && playing) { // snd.stop(id); // playing = false; // } // } // }
import android.content.Context; import android.content.pm.ApplicationInfo; import android.content.pm.PackageManager; import android.opengl.GLSurfaceView; import android.opengl.GLSurfaceView.Renderer; import android.util.AttributeSet; import android.view.View; import com.lvonasek.o4s.R; import com.lvonasek.o4s.media.Settings; import com.lvonasek.o4s.media.Sound; import java.util.ArrayList; import javax.microedition.khronos.egl.EGLConfig; import javax.microedition.khronos.opengles.GL10;
sounds.add(new Sound("sfx/engineplus.ogg", true)); } //begin setRenderer(this); } /** * Second init method - this is called when everything is ready * @param gl OpenGL object(unused because it is for java OpenGL interpretation) * @param config another OpenGL object(unused because it is for java OpenGL interpretation) */ public void onSurfaceCreated(GL10 gl, EGLConfig config) { //check if it is first time run if (!GameActivity.instance.init) { //get package assets object String apkFilePath; ApplicationInfo appInfo; PackageManager packMgmr = GameActivity.instance.getPackageManager(); //try to get assets try { appInfo = packMgmr.getApplicationInfo("com.lvonasek.o4s", 0); } catch (Exception e) { e.printStackTrace(); throw new RuntimeException("Unable to locate assets, aborting..."); } //load game apkFilePath = appInfo.sourceDir;
// Path: src/com/lvonasek/o4s/media/Settings.java // public class Settings { // // public static final int MUSIC_VOLUME = 0; // public static final int SOUND_VOLUME = 1; // public static final int VISUAL_QUALITY = 2; // public static final int RACE_EVENT = 3; // // public static final String RACE_CUSTOM_EVENT = "O4SCFG"; // // private static int[] DEFAULT_VALUES = {100, 100, 100, 0}; // // public static void init(Activity instance) { // Display display = instance.getWindowManager().getDefaultDisplay(); // Point size = new Point(); // display.getSize(size); // int level = 25 + (int) ((Math.max(size.x, size.y) - 800) / 6.4f); // level = Math.max(0, Math.min(level, 100)); // DEFAULT_VALUES[VISUAL_QUALITY] = level; // Log.v("Open4speed", "Default visual quality=" + level); // } // // public static int getConfig(Context c, int index) { // SharedPreferences pref = c.getSharedPreferences("MyPref", Context.MODE_PRIVATE); // return pref.getInt("IntCFG" + index, DEFAULT_VALUES[index]); // } // // public static void setConfig(Context c, int index, int value) { // SharedPreferences pref = c.getSharedPreferences("MyPref", Context.MODE_PRIVATE); // SharedPreferences.Editor edit = pref.edit(); // edit.putInt("IntCFG" + index, value); // edit.commit(); // } // // public static String getConfig(Context c, String str) { // SharedPreferences pref = c.getSharedPreferences("MyPref", Context.MODE_PRIVATE); // return pref.getString(str, ""); // } // // public static void setConfig(Context c, String str, String value) { // SharedPreferences pref = c.getSharedPreferences("MyPref", Context.MODE_PRIVATE); // SharedPreferences.Editor edit = pref.edit(); // edit.putString(str, value); // edit.commit(); // } // } // // Path: src/com/lvonasek/o4s/media/Sound.java // public class Sound { // // public static SoundPool snd = new SoundPool(16, AudioManager.STREAM_MUSIC, 0); // // public static float globalVolume = 1; // // int id; // boolean loop; // boolean playing; // float rate; // float volume; // // public Sound(String filename, boolean loop) { // //unzip file(Android java access) // try { // AssetFileDescriptor afd = GameActivity.instance.getAssets().openFd(filename); // id = snd.load(afd, 1); // } catch (IOException e) { // e.printStackTrace(); // this.id = -1; // } // this.loop = loop; // this.rate = 1; // this.volume = 0; // playing = false; // } // // public void play() { // if (GameLoop.paused == 0) { // //play sound // if (playing) // snd.pause(id); // snd.play(id, volume, volume, 1, loop ? -1 : 1, rate); // playing = true; // } // } // // /** // * Change frequency of sound(engine, n2o) // * @param speed is play rate(from 0.5 to 2.0) // */ // public void setFreq(float speed) { // //clamp rate speed // rate = speed; // if (speed < 0.5) { // rate = 0.5f; // } // if (speed > 2.0) { // rate = 2.0f; // } // } // // /** // * Set sound volume // * @param volume is sound volume(from 0 to 1) // */ // public void setVolume(float volume) { // //audio clip // if (GameLoop.paused == 0) { // volume *= 0.25f; // this.volume = volume * globalVolume; // } // } // // /** // * Stops playing sound // */ // public void stop() { // //audio clip // if ((GameLoop.paused == 0) && playing) { // snd.stop(id); // playing = false; // } // } // } // Path: src/com/lvonasek/o4s/game/GameLoop.java import android.content.Context; import android.content.pm.ApplicationInfo; import android.content.pm.PackageManager; import android.opengl.GLSurfaceView; import android.opengl.GLSurfaceView.Renderer; import android.util.AttributeSet; import android.view.View; import com.lvonasek.o4s.R; import com.lvonasek.o4s.media.Settings; import com.lvonasek.o4s.media.Sound; import java.util.ArrayList; import javax.microedition.khronos.egl.EGLConfig; import javax.microedition.khronos.opengles.GL10; sounds.add(new Sound("sfx/engineplus.ogg", true)); } //begin setRenderer(this); } /** * Second init method - this is called when everything is ready * @param gl OpenGL object(unused because it is for java OpenGL interpretation) * @param config another OpenGL object(unused because it is for java OpenGL interpretation) */ public void onSurfaceCreated(GL10 gl, EGLConfig config) { //check if it is first time run if (!GameActivity.instance.init) { //get package assets object String apkFilePath; ApplicationInfo appInfo; PackageManager packMgmr = GameActivity.instance.getPackageManager(); //try to get assets try { appInfo = packMgmr.getApplicationInfo("com.lvonasek.o4s", 0); } catch (Exception e) { e.printStackTrace(); throw new RuntimeException("Unable to locate assets, aborting..."); } //load game apkFilePath = appInfo.sourceDir;
float quality = 0.01f * Settings.getConfig(GameActivity.instance, Settings.VISUAL_QUALITY);
lvonasek/Open4speed
objConverter/src/ObjConverter.java
// Path: objConverter/src/geometry/Model.java // public class Model // { // public ArrayList<Triangle> faces; // public String material; // // public Model(String t) // { // faces = new ArrayList<Triangle>(); // material = t; // } // // public boolean isDynamic() // { // return material.contains("$"); // } // // public AABB getAABB() // { // Point3D min = new Point3D(99999, 99999, 99999); // Point3D max = new Point3D(-99999, -99999, -99999); // for (Triangle t : faces) // { // if (min.x > t.a.v.x) // min.x = t.a.v.x; // if (min.y > t.a.v.y) // min.y = t.a.v.y; // if (min.z > t.a.v.z) // min.z = t.a.v.z; // if (max.x < t.a.v.x) // max.x = t.a.v.x; // if (max.y < t.a.v.y) // max.y = t.a.v.y; // if (max.z < t.a.v.z) // max.z = t.a.v.z; // // if (min.x > t.b.v.x) // min.x = t.b.v.x; // if (min.y > t.b.v.y) // min.y = t.b.v.y; // if (min.z > t.b.v.z) // min.z = t.b.v.z; // if (max.x < t.b.v.x) // max.x = t.b.v.x; // if (max.y < t.b.v.y) // max.y = t.b.v.y; // if (max.z < t.b.v.z) // max.z = t.b.v.z; // // if (min.x > t.c.v.x) // min.x = t.c.v.x; // if (min.y > t.c.v.y) // min.y = t.c.v.y; // if (min.z > t.c.v.z) // min.z = t.c.v.z; // if (max.x < t.c.v.x) // max.x = t.c.v.x; // if (max.y < t.c.v.y) // max.y = t.c.v.y; // if (max.z < t.c.v.z) // max.z = t.c.v.z; // } // return new AABB(min, max); // } // }
import geometry.Model; import java.io.File; import java.util.ArrayList; import java.util.Map;
} if (!ObjLoader.exists(args[0])) { System.err.println("Input file doesn't exist"); return; } // get path of output directory String path = ""; try { path = args[1].substring(0, args[1].lastIndexOf('/')); // backup old directory new File(path).renameTo(new File("backup-" + System.currentTimeMillis())); } catch (Exception e) { System.err.println("Do not put output file into converter directory"); return; } // create output directory new File(path).mkdirs(); // process long timestamp = System.currentTimeMillis(); // load data ObjLoader obj = new ObjLoader(path); obj.loadObj(args[0]); obj.parseObj(args[0]); // subdivide data
// Path: objConverter/src/geometry/Model.java // public class Model // { // public ArrayList<Triangle> faces; // public String material; // // public Model(String t) // { // faces = new ArrayList<Triangle>(); // material = t; // } // // public boolean isDynamic() // { // return material.contains("$"); // } // // public AABB getAABB() // { // Point3D min = new Point3D(99999, 99999, 99999); // Point3D max = new Point3D(-99999, -99999, -99999); // for (Triangle t : faces) // { // if (min.x > t.a.v.x) // min.x = t.a.v.x; // if (min.y > t.a.v.y) // min.y = t.a.v.y; // if (min.z > t.a.v.z) // min.z = t.a.v.z; // if (max.x < t.a.v.x) // max.x = t.a.v.x; // if (max.y < t.a.v.y) // max.y = t.a.v.y; // if (max.z < t.a.v.z) // max.z = t.a.v.z; // // if (min.x > t.b.v.x) // min.x = t.b.v.x; // if (min.y > t.b.v.y) // min.y = t.b.v.y; // if (min.z > t.b.v.z) // min.z = t.b.v.z; // if (max.x < t.b.v.x) // max.x = t.b.v.x; // if (max.y < t.b.v.y) // max.y = t.b.v.y; // if (max.z < t.b.v.z) // max.z = t.b.v.z; // // if (min.x > t.c.v.x) // min.x = t.c.v.x; // if (min.y > t.c.v.y) // min.y = t.c.v.y; // if (min.z > t.c.v.z) // min.z = t.c.v.z; // if (max.x < t.c.v.x) // max.x = t.c.v.x; // if (max.y < t.c.v.y) // max.y = t.c.v.y; // if (max.z < t.c.v.z) // max.z = t.c.v.z; // } // return new AABB(min, max); // } // } // Path: objConverter/src/ObjConverter.java import geometry.Model; import java.io.File; import java.util.ArrayList; import java.util.Map; } if (!ObjLoader.exists(args[0])) { System.err.println("Input file doesn't exist"); return; } // get path of output directory String path = ""; try { path = args[1].substring(0, args[1].lastIndexOf('/')); // backup old directory new File(path).renameTo(new File("backup-" + System.currentTimeMillis())); } catch (Exception e) { System.err.println("Do not put output file into converter directory"); return; } // create output directory new File(path).mkdirs(); // process long timestamp = System.currentTimeMillis(); // load data ObjLoader obj = new ObjLoader(path); obj.loadObj(args[0]); obj.parseObj(args[0]); // subdivide data
Map<String, ArrayList<Model> > models = new Subdivider().subdivide(obj.getModels());
jbienz/FPVR
Android/FPVR/app/src/main/java/com/solersoft/fpvr/fpvrlib/Vehicle.java
// Path: Android/FPVR/app/src/main/java/com/solersoft/fpvr/util/TypeUtils.java // public class TypeUtils // { // public static <T> T as(Class<T> t, Object o) // { // return t.isAssignableFrom(o.getClass()) ? t.cast(o) : null; // } // }
import com.solersoft.fpvr.util.TypeUtils; import java.util.Collection; import java.util.HashSet; import java.util.Iterator;
package com.solersoft.fpvr.fpvrlib; /** * A base class implementation of the {@link IVehicle} interface. */ public abstract class Vehicle extends Connectable implements IVehicle { //region Constants private static final String TAG = "Vehicle"; //endregion //region Member Variables private Collection<IVehicleService> services = new HashSet<IVehicleService>(); //endregion //region Constructors /** * Initializes a new {@link Vehicle}. */ public Vehicle() { } //endregion //region Internal Methods protected void connectService(final Iterator<IVehicleService> iterator, final boolean allConnected, final ResultHandler handler) { if (iterator.hasNext()) { // Get next service IVehicleService service = iterator.next(); // Try to get lifecycle
// Path: Android/FPVR/app/src/main/java/com/solersoft/fpvr/util/TypeUtils.java // public class TypeUtils // { // public static <T> T as(Class<T> t, Object o) // { // return t.isAssignableFrom(o.getClass()) ? t.cast(o) : null; // } // } // Path: Android/FPVR/app/src/main/java/com/solersoft/fpvr/fpvrlib/Vehicle.java import com.solersoft.fpvr.util.TypeUtils; import java.util.Collection; import java.util.HashSet; import java.util.Iterator; package com.solersoft.fpvr.fpvrlib; /** * A base class implementation of the {@link IVehicle} interface. */ public abstract class Vehicle extends Connectable implements IVehicle { //region Constants private static final String TAG = "Vehicle"; //endregion //region Member Variables private Collection<IVehicleService> services = new HashSet<IVehicleService>(); //endregion //region Constructors /** * Initializes a new {@link Vehicle}. */ public Vehicle() { } //endregion //region Internal Methods protected void connectService(final Iterator<IVehicleService> iterator, final boolean allConnected, final ResultHandler handler) { if (iterator.hasNext()) { // Get next service IVehicleService service = iterator.next(); // Try to get lifecycle
IConnectable connectable = TypeUtils.as(IConnectable.class, service);
jbienz/FPVR
Android/FPVR/app/src/main/java/com/solersoft/fpvr/fpvrdji/DJIGimbalService.java
// Path: Android/FPVR/app/src/main/java/com/solersoft/fpvr/util/DJI.java // public class DJI // { // /** // * Returns true if the result is considered a success. // * @param errorCode the result. // * @return true if result is a success; otherwise false. // */ // public static boolean Success(int errorCode) // { // return errorCode == 0; // } // }
import android.util.Log; import com.solersoft.fpvr.fpvrlib.*; import com.solersoft.fpvr.util.DJI; import java.security.InvalidParameterException; import java.util.Timer; import java.util.TimerTask; import dji.sdk.api.DJIDrone; import dji.sdk.api.DJIError; import dji.sdk.api.Gimbal.DJIGimbal; import dji.sdk.api.Gimbal.DJIGimbalAttitude; import dji.sdk.api.Gimbal.DJIGimbalCapacity; import dji.sdk.api.Gimbal.DJIGimbalRotation; import dji.sdk.interfaces.DJIExecuteResultCallback; import dji.sdk.interfaces.DJIGimbalUpdateAttitudeCallBack;
yaw = clampYaw(yaw); // Scale int ps = (int)Math.round(pitch); int rs = (int)Math.round(roll); int ys = (int)Math.round(yaw); boolean enabled = true; boolean directionBackward = false; DJIGimbalRotation pr = new DJIGimbalRotation(enabled, directionBackward, relative, ps); DJIGimbalRotation rr = new DJIGimbalRotation(enabled, directionBackward, relative, rs); DJIGimbalRotation yr = new DJIGimbalRotation(enabled, directionBackward, relative, ys); // Move the gimbal Log.i(TAG, "Native Move: PS: " + ps + " RS: " + rs + " YS: " + ys); DJIDrone.getDjiGimbal().updateGimbalAttitude(pr, rr, yr); } private void setGimbalSpeed(int pitchSpeed, int rollSpeed, int yawSpeed) { // Make sure enabled if (!isEnabled()) { return; } // Set Gimbal Move Speed Log.i(TAG, "Updating gimbal speed: P: " + pitchSpeed + " R: " + rollSpeed + " Y: " + yawSpeed); DJIDrone.getDjiRemoteController().setGimbalControlSpeed(pitchSpeed, rollSpeed, yawSpeed, new DJIExecuteResultCallback() { @Override public void onResult(DJIError djiError) {
// Path: Android/FPVR/app/src/main/java/com/solersoft/fpvr/util/DJI.java // public class DJI // { // /** // * Returns true if the result is considered a success. // * @param errorCode the result. // * @return true if result is a success; otherwise false. // */ // public static boolean Success(int errorCode) // { // return errorCode == 0; // } // } // Path: Android/FPVR/app/src/main/java/com/solersoft/fpvr/fpvrdji/DJIGimbalService.java import android.util.Log; import com.solersoft.fpvr.fpvrlib.*; import com.solersoft.fpvr.util.DJI; import java.security.InvalidParameterException; import java.util.Timer; import java.util.TimerTask; import dji.sdk.api.DJIDrone; import dji.sdk.api.DJIError; import dji.sdk.api.Gimbal.DJIGimbal; import dji.sdk.api.Gimbal.DJIGimbalAttitude; import dji.sdk.api.Gimbal.DJIGimbalCapacity; import dji.sdk.api.Gimbal.DJIGimbalRotation; import dji.sdk.interfaces.DJIExecuteResultCallback; import dji.sdk.interfaces.DJIGimbalUpdateAttitudeCallBack; yaw = clampYaw(yaw); // Scale int ps = (int)Math.round(pitch); int rs = (int)Math.round(roll); int ys = (int)Math.round(yaw); boolean enabled = true; boolean directionBackward = false; DJIGimbalRotation pr = new DJIGimbalRotation(enabled, directionBackward, relative, ps); DJIGimbalRotation rr = new DJIGimbalRotation(enabled, directionBackward, relative, rs); DJIGimbalRotation yr = new DJIGimbalRotation(enabled, directionBackward, relative, ys); // Move the gimbal Log.i(TAG, "Native Move: PS: " + ps + " RS: " + rs + " YS: " + ys); DJIDrone.getDjiGimbal().updateGimbalAttitude(pr, rr, yr); } private void setGimbalSpeed(int pitchSpeed, int rollSpeed, int yawSpeed) { // Make sure enabled if (!isEnabled()) { return; } // Set Gimbal Move Speed Log.i(TAG, "Updating gimbal speed: P: " + pitchSpeed + " R: " + rollSpeed + " Y: " + yawSpeed); DJIDrone.getDjiRemoteController().setGimbalControlSpeed(pitchSpeed, rollSpeed, yawSpeed, new DJIExecuteResultCallback() { @Override public void onResult(DJIError djiError) {
if (!DJI.Success(djiError.errorCode))
kstenschke/referencer-plugin
src/com/kstenschke/referencer/referencers/insertOrCopy/InsertOrCopyReferencerFilesFolders.java
// Path: src/com/kstenschke/referencer/resources/StaticTexts.java // public class StaticTexts { // // @NonNls public static final String SETTINGS_DISPLAY_NAME = "Referencer"; // // /* Popup titles */ // @NonNls public static final String POPUP_TITLE_ACTION_COPY = "Select what to copy"; // @NonNls public static final String POPUP_TITLE_ACTION_INSERT = "Select Insertion"; // @NonNls public static final String POPUP_TITLE_ACTION_GO = "Select where to go"; // @NonNls public static final String POPUP_TITLE_ACTION_GO_FUNNY = "Where do you want to go today?"; // // /* Popup items */ // @NonNls public static final String POPUP_ITEM_METHODS_IN_FILE = "List of methods in current file"; // public static final String POPUP_ITEM_OPEN_FILES = "List of currently opened files"; // // /* Popup section titles */ // @NonNls public static final String POPUP_ITEM_PREFIX_SECTION_TITLE = "SECTIONTITLE:"; // // @NonNls public static final String POPUP_SECTION_BOOKMARKS = "SECTIONTITLE: Bookmarks"; // @NonNls public static final String POPUP_SECTION_FUNCTIONS = "SECTIONTITLE: Methods"; // @NonNls public static final String POPUP_SECTION_REGIONS = "SECTIONTITLE: Regions"; // @NonNls public static final String POPUP_SECTION_TITLE_DATE_TIME = "SECTIONTITLE: Date / Time"; // @NonNls public static final String POPUP_SECTION_TITLE_FILES_PATHS = "SECTIONTITLE: Files / Paths"; // @NonNls public static final String POPUP_SECTION_TITLE_JAVASCRIPT = "SECTIONTITLE: JavaScript"; // @NonNls public static final String POPUP_SECTION_TITLE_MARKDOWN = "SECTIONTITLE: Markdown"; // @NonNls public static final String POPUP_SECTION_TITLE_PHP = "SECTIONTITLE: PHP"; // @NonNls public static final String POPUP_SECTION_TITLE_TEXT_COMPLETIONS = "SECTIONTITLE: Text Completions"; // // /* Go action context menu */ // @NonNls public static final String POPUP_GO_REMOVE_ALL_BOOKMARKS = "Remove all Bookmarks from this File"; // // /* Notifications */ // @NonNls public static final String NOTIFY_GOTO_NONE_FOUND = "No GoTo destinations found"; // @NonNls public static final String NOTIFY_NO_PROJECT_OPEN = "A project must be loaded before using this option"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_DOESNT_EXIST = "No referencer_patterns.txt found"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_FAILED_SAVE = "Failed saving referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_NO_REPLACE_PATTERNS = "No search/replace patterns"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_LOADED = "Imported settings from referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_SAVED = "Exported settings to referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REPLACE_NONE_CONFIGURED = "No replace patterns configured"; // }
import com.intellij.openapi.actionSystem.AnActionEvent; import com.intellij.openapi.actionSystem.PlatformDataKeys; import com.intellij.openapi.editor.Document; import com.intellij.openapi.editor.Editor; import com.intellij.openapi.fileEditor.FileDocumentManager; import com.intellij.openapi.fileEditor.FileEditorManager; import com.intellij.openapi.project.Project; import com.intellij.openapi.vfs.VirtualFile; import com.kstenschke.referencer.resources.StaticTexts; import java.util.ArrayList; import java.util.List;
/* * Copyright Kay Stenschke * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.kstenschke.referencer.referencers.insertOrCopy; class InsertOrCopyReferencerFilesFolders { /** * Get items regarding files / folder / paths * * @param e Action system event * @return List of PHP items */ public static List<String> getReferenceItems(AnActionEvent e) { List<String> referenceItems = new ArrayList<>(); final Project project = e.getData(PlatformDataKeys.PROJECT); Editor editor = e.getData(PlatformDataKeys.EDITOR); if (project == null || editor == null) { return referenceItems; } final Document document = editor.getDocument(); /* Get line number the caret is in */ int caretOffset = editor.getCaretModel().getOffset(); int lineNumber = document.getLineNumber(caretOffset); /* File path and name */ VirtualFile file = FileDocumentManager.getInstance().getFile(document); String filePath = file != null ? file.getPath() : ""; String filename = file != null ? file.getName() : ""; /* Add items */ FileEditorManager fileEditorManager = FileEditorManager.getInstance(project); int amountOpenFiles = fileEditorManager.getOpenFiles().length; if (amountOpenFiles > 1) {
// Path: src/com/kstenschke/referencer/resources/StaticTexts.java // public class StaticTexts { // // @NonNls public static final String SETTINGS_DISPLAY_NAME = "Referencer"; // // /* Popup titles */ // @NonNls public static final String POPUP_TITLE_ACTION_COPY = "Select what to copy"; // @NonNls public static final String POPUP_TITLE_ACTION_INSERT = "Select Insertion"; // @NonNls public static final String POPUP_TITLE_ACTION_GO = "Select where to go"; // @NonNls public static final String POPUP_TITLE_ACTION_GO_FUNNY = "Where do you want to go today?"; // // /* Popup items */ // @NonNls public static final String POPUP_ITEM_METHODS_IN_FILE = "List of methods in current file"; // public static final String POPUP_ITEM_OPEN_FILES = "List of currently opened files"; // // /* Popup section titles */ // @NonNls public static final String POPUP_ITEM_PREFIX_SECTION_TITLE = "SECTIONTITLE:"; // // @NonNls public static final String POPUP_SECTION_BOOKMARKS = "SECTIONTITLE: Bookmarks"; // @NonNls public static final String POPUP_SECTION_FUNCTIONS = "SECTIONTITLE: Methods"; // @NonNls public static final String POPUP_SECTION_REGIONS = "SECTIONTITLE: Regions"; // @NonNls public static final String POPUP_SECTION_TITLE_DATE_TIME = "SECTIONTITLE: Date / Time"; // @NonNls public static final String POPUP_SECTION_TITLE_FILES_PATHS = "SECTIONTITLE: Files / Paths"; // @NonNls public static final String POPUP_SECTION_TITLE_JAVASCRIPT = "SECTIONTITLE: JavaScript"; // @NonNls public static final String POPUP_SECTION_TITLE_MARKDOWN = "SECTIONTITLE: Markdown"; // @NonNls public static final String POPUP_SECTION_TITLE_PHP = "SECTIONTITLE: PHP"; // @NonNls public static final String POPUP_SECTION_TITLE_TEXT_COMPLETIONS = "SECTIONTITLE: Text Completions"; // // /* Go action context menu */ // @NonNls public static final String POPUP_GO_REMOVE_ALL_BOOKMARKS = "Remove all Bookmarks from this File"; // // /* Notifications */ // @NonNls public static final String NOTIFY_GOTO_NONE_FOUND = "No GoTo destinations found"; // @NonNls public static final String NOTIFY_NO_PROJECT_OPEN = "A project must be loaded before using this option"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_DOESNT_EXIST = "No referencer_patterns.txt found"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_FAILED_SAVE = "Failed saving referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_NO_REPLACE_PATTERNS = "No search/replace patterns"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_LOADED = "Imported settings from referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_SAVED = "Exported settings to referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REPLACE_NONE_CONFIGURED = "No replace patterns configured"; // } // Path: src/com/kstenschke/referencer/referencers/insertOrCopy/InsertOrCopyReferencerFilesFolders.java import com.intellij.openapi.actionSystem.AnActionEvent; import com.intellij.openapi.actionSystem.PlatformDataKeys; import com.intellij.openapi.editor.Document; import com.intellij.openapi.editor.Editor; import com.intellij.openapi.fileEditor.FileDocumentManager; import com.intellij.openapi.fileEditor.FileEditorManager; import com.intellij.openapi.project.Project; import com.intellij.openapi.vfs.VirtualFile; import com.kstenschke.referencer.resources.StaticTexts; import java.util.ArrayList; import java.util.List; /* * Copyright Kay Stenschke * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.kstenschke.referencer.referencers.insertOrCopy; class InsertOrCopyReferencerFilesFolders { /** * Get items regarding files / folder / paths * * @param e Action system event * @return List of PHP items */ public static List<String> getReferenceItems(AnActionEvent e) { List<String> referenceItems = new ArrayList<>(); final Project project = e.getData(PlatformDataKeys.PROJECT); Editor editor = e.getData(PlatformDataKeys.EDITOR); if (project == null || editor == null) { return referenceItems; } final Document document = editor.getDocument(); /* Get line number the caret is in */ int caretOffset = editor.getCaretModel().getOffset(); int lineNumber = document.getLineNumber(caretOffset); /* File path and name */ VirtualFile file = FileDocumentManager.getInstance().getFile(document); String filePath = file != null ? file.getPath() : ""; String filename = file != null ? file.getName() : ""; /* Add items */ FileEditorManager fileEditorManager = FileEditorManager.getInstance(project); int amountOpenFiles = fileEditorManager.getOpenFiles().length; if (amountOpenFiles > 1) {
referenceItems.add(StaticTexts.POPUP_ITEM_OPEN_FILES);
kstenschke/referencer-plugin
src/com/kstenschke/referencer/resources/ui/PopupContextGo.java
// Path: src/com/kstenschke/referencer/resources/StaticTexts.java // public class StaticTexts { // // @NonNls public static final String SETTINGS_DISPLAY_NAME = "Referencer"; // // /* Popup titles */ // @NonNls public static final String POPUP_TITLE_ACTION_COPY = "Select what to copy"; // @NonNls public static final String POPUP_TITLE_ACTION_INSERT = "Select Insertion"; // @NonNls public static final String POPUP_TITLE_ACTION_GO = "Select where to go"; // @NonNls public static final String POPUP_TITLE_ACTION_GO_FUNNY = "Where do you want to go today?"; // // /* Popup items */ // @NonNls public static final String POPUP_ITEM_METHODS_IN_FILE = "List of methods in current file"; // public static final String POPUP_ITEM_OPEN_FILES = "List of currently opened files"; // // /* Popup section titles */ // @NonNls public static final String POPUP_ITEM_PREFIX_SECTION_TITLE = "SECTIONTITLE:"; // // @NonNls public static final String POPUP_SECTION_BOOKMARKS = "SECTIONTITLE: Bookmarks"; // @NonNls public static final String POPUP_SECTION_FUNCTIONS = "SECTIONTITLE: Methods"; // @NonNls public static final String POPUP_SECTION_REGIONS = "SECTIONTITLE: Regions"; // @NonNls public static final String POPUP_SECTION_TITLE_DATE_TIME = "SECTIONTITLE: Date / Time"; // @NonNls public static final String POPUP_SECTION_TITLE_FILES_PATHS = "SECTIONTITLE: Files / Paths"; // @NonNls public static final String POPUP_SECTION_TITLE_JAVASCRIPT = "SECTIONTITLE: JavaScript"; // @NonNls public static final String POPUP_SECTION_TITLE_MARKDOWN = "SECTIONTITLE: Markdown"; // @NonNls public static final String POPUP_SECTION_TITLE_PHP = "SECTIONTITLE: PHP"; // @NonNls public static final String POPUP_SECTION_TITLE_TEXT_COMPLETIONS = "SECTIONTITLE: Text Completions"; // // /* Go action context menu */ // @NonNls public static final String POPUP_GO_REMOVE_ALL_BOOKMARKS = "Remove all Bookmarks from this File"; // // /* Notifications */ // @NonNls public static final String NOTIFY_GOTO_NONE_FOUND = "No GoTo destinations found"; // @NonNls public static final String NOTIFY_NO_PROJECT_OPEN = "A project must be loaded before using this option"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_DOESNT_EXIST = "No referencer_patterns.txt found"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_FAILED_SAVE = "Failed saving referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_NO_REPLACE_PATTERNS = "No search/replace patterns"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_LOADED = "Imported settings from referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_SAVED = "Exported settings to referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REPLACE_NONE_CONFIGURED = "No replace patterns configured"; // }
import com.intellij.ide.bookmarks.Bookmark; import com.intellij.ide.bookmarks.BookmarkManager; import com.intellij.openapi.editor.Editor; import com.intellij.openapi.fileEditor.FileDocumentManager; import com.intellij.openapi.fileEditor.FileEditorManager; import com.intellij.openapi.project.Project; import com.intellij.openapi.vfs.VirtualFile; import com.kstenschke.referencer.resources.StaticTexts; import javax.swing.*; import java.awt.event.MouseAdapter; import java.awt.event.MouseEvent; import java.util.List;
/* * Copyright Kay Stenschke * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.kstenschke.referencer.resources.ui; public class PopupContextGo { private final JPopupMenu popup; public PopupContextGo(final Project curProject) { this.popup = new JPopupMenu(); /* Remove all bookmarks from current file */
// Path: src/com/kstenschke/referencer/resources/StaticTexts.java // public class StaticTexts { // // @NonNls public static final String SETTINGS_DISPLAY_NAME = "Referencer"; // // /* Popup titles */ // @NonNls public static final String POPUP_TITLE_ACTION_COPY = "Select what to copy"; // @NonNls public static final String POPUP_TITLE_ACTION_INSERT = "Select Insertion"; // @NonNls public static final String POPUP_TITLE_ACTION_GO = "Select where to go"; // @NonNls public static final String POPUP_TITLE_ACTION_GO_FUNNY = "Where do you want to go today?"; // // /* Popup items */ // @NonNls public static final String POPUP_ITEM_METHODS_IN_FILE = "List of methods in current file"; // public static final String POPUP_ITEM_OPEN_FILES = "List of currently opened files"; // // /* Popup section titles */ // @NonNls public static final String POPUP_ITEM_PREFIX_SECTION_TITLE = "SECTIONTITLE:"; // // @NonNls public static final String POPUP_SECTION_BOOKMARKS = "SECTIONTITLE: Bookmarks"; // @NonNls public static final String POPUP_SECTION_FUNCTIONS = "SECTIONTITLE: Methods"; // @NonNls public static final String POPUP_SECTION_REGIONS = "SECTIONTITLE: Regions"; // @NonNls public static final String POPUP_SECTION_TITLE_DATE_TIME = "SECTIONTITLE: Date / Time"; // @NonNls public static final String POPUP_SECTION_TITLE_FILES_PATHS = "SECTIONTITLE: Files / Paths"; // @NonNls public static final String POPUP_SECTION_TITLE_JAVASCRIPT = "SECTIONTITLE: JavaScript"; // @NonNls public static final String POPUP_SECTION_TITLE_MARKDOWN = "SECTIONTITLE: Markdown"; // @NonNls public static final String POPUP_SECTION_TITLE_PHP = "SECTIONTITLE: PHP"; // @NonNls public static final String POPUP_SECTION_TITLE_TEXT_COMPLETIONS = "SECTIONTITLE: Text Completions"; // // /* Go action context menu */ // @NonNls public static final String POPUP_GO_REMOVE_ALL_BOOKMARKS = "Remove all Bookmarks from this File"; // // /* Notifications */ // @NonNls public static final String NOTIFY_GOTO_NONE_FOUND = "No GoTo destinations found"; // @NonNls public static final String NOTIFY_NO_PROJECT_OPEN = "A project must be loaded before using this option"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_DOESNT_EXIST = "No referencer_patterns.txt found"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_FAILED_SAVE = "Failed saving referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_NO_REPLACE_PATTERNS = "No search/replace patterns"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_LOADED = "Imported settings from referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_SAVED = "Exported settings to referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REPLACE_NONE_CONFIGURED = "No replace patterns configured"; // } // Path: src/com/kstenschke/referencer/resources/ui/PopupContextGo.java import com.intellij.ide.bookmarks.Bookmark; import com.intellij.ide.bookmarks.BookmarkManager; import com.intellij.openapi.editor.Editor; import com.intellij.openapi.fileEditor.FileDocumentManager; import com.intellij.openapi.fileEditor.FileEditorManager; import com.intellij.openapi.project.Project; import com.intellij.openapi.vfs.VirtualFile; import com.kstenschke.referencer.resources.StaticTexts; import javax.swing.*; import java.awt.event.MouseAdapter; import java.awt.event.MouseEvent; import java.util.List; /* * Copyright Kay Stenschke * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.kstenschke.referencer.resources.ui; public class PopupContextGo { private final JPopupMenu popup; public PopupContextGo(final Project curProject) { this.popup = new JPopupMenu(); /* Remove all bookmarks from current file */
JMenuItem menuItemSelectedBookmarkAdd = new JMenuItem(StaticTexts.POPUP_GO_REMOVE_ALL_BOOKMARKS);
kstenschke/referencer-plugin
src/com/kstenschke/referencer/resources/ui/DividedListCellRenderer.java
// Path: src/com/kstenschke/referencer/resources/StaticTexts.java // public class StaticTexts { // // @NonNls public static final String SETTINGS_DISPLAY_NAME = "Referencer"; // // /* Popup titles */ // @NonNls public static final String POPUP_TITLE_ACTION_COPY = "Select what to copy"; // @NonNls public static final String POPUP_TITLE_ACTION_INSERT = "Select Insertion"; // @NonNls public static final String POPUP_TITLE_ACTION_GO = "Select where to go"; // @NonNls public static final String POPUP_TITLE_ACTION_GO_FUNNY = "Where do you want to go today?"; // // /* Popup items */ // @NonNls public static final String POPUP_ITEM_METHODS_IN_FILE = "List of methods in current file"; // public static final String POPUP_ITEM_OPEN_FILES = "List of currently opened files"; // // /* Popup section titles */ // @NonNls public static final String POPUP_ITEM_PREFIX_SECTION_TITLE = "SECTIONTITLE:"; // // @NonNls public static final String POPUP_SECTION_BOOKMARKS = "SECTIONTITLE: Bookmarks"; // @NonNls public static final String POPUP_SECTION_FUNCTIONS = "SECTIONTITLE: Methods"; // @NonNls public static final String POPUP_SECTION_REGIONS = "SECTIONTITLE: Regions"; // @NonNls public static final String POPUP_SECTION_TITLE_DATE_TIME = "SECTIONTITLE: Date / Time"; // @NonNls public static final String POPUP_SECTION_TITLE_FILES_PATHS = "SECTIONTITLE: Files / Paths"; // @NonNls public static final String POPUP_SECTION_TITLE_JAVASCRIPT = "SECTIONTITLE: JavaScript"; // @NonNls public static final String POPUP_SECTION_TITLE_MARKDOWN = "SECTIONTITLE: Markdown"; // @NonNls public static final String POPUP_SECTION_TITLE_PHP = "SECTIONTITLE: PHP"; // @NonNls public static final String POPUP_SECTION_TITLE_TEXT_COMPLETIONS = "SECTIONTITLE: Text Completions"; // // /* Go action context menu */ // @NonNls public static final String POPUP_GO_REMOVE_ALL_BOOKMARKS = "Remove all Bookmarks from this File"; // // /* Notifications */ // @NonNls public static final String NOTIFY_GOTO_NONE_FOUND = "No GoTo destinations found"; // @NonNls public static final String NOTIFY_NO_PROJECT_OPEN = "A project must be loaded before using this option"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_DOESNT_EXIST = "No referencer_patterns.txt found"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_FAILED_SAVE = "Failed saving referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_NO_REPLACE_PATTERNS = "No search/replace patterns"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_LOADED = "Imported settings from referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_SAVED = "Exported settings to referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REPLACE_NONE_CONFIGURED = "No replace patterns configured"; // }
import com.intellij.ui.Gray; import com.intellij.ui.components.JBLabel; import com.intellij.ui.components.JBList; import com.intellij.util.ui.UIUtil; import com.kstenschke.referencer.resources.StaticTexts; import javax.swing.*; import java.awt.*;
/* * Copyright Kay Stenschke * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.kstenschke.referencer.resources.ui; /** * List cell renderer with a separator, items with "_" as text are displayed as separators dividing item groups */ public class DividedListCellRenderer extends DefaultListCellRenderer { private final Font separatorFont; private final Color separatorColorBackground; private final Color separatorColorForeground; public DividedListCellRenderer(JBList<Object> list) { boolean isUnderDarcula = UIUtil.isUnderDarcula(); Font defaultFont = list.getFont(); this.separatorFont = new Font(defaultFont.getName(), defaultFont.getStyle(), defaultFont.getSize()); this.separatorColorBackground = isUnderDarcula ? Gray._79 : Gray._243; this.separatorColorForeground = isUnderDarcula ? Gray._250 : Gray._79; } /** * @return The rendered cell * @param list List of reference items * @param value Value of reference item * @param index Item index * @param isSelected Item currently selected? * @param cellHasFocus Item currently has focus? */ @Override public Component getListCellRendererComponent(JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { String valueStr = null; if (value != null) { valueStr = value.toString(); valueStr = valueStr.substring(valueStr.indexOf("=>") + 2); /* Do not output item index prefix */ /* Apply section title styling */
// Path: src/com/kstenschke/referencer/resources/StaticTexts.java // public class StaticTexts { // // @NonNls public static final String SETTINGS_DISPLAY_NAME = "Referencer"; // // /* Popup titles */ // @NonNls public static final String POPUP_TITLE_ACTION_COPY = "Select what to copy"; // @NonNls public static final String POPUP_TITLE_ACTION_INSERT = "Select Insertion"; // @NonNls public static final String POPUP_TITLE_ACTION_GO = "Select where to go"; // @NonNls public static final String POPUP_TITLE_ACTION_GO_FUNNY = "Where do you want to go today?"; // // /* Popup items */ // @NonNls public static final String POPUP_ITEM_METHODS_IN_FILE = "List of methods in current file"; // public static final String POPUP_ITEM_OPEN_FILES = "List of currently opened files"; // // /* Popup section titles */ // @NonNls public static final String POPUP_ITEM_PREFIX_SECTION_TITLE = "SECTIONTITLE:"; // // @NonNls public static final String POPUP_SECTION_BOOKMARKS = "SECTIONTITLE: Bookmarks"; // @NonNls public static final String POPUP_SECTION_FUNCTIONS = "SECTIONTITLE: Methods"; // @NonNls public static final String POPUP_SECTION_REGIONS = "SECTIONTITLE: Regions"; // @NonNls public static final String POPUP_SECTION_TITLE_DATE_TIME = "SECTIONTITLE: Date / Time"; // @NonNls public static final String POPUP_SECTION_TITLE_FILES_PATHS = "SECTIONTITLE: Files / Paths"; // @NonNls public static final String POPUP_SECTION_TITLE_JAVASCRIPT = "SECTIONTITLE: JavaScript"; // @NonNls public static final String POPUP_SECTION_TITLE_MARKDOWN = "SECTIONTITLE: Markdown"; // @NonNls public static final String POPUP_SECTION_TITLE_PHP = "SECTIONTITLE: PHP"; // @NonNls public static final String POPUP_SECTION_TITLE_TEXT_COMPLETIONS = "SECTIONTITLE: Text Completions"; // // /* Go action context menu */ // @NonNls public static final String POPUP_GO_REMOVE_ALL_BOOKMARKS = "Remove all Bookmarks from this File"; // // /* Notifications */ // @NonNls public static final String NOTIFY_GOTO_NONE_FOUND = "No GoTo destinations found"; // @NonNls public static final String NOTIFY_NO_PROJECT_OPEN = "A project must be loaded before using this option"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_DOESNT_EXIST = "No referencer_patterns.txt found"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_FAILED_SAVE = "Failed saving referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_NO_REPLACE_PATTERNS = "No search/replace patterns"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_LOADED = "Imported settings from referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REFERENCER_TXT_SAVED = "Exported settings to referencer_patterns.txt"; // @NonNls public static final String NOTIFY_REPLACE_NONE_CONFIGURED = "No replace patterns configured"; // } // Path: src/com/kstenschke/referencer/resources/ui/DividedListCellRenderer.java import com.intellij.ui.Gray; import com.intellij.ui.components.JBLabel; import com.intellij.ui.components.JBList; import com.intellij.util.ui.UIUtil; import com.kstenschke.referencer.resources.StaticTexts; import javax.swing.*; import java.awt.*; /* * Copyright Kay Stenschke * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.kstenschke.referencer.resources.ui; /** * List cell renderer with a separator, items with "_" as text are displayed as separators dividing item groups */ public class DividedListCellRenderer extends DefaultListCellRenderer { private final Font separatorFont; private final Color separatorColorBackground; private final Color separatorColorForeground; public DividedListCellRenderer(JBList<Object> list) { boolean isUnderDarcula = UIUtil.isUnderDarcula(); Font defaultFont = list.getFont(); this.separatorFont = new Font(defaultFont.getName(), defaultFont.getStyle(), defaultFont.getSize()); this.separatorColorBackground = isUnderDarcula ? Gray._79 : Gray._243; this.separatorColorForeground = isUnderDarcula ? Gray._250 : Gray._79; } /** * @return The rendered cell * @param list List of reference items * @param value Value of reference item * @param index Item index * @param isSelected Item currently selected? * @param cellHasFocus Item currently has focus? */ @Override public Component getListCellRendererComponent(JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { String valueStr = null; if (value != null) { valueStr = value.toString(); valueStr = valueStr.substring(valueStr.indexOf("=>") + 2); /* Do not output item index prefix */ /* Apply section title styling */
if (valueStr.startsWith(StaticTexts.POPUP_ITEM_PREFIX_SECTION_TITLE)) {
mozack/abra2
src/main/java/abra/IndelShifter.java
// Path: src/main/java/abra/Logger.java // enum Level { TRACE, DEBUG, INFO, WARN, ERROR };
import java.io.File; import java.io.IOException; import java.util.ArrayList; import java.util.Arrays; import java.util.List; import abra.Logger.Level; import htsjdk.samtools.Cigar; import htsjdk.samtools.CigarElement; import htsjdk.samtools.CigarOperator; import htsjdk.samtools.SAMFileWriter; import htsjdk.samtools.SAMFileWriterFactory; import htsjdk.samtools.SAMRecord; import htsjdk.samtools.SamReader; import htsjdk.samtools.TextCigarCodec;
Cigar subCigar = new Cigar(Arrays.asList(prev, elem, next)); String subSeq = seq.substring(readOffset, readOffset+subCigar.getReadLength()); Cigar newCigar = shiftIndelsLeft(refStart + refOffset, refStart + refOffset + subCigar.getReferenceLength(), chromosome, subCigar, subSeq, c2r); //TODO: Merge abutting indels if applicable elems.set(i-1, newCigar.getCigarElement(0)); elems.set(i, newCigar.getCigarElement(1)); if (newCigar.getCigarElements().size() == 3) { elems.set(i+1, newCigar.getCigarElement(2)); } else { elems.remove(i+1); elemSize -= 1; } } } mergeAbuttingElements(elems); return new Cigar(elems); } catch (RuntimeException e) { e.printStackTrace(); Logger.error("Error on: " + refStart + ", " + refEnd + "," + chromosome + ", " + cigar + ", " + seq); throw e; } } // Merge neighboring Cigar elements of same type // mutates input private void mergeAbuttingElements(List<CigarElement> elems) { int origSize = elems.size();
// Path: src/main/java/abra/Logger.java // enum Level { TRACE, DEBUG, INFO, WARN, ERROR }; // Path: src/main/java/abra/IndelShifter.java import java.io.File; import java.io.IOException; import java.util.ArrayList; import java.util.Arrays; import java.util.List; import abra.Logger.Level; import htsjdk.samtools.Cigar; import htsjdk.samtools.CigarElement; import htsjdk.samtools.CigarOperator; import htsjdk.samtools.SAMFileWriter; import htsjdk.samtools.SAMFileWriterFactory; import htsjdk.samtools.SAMRecord; import htsjdk.samtools.SamReader; import htsjdk.samtools.TextCigarCodec; Cigar subCigar = new Cigar(Arrays.asList(prev, elem, next)); String subSeq = seq.substring(readOffset, readOffset+subCigar.getReadLength()); Cigar newCigar = shiftIndelsLeft(refStart + refOffset, refStart + refOffset + subCigar.getReferenceLength(), chromosome, subCigar, subSeq, c2r); //TODO: Merge abutting indels if applicable elems.set(i-1, newCigar.getCigarElement(0)); elems.set(i, newCigar.getCigarElement(1)); if (newCigar.getCigarElements().size() == 3) { elems.set(i+1, newCigar.getCigarElement(2)); } else { elems.remove(i+1); elemSize -= 1; } } } mergeAbuttingElements(elems); return new Cigar(elems); } catch (RuntimeException e) { e.printStackTrace(); Logger.error("Error on: " + refStart + ", " + refEnd + "," + chromosome + ", " + cigar + ", " + seq); throw e; } } // Merge neighboring Cigar elements of same type // mutates input private void mergeAbuttingElements(List<CigarElement> elems) { int origSize = elems.size();
List<CigarElement> orig = Logger.LEVEL == Level.TRACE ? new ArrayList<CigarElement>(elems) : null;
mozack/abra2
src/main/java/abra/AltContigGenerator.java
// Path: src/main/java/abra/SAMRecordUtils.java // public static class ReadBlock { // private int readPos; // private int refPos; // private int length; // private CigarElement elem; // // public ReadBlock(int readPos, int refPos, int length, CigarElement elem) { // this.readPos = readPos; // this.refPos = refPos; // this.length = length; // this.elem = elem; // } // // public int getReadPos() { // return readPos; // } // // public int getRefPos() { // return refPos; // } // // public int getLength() { // return length; // } // // public CigarElement getCigarElement() { // return elem; // } // }
import htsjdk.samtools.CigarElement; import htsjdk.samtools.CigarOperator; import htsjdk.samtools.SAMRecord; import java.util.ArrayList; import java.util.Collection; import java.util.Collections; import java.util.Comparator; import java.util.HashMap; import java.util.HashSet; import java.util.List; import java.util.Map; import java.util.Set; import abra.SAMRecordUtils.ReadBlock;
elems.get(0).getOperator() == CigarOperator.M && elems.get(2).getOperator() == CigarOperator.M && (elems.get(1).getOperator() == CigarOperator.D || elems.get(1).getOperator() == CigarOperator.I)) { String insertBases = null; char type = '0'; if (elems.get(1).getOperator() == CigarOperator.D) { type = 'D'; } else if (elems.get(1).getOperator() == CigarOperator.I) { type = 'I'; int start = elems.get(0).getLength(); int stop = start + elems.get(1).getLength(); insertBases = read.getReadString().substring(start, stop); } int refStart = read.getAlignmentStart() + elems.get(0).getLength(); // Require indel start to be within region if (refStart >= region.getStart() && refStart <= region.getEnd()) { Indel indel = new Indel(type, read.getReferenceName(), refStart, elems.get(1).getLength(), insertBases, elems.get(0).getLength(), SAMRecordUtils.sumBaseQuals(read)); if (indels.containsKey(indel)) { indels.get(indel).addReadPosition(elems.get(0).getLength(), SAMRecordUtils.sumBaseQuals(read)); } else { indels.put(indel, indel); } } } else if(SAMRecordUtils.getNumGaps(read) > 1) { // Handle read containing multiple indels (create single contig) List<Indel> indelComponents = new ArrayList<Indel>();
// Path: src/main/java/abra/SAMRecordUtils.java // public static class ReadBlock { // private int readPos; // private int refPos; // private int length; // private CigarElement elem; // // public ReadBlock(int readPos, int refPos, int length, CigarElement elem) { // this.readPos = readPos; // this.refPos = refPos; // this.length = length; // this.elem = elem; // } // // public int getReadPos() { // return readPos; // } // // public int getRefPos() { // return refPos; // } // // public int getLength() { // return length; // } // // public CigarElement getCigarElement() { // return elem; // } // } // Path: src/main/java/abra/AltContigGenerator.java import htsjdk.samtools.CigarElement; import htsjdk.samtools.CigarOperator; import htsjdk.samtools.SAMRecord; import java.util.ArrayList; import java.util.Collection; import java.util.Collections; import java.util.Comparator; import java.util.HashMap; import java.util.HashSet; import java.util.List; import java.util.Map; import java.util.Set; import abra.SAMRecordUtils.ReadBlock; elems.get(0).getOperator() == CigarOperator.M && elems.get(2).getOperator() == CigarOperator.M && (elems.get(1).getOperator() == CigarOperator.D || elems.get(1).getOperator() == CigarOperator.I)) { String insertBases = null; char type = '0'; if (elems.get(1).getOperator() == CigarOperator.D) { type = 'D'; } else if (elems.get(1).getOperator() == CigarOperator.I) { type = 'I'; int start = elems.get(0).getLength(); int stop = start + elems.get(1).getLength(); insertBases = read.getReadString().substring(start, stop); } int refStart = read.getAlignmentStart() + elems.get(0).getLength(); // Require indel start to be within region if (refStart >= region.getStart() && refStart <= region.getEnd()) { Indel indel = new Indel(type, read.getReferenceName(), refStart, elems.get(1).getLength(), insertBases, elems.get(0).getLength(), SAMRecordUtils.sumBaseQuals(read)); if (indels.containsKey(indel)) { indels.get(indel).addReadPosition(elems.get(0).getLength(), SAMRecordUtils.sumBaseQuals(read)); } else { indels.put(indel, indel); } } } else if(SAMRecordUtils.getNumGaps(read) > 1) { // Handle read containing multiple indels (create single contig) List<Indel> indelComponents = new ArrayList<Indel>();
List<ReadBlock> readBlocks = SAMRecordUtils.getReadBlocks(read.getCigar(), read.getAlignmentStart());
mozack/abra2
src/main/java/abra/cadabra/CadabraOptions.java
// Path: src/main/java/abra/Logger.java // public class Logger { // // enum Level { TRACE, DEBUG, INFO, WARN, ERROR }; // // public static Level LEVEL = Level.INFO; // // private static Map<String, Level> stringToLevel; // // static { // stringToLevel = new HashMap<String, Level>(); // stringToLevel.put("TRACE", Level.TRACE); // stringToLevel.put("DEBUG", Level.DEBUG); // stringToLevel.put("INFO", Level.INFO); // stringToLevel.put("WARN", Level.WARN); // stringToLevel.put("ERROR", Level.ERROR); // } // // // For trace or debug messages, use varargs to avoid string concatenation unless enabled // // public static void trace(String format, Object... args) { // if (LEVEL == Level.TRACE) { // log(String.format(format, args), Level.TRACE); // } // } // // public static void debug(String format, Object... args) { // if (LEVEL == Level.DEBUG || LEVEL == Level.TRACE) { // log(String.format(format, args), Level.DEBUG); // } // } // // public static void info(String format, Object... args) { // if (LEVEL == Level.TRACE || LEVEL == Level.DEBUG || LEVEL == Level.INFO) { // log(String.format(format, args), Level.INFO); // } // } // // public static void warn(String message) { // if (LEVEL == Level.TRACE || LEVEL == Level.DEBUG || LEVEL == Level.INFO || LEVEL == Level.WARN) { // log(message, Level.WARN); // } // } // // public static void error(String message) { // log(message, Level.ERROR); // } // // public static void setLevel(String str) { // Level level = stringToLevel.get(str.toUpperCase()); // if (level == null) { // throw new IllegalArgumentException("Log level must be one of trace, debug, info, warn or error."); // } // // Logger.LEVEL = level; // } // // public static void log(String message, Level level) { // // String levelStr = "UNKNOWN"; // // switch (level) { // case ERROR: // levelStr = "ERROR"; // break; // case WARN: // levelStr = "WARNING"; // break; // case INFO: // levelStr = "INFO"; // break; // case DEBUG: // levelStr = "DEBUG"; // break; // case TRACE: // levelStr = "TRACE"; // break; // } // // System.err.println(levelStr + "\t" + new Date() + "\t" + message); // } // } // // Path: src/main/java/abra/Options.java // public abstract class Options { // protected static final String HELP = "help"; // // private OptionSet options; // // protected void printHelp() { // try { // getOptionParser().printHelpOn(System.err); // } // catch (IOException e) { // e.printStackTrace(); // throw new RuntimeException("IOException encountered when attempting to output help."); // } // } // // public void parseOptions(String[] args) { // // try { // options = getOptionParser().parse(args); // // if (options.has(HELP)) { // printHelp(); // } else { // init(); // validate(); // } // } catch (joptsimple.OptionException e) { // System.err.println(e.getMessage()); // printHelp(); // throw e; // } // } // // protected OptionSet getOptions() { // return options; // } // // abstract protected OptionParser getOptionParser(); // // abstract protected void validate(); // // protected void init() { // } // }
import abra.Logger; import abra.Options; import joptsimple.OptionParser;
return parser; } public void init() { this.numThreads = (Integer) getOptions().valueOf(NUM_THREADS); this.tumor = (String) getOptions().valueOf(TUMOR); if (tumor == null) { this.tumor = (String) getOptions().valueOf(SAMPLE); } this.normal = (String) getOptions().valueOf(NORMAL); this.reference = (String) getOptions().valueOf(REFERENCE); this.strpThreshold = (Integer) getOptions().valueOf(STRP_THRESHOLD); this.hrunThreshold = (Integer) getOptions().valueOf(HRUN_THRESHOLD); this.ispanFilter = (Integer) getOptions().valueOf(ISPAN_FILTER); this.qualFilter = (Float) getOptions().valueOf(QUAL_FILTER); this.fsFilter = (Integer) getOptions().valueOf(FS_FILTER); this.lowMQFilter = (Float) getOptions().valueOf(LOW_MQ_FILTER); this.minQual = (Float) getOptions().valueOf(MIN_QUAL); this.minMapq = (Integer) getOptions().valueOf(MIN_MAPQ); this.minVaf = (Float) getOptions().valueOf(MIN_VAF); this.pcrPenalty = (Integer) getOptions().valueOf(PCR_PENALTY); this.oddsr = (Float) getOptions().valueOf(ODDS_RATIO); } @Override protected void validate() { isValid = true; if (tumor == null) {
// Path: src/main/java/abra/Logger.java // public class Logger { // // enum Level { TRACE, DEBUG, INFO, WARN, ERROR }; // // public static Level LEVEL = Level.INFO; // // private static Map<String, Level> stringToLevel; // // static { // stringToLevel = new HashMap<String, Level>(); // stringToLevel.put("TRACE", Level.TRACE); // stringToLevel.put("DEBUG", Level.DEBUG); // stringToLevel.put("INFO", Level.INFO); // stringToLevel.put("WARN", Level.WARN); // stringToLevel.put("ERROR", Level.ERROR); // } // // // For trace or debug messages, use varargs to avoid string concatenation unless enabled // // public static void trace(String format, Object... args) { // if (LEVEL == Level.TRACE) { // log(String.format(format, args), Level.TRACE); // } // } // // public static void debug(String format, Object... args) { // if (LEVEL == Level.DEBUG || LEVEL == Level.TRACE) { // log(String.format(format, args), Level.DEBUG); // } // } // // public static void info(String format, Object... args) { // if (LEVEL == Level.TRACE || LEVEL == Level.DEBUG || LEVEL == Level.INFO) { // log(String.format(format, args), Level.INFO); // } // } // // public static void warn(String message) { // if (LEVEL == Level.TRACE || LEVEL == Level.DEBUG || LEVEL == Level.INFO || LEVEL == Level.WARN) { // log(message, Level.WARN); // } // } // // public static void error(String message) { // log(message, Level.ERROR); // } // // public static void setLevel(String str) { // Level level = stringToLevel.get(str.toUpperCase()); // if (level == null) { // throw new IllegalArgumentException("Log level must be one of trace, debug, info, warn or error."); // } // // Logger.LEVEL = level; // } // // public static void log(String message, Level level) { // // String levelStr = "UNKNOWN"; // // switch (level) { // case ERROR: // levelStr = "ERROR"; // break; // case WARN: // levelStr = "WARNING"; // break; // case INFO: // levelStr = "INFO"; // break; // case DEBUG: // levelStr = "DEBUG"; // break; // case TRACE: // levelStr = "TRACE"; // break; // } // // System.err.println(levelStr + "\t" + new Date() + "\t" + message); // } // } // // Path: src/main/java/abra/Options.java // public abstract class Options { // protected static final String HELP = "help"; // // private OptionSet options; // // protected void printHelp() { // try { // getOptionParser().printHelpOn(System.err); // } // catch (IOException e) { // e.printStackTrace(); // throw new RuntimeException("IOException encountered when attempting to output help."); // } // } // // public void parseOptions(String[] args) { // // try { // options = getOptionParser().parse(args); // // if (options.has(HELP)) { // printHelp(); // } else { // init(); // validate(); // } // } catch (joptsimple.OptionException e) { // System.err.println(e.getMessage()); // printHelp(); // throw e; // } // } // // protected OptionSet getOptions() { // return options; // } // // abstract protected OptionParser getOptionParser(); // // abstract protected void validate(); // // protected void init() { // } // } // Path: src/main/java/abra/cadabra/CadabraOptions.java import abra.Logger; import abra.Options; import joptsimple.OptionParser; return parser; } public void init() { this.numThreads = (Integer) getOptions().valueOf(NUM_THREADS); this.tumor = (String) getOptions().valueOf(TUMOR); if (tumor == null) { this.tumor = (String) getOptions().valueOf(SAMPLE); } this.normal = (String) getOptions().valueOf(NORMAL); this.reference = (String) getOptions().valueOf(REFERENCE); this.strpThreshold = (Integer) getOptions().valueOf(STRP_THRESHOLD); this.hrunThreshold = (Integer) getOptions().valueOf(HRUN_THRESHOLD); this.ispanFilter = (Integer) getOptions().valueOf(ISPAN_FILTER); this.qualFilter = (Float) getOptions().valueOf(QUAL_FILTER); this.fsFilter = (Integer) getOptions().valueOf(FS_FILTER); this.lowMQFilter = (Float) getOptions().valueOf(LOW_MQ_FILTER); this.minQual = (Float) getOptions().valueOf(MIN_QUAL); this.minMapq = (Integer) getOptions().valueOf(MIN_MAPQ); this.minVaf = (Float) getOptions().valueOf(MIN_VAF); this.pcrPenalty = (Integer) getOptions().valueOf(PCR_PENALTY); this.oddsr = (Float) getOptions().valueOf(ODDS_RATIO); } @Override protected void validate() { isValid = true; if (tumor == null) {
Logger.error("Please specify a " + TUMOR + " or a " + SAMPLE);
mozack/abra2
src/main/java/abra/NativeSemiGlobalAligner.java
// Path: src/main/java/abra/SemiGlobalAligner.java // static class Result { // Result(int score, int secondBest, int position, int endPosition, String cigar) { // this.score = score; // this.secondBest = secondBest; // this.position = position; // this.endPosition = endPosition; // this.cigar = cigar; // } // // int score; // int secondBest; // int position; // int endPosition; // String cigar; // // public String toString() { // return String.format("score: %d, secondBest: %d, pos: %d, endPos: %d, cigar: %s", score, secondBest, position, endPosition, cigar); // } // }
import abra.SemiGlobalAligner.Result;
package abra; public class NativeSemiGlobalAligner { private native String align(String seq1, String seq2, int match, int mismatch, int gapOpen, int gapExtend); private int match = 8; private int mismatch = -32; private int gapOpen = -48; private int gapExtend = -1; public static final int MAX_CONTIG_LEN = 1998; public static final int MAX_REF_LEN = 4998; public NativeSemiGlobalAligner(int match, int mismatch, int gapOpen, int gapExtend) { this.match = match; this.mismatch = mismatch; this.gapOpen = gapOpen; this.gapExtend = gapExtend; }
// Path: src/main/java/abra/SemiGlobalAligner.java // static class Result { // Result(int score, int secondBest, int position, int endPosition, String cigar) { // this.score = score; // this.secondBest = secondBest; // this.position = position; // this.endPosition = endPosition; // this.cigar = cigar; // } // // int score; // int secondBest; // int position; // int endPosition; // String cigar; // // public String toString() { // return String.format("score: %d, secondBest: %d, pos: %d, endPos: %d, cigar: %s", score, secondBest, position, endPosition, cigar); // } // } // Path: src/main/java/abra/NativeSemiGlobalAligner.java import abra.SemiGlobalAligner.Result; package abra; public class NativeSemiGlobalAligner { private native String align(String seq1, String seq2, int match, int mismatch, int gapOpen, int gapExtend); private int match = 8; private int mismatch = -32; private int gapOpen = -48; private int gapExtend = -1; public static final int MAX_CONTIG_LEN = 1998; public static final int MAX_REF_LEN = 4998; public NativeSemiGlobalAligner(int match, int mismatch, int gapOpen, int gapExtend) { this.match = match; this.mismatch = mismatch; this.gapOpen = gapOpen; this.gapExtend = gapExtend; }
public Result align(String seq1, String seq2) {
mozack/abra2
src/test/java/abra/CigarUtilsTest.java
// Path: src/main/java/abra/ReadEvaluator.java // static class Alignment { // String chromosome; // int pos; // String cigar; // Orientation orientation; // int numMismatches; // // int contigPos; // String contigCigar; // boolean isSecondary; // // static final Alignment AMBIGUOUS = new Alignment(); // // Alignment() { // } // // Alignment(String chromosome, int pos, String cigar, Orientation orientation, int numMismatches, int contigPos, String contigCigar, boolean isSecondary) { // this.chromosome = chromosome; // this.pos = pos; // this.cigar = cigar; // this.orientation = orientation; // this.numMismatches = numMismatches; // // this.contigPos = contigPos; // this.contigCigar = contigCigar; // this.isSecondary = isSecondary; // } // // @Override // public int hashCode() { // final int prime = 31; // int result = 1; // result = prime * result + ((cigar == null) ? 0 : cigar.hashCode()); // result = prime * result // + ((orientation == null) ? 0 : orientation.hashCode()); // result = prime * result + pos; // return result; // } // // @Override // public boolean equals(Object obj) { // if (this == obj) // return true; // if (obj == null) // return false; // if (getClass() != obj.getClass()) // return false; // Alignment other = (Alignment) obj; // if (cigar == null) { // if (other.cigar != null) // return false; // } else if (!cigar.equals(other.cigar)) // return false; // if (orientation != other.orientation) // return false; // if (pos != other.pos) // return false; // return true; // } // // }
import static org.testng.Assert.assertEquals; import java.util.Arrays; import java.util.List; import org.testng.annotations.BeforeMethod; import org.testng.annotations.Test; import abra.ReadEvaluator.Alignment;
String newCigar = CigarUtils.extendCigarWithMatches(cigar, 10, 15); assertEquals(newCigar, "60M10D65M"); cigar = "100M"; newCigar = CigarUtils.extendCigarWithMatches(cigar, 10, 15); assertEquals(newCigar, "125M"); } @Test (groups = "unit") public void testInjectSplice() { String cigar = "90M5I5D205M"; int junctionPos = 100; int junctionLength = 2000; String newCigar = CigarUtils.injectSplice(cigar, junctionPos, junctionLength); assertEquals(newCigar, "90M5I5D5M2000N200M"); } @Test (groups = "unit") public void testInjectSplices() { String cigar = "90M5I5D205M"; List<Integer> junctionPos = Arrays.asList(100, 125); List<Integer> junctionLength = Arrays.asList(2000, 50000); String newCigar = CigarUtils.injectSplices(cigar, junctionPos, junctionLength); assertEquals(newCigar, "90M5I5D5M2000N25M50000N175M"); } private int testEquivalenceAndSelectIntronPreferred(String cigar1, String cigar2) {
// Path: src/main/java/abra/ReadEvaluator.java // static class Alignment { // String chromosome; // int pos; // String cigar; // Orientation orientation; // int numMismatches; // // int contigPos; // String contigCigar; // boolean isSecondary; // // static final Alignment AMBIGUOUS = new Alignment(); // // Alignment() { // } // // Alignment(String chromosome, int pos, String cigar, Orientation orientation, int numMismatches, int contigPos, String contigCigar, boolean isSecondary) { // this.chromosome = chromosome; // this.pos = pos; // this.cigar = cigar; // this.orientation = orientation; // this.numMismatches = numMismatches; // // this.contigPos = contigPos; // this.contigCigar = contigCigar; // this.isSecondary = isSecondary; // } // // @Override // public int hashCode() { // final int prime = 31; // int result = 1; // result = prime * result + ((cigar == null) ? 0 : cigar.hashCode()); // result = prime * result // + ((orientation == null) ? 0 : orientation.hashCode()); // result = prime * result + pos; // return result; // } // // @Override // public boolean equals(Object obj) { // if (this == obj) // return true; // if (obj == null) // return false; // if (getClass() != obj.getClass()) // return false; // Alignment other = (Alignment) obj; // if (cigar == null) { // if (other.cigar != null) // return false; // } else if (!cigar.equals(other.cigar)) // return false; // if (orientation != other.orientation) // return false; // if (pos != other.pos) // return false; // return true; // } // // } // Path: src/test/java/abra/CigarUtilsTest.java import static org.testng.Assert.assertEquals; import java.util.Arrays; import java.util.List; import org.testng.annotations.BeforeMethod; import org.testng.annotations.Test; import abra.ReadEvaluator.Alignment; String newCigar = CigarUtils.extendCigarWithMatches(cigar, 10, 15); assertEquals(newCigar, "60M10D65M"); cigar = "100M"; newCigar = CigarUtils.extendCigarWithMatches(cigar, 10, 15); assertEquals(newCigar, "125M"); } @Test (groups = "unit") public void testInjectSplice() { String cigar = "90M5I5D205M"; int junctionPos = 100; int junctionLength = 2000; String newCigar = CigarUtils.injectSplice(cigar, junctionPos, junctionLength); assertEquals(newCigar, "90M5I5D5M2000N200M"); } @Test (groups = "unit") public void testInjectSplices() { String cigar = "90M5I5D205M"; List<Integer> junctionPos = Arrays.asList(100, 125); List<Integer> junctionLength = Arrays.asList(2000, 50000); String newCigar = CigarUtils.injectSplices(cigar, junctionPos, junctionLength); assertEquals(newCigar, "90M5I5D5M2000N25M50000N175M"); } private int testEquivalenceAndSelectIntronPreferred(String cigar1, String cigar2) {
Alignment a1 = new Alignment();
mozack/abra2
src/main/java/abra/CigarUtils.java
// Path: src/main/java/abra/ReadEvaluator.java // static class Alignment { // String chromosome; // int pos; // String cigar; // Orientation orientation; // int numMismatches; // // int contigPos; // String contigCigar; // boolean isSecondary; // // static final Alignment AMBIGUOUS = new Alignment(); // // Alignment() { // } // // Alignment(String chromosome, int pos, String cigar, Orientation orientation, int numMismatches, int contigPos, String contigCigar, boolean isSecondary) { // this.chromosome = chromosome; // this.pos = pos; // this.cigar = cigar; // this.orientation = orientation; // this.numMismatches = numMismatches; // // this.contigPos = contigPos; // this.contigCigar = contigCigar; // this.isSecondary = isSecondary; // } // // @Override // public int hashCode() { // final int prime = 31; // int result = 1; // result = prime * result + ((cigar == null) ? 0 : cigar.hashCode()); // result = prime * result // + ((orientation == null) ? 0 : orientation.hashCode()); // result = prime * result + pos; // return result; // } // // @Override // public boolean equals(Object obj) { // if (this == obj) // return true; // if (obj == null) // return false; // if (getClass() != obj.getClass()) // return false; // Alignment other = (Alignment) obj; // if (cigar == null) { // if (other.cigar != null) // return false; // } else if (!cigar.equals(other.cigar)) // return false; // if (orientation != other.orientation) // return false; // if (pos != other.pos) // return false; // return true; // } // // }
import java.util.ArrayList; import java.util.List; import abra.ReadEvaluator.Alignment;
newBlocks.add(new CigarBlock(blockLen1, block.type)); newBlocks.add(new CigarBlock(junctionLength, 'N')); if (blockLen2 > 0) { newBlocks.add(new CigarBlock(blockLen2, block.type)); } refPos += block.length; } else { newBlocks.add(block); refPos += block.length; } } else { // Do not advance ref pos for insertions or introns newBlocks.add(block); } } return cigarStringFromCigarBlocks(newBlocks); } // Assumes input junctions are sorted by coordinate public static String injectSplices(String cigar, List<Integer> junctionPos, List<Integer> junctionLength) { for (int i=0; i<junctionPos.size(); i++) { cigar = injectSplice(cigar, junctionPos.get(i), junctionLength.get(i)); } return cigar; }
// Path: src/main/java/abra/ReadEvaluator.java // static class Alignment { // String chromosome; // int pos; // String cigar; // Orientation orientation; // int numMismatches; // // int contigPos; // String contigCigar; // boolean isSecondary; // // static final Alignment AMBIGUOUS = new Alignment(); // // Alignment() { // } // // Alignment(String chromosome, int pos, String cigar, Orientation orientation, int numMismatches, int contigPos, String contigCigar, boolean isSecondary) { // this.chromosome = chromosome; // this.pos = pos; // this.cigar = cigar; // this.orientation = orientation; // this.numMismatches = numMismatches; // // this.contigPos = contigPos; // this.contigCigar = contigCigar; // this.isSecondary = isSecondary; // } // // @Override // public int hashCode() { // final int prime = 31; // int result = 1; // result = prime * result + ((cigar == null) ? 0 : cigar.hashCode()); // result = prime * result // + ((orientation == null) ? 0 : orientation.hashCode()); // result = prime * result + pos; // return result; // } // // @Override // public boolean equals(Object obj) { // if (this == obj) // return true; // if (obj == null) // return false; // if (getClass() != obj.getClass()) // return false; // Alignment other = (Alignment) obj; // if (cigar == null) { // if (other.cigar != null) // return false; // } else if (!cigar.equals(other.cigar)) // return false; // if (orientation != other.orientation) // return false; // if (pos != other.pos) // return false; // return true; // } // // } // Path: src/main/java/abra/CigarUtils.java import java.util.ArrayList; import java.util.List; import abra.ReadEvaluator.Alignment; newBlocks.add(new CigarBlock(blockLen1, block.type)); newBlocks.add(new CigarBlock(junctionLength, 'N')); if (blockLen2 > 0) { newBlocks.add(new CigarBlock(blockLen2, block.type)); } refPos += block.length; } else { newBlocks.add(block); refPos += block.length; } } else { // Do not advance ref pos for insertions or introns newBlocks.add(block); } } return cigarStringFromCigarBlocks(newBlocks); } // Assumes input junctions are sorted by coordinate public static String injectSplices(String cigar, List<Integer> junctionPos, List<Integer> junctionLength) { for (int i=0; i<junctionPos.size(); i++) { cigar = injectSplice(cigar, junctionPos.get(i), junctionLength.get(i)); } return cigar; }
private static int selectPrimaryAlignment(Alignment alignment1, Alignment alignment2, int def) {
mozack/abra2
src/test/java/abra/SimpleMapperTest.java
// Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // } // // Path: src/main/java/abra/SimpleMapper.java // static class SimpleMapperResult { // private int pos; // private int mismatches; // private Orientation orientation; // // SimpleMapperResult(int pos, int mismatches, Orientation orientation) { // this.pos = pos; // this.mismatches = mismatches; // this.orientation = orientation; // } // // public int getPos() { // return pos; // } // public int getMismatches() { // return mismatches; // } // public Orientation getOrientation() { // return orientation; // } // }
import static org.testng.Assert.assertEquals; import org.testng.annotations.Test; import abra.SimpleMapper.Orientation; import abra.SimpleMapper.SimpleMapperResult;
package abra; public class SimpleMapperTest { private String contig1 = "TTCAACTAGAGAGAGGTAAAAATTTTTCTAGAACATGAATTGCCCACTCCCCTCATTCCTTCTCAGAAACTAACTGAATTCCAGTGGGTGTGCCTGGCAAACCCAAAAGCAGTTTCTGTTCAGGATGCTGGTCTTACCTGTGAAGGCGTTCATGAACGTGGAGAGGGACCGGTTCAACATTTTGAAGAAAGGGTCTCTGCACGGATATTTCTGAGACCCACAAAGGACGGTATGCTCAAGAATGTGAGGAACACCAGTACTGTCCATGGGAGTGGTACGGAACTGCACGCTAGGGAAGAGAGAGGAATGGCACGCTAGGGAAGGCGAATGACCAGAACGCAAAAGGTTCAGCTTAGTGCTGCGGACACAGTTCCCAGATGCATCATCACCTCAGGCTACTAGAAATCATCATTCTGACACCACAATCCTCCAGCACAGGGTTTTCCAACTATA"; private String contig2 = "ATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGAT"; private static final double DEFAULT_MISMATCH_RATE = .05; @Test (groups = "unit" ) public void testMapExact() { SimpleMapper sm = new SimpleMapper(contig1, DEFAULT_MISMATCH_RATE); String read = "TACTGTCCATGGGAGTGGTACGGAACTGCACGCTAGGGAAGAGAGAGGAATGGCACGCTAGGGAAGGCGAATGACCAGAACGCAAAAGGTTCAGCTTAGTG";
// Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // } // // Path: src/main/java/abra/SimpleMapper.java // static class SimpleMapperResult { // private int pos; // private int mismatches; // private Orientation orientation; // // SimpleMapperResult(int pos, int mismatches, Orientation orientation) { // this.pos = pos; // this.mismatches = mismatches; // this.orientation = orientation; // } // // public int getPos() { // return pos; // } // public int getMismatches() { // return mismatches; // } // public Orientation getOrientation() { // return orientation; // } // } // Path: src/test/java/abra/SimpleMapperTest.java import static org.testng.Assert.assertEquals; import org.testng.annotations.Test; import abra.SimpleMapper.Orientation; import abra.SimpleMapper.SimpleMapperResult; package abra; public class SimpleMapperTest { private String contig1 = "TTCAACTAGAGAGAGGTAAAAATTTTTCTAGAACATGAATTGCCCACTCCCCTCATTCCTTCTCAGAAACTAACTGAATTCCAGTGGGTGTGCCTGGCAAACCCAAAAGCAGTTTCTGTTCAGGATGCTGGTCTTACCTGTGAAGGCGTTCATGAACGTGGAGAGGGACCGGTTCAACATTTTGAAGAAAGGGTCTCTGCACGGATATTTCTGAGACCCACAAAGGACGGTATGCTCAAGAATGTGAGGAACACCAGTACTGTCCATGGGAGTGGTACGGAACTGCACGCTAGGGAAGAGAGAGGAATGGCACGCTAGGGAAGGCGAATGACCAGAACGCAAAAGGTTCAGCTTAGTGCTGCGGACACAGTTCCCAGATGCATCATCACCTCAGGCTACTAGAAATCATCATTCTGACACCACAATCCTCCAGCACAGGGTTTTCCAACTATA"; private String contig2 = "ATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGAT"; private static final double DEFAULT_MISMATCH_RATE = .05; @Test (groups = "unit" ) public void testMapExact() { SimpleMapper sm = new SimpleMapper(contig1, DEFAULT_MISMATCH_RATE); String read = "TACTGTCCATGGGAGTGGTACGGAACTGCACGCTAGGGAAGAGAGAGGAATGGCACGCTAGGGAAGGCGAATGACCAGAACGCAAAAGGTTCAGCTTAGTG";
SimpleMapperResult smr = sm.map(read);
mozack/abra2
src/test/java/abra/SimpleMapperTest.java
// Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // } // // Path: src/main/java/abra/SimpleMapper.java // static class SimpleMapperResult { // private int pos; // private int mismatches; // private Orientation orientation; // // SimpleMapperResult(int pos, int mismatches, Orientation orientation) { // this.pos = pos; // this.mismatches = mismatches; // this.orientation = orientation; // } // // public int getPos() { // return pos; // } // public int getMismatches() { // return mismatches; // } // public Orientation getOrientation() { // return orientation; // } // }
import static org.testng.Assert.assertEquals; import org.testng.annotations.Test; import abra.SimpleMapper.Orientation; import abra.SimpleMapper.SimpleMapperResult;
package abra; public class SimpleMapperTest { private String contig1 = "TTCAACTAGAGAGAGGTAAAAATTTTTCTAGAACATGAATTGCCCACTCCCCTCATTCCTTCTCAGAAACTAACTGAATTCCAGTGGGTGTGCCTGGCAAACCCAAAAGCAGTTTCTGTTCAGGATGCTGGTCTTACCTGTGAAGGCGTTCATGAACGTGGAGAGGGACCGGTTCAACATTTTGAAGAAAGGGTCTCTGCACGGATATTTCTGAGACCCACAAAGGACGGTATGCTCAAGAATGTGAGGAACACCAGTACTGTCCATGGGAGTGGTACGGAACTGCACGCTAGGGAAGAGAGAGGAATGGCACGCTAGGGAAGGCGAATGACCAGAACGCAAAAGGTTCAGCTTAGTGCTGCGGACACAGTTCCCAGATGCATCATCACCTCAGGCTACTAGAAATCATCATTCTGACACCACAATCCTCCAGCACAGGGTTTTCCAACTATA"; private String contig2 = "ATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGAT"; private static final double DEFAULT_MISMATCH_RATE = .05; @Test (groups = "unit" ) public void testMapExact() { SimpleMapper sm = new SimpleMapper(contig1, DEFAULT_MISMATCH_RATE); String read = "TACTGTCCATGGGAGTGGTACGGAACTGCACGCTAGGGAAGAGAGAGGAATGGCACGCTAGGGAAGGCGAATGACCAGAACGCAAAAGGTTCAGCTTAGTG"; SimpleMapperResult smr = sm.map(read); assertEquals(0, smr.getMismatches()); assertEquals(257, smr.getPos());
// Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // } // // Path: src/main/java/abra/SimpleMapper.java // static class SimpleMapperResult { // private int pos; // private int mismatches; // private Orientation orientation; // // SimpleMapperResult(int pos, int mismatches, Orientation orientation) { // this.pos = pos; // this.mismatches = mismatches; // this.orientation = orientation; // } // // public int getPos() { // return pos; // } // public int getMismatches() { // return mismatches; // } // public Orientation getOrientation() { // return orientation; // } // } // Path: src/test/java/abra/SimpleMapperTest.java import static org.testng.Assert.assertEquals; import org.testng.annotations.Test; import abra.SimpleMapper.Orientation; import abra.SimpleMapper.SimpleMapperResult; package abra; public class SimpleMapperTest { private String contig1 = "TTCAACTAGAGAGAGGTAAAAATTTTTCTAGAACATGAATTGCCCACTCCCCTCATTCCTTCTCAGAAACTAACTGAATTCCAGTGGGTGTGCCTGGCAAACCCAAAAGCAGTTTCTGTTCAGGATGCTGGTCTTACCTGTGAAGGCGTTCATGAACGTGGAGAGGGACCGGTTCAACATTTTGAAGAAAGGGTCTCTGCACGGATATTTCTGAGACCCACAAAGGACGGTATGCTCAAGAATGTGAGGAACACCAGTACTGTCCATGGGAGTGGTACGGAACTGCACGCTAGGGAAGAGAGAGGAATGGCACGCTAGGGAAGGCGAATGACCAGAACGCAAAAGGTTCAGCTTAGTGCTGCGGACACAGTTCCCAGATGCATCATCACCTCAGGCTACTAGAAATCATCATTCTGACACCACAATCCTCCAGCACAGGGTTTTCCAACTATA"; private String contig2 = "ATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGATATCGATCGAT"; private static final double DEFAULT_MISMATCH_RATE = .05; @Test (groups = "unit" ) public void testMapExact() { SimpleMapper sm = new SimpleMapper(contig1, DEFAULT_MISMATCH_RATE); String read = "TACTGTCCATGGGAGTGGTACGGAACTGCACGCTAGGGAAGAGAGAGGAATGGCACGCTAGGGAAGGCGAATGACCAGAACGCAAAAGGTTCAGCTTAGTG"; SimpleMapperResult smr = sm.map(read); assertEquals(0, smr.getMismatches()); assertEquals(257, smr.getPos());
assertEquals(Orientation.FORWARD, smr.getOrientation());
mozack/abra2
src/main/java/htsjdk/samtools/util/SortingCollection2.java
// Path: src/main/java/abra/Logger.java // public class Logger { // // enum Level { TRACE, DEBUG, INFO, WARN, ERROR }; // // public static Level LEVEL = Level.INFO; // // private static Map<String, Level> stringToLevel; // // static { // stringToLevel = new HashMap<String, Level>(); // stringToLevel.put("TRACE", Level.TRACE); // stringToLevel.put("DEBUG", Level.DEBUG); // stringToLevel.put("INFO", Level.INFO); // stringToLevel.put("WARN", Level.WARN); // stringToLevel.put("ERROR", Level.ERROR); // } // // // For trace or debug messages, use varargs to avoid string concatenation unless enabled // // public static void trace(String format, Object... args) { // if (LEVEL == Level.TRACE) { // log(String.format(format, args), Level.TRACE); // } // } // // public static void debug(String format, Object... args) { // if (LEVEL == Level.DEBUG || LEVEL == Level.TRACE) { // log(String.format(format, args), Level.DEBUG); // } // } // // public static void info(String format, Object... args) { // if (LEVEL == Level.TRACE || LEVEL == Level.DEBUG || LEVEL == Level.INFO) { // log(String.format(format, args), Level.INFO); // } // } // // public static void warn(String message) { // if (LEVEL == Level.TRACE || LEVEL == Level.DEBUG || LEVEL == Level.INFO || LEVEL == Level.WARN) { // log(message, Level.WARN); // } // } // // public static void error(String message) { // log(message, Level.ERROR); // } // // public static void setLevel(String str) { // Level level = stringToLevel.get(str.toUpperCase()); // if (level == null) { // throw new IllegalArgumentException("Log level must be one of trace, debug, info, warn or error."); // } // // Logger.LEVEL = level; // } // // public static void log(String message, Level level) { // // String levelStr = "UNKNOWN"; // // switch (level) { // case ERROR: // levelStr = "ERROR"; // break; // case WARN: // levelStr = "WARNING"; // break; // case INFO: // levelStr = "INFO"; // break; // case DEBUG: // levelStr = "DEBUG"; // break; // case TRACE: // levelStr = "TRACE"; // break; // } // // System.err.println(levelStr + "\t" + new Date() + "\t" + message); // } // }
import htsjdk.samtools.Defaults; import java.io.File; import java.io.FileInputStream; import java.io.FileNotFoundException; import java.io.FileOutputStream; import java.io.IOException; import java.io.InputStream; import java.io.OutputStream; import java.io.Serializable; import java.lang.reflect.Array; import java.util.ArrayList; import java.util.Arrays; import java.util.Collection; import java.util.Comparator; import java.util.Iterator; import java.util.List; import java.util.NoSuchElementException; import java.util.TreeSet; import abra.Logger;
if (this.numRecordsInRam > 0) { spillToDisk(); } // Facilitate GC this.ramRecords = null; } /** * @return True if this collection is allowed to discard data during iteration in order to reduce memory * footprint, precluding a second iteration over the collection. */ public boolean isDestructiveIteration() { return destructiveIteration; } /** * Tell this collection that it is allowed to discard data during iteration in order to reduce memory footprint, * precluding a second iteration. This is true by default. */ public void setDestructiveIteration(boolean destructiveIteration) { this.destructiveIteration = destructiveIteration; } /** * Sort the records in memory, write them to a file, and clear the buffer of records in memory. */ private void spillToDisk() { try {
// Path: src/main/java/abra/Logger.java // public class Logger { // // enum Level { TRACE, DEBUG, INFO, WARN, ERROR }; // // public static Level LEVEL = Level.INFO; // // private static Map<String, Level> stringToLevel; // // static { // stringToLevel = new HashMap<String, Level>(); // stringToLevel.put("TRACE", Level.TRACE); // stringToLevel.put("DEBUG", Level.DEBUG); // stringToLevel.put("INFO", Level.INFO); // stringToLevel.put("WARN", Level.WARN); // stringToLevel.put("ERROR", Level.ERROR); // } // // // For trace or debug messages, use varargs to avoid string concatenation unless enabled // // public static void trace(String format, Object... args) { // if (LEVEL == Level.TRACE) { // log(String.format(format, args), Level.TRACE); // } // } // // public static void debug(String format, Object... args) { // if (LEVEL == Level.DEBUG || LEVEL == Level.TRACE) { // log(String.format(format, args), Level.DEBUG); // } // } // // public static void info(String format, Object... args) { // if (LEVEL == Level.TRACE || LEVEL == Level.DEBUG || LEVEL == Level.INFO) { // log(String.format(format, args), Level.INFO); // } // } // // public static void warn(String message) { // if (LEVEL == Level.TRACE || LEVEL == Level.DEBUG || LEVEL == Level.INFO || LEVEL == Level.WARN) { // log(message, Level.WARN); // } // } // // public static void error(String message) { // log(message, Level.ERROR); // } // // public static void setLevel(String str) { // Level level = stringToLevel.get(str.toUpperCase()); // if (level == null) { // throw new IllegalArgumentException("Log level must be one of trace, debug, info, warn or error."); // } // // Logger.LEVEL = level; // } // // public static void log(String message, Level level) { // // String levelStr = "UNKNOWN"; // // switch (level) { // case ERROR: // levelStr = "ERROR"; // break; // case WARN: // levelStr = "WARNING"; // break; // case INFO: // levelStr = "INFO"; // break; // case DEBUG: // levelStr = "DEBUG"; // break; // case TRACE: // levelStr = "TRACE"; // break; // } // // System.err.println(levelStr + "\t" + new Date() + "\t" + message); // } // } // Path: src/main/java/htsjdk/samtools/util/SortingCollection2.java import htsjdk.samtools.Defaults; import java.io.File; import java.io.FileInputStream; import java.io.FileNotFoundException; import java.io.FileOutputStream; import java.io.IOException; import java.io.InputStream; import java.io.OutputStream; import java.io.Serializable; import java.lang.reflect.Array; import java.util.ArrayList; import java.util.Arrays; import java.util.Collection; import java.util.Comparator; import java.util.Iterator; import java.util.List; import java.util.NoSuchElementException; import java.util.TreeSet; import abra.Logger; if (this.numRecordsInRam > 0) { spillToDisk(); } // Facilitate GC this.ramRecords = null; } /** * @return True if this collection is allowed to discard data during iteration in order to reduce memory * footprint, precluding a second iteration over the collection. */ public boolean isDestructiveIteration() { return destructiveIteration; } /** * Tell this collection that it is allowed to discard data during iteration in order to reduce memory footprint, * precluding a second iteration. This is true by default. */ public void setDestructiveIteration(boolean destructiveIteration) { this.destructiveIteration = destructiveIteration; } /** * Sort the records in memory, write them to a file, and clear the buffer of records in memory. */ private void spillToDisk() { try {
Logger.info("Sort Spilling to disk...");
mozack/abra2
src/main/java/abra/ChromosomeChunker.java
// Path: src/main/java/abra/Logger.java // enum Level { TRACE, DEBUG, INFO, WARN, ERROR };
import java.util.ArrayList; import java.util.HashMap; import java.util.List; import java.util.Map; import abra.Logger.Level;
currStart = nRegion.getStart()+1; } } } if (currStart < chromosomeLength) { chunks.add(new Feature(chromosome, currStart, chromosomeLength)); } */ } Logger.debug("Chromosome chunks:"); for (Feature chunk : chunks) { Logger.debug(chunk.toString()); } } public List<Feature> getChunks() { return chunks; } public Map<String, List<Integer>> getChunkGroups() { return chunkGroups; } public List<String> getChromosomes() { return c2r.getChromosomes(); } public static void main(String[] args) throws Exception {
// Path: src/main/java/abra/Logger.java // enum Level { TRACE, DEBUG, INFO, WARN, ERROR }; // Path: src/main/java/abra/ChromosomeChunker.java import java.util.ArrayList; import java.util.HashMap; import java.util.List; import java.util.Map; import abra.Logger.Level; currStart = nRegion.getStart()+1; } } } if (currStart < chromosomeLength) { chunks.add(new Feature(chromosome, currStart, chromosomeLength)); } */ } Logger.debug("Chromosome chunks:"); for (Feature chunk : chunks) { Logger.debug(chunk.toString()); } } public List<Feature> getChunks() { return chunks; } public Map<String, List<Integer>> getChunkGroups() { return chunkGroups; } public List<String> getChromosomes() { return c2r.getChromosomes(); } public static void main(String[] args) throws Exception {
Logger.LEVEL = Level.TRACE;
mozack/abra2
src/main/java/abra/ReadEvaluator.java
// Path: src/main/java/abra/ContigAligner.java // public static class ContigAlignerResult { // // // Used for testing // static boolean PAD_CONTIG = true; // // private int localRefPos; // private String cigar; // // private String chromosome; // private int refContextStart; // // private String sequence; // private int score; // private boolean isSecondary = false; // // public static final ContigAlignerResult INDEL_NEAR_END = new ContigAlignerResult(); // // private ContigAlignerResult() { // } // // ContigAlignerResult(int refPos, String cigar, String chromosome, int refContextStart, String sequence, int score) { // this.localRefPos = refPos; // this.cigar = cigar; // this.chromosome = chromosome; // this.refContextStart = refContextStart; // this.sequence = sequence; // this.score = score; // } // // public int getRefPos() { // return localRefPos; // } // public String getCigar() { // return cigar; // } // // public String getChromosome() { // return chromosome; // } // // public int getRefContextStart() { // return refContextStart; // } // // // This is the actual genomic position // public int getGenomicPos() { // return localRefPos + refContextStart; // } // // public String getSequence() { // return sequence; // } // // public int getScore() { // return score; // } // // public boolean isSecondary() { // return isSecondary; // } // // public void setSecondary(boolean isSecondary) { // this.isSecondary = isSecondary; // } // } // // Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // } // // Path: src/main/java/abra/SimpleMapper.java // static class SimpleMapperResult { // private int pos; // private int mismatches; // private Orientation orientation; // // SimpleMapperResult(int pos, int mismatches, Orientation orientation) { // this.pos = pos; // this.mismatches = mismatches; // this.orientation = orientation; // } // // public int getPos() { // return pos; // } // public int getMismatches() { // return mismatches; // } // public Orientation getOrientation() { // return orientation; // } // }
import htsjdk.samtools.SAMRecord; import java.util.ArrayList; import java.util.HashSet; import java.util.List; import java.util.Map; import java.util.Set; import abra.ContigAligner.ContigAlignerResult; import abra.SimpleMapper.Orientation; import abra.SimpleMapper.SimpleMapperResult;
package abra; public class ReadEvaluator { // key = SimpleMapper with cached contig, value = contig SW alignment result private Map<Feature, Map<SimpleMapper, ContigAlignerResult>> mappedContigs; public ReadEvaluator(Map<Feature, Map<SimpleMapper, ContigAlignerResult>> mappedContigs) { this.mappedContigs = mappedContigs; } /** * If an improved alignment exists for the input read, return it. * Returns null if there is no improved alignment * If multiple alignments exist for the read with the same number of mismatches, * the alignments are ambiguous and null is returned. * A read may align to multiple contigs, but result in the same alignment in * the context of the reference. In this case the alignment is considered distinct. */ public Alignment getImprovedAlignment(int origEditDist, SAMRecord samRecord, CompareToReference2 c2r) { Alignment result = getImprovedAlignment(origEditDist, samRecord.getReadString()); if (result == null) { // If soft clipped, attempt to map only the unclipped portion of the read // Relying on the original mapper to handle clipping here if (samRecord.getCigarString().contains("S")) { // Use mapper's edit distance which should be for the unclipped portion of the read only int unclippedEditDist = SAMRecordUtils.getEditDistance(samRecord, c2r, false); // Don't bother remapping if alignment cannot be improved if (unclippedEditDist > 0) { String unclipped = SAMRecordUtils.getMappedReadPortion(samRecord); result = getImprovedAlignment(unclippedEditDist, unclipped); if (result != null) { result.cigar = SAMRecordUtils.getLeadingClips(samRecord) + result.cigar + SAMRecordUtils.getTrailingClips(samRecord); } } } } return result; } public Alignment getImprovedAlignment(int origEditDist, String read) { Alignment result = null; List<AlignmentHit> alignmentHits = new ArrayList<AlignmentHit>(); int bestMismatches = read.length()+1; // Map read to all contigs, caching the hits with the smallest number of mismatches for (Feature region : mappedContigs.keySet()) { Map<SimpleMapper, ContigAlignerResult> regionContigs = mappedContigs.get(region); for (SimpleMapper mapper : regionContigs.keySet()) {
// Path: src/main/java/abra/ContigAligner.java // public static class ContigAlignerResult { // // // Used for testing // static boolean PAD_CONTIG = true; // // private int localRefPos; // private String cigar; // // private String chromosome; // private int refContextStart; // // private String sequence; // private int score; // private boolean isSecondary = false; // // public static final ContigAlignerResult INDEL_NEAR_END = new ContigAlignerResult(); // // private ContigAlignerResult() { // } // // ContigAlignerResult(int refPos, String cigar, String chromosome, int refContextStart, String sequence, int score) { // this.localRefPos = refPos; // this.cigar = cigar; // this.chromosome = chromosome; // this.refContextStart = refContextStart; // this.sequence = sequence; // this.score = score; // } // // public int getRefPos() { // return localRefPos; // } // public String getCigar() { // return cigar; // } // // public String getChromosome() { // return chromosome; // } // // public int getRefContextStart() { // return refContextStart; // } // // // This is the actual genomic position // public int getGenomicPos() { // return localRefPos + refContextStart; // } // // public String getSequence() { // return sequence; // } // // public int getScore() { // return score; // } // // public boolean isSecondary() { // return isSecondary; // } // // public void setSecondary(boolean isSecondary) { // this.isSecondary = isSecondary; // } // } // // Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // } // // Path: src/main/java/abra/SimpleMapper.java // static class SimpleMapperResult { // private int pos; // private int mismatches; // private Orientation orientation; // // SimpleMapperResult(int pos, int mismatches, Orientation orientation) { // this.pos = pos; // this.mismatches = mismatches; // this.orientation = orientation; // } // // public int getPos() { // return pos; // } // public int getMismatches() { // return mismatches; // } // public Orientation getOrientation() { // return orientation; // } // } // Path: src/main/java/abra/ReadEvaluator.java import htsjdk.samtools.SAMRecord; import java.util.ArrayList; import java.util.HashSet; import java.util.List; import java.util.Map; import java.util.Set; import abra.ContigAligner.ContigAlignerResult; import abra.SimpleMapper.Orientation; import abra.SimpleMapper.SimpleMapperResult; package abra; public class ReadEvaluator { // key = SimpleMapper with cached contig, value = contig SW alignment result private Map<Feature, Map<SimpleMapper, ContigAlignerResult>> mappedContigs; public ReadEvaluator(Map<Feature, Map<SimpleMapper, ContigAlignerResult>> mappedContigs) { this.mappedContigs = mappedContigs; } /** * If an improved alignment exists for the input read, return it. * Returns null if there is no improved alignment * If multiple alignments exist for the read with the same number of mismatches, * the alignments are ambiguous and null is returned. * A read may align to multiple contigs, but result in the same alignment in * the context of the reference. In this case the alignment is considered distinct. */ public Alignment getImprovedAlignment(int origEditDist, SAMRecord samRecord, CompareToReference2 c2r) { Alignment result = getImprovedAlignment(origEditDist, samRecord.getReadString()); if (result == null) { // If soft clipped, attempt to map only the unclipped portion of the read // Relying on the original mapper to handle clipping here if (samRecord.getCigarString().contains("S")) { // Use mapper's edit distance which should be for the unclipped portion of the read only int unclippedEditDist = SAMRecordUtils.getEditDistance(samRecord, c2r, false); // Don't bother remapping if alignment cannot be improved if (unclippedEditDist > 0) { String unclipped = SAMRecordUtils.getMappedReadPortion(samRecord); result = getImprovedAlignment(unclippedEditDist, unclipped); if (result != null) { result.cigar = SAMRecordUtils.getLeadingClips(samRecord) + result.cigar + SAMRecordUtils.getTrailingClips(samRecord); } } } } return result; } public Alignment getImprovedAlignment(int origEditDist, String read) { Alignment result = null; List<AlignmentHit> alignmentHits = new ArrayList<AlignmentHit>(); int bestMismatches = read.length()+1; // Map read to all contigs, caching the hits with the smallest number of mismatches for (Feature region : mappedContigs.keySet()) { Map<SimpleMapper, ContigAlignerResult> regionContigs = mappedContigs.get(region); for (SimpleMapper mapper : regionContigs.keySet()) {
SimpleMapperResult mapResult = mapper.map(read);
mozack/abra2
src/main/java/abra/ReadEvaluator.java
// Path: src/main/java/abra/ContigAligner.java // public static class ContigAlignerResult { // // // Used for testing // static boolean PAD_CONTIG = true; // // private int localRefPos; // private String cigar; // // private String chromosome; // private int refContextStart; // // private String sequence; // private int score; // private boolean isSecondary = false; // // public static final ContigAlignerResult INDEL_NEAR_END = new ContigAlignerResult(); // // private ContigAlignerResult() { // } // // ContigAlignerResult(int refPos, String cigar, String chromosome, int refContextStart, String sequence, int score) { // this.localRefPos = refPos; // this.cigar = cigar; // this.chromosome = chromosome; // this.refContextStart = refContextStart; // this.sequence = sequence; // this.score = score; // } // // public int getRefPos() { // return localRefPos; // } // public String getCigar() { // return cigar; // } // // public String getChromosome() { // return chromosome; // } // // public int getRefContextStart() { // return refContextStart; // } // // // This is the actual genomic position // public int getGenomicPos() { // return localRefPos + refContextStart; // } // // public String getSequence() { // return sequence; // } // // public int getScore() { // return score; // } // // public boolean isSecondary() { // return isSecondary; // } // // public void setSecondary(boolean isSecondary) { // this.isSecondary = isSecondary; // } // } // // Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // } // // Path: src/main/java/abra/SimpleMapper.java // static class SimpleMapperResult { // private int pos; // private int mismatches; // private Orientation orientation; // // SimpleMapperResult(int pos, int mismatches, Orientation orientation) { // this.pos = pos; // this.mismatches = mismatches; // this.orientation = orientation; // } // // public int getPos() { // return pos; // } // public int getMismatches() { // return mismatches; // } // public Orientation getOrientation() { // return orientation; // } // }
import htsjdk.samtools.SAMRecord; import java.util.ArrayList; import java.util.HashSet; import java.util.List; import java.util.Map; import java.util.Set; import abra.ContigAligner.ContigAlignerResult; import abra.SimpleMapper.Orientation; import abra.SimpleMapper.SimpleMapperResult;
result = null; } } else if (alignments.size() > 1) { // We have multiple possible alignments that are equal to the original alignment if (bestMismatches == origEditDist) { result = Alignment.AMBIGUOUS; } } return result; } static class AlignmentHit { SimpleMapperResult mapResult; SimpleMapper mapper; Feature region; AlignmentHit(SimpleMapperResult mapResult, SimpleMapper mapper, Feature region) { this.mapResult = mapResult; this.mapper = mapper; this.region = region; } } //TODO: Genericize this and share ? static class Alignment { String chromosome; int pos; String cigar;
// Path: src/main/java/abra/ContigAligner.java // public static class ContigAlignerResult { // // // Used for testing // static boolean PAD_CONTIG = true; // // private int localRefPos; // private String cigar; // // private String chromosome; // private int refContextStart; // // private String sequence; // private int score; // private boolean isSecondary = false; // // public static final ContigAlignerResult INDEL_NEAR_END = new ContigAlignerResult(); // // private ContigAlignerResult() { // } // // ContigAlignerResult(int refPos, String cigar, String chromosome, int refContextStart, String sequence, int score) { // this.localRefPos = refPos; // this.cigar = cigar; // this.chromosome = chromosome; // this.refContextStart = refContextStart; // this.sequence = sequence; // this.score = score; // } // // public int getRefPos() { // return localRefPos; // } // public String getCigar() { // return cigar; // } // // public String getChromosome() { // return chromosome; // } // // public int getRefContextStart() { // return refContextStart; // } // // // This is the actual genomic position // public int getGenomicPos() { // return localRefPos + refContextStart; // } // // public String getSequence() { // return sequence; // } // // public int getScore() { // return score; // } // // public boolean isSecondary() { // return isSecondary; // } // // public void setSecondary(boolean isSecondary) { // this.isSecondary = isSecondary; // } // } // // Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // } // // Path: src/main/java/abra/SimpleMapper.java // static class SimpleMapperResult { // private int pos; // private int mismatches; // private Orientation orientation; // // SimpleMapperResult(int pos, int mismatches, Orientation orientation) { // this.pos = pos; // this.mismatches = mismatches; // this.orientation = orientation; // } // // public int getPos() { // return pos; // } // public int getMismatches() { // return mismatches; // } // public Orientation getOrientation() { // return orientation; // } // } // Path: src/main/java/abra/ReadEvaluator.java import htsjdk.samtools.SAMRecord; import java.util.ArrayList; import java.util.HashSet; import java.util.List; import java.util.Map; import java.util.Set; import abra.ContigAligner.ContigAlignerResult; import abra.SimpleMapper.Orientation; import abra.SimpleMapper.SimpleMapperResult; result = null; } } else if (alignments.size() > 1) { // We have multiple possible alignments that are equal to the original alignment if (bestMismatches == origEditDist) { result = Alignment.AMBIGUOUS; } } return result; } static class AlignmentHit { SimpleMapperResult mapResult; SimpleMapper mapper; Feature region; AlignmentHit(SimpleMapperResult mapResult, SimpleMapper mapper, Feature region) { this.mapResult = mapResult; this.mapper = mapper; this.region = region; } } //TODO: Genericize this and share ? static class Alignment { String chromosome; int pos; String cigar;
Orientation orientation;
mozack/abra2
src/test/java/abra/ReadEvaluatorTest.java
// Path: src/main/java/abra/ReadEvaluator.java // static class Alignment { // String chromosome; // int pos; // String cigar; // Orientation orientation; // int numMismatches; // // int contigPos; // String contigCigar; // boolean isSecondary; // // static final Alignment AMBIGUOUS = new Alignment(); // // Alignment() { // } // // Alignment(String chromosome, int pos, String cigar, Orientation orientation, int numMismatches, int contigPos, String contigCigar, boolean isSecondary) { // this.chromosome = chromosome; // this.pos = pos; // this.cigar = cigar; // this.orientation = orientation; // this.numMismatches = numMismatches; // // this.contigPos = contigPos; // this.contigCigar = contigCigar; // this.isSecondary = isSecondary; // } // // @Override // public int hashCode() { // final int prime = 31; // int result = 1; // result = prime * result + ((cigar == null) ? 0 : cigar.hashCode()); // result = prime * result // + ((orientation == null) ? 0 : orientation.hashCode()); // result = prime * result + pos; // return result; // } // // @Override // public boolean equals(Object obj) { // if (this == obj) // return true; // if (obj == null) // return false; // if (getClass() != obj.getClass()) // return false; // Alignment other = (Alignment) obj; // if (cigar == null) { // if (other.cigar != null) // return false; // } else if (!cigar.equals(other.cigar)) // return false; // if (orientation != other.orientation) // return false; // if (pos != other.pos) // return false; // return true; // } // // } // // Path: src/main/java/abra/ContigAligner.java // public static class ContigAlignerResult { // // // Used for testing // static boolean PAD_CONTIG = true; // // private int localRefPos; // private String cigar; // // private String chromosome; // private int refContextStart; // // private String sequence; // private int score; // private boolean isSecondary = false; // // public static final ContigAlignerResult INDEL_NEAR_END = new ContigAlignerResult(); // // private ContigAlignerResult() { // } // // ContigAlignerResult(int refPos, String cigar, String chromosome, int refContextStart, String sequence, int score) { // this.localRefPos = refPos; // this.cigar = cigar; // this.chromosome = chromosome; // this.refContextStart = refContextStart; // this.sequence = sequence; // this.score = score; // } // // public int getRefPos() { // return localRefPos; // } // public String getCigar() { // return cigar; // } // // public String getChromosome() { // return chromosome; // } // // public int getRefContextStart() { // return refContextStart; // } // // // This is the actual genomic position // public int getGenomicPos() { // return localRefPos + refContextStart; // } // // public String getSequence() { // return sequence; // } // // public int getScore() { // return score; // } // // public boolean isSecondary() { // return isSecondary; // } // // public void setSecondary(boolean isSecondary) { // this.isSecondary = isSecondary; // } // } // // Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // }
import java.util.HashMap; import java.util.Map; import static org.testng.Assert.assertEquals; import org.testng.annotations.BeforeMethod; import org.testng.annotations.Test; import abra.ReadEvaluator.Alignment; import abra.ContigAligner.ContigAlignerResult; import abra.SimpleMapper.Orientation;
package abra; public class ReadEvaluatorTest { private Map<Feature, Map<SimpleMapper, ContigAlignerResult>> regionContigs; private Map<SimpleMapper, ContigAlignerResult> mappedContigs; @BeforeMethod () public void setUp() { mappedContigs = new HashMap<SimpleMapper, ContigAlignerResult>(); regionContigs = new HashMap<Feature, Map<SimpleMapper, ContigAlignerResult>>(); regionContigs.put(new Feature("foo", 1, 1000), mappedContigs); } @Test (groups="unit") public void testSingleAlignmentSingleContig() { String contig1 = "ATCGAAAAAATTTTTTCCCCCCGGGGGGATCGGCTAATCG"; String read = "ATAAAATTTTTTCCCCCCGGGGGGATCG"; // matches contig at 0 based position 4 with 1 mismatch SimpleMapper sm1 = new SimpleMapper(contig1, .05); ContigAlignerResult swc1 = new ContigAlignerResult(10, "10M1D30M", "chr1", 0, contig1, (short) 1); mappedContigs.put(sm1, swc1); ReadEvaluator re = new ReadEvaluator(regionContigs); // 1 mismatch in alignment to contig versus edit distance 2 in original read // should result in an improved alignment
// Path: src/main/java/abra/ReadEvaluator.java // static class Alignment { // String chromosome; // int pos; // String cigar; // Orientation orientation; // int numMismatches; // // int contigPos; // String contigCigar; // boolean isSecondary; // // static final Alignment AMBIGUOUS = new Alignment(); // // Alignment() { // } // // Alignment(String chromosome, int pos, String cigar, Orientation orientation, int numMismatches, int contigPos, String contigCigar, boolean isSecondary) { // this.chromosome = chromosome; // this.pos = pos; // this.cigar = cigar; // this.orientation = orientation; // this.numMismatches = numMismatches; // // this.contigPos = contigPos; // this.contigCigar = contigCigar; // this.isSecondary = isSecondary; // } // // @Override // public int hashCode() { // final int prime = 31; // int result = 1; // result = prime * result + ((cigar == null) ? 0 : cigar.hashCode()); // result = prime * result // + ((orientation == null) ? 0 : orientation.hashCode()); // result = prime * result + pos; // return result; // } // // @Override // public boolean equals(Object obj) { // if (this == obj) // return true; // if (obj == null) // return false; // if (getClass() != obj.getClass()) // return false; // Alignment other = (Alignment) obj; // if (cigar == null) { // if (other.cigar != null) // return false; // } else if (!cigar.equals(other.cigar)) // return false; // if (orientation != other.orientation) // return false; // if (pos != other.pos) // return false; // return true; // } // // } // // Path: src/main/java/abra/ContigAligner.java // public static class ContigAlignerResult { // // // Used for testing // static boolean PAD_CONTIG = true; // // private int localRefPos; // private String cigar; // // private String chromosome; // private int refContextStart; // // private String sequence; // private int score; // private boolean isSecondary = false; // // public static final ContigAlignerResult INDEL_NEAR_END = new ContigAlignerResult(); // // private ContigAlignerResult() { // } // // ContigAlignerResult(int refPos, String cigar, String chromosome, int refContextStart, String sequence, int score) { // this.localRefPos = refPos; // this.cigar = cigar; // this.chromosome = chromosome; // this.refContextStart = refContextStart; // this.sequence = sequence; // this.score = score; // } // // public int getRefPos() { // return localRefPos; // } // public String getCigar() { // return cigar; // } // // public String getChromosome() { // return chromosome; // } // // public int getRefContextStart() { // return refContextStart; // } // // // This is the actual genomic position // public int getGenomicPos() { // return localRefPos + refContextStart; // } // // public String getSequence() { // return sequence; // } // // public int getScore() { // return score; // } // // public boolean isSecondary() { // return isSecondary; // } // // public void setSecondary(boolean isSecondary) { // this.isSecondary = isSecondary; // } // } // // Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // } // Path: src/test/java/abra/ReadEvaluatorTest.java import java.util.HashMap; import java.util.Map; import static org.testng.Assert.assertEquals; import org.testng.annotations.BeforeMethod; import org.testng.annotations.Test; import abra.ReadEvaluator.Alignment; import abra.ContigAligner.ContigAlignerResult; import abra.SimpleMapper.Orientation; package abra; public class ReadEvaluatorTest { private Map<Feature, Map<SimpleMapper, ContigAlignerResult>> regionContigs; private Map<SimpleMapper, ContigAlignerResult> mappedContigs; @BeforeMethod () public void setUp() { mappedContigs = new HashMap<SimpleMapper, ContigAlignerResult>(); regionContigs = new HashMap<Feature, Map<SimpleMapper, ContigAlignerResult>>(); regionContigs.put(new Feature("foo", 1, 1000), mappedContigs); } @Test (groups="unit") public void testSingleAlignmentSingleContig() { String contig1 = "ATCGAAAAAATTTTTTCCCCCCGGGGGGATCGGCTAATCG"; String read = "ATAAAATTTTTTCCCCCCGGGGGGATCG"; // matches contig at 0 based position 4 with 1 mismatch SimpleMapper sm1 = new SimpleMapper(contig1, .05); ContigAlignerResult swc1 = new ContigAlignerResult(10, "10M1D30M", "chr1", 0, contig1, (short) 1); mappedContigs.put(sm1, swc1); ReadEvaluator re = new ReadEvaluator(regionContigs); // 1 mismatch in alignment to contig versus edit distance 2 in original read // should result in an improved alignment
Alignment alignment = re.getImprovedAlignment(2, read);
mozack/abra2
src/test/java/abra/ReadEvaluatorTest.java
// Path: src/main/java/abra/ReadEvaluator.java // static class Alignment { // String chromosome; // int pos; // String cigar; // Orientation orientation; // int numMismatches; // // int contigPos; // String contigCigar; // boolean isSecondary; // // static final Alignment AMBIGUOUS = new Alignment(); // // Alignment() { // } // // Alignment(String chromosome, int pos, String cigar, Orientation orientation, int numMismatches, int contigPos, String contigCigar, boolean isSecondary) { // this.chromosome = chromosome; // this.pos = pos; // this.cigar = cigar; // this.orientation = orientation; // this.numMismatches = numMismatches; // // this.contigPos = contigPos; // this.contigCigar = contigCigar; // this.isSecondary = isSecondary; // } // // @Override // public int hashCode() { // final int prime = 31; // int result = 1; // result = prime * result + ((cigar == null) ? 0 : cigar.hashCode()); // result = prime * result // + ((orientation == null) ? 0 : orientation.hashCode()); // result = prime * result + pos; // return result; // } // // @Override // public boolean equals(Object obj) { // if (this == obj) // return true; // if (obj == null) // return false; // if (getClass() != obj.getClass()) // return false; // Alignment other = (Alignment) obj; // if (cigar == null) { // if (other.cigar != null) // return false; // } else if (!cigar.equals(other.cigar)) // return false; // if (orientation != other.orientation) // return false; // if (pos != other.pos) // return false; // return true; // } // // } // // Path: src/main/java/abra/ContigAligner.java // public static class ContigAlignerResult { // // // Used for testing // static boolean PAD_CONTIG = true; // // private int localRefPos; // private String cigar; // // private String chromosome; // private int refContextStart; // // private String sequence; // private int score; // private boolean isSecondary = false; // // public static final ContigAlignerResult INDEL_NEAR_END = new ContigAlignerResult(); // // private ContigAlignerResult() { // } // // ContigAlignerResult(int refPos, String cigar, String chromosome, int refContextStart, String sequence, int score) { // this.localRefPos = refPos; // this.cigar = cigar; // this.chromosome = chromosome; // this.refContextStart = refContextStart; // this.sequence = sequence; // this.score = score; // } // // public int getRefPos() { // return localRefPos; // } // public String getCigar() { // return cigar; // } // // public String getChromosome() { // return chromosome; // } // // public int getRefContextStart() { // return refContextStart; // } // // // This is the actual genomic position // public int getGenomicPos() { // return localRefPos + refContextStart; // } // // public String getSequence() { // return sequence; // } // // public int getScore() { // return score; // } // // public boolean isSecondary() { // return isSecondary; // } // // public void setSecondary(boolean isSecondary) { // this.isSecondary = isSecondary; // } // } // // Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // }
import java.util.HashMap; import java.util.Map; import static org.testng.Assert.assertEquals; import org.testng.annotations.BeforeMethod; import org.testng.annotations.Test; import abra.ReadEvaluator.Alignment; import abra.ContigAligner.ContigAlignerResult; import abra.SimpleMapper.Orientation;
package abra; public class ReadEvaluatorTest { private Map<Feature, Map<SimpleMapper, ContigAlignerResult>> regionContigs; private Map<SimpleMapper, ContigAlignerResult> mappedContigs; @BeforeMethod () public void setUp() { mappedContigs = new HashMap<SimpleMapper, ContigAlignerResult>(); regionContigs = new HashMap<Feature, Map<SimpleMapper, ContigAlignerResult>>(); regionContigs.put(new Feature("foo", 1, 1000), mappedContigs); } @Test (groups="unit") public void testSingleAlignmentSingleContig() { String contig1 = "ATCGAAAAAATTTTTTCCCCCCGGGGGGATCGGCTAATCG"; String read = "ATAAAATTTTTTCCCCCCGGGGGGATCG"; // matches contig at 0 based position 4 with 1 mismatch SimpleMapper sm1 = new SimpleMapper(contig1, .05); ContigAlignerResult swc1 = new ContigAlignerResult(10, "10M1D30M", "chr1", 0, contig1, (short) 1); mappedContigs.put(sm1, swc1); ReadEvaluator re = new ReadEvaluator(regionContigs); // 1 mismatch in alignment to contig versus edit distance 2 in original read // should result in an improved alignment Alignment alignment = re.getImprovedAlignment(2, read); assertEquals(alignment.pos, 14); // Alignment pos = 10 + 4 assertEquals(alignment.cigar, "6M1D22M"); assertEquals(alignment.numMismatches, 1);
// Path: src/main/java/abra/ReadEvaluator.java // static class Alignment { // String chromosome; // int pos; // String cigar; // Orientation orientation; // int numMismatches; // // int contigPos; // String contigCigar; // boolean isSecondary; // // static final Alignment AMBIGUOUS = new Alignment(); // // Alignment() { // } // // Alignment(String chromosome, int pos, String cigar, Orientation orientation, int numMismatches, int contigPos, String contigCigar, boolean isSecondary) { // this.chromosome = chromosome; // this.pos = pos; // this.cigar = cigar; // this.orientation = orientation; // this.numMismatches = numMismatches; // // this.contigPos = contigPos; // this.contigCigar = contigCigar; // this.isSecondary = isSecondary; // } // // @Override // public int hashCode() { // final int prime = 31; // int result = 1; // result = prime * result + ((cigar == null) ? 0 : cigar.hashCode()); // result = prime * result // + ((orientation == null) ? 0 : orientation.hashCode()); // result = prime * result + pos; // return result; // } // // @Override // public boolean equals(Object obj) { // if (this == obj) // return true; // if (obj == null) // return false; // if (getClass() != obj.getClass()) // return false; // Alignment other = (Alignment) obj; // if (cigar == null) { // if (other.cigar != null) // return false; // } else if (!cigar.equals(other.cigar)) // return false; // if (orientation != other.orientation) // return false; // if (pos != other.pos) // return false; // return true; // } // // } // // Path: src/main/java/abra/ContigAligner.java // public static class ContigAlignerResult { // // // Used for testing // static boolean PAD_CONTIG = true; // // private int localRefPos; // private String cigar; // // private String chromosome; // private int refContextStart; // // private String sequence; // private int score; // private boolean isSecondary = false; // // public static final ContigAlignerResult INDEL_NEAR_END = new ContigAlignerResult(); // // private ContigAlignerResult() { // } // // ContigAlignerResult(int refPos, String cigar, String chromosome, int refContextStart, String sequence, int score) { // this.localRefPos = refPos; // this.cigar = cigar; // this.chromosome = chromosome; // this.refContextStart = refContextStart; // this.sequence = sequence; // this.score = score; // } // // public int getRefPos() { // return localRefPos; // } // public String getCigar() { // return cigar; // } // // public String getChromosome() { // return chromosome; // } // // public int getRefContextStart() { // return refContextStart; // } // // // This is the actual genomic position // public int getGenomicPos() { // return localRefPos + refContextStart; // } // // public String getSequence() { // return sequence; // } // // public int getScore() { // return score; // } // // public boolean isSecondary() { // return isSecondary; // } // // public void setSecondary(boolean isSecondary) { // this.isSecondary = isSecondary; // } // } // // Path: src/main/java/abra/SimpleMapper.java // enum Orientation { // UNSET, FORWARD, REVERSE; // } // Path: src/test/java/abra/ReadEvaluatorTest.java import java.util.HashMap; import java.util.Map; import static org.testng.Assert.assertEquals; import org.testng.annotations.BeforeMethod; import org.testng.annotations.Test; import abra.ReadEvaluator.Alignment; import abra.ContigAligner.ContigAlignerResult; import abra.SimpleMapper.Orientation; package abra; public class ReadEvaluatorTest { private Map<Feature, Map<SimpleMapper, ContigAlignerResult>> regionContigs; private Map<SimpleMapper, ContigAlignerResult> mappedContigs; @BeforeMethod () public void setUp() { mappedContigs = new HashMap<SimpleMapper, ContigAlignerResult>(); regionContigs = new HashMap<Feature, Map<SimpleMapper, ContigAlignerResult>>(); regionContigs.put(new Feature("foo", 1, 1000), mappedContigs); } @Test (groups="unit") public void testSingleAlignmentSingleContig() { String contig1 = "ATCGAAAAAATTTTTTCCCCCCGGGGGGATCGGCTAATCG"; String read = "ATAAAATTTTTTCCCCCCGGGGGGATCG"; // matches contig at 0 based position 4 with 1 mismatch SimpleMapper sm1 = new SimpleMapper(contig1, .05); ContigAlignerResult swc1 = new ContigAlignerResult(10, "10M1D30M", "chr1", 0, contig1, (short) 1); mappedContigs.put(sm1, swc1); ReadEvaluator re = new ReadEvaluator(regionContigs); // 1 mismatch in alignment to contig versus edit distance 2 in original read // should result in an improved alignment Alignment alignment = re.getImprovedAlignment(2, read); assertEquals(alignment.pos, 14); // Alignment pos = 10 + 4 assertEquals(alignment.cigar, "6M1D22M"); assertEquals(alignment.numMismatches, 1);
assertEquals(alignment.orientation, Orientation.FORWARD);
mozack/abra2
src/main/java/abra/Feature.java
// Path: src/main/java/abra/SAMRecordWrapper.java // static class Span { // int start; // int end; // // public Span(int start, int end) { // this.start = start; // this.end = end; // } // // @Override // public int hashCode() { // final int prime = 31; // int result = 1; // result = prime * result + end; // result = prime * result + start; // return result; // } // // @Override // public boolean equals(Object obj) { // if (this == obj) // return true; // if (obj == null) // return false; // if (getClass() != obj.getClass()) // return false; // Span other = (Span) obj; // if (end != other.end) // return false; // if (start != other.start) // return false; // return true; // } // }
import java.util.ArrayList; import java.util.List; import abra.SAMRecordWrapper.Span; import htsjdk.samtools.SAMFileHeader; import htsjdk.samtools.SAMRecord;
public void setKmer(int kmer) { this.kmerSize = kmer; } public static int findFirstOverlappingRegion(SAMFileHeader samHeader, SAMRecordWrapper read, int readStart, int readEnd, List<Feature> regions, int start) { if (start < 0) { start = 0; } for (int idx=start; idx<regions.size(); idx++) { Feature region = regions.get(idx); if ( (read.getSamRecord().getReferenceIndex() < samHeader.getSequenceDictionary().getSequenceIndex(region.getSeqname())) || (read.getSamRecord().getReferenceName().equals(region.getSeqname()) && readStart < region.getStart()) ) { // This read is in between regions // TODO: adjust start region here return -1; } else if (region.overlaps(read.getSamRecord().getReferenceName(), readStart, readEnd)) { return idx; } } // This read is beyond all regions return -1; } public static List<Integer> findAllOverlappingRegions(SAMFileHeader samHeader, SAMRecordWrapper read, List<Feature> regions, int start) { List<Integer> overlappingRegions = new ArrayList<Integer>();
// Path: src/main/java/abra/SAMRecordWrapper.java // static class Span { // int start; // int end; // // public Span(int start, int end) { // this.start = start; // this.end = end; // } // // @Override // public int hashCode() { // final int prime = 31; // int result = 1; // result = prime * result + end; // result = prime * result + start; // return result; // } // // @Override // public boolean equals(Object obj) { // if (this == obj) // return true; // if (obj == null) // return false; // if (getClass() != obj.getClass()) // return false; // Span other = (Span) obj; // if (end != other.end) // return false; // if (start != other.start) // return false; // return true; // } // } // Path: src/main/java/abra/Feature.java import java.util.ArrayList; import java.util.List; import abra.SAMRecordWrapper.Span; import htsjdk.samtools.SAMFileHeader; import htsjdk.samtools.SAMRecord; public void setKmer(int kmer) { this.kmerSize = kmer; } public static int findFirstOverlappingRegion(SAMFileHeader samHeader, SAMRecordWrapper read, int readStart, int readEnd, List<Feature> regions, int start) { if (start < 0) { start = 0; } for (int idx=start; idx<regions.size(); idx++) { Feature region = regions.get(idx); if ( (read.getSamRecord().getReferenceIndex() < samHeader.getSequenceDictionary().getSequenceIndex(region.getSeqname())) || (read.getSamRecord().getReferenceName().equals(region.getSeqname()) && readStart < region.getStart()) ) { // This read is in between regions // TODO: adjust start region here return -1; } else if (region.overlaps(read.getSamRecord().getReferenceName(), readStart, readEnd)) { return idx; } } // This read is beyond all regions return -1; } public static List<Integer> findAllOverlappingRegions(SAMFileHeader samHeader, SAMRecordWrapper read, List<Feature> regions, int start) { List<Integer> overlappingRegions = new ArrayList<Integer>();
for (Span span : read.getSpanningRegions()) {
GoogleContainerTools/minikube-build-tools-for-java
minikube-gradle-plugin/src/main/java/com/google/cloud/tools/minikube/MinikubeExtension.java
// Path: minikube-gradle-plugin/src/main/java/com/google/cloud/tools/minikube/util/CommandExecutorFactory.java // public class CommandExecutorFactory { // private final Logger logger; // // /** // * Creates a new factory. // * // * @param logger for logging messages during the command execution // */ // public CommandExecutorFactory(Logger logger) { // this.logger = logger; // } // // public CommandExecutor newCommandExecutor() { // return new CommandExecutor().setLogger(logger); // } // } // // Path: minikube-gradle-plugin/src/main/java/com/google/cloud/tools/minikube/util/MinikubeDockerEnvParser.java // public class MinikubeDockerEnvParser { // // private MinikubeDockerEnvParser() {} // // /** // * Parses a list of KEY=VALUE strings into a map from KEY to VALUE. // * // * @param keyValueStrings a list of "KEY=VALUE" strings, where KEY is the environment variable // * name and VALUE is the value to set it to // */ // public static Map<String, String> parse(List<String> keyValueStrings) { // Map<String, String> environmentMap = new HashMap<>(); // // for (String keyValueString : keyValueStrings) { // String[] keyValuePair = keyValueString.split("=", 2); // // if (keyValuePair.length < 2) { // throw new IllegalArgumentException( // "Error while parsing minikube's Docker environment: environment variable string not in KEY=VALUE format"); // } // if (keyValuePair[0].length() == 0) { // throw new IllegalArgumentException( // "Error while parsing minikube's Docker environment: encountered empty environment variable name"); // } // // environmentMap.put(keyValuePair[0], keyValuePair[1]); // } // // return environmentMap; // } // }
import com.google.cloud.tools.minikube.util.CommandExecutorFactory; import com.google.cloud.tools.minikube.util.MinikubeDockerEnvParser; import java.io.IOException; import java.util.Arrays; import java.util.List; import java.util.Map; import org.gradle.api.Project; import org.gradle.api.provider.Property;
/* * Copyright 2017 Google Inc. * * Licensed under the Apache License, Version 2.0 (the "License"); you may not * use this file except in compliance with the License. You may obtain a copy of * the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, WITHOUT * WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the * License for the specific language governing permissions and limitations under * the License. */ package com.google.cloud.tools.minikube; /** Minikube configuration extension. */ public class MinikubeExtension { private final Property<String> minikube; private final CommandExecutorFactory commandExecutorFactory; public MinikubeExtension(Project project, CommandExecutorFactory commandExecutorFactory) { minikube = project.getObjects().property(String.class); setMinikube("minikube"); this.commandExecutorFactory = commandExecutorFactory; } public String getMinikube() { return minikube.get(); } public void setMinikube(String minikube) { this.minikube.set(minikube); } public Property<String> getMinikubeProvider() { return minikube; } /** * Gets the minikube docker environment variables by running the command 'minikube docker-env * --shell=none'. * * @return A map of docker environment variables and their values */ public Map<String, String> getDockerEnv() throws IOException, InterruptedException { return getDockerEnv(""); } /** * Gets the minikube docker environment variables by running the command 'minikube docker-env * --shell=none'. * * @param profile target minikube profile * @return A map of docker environment variables and their values */ public Map<String, String> getDockerEnv(String profile) throws IOException, InterruptedException { if (profile == null) { throw new NullPointerException("Minikube profile must not be null"); } List<String> minikubeDockerEnvCommand = Arrays.asList(minikube.get(), "docker-env", "--shell=none", "--profile=" + profile); List<String> dockerEnv = commandExecutorFactory.newCommandExecutor().run(minikubeDockerEnvCommand);
// Path: minikube-gradle-plugin/src/main/java/com/google/cloud/tools/minikube/util/CommandExecutorFactory.java // public class CommandExecutorFactory { // private final Logger logger; // // /** // * Creates a new factory. // * // * @param logger for logging messages during the command execution // */ // public CommandExecutorFactory(Logger logger) { // this.logger = logger; // } // // public CommandExecutor newCommandExecutor() { // return new CommandExecutor().setLogger(logger); // } // } // // Path: minikube-gradle-plugin/src/main/java/com/google/cloud/tools/minikube/util/MinikubeDockerEnvParser.java // public class MinikubeDockerEnvParser { // // private MinikubeDockerEnvParser() {} // // /** // * Parses a list of KEY=VALUE strings into a map from KEY to VALUE. // * // * @param keyValueStrings a list of "KEY=VALUE" strings, where KEY is the environment variable // * name and VALUE is the value to set it to // */ // public static Map<String, String> parse(List<String> keyValueStrings) { // Map<String, String> environmentMap = new HashMap<>(); // // for (String keyValueString : keyValueStrings) { // String[] keyValuePair = keyValueString.split("=", 2); // // if (keyValuePair.length < 2) { // throw new IllegalArgumentException( // "Error while parsing minikube's Docker environment: environment variable string not in KEY=VALUE format"); // } // if (keyValuePair[0].length() == 0) { // throw new IllegalArgumentException( // "Error while parsing minikube's Docker environment: encountered empty environment variable name"); // } // // environmentMap.put(keyValuePair[0], keyValuePair[1]); // } // // return environmentMap; // } // } // Path: minikube-gradle-plugin/src/main/java/com/google/cloud/tools/minikube/MinikubeExtension.java import com.google.cloud.tools.minikube.util.CommandExecutorFactory; import com.google.cloud.tools.minikube.util.MinikubeDockerEnvParser; import java.io.IOException; import java.util.Arrays; import java.util.List; import java.util.Map; import org.gradle.api.Project; import org.gradle.api.provider.Property; /* * Copyright 2017 Google Inc. * * Licensed under the Apache License, Version 2.0 (the "License"); you may not * use this file except in compliance with the License. You may obtain a copy of * the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, WITHOUT * WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the * License for the specific language governing permissions and limitations under * the License. */ package com.google.cloud.tools.minikube; /** Minikube configuration extension. */ public class MinikubeExtension { private final Property<String> minikube; private final CommandExecutorFactory commandExecutorFactory; public MinikubeExtension(Project project, CommandExecutorFactory commandExecutorFactory) { minikube = project.getObjects().property(String.class); setMinikube("minikube"); this.commandExecutorFactory = commandExecutorFactory; } public String getMinikube() { return minikube.get(); } public void setMinikube(String minikube) { this.minikube.set(minikube); } public Property<String> getMinikubeProvider() { return minikube; } /** * Gets the minikube docker environment variables by running the command 'minikube docker-env * --shell=none'. * * @return A map of docker environment variables and their values */ public Map<String, String> getDockerEnv() throws IOException, InterruptedException { return getDockerEnv(""); } /** * Gets the minikube docker environment variables by running the command 'minikube docker-env * --shell=none'. * * @param profile target minikube profile * @return A map of docker environment variables and their values */ public Map<String, String> getDockerEnv(String profile) throws IOException, InterruptedException { if (profile == null) { throw new NullPointerException("Minikube profile must not be null"); } List<String> minikubeDockerEnvCommand = Arrays.asList(minikube.get(), "docker-env", "--shell=none", "--profile=" + profile); List<String> dockerEnv = commandExecutorFactory.newCommandExecutor().run(minikubeDockerEnvCommand);
return MinikubeDockerEnvParser.parse(dockerEnv);
kbase/kb_sdk
src/java/us/kbase/templates/TemplateFormatter.java
// Path: src/java/us/kbase/mobu/util/TextUtils.java // public class TextUtils { // public static String capitalize(String text) { // return capitalize(text, false); // } // // public static String inCamelCase(String text) { // return capitalize(text, true); // } // // public static String capitalize(String text, boolean camel) { // StringBuilder ret = new StringBuilder(); // StringTokenizer st = new StringTokenizer(text, "_-"); // boolean firstToken = true; // while (st.hasMoreTokens()) { // String token = st.nextToken(); // if (Character.isLowerCase(token.charAt(0)) && !(camel && firstToken)) { // token = token.substring(0, 1).toUpperCase() + token.substring(1); // } // if (camel && firstToken && Character.isUpperCase(token.charAt(0))) { // token = token.substring(0, 1).toLowerCase() + token.substring(1); // } // ret.append(token); // firstToken = false; // } // return ret.toString(); // } // // public static List<String> readFileLines(File f) throws IOException { // return readStreamLines(new FileInputStream(f)); // } // // public static String readFileText(File f) throws IOException { // return readStreamText(new FileInputStream(f)); // } // // public static List<String> readStreamLines(InputStream is) throws IOException { // return readStreamLines(is, true); // } // // public static List<String> readStreamLines(InputStream is, boolean closeAfter) throws IOException { // return readReaderLines(new InputStreamReader(is), closeAfter); // } // // public static List<String> readReaderLines(Reader r, boolean closeAfter) throws IOException { // BufferedReader br = new BufferedReader(r); // List<String> ret = new ArrayList<String>(); // while (true) { // String l = br.readLine(); // if (l == null) // break; // ret.add(l); // } // if (closeAfter) // br.close(); // return ret; // } // // public static void writeFileLines(List<String> lines, File targetFile) throws IOException { // writeFileLines(lines, new FileWriter(targetFile)); // } // // public static void writeFileLines(List<String> lines, Writer targetFile) throws IOException { // PrintWriter pw = new PrintWriter(targetFile); // for (String l : lines) // pw.print(l + "\n"); // pw.close(); // } // // public static void copyStreams(InputStream is, OutputStream os) throws IOException { // byte[] buffer = new byte[1024]; // int length; // while ((length = is.read(buffer)) > 0) { // os.write(buffer, 0, length); // } // is.close(); // os.close(); // } // // public static String readStreamText(InputStream is) throws IOException { // ByteArrayOutputStream baos = new ByteArrayOutputStream(); // copyStreams(is, baos); // return new String(baos.toByteArray()); // } // // public static void deleteRecursively(File fileOrDir) { // if (fileOrDir.isDirectory() && !Files.isSymbolicLink(fileOrDir.toPath())) { // File[] files = fileOrDir.listFiles(); // if (files != null) // for (File f : files) // deleteRecursively(f); // } // fileOrDir.delete(); // } // // public static List<String> getLines(String text) throws Exception { // BufferedReader br = new BufferedReader(new StringReader(text)); // List<String> ret = new ArrayList<String>(); // while (true) { // String l = br.readLine(); // if (l == null) // break; // ret.add(l); // } // br.close(); // return ret; // } // // public static void checkIgnoreLine(File f, String line) throws IOException { // TextUtils.checkIgnoreLine(f, line, true); // } // // public static void checkIgnoreLine(File f, String line, boolean showWarnings) throws IOException { // List<String> lines = new ArrayList<String>(); // if (f.exists()) // lines.addAll(FileUtils.readLines(f)); // if (!new HashSet<String>(lines).contains(line)) { // if(showWarnings) { // System.out.println("Warning: file \"" + f.getName() + "\" doesn't contain \"" + line + "\" line, it will be added."); // } // lines.add(line); // FileUtils.writeLines(f, lines); // } // } // }
import java.io.File; import java.io.IOException; import java.io.InputStream; import java.io.InputStreamReader; import java.io.Reader; import java.io.StringReader; import java.io.StringWriter; import java.io.Writer; import java.nio.charset.Charset; import java.util.Map; import org.apache.velocity.VelocityContext; import org.apache.velocity.app.Velocity; import us.kbase.mobu.util.TextUtils;
package us.kbase.templates; public class TemplateFormatter { public static boolean formatTemplate(String templateName, Map<?,?> context, File output) throws IOException { StringWriter sw = new StringWriter(); boolean ret = formatTemplate(templateName, context, sw); sw.close(); StringReader sr = new StringReader(sw.toString());
// Path: src/java/us/kbase/mobu/util/TextUtils.java // public class TextUtils { // public static String capitalize(String text) { // return capitalize(text, false); // } // // public static String inCamelCase(String text) { // return capitalize(text, true); // } // // public static String capitalize(String text, boolean camel) { // StringBuilder ret = new StringBuilder(); // StringTokenizer st = new StringTokenizer(text, "_-"); // boolean firstToken = true; // while (st.hasMoreTokens()) { // String token = st.nextToken(); // if (Character.isLowerCase(token.charAt(0)) && !(camel && firstToken)) { // token = token.substring(0, 1).toUpperCase() + token.substring(1); // } // if (camel && firstToken && Character.isUpperCase(token.charAt(0))) { // token = token.substring(0, 1).toLowerCase() + token.substring(1); // } // ret.append(token); // firstToken = false; // } // return ret.toString(); // } // // public static List<String> readFileLines(File f) throws IOException { // return readStreamLines(new FileInputStream(f)); // } // // public static String readFileText(File f) throws IOException { // return readStreamText(new FileInputStream(f)); // } // // public static List<String> readStreamLines(InputStream is) throws IOException { // return readStreamLines(is, true); // } // // public static List<String> readStreamLines(InputStream is, boolean closeAfter) throws IOException { // return readReaderLines(new InputStreamReader(is), closeAfter); // } // // public static List<String> readReaderLines(Reader r, boolean closeAfter) throws IOException { // BufferedReader br = new BufferedReader(r); // List<String> ret = new ArrayList<String>(); // while (true) { // String l = br.readLine(); // if (l == null) // break; // ret.add(l); // } // if (closeAfter) // br.close(); // return ret; // } // // public static void writeFileLines(List<String> lines, File targetFile) throws IOException { // writeFileLines(lines, new FileWriter(targetFile)); // } // // public static void writeFileLines(List<String> lines, Writer targetFile) throws IOException { // PrintWriter pw = new PrintWriter(targetFile); // for (String l : lines) // pw.print(l + "\n"); // pw.close(); // } // // public static void copyStreams(InputStream is, OutputStream os) throws IOException { // byte[] buffer = new byte[1024]; // int length; // while ((length = is.read(buffer)) > 0) { // os.write(buffer, 0, length); // } // is.close(); // os.close(); // } // // public static String readStreamText(InputStream is) throws IOException { // ByteArrayOutputStream baos = new ByteArrayOutputStream(); // copyStreams(is, baos); // return new String(baos.toByteArray()); // } // // public static void deleteRecursively(File fileOrDir) { // if (fileOrDir.isDirectory() && !Files.isSymbolicLink(fileOrDir.toPath())) { // File[] files = fileOrDir.listFiles(); // if (files != null) // for (File f : files) // deleteRecursively(f); // } // fileOrDir.delete(); // } // // public static List<String> getLines(String text) throws Exception { // BufferedReader br = new BufferedReader(new StringReader(text)); // List<String> ret = new ArrayList<String>(); // while (true) { // String l = br.readLine(); // if (l == null) // break; // ret.add(l); // } // br.close(); // return ret; // } // // public static void checkIgnoreLine(File f, String line) throws IOException { // TextUtils.checkIgnoreLine(f, line, true); // } // // public static void checkIgnoreLine(File f, String line, boolean showWarnings) throws IOException { // List<String> lines = new ArrayList<String>(); // if (f.exists()) // lines.addAll(FileUtils.readLines(f)); // if (!new HashSet<String>(lines).contains(line)) { // if(showWarnings) { // System.out.println("Warning: file \"" + f.getName() + "\" doesn't contain \"" + line + "\" line, it will be added."); // } // lines.add(line); // FileUtils.writeLines(f, lines); // } // } // } // Path: src/java/us/kbase/templates/TemplateFormatter.java import java.io.File; import java.io.IOException; import java.io.InputStream; import java.io.InputStreamReader; import java.io.Reader; import java.io.StringReader; import java.io.StringWriter; import java.io.Writer; import java.nio.charset.Charset; import java.util.Map; import org.apache.velocity.VelocityContext; import org.apache.velocity.app.Velocity; import us.kbase.mobu.util.TextUtils; package us.kbase.templates; public class TemplateFormatter { public static boolean formatTemplate(String templateName, Map<?,?> context, File output) throws IOException { StringWriter sw = new StringWriter(); boolean ret = formatTemplate(templateName, context, sw); sw.close(); StringReader sr = new StringReader(sw.toString());
TextUtils.writeFileLines(TextUtils.readReaderLines(sr, true), output);
kbase/kb_sdk
src/java/us/kbase/common/executionengine/CallbackServer.java
// Path: src/java/us/kbase/common/utils/NetUtils.java // public class NetUtils { // private static final Pattern IPADDRESS_PATTERN = Pattern.compile( // "^([01]?\\d\\d?|2[0-4]\\d|25[0-5])\\." + // "([01]?\\d\\d?|2[0-4]\\d|25[0-5])\\." + // "([01]?\\d\\d?|2[0-4]\\d|25[0-5])\\." + // "([01]?\\d\\d?|2[0-4]\\d|25[0-5])$"); // // public static List<String> findNetworkAddresses(String... networkNames) // throws SocketException { // Set<String> networkNameSet = new HashSet<String>(Arrays.asList(networkNames)); // List<String> ret = new ArrayList<String>(); // for (Enumeration<NetworkInterface> en = NetworkInterface.getNetworkInterfaces(); en.hasMoreElements();) { // NetworkInterface intf = en.nextElement(); // // breaks linux, if required for windows needs to be os-dependent // // if (!intf.isUp()) continue; // if (networkNameSet.contains(intf.getName()) || networkNameSet.contains(intf.getDisplayName())) { // for (Enumeration<InetAddress> enumIpAddr = intf.getInetAddresses(); enumIpAddr.hasMoreElements(); ) { // String ip = enumIpAddr.nextElement().getHostAddress(); // if (IPADDRESS_PATTERN.matcher(ip).matches()) // ret.add(ip); // } // } // } // return ret; // } // // public static int findFreePort() { // try (ServerSocket socket = new ServerSocket(0)) { // return socket.getLocalPort(); // } catch (IOException e) {} // throw new IllegalStateException("Can not find available port in the system"); // } // }
import java.io.ByteArrayOutputStream; import java.io.IOException; import java.io.OutputStream; import java.net.MalformedURLException; import java.net.SocketException; import java.net.URL; import java.util.Arrays; import java.util.Collections; import java.util.HashMap; import java.util.LinkedHashMap; import java.util.LinkedList; import java.util.List; import java.util.Map; import java.util.UUID; import java.util.concurrent.Callable; import java.util.concurrent.ExecutionException; import java.util.concurrent.ExecutorService; import java.util.concurrent.Executors; import java.util.concurrent.FutureTask; import java.util.concurrent.TimeUnit; import javax.servlet.http.HttpServletResponse; import org.eclipse.jetty.util.log.Log; import org.eclipse.jetty.util.log.Logger; import org.joda.time.DateTime; import org.joda.time.format.DateTimeFormat; import org.joda.time.format.DateTimeFormatter; import com.fasterxml.jackson.databind.ObjectMapper; import com.google.common.cache.Cache; import com.google.common.cache.CacheBuilder; import us.kbase.auth.AuthException; import us.kbase.auth.AuthToken; import us.kbase.auth.ConfigurableAuthService; import us.kbase.common.executionengine.CallbackServerConfigBuilder.CallbackServerConfig; import us.kbase.common.service.JacksonTupleModule; import us.kbase.common.service.JsonClientException; import us.kbase.common.service.JsonServerMethod; import us.kbase.common.service.JsonServerServlet; import us.kbase.common.service.JsonServerSyslog; import us.kbase.common.service.JsonTokenStream; import us.kbase.common.service.RpcContext; import us.kbase.common.service.UObject; import us.kbase.common.utils.NetUtils; import us.kbase.workspace.ProvenanceAction; import us.kbase.workspace.SubAction;
} protected abstract SubsequentCallRunner createJobRunner( final AuthToken token, final CallbackServerConfig config, final UUID jobId, final ModuleMethod modmeth, final String serviceVer) throws IOException, JsonClientException; @Override public void destroy() { cbLog("Shutting down executor service"); final List<Runnable> failed = executor.shutdownNow(); if (!failed.isEmpty()) { cbLog(String.format("Failed to stop %s tasks", failed.size())); } } public static URL getCallbackUrl(int callbackPort) throws SocketException { return getCallbackUrl(callbackPort, null); } public static URL getCallbackUrl(int callbackPort, String[] networkInterfaces) throws SocketException { if (networkInterfaces == null || networkInterfaces.length == 0) { networkInterfaces = new String[] {"docker0", "vboxnet0", "vboxnet1", "VirtualBox Host-Only Ethernet Adapter", "en0"}; }
// Path: src/java/us/kbase/common/utils/NetUtils.java // public class NetUtils { // private static final Pattern IPADDRESS_PATTERN = Pattern.compile( // "^([01]?\\d\\d?|2[0-4]\\d|25[0-5])\\." + // "([01]?\\d\\d?|2[0-4]\\d|25[0-5])\\." + // "([01]?\\d\\d?|2[0-4]\\d|25[0-5])\\." + // "([01]?\\d\\d?|2[0-4]\\d|25[0-5])$"); // // public static List<String> findNetworkAddresses(String... networkNames) // throws SocketException { // Set<String> networkNameSet = new HashSet<String>(Arrays.asList(networkNames)); // List<String> ret = new ArrayList<String>(); // for (Enumeration<NetworkInterface> en = NetworkInterface.getNetworkInterfaces(); en.hasMoreElements();) { // NetworkInterface intf = en.nextElement(); // // breaks linux, if required for windows needs to be os-dependent // // if (!intf.isUp()) continue; // if (networkNameSet.contains(intf.getName()) || networkNameSet.contains(intf.getDisplayName())) { // for (Enumeration<InetAddress> enumIpAddr = intf.getInetAddresses(); enumIpAddr.hasMoreElements(); ) { // String ip = enumIpAddr.nextElement().getHostAddress(); // if (IPADDRESS_PATTERN.matcher(ip).matches()) // ret.add(ip); // } // } // } // return ret; // } // // public static int findFreePort() { // try (ServerSocket socket = new ServerSocket(0)) { // return socket.getLocalPort(); // } catch (IOException e) {} // throw new IllegalStateException("Can not find available port in the system"); // } // } // Path: src/java/us/kbase/common/executionengine/CallbackServer.java import java.io.ByteArrayOutputStream; import java.io.IOException; import java.io.OutputStream; import java.net.MalformedURLException; import java.net.SocketException; import java.net.URL; import java.util.Arrays; import java.util.Collections; import java.util.HashMap; import java.util.LinkedHashMap; import java.util.LinkedList; import java.util.List; import java.util.Map; import java.util.UUID; import java.util.concurrent.Callable; import java.util.concurrent.ExecutionException; import java.util.concurrent.ExecutorService; import java.util.concurrent.Executors; import java.util.concurrent.FutureTask; import java.util.concurrent.TimeUnit; import javax.servlet.http.HttpServletResponse; import org.eclipse.jetty.util.log.Log; import org.eclipse.jetty.util.log.Logger; import org.joda.time.DateTime; import org.joda.time.format.DateTimeFormat; import org.joda.time.format.DateTimeFormatter; import com.fasterxml.jackson.databind.ObjectMapper; import com.google.common.cache.Cache; import com.google.common.cache.CacheBuilder; import us.kbase.auth.AuthException; import us.kbase.auth.AuthToken; import us.kbase.auth.ConfigurableAuthService; import us.kbase.common.executionengine.CallbackServerConfigBuilder.CallbackServerConfig; import us.kbase.common.service.JacksonTupleModule; import us.kbase.common.service.JsonClientException; import us.kbase.common.service.JsonServerMethod; import us.kbase.common.service.JsonServerServlet; import us.kbase.common.service.JsonServerSyslog; import us.kbase.common.service.JsonTokenStream; import us.kbase.common.service.RpcContext; import us.kbase.common.service.UObject; import us.kbase.common.utils.NetUtils; import us.kbase.workspace.ProvenanceAction; import us.kbase.workspace.SubAction; } protected abstract SubsequentCallRunner createJobRunner( final AuthToken token, final CallbackServerConfig config, final UUID jobId, final ModuleMethod modmeth, final String serviceVer) throws IOException, JsonClientException; @Override public void destroy() { cbLog("Shutting down executor service"); final List<Runnable> failed = executor.shutdownNow(); if (!failed.isEmpty()) { cbLog(String.format("Failed to stop %s tasks", failed.size())); } } public static URL getCallbackUrl(int callbackPort) throws SocketException { return getCallbackUrl(callbackPort, null); } public static URL getCallbackUrl(int callbackPort, String[] networkInterfaces) throws SocketException { if (networkInterfaces == null || networkInterfaces.length == 0) { networkInterfaces = new String[] {"docker0", "vboxnet0", "vboxnet1", "VirtualBox Host-Only Ethernet Adapter", "en0"}; }
final List<String> hostIps = NetUtils.findNetworkAddresses(
concentricsky/android-viewer-for-khan-academy
src/com/concentricsky/android/khanacademy/data/db/Video.java
// Path: src/com/concentricsky/android/khanacademy/data/remote/BaseEntityUpdateVisitor.java // public abstract class BaseEntityUpdateVisitor<T extends EntityBase> implements EntityVisitor { // private T updateFrom; // public BaseEntityUpdateVisitor(T updateFrom) { // this.updateFrom = updateFrom; // } // @Override // public void visit(Topic topic) { // baseUpdate(topic); // } // @Override // public void visit(Video video) { // baseUpdate(video); // } // @Override // public void visit(EntityBase.Impl entity) { // baseUpdate(entity); // } // private void baseUpdate(EntityBase toUpdate) { // String value = updateFrom.getTitle(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setTitle(value); // } // // value = updateFrom.getDescription(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setDescription(value); // } // // value = updateFrom.getHide(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setHide(value); // } // // value = updateFrom.getKa_url(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setKa_url(value); // } // // Topic parent = updateFrom.getParentTopic(); // if (!isDefaultValue(parent, Topic.class)) { // toUpdate.setParentTopic(parent); // } // // } // // /** // * Test a value to see if it is the default value for its type. // * // * @param value The value to check. // * @param valueType The value's class. In case of primitives, pass the wrapper class, such as Integer. // * @return true if the value is default for fields of the given type on this class, false otherwise. // */ // protected boolean isDefaultValue(Object value, Class<?> valueType) { // // if (String.class.equals(valueType)) { // return null == value || "".equals(value); // } else if (Integer.class.equals(valueType)) { // return Integer.valueOf(0).equals(value); // } else if (Topic.class.equals(valueType)) { // return null == value; // } // // throw new UnsupportedOperationException(String.format("Unknown type: %s", valueType.getSimpleName())); // } // // } // // Path: src/com/concentricsky/android/khanacademy/data/remote/EntityVisitor.java // public interface EntityVisitor { // public void visit(Topic topic); // public void visit(Video video); // public void visit(EntityBase.Impl entity); // }
import com.concentricsky.android.khanacademy.data.remote.BaseEntityUpdateVisitor; import com.concentricsky.android.khanacademy.data.remote.EntityVisitor; import com.fasterxml.jackson.annotation.JsonIgnoreProperties; import com.j256.ormlite.field.DatabaseField; import com.j256.ormlite.table.DatabaseTable;
return false; } } @Override public int hashCode() { return (getClass().hashCode() + getReadable_id().hashCode()) % Integer.MAX_VALUE; } /** * Be sure to refresh this Video from the database before calling this, as it relies * on a current value of download_staus. */ @Override public int getDownloaded_video_count() { return getDownload_status() == DL_STATUS_COMPLETE ? 1 : 0; } @Override public int getVideo_count() { return 1; } @Override public String getId() { return getReadable_id(); } @Override
// Path: src/com/concentricsky/android/khanacademy/data/remote/BaseEntityUpdateVisitor.java // public abstract class BaseEntityUpdateVisitor<T extends EntityBase> implements EntityVisitor { // private T updateFrom; // public BaseEntityUpdateVisitor(T updateFrom) { // this.updateFrom = updateFrom; // } // @Override // public void visit(Topic topic) { // baseUpdate(topic); // } // @Override // public void visit(Video video) { // baseUpdate(video); // } // @Override // public void visit(EntityBase.Impl entity) { // baseUpdate(entity); // } // private void baseUpdate(EntityBase toUpdate) { // String value = updateFrom.getTitle(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setTitle(value); // } // // value = updateFrom.getDescription(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setDescription(value); // } // // value = updateFrom.getHide(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setHide(value); // } // // value = updateFrom.getKa_url(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setKa_url(value); // } // // Topic parent = updateFrom.getParentTopic(); // if (!isDefaultValue(parent, Topic.class)) { // toUpdate.setParentTopic(parent); // } // // } // // /** // * Test a value to see if it is the default value for its type. // * // * @param value The value to check. // * @param valueType The value's class. In case of primitives, pass the wrapper class, such as Integer. // * @return true if the value is default for fields of the given type on this class, false otherwise. // */ // protected boolean isDefaultValue(Object value, Class<?> valueType) { // // if (String.class.equals(valueType)) { // return null == value || "".equals(value); // } else if (Integer.class.equals(valueType)) { // return Integer.valueOf(0).equals(value); // } else if (Topic.class.equals(valueType)) { // return null == value; // } // // throw new UnsupportedOperationException(String.format("Unknown type: %s", valueType.getSimpleName())); // } // // } // // Path: src/com/concentricsky/android/khanacademy/data/remote/EntityVisitor.java // public interface EntityVisitor { // public void visit(Topic topic); // public void visit(Video video); // public void visit(EntityBase.Impl entity); // } // Path: src/com/concentricsky/android/khanacademy/data/db/Video.java import com.concentricsky.android.khanacademy.data.remote.BaseEntityUpdateVisitor; import com.concentricsky.android.khanacademy.data.remote.EntityVisitor; import com.fasterxml.jackson.annotation.JsonIgnoreProperties; import com.j256.ormlite.field.DatabaseField; import com.j256.ormlite.table.DatabaseTable; return false; } } @Override public int hashCode() { return (getClass().hashCode() + getReadable_id().hashCode()) % Integer.MAX_VALUE; } /** * Be sure to refresh this Video from the database before calling this, as it relies * on a current value of download_staus. */ @Override public int getDownloaded_video_count() { return getDownload_status() == DL_STATUS_COMPLETE ? 1 : 0; } @Override public int getVideo_count() { return 1; } @Override public String getId() { return getReadable_id(); } @Override
public BaseEntityUpdateVisitor<Video> buildUpdateVisitor() {
concentricsky/android-viewer-for-khan-academy
src/com/concentricsky/android/khanacademy/data/db/Video.java
// Path: src/com/concentricsky/android/khanacademy/data/remote/BaseEntityUpdateVisitor.java // public abstract class BaseEntityUpdateVisitor<T extends EntityBase> implements EntityVisitor { // private T updateFrom; // public BaseEntityUpdateVisitor(T updateFrom) { // this.updateFrom = updateFrom; // } // @Override // public void visit(Topic topic) { // baseUpdate(topic); // } // @Override // public void visit(Video video) { // baseUpdate(video); // } // @Override // public void visit(EntityBase.Impl entity) { // baseUpdate(entity); // } // private void baseUpdate(EntityBase toUpdate) { // String value = updateFrom.getTitle(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setTitle(value); // } // // value = updateFrom.getDescription(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setDescription(value); // } // // value = updateFrom.getHide(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setHide(value); // } // // value = updateFrom.getKa_url(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setKa_url(value); // } // // Topic parent = updateFrom.getParentTopic(); // if (!isDefaultValue(parent, Topic.class)) { // toUpdate.setParentTopic(parent); // } // // } // // /** // * Test a value to see if it is the default value for its type. // * // * @param value The value to check. // * @param valueType The value's class. In case of primitives, pass the wrapper class, such as Integer. // * @return true if the value is default for fields of the given type on this class, false otherwise. // */ // protected boolean isDefaultValue(Object value, Class<?> valueType) { // // if (String.class.equals(valueType)) { // return null == value || "".equals(value); // } else if (Integer.class.equals(valueType)) { // return Integer.valueOf(0).equals(value); // } else if (Topic.class.equals(valueType)) { // return null == value; // } // // throw new UnsupportedOperationException(String.format("Unknown type: %s", valueType.getSimpleName())); // } // // } // // Path: src/com/concentricsky/android/khanacademy/data/remote/EntityVisitor.java // public interface EntityVisitor { // public void visit(Topic topic); // public void visit(Video video); // public void visit(EntityBase.Impl entity); // }
import com.concentricsky.android.khanacademy.data.remote.BaseEntityUpdateVisitor; import com.concentricsky.android.khanacademy.data.remote.EntityVisitor; import com.fasterxml.jackson.annotation.JsonIgnoreProperties; import com.j256.ormlite.field.DatabaseField; import com.j256.ormlite.table.DatabaseTable;
} DownloadUrls urls = Video.this.getDownload_urls(); if (!isDefaultValue(urls, DownloadUrls.class)) { toUpdate.setDownload_urls(urls); } int n = Video.this.getDuration(); if (!isDefaultValue(n, Integer.class)) { toUpdate.setDuration(n); } n = Video.this.getViews(); if (!isDefaultValue(n, Integer.class)) { toUpdate.setViews(n); } } @Override protected boolean isDefaultValue(Object value, Class<?> valueType) { if (DownloadUrls.class.equals(valueType)) { return null == value; } return super.isDefaultValue(value, valueType); } }; } @Override
// Path: src/com/concentricsky/android/khanacademy/data/remote/BaseEntityUpdateVisitor.java // public abstract class BaseEntityUpdateVisitor<T extends EntityBase> implements EntityVisitor { // private T updateFrom; // public BaseEntityUpdateVisitor(T updateFrom) { // this.updateFrom = updateFrom; // } // @Override // public void visit(Topic topic) { // baseUpdate(topic); // } // @Override // public void visit(Video video) { // baseUpdate(video); // } // @Override // public void visit(EntityBase.Impl entity) { // baseUpdate(entity); // } // private void baseUpdate(EntityBase toUpdate) { // String value = updateFrom.getTitle(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setTitle(value); // } // // value = updateFrom.getDescription(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setDescription(value); // } // // value = updateFrom.getHide(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setHide(value); // } // // value = updateFrom.getKa_url(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setKa_url(value); // } // // Topic parent = updateFrom.getParentTopic(); // if (!isDefaultValue(parent, Topic.class)) { // toUpdate.setParentTopic(parent); // } // // } // // /** // * Test a value to see if it is the default value for its type. // * // * @param value The value to check. // * @param valueType The value's class. In case of primitives, pass the wrapper class, such as Integer. // * @return true if the value is default for fields of the given type on this class, false otherwise. // */ // protected boolean isDefaultValue(Object value, Class<?> valueType) { // // if (String.class.equals(valueType)) { // return null == value || "".equals(value); // } else if (Integer.class.equals(valueType)) { // return Integer.valueOf(0).equals(value); // } else if (Topic.class.equals(valueType)) { // return null == value; // } // // throw new UnsupportedOperationException(String.format("Unknown type: %s", valueType.getSimpleName())); // } // // } // // Path: src/com/concentricsky/android/khanacademy/data/remote/EntityVisitor.java // public interface EntityVisitor { // public void visit(Topic topic); // public void visit(Video video); // public void visit(EntityBase.Impl entity); // } // Path: src/com/concentricsky/android/khanacademy/data/db/Video.java import com.concentricsky.android.khanacademy.data.remote.BaseEntityUpdateVisitor; import com.concentricsky.android.khanacademy.data.remote.EntityVisitor; import com.fasterxml.jackson.annotation.JsonIgnoreProperties; import com.j256.ormlite.field.DatabaseField; import com.j256.ormlite.table.DatabaseTable; } DownloadUrls urls = Video.this.getDownload_urls(); if (!isDefaultValue(urls, DownloadUrls.class)) { toUpdate.setDownload_urls(urls); } int n = Video.this.getDuration(); if (!isDefaultValue(n, Integer.class)) { toUpdate.setDuration(n); } n = Video.this.getViews(); if (!isDefaultValue(n, Integer.class)) { toUpdate.setViews(n); } } @Override protected boolean isDefaultValue(Object value, Class<?> valueType) { if (DownloadUrls.class.equals(valueType)) { return null == value; } return super.isDefaultValue(value, valueType); } }; } @Override
public void accept(EntityVisitor visitor) {
concentricsky/android-viewer-for-khan-academy
src/com/concentricsky/android/khanacademy/data/db/EntityBase.java
// Path: src/com/concentricsky/android/khanacademy/data/remote/BaseEntityUpdateVisitor.java // public abstract class BaseEntityUpdateVisitor<T extends EntityBase> implements EntityVisitor { // private T updateFrom; // public BaseEntityUpdateVisitor(T updateFrom) { // this.updateFrom = updateFrom; // } // @Override // public void visit(Topic topic) { // baseUpdate(topic); // } // @Override // public void visit(Video video) { // baseUpdate(video); // } // @Override // public void visit(EntityBase.Impl entity) { // baseUpdate(entity); // } // private void baseUpdate(EntityBase toUpdate) { // String value = updateFrom.getTitle(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setTitle(value); // } // // value = updateFrom.getDescription(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setDescription(value); // } // // value = updateFrom.getHide(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setHide(value); // } // // value = updateFrom.getKa_url(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setKa_url(value); // } // // Topic parent = updateFrom.getParentTopic(); // if (!isDefaultValue(parent, Topic.class)) { // toUpdate.setParentTopic(parent); // } // // } // // /** // * Test a value to see if it is the default value for its type. // * // * @param value The value to check. // * @param valueType The value's class. In case of primitives, pass the wrapper class, such as Integer. // * @return true if the value is default for fields of the given type on this class, false otherwise. // */ // protected boolean isDefaultValue(Object value, Class<?> valueType) { // // if (String.class.equals(valueType)) { // return null == value || "".equals(value); // } else if (Integer.class.equals(valueType)) { // return Integer.valueOf(0).equals(value); // } else if (Topic.class.equals(valueType)) { // return null == value; // } // // throw new UnsupportedOperationException(String.format("Unknown type: %s", valueType.getSimpleName())); // } // // } // // Path: src/com/concentricsky/android/khanacademy/data/remote/EntityVisitor.java // public interface EntityVisitor { // public void visit(Topic topic); // public void visit(Video video); // public void visit(EntityBase.Impl entity); // }
import com.concentricsky.android.khanacademy.data.remote.BaseEntityUpdateVisitor; import com.concentricsky.android.khanacademy.data.remote.EntityVisitor; import com.fasterxml.jackson.annotation.JsonIgnoreProperties; import com.fasterxml.jackson.annotation.JsonSubTypes; import com.fasterxml.jackson.annotation.JsonSubTypes.Type; import com.fasterxml.jackson.annotation.JsonTypeInfo; import com.j256.ormlite.field.DatabaseField;
/* Viewer for Khan Academy Copyright (C) 2012 Concentric Sky, Inc. This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. */ package com.concentricsky.android.khanacademy.data.db; @JsonIgnoreProperties(ignoreUnknown=true) @JsonTypeInfo( use = JsonTypeInfo.Id.NAME, include = JsonTypeInfo.As.PROPERTY, property = "kind", visible = true, defaultImpl = EntityBase.Impl.class ) @JsonSubTypes({ @Type(value = Video.class, name = "Video"), @Type(value = Topic.class, name = "Topic") }) public abstract class EntityBase extends ModelBase { public static class Impl extends EntityBase { @Override public int getDownloaded_video_count() { return 0; } @Override public int getVideo_count() { return 0; } @Override public String getId() { throw new UnsupportedOperationException("But Videos and Topics have ids..."); } @Override
// Path: src/com/concentricsky/android/khanacademy/data/remote/BaseEntityUpdateVisitor.java // public abstract class BaseEntityUpdateVisitor<T extends EntityBase> implements EntityVisitor { // private T updateFrom; // public BaseEntityUpdateVisitor(T updateFrom) { // this.updateFrom = updateFrom; // } // @Override // public void visit(Topic topic) { // baseUpdate(topic); // } // @Override // public void visit(Video video) { // baseUpdate(video); // } // @Override // public void visit(EntityBase.Impl entity) { // baseUpdate(entity); // } // private void baseUpdate(EntityBase toUpdate) { // String value = updateFrom.getTitle(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setTitle(value); // } // // value = updateFrom.getDescription(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setDescription(value); // } // // value = updateFrom.getHide(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setHide(value); // } // // value = updateFrom.getKa_url(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setKa_url(value); // } // // Topic parent = updateFrom.getParentTopic(); // if (!isDefaultValue(parent, Topic.class)) { // toUpdate.setParentTopic(parent); // } // // } // // /** // * Test a value to see if it is the default value for its type. // * // * @param value The value to check. // * @param valueType The value's class. In case of primitives, pass the wrapper class, such as Integer. // * @return true if the value is default for fields of the given type on this class, false otherwise. // */ // protected boolean isDefaultValue(Object value, Class<?> valueType) { // // if (String.class.equals(valueType)) { // return null == value || "".equals(value); // } else if (Integer.class.equals(valueType)) { // return Integer.valueOf(0).equals(value); // } else if (Topic.class.equals(valueType)) { // return null == value; // } // // throw new UnsupportedOperationException(String.format("Unknown type: %s", valueType.getSimpleName())); // } // // } // // Path: src/com/concentricsky/android/khanacademy/data/remote/EntityVisitor.java // public interface EntityVisitor { // public void visit(Topic topic); // public void visit(Video video); // public void visit(EntityBase.Impl entity); // } // Path: src/com/concentricsky/android/khanacademy/data/db/EntityBase.java import com.concentricsky.android.khanacademy.data.remote.BaseEntityUpdateVisitor; import com.concentricsky.android.khanacademy.data.remote.EntityVisitor; import com.fasterxml.jackson.annotation.JsonIgnoreProperties; import com.fasterxml.jackson.annotation.JsonSubTypes; import com.fasterxml.jackson.annotation.JsonSubTypes.Type; import com.fasterxml.jackson.annotation.JsonTypeInfo; import com.j256.ormlite.field.DatabaseField; /* Viewer for Khan Academy Copyright (C) 2012 Concentric Sky, Inc. This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. */ package com.concentricsky.android.khanacademy.data.db; @JsonIgnoreProperties(ignoreUnknown=true) @JsonTypeInfo( use = JsonTypeInfo.Id.NAME, include = JsonTypeInfo.As.PROPERTY, property = "kind", visible = true, defaultImpl = EntityBase.Impl.class ) @JsonSubTypes({ @Type(value = Video.class, name = "Video"), @Type(value = Topic.class, name = "Topic") }) public abstract class EntityBase extends ModelBase { public static class Impl extends EntityBase { @Override public int getDownloaded_video_count() { return 0; } @Override public int getVideo_count() { return 0; } @Override public String getId() { throw new UnsupportedOperationException("But Videos and Topics have ids..."); } @Override
public BaseEntityUpdateVisitor<Impl> buildUpdateVisitor() {
concentricsky/android-viewer-for-khan-academy
src/com/concentricsky/android/khanacademy/data/db/EntityBase.java
// Path: src/com/concentricsky/android/khanacademy/data/remote/BaseEntityUpdateVisitor.java // public abstract class BaseEntityUpdateVisitor<T extends EntityBase> implements EntityVisitor { // private T updateFrom; // public BaseEntityUpdateVisitor(T updateFrom) { // this.updateFrom = updateFrom; // } // @Override // public void visit(Topic topic) { // baseUpdate(topic); // } // @Override // public void visit(Video video) { // baseUpdate(video); // } // @Override // public void visit(EntityBase.Impl entity) { // baseUpdate(entity); // } // private void baseUpdate(EntityBase toUpdate) { // String value = updateFrom.getTitle(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setTitle(value); // } // // value = updateFrom.getDescription(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setDescription(value); // } // // value = updateFrom.getHide(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setHide(value); // } // // value = updateFrom.getKa_url(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setKa_url(value); // } // // Topic parent = updateFrom.getParentTopic(); // if (!isDefaultValue(parent, Topic.class)) { // toUpdate.setParentTopic(parent); // } // // } // // /** // * Test a value to see if it is the default value for its type. // * // * @param value The value to check. // * @param valueType The value's class. In case of primitives, pass the wrapper class, such as Integer. // * @return true if the value is default for fields of the given type on this class, false otherwise. // */ // protected boolean isDefaultValue(Object value, Class<?> valueType) { // // if (String.class.equals(valueType)) { // return null == value || "".equals(value); // } else if (Integer.class.equals(valueType)) { // return Integer.valueOf(0).equals(value); // } else if (Topic.class.equals(valueType)) { // return null == value; // } // // throw new UnsupportedOperationException(String.format("Unknown type: %s", valueType.getSimpleName())); // } // // } // // Path: src/com/concentricsky/android/khanacademy/data/remote/EntityVisitor.java // public interface EntityVisitor { // public void visit(Topic topic); // public void visit(Video video); // public void visit(EntityBase.Impl entity); // }
import com.concentricsky.android.khanacademy.data.remote.BaseEntityUpdateVisitor; import com.concentricsky.android.khanacademy.data.remote.EntityVisitor; import com.fasterxml.jackson.annotation.JsonIgnoreProperties; import com.fasterxml.jackson.annotation.JsonSubTypes; import com.fasterxml.jackson.annotation.JsonSubTypes.Type; import com.fasterxml.jackson.annotation.JsonTypeInfo; import com.j256.ormlite.field.DatabaseField;
/* Viewer for Khan Academy Copyright (C) 2012 Concentric Sky, Inc. This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. */ package com.concentricsky.android.khanacademy.data.db; @JsonIgnoreProperties(ignoreUnknown=true) @JsonTypeInfo( use = JsonTypeInfo.Id.NAME, include = JsonTypeInfo.As.PROPERTY, property = "kind", visible = true, defaultImpl = EntityBase.Impl.class ) @JsonSubTypes({ @Type(value = Video.class, name = "Video"), @Type(value = Topic.class, name = "Topic") }) public abstract class EntityBase extends ModelBase { public static class Impl extends EntityBase { @Override public int getDownloaded_video_count() { return 0; } @Override public int getVideo_count() { return 0; } @Override public String getId() { throw new UnsupportedOperationException("But Videos and Topics have ids..."); } @Override public BaseEntityUpdateVisitor<Impl> buildUpdateVisitor() { return new BaseEntityUpdateVisitor<Impl>(this) { }; } @Override
// Path: src/com/concentricsky/android/khanacademy/data/remote/BaseEntityUpdateVisitor.java // public abstract class BaseEntityUpdateVisitor<T extends EntityBase> implements EntityVisitor { // private T updateFrom; // public BaseEntityUpdateVisitor(T updateFrom) { // this.updateFrom = updateFrom; // } // @Override // public void visit(Topic topic) { // baseUpdate(topic); // } // @Override // public void visit(Video video) { // baseUpdate(video); // } // @Override // public void visit(EntityBase.Impl entity) { // baseUpdate(entity); // } // private void baseUpdate(EntityBase toUpdate) { // String value = updateFrom.getTitle(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setTitle(value); // } // // value = updateFrom.getDescription(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setDescription(value); // } // // value = updateFrom.getHide(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setHide(value); // } // // value = updateFrom.getKa_url(); // if (!isDefaultValue(value, String.class)) { // toUpdate.setKa_url(value); // } // // Topic parent = updateFrom.getParentTopic(); // if (!isDefaultValue(parent, Topic.class)) { // toUpdate.setParentTopic(parent); // } // // } // // /** // * Test a value to see if it is the default value for its type. // * // * @param value The value to check. // * @param valueType The value's class. In case of primitives, pass the wrapper class, such as Integer. // * @return true if the value is default for fields of the given type on this class, false otherwise. // */ // protected boolean isDefaultValue(Object value, Class<?> valueType) { // // if (String.class.equals(valueType)) { // return null == value || "".equals(value); // } else if (Integer.class.equals(valueType)) { // return Integer.valueOf(0).equals(value); // } else if (Topic.class.equals(valueType)) { // return null == value; // } // // throw new UnsupportedOperationException(String.format("Unknown type: %s", valueType.getSimpleName())); // } // // } // // Path: src/com/concentricsky/android/khanacademy/data/remote/EntityVisitor.java // public interface EntityVisitor { // public void visit(Topic topic); // public void visit(Video video); // public void visit(EntityBase.Impl entity); // } // Path: src/com/concentricsky/android/khanacademy/data/db/EntityBase.java import com.concentricsky.android.khanacademy.data.remote.BaseEntityUpdateVisitor; import com.concentricsky.android.khanacademy.data.remote.EntityVisitor; import com.fasterxml.jackson.annotation.JsonIgnoreProperties; import com.fasterxml.jackson.annotation.JsonSubTypes; import com.fasterxml.jackson.annotation.JsonSubTypes.Type; import com.fasterxml.jackson.annotation.JsonTypeInfo; import com.j256.ormlite.field.DatabaseField; /* Viewer for Khan Academy Copyright (C) 2012 Concentric Sky, Inc. This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. */ package com.concentricsky.android.khanacademy.data.db; @JsonIgnoreProperties(ignoreUnknown=true) @JsonTypeInfo( use = JsonTypeInfo.Id.NAME, include = JsonTypeInfo.As.PROPERTY, property = "kind", visible = true, defaultImpl = EntityBase.Impl.class ) @JsonSubTypes({ @Type(value = Video.class, name = "Video"), @Type(value = Topic.class, name = "Topic") }) public abstract class EntityBase extends ModelBase { public static class Impl extends EntityBase { @Override public int getDownloaded_video_count() { return 0; } @Override public int getVideo_count() { return 0; } @Override public String getId() { throw new UnsupportedOperationException("But Videos and Topics have ids..."); } @Override public BaseEntityUpdateVisitor<Impl> buildUpdateVisitor() { return new BaseEntityUpdateVisitor<Impl>(this) { }; } @Override
public void accept(EntityVisitor visitor) {
concentricsky/android-viewer-for-khan-academy
src/com/concentricsky/android/khanacademy/data/KADataServiceProviderImpl.java
// Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class KADataBinder extends Binder { // private KADataService dataService; // public KADataBinder(KADataService dataService) { // setDataService(dataService); // } // public KADataService getService() { // return dataService; // } // public void setDataService(KADataService dataService) { // this.dataService = dataService; // } // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public interface Provider { // public KADataService getDataService() throws ServiceUnavailableException; // public boolean requestDataService(ObjectCallback<KADataService> callback); // public boolean cancelDataServiceRequest(ObjectCallback<KADataService> callback); // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class ServiceUnavailableException extends Exception { // private static final long serialVersionUID = 581386365380491650L; // public final boolean expected; // public ServiceUnavailableException(boolean expected) { // super(); // this.expected = expected; // } // } // // Path: src/com/concentricsky/android/khanacademy/util/ObjectCallback.java // public interface ObjectCallback<T> { // public void call(T obj); // }
import com.concentricsky.android.khanacademy.util.ObjectCallback; import java.util.ArrayList; import java.util.List; import android.app.Activity; import android.app.Service; import android.content.ComponentName; import android.content.Intent; import android.content.ServiceConnection; import android.os.IBinder; import com.concentricsky.android.khanacademy.data.KADataService.KADataBinder; import com.concentricsky.android.khanacademy.data.KADataService.Provider; import com.concentricsky.android.khanacademy.data.KADataService.ServiceUnavailableException;
/* Viewer for Khan Academy Copyright (C) 2012 Concentric Sky, Inc. This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. */ package com.concentricsky.android.khanacademy.data; public class KADataServiceProviderImpl implements Provider { private Activity activity; private KADataService dataService;
// Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class KADataBinder extends Binder { // private KADataService dataService; // public KADataBinder(KADataService dataService) { // setDataService(dataService); // } // public KADataService getService() { // return dataService; // } // public void setDataService(KADataService dataService) { // this.dataService = dataService; // } // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public interface Provider { // public KADataService getDataService() throws ServiceUnavailableException; // public boolean requestDataService(ObjectCallback<KADataService> callback); // public boolean cancelDataServiceRequest(ObjectCallback<KADataService> callback); // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class ServiceUnavailableException extends Exception { // private static final long serialVersionUID = 581386365380491650L; // public final boolean expected; // public ServiceUnavailableException(boolean expected) { // super(); // this.expected = expected; // } // } // // Path: src/com/concentricsky/android/khanacademy/util/ObjectCallback.java // public interface ObjectCallback<T> { // public void call(T obj); // } // Path: src/com/concentricsky/android/khanacademy/data/KADataServiceProviderImpl.java import com.concentricsky.android.khanacademy.util.ObjectCallback; import java.util.ArrayList; import java.util.List; import android.app.Activity; import android.app.Service; import android.content.ComponentName; import android.content.Intent; import android.content.ServiceConnection; import android.os.IBinder; import com.concentricsky.android.khanacademy.data.KADataService.KADataBinder; import com.concentricsky.android.khanacademy.data.KADataService.Provider; import com.concentricsky.android.khanacademy.data.KADataService.ServiceUnavailableException; /* Viewer for Khan Academy Copyright (C) 2012 Concentric Sky, Inc. This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. */ package com.concentricsky.android.khanacademy.data; public class KADataServiceProviderImpl implements Provider { private Activity activity; private KADataService dataService;
private List<ObjectCallback<KADataService>> dataServiceCallbacks = new ArrayList<ObjectCallback<KADataService>>();
concentricsky/android-viewer-for-khan-academy
src/com/concentricsky/android/khanacademy/data/KADataServiceProviderImpl.java
// Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class KADataBinder extends Binder { // private KADataService dataService; // public KADataBinder(KADataService dataService) { // setDataService(dataService); // } // public KADataService getService() { // return dataService; // } // public void setDataService(KADataService dataService) { // this.dataService = dataService; // } // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public interface Provider { // public KADataService getDataService() throws ServiceUnavailableException; // public boolean requestDataService(ObjectCallback<KADataService> callback); // public boolean cancelDataServiceRequest(ObjectCallback<KADataService> callback); // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class ServiceUnavailableException extends Exception { // private static final long serialVersionUID = 581386365380491650L; // public final boolean expected; // public ServiceUnavailableException(boolean expected) { // super(); // this.expected = expected; // } // } // // Path: src/com/concentricsky/android/khanacademy/util/ObjectCallback.java // public interface ObjectCallback<T> { // public void call(T obj); // }
import com.concentricsky.android.khanacademy.util.ObjectCallback; import java.util.ArrayList; import java.util.List; import android.app.Activity; import android.app.Service; import android.content.ComponentName; import android.content.Intent; import android.content.ServiceConnection; import android.os.IBinder; import com.concentricsky.android.khanacademy.data.KADataService.KADataBinder; import com.concentricsky.android.khanacademy.data.KADataService.Provider; import com.concentricsky.android.khanacademy.data.KADataService.ServiceUnavailableException;
/* Viewer for Khan Academy Copyright (C) 2012 Concentric Sky, Inc. This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. */ package com.concentricsky.android.khanacademy.data; public class KADataServiceProviderImpl implements Provider { private Activity activity; private KADataService dataService; private List<ObjectCallback<KADataService>> dataServiceCallbacks = new ArrayList<ObjectCallback<KADataService>>(); private boolean dataServiceExpected; private boolean serviceRequested; private ServiceConnection serviceConnection = new ServiceConnection() { @Override public void onServiceConnected(ComponentName name, IBinder service) { // NOTE : we ignore the name, as we only connect to a single type of dataService.
// Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class KADataBinder extends Binder { // private KADataService dataService; // public KADataBinder(KADataService dataService) { // setDataService(dataService); // } // public KADataService getService() { // return dataService; // } // public void setDataService(KADataService dataService) { // this.dataService = dataService; // } // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public interface Provider { // public KADataService getDataService() throws ServiceUnavailableException; // public boolean requestDataService(ObjectCallback<KADataService> callback); // public boolean cancelDataServiceRequest(ObjectCallback<KADataService> callback); // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class ServiceUnavailableException extends Exception { // private static final long serialVersionUID = 581386365380491650L; // public final boolean expected; // public ServiceUnavailableException(boolean expected) { // super(); // this.expected = expected; // } // } // // Path: src/com/concentricsky/android/khanacademy/util/ObjectCallback.java // public interface ObjectCallback<T> { // public void call(T obj); // } // Path: src/com/concentricsky/android/khanacademy/data/KADataServiceProviderImpl.java import com.concentricsky.android.khanacademy.util.ObjectCallback; import java.util.ArrayList; import java.util.List; import android.app.Activity; import android.app.Service; import android.content.ComponentName; import android.content.Intent; import android.content.ServiceConnection; import android.os.IBinder; import com.concentricsky.android.khanacademy.data.KADataService.KADataBinder; import com.concentricsky.android.khanacademy.data.KADataService.Provider; import com.concentricsky.android.khanacademy.data.KADataService.ServiceUnavailableException; /* Viewer for Khan Academy Copyright (C) 2012 Concentric Sky, Inc. This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. */ package com.concentricsky.android.khanacademy.data; public class KADataServiceProviderImpl implements Provider { private Activity activity; private KADataService dataService; private List<ObjectCallback<KADataService>> dataServiceCallbacks = new ArrayList<ObjectCallback<KADataService>>(); private boolean dataServiceExpected; private boolean serviceRequested; private ServiceConnection serviceConnection = new ServiceConnection() { @Override public void onServiceConnected(ComponentName name, IBinder service) { // NOTE : we ignore the name, as we only connect to a single type of dataService.
dataService = ((KADataBinder) service).getService();
concentricsky/android-viewer-for-khan-academy
src/com/concentricsky/android/khanacademy/data/KADataServiceProviderImpl.java
// Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class KADataBinder extends Binder { // private KADataService dataService; // public KADataBinder(KADataService dataService) { // setDataService(dataService); // } // public KADataService getService() { // return dataService; // } // public void setDataService(KADataService dataService) { // this.dataService = dataService; // } // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public interface Provider { // public KADataService getDataService() throws ServiceUnavailableException; // public boolean requestDataService(ObjectCallback<KADataService> callback); // public boolean cancelDataServiceRequest(ObjectCallback<KADataService> callback); // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class ServiceUnavailableException extends Exception { // private static final long serialVersionUID = 581386365380491650L; // public final boolean expected; // public ServiceUnavailableException(boolean expected) { // super(); // this.expected = expected; // } // } // // Path: src/com/concentricsky/android/khanacademy/util/ObjectCallback.java // public interface ObjectCallback<T> { // public void call(T obj); // }
import com.concentricsky.android.khanacademy.util.ObjectCallback; import java.util.ArrayList; import java.util.List; import android.app.Activity; import android.app.Service; import android.content.ComponentName; import android.content.Intent; import android.content.ServiceConnection; import android.os.IBinder; import com.concentricsky.android.khanacademy.data.KADataService.KADataBinder; import com.concentricsky.android.khanacademy.data.KADataService.Provider; import com.concentricsky.android.khanacademy.data.KADataService.ServiceUnavailableException;
callback.call(dataService); } dataServiceCallbacks.clear(); } @Override public void onServiceDisconnected(ComponentName name) { // NOTE : we ignore the name, as we only connect to a single type of dataService. dataService = null; } }; public void destroy() { dataServiceCallbacks.clear(); if (serviceRequested) { activity.unbindService(serviceConnection); } activity = null; serviceConnection = null; dataService = null; } public KADataServiceProviderImpl(Activity activity) { this.activity = activity; serviceRequested = false; } @Override
// Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class KADataBinder extends Binder { // private KADataService dataService; // public KADataBinder(KADataService dataService) { // setDataService(dataService); // } // public KADataService getService() { // return dataService; // } // public void setDataService(KADataService dataService) { // this.dataService = dataService; // } // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public interface Provider { // public KADataService getDataService() throws ServiceUnavailableException; // public boolean requestDataService(ObjectCallback<KADataService> callback); // public boolean cancelDataServiceRequest(ObjectCallback<KADataService> callback); // } // // Path: src/com/concentricsky/android/khanacademy/data/KADataService.java // public static class ServiceUnavailableException extends Exception { // private static final long serialVersionUID = 581386365380491650L; // public final boolean expected; // public ServiceUnavailableException(boolean expected) { // super(); // this.expected = expected; // } // } // // Path: src/com/concentricsky/android/khanacademy/util/ObjectCallback.java // public interface ObjectCallback<T> { // public void call(T obj); // } // Path: src/com/concentricsky/android/khanacademy/data/KADataServiceProviderImpl.java import com.concentricsky.android.khanacademy.util.ObjectCallback; import java.util.ArrayList; import java.util.List; import android.app.Activity; import android.app.Service; import android.content.ComponentName; import android.content.Intent; import android.content.ServiceConnection; import android.os.IBinder; import com.concentricsky.android.khanacademy.data.KADataService.KADataBinder; import com.concentricsky.android.khanacademy.data.KADataService.Provider; import com.concentricsky.android.khanacademy.data.KADataService.ServiceUnavailableException; callback.call(dataService); } dataServiceCallbacks.clear(); } @Override public void onServiceDisconnected(ComponentName name) { // NOTE : we ignore the name, as we only connect to a single type of dataService. dataService = null; } }; public void destroy() { dataServiceCallbacks.clear(); if (serviceRequested) { activity.unbindService(serviceConnection); } activity = null; serviceConnection = null; dataService = null; } public KADataServiceProviderImpl(Activity activity) { this.activity = activity; serviceRequested = false; } @Override
public KADataService getDataService() throws ServiceUnavailableException {
ZhangJiupeng/AgentX
src/main/java/cc/agentx/client/net/nio/Tcp2UdpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); }
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/client/net/nio/Tcp2UdpHandler.java import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); }
private final XRequestResolver requestResolver;
ZhangJiupeng/AgentX
src/main/java/cc/agentx/client/net/nio/Tcp2UdpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); } private final XRequestResolver requestResolver; private final InetSocketAddress udpSource;
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/client/net/nio/Tcp2UdpHandler.java import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); } private final XRequestResolver requestResolver; private final InetSocketAddress udpSource;
private final Wrapper wrapper;
ZhangJiupeng/AgentX
src/main/java/cc/agentx/client/net/nio/Tcp2UdpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); } private final XRequestResolver requestResolver; private final InetSocketAddress udpSource; private final Wrapper wrapper; public Tcp2UdpHandler(InetSocketAddress udpSource, XRequestResolver requestResolver, Wrapper wrapper) { this.udpSource = udpSource; this.requestResolver = requestResolver; this.wrapper = wrapper; } @Override public void channelRead(ChannelHandlerContext ctx, Object msg) { Channel udpChannel = XChannelMapper.getUdpChannel(udpSource); if (udpChannel == null) { log.warn("Bad Connection! (udp channel closed)"); XChannelMapper.closeChannelGracefullyByTcpChannel(ctx.channel()); } else if (udpChannel.isActive()) { ByteBuf byteBuf = (ByteBuf) msg; try { if (!byteBuf.hasArray()) { byte[] bytes = new byte[byteBuf.readableBytes()]; byteBuf.getBytes(0, bytes); bytes = wrapper.unwrap(bytes);
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/client/net/nio/Tcp2UdpHandler.java import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); } private final XRequestResolver requestResolver; private final InetSocketAddress udpSource; private final Wrapper wrapper; public Tcp2UdpHandler(InetSocketAddress udpSource, XRequestResolver requestResolver, Wrapper wrapper) { this.udpSource = udpSource; this.requestResolver = requestResolver; this.wrapper = wrapper; } @Override public void channelRead(ChannelHandlerContext ctx, Object msg) { Channel udpChannel = XChannelMapper.getUdpChannel(udpSource); if (udpChannel == null) { log.warn("Bad Connection! (udp channel closed)"); XChannelMapper.closeChannelGracefullyByTcpChannel(ctx.channel()); } else if (udpChannel.isActive()) { ByteBuf byteBuf = (ByteBuf) msg; try { if (!byteBuf.hasArray()) { byte[] bytes = new byte[byteBuf.readableBytes()]; byteBuf.getBytes(0, bytes); bytes = wrapper.unwrap(bytes);
XRequest request = requestResolver.parse(bytes);
ZhangJiupeng/AgentX
src/main/java/cc/agentx/wrapper/ZeroPaddingWrapper.java
// Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // }
import cc.agentx.util.KeyHelper; import java.util.Arrays;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.wrapper; public class ZeroPaddingWrapper extends PaddingWrapper { // +-----------------------+--------------------+------+ // | header (padding size) | padding (nullable) | data | // +-----------------------+--------------------+------+ public ZeroPaddingWrapper(int paddingThreshold, int paddingRange) { super(paddingThreshold, paddingRange); if (paddingThreshold + paddingRange < 0xFF - 1) headerLength = 1; else if (paddingThreshold + paddingRange < 0xFFFF - 2) headerLength = 2; else if (paddingThreshold + paddingRange < 0xFFFFFF - 3) headerLength = 3; } @Override public byte[] wrap(byte[] bytes) { if (bytes.length < paddingThreshold + paddingRange) {
// Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // } // Path: src/main/java/cc/agentx/wrapper/ZeroPaddingWrapper.java import cc.agentx.util.KeyHelper; import java.util.Arrays; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.wrapper; public class ZeroPaddingWrapper extends PaddingWrapper { // +-----------------------+--------------------+------+ // | header (padding size) | padding (nullable) | data | // +-----------------------+--------------------+------+ public ZeroPaddingWrapper(int paddingThreshold, int paddingRange) { super(paddingThreshold, paddingRange); if (paddingThreshold + paddingRange < 0xFF - 1) headerLength = 1; else if (paddingThreshold + paddingRange < 0xFFFF - 2) headerLength = 2; else if (paddingThreshold + paddingRange < 0xFFFFFF - 3) headerLength = 3; } @Override public byte[] wrap(byte[] bytes) { if (bytes.length < paddingThreshold + paddingRange) {
int randomLength = KeyHelper.generateRandomInteger(
ZhangJiupeng/AgentX
src/main/java/cc/agentx/wrapper/FrameWrapper.java
// Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // }
import cc.agentx.util.KeyHelper; import java.io.ByteArrayOutputStream; import java.util.ArrayList; import java.util.Arrays; import java.util.List;
reservedHeaderLength = 4; } /** * frameHandler will be invoked before the frame re-concat into * data stream, see unwrap(). */ public FrameWrapper(int fixedFrameLength, Wrapper frameHandler) { this(fixedFrameLength); this.frameHandler = frameHandler; } /* * data will be wrapped into several frames, but marked as a whole * chunk (we call it a data-package) */ @Override public byte[] wrap(final byte[] bytes) { byte[] payload; if (frameHandler == null) { payload = bytes; } else { payload = frameHandler.wrap(bytes); } int i, nof = (payload.length / frameLength) + (payload.length % frameLength == 0 ? 0 : 1); for (i = 0; i < nof - 1; i++) { wrapBuffer.write(1); wrapBuffer.write(payload, i * frameLength, frameLength); } wrapBuffer.write(0);
// Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // } // Path: src/main/java/cc/agentx/wrapper/FrameWrapper.java import cc.agentx.util.KeyHelper; import java.io.ByteArrayOutputStream; import java.util.ArrayList; import java.util.Arrays; import java.util.List; reservedHeaderLength = 4; } /** * frameHandler will be invoked before the frame re-concat into * data stream, see unwrap(). */ public FrameWrapper(int fixedFrameLength, Wrapper frameHandler) { this(fixedFrameLength); this.frameHandler = frameHandler; } /* * data will be wrapped into several frames, but marked as a whole * chunk (we call it a data-package) */ @Override public byte[] wrap(final byte[] bytes) { byte[] payload; if (frameHandler == null) { payload = bytes; } else { payload = frameHandler.wrap(bytes); } int i, nof = (payload.length / frameLength) + (payload.length % frameLength == 0 ? 0 : 1); for (i = 0; i < nof - 1; i++) { wrapBuffer.write(1); wrapBuffer.write(payload, i * frameLength, frameLength); } wrapBuffer.write(0);
wrapBuffer.write(KeyHelper.getBytes(reservedHeaderLength, payload.length - i * frameLength), 0, reservedHeaderLength);
ZhangJiupeng/AgentX
src/main/java/cc/agentx/ui/HttpError.java
// Path: src/main/java/cc/agentx/Constants.java // public final class Constants { // public static final String APP_NAME = "agentx"; // public static final String APP_VERSION = "1.3"; // public static final String WEB_SERVER_NAME = "agentx-web-console"; // // private Constants() { // } // }
import cc.agentx.Constants; import java.util.regex.Matcher;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.ui; /** * <b>Notice:</b> this project is not for a web server, * you can see that the page configuration is embedded into * <code>cc.agentx.http.Initializer</code>. <br>However, * <code>cc.agentx.http</code> is designed separately, * it can be extracted into a single project. * <br> * Thus, this web server project might be developed in the future, * hold on and keep attention :) */ public class HttpError extends Throwable { public static final HttpError HTTP_400 = new HttpError(400, "Bad Request"); public static final HttpError HTTP_404 = new HttpError(404, "Not Found"); public static final HttpError HTTP_405 = new HttpError(405, "Method Not Allowed"); public static final HttpError HTTP_408 = new HttpError(405, "Request Timeout"); public static final HttpError HTTP_500 = new HttpError(500, "Internal Server Error"); private static final String ERROR_PAGE_CONTENT = Initializer.getStaticErrorPage(); private final int code; private final String text; HttpError(final int code, final String text) { this.code = code; this.text = text; } public static String wrapInErrorPage(String bodyText) { return ERROR_PAGE_CONTENT.replaceAll(Matcher.quoteReplacement("$0"), bodyText) .replaceAll(Matcher.quoteReplacement("$1"), bodyText)
// Path: src/main/java/cc/agentx/Constants.java // public final class Constants { // public static final String APP_NAME = "agentx"; // public static final String APP_VERSION = "1.3"; // public static final String WEB_SERVER_NAME = "agentx-web-console"; // // private Constants() { // } // } // Path: src/main/java/cc/agentx/ui/HttpError.java import cc.agentx.Constants; import java.util.regex.Matcher; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.ui; /** * <b>Notice:</b> this project is not for a web server, * you can see that the page configuration is embedded into * <code>cc.agentx.http.Initializer</code>. <br>However, * <code>cc.agentx.http</code> is designed separately, * it can be extracted into a single project. * <br> * Thus, this web server project might be developed in the future, * hold on and keep attention :) */ public class HttpError extends Throwable { public static final HttpError HTTP_400 = new HttpError(400, "Bad Request"); public static final HttpError HTTP_404 = new HttpError(404, "Not Found"); public static final HttpError HTTP_405 = new HttpError(405, "Method Not Allowed"); public static final HttpError HTTP_408 = new HttpError(405, "Request Timeout"); public static final HttpError HTTP_500 = new HttpError(500, "Internal Server Error"); private static final String ERROR_PAGE_CONTENT = Initializer.getStaticErrorPage(); private final int code; private final String text; HttpError(final int code, final String text) { this.code = code; this.text = text; } public static String wrapInErrorPage(String bodyText) { return ERROR_PAGE_CONTENT.replaceAll(Matcher.quoteReplacement("$0"), bodyText) .replaceAll(Matcher.quoteReplacement("$1"), bodyText)
.replaceAll(Matcher.quoteReplacement("$2"), "AgentX " + Constants.APP_VERSION)
ZhangJiupeng/AgentX
src/main/java/cc/agentx/security/AesCipher.java
// Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // }
import cc.agentx.util.KeyHelper; import org.bouncycastle.crypto.StreamBlockCipher; import org.bouncycastle.crypto.engines.AESEngine; import org.bouncycastle.crypto.modes.CFBBlockCipher; import org.bouncycastle.crypto.modes.OFBBlockCipher; import org.bouncycastle.crypto.params.KeyParameter; import org.bouncycastle.crypto.params.ParametersWithIV; import javax.crypto.spec.SecretKeySpec;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.security; public class AesCipher extends Cipher { // encryption mode public static final int AES_128_CFB = 16; public static final int AES_192_CFB = 24; public static final int AES_256_CFB = 32; public static final int AES_128_OFB = -16; public static final int AES_192_OFB = -24; public static final int AES_256_OFB = -32; private final int keyLength; private final StreamBlockCipher cipher; /** * <b>Notice: </b><br> * 1. the <code>AESFastEngine</code> was replaced by <code>AESEngine</code> now.<br> * 2. in <code>new CFBBlockCipher(engine, <b>16</b> * 8);</code> the IV length (16) is * reference to the shadowsocks's design. * * @see <a href="https://www.bouncycastle.org/releasenotes.html"> * https://www.bouncycastle.org/releasenotes.html</a>#CVE-2016-1000339<br> * <a href="https://shadowsocks.org/en/spec/cipher.html"> * https://shadowsocks.org/en/spec/cipher.html</a>#Cipher */ public AesCipher(String password, int mode) { key = new SecretKeySpec(password.getBytes(), "AES"); keyLength = Math.abs(mode); AESEngine engine = new AESEngine(); if (mode > 0) { cipher = new CFBBlockCipher(engine, 16 * 8); } else { cipher = new OFBBlockCipher(engine, 16 * 8); } } public static boolean isValidMode(int mode) { int modeAbs = Math.abs(mode); return modeAbs == 16 || modeAbs == 24 || modeAbs == 32; } @Override protected void _init(boolean isEncrypt, byte[] iv) { String keyStr = new String(key.getEncoded()); ParametersWithIV params = new ParametersWithIV(
// Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // } // Path: src/main/java/cc/agentx/security/AesCipher.java import cc.agentx.util.KeyHelper; import org.bouncycastle.crypto.StreamBlockCipher; import org.bouncycastle.crypto.engines.AESEngine; import org.bouncycastle.crypto.modes.CFBBlockCipher; import org.bouncycastle.crypto.modes.OFBBlockCipher; import org.bouncycastle.crypto.params.KeyParameter; import org.bouncycastle.crypto.params.ParametersWithIV; import javax.crypto.spec.SecretKeySpec; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.security; public class AesCipher extends Cipher { // encryption mode public static final int AES_128_CFB = 16; public static final int AES_192_CFB = 24; public static final int AES_256_CFB = 32; public static final int AES_128_OFB = -16; public static final int AES_192_OFB = -24; public static final int AES_256_OFB = -32; private final int keyLength; private final StreamBlockCipher cipher; /** * <b>Notice: </b><br> * 1. the <code>AESFastEngine</code> was replaced by <code>AESEngine</code> now.<br> * 2. in <code>new CFBBlockCipher(engine, <b>16</b> * 8);</code> the IV length (16) is * reference to the shadowsocks's design. * * @see <a href="https://www.bouncycastle.org/releasenotes.html"> * https://www.bouncycastle.org/releasenotes.html</a>#CVE-2016-1000339<br> * <a href="https://shadowsocks.org/en/spec/cipher.html"> * https://shadowsocks.org/en/spec/cipher.html</a>#Cipher */ public AesCipher(String password, int mode) { key = new SecretKeySpec(password.getBytes(), "AES"); keyLength = Math.abs(mode); AESEngine engine = new AESEngine(); if (mode > 0) { cipher = new CFBBlockCipher(engine, 16 * 8); } else { cipher = new OFBBlockCipher(engine, 16 * 8); } } public static boolean isValidMode(int mode) { int modeAbs = Math.abs(mode); return modeAbs == 16 || modeAbs == 24 || modeAbs == 32; } @Override protected void _init(boolean isEncrypt, byte[] iv) { String keyStr = new String(key.getEncoded()); ParametersWithIV params = new ParametersWithIV(
new KeyParameter(KeyHelper.generateKeyDigest(keyLength, keyStr)), iv
ZhangJiupeng/AgentX
src/main/java/cc/agentx/server/net/nio/Udp2TcpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); }
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/server/net/nio/Udp2TcpHandler.java import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); }
private final XRequestResolver requestResolver;
ZhangJiupeng/AgentX
src/main/java/cc/agentx/server/net/nio/Udp2TcpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); } private final XRequestResolver requestResolver;
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/server/net/nio/Udp2TcpHandler.java import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); } private final XRequestResolver requestResolver;
private final Wrapper wrapper;
ZhangJiupeng/AgentX
src/main/java/cc/agentx/server/net/nio/Udp2TcpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); } private final XRequestResolver requestResolver; private final Wrapper wrapper; public Udp2TcpHandler(XRequestResolver requestResolver, Wrapper wrapper) { this.requestResolver = requestResolver; this.wrapper = wrapper; } @Override public void channelRead(ChannelHandlerContext ctx, Object msg) throws Exception { DatagramPacket datagram = (DatagramPacket) msg; InetSocketAddress sender = datagram.sender(); Channel tcpChannel = XChannelMapper.getTcpChannel(sender); if (tcpChannel == null) { // udpSource not registered, actively discard this packet // without register, an udp channel cannot relate to any tcp channel, so remove the map XChannelMapper.removeUdpMapping(sender); log.warn("Bad Connection! (unexpected udp datagram from {})", sender); } else if (tcpChannel.isActive()) { ByteBuf byteBuf = datagram.content(); try { if (!byteBuf.hasArray()) { byte[] bytes = new byte[byteBuf.readableBytes()]; byteBuf.getBytes(0, bytes); log.info("\t Proxy << Target \tFrom {}:{}", sender.getHostString(), sender.getPort()); // write udp payload via tcp channel
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/server/net/nio/Udp2TcpHandler.java import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); } private final XRequestResolver requestResolver; private final Wrapper wrapper; public Udp2TcpHandler(XRequestResolver requestResolver, Wrapper wrapper) { this.requestResolver = requestResolver; this.wrapper = wrapper; } @Override public void channelRead(ChannelHandlerContext ctx, Object msg) throws Exception { DatagramPacket datagram = (DatagramPacket) msg; InetSocketAddress sender = datagram.sender(); Channel tcpChannel = XChannelMapper.getTcpChannel(sender); if (tcpChannel == null) { // udpSource not registered, actively discard this packet // without register, an udp channel cannot relate to any tcp channel, so remove the map XChannelMapper.removeUdpMapping(sender); log.warn("Bad Connection! (unexpected udp datagram from {})", sender); } else if (tcpChannel.isActive()) { ByteBuf byteBuf = datagram.content(); try { if (!byteBuf.hasArray()) { byte[] bytes = new byte[byteBuf.readableBytes()]; byteBuf.getBytes(0, bytes); log.info("\t Proxy << Target \tFrom {}:{}", sender.getHostString(), sender.getPort()); // write udp payload via tcp channel
tcpChannel.writeAndFlush(Unpooled.wrappedBuffer(wrapper.wrap(requestResolver.wrap(XRequest.Channel.UDP, bytes))));
ZhangJiupeng/AgentX
src/main/java/cc/agentx/client/net/nio/Udp2TcpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); }
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/client/net/nio/Udp2TcpHandler.java import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); }
private final XRequestResolver requestResolver;
ZhangJiupeng/AgentX
src/main/java/cc/agentx/client/net/nio/Udp2TcpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); } private final XRequestResolver requestResolver;
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/client/net/nio/Udp2TcpHandler.java import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); } private final XRequestResolver requestResolver;
private final Wrapper wrapper;
ZhangJiupeng/AgentX
src/main/java/cc/agentx/client/net/nio/Udp2TcpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); } private final XRequestResolver requestResolver; private final Wrapper wrapper; public Udp2TcpHandler(XRequestResolver requestResolver, Wrapper wrapper) { this.requestResolver = requestResolver; this.wrapper = wrapper; } @Override public void channelRead(ChannelHandlerContext ctx, Object msg) throws Exception { DatagramPacket datagram = (DatagramPacket) msg; InetSocketAddress sender = datagram.sender(); Channel tcpChannel = XChannelMapper.getTcpChannel(sender); if (tcpChannel == null) { // udpSource not registered, actively discard this packet // without register, an udp channel cannot relate to any tcp channel, so remove the map XChannelMapper.removeUdpMapping(sender); log.warn("Bad Connection! (unexpected udp datagram from {})", sender); } else if (tcpChannel.isActive()) { ByteBuf byteBuf = datagram.content(); try { if (!byteBuf.hasArray()) { byte[] bytes = new byte[byteBuf.readableBytes()]; byteBuf.getBytes(0, bytes); // write udp payload via tcp channel
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/client/net/nio/Udp2TcpHandler.java import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; import java.net.InetSocketAddress; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public class Udp2TcpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(Udp2TcpHandler.class); } private final XRequestResolver requestResolver; private final Wrapper wrapper; public Udp2TcpHandler(XRequestResolver requestResolver, Wrapper wrapper) { this.requestResolver = requestResolver; this.wrapper = wrapper; } @Override public void channelRead(ChannelHandlerContext ctx, Object msg) throws Exception { DatagramPacket datagram = (DatagramPacket) msg; InetSocketAddress sender = datagram.sender(); Channel tcpChannel = XChannelMapper.getTcpChannel(sender); if (tcpChannel == null) { // udpSource not registered, actively discard this packet // without register, an udp channel cannot relate to any tcp channel, so remove the map XChannelMapper.removeUdpMapping(sender); log.warn("Bad Connection! (unexpected udp datagram from {})", sender); } else if (tcpChannel.isActive()) { ByteBuf byteBuf = datagram.content(); try { if (!byteBuf.hasArray()) { byte[] bytes = new byte[byteBuf.readableBytes()]; byteBuf.getBytes(0, bytes); // write udp payload via tcp channel
byte[] content = wrapper.wrap(requestResolver.wrap(XRequest.Channel.UDP, bytes));
ZhangJiupeng/AgentX
src/main/java/cc/agentx/server/net/nio/Tcp2UdpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); }
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/server/net/nio/Tcp2UdpHandler.java import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); }
private final XRequestResolver requestResolver;
ZhangJiupeng/AgentX
src/main/java/cc/agentx/server/net/nio/Tcp2UdpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); } private final XRequestResolver requestResolver;
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/server/net/nio/Tcp2UdpHandler.java import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); } private final XRequestResolver requestResolver;
private final Wrapper wrapper;
ZhangJiupeng/AgentX
src/main/java/cc/agentx/server/net/nio/Tcp2UdpHandler.java
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); } private final XRequestResolver requestResolver; private final Wrapper wrapper; private InetSocketAddress udpTarget; public Tcp2UdpHandler(InetSocketAddress udpTarget, XRequestResolver requestResolver, Wrapper wrapper) { this.udpTarget = udpTarget; this.requestResolver = requestResolver; this.wrapper = wrapper; } @Override public void channelRead(ChannelHandlerContext ctx, Object msg) { ByteBuf byteBuf = (ByteBuf) msg; try { if (!byteBuf.hasArray()) { byte[] bytes = new byte[byteBuf.readableBytes()]; byteBuf.getBytes(0, bytes); bytes = wrapper.unwrap(bytes); // resolve xRequest
// Path: src/main/java/cc/agentx/protocol/request/XRequest.java // public class XRequest { // private Type atyp; // private String host; // private int port; // private int subsequentDataLength; // private Channel channel = Channel.TCP; // // public XRequest(Type atyp, String host, int port, int subsequentDataLength) { // this.atyp = atyp; // this.host = host; // this.port = port; // this.subsequentDataLength = subsequentDataLength; // } // // public XRequest(byte[] bytes) { // String[] target = new String(bytes).split(":"); // if (target[0].equals(Type.IPV4.name())) // this.atyp = Type.IPV4; // if (target[0].equals(Type.DOMAIN.name())) // this.atyp = Type.DOMAIN; // if (target[0].equals(Type.IPV6.name())) // this.atyp = Type.IPV6; // this.host = target[1]; // this.port = Integer.parseInt(target[2]); // this.subsequentDataLength = Integer.parseInt(target[3]); // } // // public Channel getChannel() { // return channel; // } // // public XRequest setChannel(Channel channel) { // this.channel = channel; // return this; // } // // public byte[] getBytes() { // return (atyp.name() + ":" + host + ":" + port + ":" + subsequentDataLength).getBytes(); // } // // public String getHost() { // return host; // } // // public int getPort() { // return port; // } // // public int getSubsequentDataLength() { // return subsequentDataLength; // } // // public Type getAtyp() { // return atyp; // } // // @Override // public String toString() { // return "XRequest{" + // "atyp=" + atyp + // ", host='" + host + '\'' + // ", port=" + port + // ", subsequentDataLength=" + subsequentDataLength + // ", channel=" + channel + // '}'; // } // // public enum Channel { // TCP, UDP // } // // public enum Type { // IPV4, DOMAIN, IPV6, UNKNOWN // } // } // // Path: src/main/java/cc/agentx/protocol/request/XRequestResolver.java // public abstract class XRequestResolver { // // public abstract byte[] wrap(XRequest.Channel channel, byte[] bytes); // // public abstract XRequest parse(final byte[] bytes); // // public abstract boolean exposeRequest(); // // public byte[] wrap(byte[] bytes) { // return wrap(XRequest.Channel.TCP, bytes); // } // // public byte[] unwrap(final byte[] bytes) { // return parse(bytes).getBytes(); // } // } // // Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/server/net/nio/Tcp2UdpHandler.java import java.net.InetSocketAddress; import java.util.Arrays; import cc.agentx.protocol.request.XRequest; import cc.agentx.protocol.request.XRequestResolver; import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.channel.socket.DatagramPacket; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public final class Tcp2UdpHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); } private final XRequestResolver requestResolver; private final Wrapper wrapper; private InetSocketAddress udpTarget; public Tcp2UdpHandler(InetSocketAddress udpTarget, XRequestResolver requestResolver, Wrapper wrapper) { this.udpTarget = udpTarget; this.requestResolver = requestResolver; this.wrapper = wrapper; } @Override public void channelRead(ChannelHandlerContext ctx, Object msg) { ByteBuf byteBuf = (ByteBuf) msg; try { if (!byteBuf.hasArray()) { byte[] bytes = new byte[byteBuf.readableBytes()]; byteBuf.getBytes(0, bytes); bytes = wrapper.unwrap(bytes); // resolve xRequest
XRequest request = requestResolver.parse(bytes);
ZhangJiupeng/AgentX
src/main/java/cc/agentx/ui/HttpServer.java
// Path: src/main/java/cc/agentx/Constants.java // public final class Constants { // public static final String APP_NAME = "agentx"; // public static final String APP_VERSION = "1.3"; // public static final String WEB_SERVER_NAME = "agentx-web-console"; // // private Constants() { // } // }
import cc.agentx.Constants; import java.io.*; import java.net.*; import java.text.SimpleDateFormat; import java.util.*; import java.util.concurrent.ExecutorService; import java.util.concurrent.Executors; import java.util.concurrent.TimeUnit; import java.util.concurrent.atomic.AtomicBoolean;
port = getIdlePort(); baseDir = System.getProperty("user.dir").replaceAll("\\\\", "/") + "/www/"; } new HttpServer(port, baseDir).start(); } public int start() { isRunning.set(true); executor.submit(new ServiceListener(port)); return port; } public void stop() { isRunning.set(false); shutdown(executor); } boolean shutdown(final ExecutorService pool) { pool.shutdown(); try { if (!pool.awaitTermination(60, TimeUnit.SECONDS)) { pool.shutdownNow(); if (!pool.awaitTermination(60, TimeUnit.SECONDS)) return false; } } catch (InterruptedException ie) { pool.shutdownNow(); Thread.currentThread().interrupt(); } if (info)
// Path: src/main/java/cc/agentx/Constants.java // public final class Constants { // public static final String APP_NAME = "agentx"; // public static final String APP_VERSION = "1.3"; // public static final String WEB_SERVER_NAME = "agentx-web-console"; // // private Constants() { // } // } // Path: src/main/java/cc/agentx/ui/HttpServer.java import cc.agentx.Constants; import java.io.*; import java.net.*; import java.text.SimpleDateFormat; import java.util.*; import java.util.concurrent.ExecutorService; import java.util.concurrent.Executors; import java.util.concurrent.TimeUnit; import java.util.concurrent.atomic.AtomicBoolean; port = getIdlePort(); baseDir = System.getProperty("user.dir").replaceAll("\\\\", "/") + "/www/"; } new HttpServer(port, baseDir).start(); } public int start() { isRunning.set(true); executor.submit(new ServiceListener(port)); return port; } public void stop() { isRunning.set(false); shutdown(executor); } boolean shutdown(final ExecutorService pool) { pool.shutdown(); try { if (!pool.awaitTermination(60, TimeUnit.SECONDS)) { pool.shutdownNow(); if (!pool.awaitTermination(60, TimeUnit.SECONDS)) return false; } } catch (InterruptedException ie) { pool.shutdownNow(); Thread.currentThread().interrupt(); } if (info)
System.out.println(Constants.WEB_SERVER_NAME + " stopped.");
ZhangJiupeng/AgentX
src/main/java/cc/agentx/security/BlowfishCipher.java
// Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // }
import cc.agentx.util.KeyHelper; import org.bouncycastle.crypto.StreamBlockCipher; import org.bouncycastle.crypto.engines.BlowfishEngine; import org.bouncycastle.crypto.modes.CFBBlockCipher; import org.bouncycastle.crypto.params.KeyParameter; import org.bouncycastle.crypto.params.ParametersWithIV; import javax.crypto.spec.SecretKeySpec;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.security; public class BlowfishCipher extends Cipher { // encryption mode public static final int BLOWFISH_CFB = 16; private final int keyLength; private final StreamBlockCipher cipher; /** * <b>Notice: </b><br> * 1. in <code>new CFBBlockCipher(engine, <b>8</b> * 8);</code> the IV length (8) is * reference to the shadowsocks's design. * * @see <a href="https://shadowsocks.org/en/spec/cipher.html"> * https://shadowsocks.org/en/spec/cipher.html</a>#Cipher */ public BlowfishCipher(String password, int mode) { key = new SecretKeySpec(password.getBytes(), "BF"); keyLength = mode; BlowfishEngine engine = new BlowfishEngine(); cipher = new CFBBlockCipher(engine, 8 * 8); } public static boolean isValidMode(int mode) { return mode == 16; } @Override protected void _init(boolean isEncrypt, byte[] iv) { String keyStr = new String(key.getEncoded()); ParametersWithIV params = new ParametersWithIV(
// Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // } // Path: src/main/java/cc/agentx/security/BlowfishCipher.java import cc.agentx.util.KeyHelper; import org.bouncycastle.crypto.StreamBlockCipher; import org.bouncycastle.crypto.engines.BlowfishEngine; import org.bouncycastle.crypto.modes.CFBBlockCipher; import org.bouncycastle.crypto.params.KeyParameter; import org.bouncycastle.crypto.params.ParametersWithIV; import javax.crypto.spec.SecretKeySpec; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.security; public class BlowfishCipher extends Cipher { // encryption mode public static final int BLOWFISH_CFB = 16; private final int keyLength; private final StreamBlockCipher cipher; /** * <b>Notice: </b><br> * 1. in <code>new CFBBlockCipher(engine, <b>8</b> * 8);</code> the IV length (8) is * reference to the shadowsocks's design. * * @see <a href="https://shadowsocks.org/en/spec/cipher.html"> * https://shadowsocks.org/en/spec/cipher.html</a>#Cipher */ public BlowfishCipher(String password, int mode) { key = new SecretKeySpec(password.getBytes(), "BF"); keyLength = mode; BlowfishEngine engine = new BlowfishEngine(); cipher = new CFBBlockCipher(engine, 8 * 8); } public static boolean isValidMode(int mode) { return mode == 16; } @Override protected void _init(boolean isEncrypt, byte[] iv) { String keyStr = new String(key.getEncoded()); ParametersWithIV params = new ParametersWithIV(
new KeyParameter(KeyHelper.generateKeyDigest(keyLength, keyStr)), iv
ZhangJiupeng/AgentX
src/main/java/cc/agentx/client/net/nio/XRelayHandler.java
// Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelFutureListener; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public final class XRelayHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); } private final Channel dstChannel;
// Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/client/net/nio/XRelayHandler.java import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelFutureListener; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.client.net.nio; public final class XRelayHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log; static { log = InternalLoggerFactory.getInstance(XRelayHandler.class); } private final Channel dstChannel;
private final Wrapper wrapper;
ZhangJiupeng/AgentX
src/main/java/cc/agentx/protocol/request/ShadowsocksRequestResolver.java
// Path: src/main/java/cc/agentx/protocol/Socks5.java // public class Socks5 { // public static final int VERSION = 5; // public static final int ATYP_IPV4 = 1; // public static final int ATYP_DOMAIN = 3; // public static final int ATYP_IPV6 = 4; // // preset replies // public static byte[] echo = {5, 0}; // public static byte[] reject = {5, (byte) 0xff}; // public static byte[] succeed = {5, 0, 0, 1, 0, 0, 0, 0, 0, 0}; // public static byte[] error_1 = {5, 1, 0, 1, 0, 0, 0, 0, 0, 0}; // general socks server failure // public static byte[] error_2 = {5, 2, 0, 1, 0, 0, 0, 0, 0, 0}; // connection not allowed by rule set // public static byte[] error_3 = {5, 3, 0, 1, 0, 0, 0, 0, 0, 0}; // network unreachable // public static byte[] error_4 = {5, 4, 0, 1, 0, 0, 0, 0, 0, 0}; // host unreachable // public static byte[] error_5 = {5, 5, 0, 1, 0, 0, 0, 0, 0, 0}; // connection refused // public static byte[] error_6 = {5, 6, 0, 1, 0, 0, 0, 0, 0, 0}; // ttl expired // public static byte[] error_7 = {5, 7, 0, 1, 0, 0, 0, 0, 0, 0}; // command not supported // public static byte[] error_8 = {5, 8, 0, 1, 0, 0, 0, 0, 0, 0}; // address type not supported // private Socks5() { // } // // }
import cc.agentx.protocol.Socks5; import java.util.Arrays;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.protocol.request; public class ShadowsocksRequestResolver extends XRequestResolver { public ShadowsocksRequestResolver() { } /** * <pre> * TCP Request: * +-------------------+----------------------------+ * | SOCKS5 FIELD (3) | SHADOWSOCKS REQ | * +-----+-----+-------+------+----------+----------+ * | VER | CMD | RSV | ATYP | DST.ADDR | DST.PORT | * +-----+-----+-------+------+----------+----------+ * | 1 | 1 | X'00' | 1 | Variable | 2 | * +-----+-----+-------+------+----------+----------+ * * UDP Request: * +-------------------------------------------------------------+ * | AGENTX HEADER | * +-----+---------------------+---------------------------------------+ * | SOCKS5 FIELD (3) | SHADOWSOCKS REQ | * +-----+---------------------+------+----------+----------+----------+ * | RSV | FRAG (FAKE-ATYP) | ATYP | DST.ADDR | DST.PORT | DATA | * +----+----------------------+------+----------+----------+----------+ * | 2 | X'00' | 1 | Variable | 2 | Variable | * +-----+---------------------+------+----------+----------+----------+ * </pre> * Notice: In AgentX implementation, we send udp traffic though a secure tcp tunnel, * to distinct these two types of tcp payload, we add an extra 0 byte in front of any * udp-target requests. Thus, if we find a ATYP equals to 0, after truncate the first * byte, we can get the accurate udp-target request. */ @Override public byte[] wrap(XRequest.Channel channel, final byte[] bytes) { if (channel == XRequest.Channel.UDP) return Arrays.copyOfRange(bytes, 2, bytes.length); else return Arrays.copyOfRange(bytes, 3, bytes.length); } @Override public XRequest parse(byte[] bytes) { boolean udp = false; XRequest.Type atyp; String host; int port, subsequentDataLength; // mark udp payload if (bytes[0] == 0) { udp = true; bytes = Arrays.copyOfRange(bytes, 1, bytes.length); } switch (bytes[0]) {
// Path: src/main/java/cc/agentx/protocol/Socks5.java // public class Socks5 { // public static final int VERSION = 5; // public static final int ATYP_IPV4 = 1; // public static final int ATYP_DOMAIN = 3; // public static final int ATYP_IPV6 = 4; // // preset replies // public static byte[] echo = {5, 0}; // public static byte[] reject = {5, (byte) 0xff}; // public static byte[] succeed = {5, 0, 0, 1, 0, 0, 0, 0, 0, 0}; // public static byte[] error_1 = {5, 1, 0, 1, 0, 0, 0, 0, 0, 0}; // general socks server failure // public static byte[] error_2 = {5, 2, 0, 1, 0, 0, 0, 0, 0, 0}; // connection not allowed by rule set // public static byte[] error_3 = {5, 3, 0, 1, 0, 0, 0, 0, 0, 0}; // network unreachable // public static byte[] error_4 = {5, 4, 0, 1, 0, 0, 0, 0, 0, 0}; // host unreachable // public static byte[] error_5 = {5, 5, 0, 1, 0, 0, 0, 0, 0, 0}; // connection refused // public static byte[] error_6 = {5, 6, 0, 1, 0, 0, 0, 0, 0, 0}; // ttl expired // public static byte[] error_7 = {5, 7, 0, 1, 0, 0, 0, 0, 0, 0}; // command not supported // public static byte[] error_8 = {5, 8, 0, 1, 0, 0, 0, 0, 0, 0}; // address type not supported // private Socks5() { // } // // } // Path: src/main/java/cc/agentx/protocol/request/ShadowsocksRequestResolver.java import cc.agentx.protocol.Socks5; import java.util.Arrays; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.protocol.request; public class ShadowsocksRequestResolver extends XRequestResolver { public ShadowsocksRequestResolver() { } /** * <pre> * TCP Request: * +-------------------+----------------------------+ * | SOCKS5 FIELD (3) | SHADOWSOCKS REQ | * +-----+-----+-------+------+----------+----------+ * | VER | CMD | RSV | ATYP | DST.ADDR | DST.PORT | * +-----+-----+-------+------+----------+----------+ * | 1 | 1 | X'00' | 1 | Variable | 2 | * +-----+-----+-------+------+----------+----------+ * * UDP Request: * +-------------------------------------------------------------+ * | AGENTX HEADER | * +-----+---------------------+---------------------------------------+ * | SOCKS5 FIELD (3) | SHADOWSOCKS REQ | * +-----+---------------------+------+----------+----------+----------+ * | RSV | FRAG (FAKE-ATYP) | ATYP | DST.ADDR | DST.PORT | DATA | * +----+----------------------+------+----------+----------+----------+ * | 2 | X'00' | 1 | Variable | 2 | Variable | * +-----+---------------------+------+----------+----------+----------+ * </pre> * Notice: In AgentX implementation, we send udp traffic though a secure tcp tunnel, * to distinct these two types of tcp payload, we add an extra 0 byte in front of any * udp-target requests. Thus, if we find a ATYP equals to 0, after truncate the first * byte, we can get the accurate udp-target request. */ @Override public byte[] wrap(XRequest.Channel channel, final byte[] bytes) { if (channel == XRequest.Channel.UDP) return Arrays.copyOfRange(bytes, 2, bytes.length); else return Arrays.copyOfRange(bytes, 3, bytes.length); } @Override public XRequest parse(byte[] bytes) { boolean udp = false; XRequest.Type atyp; String host; int port, subsequentDataLength; // mark udp payload if (bytes[0] == 0) { udp = true; bytes = Arrays.copyOfRange(bytes, 1, bytes.length); } switch (bytes[0]) {
case Socks5.ATYP_IPV4:
ZhangJiupeng/AgentX
src/main/java/cc/agentx/wrapper/CipherWrapper.java
// Path: src/main/java/cc/agentx/security/Cipher.java // public abstract class Cipher { // protected SecretKey key; // protected byte[] iv; // protected boolean isEncrypt; // // public void init(boolean isEncrypt, byte[] iv) { // if (this.iv == null) { // this.isEncrypt = isEncrypt; // this.iv = iv; // _init(isEncrypt, iv); // } else { // throw new RuntimeException("cipher cannot reinitiate"); // } // } // // public byte[] encrypt(byte[] originData) { // if (this.iv == null) // throw new CipherNotInitializedException(); // if (!isEncrypt) // throw new RuntimeException("cannot encrypt in decrypt mode"); // return _encrypt(originData); // } // // public byte[] decrypt(byte[] encryptedData) { // if (this.iv == null) // throw new CipherNotInitializedException(); // if (isEncrypt) // throw new RuntimeException("cannot decrypt in encrypt mode"); // return _decrypt(encryptedData); // } // // public SecretKey getKey() { // return key; // } // // public byte[] getIV() { // return iv; // } // // public abstract int getIVLength(); // // protected abstract void _init(boolean isEncrypt, byte[] iv); // // protected abstract byte[] _encrypt(final byte[] originData); // // protected abstract byte[] _decrypt(final byte[] encryptedData); // // } // // Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // }
import cc.agentx.security.Cipher; import cc.agentx.util.KeyHelper; import java.util.Arrays;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.wrapper; public class CipherWrapper extends Wrapper { private final Cipher encipher; private final Cipher decipher; private byte[] encipherIv; private byte[] decipherIv; public CipherWrapper(Cipher encipher, Cipher decipher) { if (encipher.getClass() != decipher.getClass()) throw new RuntimeException("cipher type not match"); this.encipher = encipher; this.decipher = decipher; } @Override public byte[] wrap(final byte[] bytes) { if (encipherIv == null) { int ivLength = encipher.getIVLength();
// Path: src/main/java/cc/agentx/security/Cipher.java // public abstract class Cipher { // protected SecretKey key; // protected byte[] iv; // protected boolean isEncrypt; // // public void init(boolean isEncrypt, byte[] iv) { // if (this.iv == null) { // this.isEncrypt = isEncrypt; // this.iv = iv; // _init(isEncrypt, iv); // } else { // throw new RuntimeException("cipher cannot reinitiate"); // } // } // // public byte[] encrypt(byte[] originData) { // if (this.iv == null) // throw new CipherNotInitializedException(); // if (!isEncrypt) // throw new RuntimeException("cannot encrypt in decrypt mode"); // return _encrypt(originData); // } // // public byte[] decrypt(byte[] encryptedData) { // if (this.iv == null) // throw new CipherNotInitializedException(); // if (isEncrypt) // throw new RuntimeException("cannot decrypt in encrypt mode"); // return _decrypt(encryptedData); // } // // public SecretKey getKey() { // return key; // } // // public byte[] getIV() { // return iv; // } // // public abstract int getIVLength(); // // protected abstract void _init(boolean isEncrypt, byte[] iv); // // protected abstract byte[] _encrypt(final byte[] originData); // // protected abstract byte[] _decrypt(final byte[] encryptedData); // // } // // Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // } // Path: src/main/java/cc/agentx/wrapper/CipherWrapper.java import cc.agentx.security.Cipher; import cc.agentx.util.KeyHelper; import java.util.Arrays; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.wrapper; public class CipherWrapper extends Wrapper { private final Cipher encipher; private final Cipher decipher; private byte[] encipherIv; private byte[] decipherIv; public CipherWrapper(Cipher encipher, Cipher decipher) { if (encipher.getClass() != decipher.getClass()) throw new RuntimeException("cipher type not match"); this.encipher = encipher; this.decipher = decipher; } @Override public byte[] wrap(final byte[] bytes) { if (encipherIv == null) { int ivLength = encipher.getIVLength();
this.encipherIv = KeyHelper.generateRandomBytes(ivLength);
ZhangJiupeng/AgentX
src/main/java/cc/agentx/server/net/nio/XRelayHandler.java
// Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // }
import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelFutureListener; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public final class XRelayHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log = InternalLoggerFactory.getInstance(XRelayHandler.class); private final Channel dstChannel;
// Path: src/main/java/cc/agentx/wrapper/Wrapper.java // public abstract class Wrapper implements Parcelable { // // } // Path: src/main/java/cc/agentx/server/net/nio/XRelayHandler.java import cc.agentx.wrapper.Wrapper; import io.netty.buffer.ByteBuf; import io.netty.buffer.Unpooled; import io.netty.channel.Channel; import io.netty.channel.ChannelFutureListener; import io.netty.channel.ChannelHandlerContext; import io.netty.channel.ChannelInboundHandlerAdapter; import io.netty.util.ReferenceCountUtil; import io.netty.util.internal.logging.InternalLogger; import io.netty.util.internal.logging.InternalLoggerFactory; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server.net.nio; public final class XRelayHandler extends ChannelInboundHandlerAdapter { private static final InternalLogger log = InternalLoggerFactory.getInstance(XRelayHandler.class); private final Channel dstChannel;
private final Wrapper wrapper;
ZhangJiupeng/AgentX
src/main/java/cc/agentx/wrapper/RandomPaddingWrapper.java
// Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // }
import cc.agentx.util.KeyHelper; import java.util.Arrays;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.wrapper; public class RandomPaddingWrapper extends PaddingWrapper { public RandomPaddingWrapper(int paddingThreshold, int paddingRange) { super(paddingThreshold, paddingRange); if (paddingThreshold + paddingRange < 0xFF - 1) headerLength = 1; else if (paddingThreshold + paddingRange < 0xFFFF - 2) headerLength = 2; else if (paddingThreshold + paddingRange < 0xFFFFFF - 3) headerLength = 3; } @Override public byte[] wrap(byte[] bytes) { if (bytes.length < paddingThreshold + paddingRange) {
// Path: src/main/java/cc/agentx/util/KeyHelper.java // public class KeyHelper { // private static SecureRandom randomizer = new SecureRandom(); // // private KeyHelper() { // } // // public static int generateRandomInteger(int min, int max) { // return min + randomizer.nextInt(max - min); // } // // public static byte[] generateRandomBytes(int length) { // byte[] bytes = new byte[length]; // randomizer.nextBytes(bytes); // return bytes; // } // // public static byte[] generateKeyDigest(int keyLength, String password) { // try { // MessageDigest digester = MessageDigest.getInstance("MD5"); // int length = (keyLength + 15) / 16 * 16; // byte[] passwordBytes = password.getBytes("UTF-8"); // byte[] temp = digester.digest(passwordBytes); // byte[] key = Arrays.copyOf(temp, length); // for (int i = 1; i < length / 16; i++) { // temp = Arrays.copyOf(temp, 16 + passwordBytes.length); // System.arraycopy(passwordBytes, 0, temp, 16, passwordBytes.length); // System.arraycopy(digester.digest(temp), 0, key, i * 16, 16); // } // return Arrays.copyOf(key, keyLength); // } catch (NoSuchAlgorithmException | UnsupportedEncodingException e) { // e.printStackTrace(); // } // return new byte[keyLength]; // } // // public static byte[] getCompressedBytes(int value) { // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (bytes[0] == 0 && bytes[1] == 0 && bytes[2] == 0) // return Arrays.copyOfRange(bytes, 3, 4); // if (bytes[0] == 0 && bytes[1] == 0) // return Arrays.copyOfRange(bytes, 2, 4); // if (bytes[0] == 0) // return Arrays.copyOfRange(bytes, 1, 4); // return bytes; // } // // public static byte[] getBytes(int length, int value) { // if (length < 1 || length > 4) // throw new RuntimeException("bad length"); // byte[] bytes = new byte[4]; // bytes[0] = (byte) ((value >> 24) & 0xff); // bytes[1] = (byte) ((value >> 16) & 0xff); // bytes[2] = (byte) ((value >> 8) & 0xff); // bytes[3] = (byte) (value & 0xff); // if (length == 4) // return bytes; // else // return Arrays.copyOfRange(bytes, 4 - length, 4); // } // // public static byte[] getBytes(int value) { // return getBytes(4, value); // } // // public static int toBigEndianInteger(byte[] bytes) { // byte[] value = new byte[4]; // System.arraycopy(bytes, 0, value, 4 - bytes.length, bytes.length); // return (value[0] & 0xff) << 24 | (value[1] & 0xff) << 16 // | (value[2] & 0xff) << 8 | (value[3] & 0xff); // } // // public int getRandomIdentifier(int length) { // int base = (int) Math.pow(10, length - 1); // return randomizer.nextInt(base * 9) + base; // } // } // Path: src/main/java/cc/agentx/wrapper/RandomPaddingWrapper.java import cc.agentx.util.KeyHelper; import java.util.Arrays; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.wrapper; public class RandomPaddingWrapper extends PaddingWrapper { public RandomPaddingWrapper(int paddingThreshold, int paddingRange) { super(paddingThreshold, paddingRange); if (paddingThreshold + paddingRange < 0xFF - 1) headerLength = 1; else if (paddingThreshold + paddingRange < 0xFFFF - 2) headerLength = 2; else if (paddingThreshold + paddingRange < 0xFFFFFF - 3) headerLength = 3; } @Override public byte[] wrap(byte[] bytes) { if (bytes.length < paddingThreshold + paddingRange) {
int randomLength = KeyHelper.generateRandomInteger(
ZhangJiupeng/AgentX
src/main/java/cc/agentx/server/Main.java
// Path: src/main/java/cc/agentx/server/net/nio/XServer.java // public final class XServer { // private static final InternalLogger log = InternalLoggerFactory.getInstance(XServer.class); // // private XServer() { // } // // public static XServer getInstance() { // return new XServer(); // } // // public void start() { // Configuration config = Configuration.INSTANCE; // InternalLoggerFactory.setDefaultFactory(Slf4JLoggerFactory.INSTANCE); // EventLoopGroup bossGroup = new NioEventLoopGroup(1); // EventLoopGroup workerGroup = new NioEventLoopGroup(); // try { // ServerBootstrap bootstrap = new ServerBootstrap(); // bootstrap.group(bossGroup, workerGroup) // .channel(NioServerSocketChannel.class) // .childHandler(new ChannelInitializer<SocketChannel>() { // protected void initChannel(SocketChannel socketChannel) throws Exception { // socketChannel.pipeline() // .addLast("logging", new LoggingHandler(LogLevel.DEBUG)) // .addLast(new XConnectHandler()); // if (config.getReadLimit() != 0 || config.getWriteLimit() != 0) { // socketChannel.pipeline().addLast( // new GlobalTrafficShapingHandler(Executors.newScheduledThreadPool(1), config.getWriteLimit(), config.getReadLimit()) // ); // } // } // }); // log.info("\tStartup {}-{}-server [{}]", Constants.APP_NAME, Constants.APP_VERSION, config.getProtocol()); // new Thread(() -> new UdpServer().start()).start(); // ChannelFuture future = bootstrap.bind(config.getHost(), config.getPort()).sync(); // future.addListener(future1 -> log.info("\tTCP listening at {}:{}...", config.getHost(), config.getPort())); // future.channel().closeFuture().sync(); // } catch (Exception e) { // log.error("\tSocket bind failure ({})", e.getMessage()); // } finally { // log.info("\tShutting down and recycling..."); // bossGroup.shutdownGracefully(); // workerGroup.shutdownGracefully(); // Configuration.shutdownRelays(); // } // System.exit(0); // } // }
import cc.agentx.server.net.nio.XServer; import org.slf4j.Logger; import org.slf4j.LoggerFactory;
/* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server; public class Main { private static final Logger log = LoggerFactory.getLogger(Main.class); public static void init() { try { Configuration.init(); } catch (Exception e) { log.error("\tInitialization failed ({})", e.getMessage()); System.exit(-1); } } public static void main(String[] args) { Main.init();
// Path: src/main/java/cc/agentx/server/net/nio/XServer.java // public final class XServer { // private static final InternalLogger log = InternalLoggerFactory.getInstance(XServer.class); // // private XServer() { // } // // public static XServer getInstance() { // return new XServer(); // } // // public void start() { // Configuration config = Configuration.INSTANCE; // InternalLoggerFactory.setDefaultFactory(Slf4JLoggerFactory.INSTANCE); // EventLoopGroup bossGroup = new NioEventLoopGroup(1); // EventLoopGroup workerGroup = new NioEventLoopGroup(); // try { // ServerBootstrap bootstrap = new ServerBootstrap(); // bootstrap.group(bossGroup, workerGroup) // .channel(NioServerSocketChannel.class) // .childHandler(new ChannelInitializer<SocketChannel>() { // protected void initChannel(SocketChannel socketChannel) throws Exception { // socketChannel.pipeline() // .addLast("logging", new LoggingHandler(LogLevel.DEBUG)) // .addLast(new XConnectHandler()); // if (config.getReadLimit() != 0 || config.getWriteLimit() != 0) { // socketChannel.pipeline().addLast( // new GlobalTrafficShapingHandler(Executors.newScheduledThreadPool(1), config.getWriteLimit(), config.getReadLimit()) // ); // } // } // }); // log.info("\tStartup {}-{}-server [{}]", Constants.APP_NAME, Constants.APP_VERSION, config.getProtocol()); // new Thread(() -> new UdpServer().start()).start(); // ChannelFuture future = bootstrap.bind(config.getHost(), config.getPort()).sync(); // future.addListener(future1 -> log.info("\tTCP listening at {}:{}...", config.getHost(), config.getPort())); // future.channel().closeFuture().sync(); // } catch (Exception e) { // log.error("\tSocket bind failure ({})", e.getMessage()); // } finally { // log.info("\tShutting down and recycling..."); // bossGroup.shutdownGracefully(); // workerGroup.shutdownGracefully(); // Configuration.shutdownRelays(); // } // System.exit(0); // } // } // Path: src/main/java/cc/agentx/server/Main.java import cc.agentx.server.net.nio.XServer; import org.slf4j.Logger; import org.slf4j.LoggerFactory; /* * Copyright 2017 ZhangJiupeng * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package cc.agentx.server; public class Main { private static final Logger log = LoggerFactory.getLogger(Main.class); public static void init() { try { Configuration.init(); } catch (Exception e) { log.error("\tInitialization failed ({})", e.getMessage()); System.exit(-1); } } public static void main(String[] args) { Main.init();
XServer.getInstance().start();
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/CalculatorSettings.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum Panel { // GRAPH, FUNCTION, HEX, BASIC, ADVANCED, MATRIX; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // }
import android.content.Context; import android.preference.PreferenceManager; import com.gigabytedevelopersinc.app.calculator.Calculator.Panel;
package com.gigabytedevelopersinc.app.calculator; public class CalculatorSettings { static boolean graphPanel(Context context) {
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum Panel { // GRAPH, FUNCTION, HEX, BASIC, ADVANCED, MATRIX; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/CalculatorSettings.java import android.content.Context; import android.preference.PreferenceManager; import com.gigabytedevelopersinc.app.calculator.Calculator.Panel; package com.gigabytedevelopersinc.app.calculator; public class CalculatorSettings { static boolean graphPanel(Context context) {
return PreferenceManager.getDefaultSharedPreferences(context).getBoolean(Panel.GRAPH.toString(), context.getResources().getBoolean(R.bool.GRAPH));
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/Persist.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/BaseModule.java // public enum Mode { // BINARY(0), DECIMAL(1), HEXADECIMAL(2); // // int quickSerializable; // // Mode(int num) { // this.quickSerializable = num; // } // // public int getQuickSerializable() { // return quickSerializable; // } // }
import java.io.BufferedInputStream; import java.io.BufferedOutputStream; import java.io.DataInputStream; import java.io.DataOutputStream; import java.io.FileNotFoundException; import java.io.IOException; import java.io.InputStream; import java.io.OutputStream; import android.content.Context; import com.gigabytedevelopersinc.app.calculator.BaseModule.Mode;
package com.gigabytedevelopersinc.app.calculator; class Persist { private static final int LAST_VERSION = 3; private static final String FILE_NAME = "calculator.data"; private Context mContext; History history = new History(); private int mDeleteMode;
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/BaseModule.java // public enum Mode { // BINARY(0), DECIMAL(1), HEXADECIMAL(2); // // int quickSerializable; // // Mode(int num) { // this.quickSerializable = num; // } // // public int getQuickSerializable() { // return quickSerializable; // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Persist.java import java.io.BufferedInputStream; import java.io.BufferedOutputStream; import java.io.DataInputStream; import java.io.DataOutputStream; import java.io.FileNotFoundException; import java.io.IOException; import java.io.InputStream; import java.io.OutputStream; import android.content.Context; import com.gigabytedevelopersinc.app.calculator.BaseModule.Mode; package com.gigabytedevelopersinc.app.calculator; class Persist { private static final int LAST_VERSION = 3; private static final String FILE_NAME = "calculator.data"; private Context mContext; History history = new History(); private int mDeleteMode;
private Mode mode;
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/HistoryAdapter.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/HistoryLine.java // public class HistoryLine extends LinearLayout { // private static final int COPY = 0; // private static final int COPY_BASE = 1; // private static final int COPY_EDITED = 2; // private static final int REMOVE = 3; // private String[] mMenuItemsStrings; // private HistoryEntry mHistoryEntry; // private History mHistory; // private BaseAdapter mAdapter; // // public HistoryLine(Context context, AttributeSet attrs) { // super(context, attrs); // } // // @Override // public void onCreateContextMenu(ContextMenu menu) { // MenuHandler handler = new MenuHandler(); // if(mMenuItemsStrings == null) { // Resources resources = getResources(); // mMenuItemsStrings = new String[4]; // mMenuItemsStrings[COPY] = String.format(resources.getString(R.string.copy), mHistoryEntry.getBase() + "=" + mHistoryEntry.getEdited()); // mMenuItemsStrings[COPY_BASE] = String.format(resources.getString(R.string.copy), mHistoryEntry.getBase()); // mMenuItemsStrings[COPY_EDITED] = String.format(resources.getString(R.string.copy), mHistoryEntry.getEdited()); // mMenuItemsStrings[REMOVE] = resources.getString(R.string.remove_from_history); // } // for(int i = 0; i < mMenuItemsStrings.length; i++) { // menu.add(Menu.NONE, i, i, mMenuItemsStrings[i]).setOnMenuItemClickListener(handler); // } // } // // private class MenuHandler implements MenuItem.OnMenuItemClickListener { // public boolean onMenuItemClick(MenuItem item) { // return onTextContextMenuItem(item.getTitle()); // } // } // // public boolean onTextContextMenuItem(CharSequence title) { // boolean handled = false; // if(TextUtils.equals(title, mMenuItemsStrings[COPY])) { // copyContent(mHistoryEntry.getBase() + "=" + mHistoryEntry.getEdited()); // handled = true; // } // else if(TextUtils.equals(title, mMenuItemsStrings[COPY_BASE])) { // copyContent(mHistoryEntry.getBase()); // handled = true; // } // else if(TextUtils.equals(title, mMenuItemsStrings[COPY_EDITED])) { // copyContent(mHistoryEntry.getEdited()); // handled = true; // } // else if(TextUtils.equals(title, mMenuItemsStrings[REMOVE])) { // removeContent(); // handled = true; // } // return handled; // } // // public void copyContent(String content) { // ClipboardManager clipboard = (ClipboardManager) getContext().getSystemService(Context.CLIPBOARD_SERVICE); // clipboard.setPrimaryClip(ClipData.newPlainText(null, content)); // String toastText = String.format(getResources().getString(R.string.text_copied_toast), content); // Toast.makeText(getContext(), toastText, Toast.LENGTH_SHORT).show(); // } // // private void removeContent() { // mHistory.remove(mHistoryEntry); // mAdapter.notifyDataSetChanged(); // } // // public HistoryEntry getHistoryEntry() { // return mHistoryEntry; // } // // public void setHistoryEntry(HistoryEntry historyEntry) { // this.mHistoryEntry = historyEntry; // } // // public History getHistory() { // return mHistory; // } // // public void setHistory(History history) { // this.mHistory = history; // } // // public BaseAdapter getAdapter() { // return mAdapter; // } // // public void setAdapter(BaseAdapter adapter) { // this.mAdapter = adapter; // } // // public void showMenu() { // showContextMenu(); // } // }
import java.util.Vector; import android.content.Context; import android.text.Html; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import android.widget.BaseAdapter; import android.widget.TextView; import com.gigabytedevelopersinc.app.calculator.view.HistoryLine;
package com.gigabytedevelopersinc.app.calculator; class HistoryAdapter extends BaseAdapter { private final Vector<HistoryEntry> mEntries; private final LayoutInflater mInflater; private final EquationFormatter mEquationFormatter; private final History mHistory; HistoryAdapter(Context context, History history) { mEntries = history.mEntries; mInflater = (LayoutInflater) context.getSystemService(Context.LAYOUT_INFLATER_SERVICE); mEquationFormatter = new EquationFormatter(); mHistory = history; } @Override public int getCount() { return mEntries.size() - 1; } @Override public Object getItem(int position) { return mEntries.elementAt(position); } @Override public long getItemId(int position) { return position; } @Override public boolean hasStableIds() { return true; } @Override public View getView(int position, View convertView, ViewGroup parent) {
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/HistoryLine.java // public class HistoryLine extends LinearLayout { // private static final int COPY = 0; // private static final int COPY_BASE = 1; // private static final int COPY_EDITED = 2; // private static final int REMOVE = 3; // private String[] mMenuItemsStrings; // private HistoryEntry mHistoryEntry; // private History mHistory; // private BaseAdapter mAdapter; // // public HistoryLine(Context context, AttributeSet attrs) { // super(context, attrs); // } // // @Override // public void onCreateContextMenu(ContextMenu menu) { // MenuHandler handler = new MenuHandler(); // if(mMenuItemsStrings == null) { // Resources resources = getResources(); // mMenuItemsStrings = new String[4]; // mMenuItemsStrings[COPY] = String.format(resources.getString(R.string.copy), mHistoryEntry.getBase() + "=" + mHistoryEntry.getEdited()); // mMenuItemsStrings[COPY_BASE] = String.format(resources.getString(R.string.copy), mHistoryEntry.getBase()); // mMenuItemsStrings[COPY_EDITED] = String.format(resources.getString(R.string.copy), mHistoryEntry.getEdited()); // mMenuItemsStrings[REMOVE] = resources.getString(R.string.remove_from_history); // } // for(int i = 0; i < mMenuItemsStrings.length; i++) { // menu.add(Menu.NONE, i, i, mMenuItemsStrings[i]).setOnMenuItemClickListener(handler); // } // } // // private class MenuHandler implements MenuItem.OnMenuItemClickListener { // public boolean onMenuItemClick(MenuItem item) { // return onTextContextMenuItem(item.getTitle()); // } // } // // public boolean onTextContextMenuItem(CharSequence title) { // boolean handled = false; // if(TextUtils.equals(title, mMenuItemsStrings[COPY])) { // copyContent(mHistoryEntry.getBase() + "=" + mHistoryEntry.getEdited()); // handled = true; // } // else if(TextUtils.equals(title, mMenuItemsStrings[COPY_BASE])) { // copyContent(mHistoryEntry.getBase()); // handled = true; // } // else if(TextUtils.equals(title, mMenuItemsStrings[COPY_EDITED])) { // copyContent(mHistoryEntry.getEdited()); // handled = true; // } // else if(TextUtils.equals(title, mMenuItemsStrings[REMOVE])) { // removeContent(); // handled = true; // } // return handled; // } // // public void copyContent(String content) { // ClipboardManager clipboard = (ClipboardManager) getContext().getSystemService(Context.CLIPBOARD_SERVICE); // clipboard.setPrimaryClip(ClipData.newPlainText(null, content)); // String toastText = String.format(getResources().getString(R.string.text_copied_toast), content); // Toast.makeText(getContext(), toastText, Toast.LENGTH_SHORT).show(); // } // // private void removeContent() { // mHistory.remove(mHistoryEntry); // mAdapter.notifyDataSetChanged(); // } // // public HistoryEntry getHistoryEntry() { // return mHistoryEntry; // } // // public void setHistoryEntry(HistoryEntry historyEntry) { // this.mHistoryEntry = historyEntry; // } // // public History getHistory() { // return mHistory; // } // // public void setHistory(History history) { // this.mHistory = history; // } // // public BaseAdapter getAdapter() { // return mAdapter; // } // // public void setAdapter(BaseAdapter adapter) { // this.mAdapter = adapter; // } // // public void showMenu() { // showContextMenu(); // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/HistoryAdapter.java import java.util.Vector; import android.content.Context; import android.text.Html; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import android.widget.BaseAdapter; import android.widget.TextView; import com.gigabytedevelopersinc.app.calculator.view.HistoryLine; package com.gigabytedevelopersinc.app.calculator; class HistoryAdapter extends BaseAdapter { private final Vector<HistoryEntry> mEntries; private final LayoutInflater mInflater; private final EquationFormatter mEquationFormatter; private final History mHistory; HistoryAdapter(Context context, History history) { mEntries = history.mEntries; mInflater = (LayoutInflater) context.getSystemService(Context.LAYOUT_INFLATER_SERVICE); mEquationFormatter = new EquationFormatter(); mHistory = history; } @Override public int getCount() { return mEntries.size() - 1; } @Override public Object getItem(int position) { return mEntries.elementAt(position); } @Override public long getItemId(int position) { return position; } @Override public boolean hasStableIds() { return true; } @Override public View getView(int position, View convertView, ViewGroup parent) {
HistoryLine view;
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/About.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/AboutFragment.java // public class AboutFragment extends PreferenceFragment { // @Override // public void onCreate(Bundle savedInstanceState) { // super.onCreate(savedInstanceState); // addPreferencesFromResource(R.layout.about); // Preference about = findPreference("ABOUT"); // if(about != null) { // String versionName = ""; // try { // versionName = getActivity().getPackageManager().getPackageInfo(getActivity().getPackageName(), 0).versionName; // } // catch(NameNotFoundException e) { // e.printStackTrace(); // } // about.setTitle(about.getTitle() + " " + versionName); // } // } // }
import android.app.Activity; import android.content.Intent; import android.net.Uri; import android.os.Bundle; import android.view.MenuItem; import android.view.View; import com.google.android.gms.ads.AdListener; import com.google.android.gms.ads.AdRequest; import com.google.android.gms.ads.InterstitialAd; import com.gigabytedevelopersinc.app.calculator.view.AboutFragment;
package com.gigabytedevelopersinc.app.calculator; /** * @author Emmanuel Nwokoma (Founder and CEO of Gigabyte Developers INC) **/ public class About extends Activity { //Create New Variable of type InterstitialAd private InterstitialAd mInterstitialAd; @Override protected void onCreate(Bundle savedInstanceState) { if (getActionBar() != null) { getActionBar().setDisplayHomeAsUpEnabled(true); } super.onCreate(savedInstanceState); if(savedInstanceState == null) {
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/AboutFragment.java // public class AboutFragment extends PreferenceFragment { // @Override // public void onCreate(Bundle savedInstanceState) { // super.onCreate(savedInstanceState); // addPreferencesFromResource(R.layout.about); // Preference about = findPreference("ABOUT"); // if(about != null) { // String versionName = ""; // try { // versionName = getActivity().getPackageManager().getPackageInfo(getActivity().getPackageName(), 0).versionName; // } // catch(NameNotFoundException e) { // e.printStackTrace(); // } // about.setTitle(about.getTitle() + " " + versionName); // } // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/About.java import android.app.Activity; import android.content.Intent; import android.net.Uri; import android.os.Bundle; import android.view.MenuItem; import android.view.View; import com.google.android.gms.ads.AdListener; import com.google.android.gms.ads.AdRequest; import com.google.android.gms.ads.InterstitialAd; import com.gigabytedevelopersinc.app.calculator.view.AboutFragment; package com.gigabytedevelopersinc.app.calculator; /** * @author Emmanuel Nwokoma (Founder and CEO of Gigabyte Developers INC) **/ public class About extends Activity { //Create New Variable of type InterstitialAd private InterstitialAd mInterstitialAd; @Override protected void onCreate(Bundle savedInstanceState) { if (getActionBar() != null) { getActionBar().setDisplayHomeAsUpEnabled(true); } super.onCreate(savedInstanceState); if(savedInstanceState == null) {
AboutFragment about = new AboutFragment();
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/Preferences.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/PreferencesFragment.java // public class PreferencesFragment extends PreferenceFragment { // // //Create New Variable of type InterstitialAd // private InterstitialAd mInterstitialAd; // // @Override // public void onCreate(Bundle savedInstanceState) { // super.onCreate(savedInstanceState); // addPreferencesFromResource(R.layout.preferences); // Preference about = findPreference("ABOUT"); // // // Prepare the interstitial Ad // mInterstitialAd = new InterstitialAd(getActivity()); // // Insert the Ad Unit ID // mInterstitialAd.setAdUnitId(getString(R.string.interstitial_ads)); // AdRequest adRequest = new AdRequest.Builder() // .addTestDevice(AdRequest.DEVICE_ID_EMULATOR) // .build(); // // Load requested Ad // mInterstitialAd.loadAd(adRequest); // // if(about != null) { // String versionName = ""; // try { // versionName = getActivity().getPackageManager().getPackageInfo(getActivity().getPackageName(), 0).versionName; // } // catch(NameNotFoundException e) { // e.printStackTrace(); // } // about.setTitle(about.getTitle() + " " + versionName); // about.setOnPreferenceClickListener(new Preference.OnPreferenceClickListener() { // @Override // public boolean onPreferenceClick(Preference preference) { // if (mInterstitialAd.isLoaded()) { // mInterstitialAd.show(); // mInterstitialAd.setAdListener(new AdListener() { // public void onAdClosed() { // AdRequest adRequest = new AdRequest.Builder() // .addTestDevice(AdRequest.DEVICE_ID_EMULATOR) // .build(); // mInterstitialAd.loadAd(adRequest); // Intent github = new Intent(Intent.ACTION_VIEW, Uri.parse("https://github.com/gigabytedevelopers/CalcMate")); // startActivity(github); // // } // }); // } else { // Intent github = new Intent(Intent.ACTION_VIEW, Uri.parse("https://github.com/gigabytedevelopers/CalcMate")); // startActivity(github); // } // return false; // } // }); // } // } // }
import android.app.Activity; import android.os.Bundle; import android.view.MenuItem; import com.gigabytedevelopersinc.app.calculator.view.PreferencesFragment;
package com.gigabytedevelopersinc.app.calculator; /** * @author Emmanuel Nwokoma (Founder and CEO of Gigabyte Developers INC) **/ public class Preferences extends Activity { @Override protected void onCreate(Bundle savedInstanceState) { if (getActionBar() != null) { getActionBar().setDisplayHomeAsUpEnabled(true); } super.onCreate(savedInstanceState); if(savedInstanceState == null) {
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/PreferencesFragment.java // public class PreferencesFragment extends PreferenceFragment { // // //Create New Variable of type InterstitialAd // private InterstitialAd mInterstitialAd; // // @Override // public void onCreate(Bundle savedInstanceState) { // super.onCreate(savedInstanceState); // addPreferencesFromResource(R.layout.preferences); // Preference about = findPreference("ABOUT"); // // // Prepare the interstitial Ad // mInterstitialAd = new InterstitialAd(getActivity()); // // Insert the Ad Unit ID // mInterstitialAd.setAdUnitId(getString(R.string.interstitial_ads)); // AdRequest adRequest = new AdRequest.Builder() // .addTestDevice(AdRequest.DEVICE_ID_EMULATOR) // .build(); // // Load requested Ad // mInterstitialAd.loadAd(adRequest); // // if(about != null) { // String versionName = ""; // try { // versionName = getActivity().getPackageManager().getPackageInfo(getActivity().getPackageName(), 0).versionName; // } // catch(NameNotFoundException e) { // e.printStackTrace(); // } // about.setTitle(about.getTitle() + " " + versionName); // about.setOnPreferenceClickListener(new Preference.OnPreferenceClickListener() { // @Override // public boolean onPreferenceClick(Preference preference) { // if (mInterstitialAd.isLoaded()) { // mInterstitialAd.show(); // mInterstitialAd.setAdListener(new AdListener() { // public void onAdClosed() { // AdRequest adRequest = new AdRequest.Builder() // .addTestDevice(AdRequest.DEVICE_ID_EMULATOR) // .build(); // mInterstitialAd.loadAd(adRequest); // Intent github = new Intent(Intent.ACTION_VIEW, Uri.parse("https://github.com/gigabytedevelopers/CalcMate")); // startActivity(github); // // } // }); // } else { // Intent github = new Intent(Intent.ACTION_VIEW, Uri.parse("https://github.com/gigabytedevelopers/CalcMate")); // startActivity(github); // } // return false; // } // }); // } // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Preferences.java import android.app.Activity; import android.os.Bundle; import android.view.MenuItem; import com.gigabytedevelopersinc.app.calculator.view.PreferencesFragment; package com.gigabytedevelopersinc.app.calculator; /** * @author Emmanuel Nwokoma (Founder and CEO of Gigabyte Developers INC) **/ public class Preferences extends Activity { @Override protected void onCreate(Bundle savedInstanceState) { if (getActionBar() != null) { getActionBar().setDisplayHomeAsUpEnabled(true); } super.onCreate(savedInstanceState); if(savedInstanceState == null) {
PreferencesFragment preferences = new PreferencesFragment();
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/LargePageAdapter.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum LargePanel { // GRAPH, BASIC, MATRIX; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // }
import org.achartengine.GraphicalView; import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.view.ViewGroup.LayoutParams; import android.widget.LinearLayout; import com.gigabytedevelopersinc.app.calculator.Calculator.LargePanel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager;
package com.gigabytedevelopersinc.app.calculator; public class LargePageAdapter extends PagerAdapter { private View mGraphPage; private View mSimplePage; View mMatrixPage;
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum LargePanel { // GRAPH, BASIC, MATRIX; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/LargePageAdapter.java import org.achartengine.GraphicalView; import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.view.ViewGroup.LayoutParams; import android.widget.LinearLayout; import com.gigabytedevelopersinc.app.calculator.Calculator.LargePanel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager; package com.gigabytedevelopersinc.app.calculator; public class LargePageAdapter extends PagerAdapter { private View mGraphPage; private View mSimplePage; View mMatrixPage;
private CalculatorViewPager mParent;
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/LargePageAdapter.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum LargePanel { // GRAPH, BASIC, MATRIX; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // }
import org.achartengine.GraphicalView; import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.view.ViewGroup.LayoutParams; import android.widget.LinearLayout; import com.gigabytedevelopersinc.app.calculator.Calculator.LargePanel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager;
setOrder(); switch(mLogic.mBaseModule.getMode()) { case BINARY: for(int i : mLogic.mBaseModule.bannedResourceInBinary) { View v = mSimplePage.findViewById(i); if(v != null) v.setEnabled(false); } break; case DECIMAL: for(int i : mLogic.mBaseModule.bannedResourceInDecimal) { View v = mSimplePage.findViewById(i); if(v != null) v.setEnabled(false); } break; case HEXADECIMAL: break; } } @Override public int getCount() { return count; } @Override public void startUpdate(View container) {} @Override public Object instantiateItem(View container, int position) {
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum LargePanel { // GRAPH, BASIC, MATRIX; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/LargePageAdapter.java import org.achartengine.GraphicalView; import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.view.ViewGroup.LayoutParams; import android.widget.LinearLayout; import com.gigabytedevelopersinc.app.calculator.Calculator.LargePanel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager; setOrder(); switch(mLogic.mBaseModule.getMode()) { case BINARY: for(int i : mLogic.mBaseModule.bannedResourceInBinary) { View v = mSimplePage.findViewById(i); if(v != null) v.setEnabled(false); } break; case DECIMAL: for(int i : mLogic.mBaseModule.bannedResourceInDecimal) { View v = mSimplePage.findViewById(i); if(v != null) v.setEnabled(false); } break; case HEXADECIMAL: break; } } @Override public int getCount() { return count; } @Override public void startUpdate(View container) {} @Override public Object instantiateItem(View container, int position) {
if(position == LargePanel.GRAPH.getOrder() && CalculatorSettings.graphPanel(mParent.getContext())) {
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/Help.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/HelpFragment.java // public class HelpFragment extends PreferenceFragment { // @Override // public void onCreate(Bundle savedInstanceState) { // super.onCreate(savedInstanceState); // addPreferencesFromResource(R.layout.help); // Preference about = findPreference("ABOUT"); // if(about != null) { // String versionName = ""; // try { // versionName = getActivity().getPackageManager().getPackageInfo(getActivity().getPackageName(), 0).versionName; // } // catch(NameNotFoundException e) { // e.printStackTrace(); // } // about.setTitle(about.getTitle() + " " + versionName); // } // } // }
import android.app.Activity; import android.os.Bundle; import android.view.MenuItem; import com.gigabytedevelopersinc.app.calculator.view.HelpFragment;
package com.gigabytedevelopersinc.app.calculator; /** * @author Emmanuel Nwokoma (Founder and CEO of Gigabyte Developers INC) **/ public class Help extends Activity { @Override protected void onCreate(Bundle savedInstanceState) { if (getActionBar() != null) { getActionBar().setDisplayHomeAsUpEnabled(true); } super.onCreate(savedInstanceState); if(savedInstanceState == null) {
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/HelpFragment.java // public class HelpFragment extends PreferenceFragment { // @Override // public void onCreate(Bundle savedInstanceState) { // super.onCreate(savedInstanceState); // addPreferencesFromResource(R.layout.help); // Preference about = findPreference("ABOUT"); // if(about != null) { // String versionName = ""; // try { // versionName = getActivity().getPackageManager().getPackageInfo(getActivity().getPackageName(), 0).versionName; // } // catch(NameNotFoundException e) { // e.printStackTrace(); // } // about.setTitle(about.getTitle() + " " + versionName); // } // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Help.java import android.app.Activity; import android.os.Bundle; import android.view.MenuItem; import com.gigabytedevelopersinc.app.calculator.view.HelpFragment; package com.gigabytedevelopersinc.app.calculator; /** * @author Emmanuel Nwokoma (Founder and CEO of Gigabyte Developers INC) **/ public class Help extends Activity { @Override protected void onCreate(Bundle savedInstanceState) { if (getActionBar() != null) { getActionBar().setDisplayHomeAsUpEnabled(true); } super.onCreate(savedInstanceState); if(savedInstanceState == null) {
HelpFragment help = new HelpFragment();
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/CalculatorWidget.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/BaseModule.java // public enum Mode { // BINARY(0), DECIMAL(1), HEXADECIMAL(2); // // int quickSerializable; // // Mode(int num) { // this.quickSerializable = num; // } // // public int getQuickSerializable() { // return quickSerializable; // } // }
import org.javia.arity.SyntaxException; import android.app.PendingIntent; import android.appwidget.AppWidgetManager; import android.appwidget.AppWidgetProvider; import android.content.ComponentName; import android.content.Context; import android.content.Intent; import android.preference.PreferenceManager; import android.view.View; import android.widget.RemoteViews; import com.gigabytedevelopersinc.app.calculator.BaseModule.Mode;
else if(intent.getAction().equals(DIV)) { value += context.getResources().getString(R.string.div); } else if(intent.getAction().equals(MUL)) { value += context.getResources().getString(R.string.mul); } else if(intent.getAction().equals(MINUS)) { value += context.getResources().getString(R.string.minus); } else if(intent.getAction().equals(PLUS)) { value += context.getResources().getString(R.string.plus); } else if(intent.getAction().equals(EQUALS)) { final String input = value; if(input.isEmpty()) return; final Logic mLogic = new Logic(context, null, null); mLogic.setLineLength(7); try { value = mLogic.evaluate(input); } catch(SyntaxException e) { value = context.getResources().getString(R.string.error); } // Try to save it to history if(!value.equals(context.getResources().getString(R.string.error))) { final Persist persist = new Persist(context); persist.load();
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/BaseModule.java // public enum Mode { // BINARY(0), DECIMAL(1), HEXADECIMAL(2); // // int quickSerializable; // // Mode(int num) { // this.quickSerializable = num; // } // // public int getQuickSerializable() { // return quickSerializable; // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/CalculatorWidget.java import org.javia.arity.SyntaxException; import android.app.PendingIntent; import android.appwidget.AppWidgetManager; import android.appwidget.AppWidgetProvider; import android.content.ComponentName; import android.content.Context; import android.content.Intent; import android.preference.PreferenceManager; import android.view.View; import android.widget.RemoteViews; import com.gigabytedevelopersinc.app.calculator.BaseModule.Mode; else if(intent.getAction().equals(DIV)) { value += context.getResources().getString(R.string.div); } else if(intent.getAction().equals(MUL)) { value += context.getResources().getString(R.string.mul); } else if(intent.getAction().equals(MINUS)) { value += context.getResources().getString(R.string.minus); } else if(intent.getAction().equals(PLUS)) { value += context.getResources().getString(R.string.plus); } else if(intent.getAction().equals(EQUALS)) { final String input = value; if(input.isEmpty()) return; final Logic mLogic = new Logic(context, null, null); mLogic.setLineLength(7); try { value = mLogic.evaluate(input); } catch(SyntaxException e) { value = context.getResources().getString(R.string.error); } // Try to save it to history if(!value.equals(context.getResources().getString(R.string.error))) { final Persist persist = new Persist(context); persist.load();
if(persist.getMode() == null) persist.setMode(Mode.DECIMAL);
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/PageAdapter.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum Panel { // GRAPH, FUNCTION, HEX, BASIC, ADVANCED, MATRIX; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // }
import org.achartengine.GraphicalView; import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.view.ViewGroup.LayoutParams; import android.widget.LinearLayout; import com.gigabytedevelopersinc.app.calculator.Calculator.Panel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager;
package com.gigabytedevelopersinc.app.calculator; public class PageAdapter extends PagerAdapter { private View mGraphPage; private View mFunctionPage; private View mSimplePage; private View mAdvancedPage; private View mHexPage; View mMatrixPage;
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum Panel { // GRAPH, FUNCTION, HEX, BASIC, ADVANCED, MATRIX; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/PageAdapter.java import org.achartengine.GraphicalView; import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.view.ViewGroup.LayoutParams; import android.widget.LinearLayout; import com.gigabytedevelopersinc.app.calculator.Calculator.Panel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager; package com.gigabytedevelopersinc.app.calculator; public class PageAdapter extends PagerAdapter { private View mGraphPage; private View mFunctionPage; private View mSimplePage; private View mAdvancedPage; private View mHexPage; View mMatrixPage;
private CalculatorViewPager mParent;
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/PageAdapter.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum Panel { // GRAPH, FUNCTION, HEX, BASIC, ADVANCED, MATRIX; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // }
import org.achartengine.GraphicalView; import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.view.ViewGroup.LayoutParams; import android.widget.LinearLayout; import com.gigabytedevelopersinc.app.calculator.Calculator.Panel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager;
case DECIMAL: mHexPage.findViewById(R.id.dec).setBackgroundResource(R.color.pressed_color); for(int i : mLogic.mBaseModule.bannedResourceInDecimal) { View v = mSimplePage.findViewById(i); if(v == null) v = mHexPage.findViewById(i); v.setEnabled(false); } break; case HEXADECIMAL: mHexPage.findViewById(R.id.hex).setBackgroundResource(R.color.pressed_color); break; } View easterEgg = mMatrixPage.findViewById(R.id.easter); if(easterEgg != null) { easterEgg.setOnClickListener(listener); easterEgg.setOnLongClickListener(listener); } } @Override public int getCount() { return count; } @Override public void startUpdate(View container) {} @Override public Object instantiateItem(View container, int position) {
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum Panel { // GRAPH, FUNCTION, HEX, BASIC, ADVANCED, MATRIX; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/PageAdapter.java import org.achartengine.GraphicalView; import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.view.ViewGroup.LayoutParams; import android.widget.LinearLayout; import com.gigabytedevelopersinc.app.calculator.Calculator.Panel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager; case DECIMAL: mHexPage.findViewById(R.id.dec).setBackgroundResource(R.color.pressed_color); for(int i : mLogic.mBaseModule.bannedResourceInDecimal) { View v = mSimplePage.findViewById(i); if(v == null) v = mHexPage.findViewById(i); v.setEnabled(false); } break; case HEXADECIMAL: mHexPage.findViewById(R.id.hex).setBackgroundResource(R.color.pressed_color); break; } View easterEgg = mMatrixPage.findViewById(R.id.easter); if(easterEgg != null) { easterEgg.setOnClickListener(listener); easterEgg.setOnLongClickListener(listener); } } @Override public int getCount() { return count; } @Override public void startUpdate(View container) {} @Override public Object instantiateItem(View container, int position) {
if(position == Panel.GRAPH.getOrder() && CalculatorSettings.graphPanel(mParent.getContext())) {
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/ui/AdWrapper.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public static boolean isTelevision() { // return isTelevision; // }
import android.content.Context; import android.os.Parcelable; import android.util.AttributeSet; import android.view.LayoutInflater; import android.view.View; import android.widget.FrameLayout; import com.crashlytics.android.Crashlytics; import com.google.android.gms.ads.AdListener; import com.google.android.gms.ads.AdRequest; import com.google.android.gms.ads.AdView; import com.google.android.gms.ads.InterstitialAd; import com.gigabytedevelopersinc.app.calculator.R; import static com.gigabytedevelopersinc.app.calculator.Calculator.isTelevision;
package com.gigabytedevelopersinc.app.calculator.ui; /** * A Wrapper which wraps AdView along with loading the view aswell */ public class AdWrapper extends FrameLayout { private AdView mAdView; private InterstitialAd mInterstitialAd; private boolean showInterstiatial = true; public AdWrapper(Context context) { super(context); init(context); } public AdWrapper(Context context, AttributeSet attrs) { super(context, attrs); init(context); } public AdWrapper(Context context, AttributeSet attrs, int defStyle) { super(context, attrs, defStyle); init(context); } private void init(Context context) { //Ads
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public static boolean isTelevision() { // return isTelevision; // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/ui/AdWrapper.java import android.content.Context; import android.os.Parcelable; import android.util.AttributeSet; import android.view.LayoutInflater; import android.view.View; import android.widget.FrameLayout; import com.crashlytics.android.Crashlytics; import com.google.android.gms.ads.AdListener; import com.google.android.gms.ads.AdRequest; import com.google.android.gms.ads.AdView; import com.google.android.gms.ads.InterstitialAd; import com.gigabytedevelopersinc.app.calculator.R; import static com.gigabytedevelopersinc.app.calculator.Calculator.isTelevision; package com.gigabytedevelopersinc.app.calculator.ui; /** * A Wrapper which wraps AdView along with loading the view aswell */ public class AdWrapper extends FrameLayout { private AdView mAdView; private InterstitialAd mInterstitialAd; private boolean showInterstiatial = true; public AdWrapper(Context context) { super(context); init(context); } public AdWrapper(Context context, AttributeSet attrs) { super(context, attrs); init(context); } public AdWrapper(Context context, AttributeSet attrs, int defStyle) { super(context, attrs, defStyle); init(context); } private void init(Context context) { //Ads
if(!isTelevision()){
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/MatrixInverseView.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/MutableString.java // public class MutableString { // private String text; // // public MutableString() { // // } // // public MutableString(String text) { // this.text = text; // } // // public String getText() { // return text; // } // // public void setText(String text) { // this.text = text; // } // // public int length() { // return text.length(); // } // // public boolean isEmpty() { // return text.isEmpty(); // } // // public String substring(int start) { // return text.substring(start); // } // // public String substring(int start, int end) { // return text.substring(start, end); // } // // public CharSequence subSequence(int start, int end) { // return text.subSequence(start, end); // } // // public boolean startsWith(String prefix) { // return text.startsWith(prefix); // } // }
import android.content.Context; import android.support.v7.widget.AppCompatTextView; import android.text.Html; import android.text.InputType; import com.gigabytedevelopersinc.app.calculator.MutableString; import com.gigabytedevelopersinc.app.calculator.R;
package com.gigabytedevelopersinc.app.calculator.view; public class MatrixInverseView extends AppCompatTextView { private final static char PLACEHOLDER = '\uFEFF'; public final static String PATTERN = PLACEHOLDER + "^-1"; public MatrixInverseView(Context context) { super(context); } public MatrixInverseView(final AdvancedDisplay display) { super(display.getContext()); setInputType(InputType.TYPE_CLASS_TEXT | InputType.TYPE_TEXT_FLAG_NO_SUGGESTIONS); setText(Html.fromHtml("<sup><small>-1</small></sup>")); setTextAppearance(display.getContext(), R.style.display_style); setPadding(0, 0, 0, 0); } @Override public String toString() { return PATTERN; }
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/MutableString.java // public class MutableString { // private String text; // // public MutableString() { // // } // // public MutableString(String text) { // this.text = text; // } // // public String getText() { // return text; // } // // public void setText(String text) { // this.text = text; // } // // public int length() { // return text.length(); // } // // public boolean isEmpty() { // return text.isEmpty(); // } // // public String substring(int start) { // return text.substring(start); // } // // public String substring(int start, int end) { // return text.substring(start, end); // } // // public CharSequence subSequence(int start, int end) { // return text.subSequence(start, end); // } // // public boolean startsWith(String prefix) { // return text.startsWith(prefix); // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/MatrixInverseView.java import android.content.Context; import android.support.v7.widget.AppCompatTextView; import android.text.Html; import android.text.InputType; import com.gigabytedevelopersinc.app.calculator.MutableString; import com.gigabytedevelopersinc.app.calculator.R; package com.gigabytedevelopersinc.app.calculator.view; public class MatrixInverseView extends AppCompatTextView { private final static char PLACEHOLDER = '\uFEFF'; public final static String PATTERN = PLACEHOLDER + "^-1"; public MatrixInverseView(Context context) { super(context); } public MatrixInverseView(final AdvancedDisplay display) { super(display.getContext()); setInputType(InputType.TYPE_CLASS_TEXT | InputType.TYPE_TEXT_FLAG_NO_SUGGESTIONS); setText(Html.fromHtml("<sup><small>-1</small></sup>")); setTextAppearance(display.getContext(), R.style.display_style); setPadding(0, 0, 0, 0); } @Override public String toString() { return PATTERN; }
public static boolean load(final MutableString text, final AdvancedDisplay parent) {
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/SmallPageAdapter.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum SmallPanel { // HEX, ADVANCED, FUNCTION; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // }
import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import com.gigabytedevelopersinc.app.calculator.Calculator.SmallPanel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager;
package com.gigabytedevelopersinc.app.calculator; public class SmallPageAdapter extends PagerAdapter { private View mHexPage; private View mFunctionPage; private View mAdvancedPage;
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum SmallPanel { // HEX, ADVANCED, FUNCTION; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/SmallPageAdapter.java import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import com.gigabytedevelopersinc.app.calculator.Calculator.SmallPanel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager; package com.gigabytedevelopersinc.app.calculator; public class SmallPageAdapter extends PagerAdapter { private View mHexPage; private View mFunctionPage; private View mAdvancedPage;
private CalculatorViewPager mParent;
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/SmallPageAdapter.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum SmallPanel { // HEX, ADVANCED, FUNCTION; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // }
import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import com.gigabytedevelopersinc.app.calculator.Calculator.SmallPanel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager;
case BINARY: mHexPage.findViewById(R.id.bin).setBackgroundResource(R.color.pressed_color); for(int i : mLogic.mBaseModule.bannedResourceInBinary) { View v = mHexPage.findViewById(i); if(v != null) v.setEnabled(false); } break; case DECIMAL: mHexPage.findViewById(R.id.dec).setBackgroundResource(R.color.pressed_color); for(int i : mLogic.mBaseModule.bannedResourceInDecimal) { View v = mHexPage.findViewById(i); if(v != null) v.setEnabled(false); } break; case HEXADECIMAL: mHexPage.findViewById(R.id.hex).setBackgroundResource(R.color.pressed_color); break; } } @Override public int getCount() { return count; } @Override public void startUpdate(View container) {} @Override public Object instantiateItem(View container, int position) {
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/Calculator.java // public enum SmallPanel { // HEX, ADVANCED, FUNCTION; // // int order; // // public void setOrder(int order) { // this.order = order; // } // // public int getOrder() { // return order; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/CalculatorViewPager.java // public class CalculatorViewPager extends ViewPager { // private boolean enabled; // // public CalculatorViewPager(Context context) { // this(context, null); // } // // public CalculatorViewPager(Context context, AttributeSet attrs) { // super(context, attrs); // this.enabled = true; // } // // /** // * ViewPager inherits ViewGroup's default behavior of delayed clicks on its // * children, but in order to make the calc buttons more responsive we // * disable that here. // */ // public boolean shouldDelayChildPressedState() { // return false; // } // // @Override // public boolean onTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onTouchEvent(event); // } // // return false; // } // // @Override // public boolean onInterceptTouchEvent(MotionEvent event) { // if(this.enabled) { // return super.onInterceptTouchEvent(event); // } // // return false; // } // // public void setPagingEnabled(boolean enabled) { // this.enabled = enabled; // } // // public boolean getPagingEnabled() { // return enabled; // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/SmallPageAdapter.java import android.os.Parcelable; import android.support.v4.view.PagerAdapter; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import com.gigabytedevelopersinc.app.calculator.Calculator.SmallPanel; import com.gigabytedevelopersinc.app.calculator.view.CalculatorViewPager; case BINARY: mHexPage.findViewById(R.id.bin).setBackgroundResource(R.color.pressed_color); for(int i : mLogic.mBaseModule.bannedResourceInBinary) { View v = mHexPage.findViewById(i); if(v != null) v.setEnabled(false); } break; case DECIMAL: mHexPage.findViewById(R.id.dec).setBackgroundResource(R.color.pressed_color); for(int i : mLogic.mBaseModule.bannedResourceInDecimal) { View v = mHexPage.findViewById(i); if(v != null) v.setEnabled(false); } break; case HEXADECIMAL: mHexPage.findViewById(R.id.hex).setBackgroundResource(R.color.pressed_color); break; } } @Override public int getCount() { return count; } @Override public void startUpdate(View container) {} @Override public Object instantiateItem(View container, int position) {
if(position == SmallPanel.FUNCTION.getOrder() && CalculatorSettings.functionPanel(mParent.getContext())) {
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/MatrixTransposeView.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/MutableString.java // public class MutableString { // private String text; // // public MutableString() { // // } // // public MutableString(String text) { // this.text = text; // } // // public String getText() { // return text; // } // // public void setText(String text) { // this.text = text; // } // // public int length() { // return text.length(); // } // // public boolean isEmpty() { // return text.isEmpty(); // } // // public String substring(int start) { // return text.substring(start); // } // // public String substring(int start, int end) { // return text.substring(start, end); // } // // public CharSequence subSequence(int start, int end) { // return text.subSequence(start, end); // } // // public boolean startsWith(String prefix) { // return text.startsWith(prefix); // } // }
import android.content.Context; import android.support.v7.widget.AppCompatTextView; import android.text.Html; import android.text.InputType; import com.gigabytedevelopersinc.app.calculator.MutableString; import com.gigabytedevelopersinc.app.calculator.R;
package com.gigabytedevelopersinc.app.calculator.view; public class MatrixTransposeView extends AppCompatTextView { public final static String PATTERN = "^T"; public MatrixTransposeView(Context context) { super(context); } public MatrixTransposeView(final AdvancedDisplay display) { super(display.getContext()); setInputType(InputType.TYPE_CLASS_TEXT | InputType.TYPE_TEXT_FLAG_NO_SUGGESTIONS); setText(Html.fromHtml("<sup><small>T</small></sup>")); setTextAppearance(display.getContext(), R.style.display_style); setPadding(0, 0, 0, 0); } @Override public String toString() { return PATTERN; }
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/MutableString.java // public class MutableString { // private String text; // // public MutableString() { // // } // // public MutableString(String text) { // this.text = text; // } // // public String getText() { // return text; // } // // public void setText(String text) { // this.text = text; // } // // public int length() { // return text.length(); // } // // public boolean isEmpty() { // return text.isEmpty(); // } // // public String substring(int start) { // return text.substring(start); // } // // public String substring(int start, int end) { // return text.substring(start, end); // } // // public CharSequence subSequence(int start, int end) { // return text.subSequence(start, end); // } // // public boolean startsWith(String prefix) { // return text.startsWith(prefix); // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/MatrixTransposeView.java import android.content.Context; import android.support.v7.widget.AppCompatTextView; import android.text.Html; import android.text.InputType; import com.gigabytedevelopersinc.app.calculator.MutableString; import com.gigabytedevelopersinc.app.calculator.R; package com.gigabytedevelopersinc.app.calculator.view; public class MatrixTransposeView extends AppCompatTextView { public final static String PATTERN = "^T"; public MatrixTransposeView(Context context) { super(context); } public MatrixTransposeView(final AdvancedDisplay display) { super(display.getContext()); setInputType(InputType.TYPE_CLASS_TEXT | InputType.TYPE_TEXT_FLAG_NO_SUGGESTIONS); setText(Html.fromHtml("<sup><small>T</small></sup>")); setTextAppearance(display.getContext(), R.style.display_style); setPadding(0, 0, 0, 0); } @Override public String toString() { return PATTERN; }
public static boolean load(final MutableString text, final AdvancedDisplay parent) {
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/HistoryLine.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/History.java // public class History { // private static final int VERSION_1 = 1; // private static final int MAX_ENTRIES = 100; // Vector<HistoryEntry> mEntries = new Vector<>(); // private int mPos; // private BaseAdapter mObserver; // // History() { // clear(); // } // // History(int version, DataInput in) throws IOException { // if(version >= VERSION_1) { // int size = in.readInt(); // for(int i = 0; i < size; ++i) { // mEntries.add(new HistoryEntry(version, in)); // } // mPos = in.readInt(); // } // else { // throw new IOException("invalid version " + version); // } // } // // void setObserver(BaseAdapter observer) { // mObserver = observer; // } // // private void notifyChanged() { // if(mObserver != null) { // mObserver.notifyDataSetChanged(); // } // } // // void clear() { // mEntries.clear(); // mEntries.add(new HistoryEntry("", "")); // mPos = 0; // notifyChanged(); // } // // void write(DataOutput out) throws IOException { // out.writeInt(mEntries.size()); // for(HistoryEntry entry : mEntries) { // entry.write(out); // } // out.writeInt(mPos); // } // // void update(String text) { // current().setEdited(text); // } // // boolean moveToPrevious() { // if(mPos > 0) { // --mPos; // return true; // } // return false; // } // // boolean moveToNext() { // if(mPos < mEntries.size() - 1) { // ++mPos; // return true; // } // return false; // } // // void enter(String base, String edited) { // current().clearEdited(); // if(mEntries.size() >= MAX_ENTRIES) { // mEntries.remove(0); // } // if((mEntries.size() < 2 || !base.equals(mEntries.elementAt(mEntries.size() - 2).getBase())) && !base.isEmpty() && !edited.isEmpty()) { // mEntries.insertElementAt(new HistoryEntry(base, edited), mEntries.size() - 1); // } // mPos = mEntries.size() - 1; // notifyChanged(); // } // // private HistoryEntry current() { // return mEntries.elementAt(mPos); // } // // String getText() { // return current().getEdited(); // } // // String getBase() { // return current().getBase(); // } // // public void remove(HistoryEntry he) { // mEntries.remove(he); // mPos--; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/HistoryEntry.java // public class HistoryEntry { // private static final int VERSION_1 = 1; // private String mBase; // private String mEdited; // // HistoryEntry(String base, String edited) { // mBase = base; // mEdited = edited; // } // // HistoryEntry(int version, DataInput in) throws IOException { // if(version >= VERSION_1) { // mBase = in.readUTF(); // mEdited = in.readUTF(); // } // else { // throw new IOException("invalid version " + version); // } // } // // void write(DataOutput out) throws IOException { // out.writeUTF(mBase); // out.writeUTF(mEdited); // } // // @Override // public String toString() { // return mBase; // } // // void clearEdited() { // mEdited = mBase; // } // // public String getEdited() { // return mEdited; // } // // void setEdited(String edited) { // mEdited = edited; // } // // public String getBase() { // return mBase; // } // }
import android.content.ClipData; import android.content.ClipboardManager; import android.content.Context; import android.content.res.Resources; import android.text.TextUtils; import android.util.AttributeSet; import android.view.ContextMenu; import android.view.Menu; import android.view.MenuItem; import android.widget.BaseAdapter; import android.widget.LinearLayout; import android.widget.Toast; import com.gigabytedevelopersinc.app.calculator.History; import com.gigabytedevelopersinc.app.calculator.HistoryEntry; import com.gigabytedevelopersinc.app.calculator.R;
package com.gigabytedevelopersinc.app.calculator.view; public class HistoryLine extends LinearLayout { private static final int COPY = 0; private static final int COPY_BASE = 1; private static final int COPY_EDITED = 2; private static final int REMOVE = 3; private String[] mMenuItemsStrings;
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/History.java // public class History { // private static final int VERSION_1 = 1; // private static final int MAX_ENTRIES = 100; // Vector<HistoryEntry> mEntries = new Vector<>(); // private int mPos; // private BaseAdapter mObserver; // // History() { // clear(); // } // // History(int version, DataInput in) throws IOException { // if(version >= VERSION_1) { // int size = in.readInt(); // for(int i = 0; i < size; ++i) { // mEntries.add(new HistoryEntry(version, in)); // } // mPos = in.readInt(); // } // else { // throw new IOException("invalid version " + version); // } // } // // void setObserver(BaseAdapter observer) { // mObserver = observer; // } // // private void notifyChanged() { // if(mObserver != null) { // mObserver.notifyDataSetChanged(); // } // } // // void clear() { // mEntries.clear(); // mEntries.add(new HistoryEntry("", "")); // mPos = 0; // notifyChanged(); // } // // void write(DataOutput out) throws IOException { // out.writeInt(mEntries.size()); // for(HistoryEntry entry : mEntries) { // entry.write(out); // } // out.writeInt(mPos); // } // // void update(String text) { // current().setEdited(text); // } // // boolean moveToPrevious() { // if(mPos > 0) { // --mPos; // return true; // } // return false; // } // // boolean moveToNext() { // if(mPos < mEntries.size() - 1) { // ++mPos; // return true; // } // return false; // } // // void enter(String base, String edited) { // current().clearEdited(); // if(mEntries.size() >= MAX_ENTRIES) { // mEntries.remove(0); // } // if((mEntries.size() < 2 || !base.equals(mEntries.elementAt(mEntries.size() - 2).getBase())) && !base.isEmpty() && !edited.isEmpty()) { // mEntries.insertElementAt(new HistoryEntry(base, edited), mEntries.size() - 1); // } // mPos = mEntries.size() - 1; // notifyChanged(); // } // // private HistoryEntry current() { // return mEntries.elementAt(mPos); // } // // String getText() { // return current().getEdited(); // } // // String getBase() { // return current().getBase(); // } // // public void remove(HistoryEntry he) { // mEntries.remove(he); // mPos--; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/HistoryEntry.java // public class HistoryEntry { // private static final int VERSION_1 = 1; // private String mBase; // private String mEdited; // // HistoryEntry(String base, String edited) { // mBase = base; // mEdited = edited; // } // // HistoryEntry(int version, DataInput in) throws IOException { // if(version >= VERSION_1) { // mBase = in.readUTF(); // mEdited = in.readUTF(); // } // else { // throw new IOException("invalid version " + version); // } // } // // void write(DataOutput out) throws IOException { // out.writeUTF(mBase); // out.writeUTF(mEdited); // } // // @Override // public String toString() { // return mBase; // } // // void clearEdited() { // mEdited = mBase; // } // // public String getEdited() { // return mEdited; // } // // void setEdited(String edited) { // mEdited = edited; // } // // public String getBase() { // return mBase; // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/HistoryLine.java import android.content.ClipData; import android.content.ClipboardManager; import android.content.Context; import android.content.res.Resources; import android.text.TextUtils; import android.util.AttributeSet; import android.view.ContextMenu; import android.view.Menu; import android.view.MenuItem; import android.widget.BaseAdapter; import android.widget.LinearLayout; import android.widget.Toast; import com.gigabytedevelopersinc.app.calculator.History; import com.gigabytedevelopersinc.app.calculator.HistoryEntry; import com.gigabytedevelopersinc.app.calculator.R; package com.gigabytedevelopersinc.app.calculator.view; public class HistoryLine extends LinearLayout { private static final int COPY = 0; private static final int COPY_BASE = 1; private static final int COPY_EDITED = 2; private static final int REMOVE = 3; private String[] mMenuItemsStrings;
private HistoryEntry mHistoryEntry;
gigabytedevelopers/CalcMate
app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/HistoryLine.java
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/History.java // public class History { // private static final int VERSION_1 = 1; // private static final int MAX_ENTRIES = 100; // Vector<HistoryEntry> mEntries = new Vector<>(); // private int mPos; // private BaseAdapter mObserver; // // History() { // clear(); // } // // History(int version, DataInput in) throws IOException { // if(version >= VERSION_1) { // int size = in.readInt(); // for(int i = 0; i < size; ++i) { // mEntries.add(new HistoryEntry(version, in)); // } // mPos = in.readInt(); // } // else { // throw new IOException("invalid version " + version); // } // } // // void setObserver(BaseAdapter observer) { // mObserver = observer; // } // // private void notifyChanged() { // if(mObserver != null) { // mObserver.notifyDataSetChanged(); // } // } // // void clear() { // mEntries.clear(); // mEntries.add(new HistoryEntry("", "")); // mPos = 0; // notifyChanged(); // } // // void write(DataOutput out) throws IOException { // out.writeInt(mEntries.size()); // for(HistoryEntry entry : mEntries) { // entry.write(out); // } // out.writeInt(mPos); // } // // void update(String text) { // current().setEdited(text); // } // // boolean moveToPrevious() { // if(mPos > 0) { // --mPos; // return true; // } // return false; // } // // boolean moveToNext() { // if(mPos < mEntries.size() - 1) { // ++mPos; // return true; // } // return false; // } // // void enter(String base, String edited) { // current().clearEdited(); // if(mEntries.size() >= MAX_ENTRIES) { // mEntries.remove(0); // } // if((mEntries.size() < 2 || !base.equals(mEntries.elementAt(mEntries.size() - 2).getBase())) && !base.isEmpty() && !edited.isEmpty()) { // mEntries.insertElementAt(new HistoryEntry(base, edited), mEntries.size() - 1); // } // mPos = mEntries.size() - 1; // notifyChanged(); // } // // private HistoryEntry current() { // return mEntries.elementAt(mPos); // } // // String getText() { // return current().getEdited(); // } // // String getBase() { // return current().getBase(); // } // // public void remove(HistoryEntry he) { // mEntries.remove(he); // mPos--; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/HistoryEntry.java // public class HistoryEntry { // private static final int VERSION_1 = 1; // private String mBase; // private String mEdited; // // HistoryEntry(String base, String edited) { // mBase = base; // mEdited = edited; // } // // HistoryEntry(int version, DataInput in) throws IOException { // if(version >= VERSION_1) { // mBase = in.readUTF(); // mEdited = in.readUTF(); // } // else { // throw new IOException("invalid version " + version); // } // } // // void write(DataOutput out) throws IOException { // out.writeUTF(mBase); // out.writeUTF(mEdited); // } // // @Override // public String toString() { // return mBase; // } // // void clearEdited() { // mEdited = mBase; // } // // public String getEdited() { // return mEdited; // } // // void setEdited(String edited) { // mEdited = edited; // } // // public String getBase() { // return mBase; // } // }
import android.content.ClipData; import android.content.ClipboardManager; import android.content.Context; import android.content.res.Resources; import android.text.TextUtils; import android.util.AttributeSet; import android.view.ContextMenu; import android.view.Menu; import android.view.MenuItem; import android.widget.BaseAdapter; import android.widget.LinearLayout; import android.widget.Toast; import com.gigabytedevelopersinc.app.calculator.History; import com.gigabytedevelopersinc.app.calculator.HistoryEntry; import com.gigabytedevelopersinc.app.calculator.R;
package com.gigabytedevelopersinc.app.calculator.view; public class HistoryLine extends LinearLayout { private static final int COPY = 0; private static final int COPY_BASE = 1; private static final int COPY_EDITED = 2; private static final int REMOVE = 3; private String[] mMenuItemsStrings; private HistoryEntry mHistoryEntry;
// Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/History.java // public class History { // private static final int VERSION_1 = 1; // private static final int MAX_ENTRIES = 100; // Vector<HistoryEntry> mEntries = new Vector<>(); // private int mPos; // private BaseAdapter mObserver; // // History() { // clear(); // } // // History(int version, DataInput in) throws IOException { // if(version >= VERSION_1) { // int size = in.readInt(); // for(int i = 0; i < size; ++i) { // mEntries.add(new HistoryEntry(version, in)); // } // mPos = in.readInt(); // } // else { // throw new IOException("invalid version " + version); // } // } // // void setObserver(BaseAdapter observer) { // mObserver = observer; // } // // private void notifyChanged() { // if(mObserver != null) { // mObserver.notifyDataSetChanged(); // } // } // // void clear() { // mEntries.clear(); // mEntries.add(new HistoryEntry("", "")); // mPos = 0; // notifyChanged(); // } // // void write(DataOutput out) throws IOException { // out.writeInt(mEntries.size()); // for(HistoryEntry entry : mEntries) { // entry.write(out); // } // out.writeInt(mPos); // } // // void update(String text) { // current().setEdited(text); // } // // boolean moveToPrevious() { // if(mPos > 0) { // --mPos; // return true; // } // return false; // } // // boolean moveToNext() { // if(mPos < mEntries.size() - 1) { // ++mPos; // return true; // } // return false; // } // // void enter(String base, String edited) { // current().clearEdited(); // if(mEntries.size() >= MAX_ENTRIES) { // mEntries.remove(0); // } // if((mEntries.size() < 2 || !base.equals(mEntries.elementAt(mEntries.size() - 2).getBase())) && !base.isEmpty() && !edited.isEmpty()) { // mEntries.insertElementAt(new HistoryEntry(base, edited), mEntries.size() - 1); // } // mPos = mEntries.size() - 1; // notifyChanged(); // } // // private HistoryEntry current() { // return mEntries.elementAt(mPos); // } // // String getText() { // return current().getEdited(); // } // // String getBase() { // return current().getBase(); // } // // public void remove(HistoryEntry he) { // mEntries.remove(he); // mPos--; // } // } // // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/HistoryEntry.java // public class HistoryEntry { // private static final int VERSION_1 = 1; // private String mBase; // private String mEdited; // // HistoryEntry(String base, String edited) { // mBase = base; // mEdited = edited; // } // // HistoryEntry(int version, DataInput in) throws IOException { // if(version >= VERSION_1) { // mBase = in.readUTF(); // mEdited = in.readUTF(); // } // else { // throw new IOException("invalid version " + version); // } // } // // void write(DataOutput out) throws IOException { // out.writeUTF(mBase); // out.writeUTF(mEdited); // } // // @Override // public String toString() { // return mBase; // } // // void clearEdited() { // mEdited = mBase; // } // // public String getEdited() { // return mEdited; // } // // void setEdited(String edited) { // mEdited = edited; // } // // public String getBase() { // return mBase; // } // } // Path: app/src/main/java/com/gigabytedevelopersinc/app/calculator/view/HistoryLine.java import android.content.ClipData; import android.content.ClipboardManager; import android.content.Context; import android.content.res.Resources; import android.text.TextUtils; import android.util.AttributeSet; import android.view.ContextMenu; import android.view.Menu; import android.view.MenuItem; import android.widget.BaseAdapter; import android.widget.LinearLayout; import android.widget.Toast; import com.gigabytedevelopersinc.app.calculator.History; import com.gigabytedevelopersinc.app.calculator.HistoryEntry; import com.gigabytedevelopersinc.app.calculator.R; package com.gigabytedevelopersinc.app.calculator.view; public class HistoryLine extends LinearLayout { private static final int COPY = 0; private static final int COPY_BASE = 1; private static final int COPY_EDITED = 2; private static final int REMOVE = 3; private String[] mMenuItemsStrings; private HistoryEntry mHistoryEntry;
private History mHistory;
apache/commons-fileupload
src/main/java/org/apache/commons/fileupload2/pub/FileUploadIOException.java
// Path: src/main/java/org/apache/commons/fileupload2/FileUploadException.java // public class FileUploadException extends IOException { // // /** // * Serial version UID, being used, if the exception // * is serialized. // */ // private static final long serialVersionUID = 8881893724388807504L; // // /** // * The exceptions cause. We overwrite the cause of // * the super class, which isn't available in Java 1.3. // */ // private final Throwable cause; // // /** // * Constructs a new {@code FileUploadException} without message. // */ // public FileUploadException() { // this(null, null); // } // // /** // * Constructs a new {@code FileUploadException} with specified detail // * message. // * // * @param msg the error message. // */ // public FileUploadException(final String msg) { // this(msg, null); // } // // /** // * Creates a new {@code FileUploadException} with the given // * detail message and cause. // * // * @param msg The exceptions detail message. // * @param cause The exceptions cause. // */ // public FileUploadException(final String msg, final Throwable cause) { // super(msg); // this.cause = cause; // } // // /** // * Prints this throwable and its backtrace to the specified print stream. // * // * @param stream {@code PrintStream} to use for output // */ // @Override // public void printStackTrace(final PrintStream stream) { // super.printStackTrace(stream); // if (cause != null) { // stream.println("Caused by:"); // cause.printStackTrace(stream); // } // } // // /** // * Prints this throwable and its backtrace to the specified // * print writer. // * // * @param writer {@code PrintWriter} to use for output // */ // @Override // public void printStackTrace(final PrintWriter writer) { // super.printStackTrace(writer); // if (cause != null) { // writer.println("Caused by:"); // cause.printStackTrace(writer); // } // } // // /** // * {@inheritDoc} // */ // @Override // public Throwable getCause() { // return cause; // } // // }
import java.io.IOException; import org.apache.commons.fileupload2.FileUploadException;
/* * Licensed to the Apache Software Foundation (ASF) under one or more * contributor license agreements. See the NOTICE file distributed with * this work for additional information regarding copyright ownership. * The ASF licenses this file to You under the Apache License, Version 2.0 * (the "License"); you may not use this file except in compliance with * the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.apache.commons.fileupload2.pub; /** * This exception is thrown for hiding an inner * {@link FileUploadException} in an {@link IOException}. */ public class FileUploadIOException extends IOException { /** * The exceptions UID, for serializing an instance. */ private static final long serialVersionUID = -7047616958165584154L; /** * The exceptions cause; we overwrite the parent * classes field, which is available since Java * 1.4 only. */
// Path: src/main/java/org/apache/commons/fileupload2/FileUploadException.java // public class FileUploadException extends IOException { // // /** // * Serial version UID, being used, if the exception // * is serialized. // */ // private static final long serialVersionUID = 8881893724388807504L; // // /** // * The exceptions cause. We overwrite the cause of // * the super class, which isn't available in Java 1.3. // */ // private final Throwable cause; // // /** // * Constructs a new {@code FileUploadException} without message. // */ // public FileUploadException() { // this(null, null); // } // // /** // * Constructs a new {@code FileUploadException} with specified detail // * message. // * // * @param msg the error message. // */ // public FileUploadException(final String msg) { // this(msg, null); // } // // /** // * Creates a new {@code FileUploadException} with the given // * detail message and cause. // * // * @param msg The exceptions detail message. // * @param cause The exceptions cause. // */ // public FileUploadException(final String msg, final Throwable cause) { // super(msg); // this.cause = cause; // } // // /** // * Prints this throwable and its backtrace to the specified print stream. // * // * @param stream {@code PrintStream} to use for output // */ // @Override // public void printStackTrace(final PrintStream stream) { // super.printStackTrace(stream); // if (cause != null) { // stream.println("Caused by:"); // cause.printStackTrace(stream); // } // } // // /** // * Prints this throwable and its backtrace to the specified // * print writer. // * // * @param writer {@code PrintWriter} to use for output // */ // @Override // public void printStackTrace(final PrintWriter writer) { // super.printStackTrace(writer); // if (cause != null) { // writer.println("Caused by:"); // cause.printStackTrace(writer); // } // } // // /** // * {@inheritDoc} // */ // @Override // public Throwable getCause() { // return cause; // } // // } // Path: src/main/java/org/apache/commons/fileupload2/pub/FileUploadIOException.java import java.io.IOException; import org.apache.commons.fileupload2.FileUploadException; /* * Licensed to the Apache Software Foundation (ASF) under one or more * contributor license agreements. See the NOTICE file distributed with * this work for additional information regarding copyright ownership. * The ASF licenses this file to You under the Apache License, Version 2.0 * (the "License"); you may not use this file except in compliance with * the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.apache.commons.fileupload2.pub; /** * This exception is thrown for hiding an inner * {@link FileUploadException} in an {@link IOException}. */ public class FileUploadIOException extends IOException { /** * The exceptions UID, for serializing an instance. */ private static final long serialVersionUID = -7047616958165584154L; /** * The exceptions cause; we overwrite the parent * classes field, which is available since Java * 1.4 only. */
private final FileUploadException cause;
apache/commons-fileupload
src/test/java/org/apache/commons/fileupload2/ProgressListenerTest.java
// Path: src/main/java/org/apache/commons/fileupload2/servlet/ServletFileUpload.java // public class ServletFileUpload extends FileUpload { // // /** // * Constant for HTTP POST method. // */ // private static final String POST_METHOD = "POST"; // // // ---------------------------------------------------------- Class methods // // /** // * Utility method that determines whether the request contains multipart // * content. // * // * @param request The servlet request to be evaluated. Must be non-null. // * // * @return {@code true} if the request is multipart; // * {@code false} otherwise. // */ // public static final boolean isMultipartContent( // final HttpServletRequest request) { // if (!POST_METHOD.equalsIgnoreCase(request.getMethod())) { // return false; // } // return FileUploadBase.isMultipartContent(new ServletRequestContext(request)); // } // // // ----------------------------------------------------------- Constructors // // /** // * Constructs an uninitialized instance of this class. A factory must be // * configured, using {@code setFileItemFactory()}, before attempting // * to parse requests. // * // * @see FileUpload#FileUpload(FileItemFactory) // */ // public ServletFileUpload() { // } // // /** // * Constructs an instance of this class which uses the supplied factory to // * create {@code FileItem} instances. // * // * @see FileUpload#FileUpload() // * @param fileItemFactory The factory to use for creating file items. // */ // public ServletFileUpload(final FileItemFactory fileItemFactory) { // super(fileItemFactory); // } // // // --------------------------------------------------------- Public methods // // /** // * Processes an <a href="http://www.ietf.org/rfc/rfc1867.txt">RFC 1867</a> // * compliant {@code multipart/form-data} stream. // * // * @param request The servlet request to be parsed. // * // * @return A list of {@code FileItem} instances parsed from the // * request, in the order that they were transmitted. // * // * @throws FileUploadException if there are problems reading/parsing // * the request or storing files. // */ // public List<FileItem> parseRequest(final HttpServletRequest request) // throws FileUploadException { // return parseRequest(new ServletRequestContext(request)); // } // // /** // * Processes an <a href="http://www.ietf.org/rfc/rfc1867.txt">RFC 1867</a> // * compliant {@code multipart/form-data} stream. // * // * @param request The servlet request to be parsed. // * // * @return A map of {@code FileItem} instances parsed from the request. // * // * @throws FileUploadException if there are problems reading/parsing // * the request or storing files. // * // * @since 1.3 // */ // public Map<String, List<FileItem>> parseParameterMap(final HttpServletRequest request) // throws FileUploadException { // return parseParameterMap(new ServletRequestContext(request)); // } // // /** // * Processes an <a href="http://www.ietf.org/rfc/rfc1867.txt">RFC 1867</a> // * compliant {@code multipart/form-data} stream. // * // * @param request The servlet request to be parsed. // * // * @return An iterator to instances of {@code FileItemStream} // * parsed from the request, in the order that they were // * transmitted. // * // * @throws FileUploadException if there are problems reading/parsing // * the request or storing files. // * @throws IOException An I/O error occurred. This may be a network // * error while communicating with the client or a problem while // * storing the uploaded content. // */ // public FileItemIterator getItemIterator(final HttpServletRequest request) // throws FileUploadException, IOException { // return super.getItemIterator(new ServletRequestContext(request)); // } // // }
import static org.junit.jupiter.api.Assertions.assertEquals; import static org.junit.jupiter.api.Assertions.assertTrue; import static org.junit.jupiter.api.Assertions.fail; import java.io.ByteArrayOutputStream; import java.io.IOException; import java.io.InputStream; import java.nio.charset.StandardCharsets; import org.apache.commons.fileupload2.servlet.ServletFileUpload; import org.junit.jupiter.api.Test;
*/ @Test public void testProgressListener() throws Exception { final int NUM_ITEMS = 512; final ByteArrayOutputStream baos = new ByteArrayOutputStream(); for (int i = 0; i < NUM_ITEMS; i++) { final String header = "-----1234\r\n" + "Content-Disposition: form-data; name=\"field" + (i + 1) + "\"\r\n" + "\r\n"; baos.write(header.getBytes(StandardCharsets.US_ASCII)); for (int j = 0; j < 16384 + i; j++) { baos.write((byte) j); } baos.write("\r\n".getBytes(StandardCharsets.US_ASCII)); } baos.write("-----1234--\r\n".getBytes(StandardCharsets.US_ASCII)); final byte[] contents = baos.toByteArray(); MockHttpServletRequest request = new MockHttpServletRequest(contents, Constants.CONTENT_TYPE); runTest(NUM_ITEMS, contents.length, request); request = new MockHttpServletRequest(contents, Constants.CONTENT_TYPE) { @Override public int getContentLength() { return -1; } }; runTest(NUM_ITEMS, contents.length, request); } private void runTest(final int NUM_ITEMS, final long pContentLength, final MockHttpServletRequest request) throws FileUploadException, IOException {
// Path: src/main/java/org/apache/commons/fileupload2/servlet/ServletFileUpload.java // public class ServletFileUpload extends FileUpload { // // /** // * Constant for HTTP POST method. // */ // private static final String POST_METHOD = "POST"; // // // ---------------------------------------------------------- Class methods // // /** // * Utility method that determines whether the request contains multipart // * content. // * // * @param request The servlet request to be evaluated. Must be non-null. // * // * @return {@code true} if the request is multipart; // * {@code false} otherwise. // */ // public static final boolean isMultipartContent( // final HttpServletRequest request) { // if (!POST_METHOD.equalsIgnoreCase(request.getMethod())) { // return false; // } // return FileUploadBase.isMultipartContent(new ServletRequestContext(request)); // } // // // ----------------------------------------------------------- Constructors // // /** // * Constructs an uninitialized instance of this class. A factory must be // * configured, using {@code setFileItemFactory()}, before attempting // * to parse requests. // * // * @see FileUpload#FileUpload(FileItemFactory) // */ // public ServletFileUpload() { // } // // /** // * Constructs an instance of this class which uses the supplied factory to // * create {@code FileItem} instances. // * // * @see FileUpload#FileUpload() // * @param fileItemFactory The factory to use for creating file items. // */ // public ServletFileUpload(final FileItemFactory fileItemFactory) { // super(fileItemFactory); // } // // // --------------------------------------------------------- Public methods // // /** // * Processes an <a href="http://www.ietf.org/rfc/rfc1867.txt">RFC 1867</a> // * compliant {@code multipart/form-data} stream. // * // * @param request The servlet request to be parsed. // * // * @return A list of {@code FileItem} instances parsed from the // * request, in the order that they were transmitted. // * // * @throws FileUploadException if there are problems reading/parsing // * the request or storing files. // */ // public List<FileItem> parseRequest(final HttpServletRequest request) // throws FileUploadException { // return parseRequest(new ServletRequestContext(request)); // } // // /** // * Processes an <a href="http://www.ietf.org/rfc/rfc1867.txt">RFC 1867</a> // * compliant {@code multipart/form-data} stream. // * // * @param request The servlet request to be parsed. // * // * @return A map of {@code FileItem} instances parsed from the request. // * // * @throws FileUploadException if there are problems reading/parsing // * the request or storing files. // * // * @since 1.3 // */ // public Map<String, List<FileItem>> parseParameterMap(final HttpServletRequest request) // throws FileUploadException { // return parseParameterMap(new ServletRequestContext(request)); // } // // /** // * Processes an <a href="http://www.ietf.org/rfc/rfc1867.txt">RFC 1867</a> // * compliant {@code multipart/form-data} stream. // * // * @param request The servlet request to be parsed. // * // * @return An iterator to instances of {@code FileItemStream} // * parsed from the request, in the order that they were // * transmitted. // * // * @throws FileUploadException if there are problems reading/parsing // * the request or storing files. // * @throws IOException An I/O error occurred. This may be a network // * error while communicating with the client or a problem while // * storing the uploaded content. // */ // public FileItemIterator getItemIterator(final HttpServletRequest request) // throws FileUploadException, IOException { // return super.getItemIterator(new ServletRequestContext(request)); // } // // } // Path: src/test/java/org/apache/commons/fileupload2/ProgressListenerTest.java import static org.junit.jupiter.api.Assertions.assertEquals; import static org.junit.jupiter.api.Assertions.assertTrue; import static org.junit.jupiter.api.Assertions.fail; import java.io.ByteArrayOutputStream; import java.io.IOException; import java.io.InputStream; import java.nio.charset.StandardCharsets; import org.apache.commons.fileupload2.servlet.ServletFileUpload; import org.junit.jupiter.api.Test; */ @Test public void testProgressListener() throws Exception { final int NUM_ITEMS = 512; final ByteArrayOutputStream baos = new ByteArrayOutputStream(); for (int i = 0; i < NUM_ITEMS; i++) { final String header = "-----1234\r\n" + "Content-Disposition: form-data; name=\"field" + (i + 1) + "\"\r\n" + "\r\n"; baos.write(header.getBytes(StandardCharsets.US_ASCII)); for (int j = 0; j < 16384 + i; j++) { baos.write((byte) j); } baos.write("\r\n".getBytes(StandardCharsets.US_ASCII)); } baos.write("-----1234--\r\n".getBytes(StandardCharsets.US_ASCII)); final byte[] contents = baos.toByteArray(); MockHttpServletRequest request = new MockHttpServletRequest(contents, Constants.CONTENT_TYPE); runTest(NUM_ITEMS, contents.length, request); request = new MockHttpServletRequest(contents, Constants.CONTENT_TYPE) { @Override public int getContentLength() { return -1; } }; runTest(NUM_ITEMS, contents.length, request); } private void runTest(final int NUM_ITEMS, final long pContentLength, final MockHttpServletRequest request) throws FileUploadException, IOException {
final ServletFileUpload upload = new ServletFileUpload();
apache/commons-fileupload
src/main/java/org/apache/commons/fileupload2/util/Streams.java
// Path: src/main/java/org/apache/commons/fileupload2/InvalidFileNameException.java // public class InvalidFileNameException extends RuntimeException { // // /** // * Serial version UID, being used, if the exception // * is serialized. // */ // private static final long serialVersionUID = 7922042602454350470L; // // /** // * The file name causing the exception. // */ // private final String name; // // /** // * Creates a new instance. // * // * @param pName The file name causing the exception. // * @param pMessage A human readable error message. // */ // public InvalidFileNameException(final String pName, final String pMessage) { // super(pMessage); // name = pName; // } // // /** // * Returns the invalid file name. // * // * @return the invalid file name. // */ // public String getName() { // return name; // } // // }
import java.io.ByteArrayOutputStream; import java.io.IOException; import java.io.InputStream; import java.io.OutputStream; import org.apache.commons.fileupload2.InvalidFileNameException;
final ByteArrayOutputStream baos = new ByteArrayOutputStream(); copy(inputStream, baos, true); return baos.toString(encoding); } /** * Checks, whether the given file name is valid in the sense, * that it doesn't contain any NUL characters. If the file name * is valid, it will be returned without any modifications. Otherwise, * an {@link InvalidFileNameException} is raised. * * @param fileName The file name to check * @return Unmodified file name, if valid. * @throws InvalidFileNameException The file name was found to be invalid. */ public static String checkFileName(final String fileName) { if (fileName != null && fileName.indexOf('\u0000') != -1) { // pFileName.replace("\u0000", "\\0") final StringBuilder sb = new StringBuilder(); for (int i = 0; i < fileName.length(); i++) { final char c = fileName.charAt(i); switch (c) { case 0: sb.append("\\0"); break; default: sb.append(c); break; } }
// Path: src/main/java/org/apache/commons/fileupload2/InvalidFileNameException.java // public class InvalidFileNameException extends RuntimeException { // // /** // * Serial version UID, being used, if the exception // * is serialized. // */ // private static final long serialVersionUID = 7922042602454350470L; // // /** // * The file name causing the exception. // */ // private final String name; // // /** // * Creates a new instance. // * // * @param pName The file name causing the exception. // * @param pMessage A human readable error message. // */ // public InvalidFileNameException(final String pName, final String pMessage) { // super(pMessage); // name = pName; // } // // /** // * Returns the invalid file name. // * // * @return the invalid file name. // */ // public String getName() { // return name; // } // // } // Path: src/main/java/org/apache/commons/fileupload2/util/Streams.java import java.io.ByteArrayOutputStream; import java.io.IOException; import java.io.InputStream; import java.io.OutputStream; import org.apache.commons.fileupload2.InvalidFileNameException; final ByteArrayOutputStream baos = new ByteArrayOutputStream(); copy(inputStream, baos, true); return baos.toString(encoding); } /** * Checks, whether the given file name is valid in the sense, * that it doesn't contain any NUL characters. If the file name * is valid, it will be returned without any modifications. Otherwise, * an {@link InvalidFileNameException} is raised. * * @param fileName The file name to check * @return Unmodified file name, if valid. * @throws InvalidFileNameException The file name was found to be invalid. */ public static String checkFileName(final String fileName) { if (fileName != null && fileName.indexOf('\u0000') != -1) { // pFileName.replace("\u0000", "\\0") final StringBuilder sb = new StringBuilder(); for (int i = 0; i < fileName.length(); i++) { final char c = fileName.charAt(i); switch (c) { case 0: sb.append("\\0"); break; default: sb.append(c); break; } }
throw new InvalidFileNameException(fileName,
apache/commons-fileupload
src/test/java/org/apache/commons/fileupload2/FileItemHeadersTest.java
// Path: src/main/java/org/apache/commons/fileupload2/util/FileItemHeadersImpl.java // public class FileItemHeadersImpl implements FileItemHeaders, Serializable { // // /** // * Serial version UID, being used, if serialized. // */ // private static final long serialVersionUID = -4455695752627032559L; // // /** // * Map of {@code String} keys to a {@code List} of // * {@code String} instances. // */ // private final Map<String, List<String>> headerNameToValueListMap = new LinkedHashMap<>(); // // /** // * {@inheritDoc} // */ // @Override // public String getHeader(final String name) { // final String nameLower = name.toLowerCase(Locale.ENGLISH); // final List<String> headerValueList = headerNameToValueListMap.get(nameLower); // if (null == headerValueList) { // return null; // } // return headerValueList.get(0); // } // // /** // * {@inheritDoc} // */ // @Override // public Iterator<String> getHeaderNames() { // return headerNameToValueListMap.keySet().iterator(); // } // // /** // * {@inheritDoc} // */ // @Override // public Iterator<String> getHeaders(final String name) { // final String nameLower = name.toLowerCase(Locale.ENGLISH); // List<String> headerValueList = headerNameToValueListMap.get(nameLower); // if (null == headerValueList) { // headerValueList = Collections.emptyList(); // } // return headerValueList.iterator(); // } // // /** // * Method to add header values to this instance. // * // * @param name name of this header // * @param value value of this header // */ // public synchronized void addHeader(final String name, final String value) { // final String nameLower = name.toLowerCase(Locale.ENGLISH); // final List<String> headerValueList = headerNameToValueListMap. // computeIfAbsent(nameLower, k -> new ArrayList<>()); // headerValueList.add(value); // } // // }
import static org.junit.jupiter.api.Assertions.assertEquals; import static org.junit.jupiter.api.Assertions.assertFalse; import static org.junit.jupiter.api.Assertions.assertNull; import static org.junit.jupiter.api.Assertions.assertTrue; import java.util.Iterator; import org.apache.commons.fileupload2.util.FileItemHeadersImpl; import org.junit.jupiter.api.Test;
/* * Licensed to the Apache Software Foundation (ASF) under one or more * contributor license agreements. See the NOTICE file distributed with * this work for additional information regarding copyright ownership. * The ASF licenses this file to You under the Apache License, Version 2.0 * (the "License"); you may not use this file except in compliance with * the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.apache.commons.fileupload2; /** * Unit tests {@link FileItemHeaders} and * {@link FileItemHeadersImpl}. */ public class FileItemHeadersTest { /** * @throws Exception */ @Test public void testFileItemHeaders() throws Exception {
// Path: src/main/java/org/apache/commons/fileupload2/util/FileItemHeadersImpl.java // public class FileItemHeadersImpl implements FileItemHeaders, Serializable { // // /** // * Serial version UID, being used, if serialized. // */ // private static final long serialVersionUID = -4455695752627032559L; // // /** // * Map of {@code String} keys to a {@code List} of // * {@code String} instances. // */ // private final Map<String, List<String>> headerNameToValueListMap = new LinkedHashMap<>(); // // /** // * {@inheritDoc} // */ // @Override // public String getHeader(final String name) { // final String nameLower = name.toLowerCase(Locale.ENGLISH); // final List<String> headerValueList = headerNameToValueListMap.get(nameLower); // if (null == headerValueList) { // return null; // } // return headerValueList.get(0); // } // // /** // * {@inheritDoc} // */ // @Override // public Iterator<String> getHeaderNames() { // return headerNameToValueListMap.keySet().iterator(); // } // // /** // * {@inheritDoc} // */ // @Override // public Iterator<String> getHeaders(final String name) { // final String nameLower = name.toLowerCase(Locale.ENGLISH); // List<String> headerValueList = headerNameToValueListMap.get(nameLower); // if (null == headerValueList) { // headerValueList = Collections.emptyList(); // } // return headerValueList.iterator(); // } // // /** // * Method to add header values to this instance. // * // * @param name name of this header // * @param value value of this header // */ // public synchronized void addHeader(final String name, final String value) { // final String nameLower = name.toLowerCase(Locale.ENGLISH); // final List<String> headerValueList = headerNameToValueListMap. // computeIfAbsent(nameLower, k -> new ArrayList<>()); // headerValueList.add(value); // } // // } // Path: src/test/java/org/apache/commons/fileupload2/FileItemHeadersTest.java import static org.junit.jupiter.api.Assertions.assertEquals; import static org.junit.jupiter.api.Assertions.assertFalse; import static org.junit.jupiter.api.Assertions.assertNull; import static org.junit.jupiter.api.Assertions.assertTrue; import java.util.Iterator; import org.apache.commons.fileupload2.util.FileItemHeadersImpl; import org.junit.jupiter.api.Test; /* * Licensed to the Apache Software Foundation (ASF) under one or more * contributor license agreements. See the NOTICE file distributed with * this work for additional information regarding copyright ownership. * The ASF licenses this file to You under the Apache License, Version 2.0 * (the "License"); you may not use this file except in compliance with * the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.apache.commons.fileupload2; /** * Unit tests {@link FileItemHeaders} and * {@link FileItemHeadersImpl}. */ public class FileItemHeadersTest { /** * @throws Exception */ @Test public void testFileItemHeaders() throws Exception {
final FileItemHeadersImpl aMutableFileItemHeaders = new FileItemHeadersImpl();
AmailP/robot-plugin
src/main/java/amailp/intellij/robot/extensions/ParserDefinition.java
// Path: src/main/java/amailp/intellij/robot/elements/RobotTokenTypes.java // public interface RobotTokenTypes { // // // final IElementType BadCharacter = TokenType.BAD_CHARACTER; // // final IElementType LineTerminator = new RobotIElementType("LineTerminator"); // // final IElementType SettingsHeader = new RobotIElementType("SettingsHeader"); // final IElementType TestCasesHeader = new RobotIElementType("TestCasesHeader"); // final IElementType KeywordsHeader = new RobotIElementType("KeywordsHeader"); // final IElementType VariablesHeader = new RobotIElementType("VariablesHeader"); // final IElementType TasksHeader = new RobotIElementType("TasksHeader"); // // final IElementType Ellipsis = new RobotIElementType("Ellipsis"); // final IElementType ScalarVariable = new RobotIElementType("ScalarVariable"); // final IElementType ListVariable = new RobotIElementType("ListVariable"); // final IElementType DictionaryVariable = new RobotIElementType("DictionaryVariable"); // final IElementType EnvironmentVariable = new RobotIElementType("EnvironmentVariable"); // final IElementType TestCaseSetting = new RobotIElementType("TestCaseSetting"); // final IElementType Word = new RobotIElementType("Word"); // final IElementType Space = new RobotIElementType("Space"); // final IElementType Separator = new RobotIElementType("Separator"); // final IElementType IrrelevantSpaces = new RobotIElementType("IrrelevantSpaces"); // final IElementType BlankLine = new RobotIElementType("BlankLine"); // final IElementType Comment = new RobotIElementType("Comment"); // final IElementType WithName = new RobotIElementType("LibraryAliasSeparator"); // // final TokenSet WhitespacesTokens = TokenSet.create(IrrelevantSpaces, BlankLine); // final TokenSet CommentsTokens = TokenSet.create(Comment); // final TokenSet StringLiteralElements = TokenSet.EMPTY; // final TokenSet HeaderTokens = TokenSet.create(SettingsHeader, TestCasesHeader, KeywordsHeader, VariablesHeader, TasksHeader); // }
import amailp.intellij.robot.elements.RobotTokenTypes; import amailp.intellij.robot.lang.RobotLanguage; import amailp.intellij.robot.lexer.RobotLexer; import amailp.intellij.robot.parser.PsiElementBuilder; import amailp.intellij.robot.parser.RobotParser$; import amailp.intellij.robot.psi.RobotPsiFile; import com.intellij.lang.ASTNode; import com.intellij.lang.PsiParser; import com.intellij.lexer.Lexer; import com.intellij.openapi.project.Project; import com.intellij.psi.FileViewProvider; import com.intellij.psi.PsiElement; import com.intellij.psi.PsiFile; import com.intellij.psi.tree.IFileElementType; import com.intellij.psi.tree.TokenSet; import org.jetbrains.annotations.NotNull;
package amailp.intellij.robot.extensions; public class ParserDefinition implements com.intellij.lang.ParserDefinition { @Override @NotNull public Lexer createLexer(Project project) { return new RobotLexer(); } @Override @NotNull public TokenSet getWhitespaceTokens() {
// Path: src/main/java/amailp/intellij/robot/elements/RobotTokenTypes.java // public interface RobotTokenTypes { // // // final IElementType BadCharacter = TokenType.BAD_CHARACTER; // // final IElementType LineTerminator = new RobotIElementType("LineTerminator"); // // final IElementType SettingsHeader = new RobotIElementType("SettingsHeader"); // final IElementType TestCasesHeader = new RobotIElementType("TestCasesHeader"); // final IElementType KeywordsHeader = new RobotIElementType("KeywordsHeader"); // final IElementType VariablesHeader = new RobotIElementType("VariablesHeader"); // final IElementType TasksHeader = new RobotIElementType("TasksHeader"); // // final IElementType Ellipsis = new RobotIElementType("Ellipsis"); // final IElementType ScalarVariable = new RobotIElementType("ScalarVariable"); // final IElementType ListVariable = new RobotIElementType("ListVariable"); // final IElementType DictionaryVariable = new RobotIElementType("DictionaryVariable"); // final IElementType EnvironmentVariable = new RobotIElementType("EnvironmentVariable"); // final IElementType TestCaseSetting = new RobotIElementType("TestCaseSetting"); // final IElementType Word = new RobotIElementType("Word"); // final IElementType Space = new RobotIElementType("Space"); // final IElementType Separator = new RobotIElementType("Separator"); // final IElementType IrrelevantSpaces = new RobotIElementType("IrrelevantSpaces"); // final IElementType BlankLine = new RobotIElementType("BlankLine"); // final IElementType Comment = new RobotIElementType("Comment"); // final IElementType WithName = new RobotIElementType("LibraryAliasSeparator"); // // final TokenSet WhitespacesTokens = TokenSet.create(IrrelevantSpaces, BlankLine); // final TokenSet CommentsTokens = TokenSet.create(Comment); // final TokenSet StringLiteralElements = TokenSet.EMPTY; // final TokenSet HeaderTokens = TokenSet.create(SettingsHeader, TestCasesHeader, KeywordsHeader, VariablesHeader, TasksHeader); // } // Path: src/main/java/amailp/intellij/robot/extensions/ParserDefinition.java import amailp.intellij.robot.elements.RobotTokenTypes; import amailp.intellij.robot.lang.RobotLanguage; import amailp.intellij.robot.lexer.RobotLexer; import amailp.intellij.robot.parser.PsiElementBuilder; import amailp.intellij.robot.parser.RobotParser$; import amailp.intellij.robot.psi.RobotPsiFile; import com.intellij.lang.ASTNode; import com.intellij.lang.PsiParser; import com.intellij.lexer.Lexer; import com.intellij.openapi.project.Project; import com.intellij.psi.FileViewProvider; import com.intellij.psi.PsiElement; import com.intellij.psi.PsiFile; import com.intellij.psi.tree.IFileElementType; import com.intellij.psi.tree.TokenSet; import org.jetbrains.annotations.NotNull; package amailp.intellij.robot.extensions; public class ParserDefinition implements com.intellij.lang.ParserDefinition { @Override @NotNull public Lexer createLexer(Project project) { return new RobotLexer(); } @Override @NotNull public TokenSet getWhitespaceTokens() {
return RobotTokenTypes.WhitespacesTokens;
lanixzcj/LoveTalkClient
src/com/example/lovetalk/view/EnLetterView.java
// Path: src/com/example/lovetalk/util/PixelUtil.java // public class PixelUtil { // private static Resources resources = Resources.getSystem(); // private static int desityDpi = resources.getDisplayMetrics().densityDpi; // private static float scaledDensity = resources.getDisplayMetrics().scaledDensity; // // public static int dp2px(float value) { // final float scale = desityDpi; // return (int) (value * (scale / 160) + 0.5f); // } // // public static int px2dp(float value) { // final float scale = desityDpi; // return (int) ((value * 160) / scale + 0.5f); // } // // public static int sp2px(float value) { // float spvalue = value * scaledDensity; // return (int) (spvalue + 0.5f); // } // // public static int px2sp(float value) { // final float scale = scaledDensity; // return (int) (value / scale + 0.5f); // } // }
import android.content.Context; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Paint; import android.graphics.Typeface; import android.graphics.drawable.ColorDrawable; import android.util.AttributeSet; import android.view.MotionEvent; import android.view.View; import android.widget.TextView; import com.example.lovetalk.R; import com.example.lovetalk.util.PixelUtil;
private TextView textDialog; public void setTextView(TextView mTextDialog) { this.textDialog = mTextDialog; } public EnLetterView(Context context, AttributeSet attrs, int defStyle) { super(context, attrs, defStyle); } public EnLetterView(Context context, AttributeSet attrs) { super(context, attrs); } public EnLetterView(Context context) { super(context); } protected void onDraw(Canvas canvas) { super.onDraw(canvas); int height = getHeight(); int width = getWidth(); int singleHeight = height / letters.length; for (int i = 0; i < letters.length; i++) { paint.setColor(getResources().getColor( R.color.color_bottom_text_normal)); paint.setTypeface(Typeface.DEFAULT_BOLD); paint.setAntiAlias(true);
// Path: src/com/example/lovetalk/util/PixelUtil.java // public class PixelUtil { // private static Resources resources = Resources.getSystem(); // private static int desityDpi = resources.getDisplayMetrics().densityDpi; // private static float scaledDensity = resources.getDisplayMetrics().scaledDensity; // // public static int dp2px(float value) { // final float scale = desityDpi; // return (int) (value * (scale / 160) + 0.5f); // } // // public static int px2dp(float value) { // final float scale = desityDpi; // return (int) ((value * 160) / scale + 0.5f); // } // // public static int sp2px(float value) { // float spvalue = value * scaledDensity; // return (int) (spvalue + 0.5f); // } // // public static int px2sp(float value) { // final float scale = scaledDensity; // return (int) (value / scale + 0.5f); // } // } // Path: src/com/example/lovetalk/view/EnLetterView.java import android.content.Context; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Paint; import android.graphics.Typeface; import android.graphics.drawable.ColorDrawable; import android.util.AttributeSet; import android.view.MotionEvent; import android.view.View; import android.widget.TextView; import com.example.lovetalk.R; import com.example.lovetalk.util.PixelUtil; private TextView textDialog; public void setTextView(TextView mTextDialog) { this.textDialog = mTextDialog; } public EnLetterView(Context context, AttributeSet attrs, int defStyle) { super(context, attrs, defStyle); } public EnLetterView(Context context, AttributeSet attrs) { super(context, attrs); } public EnLetterView(Context context) { super(context); } protected void onDraw(Canvas canvas) { super.onDraw(canvas); int height = getHeight(); int width = getWidth(); int singleHeight = height / letters.length; for (int i = 0; i < letters.length; i++) { paint.setColor(getResources().getColor( R.color.color_bottom_text_normal)); paint.setTypeface(Typeface.DEFAULT_BOLD); paint.setAntiAlias(true);
paint.setTextSize(PixelUtil.sp2px(12));
lanixzcj/LoveTalkClient
src/com/example/lovetalk/view/EmotionEditText.java
// Path: src/com/example/lovetalk/util/EmotionUtils.java // public class EmotionUtils { // public static List<String> emotionTexts; // public static List<String> emotionTexts1; // public static List<String> emotionTexts2; // // private static List<String> emotions; // public static int[] emotionCodes = new int[]{0x1F601, 0x1F602, 0x1F603, 0x1F604, 0x1F605, 0x1F606, 0x1F609, 0x1F60A, 0x1F60B, 0x1F60C, // 0x1F60D, 0x1F60F, 0x1F612, 0x1F613, 0x1F614, 0x1F616, 0x1F618, 0x1F61A, 0x1F61C, 0x1F61D, 0x1F61E, 0x1F620, 0x1F621, 0x1F622, 0x1F623, 0x1F624, // 0x1F625, 0x1F628, 0x1F629, 0x1F62A, 0x1F62B, 0x1F62D, 0x1F630, 0x1F631, 0x1F632, 0x1F633, 0x1F635, 0x1F637}; // public static List<String> emotions1, emotions2; // public static String[] emojiCodes = new String[]{"\\u1f60a", "\\u1f60c", // "\\u1f60d", "\\u1f60f", "\\u1f61a", "\\u1f61b", "\\u1f61c", "\\u1f61e", "\\u1f62a", "\\u1f601", "\\u1f602", "\\u1f603", // "\\u1f604", "\\u1f609", "\\u1f612", "\\u1f613", "\\u1f614", "\\u1f616", "\\u1f618", "\\u1f620", "\\u1f621", "\\u1f622", // "\\u1f621", "\\u1f622", "\\u1f623", "\\u1f625", "\\u1f628", "\\u1f630", "\\u1f631", "\\u1f632", "\\u1f633", "\\u1f637", // "\\u1f44d", "\\u1f44e", "\\u1f44f"}; // // static String getEmojiByUnicode(int unicode) { // return new String(Character.toChars(unicode)); // } // // private static Pattern pattern; // // static { // emotions = new ArrayList<String>(); // int i; // for (i = 0; i < emotionCodes.length; i++) { // emotions.add(getEmojiByUnicode(emotionCodes[i])); // } // emotions1 = emotions.subList(0, 21); // emotions2 = emotions.subList(21, emotions.size()); // // emotionTexts = new ArrayList<String>(); // for (String emojiCode : emojiCodes) { // emotionTexts.add(emojiCode); // } // emotionTexts1 = emotionTexts.subList(0, 21); // emotionTexts2 = emotionTexts.subList(21, emotionTexts.size()); // pattern = buildPattern(); // } // // private static Pattern buildPattern() { // return Pattern.compile("\\\\u1f[a-z0-9]{3}"); // } // // public static boolean haveEmotion(String text) { // Matcher matcher = pattern.matcher(text); // if (matcher.find()) { // return true; // } else { // return false; // } // } // // public static CharSequence scaleEmotions(String text) { // SpannableString spannableString = new SpannableString(text); // for (String emotion : emotions) { // Pattern pattern = Pattern.compile(emotion); // Matcher matcher = pattern.matcher(text); // while (matcher.find()) { // int start = matcher.start(); // int end = matcher.end(); // spannableString.setSpan(new RelativeSizeSpan(1.2f), start, end, Spanned.SPAN_INCLUSIVE_EXCLUSIVE); // } // } // return spannableString; // } // // public static CharSequence replace(Context ctx, String text) { // SpannableString spannableString = new SpannableString(text); // Matcher matcher = pattern.matcher(text); // while (matcher.find()) { // String factText = matcher.group(); // String key = factText.substring(1); // if (emotionTexts.contains(factText)) { // Bitmap bitmap = getDrawableByName(ctx, key); // ImageSpan image = new ImageSpan(ctx, bitmap); // int start = matcher.start(); // int end = matcher.end(); // spannableString.setSpan(image, start, end, // Spannable.SPAN_EXCLUSIVE_EXCLUSIVE); // } // } // return spannableString; // } // // public static Bitmap getDrawableByName(Context ctx, String name) { // BitmapFactory.Options options = new BitmapFactory.Options(); // Bitmap bitmap = BitmapFactory.decodeResource(ctx.getResources(), // ctx.getResources().getIdentifier(name, "drawable", // ctx.getPackageName()), options); // return bitmap; // } // }
import com.example.lovetalk.util.EmotionUtils; import android.content.Context; import android.text.TextUtils; import android.util.AttributeSet; import android.widget.EditText;
package com.example.lovetalk.view; public class EmotionEditText extends EditText { public EmotionEditText(Context context) { super(context); } public EmotionEditText(Context context, AttributeSet attrs, int defStyle) { super(context, attrs, defStyle); } public EmotionEditText(Context context, AttributeSet attrs) { super(context, attrs); } @Override public void setText(CharSequence text, BufferType type) { if (!TextUtils.isEmpty(text)) {
// Path: src/com/example/lovetalk/util/EmotionUtils.java // public class EmotionUtils { // public static List<String> emotionTexts; // public static List<String> emotionTexts1; // public static List<String> emotionTexts2; // // private static List<String> emotions; // public static int[] emotionCodes = new int[]{0x1F601, 0x1F602, 0x1F603, 0x1F604, 0x1F605, 0x1F606, 0x1F609, 0x1F60A, 0x1F60B, 0x1F60C, // 0x1F60D, 0x1F60F, 0x1F612, 0x1F613, 0x1F614, 0x1F616, 0x1F618, 0x1F61A, 0x1F61C, 0x1F61D, 0x1F61E, 0x1F620, 0x1F621, 0x1F622, 0x1F623, 0x1F624, // 0x1F625, 0x1F628, 0x1F629, 0x1F62A, 0x1F62B, 0x1F62D, 0x1F630, 0x1F631, 0x1F632, 0x1F633, 0x1F635, 0x1F637}; // public static List<String> emotions1, emotions2; // public static String[] emojiCodes = new String[]{"\\u1f60a", "\\u1f60c", // "\\u1f60d", "\\u1f60f", "\\u1f61a", "\\u1f61b", "\\u1f61c", "\\u1f61e", "\\u1f62a", "\\u1f601", "\\u1f602", "\\u1f603", // "\\u1f604", "\\u1f609", "\\u1f612", "\\u1f613", "\\u1f614", "\\u1f616", "\\u1f618", "\\u1f620", "\\u1f621", "\\u1f622", // "\\u1f621", "\\u1f622", "\\u1f623", "\\u1f625", "\\u1f628", "\\u1f630", "\\u1f631", "\\u1f632", "\\u1f633", "\\u1f637", // "\\u1f44d", "\\u1f44e", "\\u1f44f"}; // // static String getEmojiByUnicode(int unicode) { // return new String(Character.toChars(unicode)); // } // // private static Pattern pattern; // // static { // emotions = new ArrayList<String>(); // int i; // for (i = 0; i < emotionCodes.length; i++) { // emotions.add(getEmojiByUnicode(emotionCodes[i])); // } // emotions1 = emotions.subList(0, 21); // emotions2 = emotions.subList(21, emotions.size()); // // emotionTexts = new ArrayList<String>(); // for (String emojiCode : emojiCodes) { // emotionTexts.add(emojiCode); // } // emotionTexts1 = emotionTexts.subList(0, 21); // emotionTexts2 = emotionTexts.subList(21, emotionTexts.size()); // pattern = buildPattern(); // } // // private static Pattern buildPattern() { // return Pattern.compile("\\\\u1f[a-z0-9]{3}"); // } // // public static boolean haveEmotion(String text) { // Matcher matcher = pattern.matcher(text); // if (matcher.find()) { // return true; // } else { // return false; // } // } // // public static CharSequence scaleEmotions(String text) { // SpannableString spannableString = new SpannableString(text); // for (String emotion : emotions) { // Pattern pattern = Pattern.compile(emotion); // Matcher matcher = pattern.matcher(text); // while (matcher.find()) { // int start = matcher.start(); // int end = matcher.end(); // spannableString.setSpan(new RelativeSizeSpan(1.2f), start, end, Spanned.SPAN_INCLUSIVE_EXCLUSIVE); // } // } // return spannableString; // } // // public static CharSequence replace(Context ctx, String text) { // SpannableString spannableString = new SpannableString(text); // Matcher matcher = pattern.matcher(text); // while (matcher.find()) { // String factText = matcher.group(); // String key = factText.substring(1); // if (emotionTexts.contains(factText)) { // Bitmap bitmap = getDrawableByName(ctx, key); // ImageSpan image = new ImageSpan(ctx, bitmap); // int start = matcher.start(); // int end = matcher.end(); // spannableString.setSpan(image, start, end, // Spannable.SPAN_EXCLUSIVE_EXCLUSIVE); // } // } // return spannableString; // } // // public static Bitmap getDrawableByName(Context ctx, String name) { // BitmapFactory.Options options = new BitmapFactory.Options(); // Bitmap bitmap = BitmapFactory.decodeResource(ctx.getResources(), // ctx.getResources().getIdentifier(name, "drawable", // ctx.getPackageName()), options); // return bitmap; // } // } // Path: src/com/example/lovetalk/view/EmotionEditText.java import com.example.lovetalk.util.EmotionUtils; import android.content.Context; import android.text.TextUtils; import android.util.AttributeSet; import android.widget.EditText; package com.example.lovetalk.view; public class EmotionEditText extends EditText { public EmotionEditText(Context context) { super(context); } public EmotionEditText(Context context, AttributeSet attrs, int defStyle) { super(context, attrs, defStyle); } public EmotionEditText(Context context, AttributeSet attrs) { super(context, attrs); } @Override public void setText(CharSequence text, BufferType type) { if (!TextUtils.isEmpty(text)) {
super.setText(EmotionUtils.replace(getContext(), text.toString()), type);
lanixzcj/LoveTalkClient
src/com/example/lovetalk/adapter/AddFriendAdapter.java
// Path: src/com/example/lovetalk/service/AddRequestService.java // public class AddRequestService { // public static int countAddRequests() throws AVException { // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.setCachePolicy(AVQuery.CachePolicy.NETWORK_ELSE_CACHE); // q.whereEqualTo(AddRequest.TO_USER, AVUser.getCurrentUser()); // try { // return q.count(); // } catch (AVException e) { // if (e.getCode() == AVException.CACHE_MISS) { // return 0; // } else { // throw e; // } // } // } // // public static List<AddRequest> findAddRequests() throws AVException { // AVUser user = AVUser.getCurrentUser(); // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.include(AddRequest.FROM_USER); // q.whereEqualTo(AddRequest.TO_USER, user); // q.orderByDescending("createdAt"); // q.setCachePolicy(AVQuery.CachePolicy.NETWORK_ELSE_CACHE); // return q.find(); // } // // public static boolean hasAddRequest() throws AVException { // PreferenceMap preferenceMap = PreferenceMap.getMyPrefDao(DemoApplication.context); // int addRequestN = preferenceMap.getAddRequestN(); // int requestN = countAddRequests(); // if (requestN > addRequestN) { // return true; // } else { // return false; // } // } // // public static void agreeAddRequest(final AddRequest addRequest, final SaveCallback saveCallback) { // UserService.addFriend(addRequest.getFromUser().getObjectId(), new SaveCallback() { // @Override // public void done(AVException e) { // if (e != null) { // if (e.getCode() == AVException.DUPLICATE_VALUE) { // addRequest.setStatus(AddRequest.STATUS_DONE); // addRequest.saveInBackground(saveCallback); // } else { // saveCallback.done(e); // } // } else { // addRequest.setStatus(AddRequest.STATUS_DONE); // addRequest.saveInBackground(saveCallback); // } // } // }); // } // // public static void createAddRequest(AVUser toUser) throws Exception { // AVUser curUser = AVUser.getCurrentUser(); // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.whereEqualTo(AddRequest.FROM_USER, curUser); // q.whereEqualTo(AddRequest.TO_USER, toUser); // q.whereEqualTo(AddRequest.STATUS, AddRequest.STATUS_WAIT); // int count = 0; // try { // count = q.count(); // } catch (AVException e) { // e.printStackTrace(); // if (e.getCode() == AVException.OBJECT_NOT_FOUND) { // count = 0; // } else { // throw e; // } // } // if (count > 0) { // throw new Exception(DemoApplication.context.getString(R.string.contact_alreadyCreateAddRequest)); // } else { // AddRequest add = new AddRequest(); // add.setFromUser(curUser); // add.setToUser(toUser); // add.setStatus(AddRequest.STATUS_WAIT); // add.save(); // } // } // // public static void createAddRequestInBackground(Context ctx, final AVUser user) { // new MyAsyncTask(ctx) { // @Override // protected void doInBack() throws Exception { // AddRequestService.createAddRequest(user); // } // // @Override // protected void onSucceed() { // Utils.toast(R.string.contact_sendRequestSucceed); // } // }.execute(); // } // } // // Path: src/com/example/lovetalk/view/ViewHolder.java // public class ViewHolder { // public static <T extends View> T findViewById(View view, int id) { // SparseArray<View> viewHolder = (SparseArray<View>) view.getTag(); // if (viewHolder == null) { // viewHolder = new SparseArray<View>(); // view.setTag(viewHolder); // } // View childView = viewHolder.get(id); // if (childView == null) { // childView = view.findViewById(id); // viewHolder.put(id, childView); // } // return (T) childView; // } // }
import android.content.Context; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.widget.Button; import android.widget.ImageView; import android.widget.TextView; import com.avos.avoscloud.AVUser; import com.example.lovetalk.R; import com.example.lovetalk.service.AddRequestService; import com.example.lovetalk.view.ViewHolder; import java.util.List;
package com.example.lovetalk.adapter; public class AddFriendAdapter extends BaseListAdapter<AVUser> { Context mContext; public AddFriendAdapter(Context context, List<AVUser> list) { super(context, list); // TODO Auto-generated constructor stub mContext = context; } @Override public View getView(int position, View conView, ViewGroup parent) { // TODO Auto-generated method stub if (conView == null) { conView = inflater.inflate(R.layout.contact_add_friend_item, null); } final AVUser user = datas.get(position);
// Path: src/com/example/lovetalk/service/AddRequestService.java // public class AddRequestService { // public static int countAddRequests() throws AVException { // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.setCachePolicy(AVQuery.CachePolicy.NETWORK_ELSE_CACHE); // q.whereEqualTo(AddRequest.TO_USER, AVUser.getCurrentUser()); // try { // return q.count(); // } catch (AVException e) { // if (e.getCode() == AVException.CACHE_MISS) { // return 0; // } else { // throw e; // } // } // } // // public static List<AddRequest> findAddRequests() throws AVException { // AVUser user = AVUser.getCurrentUser(); // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.include(AddRequest.FROM_USER); // q.whereEqualTo(AddRequest.TO_USER, user); // q.orderByDescending("createdAt"); // q.setCachePolicy(AVQuery.CachePolicy.NETWORK_ELSE_CACHE); // return q.find(); // } // // public static boolean hasAddRequest() throws AVException { // PreferenceMap preferenceMap = PreferenceMap.getMyPrefDao(DemoApplication.context); // int addRequestN = preferenceMap.getAddRequestN(); // int requestN = countAddRequests(); // if (requestN > addRequestN) { // return true; // } else { // return false; // } // } // // public static void agreeAddRequest(final AddRequest addRequest, final SaveCallback saveCallback) { // UserService.addFriend(addRequest.getFromUser().getObjectId(), new SaveCallback() { // @Override // public void done(AVException e) { // if (e != null) { // if (e.getCode() == AVException.DUPLICATE_VALUE) { // addRequest.setStatus(AddRequest.STATUS_DONE); // addRequest.saveInBackground(saveCallback); // } else { // saveCallback.done(e); // } // } else { // addRequest.setStatus(AddRequest.STATUS_DONE); // addRequest.saveInBackground(saveCallback); // } // } // }); // } // // public static void createAddRequest(AVUser toUser) throws Exception { // AVUser curUser = AVUser.getCurrentUser(); // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.whereEqualTo(AddRequest.FROM_USER, curUser); // q.whereEqualTo(AddRequest.TO_USER, toUser); // q.whereEqualTo(AddRequest.STATUS, AddRequest.STATUS_WAIT); // int count = 0; // try { // count = q.count(); // } catch (AVException e) { // e.printStackTrace(); // if (e.getCode() == AVException.OBJECT_NOT_FOUND) { // count = 0; // } else { // throw e; // } // } // if (count > 0) { // throw new Exception(DemoApplication.context.getString(R.string.contact_alreadyCreateAddRequest)); // } else { // AddRequest add = new AddRequest(); // add.setFromUser(curUser); // add.setToUser(toUser); // add.setStatus(AddRequest.STATUS_WAIT); // add.save(); // } // } // // public static void createAddRequestInBackground(Context ctx, final AVUser user) { // new MyAsyncTask(ctx) { // @Override // protected void doInBack() throws Exception { // AddRequestService.createAddRequest(user); // } // // @Override // protected void onSucceed() { // Utils.toast(R.string.contact_sendRequestSucceed); // } // }.execute(); // } // } // // Path: src/com/example/lovetalk/view/ViewHolder.java // public class ViewHolder { // public static <T extends View> T findViewById(View view, int id) { // SparseArray<View> viewHolder = (SparseArray<View>) view.getTag(); // if (viewHolder == null) { // viewHolder = new SparseArray<View>(); // view.setTag(viewHolder); // } // View childView = viewHolder.get(id); // if (childView == null) { // childView = view.findViewById(id); // viewHolder.put(id, childView); // } // return (T) childView; // } // } // Path: src/com/example/lovetalk/adapter/AddFriendAdapter.java import android.content.Context; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.widget.Button; import android.widget.ImageView; import android.widget.TextView; import com.avos.avoscloud.AVUser; import com.example.lovetalk.R; import com.example.lovetalk.service.AddRequestService; import com.example.lovetalk.view.ViewHolder; import java.util.List; package com.example.lovetalk.adapter; public class AddFriendAdapter extends BaseListAdapter<AVUser> { Context mContext; public AddFriendAdapter(Context context, List<AVUser> list) { super(context, list); // TODO Auto-generated constructor stub mContext = context; } @Override public View getView(int position, View conView, ViewGroup parent) { // TODO Auto-generated method stub if (conView == null) { conView = inflater.inflate(R.layout.contact_add_friend_item, null); } final AVUser user = datas.get(position);
TextView nameView = ViewHolder.findViewById(conView, R.id.name);
lanixzcj/LoveTalkClient
src/com/example/lovetalk/adapter/AddFriendAdapter.java
// Path: src/com/example/lovetalk/service/AddRequestService.java // public class AddRequestService { // public static int countAddRequests() throws AVException { // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.setCachePolicy(AVQuery.CachePolicy.NETWORK_ELSE_CACHE); // q.whereEqualTo(AddRequest.TO_USER, AVUser.getCurrentUser()); // try { // return q.count(); // } catch (AVException e) { // if (e.getCode() == AVException.CACHE_MISS) { // return 0; // } else { // throw e; // } // } // } // // public static List<AddRequest> findAddRequests() throws AVException { // AVUser user = AVUser.getCurrentUser(); // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.include(AddRequest.FROM_USER); // q.whereEqualTo(AddRequest.TO_USER, user); // q.orderByDescending("createdAt"); // q.setCachePolicy(AVQuery.CachePolicy.NETWORK_ELSE_CACHE); // return q.find(); // } // // public static boolean hasAddRequest() throws AVException { // PreferenceMap preferenceMap = PreferenceMap.getMyPrefDao(DemoApplication.context); // int addRequestN = preferenceMap.getAddRequestN(); // int requestN = countAddRequests(); // if (requestN > addRequestN) { // return true; // } else { // return false; // } // } // // public static void agreeAddRequest(final AddRequest addRequest, final SaveCallback saveCallback) { // UserService.addFriend(addRequest.getFromUser().getObjectId(), new SaveCallback() { // @Override // public void done(AVException e) { // if (e != null) { // if (e.getCode() == AVException.DUPLICATE_VALUE) { // addRequest.setStatus(AddRequest.STATUS_DONE); // addRequest.saveInBackground(saveCallback); // } else { // saveCallback.done(e); // } // } else { // addRequest.setStatus(AddRequest.STATUS_DONE); // addRequest.saveInBackground(saveCallback); // } // } // }); // } // // public static void createAddRequest(AVUser toUser) throws Exception { // AVUser curUser = AVUser.getCurrentUser(); // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.whereEqualTo(AddRequest.FROM_USER, curUser); // q.whereEqualTo(AddRequest.TO_USER, toUser); // q.whereEqualTo(AddRequest.STATUS, AddRequest.STATUS_WAIT); // int count = 0; // try { // count = q.count(); // } catch (AVException e) { // e.printStackTrace(); // if (e.getCode() == AVException.OBJECT_NOT_FOUND) { // count = 0; // } else { // throw e; // } // } // if (count > 0) { // throw new Exception(DemoApplication.context.getString(R.string.contact_alreadyCreateAddRequest)); // } else { // AddRequest add = new AddRequest(); // add.setFromUser(curUser); // add.setToUser(toUser); // add.setStatus(AddRequest.STATUS_WAIT); // add.save(); // } // } // // public static void createAddRequestInBackground(Context ctx, final AVUser user) { // new MyAsyncTask(ctx) { // @Override // protected void doInBack() throws Exception { // AddRequestService.createAddRequest(user); // } // // @Override // protected void onSucceed() { // Utils.toast(R.string.contact_sendRequestSucceed); // } // }.execute(); // } // } // // Path: src/com/example/lovetalk/view/ViewHolder.java // public class ViewHolder { // public static <T extends View> T findViewById(View view, int id) { // SparseArray<View> viewHolder = (SparseArray<View>) view.getTag(); // if (viewHolder == null) { // viewHolder = new SparseArray<View>(); // view.setTag(viewHolder); // } // View childView = viewHolder.get(id); // if (childView == null) { // childView = view.findViewById(id); // viewHolder.put(id, childView); // } // return (T) childView; // } // }
import android.content.Context; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.widget.Button; import android.widget.ImageView; import android.widget.TextView; import com.avos.avoscloud.AVUser; import com.example.lovetalk.R; import com.example.lovetalk.service.AddRequestService; import com.example.lovetalk.view.ViewHolder; import java.util.List;
package com.example.lovetalk.adapter; public class AddFriendAdapter extends BaseListAdapter<AVUser> { Context mContext; public AddFriendAdapter(Context context, List<AVUser> list) { super(context, list); // TODO Auto-generated constructor stub mContext = context; } @Override public View getView(int position, View conView, ViewGroup parent) { // TODO Auto-generated method stub if (conView == null) { conView = inflater.inflate(R.layout.contact_add_friend_item, null); } final AVUser user = datas.get(position); TextView nameView = ViewHolder.findViewById(conView, R.id.name); ImageView avatarView = ViewHolder.findViewById(conView, R.id.avatar); Button addBtn = ViewHolder.findViewById(conView, R.id.add); // String avatarUrl = contact.getAvatarUrl(); // UserService.displayAvatar(avatarUrl, avatarView); nameView.setText(user.getUsername()); addBtn.setText(R.string.add); addBtn.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) {
// Path: src/com/example/lovetalk/service/AddRequestService.java // public class AddRequestService { // public static int countAddRequests() throws AVException { // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.setCachePolicy(AVQuery.CachePolicy.NETWORK_ELSE_CACHE); // q.whereEqualTo(AddRequest.TO_USER, AVUser.getCurrentUser()); // try { // return q.count(); // } catch (AVException e) { // if (e.getCode() == AVException.CACHE_MISS) { // return 0; // } else { // throw e; // } // } // } // // public static List<AddRequest> findAddRequests() throws AVException { // AVUser user = AVUser.getCurrentUser(); // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.include(AddRequest.FROM_USER); // q.whereEqualTo(AddRequest.TO_USER, user); // q.orderByDescending("createdAt"); // q.setCachePolicy(AVQuery.CachePolicy.NETWORK_ELSE_CACHE); // return q.find(); // } // // public static boolean hasAddRequest() throws AVException { // PreferenceMap preferenceMap = PreferenceMap.getMyPrefDao(DemoApplication.context); // int addRequestN = preferenceMap.getAddRequestN(); // int requestN = countAddRequests(); // if (requestN > addRequestN) { // return true; // } else { // return false; // } // } // // public static void agreeAddRequest(final AddRequest addRequest, final SaveCallback saveCallback) { // UserService.addFriend(addRequest.getFromUser().getObjectId(), new SaveCallback() { // @Override // public void done(AVException e) { // if (e != null) { // if (e.getCode() == AVException.DUPLICATE_VALUE) { // addRequest.setStatus(AddRequest.STATUS_DONE); // addRequest.saveInBackground(saveCallback); // } else { // saveCallback.done(e); // } // } else { // addRequest.setStatus(AddRequest.STATUS_DONE); // addRequest.saveInBackground(saveCallback); // } // } // }); // } // // public static void createAddRequest(AVUser toUser) throws Exception { // AVUser curUser = AVUser.getCurrentUser(); // AVQuery<AddRequest> q = AVObject.getQuery(AddRequest.class); // q.whereEqualTo(AddRequest.FROM_USER, curUser); // q.whereEqualTo(AddRequest.TO_USER, toUser); // q.whereEqualTo(AddRequest.STATUS, AddRequest.STATUS_WAIT); // int count = 0; // try { // count = q.count(); // } catch (AVException e) { // e.printStackTrace(); // if (e.getCode() == AVException.OBJECT_NOT_FOUND) { // count = 0; // } else { // throw e; // } // } // if (count > 0) { // throw new Exception(DemoApplication.context.getString(R.string.contact_alreadyCreateAddRequest)); // } else { // AddRequest add = new AddRequest(); // add.setFromUser(curUser); // add.setToUser(toUser); // add.setStatus(AddRequest.STATUS_WAIT); // add.save(); // } // } // // public static void createAddRequestInBackground(Context ctx, final AVUser user) { // new MyAsyncTask(ctx) { // @Override // protected void doInBack() throws Exception { // AddRequestService.createAddRequest(user); // } // // @Override // protected void onSucceed() { // Utils.toast(R.string.contact_sendRequestSucceed); // } // }.execute(); // } // } // // Path: src/com/example/lovetalk/view/ViewHolder.java // public class ViewHolder { // public static <T extends View> T findViewById(View view, int id) { // SparseArray<View> viewHolder = (SparseArray<View>) view.getTag(); // if (viewHolder == null) { // viewHolder = new SparseArray<View>(); // view.setTag(viewHolder); // } // View childView = viewHolder.get(id); // if (childView == null) { // childView = view.findViewById(id); // viewHolder.put(id, childView); // } // return (T) childView; // } // } // Path: src/com/example/lovetalk/adapter/AddFriendAdapter.java import android.content.Context; import android.view.View; import android.view.View.OnClickListener; import android.view.ViewGroup; import android.widget.Button; import android.widget.ImageView; import android.widget.TextView; import com.avos.avoscloud.AVUser; import com.example.lovetalk.R; import com.example.lovetalk.service.AddRequestService; import com.example.lovetalk.view.ViewHolder; import java.util.List; package com.example.lovetalk.adapter; public class AddFriendAdapter extends BaseListAdapter<AVUser> { Context mContext; public AddFriendAdapter(Context context, List<AVUser> list) { super(context, list); // TODO Auto-generated constructor stub mContext = context; } @Override public View getView(int position, View conView, ViewGroup parent) { // TODO Auto-generated method stub if (conView == null) { conView = inflater.inflate(R.layout.contact_add_friend_item, null); } final AVUser user = datas.get(position); TextView nameView = ViewHolder.findViewById(conView, R.id.name); ImageView avatarView = ViewHolder.findViewById(conView, R.id.avatar); Button addBtn = ViewHolder.findViewById(conView, R.id.add); // String avatarUrl = contact.getAvatarUrl(); // UserService.displayAvatar(avatarUrl, avatarView); nameView.setText(user.getUsername()); addBtn.setText(R.string.add); addBtn.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) {
AddRequestService.createAddRequestInBackground(mContext, user);
ga4gh/compliance
cts-java/src/test/java/org/ga4gh/cts/api/TestData.java
// Path: cts-java/src/test/java/org/ga4gh/cts/api/Utils.java // public static <T> List<T> aSingle(T s) { // return Collections.singletonList(s); // }
import com.google.common.collect.HashMultimap; import com.google.common.collect.Multiset; import com.google.common.collect.SetMultimap; import java.util.ArrayList; import java.util.Arrays; import java.util.List; import ga4gh.References.ReferenceSet; import static org.ga4gh.cts.api.Utils.aSingle;
package org.ga4gh.cts.api; /** * This class defines important constants that pertain to and describe the official test data. * It contains no methods and you cannot instantiate it. * * @author Herb Jellinek */ public class TestData { /** * You can't instantiate one of these. */ private TestData() { } /** * The default ID of the dataset that holds the test data. We use something readable so the * meaning is clear, but in reality the value of this is unlikely to be human-readable. */ public static final String DEFAULT_DATASET_ID = "compliance-dataset" ; /** * The name of the Java system property that sets the ID of the compliance dataset. */ private static final String DATASET_PROP_NAME = "ctk.tgt.dataset_id"; /** * The name of the reference in the standard test data. */ public static final String REFERENCE_NAME = "ref_brca1"; /** * The start of the reference data. */ public static final long REFERENCE_START = 0; /** * The end of the reference data. */ public static final long REFERENCE_END = 81187; /** * The name of the reference used for variant annotation in the standard test data. */ public static final String VARIANT_ANNOTATION_REFERENCE_NAME = "1"; /** * The names of the variant annotation sets used for variant annotation in the standard test data. */ public static final List<String> VARIANT_ANNOTATION_SET_NAMES = Arrays.asList("WASH7P", "OR4F"); /** * The names of known-good read groups. */ public static final SetMultimap<String, String> EXPECTED_READGROUPSET_READGROUP_NAMES = HashMultimap.create(); static { EXPECTED_READGROUPSET_READGROUP_NAMES.putAll("HG00096", Arrays.asList("SRR062634", "SRR062635", "SRR062641")); EXPECTED_READGROUPSET_READGROUP_NAMES.putAll("HG00099", Arrays.asList("SRR741411", "SRR741412")); //noinspection ArraysAsListWithZeroOrOneArgument EXPECTED_READGROUPSET_READGROUP_NAMES.putAll("HG00101", Arrays.asList("ERR229776")); } /** * The names of the readgroup sets in the standard compliance dataset. */ public static final Multiset<String> EXPECTED_READGROUPSETS_NAMES = EXPECTED_READGROUPSET_READGROUP_NAMES.keys(); /** * The names of all known {@link ga4gh.Reads.ReadGroup} objects, obtained from * {@link #EXPECTED_READGROUPSET_READGROUP_NAMES}. */ public static final List<String> EXPECTED_READGROUP_NAMES = new ArrayList<>(EXPECTED_READGROUPSET_READGROUP_NAMES.values()); /** * The AssemblyID (really, a name) of the test {@link ReferenceSet}. */ public static final String REFERENCESET_ASSEMBLY_ID = "hg37"; /** * Accession "numbers" (names, really) for the test {@link ReferenceSet}. */
// Path: cts-java/src/test/java/org/ga4gh/cts/api/Utils.java // public static <T> List<T> aSingle(T s) { // return Collections.singletonList(s); // } // Path: cts-java/src/test/java/org/ga4gh/cts/api/TestData.java import com.google.common.collect.HashMultimap; import com.google.common.collect.Multiset; import com.google.common.collect.SetMultimap; import java.util.ArrayList; import java.util.Arrays; import java.util.List; import ga4gh.References.ReferenceSet; import static org.ga4gh.cts.api.Utils.aSingle; package org.ga4gh.cts.api; /** * This class defines important constants that pertain to and describe the official test data. * It contains no methods and you cannot instantiate it. * * @author Herb Jellinek */ public class TestData { /** * You can't instantiate one of these. */ private TestData() { } /** * The default ID of the dataset that holds the test data. We use something readable so the * meaning is clear, but in reality the value of this is unlikely to be human-readable. */ public static final String DEFAULT_DATASET_ID = "compliance-dataset" ; /** * The name of the Java system property that sets the ID of the compliance dataset. */ private static final String DATASET_PROP_NAME = "ctk.tgt.dataset_id"; /** * The name of the reference in the standard test data. */ public static final String REFERENCE_NAME = "ref_brca1"; /** * The start of the reference data. */ public static final long REFERENCE_START = 0; /** * The end of the reference data. */ public static final long REFERENCE_END = 81187; /** * The name of the reference used for variant annotation in the standard test data. */ public static final String VARIANT_ANNOTATION_REFERENCE_NAME = "1"; /** * The names of the variant annotation sets used for variant annotation in the standard test data. */ public static final List<String> VARIANT_ANNOTATION_SET_NAMES = Arrays.asList("WASH7P", "OR4F"); /** * The names of known-good read groups. */ public static final SetMultimap<String, String> EXPECTED_READGROUPSET_READGROUP_NAMES = HashMultimap.create(); static { EXPECTED_READGROUPSET_READGROUP_NAMES.putAll("HG00096", Arrays.asList("SRR062634", "SRR062635", "SRR062641")); EXPECTED_READGROUPSET_READGROUP_NAMES.putAll("HG00099", Arrays.asList("SRR741411", "SRR741412")); //noinspection ArraysAsListWithZeroOrOneArgument EXPECTED_READGROUPSET_READGROUP_NAMES.putAll("HG00101", Arrays.asList("ERR229776")); } /** * The names of the readgroup sets in the standard compliance dataset. */ public static final Multiset<String> EXPECTED_READGROUPSETS_NAMES = EXPECTED_READGROUPSET_READGROUP_NAMES.keys(); /** * The names of all known {@link ga4gh.Reads.ReadGroup} objects, obtained from * {@link #EXPECTED_READGROUPSET_READGROUP_NAMES}. */ public static final List<String> EXPECTED_READGROUP_NAMES = new ArrayList<>(EXPECTED_READGROUPSET_READGROUP_NAMES.values()); /** * The AssemblyID (really, a name) of the test {@link ReferenceSet}. */ public static final String REFERENCESET_ASSEMBLY_ID = "hg37"; /** * Accession "numbers" (names, really) for the test {@link ReferenceSet}. */
public static final List<String> REFERENCESET_ACCESSIONS = aSingle("GA4GH_CTS_01");
ga4gh/compliance
ctk-transport/src/main/java/org/ga4gh/ctk/transport/protobuf/Get.java
// Path: ctk-transport/src/main/java/org/ga4gh/ctk/transport/WireTracker.java // public class WireTracker { // final static Logger log = getLogger(WireTracker.class); // // /** // * <p>The target url with which this WireTracker communicated.</p> // */ // public String theUrl; // // /** // * <p>The string BODY sent to the target.</p> // */ // public String bodySent; // // /** // * <p>The string BODY received from the target</p> // */ // public String bodyReceived; // // private GAException gae; // // private String gaeMessage; // convenience and in case non-parseable // // private int gaeErrorCode; // convenience and in case non-parseable // // /** // * <p>Returns true if and only if a {@link GAException} was received on this interaction, // * AND it was parsable.</p> // * <p>If it's non-parseable then the gaeMessage field // * will hold the returned BODY (same as the bodyReceived field) and the // * gaeErrorCode will be set to -1</p> // * // * @return true if we received a {@link GAException} on this interaction // */ // @SuppressWarnings("ThrowableResultOfMethodCallIgnored") // public boolean gotParseableGAE() { // return getGae() != null; // } // // private boolean parseableGae = false; // // RespCode responseStatus; // // public int getErrorCode() { // return gaeErrorCode; // } // // public String getMessage() { // return gaeMessage; // } // // public GAException getGae() { // if (responseStatus != RespCode.OK) { // // parse the received body // Gson gson = new Gson(); // try { // gae = gson.fromJson(bodyReceived, GAException.class); // gaeMessage = gae.getMessage(); // gaeErrorCode = gae.getErrorCode(); // } catch (Exception e) { // log.warn("Parse failure on GAException: BODY < " + bodyReceived + " > " + e // .toString()); // gaeErrorCode = -1; // gaeMessage = bodyReceived; // parseableGae = false; // gae = null; // } // } // return gae; // } // // public RespCode getResponseStatus() { // return responseStatus; // } // // public void setResponseStatus(RespCode responseStatus) { // this.responseStatus = responseStatus; // } // }
import com.google.protobuf.GeneratedMessage; import com.mashape.unirest.http.HttpResponse; import com.mashape.unirest.http.JsonNode; import com.mashape.unirest.http.Unirest; import com.mashape.unirest.http.exceptions.UnirestException; import org.ga4gh.ctk.transport.WireTracker; import java.util.Map;
package org.ga4gh.ctk.transport.protobuf; public class Get<T extends GeneratedMessage.Builder> extends Base<T> { private final String id; private final Map<String, Object> queryParams;
// Path: ctk-transport/src/main/java/org/ga4gh/ctk/transport/WireTracker.java // public class WireTracker { // final static Logger log = getLogger(WireTracker.class); // // /** // * <p>The target url with which this WireTracker communicated.</p> // */ // public String theUrl; // // /** // * <p>The string BODY sent to the target.</p> // */ // public String bodySent; // // /** // * <p>The string BODY received from the target</p> // */ // public String bodyReceived; // // private GAException gae; // // private String gaeMessage; // convenience and in case non-parseable // // private int gaeErrorCode; // convenience and in case non-parseable // // /** // * <p>Returns true if and only if a {@link GAException} was received on this interaction, // * AND it was parsable.</p> // * <p>If it's non-parseable then the gaeMessage field // * will hold the returned BODY (same as the bodyReceived field) and the // * gaeErrorCode will be set to -1</p> // * // * @return true if we received a {@link GAException} on this interaction // */ // @SuppressWarnings("ThrowableResultOfMethodCallIgnored") // public boolean gotParseableGAE() { // return getGae() != null; // } // // private boolean parseableGae = false; // // RespCode responseStatus; // // public int getErrorCode() { // return gaeErrorCode; // } // // public String getMessage() { // return gaeMessage; // } // // public GAException getGae() { // if (responseStatus != RespCode.OK) { // // parse the received body // Gson gson = new Gson(); // try { // gae = gson.fromJson(bodyReceived, GAException.class); // gaeMessage = gae.getMessage(); // gaeErrorCode = gae.getErrorCode(); // } catch (Exception e) { // log.warn("Parse failure on GAException: BODY < " + bodyReceived + " > " + e // .toString()); // gaeErrorCode = -1; // gaeMessage = bodyReceived; // parseableGae = false; // gae = null; // } // } // return gae; // } // // public RespCode getResponseStatus() { // return responseStatus; // } // // public void setResponseStatus(RespCode responseStatus) { // this.responseStatus = responseStatus; // } // } // Path: ctk-transport/src/main/java/org/ga4gh/ctk/transport/protobuf/Get.java import com.google.protobuf.GeneratedMessage; import com.mashape.unirest.http.HttpResponse; import com.mashape.unirest.http.JsonNode; import com.mashape.unirest.http.Unirest; import com.mashape.unirest.http.exceptions.UnirestException; import org.ga4gh.ctk.transport.WireTracker; import java.util.Map; package org.ga4gh.ctk.transport.protobuf; public class Get<T extends GeneratedMessage.Builder> extends Base<T> { private final String id; private final Map<String, Object> queryParams;
public Get(String urlRoot, String path, String id, Map<String, Object> queryParams, T responseBuilder, WireTracker wireTracker) {
ga4gh/compliance
ctk-transport/src/main/java/org/ga4gh/ctk/transport/protobuf/Post.java
// Path: ctk-transport/src/main/java/org/ga4gh/ctk/transport/WireTracker.java // public class WireTracker { // final static Logger log = getLogger(WireTracker.class); // // /** // * <p>The target url with which this WireTracker communicated.</p> // */ // public String theUrl; // // /** // * <p>The string BODY sent to the target.</p> // */ // public String bodySent; // // /** // * <p>The string BODY received from the target</p> // */ // public String bodyReceived; // // private GAException gae; // // private String gaeMessage; // convenience and in case non-parseable // // private int gaeErrorCode; // convenience and in case non-parseable // // /** // * <p>Returns true if and only if a {@link GAException} was received on this interaction, // * AND it was parsable.</p> // * <p>If it's non-parseable then the gaeMessage field // * will hold the returned BODY (same as the bodyReceived field) and the // * gaeErrorCode will be set to -1</p> // * // * @return true if we received a {@link GAException} on this interaction // */ // @SuppressWarnings("ThrowableResultOfMethodCallIgnored") // public boolean gotParseableGAE() { // return getGae() != null; // } // // private boolean parseableGae = false; // // RespCode responseStatus; // // public int getErrorCode() { // return gaeErrorCode; // } // // public String getMessage() { // return gaeMessage; // } // // public GAException getGae() { // if (responseStatus != RespCode.OK) { // // parse the received body // Gson gson = new Gson(); // try { // gae = gson.fromJson(bodyReceived, GAException.class); // gaeMessage = gae.getMessage(); // gaeErrorCode = gae.getErrorCode(); // } catch (Exception e) { // log.warn("Parse failure on GAException: BODY < " + bodyReceived + " > " + e // .toString()); // gaeErrorCode = -1; // gaeMessage = bodyReceived; // parseableGae = false; // gae = null; // } // } // return gae; // } // // public RespCode getResponseStatus() { // return responseStatus; // } // // public void setResponseStatus(RespCode responseStatus) { // this.responseStatus = responseStatus; // } // }
import com.google.protobuf.GeneratedMessage; import com.google.protobuf.InvalidProtocolBufferException; import com.google.protobuf.MessageOrBuilder; import com.google.protobuf.util.JsonFormat; import com.mashape.unirest.http.HttpResponse; import com.mashape.unirest.http.JsonNode; import com.mashape.unirest.http.Unirest; import com.mashape.unirest.http.exceptions.UnirestException; import org.ga4gh.ctk.transport.WireTracker;
package org.ga4gh.ctk.transport.protobuf; public class Post<T extends GeneratedMessage.Builder> extends Base<T> { private final String json;
// Path: ctk-transport/src/main/java/org/ga4gh/ctk/transport/WireTracker.java // public class WireTracker { // final static Logger log = getLogger(WireTracker.class); // // /** // * <p>The target url with which this WireTracker communicated.</p> // */ // public String theUrl; // // /** // * <p>The string BODY sent to the target.</p> // */ // public String bodySent; // // /** // * <p>The string BODY received from the target</p> // */ // public String bodyReceived; // // private GAException gae; // // private String gaeMessage; // convenience and in case non-parseable // // private int gaeErrorCode; // convenience and in case non-parseable // // /** // * <p>Returns true if and only if a {@link GAException} was received on this interaction, // * AND it was parsable.</p> // * <p>If it's non-parseable then the gaeMessage field // * will hold the returned BODY (same as the bodyReceived field) and the // * gaeErrorCode will be set to -1</p> // * // * @return true if we received a {@link GAException} on this interaction // */ // @SuppressWarnings("ThrowableResultOfMethodCallIgnored") // public boolean gotParseableGAE() { // return getGae() != null; // } // // private boolean parseableGae = false; // // RespCode responseStatus; // // public int getErrorCode() { // return gaeErrorCode; // } // // public String getMessage() { // return gaeMessage; // } // // public GAException getGae() { // if (responseStatus != RespCode.OK) { // // parse the received body // Gson gson = new Gson(); // try { // gae = gson.fromJson(bodyReceived, GAException.class); // gaeMessage = gae.getMessage(); // gaeErrorCode = gae.getErrorCode(); // } catch (Exception e) { // log.warn("Parse failure on GAException: BODY < " + bodyReceived + " > " + e // .toString()); // gaeErrorCode = -1; // gaeMessage = bodyReceived; // parseableGae = false; // gae = null; // } // } // return gae; // } // // public RespCode getResponseStatus() { // return responseStatus; // } // // public void setResponseStatus(RespCode responseStatus) { // this.responseStatus = responseStatus; // } // } // Path: ctk-transport/src/main/java/org/ga4gh/ctk/transport/protobuf/Post.java import com.google.protobuf.GeneratedMessage; import com.google.protobuf.InvalidProtocolBufferException; import com.google.protobuf.MessageOrBuilder; import com.google.protobuf.util.JsonFormat; import com.mashape.unirest.http.HttpResponse; import com.mashape.unirest.http.JsonNode; import com.mashape.unirest.http.Unirest; import com.mashape.unirest.http.exceptions.UnirestException; import org.ga4gh.ctk.transport.WireTracker; package org.ga4gh.ctk.transport.protobuf; public class Post<T extends GeneratedMessage.Builder> extends Base<T> { private final String json;
public Post(String urlRoot, String path, MessageOrBuilder request, T responseBuilder, WireTracker wireTracker) throws InvalidProtocolBufferException {
ga4gh/compliance
ctk-transport/src/main/java/org/ga4gh/ctk/transport/protobuf/Base.java
// Path: ctk-transport/src/main/java/org/ga4gh/ctk/transport/WireTracker.java // public class WireTracker { // final static Logger log = getLogger(WireTracker.class); // // /** // * <p>The target url with which this WireTracker communicated.</p> // */ // public String theUrl; // // /** // * <p>The string BODY sent to the target.</p> // */ // public String bodySent; // // /** // * <p>The string BODY received from the target</p> // */ // public String bodyReceived; // // private GAException gae; // // private String gaeMessage; // convenience and in case non-parseable // // private int gaeErrorCode; // convenience and in case non-parseable // // /** // * <p>Returns true if and only if a {@link GAException} was received on this interaction, // * AND it was parsable.</p> // * <p>If it's non-parseable then the gaeMessage field // * will hold the returned BODY (same as the bodyReceived field) and the // * gaeErrorCode will be set to -1</p> // * // * @return true if we received a {@link GAException} on this interaction // */ // @SuppressWarnings("ThrowableResultOfMethodCallIgnored") // public boolean gotParseableGAE() { // return getGae() != null; // } // // private boolean parseableGae = false; // // RespCode responseStatus; // // public int getErrorCode() { // return gaeErrorCode; // } // // public String getMessage() { // return gaeMessage; // } // // public GAException getGae() { // if (responseStatus != RespCode.OK) { // // parse the received body // Gson gson = new Gson(); // try { // gae = gson.fromJson(bodyReceived, GAException.class); // gaeMessage = gae.getMessage(); // gaeErrorCode = gae.getErrorCode(); // } catch (Exception e) { // log.warn("Parse failure on GAException: BODY < " + bodyReceived + " > " + e // .toString()); // gaeErrorCode = -1; // gaeMessage = bodyReceived; // parseableGae = false; // gae = null; // } // } // return gae; // } // // public RespCode getResponseStatus() { // return responseStatus; // } // // public void setResponseStatus(RespCode responseStatus) { // this.responseStatus = responseStatus; // } // }
import com.google.common.base.CharMatcher; import com.google.common.collect.HashBasedTable; import com.google.common.collect.Table; import com.google.protobuf.GeneratedMessage; import com.google.protobuf.InvalidProtocolBufferException; import com.google.protobuf.util.JsonFormat; import com.mashape.unirest.http.HttpResponse; import com.mashape.unirest.http.JsonNode; import com.mashape.unirest.http.exceptions.UnirestException; import ga4gh.Common; import org.apache.http.HttpStatus; import org.ga4gh.ctk.transport.GAWrapperException; import org.ga4gh.ctk.transport.WireTracker; import static org.ga4gh.ctk.transport.RespCode.fromInt; import static org.ga4gh.ctk.transport.TransportUtils.makeUrl; import static org.slf4j.LoggerFactory.getLogger;
package org.ga4gh.ctk.transport.protobuf; public abstract class Base<T extends GeneratedMessage.Builder> { static org.slf4j.Logger log; /** * <p>Holds the message traffic sent/received during the entire test run. * Intended to support test quality/coverage reporting.</p> */ private static Table<String, String, Integer> messages; static { log = getLogger(Base.class); messages = HashBasedTable.create(); } /** * url root to system-under-test; e.g., "http://localhost:8000" */ private final String urlRoot; private final String path;
// Path: ctk-transport/src/main/java/org/ga4gh/ctk/transport/WireTracker.java // public class WireTracker { // final static Logger log = getLogger(WireTracker.class); // // /** // * <p>The target url with which this WireTracker communicated.</p> // */ // public String theUrl; // // /** // * <p>The string BODY sent to the target.</p> // */ // public String bodySent; // // /** // * <p>The string BODY received from the target</p> // */ // public String bodyReceived; // // private GAException gae; // // private String gaeMessage; // convenience and in case non-parseable // // private int gaeErrorCode; // convenience and in case non-parseable // // /** // * <p>Returns true if and only if a {@link GAException} was received on this interaction, // * AND it was parsable.</p> // * <p>If it's non-parseable then the gaeMessage field // * will hold the returned BODY (same as the bodyReceived field) and the // * gaeErrorCode will be set to -1</p> // * // * @return true if we received a {@link GAException} on this interaction // */ // @SuppressWarnings("ThrowableResultOfMethodCallIgnored") // public boolean gotParseableGAE() { // return getGae() != null; // } // // private boolean parseableGae = false; // // RespCode responseStatus; // // public int getErrorCode() { // return gaeErrorCode; // } // // public String getMessage() { // return gaeMessage; // } // // public GAException getGae() { // if (responseStatus != RespCode.OK) { // // parse the received body // Gson gson = new Gson(); // try { // gae = gson.fromJson(bodyReceived, GAException.class); // gaeMessage = gae.getMessage(); // gaeErrorCode = gae.getErrorCode(); // } catch (Exception e) { // log.warn("Parse failure on GAException: BODY < " + bodyReceived + " > " + e // .toString()); // gaeErrorCode = -1; // gaeMessage = bodyReceived; // parseableGae = false; // gae = null; // } // } // return gae; // } // // public RespCode getResponseStatus() { // return responseStatus; // } // // public void setResponseStatus(RespCode responseStatus) { // this.responseStatus = responseStatus; // } // } // Path: ctk-transport/src/main/java/org/ga4gh/ctk/transport/protobuf/Base.java import com.google.common.base.CharMatcher; import com.google.common.collect.HashBasedTable; import com.google.common.collect.Table; import com.google.protobuf.GeneratedMessage; import com.google.protobuf.InvalidProtocolBufferException; import com.google.protobuf.util.JsonFormat; import com.mashape.unirest.http.HttpResponse; import com.mashape.unirest.http.JsonNode; import com.mashape.unirest.http.exceptions.UnirestException; import ga4gh.Common; import org.apache.http.HttpStatus; import org.ga4gh.ctk.transport.GAWrapperException; import org.ga4gh.ctk.transport.WireTracker; import static org.ga4gh.ctk.transport.RespCode.fromInt; import static org.ga4gh.ctk.transport.TransportUtils.makeUrl; import static org.slf4j.LoggerFactory.getLogger; package org.ga4gh.ctk.transport.protobuf; public abstract class Base<T extends GeneratedMessage.Builder> { static org.slf4j.Logger log; /** * <p>Holds the message traffic sent/received during the entire test run. * Intended to support test quality/coverage reporting.</p> */ private static Table<String, String, Integer> messages; static { log = getLogger(Base.class); messages = HashBasedTable.create(); } /** * url root to system-under-test; e.g., "http://localhost:8000" */ private final String urlRoot; private final String path;
final WireTracker wireTracker;
kb10uy/Tencocoa
app/src/main/java/org/kb10uy/tencocoa/UserInformationFragment.java
// Path: app/src/main/java/org/kb10uy/tencocoa/model/TwitterAccountInformation.java // public class TwitterAccountInformation implements Serializable { // private static final long serialVersionUID = 2591925210205947107L; // // private long userId; // private String screenName; // private AccessToken token; // // public TwitterAccountInformation(AccessToken token) { // userId = token.getUserId(); // screenName = token.getScreenName(); // this.token = token; // } // // public AccessToken getAccessToken() { // return token; // } // // public String getScreenName() { // return screenName; // } // // public long getUserId() { // return userId; // } // } // // Path: app/src/main/java/org/kb10uy/tencocoa/views/TencocoaServiceProvider.java // public interface TencocoaServiceProvider { // TencocoaWritePermissionService getWritePermissionService(); // TencocoaReadPermissionService getReadPermissionService(); // TencocoaStreamingService getStreamingService(); // boolean isWriteBound(); // boolean isReadBound(); // boolean isStreamingBound(); // }
import android.content.Context; import android.content.Intent; import android.content.SharedPreferences; import android.net.Uri; import android.os.AsyncTask; import android.os.Bundle; import android.preference.PreferenceManager; import android.support.v4.app.Fragment; import android.support.v4.app.FragmentManager; import android.support.v4.app.FragmentPagerAdapter; import android.support.v4.view.ViewPager; import android.text.SpannableString; import android.text.Spanned; import android.text.method.LinkMovementMethod; import android.text.style.ClickableSpan; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import android.widget.ImageView; import android.widget.LinearLayout; import android.widget.TextView; import com.bumptech.glide.Glide; import com.google.common.base.Strings; import com.twitter.Extractor; import org.kb10uy.tencocoa.model.TwitterAccountInformation; import org.kb10uy.tencocoa.views.TencocoaServiceProvider; import java.util.List; import twitter4j.Status; import twitter4j.User;
package org.kb10uy.tencocoa; public class UserInformationFragment extends Fragment { private ViewPager mViewPager; private UserInformationFragmentPagerAdapter mAdapter; private User currentUser;
// Path: app/src/main/java/org/kb10uy/tencocoa/model/TwitterAccountInformation.java // public class TwitterAccountInformation implements Serializable { // private static final long serialVersionUID = 2591925210205947107L; // // private long userId; // private String screenName; // private AccessToken token; // // public TwitterAccountInformation(AccessToken token) { // userId = token.getUserId(); // screenName = token.getScreenName(); // this.token = token; // } // // public AccessToken getAccessToken() { // return token; // } // // public String getScreenName() { // return screenName; // } // // public long getUserId() { // return userId; // } // } // // Path: app/src/main/java/org/kb10uy/tencocoa/views/TencocoaServiceProvider.java // public interface TencocoaServiceProvider { // TencocoaWritePermissionService getWritePermissionService(); // TencocoaReadPermissionService getReadPermissionService(); // TencocoaStreamingService getStreamingService(); // boolean isWriteBound(); // boolean isReadBound(); // boolean isStreamingBound(); // } // Path: app/src/main/java/org/kb10uy/tencocoa/UserInformationFragment.java import android.content.Context; import android.content.Intent; import android.content.SharedPreferences; import android.net.Uri; import android.os.AsyncTask; import android.os.Bundle; import android.preference.PreferenceManager; import android.support.v4.app.Fragment; import android.support.v4.app.FragmentManager; import android.support.v4.app.FragmentPagerAdapter; import android.support.v4.view.ViewPager; import android.text.SpannableString; import android.text.Spanned; import android.text.method.LinkMovementMethod; import android.text.style.ClickableSpan; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import android.widget.ImageView; import android.widget.LinearLayout; import android.widget.TextView; import com.bumptech.glide.Glide; import com.google.common.base.Strings; import com.twitter.Extractor; import org.kb10uy.tencocoa.model.TwitterAccountInformation; import org.kb10uy.tencocoa.views.TencocoaServiceProvider; import java.util.List; import twitter4j.Status; import twitter4j.User; package org.kb10uy.tencocoa; public class UserInformationFragment extends Fragment { private ViewPager mViewPager; private UserInformationFragmentPagerAdapter mAdapter; private User currentUser;
private TencocoaServiceProvider mProvider;
kb10uy/Tencocoa
app/src/main/java/org/kb10uy/tencocoa/TencocoaWritePermissionService.java
// Path: app/src/main/java/org/kb10uy/tencocoa/model/TwitterAccountInformation.java // public class TwitterAccountInformation implements Serializable { // private static final long serialVersionUID = 2591925210205947107L; // // private long userId; // private String screenName; // private AccessToken token; // // public TwitterAccountInformation(AccessToken token) { // userId = token.getUserId(); // screenName = token.getScreenName(); // this.token = token; // } // // public AccessToken getAccessToken() { // return token; // } // // public String getScreenName() { // return screenName; // } // // public long getUserId() { // return userId; // } // } // // Path: app/src/main/java/org/kb10uy/tencocoa/model/TwitterHelper.java // public final class TwitterHelper { // // public static Twitter getTwitterInstance(String ck, String cs, AccessToken token) { // Configuration tencocoaConfig = new ConfigurationBuilder() // .setGZIPEnabled(true) // .setDispatcherImpl(TencocoaDispatcher.class.getName()) // .setOAuthConsumerKey(ck) // .setOAuthConsumerSecret(cs) // .setOAuthAccessToken(token.getToken()) // .setOAuthAccessTokenSecret(token.getTokenSecret()) // .build(); // Twitter tw = new TwitterFactory(tencocoaConfig).getInstance(); // return tw; // } // // public static TwitterStream getTwitterStreamInstance(String ck, String cs, AccessToken token) { // Configuration tencocoaConfig = new ConfigurationBuilder() // .setGZIPEnabled(true) // .setDispatcherImpl(TencocoaDispatcher.class.getName()) // .setOAuthConsumerKey(ck) // .setOAuthConsumerSecret(cs) // .setOAuthAccessToken(token.getToken()) // .setOAuthAccessTokenSecret(token.getTokenSecret()) // .build(); // TwitterStream tw = new TwitterStreamFactory(tencocoaConfig).getInstance(); // return tw; // } // // public static long[] convertMediaIds(List<UploadedMedia> media) { // long[] result = new long[media.size()]; // for (int i = 0; i < media.size(); i++) { // result[i]=media.get(i).getMediaId(); // } // return result; // } // // }
import android.app.Notification; import android.app.NotificationManager; import android.app.Service; import android.content.ContentResolver; import android.content.Intent; import android.content.SharedPreferences; import android.database.Cursor; import android.net.Uri; import android.os.AsyncTask; import android.os.Binder; import android.os.IBinder; import android.preference.PreferenceManager; import android.provider.MediaStore; import android.widget.Toast; import org.kb10uy.tencocoa.model.TwitterAccountInformation; import org.kb10uy.tencocoa.model.TwitterHelper; import java.io.File; import java.util.ArrayList; import java.util.List; import twitter4j.StatusUpdate; import twitter4j.Twitter; import twitter4j.TwitterException; import twitter4j.UploadedMedia; import twitter4j.User; import twitter4j.auth.AccessToken;
package org.kb10uy.tencocoa; public class TencocoaWritePermissionService extends Service { private static final int TENCOCOA_WRITE_PERMISSION_NOTIFICATION_ID = 0xC0C0A3;
// Path: app/src/main/java/org/kb10uy/tencocoa/model/TwitterAccountInformation.java // public class TwitterAccountInformation implements Serializable { // private static final long serialVersionUID = 2591925210205947107L; // // private long userId; // private String screenName; // private AccessToken token; // // public TwitterAccountInformation(AccessToken token) { // userId = token.getUserId(); // screenName = token.getScreenName(); // this.token = token; // } // // public AccessToken getAccessToken() { // return token; // } // // public String getScreenName() { // return screenName; // } // // public long getUserId() { // return userId; // } // } // // Path: app/src/main/java/org/kb10uy/tencocoa/model/TwitterHelper.java // public final class TwitterHelper { // // public static Twitter getTwitterInstance(String ck, String cs, AccessToken token) { // Configuration tencocoaConfig = new ConfigurationBuilder() // .setGZIPEnabled(true) // .setDispatcherImpl(TencocoaDispatcher.class.getName()) // .setOAuthConsumerKey(ck) // .setOAuthConsumerSecret(cs) // .setOAuthAccessToken(token.getToken()) // .setOAuthAccessTokenSecret(token.getTokenSecret()) // .build(); // Twitter tw = new TwitterFactory(tencocoaConfig).getInstance(); // return tw; // } // // public static TwitterStream getTwitterStreamInstance(String ck, String cs, AccessToken token) { // Configuration tencocoaConfig = new ConfigurationBuilder() // .setGZIPEnabled(true) // .setDispatcherImpl(TencocoaDispatcher.class.getName()) // .setOAuthConsumerKey(ck) // .setOAuthConsumerSecret(cs) // .setOAuthAccessToken(token.getToken()) // .setOAuthAccessTokenSecret(token.getTokenSecret()) // .build(); // TwitterStream tw = new TwitterStreamFactory(tencocoaConfig).getInstance(); // return tw; // } // // public static long[] convertMediaIds(List<UploadedMedia> media) { // long[] result = new long[media.size()]; // for (int i = 0; i < media.size(); i++) { // result[i]=media.get(i).getMediaId(); // } // return result; // } // // } // Path: app/src/main/java/org/kb10uy/tencocoa/TencocoaWritePermissionService.java import android.app.Notification; import android.app.NotificationManager; import android.app.Service; import android.content.ContentResolver; import android.content.Intent; import android.content.SharedPreferences; import android.database.Cursor; import android.net.Uri; import android.os.AsyncTask; import android.os.Binder; import android.os.IBinder; import android.preference.PreferenceManager; import android.provider.MediaStore; import android.widget.Toast; import org.kb10uy.tencocoa.model.TwitterAccountInformation; import org.kb10uy.tencocoa.model.TwitterHelper; import java.io.File; import java.util.ArrayList; import java.util.List; import twitter4j.StatusUpdate; import twitter4j.Twitter; import twitter4j.TwitterException; import twitter4j.UploadedMedia; import twitter4j.User; import twitter4j.auth.AccessToken; package org.kb10uy.tencocoa; public class TencocoaWritePermissionService extends Service { private static final int TENCOCOA_WRITE_PERMISSION_NOTIFICATION_ID = 0xC0C0A3;
private TwitterAccountInformation currentUser;
kb10uy/Tencocoa
app/src/main/java/org/kb10uy/tencocoa/TencocoaWritePermissionService.java
// Path: app/src/main/java/org/kb10uy/tencocoa/model/TwitterAccountInformation.java // public class TwitterAccountInformation implements Serializable { // private static final long serialVersionUID = 2591925210205947107L; // // private long userId; // private String screenName; // private AccessToken token; // // public TwitterAccountInformation(AccessToken token) { // userId = token.getUserId(); // screenName = token.getScreenName(); // this.token = token; // } // // public AccessToken getAccessToken() { // return token; // } // // public String getScreenName() { // return screenName; // } // // public long getUserId() { // return userId; // } // } // // Path: app/src/main/java/org/kb10uy/tencocoa/model/TwitterHelper.java // public final class TwitterHelper { // // public static Twitter getTwitterInstance(String ck, String cs, AccessToken token) { // Configuration tencocoaConfig = new ConfigurationBuilder() // .setGZIPEnabled(true) // .setDispatcherImpl(TencocoaDispatcher.class.getName()) // .setOAuthConsumerKey(ck) // .setOAuthConsumerSecret(cs) // .setOAuthAccessToken(token.getToken()) // .setOAuthAccessTokenSecret(token.getTokenSecret()) // .build(); // Twitter tw = new TwitterFactory(tencocoaConfig).getInstance(); // return tw; // } // // public static TwitterStream getTwitterStreamInstance(String ck, String cs, AccessToken token) { // Configuration tencocoaConfig = new ConfigurationBuilder() // .setGZIPEnabled(true) // .setDispatcherImpl(TencocoaDispatcher.class.getName()) // .setOAuthConsumerKey(ck) // .setOAuthConsumerSecret(cs) // .setOAuthAccessToken(token.getToken()) // .setOAuthAccessTokenSecret(token.getTokenSecret()) // .build(); // TwitterStream tw = new TwitterStreamFactory(tencocoaConfig).getInstance(); // return tw; // } // // public static long[] convertMediaIds(List<UploadedMedia> media) { // long[] result = new long[media.size()]; // for (int i = 0; i < media.size(); i++) { // result[i]=media.get(i).getMediaId(); // } // return result; // } // // }
import android.app.Notification; import android.app.NotificationManager; import android.app.Service; import android.content.ContentResolver; import android.content.Intent; import android.content.SharedPreferences; import android.database.Cursor; import android.net.Uri; import android.os.AsyncTask; import android.os.Binder; import android.os.IBinder; import android.preference.PreferenceManager; import android.provider.MediaStore; import android.widget.Toast; import org.kb10uy.tencocoa.model.TwitterAccountInformation; import org.kb10uy.tencocoa.model.TwitterHelper; import java.io.File; import java.util.ArrayList; import java.util.List; import twitter4j.StatusUpdate; import twitter4j.Twitter; import twitter4j.TwitterException; import twitter4j.UploadedMedia; import twitter4j.User; import twitter4j.auth.AccessToken;
public void pushImages(List<Uri> uris) { mPendingMediaUris.addAll(uris); } public void updateStatus(StatusUpdate status) { AsyncTask<StatusUpdate, Void, String> task = new AsyncTask<StatusUpdate, Void, String>() { @Override protected String doInBackground(StatusUpdate... params) { if (currentUser == null) return getString(R.string.notification_network_unavailable); try { StatusUpdate target = params[0]; if (mPendingMediaUris.size() >= 0) { List<UploadedMedia> media = new ArrayList<>(); for (Uri u : mPendingMediaUris) { String path = ""; if (u.getScheme().equals("content")) { ContentResolver contentResolver = getApplicationContext().getContentResolver(); Cursor cursor = contentResolver.query(u, new String[]{MediaStore.MediaColumns.DATA}, null, null, null); if (cursor != null) { cursor.moveToFirst(); path = cursor.getString(0); cursor.close(); } } else { path = u.getPath(); } media.add(mTwitter.uploadMedia(new File(path))); } mPendingMediaUris.clear();
// Path: app/src/main/java/org/kb10uy/tencocoa/model/TwitterAccountInformation.java // public class TwitterAccountInformation implements Serializable { // private static final long serialVersionUID = 2591925210205947107L; // // private long userId; // private String screenName; // private AccessToken token; // // public TwitterAccountInformation(AccessToken token) { // userId = token.getUserId(); // screenName = token.getScreenName(); // this.token = token; // } // // public AccessToken getAccessToken() { // return token; // } // // public String getScreenName() { // return screenName; // } // // public long getUserId() { // return userId; // } // } // // Path: app/src/main/java/org/kb10uy/tencocoa/model/TwitterHelper.java // public final class TwitterHelper { // // public static Twitter getTwitterInstance(String ck, String cs, AccessToken token) { // Configuration tencocoaConfig = new ConfigurationBuilder() // .setGZIPEnabled(true) // .setDispatcherImpl(TencocoaDispatcher.class.getName()) // .setOAuthConsumerKey(ck) // .setOAuthConsumerSecret(cs) // .setOAuthAccessToken(token.getToken()) // .setOAuthAccessTokenSecret(token.getTokenSecret()) // .build(); // Twitter tw = new TwitterFactory(tencocoaConfig).getInstance(); // return tw; // } // // public static TwitterStream getTwitterStreamInstance(String ck, String cs, AccessToken token) { // Configuration tencocoaConfig = new ConfigurationBuilder() // .setGZIPEnabled(true) // .setDispatcherImpl(TencocoaDispatcher.class.getName()) // .setOAuthConsumerKey(ck) // .setOAuthConsumerSecret(cs) // .setOAuthAccessToken(token.getToken()) // .setOAuthAccessTokenSecret(token.getTokenSecret()) // .build(); // TwitterStream tw = new TwitterStreamFactory(tencocoaConfig).getInstance(); // return tw; // } // // public static long[] convertMediaIds(List<UploadedMedia> media) { // long[] result = new long[media.size()]; // for (int i = 0; i < media.size(); i++) { // result[i]=media.get(i).getMediaId(); // } // return result; // } // // } // Path: app/src/main/java/org/kb10uy/tencocoa/TencocoaWritePermissionService.java import android.app.Notification; import android.app.NotificationManager; import android.app.Service; import android.content.ContentResolver; import android.content.Intent; import android.content.SharedPreferences; import android.database.Cursor; import android.net.Uri; import android.os.AsyncTask; import android.os.Binder; import android.os.IBinder; import android.preference.PreferenceManager; import android.provider.MediaStore; import android.widget.Toast; import org.kb10uy.tencocoa.model.TwitterAccountInformation; import org.kb10uy.tencocoa.model.TwitterHelper; import java.io.File; import java.util.ArrayList; import java.util.List; import twitter4j.StatusUpdate; import twitter4j.Twitter; import twitter4j.TwitterException; import twitter4j.UploadedMedia; import twitter4j.User; import twitter4j.auth.AccessToken; public void pushImages(List<Uri> uris) { mPendingMediaUris.addAll(uris); } public void updateStatus(StatusUpdate status) { AsyncTask<StatusUpdate, Void, String> task = new AsyncTask<StatusUpdate, Void, String>() { @Override protected String doInBackground(StatusUpdate... params) { if (currentUser == null) return getString(R.string.notification_network_unavailable); try { StatusUpdate target = params[0]; if (mPendingMediaUris.size() >= 0) { List<UploadedMedia> media = new ArrayList<>(); for (Uri u : mPendingMediaUris) { String path = ""; if (u.getScheme().equals("content")) { ContentResolver contentResolver = getApplicationContext().getContentResolver(); Cursor cursor = contentResolver.query(u, new String[]{MediaStore.MediaColumns.DATA}, null, null, null); if (cursor != null) { cursor.moveToFirst(); path = cursor.getString(0); cursor.close(); } } else { path = u.getPath(); } media.add(mTwitter.uploadMedia(new File(path))); } mPendingMediaUris.clear();
long[] ids = TwitterHelper.convertMediaIds(media);
kb10uy/Tencocoa
app/src/main/java/org/kb10uy/tencocoa/settings/LicenseActivity.java
// Path: app/src/main/java/org/kb10uy/tencocoa/model/TencocoaHelper.java // public class TencocoaHelper { // public static final char numberSuffixes[] = new char[]{' ', 'K', 'M', 'G', 'T', 'P', 'E', 'Z', 'Y'}; // public static final int translatedErrors[] = new int[]{32, 34, 64, 68, 88, 89, 92, 130, 131, 135, 161, 179, 185, 187, 215, 226, 231, 251, 261, 271, 272, 354}; // private static SimpleDateFormat mDateFormat = new SimpleDateFormat("yyyy/MM/dd HH:mm:ss", Locale.getDefault()); // // public static boolean serializeObjectToFile(Serializable object, FileOutputStream output) { // try { // ObjectOutputStream serializer = new ObjectOutputStream(output); // serializer.writeObject(object); // return true; // } catch (IOException e) { // e.printStackTrace(); // } // return false; // } // // public static <T> T deserializeObjectFromFile(FileInputStream input) { // try { // ObjectInputStream deserializer = new ObjectInputStream(input); // return (T) deserializer.readObject(); // } catch (IOException e) { // e.printStackTrace(); // return null; // } catch (ClassNotFoundException e) { // e.printStackTrace(); // return null; // } // } // // public static String getCompressedNumberString(int num) { // DecimalFormat df = new DecimalFormat("0.0"); // double tg = num; // int si = 0; // while (tg > 1000) { // tg /= 1000.0; // si++; // } // if ((int) tg == num) { // df = new DecimalFormat("0"); // } else { // df = new DecimalFormat("0.0"); // } // StringBuilder sb = new StringBuilder(); // sb.append(df.format(tg)); // sb.append(numberSuffixes[si]); // return sb.toString(); // } // // public static String getRelativeTimeString(Date targetDate) { // Duration d = new Duration(new DateTime(targetDate), new DateTime(new Date())); // long relative = d.getStandardSeconds(); // if (relative < 20) return "now"; // if (relative < 60) return Long.toString(relative) + "s"; // if ((relative = d.getStandardMinutes()) < 60) return Long.toString(relative) + "m"; // if ((relative = d.getStandardHours()) < 24) return Long.toString(relative) + "h"; // relative = d.getStandardDays(); // return Long.toString(relative) + "d"; // } // // public static String getAbsoluteTimeString(Date targetDate) { // return mDateFormat.format(targetDate); // } // // public static void setCurrentTheme(Context ctx, String theme) { // switch (theme) { // case "Black": // ctx.setTheme(R.style.Black); // break; // case "White": // ctx.setTheme(R.style.White); // break; // case "Hinanawi": // ctx.setTheme(R.style.Hinanawi); // break; // case "Hoto": // ctx.setTheme(R.style.Hoto); // break; // case "Komichi": // ctx.setTheme(R.style.Komichi); // break; // case "Witch": // ctx.setTheme(R.style.Witch); // break; // case "Tomori": // ctx.setTheme(R.style.Tomori); // break; // } // } // // public static String createReplyTemplate(TencocoaStatus status) { // StringBuilder builder = new StringBuilder(); // Status target = status.getShowingStatus(); // User tweeter = target.getUser(); // builder.append("@").append(target.getUser().getScreenName()).append(" "); // UserMentionEntity[] entities = target.getUserMentionEntities(); // if (entities == null) return builder.toString(); // for (UserMentionEntity e : entities) { // if (tweeter.getId() == e.getId()) continue; // builder.append("@").append(e.getScreenName()).append(" "); // } // return builder.toString(); // } // // public static void Run(Runnable r) { // new AsyncTask<Void, Void, Void>() { // @Override // protected Void doInBackground(Void... params) { // r.run(); // return null; // } // }.executeOnExecutor(AsyncTask.THREAD_POOL_EXECUTOR); // } // // public static String getTwitterErrorMessage(Context ctx, TwitterException ex) { // if (Ints.contains(translatedErrors, ex.getErrorCode())) return ctx.getString(ctx.getResources().getIdentifier("text", "string", ctx.getPackageName())); // return ex.getErrorMessage(); // } // }
import android.content.SharedPreferences; import android.preference.PreferenceManager; import android.support.v7.app.AppCompatActivity; import android.os.Bundle; import android.webkit.WebView; import org.kb10uy.tencocoa.R; import org.kb10uy.tencocoa.model.TencocoaHelper;
package org.kb10uy.tencocoa.settings; public class LicenseActivity extends AppCompatActivity { @Override protected void onCreate(Bundle savedInstanceState) { SharedPreferences pref = PreferenceManager.getDefaultSharedPreferences(this);
// Path: app/src/main/java/org/kb10uy/tencocoa/model/TencocoaHelper.java // public class TencocoaHelper { // public static final char numberSuffixes[] = new char[]{' ', 'K', 'M', 'G', 'T', 'P', 'E', 'Z', 'Y'}; // public static final int translatedErrors[] = new int[]{32, 34, 64, 68, 88, 89, 92, 130, 131, 135, 161, 179, 185, 187, 215, 226, 231, 251, 261, 271, 272, 354}; // private static SimpleDateFormat mDateFormat = new SimpleDateFormat("yyyy/MM/dd HH:mm:ss", Locale.getDefault()); // // public static boolean serializeObjectToFile(Serializable object, FileOutputStream output) { // try { // ObjectOutputStream serializer = new ObjectOutputStream(output); // serializer.writeObject(object); // return true; // } catch (IOException e) { // e.printStackTrace(); // } // return false; // } // // public static <T> T deserializeObjectFromFile(FileInputStream input) { // try { // ObjectInputStream deserializer = new ObjectInputStream(input); // return (T) deserializer.readObject(); // } catch (IOException e) { // e.printStackTrace(); // return null; // } catch (ClassNotFoundException e) { // e.printStackTrace(); // return null; // } // } // // public static String getCompressedNumberString(int num) { // DecimalFormat df = new DecimalFormat("0.0"); // double tg = num; // int si = 0; // while (tg > 1000) { // tg /= 1000.0; // si++; // } // if ((int) tg == num) { // df = new DecimalFormat("0"); // } else { // df = new DecimalFormat("0.0"); // } // StringBuilder sb = new StringBuilder(); // sb.append(df.format(tg)); // sb.append(numberSuffixes[si]); // return sb.toString(); // } // // public static String getRelativeTimeString(Date targetDate) { // Duration d = new Duration(new DateTime(targetDate), new DateTime(new Date())); // long relative = d.getStandardSeconds(); // if (relative < 20) return "now"; // if (relative < 60) return Long.toString(relative) + "s"; // if ((relative = d.getStandardMinutes()) < 60) return Long.toString(relative) + "m"; // if ((relative = d.getStandardHours()) < 24) return Long.toString(relative) + "h"; // relative = d.getStandardDays(); // return Long.toString(relative) + "d"; // } // // public static String getAbsoluteTimeString(Date targetDate) { // return mDateFormat.format(targetDate); // } // // public static void setCurrentTheme(Context ctx, String theme) { // switch (theme) { // case "Black": // ctx.setTheme(R.style.Black); // break; // case "White": // ctx.setTheme(R.style.White); // break; // case "Hinanawi": // ctx.setTheme(R.style.Hinanawi); // break; // case "Hoto": // ctx.setTheme(R.style.Hoto); // break; // case "Komichi": // ctx.setTheme(R.style.Komichi); // break; // case "Witch": // ctx.setTheme(R.style.Witch); // break; // case "Tomori": // ctx.setTheme(R.style.Tomori); // break; // } // } // // public static String createReplyTemplate(TencocoaStatus status) { // StringBuilder builder = new StringBuilder(); // Status target = status.getShowingStatus(); // User tweeter = target.getUser(); // builder.append("@").append(target.getUser().getScreenName()).append(" "); // UserMentionEntity[] entities = target.getUserMentionEntities(); // if (entities == null) return builder.toString(); // for (UserMentionEntity e : entities) { // if (tweeter.getId() == e.getId()) continue; // builder.append("@").append(e.getScreenName()).append(" "); // } // return builder.toString(); // } // // public static void Run(Runnable r) { // new AsyncTask<Void, Void, Void>() { // @Override // protected Void doInBackground(Void... params) { // r.run(); // return null; // } // }.executeOnExecutor(AsyncTask.THREAD_POOL_EXECUTOR); // } // // public static String getTwitterErrorMessage(Context ctx, TwitterException ex) { // if (Ints.contains(translatedErrors, ex.getErrorCode())) return ctx.getString(ctx.getResources().getIdentifier("text", "string", ctx.getPackageName())); // return ex.getErrorMessage(); // } // } // Path: app/src/main/java/org/kb10uy/tencocoa/settings/LicenseActivity.java import android.content.SharedPreferences; import android.preference.PreferenceManager; import android.support.v7.app.AppCompatActivity; import android.os.Bundle; import android.webkit.WebView; import org.kb10uy.tencocoa.R; import org.kb10uy.tencocoa.model.TencocoaHelper; package org.kb10uy.tencocoa.settings; public class LicenseActivity extends AppCompatActivity { @Override protected void onCreate(Bundle savedInstanceState) { SharedPreferences pref = PreferenceManager.getDefaultSharedPreferences(this);
TencocoaHelper.setCurrentTheme(this, pref.getString(getString(R.string.preference_appearance_theme), "Black"));
JetBrains/teamcity-deployer-plugin
deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/smb/SmbDeployerRunnerInfo.java
// Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/DeployerRunnerConstants.java // public class DeployerRunnerConstants { // public static final String SSH_RUN_TYPE = "ssh-deploy-runner"; // public static final String SMB_RUN_TYPE = "smb-deploy-runner"; // public static final String SMB2_RUN_TYPE = "smb2-deploy-runner"; // public static final String FTP_RUN_TYPE = "ftp-deploy-runner"; // public static final String TOMCAT_RUN_TYPE = "tomcat-deploy-runner"; // public static final String CARGO_RUN_TYPE = "cargo-deploy-runner"; // // // public static final String PARAM_USERNAME = "jetbrains.buildServer.deployer.username"; // public static final String PARAM_PASSWORD = "secure:jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_PLAIN_PASSWORD = "jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_DOMAIN = "jetbrains.buildServer.deployer.domain"; // public static final String PARAM_TARGET_URL = "jetbrains.buildServer.deployer.targetUrl"; // public static final String PARAM_SOURCE_PATH = "jetbrains.buildServer.deployer.sourcePath"; // public static final String PARAM_CONTAINER_CONTEXT_PATH = "jetbrains.buildServer.deployer.container.contextPath"; // public static final String PARAM_CONTAINER_TYPE = "jetbrains.buildServer.deployer.container.type"; // // public static final String BUILD_PROBLEM_TYPE = "jetbrains.buildServer.deployer"; // }
import jetbrains.buildServer.agent.AgentBuildRunnerInfo; import jetbrains.buildServer.agent.BuildAgentConfiguration; import jetbrains.buildServer.deployer.common.DeployerRunnerConstants; import org.jetbrains.annotations.NotNull;
/* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.agent.smb; class SmbDeployerRunnerInfo implements AgentBuildRunnerInfo { @NotNull @Override public String getType() {
// Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/DeployerRunnerConstants.java // public class DeployerRunnerConstants { // public static final String SSH_RUN_TYPE = "ssh-deploy-runner"; // public static final String SMB_RUN_TYPE = "smb-deploy-runner"; // public static final String SMB2_RUN_TYPE = "smb2-deploy-runner"; // public static final String FTP_RUN_TYPE = "ftp-deploy-runner"; // public static final String TOMCAT_RUN_TYPE = "tomcat-deploy-runner"; // public static final String CARGO_RUN_TYPE = "cargo-deploy-runner"; // // // public static final String PARAM_USERNAME = "jetbrains.buildServer.deployer.username"; // public static final String PARAM_PASSWORD = "secure:jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_PLAIN_PASSWORD = "jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_DOMAIN = "jetbrains.buildServer.deployer.domain"; // public static final String PARAM_TARGET_URL = "jetbrains.buildServer.deployer.targetUrl"; // public static final String PARAM_SOURCE_PATH = "jetbrains.buildServer.deployer.sourcePath"; // public static final String PARAM_CONTAINER_CONTEXT_PATH = "jetbrains.buildServer.deployer.container.contextPath"; // public static final String PARAM_CONTAINER_TYPE = "jetbrains.buildServer.deployer.container.type"; // // public static final String BUILD_PROBLEM_TYPE = "jetbrains.buildServer.deployer"; // } // Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/smb/SmbDeployerRunnerInfo.java import jetbrains.buildServer.agent.AgentBuildRunnerInfo; import jetbrains.buildServer.agent.BuildAgentConfiguration; import jetbrains.buildServer.deployer.common.DeployerRunnerConstants; import org.jetbrains.annotations.NotNull; /* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.agent.smb; class SmbDeployerRunnerInfo implements AgentBuildRunnerInfo { @NotNull @Override public String getType() {
return DeployerRunnerConstants.SMB_RUN_TYPE;
JetBrains/teamcity-deployer-plugin
deploy-runner-agent/src/test/java/jetbrains/buildServer/deployer/agent/ssh/BaseSSHTransferTest.java
// Path: deploy-runner-agent/src/test/java/jetbrains/buildServer/deployer/agent/util/DeployTestUtils.java // public class DeployTestUtils { // public static void runProcess(final BuildProcess process, final int timeout) throws RunBuildException { // process.start(); // new WaitFor(timeout) { // @Override // protected boolean condition() { // return process.isFinished(); // } // }; // assertThat(process.isFinished()).describedAs("Failed to finish test in time").isTrue(); // assertThat(process.waitFor()).isEqualTo(BuildFinishedStatus.FINISHED_SUCCESS); // } // // public static ArtifactsCollection buildArtifactsCollection(final TempFilesFactory tempFiles, String... destinationDirs) throws IOException { // // final Map<File, String> filePathMap = new HashMap<File, String>(); // String dirTo = "dirTo"; // for (String destinationDir : destinationDirs) { // dirTo = destinationDir; // final File content = tempFiles.createTempFile(100); // filePathMap.put(content, destinationDir); // } // return new ArtifactsCollection("dirFrom/**", dirTo, filePathMap); // } // // public static void assertCollectionsTransferred(File remoteBase, List<ArtifactsCollection> artifactsCollections) throws IOException { // // for (ArtifactsCollection artifactsCollection : artifactsCollections) { // for (Map.Entry<File, String> fileStringEntry : artifactsCollection.getFilePathMap().entrySet()) { // final File source = fileStringEntry.getKey(); // final String relativePath = fileStringEntry.getValue(); // final String targetPath = relativePath + (StringUtil.isNotEmpty(relativePath) ? File.separator : "") + source.getName(); // final File target; // if (new File(targetPath).isAbsolute()) { // target = new File(targetPath); // } else { // target = new File(remoteBase, targetPath); // } // assertTrue(target.exists(), "Destination file [" + targetPath + "] does not exist"); // assertEquals(FileUtil.readText(target), FileUtil.readText(source), "wrong content"); // } // } // } // // public interface TempFilesFactory { // File createTempFile(int size) throws IOException; // } // }
import jetbrains.buildServer.BaseTestCase; import jetbrains.buildServer.agent.BuildProcess; import jetbrains.buildServer.deployer.agent.util.DeployTestUtils; import org.testng.annotations.Test; import java.io.File; import static org.testng.Assert.assertTrue;
/* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.agent.ssh; /** * Created by Nikita.Skvortsov * Date: 10/3/12, 3:13 PM */ public abstract class BaseSSHTransferTest extends BaseSSHTest { @Test public void testSimpleTransfer() throws Exception {
// Path: deploy-runner-agent/src/test/java/jetbrains/buildServer/deployer/agent/util/DeployTestUtils.java // public class DeployTestUtils { // public static void runProcess(final BuildProcess process, final int timeout) throws RunBuildException { // process.start(); // new WaitFor(timeout) { // @Override // protected boolean condition() { // return process.isFinished(); // } // }; // assertThat(process.isFinished()).describedAs("Failed to finish test in time").isTrue(); // assertThat(process.waitFor()).isEqualTo(BuildFinishedStatus.FINISHED_SUCCESS); // } // // public static ArtifactsCollection buildArtifactsCollection(final TempFilesFactory tempFiles, String... destinationDirs) throws IOException { // // final Map<File, String> filePathMap = new HashMap<File, String>(); // String dirTo = "dirTo"; // for (String destinationDir : destinationDirs) { // dirTo = destinationDir; // final File content = tempFiles.createTempFile(100); // filePathMap.put(content, destinationDir); // } // return new ArtifactsCollection("dirFrom/**", dirTo, filePathMap); // } // // public static void assertCollectionsTransferred(File remoteBase, List<ArtifactsCollection> artifactsCollections) throws IOException { // // for (ArtifactsCollection artifactsCollection : artifactsCollections) { // for (Map.Entry<File, String> fileStringEntry : artifactsCollection.getFilePathMap().entrySet()) { // final File source = fileStringEntry.getKey(); // final String relativePath = fileStringEntry.getValue(); // final String targetPath = relativePath + (StringUtil.isNotEmpty(relativePath) ? File.separator : "") + source.getName(); // final File target; // if (new File(targetPath).isAbsolute()) { // target = new File(targetPath); // } else { // target = new File(remoteBase, targetPath); // } // assertTrue(target.exists(), "Destination file [" + targetPath + "] does not exist"); // assertEquals(FileUtil.readText(target), FileUtil.readText(source), "wrong content"); // } // } // } // // public interface TempFilesFactory { // File createTempFile(int size) throws IOException; // } // } // Path: deploy-runner-agent/src/test/java/jetbrains/buildServer/deployer/agent/ssh/BaseSSHTransferTest.java import jetbrains.buildServer.BaseTestCase; import jetbrains.buildServer.agent.BuildProcess; import jetbrains.buildServer.deployer.agent.util.DeployTestUtils; import org.testng.annotations.Test; import java.io.File; import static org.testng.Assert.assertTrue; /* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.agent.ssh; /** * Created by Nikita.Skvortsov * Date: 10/3/12, 3:13 PM */ public abstract class BaseSSHTransferTest extends BaseSSHTest { @Test public void testSimpleTransfer() throws Exception {
myArtifactsCollections.add(DeployTestUtils.buildArtifactsCollection(createTempFilesFactory(), "dest1", "dest2"));
JetBrains/teamcity-deployer-plugin
deploy-runner-server/src/main/java/jetbrains/buildServer/deployer/server/SSHDeployerPropertiesProcessor.java
// Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/DeployerRunnerConstants.java // public class DeployerRunnerConstants { // public static final String SSH_RUN_TYPE = "ssh-deploy-runner"; // public static final String SMB_RUN_TYPE = "smb-deploy-runner"; // public static final String SMB2_RUN_TYPE = "smb2-deploy-runner"; // public static final String FTP_RUN_TYPE = "ftp-deploy-runner"; // public static final String TOMCAT_RUN_TYPE = "tomcat-deploy-runner"; // public static final String CARGO_RUN_TYPE = "cargo-deploy-runner"; // // // public static final String PARAM_USERNAME = "jetbrains.buildServer.deployer.username"; // public static final String PARAM_PASSWORD = "secure:jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_PLAIN_PASSWORD = "jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_DOMAIN = "jetbrains.buildServer.deployer.domain"; // public static final String PARAM_TARGET_URL = "jetbrains.buildServer.deployer.targetUrl"; // public static final String PARAM_SOURCE_PATH = "jetbrains.buildServer.deployer.sourcePath"; // public static final String PARAM_CONTAINER_CONTEXT_PATH = "jetbrains.buildServer.deployer.container.contextPath"; // public static final String PARAM_CONTAINER_TYPE = "jetbrains.buildServer.deployer.container.type"; // // public static final String BUILD_PROBLEM_TYPE = "jetbrains.buildServer.deployer"; // } // // Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/SSHRunnerConstants.java // public class SSHRunnerConstants { // // public static final String SSH_EXEC_RUN_TYPE = "ssh-exec-runner"; // // @Deprecated // public static final String PARAM_HOST = "jetbrains.buildServer.sshexec.host"; // public static final String PARAM_PORT = "jetbrains.buildServer.sshexec.port"; // @Deprecated // public static final String PARAM_USERNAME = "jetbrains.buildServer.sshexec.username"; // @Deprecated // public static final String PARAM_PASSWORD = "jetbrains.buildServer.sshexec.password"; // public static final String PARAM_KEYFILE = "jetbrains.buildServer.sshexec.keyFile"; // public static final String PARAM_UPLOADED_KEY_ID = "jetbrains.buildServer.sshexec.key.id"; // public static final String PARAM_AUTH_METHOD = "jetbrains.buildServer.sshexec.authMethod"; // public static final String PARAM_COMMAND = "jetbrains.buildServer.sshexec.command"; // public static final String PARAM_PTY = "jetbrains.buildServer.sshexec.pty"; // // public static final String PARAM_TRANSPORT = "jetbrains.buildServer.deployer.ssh.transport"; // // public static final String TRANSPORT_SCP = "jetbrains.buildServer.deployer.ssh.transport.scp"; // public static final String TRANSPORT_SFTP = "jetbrains.buildServer.deployer.ssh.transport.sftp"; // public static final String AUTH_METHOD_DEFAULT_KEY = "DEFAULT_KEY"; // public static final String AUTH_METHOD_CUSTOM_KEY = "CUSTOM_KEY"; // public static final String AUTH_METHOD_USERNAME_PWD = "PWD"; // public static final String AUTH_METHOD_SSH_AGENT = "SSH_AGENT"; // public static final String AUTH_METHOD_UPLOADED_KEY = "UPLOADED_KEY"; // // public static final String ENABLE_SSH_AGENT_FORWARDING = "teamcity.deployer.ssh.enableAgentForwarding"; // // public String getTransportType() { // return PARAM_TRANSPORT; // } // // public Map<String, String> getTransportTypeValues() { // final Map<String, String> result = new LinkedHashMap<String, String>(); // result.put(TRANSPORT_SCP, "SCP"); // result.put(TRANSPORT_SFTP, "SFTP"); // return result; // } // // // }
import jetbrains.buildServer.deployer.common.DeployerRunnerConstants; import jetbrains.buildServer.deployer.common.SSHRunnerConstants; import jetbrains.buildServer.serverSide.InvalidProperty; import jetbrains.buildServer.util.StringUtil; import java.util.Collection; import java.util.Map;
/* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.server; /** * Created by Nikita.Skvortsov * date: 13.02.14. */ class SSHDeployerPropertiesProcessor extends DeployerPropertiesProcessor { @Override public Collection<InvalidProperty> process(Map<String, String> properties) { Collection<InvalidProperty> result = super.process(properties);
// Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/DeployerRunnerConstants.java // public class DeployerRunnerConstants { // public static final String SSH_RUN_TYPE = "ssh-deploy-runner"; // public static final String SMB_RUN_TYPE = "smb-deploy-runner"; // public static final String SMB2_RUN_TYPE = "smb2-deploy-runner"; // public static final String FTP_RUN_TYPE = "ftp-deploy-runner"; // public static final String TOMCAT_RUN_TYPE = "tomcat-deploy-runner"; // public static final String CARGO_RUN_TYPE = "cargo-deploy-runner"; // // // public static final String PARAM_USERNAME = "jetbrains.buildServer.deployer.username"; // public static final String PARAM_PASSWORD = "secure:jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_PLAIN_PASSWORD = "jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_DOMAIN = "jetbrains.buildServer.deployer.domain"; // public static final String PARAM_TARGET_URL = "jetbrains.buildServer.deployer.targetUrl"; // public static final String PARAM_SOURCE_PATH = "jetbrains.buildServer.deployer.sourcePath"; // public static final String PARAM_CONTAINER_CONTEXT_PATH = "jetbrains.buildServer.deployer.container.contextPath"; // public static final String PARAM_CONTAINER_TYPE = "jetbrains.buildServer.deployer.container.type"; // // public static final String BUILD_PROBLEM_TYPE = "jetbrains.buildServer.deployer"; // } // // Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/SSHRunnerConstants.java // public class SSHRunnerConstants { // // public static final String SSH_EXEC_RUN_TYPE = "ssh-exec-runner"; // // @Deprecated // public static final String PARAM_HOST = "jetbrains.buildServer.sshexec.host"; // public static final String PARAM_PORT = "jetbrains.buildServer.sshexec.port"; // @Deprecated // public static final String PARAM_USERNAME = "jetbrains.buildServer.sshexec.username"; // @Deprecated // public static final String PARAM_PASSWORD = "jetbrains.buildServer.sshexec.password"; // public static final String PARAM_KEYFILE = "jetbrains.buildServer.sshexec.keyFile"; // public static final String PARAM_UPLOADED_KEY_ID = "jetbrains.buildServer.sshexec.key.id"; // public static final String PARAM_AUTH_METHOD = "jetbrains.buildServer.sshexec.authMethod"; // public static final String PARAM_COMMAND = "jetbrains.buildServer.sshexec.command"; // public static final String PARAM_PTY = "jetbrains.buildServer.sshexec.pty"; // // public static final String PARAM_TRANSPORT = "jetbrains.buildServer.deployer.ssh.transport"; // // public static final String TRANSPORT_SCP = "jetbrains.buildServer.deployer.ssh.transport.scp"; // public static final String TRANSPORT_SFTP = "jetbrains.buildServer.deployer.ssh.transport.sftp"; // public static final String AUTH_METHOD_DEFAULT_KEY = "DEFAULT_KEY"; // public static final String AUTH_METHOD_CUSTOM_KEY = "CUSTOM_KEY"; // public static final String AUTH_METHOD_USERNAME_PWD = "PWD"; // public static final String AUTH_METHOD_SSH_AGENT = "SSH_AGENT"; // public static final String AUTH_METHOD_UPLOADED_KEY = "UPLOADED_KEY"; // // public static final String ENABLE_SSH_AGENT_FORWARDING = "teamcity.deployer.ssh.enableAgentForwarding"; // // public String getTransportType() { // return PARAM_TRANSPORT; // } // // public Map<String, String> getTransportTypeValues() { // final Map<String, String> result = new LinkedHashMap<String, String>(); // result.put(TRANSPORT_SCP, "SCP"); // result.put(TRANSPORT_SFTP, "SFTP"); // return result; // } // // // } // Path: deploy-runner-server/src/main/java/jetbrains/buildServer/deployer/server/SSHDeployerPropertiesProcessor.java import jetbrains.buildServer.deployer.common.DeployerRunnerConstants; import jetbrains.buildServer.deployer.common.SSHRunnerConstants; import jetbrains.buildServer.serverSide.InvalidProperty; import jetbrains.buildServer.util.StringUtil; import java.util.Collection; import java.util.Map; /* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.server; /** * Created by Nikita.Skvortsov * date: 13.02.14. */ class SSHDeployerPropertiesProcessor extends DeployerPropertiesProcessor { @Override public Collection<InvalidProperty> process(Map<String, String> properties) { Collection<InvalidProperty> result = super.process(properties);
if (StringUtil.isEmptyOrSpaces(properties.get(DeployerRunnerConstants.PARAM_USERNAME)) &&
JetBrains/teamcity-deployer-plugin
deploy-runner-server/src/main/java/jetbrains/buildServer/deployer/server/SSHDeployerPropertiesProcessor.java
// Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/DeployerRunnerConstants.java // public class DeployerRunnerConstants { // public static final String SSH_RUN_TYPE = "ssh-deploy-runner"; // public static final String SMB_RUN_TYPE = "smb-deploy-runner"; // public static final String SMB2_RUN_TYPE = "smb2-deploy-runner"; // public static final String FTP_RUN_TYPE = "ftp-deploy-runner"; // public static final String TOMCAT_RUN_TYPE = "tomcat-deploy-runner"; // public static final String CARGO_RUN_TYPE = "cargo-deploy-runner"; // // // public static final String PARAM_USERNAME = "jetbrains.buildServer.deployer.username"; // public static final String PARAM_PASSWORD = "secure:jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_PLAIN_PASSWORD = "jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_DOMAIN = "jetbrains.buildServer.deployer.domain"; // public static final String PARAM_TARGET_URL = "jetbrains.buildServer.deployer.targetUrl"; // public static final String PARAM_SOURCE_PATH = "jetbrains.buildServer.deployer.sourcePath"; // public static final String PARAM_CONTAINER_CONTEXT_PATH = "jetbrains.buildServer.deployer.container.contextPath"; // public static final String PARAM_CONTAINER_TYPE = "jetbrains.buildServer.deployer.container.type"; // // public static final String BUILD_PROBLEM_TYPE = "jetbrains.buildServer.deployer"; // } // // Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/SSHRunnerConstants.java // public class SSHRunnerConstants { // // public static final String SSH_EXEC_RUN_TYPE = "ssh-exec-runner"; // // @Deprecated // public static final String PARAM_HOST = "jetbrains.buildServer.sshexec.host"; // public static final String PARAM_PORT = "jetbrains.buildServer.sshexec.port"; // @Deprecated // public static final String PARAM_USERNAME = "jetbrains.buildServer.sshexec.username"; // @Deprecated // public static final String PARAM_PASSWORD = "jetbrains.buildServer.sshexec.password"; // public static final String PARAM_KEYFILE = "jetbrains.buildServer.sshexec.keyFile"; // public static final String PARAM_UPLOADED_KEY_ID = "jetbrains.buildServer.sshexec.key.id"; // public static final String PARAM_AUTH_METHOD = "jetbrains.buildServer.sshexec.authMethod"; // public static final String PARAM_COMMAND = "jetbrains.buildServer.sshexec.command"; // public static final String PARAM_PTY = "jetbrains.buildServer.sshexec.pty"; // // public static final String PARAM_TRANSPORT = "jetbrains.buildServer.deployer.ssh.transport"; // // public static final String TRANSPORT_SCP = "jetbrains.buildServer.deployer.ssh.transport.scp"; // public static final String TRANSPORT_SFTP = "jetbrains.buildServer.deployer.ssh.transport.sftp"; // public static final String AUTH_METHOD_DEFAULT_KEY = "DEFAULT_KEY"; // public static final String AUTH_METHOD_CUSTOM_KEY = "CUSTOM_KEY"; // public static final String AUTH_METHOD_USERNAME_PWD = "PWD"; // public static final String AUTH_METHOD_SSH_AGENT = "SSH_AGENT"; // public static final String AUTH_METHOD_UPLOADED_KEY = "UPLOADED_KEY"; // // public static final String ENABLE_SSH_AGENT_FORWARDING = "teamcity.deployer.ssh.enableAgentForwarding"; // // public String getTransportType() { // return PARAM_TRANSPORT; // } // // public Map<String, String> getTransportTypeValues() { // final Map<String, String> result = new LinkedHashMap<String, String>(); // result.put(TRANSPORT_SCP, "SCP"); // result.put(TRANSPORT_SFTP, "SFTP"); // return result; // } // // // }
import jetbrains.buildServer.deployer.common.DeployerRunnerConstants; import jetbrains.buildServer.deployer.common.SSHRunnerConstants; import jetbrains.buildServer.serverSide.InvalidProperty; import jetbrains.buildServer.util.StringUtil; import java.util.Collection; import java.util.Map;
/* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.server; /** * Created by Nikita.Skvortsov * date: 13.02.14. */ class SSHDeployerPropertiesProcessor extends DeployerPropertiesProcessor { @Override public Collection<InvalidProperty> process(Map<String, String> properties) { Collection<InvalidProperty> result = super.process(properties); if (StringUtil.isEmptyOrSpaces(properties.get(DeployerRunnerConstants.PARAM_USERNAME)) &&
// Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/DeployerRunnerConstants.java // public class DeployerRunnerConstants { // public static final String SSH_RUN_TYPE = "ssh-deploy-runner"; // public static final String SMB_RUN_TYPE = "smb-deploy-runner"; // public static final String SMB2_RUN_TYPE = "smb2-deploy-runner"; // public static final String FTP_RUN_TYPE = "ftp-deploy-runner"; // public static final String TOMCAT_RUN_TYPE = "tomcat-deploy-runner"; // public static final String CARGO_RUN_TYPE = "cargo-deploy-runner"; // // // public static final String PARAM_USERNAME = "jetbrains.buildServer.deployer.username"; // public static final String PARAM_PASSWORD = "secure:jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_PLAIN_PASSWORD = "jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_DOMAIN = "jetbrains.buildServer.deployer.domain"; // public static final String PARAM_TARGET_URL = "jetbrains.buildServer.deployer.targetUrl"; // public static final String PARAM_SOURCE_PATH = "jetbrains.buildServer.deployer.sourcePath"; // public static final String PARAM_CONTAINER_CONTEXT_PATH = "jetbrains.buildServer.deployer.container.contextPath"; // public static final String PARAM_CONTAINER_TYPE = "jetbrains.buildServer.deployer.container.type"; // // public static final String BUILD_PROBLEM_TYPE = "jetbrains.buildServer.deployer"; // } // // Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/SSHRunnerConstants.java // public class SSHRunnerConstants { // // public static final String SSH_EXEC_RUN_TYPE = "ssh-exec-runner"; // // @Deprecated // public static final String PARAM_HOST = "jetbrains.buildServer.sshexec.host"; // public static final String PARAM_PORT = "jetbrains.buildServer.sshexec.port"; // @Deprecated // public static final String PARAM_USERNAME = "jetbrains.buildServer.sshexec.username"; // @Deprecated // public static final String PARAM_PASSWORD = "jetbrains.buildServer.sshexec.password"; // public static final String PARAM_KEYFILE = "jetbrains.buildServer.sshexec.keyFile"; // public static final String PARAM_UPLOADED_KEY_ID = "jetbrains.buildServer.sshexec.key.id"; // public static final String PARAM_AUTH_METHOD = "jetbrains.buildServer.sshexec.authMethod"; // public static final String PARAM_COMMAND = "jetbrains.buildServer.sshexec.command"; // public static final String PARAM_PTY = "jetbrains.buildServer.sshexec.pty"; // // public static final String PARAM_TRANSPORT = "jetbrains.buildServer.deployer.ssh.transport"; // // public static final String TRANSPORT_SCP = "jetbrains.buildServer.deployer.ssh.transport.scp"; // public static final String TRANSPORT_SFTP = "jetbrains.buildServer.deployer.ssh.transport.sftp"; // public static final String AUTH_METHOD_DEFAULT_KEY = "DEFAULT_KEY"; // public static final String AUTH_METHOD_CUSTOM_KEY = "CUSTOM_KEY"; // public static final String AUTH_METHOD_USERNAME_PWD = "PWD"; // public static final String AUTH_METHOD_SSH_AGENT = "SSH_AGENT"; // public static final String AUTH_METHOD_UPLOADED_KEY = "UPLOADED_KEY"; // // public static final String ENABLE_SSH_AGENT_FORWARDING = "teamcity.deployer.ssh.enableAgentForwarding"; // // public String getTransportType() { // return PARAM_TRANSPORT; // } // // public Map<String, String> getTransportTypeValues() { // final Map<String, String> result = new LinkedHashMap<String, String>(); // result.put(TRANSPORT_SCP, "SCP"); // result.put(TRANSPORT_SFTP, "SFTP"); // return result; // } // // // } // Path: deploy-runner-server/src/main/java/jetbrains/buildServer/deployer/server/SSHDeployerPropertiesProcessor.java import jetbrains.buildServer.deployer.common.DeployerRunnerConstants; import jetbrains.buildServer.deployer.common.SSHRunnerConstants; import jetbrains.buildServer.serverSide.InvalidProperty; import jetbrains.buildServer.util.StringUtil; import java.util.Collection; import java.util.Map; /* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.server; /** * Created by Nikita.Skvortsov * date: 13.02.14. */ class SSHDeployerPropertiesProcessor extends DeployerPropertiesProcessor { @Override public Collection<InvalidProperty> process(Map<String, String> properties) { Collection<InvalidProperty> result = super.process(properties); if (StringUtil.isEmptyOrSpaces(properties.get(DeployerRunnerConstants.PARAM_USERNAME)) &&
!SSHRunnerConstants.AUTH_METHOD_DEFAULT_KEY.equals(properties.get(SSHRunnerConstants.PARAM_AUTH_METHOD))) {
JetBrains/teamcity-deployer-plugin
deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/ftp/FtpDeployerRunner.java
// Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/base/BaseDeployerRunner.java // public abstract class BaseDeployerRunner implements AgentBuildRunner { // protected final ExtensionHolder myExtensionHolder; // // public BaseDeployerRunner(@NotNull final ExtensionHolder extensionHolder) { // myExtensionHolder = extensionHolder; // } // // @NotNull // @Override // public BuildProcess createBuildProcess(@NotNull final AgentRunningBuild runningBuild, // @NotNull final BuildRunnerContext context) throws RunBuildException { // // final Map<String, String> runnerParameters = context.getRunnerParameters(); // final String username = StringUtil.emptyIfNull(runnerParameters.get(DeployerRunnerConstants.PARAM_USERNAME)); // final String password = StringUtil.emptyIfNull(runnerParameters.get(DeployerRunnerConstants.PARAM_PASSWORD)); // final String target = StringUtil.emptyIfNull(runnerParameters.get(DeployerRunnerConstants.PARAM_TARGET_URL)); // final String sourcePaths = runnerParameters.get(DeployerRunnerConstants.PARAM_SOURCE_PATH); // // final Collection<ArtifactsPreprocessor> preprocessors = myExtensionHolder.getExtensions(ArtifactsPreprocessor.class); // // final ArtifactsBuilder builder = new ArtifactsBuilder(); // builder.setPreprocessors(preprocessors); // builder.setBaseDir(runningBuild.getCheckoutDirectory()); // builder.setArtifactsPaths(sourcePaths); // // final List<ArtifactsCollection> artifactsCollections = builder.build(); // // return getDeployerProcess(context, username, password, target, artifactsCollections); // } // // protected abstract BuildProcess getDeployerProcess(@NotNull final BuildRunnerContext context, // @NotNull final String username, // @NotNull final String password, // @NotNull final String target, // @NotNull final List<ArtifactsCollection> artifactsCollections) throws RunBuildException; // // @NotNull // @Override // public abstract AgentBuildRunnerInfo getRunnerInfo(); // } // // Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/FTPRunnerConstants.java // public class FTPRunnerConstants { // public static final String PARAM_AUTH_METHOD = "jetbrains.buildServer.deployer.ftp.authMethod"; // public static final String PARAM_TRANSFER_MODE = "jetbrains.buildServer.deployer.ftp.transferMethod"; // public static final String TRANSFER_MODE_AUTO = "AUTO"; // public static final String TRANSFER_MODE_BINARY = "BINARY"; // public static final String TRANSFER_MODE_ASCII = "ASCII"; // public static final String AUTH_METHOD_USER_PWD = "USER_PWD"; // public static final String AUTH_METHOD_ANONYMOUS = "ANONYMOUS"; // public static final String PARAM_SSL_MODE = "jetbrains.buildServer.deployer.ftp.securityMode"; // public static final String DATA_CHANNEL_PROTECTION = "jetbrains.buildServer.deployer.ftp.dataChannelProtection"; // public static final String PARAM_FTP_MODE = "jetbrains.buildServer.deployer.ftp.ftpMode"; // public static final String PARAM_FTP_CONNECT_TIMEOUT = "jetbrains.deployer.ftp.connectTimeout"; // public static final String PARAM_FTP_CONTROL_KEEP_ALIVE_TIMEOUT = "jetbrains.deployer.ftp.controlKeepAliveTimeout.seconds"; // }
import jetbrains.buildServer.ExtensionHolder; import jetbrains.buildServer.RunBuildException; import jetbrains.buildServer.agent.AgentBuildRunnerInfo; import jetbrains.buildServer.agent.BuildProcess; import jetbrains.buildServer.agent.BuildRunnerContext; import jetbrains.buildServer.agent.impl.artifacts.ArtifactsCollection; import jetbrains.buildServer.deployer.agent.base.BaseDeployerRunner; import jetbrains.buildServer.deployer.common.FTPRunnerConstants; import org.jetbrains.annotations.NotNull; import java.util.List; import java.util.Map;
/* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.agent.ftp; public class FtpDeployerRunner extends BaseDeployerRunner { public FtpDeployerRunner(@NotNull final ExtensionHolder extensionHolder) { super(extensionHolder); } @Override protected BuildProcess getDeployerProcess(@NotNull final BuildRunnerContext context, @NotNull final String username, @NotNull final String password, @NotNull final String target, @NotNull final List<ArtifactsCollection> artifactsCollections) throws RunBuildException { final Map<String, String> runnerParameters = context.getRunnerParameters();
// Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/base/BaseDeployerRunner.java // public abstract class BaseDeployerRunner implements AgentBuildRunner { // protected final ExtensionHolder myExtensionHolder; // // public BaseDeployerRunner(@NotNull final ExtensionHolder extensionHolder) { // myExtensionHolder = extensionHolder; // } // // @NotNull // @Override // public BuildProcess createBuildProcess(@NotNull final AgentRunningBuild runningBuild, // @NotNull final BuildRunnerContext context) throws RunBuildException { // // final Map<String, String> runnerParameters = context.getRunnerParameters(); // final String username = StringUtil.emptyIfNull(runnerParameters.get(DeployerRunnerConstants.PARAM_USERNAME)); // final String password = StringUtil.emptyIfNull(runnerParameters.get(DeployerRunnerConstants.PARAM_PASSWORD)); // final String target = StringUtil.emptyIfNull(runnerParameters.get(DeployerRunnerConstants.PARAM_TARGET_URL)); // final String sourcePaths = runnerParameters.get(DeployerRunnerConstants.PARAM_SOURCE_PATH); // // final Collection<ArtifactsPreprocessor> preprocessors = myExtensionHolder.getExtensions(ArtifactsPreprocessor.class); // // final ArtifactsBuilder builder = new ArtifactsBuilder(); // builder.setPreprocessors(preprocessors); // builder.setBaseDir(runningBuild.getCheckoutDirectory()); // builder.setArtifactsPaths(sourcePaths); // // final List<ArtifactsCollection> artifactsCollections = builder.build(); // // return getDeployerProcess(context, username, password, target, artifactsCollections); // } // // protected abstract BuildProcess getDeployerProcess(@NotNull final BuildRunnerContext context, // @NotNull final String username, // @NotNull final String password, // @NotNull final String target, // @NotNull final List<ArtifactsCollection> artifactsCollections) throws RunBuildException; // // @NotNull // @Override // public abstract AgentBuildRunnerInfo getRunnerInfo(); // } // // Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/FTPRunnerConstants.java // public class FTPRunnerConstants { // public static final String PARAM_AUTH_METHOD = "jetbrains.buildServer.deployer.ftp.authMethod"; // public static final String PARAM_TRANSFER_MODE = "jetbrains.buildServer.deployer.ftp.transferMethod"; // public static final String TRANSFER_MODE_AUTO = "AUTO"; // public static final String TRANSFER_MODE_BINARY = "BINARY"; // public static final String TRANSFER_MODE_ASCII = "ASCII"; // public static final String AUTH_METHOD_USER_PWD = "USER_PWD"; // public static final String AUTH_METHOD_ANONYMOUS = "ANONYMOUS"; // public static final String PARAM_SSL_MODE = "jetbrains.buildServer.deployer.ftp.securityMode"; // public static final String DATA_CHANNEL_PROTECTION = "jetbrains.buildServer.deployer.ftp.dataChannelProtection"; // public static final String PARAM_FTP_MODE = "jetbrains.buildServer.deployer.ftp.ftpMode"; // public static final String PARAM_FTP_CONNECT_TIMEOUT = "jetbrains.deployer.ftp.connectTimeout"; // public static final String PARAM_FTP_CONTROL_KEEP_ALIVE_TIMEOUT = "jetbrains.deployer.ftp.controlKeepAliveTimeout.seconds"; // } // Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/ftp/FtpDeployerRunner.java import jetbrains.buildServer.ExtensionHolder; import jetbrains.buildServer.RunBuildException; import jetbrains.buildServer.agent.AgentBuildRunnerInfo; import jetbrains.buildServer.agent.BuildProcess; import jetbrains.buildServer.agent.BuildRunnerContext; import jetbrains.buildServer.agent.impl.artifacts.ArtifactsCollection; import jetbrains.buildServer.deployer.agent.base.BaseDeployerRunner; import jetbrains.buildServer.deployer.common.FTPRunnerConstants; import org.jetbrains.annotations.NotNull; import java.util.List; import java.util.Map; /* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.agent.ftp; public class FtpDeployerRunner extends BaseDeployerRunner { public FtpDeployerRunner(@NotNull final ExtensionHolder extensionHolder) { super(extensionHolder); } @Override protected BuildProcess getDeployerProcess(@NotNull final BuildRunnerContext context, @NotNull final String username, @NotNull final String password, @NotNull final String target, @NotNull final List<ArtifactsCollection> artifactsCollections) throws RunBuildException { final Map<String, String> runnerParameters = context.getRunnerParameters();
final String authMethod = runnerParameters.get(FTPRunnerConstants.PARAM_AUTH_METHOD);
JetBrains/teamcity-deployer-plugin
deploy-runner-server/src/main/java/jetbrains/buildServer/deployer/server/SmbDeployerRunType.java
// Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/DeployerRunnerConstants.java // public class DeployerRunnerConstants { // public static final String SSH_RUN_TYPE = "ssh-deploy-runner"; // public static final String SMB_RUN_TYPE = "smb-deploy-runner"; // public static final String SMB2_RUN_TYPE = "smb2-deploy-runner"; // public static final String FTP_RUN_TYPE = "ftp-deploy-runner"; // public static final String TOMCAT_RUN_TYPE = "tomcat-deploy-runner"; // public static final String CARGO_RUN_TYPE = "cargo-deploy-runner"; // // // public static final String PARAM_USERNAME = "jetbrains.buildServer.deployer.username"; // public static final String PARAM_PASSWORD = "secure:jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_PLAIN_PASSWORD = "jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_DOMAIN = "jetbrains.buildServer.deployer.domain"; // public static final String PARAM_TARGET_URL = "jetbrains.buildServer.deployer.targetUrl"; // public static final String PARAM_SOURCE_PATH = "jetbrains.buildServer.deployer.sourcePath"; // public static final String PARAM_CONTAINER_CONTEXT_PATH = "jetbrains.buildServer.deployer.container.contextPath"; // public static final String PARAM_CONTAINER_TYPE = "jetbrains.buildServer.deployer.container.type"; // // public static final String BUILD_PROBLEM_TYPE = "jetbrains.buildServer.deployer"; // }
import jetbrains.buildServer.deployer.common.DeployerRunnerConstants; import jetbrains.buildServer.serverSide.InvalidProperty; import jetbrains.buildServer.serverSide.PropertiesProcessor; import jetbrains.buildServer.serverSide.RunType; import jetbrains.buildServer.serverSide.RunTypeRegistry; import jetbrains.buildServer.web.openapi.PluginDescriptor; import org.jetbrains.annotations.NotNull; import org.jetbrains.annotations.Nullable; import java.util.Collection; import java.util.HashMap; import java.util.Map; import java.util.regex.Pattern;
/* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.server; public class SmbDeployerRunType extends RunType { final private Pattern SIMPLE_UNC_REGEX = Pattern.compile("^(?:(\\\\\\\\)?%[^\\\\%\\s]+%)|(?:\\\\\\\\[^\\\\]+\\\\[^\\\\]+(\\\\[^\\\\]+)*)$"); private final PluginDescriptor myDescriptor; public SmbDeployerRunType(@NotNull final RunTypeRegistry registry, @NotNull final PluginDescriptor descriptor) { registry.registerRunType(this); myDescriptor = descriptor; } @NotNull @Override public String getType() {
// Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/DeployerRunnerConstants.java // public class DeployerRunnerConstants { // public static final String SSH_RUN_TYPE = "ssh-deploy-runner"; // public static final String SMB_RUN_TYPE = "smb-deploy-runner"; // public static final String SMB2_RUN_TYPE = "smb2-deploy-runner"; // public static final String FTP_RUN_TYPE = "ftp-deploy-runner"; // public static final String TOMCAT_RUN_TYPE = "tomcat-deploy-runner"; // public static final String CARGO_RUN_TYPE = "cargo-deploy-runner"; // // // public static final String PARAM_USERNAME = "jetbrains.buildServer.deployer.username"; // public static final String PARAM_PASSWORD = "secure:jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_PLAIN_PASSWORD = "jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_DOMAIN = "jetbrains.buildServer.deployer.domain"; // public static final String PARAM_TARGET_URL = "jetbrains.buildServer.deployer.targetUrl"; // public static final String PARAM_SOURCE_PATH = "jetbrains.buildServer.deployer.sourcePath"; // public static final String PARAM_CONTAINER_CONTEXT_PATH = "jetbrains.buildServer.deployer.container.contextPath"; // public static final String PARAM_CONTAINER_TYPE = "jetbrains.buildServer.deployer.container.type"; // // public static final String BUILD_PROBLEM_TYPE = "jetbrains.buildServer.deployer"; // } // Path: deploy-runner-server/src/main/java/jetbrains/buildServer/deployer/server/SmbDeployerRunType.java import jetbrains.buildServer.deployer.common.DeployerRunnerConstants; import jetbrains.buildServer.serverSide.InvalidProperty; import jetbrains.buildServer.serverSide.PropertiesProcessor; import jetbrains.buildServer.serverSide.RunType; import jetbrains.buildServer.serverSide.RunTypeRegistry; import jetbrains.buildServer.web.openapi.PluginDescriptor; import org.jetbrains.annotations.NotNull; import org.jetbrains.annotations.Nullable; import java.util.Collection; import java.util.HashMap; import java.util.Map; import java.util.regex.Pattern; /* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.server; public class SmbDeployerRunType extends RunType { final private Pattern SIMPLE_UNC_REGEX = Pattern.compile("^(?:(\\\\\\\\)?%[^\\\\%\\s]+%)|(?:\\\\\\\\[^\\\\]+\\\\[^\\\\]+(\\\\[^\\\\]+)*)$"); private final PluginDescriptor myDescriptor; public SmbDeployerRunType(@NotNull final RunTypeRegistry registry, @NotNull final PluginDescriptor descriptor) { registry.registerRunType(this); myDescriptor = descriptor; } @NotNull @Override public String getType() {
return DeployerRunnerConstants.SMB_RUN_TYPE;
JetBrains/teamcity-deployer-plugin
deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/ssh/SSHDeployerRunnerInfo.java
// Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/DeployerRunnerConstants.java // public class DeployerRunnerConstants { // public static final String SSH_RUN_TYPE = "ssh-deploy-runner"; // public static final String SMB_RUN_TYPE = "smb-deploy-runner"; // public static final String SMB2_RUN_TYPE = "smb2-deploy-runner"; // public static final String FTP_RUN_TYPE = "ftp-deploy-runner"; // public static final String TOMCAT_RUN_TYPE = "tomcat-deploy-runner"; // public static final String CARGO_RUN_TYPE = "cargo-deploy-runner"; // // // public static final String PARAM_USERNAME = "jetbrains.buildServer.deployer.username"; // public static final String PARAM_PASSWORD = "secure:jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_PLAIN_PASSWORD = "jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_DOMAIN = "jetbrains.buildServer.deployer.domain"; // public static final String PARAM_TARGET_URL = "jetbrains.buildServer.deployer.targetUrl"; // public static final String PARAM_SOURCE_PATH = "jetbrains.buildServer.deployer.sourcePath"; // public static final String PARAM_CONTAINER_CONTEXT_PATH = "jetbrains.buildServer.deployer.container.contextPath"; // public static final String PARAM_CONTAINER_TYPE = "jetbrains.buildServer.deployer.container.type"; // // public static final String BUILD_PROBLEM_TYPE = "jetbrains.buildServer.deployer"; // }
import jetbrains.buildServer.agent.AgentBuildRunnerInfo; import jetbrains.buildServer.agent.BuildAgentConfiguration; import jetbrains.buildServer.deployer.common.DeployerRunnerConstants; import org.jetbrains.annotations.NotNull;
/* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.agent.ssh; /** * Created by Kit * Date: 24.03.12 - 17:31 */ class SSHDeployerRunnerInfo implements AgentBuildRunnerInfo { @NotNull @Override public String getType() {
// Path: deploy-runner-common/src/main/java/jetbrains/buildServer/deployer/common/DeployerRunnerConstants.java // public class DeployerRunnerConstants { // public static final String SSH_RUN_TYPE = "ssh-deploy-runner"; // public static final String SMB_RUN_TYPE = "smb-deploy-runner"; // public static final String SMB2_RUN_TYPE = "smb2-deploy-runner"; // public static final String FTP_RUN_TYPE = "ftp-deploy-runner"; // public static final String TOMCAT_RUN_TYPE = "tomcat-deploy-runner"; // public static final String CARGO_RUN_TYPE = "cargo-deploy-runner"; // // // public static final String PARAM_USERNAME = "jetbrains.buildServer.deployer.username"; // public static final String PARAM_PASSWORD = "secure:jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_PLAIN_PASSWORD = "jetbrains.buildServer.deployer.password"; // @Deprecated // public static final String PARAM_DOMAIN = "jetbrains.buildServer.deployer.domain"; // public static final String PARAM_TARGET_URL = "jetbrains.buildServer.deployer.targetUrl"; // public static final String PARAM_SOURCE_PATH = "jetbrains.buildServer.deployer.sourcePath"; // public static final String PARAM_CONTAINER_CONTEXT_PATH = "jetbrains.buildServer.deployer.container.contextPath"; // public static final String PARAM_CONTAINER_TYPE = "jetbrains.buildServer.deployer.container.type"; // // public static final String BUILD_PROBLEM_TYPE = "jetbrains.buildServer.deployer"; // } // Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/ssh/SSHDeployerRunnerInfo.java import jetbrains.buildServer.agent.AgentBuildRunnerInfo; import jetbrains.buildServer.agent.BuildAgentConfiguration; import jetbrains.buildServer.deployer.common.DeployerRunnerConstants; import org.jetbrains.annotations.NotNull; /* * Copyright 2000-2022 JetBrains s.r.o. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package jetbrains.buildServer.deployer.agent.ssh; /** * Created by Kit * Date: 24.03.12 - 17:31 */ class SSHDeployerRunnerInfo implements AgentBuildRunnerInfo { @NotNull @Override public String getType() {
return DeployerRunnerConstants.SSH_RUN_TYPE;
JetBrains/teamcity-deployer-plugin
deploy-runner-agent-smb2/src/main/java/jetbrains/buildServer/deployer/agent/smb/SMBJBuildProcessAdapter.java
// Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/SyncBuildProcessAdapter.java // public abstract class SyncBuildProcessAdapter extends BuildProcessAdapter { // protected final BuildProgressLogger myLogger; // private volatile boolean hasFinished; // private volatile BuildFinishedStatus statusCode; // private volatile boolean isInterrupted; // // // public SyncBuildProcessAdapter(@NotNull final BuildProgressLogger logger) { // myLogger = logger; // hasFinished = false; // statusCode = null; // } // // // @Override // public void interrupt() { // isInterrupted = true; // } // // @Override // public boolean isInterrupted() { // return isInterrupted; // } // // @Override // public boolean isFinished() { // return hasFinished; // } // // @NotNull // @Override // public BuildFinishedStatus waitFor() throws RunBuildException { // while (!isInterrupted() && !hasFinished) { // try { // Thread.sleep(1000); // } catch (InterruptedException e) { // throw new RunBuildException(e); // } // } // return hasFinished ? statusCode : BuildFinishedStatus.INTERRUPTED; // } // // @Override // public void start() throws RunBuildException { // try { // statusCode = runProcess(); // hasFinished = true; // } catch (UploadInterruptedException e) { // hasFinished = false; // } // } // // /** // * @return true is process finished successfully // */ // protected abstract BuildFinishedStatus runProcess(); // // protected void checkIsInterrupted() throws UploadInterruptedException { // if (isInterrupted()) throw new UploadInterruptedException(); // } // // } // // Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/UploadInterruptedException.java // public class UploadInterruptedException extends RuntimeException { // // } // // Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/DeployerAgentUtils.java // public static void logBuildProblem(BuildProgressLogger logger, String message) { // logger.logBuildProblem(BuildProblemData // .createBuildProblem(String.valueOf(message.hashCode()), // DeployerRunnerConstants.BUILD_PROBLEM_TYPE, // "Deployment problem: " + message)); // }
import com.hierynomus.msdtyp.AccessMask; import com.hierynomus.mssmb.SMB1NotSupportedException; import com.hierynomus.mssmb2.SMB2ShareAccess; import com.hierynomus.protocol.transport.TransportException; import com.hierynomus.smbj.SMBClient; import com.hierynomus.smbj.SmbConfig; import com.hierynomus.smbj.auth.AuthenticationContext; import com.hierynomus.smbj.common.SMBRuntimeException; import com.hierynomus.smbj.connection.Connection; import com.hierynomus.smbj.session.Session; import com.hierynomus.smbj.share.DiskShare; import com.hierynomus.smbj.share.Share; import com.intellij.openapi.diagnostic.Logger; import com.intellij.openapi.util.text.StringUtil; import jetbrains.buildServer.agent.BuildFinishedStatus; import jetbrains.buildServer.agent.BuildRunnerContext; import jetbrains.buildServer.agent.impl.artifacts.ArtifactsCollection; import jetbrains.buildServer.deployer.agent.SyncBuildProcessAdapter; import jetbrains.buildServer.deployer.agent.UploadInterruptedException; import jetbrains.buildServer.log.Loggers; import jetbrains.buildServer.util.FileUtil; import org.jetbrains.annotations.NotNull; import org.jetbrains.annotations.Nullable; import java.io.File; import java.io.FileInputStream; import java.io.IOException; import java.io.OutputStream; import java.util.EnumSet; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.Stack; import static com.hierynomus.mssmb2.SMB2CreateDisposition.FILE_OVERWRITE_IF; import static jetbrains.buildServer.deployer.agent.DeployerAgentUtils.logBuildProblem;
"target=[" + target + "]"; Loggers.AGENT.debug(settingsString); myLogger.message("Starting upload via SMBj to " + myTarget); final List<String> components = StringUtil.split(target, "\\"); final String host = components.remove(0); final String shareName = components.size() > 0 ? components.remove(0) : ""; final String pathInShare = StringUtil.join(components, "\\"); try { SmbConfig config = SmbConfig .builder() .withMultiProtocolNegotiate(true) .withSigningRequired(true).build(); SMBClient client = new SMBClient(config); Connection connection = client.connect(host); Session session = connection.authenticate(new AuthenticationContext(myUsername, myPassword.toCharArray(), myDomain)); Share share = session.connectShare(shareName); if (share instanceof DiskShare) { DiskShare diskShare = (DiskShare)share; for (ArtifactsCollection artifactsCollection : myArtifactsCollections) { final int numOfUploadedFiles = upload(artifactsCollection.getFilePathMap(), diskShare, pathInShare); myLogger.message("Uploaded [" + numOfUploadedFiles + "] files for [" + artifactsCollection.getSourcePath() + "] pattern"); } } else {
// Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/SyncBuildProcessAdapter.java // public abstract class SyncBuildProcessAdapter extends BuildProcessAdapter { // protected final BuildProgressLogger myLogger; // private volatile boolean hasFinished; // private volatile BuildFinishedStatus statusCode; // private volatile boolean isInterrupted; // // // public SyncBuildProcessAdapter(@NotNull final BuildProgressLogger logger) { // myLogger = logger; // hasFinished = false; // statusCode = null; // } // // // @Override // public void interrupt() { // isInterrupted = true; // } // // @Override // public boolean isInterrupted() { // return isInterrupted; // } // // @Override // public boolean isFinished() { // return hasFinished; // } // // @NotNull // @Override // public BuildFinishedStatus waitFor() throws RunBuildException { // while (!isInterrupted() && !hasFinished) { // try { // Thread.sleep(1000); // } catch (InterruptedException e) { // throw new RunBuildException(e); // } // } // return hasFinished ? statusCode : BuildFinishedStatus.INTERRUPTED; // } // // @Override // public void start() throws RunBuildException { // try { // statusCode = runProcess(); // hasFinished = true; // } catch (UploadInterruptedException e) { // hasFinished = false; // } // } // // /** // * @return true is process finished successfully // */ // protected abstract BuildFinishedStatus runProcess(); // // protected void checkIsInterrupted() throws UploadInterruptedException { // if (isInterrupted()) throw new UploadInterruptedException(); // } // // } // // Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/UploadInterruptedException.java // public class UploadInterruptedException extends RuntimeException { // // } // // Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/DeployerAgentUtils.java // public static void logBuildProblem(BuildProgressLogger logger, String message) { // logger.logBuildProblem(BuildProblemData // .createBuildProblem(String.valueOf(message.hashCode()), // DeployerRunnerConstants.BUILD_PROBLEM_TYPE, // "Deployment problem: " + message)); // } // Path: deploy-runner-agent-smb2/src/main/java/jetbrains/buildServer/deployer/agent/smb/SMBJBuildProcessAdapter.java import com.hierynomus.msdtyp.AccessMask; import com.hierynomus.mssmb.SMB1NotSupportedException; import com.hierynomus.mssmb2.SMB2ShareAccess; import com.hierynomus.protocol.transport.TransportException; import com.hierynomus.smbj.SMBClient; import com.hierynomus.smbj.SmbConfig; import com.hierynomus.smbj.auth.AuthenticationContext; import com.hierynomus.smbj.common.SMBRuntimeException; import com.hierynomus.smbj.connection.Connection; import com.hierynomus.smbj.session.Session; import com.hierynomus.smbj.share.DiskShare; import com.hierynomus.smbj.share.Share; import com.intellij.openapi.diagnostic.Logger; import com.intellij.openapi.util.text.StringUtil; import jetbrains.buildServer.agent.BuildFinishedStatus; import jetbrains.buildServer.agent.BuildRunnerContext; import jetbrains.buildServer.agent.impl.artifacts.ArtifactsCollection; import jetbrains.buildServer.deployer.agent.SyncBuildProcessAdapter; import jetbrains.buildServer.deployer.agent.UploadInterruptedException; import jetbrains.buildServer.log.Loggers; import jetbrains.buildServer.util.FileUtil; import org.jetbrains.annotations.NotNull; import org.jetbrains.annotations.Nullable; import java.io.File; import java.io.FileInputStream; import java.io.IOException; import java.io.OutputStream; import java.util.EnumSet; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.Stack; import static com.hierynomus.mssmb2.SMB2CreateDisposition.FILE_OVERWRITE_IF; import static jetbrains.buildServer.deployer.agent.DeployerAgentUtils.logBuildProblem; "target=[" + target + "]"; Loggers.AGENT.debug(settingsString); myLogger.message("Starting upload via SMBj to " + myTarget); final List<String> components = StringUtil.split(target, "\\"); final String host = components.remove(0); final String shareName = components.size() > 0 ? components.remove(0) : ""; final String pathInShare = StringUtil.join(components, "\\"); try { SmbConfig config = SmbConfig .builder() .withMultiProtocolNegotiate(true) .withSigningRequired(true).build(); SMBClient client = new SMBClient(config); Connection connection = client.connect(host); Session session = connection.authenticate(new AuthenticationContext(myUsername, myPassword.toCharArray(), myDomain)); Share share = session.connectShare(shareName); if (share instanceof DiskShare) { DiskShare diskShare = (DiskShare)share; for (ArtifactsCollection artifactsCollection : myArtifactsCollections) { final int numOfUploadedFiles = upload(artifactsCollection.getFilePathMap(), diskShare, pathInShare); myLogger.message("Uploaded [" + numOfUploadedFiles + "] files for [" + artifactsCollection.getSourcePath() + "] pattern"); } } else {
logBuildProblem(myLogger, "Shared resource [" + shareName + "] is not a folder, can not upload files.");
JetBrains/teamcity-deployer-plugin
deploy-runner-agent-smb2/src/main/java/jetbrains/buildServer/deployer/agent/smb/SMBJBuildProcessAdapter.java
// Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/SyncBuildProcessAdapter.java // public abstract class SyncBuildProcessAdapter extends BuildProcessAdapter { // protected final BuildProgressLogger myLogger; // private volatile boolean hasFinished; // private volatile BuildFinishedStatus statusCode; // private volatile boolean isInterrupted; // // // public SyncBuildProcessAdapter(@NotNull final BuildProgressLogger logger) { // myLogger = logger; // hasFinished = false; // statusCode = null; // } // // // @Override // public void interrupt() { // isInterrupted = true; // } // // @Override // public boolean isInterrupted() { // return isInterrupted; // } // // @Override // public boolean isFinished() { // return hasFinished; // } // // @NotNull // @Override // public BuildFinishedStatus waitFor() throws RunBuildException { // while (!isInterrupted() && !hasFinished) { // try { // Thread.sleep(1000); // } catch (InterruptedException e) { // throw new RunBuildException(e); // } // } // return hasFinished ? statusCode : BuildFinishedStatus.INTERRUPTED; // } // // @Override // public void start() throws RunBuildException { // try { // statusCode = runProcess(); // hasFinished = true; // } catch (UploadInterruptedException e) { // hasFinished = false; // } // } // // /** // * @return true is process finished successfully // */ // protected abstract BuildFinishedStatus runProcess(); // // protected void checkIsInterrupted() throws UploadInterruptedException { // if (isInterrupted()) throw new UploadInterruptedException(); // } // // } // // Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/UploadInterruptedException.java // public class UploadInterruptedException extends RuntimeException { // // } // // Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/DeployerAgentUtils.java // public static void logBuildProblem(BuildProgressLogger logger, String message) { // logger.logBuildProblem(BuildProblemData // .createBuildProblem(String.valueOf(message.hashCode()), // DeployerRunnerConstants.BUILD_PROBLEM_TYPE, // "Deployment problem: " + message)); // }
import com.hierynomus.msdtyp.AccessMask; import com.hierynomus.mssmb.SMB1NotSupportedException; import com.hierynomus.mssmb2.SMB2ShareAccess; import com.hierynomus.protocol.transport.TransportException; import com.hierynomus.smbj.SMBClient; import com.hierynomus.smbj.SmbConfig; import com.hierynomus.smbj.auth.AuthenticationContext; import com.hierynomus.smbj.common.SMBRuntimeException; import com.hierynomus.smbj.connection.Connection; import com.hierynomus.smbj.session.Session; import com.hierynomus.smbj.share.DiskShare; import com.hierynomus.smbj.share.Share; import com.intellij.openapi.diagnostic.Logger; import com.intellij.openapi.util.text.StringUtil; import jetbrains.buildServer.agent.BuildFinishedStatus; import jetbrains.buildServer.agent.BuildRunnerContext; import jetbrains.buildServer.agent.impl.artifacts.ArtifactsCollection; import jetbrains.buildServer.deployer.agent.SyncBuildProcessAdapter; import jetbrains.buildServer.deployer.agent.UploadInterruptedException; import jetbrains.buildServer.log.Loggers; import jetbrains.buildServer.util.FileUtil; import org.jetbrains.annotations.NotNull; import org.jetbrains.annotations.Nullable; import java.io.File; import java.io.FileInputStream; import java.io.IOException; import java.io.OutputStream; import java.util.EnumSet; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.Stack; import static com.hierynomus.mssmb2.SMB2CreateDisposition.FILE_OVERWRITE_IF; import static jetbrains.buildServer.deployer.agent.DeployerAgentUtils.logBuildProblem;
Connection connection = client.connect(host); Session session = connection.authenticate(new AuthenticationContext(myUsername, myPassword.toCharArray(), myDomain)); Share share = session.connectShare(shareName); if (share instanceof DiskShare) { DiskShare diskShare = (DiskShare)share; for (ArtifactsCollection artifactsCollection : myArtifactsCollections) { final int numOfUploadedFiles = upload(artifactsCollection.getFilePathMap(), diskShare, pathInShare); myLogger.message("Uploaded [" + numOfUploadedFiles + "] files for [" + artifactsCollection.getSourcePath() + "] pattern"); } } else { logBuildProblem(myLogger, "Shared resource [" + shareName + "] is not a folder, can not upload files."); return BuildFinishedStatus.FINISHED_FAILED; } return BuildFinishedStatus.FINISHED_SUCCESS; } catch (TransportException e) { final String message; if (hasCauseOfType(SMB1NotSupportedException.class, e)) { message = "The remote host [" + host + "] does not support SMBv2 or support was explicitly disabled. Please, check the remote host configuration"; } else { message = e.getMessage(); } logBuildProblem(myLogger, message); LOG.warnAndDebugDetails("Error executing SMB command", e); return BuildFinishedStatus.FINISHED_FAILED;
// Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/SyncBuildProcessAdapter.java // public abstract class SyncBuildProcessAdapter extends BuildProcessAdapter { // protected final BuildProgressLogger myLogger; // private volatile boolean hasFinished; // private volatile BuildFinishedStatus statusCode; // private volatile boolean isInterrupted; // // // public SyncBuildProcessAdapter(@NotNull final BuildProgressLogger logger) { // myLogger = logger; // hasFinished = false; // statusCode = null; // } // // // @Override // public void interrupt() { // isInterrupted = true; // } // // @Override // public boolean isInterrupted() { // return isInterrupted; // } // // @Override // public boolean isFinished() { // return hasFinished; // } // // @NotNull // @Override // public BuildFinishedStatus waitFor() throws RunBuildException { // while (!isInterrupted() && !hasFinished) { // try { // Thread.sleep(1000); // } catch (InterruptedException e) { // throw new RunBuildException(e); // } // } // return hasFinished ? statusCode : BuildFinishedStatus.INTERRUPTED; // } // // @Override // public void start() throws RunBuildException { // try { // statusCode = runProcess(); // hasFinished = true; // } catch (UploadInterruptedException e) { // hasFinished = false; // } // } // // /** // * @return true is process finished successfully // */ // protected abstract BuildFinishedStatus runProcess(); // // protected void checkIsInterrupted() throws UploadInterruptedException { // if (isInterrupted()) throw new UploadInterruptedException(); // } // // } // // Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/UploadInterruptedException.java // public class UploadInterruptedException extends RuntimeException { // // } // // Path: deploy-runner-agent/src/main/java/jetbrains/buildServer/deployer/agent/DeployerAgentUtils.java // public static void logBuildProblem(BuildProgressLogger logger, String message) { // logger.logBuildProblem(BuildProblemData // .createBuildProblem(String.valueOf(message.hashCode()), // DeployerRunnerConstants.BUILD_PROBLEM_TYPE, // "Deployment problem: " + message)); // } // Path: deploy-runner-agent-smb2/src/main/java/jetbrains/buildServer/deployer/agent/smb/SMBJBuildProcessAdapter.java import com.hierynomus.msdtyp.AccessMask; import com.hierynomus.mssmb.SMB1NotSupportedException; import com.hierynomus.mssmb2.SMB2ShareAccess; import com.hierynomus.protocol.transport.TransportException; import com.hierynomus.smbj.SMBClient; import com.hierynomus.smbj.SmbConfig; import com.hierynomus.smbj.auth.AuthenticationContext; import com.hierynomus.smbj.common.SMBRuntimeException; import com.hierynomus.smbj.connection.Connection; import com.hierynomus.smbj.session.Session; import com.hierynomus.smbj.share.DiskShare; import com.hierynomus.smbj.share.Share; import com.intellij.openapi.diagnostic.Logger; import com.intellij.openapi.util.text.StringUtil; import jetbrains.buildServer.agent.BuildFinishedStatus; import jetbrains.buildServer.agent.BuildRunnerContext; import jetbrains.buildServer.agent.impl.artifacts.ArtifactsCollection; import jetbrains.buildServer.deployer.agent.SyncBuildProcessAdapter; import jetbrains.buildServer.deployer.agent.UploadInterruptedException; import jetbrains.buildServer.log.Loggers; import jetbrains.buildServer.util.FileUtil; import org.jetbrains.annotations.NotNull; import org.jetbrains.annotations.Nullable; import java.io.File; import java.io.FileInputStream; import java.io.IOException; import java.io.OutputStream; import java.util.EnumSet; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.Stack; import static com.hierynomus.mssmb2.SMB2CreateDisposition.FILE_OVERWRITE_IF; import static jetbrains.buildServer.deployer.agent.DeployerAgentUtils.logBuildProblem; Connection connection = client.connect(host); Session session = connection.authenticate(new AuthenticationContext(myUsername, myPassword.toCharArray(), myDomain)); Share share = session.connectShare(shareName); if (share instanceof DiskShare) { DiskShare diskShare = (DiskShare)share; for (ArtifactsCollection artifactsCollection : myArtifactsCollections) { final int numOfUploadedFiles = upload(artifactsCollection.getFilePathMap(), diskShare, pathInShare); myLogger.message("Uploaded [" + numOfUploadedFiles + "] files for [" + artifactsCollection.getSourcePath() + "] pattern"); } } else { logBuildProblem(myLogger, "Shared resource [" + shareName + "] is not a folder, can not upload files."); return BuildFinishedStatus.FINISHED_FAILED; } return BuildFinishedStatus.FINISHED_SUCCESS; } catch (TransportException e) { final String message; if (hasCauseOfType(SMB1NotSupportedException.class, e)) { message = "The remote host [" + host + "] does not support SMBv2 or support was explicitly disabled. Please, check the remote host configuration"; } else { message = e.getMessage(); } logBuildProblem(myLogger, message); LOG.warnAndDebugDetails("Error executing SMB command", e); return BuildFinishedStatus.FINISHED_FAILED;
} catch (UploadInterruptedException e) {