contents stringlengths 467 9.35k | metadata dict | id int64 1.26k 60.3M |
|---|---|---|
theoretical limit to the length of possible legitimate chemical terms. A DNA molecule could have a name of over 1,000,000,000 letters if it was written out in full.
ACETYLSERYLTYROSYLSERYLISOLEUCYLTHREONYLSERYLPROLYLSERYLGLUTAMINYLPHENYLALANYLVALYLPHENYLALANYLLEUCYLSERYLSERYLVALYLTRYPTOPHYLALANYL... | {
"pile_set_name": [
"Pile-CC",
"Pile-CC"
]
} | 41,062,277 |
of possible legitimate chemical terms. A DNA molecule could have a name of over 1,000,000,000 letters if it was written out in full.
(1,185) ACETYLSERYLTYROSYLSERYLISOLEUCYLTHREONYLSERYLPROLYLSERYLGLUTAMINYLPHENYLALANYLVALYLPHENYLALANYLLEUCYLSERYLSERYLVALYLTRYPTOPHYLALANYLASPARTYLPROLYLISOLEUCYL... | {
"pile_set_name": [
"StackExchange",
"StackExchange"
]
} | 8,329,045 |
Alison , , -
lesbian couples -,
lesbians , , , -, ,
lesbigay families, feeding of , -,
Levi-Strauss, Claude -, , , , -, -, -
Leviticus, abominations of , -
Levkoe, Charles Z. -
liberation, black -, -, -
Lidwina of Schiedam -, -
life histories, food-centered , , -, , -
lifestyles , , , , , , -
liver disease ,... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 8,624,040 |
me carrying a weight and I am
- ! # River and water to remove thirst of hundred - * when hundreds of Bhikshus remain in monastery without ... | {
"pile_set_name": [
"PhilPapers",
"PhilPapers"
]
} | 12,893,623 |
9 to 12 weeks the family groups begin to break up, and in 12 to 15 weeks the weasels reach their adult weight.
ATGTTCATTAATCGATGATTATTTTCCACTAATCACAAAGACATCGGCACCCTTTACCTCTTATTTGGTGCATGAGCCGGAATAGTAGGTACTGCCCTCAGTCTACTAATCCGCGCTGAACTTGGTCAACCTGGCGCTCTATTAGGAGACGACCAGGTTTATAACGTGATCGTGACTGCTCACGCATTTGTAATAATTTTCTTCATAG... | {
"pile_set_name": [
"Pile-CC",
"Pile-CC"
]
} | 11,031,466 |
–94
krill harvesting at,
new fungi in,
oil and mineral resources of,
pack ice of, –95
penguins of,
Shackleton Centennial Expedition to,
update, –96
vulnerability of,
Antarctic Circle, crossing of,
Antarctic Treaty,
anti-Semitism, , , ,
Anufriev, Sergey, ,
Arab Spring, ,
Arakan (Rakhine) State, , –63
auth... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 40,798,186 |
sicher hinwegzukommen, steile und oft auch mühsame Aufstiege zu bewältigen und so manches Hindernis aus dem Weg zu schaffen. Ich bin mir darüber im klaren, dass noch eine lange Strecke des Weges zurückzulegen ist, jedoch kann ich stets zuversicht-lich weiterwandern, da ich in der Geisteslehre Richtlinien für ein Dasein... | {
"pile_set_name": [
"BookCorpus2",
"BookCorpus2"
]
} | 13,078,874 |
gleichkomme.
Während die Eidgenossen – von allen Seiten durch die Achsenmächte eingeschlossen – über den Freihafen Genua und eine eigene Handelsflotte ihr materielles Überleben sicherten, fanden sich die Berner Behörden zu diskreten Vereinbarungen über den Transit deutschen Nachschubs für die in Nordafrika, dann in It... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 1,474,813 |
not quite true. My father had a way of naming things with marks, you see. Each animal, each plant, he made a sign for in the red clay that was such a part of him he is forever known by it; and in these marks he wrote my name in two parts, En and Ki. As I travelled down into the land between the rivers Tigris and Euphra... | {
"pile_set_name": [
"Pile-CC",
"FreeLaw"
]
} | 57,955,953 |
politicus_ entworfen wird, auszulöschen.
# Die Ausbreitung der neoliberalen Vernunft
# Kapitel vier
Politische Rationalität und Governance
»Politische Rationalität« oder »Regierungsrationalität« sind die Begriffe, die Foucault verwendete, um unter anderem die Art und Weise zu kennzeichnen, wie sich der Neoliberalis... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 6,099,936 |
to Dalat. Elsewhere, in Saigon, smaller prisons held soldiers from British India. All these men were sent to work either on loading and unloading ships flying the Japanese flag which were moored in Saigon Bay or else on the building of an aerodrome. The working day varied between 11 and 18 hours, with insufficient food... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 43,503,420 |
in den Kasematten der altertümlichen Festung.
Im Lauf des Nachmittags war ein Trupp der politischen Sonderpolizei aus Saigon eingetroffen, überwiegend Eurasier. Sie hatten Gefangene verhört. Dabei war gefoltert worden, wie wir bei unserer Ankunft im Fort erfuhren. Den Verdächtigen waren die Köpfe so lange in Wasserküb... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 1,475,019 |
ganska nöjd med sitt utseende, även om hon tyckte att systern Tanja var vackrare. Tanja hade fått mammans skönhet, medan Vera ärvt sina drag från pappans ryska släkt. Föräldrarna hade träffats i Västberlin och efter några år där flyttade familjen till Hamburg där pappa Oleg fick nytt arbete som biolog på ett större för... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 1,835,771 |
geworden war und somit zwei Herren hätte dienen müssen. Ihr Amt als Parlamentarische Staatssekretärin legte sie zwar nieder, wollte aber auf das üppige Übergangsgeld daraus ebenso wenig verzichten wie auf die spätere Kumulation der Altersversorgungen.
Der Wechsel war zunächst in den Medien mitgeteilt worden, ohne die ... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 4,867,234 |
and my teacher Guru-Mitra said that time has come when Buddhism will ) / # s of crime and loot and people who are defaming Buddhism will ruin it totally very soon We were interrupted as Sanjali rushed inside and she saw me sitting there and then her fa... | {
"pile_set_name": [
"PhilPapers",
"PhilPapers"
]
} | 12,893,648 |
Halliday eine scharfe Kritik am UNO-Sicherheitsrat, die sie in der britischen Zeitung _Guardian_ publizierten. »Dient denn der UNO-Sicherheitsrat nur den Mächtigen?«, so die präzise Frage der zwei Autoren. »Die USA und Großbritannien sind als ständige Mitglieder des UNO-Sicherheitsrates sehr gut darüber informiert, das... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 56,587,927 |
COURT OF APPEALS
SECOND
DISTRICT OF TEXAS
FORT
WORTH
NO.
2-04-242-CV
TXI TRANSPORTAT... | {
"pile_set_name": [
"FreeLaw",
"FreeLaw"
]
} | 3,345,020 |
silloin hän voisi hengittää rauhallisesti, sillä sitten kukaan ei enää saisi tietää hänen salaisuudestaan – siitä kammottavasta virheestä, josta vain hän itse tiesi.
## VIII
Tuona joulukuisena torstaina koulussa valmistauduttiin tulevaan itsenäisyysjuhlaan, joka pidettäisiin itsenäisyyspäivän jälkeisenä keskiviikkona... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 41,832,455 |
\\@@@@@@/@@@%%%######,
@@@@@%%%%/%%//| |\\@\\//@@%%%%%%#/####
'@@@@@%%\\/%~ | | ~ @|| %\\//%%%#####;
@@\\//@|| | __ __ | || %%||%%'######
'@|| || | | | | | || ||##\//####
|| || | | -|- | | || ||'#||###'
|| || |_|__|__|_| || || ||
|| ||_/` ======= `\__||_._|| ||
jgs__||_/` ======= `\_||___
Six year old Angie, and her fo... | {
"pile_set_name": [
"Pile-CC",
"Pile-CC"
]
} | 47,035,478 |
ja nur gesagt, dass sie mit den Pfeilen die Sonne verdunkeln wollen. War etwa irgendwann die Rede davon, jemanden zu treffen?
Und wer weiß – wenn man den richtigen Feind erwischt, reicht das Verdunkeln vielleicht schon aus.
122 Faustregel: Eine Person pro Quadratmeter = lockere Menschenansammlung; vier Personen pro Q... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 3,794,626 |
/*
Copyright (C) 2009 Onno Hommes.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, s... | {
"pile_set_name": [
"Github",
"OpenWebText2"
]
} | 9,979,674 |
<< 12 | 0b000111101, :drn, :fpul
addop 'ftrc', 0b1111 << 12 | 0b00111101, :frn, :fpul
addop 'ftrv', 0b1111 << 12 | 0b0111111101, :xmtrx, :fvn
addop 'jmp', 0b0100 << 12 | 0b00101011, :rn, :setip, :stopexec, :delay_slot
addop 'jsr', 0b0100 << 12 | 0b00001011, :rn, :setip, :saveip, :stopexec, :delay_slot
addop... | {
"pile_set_name": [
"Github",
"Github"
]
} | 9,940,537 |
ace.define("ace/mode/mips_assembler_highlight_rules",["require","exports","module","ace/lib/oop","ace/mode/text_highlight_rules"], function(require, exports, module) {
"use strict";
var oop = require("../lib/oop");
var TextHighlightRules = require("./text_highlight_rules").TextHighlightRules;
var MIPSAssemblerHighlig... | {
"pile_set_name": [
"Github",
"OpenWebText2"
]
} | 3,197,071 |
sadan naermest i tanker.
Mit blik var dybblat og uudgrundeligt som havet fra en storebaeltsfaerge. Rød var jeg som en skoldet krebs, hvis klotegn jeg saledes vankelmodigt indledte pa Stigsnaes.
Glatkødet, dog med visse fedtbolde i arm og knaehuler, tilsvarende pølser i de knyttede naever, blev jeg vasket i lunkent va... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 57,691,698 |
strafen und auch Schlachten (Kriege) über das eigene Volk oder über andere Völker bringen, wie sie auch Tod und Verderben über ihre Umwohner (Nachbarn) oder in falschem Ehrgefühl auch Tod und Verderben (Ehrenmorde) über das eigene Geschlecht (Familie/Verwandtschaft) herbei-führen.
0. Die Lauterkeiten (Tugenden) sind... | {
"pile_set_name": [
"BookCorpus2",
"BookCorpus2"
]
} | 13,081,637 |
est basse et
profonde, passée à la chaux blanche et ornée de cadres dorés où se
voient des navires, des abordages, des naufrages. Dans un angle, une
Vierge en faïence est posée sur une console, entre des bouquets
artificiels.
Ces vieux murs ont entendu vibrer bien des chants puissants de matelots,
ont vu s'épanouir bi... | {
"pile_set_name": [
"Gutenberg (PG-19)",
"Gutenberg (PG-19)"
]
} | 58,511,048 |
calculator, după care am transcris cu atenţie răspunsurile pe pagina deschisă a caietului meu, repetând răspunsul în gând, pentru a şterge din minte orice amintire a Mâinii Negre.
La ora cinci, am sunat-o pe mama, care era în New Hampshire.
— Voiam să văd dacă eşti bine, am spus, cum merge treaba?
— La fel ca de obi... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 3,297,391 |
"discard",
347: "fatserv",
4224: "xtell",
6514: "syslog-tls",
27374: "asp",
1127: "supfiledbg",
2606: "ospf6d",
2605: "bgpd",
4949: "munin",
57000: "dircproxy",
444: "snpp",
9102: "bacula-fd",
49: "tacacs",
5672: "amqp",
7006: "afs3-errors",
8080: "http-alt",
2989: "af... | {
"pile_set_name": [
"Github",
"Github"
]
} | 638,647 |
children take on these traits (395c‐d, 400d‐401d). For this reason, craftsmen who imitate good character "lead them [children] unwit‐ discourse
worth
serious
attention
has
ever
been
written
in
verse
or
prose"
(277e5‐8). Socrates goes on to distinguish the
written discourse of the philosopher from those of other
writers... | {
"pile_set_name": [
"PhilPapers",
"PubMed Central"
]
} | 3,283,540 |
<< 12 | 0b1100, :frm, :frn
addop 'fmov.s', 0b1111 << 12 | 0b1010, :frm, :@rn
addop 'fmov.s', 0b1111 << 12 | 0b1011, :frm, :@_rn
addop 'fmov.s', 0b1111 << 12 | 0b0111, :frm, :@r0rn
addop 'fmov', 0b1111 << 12 | 0b0 << 8 | 0b11100, :xdm, :drn
addop 'fmov', 0b1111 << 12 | 0b1 << 8 | 0b11100, :xdm, :xdn
addop '... | {
"pile_set_name": [
"Github",
"Github"
]
} | 9,940,535 |
sömn med Shae, men mest av allt ville han strypa sin kunglige systerson.
_Jag är inte främmande för valyriskt stål,_ hade pojken skrutit. Kaplanerna tjatade alltid om att Fadern uppe i himlen dömer oss alla. _Om Fadern ville vara så god och krossa Joff som en dyngbagge skulle jag kunna tro på honom._
Han borde ha för... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 49,977,552 |
teaches rationality and rationality is science that highlight facts and make development. I look towards Sanjali but she was not interested in the conversation, she simply looking into river. The Bank was appr ) you really want to go to see the city then I have no % ... | {
"pile_set_name": [
"PhilPapers",
"PhilPapers"
]
} | 12,893,663 |
feelings for the others, harmony, his knowledge and wisdom, and gain thereout encouragement, consolation and cognition. When I consider how often Billy has patiently and extensively answered practically the same questions for me time and time again – although I could
592 Kelch der Wahrheit
obwohl die Antworten auch i... | {
"pile_set_name": [
"BookCorpus2",
"BookCorpus2"
]
} | 13,083,352 |
at the end of July.
Page 282, ' _In the distance, Big Ben struck eleven o'clock_.' The date of this meeting is not recorded in the diaries of Agar, Dukes or Cumming. It must have been between 24 September when Agar arrived back in the country and 4 October when Dukes left London to go on leave. Cumming's diary entries... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 13,422,102 |
leben.
1570Ich Sohn des Unglücks zeige mich; sogleich
Ist dieser schöne Traum gestört. – Dafür
Soll mich die schleunigste Entfernung –
(Er will gehen.)
PRINZESSIN (überrascht und betroffen, doch sogleich wieder gefasst). Prinz –
O das war boshaft.
[64]KARLOS. Fürstin – ich verstehe,
Was dieser Blick in diesem K... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 58,446,166 |
Biju Narayanan, Priya R. Pai, Anvar Saduth and Poornasree.
Early life
Mohan Sithara was born at Peruvallur, Thrissur, Kerala, India in 1959. He started his music career as violinist in some music troupes, one of which was Sithara troup (from which he took the name Mohan Sithara). Later he worked with various music co... | {
"pile_set_name": [
"Wikipedia (en)",
"Wikipedia (en)"
]
} | 9,069,445 |
resulta difícil salir de casa, lo que significa que tenemos que ir a verla nosotros.
–Podrías limitarte a decir que no –le comenté la semana pasada.
–Prueba a hacerlo. –Sonrió y, la noche siguiente, me tendió su teléfono móvil–. Quiere hablar contigo –dijo.
«Joder», exclamé. Fue una conversación rápida. Barbara habl... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 11,657,047 |
letter_.
ǣrendwreca (-raca), m., _messenger_.
ǣrest, adj. (§ 96, (4)), _first_.
ærnan (§ 127), _ride, gallop_ [iernan].
ǣrra, adj. (§ 96, (4)), _former_.
ǣrwela, m., _ancient wealth_.
æsc, m., _ash, spear_; gen. pl., asca.
Æscesdūn, f., _Ashdown_ (in Berkshire).
æstel, m., _book-mark_ [Lat. hastula].
... | {
"pile_set_name": [
"Gutenberg (PG-19)",
"Gutenberg (PG-19)"
]
} | 57,065,969 |
→ v) = r. For r: u → v ∈ P, u and v represent the left-hand side of r, denoted by , and the right-hand side of r, denoted by , respe... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 57,164,204 |
Da immer mehr Staub und Steine in das Loch rutschten, das er freigewühlt hatte, begann er erneut heftig zu graben. Nach und nach weitete er den Raum aus, bis er sich schließlich auf seinen rechten Ellbogen aufstützen konnte. Unter einem Hustenanfall, der so stark war, dass er dachte, seine Lunge würde platzen, hievte e... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 689,096 |
ca și cum ar fi trebuit să știe cine sunt. Fusesem colegă la facultate cu un Francesco de Greci; ne-am tras-o o dată. O stradă din Florența fusese botezată cu numele familiei lui.
— Minunat.
Părea interesat. M-am prefăcut că plec.
— Luam ceva doar. Așadar... mă bucur că ne-am văzut.
M-am arătat reticentă să plec, ș... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 39,985,035 |
established his own legitimacy and place in the succession by making regular offerings to a list of the names of his predecessors. The king-lists have survived in various forms, mostly dating to the New Kingdom, but the earliest is the so-called Palermo Stone, a large fragment of a basalt stele in the Palermo Archaeolo... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 46,461,157 |
and to the feelynge of His love. Thanne bringeth love into the soule the fulheed of
vertues, and turneth hem alle into likynge and softenesse as it were withoute wirkynge
of the soule; for the soule striveth not mykil for the getynge of hem as it dide bifore, but
it hath hem esili and felith hem restfulli, oonli thorug... | {
"pile_set_name": [
"Pile-CC",
"Pile-CC"
]
} | 50,498,290 |
jak je dobře.
>> Tak jsem jen tak náhodou přišel připravený
s celou partou papírky.
A na těchto kouscích papíru jsou čísla
které představují to, co sloupce
vy se chystáte zastupovat.
Takže si budou - Jak se jmenujete?
>> STUDENT: Anna Leah.
>> DAVID Malan: Anna Leah, ty
bude 128s sloupec.
Jste?
>> STUDENT: Chris.
>> DA... | {
"pile_set_name": [
"YoutubeSubtitles",
"YoutubeSubtitles"
]
} | 5,458,678 |
[[The later Annals of Beleriand]]
* ''[[The Lost Road and Other Writings]]'', [[Quenta Silmarillion]]
* ''[[The Lost Road and Other Writings]]'', [[Quenta Silmarillion]]
Line 156:
Line 164:
* ''[[J.R.R. Tolkien: A Biography]]'' by [[Humphrey Carpenter]]
* ''[[J.R.R. Tolkien: A Biography]]'' by [[Humphrey Carpente... | {
"pile_set_name": [
"Pile-CC",
"Pile-CC"
]
} | 8,789,459 |
1925_ )
1 **Amérique** ] Amerique _LR, US 1920, 1925_
4 **à** ] á _LR, US 1920_
5 **conférencier** ] conferencier _LR, US 1920_
6 **banquier,** ] banquier; _1919, AraVP_
7] _enclosed in brackets 1919, AraVP_
9 **noir** ] noire _1919_
14 **tra là là** ] tra la la _printings prior to 1925_
15 **jusqu'à Omaha.** ]... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 7,115,279 |
era a calma em pessoa de súbito agitado, nervoso, servindo a clientela como se não me visse, e o César que tomava café ao balcão com a Adelaide, para o senhor Vergílio tão vermelho que dava dó
— Desde quando atendes fascistas Ferreira?
a neta a levantar-se num ímpeto da mesa, enojada comigo, ferrando-me com toda a fo... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 59,315,826 |
såna prylar bör ha räckt, kan man tycka, för att öppna utvägar åt N. Vokaal..._
_1 hipp kardinal som ropar antikatolska slagord,_
_1 rakkniv för nyplockad citronskörd,_
_3 brittiska brottslingar som rånats av posttåg,_
_1 spikrak kontur,_
_1 vulkanutbrott ur manliga navlar,_
_1 infödd utlänning,_
_1 armlös idiot... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 52,013,831 |
entrant, elle dit qu'elle apportait l'argent de cette barque vendue,
et on la fit asseoir très poliment pour attendre le retour du père, qui
lui signerait son reçu. Parmi tout ce monde qui était là, ses yeux
cherchèrent Yann, mais elle ne le vit point.
On était fort occupé dans la maison. Sur une grande table bien bla... | {
"pile_set_name": [
"Gutenberg (PG-19)",
"Gutenberg (PG-19)"
]
} | 58,510,903 |
tog ögonen av gagat och lapis lazuli och pärlemor, petade ut dem med knivarna. Må Modern ha förbarmande."
"Vems verk var detta?" frågade Gul. "De blodiga gycklarnas?"
"Nej", svarade den gamle. "De var nordmän, vildar som dyrkar träd. De ville ha tag i kungamördaren, sa de."
Arya hörde vad han sa och kände sig både a... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 49,976,183 |
denn ein Unter-schied ist nur gegeben in bezug auf den Stand der Bewusstseinsevolution sowie hinsichtlich dem Grad von Verstand und der Vernunft, woraus auch das Wahrnehmen der Verantwortung resultiert.
0. Das Wahrnehmen der Verantwortung aber ist auch verbunden mit dem Wahrnehmen der Realität der schöp-ferischen Ge... | {
"pile_set_name": [
"BookCorpus2",
"BookCorpus2"
]
} | 13,082,705 |
Fulham winger Alexander Kacaniklic is a major doubt for the start of the season after picking up a hamstring injury.
The 21-year-old was hurt during the pre-season friendly against Werder Bremen on Sunday and was taken off just before the half-hour mark.
He now faces a fight to be fit for the opening Premier League f... | {
"pile_set_name": [
"OpenWebText2",
"OpenWebText2"
]
} | 55,374,622 |
NEW YORK CITY — As tempting as it may be, New Yorkers shouldn't spend their snow day in the park, city officials said.
Department of Parks and Recreation officials warned that people should avoid the parks while the Thursday snowstorm pummels the city through the morning.
New Yorkers are urged to stay out of City par... | {
"pile_set_name": [
"OpenWebText2",
"StackExchange"
]
} | 44,231,050 |
end surface 104 of the mating projection 103. For this reason, there is a case where it becomes difficult to uniformly fuse all of the plurality of sets of mating projections 101 and 103.
In order to simultaneously apply the ultrasonic wave to a plurality of sets of mating projections 101 and 103 to melt the projection... | {
"pile_set_name": [
"USPTO Backgrounds",
"Github"
]
} | 57,818,741 |
alte vase de cristal vechi și porțelanuri moderne, de un portocaliu aprins, imprimate cu numele vasului, _Mandarin_ – Steve mi-a făcut entuziasmat turul vasului. Am inspectat pista de aterizare pentru elicopter, am aflat despre blindajul cabinei în stil militar rusesc, despre balcoanele de pe punte, despre peretele din... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 39,984,932 |
erwerben. Und als wir im Herbst 1989 über den Ring in Leipzig und Sie über andere ostdeutsche Straßen marschiert sind, da schritten die Immobilienhaie aus den alten Ländern bereits ihre Claims ab.
Darum ist ausgerechnet die OSTseeküste in WESThand geraten.
Wenn Ihr Geld nicht reicht, um sich in Ihrer Heimat ein Grund... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 5,350,843 |
oppe på stilladserne eller med stentransporter. Men de var tværtimod midt i et ophidset politisk møde. Mændene stod i en stor rundkreds uden om Johan Svenske, der balancerede højt til vejrs på en tønde. Han var ved at holde tale i bedste agitatorstil. Gang på gang understregede han det, han sagde, med en hævet klasseka... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 45,144,173 |
détresse qui va mourir.
Pour la Marie, c'était ainsi; au commencement cela ne paraissait pas
beaucoup; elle se tenait bien un peu inclinée, il est vrai, mais c'était
en plein matin, par un beau temps calme; il fallait savoir pour
s'inquiéter et comprendre que c'était grave.
Le capitaine faisait un peu pitié, lui qui ... | {
"pile_set_name": [
"Gutenberg (PG-19)",
"Gutenberg (PG-19)"
]
} | 58,510,950 |
of the question.
Hitler was a symbol of
huge political importance,
like the taking of the Reichstag
and the conquest of Berlin.
Indonesian:
Stalin jarang muncul dari Kremlin,
tapi ia memiliki
informan di mana-mana.
Setiap hari, dokumen
baru tentang kematian Hitler
dan identifikasinya tiba.
Mereka akurat dan pasti.
Me... | {
"pile_set_name": [
"YoutubeSubtitles",
"YoutubeSubtitles"
]
} | 40,653,354 |
that, surprisingly, the converse is also true: A weakly mixing system is even weakly mixing of every order  (Theorem 9.31 below).
The next lemma that plays a central role in this context.
Lemma 9.28 (Van der Corput).
Let H be a Hilbert space and ![
$$\(u_... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 10,981,662 |
n'ont pas tout emporté
Cet assemblage heureux de force et de clarté,
Ces prestiges secrets de l'aimable imposture
50
Qu'à l'envi m'ont prêtée et l'art et la nature.
N'attends pas toutefois que j'ose m'enhardir,
Ou jusqu'à te dépeindre, ou jusqu'à t'applaudir ;
Ce serait présumer que d'une seule vue
J'aurais vu ... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 58,137,812 |
zu Einem grossen Siege! –
Also sprach Zarathustra.
### [270] Der Genesende.
1.
Eines Morgens, nicht lange nach seiner Rückkehr zur Höhle, sprang Zarathustra von seinem Lager auf wie ein Toller, schrie mit furchtbarer Stimme und gebärdete sich, als ob noch Einer auf dem Lager läge, der nicht davon aufstehn wolle; un... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 13,798,651 |
satt sig upp och slet i sin pistol. Så hukade han sig ännu lägre och såg mot aktern. Storansiktet satt inte kvar på stolen. Han såg konturerna av de båda stolarna. Bakom honom låg pojken stilla. Honom rådde det ingen tvekan om. På ena bänken låg en man och sprattlade. På den andra såg han i ögonvrån den andre ligga hal... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 49,813,692 |
skönhet."
Catelyn tvivlade starkt på att lord Walder hade sagt så eller att han någonsin hade fallit för en skönhet. Lorden av Bron hade överlevt sju hustrur och var nu gift med sin åttonde, men han talade bara om dem som sängvärmare och avelsston. Men orden framfördes höviskt och varken Jeyne eller Robb kunde ha någo... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 49,976,667 |
Mou
Sabrina - Epikindino Pehnidi
Ena Ena
Epikindino Pehnidi
Tora Einai Arga
Den Exoume Tipota
Alli Mia Porta Ekleise
Thanos Kalliris - Fonakse Me
Adexo
Fonakse Me An Me Hriastis
Ponao
Na Mino I Na Figo
Eftixos
Filos + Erastis
Despina Vandi - Deka Entoles
Metaniono
Lefteris Pantazis - Erhete
Anesthitiko
Antypas - K... | {
"pile_set_name": [
"Wikipedia (en)",
"Pile-CC"
]
} | 41,871,665 |
cette même heure, à bord de la Marie, - sur la
mer Boréale qui était ce soir-là très remuante - Yann et Sylvestre, les
deux désirés, se chantaient des chansons, tout en faisant gaîment leur
pêche à la lumière sans fin du jour...
Chapitre VI
Environ un mois plus tard. - En juin.
Autour de l'Islande, il fait cette sor... | {
"pile_set_name": [
"Gutenberg (PG-19)",
"Gutenberg (PG-19)"
]
} | 58,510,860 |
'scoccata', lo sbaglio sarebbe stato insignificante; ma la 'scoccata' in un col punto più vicino dell'albero, costituivano semplicemente due riferimenti per stabilire una linea di direzione; naturalmente l'errore, trascurabile all'inizio, aumentava a mano a mano che noi procedevamo nel tracciato della linea, e giunti p... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 47,643,697 |
und Götzen, weshalb sie böse Gesetze erlassen und Schlachten (Kriege) hervorbringen (anzetteln), durch die viele Euresgleichen (Menschen) getötet (gemordet) und auch grosse Zerstörungen hervorgerufen werden, nebst dem, dass durch solche Häupter (Obrigkeiten/Herrscher und Mächtige) viel Not und Elend, Unfreiheit (Hörigk... | {
"pile_set_name": [
"BookCorpus2",
"BookCorpus2"
]
} | 13,080,908 |
tournoyaient. Paimpol était
toujours très mort, même le dimanche, par ces longues soirées de mai;
des jeunes filles, qui n'avaient seulement personne pour leur faire un
peu la cour, se promenaient deux par deux, trois par trois, rêvant aux
galants d'Islande...
"... Le bonjour de ma part au fils Gaos..." Cela l'avait b... | {
"pile_set_name": [
"Gutenberg (PG-19)",
"Gutenberg (PG-19)"
]
} | 58,510,820 |
SAN DIEGO (KGTV) - A suspected burglar was shot to death and a homeowner was injured during a break-in at a San Carlos home Tuesday morning.
The incident was reported shortly before 6:30 a.m. at a home in the 6300 block of Lake Shore Drive, San Diego police said.
Police told 10News that a man suspected of breaking in... | {
"pile_set_name": [
"OpenWebText2",
"PhilPapers"
]
} | 3,283,522 |
năng|Savybė|Pretty much|Požiadavka|Požadavek|Potrzeba biznesowa|Özellik|Osobina|Ominaisuus|Omadus|OH HAI|Mogućnost|Mogucnost|Jellemző|Hwæt|Hwaet|Funzionalità|Funktionalitéit|Funktionalität|Funkcja|Funkcionalnost|Funkcionalitāte|Funkcia|Fungsi|Functionaliteit|Funcționalitate|Funcţionalitate|Functionalitate|Funcionalitat... | {
"pile_set_name": [
"Github",
"Github"
]
} | 44,217,424 |
magen, och Hermione, som hade spritt ut sina läxuppgifter över tre bord.
"Var håller alla hus?" frågade Harry.
"De har farit! Har du glömt att det här är första dagen på lovet?" sade Ron och såg granskande på Harry. "Det är nästan lunchdags, jag hade tänkt komma upp och väcka dig alldeles strax."
Harry sjönk ner i e... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 3,975,247 |
både op og ned med arbejdet, han overvejede at slå sig på storvildtjagt i stedet for, havde lige skudt en elefant, der hærgede i plantagens majsmarker, en stor krabat af en han med stødtænder på tres pund. Desværre var den ekstraindtægt endt i plantageejerens lomme, men det havde ikke desto mindre givet ham gode idéer.... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 45,144,273 |
Mar sin, mé díreach a tharla ionas go teacht ullmhaithe
le bunch iomlán de duillíní páipéir.
Agus ar na píosaí de pháipéar uimhreacha
a léiríonn cad colúin
tú guys ag dul chun ionadaíocht a dhéanamh.
Mar sin, beidh tú a bheith - cad is ainm duit?
>> LÉINN: Anna Leah.
>> DAVID MALAN: Anna Leah, tú
Beidh an colún 128s.
T... | {
"pile_set_name": [
"YoutubeSubtitles",
"YoutubeSubtitles"
]
} | 5,458,656 |
um grande barulho."
"Tem uma aspirina ou coisa parecida?"
"Aqui está", disse ele, mudando a gabardina de mão para mexer no bolso de dentro do fraque, e vi como ele meteu o Norstrund na mão que segurava a gabardina. Achei que era mais prudente deixá-lo sair do quarto com ele. Iria precisar de alguns minutos para o man... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 56,927,601 |
om och om och om igen. _De måste snart tappa känseln i benen_ , tänkte Jon då det hade gått fyra timmar. _Hur länge kan de fortsätta så här?_ Han tittade på, nästan lika oroligt som magnaren som lyssnade efter ett avlägset thennskt stridshorn. Men hornen höll sig tysta och det syntes inte ett spår av nattens väktare.
... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 49,976,484 |
accentul de Liverpool, "pernă" suna ca "piernă"; și eu mi l-am modificat pe al meu, cel pe care îl foloseam la serviciu, care devenise vocea în care visam, pentru a-l face să nu pară îmbunătățit de orele de dicție, dar, spre satisfacția evidentă a lui Olly, tot aveam un accent "rafinat".
La locul meu de muncă de zi, d... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 39,984,717 |
der Ermahnung (Gewissen) und der Ungleichstimmung (Disharmonie), wie aber auch das Feuer der Unliebe und Unfreiheit und des Unfriedens lodert; also seid reuig und wendet euch ab von all eurem Übel und vom Unrecht und begeht gute Taten, die ihr immer wieder verdoppelt, auf dass der guten Taten viele Male werden und es e... | {
"pile_set_name": [
"BookCorpus2",
"BookCorpus2"
]
} | 13,080,055 |
trading and blockchain technology get better.”
In March of this year, South Korean government officials were banned from both trading and holding cryptocurrencies. More recently, in one of the first more friendly moves towards the crypto sphere, a group of South Korean lawmakers introduced a bill to make the domestic ... | {
"pile_set_name": [
"OpenWebText2",
"Github"
]
} | 10,580,724 |
awful, I'll leave that as an exercise in research or thought for the reader.
By keeping track of how many frames we've already drawn for the current 'refresh-cycle', we know how far to index into the array for the first point to be drawn for each frame.
I've tried to parameterize the code as much as possible, but it's ... | {
"pile_set_name": [
"StackExchange",
"OpenWebText2"
]
} | 44,231,081 |
gehorsam zu erfrieren. Und wenn es Fanatiker sind? Er stellte sich einen Fanatiker vor: einen hohlwangigen, glatzköpfigen Greis mit irrlichterndem Blick und einer schweren rostigen Kette um den Hals. Nein, dachte er, Fanatiker können es auch nicht sein. Und wenn es Wanderer sind? In Jutesäcken? Er musste an die zyklopi... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 44,937,088 |
qui servait autrefois à Ayrton.
Sur le lit reposait le corps d'un homme.
Soudain, Cyrus Smith recula, et d'une voix étouffée :
« Ayrton! » s'écria-t-il.
Aussitôt, la porte fut plutôt enfoncée qu'ouverte, et les colons se précipitèrent dans la chambre.
Ayrton paraissait dormir. Son visage attestait qu'il avait long... | {
"pile_set_name": [
"BookCorpus2",
"BookCorpus2"
]
} | 58,047,522 |
fois à lui, à Yann; mais c'était aisé de le reconnaître à
distance et vite elle était déçue. Ses pieds s'embarrassaient dans de
longues plantes brunes, emmêlées comme des chevelures, qui étaient les
goémons traînant à terre.
A la croix de Plouëzoc'h, elle salue le vieillard, le priant de
retourner. Les lumières de Pai... | {
"pile_set_name": [
"Gutenberg (PG-19)",
"Gutenberg (PG-19)"
]
} | 58,510,911 |
– hur hade hon kunnat leva utan så länge? Ensamheten var alltför tung, hon förstod inte hur hon mäktat med. Det var närhet och värme hon behövde, det var kärlek som fattats henne. Och nu?
En hand rörde vid hennes kropp och Orfrim slöt henne till sig. Hon blundade. Erik, tänkte hon, du skulle aldrig ha rest, du har var... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 52,938,854 |
quella orazione ricevette dalla divina visitazione sì eccessivo fervore; il quale infiammò sì fattamente l'anima sua ad amore della santa povertà, che tra per lo colore della faccia e per lo nuovo sbadigliare11 della bocca parea ch'egli gittasse fiamme d'amore. E venendo così affocato al compagno, sì gli disse: «A! a! ... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 54,307,762 |
se olisi murjottu muodottomaksi ja kaksi viikkoa, kunnes se olisi poltettu.
Jarkko poimi parkkipaikan laidasta nyrkinkokoisen kiven ja heitti sillä autoa. Kivi osui kuljettajan puoleiseen takaikkunaan, joka hajosi sälähtäen. Jarkkoa hymyilytti. Prosessia oli juuri nopeutettu. Hän käveli auton luokse ja potkaisi jalkap... | {
"pile_set_name": [
"Books3",
"Pile-CC"
]
} | 48,989,681 |
human beings of Earth, you close your own eyes to this because you incorrectly
LXXII Kelch der Wahrheit
schreitet durch euch überall der Tod voran, während ihr der effectiven schöpferischen Wahrheit mit Zweifeln gegen-übersteht, die ihr als böse Macht betrachtet. Dadurch aber werdet ihr vom menschlichen Leben ausgesc... | {
"pile_set_name": [
"BookCorpus2",
"BookCorpus2"
]
} | 13,079,116 |
lui cum îl ceartă, pe Mama cum îl cheamă de la fereastra de sus?
— Domnule Sutton, sunteți bine?
Sutton închide ochii, ridică fața spre cer.
— _Vin, Mamă._
— Domnule _Sutton?_
* * *
Mervyn Edward "Merv" Griffin Jr. (6 iulie 1925–12 august 2007), realizator de emisiuni TV, muzician, actor și mogul media american;... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 59,612,798 |
las reglas del juego político que habría permitido gobernar a ambos partidos. Pero los moderados rechazaron el acuerdo. En cuanto regresaron al poder, trataron de reservarse los ayuntamientos, clave de las mayorías parlamentarias, por medio de una legislación electoral contraria a la Constitución. El resultado fue una ... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 55,802,340 |
per alcuni anni ebbe funzione di legge un muto accordo di maniere, di gesti, di fisiologie, che nella sua evidente precarietà pure ostentava di essere altrettanto saldo, in eterno fondato e ovviamente giusto di ogni suo barbaro predecessore.
Sviluppando il gusto, il Settecento francese imprigiona e sminuisce il senso ... | {
"pile_set_name": [
"Books3",
"Books3"
]
} | 58,033,348 |
End of preview. Expand in Data Studio
README.md exists but content is empty.
- Downloads last month
- 2