text
stringlengths 173
4.38k
| subset
stringclasses 13
values |
|---|---|
I am wondering if it is possible to have biaxial headers (1st column/row both be headers) using Kendo grid? An example of what I am looking for can be found here:
- http://jsfiddle.net/uY2JB/1/
- http://tympanus.net/Tutorials/StickyTableHeaders/index2.html
Sample Code (from jsfiddle):
<html>
<body>
<TABLE border=1 width=100%>
<thead>
<TR>
<TH>DATE</TH>
<TH>Acres</TH>
<TH>Change</TH>
<TH>Total</TH>
</TR>
</thead>
<TR>
<TH>Owned</TH>
<TD></TD>
<TD></TD>
<TD></TD>
</TR>
<TR>
<TH>Leased</TH>
<TD></TD>
<TD></TD>
<TD></TD>
</TR>
<TR>
<TH>Total</TH>
<TD></TD>
<TD></TD>
<TD></TD>
</TR>
<TR>
<TH>Reason</TH>
<td colspan=3></td>
</TR>
</TABLE>
Any help is greatly appreciated!
A:
This can be done only via custom row template:
<div id="grid"></div>
<script>
$("#grid").kendoGrid({
dataSource: [
{ header: "First Row", foo: "foo" },
{ header: "Second Row", foo: "bar" }
],
columns: [
{ width: 100, title: "Header", field: "header"},
{ title: "Foo", field: "foo"},
],
rowTemplate: '<tr data-uid="#=uid#"><th class="k-header">#:header#</th><td>#: foo #</td></tr>',
altRowTemplate: '<tr data-uid="#=uid#" class="k-alt"><th
|
stackexchange
|
2. The Prior Art
It has been known that the cervical mucus of a female has a maximum fluidity just before ovulation, where ovulation is defined as the moment that an ovum is released from the follicle. This knowledge lead to the applicant's previous activities in the development of techniques for monitoring the viscoelasticity, or tackiness, and other properties of cervical mucus as a predictor of time of ovulation and to improvements in rheometer or viscometer apparatus for measuring such viscoelastic properties. See, for example, L. E. Kopita and H. J. Kosasky, "The Tackiness Rheometer Determination of the Viscoelasticity of Cervical Mucus," Human Ovulation, edited by E. S. E. Hafez, Elsevier, North-Holland Biomedical Press, 1979, pp. 351 et seq., and U.S. Pat. Nos. 4,002,056 and 4,167,110. Though the viscoelasticity of the cervical mucus has several small dips in its characteristic curve of viscosity versus time preceding, during, and following ovulation (a four-day period), there is a distinct identifiable minimum viscoelasticity. Instruments designed to measure this effect are described in, for example, U.S. Pat. Nos. 4,002,056 and 4,072,045.
Saliva is now known to undergo chemical changes during the menstrual cycle, including a change in its viscoelasticity. Especially pronounced is the change in viscoelasticity of sublingual saliva, the saliva found under the tongue. See, for example, S. S. Davis, "Saliva is Viscoelastic", Experientia, 26:1298, (1970), and R. H. Davis et al., "Saliva Viscosity Reflects the Time of Ovulation", Experientia, 30:911, (1974). As described in U.S. Pat. No. 4,779,627, issued on Oct. 25, 1988 to the present applicant, and entitled PROCESS AND APPARATUS FOR DETERMINING FEMALE OVULATION TIME BY MEASUREMENT OF SALIVA VISCOELASTICITY, incorporated herein by reference, the applicant previously discovered that sublingual saliva has a unique and reliably measurable minimum in viscoelasticity that is coincident with the ovulation cycle and its surge of estradiol.
|
uspto_backgrounds
|
In 1917, Stelle was hired by the Board of Trustees of the Tampa Free Library to serve as its first director. The brand new Tampa Free Library was funded by well known industrialist and philanthropist, Andrew Carnegie, who donated $50,000 for the library to be built, along with funds supplemented by the city. Although the library had been built by 1915, it officially opened in April 1917 and Stelle was in the receiving line, along with the Library Board, to greet its first visitors. In opening the new library, Stelle had the difficult task of not only buying the materials to stock the shelves but also in "selling" the idea of a library to the community. The location of the library was inconvenient for people to access and the residents of Tampa were at first, uninterested in any library services. Stelle was able to secure a donation of 4000 volumes from Mr. and Mrs. L.H. Lothridge to start the library collection and worked with Mayor Curtis Hixon to bring bus routes near the library to increase accessibility. Stelle oversaw the daily operations of the library which included organizing staff and selecting new materials. She also reported regularly to the Carnegie Corporation about the finances and state of the Carnegie libraries in Tampa.
After seven years as director, Stelle was able to add 25,621 books to the collection, as well as 141 periodical subscriptions. Her and her staff also conducted "story hours" for children at some of the local branches with a monthly attendance of over 1,000. More proof of her success was given in 1927, when Stelle presented to the Rotary Club in Tampa and showed how the library "operated at a lower cost per book and patron than any library in a city of like population". Under her direction, library service in the Tampa area expanded to included eight new branches and the addition of bookmobile service.
In 1932, Stelle took a leave of absence from the Tampa Free Library and traveled to Charleston, South Carolina to oversee and organize the opening of a new library. Stelle was recommended for the task by the American Library Association due to her successful record in Tampa. While in Charleston, Stelle evaluated the current library staff and conditions of the facility. She noted that many of the staff, particularly those working at the African American branch, needed proper library training and that many files and records in the library were inaccurate or out of order. She recommended enlarging the library's collection and emphasized obtaining more children's books for their simplicity,
|
wikipedia_en
|
We will prove that a finite group all of whose sections $S$ satisfy $\varphi(S)\neq 0$ is nilpotent. Assume that $G$ is a counterexample of minimal order. Then $G$ is a Schmidt group since all its proper subgroups satisfy the hypothesis. By [@8] (see also [@2; @7]) it follows that $G$ is a solvable group of order $p^mq^n$ (where $p$ and $q$ are different primes) with a unique Sylow $p$-subgroup $P$ and a cyclic Sylow $q$-subgroup $Q$, and hence $G$ is a semidirect product of $P$ by $Q$. Moreover, we have:
- if $Q=\langle y\rangle$ then $y^q\in Z(G)$;
- $Z(G)=\Phi(G)=\Phi(P)\times\langle y^q\rangle$, $G'=P$, $P'=(G')'=\Phi(P)$;
- $|P/P'|=p^r$, where $r$ is the order of $p$ modulo $q$;
- if $P$ is abelian, then $P$ is an elementary abelian $p$-group of order $p^r$ and $P$ is a minimal normal subgroup of $G$;
- if $P$ is non-abelian, then $Z(P)=P'=\Phi(P)$ and $|P/Z(P)|=p^r$.
We infer that $S=G/Z(G)$ is also a Schmidt group of order $p^rq$ which can be written as semidirect product of an elementary abelian $p$-group $P_1$ of order $p^r$ by a cyclic group $Q_1$ of order $q$ (note that $S_3$ and $A_4$ are examples of such groups). Clearly, we have $$\exp(S)=pq.$$On the other hand, it is easy to see that $$L(S)=L(P_1)\cup\{Q_1^x \mid x\in S\}\cup\{S\}.$$Thus, the section $S$ does not have cyclic subgroups of order $pq$ and consequently $\varphi(S)=0$, a contradiction. This completes the proof.
------------------------------------------------------------------------
|
arxiv
|
Анализът на механизмите на резистентност през последното десетилетие
инфекциозни болести, което мотивира тяхното изключително широко
подражават и импровизират или да се доверяват на недобросъвестни или
5. Цветообрание на старославянската книжнина в България. Събрано и на
своят крупен научен труд "История на славянския език и литература по
старославянската книжнина. На този въпрос той е посветил цял един
на баща си и хуква към някаква пропаст. Едва успяват да го
решения в т. 1., 3., 4., 5.
увеличаване относителния дял на резистентните към него бактериални
молекулите на аминогликозидите ги инактивират, и т.н. (2) Използване
време на Освободителната война с руските войски. Като
Бесарабия, 50,000 в Унгария по точно в Банат, така че около 3,500,000
резервира предварително.
език през 1849 г. тази забележителна студия бива преведена на
В посочените граници на българската реч, П. Шафарик се е опитал да
Генетични и биохимични механизми на резист
|
github
|
As a supporter of
Spay/Neuter and Release Programs, I was a little miffed that the rational
behind the new law was, in part, the number of songbirds “murdered” annually
in Wisconsin by feline vagabonds. Obviously, a hungry cat will find a
way to eat something on the food chain, and songbirds must be a tasty
delicacy to feral cats. Of course, there are natural and mechanized predators
of cats, i.e., the fisher cat, and the coyote, to name just two, and the
automobile or assault rifle . . . but I guess there’s a shortage of the
natural kind in Wisconsin.
Not to worry. When
it comes to various life forms, Americans have adopted the abortion and
death-with-dignity mantras of “disposability.” In fact, it started with
animals. If it’s too plentiful, annoying, inconvenient, too much trouble
to deal with, or sickly, it gets killed. (Next year, the residents of
Wisconsin will complain about the over-population of songbirds, bird droppings
on cars, the diseases birds carry, or the noise pollution they produce.)
It was Wisconsin’s
hunters who demanded the demise of feral cats because they’re doing what
comes naturally—hunting for their food. Evidently, they cut into the hunters’
prey—the stuff that can’t be bought at the local Piggly Wiggly, A & P,
or Wal-Mart. Please don’t get me wrong. Hunting is a sport that’s good
outdoor fun, keeps us well armed as citizens, and preserves specific groups
of animals in the wild (except feral cats who no one wants to preserve).
By the same token, cats control the rodent and bug populations.
The cat haters were
also in on passage of the new law. Cats carry horrible diseases, they
claimed. It’s true. Cats can transmit cat fever, which is no laughing
matter, and cat scratches and bites can be quite serious if not treated
immediately. Of course, anyone who goes near a feral cat without an updated
tetanus shot, protective gloves, and a large towel for wrapping the animal
so it feels secure is either nuts or ignorant. A wild animal will not
love
|
pile-cc
|
Product of -0.238473 and 0.1.
-0.0238473
What is 142750 times -0.2?
-28550
11987.07*0.4
4794.828
-0.3*28.1454
-8.44362
Product of 1907830 and 1.
1907830
What is -5217 times -0.77?
4017.09
21113 * 41
865633
-146681 * -0.8
117344.8
What is the product of 0.2 and -2993?
-598.6
Calculate 14102*0.5.
7051
-4785 times -0.06
287.1
Product of -0.1 and -1075.228.
107.5228
-140281 * -0.24
33667.44
127335*-5
-636675
Multiply -0.3 and 0.02221.
-0.006663
-0.0676*922
-62.3272
Multiply 245 and -0.163.
-39.935
What is -9 times -20396?
183564
Calculate -1.42125*-3.
4.26375
Calculate -0.025*-52019.
1300.475
0.02 times 3.8008
0.076016
What is 2 times 43878?
87756
0.3 * 56.74
17.022
-0.07 * 7426.7
-519.869
-0.1622 * -0.05
0.00811
Product of 65 and 14732.
957580
What is 54043 times 45?
2431935
-8.2 * -689
5649.8
-388 times -261
101268
Multiply 3 and -58.623.
-175.869
27.22*1173
31929.06
Multiply -0.23 and -75581.
17383.63
0.5 * 0.68746
0.34373
479*-5661
-2711619
What is the product of 2.334801 and -0.3?
-0.7004403
What is the product of -7
|
dm_mathematics
|
Good to hear from you. Yes, it was a wonderful weekend to work all weekend.
Were very busy at work and will continue to be so through the rest of the
year. It is very upsetting to hear about Kara. Seems like she has a long
way to go to recovery, but I'm optimistic that she can get to where she needs
to be. I talked to her Sunday morning. She seemed upbeat.
|
enron_emails
|
IN THE UNITED STATES COURT OF APPEALS
FOR THE FIFTH CIRCUIT
No. 13-20456
Conference Calendar
United States Court of Appeals
Fifth Circuit
FILED
August 18, 2015
UNITED STATES OF AMERICA,
Lyle W. Cayce
Clerk
Plaintiff-Appellee
v.
ANASTACIO ARANDA SOTO, also known as Anastacio Aranda Garcia, also
known as Anastacio Aranda-Soto,
Defendant-Appellant
Appeal from the United States District Court
for the Southern District of Texas
USDC No. 4:13-CR-153-1
Before JOLLY, GRAVES, and COSTA, Circuit Judges.
PER CURIAM: *
The attorney appointed to represent Anastacio Aranda Soto has moved
for leave to withdraw and has filed a brief in accordance with Anders v.
California, 386 U.S. 738 (1967), and United States v. Flores, 632 F.3d 229 (5th
Cir. 2011). Aranda Soto has not filed a response, has completed the
confinement portion of his sentence, and has been removed from the United
* Pursuant to 5TH CIR. R. 47.5, the court has determined that this opinion should not
be published and is not precedent except under the limited circumstances set forth in 5TH
CIR. R. 47.5.4.
Case: 13-20456 Document: 00513157932 Page: 2 Date Filed: 08/18/2015
No. 13-20456
States. We have reviewed counsel’s brief and the relevant portions of the
record reflected therein. We concur with counsel’s assessment that Aranda
Soto’s appeal of his conviction presents no nonfrivolous issue. Accordingly,
counsel’s motion for leave to withdraw is GRANTED, counsel is excused from
further responsibilities herein, and the APPEAL IS DISMISSED in part as
frivolous, see 5TH CIR. R. 42.2, and in part as moot, see United States v.
Rosenbaum-Alanis, 483 F.3d 381, 382-83 (5th
|
freelaw
|
------
mrwww
Two things has greatly reduced it and it resulted in a significant change in
general QOL for me; 1\. bite guard when sleeping. 2\. jaw relaxation exercise
program.
I have a malocclusion however. So ymmv perhaps.
Ask your dentist for a jaw relax program. It's just 5-6 simple exercises you
do with your jaw, (I could upload a copy of my pdf if you'd like).
Something I'm looking into now is myofunctional training/exersices (haven't
tried yet). The "science" on it doesn't seem 100% yet, and mostly promoted by
one company. Thoughts?
Edit: forgot to mention that physiotherapy helped immensely as well. I had
poor posture/forward tilting head, which i believe i feel into due to my
malocclusion. Perhaps be wary of aches/bad alignment/discomfort in neck and
shoulders and see whether physio for that could help alleviate.
~~~
bperk
Would like to see the jaw exercises PDF if you'd be willing to share.
~~~
mrwww
there are several;
[https://www.mah.se/fakulteter-och-omraden/Odontologiska-
faku...](https://www.mah.se/fakulteter-och-omraden/Odontologiska-
fakulteten/Avdelning-och-kansli/Klinisk-bettfysiologi/Tandvard/Program-for-
rorelsetraning/)
I'm using the first one. Pardon the swedish but pictures/google translate
should sort things out. That's from a orofacial pain dept at a swedish uni
------
mlthoughts2018
1\. try lots of night guards, don’t stop just when you find one you can sleep
with. Some offer even more comfort, etc. that can reduce clenching or soreness
beyond just preventing grinding.
2\. muscle relaxers if your doctor thinks it can help.
3\. reducing stress
4\. improve sleep posture and quality of bedding
5\. establish rigorous sleep habits, like when you stop eating at night, when
you stop using devices, adequate darkness, temperature control
No solution
|
hackernews
|
The general objective of this revised Program Project application is to define mechanisms whereby men are at greater risk for coronary artery disease than women. Two of the original projects (I and III) have been withdrawn. Individual projects address the following areas: (II) sex differences and steroid effects in responses to experimental acute myocardial ischemia; (IV) effects of gonadal hormones on the development of coronary atherosclerosis in experimental cardiac transplantation, (V) predictive value of urinary thromboxane metabolites in myocardial infarction in men and women
|
nih_exporter
|
Structure, interactions and effects on activity of the 5'-terminal region of human telomerase RNA.
Telomerase is an enzyme that catalyzes addition of telomeric repeat sequences to the 3'-termini of eukaryotic chromosome DNA. The catalytic core of telomerase consists of a protein component, telomerase reverse transcriptase (TERT), for the catalysis and an RNA component, telomerase RNA (TR), containing the template for the sequence. Human telomerase RNA (hTR) consists of 451 nucleotides
|
pubmed_abstracts
|
Endotoxin-free fetal bovine serum (FBS), RPMI 1640 and Lympholyte (Cedarlane Laboratories) were purchased from EuroClone (Milan, Italy). \[L-2,3,4-^3^H\]Arginine (45-70 Ci/mmol) was obtained from Perkin-Elmer (Monza, Italy). rGM-CSF for in vitro experiments (ReliaTech) was purchased from TebuBio (Milan, Italy). Sigma-Aldrich (Milan, Italy) was the source of all the other chemicals.
Results
=======
Case history
------------
The patient is an Italian male, currently aged 21. Only one mutant allele of *SLC7A7*gene was identified in the patient: this mutation, p.M50K (c.149T \> A), is located in the TM domain I and causes the substitution of a highly conserved amino acid. The p.M50K mutation was inherited from the father \[[@B20]\]. Although several groups have tried to identify the mutation inherited by the mother, these attempts have been thus far unsuccessful.
The clinical history of the patient was already described in two papers \[[@B21],[@B22]\]. Briefly, in the eighth month of life the baby was diagnosed as affected by LPI and, at the age of 15, a PAP was diagnosed based on Computed Tomography (CT) scan of a crazy paving pattern and of a mild restrictive ventilatory impairment. The patient was treated by whole lung lavage (WLL) according to the current standard of care. At a control chest CT scan performed 9 months after the WLL, the crazy paving pattern was almost totally resolved, but the lung density was slightly, diffusely increased with respect to normal lungs. After 4 years, the patient was newly admitted for fever and hypoxemia, and the lung CT scan revealed the relapse of PAP (Figure [2A](#F2){ref-type="fig"}). On January 2009 he underwent a WLL which resulted in an immediate improvement. The benefit this time was transient, and on March 2009 he was newly admitted to our Intensive Care Unit (ICU) because of severe respiratory failure. The third WLL, performed on March 2009, was complicated by an acute alveolar haemorrhage with acute anaemia, and the patient was treated with non-invasive ventilation and red blood cell transfusion. The persistence of respiratory failure suggested patient refractoriness to WLL and
|
pubmed_central
|
standard way to make crispy sweet potato fries?
I've been looking for a way to fry (not bake) sweet potatoes, maybe like the double-fry method for russet and russet-like potatoes, to get a crispy exterior.
Maybe I'm missing something but I'm having difficulty finding something for sweet potatoes (of any kind). I've consulted my cookbook library, and I haven't come across much. I've had mixed experiences with blog recipes, so I trust them less, but maybe this Munchies single-fry-from-frozen sweet potato fries article (which I will try this weekend) has some truth to it?:
Ingredients:
2 pounds large orange-fleshed sweet potatoes
1 teaspoon baking soda
1 cup plus 2 tablespoons cornstarch
Peanut oil, for frying
1 cup clubsoda or water Kosher or fine sea salt
Instructions:
Line a baking sheet with parchment paper and make enough room in the freezer for said baking sheet.
Peel the sweet potatoes, if desired, and cut them lengthwise into 1/4-inch-thick batons (fry shapes). Place them in a bowl with the
baking soda and 2 tablespoons cornstarch, and toss. Arrange the sweet
potatoes on the baking sheet in a single layer, making sure they are
not touching. Freeze them until rock hard, at least 3 hours. If making
fries later, transfer to a gallon-size zip-top freezer bag; they will
keep frozen for up to 2 weeks.
Pour the oil into a large, heavy pot, preferably a Dutch oven, that's fitted with a deep-fry thermometer to a depth of 2 inches. Set
the pot over medium heat and begin gently warming the oil to 375ºF.
In a large bowl, whisk together the remaining 1 cup cornstarch and the club soda. Stack several layers of brown paper on a baking sheet.
When the oil reaches 375ºF, drop a handful of sweet potatoes into the cornstarch mixture and coat evenly. Lift them from the bowl,
letting any excess drip into the bowl, and carefully add them to the
oil. Fry, stirring with a spider so they do not stick to the bottom of
the pot, until deep golden brown and cooked through
|
stackexchange
|
Meanwhile, an encoder is an operating circuit for receiving source data d(X) and generating a code word of a regulated form. The code word has k source data symbols and (n-k) parity symbols among a total of n symbols. The source data d(X) is data of the unit of k symbols supplied to the encoder from a signal source, and if the source data d(X) is determined, the parity is generated by a generator polynomial. In the case of C3 of the DDS format, since n=46 and k=44, two parities are produced and the generator polynomial g(X) is as follows: ##EQU1##
The generator polynomial g(X) is an important expression for generating the parity in an encoding process, and a key for correcting an error as well as checking whether an error is generated in received data in a decoding process.
In the DDS format, the recorded and reproduced data is processed by the unit of a group. As shown in FIG. 1, one group consists of 22 frames and a 23rd frame is an ECC frame for recording a parity with respect to the 22 frames. One frame of a DAT has two tracks of positive (+) and negative (-) azimuths, and the data allocation of a main region in one frame is shown in FIG.2.
In the case of the DAT, there is data of 5760 bytes while a drum is rotating once, i.e., during 30 msec, and a sampling frequency thereof is 48 KHz. As shown in FIG.2, the total number of data produced in one frame of the tape is 5824 bytes (1456 words). Moreover, a word number 0 is called a header and the ECC processing for the header is not performed. In addition, 64 bytes (word numbers 1440 to 1455) obtained by subtracting 5760 bytes generated during one rotation of a drum from 5824 bytes of the total number of data in one frame are filled with "0's". On the other hand, C3 (46,44) performs encoding with respect to 5756 bytes except for the header among 5760 bytes generated during each 30 msec period. Through the ECC process, even if there is an error in one frame among 22 frames in one group when reproducing data, it is possible to correct the error. That is, if an error occurs in one symbol out of 44 symbols of the source data d(X), the error can be detected and corrected. However,
|
uspto_backgrounds
|
The Burgkirche was a Reformed Protestant church of the Prussian Union in Königsberg, Prussia.
History
After the conversion of the Hohenzollern elector John Sigismund of Brandenburg, also Duke of Prussia from 1612, the first Calvinist service was performed in 1616 by the Hessian court chaplain Johannes Crocius in a hall of Königsberg Castle. In 1662 the 'Great Elector' Frederick William ordered the building of a new Reformed church and Latin school in the Burgfreiheit quarter near the castle, granting land near a slaughterhouse. The transfer of land only occurred in 1665, however, and the initiative was halted until the 1680s.
In 1687 the court expanded the grounds for the church by purchasing a garden on the Schlossteich pond north of the former slaughterhouse from Oberburggraf Ahasverus von Lehndorff. The new Baroque church was built from 1690–96; Johann Arnold Nering modeled it after the sober appearance of the Nieuwe Kerk in The Hague. It was dedicated in the presence of the new King in Prussia, Frederick I on 23 January 1701. By 1819 the German reformed church was known simply as the Burgkirche (Castle Church).
The wooden vault of the nave was covered with stucco, and only the apses had a stellar vault. The pulpit was on the long side of the nave covered with a crown. The organ was the work of Johann Josua Mosengel's assistant Georg Siegmund Caspari (1693–1741), who built the instrument as his “Probstück“ (=masterpiece) under Mosengel's supervision. It was, like many organs in Konigsberg, decorated with the Prussian eagle and is considered to be the last new built organ in the area of East Prussia, which was equipped with a choir organ. Commissioned by commerce official Charles Cabrit, the church's portal was designed in 1727 with allegorical sandstone figures of justice, love and, charity.
Between 1817 and 1945 the congregation formed part of the Evangelical Church in Prussia, a church body comprising Reformed, Lutheran and United Protestant congregations. The church was severely damaged by the 1944 Bombing of Königsberg in World War II and burnt out completely. The remnants were demolished by the
|
wikipedia_en
|
In order to simplify our search algorithm (at the cost of making it overall less efficient), we shall for each rational length of $S$ look at the set of possible denominators of the angles involved in $S'$ realising said length, and at the set of denominators realising any possible rational length of $S - S'$. Then we shall obtain a list of possible denominators $\delta_a$, $\delta_b$, $\delta_c$, $\delta_d$ that $a = \frac{\nu_a}{\delta_a} \pi$, $b = \frac{\nu_b}{\delta_b} \pi$, $c = \frac{\nu_c}{\delta_c} \pi$, $d = \frac{\nu_d}{\delta_d} \pi$ may have, and choose their numerators $\nu_a$, $\nu_b$, $\nu_c$, $\nu_d$ so that $0 < a$, $b$, $c$, $d < \pi$. If any number of the form $\frac{\nu}{\delta} \pi$ equals $0$, then we assume $\delta = \infty$. Such an approach is still practically reasonable, and takes about $90$ minutes in total to run in `SageMath` [@Sage] on a MacPro 2.3 GHz Intel Core i5 Processor with 8 Mb RAM. An observation from Galois theory implies that if $S = \cos a + \cos b + \cos c + \cos d$ has rational length $1$, then the list of possible denominators of angles in $S$ is $L_0= \{ 1, 2, 3, \infty \}$.
If $S$ has rational length $2$ realised by a sub-sum $S'$, then the list of possible denominators in $S'$ is $L_1 = \{ 3, 5 \}$ as indicated by item $3$ of Theorem \[thm:cj\], while the denominators in $S - S'$ can belong either to $L_0$ or to $L_1$.
If $S$ has rational length $3$ realised by a sub-sum $S'$, then the denominators of angles in $S'$ belong either to the list $L_2 = \{ 3, 7 \}$, or to $L_3 = \{ 3, 5, 15 \}$, as indicated by items $4$, $5$ and $6
|
arxiv
|
<?php
namespace Gerardojbaez\Laraplans\Models;
use Carbon\Carbon;
use Illuminate\Database\Eloquent\Model;
use Gerardojbaez\Laraplans\Contracts\PlanSubscriptionUsageInterface;
class PlanSubscriptionUsage extends Model implements PlanSubscriptionUsageInterface
{
/**
* The attributes that are mass assignable.
*
* @var array
*/
protected $fillable = [
'subscription_id',
'code',
'valid_until',
'used'
];
/**
* The attributes that should be mutated to dates.
*
* @var array
*/
protected $dates = [
'created_at', 'updated_at', 'valid_until',
];
/**
* Get feature.
*
* @return \Illuminate\Database\Eloquent\Relations\BelongsTo
*/
public function feature()
{
return $this->belongsTo(config('laraplans.models.plan_feature'));
}
/**
* Get subscription.
*
* @return \Illuminate\Database\Eloquent\Relations\BelongsTo
*/
public function subscription()
{
return $this->belongsTo(config('laraplans.models.plan_subscription'));
}
/**
* Scope by feature code.
*
* @param \Illuminate\Database\Eloquent\Builder
* @return \Illuminate\Database\Eloquent\Builder
*/
public function scopeByFeatureCode($query, $feature_code)
{
return $query->whereCode($feature_code);
}
/**
* Check whether usage has been expired or not.
*
* @return bool
*/
public function isExpired()
{
if (is_null($this->valid_until)) {
return false;
}
return Carbon::now()->gte($this->valid_until);
}
|
github
|
Also in September: Anna Kendrick goes in search of Blake Lively in “A Simple Favor” . Jennifer Garner kicks into vigilante mode in “Peppermint” . Glenn Close plays the title character in “The Wife” . Vatican investigators try to unravel an apparent suicide in “The Nun” . And in “The Sisters Brothers,” John C. Reilly and Joaquin Phoenix portray assassins on the trail of a gold prospector in 1850s Oregon.
OCTOBER
Oct. 5: The fourth time is the charm. Bradley Cooper stars in and directed this fourth version of “A Star Is Born.” He plays Jackson Maine, a famous but troubled singer who discovers and mentors the talented but shy Ally (Lady Gaga). Her star rises, his drops and, well, you know, a tragic love story ensues . The terrific Tom Hardy (“The Revenant,” “Dunkirk”) stars in “Venom.” Hardy’s Eddie Brock acquires the powers of an alien symbiote, and is forced to unleash his vicious alter ego in order to save his life.
Oct. 12: The story of astronaut Neil Armstrong and his remarkable accomplishments in space are explored in “First Man,” with Ryan Gosling playing the Ohio native who landed on the moon in 1969. Gosling reteams with director Damien Chazelle (“La La Land”), and the strong cast also features Claire Foy, Kyle Chandler and Jason Clarke . Robert Redford has said “The Old Man & the Gun” will be his farewell to acting. It is based on the true story of serial bank robber Forrest Tucker, who kept up his larcenous ways well into his 70s . A confluence of weird, dark and desperate characters find themselves at a rundown Lake Tahoe hotel for one crazy night in “Bad Times at the El Royale.” Chris Hemsworth, Dakota Johnson, Jon Hamm and Jeff Bridges star.
Oct. 19: There have been so many “Halloween”s (not to mention “Nightmare on Elm Street”s, “Friday the 13th”s, etc.) that it’s hard to believe the original with Jamie Lee Curtis debuted in 1978. That makes the new “Halloween” a tidy, 40-year cycle for Curtis, who returns as Laurie Strode to battle Michael Myers in a “final confrontation.” Don’t believe the “final” part . Race, cops and class collide
|
pile-cc
|
-816*g + 6
Let h be 1/(1*5/985). What is the third derivative of -71*v**2 + 48*v**5 - 17*v**2 + 155*v**2 - h*v**5 wrt v?
-8940*v**2
Let c(i) be the first derivative of 0*i**4 - 8 + 2/5*i**5 + 0*i - 11/2*i**6 + 71/2*i**2 + 0*i**3. What is the second derivative of c(u) wrt u?
-660*u**3 + 24*u**2
Let h(q) = -502*q**4 + 3896. Let x(v) = -251*v**4 + 1947. Let u(f) = -3*h(f) + 5*x(f). Find the first derivative of u(z) wrt z.
1004*z**3
Suppose -5*t - 11 = 69. Let w be 16/40 - t/10. Find the third derivative of -w*k**2 - 13*k**4 - 26*k**4 - 5*k**3 + 5*k**3 wrt k.
-936*k
Let r(f) = f**3 + 3*f**2 - 15*f + 4. Let m be r(4). Find the second derivative of -6753 + 6753 - m*l - 37*l**5 wrt l.
-740*l**3
Find the second derivative of 396*f**2 - f**5 - 35*f - 963*f**2 + 2 - 1392*f**2 wrt f.
-20*f**3 - 3918
Let w(p) be the second derivative of -756*p**5/5 - 208*p**2 - p - 18. What is the derivative of w(x) wrt x?
-9072*x**2
What is the derivative of -934 - 571*n**3 - n - 3*n + 4287 + 4*n wrt n?
-1713*n**2
What is the third derivative of 15326*n**3 + 4*n**2 + 39 - 38 - 4*n - 12673*n
|
dm_mathematics
|
"Larry W. Bass" <lwbthemarine@bigplanet.com> on 02/20/2001 01:03:57 PM
To: eric preston bass <Eric.Bass@enron.com>
cc:
Subject:
Good afternoon. Welcome home. Heard from your Mother that they took some of
your money. That's too bad. I have never let them take my money! By the way
|
enron_emails
|
Eckerhart, 461 U.S. 424, 437 (1983) (noting that the “district court has discretion in
determining the amount of a fee award”).
6
15 U.S.C. § 1692k(a)(3).
7
Graziano v. Harrison, 950 F.2d 107, 114 (3d Cir. 1991). “In general, a reasonable fee
is one which is ‘adequate to attract competent counsel, but which do[es] not produce
windfalls to attorneys.’” Pub. Interest Research Grp. of N.J., Inc. v. Windall, 51 F.3d
1179, 1185 (3d Cir. 1995) (quoting Student Pub. Interest Research Grp. of N.J., Inc. v.
AT&T Bell Lab., 842 F.2d 1436, 1448 (3d Cir. 1988)).
8
Brytus v. Spang & Co., 203 F.3d 238, 242 (3d Cir. 2000).
9
Id. at 243 (quoting Pennsylvania v. Del. Valley Citizens’ Council for Clean Air, 478
U.S. 546, 564 (1986)).
10
Hensley, 461 U.S. at 430 n.3, 436–37.
11
Id. at 433–34.
4
Scanno first challenges the District Court’s conclusion that she had only limited
success on the merits of her case, arguing that her total recovery, including attorney’s
fees, increased from June 2017 to September 2017. 12
The reasonableness of the fee award on the merits of the case is clear from the
District Court’s reasoning. The District Court observed that, in June 2017, Scanno
rejected a settlement offer which allowed her to recover the maximum statutory award of
$1,000, only to incur twenty-five hours of additional legal services and accept the very
same offer three months later. Scanno’s rejection of the June 2017 settlement offer
appears to have been driven primarily by counsel’s independent belief that the offer did
not account for all attorney’s fees incurred since the commencement of the litigation. 13
Even considering that Scanno’s counsel brought this suit as a class action, the case was
ultimately settled on an
|
freelaw
|
<http://www.owasp.org/index.php/Blind_SQL_Injection>
~~~
rrrhys
Thanks, great read (and interesting eye opener!)
------
riffraff
while I understand that sql injection is mostly a fault of the host
programming language/developer (php in this case) and not of the dbms/dba,
couldn't the latter have avoided this in part by limiting user privileges so
that it was impossible to "list the internal databases, tables and password
dump" e.g. "REVOKE SHOW DATABASES, SHOW VIEW" ?
(I'm aware this may make impossible to use some web frameworks which rely on
rdbms reflection, but I have the feeling this is not the case)
~~~
xd
Sorry, but how is PHP at fault? You can shoot yourself in the foot with _ANY_
programming language.
~~~
Natsu
PHP has been known to provide convenient footguns in the past (e.g.
register_globals, mercifully depreciated), so it's not surprising that
security-minded people give it a hard time.
Think of it as the difference between the language keeping loaded footguns
under its pillow with the safety off and keeping unloaded footguns in a locked
gun safe. One is a lot less likely to get used than the other, even if either
one will shoot your foot just as well.
~~~
xd
Rehashing old design floors is not an excuse to blame PHP for programmer
error.
~~~
prodigal_erik
It doesn't seem fair to call a defect "old" if it wasn't seriously addressed
between then and now. I had to pick up PHP (presumably because of heinous sins
in a past life) and every tutorial I saw was _still_ pasting user input into
non-parameterized queries. There are apparently several different MySQL
clients, and our production boxes still had the original (inexplicably still
in existence) which didn't even _support_ parameterized queries. And that was
in 2007!
~~~
damncabbage
Just hit the same issue here in 2011. Plesk, a popular package for managing
shared hosting used by hosting companies, doesn't include the MySQL drivers
for PDO (what's
|
hackernews
|
The long term objective of this research is to understand the mechanism and pathways by which eukaryotic cells identify and eliminate defective RNA molecules as a way to ensure accuracy in gene expression. Alternative pre-mRNA processing is a fundamental means through which the complexity of the human proteome is enriched. However, pre-mRNA processing steps can be error prone due to reaction speed and the subtlety of processing signals. To handle these errors, cells have evolved multiple RNA quality control systems that minimize the expression of defective RNAs
|
nih_exporter
|
Intrinsic whole number bias in humans.
Humans have great difficulty comparing quotients including fractions, proportions, and probabilities and often erroneously isolate the whole numbers of the numerators and denominators to compare them. Some have argued that the whole number bias is a compensatory strategy to deal with difficult comparisons. We examined adult humans' preferences for gambles that differed only in numerosity, and not in factors that influence their expected value (probabilities and stakes). Subjects consistently preferred gambles with more winning balls
|
pubmed_abstracts
|
###### Laboratory investigations
--------------------------------------------------------- --------------------------------------------------------------------- --------------
Investigation Value Normal range
Hemoglobin (g/dL) 10.1 13-16
Mean corpuscular volume (fL) 78 83-101
Platelets (X10\^9/L) 180 150-400
Total leucocyte count (X10\^9/L) 10 (80% neutrophils, 15% lymphocytes, 3% monocytes, 2% eosinophils) 4-12
Bilirubin (mg/dL) 1.3 0.2-1
Alkaline phosphatase (U/L) 1051 30-150
Gamma glutamyl transferase (U/L) 206 \<50
Aspartate transaminase (U/L) 227 10-40
Alanine transaminase (U/L) 127 10-40
Total protein (gm/dL) 7.3 6-8
Albumin (gm/dL) 3.2 3.5-5.5
Globulin (gm/dL) 4.1 2-3.5
Prothrombin time (seconds) 16 14 (control)
Sodium (mmol/L) 135 135-145
Potassium (mmol/L) 4.1 3.5-5.5
Urea (mg/dL) 53 15-40
Creatinine (mg/dL) 1.3 \<1.3
Glycosylated hemoglobin 5.2% \<6%
Erythrocyte sedimentation rate (ESR) (mm in 1^st^ hour) 72 \<10
C-reactive protein (CRP) (mg/L) 82 \<5
--------------------------------------------------------- --------------------------------------------------------------------- --------------
![Positive Mantoux test\
Induration (24 mm) with a ring of erythema over the forearm, 72 hours after intradermal injection of 0.1 mL
|
pubmed_central
|
A:
In the realm of natural language, the "ideas a language can be used to express" are basically "any": all languages are capable of expressing any idea, so there's only one category of expressive type. Languages do differ in the way that they express a given idea. Assume a language Gwambomambo which lacks the word "recursion". That very word could be introduced into the language, just as "ballet" or "ghee" was introduced into English; or, a word might be invented using traditional roots of the language (e.g. "thing sits on itself"). Some languages have specific tenses for negative propositions and some use words like "not" to convey the idea; some languages have different forms of words to indicate that there is just one, or many, or maybe even just two, of the thing in question – other languages don't do this but do allow you to say "1 child", "many children", "more than 1 child" etc.
The greatest disparity between languages is lexical differences, that is the fact that we need a long expression to convey the notion "2 year old male reindeer", whereas languages spoken by reindeer-herding cultures usually have a single word for this.
A:
In computer science, one essential property of all Turing-complete languages is that they are able to describe, "in their own way", how they themselves work.
For example, you can use a Turing machine to express how a Turing machine works.
Similarly, you can write, for example, a Prolog program that can interpret Prolog programs.
In the linguistic realm, it would seem to me that an analogon of "Turing completeness" is a language that can express concepts of the language itself.
For example, you can use English to describe English grammar, English words etc. Similarly, you can use Latin to describe Latin grammar. But you will in all likelihood not be able to use a language consisting of, say, 3 different whistled tones to describe how the tones themselves are constructed and related. This follows from the simple fact that the vocabulary and grammar are too restricted to talk about anything on the meta-level, or at least under reasonable assumptions (note that you can encode any information even with a single whistled tone, by reasoning about the time intervals between different occurrences of the tone).
In computer science, a
|
stackexchange
|
Approaches that are more consistent with the teachings of this invention attempt to reduce the intersymbol interference at or near the receiver, or intermediate the transmitter and the receiver. Essentially any medium capable of providing a sufficient dispersion opposite to that of the optical fiber can serve as an optical pulse equalizer. For example it is known to use a special optical fiber having an equal chromatic dispersion at a required operating wavelength but opposite in sign to that of the transmitting fiber. Other methods include the use of fiber Bragg gratings as disclosed in U.S. Pat. No. 5,909,295 in the name of Li et al., and disclosed by Shigematsu et al., in U.S. Pat. No. 5,701,188 assigned to Sumitomo Electric Industries, Ltd., and the use of planar lightwave circuit (PLC) delay equalizers. Unfortunately, special compensating fiber has a high insertion loss and in many applications is not a preferable choice. Fiber gratings are generally not preferred for some field applications due to their narrow bandwidth, and fixed wavelength. PLCs are also narrow band, although tunable devices; fabricating a PLC with large dispersion equalization remains to be difficult. Shigematsu et al. disclose a hybrid of both of these less preferred choices; dispersion compensating fibre with chirped Bragg gratings.
The exact amount of dispersion compensation required for a particular installed fiber link may not be known, and may vary with wavelength or environmental conditions such as temperature. Therefore, it is desirable to have a device capable of providing a tunable amount of dispersion compensation, to simplify installation and to provide real-time control of dispersion.
In a paper entitled xe2x80x9cOptical Equalization to Combat the Effects of Laser Chirp and Fiber Dispersionxe2x80x9d published in the Journal of Lightwave Technology. Vol. 8, No. 5, May 1990, Cimini L. J. et al. describe an optical equalizer capable of combating the effects of laser chirp and fiber chromatic dispersion on high-speed long-haul fiber-optic communications links at 1.55 xcexcm. Also discussed is a control scheme for adaptively positioning the equalizer response frequency. Cimini et al. describe a device having only one common input/output port at a first partially reflective mirror and a second 100% reflective mirror together forming a cavity. The control scheme described attempts to track signal wavelength by obtaining feedback from a receiver. The amplitude
|
uspto_backgrounds
|
Origins
The first ferry service in the region was put in place by the founder of Halifax Edward Cornwallis, who used the ferry service to move raw materials and people from a sawmill located on the Dartmouth side of the harbour. During this time there was no official service and it was not until 1752, after a council meeting, that the first ferry charter was issued to John Connor This began the official ferry service between Halifax and Dartmouth. At this time regulations stated that the boats would be run from sunrise until sunset through weekdays with a fare of three pence. In these early stages there was no schedule. Patrons would simply walk down to the pier and be taken across as needed. Connor operated the ferry for only one year and after his departure the operation of the ferry changed hands twice more before 1786.
History
The first true ferry to be employed in the harbour was not until 1816 the Sherbrooke classified as a Horseboat being powered by (in Sherbrooke’s case) nine horses walking in a circular motion in the centre of the ferry powering the central paddle. This ferry was thought to be a large improvement to the previous service due to its speed and ability to transport more people and cargo from either side of the harbour. This ferry operated in the harbour until 1830 when the first steam ferry, the Sir Charles Ogle, entered service. The continuing ferry service remained the only effective way of crossing the harbour until 1955, when the Angus L. Macdonald Bridge was first opened.
The current generation of the ferry system was implemented by the former City of Dartmouth as part of major revitalization projects undertaken in both Dartmouth and Halifax in the 1970s. All five ferries currently in service were designed by Dartmouth company, E.Y.E. Marine Consultants. In 1994, the City of Dartmouth transferred control of the ferry system to Metro Transit, later known as Halifax Transit.
Current operation
Today Halifax Transit maintains and operates the ferry service by providing two passenger ferry routes, one connecting downtown Halifax with Alderney Landing in Dartmouth (which operates daily) and the other connecting downtown Halifax with Woodside (Monday through Friday only). The harbour ferries are utilized by over 3,000 commuters daily. Both routes operate using two vessels each on a fifteen-minute schedule during peak hours, and using one vessel each on a thirty-minute schedule off-peak.
|
wikipedia_en
|
Much of the essential information content of the charge measurement is duplicated in the phonon measurement, through the production of secondary phonon populations as charges propagate through the crystal and then enter aluminum structures at the surface. These different phonon populations are produced with different initial energy distributions. In Germanium, high energy phonons exhibit high isotopic scattering rates ($\tau_{i}^{-1}~=~[36.7\times10^{-42}]\nu^4$ for Ge)[@tamura1985] meaning that they have short mean free paths and propagate diffusively ($\ell~=~[5.4~km/s]\tau_{i}~=~[1.5\times10^{44}~m/s^4]\nu^{-4}$ at long wavelengths). Only 6.1$\%$ of the top and bottom crystal surfaces is covered with phonon-absorbing aluminum (largely in the form of QETs), meaning that, per surface interaction, a phonon is far more likely to reflect off a polished Ge surface than be absorbed in a QET. A phonon’s timescale of surface absorption then is roughly proportional to its rate of surface interactions, and is therefor highly dependent on mean free path. Phonons with a mean free path on order of the detector size (ie, which propagate ballistically) are absorbed with the maximally slow decay constant of 755 $\mu$s, and higher energy phonons are absorbed with significantly faster decay constants. Phonons anharmonically decay in energy ($\tau_{a}^{-1} = [1.61\times10^{-55}]\nu^5$)[@msall1997], meaning that mean free path increases with time. This energy-dependent diffusion and decay process is typically termed “quasidiffusion”. Here we summarize the relevant characteristics of the major phonon populations in a SuperCDMS detector, emphasizing where they begin in their quasidiffusive evolution:
- **Primary phonons** produced by the recoil event itself are initially highly energetic ($\nu > $1 THz, ie $\ell~<~\sim$ 100$\mu$m). If the event occurs far from a sensor surface, the diffusive behavior slows the arrival at the surface and lengthens the eventual mean free path, slowing the absorption rate at that surface. If the event occurs near a sensor surface, there is little delay in arrival, and the comparatively short mean free path increases a the rate of absorption at that surface.
- **Neganov-
|
arxiv
|
class Materials
{
protected:
C3D_API explicit Materials( sdw::ShaderWriter & writer );
public:
virtual ~Materials() = default;
C3D_API virtual void declare( bool hasSsbo ) = 0;
C3D_API virtual BaseMaterialUPtr getBaseMaterial( sdw::UInt const & index )const = 0;
protected:
sdw::ShaderWriter & m_writer;
std::unique_ptr< sdw::Struct > m_type;
};
class LegacyMaterials
: public Materials
{
public:
C3D_API explicit LegacyMaterials( sdw::ShaderWriter & writer );
C3D_API void declare( bool hasSsbo )override;
C3D_API LegacyMaterial getMaterial( sdw::UInt const & index )const;
C3D_API BaseMaterialUPtr getBaseMaterial( sdw::UInt const & index )const override;
private:
std::unique_ptr< sdw::ArraySsboT< LegacyMaterial > > m_ssbo;
sdw::Function< LegacyMaterial, sdw::InUInt > m_getMaterial;
};
class PbrMRMaterials
: public Materials
{
public:
C3D_API explicit PbrMRMaterials( sdw::ShaderWriter & writer );
C3D_API void declare( bool hasSsbo )override;
C3D_API MetallicRoughnessMaterial getMaterial( sdw::UInt const & index )const;
C3D_API BaseMaterialUPtr getBaseMaterial( sdw::UInt const & index )const override;
private:
std::unique_ptr< sdw::ArraySsboT< MetallicRoughnessMaterial > > m_ssbo;
sdw::Function< MetallicRoughnessMaterial, sdw::InUInt > m_getMaterial;
};
class PbrSGMaterials
: public Materials
{
public:
C3D_API explicit PbrSGMaterials( sdw::ShaderWriter & writer );
C3D_API void declare( bool hasSsbo )
|
github
|
If this is your first visit, be sure to
check out the FAQ by clicking the
link above. You may have to register
before you can post: click the register link above to proceed. To start viewing messages,
select the forum that you want to visit from the selection below.
And when we are at it, endman and his countless alter egos (BSDSucksDick, kraftman, CthuIhux (not Cthulhux) and the like) also belong on the list.
But anyways, I had already a conversation with one of the mods about banning the trolls and he said that they were working on a solution. But this was a few months ago and still nothing happened.
Well I suppose the easiest thing would be to clean up comments that are off topic. BSD gets something (anything) and it turns into BSD bashing. The Mir/Wayland debate.. not sure I should use that word.. also seem to veer off topic into canonical this or that.
So if there was a mod that could temp ban people for posting off topic flame bait that would go a long way IMO.
I would also like to see people citing things instead of asspulling every "truth"... that maybe too much to ask for..
Oh and I am against the karma system giving the virtually nonexistent maturity on the Internet period... let alone around these parts.
This is funny. There are people who are really off-scale, like BO$$, because they always choose random position with sole goal of trolling.
Then, there are people who clearly have zero relation to anything Linux (topic of this project) because they are here to ignite flamewars, tossing occasional windows/anti-gpl superiority or randomly picking accusations/deficiencies of Linux for the sole goal of flaming, derailing, hate-posting - like Sonadow, zester(to major degree).
Finally, there are people who have own position, that may not always have sound position, but their position is justified and never changes, that is kraftman, elanthis, dee and co. While they do ignite flamewars and may have very contrast tastes, it happens only when people above provoke them and they retreat if the matter is settled or cleared, and they do post insightful comments or facts. They nearly always get labeled as trolls by those who have been trashing
|
pile-cc
|
60
How many months are there in 15/4 of a year?
45
What is 56.88646 nanograms in milligrams?
0.00005688646
How many millilitres are there in fifty-three quarters of a litre?
13250
What is 0.0712188kg in grams?
71.2188
What is 109191.8kg in nanograms?
109191800000000000
Convert 58101.54 milligrams to tonnes.
0.00005810154
What is 31/5 of a milligram in micrograms?
6200
How many meters are there in fifty-three quarters of a kilometer?
13250
What is 55/4 of a kilogram in grams?
13750
Convert 63.59629 weeks to microseconds.
38463036192000
How many kilometers are there in 0.6099709m?
0.0006099709
How many micrograms are there in 7/2 of a milligram?
3500
What is 3/5 of a litre in millilitres?
600
How many micrometers are there in 5965.628m?
5965628000
How many micrometers are there in 21/5 of a millimeter?
4200
Convert 2.053773 millilitres to litres.
0.002053773
What is 733.9172 decades in months?
88070.064
What is 5/8 of a litre in millilitres?
625
How many months are there in 7/4 of a century?
2100
How many micrograms are there in 34/5 of a milligram?
6800
What is seventy-five halves of a centimeter in millimeters?
375
What is 9.587463 centuries in months?
11504.9556
What is 7.4819088us in hours?
0.000000002078308
How many micrograms are there in 64411.87 nanograms?
64.41187
How many kilograms are there in 364.2168 grams?
0.3642168
What is 8.98107m in millimeters?
8981.07
How many hours are there in 78962.64 minutes?
1316.044
How many months are there in 7/4 of a century?
2100
What is 7/8 of a litre in millilitres?
875
What
|
dm_mathematics
|
Subject: Talking points about California Gas market
Christy,
I read these points and they definitely need some touch up. I don't
understand why we need to give our commentary on why prices are so high in
California. This subject has already gotten so much press.
Phillip
---------------------- Forwarded by Phillip K Allen/HOU/ECT on 12/12/2000
12:01 PM ---------------------------
From: Leslie
|
enron_emails
|
cannot allow its own evaluation of the Class’s best interests to dictate its
conclusion as to whether the requirements of Rule 23 were satisfied.
22
Case: 17-12381 Date Filed: 06/04/2018 Page: 23 of 28
Finally, we reject Appellees’ contention that approval of the settlement was
permissible because it only partially foreclosed the Class’s individualized claims.
Appellees point out that, because the settlement releases only Daikin, class
members can still pursue their individualized claims against 3M and Dyneon. But
neither Dukes nor Rule 23 allows parties to preclude absent class members’
individualized claims against one defendant, as long as those claims can still be
pursued against other parties who may have different defenses, levels of
culpability, and resources with which to satisfy a judgment.
Put simply, the parties may not accomplish through class settlement what
they otherwise would be unable to accomplish through class litigation—precluding
absent class members’ individualized claims for monetary damages without
providing notice and an opportunity to opt out. The district court abused its
discretion by failing to apply the correct legal standard for certification under Rule
23(b)(2). See Dukes, 564 U.S. at 361–65, 131 S. Ct. at 2557–60.
III. CONCLUSION
The district court abused its discretion by determining the Class was
adequately represented by counsel laboring under an inherent conflict of interest.
It also abused its discretion by certifying a class under Rule 23(b)(2) and approving
a settlement that released absent class members’ individualized claims for
23
Case: 17-12381 Date Filed: 06/04/2018 Page: 24 of 28
monetary damages. We therefore vacate the class certification, reverse approval of
the settlement, and remand for further proceedings.
VACATED IN PART, REVERSED IN PART, AND REMANDED.
24
Case: 17-12381 Date Filed: 06/04/2018 Page: 25 of 28
WILSON, Circuit Judge, dissenting:
The district court concluded that there was no fundamental conflict and that
the settlement was fair, reasonable, and adequate. That conclusion falls well
within the bounds
|
freelaw
|
“The Guardian's reader funding model is working” - lemming
https://www.theguardian.com/membership/2018/nov/12/katharine-viner-guardian-million-reader-funding
======
lemming
I've been a monthly donor to the Guardian for a long time now. Their opinion
pieces have been getting more hysterical over time but I just don't read them,
and I think their news coverage is really great.
~~~
aFanOfYou
Agreed. I subscribe to The Guardian Weekly, because The Guardian performs good
investigative journalism and offers good free news. Their opinion pieces
(Comment Is Free) are disappointing, however.
------
milanmio
Mark Curtis used to write for them, but he hasn't been very 'supportive'
lately. Their coverage on war in Yemen and Julian Assange is far from what
journalism should be.
some of his retweets
"This sub-heading is a microcosm of what a joke the Guardian is. After over 3
yrs of UK govt's total backing of mass murder in Yemen, the paper has the
temerity to equate UK policy with easing humanitarian suffering. The state
could not ask for more"
guardian article: [https://www.theguardian.com/world/2018/nov/05/uk-backs-un-
ca...](https://www.theguardian.com/world/2018/nov/05/uk-backs-un-call-for-
saudi-arabia-and-houthis-to-end-yemen-bloodshed?CMP=share_btn_tw)
[http://www.medialens.org/index.php/alerts/alert-
archive/2018...](http://www.medialens.org/index.php/alerts/alert-
archive/2018/885-how-to-be-a-reliable-mainstream-journalist.html)
I know this thread is not about quality of journalism , but this opened my
eyes before I was going to pay them.
------
mcfunk
The respect for the user here is huge. Every time I would get to the bottom of
an article I would think, you know, I read that whole
|
hackernews
|
The mission of the Michigan Cancer Research Consortium (MCRC) is to improve the oncologic health of the communities served by assuring patient access to and participation in state-of-the-art clinical trials and cancer prevention and control activities while contributing to knowledge development in the field of oncology care. The MCRC represents a proven resource with significant potential to serve the objectives of the National Cancer Institute's CCOP program. First funded in 1994 as a single component CCOP, it is now comprised of
|
nih_exporter
|
Regulation of Cav1.2 current: interaction with intracellular molecules.
Ca(V)1.2 (alpha(1c)) is a pore-forming subunit of the voltage-dependent L-type calcium channel and is expressed in many tissues. The beta and alpha(2)/delta subunits are auxiliary subunits that affect the kinetics and the expression of Ca(V)1.2. In addition to the beta and alpha(2)/delta subunits, several molecules have been reported to be involved
|
pubmed_abstracts
|
Introduction {#sec1}
============
The development of sustainable, efficient, and selective syntheses is one of the fundamental research goals in modern chemistry. In this context, it is important to perform reactions under catalytic conditions and to replace precious metal catalysts by earth-abundant nonprecious metal catalysts.^[@ref1]^ As far as chemical processes are concerned, hydrogenations and acceptorless alcohol dehydrogenation, sometimes in conjunction with hydrogen autotransfer reactions, are becoming important areas of research.^[@ref2],[@ref3]^ In particular, iron and manganese constitute promising candidates, as these are among the most abundant metals in the earth's crust, are inexpensive, and exhibit a low environmental impact. While iron hydrogenation and dehydrogenation catalysts have been the subject of intense investigation over the past decade,^[@ref4]−[@ref8]^ low-valent Mn(I) complexes just recently appeared as new but very powerful players in this field.^[@ref9]−[@ref12]^ Concerning iron, the development of novel catalysts was largely inspired by concepts known from its well-established ruthenium congeners, which are particularly effective for hydrogenative reductions and oxidations of polar substrates. After the first reports on Fe(II)-catalyzed hydrogenations, we even stated "Iron, the New Ruthenium".^[@ref13]^ However, in light of recent achievements accomplished by isoelectronic Mn(I) catalysts, the question arises whether this statement is still valid or has to be reconsidered, since these novel systems appear to show even more similarities to traditional ruthenium than iron chemistry (diagonal relationship Mn--Ru). Nevertheless, the development of base metal catalysts that can even compete with their "noble" analogues remains a challenging task since specific properties of first-row transition metals (e.g., oxidation states, spin states, ionic radii, redox potentials) are fundamentally different and new strategies and concepts have to be developed in order to circumvent unfavorable phenomena in this context. Consequently, the synthesis of isolated and structurally well-defined complexes combined with a fundamental understanding of reaction mechanisms appears to be a primary objective for the rational development of novel catalytic systems.^[@ref14],[@ref15]^
In this Account, we describe well-defined Fe(II)- and Mn(I)-based catalysts featuring PNP pincer ligands based on 2,6-diaminopyridine that have been developed by our group ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}).^[@ref16]
|
pubmed_central
|
I have been at this for quite a while now. Mainly following this tutorial. I have built the dependencies in the versions required by the instructions the 2 main parts beeing boost and caffe (which both entail a host of other dependecies).
I am running the entire thing on a fresh install of Ubuntu 19.10 (setup on a VM specifically for this project).
When i reach building of the armNN library (instructions part "Building the environment", step 4) it fails at linking libarmnn.so at ~45% with the following error output:
/usr/bin/ld: */path/to/boost*/boost_1_64_0/stage/lib/libboost_log.a(attribute_name.o): relocation R_X86_64_PC32 against symbol `_ZTVN5boost16exception_detail19error_info_injectorINS_3log12v2s_mt_posix16limitation_errorEEE' can not be used when making a shared object; recompile with -fPIC
/usr/bin/ld: final link failed: bad value
collect2: error: ld returned 1 exit status
make[2]: *** [libarmnn.so.19.11] Error 1
make[1]: *** [CMakeFiles/armnn.dir/all] Error 2
make: *** [all] Error 2
I have built the entire boost library with cxx and c flags -fPIC. I checked specifically for the file in question (using ar -x libboost_log.a
readelf --relocs attribute_name.o | egrep 'PLT' as suggest in the answer to this question)
Any suggestions on how to deal with this error or tips on what i should look into would be very much appreciated.
Patrick
A:
It took me a couple more attempts and another fresh VM but i finally managed to cross compile the armnn with caffe parsers support (X from ubuntu to android).
If you want to do the same there are a lot of dependencies which you have to compile yourself and you have to take care to compile them all with compatible versions. Which is when you are (like i was 3 weeks ago) just aquainted with all of these libraries in passing easier said then done.
Here are the most important sources I used to compile:
https://github.com/
|
stackexchange
|
Display devices capable of detecting an inputting object such as a finger and a touch pen (also called a stylus) approaching or contacting the screen have been widely employed. The operation of allowing the inputting object to approach or contact the screen is called a touch operation or a touch, and the detection of a position of the inputting object is called touch detection. Examples of the touch detection include various types such as an optical type, a resistive type, a capacitive type, and an electromagnetic induction type. The capacitive type is the detection type utilizing a feature that the electrostatic capacitance between a pair of electrodes (called a drive electrode and a detection electrode) is varied by approach or contact of the inputting object, and has benefits that the structure is comparatively simple and that the power consumption is small.
The display device equipped with the touch detection function includes an on-cell type (also called an external type) in which the display device and the touch panel implementing the touch function are produced separately and the touch panel is bonded to the screen of the display device, and an in-cell type (also called a built-in type) in which the display device and the touch panel are integrated. In the in-cell type display device, for example, the detection electrode is formed between a color filter and a polarizer, and a common electrode formed on a thin film transistor (TFT) substrate is also used as a drive electrode. Since the in-cell type display device includes no external touch panel, the display device is entirely slim and lightweight, and visibility of the display is also improved. In the in-cell type display device, however, the display period and the touch detection period need to be set separately and achievement of both the display drive and the touch detection is a problem to be solved.
Recently, touch panel-equipped display devices have increased in size. For example, elongated display devices have been developed similarly to center information display (CID) units provided on dashboards of vehicles to function as display devices for displaying road guidance information, and the like in a car navigation system. The CID unit displays gauges such as a speedometer, a tachometer, a fuel gauge, a water temperature gauge, and a range finder, and the information similar to the gauges, in addition to the road guidance information.
An in-cell type display device includes a number of wiring layers, much parasitic capacitance and much parasitic resistance, a large time constant of CR, and the drive electrode can hardly be driven
|
uspto_backgrounds
|
Rodgers' concept was little different from the one ultimately used in the Pacific War: a "leapfrog" campaign to conquer the Marshalls and Carolines (held by Japan before the war); liberation of the Philippines; and blockade. Absent was the "decisive battle" of Mahan, and of Japanese planning.
Japanese plans
The Imperial Japanese Navy developed a counter-plan to allow the U.S. Pacific Fleet to sail across the Pacific while using submarines and carrier attacks to weaken it. The Japanese fleet would then attempt to force a battle against the weakened U.S. fleet in a "decisive battle area", near Japan (see Kantai Kessen), also in line with Mahanian doctrine, which Japan had enthusiastically embraced. It was the basis for Japan's demand for a 70% ratio (10:10:7) at the Washington Naval Conference, which was considered necessary to provide Japan superiority in the "decisive battle area" (taking into account that the U.S. had naval commitments in other theaters, while Japan did not), as well as the United States' insistence on 60%, which amounted to parity.
Outcomes
Actual events generally followed the plan. Although carrier battles and the use of airplanes and submarines overshadowed surface action, the "leapfrog" campaign played out largely as anticipated.
The Imperial Japanese Navy, obsessed with the "decisive battle" doctrine, ignored the vital need for defense against submarines. The German and American submarine campaigns against their opponents' merchant shipping demonstrated the need for anti-submarine warfare. While the Allies took extensive measures to combat the threat of German U-boats, the Japanese failed to counter the American submarines which ultimately choked Japan's industrial production and paralyzed her navy. Japan also notably failed to institute an anti-commerce campaign herself; systematic use of commerce raiders could have made Allied operations much more complex and conquering and holding Japanese-held islands more difficult.
American war planners failed to appreciate that technological advances in submarines and naval aviation had made Mahan's doctrine obsolete and did not anticipate a pre-emptive strike from the Japanese. In particular, they did not yet know either that aircraft would be able to effectively sink battleships or that Japan might put the American battleship force (the Battle Line) out of action at a stroke, which actually happened at Pearl Harbor.
American plans changed after this attack. Even
|
wikipedia_en
|
The numbers of collected silhouette images of the crab, lion and hare were 100, 100 and 105, respectively (I bought silhouette images from Deposit Photos (https://jp.depositphotos.com/), and downloaded free images from Silhouette AC (https://www.silhouette-ac.com/index.html), Illust AC (https://www.ac-illust.com), Clipart Library (http://clipart-library.com), Silhouette Design (http://kage-design.com/)). Example images are shown in Fig. \[fig3\]. Of these 305 images, 240 images (80 images in each class) were used for training of the CNNs and 65 images were used as the test data set. The size of each image was 50$\times$50 pixels and the intensity of the images was normalized between 0 and 1 by dividing each intensity by 255.
To increase the accuracy even with the small number of images, k-fold cross validation was used. A training data set with 240 images was randomly divided into four groups (60 images per group), and four CNNs with the same structure were trained by using three groups (180 images) as training data sets and one group (60 images) as a validation data set (Fig. \[fig3\]). In each training of CNN, the group of validation data was changed. Each training was conducted up to 40 epochs, and the number of steps at one epoch to update the weights of the CNNs was set at 20 \[8\]. Within 40 epochs, weights resulting in the minimum loss function of the validation data set were conserved. Because the number of training images was not sufficient, the batch size was set at 180 and the training images were increased by rotating between -180$^{\circ}$ and +180$^{\circ}$ and by shifting up to 10% of the width and height of the images \[8\]. After trainings of the CNNs, the accuracy of the test data set was calculated from the mean probability by using the conserved weights of the four CNNs (Fig. \[fig4\]).
An image of the lunar maria is shown in Fig. \[fig4\]. The lunar maria are represented in black color and other effects such as the round shape of the moon itself and the color variations in the maria are removed because the purpose of this work was to evaluate the probability that the CNN can recognize and categorize the lunar maria pattern into the three animals.
Results
=======
|
arxiv
|
static char GetProjectedZF1D___doc__[] =
"Class hierarchy: :class:`freestyle.types.UnaryFunction1D` > "
":class:`freestyle.types.UnaryFunction1DDouble` > :class:`GetProjectedZF1D`\n"
"\n"
".. method:: __init__(integration_type=IntegrationType.MEAN)\n"
"\n"
" Builds a GetProjectedZF1D object.\n"
"\n"
" :arg integration_type: The integration method used to compute a single value\n"
" from a set of values. \n"
" :type integration_type: :class:`freestyle.types.IntegrationType`\n"
"\n"
".. method:: __call__(inter)\n"
"\n"
" Returns the projected Z 3D coordinate of an Interface1D.\n"
"\n"
" :arg inter: An Interface1D object.\n"
" :type inter: :class:`freestyle.types.Interface1D`\n"
" :return: The projected Z 3D coordinate of an Interface1D.\n"
" :rtype: float\n";
static int GetProjectedZF1D___init__(BPy_GetProjectedZF1D *self, PyObject *args, PyObject *kwds)
{
static const char *kwlist[] = {"integration_type", NULL};
PyObject *obj = 0;
if (!PyArg_ParseTupleAndKeywords(
args, kwds, "|O!", (char **)kwlist, &IntegrationType_Type, &obj)) {
return -1;
}
IntegrationType t = (obj) ? IntegrationType_from_BPy_IntegrationType(obj) : MEAN;
self->py_uf1D_double.uf1D_double = new Functions1D::GetProjectedZF1D(t);
return 0;
}
/*-----------------------BPy_GetProjectedZF1D type definition ------------------------------*/
PyTypeObject
|
github
|
*kicks* Pokemon is good anime Not say others are bad, as I've watched some good ones, and I hope to watch some not known here ones, but that doesn't mean Pokemon is bad.
Vote: MandyEddie35: hi everyoneSerbia: YOU IDIOT! What is THAT supposed to be? Are you even TRYING to play this game?! Kill the idiot NOW please!
ga7 wrote:In, just because it warms my heart to see a mention of Berserk Btw there was an Anime Discussion group until recently, it got deleted due to inactivity
oh *shrugs* never saw it but well try again
berserk & gantz are my 2 fav right now (though its REALLY hard to choose which i like better)
Fircoal wrote:*kicks* Pokemon is good anime Not say others are bad, as I've watched some good ones, and I hope to watch some not known here ones, but that doesn't mean Pokemon is bad.
lol then you havnt seen anything recently... back in the day i did used to watch it, but now... I fall asleep watching adult swim late at night and every morning i wake up to pokemon being on and... ya, lets just say its fallen
Ive never watched any Hentai (porn) anime, but some of those i have seen have had a sex scene or two in them, but they never last over a muinet, just enough that you know it happened for story progression.
There are plenty without any such thing though as well, plenty of VERY good ones of any genre, comedy, action, horror, romance, ect.
ga7 wrote:In, just because it warms my heart to see a mention of Berserk Btw there was an Anime Discussion group until recently, it got deleted due to inactivity
oh *shrugs* never saw it but well try again
berserk & gantz are my 2 fav right now (though its REALLY hard to choose which i like better)
Fircoal wrote:*kicks* Pokemon is good anime Not say others are bad, as I've watched some good ones, and I hope to watch some not known here ones, but that doesn't mean Pokemon is bad.
lol then you havnt seen anything recently... back in the day i did used to watch it,
|
pile-cc
|
. Let i be (-8)/(-36) - n/36. Let v = -36 + i. Which is the third biggest value? (a) -2/3 (b) v (c) -0.4
b
Let p be ((-2)/(-6))/((-11)/(-22)). Let k = -2.712 - 0.258. Let d = -2.6 - k. Which is the biggest value? (a) -3/4 (b) p (c) d
b
Let x = 13602/5 + -2721. Which is the second smallest value? (a) -1/5 (b) x (c) 2/11 (d) 2/9
a
Let o(p) = p**3 - 85*p**2 - 2*p + 174. Let l be o(85). Which is the fourth biggest value? (a) 0.3 (b) 0.6 (c) 1.63 (d) l
a
Let z(s) = -2*s**3 + 2*s + 1. Let i be z(-1). Let x = -38.47 - -40.47. What is the second smallest value in -1, x, i, -0.05?
-0.05
Let u = -29.999 + 30. Let l = u + -2.301. Let j = l + 2.3. Which is the second smallest value? (a) j (b) -2/5 (c) -8
b
Let q = -4205.5 + 4205. Let j be -1 - (5 - (2 + 0)). Suppose -5*u - w + 10 = -4*w, 0 = 4*u - 4*w. Which is the second biggest value? (a) q (b) u (c) 1 (d) j
c
Let z = -2.5 + 40.5. Let w = 37.75 - z. Let u = w + -0.25. What is the smallest value in 0.06, 3/2, u?
u
Let u be (0 - -3)*89/1335*10/4. Which is the third biggest value? (a) 0.
|
dm_mathematics
|
Last year a few of us first years (now second) ran a pretty successful
carpool from downtown San Francisco over to Haas. It makes sense for quite a
few reasons, and is a pretty good way to get to know each other. This year I
thought we should target everyone who might be interested. I've created an
egroup called haascarpool. If you're interested please go to
www.egroups.com/group/haascarpool
|
enron_emails
|
Gary Kollin, Miami, Fla., (court-appointed), for defendant-appellant.
Dexter W. Lehtinen, U.S. Atty., Linda C. Hertz, Allan J. Sullivan, Asst. U.S. Attys., Miami Fla., for plaintiff-appellant.
Appeal from the United States District Court for the Southern District of Florida.
Before KRAVITCH, HATCHETT and CLARK, Circuit Judges.
KRAVITCH, Circuit Judge:
1
Elvira Cordero was convicted by a jury of possession with intent to distribute a quantity of cocaine in excess of 500 grams and of conspiracy to possess and distribute the same in violation of 18 U.S.C. Sec. 2 and 21 U.S.C. Secs. 841(a)(1), 846. The trial court sentenced Cordero to serve concurrent mandatory five-year terms on the substantive count and the conspiracy count and to a subsequent four-year term of supervised release, all pursuant to the enhanced penalty provisions of 21 U.S.C. Sec. 841(b).1 The sole issue presented on appeal is whether the evidence adduced at trial was sufficient as a matter of law to prove beyond a reasonable doubt that the amount of cocaine involved was 500 grams or more and, thus, sufficient to trigger the penalty enhancement provisions of section 841(b).2 Concluding that the evidence adduced was sufficient to prove beyond a reasonable doubt that the amount of cocaine involved was in excess of 500 grams, we affirm.3
I.
The following facts are undisputed:
2
On May 27, 1987 a confidential informant (CI) working with the Drug Enforcement Administration (DEA) spoke with Cordero via telephone and arranged to meet her later that day at the Miami, Florida residence of one Enrique Navarro. There, Cordero and Navarro were to sell to the CI and the CI's companion, Special Agent Moratta of the DEA, five kilograms of cocaine.
3
Approximately fifteen minutes after the CI and Agent Moratta arrived at the Navarro residence, Cordero arrived. Upon her arrival, Cordero removed a large pink shoulder bag from the trunk of the car she was driving. Once inside Navarro's apartment, Cordero removed from the shoulder bag a yellow, duct-taped package which she handed to Agent Moratta.
4
Agent
|
freelaw
|
Fast forward to a month later. The tables have turned completely the other
direction. The fourth guy who I hated at first was my favorite student. The
three students I had liked at the beginning now were the ones giving me the
most greif. The extroverted easy to work with likable guys were pleasant to
deal with, but they weren't very smart, and I had a lot of trouble teaching
them stuff. The fourth guy was hard to deal with, but he was extremely smart
and I barely had to teach him anything, he learned everything on his own.
Once the economy got bad, the student/instructor ratio fell. The flight school
hired a bunch more instructors and got less students. Every instructor got 2
students instead of 4. I made it a habit to go around to all the new
instructors and ask them if they have a student they they don't really like
working with. 4 times out of 5 the instructor would tell me "yeah I have this
one guy..." My last 6 months at that job I had 8 students that basically
taught themselves. That was easy money.
I've found the best way to deal with unlikable people is to just let them go
off and do their own thing. The act like that (unconsciously) because they
resent you getting in their way.
~~~
hkmurakami
A friend of mine is like the 4th student you describe: very smart but comes
off as standoffish and cold until he warms up to you. He was actually let go
from a well known (everyone here would know the name) startup in SF/SV wiht a
noted brogammer culture after a few months since he "wasn't a culture fit".
He's now thriving at a place that suits his character much more.
In the end I think both parties "won" by his dismissal, but companies hiring
for culture fit should be aware that they're willingly constraining their
talent pool by doing this. (I don't think it's necessarily wrong either -- I
expect to have some form of latent character filter if I'm in a hiring
position as well. However, I'm much more fond of the introverted, "difficult"
types than the average person).
------
loteck
It seems like this could more accurately be entitled: Hiring Likable
|
hackernews
|
Injury to the anterior cruciate ligament (ACL) is functionally disabling to an active individual, placing the knee at risk for additional injury. There is, however, little known about the best means of rehabilitating a patient who suffers an ACL disruption and undergoes an ACL reconstruction. Some conservative rehabilitation programs include activities that are designed to produce low strains across the ACL graft, while other, more aggressive programs are aimed at rapid rehabilitation and are thought to produce greater strain magnitudes on the graft. The object
|
nih_exporter
|
Secretome analysis of testicular peritubular cells: a window into the human testicular microenvironment and the spermatogonial stem cell niche in man.
Spermatogonial stem cells (SSCs) are vital for lifelong spermatogenesis in man. In their niches, a special growth factor milieu and structural support by surrounding cells are thought to ensure their maintenance. In man, the cells of the wall of seminiferous tubules, human testicular peritubular cells (HTPCs), are
|
pubmed_abstracts
|
For missense variants, the online tools Polymorphism Phenotyping v2 (PolyPhen-2) \[[@CR18]\], Scale-Invariant Feature Transform (SIFT) \[[@CR19]\], and Mutation Taster \[[@CR20]\] were utilized to predict the pathogenicity of each variant. Multiple sequence alignment and conservative analysis were performed by ClustalX software (version 2.1; Conway Institute, University College Dublin, Dublin, Republic of Ireland). The amino acid sequences of human neurofibromin (NP_000258.1) and that of 11 different vertebrates were obtained from the National Center for Biotechnology Information (NCBI) protein database (FASTA format). For frame shift variants (small deletions and single nucleotide duplication), DNAMAN (version 5.2.2; Lynnon Biosoft, San Ramon, CA, USA) was used to predict how the reading frame was interrupted and to calculate the number of nucleotides before a premature stop codon.
Restriction fragment length polymorphism {#Sec8}
----------------------------------------
Restriction fragment length polymorphism (RFLP) was used, together with nested PCR and restriction endonuclease, to discriminate between genotypes of patients and that of unaffected individuals in Families 1--3 with larger pedigrees. In addition to the primers used for Sanger sequencing, nested PCR primers were designed to enhance the specificity of small DNA fragments or to introduce a mismatch nucleotide to create a new restriction site (Additional file [1](#MOESM1){ref-type="media"}: Table S1). Sequence differences between wild-type and mutant alleles resulted in the gain or loss of a restriction site that led to size differences between amplicons of different alleles after the restriction endonuclease reaction. The restriction endonucleases (New England Biolabs, Ipswich, MA, USA) *Taq*^α^ I (restriction site: T\|CGA), *Alu* I (restriction site: AG\|CT), and *Sac* II (restriction site: CCGC\|GG) were applied to Families 1, 2, and 3, respectively. Polyacrylamide gel electrophoresis (PAGE) using an 8% neutral polyacrylamide gel was then performed to separate DNA fragments of different sizes. Electrophoresis conditions included 1 × TBE as electrophoresis buffer and a constant voltage of 350 V for 3--5 h. Silver staining was used for the final step of the chromogenic reaction.
Results {#Sec9}
=======
Clinical manifestations {#Sec
|
pubmed_central
|
<div id="result"></div>
<script>
var letters = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z'];
var numbers = ['1', '2', '3', '4', '5', '6', '7', '8', '9', '0'];
var symbols = ['~', '!', '@', '#', '$', '%', '^', '&', '*', '(', ')', '_', '-', '=', '+', '[', '{', ']', '}', '/', ';', ':', '"', '|', '.', ',', '<', '>', '?'];
var txt = document.getElementById('txt');
var res = document.getElementById('res');
function encrypt() {
var spl = txt.value.toLowerCase().split("");
for(var i = 0; i < spl.length; i++) { //goes through the spl array
if (spl[i] == ' ') { //if the string is a space
res.innerHTML += ' '; //prints space
}
else {
for(var j = 0; j < letters.length; j++) { //goes through the letters array
if(spl[i] == letters[j]) { //if the spl array string equals to the letter array string
var ecip = (j * i) + spl.length;
if (ecip > letters.length) { //if ecip is out of the array
ecip = ecip - letters.length;
res.innerHTML += letters[ecip];
}
else {
res.innerHTML += letters[ecip];
}
}
}
for(var k = 0; k < numbers.length; k++) { //goes through the numbers array
if (spl[i] == numbers[k]) { //if the spl array string equals to the numbers array currently checked
|
stackexchange
|
A known procedure for treating vertebral compression fractures and other bone-related disorders is vertebral augmentation with bone cement. Vertebral augmentation can be performed by the direct-injection of liquid cement into the collapsed vertebral body (commonly known as “vertebroplasty”). Vertebral augmentation can also be performed after the restoration of the vertebrae to near normal vertebral body anatomy and creation of an internal cavity with the use of an inflatable bone tamp. This minimally invasive procedure is commonly known as “kyphoplasty” (see, for example, U.S. Pat. Nos. 4,969,888 and 5,108,404). During the kyphoplasty procedure, the inflatable bone tamp is inserted through a small skin incision which accommodates a working tube passed into the vertebral body. Inflation of the bone tamp compresses the cancellous bone and desirably moves the fractured cortical bone to its pre-fractured orientation, creating a cavity within the vertebral body that can then be filled with a settable material such as a cement or any number of synthetic bone substitutes. In effect, the procedure sets the vertebral body at or near its pre-fracture position and creates an internal cast, protecting the vertebral body from further fracture and/or collapse.
As compared to a traditional vertebroplasty procedure, kyphoplasty restores the vertebrae to a pre-fractured condition and the injected bone filler is less likely to leak out of the vertebral body during a kyphoplasty procedure. However, under some circumstances, it has been observed that unpredictable reductions can occur with the kyphoplasty technique in chronic or partially healed collapsed vertebral bodies. Under those circumstances, the surgeon would typically resort to a large, open operation to re-align any post-traumatic kyphosis. Further, inadequate reductions can occur with certain other spinal deformities such as scoliosis and kyphosis using the known techniques and surgical tools. The large, open operations can carry with them significant morbidity in an already physiologically compromised elderly population. The principle benefit of a percutaneous minimally invasive approach, which is the hallmark of the kyphoplasty procedure, is the minimal morbidity associated with the procedure. In this light, additional tools are required to further the kyphoplasty technique, achieve better anatomic re-alignment of the spine, and maintain the minimally invasive nature of the surgery. The additional tools will be deployed through small working portals and be able to achieve the desired strategic vertebral osteotomies to move bone in three dimensional space. One such desirable tool would
|
uspto_backgrounds
|
|-
| John Adams
| Former Minister to Great Britain
| Massachusetts
|-
| John Jay
| United States Secretary of Foreign Affairs
| New York
|-
| John Rutledge
| Former Governor of South Carolina
| South Carolina
|-
| John Hancock
| Governor of Massachusetts
| Massachusetts
|-
| Samuel Huntington
| Governor of Connecticut
| Connecticut
|-
| Benjamin Lincoln| Former U.S. Secretary of War
| Massachusetts
|-
| George Washington| Former Commander-in-Chief of the Continental Army
| Virginia
|}
Anti-Federalist candidates
General election
No nomination process existed. The framers of the Constitution presumed that Washington would be elected unopposed. For example, Alexander Hamilton spoke for national opinion when in a letter to Washington attempting to persuade him to leave retirement on his farm in Mount Vernon to serve as the first President, he wrote that "...the point of light in which you stand at home and abroad will make an infinite difference in the respectability in which the government will begin its operations in the alternative of your being or not being the head of state."
Uncertain was the choice for the vice presidency, which contained no definite job description beyond being the President's designated successor while presiding over the Senate. The Constitution stipulated that the position would be awarded to the runner-up in the Presidential election. Because Washington was from Virginia, then the largest state, many assumed that electors would choose a vice president from a northern state. However, the stipulation that the President and Vice-President must be from different states dates only to the Twelfth Amendment of 1804. In an August 1788 letter, U.S. Minister to France Thomas Jefferson wrote that he considered John Adams and John Hancock, both from Massachusetts, to be the top contenders. Jefferson suggested John Jay, John Rutledge, and Virginian James Madison as other possible candidates. Adams received 34 electoral votes, one short of a majority - because the Constitution did not require an outright majority in the Electoral College prior to ratification of the Twelfth Amendment to elect a runner-up as Vice President, Adams was elected to that post.
Voter turnout comprised a low single-digit percentage of the adult population. Though all states allowed some rudimentary form of popular vote, only 6 ratifying states allowed any form of popular vote specifically for Presidential electors. In most states only white men,
|
wikipedia_en
|
![Octahedron as a quotient of torus by involution[]{data-label="topsphere"}](square){width="5.6in" height="1.85in"}
We claim that the projection $p: \mathbb T^2 \rightarrow \mathbb S^2$ maps the semi-positive metric (\[metric2\]) to a proper Riemannian metric on $\mathbb S^2$ with induced smooth structure. Indeed, we need to check only that this works in the vicinity of the 4 fixed points.
Let us check this at the point $(0,0).$ If $x\approx \beta_2$ then $P(x)\approx c(x-\beta_2),\, c=P'(\beta_2),$ $$u_1=\int_{\beta_2}^{x_1}\frac{2dx}{\sqrt{P(x)}}\approx \int_{\beta_2}^{x_1}\frac{2dx}{\sqrt{c(x-\beta_1)}}=\frac{4}{\sqrt{c}}\sqrt{x_1-\beta_2}.$$ Thus near $(0,0)$ we have $
x_1\approx \beta_2+Cu_1^2, \,\, x_2\approx \beta_2-Cu_2^2, \,\, C=\sqrt{c}/4,
$ and thus $
x_1+x_2\approx 2\beta_2, \,\, x_1-x_2\approx C(u_1^2+u_2^2),\,\, x_1^2-x_2^2 \approx 2C\beta_2(u_1^2+u_2^2).
$
Thus locally metric (\[metric2\]) has the form $
ds^2\approx 2C\beta_2(u_1^2+u_2^2)(du_1^2+du_2^2)=2C\beta_2z\bar z dzd\bar z,
$ where we introduced complex coordinate $z=u_1+iu_2.$ The involution $\sigma$ acts by $z\to -z$, so the complex coordinate on the quotient is $w=z^2=v_1+iv_2$, in which metric takes regular form $
ds^2\approx \frac{1}{2}C\beta_2dwd\bar
|
arxiv
|
include/group_replication.inc [rpl_server_count=3]
Warnings:
Note #### Sending passwords in plain text without SSL/TLS is extremely insecure.
Note #### Storing MySQL user name or password information in the master info repository is not secure and is therefore not recommended. Please consider using the USER and PASSWORD connection options for START SLAVE; see the 'START SLAVE Syntax' in the MySQL Manual for more information.
[connection server1]
####
# 0) The test requires three servers.
####
SET SESSION sql_log_bin = 0;
call mtr.add_suppression("This member could not reach a majority of the members for more than 10 seconds. The member will now leave the group as instructed by the group_replication_unreachable_majority_timeout option.");
call mtr.add_suppression("The server was automatically set into read only mode after an error was detected.");
call mtr.add_suppression("\\[GCS\\] Timeout while waiting for the group communication engine to exit!");
call mtr.add_suppression("\\[GCS\\] The member has failed to gracefully leave the group.");
call mtr.add_suppression("The plugin encountered a critical error and will abort: Could not rejoin the member to the group after");
call mtr.add_suppression("Started auto-rejoin procedure attempt*");
call mtr.add_suppression("Auto-rejoin procedure attempt*");
call mtr.add_suppression("\\[GCS\\] Error connecting to all peers. Member join failed. Local port:*");
call mtr.add_suppression("\\[GCS\\] The member was unable to join the group.*");
call mtr.add_suppression("Timeout while waiting for a view change event during the auto-rejoin procedure");
call mtr.add_suppression("Unable to confirm whether the server has left the group or not. Check performance_schema.replication_group_members to check group membership information.");
SET SESSION sql_log_bin = 1;
include/gr_autorejoin_monitoring.inc
SET @debug_saved = @@GLOBAL.DEBUG;
SET @@GLOBAL.DEBUG='+d,group_replication_re
|
github
|
Minister for Tourism and Major Events, Kate Jones, said the return of the NRL Brisbane Doubleheader in 2017 was a score for Queensland and for fans.
“Following a sell-out event last year, this is sure to be another blockbuster sporting experience for fans and a great opportunity to enjoy a weekend in Queensland,” Ms Jones said.
“Hosting major sporting events like this plays a crucial part in growing Brisbane’s $6.3 billion tourism economy and generating local jobs.
"Last year’s event delivered more than 41,000 visitor nights and injected around $8.13 million into the local economy."
NRL Head of Football, Brian Canavan said the Doubleheader at Suncorp Stadium was a real highlight in 2016 and will no doubt be a success again in 2017.
“The fact that this year’s double header coincides with Indigenous Round will ensure it is a truly special occasion.
“The four Clubs who will be playing should be commended for supporting the concept,” Mr. Canavan said.
Manly Warringah CEO, Tim Cleary said the Sea Eagles were proud to play a home game again at Suncorp Stadium.
“The Sea Eagles have a very big following throughout Queensland and I am sure our supporters will again turn out for the Doubleheader like they did last year,’’ Mr. Cleary said.
“To play a home game as part of the Indigenous Round at Suncorp Stadium will be very special not only for our players but also for our supporters. It should be another great night of Rugby League.”
Melbourne Storm CEO, Dave Donaghy said the Doubleheader had become the marquee date of the home and away season and as a Club, couldn’t wait to be a part of it again.
“More than 52,000 fans turned up last year to witness our thrilling win over the Cowboys and we look forward to taking on the Titans this time around in front of yet another electric atmosphere.
“Some of the greatest players to ever represent Queensland will also be on show, making this the showpiece event of Indigenous Round,” Mr. Donaghy said.
Suncorp Stadium General Manager, Alan Graham said previous double headers had attracted big crowds with the concept winning the support of fans and clubs.
“We couldn’t host this event without the support of the NRL, TEQ, Brisbane Marketing the participating clubs, Fox Sports and the
|
pile-cc
|
3*s**2
Let i(p) = p. Let b(c) = 137*c**2. What is b(i(h))?
137*h**2
Let w(i) = -3*i - 6. Let o(h) = -1. Let m(q) = 6*o(q) - w(q). Let v(r) be the second derivative of 0 + 1/6*r**3 + r + 0*r**2. What is m(v(k))?
3*k
Let f(d) = -2*d. Let m(s) = -s. What is f(m(y))?
2*y
Let n(z) be the third derivative of z**5/60 + 5*z**2. Let w(k) = -33*k - 12. Let p(u) = -13*u - 5. Let v(h) = 12*p(h) - 5*w(h). What is v(n(f))?
9*f**2
Let i(q) be the second derivative of -q**5/30 + q**2/2 + 3*q. Let a(s) be the first derivative of i(s). Let h(t) = 5*t. Determine h(a(w)).
-10*w**2
Let i be 1 - 0 - (-2 - -1). Let a(o) = i*o + o - 4*o. Let f(r) = -17*r + 17*r - 3*r**2. What is f(a(t))?
-3*t**2
Let x(h) = 8*h + 6. Let w(t) = -t - 1. Let z(f) = -6*w(f) - x(f). Let y(d) be the first derivative of -3*d**2/2 - 1. Give y(z(p)).
6*p
Let b(c) = -198*c - 2 + 2 + 209*c. Let i(r) = -5*r. Give b(i(y)).
-55*y
Let l(a) be the second derivative of -a**5/60 + 2*a**2 - 4*a.
|
dm_mathematics
|
PS - the capitol of Arizona is Phoenix.
QUESTIONS THAT NEED TO BE ANSWERED
How much new gas is being produced in the Rocky Mountain and San Juan gas supply basins? [Hyatt, Kevin] San Juan Basin production peaked in 1999 at 4.3 Bcf/day and is expected to decline by 2.4% year for the next 10 years. However, over the same 10 year forcast period, 6500 new wells are scheduled
|
enron_emails
|
I respectfully dissent from that part of the majority opinion reversing the judgment on the ground that there was a defective joinder of the parties.
Appellant makes no complaint of the judgment on its merits. The only complaint is that the court did not have jurisdiction to enter the judgment because the husband was joined only as a pro forma party as distinguished from a real party. Appellant made no objection to the joinder of the husband as a pro forma party until after trial when appellees presented the trial court a proposed judgment in which the husband and wife were allowed to recover jointly.
While from a purely technical standpoint, the conclusion reached by the majority appears to have some support in the cases cited therein, I do not believe that the application of these narrow, technical rules are applicable under the facts or the present day rules of civil procedure. I am opposed to a reversal of the case on the ground that there is a defect in the parties for two reasons.
First, it must be remembered that in 1967, the 60th Legislature at page 739, ch. 309, made some significant changes in the law with respect to the rights, duties, privileges, powers and liability of spouses. Among other changes, the legislature passed Art. 4621, V.A.T.S. giving each spouse the exclusive control and disposition of that community property which he or she would have owned if a single person and also provided for combined control and management over all other community property.
At the same session, the legislature also enacted Art. 4626, V.A.T.S., providing that:
"A spouse may sue and be sued without the joinder of the other spouse. When claims or liabilities are joint and several, the spouses may be joined under the rules relating to joinder of parties generally." Amended by Acts 1963, 58th Leg., p. 1188, ch. 472, sec. 6, eff. Aug. 23, 1963; Acts 1967, 60th Leg., p. 739, ch. 309, sec. 1, eff. Jan. 1, 1968.
Thus, since the legislature granted the wife sole management and control over that community property which she would have owned if a single person and also provided that she is to have joint control over all other community, I take the position that in passing Art. 4626, supra, the legislature intended to grant the wife the right to protect her interest in the community by suing without the joinder of her husband. At any rate however, Art. 4626 specifically provides
|
freelaw
|
~~~
StrawberryFrog
Resharper
------
mkn
At a high level, jQuery has two main things going for it:
1) It has awesome functionality. 2) It's indistinguishably close to being
browser-independent
It looks like MS has adopted jQuery for (1), and their developers will get (2)
for free.
Of course, (2) may also have figured into MS's (apparent) decision to adopt.
If that's the case, more power to 'em. Nothing would please me more than
seeing (one division of) MS get a clue.
------
ironjeff
This is great news! I was just about to post this but you beat me to it.
A good follow up post about it:
[http://weblogs.asp.net/scottgu/archive/2008/09/28/jquery-
and...](http://weblogs.asp.net/scottgu/archive/2008/09/28/jquery-and-
microsoft.aspx)
~~~
wayne
And a post from Scott Hanselman about it:
[http://www.hanselman.com/blog/jQueryToShipWithASPNETMVCAndVi...](http://www.hanselman.com/blog/jQueryToShipWithASPNETMVCAndVisualStudio.aspx)
And the original announcement on the jQuery blog:
<http://jquery.com/blog/2008/09/28/jquery-microsoft-nokia/>
------
qhoxie
Congratulations to the whole jQuery team. They are constantly amassing success
stories and they could not be any more deserving. They put out a great library
and foster one of the nicest developer communities on the web.
------
subbu
I think Microsoft is offsetting the pain developers face in trying to make web
pages work in IE/JScript by promoting jQuery. Without a library like
jQuery/Prototype its really difficult to get IE to do what you want. Good
news.
I really hope they make IE conform to standards.
------
rgrieselhuber
Very cool. JQuery is one of the primary reasons I really started to enjoy
JavaScript.
------
dmose
Fantastic news. MS's libraries are crude and far behind the existing open
|
hackernews
|
The p21-activated protein kinase gamma-PAK is activated under conditions of hyperosmotic stress, by low levels of ionizing radiation, by DNA-damaging drugs, and by sphingosine. In addition, gamma-PAK is constitutively activated in early apoptosis via cleavage into two fragments by caspase 3 (CPP32). Gamma-PAK appears to function through phosphorylation of a number of different substrates. Gamma-PAK induces cytostasis as shown by injection of active gamma
|
nih_exporter
|
Relationship between intellectual status and reading skills for developmentally disabled children.
The relationship between WISC-R Full Scale IQ and scores on the Woodcock Reading Mastery Tests were explored for 80 developmentally disabled children. While the children's reading skills correlated moderately and significantly with intellectual status, abstract reading skills, e.g., word comprehension, correlated more highly with Full Scale IQ than did concrete ones, e.g., word identification. The development of concrete learning patterns by such children was discussed,
|
pubmed_abstracts
|
{#ijms-17-01670-f009}
ijms-17-01670-t001_Table 1
######
Pairwise comparison of the IL-1β amino acid sequence of largemouth bass with IL-1β of other fish species.
Species Name Amino Acid Identity (%)
------------------------ -------------------------
Mandarin perch 73
Striped trumpeter 73
Striped beak fish 65
European sea bass 66
Japanese sea bass 65
Nile tilapia 63
Gilthead seabream 58
Cobia 61
Orange spotted grouper 55
Fugu 61
Atlantic salmon 53
Rainbow trout 54
Common carp 35
ijms-17-01670-t002_Table 2
######
Primers used for cloning.
Primer Name Primer Sequence (5′--3′) Application
------------------------------------- ----------------------------------------------------------- -----------------
FIL1BF TGGAMYTKGAGATTDCMCA Partial cloning
FIL1BR AAAYCKYACCATGTCGCTG
Universal Primer Mix (UPM) Long 0.2 μM CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE
Short 0.4 μM CTAATACGACTCACTATAGGGC
Nested Universal Primer Mix (NUP) AAGCAGTGGTATCAACGCAGAGT
LMBIL1B3R1 GCATCAAAGACACACGTTACTACCTGTC
LMBIL-1b_F TGGACTTGGAGATTGCCCA q-PCR
LMBIL-1b_R AAACCGCACCATGTCGCTG
ijms
|
pubmed_central
|
public String getName(){
return this._name;
}
}
Custom Spinner Adapter (ArrayAdapter)
public class SpinAdapter extends ArrayAdapter<User>{
// Your sent context
private Context context;
// Your custom values for the spinner (User)
private User[] values;
public SpinAdapter(Context context, int textViewResourceId,
User[] values) {
super(context, textViewResourceId, values);
this.context = context;
this.values = values;
}
@Override
public int getCount(){
return values.length;
}
@Override
public User getItem(int position){
return values[position];
}
@Override
public long getItemId(int position){
return position;
}
// And the "magic" goes here
// This is for the "passive" state of the spinner
@Override
public View getView(int position, View convertView, ViewGroup parent) {
// I created a dynamic TextView here, but you can reference your own custom layout for each spinner item
TextView label = (TextView) super.getView(position, convertView, parent);
label.setTextColor(Color.BLACK);
// Then you can get the current item using the values array (Users array) and the current position
// You can NOW reference each method you has created in your bean object (User class)
label.setText(values[position].getName());
// And finally return your dynamic (or custom) view for each spinner item
return label;
}
// And here is when the "chooser" is popped up
// Normally is the same view, but you can customize it if you want
@Override
public View getDropDownView(int position, View convertView,
ViewGroup parent) {
TextView label = (TextView) super.getDropDownView(position, convertView, parent);
label.setTextColor(Color.BLACK);
label.setText(values[position].getName());
return label;
}
}
And the implementarion:
public class Main extends Activity {
|
stackexchange
|
Multiple-input and multiple-output (MIMO) requires the use of multiple antennas at both the transmitter and receiver. The signals from the antennas are combined to minimize errors and optimize data speed, providing better range and performance. However, the use of multiple inputs and outputs requires a device to utilize the same radio spectrum frequency. The United States presently uses the GSM-850 and GSM-1900 radio spectrum frequencies for cellular transmissions. GSM-850 uses 824-849 MHz for uplink and 869-894 MHz for downlink, providing channel numbers 128-251. GSM-1900 uses 1850-1910 MHz to uplink and 1930-1990 MHz to downlink, providing channel numbers 512-818. The MIMO concept defined in Third Generation Partnership Project Revision 7 (3GPP R7) and Revision 8 (MIMO R8), incorporated by reference herein in their entirety into this disclosure, requires the use of the same radio spectrum frequency for both transmission paths. These frequencies and antennas are used in spatial multiplexing or transmission diversity mode according to radio conditions. This allows for multiple simultaneous data streams, thereby increasing the data transmission rate.
MIMO R8 also requires twice the amount of antennas at both the transmitter and the receiver locations, even though the transmission takes place across a single frequency band. This creates interference in the signal, which decreases the actual gain in bandwidth created by MIMO R8. The additional signal used in MIMO R8 is another two-way transmit path. Although MIMO R8 can have up to four transmit paths, the uplink bandwidth is still equivalent to the downlink bandwidth, because each additional transmit path adds a duplex channel.
Demanding data services for individual users can exceed the capabilities of a single frequency carrier and/or radio path for a variety of transmission technologies. In this case, the capacity of multiple bi-directional frequency carriers and/or radio paths are combined, or “bonded” for the single demanding user. Multiple pre-existing bi-directional transmission pairs are allocated to the demanding user and traffic is spread across them. The Federal Communications Commission (FCC) recently auctioned the 700 MHz frequency spectrum. AWS-700 uses 776-794 MHz for uplink and 746-764 MHz for downlink.
As is, these transmission techniques offer useful means to boost individual peak throughput within the capabilities of the available transmission technology. However, bi-directional frequency carriers and/or radio paths, and the equipment required to use
|
uspto_backgrounds
|
A number of notable factories would have employed a number of local people:
Maudslay’s Ironworks and Engineering — Westminster Bridge Road — 1810-1899
Napier and Son Ltd, engineers - York Road - 1830-1903
John Doulton’s pottery — Lambeth High Street — 1826, and from the 1870s at the Doulton Works on the Thames Embankment
William Clowes (Printer) & Sons — 1825 in Upper Ground, and then in Duke Street (in the 1840s was the largest printworks in the world). It closed following bombing in 1941.
In August 1815, the Bedlam Hospital was opened nearby for 200 patients. The dome was added between 1830 and 1850. It remained until 1930 when patients were moved to a new site in Beckenham.
By 1824, most of the cultivated land had been built over, including the addition of the following streets.
Sometime after the opening of Waterloo railway station in 1848 the locality around the station and Lower Marsh became known as Waterloo.
Vauxhall Bridge and Vauxhall Bridge Road were opened in 1816. By 1860 the village had been subsumed by the town of Lambeth.
The arrival of the railway
Waterloo station was built in 1848 and completely changed forever Lambeth Marsh's relationship to its surroundings. The sheer scale and proximity of the railway created a barrier between the street and the rest of the Lambeth Marsh.
Lower Marsh was not a place that respectable Londoners would have ventured in the latter part of the 19th century.
George Sala "Twice Round the Clock" 1859
Writing of the New Cut:
"It isn’t picturesque, it isn’t quaint, it isn’t curious. It has not even the questionable merit of being old. It is simply Low. It is sordid, squalid, and the truth must out, disreputable. The broad thoroughfare, which, bordered with fitting houses, would make one of the handsomest streets in London, is gorged with vile, rotten tenements, occupied, by merchants who ofttimes pursue the very contrary to innocent callings. Everything is second hand, except the leviathan gin shops, which are ghastly in their newness and richness of decoration. The broad pavement presents
|
wikipedia_en
|
![The $1/T_1$ results at low temperatures for CeRh$_{0.5}$Ir$_{0.5}$In$_5$ measured at the In(1) at In(2) sites, respectively. The two solid lines indicate the $T^3$ and $T$-linear variations, respectively.[]{data-label="fig:11)"}](Fig11.eps)
Finally, let us compare the superconducting behavior for $x$=0.45, 0.5 and 0.55. Figure 12 shows the ac-susceptibility (ac-$\chi$) measured using our NQR coil. Although it is hard to determine the onset temperature of the superconductivity from ac-$\chi$, it can be seen that the mid-point of the transition increases in the order of $x$=0.55, 0.5 and 0.45. $T_c$ determined from the point at which $1/T_1$ displays a distinct drop is 0.8 K, 0.9 K and 0.94 K for $x$=0.55, 0.5 and 0.45, respectively. Figure 13 shows $1/T_1$ normalized by its value at $T_c$ plotted against the reduced temperature $T/T_c$ for $x$=0.55, 0.5 and 0.45. Just below $T_c$, $1/T_1$ shows identical behavior for all samples, but at lower temperatures strong variation is observed. In particular, below $T\sim$ 0.4 K, $1/T_1$ becomes again proportional to $T$, and the normalized value of $1/T_1$ increases in the order $x$=0.55, 0.5 and 0.45.
![The ac-susceptibility for CeRh$_{1-x}$Ir$_{x}$In$_5$ ($x$=0.45, 0.5 and 0.55).[]{data-label="fig:12)"}](Fig12.eps)
The most straightforward explanation for $T$-linear $1/T_1$ at low-$T$ would be the presence of disorder that produces a finite DOS remaining at $E_F$. By assuming a gap function with line nodes, $$\begin{aligned}
\Delta(\theta)=\Delta_0 cos(\theta)\end{aligned}$$ and with a finite residual DOS, $N_{res}$ (Ref.[@
|
arxiv
|
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"## Notebooks\n",
"Notebooks created by the community leveraging the mordor datasets"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"\n",
"| Author | Name | Link |\n",
"|:-------|:-----|:-----|"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"## Simulation Plan"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"\n",
"| Environment | Tool Type | Module |\n",
"|:------------|:----------|:-------|\n",
"| Mordor shire | C2 | [ShellCmd](https://github.com/cobbr/Covenant/blob/7555b19ffb9401c0e37094c25e404a640b1688d7/Covenant/Data/Tasks/SharpSploit.Execution.yaml#L96) |\n",
"| Mordor shire | tool | [lsadump](https://github.com/gentilkiwi/mimikatz/blob/6191b5a8ea40bbd856942cbc1e48a86c3c505dd3/mimikatz/modules/kuhl_m_lsadump.c#L23) |\n",
"| Mordor shire | tool | [SharpZeroLogon](https://github.com/nccgroup/nccfsas/tree/main/Tools/SharpZeroLogon) |"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"## Adversary View\n",
"```\n",
"Mimikatz Implementation (NetrServerAuthenticate2)\n",
"=================================================\n",
"\n",
"(wardog) > Shell
|
github
|
“This is arguably the most significant collection ever offered in Barrett-Jackson history,” said Craig Jackson, Chairman and CEO of Barrett-Jackson. “We are so privileged to be given this opportunity to showcase Ron Pratte’s unparalleled offering.”
Ron Pratte is the founder and former CEO of Pratte Development Company, Inc., one of the biggest wood framing and concrete foundation companies in the United States. Pratte sold the company to Pulte homes at the peak of the housing boom in Arizona and cashed out before the housing market crashed. His collection is not open to the public and being intensely private Pratte avoids most media contact and requests for interviews. He does open the collection occasionally for the benefit of charity.
As more details become available Barrett-Jackson will keep enthusiasts updated on their site www.Barrett-Jackson.com
Here’s a previous feature of Pratte’s collection from the 2012 Barrett-Jackson Scottsdale auction:
Rick Tavel writes about automobiles with an emphasis on Corvettes and the hobby in general. You can see his website at Corvetted
Charles D. Fowler, III: I stopped subsribing to both after many years, and within a year or two of even having a “feature” article accepted and published, after meeting Corvette Fever execs at Carlisle. With the merger, I...
Jeff McKay: I also asked a local dealer and they knew nothing about it. How do I order it myself? I think that would be faster than trying to convince them they should know about it.
CrystalKnight: I have always loved the 63, one of my favorite classics of all time, and I have had a many sports cars…, owned and loved the C5 even though it was heavy and underpowered, owned and loved the C6 convertible. ….I...
CrystalKnight: I have always loved the 63, one of my favorite classics of all time, and I have had a many sports cars…, owned and loved the C5 even though it was heavy and underpowered, owned and loved the C6 convertible. ….I...
tonyman262: I have an 89 C4 & an 07 C6, both white. After seeing the CUE system; the daughter may get the 07, I NEED a C7 with the CUE system. The 89 C4 stays with me. The C7 (artic white of course)
|
pile-cc
|
-2
Find the third derivative of -5*h**6 - 9*h**6 + 17*h**6 - 7*h**2 wrt h.
360*h**3
Let v(s) = -13 - s - 14 + 26. Let o(b) = 3*b - 4 + 3 - 4*b. Let m(q) = 3*o(q) - 2*v(q). What is the derivative of m(l) wrt l?
-1
Let i(j) = j**2 + 2*j - 5. Suppose -3*t - 5 = x + 9, -8 = t + 2*x. Let y be i(t). Find the second derivative of o**3 - 10*o + o**y + 6*o wrt o.
12*o
Let k(s) be the first derivative of -2/5*s**5 + 5 + 0*s**3 + 0*s**4 + 0*s + s**2. What is the second derivative of k(f) wrt f?
-24*f**2
Find the third derivative of -41*a + 41*a + 3*a**4 + 6*a**2 wrt a.
72*a
Let l(y) be the first derivative of 0*y**5 + 1/3*y**6 + 0*y**4 + 1 + 0*y**3 - 5/2*y**2 + 0*y. Find the second derivative of l(a) wrt a.
40*a**3
Let g(h) = h**2 - 1. Let r(m) = 8*m**2 + 4*m - 2. Let o(z) = -2*g(z) + r(z). Find the second derivative of o(j) wrt j.
12
Find the third derivative of 2*w**2 + 12*w**2 - 5*w**2 + 7*w**6 wrt w.
840*w**3
Let m(z) = -z**2 + 6*z + 4. Let g be m(6). What is the second derivative of -1 + 1 + 2*j + j**g wrt j?
12*j**2
Let s(y) be the first derivative of 9*y
|
dm_mathematics
|
Thanks again.
Walt Zimmerman
06/08/00 03:26 PM
To: Susan Ralph/Houston/Eott@Eott
cc: Michael Burke/Houston/Eott@Eott, Steve Duffy/Houston/Eott@Eott, Dana
Gibbs/Houston/Eott@Eott, Stanley Horton/Corp/Enron@Enron, Lori
Maddox/Houston/Eott@Eott
|
enron_emails
|
2
After being terminated from the cardiology staff at Good Samaritan Hospital, Dr. John Smith filed a complaint in federal district court for antitrust conspiracy. The district court granted summary judgment to the hospital. The district court also imposed $2,000 in Rule 11 sanctions against Smith's attorney, Jerome Berg, for misconduct including failing to read the papers he filed with the court.
3
Smith appealed and the hospital asked for fees and costs under 42 U.S.C. § 11113 claiming the appeal was frivolous. The Ninth Circuit affirmed the district court. Smith v. Ricks, 31 F.3d 1478, 1488 (9th Cir.1994), cert. denied, 115 S.Ct. 1400 (1995). That panel agreed the appeal was frivolous and imposed Rule 38 sanctions against Berg, reasoning that Berg was responsible for the frivolous appeal and should bear the costs.
4
The previous panel has already addressed Berg's contentions that he was sanctioned in violation of General Order 10.9. The only remaining issue is whether the district court abused its discretion in calculating the amount awarded to defendants.
5
The district court referred the case to a federal magistrate judge who made a report and recommendation to the district court that $110,909.21 in fees and costs be awarded to defendants. This recommendation was "a concise but clear explanation of its reasons for the fee award," Hensley v. Eckerhart, 461 U.S. 424, 437 (1982), and was adopted by the district court. The district court is charged with determining the appropriate amount of fees and will not be reversed absent an abuse of discretion. Lyddon v. Geothermal Properties, Inc., 996 F.2d 212, 213 (9th Cir.1993).
6
As correctly pointed out by appellees, the arguments now raised that are pertinent to this appeal have been waived by Berg. Even if he had preserved them, we hold that the magistrate judge correctly determined the lodestar amount and reduced the fee award where charges were duplicative or inappropriate. The district court did not abuse its discretion by adopting the magistrate's recommendation.
7
AFFIRMED.
*
The panel unanimously finds this case suitable for decision without oral argument. Fed.R.App.P. 34(a); 9th Cir.R. 34-4
**
This disposition is not appropriate for publication and may not be
|
freelaw
|
------
Myrmornis
How well does it work to version control Mathematica notebooks in git? For
example, is it possible to get meaningful textual diffs when comparing two
versions of a mathematica notebook, and can git compress them enough to keep
repo size down?
With iPython this is also an issue -- tracking code in JSON is much less clean
than tracking code in text files.
It's interesting that Mathematica and iPython both left code-as-plain-text
behind as a storage format. I wonder if it would have been possible to come up
with a hybrid solution, i.e. retain plain-text code files but with a
serialized data structure (JSON-like, or binary) as the glue.
~~~
henrikeh
I use Mathematica daily and frequently store large-ish notebooks in Git. The
format is textual, but the diffs are filled with a lot of noise.
------
hprotagonist
as a practical matter, papers will remain relevant as long as they are the
metric by which grant applications and tenure decisions are made.
as a philosophical matter, for computation heavy fields, i would love to see
literate programming tools become _de rigeur_ in the peer-reviewed
distribution of results. In some fields (AI) this basically happens already —
the blog post with code snippets and a link to arxiv at the end is a pretty
common thing now.
~~~
goerz
Papers (and PDFs) are relevant because they are easy to organize and archive,
essentially in perpetuity. Source code is too, so nothing wrong with a "Github
for Science". Notebooks, blogs, or interactive dashboards, on the other hand,
are an amazing tool both for research and for communication, but they are far
more ephemeral than a paper. They need a large overhead to keep them running
that cannot be sustained over decades or centuries. Typically, you'll have
lots of trouble re-running a 5 year old notebook. That's not to say they're
useless, e.g. as supplementary material (quite the opposite). They're just not
going to replace papers anytime soon.
~~~
hprotagonist
Those are good points. Journals have to care about this, too, these days --
supplementary information now routinely includes videos
|
hackernews
|
This proposal requests partial support for the 15th Annual Summer Institute on Addictions, an annual conference sponsored by McDermott Center (dba Haymarket Center), to be held in Oakbrook Terrace, Illinois June 9-11, 2009. The broad and long-range goal of the project is to improve the quality of substance abuse treatment by helping to bridge the gap between NIDA funded research and practice of community based substance abuse treatment through knowledge dissemination of evidence-based practices. The specific aim of
|
nih_exporter
|
The present work examines the generalizability of the anhedonia phenomenon (extinction-like responding with repeated neuroleptic treatment) by examining rats' licking behavior, a response heretofore untested, in the anhedonia paradigm. Nondeprived rats learned to lick a sucrose solution (32%) and were then tested for eight consecutive days in either a no-reward condition (N = 8) or two pimozide (PIM) with reward conditions (N = 8
|
pubmed_abstracts
|
**Volodymyr Polishchuk ^1,^\*, Miroslav Kelemen ^2^, Beáta Gavurová ^3^, Costas Varotsos ^4^, Rudolf Andoga ^2^, Martin Gera ^5^, John Christodoulakis ^4^, Radovan Soušek ^6^, Jaroslaw Kozuba ^7^, Peter Blišťan ^8^ and Stanislav Szabo, Jr. ^2^**
1. Faculty of Information Technologies, Uzhhorod National University, 88000 Uzhhorod, Ukraine
2. Faculty of Aeronautics, Technical University of Kosice, 04121 Kosice, Slovakia; <miroslav.kelemen@tuke.sk> (M.K.); <rudolf.andoga@tuke.sk> (R.A.); <stanislav.szabo.2@tuke.sk> (S.S.J.)
3. Research and Innovation Centre Bioinformatics, USP TECHNICOM, Technical University of Košice, 040 01 Kosice, Slovakia; <beata.gavurova@tuke.sk>
4. Department of Physics, National & Kapodistrian University of Athens, GR-15784 Athens, Greece; <covar@phys.uoa.gr> (C.V.); <ichristo@phys.uoa.gr> (J.C.)
5. Faculty of Mathematics, Physics and Informatics, Comenius University, Bratislava, Mlynska dolina 84248, Slovakia; <mgera@fmph.uniba.sk>
6. Faculty of Transport Engineering, University of Pardubice, 53210 Pardubice, Czech Republic; <radovan.sousek@upce.cz>
7. Faculty of Transport, Silesian University of Technology, 44100 Gliwice, Poland; <jaroslaw.kozuba@polsl.pl>
8. Faculty of Mining, Ecology, Process Control and Geotechnology of Aeronautics, Technical University of Kosice, 04121 Kosice, Slovakia; <peter.blistan@tuke.sk>
The authors would like to apologize for any inconvenience
|
pubmed_central
|
{{ Form::close() }}
</div>
public function index()
{
$vdo = Video::query();
$pic = Picture::query();
if($category = Input::get('category')){
$vdo->where('category', $category);
$pic->where('category', $category);
}
$allvids = $vdo->paginate(10);
$allpics = $pic->paginate(10);
$data = compact('allvids','allpics');
$data['category'] = Input::get('category');
$this->layout->content = \View::make('home.pics_vids_overview',$data);
}
View:
<div class="panel-body">
@if ($allvids->count())
<dl class="dl-horizontal">
<!-- Add this div class to make the table responsive -->
<div class = "table-responsive">
<table class="table">
<b>Results: </b>{{ $allvids->count() }}<br>
<tr>
<th>ID</th>
<th>Name</th>
<th>Description</th>
<th>Corner</th>
<th>Rock</th>
<th>Category</th>
<th>Project</th>
<th>Update Video</th>
</tr>
@foreach($allvids as $video)
<tr>
<td>{{ $video->video_id }}</b></td>
<td>{{ $video->video_name }}</td>
<td>{{ $video->video_description }}</td>
<td>{{ $video->video_corners }} </td>
<td>{{ $video->video_rocks }}</td>
<td>{{ $video->category }}</td>
<td>{{ $video->video_project }}</td>
<td><b>{{ link_to_route("show_video", 'Edit', array($video->video_id)) }}</b></td>
</tr
|
stackexchange
|
The devices envisaged by the present invention are those which comprise a semi cylindrical block intended to be applied with its non-arcuate face against the sample to be studied, a transducer-emitter of ultrasonic waves, a transducer-receiver, the axes of the emitter and receiver being located in a common plane normal to the axis of the semi cylindrical block, and the emitter and receiver each being carried by a slide which is symmetrically movable on the arcuate surface of said block, means for entrainment of both transducers, and means for measuring the angle which they form between them.
This apparatus is based on a method which includes emitting a beam of ultrasonic waves and appropriately directing the beam so as to produce surface waves on the material to be studied.
Detection and measurement are effected on the beam reflected by the sample surface on which the control operates. This method enables determination on the value of the speed of propagation of the Rayleigh waves on the surface of a solid by measurement of the angle of incidence of the ultrasonic beam causing the production of these surface waves. This theory is particularly developed in the works of G. Bradfield, to which reference will be made for further information, particularly to the article entitled "The ultrasonic goniometer and its applications" in the February issue, 1968, of the periodical "Non-Destructive Testing" and to British Pat. Nos. 959.029 and 772.083.
In the present case, the principle involves taking into account the fact that the speed of propagation of these surface waves is affected by the presence of a layer obtained, particularly on steel, by a thermal treatment, and in particular this variation in speed depends on the value of the thickness of said layer.
A generator delivers the electrical signals necessary to supply the transducer-emitter. The ultrasonic waves may be generated either in the form of short-duration pulses or in wave trains of regulable length; in both cases, various frequencies may be used.
The measurement assembly enables observation and analysis of the signals received by the transducer-receiver. This assembly, made up principally of an oscilloscope, may be accompanied by a recording instrument. In known devices of the type in question, the mechanical connection ensuring symmetrical movements of both transducers comprises a fairly large number of toothed sprockets and pinions, and sliding cardan-jointed shafts, rendering the assembly relatively complicated and liable to have a degree of operational play the elimination of which would make the apparatus even more complex.
One of
|
uspto_backgrounds
|
Discovery of TCE contamination at the Sacramento facility also led Aerojet to look into possible contamination of the groundwater at Aerojet's Azusa facility, where much of the testing of JATO's and Rocket engines were conducted before moving those operations to Sacramento. In 1980, it was announced that there was TCE contamination in the groundwater at Aerojet's facility in Azusa in a hearing chaired by State Senator Esteben Torres. In 1985, it was declared a Superfund Site by the EPA as San Gabriel Superfund Site II and the cleanup done under the Baldwin Park Operable Unit. In 1997, it was also discovered that there was also NDMA and Ammonium Perchlorate contamination in this plume and that Aerojet was once again labeled a Potentially Responsible Party (PRP) in this action. Aerojet sold this facility in 2001 to Northrop Grumman Corporation.
Aerojet's disposal of toxic material occurred 20 years prior to the establishment of a provisional perchlorate RfD limit of 0.0001 mg/kg/day in 1992 (to have been achieved by all companies by 1995). This limit was increased to 0.0009 mg/kg/day in 1998, and prior to the results from NAS studies, the limit was reduced to 0.00004 mg/kg/day in 2002. The NAS studies disputed the 0.00004 limit, and recommended its current limit of 0.0007 mg/kg/day.
Products
Rockets
Aerobee
Aerojet General X-8
See also
Scout (rocket) – Aerojet manufactured the "Algol" first stage of this USAF/NASA orbital launch vehicle
Bristol Aerojet - joint venture in the UK with Bristol Aeroplane Company
Robert Truax
Sea Dragon (rocket)
Aquarius Launch Vehicle
References
External links
Aerojet Rocketdyne website
GenCorp website
Google Maps view of the Florida facility
Category:GenCorp
Category:Aerospace companies of the United States
Category:Defunct aircraft manufacturers of the United States
Category:Rocket engine manufacturers of the United States
Category:Manufacturing companies based in California
Category:Technology companies based in California
Category:Companies based in Sacramento, California
Category:Defunct companies based in California
Category:Manufacturing companies established in 1942
Category
|
wikipedia_en
|
K[" u]{}ppers, M., Hartogh, P., & Villanueva, G. 2004, AAS/Division for Planetary Sciences Meeting Abstracts, 36, 25.05
Lis, D. C., et al. 1997, Icarus, 130, 355
Lovell, A. J., Kallivayalil, N., Schloerb, F. P., Combi, M. R., Hansen, K. C., & Gombosi, T. I. 2004, , 613, 615
Magee-Sauer, K., Mumma, M. J., DiSanti, M. A., Russo, N. D., & Rettig, T. W. 1999, Icarus, 142, 498
Magee-Sauer, K., Dello Russo, N., DiSanti, M. A., Bonev, B., Gibb, E. L., & Mumma, M. J. 2004, AAS/Division for Planetary Sciences Meeting Abstracts, 36, 25.03
Maki, A. G. 1974, J. Phys. Chem. Ref. Data, 3, 221
Mumma, M. J., Disanti, M. A., dello Russo, N., Fomenkova, M., Magee-Sauer, K., Kaminski, C. D., & Xie, D. X. 1996, Science, 272, 1310
Sault, R. J., Teuben, P. J., & Wright, M.C.H. 1995, in: Astronomical Data Analysis Software and Systems IV, ASP Conference Series 77, ed. R.A. Shaw, H.E. Payne, & J.J.E. Hayes, 433
Snyder, L. E., et al. 2001, , 121, 1147
Veal, J. M., et al. 2000, , 119, 1498
Womack, M., Festou, M. C., & Stern, S. A. 1997, , 114, 2789
Woodney et al. 2002, Icarus, 157, 193
Wright, M. C. H., et al. 1998, , 116, 3018
|
arxiv
|
public class MetricsPreferences {
static private JPanel panel;
static private JCheckBox collectAnonymousMetricsCheckbox;
static private String COLLECT_ANONYMOUS_METRICS_LABEL = "Collect Anonymous Metrics";
static public JPanel buildPanel() {
panel = new JPanel();
panel.setLayout(new GridBagLayout());
panel.setBorder(BorderFactory.createEmptyBorder(5,5,5,5));
collectAnonymousMetricsCheckbox = new JCheckBox(Translator.get("collectAnonymousMetrics"));
Preferences prefs = PreferencesHelper.getPreferenceNode(PreferencesHelper.MakelangeloPreferenceKey.METRICS);
collectAnonymousMetricsCheckbox.setSelected(prefs.getBoolean(COLLECT_ANONYMOUS_METRICS_LABEL, false));
GridBagConstraints c = new GridBagConstraints();
int y = 0;
c.anchor = GridBagConstraints.WEST;
c.gridwidth = 1;
c.gridx = 1;
c.gridy = y;
panel.add(collectAnonymousMetricsCheckbox, c);
y++;
return panel;
}
static public void save() {
Preferences prefs = PreferencesHelper.getPreferenceNode(PreferencesHelper.MakelangeloPreferenceKey.METRICS);
prefs.putBoolean(COLLECT_ANONYMOUS_METRICS_LABEL, collectAnonymousMetricsCheckbox.isSelected());
}
static public void cancel() {
}
static public boolean areAllowedToShare() {
if(collectAnonymousMetricsCheckbox != null) return collectAnonymousMetricsCheckbox.isSelected();
Preferences prefs = PreferencesHelper.getPreferenceNode(PreferencesHelper.MakelangeloPreferenceKey.METRICS);
return prefs.getBoolean(COLLECT_ANONYMOUS_METRICS_LABEL,false);
}
static public void setAllowedToShare(boolean newState) {
Preferences prefs = PreferencesHelper.getPreferenceNode(PreferencesHelper.MakelangeloPreferenceKey.METRICS);
prefs.
|
github
|
Considering how good tonight was and that PS2 doesn't cause my graphics card to melt anymore I'll certainly be back for more!
we were so damn close, but we couldn't contain the TR in the end (after we had lost tawrich). holding off two factions at once is bloody hard, but i reckon that us moving to the east directly after peris could have been a better move. we just acted a little too slow and allowed em too much territory last night.
"Quantacat's name is still recognised even if he watches on with detached eyes like Peter Molyneux over a cube in 3D space, staring at it with tears in his eyes, softly whispering... Someday they'll get it."
Holding off two factions at once is bloody hard, but i reckon that us moving to the east directly after peris could have been a better move. we just acted a little too slow and allowed em too much territory last night.
Agree, think we underestimated the size of the TR push (we did have other outfits moving to contain them if I remember correctly). But it also seemed like we just didn't have enough organised VS troops left on after the NC starting warping in from Esamir.
We were closer than ever before tonight! TR was down to 1 territory, NC was down to 2. Then the TR decided to redeploy to Indar and our pop advantage melted away. Alas ... we're getting closer and closer.
Yeah, you did an amazing job with that Grible. Purple giraffe for you.
Yeah, that was good fun. Never kept a Galaxy alive for that long before. Also, another purple giraffe for Qazz who took over for a good assault on the Crown, that actually succeeded after some 30-40 minutes of heavy fighting.
It was much more enjoyable playing on indar yesterday than the day before. They must've fixed the lag issues with heals/repairs/etc.
(Also, slightly off-topic: what is up with purple giraffes, by the way? A google search turns up thousands of purple giraffes, and half of them seem to be from our bloody forums!)
in a massive show of cowardice and treachery, TR forces (mostly brtd) of roughly 100 people ghostcapped indar tonight. resistance was unfortunately futile, as TR had a continent pop of ~70%. we initially managed to ghost cap
|
pile-cc
|
-1
-1001 (base 2) to base 8
-11
What is -1 (base 16) in base 2?
-1
-2 (base 13) to base 16
-2
What is 11 (base 5) in base 16?
6
What is -234 (base 5) in base 7?
-126
What is 94 (base 11) in base 14?
75
What is -2 (base 5) in base 2?
-10
Convert -31 (base 6) to base 11.
-18
Convert 33 (base 4) to base 6.
23
Convert -1 (base 7) to base 2.
-1
3 (base 5) to base 7
3
14 (base 10) to base 15
e
-1 (base 5) to base 14
-1
What is -1 (base 3) in base 12?
-1
What is -212 (base 4) in base 13?
-2c
199 (base 11) to base 12
171
What is 24 (base 14) in base 15?
22
What is 321 (base 11) in base 6?
1442
What is -10 (base 3) in base 2?
-11
78 (base 9) to base 8
107
What is -124 (base 10) in base 13?
-97
-224 (base 9) to base 5
-1214
160 (base 11) to base 7
355
Convert -2 (base 7) to base 12.
-2
Convert 10 (base 3) to base 13.
3
Convert 124 (base 5) to base 15.
29
Convert 80 (base 12) to base 9.
116
Convert -26 (base 11) to base 15.
-1d
Convert -22 (base 15) to base 12.
-28
1 (base 12) to base 8
1
-323 (base 5) to base 6
-224
31 (base 8) to base 10
25
-2 (base 14) to base 3
-2
Convert 22 (base 4) to base 3.
101
What is -130 (base 5) in base 12?
-34
Convert -4 (base 13) to base 12.
-4
Convert -13 (base 4) to base 11.
|
dm_mathematics
|
As always our timeline is tight and would therefore appreciate the data by
close of business Friday.
Let me know how this works
Thank you,
Kathryn
---------------------- Forwarded by Kathryn Corbally/Corp/Enron on 01/05/2000
07:31 PM ---------------------------
Michael Darnall
01/05/2000 07:11 PM
To: Kathryn Corbally/Corp/Enron@ENRON
cc:
Subject
|
enron_emails
|
302 F.3d 909
Marta ZAMBRANO; Margarita Rodriguez; Graciela Lopez; Andrea Ruiz; Martha Ozuna; Jorge Perdoma, Plaintiffs-Appellants,v.IMMIGRATION AND NATURALIZATION SERVICE; Edwin Meese; Alan Nelson, Defendants-Appellees.
No. 00-16191.
United States Court of Appeals, Ninth Circuit.
Argued and Submitted December 7, 2001.
Filed March 7, 2002.
Amended September 4, 2002.
Richard M. Pearl, Berkeley, CA, for the appellants.
William J. Howard and Antony W. Norwood, Office of Immigration Litigation, U.S. Department of Justice, Washington, DC, for the appellees.
Appeal from the United States District Court for the Eastern District of California; Edward J. Garcia, District Judge, Presiding. D.C. No. CV-88-00455-EJG.
Before; HUG, D.W. NELSON, and HAWKINS, Circuit Judges.
1
The Opinion filed March 7, 2002 is amended as follows: on slip opinion page 3832, last paragraph (that carries over to page 3833) [282 F.3d at 1152], change the paragraph to read:
2
The overall scheme of the new legislation reflects that by specifically making the repeal of § 377 retroactive to the date of the enactment of the IRCA, the statutory language was intended to remove a jurisdictional obstacle to litigation over applications pursuant to both the IRCA and the newly amended LIFE Act, and was not intended to retroactively bestow jurisdiction on the district court for the purposes of awarding fees.
3
At the end of this paragraph (following "awarding fees"), the following footnote should be inserted:
4
In so ruling, we make no judgment on whether a district court may, in response to a Rule 60(b) motion, or whether a Court of Appeals may, in response to a timely appeal, reinstate dismissed claims of substantial cause plaintiffs.
5
With these amendments, the panel has voted to deny the petition for rehearing and reject the suggestion for rehearing en banc.
6
The full court has been advised of the petition for rehearing en banc and no judge has requested a vote on whether to rehear the matter en banc. Fed. R.App. P. 35.
|
freelaw
|
------
mark_l_watson
My Dad named our first nice sailboat Vailima, named after Stevenson's house. I
means, if I remember correctly, 'house on 5 rivers.'
------
Latteland
The weekly standard is an 'interesting' source. Did you also notice the
featured article, [https://www.weeklystandard.com/holmes-lybrand/fact-check-
was...](https://www.weeklystandard.com/holmes-lybrand/fact-check-was-the-
recent-california-fire-started-by-the-u-s-government-using-space-lasers).
------
pmoriarty
One of the most fascinating things I've read by Stevenson was his description
of his creative process, the success of which he attributed to the "little
people" in his dreams, or what he called his "Brownies".
Referring to himself in the third person, Stevenson writes:
_" This honest fellow had long been in the custom of setting himself to sleep
with tales, and so had his father before him; but these were irresponsible
inventions, told for the teller's pleasure, with no eye to the crass public or
the thwart reviewer: tales where a thread might be dropped, or one adventure
quitted for another, on fancy's least suggestion. So that the little people
who manage man's internal theatre had not as yet received a very rigorous
training; and played upon their stage like children who should have slipped
into the house and found it empty, rather than like drilled actors performing
a set piece to a huge hall of faces._
_" But presently my dreamer began to turn his former amusement of story-
telling to (what is called) account; by which I mean that he began to write
and sell his tales. Here was he, and here were the little people who did that
part of his business, in quite new conditions._
_" The stories must now be trimmed and pared and set upon all fours, they
must run from a beginning to an end and fit (after a manner) with the laws of
life; the pleasure, in one word, had become a business; and that not only for
the dreamer, but for the little people of his theatre. These understood the
change as well as he. When he lay down to prepare himself for sleep,
|
hackernews
|
In this new proposal, we investigate our findings defining novel growth factor combinations and signaling pathways that control EC tubulogenesis and EC-pericyte tube co-assembly, which are necessary to create capillary networks, which critically support tissue perfusion, development and functional maintenance. Capillaries consist of two major cell types, ECs and pericytes, which co-assemble to form polarized EC-lined tubes with abluminally positioned pericytes and an intervening basement membrane matrix. The Davis lab has
|
nih_exporter
|
Lack of therapeutic effect of colchicine on murine toxoplasmosis.
In a previous report, we showed that addition of colchicine to cultures of glial cells infected with Toxoplasma gondii decreased the number of parasites by up to 80%. To provide support for potential therapeutic use of colchicine in toxoplasmosis, a murine model of T. gondii infection was used. Mice infected with pure RH T. gondii tachyzoites (from 2,233 to 25,000
|
pubmed_abstracts
|
1. CG equation: $\{\lbrack 1.73 \times (140 - \text{Age}) \times \text{body weight}\rbrack/(72 \times \text{SCr} \times \text{BSA})\} \times 0.85\,(\text{if female})$
2. MDRD equation: $186 \times {(\text{SCr})}^{- 1.154} \times {(\text{Age})}^{- 0.203} \times 1.212\,(\text{if black}) \times 0.742\,(\text{if female})$
3. CKD-EPI equation: $\begin{array}{l}
{\text{Female with SCr} \leq 0.7:144 \times {(0.993)}^{\text{Age}} \times {(\text{SCr}/0.7)}^{- 0.329}} \\
{\text{Female with SCr} > 0.7:144 \times {(0.993)}^{\text{Age}} \times {(\text{SCr}/0.7)}^{- 1.209}} \\
{\text{Male with SCr} \leq 0.9:141 \times {(0.993)}^{\text{Age}} \times {(\text{SCr}/0.9)}^{- 0.411}} \\
{\text{Male with SCr} > 0.9:141 \times {(0.993)}^{\text{Age}} \times {(\text{SCr}/0.9)}^{- 1.209}} \\
\end{array}$
Cisplatin dosing and chemotherapy toxicity
------------------------------------------
Physicians made decisions regarding whether to administer reduced or full doses of cisplatin to patients based on renal function as calculated using the CG equation. We evaluated hematologic and non-hematologic toxicities, including nephrotoxicity, associated with chemotherapy after the first cycle according to the National Cancer Institute Common Terminology Criteria for Adverse Events (CTACE) Version 4.0 \[[@b11-krcp-36-342]\].
Statistical analyses
--------------------
Chi-square or Fisher's exact tests were used to compare toxicities according to eGFR categories. The Friedman test was used to determine differences between renal function estimates derived using the CG, MDRD, and CKD-EPI equations. Cochran's
|
pubmed_central
|
Q:
Cutting out parts of JSON
I'm trying to parse JSON game result statistic and add/change/delete some values:
bot.Dota2.requestMatchDetails(lobby.match_id);
bot.Dota2.on("matchDetailsData", function (matchId, matchData) {
var data = JSON.parse(JSON.stringify(matchData));
data.match.type = "partyStatistic";
data.match.partyId = bot.currentLobby.id;
for (i = 0; i < data.match.players.length; i++) {
delete data.match.players[i].party_id;
data.match.players[i].account_id = bot.Dota2.ToSteamID(data.match.players[i].account_id + "") + "";
}
delete data.vote;
delete data.result;
util.log(JSON.stringify('API STATISTIC: ' + JSON.stringify(data)));
}
JSON im getting now:
{
"match": {
"duration": 647,
"startTime": 1530782586,
"cluster": 136,
"first_blood_time": 308,
"lobby_type": 1,
"human_players": 2,
"positive_votes": 0,
"negative_votes": 0,
"game_mode": "DOTA_GAMEMODE_1V1MID",
"radiant_team_score": 2,
"dire_team_score": 0,
"match_outcome": "k_EMatchOutcome_RadVictory",
"pre_game_duration": 90,
"type": "partyStatistic",
"partyId": "54333333-0bea-e611-80bc-c8600054b63d"
}
}
JSON i need:
{
"duration": 647,
"startTime": 1530782586,
"cluster": 136,
"first_blood_time": 308,
"lobby_type": 1,
"human
|
stackexchange
|
(6) In an image transfer step, the roller is to be efficiency in removal of paper dust.
For the techniques in which toner scraped off from the surface of an image-forming member by a cleaning means such as a cleaning blade and an elastic roller is collected by the above-mentioned elastic roller, there are some proposals therefor such as those disclosed in Japanese Patent Publication Open to Public Inspection (hereinafter referred to as JP OPI Publication) Nos. 60-107675/1985, 61-67073/1986 and 1-267679/1989. Wherein an elastic roller comprising a foamed material such as urethane rubber, chloroprene rubber, silicone rubber and sponge is served as both a cleaning means together with a cleaning blade and a toner guide roller, such elastic roller is rotated by bringing it into pressure contact with an image-forming member so that cleaned up toner scraped off by the cleaning means is made adhered to the guide roller and is then transported by the guide roller to a toner collection unit.
The above-mentioned foamed material such as sponge herein means that it has a pore size of not smaller than 100 .mu.m and it is quite different in itself from the open-cell cellular materials of the invention.
However, the guide rollers described in the above-mentioned patent publications cannot satisfy all the requirements (1) through (6). In the present state where a high-speed operation and a high image quality are recently demanded on copying machines, most of the above-mentioned requirements have not been satisfied and the improvements of the guide roller have also been urgently needed.
For example, Japanese Utility Model Publication Open to Public Inspection No. 57-172470/1982 proposes for an elastic roller having at least the surface comprising an open-cell cellular material to serve as a cleaning means in place of the above-mentioned cleaning blade for a copying machine. Wherein cleaned up toner is collected by a suction fan.
The elastic roller described therein is strictly a cleaning means for an image-forming member and remaining toner is required to be scraped off at a high rotation speed. It is therefore difficult to select a peculiar cellular material to meet the requirement. There are some problems that the size of a cleaning unit becomes remarkably larger than in the other image-forming apparatuses, that a noise is produced and that a cleaning effect becomes more unsatisfactory than in a cleaning blade.
It is an object of the invention to provide a toner guide roller by which toner scraped off by a cleaning blade
|
uspto_backgrounds
|
In January 2005, Petters Group Worldwide purchased the Polaroid brand for $426 million, with plans to use it on consumer electronics and new technologies. In 2006, Petters Group Worldwide acquired Sun Country Airlines. Petters Group Worldwide became a diverse holding company with 3,200 employees and investments or full ownership in 60 companies, of which it actively managed 20. With offices in North America, South America, Asia, and Europe, it had $2.3 billion in revenue in 2007.
Prosecution, conviction and sentencing
In about 2008, the FBI began investigating Petters for his role in a fraud scheme involving more than $100 million in investments. On September 24, 2008, federal investigators raided the Petters headquarters in Minnetonka and searched Tom Petters' Wayzata home. Documents released by the FBI, IRS, and other federal agencies noted that they were seeking evidence of a scheme to lure investors into funding a company based on tens of millions of dollars in purchases and sales that never occurred. The documents noted that a witness associated with Petters and his company came forward with documents and other information, and later wore a hidden microphone and recorded several conversations involving Petters and others who carried out the fraud. The affidavit alleges that Petters repeatedly admitted to the fraud scheme of providing false information to investors in the tapes; in addition, Petters admitted to falsifying his tax returns. On September 29, he resigned as the head of Petters Group Worldwide.
On October 3, Petters was arrested at his home in Wayzata. He was denied bail after prosecutors produced documents that alleged Petters had encouraged another person involved with the case to leave the country, that Petters had stated that he regretted turning over his passport, and that he had previously spoken about fleeing the country if the fraudulent scheme were discovered. The U.S. Attorney's Office charged him with mail fraud, wire fraud, money laundering and obstruction of justice.
The U.S. Attorney staff noted that the government knew nothing about the scheme until Deanna Coleman, vice president of operations for Petters Co., approached them to confess and offered to help federal authorities investigate. This led to the prosecution of Robert Dean White, who admitted to being involved in creating false bank statements and other documents that were used to trick investors in what he described as a massive Ponzi scheme. Both individuals made plea bargains with federal prosecutors in exchange for providing the government information on how the scheme worked. Coleman and White
|
wikipedia_en
|
In this section, we provide method that accomplish $1-1/e$ approximation ratio for problem \[eq:ML\_submodular\_sample\_avg\] . In high level, we use the continuous optimization method and dependent rounding technique in [@balkanski2016learning] to obtain a solution.\
\
**New Ground Set:** Similar to [@balkanski2016learning], we define new ground set of size $nm+n$ which has the orginal ground set elements and element for every $(element, function)$ pair ${\mathcal{X}}^{'}=V \cup \{a_{i,j}\}_{i\in[n],j\in[m]}$.
$$\label{eq:cont reformulation}
g(S)=\sum_{j=1}^{m} f_j(\{a_i: a_{i,j}\in S\})$$
\
\
**Continuous problem:** let us associate with each element $a_{i}$ a variable $x_i \in [0,1]$ and for each element $a_{i,j}$ a variable $x_{i,j} \in [0,1]$; then, we define the $G(x)$ as in : $$\label{eq:cont obj1}
G(x)= \mathbb{E}_{s \sim D(x)}g(S)$$ where $D(x)$ is the following distribution:
1. $a_i \in S \sim D(x)$ for each i independently with probability $x_i$
2. $a_{i,j} \in S \sim D(x)$ for each i and for each j independently with probability $\frac{x_{i,j}}{x_i}$ if $a_i \in S$ and with probability 0 otherwise.
we can write the continuous version of the problem as note that the difference between this problem and two-stage submodular problem shows itself in .
\[eq: cont\] $$\begin{aligned}
{4}
& \max_{\mathcal{S}}&& G(x)
\\
&\operatorname*{subject\,\, to \quad}&& x_i\in [0,1]&&&\forall i\in[n]\\
& && x_{i,j}\in [0,1]&&&\forall i\in[n]\forall j
|
arxiv
|
type ListServicesInput struct {
// The maximum number of service results returned by ListServices in paginated
// output. When this parameter is used, ListServices only returns maxResults
// results in a single page along with a nextToken response element. The remaining
// results of the initial request can be seen by sending another ListServices
// request with the returned nextToken value. This value can be between 1 and 100.
// If this parameter is not used, then ListServices returns up to 10 results and a
// nextToken value if applicable.
MaxResults *int32
// The short name or full Amazon Resource Name (ARN) of the cluster that hosts the
// services to list. If you do not specify a cluster, the default cluster is
// assumed.
Cluster *string
// The nextToken value returned from a ListServices request indicating that more
// results are available to fulfill the request and further calls will be needed.
// If maxResults was provided, it is possible the number of results to be fewer
// than maxResults. This token should be treated as an opaque identifier that is
// only used to retrieve the next items in a list and not for other programmatic
// purposes.
NextToken *string
// The scheduling strategy for services to list.
SchedulingStrategy types.SchedulingStrategy
// The launch type for the services to list.
LaunchType types.LaunchType
}
type ListServicesOutput struct {
// The nextToken value to include in a future ListServices request. When the
// results of a ListServices request exceed maxResults, this value can be used to
// retrieve the next page of results. This value is null when there are no more
// results to return.
NextToken *string
// The list of full ARN entries for each service associated with the specified
// cluster.
ServiceArns []*string
// Metadata pertaining to the operation's result.
ResultMetadata middleware.Metadata
}
func addawsAwsjson11_serdeOpListServicesMiddlewares(stack *middleware.Stack) {
stack.Serialize.Add(&awsAwsjson11_serializeOpListServices{}, middleware.After)
stack.Deserialize.Add(&aws
|
github
|
Wokingham Borough Council is working in partnership with the Lawn Tennis Association (LTA) to significantly improve the current nine outdoor court tennis facilities with the addition of three new courts.
Modern floodlights, that avoid light pollution, will also be installed to six courts and a new clubhouse is being built thanks to funding by the borough council and LTA.
Work is already well underway and includes the installation of an electronic court access system linked to online court booking, which will provide easy access and affordable tennis for the community.
A tennis operator will manage the tennis court facilities, deliver an exciting and varied programme of tennis activities for all ages and abilities, drive the sale of the pay and play activities and membership sales all year round. The cost of a family membership will be £65 per year – for all family members to play (excluding floodlighting). People will be able to purchase refreshments from the new clubhouse.
The improvements are being funded by S106 developer contributions and the LTA.
The borough council has previously worked with the LTA to improve opportunities to play tennis in the Wokingham Borough and increase the number of people taking part in the sport. Last year Cantley Park hosted two Great British Tennis Weekends which included free tennis sessions and people also had the opportunity to have their photo taken with the Davis Cup as part of the National Trophy Tour organised by the LTA.
Cllr Angus Ross, executive member for environment, said: “We’re delighted to be able to improve the tennis facilities in Wokingham Borough in partnership once again with the Lawn Tennis Association. This investment means that we can provide excellent tennis facilities for all our residents in the Wokingham Borough. Tennis is a fantastic sport and is a great way for people of all ages and abilities to stay fit and healthy.
“We appreciate there may be some local concerns about these tennis facility improvements at Cantley Park. However I’d like to reassure you there is plenty of open space at Cantley Park for everyone to enjoy whether you are a walker, jogger or our walking your dog. The new facilities are located on a small area of the park.”
Leo Tutt, LTA regional tennis participation manager, said: “We are delighted to be working in partnership with Wokingham Borough Council on this very exciting community tennis project. The enhanced facilities will provide new year-round tennis playing opportunities for the whole community, encouraging
|
pile-cc
|
50
What is the highest common factor of 2780 and 20?
20
Calculate the greatest common divisor of 23 and 27.
1
What is the greatest common divisor of 7139 and 77?
11
What is the highest common factor of 15792 and 32?
16
What is the highest common factor of 174 and 290?
58
Calculate the greatest common factor of 425 and 75.
25
What is the highest common factor of 16 and 1184?
16
What is the greatest common divisor of 185 and 9065?
185
Calculate the greatest common divisor of 168 and 728.
56
Calculate the greatest common factor of 2673 and 81.
81
What is the highest common factor of 69 and 46?
23
What is the highest common factor of 11 and 10703?
11
Calculate the greatest common factor of 775 and 25.
25
What is the highest common divisor of 112 and 42?
14
Calculate the highest common factor of 4 and 418.
2
Calculate the greatest common divisor of 768 and 72.
24
Calculate the greatest common divisor of 3376 and 5486.
422
Calculate the highest common divisor of 651 and 336.
21
What is the highest common factor of 10 and 34?
2
Calculate the highest common factor of 444 and 777.
111
What is the highest common factor of 58 and 5858?
58
Calculate the highest common factor of 11286 and 1386.
198
Calculate the greatest common factor of 1738 and 22.
22
What is the highest common divisor of 295 and 2596?
59
Calculate the highest common factor of 157 and 1.
1
Calculate the highest common divisor of 266 and 76.
38
What is the greatest common divisor of 26 and 4550?
26
What is the greatest common factor of 1080 and 918?
54
What is the greatest common factor of 70 and 1510?
10
Calculate the greatest common divisor of 204 and 8.
4
Calculate the highest common factor of 5258 and 11.
11
Calculate the greatest common factor of 63 and 7.
7
Calculate the highest common divisor of 58750 and 25.
25
What is the highest common factor of 16 and 148?
4
What is the highest common divisor of 760 and 200?
40
Calculate the greatest common divisor of 576 and 160.
32
What is
|
dm_mathematics
|
Stephen.Dyer@bakerbotts.com on 04/16/2001 03:49:59 PM
To: Stanley.Horton@enron.com
cc: david.hill@msdw.com, Adam.Schucher@bakerbotts.com
Subject: some questions...
We are starting on your drafting work now that we have received the
engagement letter. We have a few questions that need answering, as follows:
|
enron_emails
|
6 December 2, 2000 custodial interview of Fell conducted by the Vermont State Police; and
7 (iv) certain undated and unsigned handwritten letters purportedly written by Lee from
8 prison following his arrest for his role in the murders of Conway, Debbie, and King.2 See
9 Dkt. No. 103 at 11–12 (2d Cir. Nov. 14, 2017). Each statement broadly inculpates Lee
10 principally in the killings of Debbie and King, while also discussing in detail Fell’s role
11 in the murder of all three victims.
12 After a lengthy hearing following our order, the district court concluded that,
13 except for most of the handwritten letters, the statements by Lee that the government
14 seeks to introduce meet due process and FDPA requirements for reliability. In short, the
15 district court concluded that Lee’s statements are sufficiently reliable because they are
16 generally consistent with the evidence that will be admitted at trial.
17 The district court having now concluded that the Lee statements would be
18 inadmissible at sentence-selection under the Sixth Amendment, but largely admissible
19 under the Fifth Amendment and the FDPA, the issue is ripe for our decision. We
2
On remand to the district court following our oral argument, the government also sought to introduce reports of the
Rutland, VT police department documenting police visits to Debbie’s home on October 5 and October 6, 2000. The
district court concluded that these statements were sufficiently reliable to be introduced at sentence-selection under
the due process clause and the FDPA. Because the government did not identify these statements to us in its
November 14, 2017 letter, however, we do not think they are properly before us and we come to no conclusion
regarding their admissibility at sentence-selection.
4
1 conclude that the district court erred in holding in its January 19, 2018 order that the
2 statements at issue are sufficiently reliable under the Fifth Amendment’s due process
3 clause, and we therefore affirm on this ground alone the district court’s order of May 1,
4 2017 excluding the statements.
5 The parties do not dispute that evidence must carry sufficient “indicia of
6 reliability
|
freelaw
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.