image
imagewidth (px) 384
384
| text
stringlengths 99
12.8k
|
|---|---|
\documentclass[crop,tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{arrows,decorations.pathmorphing,backgrounds,positioning}
\definecolor{echoreg}{HTML}{2cb1e1}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\definecolor{mymauve}{rgb}{0.58,0,0.82}
\usepackage{etoolbox}
\newtoggle{redraw}
\newtoggle{redraw2}
\tikzset{%
pics/cube/.style args={#1/#2/#3/#4}{code={%
\begin{scope}[line width=#4mm]
\begin{scope}
\clip (-#1,-#2,0) -- (#1,-#2,0) -- (#1,#2,0) -- (-#1,#2,0) -- cycle;
\filldraw (-#1,-#2,0) -- (#1,-#2,0) -- (#1,#2,0) -- (-#1,#2,0) -- cycle;
\end{scope}
\iftoggle{redraw}{%
}{%
\begin{scope}
\clip (-#1,-#2,0) -- (-#1-#3,-#2,-#3) -- (-#1-#3,#2,-#3) -- (-#1,#2,0) -- cycle;
\filldraw (-#1,-#2,0) -- (-#1-#3,-#2,-#3) -- (-#1-#3,#2,-#3) -- (-#1,#2,0) -- cycle;
\end{scope}
}
\iftoggle{redraw2}{%
}{
\begin{scope}
\clip (-#1,#2,0) -- (-#1-#3,#2,-#3) -- (#1-#3,#2,-#3) -- (#1,#2,0) -- cycle;
\filldraw (-#1,#2,0) -- (-#1-#3,#2,-#3) -- (#1-#3,#2,-#3) -- (#1,#2,0) -- cycle;
\end{scope}
}
\node[inner sep=0] (-A) at (-#1-#3*0.5, 0, -#3*0.5) {};
\node[inner sep=0] (-B) at (#1-#3*0.5, 0, -#3*0.5) {};
\coordinate (-V) at (#1, #2);
\coordinate (-W) at (#1, -#2);
\end{scope}
}}}
\begin{document}
\begin{tikzpicture}
\node[] (i2) {};
\pic[fill=green!50] (I2) {cube={1.8/1.8/0.4/1}};
\togglefalse{redraw}
\togglefalse{redraw2}
\node[right=16em of i2] (y) {};
\pic[right=16em of i2, fill=echoreg!50] (Y) {cube={1.8/1.8/1/1}};
\node[right=12em of y] (y1) {};
\pic[right=12em of y, fill=red!50] (Y1) {cube={0.9/0.9/1/1}};
%transparent node to ease the arrow drawing
\pic[right=12em of y1, draw=echoreg!0, fill=echoreg!0] (Y2) {cube={0.9/0.9/2/1}};
\node[right=12em of y1] (y3) {};
\pic[below right=1.1em and 13em of y1, fill=mymauve!30] (Y5) {cube={0.45/0.45/2/1}};
\pic[below right=1.1em and 10em of y1, fill=mymauve!30] (Y6) {cube={0.45/0.45/2/1}};
\pic[above right=1.1em and 13em of y1, fill=mymauve!30] (Y4) {cube={0.45/0.45/2/1}};
\pic[above right=1.1em and 10em of y1, fill=mymauve!30] (Y3) {cube={0.45/0.45/2/1}};
\draw [-stealth, ultra thick] (I2-B) -- node[above] {Conv.} (Y-A);
\draw [-stealth, ultra thick] (Y-B) -- node[above] {Pool} (Y1-A);
\draw [-stealth, ultra thick] (Y1-B) -- node[above=0.3em, inner sep=0.1em, xshift=-1em] {Conv.} (Y2-A);
\color{black}
\toggletrue{redraw}
\toggletrue{redraw2}
\pic[right=16em of i2, fill=echoreg!50] (Y) {cube={1.8/1.8/1/1}};
\pic[right=12em of y, fill=red!50] (Y1) {cube={0.9/0.9/1/1}};
\node[] (i2) {\LARGE ${\bf input}$};
\node[above right=0.1em and 9em of y1] (z2) {\LARGE $\vec{o}_1$};
\node[below right=0em and 9em of y1] (z2) {\LARGE $\vec{o}_3$};
\node[above right=0.1em and 12em of y1] (z2) {\LARGE $\vec{o}_2$};
\node[below right=0em and 12em of y1] (z2) {\LARGE $\vec{o}_4$};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop,tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{arrows,decorations.pathmorphing,backgrounds,positioning}
\definecolor{echoreg}{HTML}{2cb1e1}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\definecolor{mymauve}{rgb}{0.58,0,0.82}
\usepackage{etoolbox}
\newtoggle{redraw}
\newtoggle{redraw2}
\tikzset{%
pics/cube/.style args={#1/#2/#3/#4}{code={%
\begin{scope}[line width=#4mm]
\begin{scope}
\clip (-#1,-#2,0) -- (#1,-#2,0) -- (#1,#2,0) -- (-#1,#2,0) -- cycle;
\filldraw (-#1,-#2,0) -- (#1,-#2,0) -- (#1,#2,0) -- (-#1,#2,0) -- cycle;
\end{scope}
\iftoggle{redraw}{%
}{%
\begin{scope}
\clip (-#1,-#2,0) -- (-#1-#3,-#2,-#3) -- (-#1-#3,#2,-#3) -- (-#1,#2,0) -- cycle;
\filldraw (-#1,-#2,0) -- (-#1-#3,-#2,-#3) -- (-#1-#3,#2,-#3) -- (-#1,#2,0) -- cycle;
\end{scope}
}
\iftoggle{redraw2}{%
}{
\begin{scope}
\clip (-#1,#2,0) -- (-#1-#3,#2,-#3) -- (#1-#3,#2,-#3) -- (#1,#2,0) -- cycle;
\filldraw (-#1,#2,0) -- (-#1-#3,#2,-#3) -- (#1-#3,#2,-#3) -- (#1,#2,0) -- cycle;
\end{scope}
}
\node[inner sep=0] (-A) at (-#1-#3*0.5, 0, -#3*0.5) {};
\node[inner sep=0] (-B) at (#1-#3*0.5, 0, -#3*0.5) {};
\coordinate (-V) at (#1, #2);
\coordinate (-W) at (#1, -#2);
\end{scope}
}}}
\begin{document}
\begin{tikzpicture}
\node (1) [draw, dashed, minimum height=15em, minimum width=62em, xshift=24em, fill=olivegreen, fill opacity=0.2, very thick, rectangle, rounded corners] {};
\node (la1) [below=0em of 1] {{\emph{encoder}}};
\node (2) [draw, dashed, minimum height=14em, fill = red, fill opacity=0.2,minimum width=35em, xshift=63.5em, very thick, rectangle, rounded corners] {};
\node (la1) [below=0em of 2] {{\emph{decoder}}};
\node[] (i2) {};
\pic[fill=green!50] (I2) {cube={1.8/1.8/0.4/1}};
\togglefalse{redraw}
\togglefalse{redraw2}
\node[right=16em of i2] (y) {};
\pic[right=16em of i2, fill=echoreg!50] (Y) {cube={1.8/1.8/1/1}};
\node[right=12em of y] (y1) {};
\pic[right=12em of y, fill=red!50] (Y1) {cube={0.9/0.9/1/1}};
\node[right=12em of y1] (y2) {};
\pic[right=12em of y1, fill=echoreg!50] (Y2) {cube={0.9/0.9/2/1}};
\node[right=10em of y2] (y3) {};
\pic[right=10em of y2, fill=red!50] (Y3) {cube={0.45/0.45/2/1}};
\node[right=9em of y3] (z1) {};
\pic[right=9em of y3, fill=mymauve!50] (Z1) {cube={0.9/0.9/1/1}};
\node[right=12em of z1] (z2) {};
\pic[right=12em of z1, fill=mymauve!50] (Z2) {cube={1.8/1.8/0.4/1}};
\draw [-stealth, ultra thick] (I2-B) -- node[above] {Conv.} node[below] {ReLU} (Y-A);
\draw [-stealth, ultra thick] (Y-B) -- node[above] {Pool} (Y1-A);
\draw [-stealth, ultra thick] (Y1-B) -- node[above=0.3em, inner sep=0.1em] {Conv.} node[below] {ReLU} (Y2-A);
\draw [-stealth, ultra thick] (Y2-B) -- node[above] {Pool} (Y3-A);
\draw [-stealth, ultra thick] (Y3-B) -- node[above] {Deconv.} node[below] {ReLU} (Z1-A);
\draw [-stealth, ultra thick] (Z1-B) -- node[above] {Deconv.} node[below] {logistic} (Z2-A);
\color{black}
\toggletrue{redraw}
\toggletrue{redraw2}
\node[right=16em of i2] (y) {};
\pic[right=16em of i2, fill=echoreg!50] (Y) {cube={1.8/1.8/1/1}};
\pic[right=12em of y, fill=red!50] (Y1) {cube={0.9/0.9/1/1}};
\pic[right=12em of y1, fill=echoreg!50] (Y2) {cube={0.9/0.9/2/1}};
\pic[right=9em of y3, fill=mymauve!50] (Z1) {cube={0.9/0.9/1/1}};
\togglefalse{redraw2}
\pic[right=10em of y2, fill=red!50] (Y3) {cube={0.45/0.45/2/1}};
\toggletrue{redraw2}
\node[] (i2) {\LARGE ${\bf X}$};
\node[right=9.25em of y2] (y3) {\LARGE ${\bf z}$};
\node[right=11em of z1] (z2) {\LARGE ${\bf X}'$};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}[font=\tt]
\node (T) at (0, 0) {ACAACG};
\node[below=0.5mm of T] (c1) {$T$};
\node[align=center] (tbl1) at (2.7, 0) {\textcolor{red}{AACG}AC\\\textcolor{red}{ACAACG}\\\textcolor{red}{ACG}ACA\\\textcolor{red}{CAACG}A\\\textcolor{red}{CG}ACAA\\\textcolor{red}{G}ACAAC};
\node[align=center] (tbl2) at (5.4, 0) {AACGA\textcolor{red}{C}\\\textcolor{red}{ACAACG}\\ACGAC\textcolor{red}{A}\\CAACG\textcolor{red}{A}\\CGACA\textcolor{red}{A}\\GACAA\textcolor{red}{C}};
\node[align=left] (BWT) at (8.6, 0) {(CGAAAC, 2)};
\node[below=0.5mm of BWT] (c2) {$BWT(T)$};
\draw[-stealth, very thick] (T) -- (tbl1);
\draw[-stealth, very thick] (tbl1) -- (tbl2);
\draw[-stealth, very thick] (tbl2) -- (BWT);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{arrows, positioning}
\tikzstyle{block} = [rectangle, draw, fill=blue!20,
text width=5em, text centered, rounded corners, minimum height=4em]
\tikzstyle{line} = [draw, -latex']
\definecolor{mygreen}{rgb}{0,0.6,0}
\definecolor{echodrk}{HTML}{0099cc}
\begin{document}
\begin{tikzpicture}[node distance=4cm, auto]
\node [block, color=red, fill=white, text width=6.5em] (if) {{\huge \bf IF}\\{\scriptsize Instruction fetch}};
\node [block, color=mygreen, fill=white, text width=6.5em, right of=if] (dc) {{\huge \bf DC}\\{\scriptsize Decode}};
\node [block, color=echodrk, fill=white, text width=6.5em, right of=dc] (ex) {{\huge \bf EX}\\{\scriptsize Execute}};
\node [block, color=black, fill=white, text width=6.5em, below = 0.5cm of dc] (intr) {{\huge \bf IRQ}\\{\scriptsize Handle interrupts}};
\path [line] (if) -- (dc);
\path [line] (dc) -- (ex);
\path [line] (ex) edge [bend left] (intr);
\path [line] (intr) edge [bend left] (if);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{arrows,shapes}
\definecolor{mygreen}{rgb}{0,0.6,0}
\pgfdeclarelayer{background}
\pgfsetlayers{background,main}
\tikzstyle{vertex}=[circle,fill=black!25,minimum size=20pt,inner sep=0pt]
\tikzstyle{selected vertex} = [vertex, fill=red!24]
\tikzstyle{select vertex} = [vertex, fill=blue!24]
\tikzstyle{selectx vertex} = [vertex, fill=green!24]
\tikzstyle{edge} = [draw,thick,-]
\tikzstyle{selected edge} = [draw,line width=5pt,-,red!50]
\begin{document}
\begin{tikzpicture}[scale=1.8, auto,swap]
\foreach \pos/\name in {{(0,2)/a}, {(2,1)/b}, {(4,1)/c},
{(0,0)/d}, {(3,0)/e}, {(2,-1)/f}, {(4,-1)/g}}
\node[vertex] (\name) at \pos {};
\foreach \source/ \dest /\weight in {b/a/7, c/b/8,d/a/5,d/b/9,
e/b/7, e/c/5,e/d/15,
f/d/6,f/e/8,
g/e/9,g/f/11}
\path[edge] (\source) -- (\dest);
\foreach \vertex / \fr in {b/4}
\path node[selected vertex] at (\vertex) {$\vec{h}_b$};
\foreach \vertex / \fr in {a/4, c/4, d/4, e/5}
\path node[select vertex] at (\vertex) {$\vec{h}_{\vertex}$};
\begin{pgfonlayer}{background}
\foreach \source / \dest in {b/c,d/b,a/b,b/e}
\path[selected edge] (\source.center) -- (\dest.center);
\end{pgfonlayer}
\foreach \pos/\name in {{(6,2)/a1}, {(8,1)/b1}, {(10,1)/c1},
{(6,0)/d1}, {(9,0)/e1}, {(8,-1)/f1}, {(10,-1)/g1}}
\node[vertex] (\name) at \pos {};
\foreach \source/ \dest /\weight in {b1/a1/7, c1/b1/8,d1/a1/5,d1/b1/9,
e1/b1/7, e1/c1/5,e1/d1/15,
f1/d1/6,f1/e1/8,
g1/e1/9,g1/f1/11}
\path[edge] (\source) -- (\dest);
\foreach \vertex / \fr in {b1/4}
\path node[selectx vertex] at (\vertex) {$\vec{h}'_b$};
\draw[-stealth, densely dotted, ultra thick, mygreen] (b) edge[bend left=20] (b1);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{pgfplots}
\begin{document}
\begin{tikzpicture}
\begin{axis}[
width=12.5cm, height=8cm,
xtick=\empty,
ytick=\empty,
xlabel={\large $t$},
ylabel={\large $x(t)$},
xmin=0, xmax=16,
ymin=-1.1, ymax=1.5,
xtick={1.365, 2.73, 4.095, 5.46},
xticklabels={$\frac{1}{f_s}$, $\frac{2}{f_s}$, $\frac{3}{f_s}$, $\dots$},
axis lines = middle,
very thick,
domain = 0:15
]
\addplot[no markers, samples = 100, smooth ,thick] {sin(2*180*x/13)};
\addplot+[ycomb, mark=*, mark color=blue, samples= 12, black, thick] {sin(2*180*x/13)};
\end{axis}
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{shapes, arrows}
\tikzstyle{block} = [rectangle, draw, fill=blue!20,
text width=5em, text centered, rounded corners, minimum height=4em]
\tikzstyle{block2} = [rectangle, draw, fill=blue!20,
text width=4em, text centered, rounded corners, minimum height=1em]
\tikzstyle{cloud} = [draw, ellipse,fill=red!20, node distance=3cm,
minimum height=2em]
\tikzstyle{line} = [draw, -latex']
\definecolor{mygreen}{rgb}{0,0.6,0}
\definecolor{echodrk}{HTML}{0099cc}
\definecolor{drkorange}{HTML}{FF7c00}
\begin{document}
\begin{tikzpicture}[node distance=3cm, auto]
\node [block, color=red, fill=white] (cpu) {CPU};
\node [cloud, color=red, fill=white, below of=cpu] (intr) {Interrupts};
\node [block, color=drkorange, fill=white, right of=cpu] (mmu) {Memory controller};
\node [block, color=echodrk, fill=white, right of=mmu] (memo) {Memory \begin{tikzpicture}\node [block2, color=echodrk, fill=white] (rom) {ROM};\node [block2, node distance=1.3em, below of=rom, color=echodrk, fill=white] (ram) {RAM};\end{tikzpicture}};
\node [block, color=black, fill=white, right of=memo] (cartr) {Cartridge reader};
\node [block, color=mygreen, fill=white, below of=memo] (gpu) {GPU};
\node [cloud, color=mygreen, fill=white, right of=gpu] (sprites) {Sprites};
\node [block, color=blue, fill=white, left of=gpu] (io) {Input};
\path [line,transform canvas={yshift=0.1em}] (cpu) -- (mmu);
\path [line,transform canvas={yshift=-0.1em}] (mmu) -- (cpu);
\path [line,transform canvas={yshift=0.1em}] (mmu) -- (memo);
\path [line,transform canvas={yshift=-0.1em}] (memo) -- (mmu);
\path [line] (io) -- (mmu);
\path [line] (mmu) -- (gpu);
\path [line] (memo) -- (gpu);
\path [line, dashed] (intr) -- (cpu);
\path [line, dashed] (io) -- (intr);
\path [line, dashed] (gpu) edge [bend left] (intr);
\path [line] (cartr) -- (memo);
\path [line, dashed] (memo) -- (sprites);
\path [line, dashed] (sprites) -- (gpu);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{snakes}
\definecolor{mygreen}{HTML}{006400}
\definecolor{mymauve}{rgb}{0.58,0,0.82}
\definecolor{mygold}{HTML}{B8860B}
\definecolor{mynavy}{HTML}{000080}
\begin{document}
\begin{tikzpicture}
\node at (0,0) {\tt GTGCATCTGACTCCTGAGGAGTAG};
\node (dnk2) at (0,-0.5) {\tt CACGTAGACTGAGGACTCCTCATC};
\node at (-2.7, 0) {\tt \dots};
\node at (2.7, 0) {\tt \dots};
\node at (-2.7, -0.5) {\tt \dots};
\node at (2.7, -0.5) {\tt \dots};
\draw[red, opacity=0.4, very thick] (-3, 0) -- (3, 0);
\draw[blue, opacity=0.4, very thick] (-3, -0.5) -- (3, -0.5);
\node at (4, -0.25) {DNA};
\node (rnk) at (0,-2.5) {\tt \textcolor{blue}{GUG}\textcolor{mygreen}{CAU}\textcolor{orange}{CUG}\textcolor{mymauve}{ACU}\textcolor{mygold}{CCU}\textcolor{mynavy}{GAGGAG}\tikz[baseline]{\node[rectangle, fill=red,inner sep=0.3mm,anchor=base] (X) {\textcolor{white}{UAG}};}};
\draw[gray, opacity=0.4, very thick] (-3, -2.5) -- (3, -2.5);
\draw [thick, decoration={ brace, mirror, raise=0.5cm}, decorate] (-2.22, -2.2) -- (-1.7, -2.2);
\draw [thick, decoration={ brace, mirror, raise=0.5cm}, decorate] (-1.65, -2.2) -- (-1.15, -2.2);
\draw [thick, decoration={ brace, mirror, raise=0.5cm}, decorate] (-1.1, -2.2) -- (-0.6, -2.2);
\draw [thick, decoration={ brace, mirror, raise=0.5cm}, decorate] (-0.55, -2.2) -- (-0.05, -2.2);
\draw [thick, decoration={ brace, mirror, raise=0.5cm}, decorate] (0, -2.2) -- (0.5, -2.2);
\draw [thick, decoration={ brace, mirror, raise=0.5cm}, decorate] (0.55, -2.2) -- (1.05, -2.2);
\draw [thick, decoration={ brace, mirror, raise=0.5cm}, decorate] (1.1, -2.2) -- (1.6, -2.2);
\draw [thick, decoration={ brace, mirror, raise=0.5cm}, decorate] (1.65, -2.2) -- (2.2, -2.2);
\node at (4, -2.5) {mRNA};
\draw[-stealth, thick] (dnk2) -- node[right] {\emph{transcription}} (rnk);
\draw[-stealth, thick] (-1.96, -2.9) -- (-1.96, -4.3);
\node at (-1.96, -4.5) {\tt \textcolor{blue}V};
\draw[-stealth, thick] (-1.4, -2.9) -- (-1.4, -4.3);
\node at (-1.4, -4.5) {\tt \textcolor{mygreen}H};
\draw[-stealth, thick] (-0.85, -2.9) -- (-0.85, -4.3);
\node at (-0.85, -4.5) {\tt \textcolor{orange}L};
\draw[-stealth, thick] (-0.3, -2.9) -- (-0.3, -4.3);
\node at (-0.3, -4.5) {\tt \textcolor{mymauve}T};
\draw[-stealth, thick] (0.25, -2.9) -- (0.25, -4.3);
\node at (0.25, -4.5) {\tt \textcolor{mygold}P};
\draw[-stealth, thick] (0.8, -2.9) -- (0.8, -4.3);
\node at (0.8, -4.5) {\tt \textcolor{mynavy}E};
\draw[-stealth, thick] (1.35, -2.9) -- (1.35, -4.3);
\node at (1.35, -4.5) {\tt \textcolor{mynavy}E};
\draw[-stealth, thick] (1.925, -2.9) -- node[right] {\emph{translation}} (1.925, -4.3);
\node at (1.925, -4.5) {\tikz[baseline]{\node[rectangle, fill=red,inner sep=0.3mm,anchor=base] (X) {\textcolor{white}{\tt STOP}};}};
\draw[gray, opacity=0.4, very thick] (-3, -4.5) -- (3, -4.5);
\node at (4, -4.5) {protein};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\tikzstyle{inputNode}=[draw,circle,minimum size=10pt,inner sep=0pt]
\tikzstyle{stateTransition}=[-stealth, thick]
\begin{document}
\begin{tikzpicture}
\node[draw,circle,minimum size=25pt,inner sep=0pt] (x) at (0,0) {$\Sigma$ $\sigma$};
\node[inputNode] (x0) at (-2, 1.5) {$\tiny +1$};
\node[inputNode] (x1) at (-2, 0.75) {$\tiny x_1$};
\node[inputNode] (x2) at (-2, 0) {$\tiny x_2$};
\node[inputNode] (x3) at (-2, -0.75) {$\tiny x_3$};
\node[inputNode] (xn) at (-2, -1.75) {$\tiny x_n$};
\draw[stateTransition] (x0) to[out=0,in=120] node [midway, sloped, above] {$w_0$} (x);
\draw[stateTransition] (x1) to[out=0,in=150] node [midway, sloped, above] {$w_1$} (x);
\draw[stateTransition] (x2) to[out=0,in=180] node [midway, sloped, above] {$w_2$} (x);
\draw[stateTransition] (x3) to[out=0,in=210] node [midway, sloped, above] {$w_3$} (x);
\draw[stateTransition] (xn) to[out=0,in=240] node [midway, sloped, above] {$w_n$} (x);
\draw[stateTransition] (x) -- (4,0) node [midway,above] {$\sigma\left(w_0 + \sum\limits_{i=1}^{n}{w_ix_i}\right)$};
\draw[dashed] (0,-0.43) -- (0,0.43);
\node (dots) at (-2, -1.15) {$\vdots$};
\node[inputNode, thick] (i1) at (6, 0.75) {};
\node[inputNode, thick] (i2) at (6, 0) {};
\node[inputNode, thick] (i3) at (6, -0.75) {};
\node[inputNode, thick] (h1) at (8, 1.5) {};
\node[inputNode, thick] (h2) at (8, 0.75) {};
\node[inputNode, thick] (h3) at (8, 0) {};
\node[inputNode, thick] (h4) at (8, -0.75) {};
\node[inputNode, thick] (h5) at (8, -1.5) {};
\node[inputNode, thick] (o1) at (10, 0.75) {};
\node[inputNode, thick] (o2) at (10, -0.75) {};
\draw[stateTransition] (5, 0.75) -- node[above] {$I_1$} (i1);
\draw[stateTransition] (5, 0) -- node[above] {$I_2$} (i2);
\draw[stateTransition] (5, -0.75) -- node[above] {$I_3$} (i3);
\draw[stateTransition] (i1) -- (h1);
\draw[stateTransition] (i1) -- (h2);
\draw[stateTransition] (i1) -- (h3);
\draw[stateTransition] (i1) -- (h4);
\draw[stateTransition] (i1) -- (h5);
\draw[stateTransition] (i2) -- (h1);
\draw[stateTransition] (i2) -- (h2);
\draw[stateTransition] (i2) -- (h3);
\draw[stateTransition] (i2) -- (h4);
\draw[stateTransition] (i2) -- (h5);
\draw[stateTransition] (i3) -- (h1);
\draw[stateTransition] (i3) -- (h2);
\draw[stateTransition] (i3) -- (h3);
\draw[stateTransition] (i3) -- (h4);
\draw[stateTransition] (i3) -- (h5);
\draw[stateTransition] (h1) -- (o1);
\draw[stateTransition] (h1) -- (o2);
\draw[stateTransition] (h2) -- (o1);
\draw[stateTransition] (h2) -- (o2);
\draw[stateTransition] (h3) -- (o1);
\draw[stateTransition] (h3) -- (o2);
\draw[stateTransition] (h4) -- (o1);
\draw[stateTransition] (h4) -- (o2);
\draw[stateTransition] (h5) -- (o1);
\draw[stateTransition] (h5) -- (o2);
\node[above=of i1, align=center] (l1) {Input \\ layer};
\node[right=2.3em of l1, align=center] (l2) {Hidden \\ layer};
\node[right=2.3em of l2, align=center] (l3) {Output \\ layer};
\draw[stateTransition] (o1) -- node[above] {$O_1$} (11, 0.75);
\draw[stateTransition] (o2) -- node[above] {$O_2$} (11, -0.75);
\path[dashed, double, ultra thick, gray] (x.north) edge[bend left=0] (h5.north);
\path[dashed, double, ultra thick, gray] (x.south) edge[bend right=0] (h5.south);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop,tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\definecolor{mymauve}{rgb}{0.58,0,0.82}
\definecolor{camdrk}{RGB}{0,62,114}
\begin{document}
\begin{tikzpicture}
\node[rectangle, draw, thick, olivegreen, minimum width=5em, minimum height=5em] (R) at (0, 0) {};
\node[rectangle, inner sep=0.1em, olivegreen,dashed, draw, thick] (C) at (-0.1, 0.1) {$\clubsuit$};
\node[rectangle, thick, inner sep=0.1em, olivegreen,dashed, draw, above right=0.1em and 0.3em of C] (D) {$\diamondsuit$};
\node[rectangle, thick, inner sep=0.1em, olivegreen,dashed, draw, below right=0.8em and -0.5em of D] (H) {$\heartsuit$};
\node[rectangle, thick, inner sep=0.1em, olivegreen,dashed, draw, below left=0.6em and 0.4em of C] (S) {$\spadesuit$};
\node[olivegreen,below=0em of R] (l1) {\emph{input}};
\node[camdrk, rectangle, draw, above right=-2.5em and 5em of R, minimum width=7em, thick] (Oc) {$\vec{o}_\clubsuit$};
\node[camdrk, rectangle, draw, above=0em of Oc, minimum width=7em, thick] (Od) {$\vec{o}_\diamondsuit$};
\node[camdrk, rectangle, draw, below=0em of Oc, minimum width=7em, thick] (Oh) {$\vec{o}_\heartsuit$};
\node[camdrk, rectangle, draw, below=0em of Oh, minimum width=7em, thick] (Os) {$\vec{o}_\spadesuit$};
\node[camdrk, left=0em of Oc] (lc) {$\clubsuit$};
\node[camdrk, left=0em of Od] (ld) {$\diamondsuit$};
\node[camdrk, left=0em of Oh] (lh) {$\heartsuit$};
\node[camdrk, left=0em of Os] (ls) {$\spadesuit$};
\node[camdrk, below=0em of Os] (lr) {\emph{objects}};
\draw[olivegreen,-stealth, thick, dashed] (C) -- (lc);
\draw[olivegreen,-stealth, thick, dashed] (D) -- (ld);
\draw[olivegreen,-stealth, thick, dashed] (H) -- (lh);
\draw[olivegreen,-stealth, thick, dashed] (S) -- (ls);
\node[draw, camdrk, thick, right=18em of R] (A) {\texttt{"two"}};
\node[camdrk, below=0em of A] {\emph{output}};
\draw[camdrk, densely dashed, very thick] (Od.north east) -- (A.north west);
\draw[camdrk, densely dashed, very thick] (Os.south east) -- (A.south west);
\fill [opacity=0.2, camdrk] (Od.north east) -- (A.north west) -- (A.south west) -- (Os.south east) -- cycle;
% let's get funky
\node[right=14.75em of R, inner sep=0em] (dum1) {};
\node[right=1.5em of Oc, inner sep=0em] (dum2) {};
\node[right=1.5em of Oh, inner sep=0em] (dum3) {};
\draw[camdrk, densely dotted, very thick] (Od.east) edge[bend left=60] (Oc.east);
\draw[camdrk, densely dotted, very thick] plot [smooth, tension=1.5] coordinates { (Od.east) (dum2) (Oh.east)};
\draw[camdrk, densely dotted, very thick] plot [smooth, tension=1.5] coordinates { (Od.east) (dum1) (Os.east)};
\draw[camdrk, densely dotted, very thick] (Oc.east) edge[bend left=60] (Oh.east);
\draw[camdrk, densely dotted, very thick] plot [smooth, tension=1.5] coordinates { (Oc.east) (dum3) (Os.east)};
\draw[camdrk, densely dotted, very thick] (Oh.east) edge[bend left=60] (Os.east);
\node[mymauve,rectangle, thick, align=center, draw, below left=3em and -4em of Os, text width=13.5em] (Q) {\texttt{"How many outlined objects are above the spade?"}};
\node[mymauve,below=0em of Q] (ql) {\emph{query}};
\path[mymauve,-stealth, dashed, thick] (Q.east) edge[bend right] (6.2, -0.7);
\node[camdrk] at (6.7, 0) (RN){\textbf{\emph{RN}}};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning, decorations.pathmorphing}
\begin{document}
\begin{tikzpicture}[node distance=1.5cm]
\node[rectangle, very thick, draw] (learning) {Learning algorithm, $L$};
\node[rectangle, very thick, draw, below = of learning] (inference) {Labelling function, $h$};
\node[left = of learning] (train) {Training data, $\vec{s}$};
\node[left = of inference] (uns) {Unseen data, $x$};
\node[right = of inference] (lab) {Label, $y$};
\draw[-stealth, very thick] (train) -- (learning);
\draw[-stealth, very thick, decoration={snake, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (learning) -- node[right] {$L(\vec{s})$} (inference);
\draw[-stealth, very thick] (uns) -- (inference);
\draw[-stealth, very thick] (inference) -- node[above] {$h(x)$} (lab);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{relsize}
\usepackage{bm}
\usetikzlibrary{positioning,decorations.pathmorphing}
\definecolor{mygreen}{rgb}{0,0.6,0}
\definecolor{mymauve}{rgb}{0.58,0,0.82}
\definecolor{camdrk}{RGB}{0,62,114}
\begin{document}
\begin{tikzpicture}
\node[circle, draw, thick] (h1) {};
\node[circle, draw, thick, right=of h1] (h2) {};
\node[circle, draw, thick, below=of h1] (h3) {};
\node[circle, draw, thick, right=of h3] (h4) {};
\node[circle, draw, thick, below=of h3] (h5) {};
\node[circle, draw, thick, right=of h5] (h6) {};
\draw[-, thick] (h1) -- (h4);
\draw[-, thick] (h2) -- (h3);
\draw[-, thick] (h2) -- (h4);
\draw[-, thick] (h3) -- (h4);
\draw[-, thick] (h3) -- (h6);
\draw[-, thick] (h4) -- (h5);
\draw[-, thick] (h5) -- (h6);
\path [draw=black, smooth, fill=camdrk, fill opacity=0.3, very thick]
([xshift=-0.5em,yshift=0.5em]h1.north west) -- ([xshift=0.5em,yshift=0.5em]h2.north east) -- ([xshift=0.5em,yshift=-0.5em]h6.south east) -- ([xshift=-0.5em,yshift=-0.5em]h5.south west) -- cycle;
\node[circle, draw, thick, red, fill=red!10, right=10em of h1] (g1) {};
\node[circle, draw, thick, red, fill=red!10, right=of g1] (g2) {};
\node[circle, draw, thick, below=of g1] (g3) {};
\node[circle, draw, thick, right=of g3] (g4) {};
\node[circle, draw, thick, red, fill=red!10, below=of g3] (g5) {};
\node[circle, draw, thick, right=of g5] (g6) {};
\draw[-, thick, dashed, lightgray] (g1) -- (g4);
\draw[-, thick, dashed, lightgray] (g2) -- (g3);
\draw[-, thick, dashed, lightgray] (g2) -- (g4);
\draw[-, thick] (g3) -- (g4);
\draw[-, thick] (g3) -- (g6);
\draw[-, thick, dashed, lightgray] (g4) -- (g5);
\draw[-, thick, dashed, lightgray] (g5) -- (g6);
\node[red] (icr) at (g1) {$\mathlarger{\mathlarger{\mathlarger{\mathlarger{\mathlarger{\bm{\times}}}}}}$};
\node[red] (icr) at (g2) {$\mathlarger{\mathlarger{\mathlarger{\mathlarger{\mathlarger{\bm{\times}}}}}}$};
\node[red] (icr) at (g5) {$\mathlarger{\mathlarger{\mathlarger{\mathlarger{\mathlarger{\bm{\times}}}}}}$};
\path [draw=black, smooth, fill=mymauve, fill opacity=0.3, very thick]
([xshift=-0.5em,yshift=0.5em]g3.north west) -- ([xshift=0.5em,yshift=0.5em]g4.north east) -- ([xshift=0.5em,yshift=-0.5em]g6.south east) -- ([xshift=-0.5em,yshift=-0.5em]g6.south west) -- ([xshift=-0.5em,yshift=-0.5em]g3.south west) -- cycle;
\node[circle, thick, right=10em of g1] (i1) {};
\node[circle, thick, right=of i1] (i2) {};
\node[circle, draw, thick, below=of i1] (i3) {};
\node[circle, draw, red, thick, fill=red!10, right=of i3] (i4) {};
\node[circle, thick, below=of i3] (i5) {};
\node[circle, draw, thick, right=of i5] (i6) {};
\draw[-, thick, dashed, lightgray] (i3) -- (i4);
\draw[-, thick] (i3) -- (i6);
\node[red] (icr) at (i4) {$\mathlarger{\mathlarger{\mathlarger{\mathlarger{\mathlarger{\bm{\times}}}}}}$};
\draw[-stealth, ultra thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] ([xshift=0.5em]h4.east) -- node[below, black] {pool} node[above] {GCN} ([xshift=-0.5em]g3.west);
\draw[-stealth, ultra thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] ([xshift=0.5em]g4.east) -- node[above] {GCN} node[below] {pool}([xshift=-0.5em]i3.west);
\path [draw=black, smooth, fill=mygreen, fill opacity=0.3, very thick]
([xshift=-0.5em,yshift=0.5em]i3.north west) -- ([xshift=0.5em,yshift=0.5em]i3.north east) --([xshift=0.5em,yshift=0.5em]i6.north east) --([xshift=0.5em,yshift=-0.5em]i6.south east) -- ([xshift=-0.5em,yshift=-0.5em]i6.south west) -- ([xshift=-0.5em,yshift=-0.5em]i3.south west) -- cycle;
\node[circle, draw, thick, right=10em of i3] (S) {$\boldsymbol\Sigma$};
\path[-stealth, mymauve, ultra thick] ([xshift=0.5em, yshift=0.5em]g4.north east) edge[bend left,decoration={zigzag, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] node[sloped,above] {mean $\|$ max} (S);
\path[-stealth, mygreen, ultra thick] ([xshift=0.4em]i6.east) edge[bend right,decoration={zigzag, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] node[sloped,below] {mean $\|$ max} (S);
\node[right=5em of S] (P) {\emph{predict}};
\draw[-stealth, ultra thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (S.east) --node[above] {MLP} (P.west);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\tikzstyle{stateTransition}=[-stealth, thick]
\begin{document}
\begin{tikzpicture}
\node[rectangle, draw, minimum width=0.5cm,minimum height=2.5cm] (X) at (-2, 0) {$\vec{x}$};
\node[rectangle, draw, right=1.5em of X, text depth=0em, minimum width=1.5cm,minimum height=2.5cm] (W1) {${\bf W_1}\times$};
\node[rectangle, draw, right=1.5em of W1, text depth=0em, minimum width=0.5cm,minimum height=2.5cm] (B1) {$+ \vec{b}_1$};
\node[rectangle, draw, right=1.5em of B1, text depth=0em, minimum width=1.5cm,minimum height=2.5cm] (RL) {
\begin{tikzpicture}
\draw[thick] (0,0) -- (0.5, 0);
\draw[thick] (0.49,-0.004) -- (0.99, 0.496);
\end{tikzpicture}
};
\node[rectangle, draw, right=1.5em of RL, text depth=0em, minimum width=1.5cm,minimum height=2.5cm] (W) {${\bf W_2}\times$};
\node[rectangle, draw, right=1.5em of W, text depth=0em, minimum width=0.5cm,minimum height=1.5cm] (B) {$+ \vec{b}_2$};
\node[right=1.5em of B, inner sep=0em] (out) {
\begin{tikzpicture}
\node[rectangle, draw, rotate=90, minimum height=0.5cm, minimum width=1.5cm] (out) {softmax};
\end{tikzpicture}
};
\node[right=1.5em of out] (outt) {};
\foreach \x in {1,...,3}
\draw[stateTransition] ([yshift=\x em]X.east) -- ([yshift=\x em]W1.west);
\foreach \x in {1,...,3}
\draw[stateTransition] ([yshift=-\x em]X.east) -- ([yshift=-\x em]W1.west);
\draw[-stealth, thick] (X) -- (W1);
\foreach \x in {1,...,3}
\draw[stateTransition] ([yshift=\x em]W1.east) -- ([yshift=\x em]B1.west);
\foreach \x in {1,...,3}
\draw[stateTransition] ([yshift=-\x em]W1.east) -- ([yshift=-\x em]B1.west);
\draw[-stealth, thick] (W1) -- (B1);
\foreach \x in {1,...,3}
\draw[stateTransition] ([yshift=\x em]B1.east) -- ([yshift=\x em]RL.west);
\foreach \x in {1,...,3}
\draw[stateTransition] ([yshift=-\x em]B1.east) -- ([yshift=-\x em]RL.west);
\draw[-stealth, thick] (B1) -- (RL);
\foreach \x in {1,...,3}
\draw[stateTransition] ([yshift=\x em]RL.east) -- ([yshift=\x em]W.west);
\foreach \x in {1,...,3}
\draw[stateTransition] ([yshift=-\x em]RL.east) -- ([yshift=-\x em]W.west);
\draw[-stealth, thick] (RL) -- (W);
\foreach \x in {-1.5, -0.5, 0.5, 1.5}
\draw[stateTransition] ([yshift=\x em]W.east) -- ([yshift=\x em]B.west);
\foreach \x in {-1.5, -0.5, 0.5, 1.5}
\draw[stateTransition] ([yshift=\x em]B.east) -- ([yshift=\x em]out.west);
\foreach \x in {-1.5, -0.5, 0.5, 1.5}
\draw[stateTransition] ([yshift=\x em]out.east) -- ([yshift=\x em]outt.west);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{amsmath}
\usetikzlibrary{decorations.pathmorphing, positioning}
\definecolor{echoreg}{HTML}{2cb1e1}
\definecolor{echodrk}{HTML}{0099cc}
\tikzstyle{mybox} = [text=black, very thick,
rectangle, rounded corners, inner sep=10pt, inner ysep=20pt]
\tikzstyle{fancytitle} =[text=black]
\newcommand{\yslant}{0.5}
\newcommand{\xslant}{-0.6}
\newcommand\overmat[3]{%
\makebox[0pt][l]{$\smash{\color{#3}\overbrace{\phantom{%
\begin{matrix}#2\end{matrix}}}^{\text{#1}}}$}#2}
\newcommand\undermat[3]{%
\makebox[0pt][l]{$\smash{\color{#3}\underbrace{\phantom{%
\begin{matrix}#2\end{matrix}}}_{\text{#1}}}$}#2}
\newcommand\partialphantom{\vphantom{\frac{\partial e_{P,M}}{\partial w_{1,1}}}}
\begin{document}
\begin{tikzpicture}[scale=0.58,every node/.style={minimum size=1cm},on grid]
\node [mybox, scale=1.0] at (10.5, 2) (box){%
\begin{minipage}{0.6\textwidth}
\[ {\mathbf M} = {\left[
\begin{matrix}
\left[\overmat{\textcolor{red}Layer 1}{
\begin{matrix}
1 & 0 & 0\\
1 & 0 & 1\\
1 & 0 & 0\\
\end{matrix}}{red}\right] & \left[\overmat{1 $\rightarrow$ 2}{
\begin{matrix}
1 & 0 & 0\\
0 & 1 & 0\\
0 & 0 & 0\\
\end{matrix}}{gray}\right]\\
\left[\undermat{2 $\rightarrow$ 1}{
\begin{matrix}
0 & 0 & 0\\
1 & 0 & 0\\
0 & 0 & 0\\
\end{matrix}}{gray}\right] & \left[\undermat{\textcolor{echodrk}Layer 2}{
\begin{matrix}
0 & 1 & 1\\
1 & 0 & 0\\
1 & 0 & 0\\
\end{matrix}}{echodrk}\right]\\
\end{matrix}\right]}\]
\end{minipage}
};
\node[fancytitle, scale=0.8] at (box.north) {\bf Tensor form:};
% Layer 2
\begin{scope}[
yshift=-120,
every node/.append style={yslant=\yslant,xslant=\xslant},
yslant=\yslant,xslant=\xslant
]
\draw[black, dashed, thin] (0,0) rectangle (7,7);
\draw[fill=echoreg]
(5,2) node(111){} circle (.1)
(2,2) circle (.1)
(3.5,5) circle (.1);
\draw[-latex, thin, color=echodrk]
(3.55,4.85) to (4.85,2.05);
\draw[-latex, thin, color=echodrk]
(4.95,2.15) to (3.65,4.95);
\draw[-latex, thin, color=echodrk]
(2.15,1.92) to (4.85,1.92);
\draw[-latex, thin, color=echodrk]
(4.85,2.05) to (2.15,2.05);
\fill[black]
(0.5,6.5) node[right, scale=.7] {Layer 2}
(5.1,1.9) node[right,scale=.7]{\bf A}
(1.9,1.9) node[left,scale=.7]{\bf B}
(3.5,5.1) node[above,scale=.7]{\bf C};
\end{scope}
% Interlayer crossconnections
\draw[thick, -latex, decoration={snake, segment length=2mm, amplitude=0.2mm}, decorate] (3.8, 4) to (3.8, -0.32);
\draw[thick, -latex, decoration={snake, segment length=2mm, amplitude=0.2mm}, decorate] (.8,2.4) to (.8,-1.8);
\draw[thick, -latex, decoration={snake, segment length=2mm, amplitude=0.2mm}, decorate] (.8, -1.8) to (3.81, 4);
% Layer 1
\begin{scope}[
yshift=0,
every node/.append style={yslant=\yslant,xslant=\xslant},
yslant=\yslant,xslant=\xslant
]
\fill[white,fill opacity=.75] (0,0) rectangle (7,7);
\draw[black, dashed, thin] (0,0) rectangle (7,7);
\draw [fill=red]
(5,2) node(111){} circle (.1)
(2,2) circle (.1)
(3.5,5) circle (.1);
\draw[-latex, thin, color=red]
(3.6,4.9) to (4.9,2.1);
\draw[-latex, thin, color=red]
(2.15,2) to (4.85,2);
\draw[-latex, thin, color=red]
(2.1,2.1) to (3.4,4.9);
\draw[-latex, thin, color=red]
(5.1,2.15) to[bend left=90] (6.3, 2) to[bend left=70] (5.1, 1.85);
\fill[black]
(0.5,6.5) node[right, scale=.7] {Layer 1}
(5.1,1.9) node[right,scale=.7]{\bf A}
(1.9,1.9) node[left,scale=.7]{\bf B}
(3.5,5.1) node[above,scale=.7]{\bf C};
\end{scope}
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning, shapes}
\begin{document}
\begin{tikzpicture}
\node (1) [draw, minimum width=15em, minimum height=2em, very thick, rounded rectangle] {};
\node (l1) [left=0em of 1] {$\vec{x}$};
\node (2) [above=3.9em of 1, draw, fill=lightgray, minimum width=9em,very thick, minimum height=2em, rounded rectangle] {};
\node (l2) [left=0em of 2] {$\vec{h}_1$};
\node (3) [above=3.9em of 2, draw, fill=lightgray, minimum width=9em,very thick, minimum height=2em, rounded rectangle] {};
\node (l3) [left=0em of 3] {$\vec{h}_2$};
\node[circle, draw, thick] (A1) {};
\node[circle, draw, thick, right=0.5em of A1] (A2) {};
\node[circle, draw, thick, right=0.5em of A2] (A3) {};
\node[circle, draw, thick, right=0.5em of A3] (A4) {};
\node[circle, draw, thick, right=0.5em of A4] (A5) {};
\node[circle, draw, thick, left=0.5em of A1] (A6) {};
\node[circle, draw, thick, left=0.5em of A6] (A7) {};
\node[circle, draw, thick, left=0.5em of A7] (A8) {};
\node[circle, draw, thick, left=0.5em of A8] (A9) {};
\node[circle, draw, fill=white, thick, above=5em of A1] (B1) {};
\node[circle, draw, fill=white, thick, right=0.5em of B1] (B2) {};
\node[circle, draw, fill=white, thick, right=0.5em of B2] (B3) {};
\node[circle, draw, fill=white, thick, left=0.5em of B1] (B4) {};
\node[circle, draw, fill=white, thick, left=0.5em of B4] (B5) {};
\node[circle, draw, fill=white, thick, above=5em of A1] (B1) {};
\node[circle, draw, fill=white, thick, right=0.5em of B1] (B2) {};
\node[circle, draw, fill=white, thick, right=0.5em of B2] (B3) {};
\node[circle, draw, fill=white, thick, left=0.5em of B1] (B4) {};
\node[circle, draw, fill=white, thick, left=0.5em of B4] (B5) {};
\node[circle, draw, fill=white, thick, above=5em of A1] (B1) {};
\node[circle, draw, fill=white, thick, right=0.5em of B1] (B2) {};
\node[circle, draw, fill=white, thick, right=0.5em of B2] (B3) {};
\node[circle, draw, fill=white, thick, left=0.5em of B1] (B4) {};
\node[circle, draw, fill=white, thick, left=0.5em of B4] (B5) {};
\node[circle, draw, fill=white, thick, above=5em of B1] (C1) {};
\node[circle, draw, fill=white, thick, right=0.5em of C1] (C2) {};
\node[circle, draw, fill=white, thick, right=0.5em of C2] (C3) {};
\node[circle, draw, fill=white, thick, left=0.5em of C1] (C4) {};
\node[circle, draw, fill=white, thick, left=0.5em of C4] (C5) {};
\foreach \x in {1,...,9}
\foreach \y in {1,...,5}
\draw[-stealth, thick] (A\x) -- (B\y);
\foreach \x in {1,...,5}
\foreach \y in {1,...,5}
\draw[stealth-stealth, thick] (B\x) -- (C\y);
\draw[-stealth, thick] (A5) -- node[right] {${\bf W}_1$} (B3);
\draw[stealth-stealth, thick] (B3) -- node[right] {${\bf W}_2$} (C3);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{amsmath}
\usepackage{amssymb}
\usetikzlibrary{positioning, decorations.pathmorphing, shapes}
\begin{document}
\begin{tikzpicture}
\node[rounded rectangle, draw, thick, align=center] (A1) {Agent 1\\$(\theta_1', \psi_1')$};
\node[rounded rectangle, draw, thick, right= of A1, align=center] (A2) {Agent 2\\$(\theta_2', \psi_2')$};
\node[rounded rectangle, draw, thick, right= of A2, align=center] (A3) {Agent 3\\$(\theta_3', \psi_3')$};
\node[right=0.4em of A3, align=center] (mid) {\dots};
\node[rounded rectangle, draw, thick, right= of A3, align=center] (AN) {Agent $n$\\$(\theta_n', \psi_n')$};
\node[rounded rectangle, draw, thick, yshift=8em, xshift=11.9em, align=center] (G) {Global state\\$(\theta, \psi)$};
\node[rounded rectangle, draw, thick, below= of A1, align=center] (E1) {Env. 1\\$(\mathcal{T}, \mathcal{R})$};
\node[rounded rectangle, draw, thick, below= of A2, align=center] (E2) {Env. 2\\$(\mathcal{T}, \mathcal{R})$};
\node[rounded rectangle, draw, thick, below= of A3, align=center] (E3) {Env. 3\\$(\mathcal{T}, \mathcal{R})$};
\node[rounded rectangle, draw, thick, below= of AN, align=center] (EN) {Env. $n$\\$(\mathcal{T}, \mathcal{R})$};
\draw[-stealth, very thick] (G) -- node[above=0.5em] {copy} (A1);
\foreach \x in {2,3,N}
\draw[-stealth, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,very thick] ([xshift=-0.5em]A\x.south) -- node[left] {$a_t$} ([xshift=-0.5em]E\x.north);
\foreach \x in {2,3,N}
\draw[-stealth, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,very thick] ([xshift=0.5em]E\x.north) -- node[right] {$r_t, s_{t+1}$} ([xshift=0.5em]A\x.south);
\draw[-stealth, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,very thick] (E1.north) -- node[right] {$s_0$} (A1.south);
\node[rectangle split,
minimum height=0.7cm,
rectangle split horizontal,
rectangle split parts=8,
draw,
anchor=center,
left=2em of G,
rectangle split part fill={white,white,white,white,white,white,white,gray}]
(q1) {};
\node[above=0.1em of q1] (N) {Queue};
\draw[-stealth, very thick] (A1) -- node[left] {$(\Delta\theta, \Delta\psi)$} (q1);
\draw[-stealth, very thick] (q1) -- node[above, xshift=-1em] {$+$} ([xshift=2.3em,yshift=-0.5em]G.west);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{pgfplots}
\usetikzlibrary{automata, positioning}
\begin{document}
\begin{tikzpicture}[-stealth,very thick,node distance = 4cm,auto]
\node[state] (x) {$x$};
\node[state] (y) [above right of=x] {$y$};
\node[state] (z) [below right of=y] {$z$};
\node[rectangle, minimum size=2em,draw] (a) [above left =of y] {$a$};
\node[rectangle,minimum size=2em, draw] (b) [above = of y] {$b$};
\node[rectangle, minimum size=2em,draw] (c) [above right =of y] {$c$};
\draw[] (x) to node[above left] {$1$} (y);
\draw[loop above] (y) to node {$0.5$} (y);
\draw[bend left=20] (y) to node {$0.5$} (z);
\draw[bend left=20] (z) to node[below left] {$0.7$} (y);
\draw[] (z) to node {$0.3$} (x);
\draw[dashed] (x) to node[left] {$0.9$} (a);
\draw[dashed] (x) to node[left] {$0.1$} (b);
\draw[bend right=30, dashed] (y) to node[right] {$0.6$} (b);
\draw[dashed] (y) to node[below right] {$0.4$} (c);
\draw[dashed] (z) to node[right] {$1$} (c);
\node[rectangle, draw, scale=0.2, minimum size=20em,above = 2cm of a] (ga){\begin{tikzpicture}
\begin{axis}[axis lines=none, ticks=none,xmax=3, xmin=-3,ymax=1.1]
\addplot[ultra thick,black, no markers,samples=200] {exp(-x^2)};
\end{axis}
\end{tikzpicture}};
\node[rectangle, draw, scale=0.2, minimum size=20em,above = 2cm of b] (gb){\begin{tikzpicture}
\begin{axis}[axis lines=none, ticks=none,xmax=3, xmin=-3,ymax=1.1]
\addplot[ultra thick,black, no markers,samples=200] {exp(-x^2)};
\end{axis}
\end{tikzpicture}};
\node[rectangle, draw, scale=0.2, minimum size=20em,above = 2cm of c] (gc){\begin{tikzpicture}
\begin{axis}[axis lines=none, ticks=none,xmax=3, xmin=-3,ymax=1.1]
\addplot[ultra thick,black, no markers,samples=200] {exp(-x^2)};
\end{axis}
\end{tikzpicture}};
\draw[dotted, bend left] (a) to node[left] {$\mu_a$} (ga);
\draw[dotted, bend right] (a) to node[right] {$\sigma_a$} (ga);
\draw[dotted, bend left] (b) to node[left] {$\mu_b$} (gb);
\draw[dotted, bend right] (b) to node[right] {$\sigma_b$} (gb);
\draw[dotted, bend left] (c) to node[left] {$\mu_c$} (gc);
\draw[dotted, bend right] (c) to node[right] {$\sigma_c$} (gc);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{tkz-graph}
\begin{document}
\begin{tikzpicture}[scale=0.8,every node/.style={scale=0.7},font=\tt]
\SetUpEdge[lw = 1.5pt,
color = red,
labelcolor = white]
\GraphInit[vstyle=Normal]
\SetGraphUnit{3}
\tikzset{VertexStyle/.append style={fill}}
\Vertex{ATG}
\EA(ATG){TGG}
\EA(TGG){GGC}
\SO(GGC){GCG}
\WE(GCG){CGT}
\WE(CGT){GTG}
\WE(GTG){TGC}
\WE(TGC){GCA}
\NO(GCA){CAA}
\EA(CAA){AAT}
\tikzset{EdgeStyle/.style={-stealth, color=black}}
\Edge(ATG)(TGC)
\Edge(GTG)(TGG)
\Edge(GGC)(GCA)
\tikzset{EdgeStyle/.style={-stealth, color=black, bend right}}
\Edge(TGC)(GCG)
\tikzset{EdgeStyle/.style={-stealth}}
\Edge(ATG)(TGG)
\Edge(TGG)(GGC)
\Edge(GGC)(GCG)
\Edge(GCG)(CGT)
\Edge(CGT)(GTG)
\Edge(GTG)(TGC)
\Edge(TGC)(GCA)
\Edge(GCA)(CAA)
\Edge(CAA)(AAT)
\Edge(AAT)(ATG)
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop,tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\node[circle, draw, thick] (z) {$\vec{a}_{real}$};
\node[circle, draw, thick, right=5em of z] (x) {$\vec{b}_{fake}$};
\draw[-stealth, thick] (z) -- node[above] {$G_{AB}(\vec{a})$} node[below, align=center] {generator\\ ($A\rightarrow B$)} (x);
\node[circle, draw, thick, right=5em of x] (xx) {$\vec{a}_{rec}$};
\draw[-stealth, thick] (x) -- node[above] {$G_{BA}(\vec{b})$} node[below, align=center] {generator\\ ($B\rightarrow A$)} (xx);
\node[left=5em of z] (i) {};
\draw[-stealth, thick] (i) -- node[above] {real data} node[below] {(type A)} (z);
\node[circle, draw, thick, right=2em of x, yshift=7.5em] (D) {$\vec{b}$};
\node[right=7em of D] (out) {real?};
\draw[-stealth, thick] (D) -- node[above] {$D_B(\vec{b})$} node[below,align=center] {discriminator\\ (type B)} (out);
\node[yshift=5em, circle, fill, inner sep=0.15em] at (x) (pt1) {};
\node[above=of x, yshift=6.4em, circle, fill, inner sep=0.15em] (pt2) {};
\node[left=2.5em of pt2, circle, draw, thick] (xt) {$\vec{b}_{real}$};
\node[left=5em of xt] (it) {};
\draw[-stealth, thick] (it) -- node[above] {real data} node[below] {(type B)} (xt);
\draw[dashed, thick] (pt1) edge[bend left] (pt2);
\node[circle, draw, thick, fill=white, inner sep=0.15em] at ([xshift=-0.83em, yshift=4em]pt1.north) (pt3) {};
\draw[-stealth, thick] (x) -- (pt1);
\draw[-stealth, thick] (xt) -- (pt2);
\draw[-stealth, thick] (pt3) -- (D);
\draw[dashed, thick, stealth-stealth] (z.south) -- ([yshift=-1.5em]z.south) -- ([yshift=-1.6em]xx.south) -- (xx.south);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\node (X1) {$\vec{e}_{1}$};
\node[rectangle, right= 0.5em of X1] (x_dots_1) {$\dots$};
\node[right=0.5em of x_dots_1] (Xj) {$\vec{e}_{j}$};
\node[rectangle, right= 1em of Xj] (x_dots_2) {$\dots$};
\node[right=1em of x_dots_2] (Xn) {$\vec{e}_{n}$};
\node[rectangle, draw, ultra thick, above=of X1] (attn1) {\large $a_\phi$};
\node[rectangle, draw, ultra thick, above=of Xj] (attnj) {\large $a_\phi$};
\node[rectangle, draw, ultra thick, above=of Xn] (attnn) {\large $a_\phi$};
\draw[-stealth, thick] (X1) -- (attn1);
\draw[-stealth, thick] (Xj) -- (attn1);
\draw[-stealth, thick] (Xj) -- (attnj);
\draw[-stealth, thick] ([xshift=3em]Xj) -- (attnj);
\draw[-stealth, thick] (Xj) -- (attnn);
\draw[-stealth, thick] (Xn) -- (attnn);
\node[above= of attn1, opacity=0.2] (alpha1j) {$\alpha_{1,j}$};
\node[above= of attnj, opacity=1] (alphajj) {$\alpha_{j,j}$};
\node[above= of attnn, opacity=0.6] (alphanj) {$\alpha_{n,j}$};
\node[circle, draw, above=of alpha1j] (times1) {$\times$};
\node[circle, draw, above=of alphajj] (timesj) {$\times$};
\node[circle, draw, above=of alphanj] (timesn) {$\times$};
\node[rectangle, draw, above=of timesj] (sum) {$\Sigma$};
\node[above=1em of sum] (x_tprim) {$\vec{e}_j'$};
\draw[-stealth, line width=1.5mm, white] (attn1) -- (alpha1j);
\draw[-stealth, thick, opacity=0.2] (attn1) -- (alpha1j);
\draw[-stealth, line width=1.5mm, white] (attnj) -- (alphajj);
\draw[-stealth, thick, opacity=1] (attnj) -- (alphajj);
\draw[-stealth, line width=1.5mm, white] (attnn) -- (alphanj);
\draw[-stealth, thick, opacity=0.6] (attnn) -- (alphanj);
\draw[-stealth, white, line width=1.5mm] (X1) edge[bend right=30] (times1);
\draw[-stealth, thick] (X1) edge[bend right=30] node[rectangle, draw, fill=white, midway] {$f_\psi$} (times1);
\draw[-stealth, white, line width=1.5mm] (Xj) edge[bend right=30] (timesj);
\draw[-stealth, thick] (Xj) edge[bend right=30] node[rectangle, draw, fill=white, midway] {$f_\psi$} (timesj);
\draw[-stealth, thick] (Xn) edge[bend right=30] node[rectangle, draw, fill=white, midway] {$f_\psi$} (timesn);
\draw[-, line width=1.5mm, white] (times1) -- (sum);
\draw[-stealth, thick] (times1) -- (sum);
\draw[-, line width=1.5mm, white] (timesj) -- (sum);
\draw[-stealth, thick] (timesj) -- (sum);
\draw[-stealth, thick] (timesn) -- (sum);
\draw[-stealth, thick] (times1) -- (sum);
\draw[-stealth, line width=1.5mm, white] (alpha1j) -- (times1);
\draw[-stealth, thick, opacity=0.2] (alpha1j) -- (times1);
\draw[-stealth, line width=1.5mm, white] (alphajj) -- (timesj);
\draw[-stealth, thick, opacity=1] (alphajj) -- (timesj);
\draw[-stealth, line width=1.5mm, white] (alphanj) -- (timesn);
\draw[-stealth, thick, opacity=0.6] (alphanj) -- (timesn);
\draw[-stealth, thick] (sum) -- (x_tprim);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{bm}
\usepackage{relsize}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\node[circle, draw, thick] (i1) {};
\node[circle, draw, thick, above=2em of i1] (i2) {};
\node[circle, draw, thick, above=2em of i2] (i3) {};
\node[circle, draw, thick, below=2em of i1] (i4) {};
\node[circle, draw, thick, below=2em of i4] (i5) {};
\node[circle, draw, thick, right=4em of i1] (h1) {};
\node[circle, draw, thick, right=4em of i2] (h2) {};
\node[circle, draw, thick, right=4em of i3] (h3) {};
\node[circle, draw, thick, right=4em of i4] (h4) {};
\node[circle, draw, thick, right=4em of i5] (h5) {};
\node[circle, draw, thick, right=4em of h1] (hh1) {};
\node[circle, draw, thick, right=4em of h2] (hh2) {};
\node[circle, draw, thick, right=4em of h3] (hh3) {};
\node[circle, draw, thick, right=4em of h4] (hh4) {};
\node[circle, draw, thick, right=4em of h5] (hh5) {};
\node[circle, draw, thick, right=4em of hh2] (o1) {};
\node[circle, draw, thick, right=4em of hh4] (o2) {};
\draw[-stealth, thick] (i1) -- (h1);
\draw[-stealth, thick] (i1) -- (h2);
\draw[-stealth, thick] (i1) -- (h3);
\draw[-stealth, thick] (i1) -- (h4);
\draw[-stealth, thick] (i1) -- (h5);
\draw[-stealth, thick] (i2) -- (h1);
\draw[-stealth, thick] (i2) -- (h2);
\draw[-stealth, thick] (i2) -- (h3);
\draw[-stealth, thick] (i2) -- (h4);
\draw[-stealth, thick] (i2) -- (h5);
\draw[-stealth, thick] (i3) -- (h1);
\draw[-stealth, thick] (i3) -- (h2);
\draw[-stealth, thick] (i3) -- (h3);
\draw[-stealth, thick] (i3) -- (h4);
\draw[-stealth, thick] (i3) -- (h5);
\draw[-stealth, thick] (i4) -- (h1);
\draw[-stealth, thick] (i4) -- (h2);
\draw[-stealth, thick] (i4) -- (h3);
\draw[-stealth, thick] (i4) -- (h4);
\draw[-stealth, thick] (i4) -- (h5);
\draw[-stealth, thick] (i5) -- (h1);
\draw[-stealth, thick] (i5) -- (h2);
\draw[-stealth, thick] (i5) -- (h3);
\draw[-stealth, thick] (i5) -- (h4);
\draw[-stealth, thick] (i5) -- (h5);
\draw[-stealth, thick] (h1) -- (hh1);
\draw[-stealth, thick] (h1) -- (hh2);
\draw[-stealth, thick] (h1) -- (hh3);
\draw[-stealth, thick] (h1) -- (hh4);
\draw[-stealth, thick] (h1) -- (hh5);
\draw[-stealth, thick] (h2) -- (hh1);
\draw[-stealth, thick] (h2) -- (hh2);
\draw[-stealth, thick] (h2) -- (hh3);
\draw[-stealth, thick] (h2) -- (hh4);
\draw[-stealth, thick] (h2) -- (hh5);
\draw[-stealth, thick] (h3) -- (hh1);
\draw[-stealth, thick] (h3) -- (hh2);
\draw[-stealth, thick] (h3) -- (hh3);
\draw[-stealth, thick] (h3) -- (hh4);
\draw[-stealth, thick] (h3) -- (hh5);
\draw[-stealth, thick] (h4) -- (hh1);
\draw[-stealth, thick] (h4) -- (hh2);
\draw[-stealth, thick] (h4) -- (hh3);
\draw[-stealth, thick] (h4) -- (hh4);
\draw[-stealth, thick] (h4) -- (hh5);
\draw[-stealth, thick] (h5) -- (hh1);
\draw[-stealth, thick] (h5) -- (hh2);
\draw[-stealth, thick] (h5) -- (hh3);
\draw[-stealth, thick] (h5) -- (hh4);
\draw[-stealth, thick] (h5) -- (hh5);
\draw[-stealth, thick] (hh1) -- (o1);
\draw[-stealth, thick] (hh1) -- (o2);
\draw[-stealth, thick] (hh2) -- (o1);
\draw[-stealth, thick] (hh2) -- (o2);
\draw[-stealth, thick] (hh3) -- (o1);
\draw[-stealth, thick] (hh3) -- (o2);
\draw[-stealth, thick] (hh4) -- (o1);
\draw[-stealth, thick] (hh4) -- (o2);
\draw[-stealth, thick] (hh5) -- (o1);
\draw[-stealth, thick] (hh5) -- (o2);
\draw[-stealth, double, dashed, thick] (5.5,0) -- node[above] {dropout} (8.6, 0);
%%% BOUNDARY %%%
\node[circle, draw, thick, red, fill=red!10, right=15em of hh1] (i1) {};
\node[circle, draw, thick, red, fill=red!10, above=2em of i1] (i2) {};
\node[circle, draw, thick, above=2em of i2] (i3) {};
\node[circle, draw, thick, below=2em of i1] (i4) {};
\node[circle, draw, thick, below=2em of i4] (i5) {};
\node[red] (icr) at (i1) {$\mathlarger{\mathlarger{\mathlarger{\mathlarger{\mathlarger{\bm{\times}}}}}}$};
\node[red] (icr) at (i2) {$\mathlarger{\mathlarger{\mathlarger{\mathlarger{\mathlarger{\bm{\times}}}}}}$};
\node[circle, draw, thick, red, fill=red!10, right=4em of i1] (h1) {};
\node[circle, draw, thick, right=4em of i2] (h2) {};
\node[circle, draw, thick, red, fill=red!10, right=4em of i3] (h3) {};
\node[circle, draw, thick, red, fill=red!10, right=4em of i4] (h4) {};
\node[circle, draw, thick, right=4em of i5] (h5) {};
\node[red] (icr) at (h1) {$\mathlarger{\mathlarger{\mathlarger{\mathlarger{\mathlarger{\bm{\times}}}}}}$};
\node[red] (icr) at (h3) {$\mathlarger{\mathlarger{\mathlarger{\mathlarger{\mathlarger{\bm{\times}}}}}}$};
\node[red] (icr) at (h4) {$\mathlarger{\mathlarger{\mathlarger{\mathlarger{\mathlarger{\bm{\times}}}}}}$};
\node[circle, draw, thick, right=4em of h1] (hh1) {};
\node[circle, draw, thick, red, fill=red!10, right=4em of h2] (hh2) {};
\node[circle, draw, thick, right=4em of h3] (hh3) {};
\node[circle, draw, thick, red, fill=red!10, right=4em of h4] (hh4) {};
\node[circle, draw, thick, right=4em of h5] (hh5) {};
\node[red] (icr) at (hh2) {$\mathlarger{\mathlarger{\mathlarger{\mathlarger{\mathlarger{\bm{\times}}}}}}$};
\node[red] (icr) at (hh4) {$\mathlarger{\mathlarger{\mathlarger{\mathlarger{\mathlarger{\bm{\times}}}}}}$};
\node[circle, draw, thick, right=4em of hh2] (o1) {};
\node[circle, draw, thick, right=4em of hh4] (o2) {};
\draw[-stealth, thick] (i3) -- (h2);
\draw[-stealth, thick] (i3) -- (h5);
\draw[-stealth, thick] (i4) -- (h2);
\draw[-stealth, thick] (i4) -- (h5);
\draw[-stealth, thick] (i5) -- (h2);
\draw[-stealth, thick] (i5) -- (h5);
\draw[-stealth, thick] (h2) -- (hh1);
\draw[-stealth, thick] (h2) -- (hh3);
\draw[-stealth, thick] (h2) -- (hh5);
\draw[-stealth, thick] (h5) -- (hh1);
\draw[-stealth, thick] (h5) -- (hh3);
\draw[-stealth, thick] (h5) -- (hh5);
\draw[-stealth, thick] (hh1) -- (o1);
\draw[-stealth, thick] (hh1) -- (o2);
\draw[-stealth, thick] (hh3) -- (o1);
\draw[-stealth, thick] (hh3) -- (o2);
\draw[-stealth, thick] (hh5) -- (o1);
\draw[-stealth, thick] (hh5) -- (o2);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning,decorations.pathmorphing}
\begin{document}
\begin{tikzpicture}
\node[circle, thick, draw] (0) {$\vec{x}_i$};
\node[circle, thick, draw, above right=0.1em and 3em of 0] (1) {};
\node[circle, thick, draw, above right=0.8em and 0.5em of 0] (2) {};
\node[circle, thick, draw, left=of 0] (3) {};
\node[circle, thick, draw, below left=0.8em and 1.5em of 0] (4) {};
\draw[-, thick] (0) -- (1);
\draw[-, thick] (0) -- (2);
\draw[-, thick] (0) -- (3);
\draw[-, thick] (4) -- (3);
\node[circle, thick, draw, below=3em of 0] (01) {$\vec{\widetilde{x}}_j$};
\node[circle, thick, draw, above right=0.1em and 2em of 01] (02) {};
\node[circle, thick, draw, below left=0.2em and 3em of 01] (03) {};
\node[circle, thick, draw, below right=0.8em and 0.5em of 01] (04) {};
\node[circle, thick, draw, below right=0.8em and 3.3em of 01] (05) {};
\node[rectangle, draw, dashed, minimum width=11em, minimum height=5.5em] (RR) {};
\node[rectangle, draw, dashed, minimum width=11em, minimum height=5.5em, below=0.05em of RR] (RR2) {};
\node[above=0em of RR] (l1) {$({\bf X}, {\bf A})$};
\node[below=0em of RR2] (l2) {$({\bf \widetilde{X}}, {\bf \widetilde{A}})$};
\draw[-, thick] (01) -- (02);
\draw[-, thick] (01) -- (03);
\draw[-, thick] (01) -- (04);
\draw[-, thick] (01) -- (05);
\draw[-, thick] (04) -- (05);
\node[rectangle, draw, dashed, minimum width=11em, minimum height=5.5em, right=12.5em of 0] (AA) {};
\node[circle, thick, draw, right=17em of 0] (0) {$\vec{h}_i$};
\node[circle, thick, draw, above right=0.1em and 3em of 0] (1) {};
\node[circle, thick, draw, above right= 0.8em and 0.5em of 0] (2) {};
\node[circle, thick, draw, left=of 0] (3) {};
\node[circle, thick, draw, below left=0.8em and 1.5em of 0] (4) {};
\draw[-, thick] (0) -- (1);
\draw[-, thick] (0) -- (2);
\draw[-, thick] (0) -- (3);
\draw[-, thick] (4) -- (3);
\node[circle, thick, draw, below=2.7em of 0] (01) {$\vec{\widetilde{h}}_j$};
\node[circle, thick, draw, above right=0.1em and 2emof 01] (02) {};
\node[circle, thick, draw, below left=0.2em and 3em of 01] (03) {};
\node[circle, thick, draw, below right=0.8em and 0.3em of 01] (04) {};
\node[circle, thick, draw, below right=0.8em and 3.1em of 01] (05) {};
\node[rectangle, draw, minimum width=11em, minimum height=5.5em, dashed, below=0.05em of AA] (AA2) {};
\node[above=0em of AA] (l1) {$({\bf H}, {\bf A})$};
\node[below=0em of AA2] (l2) {$({\bf \widetilde{H}}, {\bf \widetilde{A}})$};
\draw[-, thick] (01) -- (02);
\draw[-, thick] (01) -- (03);
\draw[-, thick] (01) -- (04);
\draw[-, thick] (01) -- (05);
\draw[-, thick] (04) -- (05);
\draw[-stealth, very thick, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,] (RR) -- node[above] {$\mathcal{E}$} (AA);
\draw[very thick] (RR.west) edge[bend right=75, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,-stealth] node[left] (CC) {$\mathcal{C}$} (RR2.west);
\draw[-stealth, very thick, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,] (RR2) -- node[above] {$\mathcal{E}$} (AA2);
\node[right=36em of CC, rectangle, draw, thick] (Re) {$\vec{s}$};
\draw[-stealth, very thick, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,] (AA) -- node[above] {$\mathcal{R}$} (Re);
\node[above=1.5em of Re] (D1) {$\mathcal{D}$};
\node[below=1.5em of Re] (D2) {$\mathcal{D}$};
\draw[-stealth, thick] (Re) -- (D1);
\draw[-stealth, thick] (Re) -- (D2);
\draw[-stealth, thick] (0) -- (D1);
\draw[-stealth, thick] (01.-11) -- (D2);
\node[right=of D1] (P) {$+$};
\node[right=of D2] (M) {$-$};
\draw[-stealth, very thick, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,] (D1) -- (P);
\draw[-stealth, very thick, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,] (D2) -- (M);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning, matrix}
\tikzset{
tablet/.style={
matrix of nodes,
row sep=-\pgflinewidth,
column sep=-\pgflinewidth,
nodes={rectangle,draw=black,text width=1.25ex,align=center},
text height=1.25ex,
nodes in empty cells
},
texto/.style={font=\footnotesize\sffamily},
title/.style={font=\small\sffamily}
}
\definecolor{dgry}{HTML}{555555}
\definecolor{lgry}{HTML}{aaaaaa}
\begin{document}
\begin{tikzpicture}
\matrix[tablet] (mp)
{
{\tt 0} & {\tt 1} & {\tt 0} & {\tt 0} & {\tt 1} & {\tt 1} & {\tt 1} & {\tt 0}\\
\node (00){\tt 1}; & \node(01){\tt 0}; & \node(02){\tt 0}; & \node(03){\tt 0}; & \node(04){\tt 1}; & \node(05){\tt 0}; & \node(06){\tt 1}; & \node(07){\tt 1};\\
};
\matrix[tablet, below = of mp] (pt)
{
\node (10){\tt 2}; & \node(11){\tt 1}; & \node(12){\tt 0}; & \node(13){\tt 0}; & \node(14){\tt 3}; & \node(15){\tt 1}; & \node(16){\tt 3}; & \node(17){\tt 2};\\
};
\matrix[tablet, draw=black, inner sep=0ex, nodes={draw=white,inner sep=0.8ex}, below = of pt] (clr)
{
|[fill=dgry]| & |[fill=lgry]| & |[fill=white]| & |[fill=white]| & |[fill=black]| & |[fill=lgry]| & |[fill=black]| & |[fill=dgry]|\\
};
\node [align=center, right = 0.05cm of mp] (c1) {Byte 1 \\ Byte 2};
\node [align=center, right = 0.05cm of pt] (c2) {Colour indices};
\node [align=center, right = 0.05cm of clr] (c3) {Tile row};
\draw [-stealth, thick] (00) -- (10) ;
\draw [-stealth, thick] (01) -- (11) ;
\draw [-stealth, thick] (02) -- (12) ;
\draw [-stealth, thick] (03) -- (13) ;
\draw [-stealth, thick] (04) -- (14) ;
\draw [-stealth, thick] (05) -- (15) ;
\draw [-stealth, thick] (06) -- (16) ;
\draw [-stealth, thick] (07) -- (17) ;
\draw [-stealth, double, thick] (13.south east) -- node[right] {\emph{palette}} (clr);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\node[circle, thick, draw] (0) {$d_0$};
\node[circle, thick, draw, below = 4.5em of 0] (1) {$d_1$};
\node[circle, thick, draw, right = 4.5em of 0] (2) {$d_2$};
\node[circle, thick, draw, right = 4.5em of 2] (3) {$d_3$};
\node[circle, thick, draw, right = 4.5em of 3] (6) {$d_6$};
\node[circle, thick, draw, above = 4.5em of 6] (5) {$d_5$};
\node[circle, thick, draw, below = 4.5em of 6] (4) {$d_4$};
\path[-stealth, very thick] (0) edge [bend right=45] (2);
\path[-stealth, very thick] (2) edge [bend right=45] (0);
\path[-stealth, very thick] (1) edge [bend right] (2);
\path[-stealth, very thick] (1) edge [->, >=stealth, loop left] (1);
\path[-stealth, very thick] (2) edge [->, >=stealth, loop above] (2);
\path[-stealth, very thick] (3) edge [->, >=stealth, loop above] (3);
\draw[-stealth, very thick] (2) -- (3);
\path[-stealth, very thick] (3) edge [bend right] (4);
\draw[-stealth, very thick] (5) -- (6);
\draw[-stealth, very thick] (6) -- (3);
\path[-stealth, very thick] (6) edge [bend right=45] (4);
\path[-stealth, very thick] (4) edge [bend right=45] (6);
\path[-stealth, very thick] (5) edge [->, >=stealth, loop right] (5);
\path[-stealth, very thick] (6) edge [->, >=stealth, loop right] (6);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\draw[ultra thick, lightgray, dashed] (5.5, 2) -- (5.5, -2);
\node[circle,inner sep=0.3em,fill=red,very thick] (X) at (4.5, 0.5) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (4.7, 0.1) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (5.2, 0.1) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (5.1, -0.3) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (5.6, -0.33) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (5.4, -0.7) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (5.8, -0.9) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (5.9, -1.3) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (6.4, -1.2) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (6.9, -1.1) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (7.4, -1.3) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (7.45, -1.7) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (7.8, -1.5) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (8.2, -1.4) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (8.3, -1.0) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (8.6, -1.3) {};
\node[circle,inner sep=0.3em,fill=blue,very thick] (Y) at (6.5, 0.5) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (6.1, 0.8) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (5.7, 0.9) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (5.8, 1.3) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (5.4, 1.15) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (5, 1.2) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (4.8, 1.5) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (4.3, 1.6) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (4.2, 1.2) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (3.8, 1.3) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (3.4, 1.3) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (3.4, 0.8) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (3.1, 1.1) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (2.75, 0.7) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (2.45, 0.1) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (2.35, 0.45) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (1.9, -0.04) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at (1.85, -0.5) {};
\draw[ultra thick, black, dashed](1.5,-1) cos
(3,0) sin (4.5,1) cos (6,0) sin (7.5,-1) cos (9,0);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\node[rectangle, draw, minimum width=2.2cm, minimum height=1cm] (FT) {\emph{new fts.}};
\node[rectangle, above =0em of FT, draw, minimum width=2.2cm] (IG) {\emph{input gate}};
\node[rectangle, above=0em of IG, draw, minimum width=2.2cm] (FG) {\emph{forget gate}};
\node[rectangle, below=0em of FT, draw, minimum width=2.2cm] (OG) {\emph{output gate}};
\node[left=of IG] (X) {$\vec{x}_t$};
\node[left=of FT] (Y) {$\vec{y}_{t-1}$};
\draw[-stealth, thick] (X.east) -- ([yshift=0.5em]FT.west);
\draw[-stealth, thick] (X.east) -- ([yshift=0.25em]IG.west);
\draw[-stealth, thick] (X.east) -- ([yshift=0.25em]FG.west);
\draw[-stealth, thick] (X.east) -- ([yshift=0.25em]OG.west);
\draw[-stealth, thick] (Y.east) -- ([yshift=-0.5em]FT.west);
\draw[-stealth, thick] (Y.east) -- ([yshift=-0.25em]IG.west);
\draw[-stealth, thick] (Y.east) -- ([yshift=-0.25em]FG.west);
\draw[-stealth, thick] (Y.east) -- ([yshift=-0.25em]OG.west);
\node[circle, draw, right=of FT] (t1) {$\times$};
\node[circle, draw, right=of t1] (pl) {$+$};
\node[rectangle, draw, right=of pl] (th) {$\sigma$};
\node[circle, draw, right=of th] (t2) {$\times$};
\node[right=of t2] (Y1) {$\vec{y}_t$};
\node[circle, draw, above=of pl] (t3) {$\times$};
\node[rectangle, thick, draw, above=of t3, minimum width=1.5cm, minimum height=1.5cm] (M) {$M$};
\draw[-stealth, thick] (FT) -- (t1);
\draw[-stealth, thick] (t1) -- (pl);
\draw[-stealth, thick] (pl) -- (th);
\draw[-stealth, thick] (th) -- (t2);
\draw[-stealth, thick] (t2) -- (Y1);
\draw[-stealth, thick] (M) -- node[left] {$\vec{c}_{t-1}$} (t3);
\draw[-stealth, thick] (t3) -- (pl);
\path[-stealth, thick] (IG.east) edge[bend left] (t1);
\draw[thick] (OG.east) -- ([xshift=10em]OG.east);
\path[-stealth, thick] (OG.east) -- ([xshift=10em]OG.east) edge[bend right=15] (t2);
\path[-stealth, thick] (FG.east) edge[bend left=10] (t3);
\path[-stealth, thick] (pl.east) edge[bend right=60] node[right] {$\vec{c}_t$} (M.east);
\draw[-stealth, very thick, dashed, gray] (-1.5, -1.5) rectangle (8.4, 4.8);
\node[] (tttxt) at (-0.8, 4.5) {\large \bf LSTM};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{amsmath}
\usepackage{amssymb}
\usepackage{xcolor}
\usetikzlibrary{positioning, decorations.pathmorphing}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\begin{document}
\begin{tikzpicture}
\node[rectangle, minimum width=5em, minimum height=5em, fill=lightgray!20] (X) {};
\node[rectangle, fill=blue!30, minimum width=2em, minimum height=2em, xshift=-1.5em, yshift=-1.5em] at (X) (AA) {};
\node[rectangle, minimum width=2em, minimum height=2em, xshift=1.5em, yshift=1.5em, olivegreen] at (X) (LA) {$\boldsymbol\pounds\boldsymbol\pounds$};
\node[rectangle, very thick, draw, minimum width=5em, minimum height=5em] at (X) (K) {};
\node[rectangle, right=5em of X, minimum width=5em, minimum height=5em, fill=lightgray!20] (Y) {};
\node[rectangle, fill=blue!30, minimum width=2em, minimum height=2em, xshift=-1.5em, yshift=1.5em] at (Y) (BB) {};
\node[rectangle, minimum width=2em, minimum height=2em, xshift=1.5em, yshift=1.5em, olivegreen] at (Y) (LB) {$\boldsymbol\pounds\boldsymbol\pounds$};
\node[rectangle, very thick, draw, minimum width=5em, minimum height=5em] at (Y) (W) {};
\node[rectangle, right=5em of Y, minimum width=5em, minimum height=5em, fill=lightgray!20] (Z) {};
\node[rectangle, fill=blue!30, minimum width=2em, minimum height=2em, xshift=1.5em, yshift=1.5em] at (Z) (CC) {};
\node[rectangle, minimum width=2em, minimum height=2em, xshift=1.5em, yshift=1.5em, olivegreen] at (Z) (LC) {$\boldsymbol\pounds\boldsymbol\pounds$};
\node[rectangle, very thick, draw, minimum width=5em, minimum height=5em] at (Z) (AS) {};
\node[below=0.5em of X] (l1) {$s_0$};
\node[below=0.5em of Y] (l2) {$s_1$};
\node[below=0.5em of Z] (l3) {$s_2$};
\node[above=4em of X] (P1) {$[0.12, {\bf 0.64}, 0.07, 0.17]$};
\node[above=4em of Y] (P2) {$[0.03, 0.24, {\bf 0.47}, 0.26]$};
\node[above=4em of Z] (P3) {$[{\bf 0.82}, 0.04, 0.08, 0.06]$};
\draw[-stealth, ultra thick] (X) -- node[left] {$\pi_\theta(s_0)$} (P1);
\draw[-stealth, ultra thick] (Y) -- node[left] {$\pi_\theta(s_1)$} (P2);
\draw[-stealth, ultra thick] (Z) -- node[left] {$\pi_\theta(s_2)$} (P3);
\node[above=2em of P1] (A1) {up};
\node[above=2em of P2] (A2) {right};
\node[above=2em of P3] (A3) {pick up};
\draw[-stealth, very thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] ([xshift=-1em]P1.north) -- (A1);
\draw[-stealth, very thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] ([xshift=1em]P2.north) -- (A2);
\draw[-stealth, very thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] ([xshift=-3em]P3.north) -- (A3);
\node[above=2em of A1] (R1) {$r_0 = 0$};
\node[above=2em of A2] (R2) {$r_1 = 0$};
\node[above=2em of A3] (R3) {$r_2 = 2$};
\draw[-stealth, very thick] (A1) -- node[left] {$\mathcal{R}(s_0, \uparrow)$} (R1);
\draw[-stealth, very thick] (A2) -- node[left] {$\mathcal{R}(s_1, \rightarrow)$} (R2);
\draw[-stealth, very thick] (A3) -- node[left] {$\mathcal{R}(s_2, \star)$} (R3);
\node[xshift=-2.5em, yshift=-0.5em] at (Y.west) {$\mathcal{T}(s_0, \uparrow)$} (R1);
\node[xshift=-2.5em, yshift=-0.5em] at (Z.west) {$\mathcal{T}(s_1, \rightarrow)$} (R2);
\draw [-stealth, very thick] plot [smooth, tension=1] coordinates { (A1.east) ([xshift=3.75em,yshift=-2em]A1.east) ([xshift=-2.5em,yshift=2em]Y.west) (Y.west)};
\draw [-stealth, very thick] plot [smooth, tension=1] coordinates { (A2.east) ([xshift=3.25em,yshift=-2em]A2.east) ([xshift=-2.5em,yshift=2em]Z.west) (Z.west)};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{decorations.pathmorphing}
\definecolor{bluport}{HTML}{21ADFD}
\definecolor{orgport}{HTML}{E37322}
\definecolor{pplport}{HTML}{4F21E9}
\definecolor{redport}{HTML}{701315}
\begin{document}
\begin{tikzpicture}
\draw[thick, bluport] (0, 0) ellipse (2 and 1);
\draw[ultra thick, bluport, decorate, decoration={snake, segment length=1mm, amplitude=0.3mm}] (0, 0) ellipse (2 and 1);
\node[text height=1em, text depth=1em] (1) at (0, 1.5) {\tt git init};
\node[text height=1em, text depth=1em, align=center, bluport] (1) at (0, -0.25) {\tt ./git \\ repository};
\draw[thick, orgport] (6, 0) ellipse (2 and 1);
\draw[ultra thick, orgport, decorate, decoration={snake, segment length=1mm, amplitude=0.3mm}] (6, 0) ellipse (2 and 1);
\node[text height=1em, text depth=1em] (1) at (6, 1.5) {\tt git clone};
\node[text height=1em, text depth=1em, align=center, orgport] (1) at (6, -0.25) {\tt ./git \\ repository};
\draw[ultra thick, redport] (-1.75, -2) rectangle (1.75, -3.5);
\node[text height=1em, text depth=1em, align=center, redport] (1) at (0, -3.25) {working directory \\ \& index of user 1};
\draw[ultra thick, pplport] (4.25, -2) rectangle (7.75, -3.5);
\node[text height=1em, text depth=1em, align=center, pplport] (1) at (6, -3.25) {working directory \\ \& index of user 2};
\draw[very thick, stealth-stealth] (1.5, 0) -- node[above] {\tt git pull} node[below] {\tt git push} (4.5, 0);
\draw[very thick, -stealth] (-0.2, -0.5) -- node[left] {\tt git pull} (-0.2, -2.4);
\draw[very thick, -stealth] (0.2, -2.4) -- node[right] {\tt git commit} (0.2, -0.5);
\draw[very thick, -stealth] (5.8, -0.5) -- node[left] {\tt git pull} (5.8, -2.4);
\draw[very thick, -stealth] (6.2, -2.4) -- node[right] {\tt git commit} (6.2, -0.5);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\begin{document}
\begin{tikzpicture}
% 1st column
\node at (0,6.5) {$t-1$};
\node[align=center, circle, draw, thick] (s1_1) at (0,5) {$s_1$\\{\scriptsize$\alpha_{t-1}(s_1)$}};
\node[align=center, circle, draw, thick] (s2_1) at (0,3) {$s_2$\\{\scriptsize$\alpha_{t-1}(s_2)$}};
\node[align=center, circle, draw, thick] (s3_1) at (0,1) {$s_3$\\{\scriptsize$\alpha_{t-1}(s_3)$}};
\node[align=center, circle, draw, thick] (s4_1) at (0,-1) {$s_4$\\{\scriptsize$\alpha_{t-1}(s_4)$}};
\node [draw, thick] at (0,-2.5) {$(y_{t-1}, id_{t-1})$};
% 2nd column
\node at (3.5,6.5) {$t$};
\node[circle, draw, thick] (s1_2) at (3.5,5) {$s_1$}
edge[gray, thin, stealth-] (s1_1)
edge[gray, thin, stealth-] (s2_1)
edge[gray, thin, stealth-] (s3_1)
edge[gray, thin, stealth-] (s4_1);
\node[circle, draw, thick] (s3_2) at (3.5,1) {$s_3$}
edge[gray, thin, stealth-] (s1_1)
edge[gray, thin, stealth-] (s2_1)
edge[gray, thin, stealth-] (s3_1)
edge[gray, thin, stealth-] (s4_1);
\node[circle, draw, thick] (s4_2) at (3.5,-1) {$s_4$}
edge[gray, thin, stealth-] (s1_1)
edge[gray, thin, stealth-] (s2_1)
edge[gray, thin, stealth-] (s3_1)
edge[gray, thin, stealth-] (s4_1);
\node[align=center, circle, draw, ultra thick, minimum size=4.25em] (s2_2) at (3.5,3) {$s_2$\\{\scriptsize$\alpha_{t}(s_2)$}};
% 3rd column
\node [] (asdf2) at (8.5,-2.5) {$(y_{t+1}, id_{t+1})$};
\node [draw, thick] (asdf3) at (12,-2.5) {$(y_{t+2}, id_{t+2})$};
\node[align=center, circle, draw, ultra thick, minimum size=4.25em] (s3_3) at (8.5,1) {$s_3$\\{\scriptsize$\beta_{t+1}(s_3)$}}
edge[gray, thin, stealth-] (s1_2)
edge[gray, thin, stealth-] (s3_2)
edge[gray, thin, stealth-] (s4_2);
\draw[-stealth, very thick, dashed, bend left=90] (asdf2.west) to node[pos=0.33, align=center, fill=white] {${\bf O'}_{3,id_{t+1}}$\\$\mathcal{N}(y_{t+1};\mu_{id_{t+1}},\sigma_{id_{t+1}})$} (s3_3.west);
\node [draw, thick] (asdf2) at (8.5,-2.5) {$(y_{t+1}, id_{t+1})$};
\node at (8.5,6.5) {$t+1$};
\node[circle, draw, thick] (s1_3) at (8.5,5) {$s_1$}
edge[gray, thin, stealth-] (s1_2)
edge[gray, thin, stealth-] (s2_2)
edge[gray, thin, stealth-] (s3_2)
edge[gray, thin, stealth-] (s4_2);
\node[circle, draw, thick] (s2_3) at (8.5,3) {$s_2$}
edge[gray, thin, stealth-] (s1_2)
edge[gray, thin, stealth-] (s2_2)
edge[gray, thin, stealth-] (s3_2)
edge[gray, thin, stealth-] (s4_2);
\node[circle, draw, thick] (s4_3) at (8.5,-1) {$s_4$}
edge[gray, thin, stealth-] (s1_2)
edge[gray, thin, stealth-] (s2_2)
edge[gray, thin, stealth-] (s3_2)
edge[gray, thin, stealth-] (s4_2);
% 4th column
\node at (12,6.5) {$t+2$};
\node[align=center, circle, draw, thick] (s1_4) at (12,5) {$s_1$\\{\scriptsize$\beta_{t+2}(s_1)$}}
edge[gray, thin, stealth-] (s1_3)
edge[gray, thin, stealth-] (s2_3)
edge[gray, thin, stealth-] (s4_3);
\node[align=center, circle, draw, thick] (s2_4) at (12,3) {$s_2$\\{\scriptsize$\beta_{t+2}(s_2)$}}
edge[gray, thin, stealth-] (s1_3)
edge[gray, thin, stealth-] (s2_3)
edge[gray, thin, stealth-] (s4_3);
\node[align=center, circle, draw, thick] (s3_4) at (12,1) {$s_3$\\{\scriptsize$\beta_{t+2}(s_3)$}}
edge[gray, thin, stealth-] (s1_3)
edge[gray, thin, stealth-] (s2_3)
edge[gray, thin, stealth-] (s4_3);
\node[align=center, circle, draw, thick] (s4_4) at (12,-1) {$s_4$\\{\scriptsize$\beta_{t+2}(s_4)$}}
edge[gray, thin, stealth-] (s1_3)
edge[gray, thin, stealth-] (s2_3)
edge[gray, thin, stealth-] (s4_3);
\draw[very thick, stealth-] (s2_2) to node [midway, fill=white] {${\bf T}_{12}$} (s1_1);
\draw[very thick, stealth-] (s2_2) to node [midway, fill=white] {${\bf T}_{22}$} (s2_1);
\draw[very thick, stealth-] (s2_2) to node [midway, fill=white] {${\bf T}_{32}$} (s3_1);
\draw[very thick, stealth-] (s2_2) to node [midway, fill=white] {${\bf T}_{42}$} (s4_1);
\draw[very thick, stealth-] (s1_4) to node [midway, fill=white] {${\bf T}_{31}$} (s3_3);
\draw[very thick, stealth-] (s2_4) to node [midway, fill=white] {${\bf T}_{32}$} (s3_3);
\draw[very thick, stealth-] (s3_4) to node [midway, fill=white] {${\bf T}_{33}$} (s3_3);
\draw[very thick, stealth-] (s4_4) to node [midway, fill=white] {${\bf T}_{34}$} (s3_3);
\draw[very thick, stealth-] (s3_3) to node [midway, fill=white] {${\bf T}_{23}$} (s2_2);
\node [draw, thick] (asdf) at (3.5,-2.5) {$(y_{t}, id_{t})$};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\definecolor{echodrk}{HTML}{0099cc}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\definecolor{camdrk}{RGB}{0,62,114}
\begin{document}
\begin{tikzpicture}
\node[circle, gray, draw, very thick] (1) {$\vec{h}^\ell_1$};
\node[circle, echodrk, draw, below right=2em and 3em of 1, very thick] (2) {$\vec{h}^\ell_2$};
\node[circle, draw, echodrk, above right=3em and 4em of 1, very thick] (3) {$\vec{h}^\ell_3$};
\node[circle, draw, olivegreen, right=7em of 1, ultra thick] (4) {$\vec{h}^{\ell+1}_4$};
\node[circle, echodrk, draw, above right=3.5em and 4em of 4, very thick] (5) {$\vec{h}^\ell_5$};
\node[circle, echodrk, draw, below right=3em and 3em of 4, very thick] (6) {$\vec{h}^\ell_6$};
\draw[gray, very thick] (1) -- (2);
\draw[gray, very thick] (2) -- (3);
\draw[red, ultra thick, -stealth] (2) -- node[below, xshift=0.9em] (ll) {$\vec{h}_{2\rightarrow 4}^\ell$} (4);
\draw[red, ultra thick, -stealth] (3) -- node[above,xshift=1em, inner sep=0em] (l1) {$\vec{h}_{3\rightarrow 4}^\ell$} (4);
\draw[red,ultra thick, -stealth] (5) -- node[right, yshift=-0.5em] (lr) {$\vec{h}_{5\rightarrow 4}^\ell$} (4);
\draw[red,ultra thick, -stealth] (6) -- node[right, xshift=0.1em] (lw) {$\vec{h}_{6\rightarrow 4}^\ell$} (4);
\node[right=5.5em of 6, echodrk] (31) {$\vec{h}^\ell_3$};
\node[right=1em of 31, echodrk] (41) {$\vec{h}^\ell_4$};
\node[rectangle, draw, camdrk, very thick, above right=3em and -0.5em of 31] (F) {$f_e^\ell$};
\node[above=3em of F, red] (34) {$\vec{h}^\ell_{3\rightarrow 4}$};
\draw[very thick, camdrk, -stealth] (31) -- (F);
\draw[very thick, camdrk, -stealth] (41) -- (F);
\draw[very thick, camdrk, -stealth] (F) -- (34);
\draw[very thick, -stealth, dashed, echodrk] (3) edge[bend left=30] (31);
\draw[very thick, -stealth, dashed, echodrk] (4) edge[bend right=65] (41);
\draw[very thick, -stealth, dashed, red] (34) edge[bend right=40] (l1);
\node[right= of 4, camdrk, rectangle, draw, very thick] (G) {$f_v^\ell$};
\node[right=4 em of G, olivegreen] (l11) {$\vec{h}^{\ell+1}_4$};
\draw[-stealth, camdrk, very thick] (4) -- (G);
\draw[-stealth, camdrk, very thick] (G) -- (l11);
\draw[very thick, -stealth, dashed, olivegreen] (l11) edge[bend left=25] (4);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\node[rectangle] (Y0) at (0, 0) {$\dots$};
\node[rectangle, draw, right=2em of Y0, minimum height=1cm, minimum width=1cm] (RNN) {LSTM$_\rightarrow$};
\node[rectangle, right=of RNN, draw, minimum height=1cm, minimum width=1cm] (RNN2) {LSTM$_\rightarrow$};
\node[rectangle, right=of RNN2, draw, minimum height=1cm, minimum width=1cm] (RNN3) {LSTM$_\rightarrow$};
\node[rectangle, right= of RNN3, draw, minimum height=1cm, minimum width=1cm] (RNN4) {LSTM$_\rightarrow$};
\node[rectangle, right=2em of RNN4] (RNN5) {$\dots$};
\node[rectangle, above=of RNN4, draw, minimum height=1cm, minimum width=1cm] (R25) {LSTM$_\leftarrow$};
\node[rectangle, left=of R25, minimum height=1cm, minimum width=1cm, draw] (R24) {LSTM$_\leftarrow$};
\node[rectangle, left=of R24, draw, minimum height=1cm, minimum width=1cm] (R23) {LSTM$_\leftarrow$};
\node[rectangle, left=of R23, draw, minimum height=1cm, minimum width=1cm] (R22) {LSTM$_\leftarrow$};
\node[rectangle, left=2em of R22] (R21) {$\dots$};
\node[right=2em of R25] (Y20) {$\dots$};
\node[below=of RNN] (X1) {$\vec{x}_2$};
\node[below=of RNN2] (X2) {$\vec{x}_3$};
\node[below=of RNN3] (X3) {$\vec{x}_4$};
\node[below=of RNN4] (X4) {$\vec{x}_5$};
\node[above=of R25] (Y5) {$\vec{h}_5$};
\node[above=of R24] (Y4) {$\vec{h}_4$};
\node[above=of R23] (Y3) {$\vec{h}_3$};
\node[above=of R22] (Y2) {$\vec{h}_2$};
\draw[-stealth, thick] (X1) -- (RNN);
\draw[-stealth, thick] (X2) -- (RNN2);
\draw[-stealth, thick] (X3) -- (RNN3);
\draw[-stealth, thick] (X4) -- (RNN4);
\draw[-stealth, thick, densely dotted] (Y0) -- (RNN);
\draw[-stealth, thick] (RNN) -- node[above, pos=0.35] {$\vec{h}_2^\rightarrow$} (RNN2);
\draw[-stealth, thick] (RNN2) -- node[above, pos=0.35] {$\vec{h}_3^\rightarrow$} (RNN3);
\draw[-stealth, thick] (RNN3) -- node[above, pos=0.35] {$\vec{h}_4^\rightarrow$} (RNN4);
\draw[-stealth, densely dotted, thick] (RNN4) -- (RNN5);
\node[below=4em of Y0] (d) {\dots};
\node[below=4em of RNN5] (d) {\dots};
\path[-stealth, ultra thick, white] (X1) edge[bend left=45] (R22);
\path[-stealth, thick] (X1) edge[bend left=45] (R22);
\path[-stealth, ultra thick, white] (X2) edge[bend left=45] (R23);
\path[-stealth, thick] (X2) edge[bend left=45] (R23);
\path[-stealth, ultra thick, white] (X3) edge[bend left=45] (R24);
\path[-stealth, thick] (X3) edge[bend left=45] (R24);
\path[-stealth, ultra thick, white] (X4) edge[bend left=45] (R25);
\path[-stealth, thick] (X4) edge[bend left=45] (R25);
\draw[-stealth, densely dotted, thick] (Y20) -- (R25);
\draw[-stealth, thick] (R22) -- (Y2);
\draw[-stealth, thick] (R23) -- (Y3);
\draw[-stealth, thick] (R24) -- (Y4);
\draw[-stealth, thick] (R25) -- (Y5);
\draw[stealth-, densely dotted, thick] (R21) -- (R22);
\draw[stealth-, thick] (R22) -- node[above, pos=0.65] {$\vec{h}_3^\leftarrow$} (R23);
\draw[stealth-, thick] (R23) -- node[above, pos=0.65] {$\vec{h}_4^\leftarrow$} (R24);
\draw[stealth-, thick] (R24) -- node[above, pos=0.65] {$\vec{h}_5^\leftarrow$} (R25);
\draw[-stealth, densely dotted, thick] (Y20) -- (R25);
\path[-stealth, ultra thick, white] (RNN) edge[bend right=45] (Y2);
\path[-stealth, thick] (RNN) edge[bend right=45] (Y2);
\path[-stealth, ultra thick, white] (RNN2) edge[bend right=45] (Y3);
\path[-stealth, thick] (RNN2) edge[bend right=45] (Y3);
\path[-stealth, ultra thick, white] (RNN3) edge[bend right=45] (Y4);
\path[-stealth, thick] (RNN3) edge[bend right=45] (Y4);
\path[-stealth, ultra thick, white] (RNN4) edge[bend right=45] (Y5);
\path[-stealth, thick] (RNN4) edge[bend right=45] (Y5);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{tkz-graph}
\begin{document}
\begin{tikzpicture}[scale=0.8,every node/.style={scale=0.7},font=\tt]
\SetUpEdge[ lw = 0.75pt,
color = red,
labelcolor = white]
\GraphInit[vstyle=Normal]
\SetGraphUnit{2}
\tikzset{VertexStyle/.append style={fill=red!50}}
\Vertex{s}
\tikzset{VertexStyle/.append style={fill=white}}
\NOEA(s){a}
\EA(a){d}
\tikzset{VertexStyle/.append style={fill=blue!50}}
\SOEA(d){t}
\tikzset{VertexStyle/.append style={fill=white}}
\EA(s){b}
\EA(b){e}
\SOEA(s){c}
\EA(c){f}
\tikzset{EdgeStyle/.style={-stealth, color=black}}
\Edge[label=6](s)(a)
\Edge[label=2](s)(b)
\SetUpEdge[labeltext=red]
\tikzset{EdgeStyle/.style={-stealth, color=red}}
\Edge[label=2](s)(c)
\SetUpEdge[labeltext=black]
\tikzset{EdgeStyle/.style={-stealth, color=black}}
\Edge[label=5](a)(d)
\Edge[label=4](a)(e)
\tikzset{EdgeStyle/.style={-stealth, color=black, bend left=15}}
\Edge[label=4](b)(e)
\Edge[label=-2](e)(b)
\SetUpEdge[labeltext=red]
\tikzset{EdgeStyle/.style={-stealth, color=red}}
\Edge[label=1](c)(f)
\SetUpEdge[labeltext=black]
\tikzset{EdgeStyle/.style={-stealth, color=black}}
\Edge[label=1](d)(t)
\SetUpEdge[labeltext=red]
\tikzset{EdgeStyle/.style={-stealth, color=red}}
\Edge[label=3](e)(t)
\Edge[label=2](f)(e)
\SetUpEdge[labeltext=black]
\tikzset{EdgeStyle/.style={-stealth, color=black}}
\Edge[label=5](f)(t)
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}[node distance=4cm, auto]
\node (00) {};
\node [right of=00] (l1) {Line 1};
\node [right of=l1] (01) {};
\draw[-stealth, very thick] (00) -- (l1) -- (01);
\node [below =1cm of 00] (10) {};
\node [right of=10] (l2) {Line 2};
\node [right of=l2] (11) {};
\draw[-stealth, very thick] (10) -- (l2) -- (11);
\node [below =1cm of 10] (20) {};
\node [right of=20] (l3) {Line 3};
\node [right of=l3] (21) {};
\draw[-stealth, very thick] (20) -- (l3) -- (21);
\node [below =1cm of 20] (30) {};
\node [right of=30] (l4) {};
\node [right of=l4] (31) {};
\node [below =1cm of 30] (1430) {};
\node [right of=1430] (l143) {Line 143};
\node [right of=l143] (1431) {};
\draw[-stealth, very thick] (1430) -- (l143) -- (1431);
\node [below =1cm of 1430] (1440) {};
\node [right of=1440] (l144) {Line 144};
\node [right of=l144] (1441) {};
\draw[-stealth, very thick] (1440) -- (l144) -- (1441);
\node [below=0.1cm of l1] (h1) {\textcolor{blue}{HBlank}};
\draw [thick, blue] (01) [bend left] to (h1);
\draw [-stealth, thick, blue] (h1) [bend right] to (10);
\node [below=0.1cm of l2] (h2) {\textcolor{blue}{HBlank}};
\draw [thick, blue] (11) [bend left] to (h2);
\draw [-stealth, thick, blue] (h2) [bend right] to (20);
\node [below=0.1cm of l3] (h3) {\textcolor{blue}{HBlank}};
\draw [thick, blue] (21) [bend left] to (h3);
\draw [-stealth, thick, blue, dashed] (h3) [bend right] to (30);
\node [below=0.1cm of l4] (h4) {\textcolor{blue}{HBlank}};
\draw [thick, blue, dashed] (31) [bend left] to (h4);
\draw [-stealth, thick, blue] (h4) [bend right] to (1430);
\node [below=0.1cm of l143] (h5) {\textcolor{blue}{HBlank}};
\draw [thick, blue] (1431) [bend left] to (h5);
\draw [-stealth, thick, blue] (h5) [bend right] to (1440);
\path (1441) -- node[pos=0.47] (v) {\textcolor{red}{\bf VBlank}} (00);
\draw [ultra thick, red] (1441) [bend right] to (v);
\draw [-stealth, red, ultra thick] (v) [bend left] to (00);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop,tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{arrows,decorations.pathmorphing,positioning}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\begin{document}
\begin{tikzpicture}
\node (1) [draw, dashed, minimum height=15em, minimum width=15em, xshift=6.5em, fill=olivegreen, fill opacity=0.2, very thick, rectangle, rounded corners] {};
\node (la1) [below=0em of 1] {\emph{encoder}};
\node (2) [draw, dashed, minimum height=14em, fill = red, fill opacity=0.2,minimum width=14em, xshift=19em, very thick, rectangle, rounded corners] {};
\node (la1) [below=0em of 2] {\emph{decoder}};
\node (3) [draw, dashed, minimum height=16em, fill = blue, fill opacity=0.2,minimum width=5em, xshift=-1.5em, very thick, rectangle, rounded corners] {};
\node (la3) [below=0em of 3] {\emph{corrupt}};
\node[circle, thick, fill=red!50, draw] (x1) {};
\node[circle, thick, draw, fill=red!50, below=1em of x1] (x2) {};
\node[circle, thick, fill=red!50, draw, below=1em of x2] (x3) {};
\node[circle, thick, fill=red!50, draw, below=1em of x3] (x4) {};
\node[circle, thick, fill=red!50, draw, above=1em of x1] (x5) {};
\node[circle, thick, fill=red!50, draw, above=1em of x5] (x6) {};
\node[circle, thick, fill=red!50, draw, above=1em of x6] (x7) {};
\foreach \x in {1,...,7}
\node at (x\x) (lx\x) {$\sim$};
\node[circle, thick, fill=white, left=2em of x1, draw] (i1) {};
\node[circle, thick, draw, fill=white, below=1em of i1] (i2) {};
\node[circle, thick, fill=white, draw, below=1em of i2] (i3) {};
\node[circle, thick, fill=white, draw, below=1em of i3] (i4) {};
\node[circle, thick, fill=white, draw, above=1em of i1] (i5) {};
\node[circle, thick, fill=white, draw, above=1em of i5] (i6) {};
\node[circle, thick, fill=white, draw, above=1em of i6] (i7) {};
\foreach \x in {1,...,7}
\draw[-stealth, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate, thick] (i\x) -- (x\x);
\node[circle, thick, right=4em of x1, fill=white, draw] (xh1) {};
\node[circle, thick, draw, fill=white, below=1em of xh1] (xh2) {};
\node[circle, thick, fill=white, draw, below=1em of xh2] (xh3) {};
\node[circle, thick, fill=white, draw, above=1em of xh1] (xh4) {};
\node[circle, thick, fill=white, draw, above=1em of xh4] (xh5) {};
\node[circle, thick, fill=white, draw, right=8em of x1, yshift=5em] (hm1) {};
\node[circle, thick, draw, fill=white, below=0.5em of hm1] (hm2) {};
\node[circle, thick, draw, fill=white, below=0.5em of hm2] (hm3) {};
\node[circle, thick, draw, fill=white, above=0.5em of hm1] (hm4) {};
\node[circle, thick, fill=white, draw, right=8em of x1, yshift=-3em] (hs1) {};
\node[circle, thick, draw, fill=white, below=0.5em of hs1] (hs2) {};
\node[circle, thick, draw, fill=white, below=0.5em of hs2] (hs3) {};
\node[circle, thick, draw, fill=white, above=0.5em of hs1] (hs4) {};
\node[] at (hm1) (mu1) {$\mu$};
\node[] at (hm2) (mu2) {$\mu$};
\node[] at (hm3) (mu3) {$\mu$};
\node[] at (hm4) (mu4) {$\mu$};
\node[] at (hs1) (s1) {$\sigma$};
\node[] at (hs2) (s2) {$\sigma$};
\node[] at (hs3) (s3) {$\sigma$};
\node[] at (hs4) (s4) {$\sigma$};
\node[circle, thick, fill=lightgray, draw, right=12em of x1, yshift=1em] (h1) {};
\node[circle, thick, draw, fill=lightgray, below=1em of h1] (h2) {};
\node[circle, thick, draw, fill=lightgray, below=1em of h2] (h3) {};
\node[circle, thick, draw, fill=lightgray, above=1em of h1] (h4) {};
\node[circle, thick, right=16em of x1, fill=white, draw] (oh1) {};
\node[circle, thick, draw, fill=white, below=1em of oh1] (oh2) {};
\node[circle, thick, fill=white, draw, below=1em of oh2] (oh3) {};
\node[circle, thick, fill=white, draw, above=1em of oh1] (oh4) {};
\node[circle, thick, fill=white, draw, above=1em of oh4] (oh5) {};
\node[circle, thick, draw, fill=white, right=20em of x1] (o1) {};
\node[circle, thick, draw, fill=white, below=1em of o1] (o2) {};
\node[circle, thick, draw, fill=white, below=1em of o2] (o3) {};
\node[circle, thick, draw, fill=white, below=1em of o3] (o4) {};
\node[circle, thick, draw, fill=white, above=1em of o1] (o5) {};
\node[circle, thick, draw, fill=white, above=1em of o5] (o6) {};
\node[circle, thick, draw, fill=white, above=1em of o6] (o7) {};
\node[circle, thick, draw, fill=white, right=24em of x1] (oo1) {};
\node[circle, thick, draw, fill=white, below=1em of oo1] (oo2) {};
\node[circle, thick, draw, fill=white, below=1em of oo2] (oo3) {};
\node[circle, thick, draw, fill=white, below=1em of oo3] (oo4) {};
\node[circle, thick, draw, fill=white, above=1em of oo1] (oo5) {};
\node[circle, thick, draw, fill=white, above=1em of oo5] (oo6) {};
\node[circle, thick, draw, fill=white, above=1em of oo6] (oo7) {};
\node[] at (o1) (muu1) {$\mu$};
\node[] at (o2) (muu2) {$\mu$};
\node[] at (o3) (muu3) {$\mu$};
\node[] at (o4) (muu4) {$\mu$};
\node[] at (o5) (muu5) {$\mu$};
\node[] at (o6) (muu6) {$\mu$};
\node[] at (o7) (muu7) {$\mu$};
\foreach \x in {1,...,7}
\foreach \y in {1,...,5}
\draw[-stealth, thick] (x\x) -- (xh\y);
\foreach \x in {1,...,5}
\foreach \y in {1,...,4}
\draw[-stealth, thick] (xh\x) -- (hm\y);
\foreach \x in {1,...,5}
\foreach \y in {1,...,4}
\draw[-stealth, thick] (xh\x) -- (hs\y);
\foreach \x in {1,...,4}
\draw[-stealth, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate, thick] (hs\x) -- (h\x);
\foreach \x in {1,...,4}
\draw[-stealth, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate, thick] (hm\x) -- (h\x);
\foreach \x in {1,...,5}
\foreach \y in {1,...,4}
\draw[-stealth, thick] (h\y) -- (oh\x);
\foreach \x in {1,...,5}
\foreach \y in {1,...,7}
\draw[-stealth, thick] (oh\x) -- (o\y);
\foreach \x in {1,...,7}
\draw[-stealth, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate, thick] (o\x) -- (oo\x);
\node[left=0.5em of i1] (l1) {$\vec{x}$};
\node[above=0em of h4] (l2) {$\vec{z}$};
\node[right=0.5em of oo1] (l3) {$\vec{x}'$};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\definecolor{mygreen}{rgb}{0,0.6,0}
\definecolor{mymauve}{rgb}{0.58,0,0.82}
\usetikzlibrary{arrows,shapes, decorations.pathmorphing,backgrounds,positioning}
\begin{document}
\begin{tikzpicture}
\node[circle, draw, thick] (h1) {$\vec{h}_1$};
\node[circle, draw, thick, above left=of h1] (h4) {$\vec{h}_2$};
\node[circle, draw, thick, left=5em of h1] (h5) {$\vec{h}_3$};
\node[circle, draw, thick, below left=of h1] (h6) {$\vec{h}_4$};
\node[circle, draw, thick, below=5em of h1] (h7) {$\vec{h}_5$};
\node[circle, draw, thick, below right=of h1] (h8) {$\vec{h}_6$};
\draw[-stealth, mymauve, thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h8.120) -- node[sloped, above, black] {$\vec{\alpha}_{16}$} (h1.-30);
\draw[-stealth, blue, thick] (h8.135) -- (h1.-45);
\draw[-stealth, mygreen, thick, decoration={zigzag, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h8.150) -- (h1.-60);
\draw[-stealth, mymauve, thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h1.30) to[looseness=7] node[sloped, above, black] {$\vec{\alpha}_{11}$}(h1.105);
\draw[-stealth, blue, thick] (h1.45) to[looseness=9] (h1.90);
\draw[-stealth, mygreen, thick, decoration={zigzag, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h1.60) to[looseness=20] (h1.75);
\draw[-stealth, mymauve, thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h4.285) -- node[sloped, below, black] {$\vec{\alpha}_{12}$}(h1.150);
\draw[-stealth, blue, thick] (h4.300) -- (h1.135);
\draw[-stealth, mygreen, thick, decoration={zigzag, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h4.315) -- (h1.120);
\draw[-stealth, mymauve, thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h5.-15) -- node[sloped, below, black] {$\vec{\alpha}_{13}$}(h1.195);
\draw[-stealth, blue, thick] (h5.0) -- (h1.180);
\draw[-stealth, mygreen, thick, decoration={zigzag, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h5.15) -- (h1.165);
\draw[-stealth, mymauve, thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h6.15) -- node[sloped, below, black] {$\vec{\alpha}_{14}$}(h1.240);
\draw[-stealth, blue, thick] (h6.30) -- (h1.225);
\draw[-stealth, mygreen, thick, decoration={zigzag, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h6.45) -- (h1.210);
\draw[-stealth, mymauve, thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h7.75) -- node[sloped, below, black] {$\vec{\alpha}_{15}$}(h1.-75);
\draw[-stealth, blue, thick] (h7.90) -- (h1.-90);
\draw[-stealth, mygreen, thick, decoration={zigzag, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h7.105) -- (h1.-105);
\node[circle, draw, thick, right=10em of h1, opacity=0.8] (hp) {$\vec{h}_1'$};
\coordinate[right=5em of h1] (A);
\draw[-stealth, mymauve, opacity=0.5, ultra thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h1.20) -- (A) -- (hp);
\draw[-stealth, mygreen, opacity=0.5, ultra thick,decoration={zigzag, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (h1.-20) -- (A) -- (hp);
\draw[-stealth, blue, opacity=0.5, ultra thick] (h1.0) -- (A) -- node[black, above, opacity=1.0] {concat/avg} (hp);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\definecolor{mygreen}{HTML}{006400}
\begin{document}
\begin{tikzpicture}[node distance=2.8em]
\node[circle, thick, fill=red, draw] (0) {};
\node[circle, thick, below left=of 0, fill=red, draw] (1) {};
\node[circle, thick, below right=of 0, fill=red, draw] (2) {};
\node[circle, thick, below right=of 1, fill=red, draw] (3) {};
\node[circle, thick, below left=of 3, fill=red, draw] (4) {};
\node[circle, thick, below right=of 3, fill=red, draw] (5) {};
\node[circle, thick, below right=of 4, fill=red, draw] (6) {};
\node[circle, thick, right=of 5, fill=mygreen, draw] (7) {};
\node[circle, thick, above right=of 7, fill=mygreen, draw] (8) {};
\node[circle, thick, below right=of 8, fill=mygreen, draw] (9) {};
\node[circle, thick, below right=of 7, fill=mygreen, draw] (10) {};
\node[circle, thick, below left=of 10, fill=mygreen, draw] (11) {};
\node[circle, thick, below right=of 10, fill=mygreen, draw] (12) {};
\node[circle, thick, above right=of 9, fill=blue, draw] (13) {};
\node[circle, thick, above right=of 13, fill=blue, draw] (16) {};
\node[circle, thick, above left=of 16, fill=blue, draw] (14) {};
\node[circle, thick, above right=of 14, fill=blue, draw] (15) {};
\node[circle, thick, above right=of 16, fill=blue, draw] (17) {};
\node[circle, thick, below right=of 16, fill=blue, draw] (18) {};
\path[-stealth, very thick] (0) edge [->, >=stealth, opacity=0.02, loop above] (0);
\draw[very thick, opacity=0.30, -stealth] (0) -- (1);
\draw[very thick, opacity=0.07, -stealth] (0) -- (2);
\draw[very thick, opacity=0.53, -stealth] (0) -- (3);
\draw[very thick, opacity=0.02, -stealth] (0) -- (4);
\draw[very thick, opacity=0.05, -stealth] (0) -- (5);
\path[-stealth, very thick] (1) edge [->, >=stealth, opacity=0.56, loop left] (1);
\draw[very thick, opacity=0.25, -stealth] (1) -- (2);
\draw[very thick, opacity=0.11, -stealth] (1) -- (3);
\draw[very thick, opacity=0.02, -stealth] (1) -- (4);
\draw[very thick, opacity=0.05, -stealth] (1) -- (5);
\draw[very thick, opacity=0.54, -stealth] (2) -- (1);
\path[-stealth, very thick] (2) edge [->, >=stealth, opacity=0.31, loop right] (2);
\draw[very thick, opacity=0.04, -stealth] (2) -- (3);
\draw[very thick, opacity=0.03, -stealth] (2) -- (4);
\draw[very thick, opacity=0.07, -stealth] (2) -- (5);
\draw[very thick, opacity=0.35, -stealth] (3) -- (1);
\draw[very thick, opacity=0.09, -stealth] (3) -- (2);
\path[-stealth, very thick] (3) edge [->, >=stealth, opacity=0.44, loop right] (3);
\draw[very thick, opacity=0.03, -stealth] (3) -- (4);
\draw[very thick, opacity=0.08, -stealth] (3) -- (5);
\draw[very thick, opacity=0.22, -stealth] (4) -- (1);
\draw[very thick, opacity=0.07, -stealth] (4) -- (2);
\draw[very thick, opacity=0.05, -stealth] (4) -- (3);
\path[-stealth, very thick] (4) edge [->, >=stealth, opacity=0.19, loop left] (4);
\draw[very thick, opacity=0.46, -stealth] (4) -- (5);
\draw[very thick, opacity=0.38, -stealth] (5) -- (1);
\draw[very thick, opacity=0.09, -stealth] (5) -- (2);
\draw[very thick, opacity=0.12, -stealth] (5) -- (3);
\draw[very thick, opacity=0.10, -stealth] (5) -- (4);
\path[-stealth, very thick] (5) edge [->, >=stealth, opacity=0.31, loop below] (5);
\draw[very thick, opacity=0.31, -stealth] (6) -- (1);
\draw[very thick, opacity=0.08, -stealth] (6) -- (2);
\draw[very thick, opacity=0.46, -stealth] (6) -- (3);
\draw[very thick, opacity=0.04, -stealth] (6) -- (4);
\draw[very thick, opacity=0.10, -stealth] (6) -- (5);
\path[-stealth, very thick] (7) edge [->, >=stealth, opacity=0.32, loop above] (7);
\draw[very thick, opacity=0.10, -stealth] (7) -- (8);
\draw[very thick, opacity=0.12, -stealth] (7) -- (9);
\draw[very thick, opacity=0.36, -stealth] (7) -- (10);
\draw[very thick, opacity=0.07, -stealth] (7) -- (11);
\draw[very thick, opacity=0.03, -stealth] (7) -- (12);
\draw[very thick, opacity=0.28, -stealth] (8) -- (7);
\path[-stealth, very thick] (8) edge [->, >=stealth, opacity=0.11, loop above] (8);
\draw[very thick, opacity=0.13, -stealth] (8) -- (9);
\draw[very thick, opacity=0.37, -stealth] (8) -- (10);
\draw[very thick, opacity=0.07, -stealth] (8) -- (11);
\draw[very thick, opacity=0.03, -stealth] (8) -- (12);
\draw[very thick, opacity=0.03, -stealth] (9) -- (7);
\draw[very thick, opacity=0.01, -stealth] (9) -- (8);
\path[-stealth, very thick] (9) edge [->, >=stealth, opacity=0.48, loop above] (9);
\draw[very thick, opacity=0.27, -stealth] (9) -- (10);
\draw[very thick, opacity=0.21, -stealth] (9) -- (11);
\draw[very thick, opacity=0.10, -stealth] (10) -- (7);
\draw[very thick, opacity=0.04, -stealth] (10) -- (8);
\draw[very thick, opacity=0.31, -stealth] (10) -- (9);
\path[-stealth, very thick] (10) edge [->, >=stealth, opacity=0.39, loop right] (10);
\draw[very thick, opacity=0.15, -stealth] (10) -- (11);
\draw[very thick, opacity=0.04, -stealth] (11) -- (7);
\draw[very thick, opacity=0.01, -stealth] (11) -- (8);
\draw[very thick, opacity=0.45, -stealth] (11) -- (9);
\draw[very thick, opacity=0.29, -stealth] (11) -- (10);
\path[-stealth, very thick] (11) edge [->, >=stealth, opacity=0.20, loop left] (11);
\draw[very thick, opacity=0.36, -stealth] (12) -- (7);
\draw[very thick, opacity=0.13, -stealth] (12) -- (8);
\draw[very thick, opacity=0.08, -stealth] (12) -- (9);
\draw[very thick, opacity=0.34, -stealth] (12) -- (10);
\draw[very thick, opacity=0.05, -stealth] (12) -- (11);
\path[-stealth, very thick] (12) edge [->, >=stealth, opacity=0.04, loop right] (12);
\path[-stealth, very thick] (13) edge [->, >=stealth, opacity=0.12, loop below] (13);
\draw[very thick, opacity=0.03, -stealth] (13) -- (14);
\draw[very thick, opacity=0.52, -stealth] (13) -- (16);
\draw[very thick, opacity=0.32, -stealth] (13) -- (17);
\draw[very thick, opacity=0.01, -stealth] (14) -- (13);
\path[-stealth, very thick] (14) edge [->, >=stealth, opacity=0.19, loop left] (14);
\draw[very thick, opacity=0.65, -stealth] (14) -- (16);
\draw[very thick, opacity=0.11, -stealth] (14) -- (17);
\draw[very thick, opacity=0.02, -stealth] (14) -- (18);
\draw[very thick, opacity=0.04, -stealth] (15) -- (13);
\draw[very thick, opacity=0.13, -stealth] (15) -- (14);
\path[-stealth, very thick] (15) edge [->, >=stealth, opacity=0.01, loop right] (15);
\draw[very thick, opacity=0.62, -stealth] (15) -- (16);
\draw[very thick, opacity=0.18, -stealth] (15) -- (17);
\draw[very thick, opacity=0.01, -stealth] (15) -- (18);
\draw[very thick, opacity=0.03, -stealth] (16) -- (13);
\draw[very thick, opacity=0.09, -stealth] (16) -- (14);
\path[-stealth, very thick] (16) edge [->, >=stealth, opacity=0.69, loop below] (16);
\draw[very thick, opacity=0.18, -stealth] (16) -- (17);
\draw[very thick, opacity=0.07, -stealth] (17) -- (13);
\draw[very thick, opacity=0.05, -stealth] (17) -- (14);
\draw[very thick, opacity=0.61, -stealth] (17) -- (16);
\path[-stealth, very thick] (17) edge [->, >=stealth, opacity=0.26, loop right] (17);
\draw[very thick, opacity=0.01, -stealth] (18) -- (13);
\draw[very thick, opacity=0.25, -stealth] (18) -- (14);
\draw[very thick, opacity=0.01, -stealth] (18) -- (15);
\draw[very thick, opacity=0.61, -stealth] (18) -- (16);
\draw[very thick, opacity=0.09, -stealth] (18) -- (17);
\path[-stealth, very thick] (18) edge [->, >=stealth, opacity=0.03, loop below] (18);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{tkz-graph}
\begin{document}
\begin{tikzpicture}[scale=0.8,every node/.style={scale=0.7},font=\tt]
\SetUpEdge[lw = 1.5pt,
color = black,
labelcolor = white]
\GraphInit[vstyle=Normal]
\SetGraphUnit{2.5}
\tikzset{VertexStyle/.append style={fill}}
\Vertex{AT}
\EA(AT){TG}
\EA(TG){GG}
\SO(GG){GC}
\SO(GC){CG}
\WE(CG){GT}
\WE(GT){CA}
\NO(CA){AA}
\tikzset{EdgeStyle/.style={-stealth}}
\Edge[label=ATG](AT)(TG)
\Edge[label=TGG](TG)(GG)
\Edge[label=GGC](GG)(GC)
\Edge[label=GCG](GC)(CG)
\Edge[label=CGT](CG)(GT)
\Edge[label=GTG](GT)(TG)
\Edge[label=TGC](TG)(GC)
\Edge[label=GCA, style={pos=.3}](GC)(CA)
\Edge[label=CAA](CA)(AA)
\Edge[label=AAT](AA)(AT)
\draw[thick, red, dashed] (AT) ++(160:13pt)coordinate(AT1) arc (-200:-340:13pt) coordinate(AT2);
\draw[thick, red, dashed] (TG) ++(160:13pt)coordinate(TG1) arc (-200:-340:13pt) coordinate(TG2);
\draw[thick, red, dashed] (GG) ++(160:13pt)coordinate(GG1) arc (-200:-400:13pt) coordinate(GG2);
\draw[thick, red, dashed] (GC) ++(40:13pt)coordinate(GC1) arc (-320:-400:13pt) coordinate(GC2);
\draw[thick, red, dashed] (CG) ++(40:13pt)coordinate(CG1) arc (-320:-520:13pt) coordinate(CG2);
\draw[thick, red, dashed] (GT) ++(-20:13pt)coordinate(GT1) arc (-380:-580:13pt) coordinate(GT2);
\draw[thick, red, dashed] (TG) ++(-140:13pt)coordinate(TG11) arc (-500:-440:13pt) coordinate(TG12);
\draw[thick, red, dashed] (GC) ++(-550:13pt)coordinate(GC11) arc (-550:-540:13pt) coordinate(GC12);
\draw[thick, red, dashed] (CA) ++(-660:13pt)coordinate(CA1) arc (-660:-590:13pt) coordinate(CA2);
\draw[thick, red, dashed] (AA) ++(-490:13pt)coordinate(AA1) arc (-490:-590:13pt) coordinate(AA2);
\draw[thick, red, dashed] (AT) ++(-490:13pt)coordinate(AT11) arc (-490:-590:13pt) coordinate(AT12);
\draw[thick, red, dashed, rounded corners=3mm] (AT2) --(TG1);
\draw[thick, red, dashed, rounded corners=3mm] (TG2) --(GG1);
\draw[thick, red, dashed, rounded corners=3mm] (GG2) --(GC1);
\draw[thick, red, dashed, rounded corners=3mm] (GC2) --(CG1);
\draw[thick, red, dashed, rounded corners=3mm] (CG2) --(GT1);
\draw[thick, red, dashed, rounded corners=3mm] (GT2) --(TG11);
\draw[thick, red, dashed, rounded corners=3mm] (TG12) --(GC11);
\draw[thick, red, dashed, rounded corners=3mm] (GC12) --(CA1);
\draw[thick, red, dashed, rounded corners=3mm] (CA2) --(AA1);
\draw[thick, red, dashed, rounded corners=3mm] (AA2) --(AT11);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning, decorations.pathmorphing}
\definecolor{mygreen}{rgb}{0,0.6,0}
\definecolor{echodrk}{HTML}{0099cc}
\begin{document}
\begin{tikzpicture}
\node[circle, draw, very thick, fill=echodrk] (11) {};
\node[below = 0.5em of 11] (11c) {$({\bf 0}, G_3)$};
\node[circle, draw, very thick, fill=echodrk, right=3em of 11] (22) {};
\node[below =0.5em of 22] (22c) {$({\bf 1}, G_3)$};
\node[circle, draw, very thick, fill=echodrk, right=3em of 22] (33) {};
\node[below =0.5em of 33] (33c) {$({\bf 2}, G_3)$};
\node[circle, draw, very thick, fill=echodrk, right=3em of 33] (44) {};
\node[below =0.5em of 44] (44c) {$({\bf 3}, G_3)$};
\node[circle, draw, very thick, fill=mygreen, above = 4.5em of 11] (111) {};
\node at ([shift={(0.53,-0.3)}]111.-45) {$({\bf 0}, G_2)$};
\node[circle, draw, very thick, fill=mygreen, right=3em of 111] (222) {};
\node at ([shift={(0.53,-0.3)}]222.-45) {$({\bf 1}, G_2)$};
\node[circle, draw, very thick, fill=mygreen, right=3em of 222] (333) {};
\node at ([shift={(0.53,-0.3)}]333.-45) {$({\bf 2}, G_2)$};
\node[circle, draw, very thick, fill=mygreen, right=3em of 333] (444) {};
\node at ([shift={(0.53,-0.3)}]444.-45) {$({\bf 3}, G_2)$};
\node[circle, draw, very thick, fill=red, above = 4.5em of 111] (1) {};
\node[above = 0.5em of 1] (1c) {$({\bf 0}, G_1)$};
\node[circle, draw, very thick, fill=red, right=3em of 1] (2) {};
\node[above =0.5em of 2] (2c) {$({\bf 1}, G_1)$};
\node[circle, draw, very thick, fill=red, right=3em of 2] (3) {};
\node[above =0.5em of 3] (3c) {$({\bf 2}, G_1)$};
\node[circle, draw, very thick, fill=red, right=3em of 3] (4) {};
\node[above =0.5em of 4] (3c) {$({\bf 3}, G_1)$};
\draw[ultra thick, -, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (11) to (111);
\draw[ultra thick, -, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (22) to (222);
\draw[ultra thick, -, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (33) to (333);
\draw[ultra thick, -, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (44) to (444);
\draw[ultra thick, -, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (1) to (111);
\draw[ultra thick, -, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (2) to (222);
\draw[ultra thick, -, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (3) to (333);
\draw[ultra thick, -, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (4) to (444);
\draw[ultra thick, -, bend right=12, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (1) to (11);
\draw[ultra thick, -, bend right=12, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (2) to (22);
\draw[ultra thick, -, bend right=12, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (3) to (33);
\draw[ultra thick, -, bend right=12, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=0.2mm}, decorate] (4) to (44);
\draw[-, ultra thick, color=echodrk] (11) to (22);
\draw[-, ultra thick, bend right=17, color=echodrk] (11) to (33);
\draw[-, ultra thick, color=echodrk] (33) to (44);
\draw[-, ultra thick, color=mygreen] (111) to (222);
\draw[-, ultra thick, color=mygreen] (222) to (333);
\draw[-, ultra thick, bend left=17, color=red] (1) to (3);
\draw[-, ultra thick, bend left=17, color=red] (1) to (4);
\draw[-, ultra thick, bend right=17, color=red] (2) to (4);
\draw[-, ultra thick, color=red] (2) to (3);
\draw[-, ultra thick, color=red] (3) to (4);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{bm}
\usetikzlibrary{positioning, matrix}
\tikzset{
tablet/.style={
matrix of nodes,
row sep=-\pgflinewidth,
column sep=-\pgflinewidth,
nodes={rectangle,draw=black,text width=1.25ex,align=center},
text height=1.25ex,
text depth=0ex,
nodes in empty cells
},
texto/.style={font=\footnotesize\sffamily},
title/.style={font=\small\sffamily}
}
\begin{document}
\begin{tikzpicture}[node distance=3cm, auto]
\node [rectangle, draw, minimum width=5em, minimum height=7em] (joyp) {\tt JOYP};
\matrix[tablet, draw=none, nodes={draw=none, inner sep = 0.16em}, inner sep=0.1em, left = -0.35cm of joyp] (pt)
{
\node (17){\scriptsize\tt 7}; \\ \node(16){\scriptsize\tt 6}; \\ \node(15){\scriptsize\tt 5}; \\ \node(14){\scriptsize\tt 4}; \\ \node(13){\scriptsize\tt 3}; \\ \node(12){\scriptsize\tt 2}; \\ \node(11){\scriptsize\tt 1}; \\ \node(10){\scriptsize\tt 0};\\
};
\node [circle, inner sep=0, minimum size=0.25em, fill=black, left = 1.2cm of 10] (a) {};
\node [circle, inner sep=0, minimum size=0.25em, fill=black, left = 1.2cm of 11] (b) {};
\node [circle, inner sep=0, minimum size=0.25em, fill=black, left = 1.2cm of 12] (select) {};
\node [circle, inner sep=0, minimum size=0.25em, fill=black, left = 1.2cm of 13] (start) {};
\node [circle, inner sep=0, minimum size=0.25em, fill=black, left = 1cm of a] (right) {};
\node [circle, inner sep=0, minimum size=0.25em, fill=black, left = 1cm of b] (left) {};
\node [circle, inner sep=0, minimum size=0.25em, fill=black, left = 1cm of select] (up) {};
\node [circle, inner sep=0, minimum size=0.25em, fill=black, left = 1cm of start] (down) {};
\node [left = 0.5cm of right] (ra) {};
\node [left = 0.5cm of left] (lb) {};
\node [left = 0.5cm of up] (usel) {};
\node [left = 0.5cm of down] (dst) {};
\node [below = 0.15cm of a] (aa) {};
\node [below = 0.15cm of right] (rr) {};
\draw (ra) -- (right) -- (a) -- (10);
\draw (lb) -- (left) -- (b) -- (11);
\draw (usel) -- (up) -- (select) -- (12);
\draw (dst) -- (down) -- (start) -- (13);
\draw (aa) -- (a) -- node[right] {\tiny\bf A} (b) -- node[right] {\tiny\bf B} (select) -- node[right] {\tiny\bf SELECT} (start) |- node[pos=0.2, right] {\tiny\bf START} (14);
\draw (rr) -- (right) -- node[right] {\tiny $\bm{\rightarrow}$} (left) -- node[right]{\tiny $\bm{\leftarrow}$} (up) -- node[right]{\tiny $\bm{\uparrow}$} (down) |- node[pos=0.1, right]{\tiny $\bm{\downarrow}$} (15);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{braids}
\newcommand{\bond}[3]{
\draw[very thick, #1] (#3, 0) -- (#3, 0.35);
\draw[very thick, densely dotted] (#3, 0.35) -- (#3, 0.65);
\draw[very thick, #2] (#3, 0.65) -- (#3, 1);
}
\begin{document}
\begin{tikzpicture}
\bond{red}{blue}{0.1}
\bond{red}{blue}{0.25}
\bond{red}{blue}{0.4}
\bond{blue}{red}{1.1}
\bond{blue}{red}{1.25}
\bond{blue}{red}{1.4}
\bond{red}{blue}{2.1}
\bond{red}{blue}{2.25}
\bond{red}{blue}{2.4}
\bond{blue}{red}{3.1}
\bond{blue}{red}{3.25}
\bond{blue}{red}{3.4}
\bond{red}{blue}{4.1}
\bond{red}{blue}{4.25}
\bond{red}{blue}{4.4}
\bond{blue}{red}{5.1}
\bond{blue}{red}{5.25}
\bond{blue}{red}{5.4}
\bond{red}{blue}{6.1}
\bond{red}{blue}{6.25}
\bond{red}{blue}{6.4}
\bond{blue}{red}{7.1}
\bond{blue}{red}{7.25}
\bond{blue}{red}{7.4}
\bond{red}{blue}{8.1}
\bond{red}{blue}{8.25}
\bond{red}{blue}{8.4}
\braid[rotate=90,style strands={1}{red, very thick},style strands={2}{blue, very thick}] (tst) at (0, 0) s_1 s_1 s_1 s_1 s_1 s_1 s_1 s_1;
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop,tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\node[circle, draw, thick] (z) {$\vec{z}$};
\node[circle, draw, thick, right=5em of z] (x) {$\vec{x}_{fake}$};
\draw[-stealth, thick] (z) -- node[above] {$G(\vec{z})$} node[below] {generator} (x);
\node[left=of z] (i) {};
\draw[-stealth, thick] (i) -- node[above] {$p_\theta(\vec{z})$} (z);
\node[above=of x, circle, draw, thick] (xt) {$\vec{x}_{real}$};
\node[left=5em of xt] (it) {};
\draw[-stealth, thick] (it) -- node[above] {$p_{data}(\vec{x})$} (xt);
\node[circle, draw, thick, right=5em of x, yshift=2.5em] (D) {$\vec{x}$};
\node[right=7em of D] (out) {real?};
\draw[-stealth, thick] (D) -- node[above] {$D(\vec{x})$} node[below] {discriminator} (out);
\node[right=2.5em of x, circle, fill, inner sep=0.15em] (pt1) {};
\node[right=2.5em of xt, circle, fill, inner sep=0.15em] (pt2) {};
\draw[dashed, thick] (pt1) edge[bend left] (pt2);
\node[circle, draw, thick, fill=white, inner sep=0.15em] at ([xshift=-0.9em, yshift=4em]pt1.north) (pt3) {};
\draw[-stealth, thick] (x) -- (pt1);
\draw[-stealth, thick] (xt) -- (pt2);
\draw[-stealth, thick] (pt3) -- (D);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{calc,decorations.pathmorphing,positioning}
\begin{document}
\begin{tikzpicture}
\node[very thick, densely dashed, draw=black,rectangle, minimum height=3.5em, minimum width=1.5em, xshift=15em, yshift=-1em, fill=lightgray] (rekt1) {};
\node[very thick, densely dashed, draw=black,rectangle, minimum height=3.5em, minimum width=1.5em, xshift=15em, yshift=-6.1em, fill=lightgray] (rekt2) {};
\draw[ultra thick] (rekt1) -- (rekt2);
\node[] (c) at ($(rekt1)!0.5!(rekt2)$) {};
\node[circle, draw, thick] (f11) {};
\node[circle, draw, thick, below=0em of f11] (f12) {};
\node[circle, draw, thick, below=0em of f12] (f13) {};
\node[circle, draw, thick, below=2em of f13] (f21) {};
\node[circle, draw, thick, below=0em of f21] (f22) {};
\node[circle, draw, thick, below=0em of f22] (f23) {};
\node[left=1em of f12] (il1) {$\vec{f}_i$};
\node[left=1em of f22] (il2) {$\vec{f}_j$};
\node[rectangle, draw, thick] (Q) at ($(il1)!0.5!(il2)$) {?};
\draw[ultra thick] (il1) -- (Q);
\draw[ultra thick] (il2) -- (Q);
\draw[dashed, ultra thick] (Q) -- (c);
\node[circle, draw, thick, right=4em of f11] (h11) {};
\node[circle, draw, thick, right=4em of f12] (h12) {};
\node[circle, draw, thick, right=4em of f13] (h13) {};
\node[circle, draw, thick, right=4em of f21] (h21) {};
\node[circle, draw, thick, right=4em of f22] (h22) {};
\node[circle, draw, thick, right=4em of f23] (h23) {};
\node[circle, draw, thick, right=4em of h11] (k11) {};
\node[circle, draw, thick, right=4em of h12] (k12) {};
\node[circle, draw, thick, right=4em of h13] (k13) {};
\node[circle, draw, thick, right=4em of h21] (k21) {};
\node[circle, draw, thick, right=4em of h22] (k22) {};
\node[circle, draw, thick, right=4em of h23] (k23) {};
\node[circle, draw, thick, right=4em of k11] (l11) {};
\node[circle, draw, thick, right=4em of k12] (l12) {};
\node[circle, draw, thick, right=4em of k13] (l13) {};
\node[circle, draw, thick, right=4em of k21] (l21) {};
\node[circle, draw, thick, right=4em of k22] (l22) {};
\node[circle, draw, thick, right=4em of k23] (l23) {};
\node[circle, draw, thick, right=4em of l12] (o1) {};
\node[circle, draw, thick, right=4em of l22] (o2) {};
\node[right=1em of o1] (ll1) {$y_i$};
\node[right=1em of o2] (ll2) {$y_j$};
\foreach \l in {1,2}
\foreach \x in {1,2,3}
\foreach \y in {1,2,3}
\draw[-stealth, thick] (f\l\x) -- (h\l\y);
\foreach \l in {1,2}
\foreach \x in {1,2,3}
\foreach \y in {1,2,3}
\draw[-stealth, thick] (h\l\x) -- (k\l\y);
\foreach \l in {1,2}
\foreach \x in {1,2,3}
\foreach \y in {1,2,3}
\draw[-stealth, thick] (k\l\x) -- (l\l\y);
\foreach \l in {1,2}
\foreach \x in {1,2,3}
\draw[-stealth, thick] (l\l\x) -- (o\l);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{tkz-graph}
\begin{document}
\begin{tikzpicture}[scale=0.8,every node/.style={scale=0.7},font=\tt]
\SetUpEdge[lw = 0.75pt,
color = red,
labelcolor = white]
\GraphInit[vstyle=Normal]
\SetGraphUnit{2}
\tikzset{VertexStyle/.append style={fill=red!50}}
\Vertex{s}
\tikzset{VertexStyle/.append style={fill=white}}
\NOEA(s){2}
\EA(2){4}
\tikzset{VertexStyle/.append style={fill=blue!50}}
\SOEA(4){t}
\tikzset{VertexStyle/.append style={fill=white}}
\EA(s){3}
\EA(3){5}
\SetUpEdge[labeltext=blue]
\tikzset{EdgeStyle/.style={-stealth, color=blue}}
\Edge[label=10/10](s)(2)
\SetUpEdge[labeltext=blue!90]
\tikzset{EdgeStyle/.style={-stealth, color=blue!90}}
\Edge[label=9/10](s)(3)
\SetUpEdge[labeltext=gray]
\tikzset{EdgeStyle/.style={-stealth, color=gray}}
\Edge[label=0/2](2)(3)
\SetUpEdge[labeltext=blue]
\tikzset{EdgeStyle/.style={-stealth, color=blue}}
\Edge[label=4/4](2)(4)
\SetUpEdge[labeltext=blue!75]
\tikzset{EdgeStyle/.style={-stealth, color=blue!75}}
\Edge[label=6/8](2)(5)
\SetUpEdge[labeltext=blue]
\tikzset{EdgeStyle/.style={-stealth, color=blue}}
\Edge[label=9/9](3)(5)
\SetUpEdge[labeltext=blue]
\tikzset{EdgeStyle/.style={-stealth, color=blue}}
\Edge[label=10/10](4)(t)
\SetUpEdge[labeltext=blue]
\tikzset{EdgeStyle/.style={-stealth, color=blue}}
\Edge[label=6/6](5)(4)
\SetUpEdge[labeltext=blue!90]
\tikzset{EdgeStyle/.style={-stealth, color=blue!90}}
\Edge[label=9/10](5)(t)
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\begin{document}
\begin{tikzpicture}[font=\tt\scriptsize, grow=up, level 1/.style={sibling distance=30mm}, level 2/.style={sibling distance=20mm}]
\node[align=center](0){AC{-}{-}A\\CC{-}{-}A\\ACG-A\\A-GTA\\A-G-A}
child{node[align=center]{AGTA\\AG-A}
child{node{AGA}}
child{node{AGTA}}
}
child{node[align=center]{AC-A\\CC-A\\ACGA}
child{node{ACGA}}
child{node[align=center]{ACA\\CCA}
child{node{CCA}}
child{node{ACA}}
}
};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning, decorations.pathmorphing}
\definecolor{mynavy}{HTML}{000080}
\definecolor{darkred}{HTML}{8B0000}
\definecolor{mygreen}{HTML}{006400}
\definecolor{mygold}{HTML}{B8860B}
\newcommand{\myGlobalTransformation}[2]
{
\pgftransformcm{1}{0}{0.4}{0.5}{\pgfpoint{#1cm}{#2cm}}
}
\tikzstyle myBG=[line width=3pt,opacity=1.0]
\begin{document}
\begin{tikzpicture}
\begin{scope}
\myGlobalTransformation{0}{0};
\draw [black!50,fill=red!5] rectangle (8,8);
\end{scope}
\begin{scope}
\myGlobalTransformation{0}{4.25};
\draw [black!50,fill=blue!5] rectangle (8,8);
\end{scope}
\begin{scope}
\myGlobalTransformation{0}{0};
\node (thisNode) at (1,3) {};
{
\pgftransformreset
\draw[white,myBG,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (thisNode) -- ++(0,4.25);
\draw[black,very thick, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,] (thisNode) -- ++(0,4.25);
}
\node (thisNode) at (3,5) {};
{
\pgftransformreset
\draw[white,myBG,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (thisNode) -- ++(0,4.25);
\draw[black,very thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (thisNode) -- ++(0,4.25);
}
\node (thisNode) at (5,7) {};
{
\pgftransformreset
\draw[white,myBG,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (thisNode) -- ++(0,4.25);
\draw[black,very thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (thisNode) -- ++(0,4.25);
}
\node (thisNode) at (7,7) {};
{
\pgftransformreset
\draw[white,myBG,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (thisNode) -- ++(0,4.25);
\draw[black,very thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (thisNode) -- ++(0,4.25);
}
\end{scope}
\begin{scope}
\myGlobalTransformation{0}{0}
\node (N1) at (1,3) [circle,white,fill=mynavy] {$S$};
\node (N2) at (3,5) [circle,white,fill=darkred] {$I$};
\node (N3) at (5,1) [circle,white,fill=mygreen] {$V$};
\node (N4) at (5,7) [circle,white,fill=mynavy] {$S$};
\node (N5) at (7,3) [circle,white,fill=darkred] {$I$};
\node (N6) at (7,7) [circle,white,fill=mynavy] {$S$};
\draw[-, darkred!10, very thick] (N3) -- (N6);
\draw[-, darkred!15, very thick] (N2) -- (N4);
\draw[-, darkred!20, very thick] (N2) -- (N6);
\draw[-, darkred!30, very thick] (N1) -- (N5);
\draw[-, darkred!50, very thick] (N2) -- (N5);
\draw[-, darkred!66, very thick] (N4) -- (N5);
\draw[-, darkred!70, very thick] (N1) -- (N3);
\draw[-, darkred!70, very thick] (N5) -- (N6);
\draw[-, darkred!75, very thick] (N3) -- (N4);
\draw[-, darkred!90, very thick] (N1) -- (N2);
\draw[-, darkred!90, very thick] (N4) -- (N6);
\draw[-, darkred, very thick] (N2) -- (N3);
\draw[-, darkred, very thick] (N3) -- (N5);
\end{scope}
\begin{scope}
\myGlobalTransformation{0}{4.25}
\node (N1) at (1,3) [circle,white,fill=magenta] {$U$};
\node (N2) at (3,5) [circle,white,fill=mygold] {$A$};
\node (N3) at (5,1) [circle,white,fill=mygold] {$A$};
\node (N4) at (5,7) [circle,white,fill=magenta] {$U$};
\node (N5) at (7,3) [circle,white,fill=magenta] {$U$};
\node (N6) at (7,7) [circle,white,fill=mygold] {$A$};
\draw[-, mynavy, very thick] (N1) -- (N2);
\draw[-, mynavy, very thick] (N1) -- (N3);
\draw[-, cyan, very thick] (N1) -- (N5);
\draw[-, blue, very thick] (N2) -- (N3);
\draw[-, mynavy, very thick] (N2) -- (N4);
\draw[-, mynavy, very thick] (N2) -- (N5);
\draw[-, blue, very thick] (N2) -- (N6);
\draw[-, mynavy, very thick] (N3) -- (N4);
\draw[-, mynavy, very thick] (N3) -- (N5);
\draw[-, blue, very thick] (N3) -- (N6);
\draw[-, cyan, very thick] (N4) -- (N5);
\draw[-, mynavy, very thick] (N4) -- (N6);
\draw[-, mynavy, very thick] (N5) -- (N6);
\end{scope}
\begin{scope}
\myGlobalTransformation{0}{0};
\node (thisNode) at (5,1) {};
{
\pgftransformreset
\draw[white,myBG,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (thisNode) -- ++(0,4.25);
\draw[black,very thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (thisNode) -- ++(0,4.25);
}
\node (thisNode) at (7,3) {};
{
\pgftransformreset
\draw[white,myBG,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (thisNode) -- ++(0,4.25);
\draw[black,very thick,decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate] (thisNode) -- ++(0,4.25);
}
\end{scope}
\begin{scope}
\myGlobalTransformation{0}{0}
\node (N3) at (5,1) [circle,white,fill=mygreen] {$V$};
\node (N5) at (7,3) [circle,white,fill=darkred] {$I$};
\end{scope}
\begin{scope}
\myGlobalTransformation{0}{4.25}
\node (N3) at (5,1) [circle,white,fill=mygold] {$A$};
\node (N5) at (7,3) [circle,white,fill=magenta] {$U$};
\end{scope}
\draw[-stealth, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,ultra thick] (0, 0.2) -- node [above=1em,rotate=90] {self-awareness} (0, 4);
\draw[-stealth, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,ultra thick] (11.3, 8.1) -- node [above=1em,rotate=-90] {immunisation} (11.3, 4.2);
\node at (10, 0.3) {\emph{\textbf{epidemics layer}}};
\node at (1.2, 8) {\emph{\textbf{awareness layer}}};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{calc}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\begin{document}
\begin{tikzpicture}[scale=0.85]
% Axis
\draw[thick,-stealth,black] (-3,0)--(3,0) coordinate (A) node[below] {$x$}; % x axis
\draw[thick,-stealth,black] (0,-3)--(0,3) node[left] {$y$}; % y axis
\draw[black,thin] (0,0) circle (2.5cm);
\draw[ultra thick,red] (0,0) -- (60:2.5cm |- 0,0) node[midway,below] {$x$}; % UpOn y axis
\draw (1,0) arc (0:60:1) node at ($(60/2:0.7)$) {$\alpha$};
\draw[ultra thick, blue] (60:2.5cm) -- (60:2.5cm |- 0,0) node[midway,right] {$y$}; % vertical line
\draw[ultra thick,olivegreen,rotate=60] (0,0) -- node [left] {$r$} (2.5,0) coordinate (B);
\draw[xshift=-1cm] (B) node[circle,fill,inner sep=1pt,label=above:$P$](e){};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning, matrix, backgrounds}
\tikzstyle{block} = [rectangle, draw, fill=blue!20,
text width=5em, text centered, rounded corners, minimum height=4em]
\definecolor{mygreen}{rgb}{0,0.6,0}
\definecolor{echodrk}{HTML}{0099cc}
\begin{document}
\begin{tikzpicture}[node distance=3cm, auto]
\draw[opacity=0] (-6, -3.5) rectangle (4, 3.3);
\begin{scope}[shift={(-4,-2)},transform canvas={scale=0.7}]
\node [block, color=black, very thick, fill=lightgray!70, minimum height=15em, text width=20em] (cpu) {};
\node [above left] (lab) at (cpu.south east) {\LARGE \bf CPU};
\node [below right=2.5em, block, color=black, very thick, fill=lightgray!30, minimum height=2em, inner sep=0em, text width=2em] (PC) at (cpu.north west) {\tt 13};
\node[below=0.1em of PC] (lPC) {\tt PC};
\node [right=1em of PC, block, color=black, very thick, fill=lightgray!30, minimum height=2em, inner sep=0em, text width=2em] (SP) {\tt 25};
\node[below=0.1em of SP] (lSP) {\tt SP};
\node [right=1em of SP, block, color=black, very thick, fill=lightgray!30, minimum height=2em, inner sep=0em, text width=2em] (A) {\tt 1};
\node[below=0.1em of A] (lA) {\tt A};
\node [right=1em of A, block, color=black, very thick, fill=lightgray!30, minimum height=2em, inner sep=0em, text width=2em] (B) {\tt 7};
\node[below=0.1em of B] (lB) {\tt B};
\node [right=1em of B, block, color=black, very thick, fill=lightgray!30, minimum height=2em, inner sep=0em, text width=2em] (C) {\tt 3};
\node[below=0.1em of C] (lC) {\tt C};
\node [right=0.6em of C] (etc) {\Huge \dots};
\node [below=1.5em of PC, block, color=black, very thick, fill=lightgray!30, minimum height=2em, inner sep=0em, text width=2em] (ZF) {\tt F};
\node[below=0.1em of ZF] (lZF) {\tt ZF};
\node [right=1em of ZF, block, color=black, very thick, fill=lightgray!30, minimum height=2em, inner sep=0em, text width=2em] (OF) {\tt T};
\node[below=0.1em of OF] (lOF) {\tt OF};
\node [right=1em of OF, block, color=black, very thick, fill=lightgray!30, minimum height=2em, inner sep=0em, text width=2em] (HCF) {\tt F};
\node[below=0.1em of HCF] (lHCF) {\tt HCF};
\node [right=1em of HCF, block, color=black, very thick, fill=lightgray!30, minimum height=2em, inner sep=0em, text width=2em] (CF) {\tt F};
\node[below=0.1em of CF] (lCF) {\tt CF};
\node [right=1em of CF, block, color=black, very thick, fill=lightgray!30, minimum height=2em, inner sep=0em, text width=5em] (tkz) {\tt 15739};
\node[below=0.1em of tkz] (ltkz) {\tt ticks};
\coordinate (PC) at (-0.5, 2);
\coordinate (A) at (1.1, 2);
\coordinate (ZF) at (-0.5, 0.6);
\coordinate (OF) at (0.3, 0.6);
\coordinate (HCF) at (1.1, 0.6);
\coordinate (CF) at (1.9, 0.6);
\coordinate (tkz) at (3.4, 1.0);
\end{scope}
\begin{scope}[font=\ttfamily, array/.style={matrix of nodes,nodes={draw, minimum size=7mm, fill=green!30},column sep=-\pgflinewidth, row sep=0.5mm, nodes in empty cells, row 2/.style={nodes={draw=none, fill=none, minimum size=5mm}}}, shift={(-2.9,2)},transform canvas={scale=1.0}]
\matrix[array,ampersand replacement=\&] (array) {
6 \& 12 \& 1 \& 214 \& 5 \& 0 \& 255 \& 4 \\
{\tiny \dots} \& 9 \& 10 \& 11 \& 12 \& 13 \& 14 \& {\tiny \dots}\\};
\begin{scope}[on background layer]
\fill[green!10] (array-2-1.north west) rectangle (array-2-8.south east);
\end{scope}
\draw[<->, opacity=0.0]([yshift=0mm]array-1-1.north west) -- node[above,color=black, opacity=1.0] {Memory} ([yshift=0mm]array-1-8.north east);
\node[draw, fill=red, opacity=0.5, minimum size=6mm] at (array-1-5) (box) {};
\draw (array-2-8.east)--++(0:3mm) node [right]{Address};
\draw[-stealth, ultra thick, red] (PC) -- (array-2-5);
\node[] (subi) at (6, -2) {\tt Sub(A, \textcolor{red}{5})};
\draw[-stealth, ultra thick, mygreen] (box) -- (subi);
\path[-stealth, ultra thick, echodrk] (subi.west) edge[bend right=20] (A);
\path[-stealth, ultra thick, echodrk] (subi.west) edge[bend right=20] (PC);
\draw[-stealth, ultra thick, echodrk] (subi) -- (tkz);
\path[-stealth, ultra thick, echodrk] (subi) edge[bend left=65] (ZF);
\path[-stealth, ultra thick, echodrk] (subi) edge[bend left=65] (OF);
\path[-stealth, ultra thick, echodrk] (subi) edge[bend left=65] (HCF);
\path[-stealth, ultra thick, echodrk] (subi) edge[bend left=65] (CF);
\end{scope}
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{matrix, positioning}
\begin{document}
\begin{tikzpicture}
\matrix (mtr) [matrix of nodes,row sep=-\pgflinewidth, nodes={draw}]
{
0 & 1 & 1 & |[fill=red!30]| 1 & |[fill=red!30]| 0 & |[fill=red!30]| 0 & 0\\
0 & 0 & 1 & |[fill=red!30]| 1 & |[fill=red!30]| 1 & |[fill=red!30]| 0 & 0\\
0 & 0 & 0 & |[fill=red!30]| 1 & |[fill=red!30]| 1 & |[fill=red!30]| 1 & 0\\
0 & 0 & 0 & 1 & 1 & 0 & 0\\
0 & 0 & 1 & 1 & 0 & 0 & 0\\
0 & 1 & 1 & 0 & 0 & 0 & 0\\
1 & 1 & 0 & 0 & 0 & 0 & 0\\
};
\draw[very thick, red] (mtr-1-4.north west) rectangle (mtr-3-6.south east);
\node [below= of mtr-5-4.south] (lm) {$\bf I$};
\node[right = 0.2em of mtr] (str) {$*$};
\matrix (K) [right=0.2em of str,matrix of nodes,row sep=-\pgflinewidth, nodes={draw, fill=blue!30}]
{
1 & 0 & 1 \\
0 & 1 & 0 \\
1 & 0 & 1 \\
};
\node [below = of K-3-2.south] (lk) {$\bf K$};
\node [right = 0.2em of K] (eq) {$=$};
\matrix (ret) [right=0.2em of eq,matrix of nodes,row sep=-\pgflinewidth, nodes={draw}]
{
1 & 4 & 3 & |[fill=green!30]| 4 & 1\\
1 & 2 & 4 & 3 & 3\\
1 & 2 & 3 & 4 & 1\\
1 & 3 & 3 & 1 & 1\\
3 & 3 & 1 & 1 & 0\\
};
\node [below = of ret-4-3.south] (lim) {${\bf I} * {\bf K}$};
\draw[very thick, green] (ret-1-4.north west) rectangle (ret-1-4.south east);
\draw[densely dotted, blue, thick] (mtr-1-4.north west) -- (K-1-1.north west);
\draw[densely dotted, blue, thick] (mtr-3-4.south west) -- (K-3-1.south west);
\draw[densely dotted, blue, thick] (mtr-1-6.north east) -- (K-1-3.north east);
\draw[densely dotted, blue, thick] (mtr-3-6.south east) -- (K-3-3.south east);
\draw[densely dotted, green, thick] (ret-1-4.north west) -- (K-1-1.north west);
\draw[densely dotted, green, thick] (ret-1-4.south west) -- (K-3-1.south west);
\draw[densely dotted, green, thick] (ret-1-4.north east) -- (K-1-3.north east);
\draw[densely dotted, green, thick] (ret-1-4.south east) -- (K-3-3.south east);
\matrix (K) [right=0.2em of str,matrix of nodes,row sep=-\pgflinewidth, nodes={draw, fill=blue!10}]
{
1 & 0 & 1 \\
0 & 1 & 0 \\
1 & 0 & 1 \\
};
\draw[very thick, blue] (K-1-1.north west) rectangle (K-3-3.south east);
\node[anchor=south east, inner sep=0.01em, blue] at (mtr-1-4.south east) (xx) {\scalebox{.5}{$\times 1$}};
\node[anchor=south east, inner sep=0.01em, blue] at (mtr-1-5.south east) (xx) {\scalebox{.5}{$\times 0$}};
\node[anchor=south east, inner sep=0.01em, blue] at (mtr-1-6.south east) (xx) {\scalebox{.5}{$\times 1$}};
\node[anchor=south east, inner sep=0.01em, blue] at (mtr-2-4.south east) (xx) {\scalebox{.5}{$\times 0$}};
\node[anchor=south east, inner sep=0.01em, blue] at (mtr-2-5.south east) (xx) {\scalebox{.5}{$\times 1$}};
\node[anchor=south east, inner sep=0.01em, blue] at (mtr-2-6.south east) (xx) {\scalebox{.5}{$\times 0$}};
\node[anchor=south east, inner sep=0.01em, blue] at (mtr-3-4.south east) (xx) {\scalebox{.5}{$\times 1$}};
\node[anchor=south east, inner sep=0.01em, blue] at (mtr-3-5.south east) (xx) {\scalebox{.5}{$\times 0$}};
\node[anchor=south east, inner sep=0.01em, blue] at (mtr-3-6.south east) (xx) {\scalebox{.5}{$\times 1$}};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{amsmath}
\usepackage{amssymb}
\usepackage{xcolor}
\usetikzlibrary{positioning, decorations.pathmorphing}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\begin{document}
\begin{tikzpicture}
\path[rounded corners, fill=blue, fill opacity=0.2] (-0.4, 3.5) -- (-0.4, -3.5) -- (4, -3.5) -- (4, -0.2) -- (5, -0.2) -- (5, 3.5) -- (-0.4, 3.5) -- (-0.4, 0);
\path[rounded corners, fill=red, fill opacity=0.2] (-0.4, -3.5) -- (-0.4, 3.5) -- (4, 3.5) -- (4, -0.2) -- (5, -0.2) -- (5, -3.5) -- (-0.4, -3.5) -- (-0.4, 0);
\path[rounded corners, fill=white] (-0.4, 0) -- (-0.4, -3.5) -- (4, -3.5) -- (4, 3.5) -- (-0.4, 3.5) -- (-0.4, 0);
\path[rounded corners, fill=olivegreen, fill opacity=0.2] (-0.4, 0) -- (-0.4, -3.5) -- (4, -3.5) -- (4, 3.5) -- (-0.4, 3.5) -- (-0.4, 0);
\path [draw, dashed, very thick, rectangle, rounded corners] (-0.4, 0) -- (-0.4, -3.5) -- (5, -3.5) -- (5, 3.5) -- (-0.4, 3.5) -- (-0.4, 0);
\node[circle, thick, fill=white, draw] (x1) {};
\node[circle, thick, draw, fill=white, below=1em of x1] (x2) {};
\node[circle, thick, fill=white, draw, below=1em of x2] (x3) {};
\node[circle, thick, fill=white, draw, below=1em of x3] (x4) {};
\node[circle, thick, fill=white, draw, below=1em of x4] (x5) {};
\node[circle, thick, fill=white, draw, above=1em of x1] (x6) {};
\node[circle, thick, fill=white, draw, above=1em of x6] (x7) {};
\node[circle, thick, fill=white, draw, above=1em of x7] (x8) {};
\node[circle, thick, fill=white, draw, above=1em of x8] (x9) {};
\node[circle, thick, right=4em of x1, fill=white, draw] (xhh1) {};
\node[circle, thick, draw, fill=white, below=1em of xhh1] (xhh2) {};
\node[circle, thick, fill=white, draw, below=1em of xhh2] (xhh3) {};
\node[circle, thick, fill=white, draw, below=1em of xhh3] (xhh4) {};
\node[circle, thick, fill=white, draw, above=1em of xhh1] (xhh5) {};
\node[circle, thick, fill=white, draw, above=1em of xhh5] (xhh6) {};
\node[circle, thick, fill=white, draw, above=1em of xhh6] (xhh7) {};
\node[circle, thick, right=8em of x1, fill=white, draw] (xh1) {};
\node[circle, thick, draw, fill=white, below=1em of xh1] (xh2) {};
\node[circle, thick, fill=white, draw, below=1em of xh2] (xh3) {};
\node[circle, thick, fill=white, draw, below=1em of xh3] (xh4) {};
\node[circle, thick, fill=white, draw, above=1em of xh1] (xh5) {};
\node[circle, thick, fill=white, draw, above=1em of xh5] (xh6) {};
\node[circle, thick, fill=white, draw, above=1em of xh6] (xh7) {};
\node[circle, very thick, fill=blue!30, draw, right=12em of x1, yshift=5em] (hm1) {};
\node[circle, very thick, draw, fill=blue!30, below=0.5em of hm1] (hm2) {};
\node[circle, very thick, draw, fill=blue!30, below=0.5em of hm2] (hm3) {};
\node[circle, very thick, draw, fill=blue!30, above=0.5em of hm1] (hm4) {};
\node[circle, very thick, draw, fill=blue!30, above=0.5em of hm4] (hm5) {};
\node[circle, very thick, fill=red!30, draw, right=12em of x1, yshift=-5em] (hs1) {};
\node[right=1.5em of hm1, blue] (mu1) {$\pi_\theta(s, \alpha_3)$};
\node[right=1.5em of hm2, blue] (mu2) {$\pi_\theta(s, \alpha_4)$};
\node[right=1.5em of hm3, blue] (mu3) {$\pi_\theta(s, \alpha_5)$};
\node[right=1.5em of hm4, blue] (mu4) {$\pi_\theta(s, \alpha_2)$};
\node[right=1.5em of hm5, blue] (mu5) {$\pi_\theta(s, \alpha_1)$};
\node[right=1.5em of hs1, red] (s1) {$V_\psi(s)$};
\foreach \x in {1,...,9}
\foreach \y in {1,...,7}
\draw[-stealth, thick] (x\x) -- (xhh\y);
\foreach \x in {1,...,7}
\foreach \y in {1,...,7}
\draw[-stealth, thick] (xhh\x) -- (xh\y);
\foreach \x in {1,...,7}
\foreach \y in {1,...,5}
\draw[-stealth, thick, blue] (xh\x) -- (hm\y);
\foreach \x in {1,...,7}
\draw[-stealth, thick, red] (xh\x) -- (hs1);
\draw[-stealth, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate, thick, red] (hs1) -- (s1);
\foreach \x in {1,...,5}
\draw[-stealth, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate, thick, blue] (hm\x) -- (mu\x);
\node[left=0.75em of x1] (l1) {$s$};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{decorations.pathmorphing}
\definecolor{bluport}{HTML}{21ADFD}
\definecolor{orgport}{HTML}{E37322}
\definecolor{pplport}{HTML}{4F21E9}
\definecolor{redport}{HTML}{701315}
\begin{document}
\begin{tikzpicture}
\fill[pplport!15] (0, 0) ellipse (0.25 and 3);
\fill[redport!15] (2.75, -3) rectangle (3.25, 3);
\fill[bluport!15] (6, 0) ellipse (0.25 and 3);
\fill[orgport!15] (9, 0) ellipse (0.25 and 3);
\draw[thick, pplport] (0, 0) ellipse (0.25 and 3);
\draw[ultra thick, pplport, decorate, decoration={snake, segment length=1mm, amplitude=0.3mm}] (0, 0) ellipse (0.23 and 3.05);
\node[text height=1em, text depth=1em, pplport] (1) at (0, -3.5) {\emph{stash}};
\draw[ultra thick, redport] (2.75, -3) rectangle (3.25, 3);
\node[text height=1em, text depth=1em, redport] (2) at (3, -3.5) {\emph{working directory}};
\draw[thick, orgport] (9, 0) ellipse (0.25 and 3);
\draw[ultra thick, orgport, decorate, decoration={snake, segment length=1mm, amplitude=0.3mm}] (9, 0) ellipse (0.23 and 3.05);
\node[text height=1em, text depth=1em, orgport] (4) at (9, -3.5) {\emph{repository}};
\draw[-stealth, very thick] (6, 2) -- node[above] {\tt\footnotesize git commit} (9, 2);
\draw[-stealth, very thick] (9, 1) -- node[above] {\tt\footnotesize git checkout} (6, 1);
\draw[-stealth, very thick] (9, 0) -- node[above] {\tt\footnotesize git reset} (6, 0);
\draw[very thick] (6, -2) -- node[above] {\tt\scriptsize git diff -{}-staged} (9, -2);
\draw[very thick] (3, -2.5) -- node[above, pos=0.75] {\tt\scriptsize git diff HEAD} (9, -2.5);
\draw[-stealth, very thick] (9, -0.5) -- node[above, pos=0.25] {\tt\footnotesize git rebase} (3, -0.5);
\draw[-stealth, very thick] (9, -1) -- node[above, pos=0.25] {\tt\footnotesize git merge} (3, -1);
% draw the blue portal here for the portal effect
\draw[thick, bluport] (6, 0) ellipse (0.25 and 3);
\draw[ultra thick, bluport, decorate, decoration={snake, segment length=1mm, amplitude=0.3mm}] (6, 0) ellipse (0.23 and 3.05);
\node[text height=1em, text depth=1em, bluport] (3) at (6, -3.5) {\emph{index}};
% Redraw some lines for piercing effect through blu port
\draw[-stealth, very thick] (6, -0.5) -- (3, -0.5);
\draw[-stealth, very thick] (6, -1) -- (3, -1);
\draw[very thick] (3, -2.5) -- (6, -2.5);
\draw[-stealth, very thick] (3, 2.5) -- node[above] {\tt\footnotesize git add/rm} (6, 2.5);
\draw[-stealth, very thick] (3, 1.5) -- node[above] {\tt\footnotesize git stash save} (0, 1.5);
\draw[-stealth, very thick] (6, 1) -- node[above] {\tt\footnotesize git checkout} (3, 1);
\draw[-stealth, very thick] (0, 0.5) -- node[above] {\tt\footnotesize git stash pop} (3, 0.5);
\draw[-stealth, very thick] (0, -0.5) -- node[above] {\tt\footnotesize git stash apply} (3, -0.5);
\draw[very thick] (3, -1.5) -- node[above] {\tt\footnotesize git diff} (6, -1.5);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{pgfplots}
\begin{document}
\begin{tikzpicture}[cross/.style={path picture={
\draw[black] (path picture bounding box.south east) -- (path picture bounding box.north west) (path picture bounding box.south west) -- (path picture bounding box.north east);
}}]
\node[rectangle, align=center] (fm) at (-2, 0) {\begin{tikzpicture}[samples=1000, domain=0:5]
\begin{axis}[
hide axis,
width=4cm, height=2cm,
xtick=\empty,
ytick=\empty,
xlabel=\empty,
ylabel=\empty,
xmin=0, xmax=5,
ymin=-2.1, ymax=2.1,
trig format = rad
]
\addplot expression [no markers, smooth, thick, black] {2*sin(2*pi*3*x - 8*cos(2*pi*0.25*x))};
\end{axis}
\end{tikzpicture}\\ $FM(t)$};
\node[rectangle, align=center] (cos) at (1, -3) {\tikz \draw[x=1.5ex, y=1ex, thick] (0, 0) sin (0.5, 0.5) cos (1, 0) sin (1.5, -0.5) cos (2, 0) sin (2.5, 0.5) cos (3, 0) sin (3.5, -0.5) cos (4, 0) sin (4.5, 0.5) cos (5, 0) sin (5.5, -0.5) cos (6, 0);\\ $\cos(2\pi f t)$};
\node[circle, draw, cross, thick] (mul1) at (1, -0.7) {};
\node[circle, draw, cross, thick] (mul2) at (2, 1.3) {};
\node[rectangle, draw, thick] (rot) at (2, 0.3) {$-90^\circ$};
\node[rectangle] (it) at (3, -1) {$I(t)$};
\node[rectangle] (qt) at (3, 1.6) {$Q(t)$};
\node[rectangle, draw, thick, align=center] (lp1) at (4.75, -0.7) {\tikz \draw[x=3.5ex, y=1ex, thick] (0, 0) sin (0.5, 0.5) cos (1, 0) sin (1.5, -0.5) cos (2, 0) (0.6, -0.5) -- (1.4, 0.5);\\ \tikz \draw[x=3.5ex, y=1ex, thick] (0, 0) sin (0.5, 0.5) cos (1, 0) sin (1.5, -0.5) cos (2, 0);};
\node[rectangle, draw, thick, align=center] (lp2) at (4.75, 1.3) {\tikz \draw[x=3.5ex, y=1ex, thick] (0, 0) sin (0.5, 0.5) cos (1, 0) sin (1.5, -0.5) cos (2, 0) (0.6, -0.5) -- (1.4, 0.5);\\ \tikz \draw[x=3.5ex, y=1ex, thick] (0, 0) sin (0.5, 0.5) cos (1, 0) sin (1.5, -0.5) cos (2, 0);};
\node[rectangle, draw, thick] (samp1) at (7.25, -0.7) {sample};
\node[rectangle, draw, thick] (samp2) at (7.25, 1.3) {sample};
\node[rectangle] (in) at (8.5, -1) {$I_n$};
\node[rectangle] (qn) at (8.5, 1.6) {$Q_n$};
\draw[thick, -stealth] (-0.65, 0.3) -- (0, 0.3) |- (mul1);
\draw[thick, -stealth] (0, 0.3) |- (mul2);
\draw[thick, -stealth] (cos) -- (mul1);
\draw[thick, -stealth] (1, -1.85) -| (rot);
\draw[thick, -stealth] (rot) -- (mul2);
\draw[thick] (mul1) -- (1.9, -0.7);
\draw[thick] (1.89, -0.7) sin (2, -0.6) cos (2.11, -0.7);
\draw[thick, -stealth] (2.1, -0.7) -- (lp1);
\draw[thick, -stealth] (mul2) -- (lp2);
\draw[thick, -stealth] (lp1) -- (samp1);
\draw[thick, -stealth] (lp2) -- (samp2);
\draw[thick] (samp1) -| (9, 0.3);
\draw[thick] (samp2) -| (9, 0.3);
\draw[thick, -stealth] (9, 0.3) -- node[below] {$(I_n, Q_n)$} (11, 0.3);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{pgfplots}
\usepackage{amsbsy}
\usetikzlibrary{automata, chains, decorations.pathmorphing, positioning}
\definecolor{echodrk}{HTML}{0099cc}
\begin{document}
\begin{tikzpicture} [scale=1.3, every node/.style={transform shape},start chain=1 going right, start chain=2 going right]
\node[state, fill=red!20, on chain=1, very thick, text depth=0pt] (1) {$s_0$};
\node[state, fill=red!20, on chain=1, very thick, text depth=0pt] (2) {$s_1$};
\node[state, fill=red!20, on chain=1, very thick, text depth=0pt] (3) {$s_2$};
\node[on chain=1] (md) {\dots};
\node[state, fill=red!20, on chain=1, very thick, text depth=0pt] (n) {$s_n$};
\draw[>=stealth, color=red, text=black, very thick, auto=right,loop above/.style={out=75,in=105,loop}, every loop]
(1) edge node[above] {\footnotesize$\boldsymbol \omega_{11}$} (2)
(2) edge node[above] {\footnotesize$\boldsymbol \omega_{11}$} (3)
(3) edge node[above] {\footnotesize$\boldsymbol \omega_{11}$} (md)
(md) edge node[above] {\footnotesize$\boldsymbol \omega_{11}$} (n);
\node[rectangle, thick, fill=red!20, draw] at (-2, 1.7) (y1) {$id_0$};
\node[rectangle, thick, fill=red!20, draw] at (0, 1.7) (y2) {$id_1$};
\node[rectangle, thick, fill=red!20, draw] at (2, 1.7) (y3) {$id_2$};
\node at (4, 1.7) (ymd) {\dots};
\node[rectangle, thick, fill=red!20, draw] at (6, 1.7) (yn) {$id_n$};
\draw[-stealth, color=red, text=black, very thick, dashed]
(1) edge node[right] {${\bf O'}_{0,id_0}^1$} (y1)
(2) edge node[right] {${\bf O'}_{1,id_1}^1$} (y2)
(3) edge node[right] {${\bf O'}_{2,id_2}^1$} (y3)
(n) edge node[right] {${\bf O'}_{n,id_n}^1$} (yn);
\node[rectangle, fill=red!20, draw, scale=0.2, minimum size=20em,above = 2cm of y1] at (-1, 2) (gauss1) {
\begin{tikzpicture}
\begin{axis}[axis lines=none, ticks=none,xmax=3, xmin=-3,ymax=1.1]
\addplot[ultra thick,black, no markers,samples=200] {exp(-x^2)};
\end{axis}
\end{tikzpicture}
};
\node[rectangle, fill=red!20, draw, scale=0.2, minimum size=20em,above = 2cm of y2] at (1, 2) (gauss2) {
\begin{tikzpicture}
\begin{axis}[axis lines=none, ticks=none,xmax=3, xmin=-3,ymax=1.1]
\addplot[ultra thick,black, no markers,samples=200] {exp(-x^2)};
\end{axis}
\end{tikzpicture}
};
\node[rectangle, fill=red!20, draw, scale=0.2, minimum size=20em,above = 2cm of y3] at (3, 2) (gauss3) {
\begin{tikzpicture}
\begin{axis}[axis lines=none, ticks=none,xmax=3, xmin=-3,ymax=1.1]
\addplot[ultra thick,black, no markers,samples=200] {exp(-x^2)};
\end{axis}
\end{tikzpicture}
};
\node at (5, 4.7) (gaussmd) {\dots};
\node[rectangle, fill=red!20, draw, scale=0.2, minimum size=20em,above = 2cm of yn] at (7, 2) (gaussn) {
\begin{tikzpicture}
\begin{axis}[axis lines=none, ticks=none,xmax=3, xmin=-3,ymax=1.1]
\addplot[ultra thick,black, no markers,samples=200] {exp(-x^2)};
\end{axis}
\end{tikzpicture}
};
\draw[-stealth, color=red, text=black, very thick, dotted]
(y1) edge node[left] {$\mu_{id_0}^1$} node[right] {$\sigma_{id_0}^1$} (gauss1)
(y2) edge node[left] {$\mu_{id_1}^1$} node[right] {$\sigma_{id_1}^1$} (gauss2)
(y3) edge node[left] {$\mu_{id_2}^1$} node[right] {$\sigma_{id_2}^1$} (gauss3)
(yn) edge node[left] {$\mu_{id_n}^1$} node[right] {$\sigma_{id_n}^1$} (gaussn);
%%%%%% BOUNDARY %%%%%%%
%%%%%% BOUNDARY %%%%%%%
\node[state, fill=echodrk!20, on chain=2, very thick, text depth=0pt] (21) at (0, -2) {$s_0$};
\node[state, fill=echodrk!20, on chain=2, very thick, text depth=0pt] (22) {$s_1$};
\node[state, fill=echodrk!20, on chain=2, very thick, text depth=0pt] (23) {$s_2$};
\node[on chain=2] (2md) {\dots};
\node[state, fill=echodrk!20, on chain=2, very thick, text depth=0pt] (2n) {$s_n$};
\draw[>=stealth, color=blue, text=black, very thick, auto=right,loop above/.style={out=75,in=105,loop}, every loop]
(21) edge node[below] {\footnotesize$\boldsymbol \omega_{22}$} (22)
(22) edge node[below] {\footnotesize$\boldsymbol \omega_{22}$} (23)
(23) edge node[below] {\footnotesize$\boldsymbol \omega_{22}$} (2md)
(2md) edge node[below] {\footnotesize$\boldsymbol \omega_{22}$} (2n);
\node[rectangle, thick, fill=echodrk!20, draw] at (-2, -3.7) (2y1) {$id_0$};
\node[rectangle, thick, fill=echodrk!20, draw] at (0, -3.7) (2y2) {$id_1$};
\node[rectangle, thick, fill=echodrk!20, draw] at (2, -3.7) (2y3) {$id_2$};
\node at (4, -3.7) (2ymd) {\dots};
\node[rectangle, thick, fill=echodrk!20, draw] at (6, -3.7) (2yn) {$id_n$};
\draw[-stealth, color=blue, text=black, very thick, dashed]
(21) edge node[right] {${\bf O'}_{0,id_0}^2$} (2y1)
(22) edge node[right] {${\bf O'}_{1,id_1}^2$} (2y2)
(23) edge node[right] {${\bf O'}_{2,id_2}^2$} (2y3)
(2n) edge node[right] {${\bf O'}_{n,id_n}^2$} (2yn);
\node[rectangle, fill=echodrk!20, draw, scale=0.2, minimum size=20em,above = 2cm of 2y1] at (-1, -9.5) (2gauss1) {
\begin{tikzpicture}
\begin{axis}[axis lines=none, ticks=none,xmax=3, xmin=-3,ymax=1.1]
\addplot[ultra thick,black, no markers,samples=200] {exp(-x^2)};
\end{axis}
\end{tikzpicture}
};
\node[rectangle, fill=echodrk!20, draw, scale=0.2, minimum size=20em,above = 2cm of 2y2] at (1, -9.5) (2gauss2) {
\begin{tikzpicture}
\begin{axis}[axis lines=none, ticks=none,xmax=3, xmin=-3,ymax=1.1]
\addplot[ultra thick,black, no markers,samples=200] {exp(-x^2)};
\end{axis}
\end{tikzpicture}
};
\node[rectangle, fill=echodrk!20, draw, scale=0.2, minimum size=20em,above = 2cm of 2y3] at (3, -9.5) (2gauss3) {
\begin{tikzpicture}
\begin{axis}[axis lines=none, ticks=none,xmax=3, xmin=-3,ymax=1.1]
\addplot[ultra thick,black, no markers,samples=200] {exp(-x^2)};
\end{axis}
\end{tikzpicture}
};
\node at (5, -6.8) (2gaussmd) {\dots};
\node[rectangle, fill=echodrk!20, draw, scale=0.2, minimum size=20em,above = 2cm of 2yn] at (7, -9.5) (2gaussn) {
\begin{tikzpicture}
\begin{axis}[axis lines=none, ticks=none,xmax=3, xmin=-3,ymax=1.1]
\addplot[ultra thick,black, no markers,samples=200] {exp(-x^2)};
\end{axis}
\end{tikzpicture}
};
\draw[-stealth, color=blue, text=black, very thick, dotted]
(2y1) edge node[left] {$\mu_{id_0}^2$} node[right] {$\sigma_{id_0}^2$} (2gauss1)
(2y2) edge node[left] {$\mu_{id_1}^2$} node[right] {$\sigma_{id_1}^2$} (2gauss2)
(2y3) edge node[left] {$\mu_{id_2}^2$} node[right] {$\sigma_{id_2}^2$} (2gauss3)
(2yn) edge node[left] {$\mu_{id_n}^2$} node[right] {$\sigma_{id_n}^2$} (2gaussn);
%%%% COMBO %%%%%
\draw[-stealth, very thick, auto=right,decoration={snake, segment length=2mm, amplitude=0.5mm,post length=1.5mm}]
(1) edge[decorate] node[left, near start] {\footnotesize$\boldsymbol \omega_{12}$} (22)
(2) edge[decorate] node[left, near start] {\footnotesize$\boldsymbol \omega_{12}$} (23)
(3) edge[decorate] node[left, near start] {\footnotesize$\boldsymbol \omega_{12}$} (2md)
(md) edge[decorate] node[left, near start] {\footnotesize$\boldsymbol \omega_{12}$} (2n);
\draw[-stealth, very thick, auto=right,decoration={snake, segment length=2mm, amplitude=0.5mm,post length=1.5mm}]
(21) edge[decorate] node[left, near start] {\footnotesize$\boldsymbol \omega_{21}$} (2)
(22) edge[decorate] node[left, near start] {\footnotesize$\boldsymbol \omega_{21}$} (3)
(23) edge[decorate] node[left, near start] {\footnotesize$\boldsymbol \omega_{21}$} (md)
(2md) edge[decorate] node[left, near start] {\footnotesize$\boldsymbol \omega_{21}$} (n);
%%%% START STATES %%%%%
\node[text depth=0pt] at (-2, -1) (S) {start};
\draw[-stealth, very thick, auto=right,decoration={snake, segment length=2mm, amplitude=0.5mm,post length=1.5mm}]
(S) edge[decorate] node[above] {\footnotesize$\pi_1$} (1)
(S) edge[decorate] node[below] {\footnotesize$\pi_2$} (21);
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{decorations.pathmorphing,positioning}
\definecolor{mynavy}{HTML}{000080}
\definecolor{darkred}{HTML}{8B0000}
\newcommand{\myGlobalTransformation}[2]
{
\pgftransformcm{1}{0}{0.5}{0.25}{\pgfpoint{#1cm}{#2cm}}
}
\tikzstyle myBG=[line width=3pt,opacity=1.0]
\begin{document}
\begin{tikzpicture}
\begin{scope}
\myGlobalTransformation{0}{0};
\draw [black!50,fill=red!5] (-1, 0) rectangle (9,8);
\end{scope}
\begin{scope}
\myGlobalTransformation{0}{4.25};
\draw [black!50,fill=blue!5] (-1, 0) rectangle (9,8);
\end{scope}
\begin{scope}
\myGlobalTransformation{0}{0}
\node (N1) at (1,1) [circle,white,fill=darkred] {};
\node (N2) at (1,3) [circle,white,fill=darkred] {};
\node (N3) at (1,5) [circle,white,fill=darkred] {};
\node (N4) at (1,7) [circle,white,fill=darkred] {};
\node (N5) at (4,1) [circle,white,fill=darkred] {};
\node (N6) at (4,3) [circle,white,fill=darkred] {};
\node (N7) at (4,5) [circle,white,fill=darkred] {};
\node (N8) at (4,7) [circle,white,fill=darkred] {};
\node (N9) at (7,1) [circle,white,fill=darkred] {};
\node (N10) at (7,3) [circle,white,fill=darkred] {};
\node (N11) at (7,5) [circle,white,fill=darkred] {};
\node (N12) at (7,7) [circle,white,fill=darkred] {};
\node (N13) at (8.5,1) {};
\node (N14) at (8.5,3) {};
\node (N15) at (8.5,5) {};
\node (N16) at (8.5,7) {};
\node (N0) at (-0.5,1) {};
\node (N00) at (-0.5,3) {};
\node (N000) at (-0.5,5) {};
\node (N0000) at (-0.5,7) {};
\foreach \x in {1,...,4}
\foreach \y in {5,...,8}
\draw[-stealth, darkred, very thick] (N\x) -- (N\y);
\foreach \x in {5,...,8}
\foreach \y in {9,...,12}
\draw[-stealth, darkred, very thick] (N\x) -- (N\y);
\draw[-stealth, darkred, very thick] (N9) -- (N13);
\draw[-stealth, darkred, very thick] (N10) -- (N14);
\draw[-stealth, darkred, very thick] (N11) -- (N15);
\draw[-stealth, darkred, very thick] (N12) -- (N16);
\draw[-stealth, darkred, very thick] (N0) -- (N1);
\draw[-stealth, darkred, very thick] (N00) -- (N2);
\draw[-stealth, darkred, very thick] (N000) -- (N3);
\draw[-stealth, darkred, very thick] (N0000) -- (N4);
\begin{scope}
\pgftransformreset
\myGlobalTransformation{0}{4.25};
\node (T9) at (7,1) {};
\node (T10) at (7,3) {};
\node (T11) at (7,5) {};
\node (T12) at (7,7) {};
\foreach \x in {5,...,8}
\foreach \y in {9,...,12}
\draw[-stealth,very thick, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,] (N\x) -- (T\y);
\end{scope}
\end{scope}
\begin{scope}
\myGlobalTransformation{0}{4.25}
\node (N1) at (1,1) [circle,white,fill=mynavy] {};
\node (N2) at (1,3) [circle,white,fill=mynavy] {};
\node (N3) at (1,5) [circle,white,fill=mynavy] {};
\node (N4) at (1,7) [circle,white,fill=mynavy] {};
\node (N5) at (4,1) [circle,white,fill=mynavy] {};
\node (N6) at (4,3) [circle,white,fill=mynavy] {};
\node (N7) at (4,5) [circle,white,fill=mynavy] {};
\node (N8) at (4,7) [circle,white,fill=mynavy] {};
\node (N13) at (8.5,1) {};
\node (N14) at (8.5,3) {};
\node (N15) at (8.5,5) {};
\node (N16) at (8.5,7) {};
\node (N0) at (-0.5,1) {};
\node (N00) at (-0.5,3) {};
\node (N000) at (-0.5,5) {};
\node (N0000) at (-0.5,7) {};
\begin{scope}
\pgftransformreset
\myGlobalTransformation{0}{0};
\node (T9) at (7,1) {};
\node (T10) at (7,3) {};
\node (T11) at (7,5) {};
\node (T12) at (7,7) {};
\foreach \x in {5,...,8}
\foreach \y in {9,...,12}
\draw[-stealth,very thick, decoration={snake, pre length=0.01mm, segment length=2mm, amplitude=0.3mm, post length=1.5mm}, decorate,] (N\x) -- (T\y);
\end{scope}
\node (N9) at (7,1) [circle,white,fill=mynavy] {};
\node (N10) at (7,3) [circle,white,fill=mynavy] {};
\node (N11) at (7,5) [circle,white,fill=mynavy] {};
\node (N12) at (7,7) [circle,white,fill=mynavy] {};
\draw[-stealth, mynavy, very thick] (N0) -- (N1);
\draw[-stealth, mynavy, very thick] (N00) -- (N2);
\draw[-stealth, mynavy, very thick] (N000) -- (N3);
\draw[-stealth, mynavy, very thick] (N0000) -- (N4);
\foreach \x in {1,...,4}
\foreach \y in {5,...,8}
\draw[-stealth, mynavy, very thick] (N\x) -- (N\y);
\foreach \x in {5,...,8}
\foreach \y in {9,...,12}
\draw[-stealth, mynavy, very thick] (N\x) -- (N\y);
\draw[-stealth, mynavy, very thick] (N9) -- (N13);
\draw[-stealth, mynavy, very thick] (N10) -- (N14);
\draw[-stealth, mynavy, very thick] (N11) -- (N15);
\draw[-stealth, mynavy, very thick] (N12) -- (N16);
\end{scope}
\node at (11, 0.3) {\emph{\textbf{stream 1}}};
\node at (1, 6) {\emph{\textbf{stream 2}}};
\node at (10.8, 3.5) {\emph{\textbf{$\times$-connections}}};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning, matrix}
\tikzset{
table/.style={
matrix of nodes,
row sep=-\pgflinewidth,
column sep=-\pgflinewidth,
nodes={rectangle,draw=black,text width=0.05ex,align=center},
nodes in empty cells
},
texto/.style={font=\footnotesize\sffamily},
title/.style={font=\small\sffamily}
}
\tikzset{
tablet/.style={
matrix of nodes,
row sep=-\pgflinewidth,
column sep=-\pgflinewidth,
nodes={rectangle,draw=black,text width=2.25ex,align=center},
text height=1.625ex,
text depth=0ex,
nodes in empty cells
},
texto/.style={font=\footnotesize\sffamily},
title/.style={font=\small\sffamily}
}
\tikzset{
tablett/.style={
matrix of nodes,
row sep=-\pgflinewidth,
column sep=-\pgflinewidth,
nodes={rectangle, text width=0.05ex,align=center},
nodes in empty cells
},
texto/.style={font=\footnotesize\sffamily},
title/.style={font=\small\sffamily}
}
\begin{document}
\begin{tikzpicture}[node distance=0.5cm, auto]
\matrix[table] (t1)
{
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
& & & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
& & & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
};
\node[above = 0.01cm of t1] (c1) {Tile 1};
\matrix[table, right =of t1] (t2)
{
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
};
\node[above = 0.01cm of t2] (c2) {Tile 2};
\matrix[table, right =of t2] (t3)
{
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & & & \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
};
\node[above = 0.01cm of t3] (c3) {Tile 3};
\matrix[tablet, below = 1cm of t1] (mp)
{
\node (1) {\tt 1}; & \node (2) {\tt 2}; & \node (22) {\tt 2}; & \node (3) {\tt 3}; & \dots \\
\vdots & \vdots & \vdots & \vdots & $\ddots$ \\
};
\node[below = 0.01cm of mp] (c4) {Background map};
\draw [-stealth, thick] (1.north) -- (t1.south) ;
\draw [-stealth, thick] (2.north) -- (t2.south);
\draw [-stealth, thick] (22.north) -- (t2.south);
\draw [-stealth, thick] (3.north) -- (t3.south);
\matrix[tablett, rectangle, draw, scale=0.2, inner sep=0ex, nodes={inner sep=0.4ex}, below right = 1.1cm and -1.5cm of t2] (bg1)
{
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
& & & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
& & & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
};
\matrix[tablett, rectangle, draw, scale=0.2, inner sep=0ex, nodes={inner sep=0.4ex}, right = 0cm of bg1] (bg2)
{
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
};
\matrix[tablett, rectangle, draw, scale=0.2, inner sep=0ex, nodes={inner sep=0.4ex}, right = 0cm of bg2] (bg3)
{
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
};
\matrix[tablett, rectangle, draw, scale=0.2, inner sep=0ex, nodes={inner sep=0.4ex}, right = 0cm of bg3] (bg4)
{
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & & & \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
};
\node[below right = 0.01cm and 0.03cm of bg1] (c5) {Background};
\draw [-stealth, white, ultra thick] (t1.south) -- (bg1.north) ;
\draw [-stealth, white, ultra thick] (t2.south) -- (bg2.north);
\draw [-stealth, white, ultra thick] (t2.south) -- (bg3.north);
\draw [-stealth, thick] (t1.south) -- (bg1.north);
\draw [-stealth, thick] (t2.south) -- (bg2.north);
\draw [-stealth, thick] (t2.south) -- (bg3.north);
\draw [-stealth, thick] (t3.south) -- (bg4.north);
\matrix[tablett, rectangle, draw, scale=0.2, inner sep=0ex, nodes={inner sep=0.4ex}, below right = 1.1cm and -1.5cm of t2] (bg1)
{
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
& & & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
& & & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
};
\matrix[tablett, rectangle, draw, scale=0.2, inner sep=0ex, nodes={inner sep=0.4ex}, right = 0cm of bg1] (bg2)
{
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
};
\matrix[tablett, rectangle, draw, scale=0.2, inner sep=0ex, nodes={inner sep=0.4ex}, right = 0cm of bg2] (bg3)
{
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| \\
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
};
\matrix[tablett, rectangle, draw, scale=0.2, inner sep=0ex, nodes={inner sep=0.4ex}, right = 0cm of bg3] (bg4)
{
& & & & & & & \\
& & & & & & & \\
& & & & & & & \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & & & \\
|[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
& & & |[fill=gray]| & |[fill=gray]| & & & \\
};
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{pgfplots}
\begin{document}
\begin{tikzpicture}[samples=1000, domain=0:10*pi]
\begin{axis}[
width=11cm, height=3.5cm,
xtick=\empty,
ytick=\empty,
xlabel={\large $t$},
ylabel={\large $x(t)$},
xmin=0, xmax=11*pi,
ymin=-0.5, ymax=7.5,
axis lines = middle,
very thick,
trig format = rad
]
\addplot [no markers, smooth, thick] {2.5 + 2*sin(0.5*x)};
\end{axis}
\begin{axis}[
at={(0, -2.25cm)},
width=11cm, height=3.5cm,
xtick=\empty,
ytick=\empty,
xlabel={\large $t$},
ylabel={\textcolor{blue}{carrier wave}},
xmin=0, xmax=11*pi,
ymin=-3, ymax=5,
axis lines = middle,
very thick,
trig format = rad
]
\addplot [no markers, smooth, blue, very thick] {2*sin(6*x)};
\end{axis}
\begin{axis}[
at={(0, -5cm)},
width=11cm, height=4cm,
xtick=\empty,
ytick=\empty,
xlabel={\large $t$},
ylabel={\textcolor{red}{AM wave}},
xmin=0, xmax=11*pi,
ymin=-10, ymax=17,
axis lines = middle,
very thick,
trig format = rad
]
\addplot [no markers, smooth, red, very thick] {(2.5 + 2*sin(0.5*x)) * 2*sin(6*x)};
\end{axis}
\end{tikzpicture}
\end{document}
|
|
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{pgfplots}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\begin{document}
\begin{tikzpicture}[samples=1000, domain=0:10]
\begin{axis}[
width=11cm, height=3.5cm,
xtick=\empty,
ytick=\empty,
xlabel={\large $t$},
ylabel={\large $x(t)$},
xmin=0, xmax=11,
ymin=-3, ymax=5,
axis lines = middle,
very thick,
trig format = rad
]
\addplot [no markers, smooth, thick] {2*sin(2*pi*0.25*x)};
\end{axis}
\begin{axis}[
at={(0, -2.25cm)},
width=11cm, height=3.5cm,
xtick=\empty,
ytick=\empty,
xlabel={\large $t$},
ylabel={\textcolor{blue}{carrier wave}},
xmin=0, xmax=11,
ymin=-3, ymax=5,
axis lines = middle,
very thick,
trig format = rad
]
\addplot [no markers, smooth, blue, very thick] {2*sin(6*pi*x)};
\end{axis}
\begin{axis}[
at={(0, -4.5cm)},
width=11cm, height=3.5cm,
xtick=\empty,
ytick=\empty,
xlabel={\large $t$},
ylabel={\textcolor{olivegreen}{FM wave}},
xmin=0, xmax=11,
ymin=-3, ymax=5,
axis lines = middle,
very thick,
trig format = rad
]
\addplot expression [no markers, smooth, olivegreen, very thick] {2*sin(2*pi*3*x - 8*cos(2*pi*0.25*x))};
\end{axis}
\end{tikzpicture}
\end{document}
|
|
\documentclass[tikz]{standalone}
\usetikzlibrary{patterns}
\begin{document}
\begin{tikzpicture}[rotate=45]
\draw (-2,0) node[left] {$\varphi_a$} -- (2,0) node[right] {$\varphi_c$} (0,2) node[above] {$\varphi_b$} -- (0,-2) node[below] {$\varphi_d$};
\draw[->,yshift=5pt] (-1.7,0) -- (-0.7,0) node[midway,above] {$p_1$};
\draw[<-,yshift=5pt] (0.7,0) -- (1.7,0) node[midway,above] {$p_3$};
\draw[->,xshift=5pt] (0,1.7) -- (0,0.7) node[midway,right] {$p_2$};
\draw[<-,xshift=5pt] (0,-0.7) -- (0,-1.7) node[midway,right] {$p_4$};
\draw[fill=white,postaction={pattern=north east lines}] (0,0) circle (0.25) node[right=5pt] {$\Gamma_{k,abcd}^{(4)}(p_1,p_2,p_3,p_4)$};
\end{tikzpicture}
\end{document}
|
|
\documentclass[tikz]{standalone}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}[trafo/.style={midway,font=\tiny}]
\def\hd{2}\def\vd{0.5}
\node (Zm) at (0,0) {$Z_m(E)$};
\node[right=\hd of Zm] (Zc) {$Z_c(\beta)$};
\node[right=\hd of Zc] (Zg) {$Z_g(\mu)$};
\node[below=\vd of Zm] (Sm) {$\sigma = \frac{S_m}{N}$};
\node[below=\vd of Zc] (F) {$f = \frac{F}{N}$};
\node[below=\vd of Zg] (O) {$\frac{\Omega}{V}$};
\draw[->] (Zm) -- (Sm);
\draw[->] (Zc) -- (F);
\draw[->] (Zg) -- (O);
\draw[->] (Zm) -- (Zc) node[trafo,below] {Laplace in $E$};
\draw[->] (Zc) -- (Zg) node[trafo,below] {Laplace in $N$};
\draw[->] (Sm) -- (F) node[trafo,above] {Legendre in $\epsilon = \frac{E}{N}$};
\draw[->] (F) -- (O) node[trafo,above] {Legendre in $\rho = \frac{N}{V}$};
\end{tikzpicture}
\end{document}
|
|
\documentclass[tikz,svgnames]{standalone}
\usetikzlibrary{backgrounds}
\begin{document}
\begin{tikzpicture}[scale=3]
\def\xmin{-1} \def\xmax{1}
\def\ymin{-0.1} \def\ymax{2}
\draw [thick,->] (\xmin,0) -- (\xmax,0);
\draw [thick,->] (0,\ymin) -- (0,\ymax);
\draw [thick] (-0.5,-0.02) -- (-0.5,0.02) node [below=2] {$-\frac{1}{2}$};
\draw [thick] (0.5,-0.02) -- (0.5,0.02) node [below=2] {$\frac{1}{2}$};
\draw [thick] (-0.02,1) -- (0.02,1) node [below right=-2] {$i$};
\node at (0,3*\ymax/4) [right] {$F_0$};
\node at (0,0.8) [left] {$F_0^\prime$};
\begin{pgfonlayer}{background}
\draw [DarkBlue,->] (-0.5,0) -- (-0.5,\ymax) node [pos=0.7,above left] {$A$};
\draw [DarkBlue,->] (0.5,0) -- (0.5,\ymax) node [pos=0.7,above right] {$A^\prime$};
\draw [DarkRed] (1,0) arc (0:180:1) node [auto,swap,pos=0.55] {$B$} node [auto,swap,pos=0.45] {$B^\prime$};
\draw [DarkGreen] (0,0) arc (0:90:1) node [auto,pos=0.4] {$C$};
\draw [DarkGreen] (1,1) arc (90:180:1) node [auto,pos=0.6] {$C^\prime$};
\path[clip] (1,\ymax) -- (1,1) arc (90:180:1) -- (0,0) arc (0:90:1) -- (-1,\ymax) -- cycle;
\begin{scope}
\path[clip] (1,\ymax) -- (1,1) arc (90:180:1) -- (0,0) arc (0:90:1) -- (-1,\ymax) -- cycle;
\fill[gray,opacity=0.3] (-0.5,0) rectangle (0.5,\ymax);
\fill[gray,opacity=0.6] (1,0) arc (0:180:1);
\end{scope}
\end{pgfonlayer}
\end{tikzpicture}
\end{document}
|
|
\documentclass[tikz]{standalone}
\begin{document}
\begin{tikzpicture}[thick]
\def\r{5}
\fill[teal!60] (\r,-\r) -- (0,0) -- (\r,0) -- cycle;
\fill[yellow!60] (\r,-\r) -- (0,0) -- (0,-0.\r) -- (4.\r,-\r) -- cycle;
\fill[red!60] (0,0) rectangle (\r,0.3\r);
\draw (-\r,-\r) rectangle (\r,\r);
\draw[dashed] (-\r,-\r) -- (\r,\r) (\r,-\r) -- (-\r,\r) (-\r,0) -- (\r,0) (0,-\r) -- (0,\r);
\foreach \a in {-0.8*\r,0.8*\r}
\foreach \b in {-0.8*\r,0.8*\r}
\draw[fill=yellow!60] (\a,\b) +(-0.3,-0.3) rectangle +(0.3,0.3);
\foreach \a in {-0.7*\r,0.7*\r} {
\draw[fill=red!60] (\a,0) circle (0.3);
\draw[fill=red!60] (0,\a) circle (0.3);
}
\foreach \i in {1,...,8}
\draw[rotate=45,fill=teal!60] (\i*360/8+22.5:2cm) +(-0.3,-0.3) rectangle +(0.3,0.3);
\end{tikzpicture}
\end{document}
|
|
\documentclass[tikz]{standalone}
\begin{document}
\begin{tikzpicture}[scale=0.6]
\foreach \y [count=\n] in {
{74,25,39,20,3,3,3,3,3},
{25,53,31,17,7,7,2,3,2},
{39,31,37,24,3,3,3,3,3},
{20,17,24,37,2,2,6,5,5},
{3,7,3,2,12,1,0,0,0},
{3,7,3,2,1,36,0,0,0},
{3,2,3,6,0,0,45,1,1},
{3,3,3,5,0,0,1,23,1},
{3,2,3,5,0,0,1,1,78},
} {
% column labels
\ifnum\n<10
\node[minimum size=6mm] at (\n, 0) {\n};
\fi
% heatmap tiles
\foreach \x [count=\m] in \y {
\node[fill=yellow!\x!purple, minimum size=6mm, text=white] at (\m,-\n) {\x};
}
}
% row labels
\foreach \a [count=\i] in {a,b,c,d,e,f,g,h,i} {
\node[minimum size=6mm] at (0,-\i) {\a};
}
\end{tikzpicture}
\end{document}
|
End of preview. Expand
in Data Studio
No dataset card yet
- Downloads last month
- 3