Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
referring now to fig1 , there is disclosed mathematical matrix ( 1 ) presenting a single integrated apparatus depicting conceptual relationships between numbers 0 to 100 which allows children to count each of the numbers individually and to count to 100 by 1 &# 39 ; s , 2 &# 39 ; s , 5 &# 39 ; s or 10 &# 39 ; s as well as to count by odd or even numbers . the mathematical matrix ( 1 ) is organized about a vertical y - axis and a horizontal x - axis with stations ( 103 ). a pair of top terminal stations having the numbers 50 and 50 and a pair of bottom terminal stations having the numbers 0 and 100 . a balanced display of numbers from 0 to 100 is presented in fig1 . in some embodiments the 50 and 50 pair and the 0 and 100 pair may be on the left and right of the x - axis . considering the structure of the matrix more specifically , ascending numbers from 0 to 50 are arranged in a first string a on the left side of the y - axis and descending numbers from 100 to 50 are arranged in a second string , b on the right side of the y - axis . numbers which are on lines parallel to the x - axis always sum to the number 100 ( 105 ), for example 47 and 53 ; 21 and 79 , and 9 and 91 . thus , the matrix provides an apparatus to teach addition and subtraction . in order to make numbers countable by 10 &# 39 ; s more readily distinguishable , these numbers occur in straight lines parallel to the y - axis with numbers other than 50 , 50 and 0 , 100 being offset substantially from the y - axis . each of the 10 &# 39 ; s numbers occurs at an apex with portions strings approaching the 10 &# 39 ; s number converging . each number ending in 5 , so as to be wholly divisible by 5 is located at an apex in - board of the numbers evenly divisible by 10 . consequently , the matrix allows a student to readily count by 10 &# 39 ; s and by 5 &# 39 ; s while clearly showing that the 5 &# 39 ; s occur evenly between the 10 &# 39 ; s , and upon counting are always separated by 10 digits . referring now to fig2 , there is shown a puzzle arrangement wherein the numbers at stations ( 203 ) in the strings a and b are not present . students are then presented with the task of entering the numbers which are provided on chips ( 201 ) in a separate pile . the chips ( 201 ) may be in a container which can be shaken . the chips ( 201 ) may pour out on a table or desk surface next to the matrix . the student &# 39 ; s task is to properly place the chips in the matrix while initially viewing a complete or partially complete matrix displayed to the class . in order to distinguish even numbers from odd numbers , all even numbers occur at stations ( 203 ) represented by circles and all odd numbers occur at stations ( 203 ) represented by triangles . in some embodiments all the stations ( 203 ) are the same shape and in some embodiments the shape of the station ( 203 ) is determined by the number in the digit ( n ) or ( m ) in that the station ( 203 ) has the same number of sides as the number in the digit ( n ) or ( m ) for example see fig5 . optionally , the matrix may further distinguish even and odd numbers by color , for example , the even number stations ( 203 ) may be red , and the odd number stations ( 203 ) may be blue . in order to make it easier to count by 10 &# 39 ; s , the stations ( 203 ) with numbers 0 , 10 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 , and 100 may optionally be the same color . also , the stations ( 203 ) with numbers counting by 5 , but not ending in 0 , may be a particular color . in lieu of having a mechanical arrangement a computerized version of the game is shown in fig3 in which an electronic image ( 200 ) of the matrix of fig1 is displayed with numbers up to ( 100 ). another image ( 300 ) of the matrix is provided with empty or partially empty stations . a separate image ( 400 ) with a bank of numbers from 0 to 100 is also provided for filling in empty stations the image ( 300 ). there are options for placing numbers from the numbers bank ( 400 ) in stations on the matrix ( 300 ) which can be done either with the image ( 200 ) present at another location or located on separate sheets at the location of each computer terminal . children may be instructed to place all of the 10 numbers on the board and then perhaps all of the 5 numbers on the board . finally , students can be requested to place all the numbers between the 10 &# 39 ; s and 5 &# 39 ; s on the board . various exercises can be performed using the image of the matrix ( 300 ) with empty or partially empty stations so that the students may work with the numbers and learn what the matrix has to teach them about the relationship between the various numbers between 0 and 100 . in other embodiments other ranges may be substituted for 0 - 100 for example 100 - 1000 . if necessary , an element of competition may be introduced into the instruction by timing how long it takes each student or group of students to insert a random distribution of numbers in the matrix . when a student correctly places the numbers , an audible or non - audible finish signal is provided so that those who complete the task by a selected time are rewarded . this game has many options for encouraging kids to learn about the numbers 0 to 100 . while the matrix and associated learning activities are the primary use of the matrix , other uses of the matrix have been conceived , such as but not limited to , table gaming wherein wagerers place bets on numbers they select and are rewarded according to formulas derived from the relationship of selected numbers to complements thereof which equal 100 . fig4 is an illustrative example of the game in hypothetical play . the stations ( 403 ) are shown alternating between circles and triangles where circles correspond to even numbers and triangles correspond to odd numbers . special movement spaces and examples of their effects ( 405 , 407 , 409 , 411 , and 413 ) are used by a user / player ( 419 ) when they perform an action that grants them access to the spaces for example landing on the space , answering a question , or drawing a card . when landing on a space granting downward diagonal movement a slide ( 405 ) may be used to transfer the user ( 419 ). when landing on a space granting movement directly across to the other string a car on a road ( 409 ) may be used to transfer the user ( 419 ). when landing on a space granting upward diagonal movement an airplane ( 413 ) may be used to transfer the user ( 419 ). when landing on a space granting upward movement a latter ( 411 ) may be used to transfer the user ( 419 ). when landing on a space granting downward movement an elevator ( 407 ) may be used to transfer the user ( 419 ). the special movement spaces and examples of their effects ( 405 , 407 , 409 , 411 , and 413 ) are illustrative examples and are not meant to be limiting for example an escalator could be used to show upward or downward diagonal movement . math problem bubbles ( 415 ) may optionally be displayed in the computerized embodiments when user lands on a space or before a user may move from a space . the math problem bubbles ( 415 ) may be any type of math questions for example a word problem , identifying the next number in a sequence , an algebra problem , a calculus problem , naming a geometric shape , or a geometry problem . in some embodiments math problems are written on cards ( 417 ). the cards ( 417 ) may be real or displayed on a computer . fig5 shows a series of ten stations where each station is a represented by a geometric shape with the number of sides of the shape corresponding to the ones digit of the number associated with it . numbers ending in 0 are represented by a circle ( 501 ). numbers ending in 1 are represented by a horizontal line segment ( 503 ). numbers ending in 2 are represented by an absolute value sign ( 505 ). numbers ending in 3 are represented by a triangle ( 507 ). numbers ending in 4 are represented by a square ( 509 ). numbers ending in 5 are represented by a pentagon ( 511 ). numbers ending in 6 are represented by a hexagon ( 513 ). numbers ending in 7 are represented by a heptagon ( 515 ). numbers ending in 8 are represented by an octagon ( 517 ). numbers ending in 9 are represented by a nonagon ( 519 ). fig5 is an illustrative example using regular polygons . some embodiments may use irregular polygons or have their sides correspond to numbers other than those in the ones digit position . without further elaboration , it is believed that one skilled in the art can , using the preceding description , utilize the present invention to its fullest extent . the preceding preferred specific embodiments are , therefore , to be construed as merely illustrative , and not limitative of the remainder of the disclosure in any way whatsoever . the entire disclosures of all applications , patents and publications , cited herein and of corresponding u . s . provisional application ser . no . 61 / 318 , 514 , filed mar . 29 , 2010 , are incorporated by reference herein . from the foregoing description , one skilled in the art can easily ascertain the essential characteristics of this invention and , without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions .	6
this invention affords foam inhibiting substances whose performance properties are at least equivalent to those already known in the art , and which have the additional property of improved biodegradability . the inventive foam inhibitors may be generally described as adducts of ethylene oxide with relatively long chain aliphatic alcohols or vicinal glycols , whose terminal groups are alkyl - blocked . more specifically , the present invention relates to foam inhibitor additives for cleaning preparations in the nature of at least one hydroxyalkyl polyethylene glycol ether of the formula : r 3 is a straight - chain or branched c 4 - 8 - alkyl ; and with the proviso that the total number of carbon atoms in r 1 and r 2 is between 6 and 16 . other than in the operating examples , or where otherwise indicated , all numbers expressing quantities of ingredients or reaction conditions used herein are to be understood as modified in all instances by the term &# 34 ; about &# 34 ;. suitable starting materials for producing the polyglycol ethers corresponding to formula i include linear or branched c 4 - 8 alcohols , such as n - butanol , i - butanol , n - amyl alcohol , i - amyl alcohol , n - hexanol , isomeric hexanols , n - heptanol and isomeric n - heptanols , n - octanol and isomeric octanols , such as 2 - ethylhexanol . these alcohols , which may be used either individually or in admixture , are reacted with ethylene oxide in known manner in a molar ratio of from 1 : 7 to 1 : 12 . the reaction products obtained are reacted with c 8 - 18 - epoxides , preferably in the presence of suitable alkaline catalysts . both 1 , 2 - epoxides and also compounds containing an internal epoxide group may be used for the reaction . c 12 - 16 - 1 , 2 - epoxides have proven to be particularly suitable . mixtures of epoxides of different chain lengths are also suitable . the molar ratio of alkyl polyglycol ether to epoxide preferably is 1 : 1 and the addition of alkaline catalyst is between 0 . 1 to 1 % by weight , based on the quantity of epoxide used . the reaction is carried out by heating for several hours to temperatures of 100 ° to 200 ° c ., preferably 120 ° to 180 ° c . the conversion level may readily be determined by determining the epoxide content of the mixture . heating for 4 to 8 hours to 150 °- 170 ° c . is generally sufficient . further information on the reaction of polyglycol ethers with long chain epoxides can be found in european published patent application no . 88 , 039 . in preferred embodiments of the invention , referring to formula i , r 1 is a linear c 12 - 16 - hydrocarbon , r 2 is hydrogen , r 3 is n - butyl , n - hexyl , or n - octyl , and n is a number from 8 to 10 . it is particularly preferred to use compounds of formula i in which r 3 is an n - butyl radical . the polyglycol ethers corresponding to formula i may be used either individually or in a mixture thereof , or in further combination with at least one secondary foam - inhibitive compound which is a polyethylene glycol ether of the type obtainable by the addition of from 4 to 20 parts of ethylene oxide onto 1 part by weight of polyglycerol having a hydroxyl number of from 900 to 1200 , followed by etherification of the free hydroxyl groups with at least one alkyl halide containing from 4 to 8 carbon atoms , as described in german patent application no . 33 15 952 ( and corresponding u . s . application no . 06 / 601 , 477 , now u . s . pat . no . 4 , 522 , 740 which is incorporated herein by reference ). mixtures of the polyglycol ethers of formula i and the terminal group blocked polyglycerol polyglycol ethers defined above in a ratio by weight of 1 - 9 : 1 , preferably 2 . 3 - 9 : 1 , have a particularly pronounced foam inhibiting effect . the terminal group blocked hydroxyalkyl polyglycol ethers of formula i used in accordance with the invention are distinguished by their high stability to alkalis and acids , by their very effective inhibition of foaming in mildly acidic to strongly alkaline cleaning solutions and by favorable degradation rates in the waste water . their biodegradability , as determined by the prescribed methods , is equivalent to a bias - removal of more than 80 %. the cleaning preparations in which the terminal group blocked polyglycol ethers are used in accordance with the invention may contain the constituents normally present in preparations of this type , such as wetting agents , builders and complexing agents , alkalis or acids , corrosion inhibitors and , if desired , even antimicrobial agents and / or organic solvents . suitable wetting agents are nonionics , such as polyglycol ethers of the type obtained by the addition of ethylene oxide onto alcohols , particularly fatty alcohols , alkyl phenols , fatty amines and carboxylic acid amides , and anionics , such as alkali metal , amine and alkylol amine salts of fatty acids , alkyl sulfuric acids , alkyl sulfonic acids and alkyl benzene sulfonic acids . the builders and complexing agents which the cleaning preparations may contain include alkali metal orthophosphates , polymer phosphates , silicates , borates , carbonates , polyacrylates and gluconates and also citric acid , nitriloacetic acid , ethylene diamine tetraacetic acid , 1 - hydroxyalkane - 1 , 1 - diphosphonic acids , amino tri -( methylene - phosphonic acid ) and ethylene diamine tetra -( methylene - phosphonic acid ), phosphonoalkane polycarboxylic acids such as , for example , phosphonobutane tricarboxylic acid , and alkali metal salts of these acids . highly alkaline cleaning preparations , particularly those for washing bottles , contain considerable quantities of caustic alkali in the form of sodium and potassium hydroxide . if it is desired to obtain special cleaning effects , the cleaning agents may contain organic solvents , for example alcohols , petroleum fractions and chlorinated hydrocarbons , and free alkylol amines . in the context of the invention , cleaning preparations are primarily understood to be the aqueous solutions intended for direct application to the substrates to be cleaned . in addition , the expression &# 34 ; cleaning preparations &# 34 ; also applies to the concentrates and solid mixtures intended for the preparation of the working solutions . the solutions ready for use may be mildly acidic to strongly alkaline . the hydroxyalkyl polyglycol ethers of formula i either alone or in admixture with the second compound when used in accordance with the invention are added to the ready - to - use cleaning preparations in a foam inhibitive amount , preferably in a concentration of 10 to 2500 ppm , most preferably 50 to 500 ppm . 484 g ( 1 mol ) of the adduct of 10 mols of ethylene oxide with 1 mol of n - butanol , 227 . 5 g ( 1 mol ) of linear 1 , 2 - epoxy tetradecane and 1 . 3 g of sodium methylate ( 30 % solution in methanol ) were heated in vacuo to 100 ° c . to remove the methanol introduced with the catalyst and then heated with stirring for 6 hours to 160 ° c . in an inert gas atmosphere . after cooling , the reaction product was neutralized with the equivalent quantity of acetic acid and filtered . the product had an analytically determined hydroxyl number of 80 . its cloud point , as determined in 1 % sodium hydroxide , was below 5 ° c . the terminal group blocked hydroxyalkyl polyglycol ethers shown in table i were similarly produced . their cloud points were determined in 1 % sodium hydroxide solution . e . o . stands for added ethylene oxide groups and the symbol & lt ; for &# 34 ; less than &# 34 ;. table i______________________________________ cloudexample starting materials oh pointno . epoxide glycol ether number (° c . ) ______________________________________1 1 , 2 - epoxytetra - n - butanol + 80 & lt ; 5 decane 10 e . o . 2 1 , 2 - epoxyoctane n - butanol + 99 . 5 37 9 e . o . 3 1 , 2 - epoxydecane n - butanol + 100 19 9 e . o . 4 1 , 2 - epoxydo - n - butanol + 101 17 decane 9 e . o . 5 1 , 2 - epoxyhexa - n - butanol + 75 . 6 & lt ; 5 decane 9 e . o . 6 1 , 2 - epoxyoctan - n - butanol + 70 & lt ; 5 decane 9 e . o . 7 1 , 2 - epoxytetra - n - hexanol + 69 . 5 & lt ; 5 decane 10 e . o . 8 1 , 2 - epoxydo - 2 - ethylhexanol + 69 & lt ; 5 decane 10 e . o . ______________________________________ production of the terminal group blocked polyglycerol polyglycol ethers in accordance with german patent application no . 33 15 952 in an autoclave , 137 g of polyglycerol ( hydroxyl number 961 ) were reacted with 1400 g of ethylene oxide ( ratio by weight 1 : 10 . 9 ) at 180 ° c ./ 10 bar in the presence of 3 g sodium methylate . 1313 g of polyglycerol ethylene glycol ether , hydroxyl number 113 , were obtained . 350 g of the product obtained , 171 g of n - hexyl chloride and 228 g of 75 % by weight sodium hydroxide solution were stirred for 4 hours at 120 ° c . the organic phase was separated off from the cooled reaction mixture . the organic phase was washed with water at 50 ° c . until the washing liquid showed a neutral reaction . unreacted hexychloride and water were removed from the reaction mixture by heating in vacuo to 150 ° c . 281 . 5 g of polyglycerol polyethylene glycol hexylether ( polyglycerol + 10 . 9 butyl - e . o .) were obtained . the product had a hydroxyl number of 3 . 5 . the reaction product is referred to hereinafter as product b . the foam inhibiting effect was determined using test solutions containing 1 % by weight of sodium hydroxide and 0 . 03 % by weight ( 300 ppm ) of foam inhibitor . in the course of the tests , triethanolamine tetrapropylene benzene sulfonate was added to these solutions as the test foaming agent in quantities increasing in stages by amounts of 100 ppm . quantities of 200 ml of the test solutions were tested at 65 ° c . in the foam beating apparatus according to german industrial standard ( din ) 53 , 902 . the foam volume in ml was read off at 5 seconds . an average value from 5 individual measurements was determined for each concentration of the test foam agent . from the results obtained , the foam volume observed at a concentration of the test foaming agent of 1200 ppm is shown in the second column of table ii below . as a second representative measured value , the concentration of test foaming agent at which a foam volume of more than 200 ml was measured for the first time is shown in the third column of table ii . table ii______________________________________ ppm of testfoam inhibitor ml of foam at 1200 ppm foaming agent forof example no . of test foaming agent & gt ; 200 ml of foam______________________________________2 300 6003 300 12004 200 16001 30 20005 35 22006 40 18007 30 20008 30 1800______________________________________ a storable , solid , bottle washing preparation was prepared by mechanically mixing the following components : 80 parts by weight of caustic soda , 12 parts by weight of sodium tripolyphosphate , 5 parts by weight of sodium silicate ( molar ratio of na 2 o to sio 2 1 : 3 . 35 ) and 3 parts by weight of the product of example 1 . using a 1 % by weight solution of this preparation , milk bottles were washed at 80 ° c . in a standard bottle washing machine having one solution zone and an hourly throughput of 18 , 000 bottles . the cleaning effect was good and no troublesome foaming was observed . a storable , solid mixture was obtained by mechanically mixing the following active components : 80 parts by weight of sodium tripolyphosphate and 20 parts by weight of the product of example 5 . beer bottles were washed at 85 ° c . in a bottle washing machine having three solution zones and an hourly throughput of 80 , 000 bottles . the beer bottles had been labeled with paper labels using casein glue which normally causes vigorous foaming in immersion baths . when 1 . 5 % by weight sodium hydroxide solution containing 0 . 15 % by weight of the active mixture described above was used for washing , the machine could be operated without any troublesome foaming . a storable mixture was prepared by mechanically mixing the following active components : 40 parts by weight of sodium ethylene diamine tetraacetate , 20 parts by weight of sodium tripolyphosphate , 30 parts by weight of sodium gluconate , 10 parts by weight of the product of example 1 . wine bottles were washed at 85 ° c . in a standard commercial bottle washing machine having two separate solution zones and an hourly throughput of 24 , 000 bottles . a 1 . 5 % by weight sodium hydroxide solution to which 0 . 5 % by weight of the concentrate described above had been added was used as the cleaning solution . washing was not accompanied by any troublesome foaming and the bottles were satisfactorily clean . a storable cleaning preparation for cleaning metal surfaces by spraying was prepared by mechanically mixing the following components : 80 parts by weight of sodium metasilioate pentahydrate , 16 parts by weight of sodium tripolyphosphate , 4 parts by weight of cocoamine + 12 e . o ., 1 part by weight of the product of example 1 . the foam formatlon and foam collapse of a 2 % by weight solution of this cleaning agent was tested at 60 ° c . in accordance with german industrial standard ( din ) 53 , 902 by comparison with an agent which did not contain the product of example 1 , but which had otherwise the same composition . the results are set out in table iv below . table iv______________________________________ ml . of foam after mins . cleaning agent 0 1 2 10______________________________________comparison example 530 140 0 0example 13 180 15 0 0______________________________________ an immersion type degreasing agent for metals was prepared by mechanically mixing the following components : 40 parts by weight of sodium metasilicate pentahydrate , 35 parts by weight of sodium carbonate , 20 parts by weight of sodium tripolyphosphate , 2 . 5 parts by weight of sodium alkyl benzene sulfonate , 2 . 5 parts by weight of nonyl phenol + 14 e . o ., 4 . 5 parts by weight of the product of example 1 , 0 . 5 part by weight of product b . greasy steel moldings were cleaned at 60 ° c . by immersion in a 4 % by weight solution of this cleaning preparation . the degreasing effect was very good and no troublesome foaming was observed . a storable concentrate for cleaning metal surfaces was prepared by dissolving the following components in water : 30 parts by weight of sodium caprylate , 10 parts by weight of borax , 14 parts by weight of sodium tripolyphosphate , 10 parts by weight of triethanolamine , 2 parts by weight of monoethanolamine , 6 parts by weight of the product of example 1 , 78 parts by weight of water . iron surfaces were sprayed at 50 ° to 55 ° c . with a 1 . 5 % by weight solution of this cleaning agent ( ph 8 . 5 ). the cleaning effect was good and no troublesome foaming was observed . a storable concentrate for cleaning metal surfaces was prepared by dissolving the following components in water : 25 parts by weight of the diethanolamine salt of isononanoic acid , 20 parts by weight of diethanolamine , 1 part by weight of benztriazole , 4 parts by weight of the product of example 6 and 50 parts by weight of water . gray iron castings were sprayed at 50 ° to 55 ° c . with a 1 % by weight solution of this cleaning preparation . the cleaning effect was good and no troublesome foaming was observed .	2
a distributed telecommunications system provides functionality to support modern small or large office business settings , such as call forwarding , auto - attendant , voice mail , voice messaging , etc . the telecommunications system is made up of components that can be located in various locations that are remote from each other . each of the components is coupled to an internet protocol ( ip ) based wide - area network . the system provides message storage assurance to subscribers and enables a caller to generate a message and terminate the communication with a voice recorder without having to wait on - the - line for a confirmation that the voice message was successfully delivered and stored . the system also provides message durability in that once the voice message is recorded , the system ensures that despite device and network service outages , the voice message is saved in the common message store . a geographically distributed messaging system 100 comprising a media server 120 , document server 160 , and a common message store 170 , provides for message storage assurance and durability of voice messages . media server 120 couples the distributed messaging system 100 to one or more networks . document server 160 , located remotely from the media server 120 , manages storage of voice messages in common message store 170 . the complexities of interfacing to telecommunications networks such as the public switched telephone network ( pstn ) 115 are handled through a signaling gateway function ( sgf ) 117 coupled between media server 120 and pstn 115 with sigtran protocol used in the link between media server 120 and sgf 117 and signaling system 7 ( ss7 ) is used to perform out - of - band signaling in support of the call - establishment , billing , routing , and information - exchange functions between sgf 117 and pstn 115 . as illustrated in fig1 , media server 120 is also coupled to pstn 115 via t1 / e1 or other multiple channel links . a voice over ip ( voip ) gateway 133 integrates the media server 120 with a modular voice processor 130 or other devices that use session initiation protocol ( sip ). access control 107 manages the complexities of integrating multiple media servers 120 with internet protocol ( ip ) network 105 . when a single media server 120 is used , a communication link using sip , sigtran , or the h . 323 messaging protocols couples media server 120 to ip network 105 . one or more automatic - speech recognition ( asr ) modules 135 and one or more text - to - speech ( tts ) conversion modules are coupled to media server 120 to enable both audio and text input and output to / from distributed messaging system 100 . a voice over ip ( voip ) gateway 133 integrates the media server 120 with a modular voice processor 130 or other devices that use session initiation protocol ( sip ). a simplified protocol is used for communications between the remaining components of the distributed messaging system . voice extensible markup language ( voicexml or vxml ) is one mode of communication between media server 120 and remotely located document server 160 . vxml , which uses hypertext transfer protocol ( http ) to communicate information in packets , allows a user to interact with devices coupled to ip networks using voice - recognition technology . instead of a traditional graphical user interface based browser , vxml relies on a voice browser and / or any of a plethora of voice - based devices such as telephones , mobile phones and combination devices . instead of a traditional browser that relies on a keyboard and a mouse , vxml relies on a voice browser and a voice - based device . using vxml , the user interacts by listening to audio output that is either pre - recorded or synthesized and submits input through the user &# 39 ; s natural speaking voice or a touch - tone keypad . vxml is designed for creating audio dialogs that feature synthesized speech , digitized audio , and recognition of spoken and dual - tone multiple frequency encoded inputs , recording of voice messages , and mixed conversations . as will be explained in further detail below , vxml http requests are communicated from media server 120 to document server 160 , which manages the storage , confirmation , and retrieval of voice messages saved in common message store 170 . application server 150 , coupled to document server 160 and internet 155 , provides a mechanism for subscribers of the distributed messaging system and third - parties with proper access privileges to access previously stored voice messages from common message store 170 . messages are durable when once a subscriber records a message in a vxml session , the message is saved and accessible via a common message store remotely located from the subscriber despite media server 120 failures , document server 160 failures and wide area network service outages . this is accomplished because message storage from a local data store to the remotely located common message store can be asynchronous . that is , the subscribing caller does not need to wait on - the - line for acknowledgement of a successful transfer of the message . because the common message store comprises an array of disks , the messages and metadata stored therein can survive numerous device failures and request restarts for transfers of message blocks . fig2 is a functional block diagram illustrating an embodiment of a message durability subsystem 200 that can be implemented within the distributed messaging system 100 of fig1 . the message durability subsystem 200 comprises media server 120 , document server 160 , and common message store 170 . media server 120 comprises a message deposit application 222 coupled to vxml browser 224 . message deposit application 222 prepares and controls the media server 120 to enable message recording . vxml browser 224 is further coupled to sender 140 and local data store 220 . vxml browser 224 communicates with sender 140 via tcp / ip . local data store 220 comprises file system 226 , which provides a filename and path to associate with the actual voice data and database 228 , which saves and associates metadata with a recorded voice message . sender 140 communicates requests to document server 160 via simple object access protocol ( soap ). sender 140 provides a socket connection for vxml browser 224 . the socket connection can be accessed by multiple languages using multiple computing platforms . request information transferred to the document server 160 includes attachment file path and name , message type identifier , message status identifier , time for delivery , originator identifier , and identifiers for one or more recipients . sender 140 is configured to save the request including message request delivery state information into local data store 220 , send message header information ( metadata ) together with the attachment file to the document server 160 , delete the request and delivery information when the message has been successfully delivered to the document server 160 , and retry delivery for messages that are not successfully delivered . document server 160 comprises receiver 262 , message server 264 , message manager 266 , unified message service 280 , layered service provider server 268 , and application 270 . receiver 262 is configured to receive the soap requests from sender 140 , retrieve the message information and attachments , invoke the unified message service to create a java message service message and save the created message in message server 264 persistently . receiver 262 is further configured to handle soap fault reporting when data transfer errors occur . unified message service 280 communicates with message server 264 via connector 285 . message server 264 provides persistent storage to the message and related data on the document server 160 , asynchronous message delivery , ensures once - and - only - once delivery of the message to the common message store 170 , and deletes the message when the message has been successfully stored in the common message store 170 . message manager 266 gets messages from the message server 264 , then forwards them to the common message store 170 using the link provided by the unified message service application interface and the layered service provider server 268 . message manager 266 is configured to status the message server 264 regarding whether the message was successfully delivered to the common message store 170 . message manager 266 is further configured to retry message delivery for messages that were not successfully uploaded and integrated with the common message store 170 . two approaches for providing message attachment are contemplated . the first approach is that the attachment content of the soap message received by the receiver 262 is delivered to the message server 264 together with the header information or metadata as one java message service compatible message without writing to an intermediate file . using this approach , the receiver 262 and the message server 264 have the flexibility to be distributed so that any document server is able to deliver a message stored in the message server 264 to the common message store . the alternative approach is that the attachment content of the soap message received by receiver 262 is saved into a file , then the file name and message metadata are delivered to the message server 264 . using this approach , the message server handles text data only . application server 270 , interposed between unified message service 280 and vxml browser 224 , exposes previously stored messages to one or more subscribers communicatively coupled to media server 120 . fig3 is a functional block diagram of an embodiment of a message channel 300 that links document server 160 to the common message store 170 of the message durability subsystem 200 of fig2 . as indicated in fig3 , application 270 , operable on or in communication with document server 160 , is coupled via unified message service 280 and a layered service provider ( lsp ) server 268 to an upper library 340 and lower library 350 . the unified message service 280 includes a connector 285 configured as a common object request broker architecture ( corba ) client . layered service provider server 268 is configured as corba server . layered service provider server 268 provides a robust , efficient and scalable message and subscriber preference adjustable service . connector 285 communicates with layered service provider server 268 via internet inter - orb protocol ( iiop ). upper library 340 is a high - level application interface that encapsulates device - specific logic in lower library 350 . upper library 350 includes multiple functions for supporting messaging services . lower library 350 uses a peer - to - peer protocol to communicate with storage device 360 , storage device 362 , and storage device 368 and additional storage devices ( not shown ) under the management and control of common message store 170 . fig4 is a system diagram illustrating the components and data flow within the distributed messaging system 100 . distributed voice messaging system 100 includes a message durability subsystem 200 , which comprises media server 120 , document server 160 , and a common message store ( not shown ). the media server 120 can be configured with internal and or externally coupled data storage devices used to provide the previously introduced file system 226 and local data store 228 functions . media server 120 is communicatively coupled to remotely located document server 160 via a packet - switched wide area network . media server 120 is further coupled to pstn 115 . in operation , subscriber 405 initiates a call with a telephone 410 at a location coupled to pstn 115 . the call is established over pstn 115 and terminated by media server 120 , which provides the telephony interface between pstn 115 and distributed messaging system 100 . message deposit application 222 , operable within media server 120 , generates a new filename for the message about to be recorded and collects or otherwise generates new metadata 432 in accordance with one or more identifiers used to classify or otherwise describe the nature of the call , subscriber , and the voice message . metadata 432 is associated with the filename . the message deposit application 222 addresses the vxml browser 224 , sender 140 , file system 226 , and local data store 228 to ensure the media server 120 is prepared to record the voice message . if any of these devices reports a non - ready condition to the message deposit application 222 , the message deposit application 222 immediately informs the subscriber 405 that a system failure has occurred that the message cannot be recorded and aborts the recording process . otherwise , if each of the media server devices is ready , voice message 434 is recorded and temporarily stored within media server 120 . thereafter , the subscriber 405 can access other system functions or terminate the call without waiting for acknowledgment that the voice message 434 has been saved in the common message store 170 . the message deposit application 222 in accordance with a self - generated initialization trigger or an externally generated signal forwards a request to sender process 440 to forward the data to remotely located document server 160 . sender process 440 accepts the request 444 , saves the request 444 and metadata 442 in a local database , and forwards the request 444 via an ip based network to a receiver associated with the document server 160 . the document server 160 , in turn saves a received copy of metadata 462 and message 464 in a common data store 170 ( not shown ). fig5 is a schematic diagram illustrating an embodiment of the distributed messaging system of fig1 when a subscriber retrieves a voice message . as indicated by the illustrated embodiment , document server 160 may be associated with or controlled by various applications operable on application server 150 . thus , a subscribing user with appropriate access to an ip based network that is coupled to application server 150 can access , review , comment , and forward previously stored voice messages integrated via document server 160 in common message store 170 . in addition to providing access to subscribers via application server 150 , previously stored voice messages can be returned to a subscribing caller 405 coupled to the distributed voice messaging system 100 via pstn 115 . one or more applications operable on or in communication with document server 160 can return voice messages via vxml browser 224 associated with media server 120 . fig6 is a flow diagram illustrating an embodiment of a method 600 for generating and locally storing a voice message . as described above , the media server 120 is configured to record and locally store incoming voice messages . media server 120 provides the locally stored voice messages to document server 160 at an appropriate time for transfer to common message store 170 . media server 120 is configured with appropriate processing resources to concurrently store one or more incoming voice messages in a local data store coupled to the media server 120 , while allowing access to previously stored “ local ” voice messages . method 600 begins with block 602 where a call , originated by a subscriber of the distributed voice messaging system 100 ( fig1 ) is serviced by media server 120 . next , as indicated in block 604 , the subscriber is prompted to record a voice message at some time during the call . the subscriber records the voice message , as shown in block 606 . thereafter , media server 120 generates a filename for the voice message and associates appropriate metadata for identifying the voice message , as indicated in block 608 . after the voice message has been recorded , the filename , voice message and any header information , such as metadata is stored in a local data store 228 , as indicated in input / output block 610 . metadata associated with the voice message includes storage location , type , caller , session , urgency , and confidentiality identifiers . the local storage location identifier contains an absolute path and filename of the data file on local file system 226 . the type identifier indicates whether the processed message is a voice or a fax message . the caller identifier indicates a subscriber identification if the message depositor is a subscriber of the system . otherwise , the caller is identified as a “ guest .” the session identifier indicates a depositor session identification . the urgency identifier indicates whether the associated message is a high priority message or a standard priority message that may be processed and addressed in due course . the confidentiality identifier indicates whether the message is designated for access to a limited number of recipients . metadata associated with the voice message also identifies the message sender and one or more message recipients . additional and optional metadata associated with a voice message may include information indicative of a preferred date and time for delivery . when not associated with the message the media server 120 is configured to periodically initiate the transfer of a new message to common message store 170 . conditional metadata is also associated with some messages processed by the distributed messaging system 100 . for example , conditional metadata identifies when the stored voice message is a comment referring to an attached forwarded message . in addition to a forwarded message identifier , conditional metadata includes forwarded message note and dictation length identifiers . the forwarded message identifier is the message identifier associated with the forwarded voice message . the forwarded message note identifier is a separate identifier associated with a note or comment regarding the forwarded message . the dictation length identifier indicates the length of the forwarded message associated with the note . fig7 is a flow diagram illustrating an embodiment of a method for message storage assurance 700 that can be implemented using the distributed messaging system 100 of fig1 . the method for message storage assurance 700 involves forwarding the locally - recorded and stored messages at the appropriate time to the common message store 170 and sending confirmation back to the media server 120 that the message has been stored . the method for storage assurance 700 begins with block 702 by polling the local data store associated with the media server 120 for new voice messages 434 . when a new voice message 434 has been detected , as indicated by a positive response from query 704 , the media server 120 provides an indication to the document server 160 , which in turn , notifies the common message store 170 in block 706 of the presence of the new message . as indicated in block 708 , the common message store prepares space for the new voice message designated for integration in common message store 170 . next , as shown in block 710 and query block 712 , common message store 170 requests message content using a block - by - block repetitive process until the entire message has been delivered via the document server 160 and received in the common message store 170 . once the entire message has been received , common message store 170 sends an acknowledgement that the entire message has been received , as shown in block 714 . the acknowledgement issued from the common message store 170 is received and forwarded by document server 160 as shown in block 716 . the acknowledgement received by document server 160 is forwarded to the media server 120 as shown in block 718 . the acknowledgement received by media server 120 confirms that the voice message has been successfully stored and integrated with common message store 170 . in an alternate embodiment , polling for new messages in the local data store 228 associated with the media server 120 may be performed by software or firmware operable within the document server 160 or by an application in communication with document server 160 . in this way , one or more remotely located devices can be configured to monitor multiple media servers . fig8 a and 8b are a flow diagram illustrating an alternative embodiment of a method 800 for message storage assurance that can implemented using the distributed messaging system 100 of fig1 . method 800 begins with block 802 where a local data store 228 co - located with a local voice mail system is polled to determine if a voice message has been stored to the data store 228 . thereafter , as indicated by input / output block 804 , the common message store 170 is notified that a new voice message is present in the ( remotely located ) local data store 228 . next , the voice message is transferred to the common message store 170 from the local data store 228 as illustrated in input / output block 806 . a query 808 and an associated wait process 810 are repetitively performed until the voice message has been successfully stored in its entirety in the common message store 170 . at this point , the voice message has been stored in the common message store 170 . as indicated by connector a , which associates the steps illustrated in fig8 a with those shown in fig8 b , method 800 continues with block 812 where the stored voice message is made available to the subscriber and those with access privileges that are communicatively coupled to the document server 160 and common message store 170 . in block 814 , the message stored in the local data store 228 is deleted . the functions illustrated in blocks 812 and 814 may be performed out - of - sequence or substantially simultaneously . fig9 a and 9b are a datagram illustrating an embodiment of message flow through the distributed message system 100 of fig1 during a message transfer from local data store 228 to common message store 170 . as shown in the sample embodiment , a host of communications are sent and received by various system entities . a caller device both records a message and forwards an object tag to a vxml browser . the vxml browser saves or otherwise associates the recorded message into a file and sends a request to temporarily store the message in the local data store . a sender process accepts the request , saves the request in a local database , forwards the request to a receiver associated with the document server 160 . the receiver delivers the message via a unified message service to a message server . the message server queues the message request , receives , and forwards the message to a message manager . the message server retains the message and associated metadata until it receives an acknowledgement from the message manager that the message has been successfully processed into the common message store . in the illustrated embodiment , once the message server queues the message , an acknowledgement is forwarded to the vxml browser via the unified message service connection , receiver , and sender in that order . when the sender receives the acknowledgement that the message has been queued in the message server , the sender deletes the message and associated data that were temporarily stored in the local data store . in an alternative embodiment , the acknowledgement stream from the message server to the vxml browser may be withheld or otherwise delayed until the message server receives a positive acknowledgment from the common message store . the message manager receives the message from the message server and forwards the message to a unified message service application interface , which in turn forwards the message via a lsp server that deposits the message in the common message store 170 . once the common message store has successfully deposited the message , an acknowledgement message identified by the associated message identifier is forwarded to the message server via the lsp server , unified message service application interface and message manager , in that order . in response , the message server deletes the message and associated metadata . fig1 a and 10b are a datagram illustrating an embodiment of message flow through the distributed messaging system 100 of fig1 during message or greeting retrieval from common message store 170 . as shown in the sample embodiment , a host of communications are sent and received by various system entities . a vxml browser initiates a request to get voice message blocks which is forwarded via a message application and message server to an upper or first library . when the request is for voice message blocks , the upper library responds to the request by issuing a get account data process . if the account data is not available in the upper library , the upper library forwards a request to get the account data from the lower or second library . the upper library caches the account data returned from the lower library . thereafter , the upper library uses the cached account data to issue a request for message record data . if the message record data is not available in the upper library , the upper library forwards a request to the record data from the lower library . thereafter , the upper library uses the record data to generate a request for a voice block . not illustrated but implied by the datagram , the lower library responds by forwarding the identified voice block from the common message store which is returned to the vxml browser via the upper library , message server , and message application interface in that order . when the request is for a greeting , the upper library responds to the request by issuing a get greeting message data process . if the greeting message data is not present in the upper library , the upper library forwards a request to get the greeting message data from the lower or second library . the upper library caches the greeting message data returned from the lower library . thereafter , the upper library uses the cached greeting message data to issue a request for a voice block that includes the greeting . not illustrated but implied by the datagram , the lower library responds by forwarding the identified voice block from the common message store which is returned to the vxml browser via the upper library , message server , and message application interface in that order . the flow diagrams of fig6 - 8b and the datagrams of fig9 and 10 show the architecture , functionality , and operation of a possible implementation via software and or firmware associated with a host of communicatively coupled hardware devices that causes the process of collection , integration and distribution of voice - based messages to be performed . in this regard , each block represents a module , segment , or portion of code , which comprises one or more executable instructions for implementing the specified logical function ( s ). it should also be noted that in some alternative implementations , the functions noted in the blocks may occur out of the order noted in the drawings . for example , two blocks shown in succession in the flow diagram of fig8 b may in fact be executed substantially concurrently or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . the operational software programs that may be used by the various devices of the distributed messaging system 100 , as well as operational software that may be used in conjunction with the vxml browser , telephonic devices , and applications that interface with distributed messaging system 100 , which comprise an ordered listing of executable instructions for implementing logical functions , can be embodied in any computer - readable medium for use by or in connection with an instruction execution system , apparatus , or device , such as a computer - based system , processor - containing system , or other system that can fetch the instructions from the instruction execution system , apparatus , or device and execute the instructions . in the context of this document , a “ computer - readable medium ” can be any means that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the computer - readable medium can be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples ( a non - exhaustive list ) of the computer - readable medium would include the following : an electrical connection ( electronic ) having one or more wires , a portable computer diskette ( magnetic ), a random access memory ( ram ) ( magnetic ), a read - only memory ( rom ) ( magnetic ), an erasable programmable read - only memory ( eprom or flash memory ) ( magnetic ), an optical fiber ( optical ), and a portable compact disc read - only memory ( cdrom ) ( optical ). note that the computer - readable medium could even be paper or another suitable medium upon which the program is printed , as the program can be electronically captured , via , for instance , optical scanning of the paper or other medium , then compiled , interpreted or otherwise processed in a suitable manner if necessary , and then stored in a computer memory . while various embodiments of the systems and methods for message storage assurance have been described , it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible that are within the scope of the accompanying claims . accordingly , the systems and methods for message storage assurance are not to be restricted beyond the attached claims and their equivalents .	7
in fig1 a portion of a standard integrated circuit device is schematically depicted . the illustrative device includes two conductive elements 10 and 12 disposed on a substrate 14 . herein , for purposes of a specific example only , the elements 10 and 12 will be assumed to be made of doped polysilicon and the substrate 14 will be assumed to be made of silicon . deposited on the top surface of the substrate 14 and covering the elements 10 and 12 is a conventional passivating layer 16 of phosphorus glass . in accordance with standard steps of a known device fabrication sequence , openings or windows are formed in the layer 16 of fig1 in aligned registry with the conductive elements 10 and 12 . a conductive material such as aluminum is then deposited on the top surface of the device and in the aligned windows to establish electrical connections to the underlying elements 10 and 12 . as is well known in the art , the aforespecified windows in the layer 16 may be formed by depositing a radiation - sensitive resist layer 18 on the layer 16 . by standard patterning techniques , openings are made in the resist layer 18 directly overlying the windows to be formed in the passivating layer 16 . then , using the patterned resist as a masking layer , the desired windows are formed in the layer 16 by , for example , standard etching techniques . in one actual device embodiment , the steeply stepped elements 10 and 12 of fig1 each have a vertical height h above the top of the substrate 14 of approximately one micrometer ( μm ). as a result of the irregular topology introduced by the elements 10 and 12 , the overlying layer 16 typically exhibits a nonplanar top surface and a variable thickness . similarly , the resist layer 18 also has a variable thickness . in addition , as discussed earlier above , the layer 18 must as a practical matter be designed thicker than desired thereby to insure adequate step coverage over contours in the nonplanar top surface of the passivating layer 16 . consequently , it has been found in practice that a microminiature device made by techniques of the type represented in fig1 often does not possess adequate resolution and linewidth control to meet stringent requirements specified for certain categories of large - scale and very - large - scale integrated circuit devices . to illustrate the applicability of applicants &# 39 ; inventive principles to the fabrication of integrated circuit devices , a particular device structure of the same type as that depicted in fig1 will be assumed . it will be apparent though that these principles are general purpose in nature and thus applicable to making a wide variety of integrated circuit , as well as discrete , devices . moreover , although primary emphasis herein is on fabricating silicon devices , it is obvious that these principles are also applicable to various known magnetic devices , integrated - optics devices , etc . as in fig1 each of fig2 through 5 shows a portion of a specific illustrative device structure having a substrate 14 , conductive elements 10 and 12 and a passivating layer 16 . in accordance with the principles of the present invention , a relativvely thick sacrificial layer is applied to the top nonplanar surface of the layer 16 . as indicated in fig2 this thick layer ( designated by reference numeral 18 ) has a bottom surface that conforms to the contours of the top surface of the layer 16 . but in practice , in accordance with the specific teachings set forth in detail below , the top surface of the thick layer 18 can be accurately and reproducibly controlled to be essentially flat . accordingly , a basis is provided for depositing an extremely thin and uniform layer to be patterned on top of the essentially flat surface . step coverage considerations are thereby virtually removed as a factor in selecting the thickness of the layer to be patterned . in that way , very - high - resolution patterning , with excellent linewidth control , is achieved . in fig2 the aforementioned thin layer to be patterned is designated by reference numeral 20 . in accordance with one specific aspect of the principles of the present invention , a so - called intermediate masking layer 22 is interposed between the layers 18 and 20 . but , in appropriate circumstances , which will be specified later below , the layer 22 may be omitted . in that case , of course , the layer 20 is applied directly to the essentially flat top surface of the sacrificial layer 18 . for now , the layer 22 will be assumed to be included in the depicted structure . in accordance with the principles of the present invention , the thin layer 20 shown in fig2 comprises a positive or negative resist material that can be selectively patterned by , for example , directing light , electrons , x - rays or ions thereat . a wide variety of such materials are well known in the art . many standard techniques are available for selectively exposing and developing these materials to form a specified high - resolution pattern in the layer 20 . in accordance with the principles of this invention , the sacrificial layer 18 shown in fig2 comprises an organic material capable of conforming and adhering to the nonplanar top surface of the passivating layer 16 . advantageously , this material is applied on top of the layer 16 by standard spinning techniques . in practice , it has been found that as the thickness of such a spun layer 18 is increased , the degree of flatness of the top surface thereof increases . in one specific illustrative embodiment of the principles of the present invention , wherein each of the elements 10 and 12 of fig2 had a height h of one μm and the layer 16 had a thickness m of one μm , the layer 18 constituted a spun - on layer of a novalac - resin positive photoresist having a thickness n of approximately 2 . 6 μm . in one such particular case , the maximum variation between peaks and valleys in the top surface of the layer 18 was measured to be only about 1000 angstrom units ( a ). herein , such a surface will be termed essentially flat . by contrast , the corresponding variation p in the top nonplanar surface of the layer 16 was measured to be about one μm . in accordance with the present invention , a variety of organic materials characterized by ease of application ( spinning , spraying , etc .) and good adhesion to the underlying surface are suitable for forming the sacrificial layer 18 shown in fig2 . the material selected for the sacrificial layer should advantageously be respectively resistant or susceptible to the several processing techniques specified later below . moreover , for use in a photolithographic fabrication sequence , it is advantageous that the material of the layer 18 be highly absorptive of the light utilized to selectively expose the overlying resist layer 20 . in addition , it is often advantageous in such a sequence that the layer 18 have an index of refraction that closely matches those of the layers 20 and 22 . in that way , the common problems of standing waves and scattering in photolithography are minimized . further , for use in electron - beam and x - ray lithography , it is advantageous that the layers 18 and 22 be low - electron - scattering materials thereby to minimize proximity effects in the overlying resist material . in accordance with the principles of the present invention , a number of available organic materials are suitable for forming the sacrificial layer 18 of fig2 . such materials include a variety of known positive and negative resists such as , for example : standard novalac resins , polymethyl methacrylates , poly ( 2 , 3 - dichloro - 1 - propyl acrylate ), poly ( glycidyl methacrylate - co - ethyl acrylate ), combinations of the two last - specified materials and other poly isoprenes , materials of the type described in u . s . pat . no . 3 , 201 , 239 or u . s . pat . no . 3 , 770 , 433 , and hunt hpr - 104 which is commercially available from phillip a . hunt chemical corporation , palisades park , n . j . in addition , a variety of known polymides such as kapton ( which is a registered trademark of e . i . dupont de nemours and co .) or pyralin are suitable for forming the layer 18 . other such suitable materials include standard epoxy groups . in one specific illustrative embodiment of the principles of the present invention , the structure shown in fig2 comprises a one - μm - thick layer 20 made of poly ( 2 , 3 - dichloro - 1 - propyl acrylate ) ( a negative x - ray resist ), a 1500 - a - thick layer 22 of silicon dioxide and a 2 . 6 - μm - thick layer of a standard novalac - resin positive photoresist . in that particular embodiment , the layer 18 is characterized by an essentially flat top surface ( maximum peak - to - valley height of 1000 a ). the top surface of the layer 22 is similarly flat . as a result , the overlying thin resist layer 20 exhibits a substantially uniform thickness . patterning of the layer 20 of fig2 is done by conventional lithographic techniques . for the case wherein the layer 20 is made of an x - ray resist material , patterning is carried out by means of a known x - ray exposure tool . after being exposed and developed in standard ways , the patterned layer 20 typically exhibits a reduced uniform thickness . the remaining portions of the layer 20 , comprising a specified pattern , are shown in fig3 . each such portion is designated by reference numeral 24 . subsequently , using the portions 24 of fig3 as a mask , the layer 22 is correspondingly patterned . in accordance with one aspect of the principles of the present invention , this patterning is advantageously ( but not necessarily ) done by one of several techniques each of which achieves near - vertical walls and substantially no undercutting in the layer being patterned . accordingly , the resulting pattern in the layer 22 conforms substantially exactly to that originally formed in the resist layer 20 . the remaining conforming portions of the layer 22 are shown in fig4 wherein each such portion is designated by reference numeral 26 . patterning of the layer 22 ( fig3 ) may be carried out , for example , by a reactive sputter etching process of the type described in &# 34 ; profile control by reactive sputter etching ,&# 34 ; by h . w . lehmann and r . widmer , journal of vacuum science and technology , pages 319 - 326 , march / april 1978 . alternatively , the layer 22 may be plasma etched in accordance , for example , with the process described in a commonly assigned copending application of w . r . harshbarger , h . j . levinstein , c . j . mogab and r . a . porter , ser . no . 929 , 549 , filed july 31 , 1978 . in accordance with the harshbarger et al . technique , etching is based on establishing a plasma that contains both recombination centers and active etchant species . in a selectively controllable way , recombination centers effectively terminate etchant species lifetime in the immediate vicinity of etched walls , thus providing a means for precisely controlling etching and anisotropy . other known dry processing techniques characterized by controllable etching anisotropy may be utilized for patterning the layer 22 of fig3 . the relative etching rates of the layer 22 and the overlying masking regions 24 will be an important consideration in selecting an appropriate technique for patterning a particular combination of materials . moreover , although it may in some cases be particularly advantageous to utilize a dry processing technique characterized by anisotropy to pattern the layer 22 , it should be recognized that it is also feasible to employ isotropic techniques such as standard wet processing techniques therefor . next , using the patterned portions shown in fig4 as a mask , the thick sacrificial layer 18 is correspondingly patterned . in accordance with aspects of the principles of the present invention , patterning of the layer 18 is advantageously carried out by , for example , ion milling , sputter etching or reactive sputter etching , which dry processes are specified in detail below . significantly , applicants found that such processes are capable of patterning thick organic layers of the type described herein to achieve near - vertical walls while substantially avoiding undercutting therein . as indicated above , the sacrificial layer 18 shown in fig4 may be ion milled . this may be done in a standard ion milling apparatus utilizing , for example , an inert or substantially inert atmosphere of argon , helium , krypton , neon , xenon or nitrogen at a pressure in the range 1 to 100 μm at an operating voltage in the range 50 to 2000 volts . alternatively , the layer 18 may be sputter etched utilizing , for example , an inert or substantially inert atmosphere of argon , helium , krypton , neon , xenon or nitrogen at a pressure in the range 1 to 100 μm in an apparatus in which an asymmetrical dark space is established . this last - stated requirement minimizes contamination in the sputter etching apparatus during the etching process and insures that a sufficient ion - accelerating voltage is established in the apparatus between the plasma therein and the cathode on which the devices being processed are mounted . in addition , the layer 18 of fig4 may be patterned by reactive sputter etching in , for example , an atmosphere including a halocarbon such as carbon tetrafluoride and / or oxygen at a pressure in the range of 1 to 100 μm in an apparatus in which an asymmetrical dark space is established . during the course of etching or milling the sacrificial layer 18 of fig4 the patterned resist portions 24 are removed . by contrast , the patterned portions 26 are highly resistant to the aforespecified dry processing techniques and , accordingly , remain in place substantially unaffected . in one specific illustrative case in which the intermediate masking layer 22 originally comprised a 1200 - a - thick layer of plasma - deposited silicon dioxide , the thickness loss of the patterned portions 26 of the masking layer during sputter etching of the sacrificial layer 18 was less than 200 a . in accordance with the techniques described above , the masked sacrificial layer 18 of fig4 is processed to form therein a pattern that corresponds to the pattern defined by the portions 26 of the intermediate masking layer . the remaining patterned portions of the layer 18 are shown in fig5 and designated by reference numeral 28 . it is significant that the trenches or grooves formed in the sacrificial layer to establish the prescribed pattern therein are characterized by near - vertical walls and substantially no undercutting . importantly , the pattern formed in the thick layer 18 conforms substantially identically to the high - resolution pattern originally formed in the thin layer 20 . by using the patterned portions 28 ( fig5 ) as a mask , the layer 16 of the integrated circuit device being fabricated is then processed to form windows therethrough in alignment with the conductive elements 10 and 12 , as described earlier above . this is done , for example , in a standard plasma etching step . it is apparent that the particular window - forming sequence above is only illustrative of the applicability of the principles of the present invention to fabricating integrated circuit devices . by means of the thick patterned portions 28 shown in fig5 it is also , of course , feasible to treat exposed underlying regions of a device surface in accordance with a variety of standard fabrication processes ( such as deposition , diffusion , etching , implantation , etc .) after the patterned portions 28 ( fig5 ) have been utilized as a mask in the illustrative ways specified above , it is customary to remove the portions 28 from the surface of the device being fabricated . this is done , for example , by applying a suitable solvent to the structure depicted in fig5 or by processing the structure in a plasma etching step in an oxygen atmosphere . in either case , the portions 28 and the overlying portions 26 are thereby removed . the device is then ready for another step in its prescribed fabrication sequence , which may include further processing by means of a patterned sacrificial layer in accordance with the principles of the present invention . in some cases of practical interest , it has been observed that the presence of metals in the chamber in which dry processing of the sacrificial layer 18 is carried out causes so - called texturing ( metallic oxide fibers ) to occur on the device surface . the formation of such fibers can be prevented by avoiding the use of any exposed metallic surfaces in the processing chamber . this dictates , for example , that a nonmetallic material ( such as the aforespecified silicon dioxide , or boron nitride or silicon nitride or glass ) be utilized for the intermediate masking layer 22 . ( the term &# 34 ; glass &# 34 ; as employed herein includes , for example , a variety of spun - on liquid glasses , silica films , glass resins and spun - on oxides which are essentially ta 2 o 5 or tio 2 .) in accordance with the principles of the present invention , the intermediate masking layer 22 may in some cases be omitted altogether . this is feasible whenever the materials utilized to form the thin resist layer 20 and the thick sacrificial layer 18 exhibit relatively high and low resistance , respectively , to the particular dry processing technique employed to pattern the layer 18 . thus , for example , a 0 . 5 μm - thick layer 20 of a silver halide emulsion can serve , when patterned , as a mask for ion milling or sputter etching a corresponding pattern in the layer 18 . finally , it is to be understood that the above - described arrangements and techniques are only illustrative of the principles of the present invention . in accordance with those principles , numerous modifications and alternatives may be devised by those skilled in the art without departing from the spirit and scope of the invention . for example , although emphasis herein has been directed to applying applicants &# 39 ; inventive principles to the direct fabrication of integrated circuit devices , it is to be understood that those principles are also applicable to the fabrication of high - resolution mask structures which , in turn , are used to make integrated circuit devices . thus , illustratively , it is feasible to form patterned regions ( such as those designated 26 and 28 in fig5 ) on an essentially flat 0 . 02 - μm - thick film of gold which is deposited on top of a 0 . 01 - μm - thick layer of titanium supported on a planar polymide film . then , by using the patterned regions as a mask , a relatively thick layer of gold can be electroplated onto the exposed regions of the gold film . in that way , high - resolution gold elements definitive of a prescribed mask structure are formed for use , for example , in an x - ray lithographic system . moreover , in accordance with aspects of the principles of the present invention , a thick patterned sacrificial layer on a planar surface may be utilized as a masking layer for , for example , ion implantation purposes .	7
the invention relates to a method and apparatus for dynamic programming across a computer network . the invention includes a method of programming a server computer from a client computer using logical components to build the program . each logical component has the capability to perform a function that is delivered to the client computer , and which performs tasks that adds value to the overall system . [ 0018 ] fig1 depicts a network of a server and clients such as is known on the world wide web and includes a large set of web servers and web clients . the servers are used to store and deliver information over a wide area network ( wan ) to clients . fig1 depicts a very small network 10 that contains five clients 12 , 14 , 16 , 18 and 20 and one server 22 . the clients normally make requests for information from the server over the network . as shown in fig2 a - 2 b , the server 22 can publish a static html page to the client 12 . alternately , as shown in fig2 c , the server 22 can utilize a user profile to publish a customized page to the client 12 . if a user profile is employed , the user profile is identified by the user logging onto the server or by the server retrieving client identification by a technique such as cookies ( information stored on the client ). this process normally uses a template similar to that shown in fig3 and replaces the “ tag ” with information provided in the user profile . the template shown in fig3 is coded in html and displays the open / close html tags . the program using this template is requested by the client 12 and the server 22 for the information to be merged and published to the client 12 . the server program that performs these tasks including the user interface must be pre - compiled prior to the client making the request . this pre - compilation is a conventional technique that does not allow program steps to be rearranged in order to perform a different task or process . the invention employs a computer structure 50 shown in fig4 . this structure includes a conventional cpu 52 such as an intel pentium running an operating system such as windows nt or unix . a memory 54 is connected to the cpu and includes a program portion 56 , a data portion 58 and a general portion 60 . the program portion 56 includes a server program 56 a for program execution and for retrieving logical components 56 b to assemble into the user program . the data portion 58 includes an available component portion 58 a , a user profile portion 58 b and a user specified component portion 58 c . by assembling the user specified logical components as described below and sequentially storing pointers in data portion 58 c , the server program 56 a can execute each user program according to each user &# 39 ; s specification , without the need for the user to have a compiler . the computer structure 50 also includes a web interface 62 for communicating with clients . this interface is configured to receive calls from the clients and to transmit responses to the clients . the server 50 is also a fully functional computer and can become a client to other servers on the network when desired by a user via user interface 64 . [ 0023 ] fig5 depicts logical components assembled into a user program 70 . this assembly of logical components comprises a user program . the exemplary program includes seven components that are assembled to perform a complex process . these components are stored within memory portion 58 a and are available to the cpu 52 . a reference to each logical component is stored in the user profile memory portion 58 b in sequence of the specific user program specified by the user . an exemplary user profile is shown in table 1 . the user profile is typically retrieved when the user requests execution of their user program . table 2 unique identifier interface definition task - summarized data action 1 - retrieve input arguments for the for the current month current month manufacturing workload action 2 - query database based on arguments and output to an html action 3 - sum the results from query format action 4 - format and output summed results in html format exception handling memory management with regard to the actions , each defined logical component performs a predetermined task . in a manufacturing plant example , the logical components 72 through 84 perform the following tasks shown in table 3 . [ 0027 ] fig6 depicts available logical components as stored in memory portion 58 a . these components are available for selection by the user in order to build a user program . when the user specifies the desired components , the components are arranged in sequence in the memory portion 58 b . once the specified components are arranged , the server program stored in memory portion 60 assembles the specified components and generates the user program 70 . each example task above represents a logical component . the user program 70 is assembled on the server over the computer network by the user specifying pre - programmed components and then initiating the assembly . these components can also be re - assembled across the network to perform a significantly different task for a different user without having to re - compile the server program 56 a . the invention is used to perform complex processes defined by the user or the requesting client on the server or a system connected to the server . the invention has the capability of performing actions programmed remotely across a computer network , these actions can be a variety of processes , such as producing pages from several databases or delivering any media that can be transmitted over a computer network or any set of program steps such as managing and controlling a manufacturing site . examples of other tasks and sub - tasks are : evaluating values from a chemical analysis ; identifying out of range values ; formatting the out of range values and valid ranges into a textural message for an user ; interrogating a database for a set of e - mail addresses for interested parties regarding test results ; and sending an email formatted message to each interested party . the server program execution is performed as described below . by constructing logical components and storing their pointers in sequence in data portion based on the user &# 39 ; s profile 58 b , the server program can execute each user program without the need to re - compile the server program . execution of the logical components requires the base programming language to have the ability to dynamically load , bind and execute pre - built logical component of programming code . fig7 is a flowchart of the server program depicting process steps under an execution of the logical components that are assembled into the user program according to an embodiment of the invention . this flowchart provides details of the actions required to load and execute an user program . in step 102 , the server program identifies the user and retrieves the user profile for that identified user . step 104 retrieves the specified logical components based on the user profile . step 106 retrieves the list of logical components that are to be executed in sequence and stored in memory . step 108 retrieves logical component defaults for the requested program and store in memory . step 110 allocates a memory work space of required details to execute each logical component . step 112 packages required parameters and arguments for each logical component . step 114 determines if the logical component is loaded into memory . step 116 checks if the logical component is not loaded , then it loads the logical component into memory . step 118 binds the call to the newly loaded logical component and pass the required parameters . step 120 retrieves the output from the logical component if an output was produced . step 122 appends the results to any previously constructed results . step 124 determines if all the logical components have been called . if more logical components need to be called , step 126 queues the next logical component and restarts the execution process at step 114 . if all the logical components have been called and executed then step 128 outputs the results of all logical components to the web interface 62 or the user interface 64 . this process describes the server program as it retrieves and binds logical components stored in memory portion 56 b to create the user program . within fig7 steps 106 and 118 are important to insure that the correct program is executed by calling and late - binding the call to the correct logical component . each logical component must have a defined interface so that the server program can identify and call it to perform the required task . the logical component can perform any variety of logical task by accessing a data source ( s ), formatting information , requesting data that the user has entered and acting on that data , such as storing the information into a database . each logical component can act independently of other requested logical components or act in concert with each other . the independent action of each logical component is important because it allows the assembly of logical components that have been constructed by different programmers and possibly by independent methodologies . this enables the workload for an entire system to be divided among a group of programmers , provided that they follow predetermined interface rules of the server program . the server program and these logical components work in concert to perform the tasks . because each logical component is called independently , they can access information across a system without concern of interference from other logical components . the following exemplary steps for logical components depicted in table 4 are generalized from a specific method . advantages of the invention include the ability for a network client or web - browser to program or re - program a remote server &# 39 ; s actions , tasks and methods without a compiler . this allows a variety of tasks to be combined to produce work output that is easily modifiable by the user over a wide area network . having disclosed exemplary embodiments and the best mode , modifications and variations may be made to the exemplary embodiments while remaining within the scope of the invention as defined by the following claims .	7
throughout all the figures , same or corresponding elements may generally be indicated by same reference numerals . these depicted embodiments are to be understood as illustrative of the invention and not as limiting in any way . it should also be understood that the figures are not necessarily to scale and that the embodiments may be illustrated by graphic symbols , phantom lines , diagrammatic representations and fragmentary views . in certain instances , details which are not necessary for an understanding of the present invention or which render other details difficult to perceive may have been omitted . turning now to the drawing , and in particular to fig1 , there is shown a sectional view of a drive arrangement for driving a vertical mill , generally designated by reference numeral 2 . the drive arrangement includes a torque transmitter 12 and a fluid coupling 8 , with the torque transmitter 12 being arranged between the fluid coupling 8 and the vertical mill 2 . the vertical mill 2 operates as a work machine and has a grinding table 20 which is rotatable about a vertical rotation axis a . a grinding track is embodied on the top side of the grinding table 20 , upon which one or a number of grinding rollers 21 roll . the grinding table 20 is arranged in a torsion - resistant manner on a vertical upper end of a drive shaft 22 mounted in an axial bearing 23 and extending along the rotation axis a . a horizontally arranged gear rim 24 is arranged in a torsion - resistant manner on the shaft 22 below the grinding table 20 . a drive arrangement , comprising a motor 4 , a gearing 6 and a shaft 41 connecting the motor 4 and the gearing 6 serves to drive the drive shaft 22 . the shaft 41 comprises a first part , namely a drive shaft of the motor 4 , and a second part , a drive shaft of the gearing 6 . both parts are coupled by means of a fluid coupling 8 . the motor 4 drives an output - side pinion 61 of the gearing 6 by way of the fluid coupling 8 , said pinion 61 cogging with the gear rim 24 . a torque transmitter 12 is arranged between the fluid coupling 8 and the gearing 6 . this can be an automatically switching coupling , e . g . a free - wheel , if necessary with hydraulic support , or an externally - switched coupling , e . g . an electromagnetically or hydraulically switched multiple - disc coupling . during the milling operation , the torque of the motor 4 is transmitted via the shaft 41 , the fluid coupling 8 , the free - wheel 10 and the gearing 6 to the pinion 61 and the gear rim 24 . a rotation of the motor 4 therefore results in a rotation of the grinding table 20 in the work direction of the mill 2 . since the fluid coupling 8 in this case transmits the motor power to the gearing 6 , heat is generated in the fluid coupling 8 on account of the slip of the fluid coupling 8 . when operation of the mill 2 is now temporarily stopped , the fluid coupling 8 can be cooled down in this break of the drive by the torque transmission between the fluid coupling 8 and the mill 2 being temporarily interrupted and the fluid coupling 8 being rotated idling by the motor . since on account of the free - wheel 10 in this case the fluid coupling 8 transmits no power to the gearing 6 , the slip of the fluid coupling 8 is almost zero and there is no significant heat generation in the fluid coupling 8 . however , the rotation causes the fluid coupling 8 to “ ventilate ” and a large heat discharge from the fluid coupling 8 takes place so that the fluid coupling 8 essentially cools down more quickly than when stationary ; as a result the drive is ready to start again relatively quickly . in the case of the free - wheel , the motor 4 can be operated counter to the work direction of rotation , i . e . backwards . in the case of the detached multiple - disc coupling , the motor 4 can be operated in any direction , forwards or backwards . in the event that the mill has to be started up from stationary , the switchable torque transmitter 12 is also advantageous . by the torque transmission between the fluid coupling 8 and the mill 2 being temporarily interrupted , the motor can be brought to a predetermined speed without load . only after a defined speed of the motor has been achieved will the torque transmission between the fluid coupling and the work machine be re - established , i . e . the motor is coupled to the work machine again . this is particularly important when the mill has a number of drives , as shown in the exemplary embodiment shown in fig4 . the top view onto the vertical mill shows four drive arrangements arranged evenly around the mill axis a at the positions 0 , 90 , 180 , and 270 degrees , each comprising an electric motor 4 , a shaft 41 , a fluid coupling 8 , a switchable torque transmitter 12 and a gearing 6 with an output - side pinion 61 . the output pinions 61 of the drive arrangements all cog with a shared gear rim 24 , which is connected to a milling table 20 in a torsion - resistant manner . in this case the motors 4 can generally not be accelerated at the same time , because this would result in the electricity - supply system becoming overloaded . therefore , all motors 4 of the multiple point machine can be brought successively to idle speed , without the energy network being loaded with excessive current intensities . when all the motors 4 of the multiple point machine are up to speed , the clutch couplings 12 can be coupled simultaneously or according to a predetermined switching strategy . therefore all drive trains in an optimal case simultaneously generate the drive torque , wherein the drive torque is not restricted in terms of level and its temporal availability is at a maximum . fig2 shows a section of a drive arrangement for driving a vertical mill , in which a torque transmitter 11 is arranged between the motor 4 and the fluid coupling 8 . besides the difference that the torque transmitter 11 is arranged between the motor 4 and the fluid coupling 8 in the exemplary embodiment in fig2 , and not between the fluid coupling and the vertical mill in the exemplary embodiment in fig1 , the exemplary embodiment in fig2 corresponds to that in fig1 . when a temporary interruption in the torque transmission between the motor 4 and the fluid coupling 8 is effected by means of the switchable torque transmitter 11 , the motor 4 can be started up without the load of the work machine 2 . only after a defined speed of the motor 4 has been achieved will the torque transmission between the motor 4 and the fluid coupling 8 be re - established , i . e . the motor 4 is coupled to the work machine 2 again . this is particularly important when the mill has a number of drives , which cannot be started up simultaneously , because this would result in the electricity - supply system becoming overloaded . therefore , all motors of the multiple point machine can be successively brought to idle speed , without the energy network being loaded with excessive current intensities . when all motors of the multiple point machine are up to speed , the clutch couplings can be engaged simultaneously or according to a predetermined switching strategy . therefore in an optimal case all the drive trains generate the drive torque simultaneously , wherein the drive torque is not restricted in terms of degree and its temporal availability is at a maximum . fig3 shows a section of a drive arrangement for driving a vertical mill , in which a first torque transmitter 11 is arranged between the motor 4 and the fluid coupling 8 and a second torque transmitter 11 is arranged between the fluid coupling 8 and the vertical mill 2 . in this way the operator of the vertical mill 2 has complete freedom in terms of the manner in which he would like to perform the torque transmission , in order to achieve the afore - described advantageous technical effects . fig5 shows a time - temperature diagram with cooling curves of a stationary fluid coupling and a rotating fluid coupling , which clarifies the temporal advantage which can be achieved by the invention . the time t is plotted in the unit hours h and minutes min from 0 to 5 hours to the right on the horizontal axis . the temperature is plotted in the unit degrees celsius from 0 to 180 ° c . to the top on the vertical axis . the starting point of both curves is a fluid coupling heated to 160 ° c . the dashed curve is the cooling curve of the stationary fluid coupling . the stationary fluid coupling cools down relatively slowly and even after five hours of cooling time has still not reached the ambient temperature tu of 50 ° c . the solid curve is the cooling curve of the rotating fluid coupling . the fluid coupling can be operated by the motor without load due to a temporary interruption in the torque transmission between the fluid coupling and the work machine , i . e . can be rotated . this results in a cooling “ ventilation ” of the fluid coupling . the load - free rotating fluid coupling cools down considerably faster than the stationary fluid coupling and has reached the ambient temperature tu of 50 ° c . after approx . 50 minutes of cooling time . while the invention has been illustrated and described in connection with currently preferred embodiments shown and described in detail , it is not intended to be limited to the details shown since various modifications and structural changes may be made without departing in any way from the spirit and scope of the present invention . the embodiments were chosen and described in order to explain the principles of the invention and practical application to thereby enable a person skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims and includes equivalents of the elements recited therein :	5
fig1 is a diagrammatic drawing of a cam phaser system 10 of the present invention . the cam phaser system 10 is provided with pressurized hydraulic fluid such as oil by an oil pump 12 and an oil filter 14 . a four - way solenoid valve 16 controls the oil flow to a cam phaser 18 . the solenoid valve 16 is controlled by a powertrain control module 15 to pulse width modulate ( pwm ) the four - way valve 16 . the cam phaser 18 is coupled between a camshaft sprocket and the end of the camshaft . the camshaft sprocket is coupled to the crankshaft , as is commonly known in the art . the cam phaser 18 includes a piston 20 and spring 24 that are acted upon by oil pressure to move the piston 20 in the directions of arrow a . the sliding piston 20 will rotate sliding helical gears on the sprocket and camshaft to rotate the camshaft relative to the cam shaft sprocket and produce the variable cam phaser functionality of the present invention . oil pressure and flow is provided via the solenoid valve 16 to act upon both sides of the piston 20 . the spring 24 opposes movement of the piston 20 in one direction . the movement of the piston 20 , and thus the cam phaser 18 , will be controlled by the oil flow to either side of the piston 20 . the camshaft further includes target wheel and sensors 30 , 32 to detect the speed and position of the camshaft and / or crankshaft and provide feedback for a camshaft position algorithm . the amount of oil flow to the piston 20 is controlled by the modulation of the solenoid valve 16 . the powertrain controller 15 controls the duty cycle of the solenoid valve 16 to generate the desired position of the piston 20 and thus the cam phaser 18 . in certain situations , debris in the oil may restrict the solenoid valve 16 , preventing the modulation of oil flow through the solenoid . depending on operating conditions , the inability to modulate oil flow will result in uncontrolled movement of the cam phaser 18 , or inability to move the cam phaser 18 . the method and apparatus of the present invention will detect this jammed condition and generate a control current of cyclic output to the solenoid valve 16 to jar the debris loose and release the solenoid 16 . fig2 , 3 and 4 are flowcharts of preferred methods of the present invention . as the cam phaser 18 velocity and direction are related to solenoid position , and since the solenoid 16 can stick in any position , cam phase angle is difficult to use as an indication of a sticking solenoid . the present invention uses error counts ( time ) of two cam phase angle correlation diagnostic to determine if the solenoid 16 is stuck or jammed . once this determination has been made , the controller 15 will apply a cyclic current output to the solenoid 16 to allow the debris or other sticking conditions to be released . the output is preferably applied at a rate that prevents the cam phaser 18 from responding to the cyclic current output once the solenoid 16 has been released . the parameters of the cyclic output are preferably calibrated to ensure that enough force can be applied to release the solenoid 16 , while keeping the frequency high enough to prevent the cam phaser 18 from responding and creating another position error . fig2 is a flow chaff of a preferred solenoid release detection method of the present invention . the software routine of the present invention at block 50 determines if the controller 15 has provided a cyclic current output to the solenoid 16 to unstick the solenoid 16 at the current commanded cam phaser 18 position . this determination is made by checking the flag set at block 50 . the application of cyclic current to the solenoid 16 by the controller 15 will be termed as the “ cycler ” routine . the cycler routine may be executed only once per cam phaser 18 move . if the cycler has been active this cam phaser 18 move , then the routine will exit at block 100 . if the cyclor has not been active as this commanded cam phaser 18 position , the routine will continue to block 52 to determine if the cycler has been activated more than a certain calibrated number of times in this ignition cycle . if the cycler has been active more than the calibrated number of times in this ignition cycle , then the routine will exit at block 100 to allow the diagnostic to complete and indicate that there is a mechanical or engine problem . if the cycler has not been active more than the calibrated number of times in this ignition cycle , the routine will continue to block 54 . block 54 represents a diagnostics routine ( p0016 ) to detect a cam phaser 18 home position fault . the p0016 diagnostic runs when the cam phaser 18 is commanded to its home ( fully advanced ) position . the diagnostic compares the current position of the cam phaser 18 to its design intent home position . if these positions vary by more than a calibrated amount , the cam phaser is determined to be stuck and the p0016 diagnostic failure counter ( timer ) will increment . if the condition remains for a calibrated amount of time , the diagnostic will log a failure of this condition in the controller 15 and will disable the operation of the cam phaser 18 . the p0016 diagnostic is determined to have been passed ( i . e ., diagnostic indicates no faults ) when the current cam phaser 18 position is within a calibrated range of the design intent home position for a calibrated amount of time . if a cam phaser 18 fault has been detected by block 54 , the routine will continue to block 58 . the fault detection at block 54 occurs at a lower calibrated time , than failure of the p0016 diagnostic , and therefore before a cam phaser 18 fault is logged or cam phasing is disabled . if a cam phaser 18 fault has not been detected at block 54 , the routine will continue to block 56 having a second diagnostics routine ( p0014 ). the p0014 diagnostic runs when the cam phaser 18 is commanded to any position other than its home ( fully advanced ) position . the diagnostic compares the current position of the cam phaser 18 to its commanded position . if these positions vary by more than a calibrated amount , the cam phaser is determined to be faulted and the p0014 diagnostic failure counter ( timer ) will increment . if the condition remains for a calibrated amount of time , the diagnostic will log a failure of this condition in the controller 15 and will disable operation of the cam phaser 18 . the p0014 diagnostic is determined to have passed when the current cam phaser 18 position is within a calibrated range of the commanded cam phaser 18 position for a calibrated amount of time . if no cam phaser fault is detected at block 56 , the routine will end at block 100 . if a cam phaser fault has been detected at block 56 , the routine will continue to block 58 . the fault detection at block 56 occurs at a lower calibrated time , than failure of the p0014 diagnostic , and therefore before a cam phaser 18 fault is logged before cam phasing is disabled . the routine , at block 58 , sets a flag to indicate that the cyclic output should be enabled and continues to block 60 to set a flag indicating that the cycler has been activated at this commanded cam phaser 18 position . the flag set at block 60 will prevent the cycler from being activated again until the cam phaser 18 is commanded to a new position . continuing to block 62 , the routine increments a first counter that indicates how many times the cycler has been activated in this specific ignition cycle . the cycle counter at block 64 is initialized to allow the cycler to perform a calibrated number of square wave pwm cycles to release the sticking solenoid 16 . once a cam phaser fault has been detected by the algorithm in fig2 , the software routine to release the solenoid 16 is activated . fig3 is a flow chart of a preferred solenoid release control software routine of the present invention . starting at block 80 , the routine will determine if the solenoid release routine should be active . the flag set at block 58 will indicate if the solenoid release routine should be active . if the flag has not been set , the routine will return to normal closed loop control for the cam phaser 18 at block 82 . block 84 determines if the number of release cycles or current pulses initialized to a calibrated value at 64 have been completed , as determined by a first counter . the first counter indicates the number of square wave pwm output cycles remaining to be completed by the cycler . if the calibrated number of square wave pwm cycles are complete as indicated by the first counter being zero , then the solenoid release routine will be stopped at block 86 by clearing the flag set at block 58 and checked at block 80 , and the cam phaser 18 will be returned to normal closed loop control at block 82 . continuing to block 88 , when the release cycles have not been completed , block 88 determines if the output of the controller (“ control signal ”) to tile solenoid 16 should be in a high or on position for the current output cycle . this determination is made by comparing a second counter to a calibrated desired high time . if the control signal should be high , then the second counter is incremented at block 90 and the control signal is forced to a high condition for the current output cycle at block 92 . the routine then exits at block 94 . if the controller determines that the control signal for the current output cycle should not be high , the routine continues to block 96 . block 96 determines if the control signal should be low or off . this determination is made by comparing a third counter to a calibrated desired low time . if the control signal should not be low , the second and third counters are reset at block 98 and the first counter is incremented at block 100 . the routine will then continue to block 84 . if the controller determines that the control signal should be low at block 96 , the third counter will be incremented at block 102 and the control signal will be forced to a low condition for the current output cycle at block 104 . the routine will then exit at block 94 . the routine of fig3 will thus modulate a control signal to the solenoid that will be held high and low for a certain calibrated amount of time and a certain calibrated number of cycles to release the solenoid 16 from a jammed or stuck condition . fig4 is a flow chart of a preferred routine to clear the flag that indicates that the cycler has been active at the current desired cam phaser 18 position of the present invention . the routine starts at block 110 . at block 112 , the routine determines if the commanded cam phaser 18 position has changed . this determination is made by comparing the current commanded position to the previous commanded position . if the commanded position has changed , execution continues at block 114 . the flag to indicate that the cycler has been active at the current commanded cam phaser 18 position is cleared at block 114 . this action allows the cycler to be made active again at the current commanded cam phase position if necessary . this flag is checked at block 60 in fig2 . if the commanded cam phaser 18 position has not changed from the previous position , as determined in block 112 , the routine exits at block 116 . while this invention has been described in terms of some specific embodiments , it will be appreciated that other forms can readily be adapted by one skilled in the art . accordingly , the scope of this invention is to be considered limited only by the following claims .	5
the invention is described hereinafter by way of a preferred embodiment as shown in the drawings , and specifically with respect to a smaller sized forklift truck of about 5 , 000 pounds lift capacity ; however , it will be appreciated that the invention is broader in scope and pertains to an alternative fuel system for other types of self - propelled vehicles where space on the vehicle and in the engine compartment is limited . referring to fig1 a lift truck ( 1 ) is propelled by drive wheels ( 2 ) in front and steered from the rear by steer wheels ( 3 ) while maneuvering and positioning pallet loads raised and lowered on the forks of the truck carried on an extendable mast ( 4 ). the body of the lift truck includes a counterweight structure ( 5 ) at the rear , which counterbalances the load lifted by the mast ( 4 ). a side door ( 6 ) is hinged along the front edge andmay be swung out of the way and the seat deck ( 7 ) raised , as in fig3 . a bulkhead extension plate ( 9 ), attached to the bulkhead ( 10 ) at the rear ofthe engine compartment , mates with the deck ( 7 ) when closed . a tank ( 12 ) containing compressed natural gas is mounted on top of the counterweight structure ( 5 ) by means of straps ( 13 ) encircling the cylindrical body portion of the tank and firmly clamping it to mounting legs ( 14 ) bolted to the counterweight structure . the tank is constructed of deep - drawn , seamless , steel reinforced with glass fibers producing a wall thickness of approximately 1 / 4 &# 34 ; to withstand the internal gas pressure of up to 3 , 000 psig . since compressed natural gas ( cng ) at sea level and ambient temperature of 70 ° remains a gas at 3 , 000 psi , unlike propane , which is liquified at these conditions , the manufacture ofa cng tank is strictly controlled under the u . s . department of transportation ( dot ) specifications and quality control . for example , cng tanks of various sizes may be obtained from pressed steel tank company in milwaukee , wis ., a certified dot manufacturer . in order to obtain the fuelcapacity required for a normal eight - hour shift , or the equivalent of about51 / 2 gallons of gasoline , or 33 pounds of liquid propane ( lpg ), the size ofthe tank ( 12 ) must be about twice the size of a standard propane tank in terms of overall dimensions . the tank in the case of a 5 , 000 pound lift truck , as illustrated in fig1 is approximately 32 &# 34 ; along its longitudinal axis , and is approximately 16 &# 34 ; in diameter , across the cylindrical body portion , creating an internal volume of 4 , 455 cubic inches ( 73 . 18 liters ) and weighing about 105 pounds ( 75 kilograms ). this tank will have a capacity of about 670 cubic feet of natural gas under 3 , 000 psi at 70 ° f . referring to fig4 a and 4b , a shutoff valve ( 16 ) is threaded into the mouth ( 15 ) of the tank in the neck ( 22 ). a pressure gauge ( 17 ) communicates upstream or above the shutoff in the chamber of valve ( 16 ) for registering the pressure in the tank ( 12 ) at all times . a cylindrical collar ( 18 ) is aligned with the axis of the tank and is bolted or otherwise firmly secured to a clamping ring ( 19 ) which has mating halves drilled and tapped at ( 20 ), ( 21 ) for securing it onto the neck ( 22 ) of thetank so that the collar ( 18 ) is in firm cylindrical engagement with the semi - spherical end of the tank . the collar extends laterally to surround the shut - off valve ( 16 ), and gauge ( 17 ), but not beyond the side plane of the lift truck . the collar ( 18 ) has an opening ( 23 ) through which a high - pressure line ( 24 ) extends . a fitting ( 25 ) threads into a right angleopening ( 26 ) communicating in the body of the shutoff valve ( 16 ) downstreamor below the seat in the valve chamber . the high - pressure line ( 24 ) is coiled , or looped at ( 28 ) to attenuate vibrations . it connects at the opposite end ( 29 ) to a fitting ( 30 ) threaded into a t - bulkhead fitting ( 31 ), the body of which has a cross passage at right angles opening down where a second high - pressure line ( 34 ) is connected by a fitting ( 35 ) to the lower outlet of the bulkhead fitting ( 31 ). at the opposite end of the line ( 34 ), an elbow ( 36 ) is connected to the inlet ( 39 ) to a high - pressure regulator ( 37 ). the line ( 34 ) also has a loop ( 38 ) intermediate the fitting ( 35 ) and elbow ( 36 ) to take out additional vibrations . the regulator ( 37 ) is a known type of industrial vehicle regulator which converts the 3 , 000 psig gas pressure atthe inlet ( 39 ) to 125 psi at the outlet ( 40 ). hoses ( 41 , 43 ) connect to thecooling system of the engine to deliver hot fluid to the body ( 42 ) of the regulator , circulating engine coolant at approximately 180 ° f . around passages surrounding the regulator nozzle and decompression chamberto prevent freeze - up . a regulator suitable for use in the system in accordance with the preferred embodiment of the invention is available from modern engineering company in st . louis , mo ., and is referred to as atype p , ngv regulator with enviroal - cap , model no . 8433 . gas from the outlet ( 40 ) is delivered by line ( 44 ) to a second stage regulator ( 45 ). gas outlet pressure from the first stage regulator enters the second stageregulator at the bottom through elbow ( 46 ) secured on the end of line ( 44 ). the regulator ( 45 ) is of the same type used in liquid propane fuel systems known as an ohg model x - 2 sold by the ohg corporation in santa fe springs , calif ., the operation of which is generally known , that is , it delivers gaseous fuel in the properly metered proportions to the engine carburetor ( 49 ) for mixing with air in the optimum proportions for the emission and performance requirements of the engine . the regulator ( 45 ) functions as both a lock - off and decompression chamber such that when the engine is shut off , and there is no vacuum to hold the valve open , the diaphragm internally of the regulator locks off the fuel pressure entering the regulator in a known manner . a feature of the invention with particular application in compact vehicles having limited space in the engine compartment is the mounting bracket ( 52 ) which bolts to the bulkhead section ( 53 ) ( see fig3 ). a horizontal upper surface ( 54 ) is provided for mounting the second stage regulator ( 45 ) while on the same bracket ( 52 ) a right angle surface ( 55 ) faces inwardly , providing a mounting for the high - pressure regulator ( 37 ). placing the regulators ( 37 ) ( 45 ) at ninety degrees to each other helps with space utilization in strict confines of the engine compartment . the hoses ( 41 ) ( 43 ) can reach the body ( 42 ) directly without having to bend ina ninety degree path . in addition , the bracket serves as a solid mounting structure and heat transfer member for the hoses and lines connected to the subassembly of regulators 37 , 45 , for more uniform counteraction of the refrigeration effect . referring to fig4 a , a refilling valve body ( 60 ) is threaded into the upper end of the bulkhead fitting ( 31 ) at its lower end . the valve body ( 60 ) has a valve chamber ( 62 ), fig5 c , in which a piston ( 63 ) is biased by spring ( 64 ) to a normally closed position with the passageway ( 65 ) communicating at right angles with a refilling receptacle passageway ( 66 ) which is normally closed by the dust plug ( 67 ), shown in fig5 a . a blow - off vent ( 68 ) connects with the passageway ( 65 ) in the case of an over - pressure situation . the dust plug ( 67 ) is removed and a hose nozzle ( 70 ) ( see fig2 ) is inserted in the filling receptacle passageway ( 66 ), when refilling the tank 12 . a shutoff valve at the nozzle ( 70 ), is manually opened releasing gas at high pressure for filling the tank ( 12 ) from a fuel dispensing tower ( not shown ) of the filling station . the gas pressure unseats the piston ( 63 ) against the force of spring ( 64 ), allowing gas to enter the upper end of the bulkhead fitting ( 31 ) and flow in reverse direction through the line ( 24 ), to the tank ( 12 ). a microswitch ( 72 ) ( see fig5 a , b ) has leads ( 73 ) which are wired into the ignition circuit of the truck so as to interrupt the circuit , when the nozzle ( 70 ) in inserted . so long as the nozzle ( 70 ) is fully inserted in the refueling receptacle passageway ( 66 ), the microswitch ( 72 ) is held open by the end of the nozzle engaging the switch actuator ( 74 ). referring to fig4 a , the bulkhead fitting ( 31 ) forms a bulkhead connectionwith the first and second high - pressure lines ( 24 ) ( 34 ) and the refilling valve ( 60 ) in the bulkhead extension plate ( 9 ). this assembly is protectedwithin a housing ( 75 ) from being struck by objects protruding in the aisle or by falling loads . an aperture ( 76 ) in the side of housing ( 75 ) facing to the right facing forward aligned with the refilling valve body passageway ( 66 ) of the refilling valve ( 60 ), and is normally closed by thedust plug ( 67 ) which is shown tethered by a chain ( 77 ) in fig2 to the topplate ( 78 ) of the housing ( 75 ). it will be appreciated from the foregoing description that according to thepresent invention , natural gas flows through the line ( 24 ) where it is decompressed by the high - pressure regulator ( 37 ). since the high - pressure regulator is located near the cng tank ( 12 ), the length of the high - pressure line is substantially shortened , decreasing the possibility of rupture or loosening of the fittings due to vibration . when the engine compartment is completely buttoned up , as it would be during normal operation or refueling , it is virtually impossible for the high - pressure lines to be damaged because the configuration of the lift truck itself is taken into account in designing the cng system . the overhead guard ( 74 ) has a right rear leg that provides a pillar guarding against protruding objects in the aisle striking the exposed portion of the fuel line ( 24 ) ( fig3 ). the line ( 24 ) comes out of tank ( 12 ) directlydownward after passing through opening ( 23 ) in the collar ( 18 ). the line isbent ninety degrees and routed along the top of counterweight ( 5 ) to the connection ( 30 ) with the bulkhead fitting ( 31 ). it is covered by a guard tunnel ( 79 ) ( fig4 a ) integral with the housing ( 75 ) that prevents damage to the line by heavy objects accidentally being dropped on it or the operator stepping inadvertently on the line . the line runs immediately behind the overhead guard leg ( 74 ) before taking a path along the surface of the counterweight behind the leg ( fig3 ) and thence inside the tunnel ( 79 ) behind the leg , and around to the opposite side to enter the bulkheadfitting ( 31 ) from the rear . of course , such precautions may be unnecessary , in many applications ; however , fork lift trucks encounter a variety of workplace hazards . for example , in traveling between narrow aisles , or through tight doorways in reverse , an unseen protruding object could easily rip off an otherwise unprotected high - pressure line . since fork lift trucks operate in reverse much of the time , the collar ( 18 ) clamps solidly onto the neck ( 22 ) of thetank to protect the line ( 24 ), the shutoff valve ( 16 ) and gauge ( 17 ). a short length of the high - pressure line ( 24 ) lays close to the rear of the guard leg such that it is virtually integral with it , and is protected by it . the housing ( 75 ) and guard tunnel ( 79 ) cooperates with the guard leg to protect the line ( 24 ) from being struck from above . should a leak nonetheless be caused by accidental impact directly to the high - pressure line at the only very short exposed section , the leak occurs outside of the engine compartment and behind the operator . since natural gas is lighter than air , it is quickly dissipated , rather than being trapped inside the engine compartment . once the high - pressure gas line enters the engine compartment below the bulkhead extension plate ( 9 ), line ( 34 ) is protected by the seat deck ( 7 ) and the side door ( 6 ) so that it is not possible for any falling object to strike the line or the components ( 37 ) ( 45 ). the compact arrangement takes part of its advantage from the bracket ( 52 ) which also enhances the heating effect by locating the components ( 37 , 45 ) in close proximity . the expansion of the gas takes place in these components , with accompanying cooling effect . this is more efficiently counteracted due to heating of these parts promptly after starting the engine by lines ( 41 , 43 ). the gas is maintained at a uniform temperature by the heat transferred through the bracket ( 52 ) to the regulators ( 37 ) ( 45 ) preventing freezing up of the lines , nozzles and associated parts . the mounting bracket ( 52 ) bolts to the bulkhead section ( 53 ) which , in part , provides a heat sink for the rear mounted radiator ( not shown ) and functions as a source of heat transferred tot he bracket ( 52 ) to assist inthe vaporization of the cng fuel . while these and other advantages will become more apparent in reference to the aforementioned description of the preferred embodiment of the invention , it will be appreciated that additional objects , features and advantages of the invention may take other forms without departing from the scope of the invention as defined in the appended claims .	8
fig1 shows a toy archery set 10 of the present invention which comprises a bow 12 and arrows 14 . the bow 12 includes limb portions 16 , a bowstring 18 , barrel housing 19 , a barrel 20 , and a plunger 24 . the limb portions 16 are connected to , or integrally formed with the barrel housing 19 . the connection between the limbs 16 and barrel housing 19 may be formed by interlocking the two pieces , by using pins , or by applying any other method known in the art . the exterior of the barrel housing 19 has a lower end formed as a handhold 26 suitable for being grasped by the user operating the bow 12 . a quiver which may be a collet 28 may be mounted on the limb portions 16 on the barrel housing 19 or on any other appropriate portion of the bow 12 . the collet 28 has two rings 30 and 32 ( shown in fig2 ), which are each sized to receive an arrow 14 . the limb portions 16 of the bow 12 are connected to bowstring 18 . plunger 24 has a handle 34 for drawing the bow 12 . the handle 34 is grooved to receive bow string 18 . the handle 34 may have finger grooves ( not shown ). the handle 34 may also have a hand opening 35 . the bowstring 18 can be attached to handle 34 of the plunger 24 . rigid attachment of the bowstring 18 to handle 34 provides structural stability to the bow 12 through the plunger 24 . proximal to the handle 34 is a shoulder portion 39 . shoulder portion 39 may be tapered distally . the forward movement of the plunger 24 ( to be described later ) may halt before the shoulder portion 39 touches the barrel 20 . either the tapering or preventing the shoulder portion 39 from touching the barrel 20 helps protect the user &# 39 ; s fingers from being pinched . these two safety features are not necessary if the archery set is used properly . the barrel housing 19 is attached perpendicularly to the approximate longitudinal center of the bow 12 . barrel 20 is coupled within housing 19 generally perpendicular to the length of the bow 12 . the housing 19 and barrel 20 may be attached or integral with each other . an arrow support tip 36 is also coupled to housing 19 generally perpendicular to the length of the bow 12 , and opposite barrel 20 . arrow support tip 36 is a generally cylindrically shaped tip , having an opening ( s ) 38 is its arrow - engaging end . the opening ( s ) 38 are directed sideward for safety purposes . arrows 14 have an axial bore formed within them . the axial bore has an opening at a bow - engaging end 37 of arrows 14 . arrow support tip 36 has a diameter which is approximately the same as the diameter of the axial bore in arrows 14 . therefore , an arrow 14 can be mounted on bow 12 for firing by having tip 36 inserted in the axial bore of an arrow 14 . during operation , an arrow 14 is mounted for firing on tip 36 . the operator of bow 12 places one hand on handhold 26 and grasps handle 34 with the other hand . the operator pulls handle 34 away from housing 19 , thus moving plunger 24 to its drawn position ( shown in fig1 ). when plunger 24 is drawn , it compresses a spring , encased in barrel 20 . the operation of the spring mechanism will be described in more detail later in the specification . when the operator releases handle 34 , the force of the compression spring urges plunger 24 into barrel 20 . as a result , a compressed stream of air is forced through opening ( s ) 38 in tip 36 , thereby propelling the arrow 14 mounted on tip 36 . as a result , a compressed stream of air is forced through opening ( s ) 38 in tip 36 . the air acts as a driving force on the arrow and as a lubricant between the arrow 14 and the support tip 36 . the air also acts as a force to propel the arrow 14 mounted on tip 36 . fig2 shows a front view of archery set 10 . the elements corresponding to those shown in fig1 are correspondingly numbered . fig2 more clearly shows the arrangement of collet 28 and rings 30 and 32 . rings 30 and 32 are generally semi - circular rings , having openings 40 and 42 , respectively . arrows 14 are formed , preferably , of a compressible , resilient material such as foam . rings 30 and 32 each have an inner radius of curvature , which are sized to receive the arrows 14 . thus , arrows 14 , when pressed into rings 30 and 32 , are secured within the rings 30 and 32 . fig2 also shows a sight 44 formed in bow 12 . in this preferred embodiment , sight 44 is a circular opening formed through the barrel housing 19 in bow 12 . sight 44 may include a clear plastic lens with cross - hairs , or it may simply be an opening . bow string 18 can be used in alignment with sight 44 to aim bow 12 . fig3 shows a side sectional view of one preferred embodiment of bow 12 . some of the elements shown in fig3 are similar to those shown in fig1 and 2 . similar elements are correspondingly numbered . fig3 shows that barrel 20 defines a center opening 46 . plunger 24 has a shaft portion 48 that extends within center opening 46 . shaft portion 48 has a first end 50 which is attached to a collar 52 . in turn , collar 52 has a opening for receiving a spring mechanism 56 . collar 52 is also attached to annular ring 54 and mounting post 62 . annular ring 54 may be cup - shaped , opening towards tip 36 . spring mechanism 56 is inserted within collar 52 and rests against a shoulder 58 of collar 52 . spring mechanism 56 also rests against a back - spring stop 60 at the distal end of center opening 46 . shaft 48 of plunger 24 is rigidly attached to the collar 52 and to the annular ring 54 . therefore , when an operator draws bow 12 by pulling handle 34 , and consequently plunger 24 , away from barrel housing 19 , collar 52 and annular ring 54 are also pulled away from barrel housing 19 within barrel 20 . therefore spring 56 is compressed between spring stop 60 and shoulder 58 on collar 52 . arrow support tip 36 has a passage extending from opening ( s ) 38 to a base 59 . the passage at base 59 opens into center opening 46 in barrel 20 . center opening 46 and base 59 can be formed by a plurality of tubular pieces being joined together or by one integrally formed tube extending from opening ( s ) 38 to spring stop 60 . fig4 shows bow 12 in a partially drawn position . as the operator draws bow 12 , spring 56 compresses , thereby applying a spring force to urge collar 52 and annular ring 54 back toward base 59 . annular ring 54 snugly abuts the inner surface 55 of barrel 20 . also , a central opening in annular ring 54 snugly receives mounting post 62 of collar 52 . therefore , the combination of annular ring 54 and mounting post 62 forms a substantially air tight barrier within barrel 20 . the annular ring 54 helps draw air into the barrel 20 when the operator draws the bow 12 . when the operator releases handle 34 , spring mechanism 56 expands , and pushing collar 52 , as well as annular ring 54 and mounting post 62 , towards base 59 . spring mechanism 56 exerts enough force so that this movement is quite rapid . movement of this generally air tight barrier rapidly compresses air into a compressed air stream directed out through opening ( s ) 38 in tip 36 . this air stream has enough velocity to propel an arrow 14 mounted on tip 36 into flight . fig5 is an enlarged cross - sectional view of a portion of bow 12 wherein center opening 46 meets the base 59 of the tip 36 . fig5 shows that central opening 46 opens into a widened end 66 at shoulder 72 . annular ring 54 abuts the interior surface of the widened end 66 of center opening 46 and is urged against a stop 67 . fig5 also shows that collar 52 is attached to shaft 48 through the use of screws 68 and 70 . also , mounting post 62 is either frictionally fit into an opening in collar 52 or is formed integrally with collar 52 . as the operator draws bow 12 , annular ring 54 is pulled away from stop 67 in widened end 66 of center opening 46 . the annular ring 54 moves backward past shoulder 72 into a narrower portion of center opening 46 . annular ring 54 is formed of a compressible , resilient material . upon engaging shoulder 72 , the annular ring 54 compresses to snugly fit the interior surface of barrel 20 along the narrow portion of center opening 46 . the resilience of annular ring 54 assures that , when in the narrower portion of the center opening 46 , annular ring 54 along with mounting post 62 forms the substantially air tight barrier in barrel 20 referred to with reference to fig4 . once the operator releases the handle 34 of the bow 12 , compression spring 56 forces the air tight barrier back toward the widened end 66 and stop 67 in barrel 20 . this causes an air stream to rush through barrel 20 , into the bore in tip 36 and through opening ( s ) 38 until annular ring 54 comes to rest against stop 67 . thus , spring 56 , along with annular ring 54 , mounting post 62 and collar 52 essentially forms a pneumatic piston . spring 56 provides the driving force for the pneumatic piston . the piston creates a pressurized air stream with enough force to drive an arrow 14 mounted on tip 36 into flight . fig6 is a side view of a second embodiment of the present invention . in fig6 a second bow 80 is shown with portions of bow 80 broken away . fig6 also shows a portion of an arrow 81 broken away . bow 80 includes limb portions 82 , hand hold 84 , barrel 86 and plunger 88 . plunger 88 includes compression spring 90 , shaft 92 , back - spring stop 94 , front spring stop 96 , handle end 98 and arrow engaging end 100 . bow 80 may also have at least one arrow engaging ring 112 for holding an arrow 81 . bow string 102 is attached to limb portion 82 and may also be fixedly attached , through a handle 104 at handle end 98 . handle 104 includes a gripping portion which has finger grooves 106 . proximal to the handle 104 is a shoulder portion 110 which may taper distally . during operation , the bow operator may draw bow 80 while gripping handle 104 and hand hold 84 . the operator then draws handle 104 away from hand hold 84 . shaft 92 is slidably mounted within barrel 86 . therefore , when the operator draws bow 80 , front spring stop 96 compression spring 90 against back - spring stop 94 . arrow engaging end 100 of plunger 88 includes an arrow plug 108 which fits snugly into an axial opening in arrow 81 . thus , when he operator releases handle 104 , compression spring 90 acts on front spring stop 96 to urge handle 104 back toward hand hold 84 . handle 104 moves toward hand hold 84 quickly until the front spring stop 94 of the plunger 88 abuts a front spring stop 95 halting further movement before the shoulder portion 110 of plunger 88 abuts the back - spring stop 94 . this causes plunger 88 to come to an abrupt halt . the momentum of the arrow 81 causes it to disengage from the arrow plug 108 and become airborne . in the embodiments shown in fig1 and 6 , arrows 14 and 81 are primarily formed int eh same ( other than the axial bore of arrow 14 and axial opening of arrow 81 ). the arrows have a shank portion 114 formed of foam , or another appropriate soft , lightweight resilient material . arrows 14 and 81 may alternatively have a tip portion 116 formed of a grasping material , such as hook and loop - type material , a magnet , or a suction cup . arrows 14 and 81 have blades 118 which are attached to shank 114 through the use of adhesive , heat welding , or another appropriate attachment means . the individual blades 118 collectively comprise the fletching . the distal end of the shank 114 may have grooves or recesses ( not shown ) designed to receive the blades 118 . the blades 118 may be oriented such that the longitudinal axis of the shank 114 is in the longitudinal plane of the blades 118 . alternatively , the longitudinal access of the blades 118 may bisect the longitudinal axis of the shank 114 . preferably the blades 118 are equally spaced about the distal end of the shaft and formed integral with the shaft 114 . blades 118 , which can be formed of foam , plastic , or another suitable material , guide the arrow 14 or 81 in a generally predictable flight path . the present invention provides an archery set which substantially encloses the projective force used to project foam arrows . further , the archery set of the present invention provides a projective force which does not rely on either the elasticity of the bow string or the resiliency of the bow itself . therefore , operation of the bow is made significantly easier than operation of traditional archery sets which require a significant amount of coordination . the projective force can be provided by a number of suitable means including a spring mechanism , or a spring mechanism acting in conjunction with a pneumatic piston . although the present invention has been described with reference to preferred embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention .	5
the polyglycerol used in the examples below has the following composition ( in molar %): glycerol : about 27 % ( between 24 and 30 %); diglycerol : about 31 % ( between 28 and 34 %); triglycerol : about 23 % ( between 20 and 26 %); tetraglycerol : about 12 % ( between 9 and 15 %); pentaglycerol : about 7 % ( between 4 and 10 %); ie . it has a degree of polymerization ranging between 2 and 3 , in fact of about 2 . 4 , and an average number of hydroxyl funtions of about 4 . 4 . it is then esterified with a mole / mole stoichiometry with a c8 – c10 fatty acid to reach a mono - c8 – c10 polyglycerol majority distribution called pg 8 / 10 below , with a free oh / esterified oh molar ratio of about 3 . 4 : 1 . “ c8 – c10 fatty acid ” is understood to be an industrial acid consisting essentially of c8 or c10 acids , but possibly also containing small quantities of heavier or lighter acids , this resulting from the natural origin and from the manufacturing process . the purpose of tests or experiments in porous media is to simulate passage of the filtrate through a reservoir rock and to study the interaction thereof on the saturations in place in the rock . two types of experiments are conducted : in both cases , the residual water saturation of the rock is observed to change , as is the oil permeability in the direction opposite the filtration direction ( backflow ). the experimental device is diagrammatically shown in fig1 . the porous medium 2 is placed in a hassler cell 1 . a confining pressure of 2 mpa is applied to the medium by means of a squeeze cap 3 . brine , oil , or a simulated filtrate can be circulated in the porous medium . the flow rate of the injected solution is controlled by a pharmacia type piston pump 4 . a differential pressure sensor 5 is placed between the inlet and the outlet of the cell . the device is connected to a computer 6 which allows to calculate , among other things , the permeability of the rock to the injected liquid . core sample 2 is made of clashack sandstone for experiments ( i ) or vosges sandstone for experiments ( ii ). it has the following dimensions : length 60 mm , section 32 . 7 mm , pore volume vp approximately 8 . 5 cm 3 , porosity approximately 17 %. the porous medium must be under conditions similar to those of the reservoir . the core sample must therefore be saturated with brine , then with oil ( a ) saturating rock with brine : the core sample is saturated in a vacuum drier , then subjected to a confining pressure of 2 mpa and brine is passed therethrough ( 40 g / l nacl , 5 g / l kcl ) at 10 cm 3 / h for 48 hours with 10 bars pore pressure . ( b ) measuring permeability to brine : brine is passed through the core sample at different flow rates ( q : 300 , 200 , 100 cm 3 / h ) and the pressure difference ( δp ) between the ends of the porous medium is measured . the slope of the line q = f ( δp ) enables the permeability of the rock to brine kw ( in milidarcy ) to be calculated . ( c ) measuring permeability to oil : injection of soltrol 130 ® oil ( refined oil sold by phillips chemical co . having a viscosity 0 . 7 mpa . s at 80 ° c .) at 10 cm 3 / h for 24 hours , then gradual increase of the flow rate from 100 cm 3 / h to 500 cm 3 / h . the volume of water collected enables the saturation rate of the oil ( so ) and water ( sw ) to be calculated . oil is then passed through the core sample at different flow rates ( 300 , 200 , 100 cm 3 / h ) and the differential pressure δp is measured . the slope of line q = f ( δp ) enables the permeability of the rock to oil ko ( in millidarcy ) to be calculated . the solution simulating the filtrate ( brine or brine + additive or brine + polymers or brine + polymers + additive ) is injected at 10 cm 3 / h . the volume of oil collected enables the new water and oil saturation rates to be calculated . production start is simulated by backflow injection of oil ( i . e . in the opposite direction to injection of the filtrate ) at 10 cm 3 / h . the volume of water collected enables the new water and oil saturation rates sw and so to be calculated . oil is then passed through the core sample at various flow rates ( 300 , 200 , 100 cm 3 / h ) and the differential pressure δp is measured . the slope of line q = f ( δp ) enables the permeability of the rock to oil ko 1 ( in md ) to be calculated . 2 . dynamic filtration ( 600 s − 1 ) under pressure ( 3 . 5 mpa ) and temperature : once saturated under the conditions of a reservoir , the core sample is placed in a dynamic filtration cell . a water - based drilling mud is then filtered , and an external and internal cake forms during filtration . this experiment is closer to real conditions because a real water - based mud filtrate , and no longer a simple simulated filtrate , passes through the core sample . the core sample is then transferred into the hassler cell and the water and oil saturations and the return permeability to oil are measured as before , by backflow injection of oil . the tests consist in injecting a brine , to which the additive according to the invention is or is not added , into a porous medium previously saturated in the presence of oil and water under swi ( initial water saturation ) conditions ( type ( i ) test ). sw is the water saturation ( percentage water contained in the pore volume ) ko is the permeability of the core sample to oil expressed in millidarcy ( in si units , the conversion factor is : 1 darcy = 9 . 87 . 10 − 13 m 2 ). in the presence of 0 . 1 g / l of pg8 / 10 additive in the brine , the results become : these filtration tests show that addition of 0 . 1 g / l of pg8 / 10 additive allows to remove most of the residual water . addition of the additive to a brine injected into a porous medium thus enables the saturations to be changed by displacing residual water , thus leading to higher oil saturations . note that permeability to oil also increases after backflow . the same experiments are conducted in the presence of 0 . 5 g / l of polymer ( polyacrylamide pam ) to approximate the real composition of a water - based mud filtrate . in the presence of pam alone , there is no change in residual water saturation . however , the oil permeability is decreased due to adsorption of the polymer on the rock and to clogging of its pores by the polymer aggregates . as can be seen from the example below , when pg8 / 10 is added , most of the residual water is displaced . note also that the decrease in the oil permeability of the rock is less than when pam alone is present . one may conclude that , even in the presence of polymers , addition of pg8 / 10 removes most of the residual water and limits the reduction in oil permeability . to come closer to actual conditions , dynamic filtration is carried out , then reinstitution of well production is simulated ( type ( ii ) test ). the water - based mud formulation is called flopro , it is marketed by the mi drilling fluids company ( usa ). these tests , carried out on a complete formulation , confirm the good results obtained with saturation ( saturation with residual water after oil backflow of 29 % in the presence of 1 g / l pg8 / 10 is obtained , as opposed to 53 % without additive ). the goal is to show the effect of the additive on the wettability of the rock . for this purpose , spreading of a drop of oil on the surface of a rock ( claschach sandstone ) immersed in a salted aqueous solution that contains or does not contain the additive according to the invention is observed . the experimental device ( fig2 ) is a crystallizer 10 containing an aqueous solution 11 ( 40 g / l nacl , 5 g / l kcl ), a rock support 12 , a slice of rock 13 , and a drop of oil 14 ( soltrol ®) deposited with a syringe 15 . the method of operation is as follows : a slice of a claschach sandstone type rock is suspended in a salted aqueous solution that contains or does not contain the additive . after immersion for about 40 seconds , a drop of soltrol ® oil coloured with sudan blue is introduced at the surface of the rock with a needle . the form of the drop is then observed in the presence or not of the additive according to the invention contained in the solution . in the salted water alone , the oil drop is round and does not spread ( fig2 ). the rock is thus preferentially water wet . from a concentration of 0 . 3 g / l pg8 / 10 in the brine , the oil drop is observed to spread on the rock and it even penetrates it at 2 g / l of active product . these tests , not illustrated here , confirm that pg8 / 10 increases the oil wettability of the rock . the surface tension ( brine / air ) and interfacial tension ( brine / soltrol ) were measured at 25 ° c . the brine used contains 40 g / l nacl and 5 g / l kcl . with no additive , the brine / air surface tension is 72 mn / m . with 100 ppm of additive , it drops to 25 mn / m . without additive , the brine / soltrol interfacial tension is 38 mn / m . with 10 ppm of additive it drops to 19 mn / m , reaching 14 mn / m with 15 ppm of additive . the results show that pg8 / 10 has a definite interfacial activity because it can reduce the surface tension of water to 25 mn / m and the brine / soltrol interfacial tension to 14 mn / m for low concentrations , less than the cmc ( critical micellar concentration ) of pg8 / 10 which is approximately 100 ppm . the efficiency of the present invention is shown by a reservoir damage simulation test conducted on 40 - cm long rock samples . the details of the experiment can be found in the following document : “ performance evaluation and formation damage potential of new water based drilling formulations ,” argillier j - f , audibert a ., longeron d . spe drilling and completion , 14 , no . 4 , 266 – 273 , 1999 . the rock used is claschach sandstone with the following composition : 94 . 7 % quartz , 2 . 6 % potassium feldspar , 0 . 5 % chlorite , and 0 . 7 % illite ( including mica ). the conditions to which the sample is subjected are known as irreducible water saturation ( swi ) by evacuation , saturation with brine , then injection of soltrol 130 ® oil ( approximately 10 pore volumes ). the oil permeability of the sample is then measured ( ko at swi ). the rock sample is made to contact the drilling and / or workover fluid circulating along the front face of the sample under the following conditions : overpressure 0 . 35 to 2 mpa in stages of 0 . 5 mpa every 2 minutes , then stabilization at 2 mpa where the mud circulates at a rate of 5 l / min . during filtration , oil is produced at the end of the sample , corresponding to invasion of the core sample by the mud filtrate . the test is stopped at the filtrate breakthrough , i . e . when the first drop of filtrate comes out at the end of the core sample . the mud used here is a formulation marketed by mi drilling fluids ( usa ) and it contains : 6 g / l flovis ® ( xanthan ), 7 g / l flotrol ® ( starch ), 20 g / l nacl , 20 g / l kcl , and 360 g / l calcium carbonate ( test 1 ) to which 0 . 1 g / l pg8 / 10 may be added ( test 2 ). the results of these two tests are provided in the table hereafter for comparison : we observe a significant difference in return permeability ( after backflow ) when pg8 / 10 is added to the mud , particularly in the first few centimeters of the core sample . this indicates that , during backflow , the porous medium once more becomes more easily saturated with oil in the case of mud with the presence of additive . thus , the additive entrained with the filtrate preferentially clogs the adsorption sites , thus limiting adsorption / retention of polymers contained in the mud and hence entrained with the filtrate into the porous medium . this limits clogging or shrinking of the pores by polymers , thus improving oil permeability . since the additive is added to the drilling fluid or to the well fluid , it is essential for it to be able to penetrate the permeable rock formation . in the case of a drilling fluid , it is essential for the molecule to be able to pass through the cake into the filtrate . passage of the molecule through the cake was therefore studied . the tests presented below were conducted on green bond ( 70 g / l green bond ®, bentonite marketed by the sbf company ; 1 g / l of pac lv , an anionic low - viscosity cellulose polymer , 1 g / l nacl ), and flopro muds ( example 3 ). first , the muds are centrifuged with and without pg8 / 10 to find out the adsorption of pg8 / 10 and polymers on the clay . also , the muds are filtered for 30 minutes at 0 . 7 mpa and room temperature . all the solutions obtained are subjected to toc analysis in order to establish a material balance in ppm of carbon . to find out the correspondence between the ppm of molecule and of carbon , the pg8 / 10 calibration curve was obtained . for the green bond ® mud , the results show that 35 % of the gp8 / 10 adsorbs on clay and of the remaining 65 %, 84 % passes through the cake . for flopro ® mud , the material balance is more complex because of the presence of the polymers that contribute to the carbon value measured in the filtrate . even so , when pg8 / 10 is used , there is a sharp increase in carbon in the filtrate , due largely to the presence of pg8 / 10 in the filtrate . these tests show that part of the pg8 / 10 molecules passes through the cake and is thus available for modifying the saturations in the oil formation . the compatibility of the product with the various constituents of a mud was tested . for this purpose , the properties of the mud containing the additive were studied in terms of rheology and filtration . the results of this study on the green bond ® and flopro ® muds with and without pg8 / 10 , before ( a - v ) and after ( p - v ) aging , are summarized in the table below : addition of 1 g / l pg8 / 10 does not significantly affect the filtration or rheology properties of the muds tested , which shows that such an additive , as defined in the present invention , is compatible with the conventional constituents of drilling and / or workover fluids . in order to avoid any additional damage at the well bore , it is necessary to evaluate if any in situ emulsion can be generated between reservoir fluids ( brine , oil ) and the mud filtrate . thus , one of the conditions is that the water - based mud filtrate is compatible with the reservoir fluids . the proportion of each phase is varied in order to plot a ternary diagram . emulsion formation and stability are determined by means of the so - called “ bottle test ” as described hereunder . brine ( nacl 20 g / l ), an organic phase , i . e ., oil reservoir constituting reservoir fluids , are put into contact with a mud filtrate containing the additive of this invention . the filtrate is constituted from water , salts , and polymers ( xanthan 0 . 5 g / l , starch 0 . 5 g / l ). a mixture a composed of 80 ml of reservoir oil and 20 ml of aqueous phase and a mixture b composed of 60 ml of reservoir oil and 40 ml of aqueous phase are prepared . the aqueous phase is composed of brine ( reservoir fluid ) and mud filtrate containing 1 g / l of the additive here described with the following proportions 25 / 75 , 50 / 50 and 75 / 25 by volume . the agitation is performed with a magnetic stirrer for a reservoir oil ( low agitation during the drop by drop addition , followed by a high speed agitation during 15 min .) or with an hamilton beach for a model oil ( low speed agitation during the drop by drop addition , followed by an agitation period of 15 min . at the same speed ). the emulsion is transferred in a flask and it is observed whether the emulsion breaks or not . results are obtained with the following additives used at a concentration of 1 g / l . 1 . polyglycerol mono oleate ( c18 ) 2 . polyglycerol mono myristate ( c14 ) 3 . polyglycerol mono laurate ( c12 ) 4 . polyglycerol mono c8 – c10 5 . polyglycerol mono hexanoate ( c6 ) the reservoir oil is a real one with the following properties : density ( 20 ° c . ): 850 kg / m3 viscosity ( 20 ° c . ): 8 . 3 cp composition ( sara method ): some tests have been performed with a model oil ( soltrol 130 ®), which contains no natural surfactants . the risk of emulsion is indicated in the following table ( observation performed after 16 hours unless otherwise indicated ). in all the cases , the presence of the additive within the filtrate induces the emulsion breaking if any . the longer the alkyl chain , the faster the breaking . the results of the additional tests performed with a model oil , soltrol 130 ®, are summarized in the following table : it was further observed that , in the absence of stirring , the additives corresponding to the longer acid chains have the tendency of forming light white precipitates , this denoting approaching the solubility limit . such a phenomenon can cause interactions with the other components of the mud .	2
with reference to the drawing , the first nomex ® layer 10 is fed from unwinder 12 , and the second support layer 14 is fed from unwinder 16 into juxtaposition with one side of first layer 10 . while it is not critical to the present invention , it is preferred that layers 10 and 14 both be preformed and prebonded layers , with known basis weights and other physical properties , so that the layers can be pre - inspected prior to lamination to minimize process start - up waste and to assure that only acceptable product is produced . alternatively , layers 10 and 14 may be formed in - line , and unwinders 12 and 16 can be eliminated . in either event , the layer 10 of nomex ® fibers may be formed by carding and airlaying , as is well understood in the art . support layer 14 may be a staple fiber web , such as a thermally point - bonded polyester spunbond web . alternatively , and preferably , layer 14 may be a continuous polyester filament web formed in accordance with the teachings of commonly assigned u . s . patent application ser . no . 09 / 287 , 673 , filed apr . 7 , 1999 , and its continuation - in - part application ser . no . 09 / 475 , 544 , filed dec . 30 , 1999 , the disclosures of such applications being expressly incorporated herein by this reference . such continuous filament webs are preferred , because they may be pre - bonded by thermal bonds , which do not interfere with the lamination bonding to the layer 10 of nomex ® fibers , as is hereinafter explained in detail . moreover , the filaments of such continuous filament webs are essentially endless , so that there are no ends that could penetrate the layer of nomex ® fibers and appear at the surface thereof . as a result , there is a surface richness , or high concentration , of nomex ® fibers at one face , or side , of the resulting laminate . while polyester is the preferred material for the support layer 14 , other high melting point thermoplastic materials , such as nylon , can also be used . moreover , the method of formation of layer 14 is not critical to the invention , and a wide variety of such techniques will be readily apparent to those of skill in the art . because the nomex ® fibers are relatively costly , particularly as compared to the cost of the fibers or filaments of layer 14 , the present invention contemplates that the basis weight of layer 10 will be substantially less than the basis weight of layer 14 . in this regard , it is contemplated that the basis weight of layer 10 may be from about 1 to about 3 oz ./ yd . 2 , whereas the basis weight of layer 14 may be from about 2 to about 5 oz ./ yd . 2 . when layer 14 is formed of spunbonded polyester fibers , it is also contemplated that layer 14 may comprise a plurality of sub - layers , with each sub - layer having substantially the same basis weight . referring again to the drawing , layers 10 and 14 are disposed in surface - to - surface juxtaposition with one another , and are fed over guide rollers 18 and 20 to entangling drum 22 . layer 14 is disposed against drum 22 , and layer 10 faces away from the drum . water , under high pressure from line 24 , is directed against layer 10 from high pressure water jets 26 that are spaced radially outwardly of drum 22 . entangling drum 22 and high pressure water jets 26 may be formed , and operated , as taught by evans u . s . pat . no . 3 , 485 , 706 . layers 10 and 14 are laminated to one another by the high pressure water streams emanating from jets 26 . the laminate l then is trained over a guide roller 28 and directed to an image transfer device 30 , where a three - dimensional image is formed in laminate l . the layer 10 of nomex ® fibers faces image transfer device 30 , and high pressure water from line 24 is directed against the outwardly facing layer 14 from jets 32 spaced radially outwardly of image transfer device 30 . image transfer device 30 and jets 32 may be formed , and operated , in accordance with the teachings of commonly assigned u . s . pat . nos . 5 , 098 , 764 , 5 , 244 , 711 , 5 , 822 , 833 , and 5 , 827 , 597 , the disclosures of which are expressly incorporated herein by this reference . it is presently preferred that the laminate l be given a corduroy appearance , and a three - dimensional forming surface like that illustrated in fig1 - 19 of commonly assigned u . s . pat . no . 5 , 997 , 986 ( also expressly incorporated herein by this reference ) may be suitable for this purpose . instead of the two - sided treatment described above , it is possible to produce some products with a single - sided treatment . in accordance with this aspect of the invention , bonding and patterning are completed in a single step and entangling drum 22 and jets 26 are eliminated . the resulting imaged laminate il is then fed to a drying station 34 , where some or all of the water is removed from the imaged laminate . in accordance with a further aspect of the invention , the imaged laminate is then fed to a chemical application station 36 where a fire - retardant binder is applied to the imaged laminate to stabilize the three - dimensional image , and to provide enhanced flame - retardant and durability properties . while in its broadest aspects , the present invention is not limited to any particular binder , it has been found that a binder with the following composition has been particularly useful . such a binder includes about 0 . 25 % defoam 525 , about 0 . 5 % chem wet mq2 , about 5 . 0 % antimigrant 942 , and about 20 . 0 % pyron 6133 , all of said constituents being expressed in weight percent and being available from chemonics industries . the constituents are mixed in water , about 75 % by weight , for about 15 minutes and then applied to the imaged laminate by an appropriate commercially available applicator , such as a standard textile padder . binder wet pick up of about 130 % are generally suitable for the purposes of the present invention . in addition to providing enhanced flame - retardant properties , the added binder imparts wash durability to the imaged laminate , which is important for certain end products . the imaged laminate with fire - retardant binder thereon is then fed from application station 36 to drying station 38 , which may include standard textile drying cans . once the imaged laminate with applied binder is dried , it is wound upon a winder drum 40 for storage prior to conversion into a final end product . in accordance with yet another aspect of this invention , the imaged laminate with binder thereon may be jet dyed subsequent to drying and being wound on drum 40 . in such a commercially available jet dyeing apparatus , it is possible to apply the dye to polyester layer 14 only , so that the resulting product has two different colors at opposite faces thereof .	1
the structure of clomiphene , 2 -[ 4 -( 2 - chloro - 1 , 2 - diphenylethenyl )- phenoxy ]- n , n - diethylethanamine ; 2 -[ p -( 2 - chloro - 1 , 2 - diphenylvinyl ) phenoxy ] triethylamine ; 2 -[ p -( β - chloro - α - phenylstyryl ) phenoxy ] triethylamine ; 1 -[ p -( β - diethylaminoethoxy ) phenyl ]- 1 , 2 - diphenylchloroethylene ; clomifene ; chloramiphene ; c 26 h 28 clno ; mol . wt . 405 . 98 , is as follows : ## str1 ## allen et al , u . s . pat . no . 2 , 914 , 563 describes the preparation of clomiphene . clomiphene as used in this invention can also be utilized in its citrate form , i . e ., clomiphene citrate . clomiphene binds to the estrogen receptors and acts by stimulating the hypothalmic - pituitary - ovarian axis in a similar fashion as estrogen . the effectiveness of clomiphene in inducing ovulation relates to its ability to bind to the estrogen receptor for a prolonged period as opposed to naturally occurring estrogen . the hypothalamic - pituitary axis is then able to initiate the pre - ovulatory lh surge necessary for ovulation to occur . without wishing to be bound by any theory of operability , it is believed that clomiphene may act either indirectly via the hypothalamic - pituitary axis to promote increased bone formation , or directly on the bone itself in humans . based on animal studies it was believed that clomiphene would decrease bone mass . the applicants , however , have discovered that clomiphene actually increases bone mass in humans . clomiphene can , therefore , be utilized to treat disorders where decreased bone mass is a consequence , such as osteoporosis . clomiphene can also be used prophylactically to increase bone mass prior to the menopausal period , thereby avoiding the development of postmenopausal osteoporosis or decreasing the magnitude of the associated bone loss . clomiphene may also be used as a marker of potential fertility since increased bone formation occurs primarily in women who are capable of sustaining a pregnancy , but may not in women who remain infertile despite clomiphene therapy . clomiphene is presently sold by merrell dow pharmaceuticals inc ., indianapolis , indiana , under the name &# 34 ; clomid &# 34 ; and by serono under the name &# 34 ; serophene &# 34 ;. clomiphene is also sold under the names &# 34 ; clomphid &# 34 ;, &# 34 ; clomivid &# 34 ;, &# 34 ; clostilbegyt &# 34 ;, &# 34 ; dyneric &# 34 ; and &# 34 ; ikaclomine &# 34 ;. clomiphene can be utilized in the present invention as a pharmaceutical composition containing clomiphene ( the active ingredient ) in admixture with a solid , liquid or liquefied gaseous diluent . clomiphene may also be utilized as a pharmaceutical composition in the form of a sterile and / or physiologically isotonic aqueous solution . clomiphene may also be used as a medicament in dosage unit form or as a medicament in the form of tablets ( including lozenges and granules ), caplets , dragees , capsules , pills , ampoules or suppositories . &# 34 ; medicament &# 34 ; as used herein means physically discrete coherent portions suitable for medical administration . &# 34 ; medicament in dosage unit form &# 34 ; as used herein means physically discrete coherent units suitable for medical administration , each containing a daily dose or a multiple ( up to four times ) or a sub - multiple ( down to a fortieth ) of a daily dose of the compound of the invention in association with a carrier and / or enclosed within an envelope . whether the medicament contains a daily dose , or for example , a half , a third or a quarter of a daily dose will depend on whether the medicament is to be administered once or , for example , twice , three times or four times a day , respectively . the pharmaceutical compositions according to the invention may , for example , take the form of suspensions , solutions and emulsions of the clomiphene in aqueous or non - aqueous diluents , syrups , granulates or powders . the diluents to be used in pharmaceutical compositions ( e . g ., granulates ) adapted to be formed into tablets , dragees , capsules and pills include the following : ( a ) fillers and extenders , e . g ., starch , sugars , mannitol and silicic acid ; ( b ) binding agents , e . g ., carboxymethyl cellulose and other cellulose derivatives , alginates , gelatine and polyvinyl pyrrolidone ; ( c ) moisturizing agents , e . g ., glycerol ; ( d ) disintegrating agents , e . g ., agaragar , calcium carbonate and sodium bicarbonate ; ( e ) agents for retarding dissolution , e . g ., paraffin ; ( f ) resorption accelerators , e . g , quaternary ammonium compounds ; ( g ) surface active agents , e . g ., cetyl alcohol , glycerol monostearate ; ( h ) adsorptive carriers , e . g ., kaolin and bentonite ; ( i ) lubricants , e . g ., talc , calcium and magnesium stearate and solid polyethyl glycols . the tablets , dragees , capsules , caplets and pills formed from the pharmaceutical compositions of the invention can have the customary coatings , envelopes and protective matrices , which may contain opacifiers . they can be so constituted that they release the active ingredient only or preferably in a particular part of the intestinal tract , possibly over a period of time . the coatings , envelopes and protective matrices may be made , for example , from polymeric substances or waxes . clomiphene can also be made up in microencapsulated form together , with one or several of the above - mentioned diluents . the diluents to be used in pharmaceutical compositions adapted to be formed into suppositories can , for example , be the usual water - soluble diluents , such as polyethylene glycols and fats ( e . g ., cocoa oil and high esters , [ e . g ., c 14 - alcohol with c 16 - fatty acid ]) or mixtures of these diluents . the pharmaceutical compositions which are solutions and emulsions can , for example , contain the customary diluents ( with , of course , the above - mentioned exclusion of solvents having a molecular weight below 200 , except in the presence of a surface - active agent ), such as solvents , dissolving agents and emulsifiers . specific non - limiting examples of such diluents are water , ethyl alcohol , isopropyl alcohol , ethyl carbonate , ethyl acetate , benzyl alcohol , benzyl benzoate , propylene glycol , 1 , 3 - butylene glycol , dimethylformamide , oils ( for example , ground nut oil ), glycerol , tetrahydrofurfuryl alcohol , polyethylene glycols and fatty acid esters of sorbitol or mixtures thereof . for parenteral administration , solutions and emulsions should be sterile and , if appropriate , blood - isotonic . the pharmaceutical compositions which are suspensions can contain the usual diluents , such as liquid diluents , e . g ., water , ethyl alcohol , propylene glycol , surface - active agents ( e . g ., ethoxylated isostearyl alcohols , polyoxyethylene sorbite and sorbitane esters ), microcrystalline cellulose , aluminium metahydroxide , bentonite , agar - agar and tragacanth or mixtures thereof . all the pharmaceutical compositions for use in the invention can also contain coloring agents and preservatives , as well as perfumes and flavoring additions ( e . g ., peppermint oil and eucalyptus oil ) and sweetening agents ( e . g ., saccharin and aspartame ). the pharmaceutical compositions for use in the invention generally contain from 0 . 5 to 90 % of clomiphene by weight , relative to the weight of the total composition . in addition to clomiphene , the pharmaceutical compositions and medicaments used according to the invention can also contain other pharmaceutically active compounds . any diluent in the medicaments of the present invention may be any of those mentioned above in relation to the pharmaceutical compositions for use in the present invention . such medicaments may include solvents of molecular weight less than 200 as the sole diluent . the discrete coherent portions constituting the medicament for use in the invention will generally be adapted by virtue of their shape or packaging for medical administration and may be , for example , any of the following : tablets ( including lozenges and granulates ), pills , dragees , capsules , suppositories and ampoules . some of these forms may be made up for delayed release of the active ingredient . some , such as capsules , may include a protective envelope which renders the portions of the medicament physically discrete and coherent . the preferred daily dose for administration of the medicaments for use in the invention is 2 . 5 to 250 mg of clomiphene in the case of intravenous administration and 25 to 250 mg , preferably 150 mg , of clomiphene in the case of oral administration . the drug is generally administered for a portion of every month , but can be administered daily . the product of the above - mentioned pharmaceutical compositions and medicaments is carried out be any method known in the art , for example , by mixing the clomiphene with the diluents ( s ) to form a pharmaceutical composition ( e . g ., a granulate ) and then forming the composition into the medicament ( e . g . tablets ). this invention provides a method for treating the above - mentioned diseases in humans , which comprises administering clomiphene to a human , alone or in admixture with a diluent or in the form of a medicament according to the invention . it is envisaged that clomiphene will be administered perorally , parenterally ( for example , intramuscularly , intraperitoneally , subcutaneously or intravenously ), rectally , vaginally or locally , preferably orally or parenterally . preferred pharmaceutical compositions and medicaments are , therefore , those adapted for administration such as oral or parenteral administration . administration in the method of the invention is preferably oral . clomiphene can also be administered via a depot formulation , e . g ., a slow release form placed subcutaneously and / or intramuscularly . in general , it has proved advantageous to administer intravenously amounts of from 0 . 01 mg to 10 mg / kg , preferably 0 . 05 to 5 mg / kg , of body weight per day and to administer orally 0 . 05 to 20 mg / kg , preferably 0 . 5 mg to 5 mg / kg of body weight per day , to achieve effective results . nevertheless , it can at times be necessary to deviate from those dosage rates , and in particular to do so as a function of the nature and body weight of the human subject to be treated , the individual reaction of this subject to the treatment , type of formulation in which the active ingredient is administered , the mode in which the administration is carried out and the point in the progress of the disease or interval at which it is to be administered . thus , it may in some case suffice to use less than the above - mentioned minimum dosage rate , whilst other cases the upper limit mentioned must be exceeded to achieve the desired results . where larger amounts are administered , it may be advisable to divide these into several individual administrations over the course of the day . clomiphene may be used in the present invention as an effective estrogen alternative for action on bone , without the estrogenic side effects at other sites . clomiphene could be the ideal hormonal replacement for postmenopausal women who have or are at risk for endometrial and breast carcinoma , preserving the skeleton while reducing the risk of cancer . ( b ) to increase bone mass prior to an anticipated loss of bone thereby preventing osteoporosis or decreasing the magnitude of bone loss or ( c ) as a marker of potential fertility , since it appears that women with normal reproductive capacities primarily experience the increased bone mass following clomiphene therapy . although this invention may be used to predict fertility in women with noraml reproductive capabilities , clomiphene may also be utilized according the present invention to treat osteoporosis in perimenopausal and postmenopausal women in which fertility is not a consideration . the invention will now be described with reference to the following non - limiting examples . quantitative computer tomography ( qct ) of distal radius described in p . s . jensen , s . c . orphanoudakis , e . n . rauschkolb , r . baron , r . lang and h . rasmussen , &# 34 ; assessment of bone mass in the radius by computed tomography &# 34 ;, american journal of radiology , 134 , 285 - 292 , ( 1980 ) was used to measure bone mass in twenty women with endometriosis . it was found that trabecular mass was normal in the seventeen women with endometriosis and increased in three women . in addition , these three women with significantly increased trabecular bone mass had been treated with the drug &# 34 ; clomid &# 34 ; ( clomiphene ) in the past . trabecular bone mass was not , however , significantly different from normal in the women with endometriosis who were not treated with clomiphene . the magnitude of the increase in trabecular bone mass was dramatic , i . e ., equivalent to as much as a 50 % increase in contrast to normal subjects and other women with endometriosis who had not been treated with the drug &# 34 ; clomid &# 34 ;. bone density was reported in hounsfield units ( hu ). for reference , air has a value of - 1000 hu and water is set at 0 hu . mean (± sd ) of these results are shown below : table 1______________________________________mean cortical and trabecular bone massin women with endometriosiscortex ( hu ) trabecular ( hu ) number of age trabecularsubjects ( years ) cortex ( hu ) ( hu ) ______________________________________normal 10 31 . 7 ± 4 1267 ± 69 212 ± 51endo - metriosisno 17 29 . 6 ± 5 1105 ± 106 * 173 ± 68clomipheneclomiphene 3 30 . 3 ± 3 1137 ± 44 310 ± 64 * ______________________________________ * p & lt ; 0 . 05 when compared to normal conditions . cortical bone mass was found to be significantly decreased in women with endometriosis , ( f . comite , p . jensen , k . hutchinson , m . l . polan , f . haseltine and a . decherney , &# 34 ; reduced cortical bone mass in endometriosis &# 34 ;, ( in ) society for gynecologic investigation &# 34 ;, toronto , march , 1986 , # 357 ), comparable to that noted in the perimenopausal subjects . none of the twenty women treated were cigarette smokers . to applicants &# 39 ; knowledge endometriosis has heretofore not been described as a potential risk factor for osteoporosis . random hormonal measurements were obtained in the women with endometriosis . mean serum estradiol ( e 2 ) was 100 ± 36 pg / ml and progesterone ( p ) was 4 . 1 ± 2 . 3 ng / ml . although these values were within the normal range for the date of the last known menstrual cycle , they tended to be at the lower end of the normal range . all women cycled regularly , however , eleven of the twenty subjects were infertile secondary to endometriosis . fertility had not been determined in the nine remaining subjects , who had presented for treatment of pelvic pain secondary to endometriosis . decreased cortical bone mass is known to occur in association with estrogen deficiency , ( j . a . schlechte , b . sherman and r . martin , &# 34 ; bone density in amenorrheic women with and without hyperprolactinemia &# 34 ;, j . clin . endocrinol . metab ., 56 , 1120 - 1123 , ( 1983 )). although random estradiol levels were normal in this group of women with endometriosis , mean intergrated estradiol levels over time are unknown . however , this decrease in cortical bone suggests uncoupling of the normal bone resorption - formation sequence similar to that seen in perimenopausal women . trabecular bone is reported to be acutely affected by surgically induced menopause , ( a . horsman , m . simpson , p . a . kirby and b . e . c . nordin , &# 34 ; non - linear bone loss in oophorectomized women &# 34 ;, br . j . radiol ., 50 , 504 , ( 1977 )). however , cortical bone mass appears to decrease while trabecular bone is maintained in the period prior to the onset of menopause . it may be that cortical bone changes reflect the more subtle decrease in estradiol , such as that which occurs as women move from pre - to peri - to the postmenopausal period . trabecular bone mass was not significantly different from normal in the women with endometriosis who were not treated with clomiphene . however , there was a dramatic increase in the trabecular bone mass in three women who had been treated with clomiphene in the past and had conceived following this therapy . measurements of qct of the distal radius in a group of fertile and infertile patients previously treated with clomiphene ( within a period of six months to two years ) were obtained to determine a possible link between clomiphene and increased bone mass . this was a retrospective study which evolved as a result of the increased trabecular bone noted in the women with endometriosis who had been treated with clomiphene . it was believed that , although clomiphene is a mixed estrogen agonist - antagonist , it might have estrogen - like effects on the bone . eight of the twenty women had successfully sustained a pregnancy following the clomiphene therapy . twelve women have remained nulliparous . table 2______________________________________ number of age trabeculae subjects ( years ) cortex ( hu ) ( hu ) ______________________________________normal 10 31 . 7 ± 4 1267 ± 69 212 ± 51infertility + clomipheneno pregnancy 12 31 . 5 ± 4 1098 ± 132 * 150 ± 54 * pregnancy 8 33 . 3 ± 3 1184 ± 70 280 ± 45 * ______________________________________ mean ± sd * p & lt ; 0 . 05 when compared to normal controls table 3__________________________________________________________________________summary of quantitative computedtomography ( qct ) data number of subjects age ( years ) cortex ( hu ) trabeculae ( hu ) __________________________________________________________________________normal ( crc study ) 20 31 . 3 ± 4 1244 ± 85 206 ± 39normal non - smoking 10 31 . 7 ± 4 1267 ± 69 212 ± 51irregular menses 8 30 . 7 ± 4 1186 ± 120 157 ± 55 * primary amenorrhea 9 25 . 7 ± 6 911 ± 111 * 66 ± 45 * perimenopausal 10 48 . 8 ± 2 1089 ± 58 * 198 ± 26postmenopausal 20 64 . 7 ± 8 835 ± 160 * 72 ± 69 * endometriosisno clomiphene 17 29 . 6 ± 5 1105 ± 106 * 173 ± 68clomiphene 3 30 . 3 ± 3 1137 ± 44 * 310 ± 64 * infertility + clomipheneno pregnancy 12 31 . 5 ± 4 1098 ± 132 * 150 ± 54 * pregnancy 8 33 . 3 ± 3 1184 ± 70 280 ± 45 * __________________________________________________________________________ mean ± sd * p & lt ; 0 . 05 when compared to normal controls cortical and trabecular bone mass was significantly decreased in the group of infertile women treated with clomiphene in contrast to the fertile subjects and normal controls . a significant increase in the trabecular bone mass was demonstrated in the women who were proven to be fertile following clomiphene therapy . this study was limited by the fact that no baseline qct prior to pregnancy was obtained due to the retrospective design . therefore , it is not possible to rule out pregnancy as a significant factor in the increase in trabecular bone mass . it is of interest that the cortical bone mass in these women who were fertile was normal . this is in contrast to the significantly reduced cortical bone mass observed in the three fertile women with endometriosis who were also treated with clomiphene . the amount of cortical bone in the fertile women with endometriosis was similar to the cortical bone mass seen in the other women with endometriosis . without wishing to be bound by any particular theory of operability , this suggests that the factor ( s ) responsible for the cortical bone reduction in the patients with endometriosis may interfere with the gain in cortical bone that might be induced by clomiphene . it will be appreciated that the instant specification and claims are set forth by way of illustration and not limitation and that various modifications and changes may be made without departing from the spirit and scope of the present invention .	8
the constituent elements of this transmission are distributed between two power trains , which connect internal combustion engine 1 in parallel to wheels 3 of the vehicle . according to the diagram , these means include two electric machines 2 , 4 forming a variator , a plurality of epicyclic gearsets 5 , 6 , 7 , two control devices 8 , 9 and a plurality of reducing stages 11 . this diagram shows the two power trains connecting internal combustion engine 1 to wheels 3 of the vehicle . the first train , or primary power transmission train , is reunited with the second in first epicyclic gearset 5 . first electric machine 2 is reunited with the power - splitting train in second epicyclic gearset 6 . the two electric machines are separated by a third epicyclic gearset 7 , associated with its two control devices 8 , 9 . finally , internal combustion engine 1 , the wheels and the two electric machines 2 , 4 are connected to reducing stages 11 , whose particular arrangement indicated in the figure does not have limitative character for the scope of the invention , because it is possible to envision a different number and / or arrangement of these reducing stages without departing from the scope thereof . this transmission has a primary power train via which a large part of the torque flows between the internal combustion engine and the wheels , and a secondary or power - splitting train on which there are disposed the two electric machines constituting the variator , in such a way as to achieve infinitely variable torque transmission between the engine and the wheels . it has two modes of operation , in which the first or the second control means 8 , 9 of the third epicyclic gearset are respectively active . the purpose of these two modes of operation is to broaden the operating ranges of the infinitely variable transmission . they correspond to the establishment of two different step - down ratios in third epicyclic gearset 7 , by virtue of the respective activation of associated first and second control means 8 , 9 . the infinitely variable transmission illustrated by the figures is said to be of the “ matching point ” and of the “ coupled input ” type , because power splitting at the output of the internal combustion engine is assured by a pair of power - splitting pinions ( not illustrated ), whereas the reuniting of the two power trains upstream from the wheels is effected in an assembler epicyclic gearset 5 . nevertheless , this particular arrangement does not have any limitative character , and the invention is equally applicable to any coupled - output , power - splitting , infinitely variable transmission provided with a torque - dividing gearset at the output of the engine and a pair of reassembler pinions upstream from the wheels . under the same conditions , the invention can be applied to any power - splitting infinitely variable “ two matching points ” type transmission provided with a torque - dividing epicyclic gearset and a torque - reassembler gearset ( which brings the total number of gearsets to four , counting gearset 6 , associated with the second electric machine , and operating mode - changing gearset 7 ). as indicated in the diagram , mode changing devices 8 , 9 are associated with this third gearset 7 . according to the invention , these control devices may consist of brakes , clutches or claw - coupling systems . according to the particular embodiment of the invention illustrated by the diagram , the closing of first control device 8 ensures relative immobilization of the constituent elements of the third gearset and rotation thereof as a whole , and the closing of second control device 9 ensures immobilization of an element of the third gearset relative to the case . as indicted hereinabove , the closing of the first or of the second control device 8 , 9 places the transmission in its first or in its second mode of operation respectively . in this context , a particularly advantageous but non - limitative arrangement of the invention comprises disposing first control device 8 between the ring gear and the planet carrier of third gearset 7 , and the second control device between the planet carrier of the third epicyclic gearset and the case . thus , in the first mode of operation , first control device 8 is closed and second 9 is open . gearset 7 rotates as a whole , and the step - down ratio introduced thereby into the power - splitting train is equal to unity . in the second mode , first device 8 is open and second device 9 is closed , in such a way as to immobilize one of the constituent elements of third gearset 7 relative to the case . gearset 7 then introduces its step - down ratio , which is different from unity , into the power - splitting train . finally , during the transient mode - changing phase , the two control devices can be closed simultaneously , a situation in which third gearset 7 is immobilized . in conclusion , the merit of replacing the two parallel reducing stages of the power - splitting transmission and two known modes of operation by a third planetary gearset is that a more compact architecture is achieved , wherein the three gearsets can be aligned along one and the same axis . in fact , the prior art solution involved providing a specific shaft for each reducing stage , whereas the invention makes it possible to align the third epicyclic gearset with the first two . finally , while the invention can be implemented by using brakes , clutches or claw - coupling systems , the use of the said systems is by far the most economical .	8
the container 12 of the invention is shown assembled in fig1 - 5 and is shown disassembled in fig6 and 7 . as stated earlier , the container 12 has a two - piece construction . one piece forms the exterior of the container 12 and the other piece is a flexible sheet that seals the contents of the container . the basic two piece construction of the container enables it to be manufactured easily and inexpensively . this results in the container being offered to consumers at a reduced price . the first piece of the disassembled container is shown in fig6 . the first piece forms both the bottom part 14 and top part 16 of the container exterior . the two parts are connected by a hinge 18 that extends along the back of the assembled container . in the exemplary embodiment the bottom part 14 , top part 16 and hinge 18 are all molded of a semi - rigid plastic , or other similar material . although the parts of only one container 12 are shown in fig6 , it is possible that several containers can be molded from a single sheet of plastic material and then subsequently separated from each other . additionally , although the top part 14 and bottom part 16 of the container shown in fig6 have complementary rectangular configurations , the container 12 could be formed with other configurations such as a circular configuration , a triangular configuration , etc . the container bottom part 14 has a central area that is formed as a receptacle 22 for the ant bait to be contained in the container . the receptacle 22 has a generally rectangular bottom surface 24 defined by a rectangular perimeter edge 26 of the bottom surface . four sidewalls 28 , 32 , 34 , 36 extend upwardly from the bottom surface perimeter edge 26 . in another embodiment of the container having a circular configuration , the container receptacle would have a cylindrical configuration with a circular bottom surface and a single cylindrical sidewall . together the sidewalls 28 , 32 , 34 , 36 and the bottom surface 24 define the receptacle 22 . the top edges of the sidewalls 28 , 32 , 34 , 36 define a perimeter edge 38 of an open top of the receptacle 22 . a substantially flat , rectangular border surface 42 extends around the open top perimeter edge 38 . an upwardly angled rear flange 44 extends from the back of the border surface 42 to the hinge 18 . a pair of upwardly angled left 46 and right 48 flanges extend along the opposite sides of the border surface 42 as viewed in fig6 . the left 46 and right 48 side flanges extend upwardly to respective left 52 and right 54 side strips as viewed in fig6 . the two side strips 52 , 54 are substantially coplanar . an inclined surface 56 extends downwardly from the forward ends of the border surface 42 , the left 46 and right 48 flanges and the left 52 and right 54 side strips . as the incline surface 56 extends away from the receptacle 22 it angles downwardly to a forward edge 58 of the surface . the forward edge 58 is in substantially the same plane as the receptacle bottom surface 24 . the container top part 16 has a similar configuration to that of the bottom part 14 although it does not include a receptacle 22 . the top part 16 has a central area defined by a substantially flat top surface 62 . the top surface 62 has basically the same configuration as the bottom part border surface 42 , although slightly longer in length . although the top surface 62 is shown as a continuous surface , it could also have one or more holes . the top surface 62 is connected to the hinge 18 by a rear flange 64 . the rear flange 64 is angled upwardly as it extends from the hinge 18 to the top part 62 . the top part 16 also has an upwardly angled left flange 66 and an upwardly angled right flange 68 , as well as a left side strip 72 and a right side strip 74 . the left flange 66 and right flange 68 angle upwardly as they extend from the respective left strip 72 and the right strip 74 to the top surface 62 . the left strip 72 and right strip 74 are also substantially coplanar . a tab 76 is formed at the forward edge of the top surface 62 . the tab 76 is connected to the top surface 62 by a frangible connection , for example a line of perforations 78 . other types of frangible connections could be employed to secure the tab 76 to the top surface 62 . the flexible sheet 82 of the container 12 is shown disassembled from the container in fig7 . the sheet 82 can be constructed of any known material typically employed in hermetically sealing packages such as plastic , foil , etc . the sheet 82 has an elongate length with a pair of parallel left 84 and right 86 side edges that extend along a majority of the sheet length to an end edge 88 of the sheet . the end edge 88 is substantially perpendicular to the side edges 84 , 86 . the width of the sheet between the side edges 84 , 86 is substantially the same as the width of the flat border surface 42 of the container bottom part 14 . a pair of inwardly angled edges 92 , 94 extend forwardly from the respective left 84 and right 86 side edges of the sheet . the angled edges 92 , 94 extend forwardly to a tab 96 formed on the sheet 82 . the tab 96 has substantially the same configuration as the tab 76 on the container top part 16 . in an alternate embodiment the tab 96 could just be an extension of the sheet and not have the configuration shown . when the sheet is assembled into the container 12 it is folded over at a fold 98 . the folded sheet has a lower piece 102 and an upper piece 104 . after the ant bait or other substance 106 has been positioned in the receptacle 22 , the sheet 82 is assembled to the container 12 as shown in fig8 . the end edge 88 of the sheet is positioned adjacent the forward end of the border surface 42 of the container bottom part 14 . in an alternate embodiment the sheet end edge 88 could be positioned adjacent the forward edge 58 of the inclined surface 56 . the lower piece 102 of the sheet is laid across the border surface 42 and over the receptacle 22 . the portion of the sheet lower piece 102 that engages with the border surface 42 is removably secured to the border surface by adhesives , by heat sealing , by rf welding , or by other equivalent means . the fold 98 of the sheet is positioned adjacent the container hinge 18 . from the fold 98 the sheet upper piece 104 extends across the top surface 62 of the container top piece 16 . this portion of the sheet is not secured to the top surface 62 or any other portion of the container top piece 16 . however , the tab 96 of the sheet is secured by adhesives , heat sealing , rf welding or other equivalent means to the container top piece tab 76 . with the sheet 82 assembled to the container bottom part 14 and top part 16 as shown in fig8 , the container top part 16 is folded over the bottom part 14 to complete the assembly of the container 12 as shown in fig1 - 5 . the angled flanges of the bottom part 44 , 46 , 48 and the angled flanges of the top part 64 , 66 , 68 space the top part tab 76 above the inclined surface 56 and form an opening 108 into the container interior . the side strips 52 , 54 of the container bottom part 14 and the respective side strips 72 , 74 of the container top part 16 are secured together by adhesives , by heat sealing , by rf welding or by other equivalent means . this completes the assembly of the container . use of the container 12 is shown in fig9 - 12 . in use of the container 12 , the tab 76 of the container top part 16 and the connected tab 96 of the sheet 82 are manually grasped and pulled from the remainder of the container . when the top part tab 76 separates from the top surface 62 , continued pulling of the container tab 76 and the connected tab 94 of the sheet will pull the sheet through the container opening 108 . continued pulling will gradually cause the sheet lower piece 102 to peel away from the border surface 42 of the container bottom part 14 . continued pulling will remove the sheet 82 from the interior of the container 14 and expose the ant bait 106 in the receptacle 22 to the exterior environment of the container through the container opening 108 . still further pulling will separate the sheet 82 from the container 12 . the container 12 is then ready for use as an ant trap . when placed on a floor surface , the inclined surface 56 provides access to the opening 108 and the ant bait in the container interior . although the container 12 is described above is being used as an ant trap containing an ant bait , it should be appreciated that the container can be used to contain any substance , for example other types of insect baits , or air fresheners , or animal repellents , or other types of substances . additionally , although the container 12 is described as having only one receptacle 22 , it should be appreciated that the container could be formed with multiple receptacles positioned side - by - side along the flat border surface 42 of the container bottom part 14 . pulling the sheet 82 from the container could be stopped after one of the receptacles 22 is uncovered , exposing the substance of the one receptacle to the exterior environment of the container through the opening 108 . once the substance in the one receptacle is no longer useful , the sheet 82 could then be further pulled from the container to expose the second receptacle to the exterior environment . still further , although the container 12 has been described with the bottom part 14 and top part 16 being connected by a hinge 18 , the container could be constructed with the bottom part 14 and top part 16 being separate parts . as various modifications could be made in the construction of the invention herein described and illustrated without departing from the scope of the invention , it is intended that all matter contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative rather than limiting . thus , the breadth and scope of the present invention should not be limited by any of the above described exemplary embodiments , but should be defined only in accordance with the following claims appended hereto and their equivalents .	0
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . the present invention may take the form of a hardware embodiment , a software embodiment or an embodiment combining software and hardware aspects . the present invention will now be further described with reference to the block diagram illustration of embodiments of the present invention in fig2 . as shown in fig2 a signal s ( t ) is transmitted over a channel 202 having a channel characteristic c ( t ), such as a wireless cellular radio telephone communication channel . the transmitted signal , including channel induced effects , is received as a signal r ( t ) at the receiver / rf processor 200 which provides a front end receiver for a receiver device 204 according to an embodiment of the present invention . the receiver 200 may include a radio frequency ( rf ) processor which provides a front end receiver for receiving the communication signals r ( t ) which include a signal disturbance , more particularly which may be subject to a colored noise signal disturbance . the receiver 200 , as illustrated in fig2 down samples the received signals to a symbol rate of the communication signals to provide a receive signal r ( n ). as shown in fig2 the receiver device further includes an equalizer 205 which processes the received signal samples r ( n ) to generate estimates of the received signals s ( n ). the output of the equalizer 205 will typically be provided to further signal processing components , such as a decoder 210 . the equalizer 205 generates symbol estimates from the received signal samples utilizing associated channel coefficients of the equalizer 205 . a channel estimator 215 generates the channel coefficients based on the received wireless communication signals , predetermined information associated with the received wireless communication signals , such as a synchronization signal , and an associated noise color of the signal disturbance . as illustrated in the embodiment of fig2 the color of the noise may be characterized by its auto - correlation ρ vv ( k ). alternatively , an associated power spectrum may be provided as the color characteristic of the noise . more particularly , the channel estimator 215 is configured to iteratively estimate the channel coefficients c ( k ) and the associated noise color ρ vv ( k ). such an iterative estimate may be provided by setting one of the channel coefficients and the associated noise color to a value generated in a previous iteration and solving for the other of the channel coefficients and the associated noise color and then using the other of the channel coefficients and the associated noise color as a value generated in a previous iteration in a subsequent iteration . referring now to the flowchart illustration of fig3 operations according to embodiments of the present invention for receiving a communication signal subject to colored noise over a communication channel will now be further described . operations begin at block 300 when a communications signal , including the additive colored noise , is received at the receiver device . in accordance with embodiments of the present invention , a channel estimate for the communication channel based on the received signal , the predetermined information associated with the received signal and an estimated color characteristic of the colored noise , an auto - correlation for the illustrated example , is then generated as will be described with reference to blocks 305 - 325 . an initial channel estimate , a channel coefficient set in the illustrated embodiment , is first generated based on an assumed auto - correlation , preferably a white noise assumption , and the received signal and the predetermined information , preferably a synchronization signal in each burst of the communication signal ( block 305 ). an updated auto - correlation based on the initial channel estimate , the received signal and the predetermined information is then generated . ( block 310 ). the updated auto - correlation is then used in generating an updated set of channel coefficients which , in the illustrated embodiment , includes providing a whitening filter based on the updated auto - correlation ( block 315 ) and filtering the received signal to whiten the received signals and the predetermined information ( block 318 ). updated channel coefficients are then generated based on the filtered signals generated based on the updated auto - correlation ( block 320 ). it is to be understood that , for purposes of explanation in the various embodiments herein , the channel estimate may be provided in the form of channel coefficients generated by the channel estimator 215 for the equalizer 205 . operations as described at blocks 310 through 320 are repeated for a number of iterations ( block 325 ) such as a fixed predetermined number of iterations or a variable number of iterations depending upon a quality measure criteria for the channel coefficients . for example , operations could be repeated until the incremental improvement in the channel estimate , for example as measured by equation 7 below , is less than a specified value . a signal estimate for the received signal may then be generated using the determined channel coefficients ( block 330 ). operations as generally described with reference to fig3 will now be described in more detail for particular embodiments utilizing least squares optimization . in this example , the channel coefficients ĉ ( k ) and the auto - correlation of the baseband disturbance { circumflex over ( ρ )} vv ( k ) are jointly estimated . this estimation can be expressed as the solution of the following minimization criteria : c ^   ( k ) = ( c   ( k ) , ρ vv   ( k ) ) arg   min   ∑ n = n0 + l n0 + m - 1    r   ( n ) - r ^  [ n \| n - 1 ; c   ( k ) ; ρ vv   ( k ) ]  2 ( 7 ) where { circumflex over ( r )}[ n \| n − 1 ; c ( k ); ρ vv ( k )] is the one - step ahead prediction of r ( n ) given { r ( k ): k & lt ; n }, { s ( k ): k ≦ n }, channel coefficients c ( k ) and the auto - correlation of the disturbance ρ vv ( k ). for this example , the pair ( c ( k ), ρ vv ( k )) is determined that minimizes the criteria in equation ( 7 ) using , for example , the generalized least squares ( gls ) algorithm , as described generally in l . ljung , system identification : theory for the user , prentice - hall , 1987 , an iterative approach which can be described by the following steps : 1 . find an initial least - squares estimate for the channel coefficients ĉ ( k ) using equation ( 4 ) with given { r ( n )} and { s ( n )} ( block 305 ). 2 . assuming that the previous channel estimate ĉ ( k ) is correct , obtain a new estimate of ρ vv ( k ) ( block 310 ). 3 . assuming that the previous auto - correlation estimate ρ vv ( k ) is correct , obtain a new estimate of ĉ ( k ) using equation ( 7 ) ( blocks 315 through 320 ). 4 . go back to step ( 2 ) and repeat for a desired number of iterations ( block 325 ). the above four steps provide one of many possible ways to implement equation ( 7 ) and are not intended to be limiting of the present invention . in embodiments of the present invention , the gls algorithm is applied in an adaptive manner which may provide improved channel estimates . operations for each of the steps will now be described in further detail for exemplary embodiments to obtain an adaptive channel estimate . step 1 may be implemented using a conventional least squares estimation as described in l . ljung , system identification : theory for the user , prentice - hall , 1987 . in step 2 , the disturbance correlation ρ vv ( k ) may be estimated from the received signal { r ( n )} and the known symbols { s ( n )} ad the previous channel estimate ĉ ( k ) by : ρ ^ vv   ( l ) = 1 m - l   ∑ n = n0 + l n0 + m - 1 - l   ( r   ( n + l ) - ∑ k = 0 l - 1   c ^   ( k )   s   ( n + l - k ) )   ( r   ( n ) - ∑ k = 0 l - 1   c ^   ( k )   s   ( n - k ) ) * ( 8 ) where { circumflex over ( ρ )} vv ( l ) is an estimate of the l - the auto - correlation lag of the disturbance v ( n ), l is the auto - correlation lag , m is the number of known transmitted symbols , l is the length of the channel estimate ( such as the number of channel coefficients ), n 0 is the index of the first known transmitted symbol , ĉ ( k ) is a previously obtained channel estimate , r ( n ) is the discrete - time received signal and s ( n ) are the known transmitted symbols ĉ ( k ) is given by step 1 . 1 . compute a finite impulse response ( fir ) whitening filter { h ( k )} k = 0 k = q for the given { circumflex over ( ρ )} vv ( k ) using well - known algorithms , such as the levinson - durbin algorithm , cf . s . m . kay , modern spectral estimation : theory and application , prentice - hall , 1988 ( block 315 ). 2 . filter r ( n ) and s ( n ) to obtain r ′( n )= h ( n )* r ( n ) and s ′( n )= h ( n )* s ( n ) ( block 318 ). 3 . find a least - squares estimate for the channel coefficients ĉ ( k ) with the given r ′( n ) and s ′( n ), i . e . c ^   ( k ) = c   ( k ) arg   min   ∑ n = n0 + l n0 + m - 1    r ′   ( n ) - ∑ k = 0 l - 1   c   ( k )   s ′   ( n - k )  2 ( 9 ) where r ′( n ) is r ( n ) filtered by the whitening filter , s ′( n − k ) is s ( n ) filtered by the whitening filter and delayed by k samples and q + 1 is the length of the whitening filter ( block 320 ). the determination and use of a whitening filter to whiten the received signals in steps 1 and 2 ( blocks 315 and 318 ) is further described in u . s . pat . application ser . no . 09 / 450 , 684 entitled “ methods , receiver devices and systems for whitening a signal disturbance in a communication signal ” which is hereby incorporated herein by reference as if set forth in its entirety . referring now to the block diagram illustration of fig4 further embodiments of a receiver device for receiving a communication signal subject to colored noise over a communication channel will now be further described . the receiver device 404 of the embodiments shown in fig4 includes a receiver 400 which operates in a manner similar to that described previously with reference to the receiver 200 of fig2 and further includes an equalizer 405 which may operate in a manner similar to that described for the equalizer 205 in fig2 . symbol estimates from the equalizer 405 may be provided to further signal processing circuitry , such as a decoder 410 . the receiver device of the embodiment of fig4 further includes a channel estimator 415 and an auto - correlation memory 420 coupled to the channel estimator 415 . the channel estimator 415 generates the channel coefficients c ( k ) and provides these channel coefficients to the equalizer 405 utilizing a plurality of candidate auto - correlations ρ i vv ( k ) obtained from the auto - correlation memory 420 . more particularly , the channel estimator 415 includes a plurality of coefficient estimation circuits 422 each including , in the illustrated embodiments , a whitening filter estimation circuit 425 , a whitening filter 430 and a least squares channel coefficient estimation circuit 435 . each of the plurality of candidate auto - correlations is processed by one of the coefficient estimation circuits 422 and the resulting plurality of channel coefficient sets is provided to the selection circuit 440 . the selection circuit 440 is configured to select one of the generated channel coefficient sets as the channel coefficients and provide the selected set to the equalizer 405 . referring now to the flowchart illustration of fig5 operations for receiving a communication signal subject to colored noise over a communication channel will now be described . operations begin at block 500 with receipt of the communication signal including the colored noise . in this embodiment , a plurality of candidate auto - correlations are selected for use in generating channel coefficients ( block 505 ). the candidate auto - correlation values are preferably selected to include a range of auto - correlations likely to be encountered on a communication channel . one of the plurality of candidate auto - correlations is then selected ( block 510 ). a whitening filter is determined based on the selected one of the plurality of auto - correlations ( block 515 ). alternatively , the whitening filters may be determined in advance for each candidate auto - correlation value and saved in memory , in which case , the predetermined whitening filter is selected at block 515 . the received signal and the predetermined information associated with the received signal , such as a synchronization signal , is filtered using the determined whitening filter ( block 520 ). a set of channel coefficients based on the filtered received signal and the filtered predetermined information is generated for the selected candidate auto - correlation ( block 525 ). if an additional candidate auto - correlation remains ( block 530 ) operations at blocks 510 through 525 repeat until a set of channel coefficients has been generated for each of the candidate auto - correlation values . among these n pairs of channel estimates and auto correlation estimates , the one that minimizes the ml criteria in equation ( 7 ) is chosen ( block 532 ). a signal estimate is then generated for the receive signal using the determined channel estimate ( block 535 ). operations as generally described with reference to fig5 will now be described in more detail for particular embodiments utilizing least squares optimization . in this example , the auto - correlation of the disturbance is assumed to belong to a finite set of candidate auto - correlations , and this set is either known or determined in advance ( block 505 ). for purposes of this description , these candidate auto - correlations shall be expressed as {{ circumflex over ( ρ )} 1 vv ( k )}, i = 1 n , where n denotes the number of candidate autocorrelations . for each candidate auto - correlation { circumflex over ( ρ )} 1 vv ( k ), the channel estimate , ĉ i ( k ), is generated using the equation ( blocks 510 - 530 ): c ^ i   ( k ) = c   ( k ) arg   min   ∑ n = n0 + l + q i n0 + m - 1    r i ′   ( n ) - ∑ k = 0 l - 1   c   ( k )   s i ′   ( n - k )  2 , ( 10 ) where r i ′( n ) is r ( n ) filtered by the whitening filter associated with this candidate autocorrelation , s ′( n − k ) is s ( n ) filtered by the whitening filter and delayed by k samples , and q i + 1 is the length of the whitening filter . finally , among these n pairs of channel estimates and auto - correlation estimates , the one that has the smallest associated squared - error given by the equation : ɛ i = ∑ n = n0 + l + q i n0 + m - 1    r i ′   ( n ) - ∑ k = 0 l - 1   c ^ i   ( k )   s i ′   ( n - k )  2 . ( 11 ) as noted above , because the candidate auto - correlations {{ circumflex over ( ρ )} 1 vv ( k )} i = 1 n are known in advance in this method , the whitening filter h ( n ) corresponding to each { circumflex over ( ρ )} 1 vv ( k ) can be pre - computed and stored in memory and selected from memory at block 515 . the present invention may benefit a variety of cellular receivers that perform channel estimation in the presence of colored baseband noise . such receivers include gsm receivers and enhanced data rates for global evolution ( edge ) receivers . a simulation has been performed implementing the present invention for 8psk ( 8 symbol phase shift keyed )- edge . in this simulation , the block error rate ( bler ) performance versus carrier to adjacent channel interference power ration ( c / iadj ) improves by more than 4 decibels at a 10 % block error rate in a typical channel at a speed of three kilometers per hour with ideal frequency hopping ( tu3ifh ) channel using the present invention . the results of this simulation are graphically illustrated in fig6 . the present invention has been described above with respect to the block diagram illustrations of fig2 and 4 the flowchart illustrations of fig3 and 5 . it will be understood that each block of the flowchart illustrations and the block diagram illustrations of fig2 through 5 , and combinations of blocks in the flowchart illustrations and the block diagram illustrations of fig2 through 5 , can be implemented by computer program instructions . these program instructions may be provided to a processor to produce a machine , such that the instructions which execute on the processor create means for implementing the functions specified in the flowchart and block diagram block or blocks . the computer program instructions may be executed by a processor to cause a series of operational steps to be performed by the processor to produce a computer implemented process such that the instructions which execute on the processor provide steps for implementing the functions specified in the flowchart and block diagram block or blocks . accordingly , blocks of the flowchart illustrations and the block diagrams support combinations of means for performing the specified functions , combinations of steps for performing the specified functions and program instruction means for performing the specified functions . it will also be understood that each block of the flowchart illustrations and block diagrams , and combinations of blocks in the flowchart illustrations and block diagrams , can be implemented by special purpose hardware - based systems which perform the specified functions or steps , or combinations of special purpose hardware and computer instructions . for example , while various components of receiver device 204 have been illustrated in fig2 in part , as discrete elements , they may , in practice , be implemented by a micro controller including input and output ports and running software code , by custom or hybrid chips , by discrete components or by a combination of the above . for example , the equalizer 205 and the channel estimator 215 may be implemented in part as code executing on a processor . the present invention has been described above primarily with reference to mlse equalizers . however , the present invention is not so limited and may also be applied to other types of equalizers , for example , decision feedback sequence estimator ( dfse ) equalizers . in the drawings and specification , there have been disclosed typical preferred embodiments of the invention and , although specific terms are employed , they are used in a generic and descriptive sense only and not for purposes of limitation , the scope of the invention being set forth in the following claims .	7
the preferred embodiments of the present invention will now be described with reference to the drawings . to facilitate description , any identifying numeral representing an element in one figure will represent the same element in any other figure . fig1 - 3 illustrate a cargo lock 70 having a configuration which is generally applicable to the details in the cargo lock 70 a embodiment of fig4 - 6 or the cargo lock 70 b embodiment of fig7 . referring to fig1 - 6 , the cargo lock 70 / 70 a is connected to the seat track 40 arranged in the floor of the aircraft , the floor 50 being supported by beams 51 , 52 . the cargo lock 70 / 70 a comprises a frame or baseplate 10 , a pair of pawls 31 and 32 , shear ties 21 and 22 , and track connectors , shown as tensile studs 11 and 12 . the pawls 31 and 32 are located in the center of the cargo lock 70 / 70 a . the pawls 31 , 32 have a curved or hook portion which secure cargo pallets 33 and 34 to the cargo lock 70 / 70 a . for the purposes of this description , a pawl may comprise any suitable connector which secures the cargo pallet to the cargo lock . the shear ties 21 and 22 fit in scalloped holes 41 in the seat track 40 to prevent horizontal movement of the cargo lock 70 / 70 a . details of the tensile studs 11 , 12 are best shown in fig5 . the stud 11 is in the shape of an inverted “ t ” formed with a flange portion 11 a and a leg portion 11 b . typically , the leg portion 11 b may have threads 11 c at the end for attachment to the baseplate 10 either directly or via a nut or other suitable connection mechanism . the tensile studs 11 and 12 are inserted into the seat tracks 40 through the scalloped holes 41 and subsequently moved to a position in - between the holes 41 by sliding a short distance p along the length of the seat track 40 ( before the shear ties 21 and 22 are inserted ). in this position , the circular flange 11 a of each stud 11 is locked below the seat track inner flange 42 . the lock 70 / 70 a is secured in this position by inserting shear ties 21 and 22 . thus secured in seat track 40 , the lock 70 / 70 a is held in position both vertically and horizontally . the tensile stud 11 is located at one side of the pawls 31 and 32 on baseplate 10 and tensile stud 12 at the other side of the pawls 31 and 32 on baseplate 10 . the distance between the two tensile studs is d . the pawls 31 and 32 are centrally located near the middle of the distance d . the transverse floor beams 51 and 52 support the seat track 40 at an interval b . the cargo lock is designed with a distance d preferably selected to be as close to b as possible , with the maximum benefit realized as d is equal to b or as d exceeds b . the cargo lock 70 / 70 a includes a plurality of rollers 35 , 36 , 37 and 38 secured to the baseplate 10 . the rollers 35 - 38 extend outward from the bottom of the frame 10 and serve to allow the cargo pallets to roll along the cargo locks thereby facilitating movement of pallets 33 and 34 during loading and unloading . outer rollers 35 , 38 are located at the extremities of baseplate 10 . the purpose of these outer rollers 35 , 38 is to ensure that the pallets edge does not become blocked against the edge of the baseplate 10 . inner rollers 36 , 37 are located close to pawls 31 and 32 within a distance e . the purpose of locating inner rollers 36 , 37 close to the pawls 31 , 32 is to distribute a load from a single container in the downward direction over as much as possible the full length of the baseplate 10 . without these inner rollers , this down load would be concentrated at an extremity of baseplate 10 on either roller 35 or roller 38 . fig7 illustrates an alternative embodiment for a cargo lock in which the same reference numerals have been used as in fig1 through 6 to indicate corresponding parts . in the embodiment of fig7 the number of tensile studs has been increased to two per side resulting in studs 11 and 13 , the first track connector , on one side and studs 12 and 14 , the second track connector on the other side , which is the same number of studs as illustrated in fig1 - 3 . the centroid 71 of the group of tensile studs 11 and 13 is the location of the effective working axis of force when both tensile studs are equally loaded with a vertical force ( for groups comprising of two tensile studs the centroid is located half way between tensile studs ). similarly , the centroid 72 of the group of tensile studs 12 and 14 is located in between these studs . the distance between the centroids 71 and 72 of the two groups of tensile studs now defines d ′. the pawls 31 and 32 continue to be located near the middle of the distance d ′. one advantage of the alternative embodiment is that the load per tensile stud is reduced . in addition , the baseplate 10 and the seat track 40 are fixed together at the stud groups more securely . this arrangement may have several additional beneficial effects , including but not limited to : 1 ) preventing the potential rolling over of the top flanges 53 and 54 of the transverse floor beams 51 and 52 when the stud groups are located offset from the beams as shown ; and 2 ) reducing maximum bending moment in baseplate 10 which occurs near the pawls 31 and 32 . in use , the tensile studs secure the cargo locks to the tracks in the event of a downward acceleration of the vehicle resulting in large tensile forces being applied to the lock . the tensile force is transmitted from the pawls 31 , 32 , through the baseplate 10 , and to the studs 11 , 12 . the studs then transmit the upward force to the track 40 which in turn transmit the forces to the floor and support beams 51 , 52 . the distance d is defined as the length of the effective separation of the tensile attachment points of the cargo lock 70 a to the tracks . in the cargo lock 70 a of fig4 the tensile attachment points are located at the center of the tensile studs 11 and the center of tensile stud 12 . the tensile studs 11 , 12 are intentionally positioned at the outer ends of the cargo lock 70 a so as to provide desired separation between the attachment points . where additional tensile studs are provided such as in cargo lock 70 b of fig7 the attachment points ( i . e . the centroid of attachment ) are between the stud pairs , namely centroid 71 between stud pair 11 , 13 and centroid 72 between stud pair 12 , 14 . the stud pairs of cargo lock 70 b are still separated by a distance d ′ providing the desired effective separation between the attachment points . if additional studs are included along the length of the cargo lock ( for example studs 16 , 17 , 18 , 19 shown in fig4 in phantom ) such studs are preferably designed in conjunction with the flexibility of the tracks and aircraft floor so as not to negate the force separation quality of the primary attachment points at the outer ends of the cargo lock . such flexibility may be accomplished by including additional vertical spacing or elastomeric connection in the center studs 16 - 19 such that even though the upward tensile force is applied at the center of the cargo lock by the pawls 31 , 32 , the majority of the upward tensile force is transferred to the primary end studs 11 , 12 and thereby distributed between the support beams 51 , 52 . in a preferred construction , the cargo lock is elongated having a relatively low aspect ratio r defined as the ratio of the height h ( i . e . a maximum height of the lock as measured with the pawls 31 , 32 retracted ) to the length d ( the effective distance between the end attachment points ): preferably , the aspect ratio of an elongated cargo lock is less than about ⅛th ( 0 . 125 ) or even smaller , namely about 0 . 10 , with certain implementations being about0 . 06 . the aspect ratio h / d of the cargo lock 70 a of fig4 and the aspect ratio h / d ′ of the cargo lock 70 b of fig7 are about 0 . 05 . in a boeing 727 aircraft , the distance b between the support columns is about 20 inches . in actual construction , the dimensions of a cargo lock 70 b for this boeing 727 aircraft may be in smaller aircraft , the distance between support beams will be smaller , but the size of the cargo locks will also be smaller but would be designed such that d ≧ b and having an aspect ratio r less than 0 . 125 to provided the desired spacing of attachment points . one or more pawls to secure cargo pallets to the lock mounted on the baseplate ; a tensile stud set ( of one or more tensile studs ) mounted on the baseplate on each side of the pawl ( s ), the stud set being spaced from the pawl ( s ) at a distance that is about half the spacing of the seat track support points ; preferably , the distance between the pawl ( s ) and the tensile studs is larger than half the spacing of the seat track support points . the distance may be somewhat smaller , but if the distance is too small , the preferred weight distribution advantages may be lost . the rollers are preferably located a distance e ( see fig3 ) away from the pawl ( s ) where e is about less than one - fifth the spacing of the seat track support points . in another preferred configuration , a single stud is used on each side of the pawls . in another preferred configuration , a pair of tensile studs are disposed on each side of the pawls , the studs of the pair being separated by about one seat track hole distance ( 2 p ). in another preferred embodiment , a shear tie is located in - between the two tensile studs in a group . in another preferred embodiment , a single stud is replaced with a group of two or more tensile studs in any arrangement for which the distance between the pawl ( s ) and the closest tensile stud is about equal to half the distance between the seat track support points . in another preferred embodiment , a cargo lock may include additional rollers to further distribute the compressive load across the floor . the cargo locks 70 a / 70 b of fig4 and 7 have four rollers 35 - 38 . a cargo lock may include for example six rollers as the lock 70 in fig1 - 3 , which has a roller 39 a mounted to the baseplate 10 between rollers 35 and 36 and another roller 39 b mounted between rollers 37 and 38 at the other end of the baseplate 10 . the cargo lock may be provided with any number of additional rollers . the rollers are preferable separated as much as possible to distribute the loads . in the embodiment of fig1 - 3 , the center rollers 36 , 37 are located adjacent the pawls 31 , 32 . the rollers 36 , 37 are shown so close to the pawls 31 , 32 that the pawls 31 , 32 or the rollers 36 , 37 may require movable connections ( not shown ) to the baseplate 10 in order to accommodate retraction of the pawls 31 , 32 . though the present invention has been set forth in the form of its preferred embodiments , it is nevertheless intended that modifications to the disclosed embodiments may be made without departing from inventive concepts set forth herein . the invention , therefore , is not to be restricted except in the spirit of the claims that follow .	1
fig1 is a schematic cross sectional view of a copying machine provided with a display device embodying this invention . a photosensitive member 2 is set in the substantially control part of a casing 1 of a copying machine . this photosensitive member 2 is coated with a selenium layer , and is made rotatable in a direction of an indicated arrow a . fitted to the top of the casing 1 is an original sheet table 3 on which a sheet bearing an original impression is to be placed . the original sheet table 3 reciprocates in the directions indicated by arrows b &# 39 ; and b . an exposure lamp 4 for illuminating the original sheet is provided below the original sheet table 3 . a light is shed from end to end of the original sheet , as the original sheet table 3 moves on . light beams reflected from the original sheet are projected on the surface of the photosensitive member 2 through a first mirror 5 , lens unit 6 and second mirror 7 collectively constituting an exposure device 8 . arranged near the photosensitive member 2 are discharging lamp 10 , for eliminating an electric charge accumulated on the surface of the photosensitive member 2 , and a charging device 11 , for electrically charging the surface of the photosensitive member 2 . when the surface of the photosensitive member 2 , which is charged after the preceding discharge , is exposed to a light emitted from the exposure device 8 , then a latent image is formed on said surface . set beyond the charging device 11 is a developing device 12 which renders the static latent image visible by a developing agent ( hereinafter referred to as &# 34 ; a toner &# 34 ;). this developing device 12 comprises a toner hopper 13 for holding the toner and a magnetic brush developer 15 which uniformly spreads the toner supplied from the toner hopper 13 in fine particles over the surface of the photosensitive member 2 by means of a transport magnet roller 14 rotating in a direction indicated by arrow c . the developing device 12 is detachably received in the casing 1 . a freely operable hopper cover 13a is mounted on the upper opening of the toner hopper 13 . further received in the casing 1 are a magnet 13b actuated in accordance with the opening and closing of the hopper cover 13a and a magnet switch 13c for detecting the opening and closing of the hopper cover 13a from the actuation of said magnet 13b . set below the developing device 12 is a sheet feeder 20 for carrying a copy sheet to the underside of the photosensitive member 2 . the sheet feeder 20 comprises a sheet - feeding cassette 21 which holds a plurality of copy sheets and is detachably positioned on a side of the casing 1 and a third sheet feed roller 22 for drawing out copy sheets from said sheet - feeding cassette 21 one after another . above the sheet - feeding cassette 21 and detachably portioned on a side of the casing 1 is a sheet feed cassette 23 by means of a sheet feed mechanism 24 . said sheet feed cassette 23 enables sheets to be supplied either manually or by means of a cassette . second sheet feed rollers 25 , 25 are provided to carry forward a sheet drum from the sheet feed cassette 23 . the sheet feeder 20 is provided with aligning rollers 26 , 26 for transporting a sheet pulled out of the sheet feed cassette 21 or 23 with the leading end portion of said sheet secured in a proper position . detachably provided beyond the sheet feeder 20 is a unit consisting of a transcription charger 27 for transposing a toner image formed on the surface of the photosensitive member 2 on to a sheet brought by the aligning rollers 26 and a separation charger 28 for releasing from the photosensitive member 2 a sheet on which a toner image has been transcribed . the photosensitive member 2 embodying this invention has an outer diameter of about 80 mm , thereby eliminating the necessity of providing a separation pawl as has been the case with the prior art when , a sheet is taken off the photosensitive member 2 . set beyond the separation charger 28 is a cleaning device 29 for recovering toner particles retained on the surface of the photosensitive member 2 after the transcription of a toner image on a copy sheet . the aforementioned discharging lamp 10 is fitted to the cleaning device 29 in a state length wise extending along part of the outer wall of the photosensitive member 2 at a prescribed distance therefrom . a suction sheet - carrying device 30 is provided to carry forward a sheet which has been taken off the photosensitive member 2 after the transcription of a toner image on said sheet . said suction sheet - carrying device 30 is constructed by a plurality of flat belts 31 , each of which is provided with a plurality of orifices and each of which is rotatably stretched over guide rollers 32 , 32 , 32 . a suction duct 33 connected to a suction blower ( not shown ) is pressed against part of the inner wall of said flat belts 31 . therefore , a copy sheet is carried forward in a state adsorbed to the flat belts 31 . application of such suction sheet - carrying device 30 enables copy sheets of various sizes to be transported very easily . moreover , air is guided through the suction duct 33 , thereby also providing the effect of cooling the interior of the casing 1 and the ventilating efficiency therein . a fixing device 36 is provided which is formed of heat rollers 35 , 35 designed to fix a toner image transcribed on a copy sheet brought by the suction sheet - carrying device 30 . a copy sheet on which a transcribed toner image is fixed is drawn into an external discharged copied sheet tray 38 through copied sheet - discharging rollers 37 , 37 . reference numeral 39 given in fig1 denotes an exhaust fan . the aforementioned exposure device 8 , developing device 12 , transcription charger 27 , separation charger 28 , cleaning device 29 and suction sheet - carrying device 30 are fully assembled into a unit . this unit is received in the casing 1 in an easily detachable state , thereby ensuring a reduction in the cost of manufacturing a copying machine and facilitating its maintenance . fig2 shows the layout of various patterns impressed on the display panel of the display device of this invention . the display panel is formed of a liquid crystal . in fig2 a reference numeral 41 denotes a liquid crystal display panel ; 42 a lower cover display segment ; 43 a closed upper cover display segment ; 44 an open upper cover display segment ; 45 a sheet feed cassette segment ; 46 a pictorial notation segment for indicating the absence of copy sheets in the sheet feed cassette ; 47 a manual sheet feed table segment ; 48 , 49 , 50 sheet passage segments ; 51 a pictorial notation segment for indicating a manual sheet feed passage jammed with sheets ; 52 a pictorial notation segment for indicating a sheet feed passage jammed with sheets ; 53 a pictorial notation segment for indicating the fixing device 36 or a sheet passage nearby which is jammed with sheets ; 54 a pictorial notation segment for indicating the photosensitive member 2 jammed with tightly wound sheets or the cleaning device 29 jammed with sheets carried thereinto ; 55 a segment for indicating the photosensitive member 2 intended to produce a toner image ; 56 a pictorial notation segment for indicating the cleaning device 29 fully filled with recovered toner particles ; 57 a pictorial notation segment for indicating that the toner has all been drawn from the toner hopper 13 of the developing device 12 ; 58 a pictorial notation segment for indicating that the original sheet table 3 or drive motor has become immovable , requiring maintenance or repair by a serviceman ; 59 a segment for indicating a tray into which copied sheets are collected ; 60 a pictorial notation segment for indicating that a key counter has been rendered ready for operation ; 61 a pictorial notation segment for indicating that full preparation has been made for the copying operation ; 62 a pictorial notation segment , which , with the aid of said segment 61 , shows that the copying machine has failed ; 63 a 2 - digits segment for indicating the number of copied sheets ; 64 a pictorial notation segment for indicating an enclosure in which a number of copied sheets is to be displayed ; 65 a pictorial notation segment for indicating that the displayed two digits denote the number of copied sheets ; 66 a pictorial notation segment for indicating that an image outline has been reduced in conformity to the size of a copy sheet used ; 67 a pictorial notation segment for indicating an upper copy sheet cassette already holding copy sheets ; 68 a pictorial notation segment for indicating a lower copy sheet cassette already holding copy sheets ; 69 a pictorial notation segment for indicating that the upper copy sheet cassette has been selected for use ; and 70 a pictorial notation segment for indicating that the lower copy sheet cassette has been selected for use . a common electrode ( not shown ) is provided at the back of the respective segments . some , ( for example , 42 , 47 , 59 ) of the above listed segments are connected together , in the display element 41 of fig2 to be lighted by the same signal . a light from a light source is projected on the respective segments through a color filter . before being impressed with voltage the whole of each segment presents a color ( for example , a black color ) peculiar to the color element of said color filter . when looking through the color filter , the operator can recognize the color of that part of the color filter which faces a segment impressed with voltage . a yellow color filter ( not shown ) is so set as to face the sheet feed cassette segment 45 and pictorial notation segments 46 , 51 , 60 , 62 , which , therefore , are displayed in yellow . a red color filter ( not shown ) is so positioned as to face the pictorial notation segments 52 , 53 , 56 , 58 , which , therefore , are displayed in red . fig3 is a schematic block circuit diagram of the display device embodying this invention . reference numeral 78 denotes a plurality of detectors which are set at those spots of the copying machine of fig1 at which the prescribed conditions thereof are to be detected . reference numeral 80 represents a main control section , which controls the operation of the body of the copying machine and converts output signals from the respective detectors into [ 1 , 2 , 4 , 8 ] weighted binary code signals , and delivers said converted binary code signals to an output terminal d , of the main control section 80 . fig4 is a schematic block circuit diagram of the main control section 80 of the display device of fig3 . a copying machine condition - judging circuit 80 1 ( hereinafter referred to as &# 34 ; a condition - judging circuit &# 34 ;) judges a given condition of the copying machine according to the contents of an output signal from the corresponding detector 78 , and sends forth a signal denoting the result of said judgment . a decoder 80 2 converts a received judgment signal into a binary code signal . table 1 below indicates the judged conditions and the corresponding output binary code signals from the decoder 80 2 . table 1__________________________________________________________________________judgedcondi - decoder outputtion 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32__________________________________________________________________________standby 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 1 1 1 1 1 1 0 0 0 0 0 0 0 0ready 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0no copy 1 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0sheetpaper 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 1 0 0 0 0 0 0 0jammingin sup - ply unitkey 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1counterno toner 1 1 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1filled 1 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1with re - coveredtonercall for 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1service - manwrong 1 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1papersepara - tionfrommemberpaper 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1jammingin dis - chargeunit__________________________________________________________________________ a buffer 80 3 temporarily holds an output binary code signal from the decoder 80 2 . a timing circuit 80 4 sends forth clock signals and also latch signals in synchronization with the prescribed ones of the clock signals . the display device is operated in synchronization with the prescribed ones of the clock signals . data temporarily held in the buffer 80 3 is issued in synchronization with an output clock signal from the timing circuit 80 4 . the main control circuit 80 is formed of , for example , a microcomputer . reference numeral 81 denotes a liquid crystal drive circuit , whose input terminal d receives data signals from the main control circuit 80 , each time a clock signal is supplied to the input terminal c p of said liquid crystal drive circuit 81 . reference numeral 82 represents an oscillation circuit which oscillates signals in an optimum frequency for the drive of the liquid crystal . the oscillation circuit generates a drive pulse signal , and an inverter circuit 83 sends forth an inverted drive pulse signal . this inverted drive pulse signal is supplied to the liquid crystal drive circuit 81 . the output terminals o1 to o32 of the liquid drive circuit 81 issue output signals corresponding to the segments s1 to s32 of a liquid crystal display element received in the liquid crystal display panel 41 . an output drive pulse from the oscillation circuit 82 is delivered to the segment s33 of the liquid crystal display element . an output inverted drive pulse signal from the inverter circuit 83 is supplied to a common electrode 84 provided for the segments s1 to s33 . fig5 is a schematic block circuit diagram of the liquid crystal drive circuit 81 . data signals supplied from the input terminal d are supplied in succession to the thirty - two shift registers sr1 to sr32 , each time a clock pulse is delivered to the input terminal c p . directly connected to said shift registers sr1 to sr32 are store registers rg1 to rg32 for holding the contents of said shift registers sr1 to sr32 upon receipt of a latch signal from the input terminal l . the store registers rg1 to rg32 control the operation of thirty - two switches sw1 to sw32 according to the contents stored in said store registers rg1 to rg32 , and supply a drive pulse signal or inverted drive pulse signal to output terminals 01 to 032 . when the contents of some of the store registers rg1 to rg32 have a logic level &# 34 ; 1 &# 34 ;, then a drive pulse signal is issued to the corresponding output terminals . when the contents of some of the store registers rg1 to rg32 have a logic level &# 34 ; 0 &# 34 ;, then an inverted drive pulse signal is sent forth to the corresponding output terminals . the shift register sr1 , store register rg1 , switch sw1 and output terminal o1 correspond to each other . similarly , the other thirty - one shift registers sr2 to sr32 , thirty - one store registers rg2 to rg32 , thirty - one switches sw2 to sw32 and thirty - one output terminals o2 to o32 correspond to each other . reference numeral 85 denotes a cooled cathode discharge tube . when a light is allowed to pass through a color filter ( not shown ) from below the liquid crystal display panel 41 , then the color of said color filter is displayed . description is now given with reference to fig6 and 7 of the operation of a display device embodying this invention . when the power switch of a copying machine ( not shown ) is rendered conducting at time t0 ( fig6 a ), then the main control section 80 is operated in the previously programmed order . the main control section 80 causes a fixing heater to be supplied with power . at this time the fixing device 36 is not yet sufficiently heated to carry out fixing ( fig6 b ). therefore , the main control section 80 sends forth a binary code signal [ 0000 0000 0000 1100 0011 1111 0000 0000 ] denoting a standby state ( a state in which copying operation is impossible ) indicated in table 1 ( said binary code signal is hereinafter referred to as &# 34 ; a data a signal &# 34 ;) in synchronization with the prescribed ones of clock signals sent forth from the output terminal c p . ( fig6 c and 6d ). when the transfer of the data of the last 32nd bit is brought to an end , the main control section 80 issues a latch signal ( fig6 e ). as a result , the bits of the data a signal are held in the store registers rg1 to rg32 of the liquid crystal drive circuit 81 . drive pulse signals ( fig7 a ) are issued from the output terminals o13 , o14 , o19 , o20 , o21 , o22 , o23 , o24 corresponding to store registers rg13 , rg14 , rg19 , rg20 , rg21 , rg22 , rg23 , rg24 where contents are set at a logic level &# 34 ; 1 &# 34 ;. these drive pulses are supplied to the corresponding segments s13 , s14 , s19 , s20 , s21 , s22 , s23 , s24 shown on the liquid crystal display panel 41 ( fig7 d ). inverted drive pulses ( fig7 b ) are sent forth from the output terminals of the remainder ( whose contents are set at a logic level &# 34 ; 0 &# 34 ;) of the thirty - two store registers obtained by excluding the aforementioned store registers rg13 , rg14 , rg19 , rg20 , rg21 , rg22 , rg23 , rg24 . said inverted drive pulses are supplied to the other segments than the previously described segments of the liquid crystal display panel 41 . the common electrode 84 ( fig3 ) is supplied with an inverted drive pulse signal ( fig7 c ). as shown , therefore , in fig7 f , a voltage signal having a level equal to a difference between the level of fig7 d and the level of fig7 c is impressed between the common electrode 84 and the segments s13 , s14 , s19 , s20 , s21 , s22 , s23 , s24 , which in turn are lighted . in contrast , a voltage signal having the same level ( fig7 c and 7e ) as impressed between the common electrode 84 and the other segments of the thirty - two segments . as shown in fig7 g , therefore , no potential difference appears between the common electrode 84 and the remainder of the thirty - two segments arrived at by subtracting the aforesaid segments s13 , s14 , s19 , s20 , s21 , s22 , s23 , s24 , thereby preventing said remainder of the thirty - two segments from being lighted . the same a . c . voltage as shown in fig7 f is impressed between the common electrode 84 and the segment s33 which is always supplied with a drive pulse signal . therefore said segment s33 always remains lighted . as seen from fig8 therefore , there are lighted pictorial notation display segments 61 , 62 , and lighted digit display segments 63 , 64 , 65 corresponding to the segments s13 , s14 , s19 , s20 , s21 , s22 , s23 , s24 . the display pattern of fig8 shows that the copying machine remains in a standby state , that is , a state in which it is impossible to conduct a copying operation . when , after the standby state , the copying machine is sufficiently heated for fixing at time t1 and rendered ready for a copying operation ( fig9 b ), then the main control section 80 causes a binary code signal denoting full preparation for a copying operation which is represented by binary codes [ 0000 0000 0000 1000 0001 1000 0000 0000 ] as shown in table 1 ( said binary code signal is hereinafter referred to as &# 34 ; a data b signal &# 34 ;) to be issued in synchronization with the prescribed ones of clock signals sent forth from the output terminal c p ( fig9 c and 9d ). when the transfer of the data of the last 32nd bit is brought to an end , a latch signal is produced from the output terminal l . as a result , the data b signal is held in the store registers rg1 to rg32 of the liquid crystal drive circuit 81 , causing a drive pulse signal to be sent forth from the output terminals o13 , o20 , o21 corresponding to those store registers which store a signal having a logic level &# 34 ; 1 &# 34 ;. the drive pulses are respectively supplied to the corresponding segments s13 , s20 , s21 of the liquid crystal display panel 41 . an inverted drive pulse signal is issued from the other output terminals corresponding to those store registers which store a signal having a logic level &# 34 ; 0 &# 34 ;. as previously described , the common electrode 84 is supplied with an inverted drive pulses ( fig3 ), and the segment s33 is supplied with a drive pulse signal . as shown , therefore , in fig1 f , a voltage signal having a level equal to a difference between the level of the common electrode 84 and the level of the segments s13 , s20 , s21 , s33 is supplied , causing said segments s13 , s20 , s21 , s33 to be lighted . a voltage signal having the same phase is impressed between the common electrode 84 and the other segments of those described above , thereby giving rise to no potential difference as illustrated in fig1 g . consequently the segments other than the aforementioned segments s13 , s20 , s21 , s33 are prevented from being lighted . at this time , a pictorial relation display segment 61 , digit display segment 63 and segments 64 , 65 are lighted , thereby indicating that the copying machine has been made fully ready for a copying operation and that a number of copy sheets to be copied during a prescribed length of time is , for example , one , as illustrated by a digit &# 34 ; 1 &# 34 ; represented by said digit display segment 63 . when , as shown in fig1 a , copy sheets have all been drawn off from the sheet feed cassette 21 at time t2 during a copying operation and a detecting means ( not shown ) finds this event , then the main control section 80 stops the operation of the copying machine , and supplies to the output terminal d a binary code signal shown in table 1 as [ 1101 0000 0000 1000 0011 1111 1000 0000 ] which denotes the absence of copy sheets in the cassette 21 ( fig1 b , 12c and 12d ). as a result , there is supplied a voltage signal having a level equal to a difference between the level of the common electrode 84 and the level of the segments s1 , s2 , s4 , s13 , s19 , s20 , s21 , s22 , s23 , s24 , s25 and s33 . therefore these segments are lighted , and the other segments are prevented from being lighted . at this time , upper and lower cover segments 43 , 42 , manual sheet feed table display segment 47 , tray display segment 59 , pictorial notation display segment 61 , digit display segment 63 and other segments 64 , 65 are lighted . further , the sheet feed cassette display segment 45 and pictorial notation display segment 46 are intermittently displayed in yellow , thereby indicating that copy sheets have all been drawn off from the copying machine . the shift registers sr19 to sr32 and store registers rg19 to rg32 of the liquid crystal display drive circuit 81 are used to indicate a number of copied sheets . in the above - mentioned example of fig1 a number of &# 34 ; 1 &# 34 ; is subtracted from the digit represented by the digit display segment 63 , each time one copy sheet is copied . therefore , the digit &# 34 ; 8 &# 34 ; denoted by said digit display segment 63 means that copy sheets have all been drawn off from the sheet feed cassette 21 , though eight more copy sheets have to be copied . when , at time t3 ( fig1 a ) during the copying operation , copy sheets supplied from a sheet feed cassette ( not shown ) are jammed immediately after their feeding , and this event is detected by detection means ( not shown ), then the main control section 80 stops the operation of the copying machine in accordance with a program , and delivers to the output terminal d a binary code signal denoting the jamming of copy sheets , as [ 1010 1000 0000 0000 0010 1111 1000 0000 ] shown in table 1 ( fig1 b , 15c and 15d ). as a result there is supplied a voltage signal having a level equal to a difference between the level of the common electrode 84 and the level of the segments s1 , s3 , s5 , s19 , s21 , s22 , s23 , s24 , s25 , s33 , causing these segments to be lighted and preventing the other segments from being lighted . at this time , the upper and lower cover display segments 44 , 42 , photosensitive member display segment 55 , tray display segment 59 , digit display segment 63 , and other segments 64 , 65 are lighted as shown in fig1 . further , the manual sheet feed table display segment 47 , and sheet passage display segment 49 are intermittently displayed in yellow , and the pictorial notation display segment 52 is intermittently displayed in red . thus , the jamming of sheets has occurred in the copying machine . as seen from fig1 , the upper cover of the copying machine which has been closed up to this time is now shown to be opened . in the case of fig1 , the jamming of copy sheets has taken place , when for example , six more sheets have to be copied . as described above , the main control section 80 causes a binary code signal ( shown in table 1 ) corresponding to a prescribed condition of a copying machine to be issued to the liquid crystal drive circuit 81 upon receipt of an output signal from a detector positioned at that part of the copying machine where its prescribed condition is to be recognized . as a result , a desired pattern is shown on the liquid crystal display panel 41 . when a key counter is not set in a copying machine which can not carry out a copying operation under such condition , then the upper and lower cover display segments 43 , 42 , manual sheet feed table display segment 47 , tray display segment 59 , digit display segment 63 and other segments 64 , 65 are lighted , and a pictorial notation display segment 60 is intermittently displayed in yellow ( fig1 ). the above - mentioned operation is used to indicate that the setting of the key counter is commanded , and the copying machine still remains incapable of a copying operation . when the toner is all drawn from the toner hopper 13 , then the upper and lower cover display segments 43 , 42 , manual sheet feed table display segment 47 , tray display segment 59 , pictorial notation display segment 61 , digit display segment 63 and the associated segments 64 , 65 are lighted , and the pictorial notation display segment 57 is intermittently displayed in yellow ( fig1 ). the above - mentioned operation is used to indicate the absence of the toner in the toner hopper 13 . when the cleaning device 29 is fully filled with recovered toner particles , then the upper and lower cover display segments 43 , 42 , manual sheet feed table display segment 47 , tray display segment 55 , digit display segment 63 and the other associated segments 64 , 64 are lighted , and further a pictorial notation display segment 56 is intermittently displayed in yellow ( fig2 ). the above - mentioned operation is used to indicate that the discharge of recovered toner particles is pictorially instructed . when the motor ( not shown ) or the original sheet table 3 happens to become immovable , then a digit display segment 63 and the associated segments 64 , 65 are lighted , and further a pictorial notation display segment 58 is intermittently displayed in red ( fig2 ). the above - mentioned operation is used to indicate that a demand is pictorially instructed for the call of a serviceman . when a copied sheet fails to be released from the surface of the photosensitive member 2 , then the upper and lower cover display segments 44 , 42 , manual sheet feed table display segment 47 , photosensitive member display segment 55 , tray display segment 59 , digit display segment 63 and the associated segments 64 , 65 are lighted , and further a pictorial notation display segment 54 is displayed in red ( fig2 ). the above - mentioned operation is used to indicate that a copied sheet has failed to be taken off the photosensitive member , and the copying machine has become incapable of performing a copying operation . when sheet jamming arises in the fixing device 36 , or sheet passage , then the upper and lower cover display segments 44 , 42 , manual sheet feed table display segment 47 , photosensitive member display segment 55 , tray display segment 59 , digit display segment 63 , and the associated segments 64 , 65 are lighted , and further a sheet passage display segment 50 and a pictorial notation display segment 53 are intermittently displayed in red ( fig2 ). the above - mentioned operation is used to indicate that sheet jamming has taken place in the aforesaid fixing device 36 or sheet passage . when sheet jamming occurs in a manual sheet feed guide , then the upper and lower cover display segments 43 , 42 , manual sheet feed table display segment 47 , sheet passage 48 , tray display segment 59 , digit display segment 63 , and the associated segments 64 , 65 are lighted , and further a pictorial notation display segment 51 is intermittently displayed in yellow ( fig2 ). the above - mentioned operation is used to indicate that sheet jamming has occurred in the manual sheet feed guide . when a lens system fails to take a position where the original impression is to be magnified or reduced in size , then the digit display segment 63 and the associated segments 64 , 65 are lighted , and further another display segment 66 is intermittently displayed in green , and a pictorial rotation display segment 58 is intermittently displayed in red . the above - mentioned operation is used to indicate that a demand for the call of a serviceman is pictorially instructed . a display device embodying this invention which is arranged as described above has the advantages that the various conditions of a copying machine can be accurately and concretely indicated ; when sheet jamming arises , or a copied sheet fails to be released from the surface of a photosensitive member , then the operator can easily judge whether the upper cover should be opened or can be left closed or whether the power switch should be cut off or can remain conducting in order to resolve the above mentioned abnormal conditions ; the operator can become accustomed to the operation of the copying machine and consequently carry out the copying work more quickly than has been possible in the past ; and not only an accurate and distinct instruction can be given but also a proper easily understandable display can be made to the operator with respect to an abnormal condition of the copying machine . the foregoing description refers to the case where the display element was formed of a liquid crystal . however , the same effect can be assured , even if any other light - emitting element such as a light - emitting diode is jointly used with a well - matched drive device . the liquid crystal display element can be so arranged to make a positive or negative display . description was given of the case where the display device of the invention was applied to indicate the conditions of an ordinary electronic copying machine . however , the subject display device is not limited to said application , but can be used to display the various conditions of an electronic printer , facsimile transceiver or image - detecting device which has a construction similar to that of said ordinary electronic copying machine . the point is that the display device of the invention is applicable to any instrument where a movable section is so operated by the user as to meet the need . obviously , this invention can be applied in various modifications without departing from the object described above .	6
the molding composition used in this invention is usually a mixture of 100 parts by weight of ethylenic polymer , 0 . 05 to 30 parts by weight , preferably 0 . 1 to 15 parts by weight , of a foaming agent and 0 . 05 to 10 parts by weight , preferably 0 . 1 to 5 . 0 parts by weight , of a cross - linking agent . furthermore , a molding composition suitable for forming cross - linked , foamed moldings possessing excellent abrasion resistance is a mixture of 100 parts by weight of ethylenic polymer , 1 . 0 to 15 parts by weight of a foaming agent , and 0 . 2 to 3 . 0 parts by weight of a cross - linking agent . if desired , an inorganic filler such as asbestos , talc , calcium carbonate , etc . ; a lubricant such as zinc stearate , stearic acid , etc . ; and a pigment may be incorporated in the molding composition . in order to simultaneously carry out foaming and cross - linking of the molding composition in the molding composition holding chamber and to further carry out continuous injection molding in the present invention , it is necessary that the decomposition temperature of the foaming agent and cross - linking agent be higher than the plasticizing temperature of the ethylenic polymer employed . further , if the temperature difference between the decomposition temperature of the foaming agent ( temperature at which the foaming agent generates a foaming gas by the thermal decomposition thereof ) and the decomposition temperature ( one minute half - life temperature ) of the cross - linking agent for forming radicals necessary for initiating cross - linking reaction is too large , the faults occur that the molding composition in the holding chamber loses fluidity due to non - foaming and excessive cross - linkage or cross - linking becomes insufficient , which sometimes makes it difficult to obtain satisfactory , homogeneous cross - linked , foamed moldings . thus , it is necessary that the decomposition temperature of the foaming agent used not differ too much from the decomposition temperature ( one minute half - life temperature ) of the cross - linking agent used , or the temperature difference between both decomposition temperatures be at most 20 ° c . the decomposition temperature of the foaming agent can be reduced using a foaming aid , and in the case of using such a foaming aid , the decomposition temperature means the thus obtained reduced decomposition temperature . the term &# 34 ; ethylenic polymer &# 34 ; used throughout the specification and claims includes homopolymers of ethylene such as high - pressure polyethylene , intermediate - pressure polyethylene and low - pressure polyethylene ; copolymers of ethylene and one or more comonomers such as vinyl acetate , propylene , acrylic acid , acrylic acid esters , etc . ; mixtures of two or more of such polymers ; and mixtures of the aforesaid polymers and other polymers miscible with the aforesaid polymers , such as natural rubber , ethylene - propylene rubber , styrene - butadiene copolymer , polybutene - 1 , butyl rubber , polyisobutylene , polystyrene , abs rubber , etc . ethylene - vinyl acetate copolymers are most preferable . examples of the foaming agents used are azodicarbonamide , p - toluenesulfonyl hydrazide , azobis - isobutyronitrile , dinitrosopentamethylene tetramine , etc ., all of which have a decomposition temperature higher than the plasticizing temperature of the ethylenic polymer . examples of the cross - linking agents used are 1 , 3 - di -( t - butyl - peroxy - isopropyl ) benzene , benzoyl peroxide , dicumyl peroxide , 1 , 1 - di - t - butyl - peroxy - 3 , 3 , 5 - trimethylcyclohexane , etc ., all of which have a decomposition temperature higher than the plasticizing temperature of the ethylenic polymer . the molding composition can be prepared by any mixing method , but it is necessary to mix at temperatures which do not cause decomposition of the cross - linking agent and the foaming agent . mixing in a henschel mixer , a tumbler mixer , etc ., may be used . also , for kneading the molding composition , a banbury mixer , a roll , a granulator , etc ., can be used . an example of the present invention will now be given by referring to the accompanying drawings . fig1 a shows a sectional side view of one embodiment of a cylinder head having a molding composition holding chamber provided at the exit end of the cylinder of an injection molding machine suitable for the practice of this invention . a molding composition comprising an ethylenic polymer , a foaming agent , a cross - linking agent , and , if desired , other additives is fused , kneaded , and passed by means of screw 1 for plasticization and injection through the area of cylinder 2 ( heated by heater 4 - 1 to a temperature which is higher than the plasticization temperature of the ethylenic polymer but lower than the temperature which would cause substantial decomposition of the foaming agent and cross - linking agent ), and then introduced into a molding composition holding chamber 5 formed at the exit end of cylinder head 3 . the molding composition holding chamber can be of the known accumulator type . the molding composition thus plasticized and introduced into the molding composition holding chamber 5 is heated therein to the proper temperature and retained therein for a proper residence time at a temperature suitable to cause foaming and cross - linking in the molding composition holding chamber ( which essentially functions as a reaction chamber until the molding composition is injected from injection nozzle 10 . the molding composition thus provided with the proper degree of cross - linking in the molding composition holding chamber is injected into a mold , wherein the molding composition is shaped and solidified by cooling in situ . the injection of the molding composition is carried out by moving spring bearing 7 to the left as shown in fig1 a and sliding needle 9 in a valve housing 8 to the left as shown in fig1 a . after the injection is completed , needle 9 moves to the right as shown in fig1 a , due to the action of spring 6 , to close nozzle 10 . the expansion ratio of the molding composition can be adjusted by controlling the amount of the molding composition fed to the mold . in fig1 a elements 4 - 2 and 4 - 3 represent heating means for the molding composition holding chamber and the injection nozzle , respectively . as will be appreciated from later discussion , the heating means 4 - 2 serves to heat the molding composition holding chamber , the walls of which can be considered &# 34 ; heat conductors &# 34 ; for purposes of determining the maximum cross - sectional length of the molding composition holding chamber . fig2 a and 2b show a further embodiment of apparatus for use in practicing the present invention wherein like numerals to those utilized in fig1 a and 1b are used . the only difference of substance between fig1 a and 1b and fig2 a and 2b is that an annular molding composition holding chamber is utilized in fig2 a and 2b , with a centrally disposed heated conductor 4 - 2a also being shown , wherein the inner radius of the annulus is shown as r 2 in fig2 b and the outer radius of the annulus is shown as r 1 in fig2 b . in the present specification , it will be appreciated by one skilled in the art that the cylinder portion of the injection molding machine represents that portion prior to the molding composition holding chamber . the examples shown below illustrate in detail the process of this invention for forming homogeneous cross - linked , foamed moldings of ethylenic polymer having excellent abrasion resistance . as shown in example 1 , it is necessary with a molding composition comprising an ethylene - vinyl acetate copolymer as the ethylenic polymer , 1 , 3 - bis -( t - butyl - peroxyisopropyl ) benzene as the cross - linking agent , and azodicarbonamide as the foaming agent , that the temperature of the cylinder portion ( pre - holding chamber area ) be kept below 200 ° c ( the one minute half - life temperature of the cross - linking agent plus 20 ° c ) and the highest temperature of the molding composition holding chamber be kept at 250 ° c ( the one minute half - life temperature of the cross - linking agent plus 70 ° c ) to increase the gel percentage of the molded article to higher than 30 %. furthermore , as shown in example 2 , it is necessary with a molding composition comprising an ethylene - vinyl acetate copolymer as the ethylenic polymer , 1 , 1 - di - t - butyl - peroxy - 3 , 3 , 5 - trimethyl cyclohexane as the cross - linking agent , and azodicarbonamide as the foaming agent , the temperature of the cylinder portion ( pre - holding chamber area ) be kept below 170 ° c ( the one minute half - life temperature of the cross - linking agent plus 20 ° c ) and the highest temperature of the molding composition holding chamber be kept at 220 ° c ( the one minute halflife temperature of the cross - linking temperature plus 70 ° c ) in order to increase the gel percentage of the molded article to higher than 30 % but less than about 40 % as particularly shown in fig8 and example 2 . in addition , it should be understood that the lowest temperature of the molding composition holding chamber is the temperature of the cylinder portion , i . e ., that portion of the apparatus prior to the molding composition holding chamber . when the temperatures of the cylinder portion and the molding composition holding chamber are too high , the gel percentage of the molded articles is reduced because the radicals generated by the decomposition of the cross - linking agent are disturbed by the foaming agent or the decomposition product of the foaming agent . this is supported by the results shown in the reference example described below , where with a molding composition containing no foaming agent no trouble occurred with the cross - linking reaction even when the temperature of the molding composition was increased to a temperature of 100 ° c higher than the one minute half - life temperature of the cross - linking agent in the molding composition . also , by referring to the results in the reference example where cross - linking was hindered by the foaming agent or the decomposition product of the foaming agent , it is clear that the above rules hold with ethylenic polymers other tha those illustrated in the examples , and thus the invention is not to be limited to the examples . if the gel percentage of the cross - linked , foamed moldings is lower than 30 %, the molded articles show insufficient abrasion resistance , i . e ., to obtain cross - linked , foamed moldings having excellent abrasion resistance , it is necessary that the gel percentage of the moldings be higher than 30 %. the term &# 34 ; gel percentage &# 34 ; in this specification is defined as follows : when 0 . 3 - 0 . 4 g of a sample from a cross - linked , foamed molding is placed in a metallic screen box ( 120 mesh ) in xylene at 80 ° c , the gel percentage of the sample is calculated as follows : wherein ( a ) is the weight of the sample remaining in the metal screen box after the test and ( b ) is the weight of the sample before the test . one embodiment of apparatus in accordance with the present invention for forming cross - linked , foamed moldings of excellent abrasion resistance will now be explained in detail . it is necessary that the molding composition holding chamber of the injection molding machine of this invention has a capacity sufficient to contain at least the amount of molding composition needed to form one molded article , i . e ., sufficient to complete one injection molding cycle , and , for commercial scale operation , the capacity of the molding composition holding chamber is greater than the amount of the molding composition injected into the mold for forming one molded article . if the capacity of the molding composition holding chamber is less than the amount of the molding composition injected into the mold to form one molded article , a part of the molding composition injected into the mold will not have been retained in the molding composition holding chamber for a sufficient time . in such a case , cross - linking and foaming do not occur uniformly and , since the foaming agent remains partially unreacted , the remaining foaming agent colors the molded article . thus , as described above , the capacity of the molding composition holding chamber of the injection molding machine of this invention must be at least equal to and can be larger than the volume of the molding composition injected into the mold to form one article . if the capacity of the molding composition holding chamber is larger than the volume of the molding composition to be injected into the mold , some of the molding composition introduced into the molding composition holding chamber may remain therein without being injected into the mold in the first injection step , but since the temperature of the molding composition holding chamber is selected according to the residence time of the molding composition in the holding chamber , good molded articles can be continuously formed even in such a case . as shown in example 3 , when the molding cycle ( i . e ., the residence time of the molding composition in the holding chamber ) is one minute , it is necessary , to obtain uniform foamed molded articles which have been cross - linked at a gel percentage of higher than 30 %, to employ a molding composition holding chamber having a cross section of less than 50 mm ( inner diameter ) in the case that the cross section of the molding composition holding chamber is circular and to employ a molding composition holding chamber having a cross section of wherein r 1 is the outer radius of the annular holding chamber and r 2 is inner radius of the annular holding chamber , in the case that the molding composition holding chamber is annular , as shown in example 3 , if the shape of the molding composition holding chamber differs from the aforesaid shape unfoamed portions of the molded articles can be foamed completely using a one minute molding cycle by increasing the temperature of the molding composition holding chamber , but in this case the gel percentage of the molded articles formed is low , and thus the products which have been cross - linked to a gel percentage of higher than 30 % and uniformly foamed cannot be obtained . it should be understood that the above parameters are also applicable to the molding composition holding chambers having forms other than those illustrated above , i . e ., to obtain molded articles which are cross - linked to a gel percentage of higher than 30 % and uniformly foamed it is only necessary to use a holding chamber for the molding composition which has a hollow form in which the greatest value of the shortest distance from any point in a cross - section of the molding composition holding chamber to a heat conductor is less than 25 mm or to use a holding chamber for the molding composition having an annular form in which the greatest value of the shortest distance from any point in a cross - section of the molding composition holding chamber to a heat conductor is less than 15 mm . several examples of cross sectional views of hollow and annular molding composition holding chambers which can be employed in this invention are illustrated in fig3 a to 3e , although the molding composition holding chambers are not to be limited thereto . the heat conductor is shown by the shaded portions in fig3 a to 3e . in each figure of fig3 a to 3e , the greatest value of the shortest distance from any point in the molding composition holding chamber to a heat conductor in the cross section is shown by an arrow . the above - described results are those obtained when the molding cycle is one minute on an industrial scale ; a molding cycle of one minute is considered to be the longest desirable commercial molding cycle , as if the molding cycle is longer than one minute , the time required for the formation of the moldings becomes undesirably high from a cost ( output ) viewpoint , and thus , the aforesaid results apply to the commercial use of this invention . in example 3 a molding composition consisting of an ethylene - vinyl acetate copolymer as the ethylenic polymer , 1 , 3 - bis -( t - butyl - peroxy - isopropyl ) benzene as the cross - linking agent , and azodicarbonamide as the foaming agent was used . since the decomposition temperature of the cross - linking agent is near that of the foaming agent , other molding compositions than the above , consisting of combinations or other cross - linking agents and foaming agents with an ethylenic polymer can be used , the decomposition temperatures of the agents are higher than the plasticization temperature of the ethylenic polymer , may be molded as in example 3 by only changing parallelly the temperature of the cylinder and the molding composition holding chamber of the injection molding machine as degree as the difference between the decomposition temperature of the crosslinking agent of this molding composition and that of the molding composition in example 3 . that is , the molding composition in this invention is not limited to the system of the ethylenic polymer , the cross - linking agent , and the foaming agent as described in example 3 . the process and the apparatus of this invention have the following merits : 1 . since foaming and cross - linking of the molding composition are carried out in the molding composition holding chamber and then the molding composition is injected followed by solidification by cooling , the dimensional accuracy and reproducibility are high for both low foaming ratio moldings and high foaming ratio moldings . 2 . since foaming and cross - linking are carried out simultaneously and continuously in a molding composition holding chamber and then the cross - linked , foamed composition is cooled immediately in a mold , the molding production rate is shortened , which is quite profitable from the viewpoint of cost . 3 . uniformly cross - linked , foamed moldings having excellent abrasion resistance and a cross - linkage of higher than 30 % ( gel percentage ) can be obtained in a continuous fashion . the invention will now be further illustrated by the following examples . a mixture of 100 parts by weight of an ethylene - vinyl acetate copolymer ( melt index , 20 dg / min ; vinyl acetate content , 20 % by weight ), 5 parts by weight of azodicarbonamide as the foaming agent ( decomposition temperature 200 ° c ; when 2 parts by weight of zinc stearate is added thereto , the decomposition temperature is reduced to about 180 ° c ), 0 . 6 part by weight of 1 , 3 - bis -( t - butyl - peroxy - isopropyl ) benzene ( one minute half - life temperature 180 ° c ; purity 40 %) as the cross - linking agent , 20 parts by weight of calcium carbonate as a filler and 2 parts by weight of zinc stearate as a foaming aid agent was kneaded on a 16 inch roll for 15 minutes at a temperature of 90 ° c to provide a molding composition . the molding composition thus prepared was injected into a mold for shoe soles having a volume of 600 cc using the apparatus shown in fig1 ( the volume of the molding composition holding chamber was 300 cc and the inner diameter of the holding chamber was 40 mm ), and a cross - linked , foamed molding having a gel percentage of more than 30 % was obtained . the foaming ratio of the product was 2 . 0 - 2 . 2 times . the relations between various moldings prepared in the same way as above and the gel percentages of the products are illustrated in fig4 fig5 and fig6 ( reference example ). a mixture of 100 parts by weight of an ethylene - vinyl acetate copolymer ( melt index , 20 dg / min ; vinyl acetate content , 20 % by weight ), 5 parts by weight of azodicarbonamide as the foaming agent ( decomposition temperature 150 ° c ), 1 . 5 parts by weight of 1 , 1 - di - t - butyl - peroxy - 3 , 3 , 5 - trimethylcyclohexane ( one minute half - life temperature 150 ° c ; purity 40 %) as the cross - linking agent , 20 parts by weight of calcium carbonate as a filler , and 1 part by weight of zinc stearate as a foaming aid agent was kneaded on a 16 inch roll for 15 minutes at 75 ° c to provide a molding composition . the molding composition thus prepared was injected into a mold for shoe soles having a volume of 600 cc using the apparatus shown in fig1 ( the volume of the molding composition holding chamber was 300 cc and the inner diameter of the holding chamber was 40 mm ) and a cross - linked , foamed molding having a gel percentage of more than 30 % was obtained . the foaming ratio of the product was 2 . 0 - 2 . 2 times and almost the complete molding composition in the holding chamber was injected per one shot . the relationship between the molding conditions and the gel percentages of the moldings are shown in fig7 fig8 and fig9 ( reference example ). by injecting the molding composition of example 1 using various mold volumes and the apparatus as shown in fig1 or fig2 having the various molding composition holding chambers as shown in table 1 , uniformly foamed , cross - linked moldings having a gel percentage of more than 30 % were obtained using a one minute molding cycle . the influence of the shape of the molding composition holding chamber and the molding conditions on the foaming state and the gel percentage of the moldings obtained are shown in table 1 together with those of the reference example . table 1__________________________________________________________________________one minute molding cyclecross section of moldingcomposition holding circular annularchamberlongest dimension of the ( d ) 40 mm ( d ) 50 mm ( d ) 60 mm ( r . sub . 1 - r . sub . 2 ) = 30 ( r . sub . 1 - r . sub . 2 ) = 40 mmcross section ( r . sub . 2 = 30 ( r . sub . 2 = 40 mm ) volume of holding 300 450 700 450 700chamber ( cc ) mold volume ( cc ) 600 900 1 , 400 900 1 , 400 cross - cross - cross - cross - cross - temp . of cylinder ( 180 ° c ) foaming linking foaming linking foaming linking foaming linking foaming linkingtemp . of molding 230 ° c o o o o x δ * o o x δ * compositionholding chamber 260 ° c o x o x * o x * o x * o x * temp . of cylinder ( 200 ° c ) temp . of molding 230 ° c 0 o o o x δ * o o x δ * compositionholding chamber 260 ° c o x * o x * o x * o x * o x * __________________________________________________________________________ in the above table , the foaming evaluation grades were as follows :? o : uniformly foamed moldings were obtained . x : moldings having considerable unfoamed portions were obtained ; and the cross - linking evaluation grades were as follows : o : gel percentage of more than 30 %. δ : gel percentage of 20 - 30 %. x : gel percentage of lower than 20 %. *: comparison example . the foaming ratio of all moldings was about 2 . 0 - 2 . 2 times . pre - heating condition : heated for 5 minutes at a contact pressure of 5 - 10 kg / cm 2 at the testing temperature pressing condition : after pre - heating , the sample was pressed for 10 minutes at 30 kg / cm 2 at the testing temperature cooling condition : after pressing , the sample was cooled under a pressue of 30 kg / cm 2 for 5 minutes by means of a cold press 3 . the results of measuring the gel percentages of various kinds of press cross - linked , foamed sheets are shown in fig1 where numbers 1 to 4 correspond to samples 1 to 4 described below . table 2__________________________________________________________________________sample foamingno . resin cross - linking agent foaming agent aid filler__________________________________________________________________________1 ethylene - vinyl acetate copolymer 1 , 3 - bis ( t - butyl - peroxy - azodicarbonamide zinc calcium ( melt index , 20 dg / min ; vinyl isopropyl ) benzene ( decomposition temp . 200 ° stearate acetate content , 20 % by weight 0 . 6 part 5 parts 2 . 0 parts carbonate 100 parts 20 parts2 &# 34 ; &# 34 ; &# 34 ; &# 34 ; &# 34 ; 100 parts 0 . 6 part 0 2 . 0 parts 20 parts3 &# 34 ; 1 , 1 - di - t - butyl - peroxy - azodicarbonamide zinc &# 34 ; 3 , 3 , 5 - trimetylcyclo - ( decomposition ) temp . 150 ° stearate 20 parts hexane 5 parts 1 . 0 part 100 parts 1 . 5 parts4 &# 34 ; &# 34 ; &# 34 ; &# 34 ; &# 34 ; 100 parts 1 . 5 parts 0 1 . 0 part 20__________________________________________________________________________ parts while the invention has been described in detail and with reference to specific embodiments thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof .	1
referring to fig1 blood is drawn from a cannulated vein 10 of a diver or aviator &# 39 ; s arm 12 through a venous puncture . this is possible by the use , for example , of a commercially available single - access dual - flow catheter with a 18 - gauge needle , as is securely used in clinical hemodialysis . of course , conventional double - needle cannulas could also be used . the collected blood is transported through a conduit 14 to a gas exchange cell 16 . the cell may consist of a cylindrically - shaped container which is sealingly closed at opposite ends by means of caps or manifolds 18 and 20 , respectively provided with an inlet port 22 and an outlet port 24 . blood received in conduit 14 passes by an afferent flow monitor 25 to enter inlet port 22 and then passes through a plurality of hollow fibers 26 , each fiber having a gas permeable membrane into a liquid having high uptake capacities for gases . the blood then exits at the outlet port 24 and is returned to the vein through conduit 28 . blood flow is supported by a pump 30 . in the blood return conduit , an electronic air / foam detector 32 with a warning light is provided in order to stop pump 30 if a passing bubble changes the optical density in the conduit . an afferent flow monitor 34 is also provided in the return conduit as well as a further monitor 36 which is used to indicate the pressure of the blood being returned . the exchange cell further includes an inlet port 38 and an outlet port 40 to allow the dialysis liquid to pass along membranes 26 . conduits 42 and 44 connect the inlet and outlet ports to a reservoir 46 containing the perfluorocarbon or silicone liquid . pump 30 also serves to circulate the liquid between the reservoir 46 and the exchange cell 16 . the liquid is brought to the body temperature by means of a heating element 48 , controlled by a thermostat 50 . on return to the reservoir , the optical absorbance of the liquid is monitored at 52 , at the exit manifold , in order to detect possible blood leaks through the exchange surface . the exchange surface in the hollow fiber cartridge should be as large as possible . areas of up to 1 . 5 m 2 are typical for cartridges used in conventional hemodialysis . cartridges about 40 cm long can hold enough fibers with a diameter of 200 micrometers to give an exchange area of more than 3 m 2 . several valves ( not shown ) permit to interrupt the flow safely ; ports ( not shown ) are provided to inject heparin or other anticoagulants continuously . the maximum volume of metabolically inert gas that dissolves in the body tissues hyperbaric conditions is estimated to be about 4 . 5 liters , a value extrapolated from measurements performed normobarically . accordingly , the dialyzate reservoir should contain about 20 liters of perfluorocarbon liquid in order to maintain the appropriate partial pressure gradient with the blood at all times . in reality , the fluid volume can be much smaller than that since the release of nitrogen from the tissues is diffusion - limited and the 1 to 2 liters of circulating blood are rapidly cleared of gas . the apparatus illustrated schematically in fig1 will easily fit into a portable canister 58 appropriately armoured to withstand the water pressure . the equipment to be used for the cannulation of a blood vessel under water is shown in fig2 . a perspex cup 60 is attached to the bend of the arm by two straps 62 and 64 fixing it in an extended position . a piston 66 draws water out of the cup in order to establish a negative pressure with respect to the outside . this seals the cup with its cushioned rim 68 against the arm and makes the blood vessels under it stand out . the catheter and needle 70 enter the perspex cup at a shallow angle through a port 72 , closed by a rubber membrane 74 , to facilitate cannulation . the tubings , 14 and 28 from the cup to the canister containing the dialysis equipment is wrapped in a flexible armoured conduit 74 . only ab out 5 vol % of the oxygen bound to hemoglobin inside the red blood cells is normally used up by the body so that the hemoglobin on the venous side still holds about 16 of the 21 vol % to which the blood is charged in the lungs . the small fraction of oxygen dissolved physically in the plasma is in equilibrium with that bound to hemoglobin in the erythrocytes and decompression dialysis will thus also reduce the amount of oxygen carried by the red blood cells . it is therefore recommended that persons undergoing decompression dialysis respire an atmosphere enhanced in oxygen . before use , the apparatus for decompression dialysis is to be primed , on the blood side , with a degassed physiological saline solution and , on the side of the dialyzate , with the degassed perfluorocarbon liquid . this prevents that bubbles form in the tubing or that the procedure would be started with bubbles adhering to the surfaces . decompression dialysis as described will remove gases dissolved in the blood and the tissues of a diver much faster than they can be passed through the lungs during the slow ascent in stages prescribed by international diving tables . as a consequence , divers can be brought to the surface rapidly in an emergency , without suffering the effects of decompression sickness , or , suffering them to a much lesser extent . conceivably , many lives may be saved which are otherwise lost due to the fact that recompression facilities are not immediately at hand . the principles involved in decompression dialysis are simple and the apparatus required is far from complicated so that the divers themselves could be instructed in its use at the surface or even under water as a first - aid measure . the process of hemodialysis started at depth can then continue above the surface . decompression dialysis could also be used as a preventive measure to extent the diving times which are , at present , limited by the long ascent periods more than by the degree of physical exertion at depth . this application would require , of course , that divers submit to the inconvenience of having a vein cannulated before the dive , to permit prompt access to the dialysis equipment .	0
in fig1 a router 100 and a bridge 102 are used to create four virtual lans ( identified as vlan 1 through vlan 4 ) from 12 individual lans , each represented by a single line on the right of the figure . router 100 is referred to herein as a vml client and bridge 102 is referred to as a vml server . bridge 102 is a large switch , such as dec &# 39 ; s gigaswitch , which has been modified to appear as four virtual bridges 104 ( 1 ) through 104 ( 4 ). virtual bridges 104 ( 1 )- 104 ( 4 ) communicate with each other through router 100 . in the described embodiment , the packets sent to router 100 by virtual bridges 104 ( 1 )- 104 ( 4 ) are multiplexed over a single line 106 that connects router 100 to bridge 102 . filters internal to bridge 102 are used to make the bridge appear as a plurality of virtual bridges . and the multiplexing of packet traffic over the single line connecting bridge 102 to router 100 is accomplished by an extra protocol between a vml client layer at router 100 and a vml server layer at bridge 102 . the following describes both the required bridge filters and the protocol between vml clients and servers in greater detail . the configuration in fig2 of a router 110 and a bridge 112 connected by two links 114 ( 1 ) and 114 ( 2 ) will be used to illustrate the interfaces that are used to set up a virtual lan . in that configuration two vlans are shown , namely vlan 1 and vlan 2 . the interfaces used to set up these vlans are shown in fig3 . a vlan is set up using five steps . first , the user uses a management interface at bridge 112 to create vlan 1 by declaring which bridge ports belong to this vlan ( i . e ., ports 8 and 12 in the figure ) and giving the vlan a name , which has purely local significance ( step 130 ). during this first step , the manager also gives the vlan a vlanid ( which in this case is 1 ). the vlanid is used to coordinate vlan set up at router 110 and bridge 112 . a similar procedure is used to set up vlan 2 at the bridge . also note that each vlan is given a type which represents the protocols that this vlan serves . in other words , bridge 112 can appear to be divided into different vlans for different protocol types . this allows protocols that cannot be connected through a router to be set up so that such protocols “ see ” bridge 112 as a single lan . however , any two vlans with the same type cannot have a common bridge port . in the next step , the manager specifies the bridge ports that are connected to vml clients ( i . e ., routers ) ( step 132 ). in the illustrated example , bridge ports 17 and 6 are connected to a client router . note that the manager does not specify which client ports are connected to the same router . the protocol figures this out by receiving “ hellos ” ( to be described later ) from client routers . after the clients have been defined , the next few steps occur at the router . the user creates a vml server at router 110 by specifying which router ports are connected to the same bridge ( in this case , ports 23 and 19 ) ( step 134 ). if router 110 was connected to another bridge , then the manager would create another vml server for the second bridge . the server is also given a local name . next , the user creates vlans at router 110 by specifying the local name of the server , the routing type , and the vlanid used to identify the vlan at the server end ( step 136 ). fig3 shows the creation of a vlan locally called “ foo ” at the router and which corresponds to vlan 1 at bridge 112 . the correspondence is made because they both use a common vlanid of 1 . the user creates a second vlan at router 110 corresponding to vlan 2 at bridge 112 . finally , for each routing type that is supported , the user creates a circuit corresponding to each vlan . thus , for example , a circuit is created corresponding to vlan 1 and a second circuit can be created corresponding to vlan 2 . the net result is that the router has circuits for each vlan . creating vlans at both bridge 112 and router 110 is necessary because current router interfaces require all router circuits to be declared in advance ( although their status can change to reflect whether the circuit is up or down ). also , an alternative would have been to put all the details of creating a vlan ( i . e ., which server , which vlanid etc .) in the circuit creation call at router 110 . however , it seemed more desirable to provide a routing layer with a clean abstraction ( i . e . a vlan ) that looks very much like a lan . it also seemed desirable that the routing layer interfaces required to create a vlan circuit be similar to the interfaces needed to create a lan circuit . the details of mapping vlans are present in the vml layer . when packets arrive at the router from the bridge , the router must be able to tell which vlan the packet was sent on . similarly when packets are sent by the router to the bridge on a specific vlan , the bridge must be able to tell which vlan the packet was sent on . these capabilities are provided through a mechanism by which information about a vlan ( specifically the vlanid described in the previous section ) is embedded in a packet . first , the mechanism will be described and then the manner by which the mechanism is used to provide the capabilities will be described . consider a data packet p . the system provides a function that adds to p some information ( e . g . the vlanid of the vlan ) that describes the vlan on which p was sent . the system also provides a second function that removes the vlanid field from p . there are two simple methods by which the vlanid can be added to packet p . the simplest method is to embed p in another packet q and to add a specially created vlanid field to the header of packet q . to remove the vlanid field , the system simply extracts p from q . another method is to use a redundant field in p . if there is some field in p that contains redundant information that can be derived from other fields in p , then that field can be used to encode the vlanid field . for example , there is a redundant field called the ssap field in the data link headers of most data packets on a lan . this field is almost always equal to another field called the dsap field . thus , to add the vlanid , the ssap can be set equal to the vlanid ; and to remove the vlanid , the ssap field can be set equal to the dsap field . the first method is more general but the second is more efficient as it does not require the addition of headers to the original packet p . referring to fig2 consider a packet p sent from router 110 to bridge 112 on vlan 1 . two cases must be distinguished , namely , p is either ( 1 ) a multicast packet or a unicast packet destined to another router or ( 2 ) a unicast packet other than one destined to another router . a multicast packet is defined as a message that is sent on a lan to a group of stations . the destination address in a multicast packet is a group or multicast address . a unicast packet is a message sent on a lan to a single station . the destination address in a unicast packet is an individual address . if p is a multicast packet , p has a destination address that is a group address which identifies a set of stations . in this case , it is crucial that p be sent only to bridge ports corresponding to vlan 1 . failure to do so can cause routing protocols to break because they use multicast packets to determine which stations are present on a lan . thus , multicast packet p sent by router 110 must carry some information so that the bridge can identify which vlan packet p is to be sent on . router 110 supplies this information by adding a vlanid field to multicast packets which it sends . the vlanid field identifies the vlan , in this case vlan 1 . in a previous section , two options were described for adding a vlanid field to a packet . both options for adding a vlanid require changing the normal forwarding process of a bridge . however , most bridges process multicast packets in software ; thus , the required changes to the forwarding process can easily be made in software . when bridge 112 receives multicast packet p , it reads the vlanid field in p to find which vlan p is to be sent on . it then sends p to only the bridge ports corresponding to vlan 1 . thus in fig2 p is only sent on ports 8 and 12 . p is not sent on ports 9 and 15 as these correspond to vlan 2 . however , before bridge 112 sends p on ports 8 and 12 , it removes the vlanid field because lan stations may detect an error if they receive a packet with a vlanid field . if p is a unicast packet destined for another router 111 ( also desingated r 2 in fig2 ), then the vlanid field is added to p before it is sent to the router . once again , although this is a non - standard packet format , the router is able to receive such packets with an encoded vlanid . if p is a unicast packet , p has a destination address that is an individual address which identifies a single station . router 110 could add a vlanid field to p as was done for multicast packets . however , many bridges forward unicast packets in hardware . thus , it is hard to add the changes required for vlanid processing without redesigning the hardware . another solution is to send a unicast packet p from the router without a vlanid field . when the packet p arrives at the bridge there are two possibilities . if the destination address da in packet p is known to the bridge , packet p is sent to the bridge port corresponding to da . if the destination address da in p is unknown to the bridge , the packet p is sent on all bridge ports . for example , if packet p was destined to a station a on vlan 1 , but the address of station a has not been “ learned ” by bridge 112 , then p will be sent on all ports , including that of vlan 2 . since station a is only on one bridge port , the other copies will be ignored . thus , until bridge 112 learns of station a , packets sent from router 110 to station a will cause redundant copies to be sent on all ports . this is much the same as normal bridge operation . referring again to fig2 suppose station a on vlan 1 sends a packet p that is destined to router 110 . bridge 112 forwards packet p to router 110 . when packet p arrives at router 110 , router 110 determines which vlan the packet was sent on . again , the two cases can be distinguished , one involving the handling of multicast packets and the other involving the handling of unicast packets . if the packet is a multicast packet , as noted above , bridge 112 adds a vlanid field before forwarding the packet . thus , when router 110 receives the packet , it decodes the vlanid field to yield the vlan the packet was sent on . if the packet is a unicast packet sent by a bridge , it will not carry a vlanid . thus , a different approach is necessary . there are at least two different solutions , which shall be referred to as method 1 and method 2 . according to method 1 , the router uses distinct source addresses for each vlan . the router is assigned a unique source address for each vlan it connects to . thus , for example , referring to fig4 if a router 140 has two vlans , vlan 1 and vlan 2 , the router is assigned an address x for vlan 1 and an address y for vlan 2 . when router 140 sends any packet p on vlan 1 to bridge 142 , it uses x as the source address ( in the data link header of packet p ). similarly , when router 140 sends any packet q on vlan 2 to bridge 142 it uses y as the source address . a station such station a on vlan 1 learns the address of router 140 from the source address of packets sent by router 140 to station a . thus , stations on vlan 1 , like station a and station b , will learn the router &# 39 ; s address as being x . similarly , stations on vlan 2 , like station c and station d , will learn the router &# 39 ; s address as being y . all unicast packets sent from vlan 1 to router 140 will be sent to x ; similarly all unicast packets sent from vlan 2 to router 140 will be sent to y . router 140 is thus able to distinguish the vlan on which a packet is sent by looking at the destination address . in the example , packets sent to x are for vlan 1 , while packets sent to y are for vlan 2 . method 1 is elegant but has two drawbacks . first , some routing protocols insist that the router uses the same source address on all lans that the router connects to , making this method inapplicable for such protocols . second , this method requires that there be multiple addresses for each vlan . this may be a problem for some implementations . method 2 avoids these drawbacks . referring again to fig4 according to method 2 the router keeps a source vlan table 144 that associates 48 - bit source addresses with vlans . received packets are distinguished by finding the vlan associated with the source address of a received packet . for example , the router &# 39 ; s table maps the address of station a to vlan 1 and the address of station c to vlan 2 . thus , any packet with source address of station a that is received at the router is assumed to have been sent on vlan 1 . source vlan table 144 at router 140 is updated by bridge 142 using the following mechanism . bridge 142 eventually learns the bridge port corresponding to each source address and enters this information into its forwarding database 146 . thus , bridge 142 will learn that station a belongs to bridge port 8 and station c belongs to bridge port 9 . whenever there is a change to forwarding database 146 , e . g . either a new entry is learned or a “ timed out ” entry is deleted , bridge 142 sends this information to router 140 using a reliable transport protocol . each update sent to router 140 also carries the mapping of ports to vlans , i . e ., bridge 142 also indicates that bridge ports 8 and 12 belong to vlan 1 , while bridge ports 9 and 15 belong to vlan 2 . on receiving such an update , router 140 has enough information to update its source vlan table 144 . method 2 is general but it requires extra processing for look - up in the source vlan table and for updating this table . however , most routers today are brouters , i . e ., they implement the bridge forwarding algorithm as well as the normal forwarding code . since a lookup of the source address is part of the bridge forwarding algorithm , the router often has hardware support for this operation , which makes the operation quite inexpensive . in sum , method 2 works for all routing protocols and can be efficient with a small amount of hardware support . in the description thus far , only lans have been connected to the bridge . however , there could also be wide area links connected to the bridge . the vml layer makes it appear that the wide - area link is directly connected to one particular router . in other words , if the router does not have an atm or sonet interface but the bridge does , then the vml layer can provide a lan “ pipe ” between the atm line on the bridge and the router . conceptually , this is no different from providing virtual lans except that these lines are typically point - to - point wide area links running protocols like hdlc and smds ( as opposed to a lan which has multiple stations whose addresses are unknown ). thus the source vlan table required for this kind of “ vlan ” is quite small and static , and hence can even be updated manually . a model implementation is shown in fig5 . a client 150 ( i . e ., a router ) and a server 152 ( i . e ., a bridge ) are each connected to a link 154 through respective data link layers 157 and 159 . in the figure , the solid lines denote the flow of packets ( data flow ) and the dotted lines denote the major control flow . thus , an arrow from a process to a database indicates that the process writes the database ; an arrow from the database to the process indicates that the process reads the database . each client has a single client vlan multiplexing layer ( vml client layer ) 156 which is responsible for multiplexing vlans on to physical links to servers . the multiplexing at the client is controlled by two data structures , namely , a serverlist 158 and a vlanlist 160 , that are set up by management . briefly , serverlist 158 contains an entry for every server the client is connected to , and lists the router links that are physically connected to the server . vlanlist 160 contains an entry for every vlan that the client wishes to connect to and lists information like the server on which this vlan belongs and the vlanid which helps identify the vlan at the server . client vml layer 156 reads serverlist 158 and vlanlist 160 and uses this and other state information to multiplex and demultiplex packets . client vml layer 156 offers the illusion of multiple vlans to routing protocols . the routing protocols interface to the vlans exactly as they do to lans , i . e ., they begin by opening a port , identifying which protocol types they wish to receive , and finally sending and receiving packets on the opened port . a routing protocol can also ( optionally ) open a port on what is referred to as an “ unknown ” vlan . suppose a packet is received by client vml layer 156 with a protocol type specified by the routing protocol . suppose also that client vml layer 156 is unable to decide which vlan the packet arrived on . then , client vml layer 156 queues the packet on the unknown vlan port . the routing protocol can then optionally decide to forward or discard the packet . forwarding packets received on unknown vlans can help data packets to be forwarded even during periods when client vml layer 156 is still learning the information needed to demultiplex packets . opening a port to the “ unknown ” vlan is just a way to model this mechanism . at the server end , there is a corresponding vml server layer 164 . unlike vml client layer 156 at client 150 , vml server layer 164 is only involved in setting up vlans at the server and not in the actual forwarding of data packets . all packets received by data link 159 are handed to a bridge forwarding layer 166 . bridge forwarding layer 166 forwards unicast packets to known destinations much as they would be handled in a normal bridge ; however , the handling of multicast and unicast packets to an unknown destination is quite different . bridge forwarding layer 166 consults a vlanlist 168 at server 152 which contains a record for every vlan declared at the server . vlanlist 168 is used to forward multicast packets received on a vlan only to the bridge ports corresponding to that vlan . vlanlist 168 is written by management , represented in fig5 by management interface 170 . vml server layer 164 sends hello messages on every link that is declared to be a link to a client / router . the hellos sent on a link 154 are used to set up a transport connection to the vml client layer at the other end of link 154 . if vml client layer 156 replies , a transport connection is set up . vml server layer 164 then begins to send updates reliably to vml client layer 156 on link 154 . as indicated in fig5 bridge forwarding layer 166 consults a forwarding database 172 , which models the standard forwarding database on a bridge . the learning process in the bridge is modelled by a learning process 174 which writes information to forwarding database 172 . there is also an interface between learning process 14 and vml server 164 . learning process 174 sends to all vml clients all updates that it has used to update bridge forwarding database 172 . when a new line to a vml client comes up , vml server 164 informs learning process 174 . learning process 174 then begins sending learning updates ( corresponding to the current state of forwarding database 172 ) to vml server 164 . vml server 164 packages this information and sends it to vml client 156 . finally , vml client 156 uses the updates to build a source vlan table . recall that the source vlan table , described in connection with fig4 is used by vml client layer 156 to demultiplex received packets . as learning process 174 gets new information it does not send a complete copy of the new database ; instead it only sends incremental updates . thus , a complete set of updates is only sent when a line to a vml client first comes up . later changes are sent as incremental updates . however , the use of incremental updates requires a reliable transport protocol between the server and client on each line . the transport protocol is responsible for retransmitting each update until an ack is received from the client . for the described embodiment , it is assumed that all vml servers are ieee 802 . 1 compliant spanning tree bridges . thus , there are two ways the spanning tree protocol can interact with the vml protocol . vml server 164 can implement a single spanning tree for all vlans or a separate spanning tree for each vlan . in the described embodiment , every vml server 164 implements a single spanning protocol for all vlans . in other words , each vml server implements the spanning tree protocol on all its links . once the spanning tree has stabilized , the vlan ports specified by management will define the breakup of the extended lan into vlans . similarly , vml server 164 builds a single learning database for the entire bridge and not a separate learning database for each vlan . as in the bridge architecture , the station addresses are unique over the entire extended lan ( as opposed to only requiring unique addresses for each vlan ). the principle data structures stored in memory at both client and server are shown in fig6 . considering first the data structures at the client end , there is a vlanrecord 200 for each vlan declared at the client and there is a serverrecord 202 for each server that the client knows about . each vlanrecord 200 points to the server record 202 corresponding to the server on which this vlan belongs . each serverrecord 202 points to a set of physical link interfaces that connect the client to the server . each such link interface has a linkrecord 204 which contains variables required to implement a reliable transport protocol . the transport protocol is used to send information ( from the server to the client ) that maps source addresses to vlans . this mapping information is stored in a sourcevlantable 206 at the client end . there is one sourcevlantable 206 per link at the client and it is pointed to by the corresponding linkrecord 204 . note that one may use multiple links between the router and the bridge as described in the u . s . patent application entitled “ system for achieving scalable router performance ”, by george varghese , david r . oran , and robert e . thomas , filed on an even date herewith , and which issued as u . s . pat . no . 5 , 905 , 723 on may 18 , 1999 and incorporated herein by reference . in that case , there would be multiple linkrecords . vlanrecords 200 are linked together in a vlanlist . serverrecords 202 are linked together in a serverlist . and linkrecords 204 are stored in an array indexed by the link number . each of the three records will now be described in greater detail . each vlanrecord 200 contains a vlanid 200 ( 1 ), which identifies the corresponding vlan at the server ; a name 200 ( 2 ), which only has local significance and is set according to the manager &# 39 ; s convenience ; a type 200 ( 3 ), which identifies the routing type of the vlan ; and a servername 200 ( 4 ), which identifies the name of the server on which this vlan belongs . these variables are set by management . each vlanrecord 200 also has two other variables , both of which are set by the protocol , namely , a status variable 200 ( 5 ) and an as signedlink variable 200 ( 6 ). status variable 200 ( 5 ) indicates if the vlan is correctly set up and if not , gives an indication of the type of error . the three possible errors are typemismatch , if the vlan type at the client does not match the vlan type of the corresponding vlan at the server ; idmismatch , if there is no vlan at the server with a vlanid equal to that declared at the client end ; and serverfailure , if none of the links to the server are considered operational . assignedlink variable 200 ( 6 ) describes the physical interface assigned to this vlan at the client . serverrecord 202 contains two variables that are set by management . the first is a name variable 202 ( 1 ) that is a local name assigned by management to this server . a vlanrecord v is made to point to a serverrecord s by setting v . servername = s . name . the second variable set by management is links 202 ( 2 ), a variable that identifies the set of physical interfaces that connect the client to this particular server . fig6 shows two links between the client and the server . thus , serverrecord 202 at the client points to the two corresponding link records . serverrecord 202 also contains two other variables that are set by the protocol . first , there is a livelinks variable 202 ( 3 ) which is the subset of physical links declared in links that are operational . the traffic from the client to the server must only be split among the set of livelinks . as links fail and recover livelinks is updated by the protocol . finally , there is a state variable 202 ( 4 ) which describes error conditions . the two possible errors are multipleservers , if any two links in links are connected to two distinct servers , and broadcast , if any link to links is not a point - to - point link to the server . each linkrecord 204 contains variables required to implement a reliable transport connection with a corresponding link at the server end . note that if there are multiple links between a client and a server , separate transport connections on each link are set up . serverid 204 ( 1 ) is a 48 - bit unique id of the remote server and connectid 204 ( 2 ) is a 32 bit connection identifier . state 204 ( 3 ) is the state of the connection ; the link is considered to be operational when the connection state is on . sequencenumber 204 ( 4 ) is the number of the last update successfully received from the server . each linkrecord contains a pointer to a sourcevlantable 206 that is used to map source addresses of received unicast packets to the vlan on which the packet was sent . finally , a clientaddresses variable 204 ( 6 ) is a list of addresses used by all vml clients on the same server , as reported by the server . a more comprehensive description of the client data structures can be found in the pseudocode that is presented in appendix i , attached hereto . the description uses the simple data types that are described appendix iii , also attached hereto . as at the client , the server keeps a vlanrecord 210 for every vlan declared at the server . the server also has a variable called clientlinks 212 that lists the set of server links that are connected to clients . for each such link , the server keeps a linkrecord 214 that has more fields than the corresponding linkrecord 204 kept at the client . finally , just as the client keeps a serverrecord 202 for each server , the server keeps a clientrecord 209 for each client it knows about . the clientrecord information is useful in implementing hunt groups at the server . for further discussion of hunt groups as they apply to the bridge see u . s . patent application ser . no . 07 / 542 , 856 , entitled fast arbiter having easy scaling for large numbers of requesters , large numbers of resource types with multiple instances of each type , and selectable queuing disciplines , incorporated herein by reference ). vlanrecord 210 includes vlanid , name , and type fields 210 ( 1 ), 210 ( 2 ), and 210 ( 3 ) the contents of which are declared by management just as at the client end . however , at the server end , management also specifies vlanlinks 210 ( 4 ) which is the set of bridge links that belong to this vlan . there are also two variables set by the protocol , namely , a clientlinks variable 210 ( 5 ) and a status variable 210 ( 6 ). clientlinks 210 ( 5 ) is a subset of the server variable clientlinks that represents the client links to which this vlan has been assigned . if there are multiple links between a server and a client , the client assigns each vlan to exactly one operational link . each client reports the link to which it assigns vlan v to the server , and the server stores the set of assigned links to clientlinks 210 ( 5 ). status variable 210 ( 6 ) is identical to status variable 200 ( 5 ) found in a client vlanrecord 200 . linkrecord 214 includes a clientid variable 214 ( 1 ), a connectid variable 214 ( 2 ), a state variable 214 ( 3 ), a sequencenumber variable 214 ( 4 ), all corresponding to previously described similar variables in the client linkrecord . server linkrecord 214 also includes additional variables . first , there is a buffer variable 214 ( 5 ) which is a buffer that stores the current update being transmitted on the link to the server . there is a retransmits variable 214 ( 6 ) that counts the number of times the update stored in buffer variable 214 ( 5 ) has been retransmitted to the client without receiving an acknowledgement . there is an other info field 214 ( 7 ) that contains various 48 - bit addresses that are used by the client . finally , there is a vlans variable 214 ( 8 ) that identifies the vlans that are assigned to the link . just as in a serverrecord at the client , each clientrecord 209 stores a clientid and a livelinks variable which represents the set of links to this client that are considered to be operational . a formal description of the server data structures can be found in appendix ii , attached hereto . there are four basic types of messages used by the vml protocol . first , servers send serverhello messages and clients respond with clienthello messages . these messages are used to set up the transport connections on links and also to coordinate vlan information between client and server . next , servers send update messages to clients containing mapping information that is used by clients to update information in the sourcevlantable of each link . each update message is numbered with a sequence number and clients respond to updates by sending an ack . the relevant fields in each message are shown in appendix iv , which presents only a logical view of the message formats . for example , in order to encode a variable length sequence ( such as a set of vlanrecords ), a length field is also needed . for the most part , the fields of the messages shown in appendix iv correspond to fields of similar names in the link records at client and server . the relevant state variables are copied into fields of the same name in the protocol message . thus , all fields in the client hello ( except the phaseiv address in the case of the decnet phase iv communication protocol ) are copied from fields of the same name in the corresponding link record at the client . the phaseiv address is copied from a global client variable that represents the 48 - bit address corresponding to the phaseiv address of the client ( i . e ., phase iv address prefixed by hi - ord ). if the client has no phase iv address , this field is set to all 0 &# 39 ; s . similarly , all fields except clientaddresses in the server hello are copied from fields of the same name in the corresponding link record at the client . the clientaddresses field is copied from a global server variable that represents all the 48 - bit addresses reported by clients . each update carries the server id , the connection identifier , a sequence number and the actual data . the ack has the same fields except for the data field . the state machine used for the transport protocol is shown in fig7 a - b . state machines attempt to set up a transport connection on each link between a client and a server . once management declares a clientlink at the server , the server creates a linkrecord for the link . on creation and on power up or reset of the link , the linkrecord is reset by setting the state of the link to init 300 . the init state causes a wait for a timeout period that is sufficiently long such that by the time the server link exits init state : ( 1 ) all old control messages sent by the server and the client on this link will have disappeared ( any control messages received by the server on a link in init state are ignored ); and ( 2 ) the client will have timed out all old state information it had . thus , the timer in init state ( called connecttimer ) is set to be large enough to “ flush ” all old messages and state information . on expiry of the connecttimer , the server sets the state of the link to req 302 ( i . e ., requesting a connection ) and sends a server hello periodically to the client . all hellos sent by the server list the vlan id and type of all vlans known to the server . all hellos ( sent by either the client or server ) carry the state of the sender ; a hello with state req is called a requesthello ; a hello with state on is called an onhello . if the client receives a requesthello while in req state , the client transitions to an on state 304 and sends back an onhello . while the server periodically sends hellos in the req and on state , the client only sends hellos in response to server hellos . the client is responsible for distributing the vlans heard from a server among the multiple lines going to the server that are on . it is also useful for deciding which links multicast traffic for a vlan will flow on . the client distributes vlans by setting the variable assignedlink in a vlanrecord to point to the assigned link . a simple policy would be to distribute the vlans in roughly equal fashion among all links to the server that are on . having distributed the vlans among links to the server , the client sends back a hello to the server on the link it received a hello . the client hello lists all vlans assigned by the client to this link . notice that the server lists all its vlans in its hellos , while the client lists the vlans assigned to the line on which the hello is sent . suppose an onhello comes back on link l to the server . suppose the hello is received while the server link record is in req state and the connection id in the hello matches the server connectionid . then the two way handshake to set up the connection is considered to be complete , and the server changes the state of the link to on state 304 . also if a vlan v is mentioned in the hello sent by the client , then the server updates the vlanrecord for v to include l in its list of clientlinks . the clientlinks for a vlan is a subset of the clientlinks of the server . basically , when a server has multiple links to a client , the server selects exactly one of these links for each vlan based on hellos sent by the client . the selected link is used by the server to send multicast traffic for the vlan to the client . in normal operation , once both client and server have turned a link on , the server periodically sends hellos to the client and the client responds with a hello . however , if the client does not hear a hello from the server for a timeout period , the client transitions the link to req state 310 . the default value of the timer in init state at the server is chosen to be three times as large as the client timeout . besides the normal operation , there are two other interesting cases . first , if the client receives a hello from the server with a new connection id or server id ( i . e ., if the old server is disconnected and a new server plugged in ) while in on state , the client remains in on state but essentially starts a new connection . if the client crashes and comes up , the client starts the link in req state . however , the client will not leave req state until the server sends an onhello to the client and the client responds with a requesthello . receipt of the requesthello causes the server to go into req state and restart the connection . this is important because when the client crashed it may have lost all previous updates ; thus it must force the server to send it all updates by restarting the connection . the hellos sent by the client also lists the 48 - bit addresses used by the client on the link , including any address derived from the client address . when the server gets the hello it sets up all bridge forwarding databases such that the address listed in the hello point to the link the hello was received on . the vmlserver also builds up a list of all client addresses ( using a variable clientaddresses ) that it reports back to clients in its server hellos . note that if a client r sends a packet to another vml client router s , client r then includes a vlanid in the packet . client r can distinguish packets sent to other vml clients by consulting a list of client addresses sent to r by the server . recall that the manager enters information at both client and server to set up vlans . the code has a few consistency checks on this information . recall that the server sends a list of all its vlans in its hellos with vlanid and type . consider a vlan v declared at the client with vlanid = i . the client will not assign vlan v to a line unless it finds that the server reports some vlan with vlanid = i in its hello . thus , if the manager incorrectly enters the vlanid field for a vlan at the server and client , the client will not “ bring up ” the vlan . instead the state of vlan v is reported as idmismatch . suppose by accident , the manager connects a client to two different servers using links l 1 and l 2 but declares l 1 and l 2 to be part of one server record at the client . the client will detect this since it receives hellos with two different server ids on both links . the state of the corresponding server record is set to multipleservers and all vlans that belong to this server have their state changed to serverfailure . if the state of a vlan is anything other than on , the client will not send any traffic on this vlan and will not assign this vlan to any link . the formal code used by the server to control vlans is presented in appendices v , vi , and vii . appendix v shows the timers , constants , and macros used by the server transport protocol on each link . the code describes the timers as constants . when a client hello is received on a link , the information in the link record for that link may change and the macros shown in appendix vi are used to update information about vlans , clients , and addresses . the first macro updateclientlist keeps track of the client links associated with each distinct client ( some clients may be connected to the server with multiple links ); if hunt groups are implemented , this information is used to create a single hunt group for all the on links connected to each client . updatevlanstatus is used to choose at most one assigned link per client for each vlan ; the assigned link is the link on which the client reports the vlan . this information is gathered into a set of client links for each vlan that is used to forward multicast traffic . ( exactly one copy of a multicast packet sent on a vlan is sent to each client by sending the packet to the assigned link for that client .) finally , updateaddresses ( in appendix vi ) updates the set of 48 - bit addresses reported by clients . it also makes forwarding database entries for these addresses . in the formal code for the server transport protocol ( appendix vii ), when some action on a link l is executed , it typically begins by obtaining the linkrecord by looking up linkarray [ l ]. it is , of course , assumed that there is a check as to whether l is a clientport and if l is not , the routine is not executed . the server code describes actions taken when a hello is received and transport timers expire . it follows the state transitions described earlier . the client code to control vlans is described in appendices viii and ix . appendix viii contains a set of useful macros that are called by the client transport protocol . initializeconnection is called when a connection first begins at a client and initializes transport variables . updateserverrecord and updatevlanstatus are called whenever the client receives a new server hello . updateserverrecord checks for server errors ( such as being connected to two different servers on two links that were declared to be part of one server record ) and updates the concerned server record . updatevlanstatus similarly checks for vlan errors ( i . e ., a vlan declared at the client does not have a matching vlan at the server ) and also distributes client vlans among all the on lines that connect the client and the server . finally , the main client code is described in appendix ix . it has routines to process a received server hello and for handling transport timer expiry . it follows the state machine described earlier . this section describes how the forwarding tables at the server are sent reliably to the client using the transport connections set up on links . as was previously described , when the server turns a link on , the server initializes the sequencenumber field ( for the link ) to 1 . similarly when the client starts a connection , the client initializes the sequencenumber field to 0 . the client also initializes its sourcevlantable to be empty . in normal operation , the server will send its forwarding table suitable encoded to the client on each line . the client will send acks backs separately on each line . this is redundant because if a client has multiple lines to the server it really only needs one copy of the forwarding table . however , by sending multiple copies parallel processing is possible . when a connection starts at the server , the server informs the update process using a routine called informupdateprocess together with a status variable that is set to “ new ”. it is assumed that the update process keeps track of the outstanding updates on each client link . when the update process gets a status of new for a line , it begins to send the entire forwarding database to the client as a sequence of updates . however , the update process sends only one update at a time . each update is numbered with the server sequence number ; when the client receives the update , the client incrementally updates its sourcevlantable using the update and sends back an ack . when the ack is received at the server , the server informs the update process using the routine informupdateprocess together with a status variable that is set to free . when this happens the update process sends the next outstanding update . if the forwarding database changes while the client is being loaded , the updateprocess must keep track of the outstanding updates for each client link . the current update being sent to a client is stored in a variable called buffer . if an ack is not received before a retransmittimer expires , the update is retransmitted from buffer . if more than a certain number of retransmissions takes place , the server starts a new connection by going into req state and incrementing the connection identifier . the net result is that on each line , the client will build up a sourcevlantable that maps source 48 - bit addresses to vlans . the server code for sending updates reliably is described in appendix x . it uses a macro that is an interface to the update process . it has routines to send a new update , to retransmit an update , and to receive an ack from the server . the client code for receiving updates reliably and sending updates is described in appendix xi . it uses a macro that encapsulates the implementation specific method used to update the sourcevlantable when a new update arrives . the code has only one routine , a routine that receives an update , checks whether it is a duplicate , and sends an ack back to the server . normally the interface to a data link is via a port . according to a simplified view of a port interface , a client opens a port and is given a descriptor ( much like a unix file descriptor ). the client then enables a certain protocol specifier ( includes information on saps , protocol types , multicast etc .) on the port . the specifier describes the kinds of packets the client wants to receive . finally , clients can transmit packets to the port ; these packets are then sent out on the link . also received packets of the specified type are queued to the port . the actual dna data link specifications are slightly different ; for instance , the client does not give the port a single protocol specifier but instead separately enables each sap , protocol type , etc . also , the interface to receive a packet is typically a polling interface . however , these are just details . one object is to make a vlan look just like a lan to clients and a similar port interface is offered to vlans except that the ports on a vlan are called vlanports to avoid confusion . thus a routing protocol ( e . g . phase v decnet ) begins by opening a virtual port on a specified vlan . then the routing protocol enables a single protocol specifier on the virtual port which describes all the kinds of packets that the routing protocol wishes to receive . finally , the routing protocol transmits to the vlanport and received packets are queued to the vlanport . when a virtual port is opened and given a protocol specifier , the vml layer at the client attempts to open up corresponding ports on all the physical links associated with this vlan . thus each vlan has a server and each server has a set of physical links . the client vml layer opens up data link ports on each such link and enables each such data link port with the specifier of the vlanport . the client stores the mapping between vlanports and data link ports in the portmappinglist . this list consists of a record for each association between a vlanport and a data link port . thus each vlanport has multiple records in the portmappinglist , one for each data link port it is associated with . the routing protocol can choose to open a port to the unknown vlan . in this case , the client opens associated physical ports on all server links . when forwarding a packet sent on vlanport vp on vlan v , the client first picks a link l among all the “ live ” links associated with vlan v . these are the links associated with v &# 39 ; s server that are in on state . next , the client searches the portmapping list to find the data link port lp associated with l . if the packet is multicast or is destined to another vml client , a vlanid field is added to the packet . finally the packet is queued to data link port lp . when a packet is received on link l with protocol specifier s , the client attempts to find the vlan v the packet was sent on by first looking for a vlanid field ( if it exists ) and then consulting the sourcevlantable ( if packet is unicast ). if such a v is found , the client searches the portmappinglist to find the vlanport vp associated with vlan v and specifier s ; the client then queues the packet to vp . if no such v is found , the client searches the portmappinglist to find the vlanport vp associated with the “ unknown ” vlan and specifier s . if such a port exists , the client queues the packet to vp . the server forwarding algorithm is essentially the bridge forwarding algorithm except for small changes to the way a server forwards : a ) multicast packets and b ) packets sent to an unknown destination address . the vlan associated with a received multicast packet p is determined by the type of link p was received on . if p was received on a client link , the vlan is determined from the vlanid field in p . if p was received on a client link , the vlan is determined from the vlanid field in p . if p was received on a vlan link l , the vlan is determined from the vlan that link l has been declared to be part of . multicast packets sent on a vlan v are forwarded only to vlan links associated with v and to client links that report vlan v in their client hellos . before a multicast packet is sent on a client link , a vlanid field is added ; similarly when a multicast packet is received from a client link , the vlanid field is removed before the packet is sent to vlan links . packets with unknown destination address that are received on client links are sent to all vlan links that are turned on in the spanning tree . packets with unknown destination address that are received on a vlan link are sent only on the vlan associated with that link . packets with unknown destination address are never sent on client links . this is because client hellos list all addresses of clients ; hence client destination addresses should be unknown only during the ( hopefully brief ) period when the protocol initializes . the server code for forwarding packets is formally described in appendices xii and xiii . the main server forwarding routines are in appendix xiii . the two main routines are multicast_forward ( which describes how multicast packets are forwarded ) and unknown_forward ( which describes how packets with unknown destination addresses are forwarded ). appendix xii describes the macros used by the main code in appendix xiii . the macros are mostly used to find the links associated with vlans and to add and remove the vlanid field in the packet . the formal code for the client forwarding protocol is described in appendices xiv and xv . the major routines in appendix xv are the transmit routine ( to transmit packets on a vlan , possibly adding a vlanid to a packet ) and the receive routine ( to demultiplex a received data link packet using either a vlanid field or the source mapping table ). appendix xiv describes the macros used by the main code in appendix xv . the macros are mostly used to search the portmappinglist . for mappings between virtual ports , link ports , and protocol specifiers . the sourcelookup macro finds the vlan associated with a source address . it uses two architectural constants , unknownvlanid ( vlanid of the unknown vlan ) and vmlrouterid ( a second vlanid reserved to denote that this source address is a vml router ). the receive macro finds the vlan associated with a packet as follows : if the packet is multicast , obtain vlan from the vlanid field in packet . if the result indicates the packet is from a vml router then find the vlan from the vlanid field in the packet .	7
as a preliminary matter , it will readily be understood by one having ordinary skill in the relevant art (“ ordinary artisan ”) that the present invention has broad utility and application . furthermore , any embodiment discussed and identified as being “ preferred ” is considered to be part of a best mode contemplated for carrying out the present invention . other embodiments also may be discussed for additional illustrative purposes in providing a full and enabling disclosure of the present invention . moreover , many embodiments , such as adaptations , variations , modifications , and equivalent arrangements , will be implicitly disclosed by the embodiments described herein and fall within the scope of the present invention . accordingly , while the present invention is described herein in detail in relation to one or more embodiments , it is to be understood that this disclosure is illustrative and exemplary of the present invention , and is made merely for the purposes of providing a full and enabling disclosure of the present invention . the detailed disclosure herein of one or more embodiments is not intended , nor is to be construed , to limit the scope of patent protection afforded the present invention , which scope is to be defined by the claims and the equivalents thereof . it is not intended that the scope of patent protection afforded the present invention be defined by reading into any claim a limitation found herein that does not explicitly appear in the claim itself . thus , for example , any sequence ( s ) and / or temporal order of steps of various processes or methods that are described herein are illustrative and not restrictive . accordingly , it should be understood that , although steps of various processes or methods may be shown and described as being in a sequence or temporal order , the steps of any such processes or methods are not limited to being carried out in any particular sequence or order , absent an indication otherwise . indeed , the steps in such processes or methods generally may be carried out in various different sequences and orders while still falling within the scope of the present invention . accordingly , it is intended that the scope of patent protection afforded the present invention is to be defined by the appended claims rather than the description set forth herein . additionally , it is important to note that each term used herein refers to that which the ordinary artisan would understand such term to mean based on the contextual use of such term herein . to the extent that the meaning of a term used herein — as understood by the ordinary artisan based on the contextual use of such term — differs in any way from any particular dictionary definition of such term , it is intended that the meaning of the term as understood by the ordinary artisan should prevail . furthermore , it is important to note that , as used herein , “ a ” and “ an ” each generally denotes “ at least one ,” but does not exclude a plurality unless the contextual use dictates otherwise . thus , reference to “ a picnic basket having an apple ” describes “ a picnic basket having at least one apple ” as well as “ a picnic basket having apples .” in contrast , reference to “ a picnic basket having a single apple ” describes “ a picnic basket having only one apple .” when used herein to join a list of items , “ or ” denotes “ at lease one of the items ,” but does not exclude a plurality of items of the list . thus , reference to “ a picnic basket having cheese or crackers ” describes “ a picnic basket having cheese without crackers ”, “ a picnic basket having crackers without cheese ”, and “ a picnic basket having both cheese and crackers .” finally , when used herein to join a list of items , “ and ” denotes “ all of the items of the list .” thus , reference to “ a picnic basket having cheese and crackers ” describes “ a picnic basket having cheese , wherein the picnic basket further has crackers ,” as well as describes “ a picnic basket having crackers , wherein the picnic basket further has cheese .” turning now to the drawings , a right side elevational view and a right side cross - sectional view of a first embodiment 118 of an apparatus in accordance with the present invention are illustrated , respectively , in fig1 and 15 . a front elevational view of the apparatus 118 is illustrated in fig1 . the apparatus 118 is shown in fig1 - 15 in conjunction with a conveyor 12 of a shrink packaging machine 10 , wherein an article 146 to be shrink wrapped is just coming into contact with the apparatus 118 . the apparatus 118 includes a plurality of spaced apart rollers 20 and a support 122 for disposition of the plurality of rollers 20 above the conveyer 12 . the rollers 20 and their disposition above the conveyor 12 are similar to those described previously with regard to fig1 - 12 , and each roller 20 includes a central horizontal shaft 24 and a cylinder 26 that is rotatably mounted on the shaft 24 . the cylinder 26 of each roller 20 preferably is covered with a high temperature - resistant non - stick coating , such as silicon rubber or teflon ®. the covering may constitute an application of the material to the roller , thereby forming a coating , or , alternatively , the covering may constitute a piece of the material that is adhered , or otherwise attached to , the rollers 20 . the support 122 includes a pair of spaced apart side members comprising side rails 128 , 130 which define slots 132 for receiving opposite ends of the shaft 24 of each roller 20 . fig1 is a right side elevational view of one of the side rails 130 of the apparatus of fig1 . the slots 132 of the left side rail 128 are preferably directly opposite and identical in shape to corresponding slots 132 of the right side rail 130 so that each of the plurality of rollers 20 is oriented with its axis disposed generally orthogonal to the direction of motion 34 of the conveyer 12 . the support 122 also preferably includes at least one threaded stud 36 passing through both side rails 128 , 130 for securing the side rails 128 , 130 in their spaced apart relationship . in the embodiment shown , each threaded stud 36 is secured to the side rails 128 , 130 by inner nuts 38 and outer nuts 40 . each slot 132 preferably extends in a direction having both a vertical component 42 and a horizontal component 44 . the vertical component 42 allows vertical displacement of a corresponding one of the plurality of rollers 20 by an article 146 as the article 146 is conveyed past the roller 20 . the horizontal component 44 of each slot 132 allows horizontal displacement of a corresponding roller 20 whereby the corresponding roller 20 is pushed slightly backwards in the direction 34 of motion of the conveyer 12 , making it easier for the article 146 to lift the roller 20 . each side rail 128 , 130 may form regularly spaced pairs of apertures positioned just above the slots 132 for receiving the threaded studs 36 and / or for receiving mounts for mounting threaded legs ( not shown ). the rails 128 , 130 thus can be cut to any length without special manufacture , and both rails 128 , 130 can be cut from the same stock , simply reversing the direction which a particular rail faces to make it either a right side rail 130 or a left side rail 128 . the threaded legs may be generally similar to the threaded legs 48 of fig3 and have similar functionality and design . referring now to fig1 , a significant distinction is evident between the slots 132 in the side rails 128 , 130 of the apparatus 118 and the slots 32 shown and described previously with respect to the apparatus 18 of fig1 - 12 . specifically , as shown in fig1 , variations in slot length exist between a first subset of slots 133 , a second subset of slots 134 , a third subset of slots 135 , and a fourth subset of slots 136 of the apparatus 118 , wherein the apparatus 18 of fig1 - 12 include slots 32 having substantially uniform length , wherein each subset includes one or more slots . in this regard , each of the fourth subset of slots 136 are preferably of the same general size and design as the slots 32 shown , for example , in fig5 . the first , second and third subsets of slots 133 , 134 , 135 , however , are of progressively greater lengths , all of which are less than the slot length of the fourth subset of slots 136 . additionally , the lower end of each of the first subset of slots 133 preferably is positioned at a distance from the bottom of the rail 130 that is slightly greater than the distance from the bottom of the rail 130 of each lower end of the second subset of slots 134 . similarly , the lower end of each of the second subset of slots 134 is positioned at a distance from the bottom of the rail 130 that is slightly greater than the distance from the bottom of the rail 130 of each lower end of the third subset of slots 135 , and the lower end of each of the third subset of slots 135 is positioned at a distance from the bottom of the rail 130 that is slightly greater than the distance from the bottom of the rail 130 of each lower end of the fourth subset of slots 136 . when rollers having similar diameters ( such as illustrated rollers 20 ) are mounted in these slots , this arrangement creates a graduated or tapered opening into the upstream end of the shrink tunnel of the shrink packaging machine in which the apparatus 118 is included . this graduated or tapered opening provided by the relative positions of the rollers 20 retained by the first , second , and third subsets of slots 133 , 134 , 135 provides a significant advancement over the prior arrangements of rollers 20 , such as that shown in fig1 - 12 . in particular , relatively thicker articles , such as articles 146 of fig1 - 12 , are accommodated by the apparatus 118 of the present invention in contrast to the apparatus 18 of the prior art illustrated in fig1 - 12 . in operation , the article 146 first comes into contact with the lower front portion of a roller 20 retained in a slot 133 . because the article 146 engages the lower portion of the first roller 20 , i . e ., because the article 146 does not initially engage the first roller in a direction that is substantially perpendicular to the surface of the roller at the point of engagement , the first roller 20 is readily displaced for passage of the article 146 under the first roller 20 . once the article 146 passes beneath the first roller 20 , the article 146 comes into contact with the lower front portion of the next subsequent roller 20 retained in a slot 134 . because the first roller 20 rides on top of the article 146 when the article 146 comes into contact with the second roller 20 , the first roller 20 tends to exert pressure upon the article 146 and serves to counteract any tendency of the back portion of the article 146 to lift up from the conveyor 12 upon contact with the second roller 20 . consequently , the second roller is more readily displaced by the article 146 . the article 146 furthermore preferably engages the second roller in a direction that is not substantially perpendicular to the surface of the roller at the point of engagement , whereby the second roller is more readily displaced for passage of the article 146 there under . however , it will be appreciated that , because of the force exerted by the first roller on the article 146 , the article 146 may engage the second roller in a direction that is closer to being orthogonal to the surface of the roller at the point of engagement than the direction of contact at the point of engagement between the article 146 and the first roller . the article 146 then comes into contact with the lower front portion of the next subsequent roller 20 retained in a slot 135 . because one or more of the previous rollers continue to ride upon of the article 146 when the article 146 comes into contact with the next subsequent roller , pressure is exerted upon the article 146 that serves to counteract any tendency of the back portion of the article 146 to lift up from the conveyor 12 upon contact with the next subsequent roller . consequently , the next subsequent roller is more readily displaced by the article 146 . the article 146 furthermore preferably engages the next subsequent roller in a direction that is not substantially perpendicular to the surface of the roller at the point of engagement , whereby the next subsequent roller is more readily displaced for passage of the article 146 there under . however , it will be appreciated that , because of the continued force exerted by one or more previous rollers on the article 146 , the article 146 may engage the next subsequent roller in a direction that is closer to being orthogonal to the surface of the roller at the point of engagement than the direction of contact at the point of engagement between the article 146 and a previous roller . finally , the article 146 comes into contact with the lower front portion of the next subsequent roller 20 retained in a slot 136 . because one or more of the previous rollers continue to ride upon of the article 146 when the article 146 comes into contact with the next subsequent roller , pressure is exerted upon the article 146 that serves to counteract any tendency of the back portion of the article 146 to lift up from the conveyor 12 upon contact with the next subsequent roller . consequently , the next subsequent roller is more readily displaced by the article 146 . the article 146 furthermore preferably engages the next subsequent roller in a direction that is not substantially perpendicular to the surface of the roller at the point of engagement , whereby the next subsequent roller is more readily displaced for passage of the article 146 there under . however , it will be appreciated that , because of the continued force exerted by one or more previous rollers on the article 146 , the article 146 may engage the next subsequent roller in a direction that is closer to being orthogonal to the surface of the roller at the point of engagement than the direction of contact at the point of engagement between the article 146 and a previous roller . in fact , the point of engagement may be such that the roller would not be displaced by the article 146 but for the continued force being exerted upon the article 146 by one or more of the previous rollers . it will also be noted that the tapered opening provided by the apparatus 118 especially works well if the article 146 itself is compressible . in this regard , while the article 146 displaces the first roller 20 , the article 146 further may be compressed by the first roller 146 , thereby lowering the vertical height of its point of impact with the second roller . the degree of compression further may be increased by increasing the weight of the first roller , or by fixing the vertical disposition of the first roller as in other embodiment of the invention described below . compression of the article 146 also tends to facilitate passage of the article 146 under subsequent rollers . some overall benefits are shown , for example , in fig1 - 18 , which illustrate a right side elevational view and a right side cross - sectional view , respectively , of the apparatus 118 . as shown in fig1 - 18 , a thick article 146 to be shrink wrapped has been transported midway through the apparatus 118 on the conveyor 12 . as the article 146 has passed the various rollers 20 forming the tapered opening of the shrink packaging machine , the rollers 20 are successively displaced while their weight causes the article 146 to be compressed . in this way , article 146 , which would have been too thick to be reliably guided under the first roller 20 of the prior art apparatus 18 illustrated in fig1 - 12 without manual intervention and adjustment , now may be shrink wrapped without such manual intervention using the apparatus 118 of the present invention . apart from the aforementioned , the structure and operation of the apparatus 118 of the present invention is otherwise very similar to that of the apparatus 18 of fig1 - 12 . in this regard , the articles 146 is shrink wrapped by covering the article 146 with shrink film in the normal way , which is well known in the art ; conveying covered article 146 on conveyer 12 through the shrink tunnel ; holding the covered article 146 down by exerting pressure from at least one of the plurality of rollers ; and blowing hot air on the shrink film covering the article 146 in a hot air chamber while the article 146 is held down by the at least one roller 20 . furthermore , it will be appreciated that having a plurality of rollers 20 spaced apart from each other allows hot air to be blown in - between the rollers and around the article 146 . the cylinders 26 of the rollers 20 also may be disposed so as to rest upon the surface of conveyer 12 , thereby imparting to each cylinder 26 rotational motion around its respective shaft 24 and further facilitating movement of the article 146 underneath each of the plurality of rollers 20 during movement of the conveyor 12 . however , as will be appreciated , in order for all of the rollers 20 to be so driven by the conveyor 12 , the diameters of the rollers 20 will differ between the rollers 20 . it alternatively is contemplated that , while each of the rollers 20 preferably is disposed low enough to actually contact the particular article 146 to be shrink wrapped , it is possible to simply have rollers 20 disposed so as to be slightly positioned above the article 146 without actually contacting the article absent initial curling or deformation of the article , which would be sufficient to prevent the article 146 from curling or deforming more than a limited amount . a characteristic of the apparatus 118 of fig1 - 18 is that the angle of the tapered opening created by the rollers 20 retained by the four subsets of slots 133 , 134 , 135 , 136 is fixed , i . e ., the lowest point of slot 133 is vertically fixed relative to the lowest point of slot 134 , the lowest point of slot 134 is vertically fixed relative to the lowest point of slot 135 , and the lowest point of slot 135 is vertically fixed relative to the lowest point of slot 136 . in variations of the apparatus 118 of the first preferred embodiment , the cylinders of the rollers may include varying diameters ( rather than uniform diameters as described ) such that a tapered opening is not necessarily provided and such that the conveyor drives each of the rollers when disposed in its respective lowermost position . nevertheless , because the height of the axes of rotation of at least the first couple of the rollers successively decreases , articles having a greater height still are accommodated generally as described above . fig1 is a right side elevational view of a second preferred embodiment 218 of an apparatus in accordance with the present invention . this apparatus 218 is similar to the first preferred embodiment 118 except that one or both of the side rails 128 , 130 of the first preferred embodiment have been replaced by a side member such as the right side rail 230 shown in fig1 . this side rail 230 includes slots all having a substantially uniform slot length , such as the fourth subset of slots 136 ; however , the apparatus 218 also includes an adjustable positioning arm 270 mounted at a pivot point 272 . the arm 270 may have any one of various configurations so long as it serves the function of establishing a lower limit on the movement of the respective rollers 20 in one or more of the slots 136 . thus , an upper edge 274 of the arm 270 is arranged to receive and support the end of one or more of the roller shafts 24 , as shown in fig1 . the arm 270 is held in place by tightening a fastener 276 at the pivot point 272 . the arm 270 additionally , or alternatively , may be further reinforced by a second fastener 278 inserted through a curved slot 280 , located near the end of the arm 270 so as to optimize the moment of force relative to the pivot point 272 . as shown , the slot 280 may be arranged in the body of the side rail 230 , but it will be apparent that generally similar results may be achieved by locating the slot in the arm itself , provided that the arm is modified in such a way as to accommodate a slot 280 of suitable length . the second fastener 278 preferably includes a thumb screw with a relatively large diameter , thereby making adjustment thereof easier . when the second fastener 278 is used , the first fastener 276 may remain loosened . in operation , the thumb screw of the second fastener 278 then only need be loosened enough to permit the arm 270 to be positioned at a desired angle . once in place , the second fastener 278 is tightened so as to fix the lower range of movement of the roller shafts 24 in their respective slots 136 . the apparatus 218 may then be used in like manner to the one shown in fig1 - 18 . however , if unsatisfactory results are being achieved in the shrink wrapping operation , or if the size of the articles being shrink wrapped is changed beyond what otherwise can be accommodated by the prevailing setting , then the lower range of movement of the roller shafts 24 may be adjusted merely by loosening the thumb screw 278 , repositioning the arm 270 , and retightening the thumb screw 278 . the basic functionality of the present invention may also be accomplished in any of a variety of alternative configurations . for example , results similar to those achieved with the preferred embodiment 218 of fig1 may be achieved by replacing the pivoting arm 270 illustrated therein with a member that may be moved up and down at each end , by a plurality of separate pivoting arms or members that each control the position of a portion of the roller shafts 24 , or the like . further , each movable end of a member or pivoting arm may be secured using a fastener inserted through a slot , as illustrated in fig1 , by a ratcheting mechanism , by a slot arrangement having a plurality of detent positions , or any other suitable attachment means . additionally , in variations of the apparatus 218 of the second preferred embodiment , the cylinders of the rollers may include varying diameters ( rather than uniform diameters as described ) such that a tapered opening is not necessarily provided and such that the conveyor drives each of the rollers when disposed in its respective lowermost position . nevertheless , because the height of the axes of rotation of at least the first couple of the rollers successively decreases , articles having a greater height still are accommodated generally as described . fig2 illustrates a right side elevational view of a side rail 330 of yet a third preferred embodiment of an apparatus of the present invention ( not shown ). this side rail 330 is somewhat similar to the side rail 230 of fig1 , in that it includes slots all having a substantially uniform slot length , such as the fourth subset of slots 136 . however , the side rail 330 includes one or more slot inserts 90 , 92 , 94 ( more clearly shown in fig2 ), each of which is retained in place by a fastener arrangement 96 such as , for example , a nut , washer , and bolt assembly . these inserts 90 , 92 , 94 may be installed or removed as necessary from the slots 136 nearest the front of the apparatus of which side rail 330 forms a part in order to control the lower range of movement of the roller shafts 24 in their respective slots 136 . different sizes or numbers of inserts may be used in order to produce tapered openings of different lengths or angles . in variations of the apparatus of this third preferred embodiment , the cylinders of the rollers may include varying diameters ( rather than uniform diameters as described ) such that a tapered opening is not necessarily provided and such that the conveyor drives each of the rollers when disposed in its respective lowermost position . nevertheless , because the height of the axes of rotation of at least the first couple of the rollers successively decreases , articles having a greater height still are accommodated generally as described . fig2 illustrates a right side elevational view of a side rail 430 of a fourth preferred embodiment of an apparatus ( not shown ) in accordance with the present invention . this side rail 430 also provides some adjustability to the length or angle of the tapered opening , which is accomplished via the inclusion of one or more series of holes 97 , 98 in a pattern that facilitates the creation of the tapered opening . as shown in fig2 , a first series of holes 97 creates a first line , generally collinear with the bottom of the first slot 136 , while a second series of holes 98 creates a second line , also generally collinear with the bottom of the first slot 136 . rollers 20 inserted in either series of holes 97 , 98 thus form a gradual linear progression downward from high to low , thereby creating the tapered opening . additional series of holes , or series having different numbers of holes , may likewise be used . the opening further need not be linear and may be curved . the arrangement provide , though , suffers from the disadvantage of not permitting movement of the rollers 20 in the series of holes 97 , 98 , but provides for a tapered opening and adjustability of the angle or length of the opening that is provided . in variations of the apparatus of this fourth preferred embodiment , the cylinders of the rollers may include varying diameters ( rather than uniform diameters as described ) such that a tapered opening is not necessarily provided and such that the conveyor drives each of the rollers when disposed in its respective lowermost position . nevertheless , because the height of the axes of rotation of at least the first couple of the rollers successively decreases , articles having a greater height still are accommodated generally as described . it will be apparent to the ordinary artisan that the relatively short side rails 130 , 230 , 330 , 430 shown in fig1 - 22 may represent merely an end section of a longer side rail . for example , fig2 illustrates a right side elevational view of a portion of a long side rail that includes an end portion similar to the side rail 130 of fig1 . it also will be clear that the slot and hole arrangements described and illustrated above may be used in side rails of any length . alternatively , larger side rails may be constructed from shorter ones . for example , fig2 is a right side elevational view of the side rail 130 of fig1 connected to the side rail 30 of fig6 . connection may be accomplished in any of a variety of ways , including but not limited to the connection plate 100 fastened to respective ends of the side rails 130 , 30 as shown in fig2 .	1
embodiments of the present disclosure may provide mosquito - repelling wearables that may be formed of repellent - treated mesh that is soft and breathable as it protects the wearer from insect bites . in embodiments of the present disclosure , the repellent technology used to treat the mesh may tightly bond a permethrin formulation into the actual fibers of the fabric during manufacturing , resulting in effectively , odorless insect protection . permethrin is a chemical that may be used as an insect repellent . it belongs to the family of synthetic chemicals called pyrethroids and functions as a neurotoxin , affecting neuron membranes by prolonging sodium channel activation , and it has been a u . s . environmental protection agency ( epa )- registered chemical for almost 40 years , with an excellent safety record . inclusion of the permethrin formulation into the fibers of the fabric may repel insects , including but not limited to , mosquitoes , ticks , ants , flies , chiggers , and midges ( no - see - ums ). while wearables according to embodiments of the present disclosure have been described as including the permethrin formulation bonded with the mesh , it should be appreciated that other repellent formulations may be utilized without departing from the present disclosure . the repelling nature of wearables according to embodiments of the present disclosure may last through approximately 25 launderings , which is the general expected lifetime of a garment . this life span is well beyond the life of most performance finishes commonly used in the technical - apparel industry . wearables according to embodiments of the present disclosure may be worn by adults and children alike . it should be appreciated that these wearables may be provided in a variety of colors , patterns , and styles , even including camouflage , according to embodiments of the present disclosure . in some embodiments of the present disclosure , these wearables may resemble mosquito netting but are formed of a three - dimensional mesh , similar to the top portion of running shoes ; this mesh may breathe but will reduce the likelihood that a mosquito will penetrate the spongy fabric when worn . in further embodiments of the present disclosure , these wearables are formed of a single - layer repellent - treated mesh , either in place of or in addition to the three - dimensional mesh . it should be appreciated that the three - dimensional mesh may or may not be repellent - treated in embodiments of the present disclosure . these wearables may be worn in warmer climates ; however , there may be embodiments of the present disclosure where heavier clothes may be worn underneath the wearable , such as when the climate is a little cooler but certain insects are still present . there may be further embodiments where more than one layer of repellent - treated mesh may be utilized , again when the climate is a little cooler . embodiments of the present disclosure may provide a wrap jacket ( see fig1 a - 1d ) that is treated with the permethrin repellent formulation , provided by insect shield ® in some instances . this type of jacket may be worn by women , including women that are pregnant and may be more susceptible to diseases such as the zika virus . the jacket may be constructed of repellent - treated mesh that is soft , lightweight , and / or breathable as it helps protect the wearer from insect bites . the repellent within the mesh is tightly bonded into the actual fibers of the fabric , thereby providing built - in protection from mosquitoes , ticks and other potentially dangerous biting insects . the mesh forming this wearable may be soft , breathable and may be stretchy / pliable in nature . the repellent may be effective for approximately 25 launderings . fig1 a - 1d depict different views of mosquito - repelling wrap jackets according to embodiments of the present disclosure . more specifically , fig1 a depicts a front view of a mosquito - repelling wrap jacket according to an embodiment of the present disclosure . in this embodiment , the wrap jacket is shown on a hanger ( i . e ., not being worn ), and this reflects the draping nature of the wrap jacket . while the wrap jacket may be sold in a variety of sizes , it should be appreciated that the draping nature of the wrap jacket may allow for people of differing sizes and shapes to wear it , including pregnant women , such as the wrap jacket depicted in the front view of fig1 b . it also should be appreciated that wrap jackets according to embodiments of the present disclosure may be provided in varying colors , patterns , and styles . fig1 b depicts front and back views of mosquito - repelling wrap jackets as worn according to an embodiment of the present disclosure . in this embodiment , belting mechanisms have been utilized to provide closure for the front of the wrap jacket , and the back view illustrates how the belting mechanism may wrap around the wearer . fig1 c depicts front and back views of a mosquito - repelling wrap jacket as worn according to an embodiment of the present disclosure . in this embodiment , the draping nature of the wrap jacket is visible from the back view . further , one of the front views depicts how the wrap jacket may be drawn over a wearer &# 39 ; s head in some embodiments of the present disclosure to provide additional protection for the wearer &# 39 ; s face , neck and head . however , there may be other embodiments wherein one may wear the wrap jacket and also utilize a scarf or head wrap formed of the repellent - treated mesh as described with respect to the wrap jacket . fig1 d depicts a front / side view of a mosquito - repelling wrap jacket as worn according to an embodiment of the present disclosure . in this embodiment , the wrap jacket has been belted to provide a more flattering silhouette for the wearer and make the wearer &# 39 ; s outfit more fashion - forward . in another embodiment of the present disclosure , a tracksuit ( fig2 a - 2c ) may be constructed of mesh ( i . e ., a single - layer repellent - treated mesh and / or a three - dimensional mesh , which may or may not be repellent - treated ) that is soft and breathable . such a tracksuit may be provided for adults and children alike . by wearing the tracksuit , a human may be protected from insect bites as the repellent within the mesh fabric is tightly bonded into the actual fibers of the fabric . this may provide built - in protection from mosquitoes , ticks and other potentially dangerous biting insects . like the net wrap jacket , a tracksuit according to embodiments of the present disclosure may be formed of soft and breathable stretch mesh having a repellent that is effective for approximately 25 launderings . fig2 a - 2c depict different views of mosquito - repelling tracksuits according to embodiments of the present disclosure . more specifically , these figures depict front and back views of children wearing tracksuits according to embodiments of the present disclosure . the trouser portion of the tracksuit may have a waistband , and the trousers may cover the lower torso and legs of the wearer , while the jacket portion may cover the upper torso and arms of the wearer in some embodiments of the present disclosure . as depicted , these tracksuits are suitable for girls as well as boys and may be provided in a variety of colors , patterns and styles . it also should be appreciated that tracksuits as well as other wearables according to embodiments of the present disclosure may include reflective patterns or other safety / design features . further , while the tracksuits of fig2 a - 2c are being worn by children , it should be appreciated that these tracksuits may also be formed in sizes / styles to be worn by men and women without departing from the present disclosure . in addition , tracksuits according to embodiments of the present disclosure may be provided in a variety of sizes ; however , there may be some embodiments of the present disclosure wherein tracksuits could be provided in a one - size - fits - most style . fig2 a - 2c depict the relatively see - through nature of tracksuits according to embodiments of the present disclosure ; accordingly , wearers generally wear the tracksuits in sizes that allow for their regular clothes to fit underneath the track suit when worn . fig2 a provides a front view of a tracksuit according to an embodiment of the present disclosure . in this embodiment , the fabric is formed in a gathered manner at various points of the track suit , particularly at the wrists , the waistband and the ankles of the wearer . this gathering may reduce the likelihood that a mosquito may reach the wearer &# 39 ; s skin through one of these more open areas of the tracksuit . the gathering may be a ribbed material in some embodiments of the present disclosure . the tracksuit also may include a collar that may have a fold on top but be seamed at the corner front in some embodiments of the present disclosure . this collar also may be formed of a ribbed material . fig2 a also depicts how the tracksuit according to an embodiment of the present disclosure may have a zippered front closure to allow for easy wearability ; the zipper may be attached to the track suit by way of fabric strips ; however , other methods of attachment may be used without departing from the present disclosure . it also should be appreciated that there may be other embodiments of the present disclosure where closure mechanisms other than a zipper may be utilized , for example , buttons or velcro . there may be further embodiments wherein the jacket portion of the track suit may be formed more like a pullover jacket in which case a closure mechanism may not be necessary . in addition , wearable may have reflective portions on one or more sections so that safety can be increase in low - light , hunting , or other similar situations . in a further embodiment of the present disclosure , a track jacket ( fig3 a - 3b ) may be provided . this track jacket may be constructed of a single - layer repellent - treated mesh that is soft and breathable as it helps protect the wearer from inspect bites . the repellent within the mesh may be tightly bonded into the actual fibers of the fabric . this may provide built - in protection that helps protect the wearer against mosquitoes , ticks and other potentially dangerous biting insects . like the other wearables previously described , the track jacket according to embodiments of the present disclosure may be formed of a soft and breathable stretch mesh having a repellent that is effective for approximately 25 launderings . fig3 b depicts how a track jacket according to an embodiment of the present disclosure may cover the upper torso of the wearer in the form of a jacket . while the wearer in fig3 b is depicted as a woman , it should be appreciated that jackets may be provided for men and children ( boys and girls ) as well without departing from the present disclosure . while not specifically depicted in fig2 a - 2c or fig3 a - 3b , it should be appreciated that a track suit or track jacket according to embodiments of the present disclosure may include a hood that connects to the track suit or jacket at a neck line . fig6 depicts a view of mosquito - repelling pants according to an embodiment of the present disclosure . like the pants described in fig2 a - 2c , a ribbed material may be utilized to form a waistband ; however , the pants in fig6 also depict a drawstring closure . further , the pants in fig6 also include drawstring closures at the ankle portions of the pants along with ribbed material . while drawstring closures are depicted in fig6 , it should be appreciated that these closures may not be utilized in all embodiments of the present disclosure . fig7 a depicts a view of a mosquito - repelling infant bunting according to an embodiment of the present disclosure . a hood may be provided as depicted in fig7 a . the bunting also may include a zipper to open and close the bunting , and the bunting also may include a front face that covers the zipper for cleaner finishing on the bunting . the arm portions of the bunting may include back pocket folds over the front to cover the infant &# 39 ; s fingers in some embodiments of the present disclosure . the bunting as depicted in fig7 a may provide a completely closed bottom , such as when the bunting may be employed for a sleeping infant ; however , it should be appreciated that there may be embodiments of the present disclosure where the bunting may not be completely closed and / or may not be used for a sleeping infant . fig7 b depicts a view of a mosquito - repelling infant bunting being worn by an infant according to an embodiment of the present disclosure . fig8 a and 8b depict mosquito - repelling cover - ups according to an embodiment of the present disclosure . more specifically , fig8 a depicts a front view of a cover - up including a hood where there is an overlapping edge between the hood and the body portion of the cover - up to improve skin coverage when worn . fig8 b depicts a cover - up that includes a hood , and this cover - up also includes a neck portion formed of a ribbed material . in some embodiments of the present disclosure , the neck portion may include a slit for the neck opening and / or a serge neckline seam . it should be appreciated that a cover - up may include openings for the arms to be received but otherwise may be closed at the sides . fig9 a depicts a front view of a mosquito - repelling poncho according to an embodiment of the present disclosure , and fig9 b depicts a back view of a mosquito - repelling poncho according to an embodiment of the present disclosure . as depicted herein , a poncho may include a hood that may be placed on the outside of the collar portion . a poncho may differ from the cover - ups depicted in fig8 a and 8b at least insofar as the poncho is open at the sides ( i . e ., does not contain armholes ). the neck portion of the poncho as depicted in fig9 a and 9b may include a ribbed material , and it also may include a button , elastic cord loop or another fastening mechanism around the neck portion to secure the poncho in place in some embodiments of the present disclosure . as depicted in fig9 b , the hood is outside the collar portion at the back of the wearer &# 39 ; s neck and may be gathered as described in other embodiments of the present disclosure . fig1 depicts a front view of a mosquito - repelling caftan cover - up according to an embodiment of the present disclosure . the caftan cover - up of fig1 is similar to the cover - ups and / or ponchos previously described in that it may include ribbed material around the neck portion ; however , it does not include a hood portion . fig4 depicts a mosquito - repelling mesh according to an embodiment of the present disclosure , and fig5 depicts a close - up view of a mosquito - repelling fabric forming the track jackets of fig3 a and 3b . while embodiments of the present disclosure have been described as having repellent within the mesh fabric tightly bonded into the actual fibers of the fabric , it should be appreciated that the repellent also may be woven into the fabric or may be sprayed onto or otherwise applied to the fabric without departing from the present disclosure . in addition , the mosquito - repelling fabric , in one embodiment , can be three - dimensional fabric / mesh , such as depicted in fig2 b and 2c . this three - dimensional mesh may or may not be repellent - treated in embodiments of the present disclosure . the type of fabric used to form wearables according to embodiments of the present disclosure may depend on the type of wearable . for example , a tracksuit may be formed from a combination of sheer stretch or spandex mesh ( approximately 82 % nylon and approximately 18 % spandex ) and milliskin tricot ( approximately 80 % nylon and approximately 20 % spandex ) while a wrap jacket may be formed of just the sheer stretch or spandex mesh ( i . e ., no milliskin tricot ). there also may be embodiments of the present disclosure where a three - dimensional mesh may be used in addition to or in place of the sheer stretch or spandex mesh and / or milliskin tricot . this three - dimensional mesh may or may not be repellent - treated in embodiments of the present disclosure . however , it should be appreciated that other similar materials may be utilized without departing from the present disclosure . the fabric forming wearables according to embodiments of the present disclosure may have a spongy or springiness that may resist compression and reduction in thickness of the fabric when in use ; this may lessen the likelihood that the insect stinger penetrates the wearer &# 39 ; s skin . the fabric also may provide for sufficient ventilation such that the resultant wearable is not too hot to wear when the weather is warm or when the wearer is engaging in physical activity . regardless the composition of the fabric , the fabric , particularly with respect to a three - dimensional mesh , should be formed of sufficient thickness to prevent an insect stinger bite from penetrating the skin of the wearer . this thickness may be approximately ⅛ inches thick ; however , the fabric may be thicker or thinner without departing from the present disclosure . further , the mesh pattern should be formed in such a way that the distance between the wearer &# 39 ; s skin and the insect stinger is as large as possible . also , because of the tightly woven nature of the fabric , the stinger is less likely to penetrate the fabric due to the lack of passageways through the fabric ; this is where the 3 - d nature of the fabric also may be helpful . thus , wearables according to embodiments of the present disclosure may place the repellent near the wearer &# 39 ; s skin instead of being applied to the skin itself . the repellent nature is long - lasting and does not have to be reapplied to the fabric . in addition , the wearables may also include sensors , gps sensors , bluetooth sensors , wi - fi sensors , watches , heart rate monitor , humidity sensor , phone , touchscreen , display , graphical user interface , voice recognition interface , temperature sensor , watch , blood sugar monitor , panic button , camera , drone interface , lte / wi - fi / bluetooth communication processors / sensors , used either alone or in combination with one another , to better improve the use of the wearable . while the embodiments described herein have focused on wearables for humans , there also may be embodiments of the present disclosure wherein pets , such as dogs and cats , may be provided with wearables that may reduce the risk of mosquito bites . for example , a jacket or vest may be provided that may be formed of repellent - treated mesh that a dog may wear when he / she is being walked outside . although the present disclosure and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the disclosure as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present disclosure . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps .	0
referring to fig1 and 2 , there is shown a rotary sliding vane device or pump 10 comprising a casing 11 and a cartridge or subassembly 12 . casing 11 comprises a body 11b and a cover 11a . the cartridge 12 includes a cam ring 13 sandwiched between support plates 14 , 15 with intermediate cheek plates 16 , 17 , all of which are secured to each other by bolts 18 extending through support plate 14 and cam 13 into threaded holes in support plate 15 . the cover 11a is provided with an inlet supply connection port 19 leading into a pair of fluid port inlet openings 20 in cam 13 , as shown in fig2 and passages 23 formed in the support plates 14 and 15 as shown in fig1 and recesses 24 , in the cheek plates 16 and 17 as shown in fig1 and 2 . an outlet connection port 22 is provided in the body 11b which is directly connected by a passage 22a to a pressure delivery chamber formed in support plate 15 and passages 48 in the cheek plates 16 and 17 . a rotor 25 is rotatably mounted within the cam 13 on the splined portion 26 of a shaft 27 which is rotatably mounted within a bearing 28 in the support plate 14 and a ball bearing 29 mounted with the body 11b . cam 13 has an internal contour 30 which is substantially oval in shape and which together with the periphery of the rotor 25 and the adjoining surfaces of the cheek plates 16 , 17 define two opposed pumping chambers 31 , 32 , each of which traverse the fluid inlet , fluid transition , and fluid outlet zones . the fluid inlet zones comprise those portions of the pumping chambers or spaces 31 , 32 , respectively , registering with the fluid inlet port openings 20 and cheek plate passages 24 . the fluid delivery zones comprise those portions of the pumping chambers 31 , 32 registering , respectively , with opposed arcuately shaped fluid delivery port openings 48 in cheek plates 16 , 17 which are directly connected to the outlet connection port 22 . fluid flows to the inlet zones through inlet port openings 20 and also through the passages 23 formed in the support plates 14 , 15 and recesses 24 in the cheek plates 16 , 17 which permit the fluid to flow from the inlet 19 between the sides of cam 13 . the pumping device so far described is of the well known structure disclosed in the u . s . pat . no . 2 , 967 , 488 . it has been the practice in devices of this type to provide the rotor with a plurality of radial vane slots 35 , each of which has a vane 36 slidably mounted therein . the outer end or vane tip of vanes 36 engage the inner contour of cam 13 . the contour of cam 13 includes an inlet rise portion , an intermediate arcuate portion , an outlet fall portion , and another intermediate arcuate portion . the cam contour is symmetrical about its minor axis , thus each of the rise , fall and arcuate portions are duplicated in the other opposed portion of the contour . as the tips of vanes 36 carried by the rotor 25 and the vane tips traverse the outlet fall portions , the vanes 36 move radially inward . the spacing between each pair of vanes 36 is adapted to span the distance between each pair of ports in a manner to provide proper sealing between the inlet and outlet chambers of the pumping device . each vane 36 has a rectangular notch 37 extending from the inner end or base of the vane to substantially the mid - section thereof . a reaction member 38 comprises a flat sided blade substantially equal in width and thickness to that of the notch 37 in the vane so as to have a sliding fit within the vane and the side walls of each rotor vane slot 35 . the side walls of the rotor vane slot 35 , the vane 36 and the reaction member 38 define an expansible intra - vane chamber 39 . an undervane pressure chamber 40 is defined by the base of each vane 36 and the base and side walls of each rotor vane slot 35 . chambers 39 and 40 are separated by and sealed from each other by reaction member 38 . thus , the two chambers 39 , 40 are provided substantially the same as shown in u . s . pat . no . 2 , 967 , 488 which is incorporated herein by reference . referring to fig1 and 2 , the undervane chamber 40 associated with the base of each vane 36 is provided with fluid pressure by radial passage 41 in rotor 25 . the radial passages 41 transmit fluid to the undervane chambers 40 and , thus , to the bases of the vanes 36 . thus , the cyclically changing pressure which is exerted on the tips of the vanes 36 as they traverse the inlet and outlet portions of the cam contour is transmitted to the bases of the vanes 36 . fluid under pressure is supplied to the chamber 39 by transverse slots 42 in rotor 25 which communicate with arcuate grooves 44 in each face of each cheek plate 16 , 17 . each groove 44 extends about a portion of the travel of rotor 25 . grooves 43 are provided in the displacement zones in concentric relation with the grooves 44 for registry with the slots 42 . a pressure balancing pad 45 is provided on the opposite face of the cheek plate and is circumscribed by a seal . an opening 46 extends through the plate and communicates each groove 43 with the pressure pad 45 . two openings 47 extend through the plate and provide communication between groove 44 and pressure pad 45 . as the axial slots 42 move across the arcuate grooves 43 the displaced fluid at the intra - vane chamber 39 is transmitted to and is exhausted through the restricted opening 46 and into the cavity of the pressure balancing pad 45 . the resulting increased fluid pressure is transmitted to the intra - vane chambers 39 and acts to hold the reaction members 38 against the base of the undervane chamber 40 and also holds the vane on the cam 13 . as shown in fig1 each vane moves successively through the fluid inlet zone , the fluid precompression zone , the fluid discharge zone , and the fluid decompression zone . groove 44 associated with the intra - vane chambers 39 provides communication between adjacent intra - vane chambers as the vane moves through a portion of the decompression zone , the inlet zone , and a portion of the precompression zone . groove 43 associated with the intra - vane chambers 39 provides communication between adjacent intra - vane chambers as the vanes thereafter move through a portion of the precompression zone and the discharge zone . groove 33 associated with the undervane chambers 40 provides communication between adjacent undervane chambers as the vanes move through the inlet zone . groove 50 provides communication between the undervane chambers 40 as the vanes move through the discharge zone . during the pumping the cycles , the internal pressure distribution between the rotating group and the cheek plates is equalized or slightly exceeded by the hydrostatic pressure force of the balancing pads 45 . this feature is described in u . s pat . no . 3 , 752 , 609 . on the inlet rise portions of the cycle , the passages 41 function to maintain pressure at the inlet pressure . on the outlet fall portion of the cycle , passages 41 function to increase the undervane pressure and retard the radially inward movement of the vanes to maintain the vanes in contact with the cam 13 . on the minor dwell portion of the cycle between the outlet and inlet zones , the passages 41 function to decompress the volume not displaced . during the inlet to pressure transition , passage 41 in combination with the axial slot 42 encase the vane with a pressurized fluid film to ease the vane movement and to prevent the loaded rotor segment from pinching the vane in the rotor slot . although the invention has been described as used in a pump , it can also be used in a motor of the sliding vane type . in accordance with the invention , the vanes 36 which have an end configuration such as shown in fig4 are reversed in the slots 35 from the normal position in the prior art so that the radially outermost top portion t trails with respect to the direction of rotation . in addition , the pressure sensing passages 41 in the rotor 25 are positioned in advance of the respective vanes 36 with the respect to the direction of rotation so that they sense the pressure ahead of the vanes 36 and provide the fluid at that pressure to the appropriate chamber associated with the respective vane . the leading passages 41 also provide the path for exhausting the undervane displacement to ensure hydrostatic pressure bias on the vanes . this biased pressure is distributed in groove 50 to provide the added radial hydrostatic support for the vane in the displacement zone . it has been found that the resultant construction will permit operation at a higher pressure without significantly enlarging the radial size of the rotor . in addition , the operation will be without excessive noise , reduce the tendency of the vanes to wear in the rotor slots , will provide less sensitivity to radial unbalance as a result of vane tip wear and will provide more positive vane tracking of the cam contour . fig5 a and 5b are diagrammatic views of the prior art and the present device , respectively . in the prior art , the stress at the base of the slots 35 produces a tensile stress whereas the stress at the corresponding portion of the rotor 25 of the present device produces a compressed stress at the inner ends of the radial passages 41 which intersect the vane slots 35 . it has been found that on repeated cycle testing the fatigue strength of the rotor substantially improved in pumps embodying the invention . referring to fig6 a and 6b , which are diagrammatic views of the prior art and the present device , it has been found that since the undervane chambers 40 sense pressure ahead of the vanes 36 , the vane slots 35 become completely pressurized more quickly during the inlet to discharge transition , as compared with the prior design . as a result there is less coulomb friction and wear during the beginning of the inward displacement cycle as represented by the pressure distribution arrows . referring to fig7 a and 7b , which are diagrammatic views of the prior art and the present device , in the present device the discharge pressure is sensed ahead of the vane 36 and communicated beneath the vane 36 . in addition to centrifugal force , the radial outward force on the vane 36 is a product of the discharge pressure acting on the undervane area ; also included is the force of the system pressure acting on the intra - vane area . the total inward radial force on the vane &# 34 ; in the transition zone &# 34 ; ( inlet to discharge ) is the product of the discharge pressure on the vane tip area . the amount of the exposed vane tip area is determined by the location of the line contact of the vane tip tracking the cam contour . as the vane tip wears , the line contact shifts and reduces the amount of the area exposed to the internal discharge pressure and the net outward force becomes proportionately larger . in the prior art intra - vane pump designs the vane tip wear , with consequent shifting of the line contact on the cam contour , causes a reduction in the net outward force upon the vane . when the exposed area of the vane tip exceeds that of the intra - vane , vane instability can be expected . referring to fig8 a and 8b , which are diagrammatic views of the prior art and the present designs , it can be seen that in the prior art designs as shown in fig8 a the undervane volume is displaced into the trailing common chambers between the extended vane as shown in fig8 a . the pressure p 1 in the undervane chambers entering the discharge zone is momentarily lower than discharge pressure p because of the inherent pressurizing delay caused by the pressure sensing passages 41 completing the inlet to discharge transition . also the discharge pressure p includes the added potential energy due to the discharge flow changing direction from tangential flow to axial flow ; this added pressure becomes more pronounced with increased shaft speeds . if the discharge pressure p is greater than p 1 , there will be a tendency for the vane entering the discharge zone to become unstable . in the present design fig8 b , the undervane displacement is directed into the leading passages 41 which communicate directly into the pump discharge chamber . since the undervane displacement originates at the vane , the pressure p 1 has to be greater than the pressure p in the discharge chamber . the resulting net force bias will maintain the vane on the cam contour . in the prior design fig8 a , the discharge flow from the intra - vane chamber was restricted in the attempt to stabilize the vane in the discharge quadrant . this feature was limited because this displaced volume was relatively small and its discharge pressure was difficult to control ( increase ) because of the inherent leakage paths of the axial clearances between the cheek plates and the rotating group . in order to optimize the functioning of the passages 41 which lead the vanes 36 , undervane arcuate discharge grooves 50 are provided in each cheek plate ( fig3 ). these grooves 50 function to communicate the increased undervane pressures to the vanes 36 in the discharge zone and the vanes entering the pressure inlet transition zone , thereby assuring continuous vane contact on the cam contour 13 . in addition , a decompression groove 52 of uniform cross section is extended from the undervane filling openings 33 . the grooves 52 are positioned such that the passages 41 are exposed to the grooves 52 and the spaces 31 and 32 thereby provide early decompression of the scavenged volume between the vanes and in the passages 41 and also provide early filling of undervane chambers . this may be contrasted to the prior art cheek plate as shown in fig9 wherein the opening 33a provides a shorter period for filling the undervane chamber . each cheek plate is also provided with a pressure metering groove 48b associated with filling openings 48 to control the rate at which the volume is brought up to pressure during the discharge transition period . during the displacement cycle , a period of mechanical precompression is applied to the intervane volume about to be displaced . the principal purpose is to reduce the outgassing of the throttled flow admitted by the metering groove 48b . the mechanical precompression is controlled by delaying the combined openings of the metering groove 48b and port 48 . the leading porting passages 41 permit this precompression because the anticipated pressure delay between the vane tip and the undervane occur at the trailing vane and not at the leading vane which provides the seal between inlet and discharge . ( fig1 ) with the prior art vane pump design ( passages 41 trailing the vanes ) the anticipated momentary pressure ( created by the mechanical precompression ) unbalance would occur at the leading vane which provides the critical sealing between the inlet and discharge . although the grooves and pockets have been shown in cheek plates , they can be provided in fixed portions of the housing if flexible cheek plates are not used . in addition , the cheek plate embodying the invention includes erosion control pockets 53 in the area near the inlet in order to permit dissipation of the formation of bubbles in a pressure - inlet transition and accordingly prevent erosion damage to the critical surface of the cheek plates ( fig3 ). this may be contrasted to the prior art plate wherein the erosion pockets 53a are nearer the discharge than the inlet ( fig9 ). although the invention has been described in connection with pressure energy translating devices that have the intervane chamber provided as shown in fig1 the invention is also applicable to other types of vane type pressure energy translating devices such as shown in the aforementioned patents wherein there are two chambers associated with the vane . thus , as shown in fig1 and 11 , the pressure energy translating device 70 includes vanes 71 positioned so that the tip 71a trails the direction of rotation . pins 72 engage the base of the vanes and pockets 73 are provided to urge the pins radially outwardly . a passage 74 is defined by grooves 75 in the rotor and leads the respective vanes 71 in the direction of rotation . this such pressure energy translating device is shown in u . s . pat . no . 4 , 629 , 406 and is of the general type shown in fig1 and 13 wherein identical parts have the same reference numbers with the suffix &# 34 ; a &# 34 ;. as shown in fig1 and 13 , the passages 74a trail the vanes 71a and the tips ta lead the vane . as shown in fig1 in the prior art , the maximum of area pressure defined by the surface s of the vane slot is interrupted by the passage 72a . this may be contrasted to fig1 wherein in the pressure energy translating device embodying the invention the surface s is continuous without interruption , thereby providing a greater load bearing area in addition to the other advantages in the present invention . in the modified form shown in fig1 , the vanes 80 have portions 81 at their ends cut away to define radial passages which lead with respect to the direction of movement of the vanes 81 and the tips formed in the manner as shown in fig2 . in this form , the vanes are formed with intra - vane chambers 82 that communicate with one another through a circumferential passage 83 that in turn communicates with the periphery of the rotor which communicates through passage 84 with the periphery of the rotor 85 . the undervane chambers 86 communicate with the groove 87 in the cheek . this form is otherwise similar to that disclosed in the u . s . pat . no . 4 , 431 , 389 which is incorporated herein by reference . in the form of the invention shown in fig1 the leading passages are in the form of grooves 90 in the vanes 91 . each vane is formed with an intra - vane chamber 92 and an undervane chamber 93 which communicate with passages 94 and 95 as in the form shown in fig1 ; otherwise this form is identical to that shown in u . s . pat . no . 4 , 505 , 654 which is incorporated herein by reference . in both of the forms shown in fig1 and 15 the position of the vanes is reversed with respect to the direction of rotation so that the apex of the vane is in a trailing direction with respect to the direction of rotation . in this form of the invention shown in fig1 and 15 the trailing interrupted surface between the vane and rotor slot provides a superior load bearing support .	5
the disclosure , including the accompanying drawings , is illustrated by way of example and not by way of limitation . it should be noted that references to “ an ” or “ one ” embodiment in this disclosure are not necessarily to the same embodiment , and such references mean at least one . referring to fig1 , an exemplary embodiment of a tweezers includes a main body with two resilient levers 10 , and two pincers 20 . first ends of the levers 10 are connected together , with an angle defined between the levers 10 to make second ends of the levers 10 opposite to the first ends spaced from each other . a slot 11 is defined in the second end of each lever 10 . a resilient tab 12 extends toward the first end of each lever 10 from a side bounding each slot 11 adjacent to the second end of the corresponding lever 10 . in this embodiment , a hollow and substantially rectangular shaped connection portion 21 extends from a first end of each pincer 20 , and defines a receiving space 22 with an opening 25 of the receiving space 22 opposite to a second end of the corresponding pincer 20 . a slot 24 is defined in a side of each connection portion 21 , communicating with the corresponding receiving space 22 . referring to fig2 , in assembly , the second ends of the levers 10 enter the receiving spaces 22 through the openings 25 of the corresponding connection portions 21 . the resilient tabs 12 engage in the corresponding slots 24 , to fix the pincers 20 to the corresponding levers 10 . in disengagement of the pincers 20 from the corresponding levers 10 , the resilient tabs 12 are pressed toward the corresponding receiving spaces 22 to withdraw in the receiving spaces 22 , thereby readily disengaging from the corresponding receiving spaces 22 . thereby , the pincers 20 can be removed from the corresponding levers 10 easily . referring to fig3 , in other embodiments , the tabs 12 and the slots 21 can be omitted , and the levers 10 may be engaged in two receiving spaces 22 of two pincers 30 tightly and directly . moreover , distal ends of the corresponding pincers 20 opposite to the corresponding connection portions 21 can be any shaped , such as cuspate , or hamulus - shaped . it is believed that the present embodiments and their advantages will be understood from the foregoing description , and they will be apparent that various changes may be made thereto without departing from the spirit and scope of the description or sacrificing all of their material advantages , the examples hereinbefore described merely being exemplary embodiment .	1
while useful , the random surfer model for page ranking ignores the reality that not all web pages are equal . that is , some web pages are clearly more popular than others . hence , links associated with such pages are more likely to be traversed by actual web surfers and , accordingly , should be accorded more weight than links which are unlikely to be selected by web surfers . accordingly , the present inventor has developed a new procedure for ranking web pages which takes into account the actions of an actual web surfer . the process and system implementing same are described below . in the definition of pagerank , the coefficient 1 / l ( pg j ), which is multiplied by pr ( pg j ) in computing the rank value of a particular page , can be viewed as the probability that a random surfer will select ( e . g ., click on ) a particular link on page pg j . the same value , 1 / l ( pg j ), is used in computing pagerank values for all pages to which page pg j points . because the same value is used for outgoing links to pages , the random surfer model of pagerank assumes that all outgoing links have equal probability of being followed . in other words , a random surfer will click on a link on a particular page with equal probability . the present invention , however , recognizes that the probabilities of following links on a particular page pg j do not have to be equal . accordingly , in computing rank values , we replace the single coefficient 1 / l ( pg j ), which is constant for pg j , with a set of probabilities p ij . probability p ij is the probability that a surfer will click the link to the page p i on the page p j . thus , in accordance with the present invention , the rank a web page is computed as follows : pr ⁡ ( pg i ) = 1 - d n + d ⁢ ∑ j ⁢ ⁢ pr ⁡ ( pg j ) ⁢ p ij . the set of probabilities p ij for a given page , pg j , represent a discrete probability distribution satisfying the following constraints : in order to determine probabilities p ij , we keep track of actual web surfer behavior by monitoring user selection of links on a page and counting same . this is done , in one embodiment of the invention , using a browser extension or other application installed on an individual user &# 39 ; s computer system . when a user loads a web page in the browser , the identity of the page is recorded ( e . g ., using the uniform resource locator ( url ) of the page , or some other identifier ) and when a user selects a link on the page a counter associated with that link is incremented . in one embodiment of the invention , the counter is implemented in a distributed network organized as a distributed hash table . in other instances , the counters can be stored in a centralized system of computers connected through a local network or a hybrid combination of distributed and centralized systems . for every page pg j then , there is a set of counters , one each for each link on that page . every time an user selects a link to page pg i on page pg j , the corresponding counter is incremented . now , if we let v ij be the value for the counter for the link to page pg i on page pg j , and v j be the sum of all v ij on page pg j , i . e ., the sum of all selections of all links on page pg j : note that p ij forms a discrete probability distribution by definition : ∑ i ⁢ ⁢ p ij = ∑ i ⁢ ⁢ v ij ⁢ iv j = 1 as noted , the probabilities p ij are intended to measure actual probabilities of users following links on pages , as determined by actual link selections from a set of users , instead of assuming an uniform probability . in one embodiment of the present invention , the links selections are counted by a computer - implemented process running on a user &# 39 ; s computer system . an example of such a computer system is shown in fig1 . computer system 100 , upon which the link selection monitoring software may be installed , includes a bus 102 or other communication mechanism for communicating information , and a processor 104 coupled with the bus 102 for processing information . computer system 100 also includes a main memory 106 , such as a ram or other dynamic storage device , coupled to the bus 102 for storing information and instructions ( such as instructions comprising the link selection monitoring software when the program is running ) to be executed by processor 104 . main memory 106 also may be used for storing temporary variables or other intermediate information during execution of instructions to be executed by processor 104 . computer system 100 further includes a rom 108 or other static storage device coupled to the bus 102 for storing static information and instructions for the processor 104 . a storage device 110 , such as a hard disk , is provided and coupled to the bus 102 for storing information and instructions ( such as instructions comprising the link selection monitoring software ). computer system 100 may be coupled via the bus 102 to a display 112 for displaying information to a computer user . an input device 114 , including alphanumeric and other keys , is coupled to the bus 102 for communicating information and command selections to the processor 104 . another type of user input device is cursor control device 116 , such as a mouse , a trackball , or cursor direction keys for communicating direction information and command selections to processor 304 and for controlling cursor movement on the display 112 . computer system 100 also includes a communication interface 118 coupled to the bus 102 . communication interface 108 provides for two - way , wired and / or wireless data communication to / from computer system 100 , for example , via a local area network ( lan ). communication interface 118 sends and receives electrical , electromagnetic or optical signals which carry digital data streams representing various types of information . for example , two or more computer systems 100 may be networked together in a conventional manner with each using a respective communication interface 118 . network link 120 typically provides data communication through one or more networks to other data devices . for example , network link 120 may provide a connection through lan 122 to a host computer 124 or to data equipment operated by an internet service provider ( isp ) 126 . isp 126 in turn provides data communication services through the internet 128 , which , in turn , may provide connectivity to multiple remote computer systems 130 a - 130 n ( any or all of which may be similar to computer system 100 . lan 122 and internet 128 both use electrical , electromagnetic or optical signals which carry digital data streams . computer system 100 can send messages and receive data through the network ( s ), network link 120 and communication interface 118 . fig2 illustrates the same computer system 100 , this time from an architectural standpoint . in this simplified representation , the computer system includes a hardware layer 202 , which is abstracted by an operating system 204 . any conventional operating system may be used . the operating system may be stored in storage device 110 and read into memory 106 when executing . running on top of the operating system are the programs which make up the application layer 206 , including a web browser 208 . as shown , the link monitoring software can be implemented in form of a browser extension or plug - in 210 , or in other cases may be a separate program in application layer 206 . browser plug - ins and extensions are computer implemented processes integrated into a browser environment and which are capable of performing miscellaneous actions in response to user actions within the browser . fig3 illustrates a process 300 that highlights the operations of the link selection monitoring software . every time an user clicks on a link within a browser ( 302 ), an http request is initiated by the browser ( 304 ). the request includes the url of the page which is being requested ( the requested page ), i . e ., the url of the link on which the user clicked . in addition , it includes the url of the page which the user was looking at ( the requesting page ) and on which the requested link exists . the url of the requesting page is specified in the “ referer ” field of the http request initiated by the browser . in other words , a request for the link to page pg i on page pg j will have the http referer field of the header set to the url of page pg j and the requested url will be the url of page pg i . in accordance with the present invention , such a request causes an increase in the count of selections for the link to page pg i on page pg j ( 308 ). this process repeats for each link selection from each page being browsed by the user ( 310 ). that is , the browser extension software on the user &# 39 ; s computer system observes the user &# 39 ; s link selections and initiates actions for updates of counts of such selections on the referer pages . preferably , and in accordance with an embodiment of the present invention , the counters of link selections v ij are distributed in a peer - to - peer network , comprising a distributed file system . such a system 400 , is illustrated in fig4 . each computer 402 a - 402 n is communicatively coupled via one or more networks 404 ( such as the internet ) and can be responsible for handling counters for a set of pages . the name space of urls for all pages is divided among computers 402 a - 402 n using a distributed hash table ( dht ) and each respective counter for a given url is stored at a location determined by the dht . in other instances , the counters of link selections can be stored in a centralized system of computers connected through a local network or a hybrid combination of distributed and centralized systems . for example , the counts of the link selections may be stored at locations determined by arrangement of nodes in a network with a logarithmic network diameter where the time to find any node in the network is a logarithmic function of a size of the network . a hash table is a function that uniformly and , often uniquely , maps strings to a range of numbers . the number to which a hash function maps a given string is called the key for that string . a dht then is a means for partitioning the space of all possible keys among a set of computers connected through a network . one or more of the computer systems 402 a - 402 n may be configured with the link selection monitoring software and each may be configured to perform the data storage and synchronization processes associated with the dht - based distributed file system ( dhtfs ), for example through the use of appropriately coded computer - readable instructions stored on computer - readable media and executed by computer processors associated with each computer system . the dhtfs stores content across the address space defined by the storage devices of computer systems 402 a - 402 n using the dht keys as partitions for that address space . in practice , the number of individual computer systems that make up distributed system 400 may be very large . in accordance with the present invention then , the file system used by distributed system 400 relies on the mappings provided by a dht to partition the storage of content items within the distributed system so that content items ( the count values for the link selections observed by the link selection monitoring software ) are stored at individual ones of computer systems 402 a - 402 n , but are accessible to all such computer systems . the storage and retrieval of content items are facilitated through two principal kinds of messages : the dht put message is used for storing an arbitrary sequence of bytes value under the key key . the dht get message returns the last value stored in the dht under a given key . thus , each increase in count for a counter v ij can be encoded as a dht put request to the hash corresponding to the url of page p j . for instance , such a dht put could be encoded as the second argument encodes a message to increment the counter for pg i . this increment request is automatically routed by the dht to the computer responsible for handling counters for page pg j . creation of replicas of the stored data and synchronization among them is handled by the underlying distributed file system as more fully discussed in a co - pending u . s . patent application entitled , “ dht - based distributed file system for simultaneous use by millions of frequently disconnected , world - wide users ”, ser . no . 12 / 608 , 932 , filed on even date herewith , assigned to the assignee of the present invention and incorporated herein by reference in its entirety . in one embodiment of the invention , the computers in the distributed network compute rank values of all pages by performing a distributed computation and communicating values of probabilities p ij as well as values for intermediate computations . in another embodiment , the individual computers monitoring http requests send information about the observed link selections to a common server , a collection of servers connected through a local network , or a hybrid system consisting of a combination of distributed and centralized systems . the server , or servers , use information received from the individual computers to compute probabilities p ij and compute the rank values as described above . in response to a search request , the rank of each page associated with a result for the request can be read ( e . g ., using a get operation ) and the urls for such pages listed in an order determined by such ranks . such organization may be accomplished at each browser , or at a central server or servers before the results are passed to an individual computer system &# 39 ; s browser . as should be apparent from the foregoing discussion , various embodiments of the present invention may be implemented with the aid of computer - implemented processes or methods ( i . e ., computer programs or routines ) or on any programmable or dedicated hardware implementing digital logic . such processes may be rendered in any computer language including , without limitation , a object oriented programming language , assembly language , markup languages , and the like , as well as object - oriented environments such as the common object request broker architecture ( corba ), java ™ and the like , or on any programmable logic hardware like cpld , fpga and the like . it should also be appreciated that the portions of this detailed description that are presented in terms of computer - implemented processes and symbolic representations of operations on data within a computer memory are in fact the preferred means used by those skilled in the computer science arts to most effectively convey the substance of their work to others skilled in the art . in all instances , the processes performed by the computer system are those requiring physical manipulations of physical quantities . the computer - implemented processes are usually , though not necessarily , embodied the form of electrical or magnetic information ( e . g ., bits ) that is stored ( e . g ., on computer - readable storage media ), transferred ( e . g ., via wired or wireless communication links ), combined , compared and otherwise manipulated . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , keys , numbers or the like . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise , it should be appreciated that the use of terms such as processing , computing , calculating , determining , displaying or the like , refer to the action and processes of a computer system , or similar electronic computing device , that manipulates and transforms data represented as physical ( electronic ) quantities within the computer system &# 39 ; s registers , memories and other storage media into other data similarly represented as physical quantities within the computer system memories , registers or other storage media . embodiments of the present invention can be implemented with apparatus to perform the operations described herein . such apparatus may be specially constructed for the required purposes , or may be appropriately programmed , or selectively activated or reconfigured by a computer - readable instructions stored in or on computer - readable storage media ( such as , but not limited to , any type of disk including floppy disks , optical disks , hard disks , cd - roms , and magnetic - optical disks , or read - only memories ( roms ), random access memories ( rams ), erasable roms ( eproms ), electrically erasable roms ( eeproms ), magnetic or optical cards , or any type of media suitable for storing computer - readable instructions ) to perform the operations . of course , the processes presented herein are not restricted to implementation through computer - readable instructions and can be implemented in appropriate circuitry , such as that instantiated in an application specific integrated circuit ( asic ), a programmed field programmable gate array ( fpga ), or the like . thus , methods and systems for determining user - driven page rankings of web pages have been described . although discussed with reference to certain examples , the present invention should not be limited thereby . instead , the invention should be measured only in terms of the claims , which follow .	6
fig1 shows a stand consisting of five vertical square tubes 1 - 5 , which are welded together by twelve iron rails . in this way , a parallelopiped - like skeleton or frame is formed . the lower ends of the four corner posts 2 - 5 are welded together with four iron rails 6 - 9 . in this way , the rectangular basal area of the stand according to fig1 is formed . two iron rails with u - shaped profiles , 6 and 8 , are welded together with two further iron rails 10 and 11 . these two iron rails 10 and 11 are affixed to iron rails 6 and 8 in such a way that the space between these two iron rails 10 and 11 is exactly in the middle of the basal area . this space between the two iron rails 10 and 11 is determined by square tube 1 , which is fixed in the center of the basal area of the stand . at the upper ends of the four corner posts 2 - 5 four iron rails with u - shaped profiles , 12 - 15 , are also attached . these form the upper surface of the parallelopiped - shaped skeleton frame . two iron rails , 12 and 14 , which are above iron rails 6 and 8 , are also connected by two iron rails 16 and 17 , which are above iron rails 10 and 11 . in the space between iron rails 16 and 17 is the upper end of square tube 1 , which is welded to iron rails 16 and 17 . this vertically standing square tube 1 accordingly forms an opening into which tubes with a smaller cross - section can be inserted from above . these tubes are then secured against collapse , as the basal area of the stand forms a safe base for the inserted tube . any sign or signholder can then be affixed to the inserted tube . it is therefore possible to set up a stand according to the invention at any point and to set up a sign at this point simply by inserting a tube in square tube 1 , whereby the tube is affixed to the sign . fig2 shows a square tube 18 , which is closed or terminated on one side by means of an iron plate 19 , which projects along the edges . this square tube 18 has a smaller cross - section than the square tubes 2 - 5 , shown in fig1 which serves as corner posts of the stand . hence , it is possible to insert from below square tubes with welded iron plates , as shown in fig2 into the square tubes 2 - 5 , as shown in fig1 . to one side of each corner post iron plates 20 and 21 have been welded , and the iron plate for each corner post contains at least one threaded hole 22 . if a foot , as shown in fig2 is inserted from below into the corner post 4 , then the square tube 18 in corner post 4 can be held securely at any point or place along its side by means of a screw inserted in threaded hole 22 through iron plate 20 and corner post 4 . it is possible in this way to alter at will the length of the part of the square tube 18 projecting downwardly from corner post 4 . if one carries out this procedure on all four corner posts of the stand , then a foot with the desirable length projects from the lower end of each of the corner posts . in this way , the basal area of the stand shown in fig1 can be adapted at will to the ground beneath the stand . thus , it is possible to set up the stand even when the ground is slanting or uneven . pointed or rounded pins or pegs 43 can be welded to the iron plates 19 ; these pins or pegs 43 enable the foot shown in fig2 to become firmly anchored to the ground underneath . at the two corner posts 3 and 4 , shown in fig1 iron plates 23 and 24 are welded . these iron plates 23 and 24 project somewhat beyond the lower end of corner posts 3 and 4 and serve to dig into the ground when the stand is set up and thus contribute to its stabilization . fig1 furthermore shows holding devices 25 - 28 , which consist of a piece of iron rail with a u - shaped profile . these devices are attached to the corresponding horizontal iron rails 7 , 9 , 13 and 15 . the opening of the u - shaped profile of the holding devices 25 - 28 extends away from the stand . on each side two holding devices , 25 and 26 , and 27 and 28 , are arranged one above the other . all the holding devices are attached in the middle of their respective iron rails ; e . g ., holding device 25 is in the middle of iron rail 13 . these holding devices 25 - 28 form the guide for cantilevers . one such cantilever is shown in fig3 . this cantilever is formed from a flat iron which is welded to form a triangle . side 30 of the triangle extends beyond vertex 31 and forms hook 32 . to stabilize the triangle , a round iron or rod 33 was welded to the two sides 34 and 35 of the triangle . at the vertex formed by the two sides 34 and 35 , there is a square tube 36 , which has been provided with a threaded hole 37 . an iron plate 38 is welded to side 34 . pointed or rounded pegs or pins 44 may be welded to this iron plate 38 to make it possible for the end of the cantilever shown in fig3 to maintain a secure hold to the ground underneath . the cantilever shown in fig3 is placed with side 30 along a side of the stand shown in fig1 ; on this side , there are two of the holding devices 25 - 28 described above . if this cantilever is placed along the side which has holding devices 25 and 26 , then hook 32 is interlocked from below with the u - shaped profile of iron rail 7 . it should be noted that side 30 would be located in the u - shaped profile of holding devices 25 and 26 . in this way , the shifting of the cantilever shown in fig3 is avoided . it is desirable that the holding devices have borehold openings . these boreholes , 29 and 39 , are shown in fig2 as being located on the free sides of the u - shaped profile of the holding device 26 . when a cantilever is located in the u - shaped profile of holding device 26 , a pin can be pushed through the openings 29 and 39 to prevent the cantilever from changing its position . similarly , openings 29 &# 39 ; and 39 &# 39 ;, which are located on holding device 25 , serve to receive such a pin or stop . at the outer end of the cantilever shown in fig3 iron plate 38 is welded to the bottom . this plate 38 serves as the base of the cantilever at its outer point . it is desirable to have this base surface 38 somewhat larger than the base surface formed by the outer end of side 34 . according to a preferred embodiment , there is a square tube 36 with a threaded hole 37 at the outer vertex of the cantilever formed by the intersection of sides 35 and 34 . into this square tube 36 , a foot , as shown in fig2 can be inserted from below if the cross - section of the square tube 18 is smaller than the cross - section of square tube 36 . after this foot has been inserted from below into square tube 36 , square tube 18 can be secured at any place along one of its sides by means of a screw inserted through threaded hole 37 . thus , the length of the part of square tube 18 projecting downwardly can be chosen at will . when a stand as illustrated in fig1 having a cantilever as illustrated in fig3 is set up on an uneven surface , the stand can nevertheless be erected vertically since the inserted foot with its variable length can be adjusted to traverse the distance between the end of the cantilever and the ground surface . in fig1 moreover , two rods , 40 and 41 , are shown connecting the two corner posts 2 and 3 and 4 and 5 , respectively . the rod 41 connecting corner posts 4 and 5 is solidly welded to both of the corner posts , whereas rod 40 is attached in a movable manner to corner posts 2 and 3 . rod 40 can be removed from hook 42 by pushing it upwardly , thus making the interior of the stand accessible . it therefore becomes possible to insert batteries from the front into the interior of the stand shown in fig1 . these batteries may then be placed in their proper position within . when rod 40 has been reattached with its outer end behind hook 42 , the batteries inside the stand are protected against falling out . if the stand is intended to serve as the base element for the erection of a sign that is to be illuminated , then these batteries provide the energy source for the electric light or lights . it is furthermore possible to introduce into the free space in the interior of the parallelopiped - shaped frame bodies ( i . e ., so - called center of gravity bodies ) which serve to increase the stability of the stand according to the invention . such center of gravity bodies may consist of concrete blocks . it is to be understood that , for illustrative purposes only , the elements of the stand according to the present invention have been described as being of iron . it is understood that other metals ( e . g ., aluminum , steel , etc .) or nonmetals ( e . g ., fiberglass ) could also be substituted . similarly , other cross - sectional shapes could be substituted for the square cross - sectional shapes described above .	4
various embodiments and aspects of the disclosure will be described with reference to details discussed below . the following description and drawings are illustrative of the disclosure and are not to be construed as limiting the disclosure . the drawings are not necessarily to scale . numerous specific details are described to provide a thorough understanding of various embodiments of the present disclosure . however , in certain instances , well - known or conventional details are not described in order to provide a concise discussion of embodiments of the present disclosure . as used herein , the terms , “ comprises ” and “ comprising ” are to be construed as being inclusive and open ended , and not exclusive . specifically , when used in this specification including claims , the terms , “ comprises ” and “ comprising ” and variations thereof mean the specified features , steps or components are included . these terms are not to be interpreted to exclude the presence of other features , steps or components . as used herein , the term “ exemplary ” means “ serving as an example , instance , or illustration ,” and should not be construed as preferred or advantageous over other configurations disclosed herein . as used herein , the terms “ about ” and “ approximately ”, when used in conjunction with ranges of dimensions of particles , compositions of mixtures or other physical properties or characteristics , are meant to cover slight variations that may exist in the upper and lower limits of the ranges of dimensions so as to not exclude embodiments where on average most of the dimensions are satisfied but where statistically dimensions may exist outside this region . it is not the intention to exclude embodiments such as these from the present disclosure . as used herein , the phrase “ rigidized ” refers to a joint , union or contact between two items where a predetermined amount of stiffness has been achieved between the two items . the term “ rigidizing ” refers to the process of achieving this condition . the capture device disclosed herein has been conceived to address two types of spacecraft / space object capture . in general , it is for capturing “ non - prepared ” objects . this refers to a class of client spacecraft which were not designed with purpose - made features that would be used for later capture by a servicing spacecraft once the client spacecraft was in orbit . the capture device has been designed to capture through a grasping action of natural features like launch adapter rings which are present on most spacecraft for the purposes of attachment to the launch vehicle prior to release on - orbit . other natural features such as rails would also be applicable . a secondary feature of these non - prepared spacecraft for which this proposed capture device is intended is non - cooperative spacecraft . these are client spacecraft which are no longer under standard attitude control with the spacecraft no longer held in a stable attitude , but are instead are tumbling , i . e . rotating in one or more axis with respect to their desired pointing direction . in non - tumbling capture , the rendezvousing servicer spacecraft generally is moving relative to the client on a single axis of motion . in capturing a tumbling spacecraft , the servicer spacecraft and / or its manipulator arm must close the separation between it and the client in a number of axes . this puts a premium on the capture device being able to quickly grasp the tumbling spacecraft in what is a much narrower capture zone time , generally limited by the responsiveness of the spacecraft attitude and orbital control system and the responsiveness and peak rates of the manipulator arm . the pool of viable clients will increase with the capture mechanism &# 39 ; s ability to more quickly capture a mechanical feature on the client over a larger range of relative motion . in addition , the spacecraft carrying the capture mechanism will not have to control its own position as precisely , which will result in less propellant being needed and less complex avionics being required resulting in lower overall mission costs . this premium on quickly grasping the client which is potentially tumbling presents a challenge for typical robotic grippers . they first must quickly close trapping or soft capturing the mechanical feature , and then very quickly produce a sufficiently high applied gripping load to ensure that the captured spacecraft remains grasped while resisting the forces and moments that develop at the interface as the servicer spacecraft and manipulator arrest the relative motion of the client . this presents a challenge for typical single action gripping devices which generally use some sort of gearing or transmission in the clamping action . in space systems , this gearing is needed because there is a need for lightweight actuators . as the gearing is increased to compensate for the low torque of the actuator , the penalty is a lower closure rate . this design trade - off in single action robotic grippers is a primary motivation for the two - stage , capture device disclosed . as discussed above , the spacecraft being captured are generally moving relative to one another and the physical grasping of one spacecraft by another is a principle method of cancelling out the relative motions between the two spacecraft . once a rigid grasp has been obtained upon the client spacecraft it is then necessary that the grasp between the two spacecraft be strong enough to absorb the forces and moment generated as the disparate motions between the two spacecraft are absorbed by the positioning mechanism and capture mechanisms now connecting the vehicles . even with small relative motions between spacecraft , significant forces can be generated at the grasp points and within the capture mechanism . spreading out the stance of the grasp reduces many of the internal forces permitting the mechanism to be lighter and achieve a better grasp with lower forces . broadly speaking , there is disclosed herein a system for capturing a rail and or flange feature ( herein all referred to as a “ capture feature ”) on a free flying spacecraft . the system includes a capture mechanism which includes what may be characterized as a quick grasp mechanism mounted for movement in a housing with the quick grasp mechanism including at least one pair of grasping jaws . the quick grasp mechanism is configured to grasp the capture feature when the capture feature is in sufficiently close proximity , the trigger mechanism is initiated causing the the at least one pair of grasping jaws to quickly close to soft capture the capture feature . the capture mechanism includes an opening / closing mechanism which force the grasping jaws of the quick grasp mechanism further together to a closed position . the capture mechanism also includes a rigidizing contact . after the grasping jaws have been quickly closed to soft capture the capture feature , the rigidizing contact is driven into contact with the capture feature within the grasping jaws to secure the capture feature between the rigidizing contact and the closed grasping jaws , thereby to rigidize the capture feature and hence spacecraft within the capture mechanism . this embodiment of the capture mechanism tool is comprised of the following parts : the structure of the capture mechanism will first be described and particular reference is made to a feature on most spacecraft named a marman flange which is used as a launch adapter ring between the launching booster and the client spacecraft but it will be understood the present capture mechanism can be configured to capture any available similar feature on a spacecraft not necessarily intended to be grasped . referring to fig3 and 36 , using known methods not part of this disclosure the servicer spacecraft 500 approaches the client spacecraft 503 and manoeuvres within the reach of the robotic arm 501 attached to the client spacecraft 500 . the robotic arm 501 manoeuvres the capture device to within a prescribed distance from the launch adapter ring 502 on the client spacecraft 503 either by autonomous control from the computer system 600 or with partial or full control by human operators located either on the servicer spacecraft or at a remote location . once the capture mechanism 100 is at the prescribed distance , the computer system 600 assumes automatic control of the final grasping and rigidisation actions . providing position information to the computer system 600 , the vision system 602 receives input from the cameras 150 within the mechanism as well as other sensors on the servicer spacecraft 500 . the computer system 600 uses these inputs to calculate requited motions needed to manoeuvre the robotic arm 501 and the capture mechanism 100 into the final positions near the launch adapter ring 502 while tracking any motions of the client spacecraft 503 . at the proper moment , the computer system 600 directs the robotic arm 501 to advance the capture mechanism 100 into contact with the launch adapter ring 502 . it will be appreciated that if the servicer spacecraft is particularly maneuverable , an arm may not be required or needed at all and the spacecraft attitude and orbital control system ( aocs ) could be used to manoeuvre the capture tool 100 into the proper relative position with respect to the client spacecraft launch adapter ring 502 . fig1 shows a perspective view of the capture mechanism 100 of the present invention in the open position as if approaching a bracket such as a rail and or a flange feature on a free flying spacecraft , or any other part that can be grasped , collectively referred to as a capture feature located on a free flying spacecraft to be captured . fig2 is a side view of the capture mechanism of fig1 in the open position . fig3 shows a perspective view of the capture mechanism 100 of fig1 but from a different perspective than shown in fig1 . fig4 is a perspective view similar to fig1 but with a capture feature ( in this case a bracket , rail or launch adapter ring 502 located on the free flying spacecraft ) being grasped by two clamp jaw assemblies 200 forming part of the capture mechanism 100 , which is shown in the closed position . while fig1 , 3 and 4 show a pair of clamp jaw assemblies 200 pivotally mounted on the main housing 110 , it will be appreciated that the capture mechanism 100 may have only one clamp jaw assembly 200 or may have more than two clamp jaw assemblies 200 . as best seen in fig1 and 4 , forward and rear light sources 154 and 155 respectively are mounted on one end of a light curtain support 153 and produce front and rear light beams 300 and 301 respectively . front and rear detectors 156 and 157 are mounted on the other end of light curtain support 153 and located to receive the beams 300 and 301 respectively . the light sources 154 and 155 and their associated detectors 156 and 157 are positioned on light curtain supports 153 with respect to the clamp jaw assemblies 200 so that when capture feature 502 on the free flying spacecraft is in close proximity to the clamp jaw assemblies 200 the beams of light 300 and 301 are broken which triggers the clamp jaw assembly 200 to close around capture feature 502 , discussed in more detail below . the collection of light sources and receivers and the appropriate circuitry ( including in this embodiment the computer 600 ) comprise the optical initiator . each clamp jaw assembly 200 includes a variable jaw assembly 210 pivotally mounted with respect to a locking jaw assembly 230 which will be discussed in great detail hereinafter . fig5 is a partial cross sectional view of the clamp jaw assembly 200 in the open position taken along line 5 - 5 of fig8 . the combination of the local shape of the jaw cam surfaces 302 and the location of the cam rollers 248 allow the variable jaw assembly 210 and the locking jaw assembly 230 , rotating about hinge pins 204 to be biased apart by the jaw hinge springs 207 . fig6 is a partial cross sectional view of the capture mechanism in the closed and locked position taken along line 5 - 5 of fig8 except the jaws are in the closed position . in this view the cam follower assembly 240 has been moved forward ( to the left in the figure ) and as the cam rollers 248 move along the contours of the jaw cam surfaces 302 , they force the variable jaw assembly 210 and the locking jaw assembly 230 together against the forces of the jaw hinge springs 207 ( see also fig5 ). the capture feature 502 has been pressed down into the contact plunger 217 compressing the contact spring 218 which is within the spring housing 219 . at the same time , the contact feature 246 has been pressed into the face of the capture flange 502 compressing the contact spring 245 contained within the contact housing 247 . the combination of compressed spring 245 and compressed contract spring 218 act together to hold the capture flange 502 against the fixed elements of the clamp jaw assembly 200 with the desired level of security or contact stiffness . the cam follower assembly 240 has advanced to its furthest forward limit and the lock roller 252 has forced the lock 235 inwards against the capture feature 502 thereby mechanically securing the capture flange 502 in place . fig7 is a top view of the capture mechanism 100 taken along arrow 7 of fig2 . this view shows how the shuttle 114 is linked to the draw bars 116 which are flexibly connected to associated contact shafts 242 that serve to advance their associated cam follower assemblies 240 . fig8 is a view of the front of the capture mechanism 100 with the clamping jaw assemblies 200 in the open position and illustrates the relative positions of the cameras 150 , line - producing lasers 151 and the clamp jaw assemblies 200 . it also shows how the situational camera assembly 152 can be positioned to oversee the operation of the capture mechanism 100 . fig9 is a view of the back of the capture mechanism 100 with the clamping jaw assemblies 200 in the open position . fig1 is a section view of the capture mechanism taken along the line 10 - 10 in fig9 and shows how the guide shaft bearings 112 and guide shaft bearing spacer 113 act to support the guide shaft 111 . it also shows how the shuttle 114 is connected to the draw bars 116 . fig1 is a perspective view of the cross sectional view in fig1 . it shows how the plunger springs 171 acts upon the spring housings 172 and the plungers 170 to force the draw bars 116 forward . the spring housings 172 are attached to the main housing 110 . fig1 is a close up of fig1 with gearbox cover 183 removed showing the arrangement of gears 184 , 185 and 186 that transmit torque from the actuator 180 to the ball screw shaft 120 . fig1 is a close up of the trigger mechanism in the armed condition with several structural elements of the capture mechanism not shown for clarity . fig1 is a repeat of fig1 except showing a partial cross section of the trigger reset pawl 135 and how it is mounted to the trigger reset lever 136 and how the trigger reset pawl relates to the trigger pawl surface 304 on the trigger bar support 131 . it also shows how the trigger bar 130 sits within the trigger bar support 131 and how the sear 141 is biased by the sear spring 139 acting upon the spring retaining pin 138 . fig1 is a repeat of fig1 except showing a further partial cross section of the trigger reset arrangement showing how , when the trigger reset lever 136 is rotated when the trigger pawl surface 304 moves the trigger reset pawl 135 it causes the sear reset rod 143 to rotate the sear 141 . it also shows how the motion of the trigger reset lever 135 is limited in the aft direction by the trigger lever stop 147 and how the motion of the trigger bar 130 is restrained by the contact with the sear 141 along the trigger bar surface 307 . fig1 is a repeat of fig1 except showing a further partial cross section of the trigger mechanism showing how the trigger bar 130 rests upon the sear 141 and how the trigger roller 145 holds the sear 141 in place . fig1 is a close up of the solenoid 160 and how it interacts with the trigger mechanism with the reciprocating motion of the solenoid 160 being transmitted and the force amplified by the solenoid lever 162 which forces the trigger striker 165 into contact with the trigger 140 forcing it to rotate . fig1 is a sectional view through the lines 18 - 18 in fig9 showing the guide shaft 111 , shuttle 114 , and how the ball screw shaft 120 interacts with the shuttle 114 via the ball screw nut 124 and shock absorber mount plate 126 to force the shuttle 114 and therefore the draw bars 116 and the contact shaft 242 forwards . fig1 a to 19e are partial sectional views similar to fig5 illustrating the bracket 502 capture sequence when viewed in alphabetical order . fig1 a shows the capture mechanism 200 at the moment the trigger 140 is struck and the sear 141 is free to rotate releasing the trigger bar 130 allowing the shuttle 114 to move . fig1 b shows the jaw assembly 200 closed to the soft capture position just as the rigidisation starts . the plunger springs 171 are at minimum compression and , via the plungers 170 , have driven the draw bars 116 and contact shafts 242 as far forward as they can . fig1 c shows the cam follower assembly 240 having been pushed further forward by the action of the ball screw shaft 120 on the ball screw nut 124 with the bracket 502 fully captured and seated within the jaws 210 and 230 but without any preload applied , fig1 d shows the clamp jaw assembly 200 fully preloaded with the forward motion of the cam rollers 248 forcing the jaw cam surfaces 302 together forcing the bracket 502 into the contact plunger 217 and the contact 246 . this motion is resisted by spring 216 and contact spring 245 creating a connection of known rigidity between the bracket 502 and the capture mechanism 100 . fig1 e shows the cam follower assembly 240 even further forward where the lock roller 252 has pushed the optional lock 235 into position against the bracket 502 to restrain the bracket 502 within the jaws 210 and 230 . fig2 is a partial sectional view along the line 21 - 21 of fig2 showing the installation of the shock absorbers 125 attached to the shock absorber mount plate 126 which is then attached to the nut plate 127 capturing the ball screw nut 124 between them . the three assembled items 125 , 126 and 127 are then free to move within the ball screw nut slot 308 in the shuttle 114 . fig2 is a partial exploded view of the main housing 110 showing installation of the shaft 111 and ball screw 120 . the shock absorbers 125 are attached to the shock absorber mount plate 126 which is then attached to the nut plate 127 capturing the ball screw nut 124 between them . the shuttle 114 moves back and forth guided by the guide shaft 111 with friction being reduced by the guide shaft bearings 112 that are spaced appropriately by the guide shaft bearing spacer 113 . the ball screw shaft 120 is secured to the main housing 110 by the ball screw thrust bearing 121 and stabilised by the ball screw tail bearing 122 which is secured by the bearing cover 123 . fig2 shows details of the shuttle 114 , the trigger bar 130 and the trigger bar supports 131 that secure the trigger bar 130 to the shuttle 114 . the ball screw nut slot 308 is sized such that with the ball screw nut 124 in the ready - to - latch position as shown in fig2 , the free play in the slot permits the shuttle 114 to advance very rapidly under the influence of the plunger springs 171 without requiring the ball screw shaft 120 to rotate . this permits the rapid soft capture action of the capture mechanism 100 . fig2 shows details of the trigger mechanism . the trigger mechanism is comprised of three parts , the trigger reset lever 136 , the sear 141 and the trigger 140 all mounted such that they are free to rotate and yet biased into preferred positions by the trigger lever return spring 146 , the sear spring 139 and the trigger spring 142 , respectively . the trigger reset pawl 135 transmits motion from the trigger bar support 131 to the trigger reset lever 136 , which then moves the trigger reset rod 143 which rotates the sear 141 out of the way permitting the trigger 140 to return to the armed position driven by the trigger spring 140 . fig2 is a partial exploded view showing the optical elements of the vision system 602 showing the positions of the cameras 150 , and the line - producing lasers 151 mounted on the main housing 110 . fig2 showing details of the trigger - actuating solenoid subassembly . the solenoid 161 , mounted to the solenoid mounting plate 160 , acts when commanded by the computing system 600 . the shaft of the solenoid retracts into the body of the solenoid 161 when activated , which causes the solenoid lever 162 to rotate . this solenoid lever 162 is connected to the solenoid 161 by the solenoid pin 163 and to the solenoid mounting plate 160 by the lever pin 164 . the trigger striker 165 is mounted to the solenoid lever 162 such that it forces the trigger 140 to rotate sufficiently to activate the capture mechanism 100 . fig2 is a partial exploded view showing installation of the shuttle plungers 170 . microswitches 117 are mounted to the main housing 110 such that as they open or close , they provide desired information on the location of the shuttle 114 to the computer system 600 . guide shaft retainer 115 secures the guide shaft 111 to the main housing 110 . the plungers 170 are free to move reciprocally within the spring housings 172 which are secured to the main housing 110 . the forward end of the plungers 170 butt against the aft face of the draw bars 116 ( not shown ). the aft motion of the plungers 170 is constrained by the plunger springs 171 , which in the armed condition , are compressed sufficiently to propel the plungers 170 forward forcing the draw bars 116 and cam roller assemblies 240 to complete the soft capture action . the plungers 170 are contained within the spring housings 172 by the retainer nuts 173 . fig2 shows details of the actuator 180 and associated gearing . the actuator 180 is secured to the motor output gear 184 which rotates the idler gear 185 , secured by the idler axle 181 to the actuator mounting 182 which is attached to the main housing 110 . the idler gear 185 rotates the ball screw input gear 186 which is secured to the ball nut shaft 120 rotating the ball nut shaft 120 and transmitting the actuator 180 torque to the ball nut shaft 120 . fig2 shows how the draw bars 116 assemble into the shuttle 114 and how the plungers 170 interfaces with the draw bars 114 . it also shows the relationship between the stereo pair of cameras 150 , situational cameras 152 , the solenoid mounting plate 160 , the microswitches 117 and the main housing 110 . fig2 is an exploded view showing details of the clamp jaw assembly 200 . the variable jaw assembly 210 and the locking jaw assembly 230 are flexibly mounted to the clamp housing 201 by hinge pins 204 and biased to a preferred position by jaw hinge springs 207 . bearing cover plate 202 secures the clamp housing bearing 202 to the clamp jaw assembly 200 . the cam rollers 248 and lock roller 252 are secured to the cam follower assembly 240 but free to rotate by the roller axles 250 and located by the spacers 249 . the links 251 maintain the correct spacing between the cam rollers 248 when under load during the rigidising action . the jaw bearing plate 205 , in conjunction with the clamp housing bearing 203 , permits the clamp jaw assembly 200 to rotate with respect to the main housing 110 while being axially and laterally supported in the main housing 110 . the journal bearing 206 permits the cam follower assembly to move axially with respect to the rest of the clamp jaw assembly 200 . fig3 showing details of the variable clamp jaw assembly 210 . the clamp hinge plate 212 is secured to the jaw hinge 211 . the spring mounts 213 permit jaw hinge springs 207 ( not shown ) to be mounted to the assembly . the variable jaw 214 is attached to the clamp hinge plate 212 by the clamp hinge pin 215 , but is free to rotate . the position of the variable jaw 214 is biased to a preferred position by the spring 216 . the contact plungers 217 are secured to the spring housing 219 by the plunger retaining nuts 220 such that they may move axially and trap the contact springs 218 . the spring housings 219 are attached to the variable jaws 214 by the plunger mounting plate 221 . fig3 shows details of how the clamp jaw assembly 200 is free to move within the main housing 110 . the jaw bearing plate 205 is fastened to the main housing 110 which , in concert with the clamp housing bearing 203 permits the clamp jaw assembly 200 to rotate with respect to the main housing 110 . the contact shaft 242 is secured to the draw bar 116 using the clamp retainer 261 . the compliance spring 260 and the journal bearing 262 permit the draw bar 116 to move axially with respect to the clamp jaw assembly 200 reducing the chances of damage at the end of draw bar 116 travel . fig3 shows details of the mechanism that restrains rotary motion of the clamp jaw assembly 200 . with the brackets 281 secured to the main housing 110 , the torque rod 284 is placed with a slot in the bracket 281 . a spring 283 is placed over each end of the torque rod 284 such that the bracket 281 is sandwiched between them . the springs 283 are secured by a rod retainer nut 285 on the interior end and by a link 282 on the external end . the hole in the link 282 is secured to a clevis in the clamp housing 201 by a link pin 286 and a link pin nut 287 . the torque rod 284 is free to move within the slot in the bracket 281 yet is centred by the opposing actions of the springs 283 thus centring the position of the clamp jaw assembly 200 with respect to the main housing 110 . fig3 shows details of the cam follower assembly 240 . the contact shaft 242 is attached to the housing 241 by the shaft retaining nut 244 . the contact housing 247 is fastened to the housing 241 permitting the contact 246 to move axially within it constrained by the contact spring 245 . guide pins 243 are fastened to the housing 241 and engage axial slots on the clamp housing 201 to prevent the cam follower assembly 240 from rotating about the axis of the clamp shaft 242 while permitting it to move freely axially with respect to the clamp housing 201 . fig3 showing details of the locking jaw assembly 230 . the clamp plate 233 is secured to the jaw hinge 231 . the spring mounts 213 permit jaw hinge springs 207 to be mounted to the assembly . the lack 235 is attached to the clamp plate 233 by the lock hinge pin 234 , but is free to rotate . the position of the lock 235 is biased to a preferred position by the lock spring 236 . contact rods 232 are secured to the clamp plate 233 and the jaw hinge 231 and provides a hard contact surface that the feature 502 can abut to . fig3 is an overall view of an alternate embodiment of the tool 900 that has been fitted with a mechanical trigger for the mechanism in addition to the solenoid trigger method shown in fig1 and 17 . in this embodiment a pusher plate 650 has been arranged such that it is a back - up activating method and thus is not engaged unless the electronic triggering method fails . it will be understood that should it be required , this arrangement can be reversed so that the mechanical trigger is the primary method and the electronic triggering method is the back - up method . the pusher plate 650 is connected to a rod 653 that transmits the contact force via the trigger pin 670 to the trigger 140 ( best seen in fig3 ). the rod 653 is supported at the front by support 652 and at the rear by bushing block 656 which is fastened to the main housing 110 . the rod 653 is guided by bushings 651 and terminates in a pin support 671 . fig3 is a sectional view taken in the same plane as the section for fig1 as shown in fig9 . it shows how the pusher plate 650 is connected by rod 653 to the trigger pin 670 which then contacts the trigger 140 . the motion of the pusher plate 650 and rod 653 are controlled by spring 655 , the effect of which is adjusted by securing collar 654 at various points along the rod 653 . a second collar 654 prevents the rod 653 from extending too far out of the tool 900 . depending upon the final purpose to which the tool 900 will be put , the adjustability of the securing collar 654 may be limited to establishing the correct performance of the tool 900 by being adjusted only during manufacture or , in an alternate embodiment not shown , by the use of an additional actuator ( s ) to vary the position of the securing collar 654 on the rod 653 thus varying the performance of the spring 655 and the performance of the mechanical triggering portion of the tool 900 as a whole . a slot 658 in rod 653 is engaged by a pin 657 that is secured within the bushing block 656 and keeps the trigger pin 670 properly aligned by preventing the rod 653 from rotating around its long axis . fig3 is a detailed view showing how the trigger pin 670 acts in parallel with and independently of the trigger striker 165 to contact the trigger 140 and release the sear 141 to activate the mechanism . aftward motion of the rod 653 forces the trigger pin 670 against the surface of trigger 140 . pin support 671 is threaded for trigger pin 670 and the exact timing of when the trigger pin 670 strikes the trigger 140 is set by advancing or retarding the position of the trigger pin 670 within the pin support 671 . an alternate embodiment of the tool , as shown generally at 940 in fig4 , includes a shock absorber system to reduce the internal forces generated by the powerful plunger spring 171 when the mechanism is activated . these forces can cause damage to tool or impose shock loads on the servicer spacecraft 500 or the client spacecraft 503 . fig4 is an overall view of the alternate embodiment of the tool 940 fitted with a shock absorber system 702 showing the general arrangement from the back of the tool . when the mechanism is activated the draw bars 116 are forced forward by the plunger springs 171 acting upon the plungers 170 . in this embodiment the plungers 171 are connected together by the connector plate 700 which transfers some of the plunger spring 171 forces to the shock absorbers 702 through the pistons 701 ( best seen in fig4 ). the shock absorbers 702 slow the motion of the draw bars 116 and reduce the internal forces acting upon the housing 110 to decelerate the mechanism at the end of its stroke . the drag caused by the shock absorbers 702 and the spacing 707 ( shown in fig4 ) between the connector plate 700 and the pistons 701 can be varied to fine tune the timing and forces required by the tool 100 to perform successfully . fig4 is a section showing the arrangement of the shock absorber system taken along the line 42 - 42 of fig9 . the shock absorber 702 is secured to the housing 110 by mounting plate 704 . both mounting plate 704 and the exterior of the shock absorbers 702 are threaded such that the axial position of the shock absorber 702 can be varied to set the spacing 707 . once located correctly , nut 703 is tightened securing the shock absorber 702 in the correct position . bumper 706 acts to spread the load from plunger 170 to the draw bars 116 . an additional alternate embodiment of the tool 980 equipped with a jaw adjustment mechanism 800 for altering the angular position , also known as the pose , of the clamp jaw assemblies 200 is shown in fig4 . the jaw adjustment system 800 both coordinates the motion of the two clamp jaw assemblies 200 and allows the clamp jaw assemblies 200 to be adjusted to capture launch adapter rings 502 , or other features , of varying diameters . the jaw adjustment system 800 also incorporates features that provide compliance to the individual clamp jaw assemblies 200 to accommodate small misalignments and client satellite 503 movements . the coordinated motion function is accomplished by the combination of components , drive gear 809 , idler gear 805 and bell crank 807 . a rotational input , in this case affected by the linear actuator 801 , to one clamp jaw assembly 200 ( the left side , for example ) will cause the clamp jaw assembly 200 to rotate about the clamp housing bearing 203 ( best seen in fig5 ). this will move the arm securing the link 282 ( best seen in fig3 ) or jaw compliance mechanism 810 to the link pin 286 . the jaw compliance mechanisms 810 are free to rotate about either the link pin 286 or the pin 806 at either end . movement of the jaw compliance mechanism 810 moves the moment arm 803 connected to the idler 805 . rotation of the idler 805 rotates the drive gear 804 , but in the opposite direction , which then moves the connected moment arm 803 . that moment arm 803 is connected to the shaft 802 and the linear actuator 801 each of which has a pin that is free to rotate at the end . for embodiments where varying the nominal capture radius of the tool is unnecessary , the linear actuator 801 and shaft 802 may be replaced with a single rigid component fitted with free rotating pins on either end ( not shown in this embodiment ). rigid motion of the linear actuator 801 causes the bell crank 807 to rotate about axle 809 causing the second jaw compliance mechanism or link to be rotated and then transfer the rotation to the sending clamp jaw assembly 200 , but with an opposite and coordinated rotation . fig4 is a detail view showing how a linear actuator 801 is integrated within the jaw adjustment system 800 of fig4 . when it is desired to vary the radius of curvature that the clamp jaw assemblies 200 can accommodate the linear actuator 801 can extend or contract the shaft 802 . as configured in fig4 , extending the shaft 802 will enable the clamp jaw assemblies 200 to grasp a smaller radius feature through the motion of the gears 804 and 805 , bell crank 807 and compliance mechanisms 810 as described above . retracting the shaft 802 will enable the clamp jaw mechanisms to grasp a larger radius feature , adjusting their pose or rotational position relative to their link pin axes 286 on the main housing 110 . the axles 809 are mounted rigidly to the bracket 808 which is rigidly mounted to the housing 110 . different arrangements of gears 804 and 805 and bell cranks 807 can be created to change the motion parameters of the system . in addition , as an alternate method of adjusting the grasp radius , the linear actuator 801 can be replaced by a rigid shaft and a rotary actuator or motor connected rigidly to the axle 809 of either gear 804 or 805 . fig4 is a detail that shows how the jaw compliance mechanism 810 ( fig4 ) is integrated within the jaw adjustment system 800 ( fig4 ). undesirable motion variances of the individual clamp jaw assemblies 200 can be accommodated through the introduction of compliance between the two clamp jaw assemblies 200 and between the two clamp jaw assemblies 200 and any actuator 801 used to adjust the nominal clamping radius of curvature . an un - commanded motion of the clamp housing 201 will apply a force on one end of the housing 811 of the jaw compliance mechanism 810 through link pin 286 . springs 814 within the jaw compliance mechanism 810 ( see fig4 ) permit the exterior components of the jaw compliance mechanism 810 to move relative to the compliance shaft 813 which is connected to the rest of the jaw adjustment system 800 . the strength and configuration of the springs 814 within the jaw compliance mechanism 810 determine the compliance performance of the jaw compliance mechanism 810 . fig4 is a section through the jaw compliance mechanism 810 . in this example , the jaw compliance mechanism consists of housing 811 connected by a link pin 286 to the clamp housing 201 part of the clamp jaw assembly 200 . the parts internal to the jaw compliance mechanism 810 are secured by a cap 812 . the housing 811 contains a piston 813 with a central stop 815 and springs 814 that act upon the central stop and upon the housing 811 at one end and upon the cap 812 on the other end . the opposing springs 814 act to centralise the piston 813 , returning the mechanism to a preset neutral position if perturbed . the details of each spring 814 may be varied to provide specified piston performance to suit the desired overall requirements of the tool . in addition , a damping element , not shown in this embodiment , may be added to the mechanism to further customise its performance . piston 813 is then connected to the rest of the jaw adjustment system 800 through pin 806 connected to moment arm 803 . an alternate embodiment , not shown , may omit the actuator 801 and any linkage between the bell crank 807 and the idler gear 805 and add actuators to drive the bell crank 807 and idler gear 805 independently of one another . this would further increase the capability of the tool 980 to grasp capture features of varying shapes . it will be understood that the alternate embodiments described above may be incorporated in the tool 100 of fig1 singly or in any combination depending upon the demands of the purpose for which the tool 100 is being used . the exact alternate embodiments described above are also exemplary , there being other arrangements of mechanical triggers , shock absorbers and actuators that will perform the same functions as those listed above . the operation of clamping mechanism 100 of fig1 will now be described but it will be understood that this description applies also to the embodiments shown in fig3 to 46 , noting that the operation of the additional features shown in these figures have been largely described above . in operation , referring to fig1 and 4 , when the launch adapter ring 502 breaks the forward light beam 300 formed between the forward light 154 and the forward receiver 156 a signal is sent to and interpreted by the computer system 600 . any differences in the signals sent by the forward receivers 156 on each clamp jaw assembly 200 ( shown in more detail in fig2 ) are interpreted as errors by the computer system 600 and may be used , as part of a broader control system , to correct the position of the capture mechanism 100 in real time . the capture mechanism 100 continues to be advanced over the launch adapter ring 502 until the aft light beams 301 formed by the aft lights 155 and the aft receivers 157 are broken by the launch adapter ring 502 . if the two forward light beams 302 remain broken and at least one of the aft light beams 301 is broken , the capture mechanism is configured to be in an acceptable position to grasp the launch adapter ring 502 . this prompts the optical initator &# 39 ; s activation of the trigger 140 whereby the computer system 600 generates a signal that causes the solenoid 161 ( fig1 ) to activate , causing the solenoid lever 162 ( fig1 and 25 ) to rotate and forcing the trigger striker 165 to contact the trigger 140 causing it to rotate . fig2 shows an exploded view of the solenoid assembly which includes solenoid 161 , solenoid lever 162 , trigger striker 165 , a lever pin 164 , solenoid pin 163 and solenoid mounting plate 160 . an alternate embodiment to initiating the motion of the trigger 140 would be to introduce a mechanical initiator that is activated by physical contact of the capture mechanism with the launch adapter ring 502 or other bracket to be grasped . this mechanical initiator would include a contact rod secured to the main housing 110 in such a way that the contact force as the rod strikes the client bracket is transmitted directly to the trigger 140 . the use of sliding bearings , bell cranks and other methods of mechanical force transmission well known in the art , permit the location of the contact rod to be optimised to the client bracket and the design of the rest of the capture mechanism 100 . this mechanical contact means of initiating the trigger 140 could be the primary trigger initiation method or act as a secondary or back - up to the electromechanical trigger initiation method . a second alternative embodiment for initiating the rotation of the trigger 140 would involve replacing the optical light curtain with inductive sensing means which detected when the launch adapter ring 502 is sufficiently aligned over the inductive sensors . once the trigger 140 rotates , the trigger roller 145 ( fig1 , 14 , 15 and 17 ) rolls up the face of the sear 141 , the trigger roller 145 acting to reduce friction and ensuring a smooth and repeatable release . fig2 is a partial exploded view showing installation of the shuttle plungers 170 . referring to fig1 and 26 , the plunger springs 171 and plungers 170 push against the draw bars 116 attached to the shuttle 114 and apply a force that attempts to move the shuttle 114 forward . the sear 141 is in contact with the trigger bar 130 ( fig1 ) attached to the shuttle 114 preventing the shuttle 114 from moving forward . see fig1 , 14 , 15 and 16 that illustrate how the trigger 140 and sear 141 resist the motion of the trigger bar 130 . when the trigger roller 145 has moved far enough that it no longer restricts the rotation of the sear 141 , the sear 141 is rotated by the forces generated by the plunger springs 171 and the shuttle 114 and draw bars 116 are free to move forward very quickly . referring to fig1 , as the shuttle 114 moves forward it is guided by sliding on the guide shaft 111 , friction being reduced by the use of the guide shaft bearings 112 , appropriately spaced by the guide shaft bearing spacer 113 . should the capture mechanism 100 be triggered in error or fail to capture the client spacecraft 503 the shuttle 114 may continue too far forward striking the ball screw nut 124 ( fig9 ). to prevent damage in such a condition , the ball screw nut 124 is fitted with two shock absorbers 125 that will absorb the impact of the shuttle 114 from a failed capture . referring to fig1 a and 33 , the forward motion of the draw bars 116 also forces the cam follower assembly 240 forward . the cam follower 240 assembly is connected to the main housing 110 by journal bearings 206 and 262 ( fig2 and 31 ) that restrict lateral movement but permit rotational and axial movement and by a compliance spring 260 that prevents damage at the extremes of motion which is contained by the clamp retainer 261 which is bolted to the main housing 110 . fig1 a shows the configuration of the clamp jaw assembly 200 at the instant the shuttle 114 begins to move . the launch adapter ring 502 is in the correct position to be grasped . as the cam follower assembly 240 moves forward the cam rollers 248 move along a predetermined jaw cam surface 302 ( fig5 ) and force the variable jaw assembly 210 and the locking jaw assembly 230 closer towards each other overcoming the biasing effect of the jaw hinge springs 207 . fig1 b shows the clamp jaw assembly 200 at the end of the plunger spring 171 stroke with the variable jaw assembly 210 and the locking jaw assembly 230 closed sufficiently such that the launch adapter ring 502 cannot escape , yet there is no actual contact with the launch adapter ring 502 . the launch adapter ring 502 is now considered “ soft captured ” and the first , automatic step of the two - step capture is complete . referring to fig1 , 11 , 26 , 27 and 28 , microswitches 117 ( fig1 ) within the capture mechanism 100 are closed as the shuttle 114 passes by them providing a signal to the computer system 600 that soft capture has been achieved . the computer system 100 then commands the actuator 180 to rotate such that the torque is transmitted from the motor output gear 184 through the idler 185 and to the ball screw input gear 186 causing the ball screw 120 to rotate . the ball screw 120 rotates within and is connected to the main housing 110 by the ball screw thrust bearing 121 and the ball screw tail bearing 122 ( fig2 ). as shown in fig2 , ball screw 120 also rotates within the ball nut 124 which is fixed within the shuttle 114 by the shock absorber mount plate 126 and the nut plate 127 . because the ball nut 124 is constrained from rotating within the shuttle 114 , the actuator 180 torque results in an axial force on the shuttle 114 forcing the shuttle to continue to move forward also driving the two cam follower assemblies 240 further forward . during the rotation of actuator 180 during the capture sequence , the rotation location of the actuator shaft may be continuously monitored and stored in the computer 600 . alternatively , calibration during assembly will reveal the number of rotations of the actuator shaft of actuator 180 required to perform the capture sequence and hence the reset sequence . as the cam follower assembly 240 moves further forward , the shape of the jaw cam surfaces 302 forces the variable jaw assembly 210 and the lock jaw assembly 230 closer together , as shown in fig1 c . part of the cam follower assembly 240 is the contact 246 . in the position defined as “ seated ”, shown in fig1 c , the jaws 210 and 230 are closed to the point that they just about touch the outer and inner diameters of the launch adapter ring 502 and the contact 246 almost touches the face of the launch adapter ring 502 . as the actuator 180 continues to apply torque the cam follower continues to move forward and the variable jaw assembly 210 and the lock jaw assembly 230 continue to get closer together . the launch adapter ring eventually contacts the contact rods 232 on the locking jaw assembly 230 , the contact plungers 217 on the variable jaw assembly 210 and the contact 246 on the cam follower assembly 240 . the actuator 180 continues to force the cam follower assembly 240 further forward and , as shown in fig1 c , the shape of the jaw cam surface 302 forces the variable jaw assembly 210 and the lock jaw assembly 230 even closer together . in doing so , the contact rods 232 ( fig3 ) force the launch adapter ring 502 down onto the contact plungers 217 compressing the contact springs 218 ( fig3 ). at the same time the contact 246 in fig3 is pushed into the face of the launch adapter ring 502 compressing the contact spring 245 in fig3 . when the desired level of force is generated in the contact springs 218 and 245 the launch adapter ring 502 is considered fully preloaded to the point where the attachment between the capture mechanism 100 and the launch adapter ring 502 has achieved the desired level of stiffness ( i . e . has been “ rigidised ”) to permit the attachment to resist loads generated during spacecraft stabilisation and other servicing tasks . this condition is shown in fig1 d . in order to provide a further lock between the two spacecraft , the locking jaw assembly 230 in fig3 is equipped with a lock that physically prevents the launch adapter ring 502 from being removed from the capture mechanism 100 . as shown in fig1 e , when the cam follower assembly 240 has reached the position where the full preload has been developed , it is advanced still further . the combination of the cam rollers 248 and the jaw cam surface 302 do not act to compress the jaws 210 and 230 further , but the lock roller 252 now engages with the lock cam surface 303 on the back of the lock 235 and overcomes the biasing effect of the lock spring 236 ( shown in fig3 ) to force the lock 235 into a position where it prevents the movement of the launch adapter ring 502 . the capture mechanism 100 and the launch adapter ring 502 are now preloaded and locked together completing the second stage of the two - stage capture sequence . referring again to fig1 e to 19a , to permit the servicing of several spacecraft or to permit additional attempts to capture a client spacecraft that might not have been captured on the first attempt , the capture mechanism 100 can be unlatched and reset to its initial condition . to do so generally amounts to running the actuator 180 in the opposite direction and causing the cam follow assembly 240 to move aft , moving the cam rollers 248 in the reverse direction down the lock cam surface 302 and the jaw cam surface 301 which , in sequence allows the lock 235 to be biased away from the launch adapter ring 502 and then unloads the contact 246 and the contact plungers 217 . the jaw hinge springs then can bias the jaws 210 and 230 away from the launch adapter ring 502 . at any point between fig1 b and 19a it is possible for the capture mechanism to be maneuvered away from the launch adapter ring 502 by the robotic arm 501 . to fully reset the capture mechanism 100 , the trigger 140 must be reset in its initial position . to do so , the actuator 180 continues to force the shuttle 114 aftwards within the capture mechanism 100 until the trigger reset pawl 135 , see fig1 , located on the trigger reset lever 136 , contacts the trigger pawl surface 304 on the trigger bar support 131 . the trigger reset lever 136 is biased in the untriggered position by the trigger lever reset spring 146 and prevented from rotating too far by the trigger lever reset stop 147 as shown in fig1 . as the shuttle 114 is pushed aft , the contact between the trigger reset pawl 135 and the trigger pawl surface 304 rotates the trigger reset lever 136 . the sear reset rod 143 contacting the back of the lever slot 305 then forces the sear 141 to rotate along with the trigger reset lever 135 . the trigger 140 and trigger roller 145 are flexibly secured within the trigger housing 132 and biased to the untriggered position by the trigger spring 142 . as the trigger roller 145 is moved out of the way by the motion of the sear 141 , the trigger 140 rotates until the trigger roller 145 passes over the top of the sear 141 and then starts to contact the trigger surface 306 , see fig1 . prior knowledge of how many actuator 180 turns are required to reset the trigger 140 allows the computer system 600 or a human operator to know when the trigger 140 has been reset . alternately , a position sensor ( not shown in the embodiment ) may be used to determine when the sear 141 had returned to the untriggered state . the trigger spring 142 biases the trigger 140 into the correct position against the trigger surface 306 on the sear 141 . the rotation of the actuator 180 is once again reversed to drive the shuttle 114 forward . as the shuttle 114 moves forward the trigger bar 130 contacts the trigger bar surface 307 on the sear 141 . the trigger mechanism is now reset , however the ball screw nut 124 continues to be driven forward in the ball screw nut slot 308 , ( fig2 and 24 ) leaving the shuttle 114 to be retained by the trigger mechanism . the ball screw nut 124 has been moved forward sufficiently that when the capture mechanism 100 is triggered the shuttle 114 can move forward far enough to attain the soft capture state without being restricted by the shuttle 114 prematurely striking the ball nut screw 124 . the capture mechanism 100 is now completely reset and ready for another capture . referring to fig1 , in order to service a wider range of clients and to accommodate variations in bracket size and position , the capture mechanism 100 may include additional features . to accommodate differences in launch adapter ring 502 diameter , the two clamp jaw assemblies 200 are mounted on clamp housing bearings 203 as shown in fig2 . these bearings 203 permit the clamp housing 201 to rotate about the axis of the cam follower assembly 240 with respect to the main housing 110 . in this embodiment the two clamp jaw assemblies 200 are free to rotate independently . to keep the clamp jaw assemblies 200 in their nominal positions , each assembly 200 is connected to a torque rod 284 ( fig3 ) by a link 282 and then connected to the main housing 110 by a bracket 281 . to keep the torque rod 284 centred on the bracket 281 a spring 283 is located on either side of the bracket 281 . rotations of the clamp jaw assembly 200 are accommodated by the sliding of the torque rod 284 within a slot in the bracket 281 which compresses one or the other spring 283 which generates a righting moment that returns the clamp jaw assembly 200 to the nominal position . as shown in fig3 , to accommodate launch adapter rings 502 of differing profile shape the variable jaw assembly 210 incorporates a two - part jaw with a fixed clamp hinge plate 212 connected flexibly to a variable jaw 214 by a clamp hinge pin 215 . rotation of the variable jaw 214 is limited to a desired range by features machined into the variable jaw 214 and the clamp hinge plate 212 and the variable jaw 214 is biased to any desired position relative to the clamp hinge plate 212 by the spring 216 . when the variable jaw assembly 210 is closed over varying profiles within a known range of shapes , the shape and flexible position of the variable jaw 214 permits the entire clamp jaw assembly 200 to correctly grasp varying shapes within a predetermined range . an alternate embodiment can incorporate a linking mechanism that coordinates the rotation of the two clamp jaw assemblies 200 so that a wider range of launch adapter ring 502 diameters can be accommodated . to further increase the range of launch adapter ring 502 diameters , each bracket 281 can be connected to an actuator that changes the nominal position of the bracket , and therefore the changes nominal diameter of launch adapter ring 502 being grasped . an alternate embodiment has the entire capture mechanism 100 as a separate tool that the robotic arm 501 may releasably grip to permit the robotic arm to perform additional functions . the separate tool embodiment would include a releaseable interface between the robotic arm 501 and the capture mechanism 100 such that mechanical forces , electrical power and sensor signals can be transmitted across the interface . several such interfaces exist in prior art and they are not part of this invention . an alternate embodiment would delete the vision system 602 , and the line producing lasers 151 and rely exclusively upon human control to maneuver the capture mechanism 100 and upon mechanical contact to actuate the trigger mechanism per the alternate embodiment above . the capture mechanism disclosed herein is very advantageous over the spacecraft capture mechanism disclosed in us patent publication 2013 - 0249229 - a1 published sep . 26 , 2013 , ( hereinafter &# 39 ; 229 ), for the following reasons . the capture mechanism disclosed in &# 39 ; 229 has a very limited range of objects that it can optimally grasp , while the mechanism disclosed herein is designed for a much greater range of objects that it can optimally grasp and that adjustment can be varied during the use of the tool to greatly increase the utility of the tool . as one example of this , the pairs of grasping jaws include structural features configured to accommodate local variations in size and shape of the capture feature at the two locations on the capture feature being grasped by the two pairs grasping jaws . further , mechanism disclosed in &# 39 ; 229 has a single set of grasping members , or jaws , which results in larger forces within the entire capture mechanism during the rigidising operation thereby requiring members of greater size and mass to withstand those forces . larger and more massive members not only reduce response time , but also lead to a higher overall mechanism size and mass which is highly undesirable for spacecraft systems . the single set of grasping members in &# 39 ; 229 is manufactured to optimally grasp features of a limited range of sizes . this range cannot be changed once the grasping members are manufactured and installed in the mechanism . to increase its adjustability and utility , the mechanism in the current disclosure has multiple grasping mechanisms which may be adjusted in service to optimally grasp a much wider range of features and that may be changed for each grasping operation to greatly increase the utility of the tool . in addition , the individual grasping members or pairs of grasping jaws of the capture mechanism disclosed herein also have adjustability designed into them to allow each of the grasping members to optimally contact and grasp objects with their anticipated relative motion with respect to the capture mechanism . this greatly enhances the tool &# 39 ; s ability to accommodate varying objects to be grasped and increases the utility of the tool . as an example of this , at least one grasping jaw of each pair of grasping jaws has a distal end locking portion which is flexibly mounted to a remainder of the grasping jaw and includes a cam surface which when in contact with an associated cam follower is forced into a locking position to lock the feature within the grasping jaws . in addition the present capture mechanism includes positioning mechanisms connected to each of the pairs of grasping jaws configured to vary a pose of each pair of grasping jaws with respect to the capture feature being grasped prior to being grasped . the quick grasp mechanism is configured such that each pair of grasping jaws is positioned independently of all other pairs of grasping jaws . it will be understood that while the above discussion relates to an embodiment with at least two pairs of grasping jaws spaced from each other , it will be understood that more than two pairs of grasping jaws may be used , as the present disclosure is not meant to be limited to two pairs . in addition , the present disclosure may encompass an embodiment where only one pair of grasping jaws are needed . as the grasping jaws disclosed herein have various structure features that allow them to be adjusted for various sizes and shapes of capture features . this would be beneficial when the satellite being captured is very small and the capture feature is such that it is more amenable to grasping by one pair of grasping jaws . in addition , a satellite may be produced with the capture system as part of the satellite . referring again to fig3 , a block diagram showing those items pertaining to the capture of a client spacecraft 503 in addition to the capture mechanism 100 . these include the servicer spacecraft 500 , the client spacecraft 503 with launch adapter ring 502 to be captured , a robotic arm 501 to which the capture mechanism 100 is interfaced and a communication system 506 to provide a two - way radio link 504 to earth 505 ( or space station or mother ship , whichever is the location of the teleoperation control ). in addition , the servicer spacecraft 500 includes an onboard computer control system 600 ( see fig3 ) which may be interfaced with the capture mechanism 100 , so that it can coordinate all the components that are involved in the capture process , including the vision system 602 , robotic arm ( s ) 501 ( if more than one capture mechanism 100 is used ). this control system 600 is also interfaced with any sensors used to determine the position and loading state of the soft capture or rigidise mechanisms . these sensors may include contact or non - contact sensors used to trigger the quick grasp mechanism ( in lieu of the plunger ) and position sensors to determine the degree of closure of the mechanisms using continuous means ( encoders or resolvers ) or discretely ( using limit switches ). with the presence of the computer system 600 interfaced with the capture mechanism 100 , the capture process may be autonomously controlled by a local mission manager or may include some levels of supervised autonomy so that in addition to being under pure teleoperation there may be mixed teleoperation / supervised autonomy . referring again to fig3 , an example computing system 600 forming part of the servicing system is illustrated . the system includes a computer control system 601 configured , and programmed to control movement of the robotic arm 501 during the entire procedure of capturing launch adapter ring 502 on the client satellite 503 . the command and control system is also configured to control movement of the robotic arm 501 and for controlling the action of the capture mechanism 100 . this may be the same command and control system that is interfaced with the capture mechanism 100 , for example a computer mounted on the servicer spacecraft which is programmed with instructions to carry out all operations needed to be performed by the servicer satellite during approach , capture / docking with the client satellite and refueling operations . it may also be a separate computer system . communication system 506 is interfaced with the robotic arm 501 and configured to allow remote operation ( from the earth 505 or from any other suitable location ) of the vision system 602 ( which may include one or more cameras ), the robotic arm 501 and hence the capture mechanism 100 . the vision system 602 may include distinct markers mounted on the capture mechanism 100 . the communication system allows local automatic or autonomous control , and may send a ) vision system information robot control computer on spacecraft , where it processes visual information to determine relative pose and allow the arm / positioning device to position the capture mechanism relative to the capture 500 ; and / or b ) capture tool information / telemetry including the light beam state and trigger information . alternatively , it may be under teleoperated control from a remote location ( earth ) where the vision system information and other telemetry is provided to the operator to make decisions and control the action of the positioning device ( arm ) and the capture tool . in one form , the vision system 602 may include one or more video cameras . to improve depth perception , it may be augmented with a range finding device , such as a laser range finder or radar . the cameras of vision system 602 may be used within a telerobotic control mode where an operator controlling the servicing actions on earth or from some other remote location views distinct views of the worksite on display screens at the command and control console . in an alternative mode , the position of elements of the capture mechanism 100 or launch adapter ring 502 may be determined by either a stereo camera and vision system which extracts 3 d points and determines position and orientation of the capture mechanism 100 or other relevant features on the ring 502 , client spacecraft 503 or capture mechanism 100 from which the robotic arm 501 can be driven to desired locations according the sensed 6 degree - of - freedom coordinates . it should be noted that the term position in the context of the positioning of the servicing spacecraft with respect to the spacecraft to be captured includes the orientation of the object as well as the translation vector between the two objects , i . e . the overall relative pose of the capture feature on the client spacecraft with respect to servicer spacecraft . the stereo camera could also be replaced with a scanning or flash lidar system from which desired 6 degree - of - freedom coordinates could be obtained by taking measured 3 - d point clouds and estimating the pose of desired objects based on stored cad models of the desired features or shapes on the refueling worksite . for those applications where the spacecraft was designed with the intention to be serviced , a simple target such as described in ogilvie et al . ( ogilvie , a ., justin allport , michael . hannah , john lymer , “ autonomous satellite servicing using the orbital express demonstration manipulator system ,” proc . of the 9th international symposium on artificial intelligence , robotics and automation in space ( i - sairas &# 39 ; 08 ), los angeles , calif ., feb . 25 - 29 , 2008 ) could be used in combination with a monocular camera on the servicing robotics to locations items of interest . finally , the robotic arm or device used to position the capture mechanism 100 may include a sensor or sensors capable of measuring reaction forces between the capture tool and the bracket being captured . these can be displayed to the operator to aid the operator in teleoperation control or can be used in an automatic force - moment accommodation control mode , which either aids a tele - operator or can be used in a supervised autonomous control mode . as mentioned above , computer control system 603 is interfaced with vision system 602 and robotic arm 501 . previously mentioned communication system 506 is provided which is interfaced with the robotic arm 501 and configured to allow remote operation ( from the earth 506 or from any other suitable location ) of the vision system 602 ( the robotic arm 501 and capture mechanism 100 . a system of this type is very advantageous particularly for space based systems needing remote control . the robotic arm 501 possesses its own embedded processor and receives commands from the servicing spacecraft computer . the robotic arm 501 also passes power and data from the central computer through to the capture mechanism 100 in the event there are sensors of any type , gauges or other power requiring devices some aspects of the present disclosure can be embodied , at least in part , in software . that is , the techniques can be carried out in a computer system or other data processing system in response to its processor , such as a microprocessor , executing sequences of instructions contained in a memory , such as rom , volatile ram , non - volatile memory , cache , magnetic and optical disks , or a remote storage device . further , the instructions can be downloaded into a computing device over a data network in a form of compiled and linked version . alternatively , the logic to perform the processes as discussed above could be implemented in additional computer and / or machine readable media , such as discrete hardware components as large scale integrated circuits ( lsi &# 39 ; s ), application - specific integrated circuits ( asic &# 39 ; s ), or firmware such as electrically erasable programmable read - only memory ( eeprom &# 39 ; s ). fig3 provides an exemplary , non - limiting implementation of computer control system 601 , forming part of the command and control system , which includes one or more processors 603 ( for example , a cpu / microprocessor ), bus 609 , memory 607 , which may include random access memory ( ram ) and / or read only memory ( rom ), one or more internal storage devices 604 ( e . g . a hard disk drive , compact disk drive or internal flash memory ), a power supply 606 , one more communications interfaces 605 , and various input / output devices and / or interfaces 608 . although only one of each component is illustrated in fig3 , any number of each component can be included in computer system 600 . for example , a computer typically contains a number of different data storage media . furthermore , although bus 609 is depicted as a single connection between all of the components , it will be appreciated that the bus 609 may represent one or more circuits , devices or communication channels which link two or more of the components . for example , in personal computers , bus 609 often includes or is a motherboard . in one embodiment , computer control system 601 may be , or include , a general purpose computer or any other hardware equivalents configured for operation in space . computer control system 601 may also be implemented as one or more physical devices that are coupled to processor 603 through one of more communications channels or interfaces . for example , the computer control system 601 can be implemented using application specific integrated circuits ( asic ). alternatively , computer control system 601 can be implemented as a combination of hardware and software , where the software is loaded into the processor from the memory or over a network connection . the computer control system 601 may be programmed with a set of instructions which when executed in the processor causes the system to perform one or more methods described in the present disclosure . computer control system 601 may include many more or less components than those shown . while some embodiments have been described in the context of fully functioning computers and computer systems , those skilled in the art will appreciate that various embodiments are capable of being distributed as a program product in a variety of forms and are capable of being applied regardless of the particular type of machine or computer readable media used to actually effect the distribution . a computer readable medium can be used to store software and data which when executed by a data processing system causes the system to perform various methods . the executable software and data can be stored in various places including for example rom , volatile ram , non - volatile memory and / or cache . portions of this software and / or data can be stored in any one of these storage devices . in general , a machine readable medium includes any mechanism that provides ( i . e ., stores and / or transmits ) information in a form accessible by a machine ( e . g ., a computer , network device , personal digital assistant , manufacturing tool , any device with a set of one or more processors , etc .). examples of computer - readable media include but are not limited to recordable and non - recordable type media such as volatile and non - volatile memory devices , read only memory ( rom ), random access memory ( ram ), flash memory devices , floppy and other removable disks , magnetic disk storage media , optical storage media ( e . g ., compact discs ( cds ), digital versatile disks ( dvds ), etc . ), among others . the instructions can be embodied in digital and analog communication links for electrical , optical , acoustical or other forms of propagated signals , such as carrier waves , infrared signals , digital signals , and the like . the present system is also configured for full autonomous operation . a fully autonomous system is a system that measures and responds to its external environment ; full autonomy is often pursued under conditions that require very responsive changes in system state to external conditions or for conditions that require rapid decision making for controlling hazardous situations . the implementation of full autonomy is often costly and is often unable to handle unforeseen or highly uncertain environments . supervised autonomy , with human operators able to initiate autonomous states in a system , provides the benefits of a responsive autonomous local controller , with the flexibility provided by human teleoperators .	1
while the specification concludes with claims defining the features of the invention that are regarded as novel , it is believed that the invention will be better understood from a consideration of the following description in conjunction with the drawing figures , in which like reference numerals are carried forward . referring now to fig1 , a virtual lattice network with ubication bread crumbs 100 illustrates operation of the invention as used by a firefighter when entering a building . as the firefighters or rescuers enter the building , they can decide the first placement of a ubication repeater 101 . the ubication repeater may be enabled merely by pulling the repeater from the user &# 39 ; s fire jacket or , alternatively , by squeezing the bread crumb ubication repeater which would switch it to an active state . repeaters in the invention are referred to as “ ubication ” repeaters since they refer to a quality or state of being in a place , local relation , position or location . the ubication repeater 101 can only be enabled by a firefighter with location capable technology . this enables the firefighter &# 39 ; s two - way radio 102 or other device to convey location information to the ubication repeater 101 as it is activated at its selected location . thus , each repeater is automatically position stamped prior to placement , allowing the ubication repeater 101 to convey its position to both an oncoming firefighter or a central network station 104 . the central network station might typically be located at a command post or at the fire truck located outside the building . this allows information to be reviewed by a rescue intervention team ( rit ) using a heads up display ( hud ) to provide a composite overview of all ubication information in the event there is no visibility within the building . once enabled , the environmental status with position is continuously transmitted or “ chirped ” to the central network station or other firefighter in close proximity to the ubication repeater 101 . this ubication information represents environmental data including but not limited to ambient temperature , air pressure , relative humidity and / or the presence of any harmful airborne chemicals or biotoxins that would be harmful to the firefighter . as the firefighter moves through the building , additional ubication repeaters 103 , 105 , 107 are similarly positioned that will convey position and environmental information to the central network station . the ubication repeaters may be activated as needed in order to cover a predetermined route until the firefighter or rescuer exits the building . any number of ubication repeaters may be used as needed to establish coverage zones within a building , allowing the firefighter the ability to be alerted when approaching a ubication repeater that senses a dangerous condition . since each ubication repeater is not formally networked with other repeaters in a backbone , i . e ., each ubication repeater does not communicate with others to establish communication , only a “ virtual ” network is established with the radio system used by the firefighters . for example , only the central station 104 used for communication by the firefighters would be able to interpret data from all of the ubication repeaters . communication from the ubication repeaters 101 , 103 , 105 , 107 to the central station 104 is achieved through background or manually initiated communication via a firefighter &# 39 ; s radio 102 that is in proximity to a given repeater . thus , when multiple firefighters , operating over a wide area , are periodically passing through multiple ubication repeaters zones enabling updates by the ubication repeater to the central station via the firefighters &# 39 ; radios , the central station is able to obtain a general overview of the operational environment for the area surrounding the repeaters . this enables firefighter command personnel to communicate pertinent information to all or any group of firefighters who may be outside a specific ubication repeater zone , even though any approaching firefighter could be alerted by the ubication repeater directly when in its immediate zone . given that in an emergency situation , a first responder &# 39 ; s ingress and egress routes for a building are often consistent and are vital to personal safety , placement of the ubication repeaters upon initial building entry enables those persons operating at the central station to monitor the overall usability of a vital route within a building , enhancing firefighter safety in a fire or other emergency situation . the wireless communications between the ubication repeater and the firefighter &# 39 ; s portable radio , and communication between the portable radio and the central station can be structured as simply as deemed necessary . for example , a “ bluetooth ” asynchronous connection link ( acl ) could be established between the firefighter &# 39 ; s radio and the ubication repeater during initial position - stamp and placement of the ubication repeater . the firefighter &# 39 ; s radio would then communicate the pertinent information received from the ubication repeater back to the central station on secondary frequencies utilizing the association of public safety communications officials ( apco ) protocol structure , or using asynchronous aloha protocol for very simple applications . if asynchronous collisions between the radio and central station increased beyond an acceptable threshold , synchronous time division multiple access ( tdm ) communication using protocols such as are being made available in the 700 mhz public safety band could be utilized . it will be apparent to those skilled in the art that any number of wireless protocols and technologies could be employed to establish connectivity between the ubication repeater and portable radio , and between the portable radio and the central station without departing from the spirit of this invention fig2 illustrates a block diagram of a ubication bread crumb repeater 200 where a plurality of sensors are used to determine environmental conditions . a first sensor 201 , second sensor 203 are shown connected to a microprocessor 205 that works to interpret incoming environmental data such as temperature , pressure , relative humidity , harmful chemicals or biotoxins . a third sensor 207 or up to n sensors 209 may be used externally with the ubication repeater 200 to provide any needed environmental data to the microprocessor 205 . the ubication repeater 200 further includes a two - way radio transceiver 211 used to communicate information to an external radio transceiver 213 either worn by the firefighter or received by a central network station ( not shown ). the ubication repeater 200 further includes a power - on circuit 215 and a battery 217 allowing it to operate portably with its own internal power supply . fig3 illustrates a front elevational view of the physical model for the ubication repeater 300 . the ubication repeater typically may take the form of a disk - like housing 301 that may be easily worn or carried by a firefighter on his fire jacket or the like . when pulled from the jacket , the firefighter may activate the repeater with a top mounted push button switch 303 . the firefighter might typically position the repeater on the floor of the building where a plurality of feet 305 might be used to hold the ubication repeater in a fixed position . thus , to summarize , a virtual lattice or trail of ad hoc bread crumbs are generated in real time by first firefighter responders as they first enter a building . when each bread crumb ubication repeater is activated , a location stamp is automatically registered between the firefighter &# 39 ; s tactical position via his two - way radio . the ubication repeater is deployed and subsequent repeaters are activated and left at intervals of approximately 50 to 100 meters at the firefighter &# 39 ; s discretion . the stamped location registered at repeater placement during entry is continuously chirped after deployment as the firefighter continues to penetrate the building . small environmental sensors located within the ubication repeater monitor the local ambient environment with reference and real - time calibration . should the environment degrade beyond the environmental stress threshold after placement , a warning signal is chirped along with the location stamp that will alert the firefighter to an environmental danger should that firefighter attempt to egress the building in the manner in which he entered . the bread crumb ubication repeater is a low - cost throwaway solution with very low transmit power which is not interfaced to any backbone network . the information is registered by the individual firefighter when he is in proximity to the ubication repeater which is later decoded by a receiver . the ubication repeater can also be used as a damage assessment module ( dam ) that allows the firefighter to activate the bread crumb and toss the sensor into an unknown room . this allows the firefighter a great deal of versatility , allowing him to verify environment remotely before exposing himself physically to a potential hazard . while the preferred embodiments of the invention have been illustrated and described , it will be clear that the invention is not so limited . numerous modifications , changes , variations , substitutions and equivalents will occur to those skilled in the art without departing from the spirit and scope of the present invention as defined by the appended claims .	0
an embodiment of the invention , being an ice skate 100 ( for the right foot ), is shown in fig1 . ( other embodiments of the invention include , but are not limited to , left ice skates , and inline roller skates .) skate 100 has a skate boot 102 and a skate blade assembly 104 . skate has a skate boot shell 106 , which is shown with a cut - away to reveal the sub - shells 120 , 122 thereof described in further detail below . skate boot 102 also has a skate boot toe cap 108 , a skate boot tongue 110 , a skate boot liner 118 , and skate boot facing 112 . skate blade assembly 104 has a skate blade 114 and a skate blade holder 116 . the skate boot toe cap 108 , skate boot tongue 110 , skate boot liner 118 , and skate blade assembly 104 and their various components are conventional , and their manufacture , assembly , and use are within the knowledge of one skilled in the art of skate design , and will not be described further herein . fig2 shows an exploded view of the ice skate 100 of fig1 , to allow for a better understanding of the various components thereof . referring particularly to skate boot shell 106 , it will be seen that in this embodiment , skate boot shell 106 has two sub - shells , an outer sub - shell 120 and an inner sub - shell 122 . skate 100 also has an associated reinforcing element 124 ( being a conventional molded plastic ankle protector ), a conventional lace bite protector 128 , and a conventional mid - sole 123 ( for securing the skate blade assembly 104 to the skate boot 102 ). skate liner 118 also has conventional foam ankle padding 126 . fig3 shows an exploded view of the boot shell 106 , showing the two sub - shells , outer sub - shell 120 and inner sub - shell 122 . each of outer sub - shell 120 and inner sub - shell 122 have a three - dimensional shape having a heel portion 120 h and 122 h ( respectively ), an ankle portion 120 a and 122 a ( respectively ), a lateral portion 120 l and 122 l ( respectively ), a medial portion 120 m and 122 m ( respectively ), and a sole portion 120 s and 122 s ( respectively ). thus , referring to fig4 , the boot shell 106 itself , when assembled , has a three - dimensional shape having a heel portion 106 h , an ankle portion 106 a , a lateral portion 106 l , a medial portion 106 m , and a sole portion 106 s . outer sub - shell 120 is a vacuum - molded three - dimensional structure made of surlyn ®, made via a conventional vacuum molding technique . outer sub - shell 120 is three - dimensionally shaped ( when molded ) so as to ( when incorporated into boot shell 106 and when boot shell 106 is incorporated into skate 100 ) conform well to the foot of a wearer during use of the skate 100 . various views of the three - dimensional shape of outer sub - shell 120 can be seen in fig6 and 8 . referring to fig5 , which shows outer sub - shell 120 in cross - section , the thickness 120 t of the outer sub - shell 120 can vary from between about 0 . 1 mm to about 5 mm . preferably , the thickness 120 t is between about 0 . 5 mm to about 5 mm , and more preferably between about 1 mm to about 3 mm . the density of outer sub - shell 120 can vary between about 0 . 75 g / cm 3 and about 1 . 1 g / cm 3 . preferably , the density is between about 0 . 85 g / cm 3 and about 1 . 0 g / cm 3 . more preferably , the density is between about 0 . 9 g / cm 3 to about 1 . 0 g / cm 3 . most preferably , the density is between about 0 . 95 g / cm 3 to about 0 . 98 g / cm 3 . inner sub - shell 122 is an injection molded three - dimensional structure made of epp , made via a conventional injection technique ( with resin being injected into and then being allowed to expand in the mold ). inner sub - shell 122 is shaped so as to ( when incorporated into boot shell 106 and when boot shell 106 is incorporated into skate 100 ) conform well to the foot of a wearer during use of the skate 100 . various views of the three - dimensional shape of the inner sub - shell 122 can be seen in fig7 and 9 , showing the assembled boot shell 106 . although not shown , the thickness of the inner sub - shell 122 is generally constant in this embodiment ( although it may vary in others ). preferably , the thickness of the inner sub - shell 122 is between about 1 mm to about 15 mm . more preferably , the thickness of the inner sub - shell 122 is between about 2 mm to about 10 mm . still more preferably , the thickness of the inner sub - shell 122 is between about 4 mm to about 8 mm . yet more preferably , the thickness of the inner sub - shell 122 is between about 5 mm to about 6 mm . most preferably , the thickness of the inner sub - shell 122 is about 5 . 4 mm . the density of inner sub - shell 122 can vary between about 0 . 016 g / cm 3 ( 1 lb / ft 3 ) and about 0 . 32 g / cm 3 ( 20 lb / ft 3 ). preferably , the density is between about 0 . 032 g / cm 3 ( 2 lb / ft 3 ) and about 0 . 16 g / cm 3 ( 10 lb / ft 3 ). more preferably , the density is between about 0 . 80 g / cm 3 ( 5 lb / ft 3 ) and about 0 . 96 g / cm 3 ( 6 lb / ft 3 ). most preferably , the density is about 0 . 83 g / cm 3 ( 5 . 2 lb / ft 3 ). referring to fig3 , inner sub - shell 122 has an outer surface 122 o having a contoured three dimensional shape . outer sub - shell 120 has an inner surface 120 i having a contoured three dimensional shape . the contoured shapes of the outer surface 122 o and the inner surface 120 i are complimentary such that when the inner sub - shell 122 is placed within the outer sub - shell 120 , the surfaces 122 o , 120 i register well in forming the boot shell 106 . further , as can be seen in the figures , both the outer sub - shell 120 and the inner sub - shell 122 are shaped so as to have ridges 120 r , 122 r ( respectively ) on their outer surfaces 120 o , 122 o ( respectively ) to provide reinforcement . the ridge 122 r on the outer surface 122 o of the inner sub - shell 122 is complimentary with a ridge - receiving shape 125 on the inner surface 120 i of the outer - shell 120 , such that they register when the boot shell is formed ; and , together with the ridge 120 r of the outer sub - shell , form boot shell reinforcement ridge 106 r . referring to fig4 , 7 and 9 , when the inner sub - shell 122 is placed within the outer sub - shell 120 to form boot shell 106 , in this embodiment , the entirety of the outer surface 122 o of the inner sub - shell 122 is covered by the inner surface 120 i of the outer sub - shell 120 . boot shell 106 is assembled by first coating the outer surface 122 o of inner sub - shell 122 with a conventional adhesive and then placing inner sub - shell 122 within outer sub - shell 120 . once boot shell 106 is assembled , skate 100 is assembled in a conventional manner with the exception of facing 112 ( which is made of eva ). in skate 100 , ( in contrast with conventional facings ) facing 112 is secured to boot shell 106 via stitching 113 only along the bottom portion of the facing . thus , the majority of the body 117 of facing 112 ( including the eyelets 115 ) neither underlies nor overlies the boot shell 106 and it is not secured to the boot shell . this leaves the majority of the body 117 of facing 112 free to stretch , move , contract , etc . during use of the skate 100 , adding to the skate &# 39 ; s flexibility . referring now to fig1 and 11 , there is shown a second embodiment of the present invention , being skate boot shell 206 ( for a right skate — the full skate has been omitted for ease of illustration since it is otherwise conventional ), which is similar to the skate boot shell 206 with some exceptions . in this embodiment each of the outer sub - shell 220 and inner sub - shell 222 are formed as two halves . thus , outer sub - shell 220 has a right half 236 and a left half 234 . similarly inner sub - shell 222 has a right half 232 and a left half 230 . outer sub - shell 220 has a heel portion 220 h , a part of which is located on right half 236 and a part of which is located on left half 234 . outer sub - shell 220 also has an ankle portion 220 a , a part of which is located on right half 236 and a part of which is located on left half 234 . outer sub - shell 220 also has a medial portion 220 m located on the left half 234 and a lateral portion 220 l located on the right half 236 . outer sub - shell 220 also has a sole portion 220 s , a part of which is located on right half 236 and a part of which is located on left half 234 . inner sub - shell 222 has a heel portion 222 h , a part of which is located on right half 232 and a part of which is located on left half 230 . inner sub - shell 222 also has an ankle portion 222 a , a part of which is located on right half 232 and a part of which is located on left half 230 . inner sub - shell 222 also has a medial portion 222 m located on the left half 230 and a lateral portion 222 l located on the right half 232 . inner sub - shell 222 also has a sole portion 222 s , a part of which is located on right half 232 and a part of which is located on left half 230 . inner sub - shell 222 has an outer surface 222 o ( split across its left half 230 and its right half 232 ). outer sub - shell 220 has an inner surface 220 i ( split across its left half 234 and its right half 236 ). the outer surface 222 o of the inner sub - shell 220 is complimentary with the inner surface 220 i of the outer sub - shell 220 such that the two register well when the sub - shell halves 230 , 232 and 234 , 236 are formed into a whole sub - shell 222 and 220 ( respectively ) and the resultant sub - shells 220 , 220 are assembled into boot shell 206 . outer sub - shell halves 234 , 236 are each a vacuum - molded three - dimensional structure made of surlyn ®, made via a conventional vacuum molding technique . once manufactured , outer sub - shell halves 234 , 236 are secured together at surfaces 243 via any suitable conventional technique ( e . g . bonding , fastening , stitching etc .) to form joint 244 ( in fig1 ) and thus outer sub - shell 220 ( which is otherwise similar to outer sub - shell 120 of the first embodiment , skate 100 ). once manufactured , inner sub - shell halves 230 , 232 are secured together at surfaces 242 via any suitable conventional technique ( e . g . bonding , fastening , stitching , etc .) to form joint 245 ( in fig1 ) and thus inner sub - shell 222 ( which is otherwise similar to inner sub - shell 220 of the first embodiment , skate 100 ). boot shell 206 is then assembled as is described above in relation to the first embodiment , skate 100 . modifications and improvements to the above - described embodiments of the present invention may become apparent to those skilled in the art . the foregoing description is intended to be exemplary rather than limiting . the scope of the present invention is therefore intended to be limited solely by the scope of the appended claims .	0
fig1 is an illustration of exemplary flow 100 , adapted according to one embodiment . exemplary flow 100 may be performed entirely by a health care provider , though one or more actions may be performed by other entities , as explained further below . in block 110 , a recommendation is provided to a patient to participate in an at - home electronically - provided physical therapy regime . for instance , a physician may recommend , refer , dispense , sell , give , or prescribe an at - home electronically - provided physical therapy instruction program to the patient in response to a diagnosis of a physical limitation ( e . g ., back or shoulder pain , foot or leg sprain or pain , work injury , etc .). in another example , an employer may recommend , give sell , or provide an at - home electronically - provided physical therapy instruction program to the employee , or the patient may be referred by a physician to a physical therapist who then provides , sells , dispenses , gives , or utilizes an at - home electronically - provided physical therapy program as part of a proposed therapeutic regimen . in the present embodiment , the recommended physical therapy program is not the conventional out - patient or in - patient physical therapy regimen that is typically performed at a facility . instead , the present embodiment includes a regimen that can be completed remotely from conventional in - or out - patient therapy at home by the patient using standard home technology , such as a television , dvd player , blu - ray player , gaming console , or computer , or combination thereof . it is an advantage of some embodiments that some patients may feel more comfortable at home and more appreciative of the lower - cost and substantial time - savings of the home option , thereby inviting at least a subset of patients to get involved and stay involved with the regimen . this can advantageously reduce recidivism , recurring or chronic pain , etc . through at least increased compliance , or even completion , of recommended physical therapy . in block 120 , the patient is provided access to the electronic - media - based physical therapy instruction resources . in one example , the physician may sell access in his or her office by dispensing or providing a disc to the patient or signing the patient up for on - line services . in another example , the physician may give the patient a prescription ( or “ script ”) for the physical therapy program , and the patient then goes to a third party , such as a pharmacy , a company store at an employer , a retail store , or an on - line retailer , to get access to the electronic - media - based physical therapy instruction resource ( s ). block 120 may include being reimbursed for the electronic - media - based physical therapy instruction resources . for instance , the physician or third party may receive payment for providing access to the resources . in some instances , insurance may cover all or a part of the patient &# 39 ; s access to the resources , e . g ., there may be a small or no co - pay as a financial incentive by the insurance company to encourage patients to comply with a healthcare - professional - recommended physical therapy regimen . in block 130 , a health - care provider may track the patient &# 39 ; s progress in the physical therapy regimen . in one example , the patient &# 39 ; s participatory information may be available electronically and / or inferable from a subsequent physical exam , such as increased time between visits , fewer visits for pain management , decreased analgesic medication usage , or actual improvement in the condition being treated or managed . fig2 is an illustration of exemplary flow 200 , adapted according to one embodiment . flow 200 is from the perspective of a patient . in block 210 , the patient accesses the electronic - media - based physical therapy regimen instruction resources . block 210 may include using any of a variety of household technology to execute computer - readable data and provide a user interface with instructions for exercises . in one example , the patient inserts an optical disc into a digital video disc ( dvd ) player or blu - ray player , and the physical therapy regimen instructions are displayed on a television , projected , or on a computer monitor similarly to a movie . in another example , the patient inserts a computer - readable medium into a computer , and the computer provides interactive instructions to the patient . in yet another embodiment , the patient inserts a disc or other medium into a gaming console ( e . g ., wii ™ or x - box ™), and the gaming console provides interactive physical therapy instructions through its typical input components , such as a camera and motion sensors , a device including one or more accelerometers , or any combination thereof , and , for example , a connected television . in any embodiment , it is possible to provide some or all of the computer - readable code via a network rather than by a disc or other physical medium . in fact , some embodiments include access through a smartphone , television , or other device with specialized network applications (“ apps ”). various embodiments are not limited by any particular technique for accessing the electronic - media - based resources . in block 220 , the patient participates in the physical therapy program . in one example , the patient adheres to a suggested regimen that lasts , e . g ., around six to eight weeks and includes exercises to focus on particular physical limitations . the physical therapy program may be interactive , with intelligent , real - time feedback , or may be non - interactive with the patient keeping track of his or her own progress . in certain embodiments , the physical therapy program can increase in difficulty over time , or be based on real - time feedback or patient - selected increases in difficulty . fig3 is an illustration of exemplary flow 300 , adapted according to one embodiment . flow 300 shows the actions taken by some interactive embodiments , though it is understood that other embodiments may not be interactive . in block 310 , instructions for the physical therapy regimen are presented to the user via a display . the physical therapy regimen includes exercises that are indicated for treatment of physical limitation . the instructions may be presented to the user as an audio and video experience , though the scope of embodiments is not limited to a particular type , or combination of types , of media . examples of instructions include a human image or computer graphic avatar performing exercises and encouraging the patient to complete the exercises by following the image or avatar . furthermore , some embodiments include an avatar of the patient to encourage the patient , illustrate exercises , and / or guide the patient through the program . this user avatar may be alternatively or additionally to an avatar instructor . in some embodiments , other sensory inputs , such as tactile inputs via a handheld controller , may be provided to the user as well . in block 320 , data is received from a user interface device that indicates physical movements and / or feedback of the patient . in one example , the patient holds a motion - sensing controller and / or stands on a weight / balance sensing device . in another example , the patient stands in front of a camera that monitors the patient &# 39 ; s motion . in a third example , the patient responds to an inquiry from the program through the use of a keyboard , controller or by speaking . in all three examples , the interface hardware sends signals to a computer processor that are indicative of the patient &# 39 ; s motion and / or feedback . various embodiments are not limited by any particular interface hardware , as other interface hardware now known or later developed may be adapted for use in association with some embodiments . in block 330 , the data from the user interface device is analyzed to discern patient achievement within the physical therapy regimen . for instance , the computer processor analyzes the data in real time to determine whether the user is at least approximating the movements of the exercise or whether the user is having difficulty with the exercise based upon the user &# 39 ; s feedback . the computer processor may also generate cumulative scores and health data as the patient participates over time . in block 340 , subsequent exercises are selected for the patient based at least in part on the analyzed data . for instance , the patient &# 39 ; s approximation of the movements of the exercise can be an indication as to whether more repetitions of the exercise are appropriate or whether the patient needs more instruction on performing the exercise or more exercises at that level to be better prepared for handling increased repetitions or complexity of exercise . also , a patient &# 39 ; s performance and / or their feedback in one exercise may be used to determine whether the patient should move on to a different exercise and which different exercises are appropriate . blocks 310 - 340 illustrate a feedback loop where the patient receives instructions , performs movements in response to the instructions , and subsequent instructions are affected by the patient &# 39 ; s performance and / or feedback in this embodiment . there is also an electronic feedback loop where the user interface devices provide patient movement data to the computer processor , which instructs the patient to move and cause the user interface devices to generate further data . when implemented via computer - executable instructions , various elements of embodiments are in essence the software code defining the operations of such various elements . the executable instructions or software code may be obtained from a tangible readable medium ( e . g ., a hard drive media , optical media , ram , eprom , eeprom , tape media , cartridge media , flash memory , rom , memory stick , network storage device , and / or the like ). in fact , readable media can include any medium that can store information . fig4 illustrates an example computer system 400 adapted according to one embodiment . that is , computer system 400 comprises an example system on which embodiments may be implemented ( such as a computer , a smartphone , or a gaming console ). central processing unit ( cpu ) 401 is coupled to system bus 402 . cpu 401 may be any general purpose or specialized purpose cpu . however , the present invention is not restricted by the architecture of cpu 401 as long as cpu 401 supports the inventive operations as described herein . cpu 401 may execute the various logical instructions according to embodiments . for example , one or more cpus , such as cpu 401 , may execute machine - level instructions according to the exemplary operational flow described above in conjunction with fig3 . computer system 400 also preferably includes random access memory ( ram ) 403 , which may be sram , dram , sdram , or the like . in this example , computer system 400 uses ram 403 to store data and instructions as it executes code to perform actions illustrated in fig3 . computer system 400 preferably includes read - only memory ( rom ) 404 which may be prom , eprom , eeprom , or the like . ram 403 and rom 404 hold user and system data and programs , as is well known in the art . computer system 400 also preferably includes input / output ( i / o ) adapter 405 , communications adapter 411 , user interface adapter 408 , and display adapter 409 . i / o adapter 405 , user interface adapter 408 , and / or communications adapter 411 may , in certain embodiments , enable a user to interact with computer system 400 in order to input information , such as selecting a particular exercise . i / o adapter 405 , user interface adapter 408 , and / or communications adapter 411 may also receive data on the user &# 39 ; s movements and feedback to prompts and provide that data to cpu 401 . i / o adapter 405 preferably connects to storage device ( s ) 406 , such as one or more of hard drive , compact disc ( cd ) drive , floppy disk drive , tape drive , etc . to computer system 400 . the storage devices may be utilized when ram 403 is insufficient for the memory requirements associated with storing multi - media data . communications adapter 411 is preferably adapted to couple computer system 400 to network 412 ( e . g ., the internet , a lan , a cellular network , etc .) to , e . g ., receive computer - readable code that embodies all or a portion of a physical therapy instruction computer program . user interface adapter 408 couples user input devices , such as keyboard 413 , pointing device 407 , and microphone 414 and / or output devices , such as speaker ( s ) 415 to computer system 400 . display adapter 409 is driven by cpu 401 to control the display on display device 410 to , for example , display a human user or avatar during physical therapy . while fig4 shows a general - purpose computer , it should be noted that the exact configuration of a portion of a system according to various embodiments may be somewhat different . for example , the same basic architecture is adapted into smaller or more specialized forms for gaming consoles and smartphones . in the cases of gaming consoles and smartphones , the user interface devices may include motion sensing controllers , touch screens , and / or the like . moreover , embodiments may be implemented on application specific integrated circuits ( asics ) or very large scale integrated ( vlsi ) circuits . in fact , persons of ordinary skill in the art may utilize any number of suitable structures capable of executing logical operations according to various embodiments . patients can access electronic - media - based physical therapy instruction resources through any market channel , including the following four examples . first , national and regional healthcare insurance companies ( hics ) are aggressively seeking to cut the utilization expenses of their millions of covered lives through preventative measures and less costly therapeutic options . present high cost expenditures include but are not limited to healthcare provider visits , emergency room visits , physical therapy , medications , injections , other pain management services , and surgery . partners / distributors such as kaiser permanente , blue cross / blue shield , aetna , and other commercial insurers , as well as governmental programs such as medicare and medicaid are interested in broadly disseminating a comparatively lower cost therapeutic program throughout their insurance networks . in some embodiments , hics provide access to electronic - media - based physical therapy instruction resources by , e . g ., providing , as covered a benefit , a disc to a patient , providing web access to the resources , and / or the like . second , healthcare providers ( hcps ) are another market channel through which patients may access resources . there are thousands of hcps who are experiencing diminishing annual income , e . g ., due to recent healthcare payment changes . many hcps are presently seeking additional sources of income in their practices and would utilize a product that provides additional income to them while providing accessible and affordable treatment options to their patients . examples of hcps include , but are not limited to , physicians , physician specialties of primary care , orthopedics , occupational medicine , physiatrists , neurosurgeons , pain management specialists , neurologists , and rheumatologists , as well as chiropractors , nurses and nurse practitioners , physical therapists , and the like . in one example , a hcp sells , dispenses , or gives a disc directly to a patient , or instructs the patient to go to a third party ( or provides a prescription to be filled by a third party ), such as a pharmacy , drug store , retail establishment , or website to receive the electronic - media - based physical therapy instruction resources . in some scenarios , hcps may receive a profit from sales or distribution of the electronic - media - based physical therapy instruction resources . third , large organizations are yet another marketing channel encompassed by the present disclosure . governmental organizations and large corporate employers responsible for servicing vast numbers of individuals typically have a need to provide lower - cost but effective health care options . in fact , many large employers often seek low - cost options for employee injury treatment . in some examples , a large organization may give a disc directly to a patient or employee , recommend this disc be dispensed by their contracted or employed healthcare practitioners , or instruct the patient to go to a third party , such as a pharmacy , drug store , retail establishment , or website to receive the electronic - media - based physical therapy instruction resources . in some scenarios , organizations may receive volume discounts for large orders of the electronic - media - based physical therapy instruction resources . fourth , many individuals will be interested in obtaining the program outside of the aforementioned channels and may self - direct purchase of the product for themselves , relatives , friends or others . if they are unable or unwilling to gain access through the aforementioned channels , they will have the option of buying electronic - media - based physical therapy instruction resources directly through a number of channels , including , but not limited to , websites ( e . g ., by mail order , streaming , etc . ), pharmacies ( e . g ., by dvd , audiovisual cd for computer , etc . ), drug stores , retail establishments , health care providers ( e . g ., doctor &# 39 ; s office , testing / diagnostic lab , etc . ), health clubs , gyms , and infomercials . the electronic - media - based physical therapy instruction resources can be offered in any number of forms . in one example , resources are sold in discrete units ( e . g ., discs , downloadable files ) that are targeted at single , specific body areas . examples of resources that focus on single areas are back , hip , shoulder , knee , neck , wrist , foot , ankle , joints and muscles , and areas affected by fibromyalgia . in some instances , the resources include a core component of generalized and comprehensive exercises of importance that are central to sustainable health and fitness . a physical therapy regimen provided by electronic - media - based physical therapy instruction resources may include one or more of the following features . the scope of embodiments is not so limited , as any number of features for treatment of physical limitations may be included . in one example , a regimen is a 4 to 12 week , optionally a 6 - 8 week , program that is similar to a course of traditional physical therapy , with the option for the individual to progress as they are able and with elements for maintenance . however , any length is possible for a given program depending on the physical therapy needed to manage or treat the condition , optionally but preferably as monitored by a subsequent visit to a healthcare provider if relevant . some programs include a module for “ assessment of capabilities ” and appropriateness of participation . examples include questionnaires , real - time performance analysis , feedback , or combinations thereof that estimate a patient &# 39 ; s capabilities . such module may also query to determine specific reasons for participation and goals for each patient . furthermore , the module may also include a body mass index ( bmi ) assessment or other general health measures and goals for a patient to explore if desired . if the assessment identifies the need for weight loss , then separate promotional information , products and resources can be offered as part of the program . this may be particularly the situation for embodiments where the physical therapy regimen is focused on upper back , lower back , foot , ankle , knee , leg , neck , or hip - related pain . interactions preferably include a high degree of positive reinforcement and encouragement to prolong participation and enhance effectiveness . various embodiments may also include interval assessment of progress and achievement of goals that can be accessed by the patient and / or other entities , such as hcps , insurance companies , and large organizations . for instance , some embodiments include an option to track progress online so the data analysis can be utilized for further enhancement , marketing and sales , determination of credibility , corporate utilization , and insurance coverage benefits . there are a wide variety of physical therapy exercise programs that can be constructed based upon a set of possible exercises . in one example , the programs include a core or fundamental exercise program , which encompasses the total body to provide stretching , strengthening , conditioning , and maintenance with the following emphases : yoga , tai chi , stretch , mild cardio exercise , and preferably combinations thereof . and in another example , there is provided specific body area exercise resources , such as regimens directed to lower backs , knees , shoulders , hips , wrists , necks , foot and ankle , musculoskeletal and joint , and fibromyalgia among others . any given program may be tailored to functional restoration through flexibility enhancement , strength enhancement , fitness enhancement , and weight loss . exercises can be loosely categorized by type . examples of types include , e . g ., warm - up / cool - down , stretching , rehabilitative , flexibility ( e . g ., pilates ), movement ( e . g ., yoga , tai chi ), strength ( e . g ., upper body , lower body , core , etc . ), toning , and cardio fitness . there is cross - over of exercises into types , and most exercises can have differing degrees ( levels ) of difficulty . some exercises are preferably performed independently on both sides of the body , or optionally one side depending on the condition or body part ( s ) being addressed . workout routines may have a broad set of options , as depicted in fig5 . routine 510 includes a fixed sequence of fixed exercises . routine 520 includes a fixed sequence of level - based exercises . routine 530 includes a variable sequence of fixed exercises . routine 540 includes a variable sequence of level - based exercises . exercises can be mixed and matched as appropriate for any given patient &# 39 ; s treatment . exercises and curriculum are preferably developed in conjunction with respected , credible , e . g ., peer - qualified hcps in specialties of orthopedics , physiatry , neurosurgery , occupational medicine , pain management , chiropractic and physical therapy . the acumen and expertise of the hcps may be used to create resources that are directed at treating physical impairments , pain , and / or disorders of the lumbar spine , cervical spine , knee , hip , shoulder , wrist , foot , ankle , and other particular joint or muscle injuries , fibromyalgia , or other conditions . in some embodiments , each patient progresses through increasing difficulty levels as the patient improves and becomes more capable . some embodiments also offer patients the ability to skip some exercises if needed due to impairment , lack of time , or improvement of a particular ability , thereby allowing patients some customization of their regimens . furthermore , in order to keep patients involved , encouraged , and not pushed beyond their physical limits , each body area program preferably lasts no greater than about 35 - 40 minutes , though different lengths are possible in other embodiments . there are options for physical therapy with and without equipment . examples of equipment include , but are not limited to , resistance bands , body bands , yoga mats , yoga blocks , inflatable exercise balls , exercise roller wheels , low weight dumbbells / wrist and ankle weights , push up assistive devices , hot packs , cold packs , support garments for lower backs and knees , pain relief gels , recovery drinks , nutritional meals and supplements , weight loss programs , and the like , typically equipment that is present or readily available for home use . the electronic - media - based physical therapy instruction resources offer an opportunity for upsale to other products or other exercise / fitness programs , which is an additional revenue generator for the creator of the resource as well as for other entities that might supply the equipment . examples of other materials include , but are not limited to , a product guide which will provide information about the product , help elicit and define the end user &# 39 ; s motivations and reasons for participation in the product , educate and describe the products therapeutic objectives , instruct the end user in the use of the product and program , and provide an explanation of the product &# 39 ; s efficacy . an assessment guide and recommended tests may also be included to determine baseline physical degree of impairment and appropriate level of participation . the assessment guide may be accompanied by an online test collection of results for later analysis and use by hcps and other entities . some examples additionally include an assessment of end user objectives and goals through a formatted questionnaire . other materials may include a program schedule , a nutrition guide , website forums , opportunities to buy or rent equipment , other educational resources , and the like . the electronic - media - based physical therapy instruction resources can be used on a variety of platforms , including , for example : pcs attached to tv sets / monitors , connected to the internet , running hosted software any streamable portable device , including without limitation a cell phone , tablet device , laptop , netbook , etc . regarding any streamable device or other internet connected device , the connectivity may be wired , wireless , radio frequency , cellular data , sms , satellite , or any other type of internet connection available . also , there are varying degrees of interaction with the user . dvd systems are generally not very interactive , whereas computer - based systems and game console - based systems are generally more interactive . platforms with such interactive intelligence , including web - based platforms with real - time or periodic human input , query the patient , adjust the workouts accordingly , interact on an individual basis , and record performance , amongst other capabilities . platforms with interactive feedback monitor the patient in real - time , giving constant feedback on how well the patient is performing the exercise routines . the scope of embodiments includes multiple products with different levels of interaction , where examples of the products include , but are not limited to : various embodiments include one or more advantages over conventional physical therapy . in one aspect , the electronic - media - based physical therapy instruction resources preferably : 1 ) increase compliance with a medically recommended or prescribed treatment plan and 2 ) decrease the recidivism of functional impairment and pain and 3 ) decrease the requirement for additional healthcare utilization through a sustainable maintenance program . furthermore , some embodiments provide comparatively lower cost option compared to present physical therapy options , optimal and flexible scheduling for participation as time of day is entirely end user determined , and elimination of the need for transportation to / from a physical therapy center . moreover , the ability to use the physical therapy instruction resources in the home provides an enjoyable and convenient environment that users are able to utilize daily without an associated per visit / treatment cost that is typically associated with traditional physical therapy programs . in various embodiments , there is a creating party behind the physical therapy instruction resources . an example is a person or company designing , programming , and / or distributing the physical therapy resources . in one other embodiment , the creating party designs , programs , and distributes one or more physical therapy resource ( s ). in this example , however , the creating party is the originator of the resources and provides the resources to a hcp , a hic , a government or private employer , or directly to the end - user or through a third party such as a pharmacy . an originating party may also include a person or company who purchases the rights to distribute the resources from a creating party . further in this example , the originating party acts a resource , either directly to the patient , or through a third party , such as a hcp , an hic , or an employer . for instance , the originating party may have a website and / or phone line set up to assist patients and / or third parties and to generally facilitate the provision and use of the resources . for instance , the originating party may have network resources that track progress of individual patients and then report on the progress to the patients themselves and / or to employers , hcps , hics . in fact , in some instances , the originating party may act as a resource to both the patient ( by providing the resources ) and the employer / hcp / hic by reporting on progress and status . in some instances , the electronic resources that the patient uses manually or automatically report on the patient &# 39 ; s progress . the employer / hcp / hic then uses a web portal or other electronic resource to receive the reporting . the originating party may also act as a reference for education for patients and prospective patients through , for example , a web portal or other media . education may focus on physical therapy generally , one or more specific body parts , pain , success , etc . some embodiments also include the originating party offering personal interaction to the patients , either in - person or electronically . for instance , an originating party may be affiliated with service providers around the country or around the world . in one example , the originating party has a network of physical therapists available for phone consultations , video consultations , in - person visits , and / or the like . in fact , any type of health service provider , such as a physical therapist , md , chiropractor , etc ., may be affiliated with the originating party to supplement the electronic resources . in some instances , the network of health service providers may be geographically linked so that patients may be referred to local or regional health service providers . referrals may be made in any manner , including by a web resource of the originating party ( e . g ., sites to “ find a physical therapist in your area ,” “ find a chiropractor in your area ,” etc .). furthermore , the patient may receive access to the network of health service providers included in a set of services with the electronic resources , a la carte , or in any other manner . the network of health services may provide one or more of any of the following services : one - on - one time with patients , personalized tailoring of regimens , patient follow - up , patient analysis , patient confidence building , patient education , etc . the originating party may receive payment in any of a variety of ways , including directly from a patient and / or through a employer / hcp / hic . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , system , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , systems , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps .	6
fig1 is a top plan view of a seven gang mower unit carried on a trailer 11 pulled by an industrial or farm type tractor 13 . a hydraulic pump and reservoir unit 15 is mounted on a frame 17 which is attached to the three point hitch 18 of the tractor . the trailer 11 is intended for supporting reel mowers 19 which are hydraulically driven and are of the type having front caster wheels 21 and a rear roller 23 . each reel mower is driven by an independent hydraulic motor 25 . the trailer 11 includes a u - shaped frame 31 with its open end extending in the forward direction of the trailer . the frame has longitudinally extending side members 33 joined by an end cross member 35 at its rear . rearwardly and outwardly diagonally extending beams 37 are connected intermediate their ends to the forward ends of the longitudinally extending side members 33 . front cantilever beams 39 extend upwardly and laterally outwardly from the longitudinal side members 33 and are fastened to the rearward ends of the diagonal members 37 . rear cantilevered beams 41 extend upwardly and laterally outwardly from the longitudinally extending side members 33 in alignment with the end cross member 35 . a wheel support beam 43 is mounted on plates 45 which are supported on the longitudinally extending side members 33 of the frame . the beam extends beyond the side members 33 and spindles 47 which are attached to opposite ends of the wheel support beam have wheels 49 rotatably mounted thereon . three of the mowers 19 are fastened to the frame 31 generally inside the dimensions of the frame with each attached by an arm 53 which is pivotally mounted to the frame for up and down movement . each arm is connected to a mower by a ball connector 55 . the two mowers 19 which are carried behind the trailer are each connected to a mower arm 57 by a ball joint 59 . each mower arm 57 is pivotally connected at its inner end to an arm 61 extending at right angles thereto which arm in turn is pivotally mounted to the frame 31 for rotation about a horizontal axis at 63 . the side mowers 19 are connected to the outer ends of irregularly shaped side mower arms 67 which arms are fastened to tubes 69 mounted in sleeves 71 . sleeves 71 are supported at the ends of the front and rear cantilever beams 39 and 41 , respectively . the mowers are connected to the side mower arms 67 by ball connectors 73 . the ball connectors 73 generally align with the wheel support beam 43 and the wheel spindles 47 to provide stability for the trailer during lifting and lowering of the mowers mounted on the arms 67 . the positioning of the mowers relative to the frame 31 applies most of the weight to the support beam 43 and thus to the wheels 49 and not to the trailer 13 . the hydraulic system for raising and lowering the mowers 19 is shown in detail in fig3 and will be described hereinafter . for clarity of illustration , many of the details of the mower lifting system have been omitted from these drawings but the system is similar to that shown and described in u . s . pat . no . 3 , 832 , 835 assigned to the same assignee as this specification . the trailer 11 may be connected to the frame 17 of the hydraulic pump and reservoir unit 15 which is mounted on the tractor 13 by a tow bar assembly 77 shown in enlarged detail in fig2 of the drawings . the tow bar assembly includes a pair of upstanding plates 79 which are located at opposite ends of a cross plate 81 . two rows of openings 83 are formed in each of the plates 79 . the openings are sized to receive bolts ( not shown ) which also fit in openings ( not shown ) in angles 85 attached to the forward ends of the diagonal members 37 of the frame 31 . the rows of openings permit vertical adjustable attachment of the tow bar assembly relative to the trailer 11 . a tube 87 extends in a forwardly direction from the cross plate 81 and is fastened thereto . the eye 89 of a spring loaded bolt extends out of the tube 87 and is fastened by a pivot pin 91 to a bracket 93 which is in turn fastened by a pivot pin 95 to the frame 17 . the spring loaded bolt which moves in and out of the tube 87 permits the tractor to make a turn of 90 ° relative to the trailer without permitting the tractor to strike the trailer . a hose support 97 is pivotally mounted in an upstanding position on the tube 87 . the hose support includes a rectangularly shaped opening 99 for receiving the hydraulic mower hoses ( not shown ) and a stirrup portion 101 for supporting the hydraulic cylinder hoses shown in fig3 . a trailer parking wheel 103 which can be raised and lowered is mounted on one of the rearwardly extending diagonal members 37 of the trailer frame . fig3 of the drawings shows the hydraulic system for operating the hydraulic cylinders which raise and lower the hydraulic driven mowers 19 carried on the trailer 11 . the pressurized hydraulic fluid for operating the hydraulic cylinders is provided from the hydraulic system of the tractor 13 by means of hydraulic hoses 107 having quick connect and disconnect fittings 109 . the hoses 107 connect to lever operated ganged spool valves 111 which are mounted in a housing 113 . the housing is supported on a tubular post 115 . the tubular post 115 telescopes inside a tubular socket 117 which is supported on a frame 119 . the frame 119 is mounted on the hydraulic pump and reservoir unit 15 . a removable locking pin ( not shown ) extends through alignable openings in the tubular post 115 and tubular sockets 117 to secure the spool valve housing 113 in proper position . hydraulic hoses 121 extend from the spool valves 111 to a support block 123 mounted on a cross beam 125 of the trailer frame 31 . hydraulic hoses 127 lead from the support block 124 to the individual hydraulic cylinders 129 which are pivotally mounted on the longitudinally extending side members 33 and end cross member 35 of the trailer frame 31 . since there are five hydraulic cylinders 129 , there are five lever operated spool valves 111 and ten sets of hydraulic hoses 121 and 127 with a set of hoses leading to each hydraulic cylinder . when the trailer 11 is to be disconnected from the tractor 13 , it is only necessary to disconnect the two hydraulic lines 107 leading from the tractor hydraulic power supply to the housing 113 containing the handle lever operated spool valves 111 . since the hydraulic fluid lines 107 from the tractor have quick disconnect fittings 109 , this is easily accomplished . the pin holding the tubular post 115 in place in the tubular socket 117 is removed and the housing 113 is lifted from the socket 117 carrying its hydraulic hoses 121 along with it . a tubular socket 131 identical to the tubular socket 117 is provided on the frame 31 of the trailer 11 to receive the tubular post 115 and thereby support the housing 131 , spool valves 111 and hoses 121 on the trailer 11 . thus , the hydraulics applied to the hydraulic cylinders 129 can be disconnected and connected simply by disconnecting or connecting two hoses 107 rather than the ten hydraulic hoses 121 which normally would have to be manipulated .	0
in conventional backpacks , comfort is not optimized even when comfort - enhancing features are incorporated into the backpack . the novel arrangement , positioning , and dimensions of features in the ergonomic backpacks with enhanced fit described in this application provide a user with optimal fit and comfort . fig1 - 6 illustrate examples of the present invention designed as unisex backpacks . fig7 - 8 illustrate examples of the present invention designed specifically for women . fig1 illustrates an ergonomic backpack with enhanced fit 100 . backpack 100 includes a storage portion 102 that includes one or more compartments capable of storing cargo . storage portion 102 has a top side 104 , a bottom side 106 , a left side 108 , and a right side 110 . when backpack 100 is worn by a user ( as illustrated in fig2 - 3 ), top side 104 is nearer to the user &# 39 ; s head than bottom side 106 , bottom side 106 is nearer to the user &# 39 ; s legs than top side 104 , left side 108 is nearer to the user &# 39 ; s left shoulder than right side 110 , and right side 110 is nearer to the user &# 39 ; s right shoulder than left side 108 . storage portion 102 is connected to a first end 112 of a primary left shoulder strap 114 along a first connection area 116 . first connection area 116 is on the top and left side of storage portion 102 . storage portion 102 is also connected to a first end ( not shown ) of a primary right shoulder strap 118 along a second connection area ( not shown ). the second connection area is on the top and right side of storage portion 102 . secondary left shoulder strap 120 is attached at a first end 122 to the bottom and left side of storage portion 102 . secondary left shoulder strap 120 is also connected to a second end 124 of primary left shoulder strap 114 . similarly , secondary right shoulder strap 126 is attached at a first end 128 to the bottom and right side of storage portion 102 . secondary right shoulder strap 126 is also connected to a second end 130 of primary right shoulder strap 118 . fig1 illustrates buckles 132 and 134 connecting primary left shoulder strap 114 and primary right shoulder strap 118 to their respective secondary shoulder straps . any number of connecting devices or techniques may be used to facilitate these connections . in some examples , the connections are detachable and / or adjustable . fig2 illustrates ergonomic backpack with enhanced fit 100 while being worn by a user 200 . primary left shoulder strap 114 is worn over the user &# 39 ; s left shoulder 202 , and primary right shoulder strap 118 is worn over the user &# 39 ; s right shoulder 204 . to better illustrate some of the novel features of the invention , fig3 - 8 show examples of an ergonomic backpack with enhanced fit with the primary and secondary shoulder straps not connected and the primary straps raised such that they extend upward and away from the body of a user wearing the backpack . as stated above , in some examples the primary and secondary shoulder straps may be detachable . fig3 - 8 are also intended to illustrate examples in which the primary and secondary shoulder straps are not detachable , even though the primary and secondary straps are shown not connected for illustration purposes . fig3 illustrates a user 300 wearing ergonomic backpack 100 . a dashed line represents a vertical plane 302 extending through the body of user 300 . primary right shoulder strap 118 and primary left shoulder strap 114 ( not shown ) are raised such that primary right shoulder strap 118 and primary left shoulder strap 114 extend upward from the body of user 300 and are substantially parallel with vertical plane 302 . primary right shoulder strap 118 and primary left shoulder strap 114 also extend away from the center of backpack 100 when the primary straps are in this position , as is clearly illustrated in fig4 - 8 . fig3 is intended for illustration purposes . it should be appreciated that gravitational force would cause backpack 100 to fall off of user 300 if user 300 attempted to wear backpack 100 with the primary straps in a raised , substantially vertical position as shown . fig3 establishes a frame of reference for a more complete discussion of the novel features of backpack 100 in subsequent figures . fig4 is a plan view of backpack 100 looking at the surface of backpack 100 that rests against a user &# 39 ; s back . primary shoulder straps 114 and 118 are raised to a substantially vertical position as shown in fig3 . secondary shoulder straps 120 and 126 are also shown , and storage portion 102 is shown as a dotted line so as to not distract from the explanation of novel features of backpack 100 . as discussed with regard to fig1 , first end 112 of primary left shoulder strap 114 is connected to storage portion 102 along first connection area 116 . first end 402 of primary right shoulder strap 118 is connected to storage portion 102 along second connection area 404 . first connection area 116 and second connection area 404 are each spaced approximately the same distance from a substantially vertical bisecting line 406 extending through backpack 100 from top side 104 to bottom side 106 . first connection area 116 and second connection area 404 are substantially collinear with a substantially horizontal line 408 extending across top side 104 of backpack 100 . primary left shoulder strap 114 connects to first connection area 116 and primary right shoulder strap 118 connects to second connection area 404 at substantially equal angles relative to substantially horizontal line 408 . in some examples , the material comprising primary shoulder straps 114 and 118 extends beyond connection areas 116 and 404 and along the surface of storage portion 102 and may meet at approximately substantially vertical bisecting line 406 , as indicated by dotted lines in fig4 . in other examples , primary straps 114 and 118 end at connection areas 116 and 404 or extend a different length and / or geometry along storage portion 102 . primary left shoulder strap 114 , primary right shoulder strap 118 , and substantially horizontal line 408 are all tangential to a first circle 410 having a radius 412 of approximately between 8 and 12 centimeters . first circle 410 is substantially parallel to vertical plane 302 shown in fig3 . in one example , radius 412 measures approximately 10 centimeters . primary left shoulder strap 114 and primary right shoulder strap 118 curve away from substantially vertical bisecting line 406 at between approximately one - third to two - thirds of the length of each strap , the curve being substantially equal to the curve of an arc 414 of a second circle 416 having a radius 418 of approximately between 7 and 11 centimeters . arc 414 measures approximately between 25 and 45 degrees . in one example , radius 418 measures approximately 9 . 5 cm . in another example , arc 414 measures approximately 36 degrees . as used herein , an arc measurement of a certain number of degrees is defined by the angle whose sides are extended until the circumference of the circle is intersected . for example , when a 36 - degree angle &# 39 ; s sides are extended to the circumference of a circle from the center , the portion of the circumference between the extended sides is a 36 - degree arc . fig4 shows primary shoulder straps 114 and 118 as having the same amount of curve . in other examples , the curve could vary slightly to account for an individual &# 39 ; s physique . primary shoulder straps 114 and 118 may be of varying width . a range of desirable widths is shown in fig4 , with the white areas representing the minimum desired width of each strap and the gray areas representing the maximum desired extent for optimal comfort . as illustrated , the width of each strap may vary within the range of approximately 2 centimeters and approximately 12 centimeters . as noted in some examples below , however , variation to greater and / or lesser widths do not depart from the scope of the present invention . in one example , at the area where the straps attach to storage portion 102 , the minimum desired width of each strap is approximately 3 centimeters , and the maximum desired width is approximately 8 centimeters . in another example , at the second ends of the primary shoulder straps where the primary straps connect to the secondary straps , the minimum desired width of each strap is approximately 1 centimeter , and the maximum desired width is approximately 5 centimeters . in a further example , at the area where the straps attach to storage portion 102 , the minimum desired width of each strap is approximately 4 . 125 ( 4 and ⅛ ) centimeters , and the maximum desired width is approximately 4 . 75 ( 4 and ¾ ) centimeters . in still a further example , at the second ends of the primary shoulder straps where the primary straps connect to the secondary straps , the minimum desired width of each strap is approximately 1 . 375 ( 1 and ⅜ ) centimeters , and the maximum desired width is approximately 3 . 5 ( 3 and ½ ) centimeters . the specific strap width selected can vary depending upon the activity for which backpack 100 is designed , anticipated size of the user , mobility concerns , anticipated clothing that will be worn under the backpack , and other considerations . as shown in fig4 , the minimum desired strap width tapers from widest at connection areas 116 and 404 to narrowest where primary shoulder straps 114 and 118 connect to secondary shoulder straps 120 and 126 . although not shown in the figures , a sternum strap and / or waist strap may be included in backpack 100 . in examples including a sternum strap , the sternum strap may attach to primary shoulder straps 114 and 118 from approximately where primary shoulder straps 114 and 118 begin to curve to second ends 124 and 130 of primary shoulder straps 114 and 118 . the maximum desired extent 420 of bottom side 106 of storage portion 102 is approximately 55 centimeters in the vertical direction from substantially horizontal line 408 . in one example , maximum desired extent 420 is approximately 50 centimeters . the first ends 122 and 128 of secondary shoulder straps 120 and 126 attach to storage portion 102 at a minimum desired vertical distance 422 of approximately 35 centimeters from substantially horizontal line 408 . in one example , minimum desired vertical distance 422 is approximately 39 centimeters . in another example , minimum desired vertical distance 422 is approximately 38 . 8 centimeters . it is appreciated that approximately 38 . 8 centimeters can be considered to be approximately 39 centimeters . the vertical distance 424 between substantially horizontal line 408 and both the midpoint of second end 124 of primary left shoulder strap 114 and the midpoint of second end 130 of primary right shoulder strap 118 is approximately between 20 and 35 centimeters . in one example , vertical distance 424 measures 28 centimeters . the horizontal distance 426 between the midpoint of second end 124 of primary left shoulder strap 114 and the midpoint of second end 130 of primary right shoulder strap 118 is approximately between 65 and 85 centimeters . in one example , horizontal distance 426 is approximately 75 centimeters . fig5 illustrates in detail the attachment of first end 128 of secondary right shoulder strap 126 to storage portion 102 . strap 126 attaches to storage portion 102 such that when strap 126 is extended toward top side 104 , strap 126 forms an angle having a desired range of approximately between 0 and 45 degrees , measured down ( and to the left ) from vertical . in some examples , the desired maximum of this angle is between 15 and 30 degrees . in other examples , the desired minimum of this angle is between 0 and 10 degrees . combinations of desired minimum angles between 0 and 10 and desired maximum angles between 15 and 30 are also contemplated . in one specific example , the desired minimum angle is approximately 5 degrees , and the desired maximum angle is approximately 20 degrees . in another specific example , the desired minimum angle is approximately 10 degrees , and the desired maximum angle is approximately 15 degrees . when first end 128 is substantially perpendicular to sides 502 and 504 of secondary right shoulder strap 126 such that strap 126 appears rectangular , the attachment angle 506 of first end 128 to storage portion 102 corresponds to the angle of strap 126 from vertical . that is , attachment angle 506 is between 0 and 45 degrees measured up ( and left ) from horizontal line 508 and the angle of strap 126 measured down ( and left ) from vertical is also between 0 and 45 degrees . dashed lines 510 and 512 indicate the desired angle range of sides 502 and 504 of strap 126 when sides 502 and 504 are substantially parallel , first end 128 is connected to storage portion 102 , and strap 126 is extended toward the top side 104 from first end 128 . dashed line 510 indicates the maximum desired angle of sides 502 and 504 , which , when first end 128 is perpendicular to sides 502 and 504 , occurs when angle 506 is at the maximum desired . that is , when connection angle 506 is at the maximum desired , sides 502 and 504 are substantially parallel to dashed line 510 . similarly , dashed line 512 indicates the minimum desired angle of sides 502 and 504 , which , when first end 128 is perpendicular to sides 502 and 504 , occurs when angle 506 is at the minimum desired angle of 0 , resulting in sides 502 and 504 being substantially vertical . in some examples , dashed line 510 is at an angle of approximately 45 degrees measured down ( and to the left ) from vertical . in other examples , dashed line 510 is at an angle of between approximately 10 and 30 degrees measured down from vertical . in still a further example , dashed line 510 is at angle of approximately 20 degrees measured down from vertical . dashed line 512 is substantially vertical . in other examples , dashed line 512 is at an angle of between approximately 0 and 10 degrees measured down ( and to the left ) from vertical . in other examples , first end 128 is not perpendicular to sides 502 and 504 , and first end 128 is attached at an angle selected to cause sides 502 and 504 to have an angle between dashed lines 510 and dashed lines 512 , as described above . it should be appreciated that fig5 illustrates strap 126 attached such that sides 502 and 504 of strap 126 have an angle measured down and to the left of vertical between the angles represented by dashed lines 510 and 512 . solid lines 514 and 516 , along with dashed lines 510 and 512 represent an approximate area of storage portion 102 on which it is desirable to attach first end 128 . as discussed above , minimum desired vertical distance 422 in fig4 indicates the minimum desired vertical distance between substantially horizontal line 408 of fig4 and the midpoint of first end 128 when attached to storage portion 102 . in some examples , the attachment illustrated in fig5 is mirrored for secondary left shoulder strap 120 . fig6 illustrates ergonomic backpack with enhanced fit 600 that has a “ yoke ” strap configuration . backpack 600 is substantially similar to backpack 100 of fig1 - 5 except for the connection of the primary shoulder straps to the storage portion . primary left shoulder strap 614 attaches to storage portion 602 along first connection area 620 , and primary right shoulder strap 618 connects to storage portion 602 along first connection area 622 . in fig4 , the primary straps were shown as being tangential , along with a substantially horizontal line , to a circle . in the example shown in fig6 , the area between the points along primary shoulder straps 614 and 618 that first touch circle 624 is filled in with material to form a yoke connection . primary left shoulder strap 614 and primary right shoulder strap 618 are connected to each other and to storage portion 602 adjacent to first and second connection areas 620 and 622 with one or more pieces of material such that the one or more pieces of material form a curve between primary left shoulder strap 614 and primary right shoulder strap 618 substantially the same as the curve of circle 624 . many backpacks , such as the backpacks illustrated in fig1 - 6 , are designed to be “ unisex ” and fit both men and women . women often still prefer backpacks designed especially for the female physique . fig7 and 8 illustrate ergonomic backpacks with enhanced fit similar to the backpacks shown in fig4 and 6 but that are specifically designed for women . fig7 illustrates an ergonomic backpack with enhanced fit 700 . as with backpack 100 of fig1 - 6 , backpack 700 includes primary left shoulder strap 702 , primary right shoulder strap 704 , storage portion 706 , and secondary shoulder straps 708 and 710 . in contrast to circle 410 of fig4 , the circle 712 tangential to primary left shoulder strap 702 , primary right shoulder strap 704 , and substantially horizontal line 714 has a smaller radius 716 of between approximately 5 and 10 centimeters . in one example , radius 716 measures approximately 7 . 5 centimeters . the vertical distance 718 between substantially horizontal line 714 and both the midpoint of second end 720 of primary left shoulder strap 702 and the midpoint of second end 722 of primary right shoulder strap 704 is approximately between 20 and 35 centimeters . in one example , vertical distance 718 measures approximately 28 centimeters . in another example , vertical distance 718 measures approximately 27 . 3 centimeters . the horizontal distance 724 between the midpoint of second end 720 of primary left shoulder strap 702 and the midpoint of second end 722 of primary right shoulder strap 704 is approximately between 65 and 85 centimeters . in one example , horizontal distance 724 is approximately 75 centimeters . in another example , horizontal distance 724 is approximately 75 . 1 centimeters . backpack 700 also differs from backpack 100 in the amount of curvature of primary shoulder straps 702 and 704 as represented by circle 726 . arc 728 of circle 726 is between approximately 35 and 55 degrees . in one example , arc 728 measures approximately 45 degrees . radius 730 is approximately between 7 and 11 centimeters . in one example , radius 7 30 measures approximately 9 . 5 centimeters . other dimensions , such as the maximum extent of storage portion 706 relative to substantially horizontal line 714 , may be the same as for backpack 100 or may be smaller to account for the smaller size of the average woman relative to the average man . fig8 illustrates an ergonomic backpack 800 with enhanced fit having a yoke connection between primary left shoulder strap 802 , primary right shoulder strap 804 , and storage portion 806 , similar to that discussed with regard to claim 6 . the present invention has been described in relation to particular examples , which are intended in all respects to be illustrative rather than restrictive . alternative examples will become apparent to those of ordinary skill in the art to which the present invention pertains without departing from its scope . from the foregoing , it will be seen that this invention is one well adapted to attain all the ends and objects set forth above , together with other advantages which are obvious and inherent to the system and method . it will be understood that certain features and subcombinations are of utility and may be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the claims .	0
or a salt , ester or derivative thereof , wherein : r1 represents angeloyl group ; r2 represents angeloyl group ; r3 represents oh or h ; r4 represents ch3 or ch 2 oh ; and r5 represents d - glucose or d - galactose . or a salt , ester or derivative thereof , wherein : r1 represents angeloyl group ; r2 represents angeloyl group ; and r3 represents ac or h . or a salt , ester or derivative thereof , wherein : r1 represents angeloyl group ; r2 represents angeloyl group ; r3 represents oh or h ; r4 represents ch3 or ch2oh ; and r5 represents sugar moiety or sugar chain selected from the group consisting of : d - glucose , d - galactose , l - rhamose , l - arabinose , d - xylose , alduronic acid , d - glucuronic acid and d - galacturonic acid . r1 represent angeloyl group ; r2 represent angeloyl group ; r3 represents ac or h ; r4 represents h or oh ; and r5 represents sugar moiety or sugar chain selected from the group consisting of : d - glucose , d - galactose , l - rhamnose , l - arabinose , d - xylose , alduronic acid , d - glucuronic acid and d - galacturonic acid . in an embodiment , the angeloyl groups are in the trans - position on a planar structure . this invention provides a composition for inhibiting tumor cell growth , comprising the above - described compounds . in an embodiment , the composition comprises a suitable carrier . in another embodiment , the composition comprises a pharmaceutically suitable carrier . this invention provides a method for treating ovarian cancer in a subject , comprising administering to said subject an effective amount of the above - described compositions . a method for isolating compounds from xanthoceras sorbifolia herb or plants from the sapindaceae family comprising the steps of : ( a ) extracting xanthoceras sorbifolia or plant powder with organic solvents to obtain an organic extract ; ( b ) collecting the organic extract ; ( c ) refluxing the organic extract to obtain a second extract ; ( d ) removing the organic solvent from the second extract ; ( e ) drying and sterilizing the second extract to obtain a crude extract powder ; ( f ) fractionating the crude extract powder into components using hplc and fplc chromatography with silica gel , c18 and other equivalent solid phase materials ; ( g ) monitoring absorption wavelength at 207 nm or 254 nm ; ( h ) identifying the bioactive components of the crude extract powder ; ( i ) purifying one or more bioactive components of the crude extract powder with fplc to obtain one or more fraction of the bioactive component ; and ( j ) isolating the desired fraction of the bioactive component with preparative hplc . this invention provides a compound comprising the following structure , i . e ., see fig1 , with the formula of c 57 h 88 o 23 and the name of 3 - o -[ β - d - galactopyranosyl ( 1 → 2 )]- α - l - arabinofuranosyl ( 1 → 3 )- β - d - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 15α , 16α , 21β , 22α , 28 - hexahydroxyolean - 12 - ene , also known as xanifolia - y . this compound was isolated from xanthoceras sorbifolia . this compound belongs to an oleanene triterpenoidal saponin with a trisaccharide chain attached at c - 3 of the aglycone and two angeloyl groups acylated at c - 21 and c - 22 . this compound has anti - cancer activity , the assignment of this structure is supported by spectral data , i . e ., h - nmr , 2d nmr ( hmbc , hmqc ), and ms ( maldi - tof , ems ). accordingly , this compound has the characteristic property as shown in fig1 - 22 or table 5 . 1 . this invention provides another compound comprising the following structure , i . e ., see fig2 , with the formula of c 65 h 100 o 27 and the name of 3 - o -[ β - d - galactopyranosyl ( 1 → 2 )]- α - l - arabinofuranosyl ( 1 → 3 )- β - d - glucuronopyranosyl - 21 - o -( 3 , 4 - diangeloyl )- α - l - rhamnophyranosyl - 22 - o - acetyl - 3β , 16α , 21β , 22α , 28 - pentahydroxyolean - 12 - ene , also known as xanifolia - y1 . this compound is a bisdesmosidic polyhydroxyoleanene triterpenoidal saponin with a trisaccharide chain at c - 3 of the backbone and a monosaccharide moiety at c - 21 where two angeloyl groups were acylated at c - 3 and c - 4 position . this compound has anti - cancer activity . the assignment of this structure is supported by spectral data , i . e ., h - nmr , 2d nmr ( hmbc , hmqc , cosy ), and ms ( maldi - tof ). accordingly , this compound has the characteristic property as shown in fig2 - 27 . this invention provides a third compound comprising the following structure , i . e ., see fig2 , with the formula of c 57 h 88 o 24 and chemical name of 3 - o -[ β - d - glucopyranosyl -( 1 → 2 )]- α - l - arabinofuranosyl ( 1 → 3 )- β - d - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 15α , 16α , 21β , 22α , 24β , 28 - heptahydroxyolean - 12 - ene , also known as y2 . this compound ( y2 ) belongs to saponins comprising a triterpene , a sugar moiety and angeloyl groups linked to the backbone . the angeloyl groups are linked to the backbone at c21 and c22 positions . this compound has anti - cancer activity . the assignment of this structure is supported by spectral data , i . e ., h - nmr , c - nmr , 2d nmr ( hmbc , hmqc , tocsy ), and ms ( maldi - tof ). accordingly , this compound has the characteristic property as shown in fig2 - 34 . this invention provides a fourth active compound y8 and the structure was determined by 1d nmr , 2d nmr , and ms analysis . the compound comprises the following structure , i . e . see fig3 , with the formula of c 57 h 87 o 23 and chemical name of 3 - o -[ β - glucopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 3 )- β - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 16α , 21β , 22α , 24β , 28 - hexahydroxyolean - 12 - ene . the assignment of this structure is supported by spectral data , i . e ., h - nmr , c13 - nmr and 2d nmr ( hmqc ). accordingly , this compound has the characteristic property as shown in fig3 - 38 . this invention provides a fifth active compound y9 and the structure was determined by 1d nmr , 2d nmr , and ms analysis . the compound comprises the following structure , i . e ., see fig3 , with the formula of c 63 h 98 o 26 and chemical name of 3 - o -[ β - galactopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 3 )- β - glucuronopyranosyl - 21 - o -( 3 , 4 - diangeloyl )- α - rhamnopyranosyl - 3β , 16α , 21β , 22α , 28 - pentahydroxyolean - 12 - ene . the assignment of this structure is supported by spectral data , i . e ., h - nmr , 2d nmr ( hmqc and hmbc ). accordingly , this compound has the characteristic property as shown in fig4 - 42 . this invention provides a sixth active compound y10 and the structure was determined by 1d nmr , 2d nmr and ms analysis . the compound comprises the following structure , i . e ., see fig4 , with the formula of c 57 h 87 o 22 and chemical name of 3 - o -[[ β - galactopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 43 )- β - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 16α , 21β , 22α , 28 - pentahydroxyolean - 12 - ene . the assignment of this structure is supported by spectral data , i . e ., h - nmr , c13 - nmr and 2d nmr ( hmqc ). accordingly , this compound has the characteristic property as shown in fig4 - 46 . this invention provides a compound comprising a sugar and a triterpene or sapogenin , wherein the triterpene or sapogenin is acylated at carbon 21 and 22 with angeloyl groups . in an embodiment , the compound comprises one or more sugars . this invention shows that extracts of xanthoceras sorbifolia have anticancer activity . the experiments for determining the anti - cancer activity employ human cells lines derived from eleven human organs ( htb - 9 ( bladder ), hela - s3 ( cervix ), du145 ( prostate ), h460 ( lung ), mcf - 7 ( breast ), k562 ( leukocytes ), hct116 ( colon ), hepg2 ( liver ), u2os ( bone ), t98g ( brain ) and ovcar - 3 ( ovary )). among the 11 cell lines studies , their sensitivity toward xanthoceras sorbifolia extract can be divided into four groups : ( a ) most sensitive : ovary , see fig1 ; ( b ) sensitive : bladder , bone , ( c ) srmi - sensitive : prostate , leukocyte , liver , breast , and brain ; and ( d ) lease sensitive : colon , cervix , and lung . see fig1 a - d . their ic50 values are listed in table 3 . 1 . table 3 . 1 ic50 values of xanthoceras sorbifolia extract determined in different cancer cells ic50 determined by cancer cells from different organs mtt assay ( ug / ml ) ovary ( most sensitive ) 15 - 15 bladder ( sensitive ) 45 - 50 bone 40 - 55 prostate ( semi - sensitive ) 40 - 50 leukocyte 45 - 50 liver 45 - 65 breast 65 brain 70 - 85 colon ( least sensitive ) 90 cervix 115 lung 110 in order to identify the active compounds of xanthoceras sorbifolia , the extracts from xanthoceras sorbifolia were separated by chromatography comprising fplc ( fast protein liquid chromatography ) and hplc ( high preferment liquid chromatography ). multiple fractions were obtained by fplc procedures , i . e ., see fig9 and hplc , i . e ., see fig8 . analysis of the fractions by hplc shows that the extract comprises 26 identifiable fractions , designated as a to z , which are shown in fig8 . anti - cancer activities of these fractions were determined by the mtt assay . fplc fraction 5962 , i . e ., see fig1 , which coresponding to fraction y in hplc , i . e ., see fig8 , has the anti - cancer activity . fraction 5962 was further separated into 4 components y1 to y4 , i . e ., see fig1 . fraction 6365 was further seperated into 5 - 6 components , designated as y5 - y10 . see fig1 . the compounds y or y3 , y1 and y2 show strong anti - tumor activity , i . e ., see fig2 - 3 , and were therefore isolated . similarly , compounds y8 , y9 and y10 also show strong anti - tumor activity , i . e ., see fig4 , and were therefore purified . see fig1 . the structures of these active compounds , i . e ., y , y1 , y2 , y8 , y9 and y10 and their uses are the subject of this application . the inhibition effects of the compounds of the present invention on ovarian cancer cells were evaluated with the mtt assay . compound y shows at least 10 times higher potency ( ic50 = 1 . 5 ug / ml ), i . e ., see fig2 , than the original crude extract as shown in fig1 ( ic50 = 20 ug / ml ). the selectivity of compound y toward different cell lines was tested , and it was found that compound y has a much higher potency toward ovarian cancer cells as compared to the cervical cancer cells . see fig1 . this invention provides a method for identifying and isolating the active compounds from plants , herbs or plant extracts . in an embodiement , the extracts include extracts of xanthoceras sorbifolia or of plants from the sapindaceae family . this invention provides the chemical structures of six active compounds obtainable from xanthoceras sorbifolia or of plants from the sapindaceae family . the compounds are shown in fig1 . this invention provides spectral data including h - nmr , c - 13 - nmr , 2d nmr ( hmbc , hmqc , cosy , tocsy ), and ms ( maldi - tof , esi - ms ) in supporting the assigned structures . this invention provides a consensus sub - structure or functional group from the active compounds purified from fraction y . the compounds , such as y or y3 , y1 , y2 , y8 , y9 and y10 , obtainable from fraction y are collectively referred to as “ ys ”. the consensus sub - structure or functional group of these compounds is the biangeloyl groups located on adjacent carbons . for example , in compound y , y2 , y8 and y10 , the biangeloyl are located at 21β and 22α of the triterpene backbone . see fig5 . in compound y1 and y9 , the biangeloyl groups are located at c3 and c4 of the sugar ring . see fig6 . accordingly , the biangeloyl groups of these active compounds are situated in trans - position with respect to each other on a planar structure . see fig7 . the results of this invention indicate the active functional group of these compounds is a biangeloyl group attached in - trans to adjacent carbons located in a planar structure . see fig7 . this invention provides a composition comprising the above - described compounds and a suitable carrier . this invention provides a pharmaceutical composition comprising an effective amount of the above - described compounds and a pharmaceutically acceptable carrier . this invention provides an anti - ovarian cancer agent or composition comprising the above - described compositions . this invention provides a composition effective against cancer growth . the cancer includes but is not limited to bladder cancer , bone cancer and ovary cancer . this invention provides a composition comprising the above - described compounds and their salts , esters , derivatives or metabolites capable of inhibiting tumour growth . this invention provides a composition comprising the above - described compounds and their salts , esters , derivatives or metabolites capable of inhibiting virus growth and / or activities . in addition to the compound ys , other compounds were also purified from fraction r and fraction o of the extract of xanthoceras sorbifolia , which are designated herein as r1 and o54 , respectively . their structures were determined . preliminary experiments indicate both r1 and o54 do not have anticancer activity . the structure of compound r1 shown below and in fig4 , has a chemical formula of c 65 h 106 o 29 and chemical name of 3 - o -[ angeloyl -( 1 → 3 )- β - d - glucopyranosyl -( 16 )]- β - d - glucopyranosyl - 28 - o -[ α - l - rhamnopyranosyl -( 1 → 2 )- β - d - glucopyranosyl -( 1 → 6 )- β - d - glucopyranosyl - 3β , 21β , 22α , 28 - tetrahydroxyolean - 12 - ene , also known as xanifolia - r1 . the assignment of this structure is supported by spectral data , i . e ., h - nmr , c - 13 - nmr , 2d nmr ( hmbc , hmqc , cosy ), and ms ( maldi - tof , ems ). accordingly , this compound has the characteristic property as shown in fig4 - 52 . this invention provides a compound o54 purified from the extract of xanthoceras sorbifolia . the structure of o54 was determined and has a formula of c 60 h 100 o 28 . the structure of compound o54 is shown below , i . e ., see fig5 : the assignment of this structure is supported by spectral data , i . e ., 1h - nmr , 2d nmr ( hmbc , hmqc ). accordingly , this compound has the characteristic property as shown in fig5 - 56 . this invention provides methods for identifying and purifying compounds from the plant extract of xanthoceras sorbifolia . six compounds have been identified and purified , and have been shown to have anticancer activity . these compounds are collectively referred to as triterpenoidal saponins . a consensus sub - structure is identified from these active compounds . a consensus sub - structure or active functional groups of these compounds is the biangeloyl groups located on adjacent carbons . the biangeloyl groups are located at 21β and 22α of the triterpene backbone , i . e ., see fig5 , or located at c3 and c4 of the sugar ring , i . e ., see fig6 . accordingly , the biangeloyl groups of these active compounds are situated in trans - position in respect to each other on a planar structure . see fig7 . the structures or derivatives of the compounds of the present invention are also obtainable by chemical systhesis or from biological sources . this invention will be better understood from examples which follow . however , one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter . ( a ) extracting xanthoceras sorbifolia powder of husks or branches or stems or leaves or kernels or roots or barks with organic solvent at ratio of 1 : 2 for 4 - 5 times for 20 - 35 hours each time to form an organic extract ; ( b ) collecting the organic extract ; ( c ) refluxing the organic extract for 2 - 3 times at 80 ° c . to form second extracts ; ( d ) removing the organic solvent from the second extract ; and ( e ) drying and sterilizing the extract to form a xanthoceras sorbifolia extract powder . experiment 2 : analysis of xanthoceras sorbifolia extract components by hplc chromatography hplc . a c - 18 reverse phase μbondapak column ( water p / n 27324 ) was equilibrated with 10 % acetonitrile , 0 . 005 % trifluoroacetic acid ( equilibration solution ). an extract of xanthoceras sorbifolia prepared using the methods described in experiment 1 was dissolved in equilibration solution ( 1 mg / ml ) before applying into the column . 20 ug of samples was applied into column . elution conditions : fractions were eluted ( with flow rate 0 . 5 ml / min .) with acetonitrile gradient from 10 % to 80 % in 70 min , and then remains at 80 % for 10 min . the acetonitrile concentration then decreased to 10 % and remained at 10 % for 25 min . the fractions were monitored at 207 nm and recorded in chart with a chart speed of 0 . 25 cm / min and with od full scale of 0 . 128 . instruments . waters model 510 solvent delivery system ; waters 484 tunable absorbance detector ; waters 745 / 745b data module . absorbance analysis . the absorption profile of xanthoceras sorbifolia extract at various wavelengths was determined . an extract of xanthoceras sorbifolia of the present invention was dissolved in 10 % acetonitrile / tfa and scanned at 200 - 700 nm with a spectrophotometer [ spectronic ins . model gene sys2 ]. hplc . about 60 - 70 peaks can be accounted for in the profile . among them four are major peaks , 10 are of medium size and the rest are small fractions . the peaks are labelled with a to z following increased concentration of acetonitrile elution . see fig8 . absorption maximum . three absorption maximum were identified for xanthoceras sorbifolia plant extract ; 207 nm , 278 nm and 500 nm . see fig5 . experiment 3 : determination of the cell - growth activity effected by xanthoceras sorbifolia extract with cancer cells derived from different human organs using mtt assay cells . human cancer cell lines were obtained from american type culture collection : htb - 9 ( bladder ), hela - s3 ( cervix ), du145 ( prostate ), h460 ( lung ), mcf - 7 ( breast ), k562 ( leukocytes ), hct116 ( colon ), hepg2 ( liver ), u2os ( bone ), t98g ( brain ) and ovcar - 3 ( ovary ). cells were grown in culture medium ( hela - s3 , du145 , mcf - 7 , hep - g2 and t98g in men ( earle &# 39 ; s salts ); htb - 9 , h460 , k562 , ovcar - 3 in rpmi1640 ; hct - 116 , u2os in mccoy - 5a ) supplemented with 10 % fetal calf serum , glutamine and antibiotics in a 5 % co 2 humidified incubator at 37 ° c . mtt assay . the procedure for mtt assay followed the method described in ( carmichael et al ., 1987 ) with only minor modifications . cells were seeded into a 96 - wells plate at concentrations of 10 , 000 / well ( htb - 9 , hela , h460 , hct116 , t98g , ovcar - 3 ), 15 , 000 / well ( du145 , mcf - 7 , hepg2 , u2os ), or 40 , 000 / well ( k562 ), for 24 hours before drug - treatment . cells were then exposed to drugs for 48 hours ( 72 hours for hepg2 , u2os , and 96 hours for mcf - 7 ). after the drug - treatment , mtt ( 0 . 5 mg / ml ) was added to cultures for an hour . the formation of formazan ( product of the reduction of tetrazolium by viable cells ) was dissolved with dmso and the o . d . at 490 nm was measured by an elisa reader [ dynatech . model mr700 ]. the mtt level of cells before drug - treatment was also measured ( to ). the % cell - growth (% g ) is calculated as : where tc or td represent o . d . readings of control or drug - treated cells . when t0 & gt ; td , then the cytotoxicity ( lc ) expressed as % of the control is calculated as : among the 11 cell lines studies , inhibition of cell - grwoth after exposure of plant extract was observed . however , their sensitivity toward xanthoceras sorbifolia extract is different . it can be divided into four groups : most sensitive , i . e ., ovary ; sensitive , i . e ., bladder , bone ; semi - sensitive , i . e ., prostate , leukocyte , liver , breast , and brain ; and least sensitive , i . e ., colon , cervix , and lung . see fig1 , 15 and 16 a - d . their ic50 values are listed in table 3 . 1 . table 3 . 1 ic50 values of xanthoceras sorbifolia extract determined in different cancer cells ic50 determined by cancer cells from different organs mtt assay ( ug / ml ) ovary ( most sensitive ) 15 - 15 bladder ( sensitive ) 45 - 50 bone 40 - 55 prostate ( semi - sensitive ) 40 - 50 leukocyte 45 - 50 liver 45 - 65 breast 65 brain 70 - 85 colon ( least sensitive ) 90 cervix 115 lung 110 in addition to cell - growth inhibition , the xanthoceras sorbifolia plant extract also stimulate a minor cell growth at low concentrations in bladder , bone and lung cells . results indicate that there is a cell or tissue stimulation component ( s ) in the extract . see fig1 a and 16d . to investigate the inhibition components of the xanthoceras sorbifolia plant extract , the plant extract was fractionated . fig1 shows the results of the screening of fractions obtained after fplc chromatography for cell growth - inhibition activity . the assay was conducted with bladder cells . the fractions obtained from fplc , as shown in fig9 , were used . as shown in fig9 , different components of xanthoceras sorbifolia extracts cause either growth or inhibition effects on cells . only fractions 5962 , designated as fraction y , cause cell growth inhibition . abscissa : concentration ( ug / ml ). ordinate : % cell growth ( determined by mtt assay ). experiment 4 : purification of the inhibition components in the xanthoceras sorbifolia extract . column . octadecyl functionalized silica gel . column dimension : 2 cm × 28 cm ; equilibrated with 10 % acetonitrile — 0 . 005 % tfa before use . gradient elution condition : 10 - 80 % acetonitrile in a total volume of 500 ml . the elution profile of the chromatography shows 4 - 5 broad fractions . see fig9 . these fractions were analyzed with hplc . specific components , corresponding to a - z as specified in fig8 , are then assigned in these fplc fractions . fplc fractions are then grouped into 7 pools and analyzed for cell growth activity in bladder cells with mtt assay . see experiment 3 . it was found that only pool # 5962 , corresponding to fraction y in hplc , contains inhibition activity . see fig1 . it was also found in later experiments that fractions beyond 62 also show inhibition activity . the components isolated from fractions 63 - 65 showed inhibition activities . see fig4 and 13 . elution conditions : 45 % acetonitrile isocratic elution with flow rate of 1 ml / min . final separation of y fractions was achieved by hplc with a preparative column . see fig1 and 12 . these fractions , which include compound y1 , y2 , y or y3 and y4 , were collected . re - chromatography of compound y showed a single peak in hplc with a c18 reverse phase column . see fig1 a and 11b . re - chromatography of the compound y8 , y9 and y10 showed a single peak in hplc with a c18 reverse phase column . see fig1 . the pure compound ys is an amorphous white powder , soluble in aqueous alcohol , i . e ., methanol or ethanol , 50 % acetonitrile and 100 % pyridine . inhibition analysis of compound y was determined with mtt assay . fig2 shows that compound y has activity against ovarian cancer cells ( ocar - 3 ) with ic50 value of 1 . 5 ug / ml which is 10 - 15 times more potent than the unpurified extract shown in fig1 . fig1 shows the selectivity of compound y to ovarian cancer cells compared with cervical cancer cells ( hela ). fig3 shows the inhibition activities of compound y1 and y2 on the growth of ovarian cancer cells ( ocar - 3 ). fig4 shows the inhibition activities of compound y , y8 , y9 and y10 on the growth of ovarian cancer cells ( ocar - 3 ). nmr analysis . the pure compound y of xanthoceras sorbifolia was dissolved in pyridine - d5 with 0 . 05 % v / v tms . all nmr spectra were acquired using a bruker avance 600 mhz nmr spectrometer with a qxi probe ( 1h / 13c / 15n / 31p ) at 298 k . the numbers of scans for 1d 1h spectra were 16 to 128 , depending on the sample concentration . 2d hmqc spectra were recorded with spectral widths of 6000 × 24 , 000 hz and data points of 2024 × 256 for t2 and t1 dimensions , respectively . the number of scans were 4 to 128 . 2d hmbc were acquired with spectral widths of 6000 × 30 , 000 hz and data points of 2024 × 512 for t2 and t1 dimensions , respectively . the numbers of scans were 64 . the 2d data were zero - filled in t1 dimension to double the data points , multiplied by cosine - square - bell window functions in both t1 and t2 dimensions , and fourier - transformed using software xwin - nmr . the final real matrix sizes of these 2d spectra are 2048 × 256 and 2048 × 512 data points ( f2 × f1 ) for hmqc and hmbc , respectively . mass spectral analysis . the mass of samples was analyzed by ( a ) maldi - tof mass spectrometry and by ( b ) esi - ms mass spectrometry . ( a ) samples for maldi - tof were first dissolved in acetonitrile , and then mixed with the matrix chca , i . e ., alpha - cyano - 4 - hydroxycinnamic acid , 10 mg chca / ml in 50 : 50 water / acetonitrile and 0 . 1 % tfa in final concentration . the molecular weight was determined by the high resolution mass spectroscope analysis with standards . ( b ) for esi , the sample was analyzed with lcq deca xp plus machine made by thermo finnigan . it is ionized with esi source and the solvent for the compound is acetonitrile . the profile of the proton nmr is presented in fig1 . the 2d nmr profiles of hmqc and hmbc are shown in fig1 and 20 , respectively . table 5 . 1 summarizes the 2d nmr chemical shift data and the assignment of functional groups derived from these data . based on these data and analysis , the structure of compound y ( y3 ) is assigned as shown below . table 5 . 1 13c and 1h nmr data for compound y ( in pyridine - d5 ) a position c h key hmbc correlations 1 38 . 7 0 . 83 , 1 . 40 c - 3 , c - 5 , c - 9 2 26 . 4 1 . 81 , 2 . 14 — 3 89 . 6 3 . 25 , 1h , dd , c - 23 , c - 24 , glca c - 1 ′ 12 . 0 / 4 . 0 hz 4 39 . 4 — — 5 55 . 3 0 . 78 — 6 18 . 5 1 . 55 , 1 . 59 c - 8 , c - 10 7 36 . 5 2 . 00 , 2 . 10 c - 5 , c - 9 8 41 . 2 — — 9 47 . 0 3 . 06 c - 7 , c - 8 , c - 12 , c - 14 , c - 26 10 37 . 2 — — 11 23 . 7 1 . 74 , 1 . 89 — 12 125 . 2 5 . 49 , 1h , br s c - 9 , c - 11 , c - 14 , c - 18 13 143 . 4 — — 14 47 . 5 — — 15 67 . 3 4 . 21 c - 8 , c - 27 16 73 . 6 4 . 45 c - 14 , c - 15 , c - 18 17 48 . 3 — — 18 40 . 8 3 . 07 c - 12 , c - 13 , c - 14 , c - 16 , c - 19 , c - 20 , c - 28 , 19 46 . 8 1 . 41 , 1 . 69 — 20 36 . 2 — — 21 79 . 3 6 . 71 , 1h , d , 10 hz c - 20 , c - 22 , c - 29 , c - 30 , 21 - o - ang c - 1 ′′′′ 22 73 . 5 6 . 32 , 1h , d , 10 hz c - 16 , c - 17 , c - 21 , c - 28 , 22 - o - ang c - 1 ′′′′ 23 27 . 7 1 . 26 , 3h , s c - 3 , c - 4 , c - 5 , c - 24 24 16 . 5 1 . 16 , 3h , s c - 3 , c - 4 , c - 5 , c - 23 25 16 . 0 0 . 81 , 3h , s c - 1 , c - 5 , c - 9 , c - 10 26 17 . 3 0 . 99 , 3h , s c - 7 , c - 8 , c - 9 , c - 14 27 21 . 0 1 . 85 , 3h , s c - 8 , c - 13 , c - 14 , c - 15 28 62 . 9 3 . 50 , 1h , d , 11 . 0 hz , c - 16 , c - 17 , c - 18 , c - 22 3 . 76 , 1h , d , 11 . 0 hz , 29 29 . 2 1 . 09 , 3h , s c - 19 , c - 20 , c - 21 , c - 30 30 20 . 0 1 . 32 , 3h , s c - 19 , c - 20 , c - 21 , c - 29 glca 1 ′ 104 . 9 4 . 89 , 1h , d , 7 . 8 hz c - 3 2 ′ 79 . 1 4 . 38 glca c - 1 ′, c - 3 ′, gal c - 1 ′′ 3 ′ 86 . 1 4 . 20 glca c - 2 ′, c - 4 ′, ara c - 1 ′′′ 4 ′ 71 . 5 4 . 42 glca c - 3 ′, c - 5 ′, c - 6 ′ 5 ′ 78 . 0 4 . 52 glca c - 4 ′, c - 6 ′ 6 ′ 171 . 9 — — gal 1 ′′ 104 . 6 5 . 32 , 1h , d , 7 . 7 hz glca c - 2 ′ 2 ′′ 73 . 6 4 . 42 gal c - 1 ′′, c - 3 ′′ 3 ′′ 74 . 9 4 . 10 gal c - 2 ′′ 4 ′′ 69 . 5 4 . 56 gal c - 2 ′′, c - 3 ′′ 5 ′′ 76 . 4 3 . 94 gal c - 4 ′′, c - 6 ′′ 6 ′′ 61 . 6 4 . 43 , 4 . 52 gal c - 4 ′′, c - 5 ′′ ara - f 1 ′′′ 110 . 6 6 . 03 . 1h , br s glca c - 3 ′, ara c - 2 ′′′, c - 4 ′′′ 2 ′′′ 83 . 4 4 . 94 ara c - 3 ′′′ 3 ′′′ 78 . 3 4 . 78 ara c - 2 ′′′ 4 ′′′ 85 . 2 4 . 82 ara c - 5 ′′′ 5 ′′′ 62 . 2 4 . 12 , 4 . 28 ara c - 3 ′′′ 21 - o - ang 1 ′′′′ 167 . 7 — — 2 ′′′′ 129 . 6 — — 3 ′′′′ 137 . 2 5 . 96 , 1h , dq , 7 . 0 / 1 . 5 hz ang c - 1 ′′′′, c - 4 ′′′′, c - 5 ′′′′ 4 ′′′′ 15 . 5 2 . 10 , 3h , dq , 7 . 0 / 1 . 5 hz ang c - 2 ′′′′, c - 3 ′′′′ 5 ′′′′ 20 . 8 2 . 00 , 3h , s ang c - 1 ′′′′, c - 2 ′′′′, c - 3 ′′′′ 22 - o - ang 1 ′′′′ 167 . 9 — — 2 ′′′′ 129 . 8 — — 3 ′′′′ 136 . 3 5 . 78 , 1h , dq , 7 . 0 / 1 . 5 hz ang c - 1 ′′′′, c - 4 ′′′′, c - 5 ′′′′ 4 ′′′′ 15 . 5 1 . 93 , 3h , dq , 7 . 0 / 1 . 5 hz ang c - 2 ′′′′, c - 3 ′′′′ 5 ′′′′ 20 . 5 1 . 74 , 3h , s ang c - 1 ′′′′, c - 2 ′′′′, c - 3 ′′′′ a the data were assigned based on hmqc and hmbc correlations . the mass spectrum of compound y as determined by maldi - tof and esi - ms , i . e ., see fig2 , 22 , indicates that the mass of compound y is 1140 . 57 which agree with the theoretical mass of the compound y . the active compound y isolated from extract of xanthoceras sorbifolia is an oleanene triterpenoidal saponin with a trisaccharide chain attached at c - 3 of the aglycone and two angeloyl groups acylated at c - 21 and c - 22 . the formula of y is c 57 h 88 o 23 , and the chemical name of compound y is : 3 - o -[ β - d - galactopyranosyl ( 1 → 2 )]- α - l - arabinofuranosyl ( 1 → 3 )- β - d - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 15α , 16α , 21β , 22α , 28 - hexahydroxyolean - 12 - ene . experiment 6 : determination of the chemical structure of compound y1 of xanthoceras sorbifolia extract the method for nmr and ms analysis for compound y1 is similar to the method described in experiment 5 . the spectrum of the h - nmr is presented in fig2 . the 2d nmr spectra of hmqc , hmbc and cosy are shown in fig2 , 26 and 27 , respectively . table 6 . 1 summarizes the chemical shift data and the assignment of functional groups derived from these data . table 6 . 1 13c and 1h nmr data for compound y1 ( in pyridine - d5 ) position c h 1 38 . 6 0 . 85 , 1 . 33 2 26 . 3 1 . 86 , 2 . 10 3 89 . 7 3 . 25 , 1h , dd 4 39 . 5 — 5 55 . 5 0 . 75 6 18 . 3 1 . 40 , 1 . 43 7 33 . 1 1 . 20 , 1 . 50 8 40 . 0 — 9 46 . 7 1 . 69 10 36 . 5 — 11 22 . 5 2 . 30 12 123 . 6 5 . 36 , 1h , br s 13 143 . 5 — 14 41 . 8 — 15 34 . 7 1 . 53 , 1 . 73 16 68 . 5 4 . 45 17 48 . 2 — 18 39 . 9 3 . 04 19 47 . 6 1 . 30 , 3 . 05 20 36 . 7 — 21 85 . 3 5 . 05 , 1h , d 22 73 . 8 6 . 17 , 1h , d 23 27 . 7 1 . 29 , 3h , s 24 16 . 5 1 . 16 , 3h , s 25 15 . 5 0 . 81 , 3h , s 26 17 . 1 0 . 82 , 3h , s 27 20 . 6 1 . 83 , 3h , s 28 63 . 7 3 . 42 , 1h , d , 3 . 60 , 1h , d 29 29 . 9 1 . 42 , 3h , s 30 19 . 9 1 . 37 , 3h , s glca 1 105 . 0 4 . 88 , 1h , d 2 79 . 0 4 . 37 3 86 . 0 4 . 20 4 71 . 6 4 . 43 5 78 . 0 4 . 50 6 171 . 8 — gal 1 104 . 5 5 . 31 , 1h , d 2 73 . 5 4 . 43 3 74 . 9 4 . 10 4 69 . 5 4 . 57 5 76 . 3 3 . 95 6 61 . 1 4 . 44 , 4 . 53 ara - f 1 110 . 9 6 . 04 . 1h , br s 2 83 . 3 4 . 95 3 78 . 3 4 . 78 4 85 . 2 4 . 82 5 62 . 0 4 . 13 , 4 . 31 21 - o - rha 1 105 . 1 4 . 92 , 1h , d 2 70 . 5 4 . 25 3 74 . 0 5 . 59 4 71 . 5 5 . 70 5 68 . 5 3 . 89 6 17 . 6 1 . 18 , 3h , d rh - 3 - ang 1 167 . 2 — 2 127 . 9 — 3 138 . 7 5 . 92 , 1h , q 4 15 . 7 2 . 02 , 3h , d 5 20 . 6 1 . 92 , 3h , s rh - 4 - ang 1 167 . 2 — 2 128 . 0 — 3 137 . 9 5 . 87 , 1h , q 4 15 . 5 1 . 96 , 3h , d 5 19 . 8 1 . 85 , 3h , s 22 - o - ac 1 171 . 4 — 2 21 . 8 2 . 31 , 3h , s based on these data and analysis , the structure of compound y1 is assigned and shown below . compound y1 isolated from extract of xanthoceras sorbifolia is a bisdesmosidic polyhydroxyoleanene triterpenoidal saponin with a trisaccharide chain at c - 3 of the backbone and a monosaccharide moiety at c - 21 where two angeloyl groups were acylated at c - 3 and c - 4 position . the formula of y1 is c 65 h 100 o 27 , experiment 7 : determination of the chemical structure of compound y2 of xanthoceras sorbifolia extract . the method for nmr and ms analysis for compound y2 is similar to the method described in experiment 5 . the 1 d and 2 d nmr spectra of h - nmr , c - 13 nmr , hmqc , hmbc and ( tocsy ) and ms ( maldi - tof ) of y2 are showed in fig2 - 34 . table 7 . 1 summarizes the 1 d and 2d nmr chemical shift data and the assignment of functional groups derived from these data . table 7 . 1 13c and 1h nmr data for y2 ( in pyridine - d5 ) a position c h 1 38 . 4 0 . 83 , 1 . 36 2 26 . 4 1 . 89 , 2 . 25 3 91 . 3 3 . 39 , 1h , m 4 43 . 4 — 5 56 . 7 0 . 87 , 1h , d , 12 . 0 hz 6 18 . 6 1 . 31 , 1 . 57 7 36 . 3 1 . 97 , 2 . 12 8 40 . 7 — 9 46 . 7 1 . 63 10 36 . 6 — 11 23 . 9 1 . 69 , 1 . 89 12 125 . 1 5 . 48 , 1h , br s 13 143 . 4 — 14 47 . 5 — 15 67 . 1 4 . 18 , 1h , d , 4 . 1 hz 16 73 . 2 4 . 43 17 48 . 1 — 18 41 . 4 3 . 06 19 46 . 6 1 . 40 , 3 . 08 20 36 . 1 — 21 78 . 3 6 . 69 , 1h , d , 10 . 2 hz 22 73 . 1 6 . 30 , 1h , d , 10 . 2 hz 23 22 . 0 1 . 29 , 3h , s 24 62 . 9 3 . 28 , 1h , d , 11 . 2 hz ; 4 . 32 25 15 . 6 0 . 64 , 3h , s 26 17 . 1 0 . 94 , 3h , s 27 20 . 8 1 . 84 , 3h , s 28 63 . 1 3 . 48 , 3 . 72 ( each , 1h , d , 10 . 6 hz ) 29 29 . 3 1 . 09 , 3h , s 30 20 . 0 1 . 32 , 3h , s 3 - o - glca 1 104 . 5 4 . 87 , 1h , d , 7 . 2 hz 2 78 . 6 4 . 31 3 86 . 5 4 . 23 4 71 . 6 4 . 45 5 77 . 4 4 . 53 6 171 . 9 glc 1 103 . 7 5 . 48 , 1h , d , 7 . 8 hz 2 75 . 3 4 . 02 3 78 . 0 4 . 31 4 69 . 3 4 . 52 5 78 . 2 3 . 62 6 61 . 5 4 . 33 , 4 . 50 ara 1 110 . 1 6 . 05 , 1h , br s 2 83 . 5 4 . 97 3 77 . 8 4 . 74 4 85 . 0 4 . 84 5 62 . 2 4 . 18 , 4 . 33 21 - o - ang 1 167 . 5 — 2 128 . 7 — 3 137 . 2 5 . 95 , 1h , dd , 14 . 4 / 7 . 2 hz 4 16 . 7 2 . 08 , 3h , d , 7 . 2 hz 5 20 . 6 2 . 00 , 3h , s 22 - o - ang 1 167 . 9 — 2 128 . 9 — 3 136 . 3 5 . 76 , 1h , dd , 14 . 4 / 7 . 2 hz 4 15 . 6 1 . 95 , 3h , dd , 7 . 2 hz 5 20 . 4 1 . 74 , 3h , s a the data were assigned based on cosy , hmqc and hmbc correlations . based on these data and analysis , the compound y2 isolated from extract of xanthoceras sorbifolia is an oleanene triterpenoidal saponin with a trisaccharide chain attached at c - 3 of the aglycone and two angeloyl groups acylated at c - 21 and c - 22 . the chemical structure of y2 is shown below . see also fig2 . the formula of y2 is c 57 h 88 o 24 , and the chemical name of compound y2 is : 3 - o -[ β - d - glucopyranosyl -( 1 → 2 )]- α - l - arabinofuranosyl ( 1 → 3 )- β - d - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 15α , 16α , 21β , 22α , 24β , 28 - heptahydroxyolean - 12 - ene . the profile of the proton nmr of y4 is presented in fig5 . the profiles of 2d nmr ( hmqc ) of y4 is presented in fig5 . experiment 8 . purification of the inhibition components y8 - y10 in the xanthoceras sorbifolia extract ( a ) fractionation of xanthoceras sorbifolia extracts components with fplc methods the methods for this experiment are similar to the methods decribed in experiment 4 section ( a ) and ( b ). the elution profile shows 4 - 5 broad fractions . see fig9 . these fractions were analyzed with hplc . fplc fractions 63 , 64 and 65 are further separated on 45 % isocratic analysis , 4 - 5 major components were separated ( fig1 ). these fractions were assigned designations y8 , y9 and y10 . these fractions were collected . re - chromatography of the compound y8 , y9 and y10 showed a single peak in hplc with a c18 reverse phase column . see fig1 . inhibition analysis of purified compounds was determined with the mtt assay . results indicate that compound y8 , y9 and y10 has activity against ovarian cancer cells ( ocar - 3 ) with ic50 values of 3 , 4 and 1 . 5 ug / ml , respectively . see fig4 . experiment 9 . determination of the chemical structure of compound y8 of xanthoceras sorbifolia extract the method for nmr and ms analysis for compound y8 is similar to the method described in experiment 5 . the spectral profiles of the h - nmr , c13 - nmr 2d nmr ( hmqc ) of compound y8 are presented in fig3 - 38 . based on these data and analysis , the compound y8 isolated from extract of xanthoceras sorbifolia is an oleanene triterpenoidal saponin with a trisaccharide chain attached at c - 3 of the aglycone and two angeloyl groups acylated at c - 21 and c - 22 . the formula of compound y8 is c 57 h 87 o 23 , and the chemical name of y8 is : 3 - o -[ β - glucopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 3 )- β - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 16α , 21β , 22α , 24β , 28 - hexahydroxyolean - 12 - ene . the chemical structure of compound y8 is presented in the following figure . see also fig3 . experiment 10 . determination of the chemical structure of compound y9 of xanthoceras sorbifolia extract the method for nmr and ms analysis for compound y9 is similar to the method described in experiment 5 . the spectral profiles of the h - nmr , 2d nmr , i . e ., hmqc and hmbc , of y9 are shown in fig4 - 42 . based on these data and analysis , compound y9 isolated from extract of xanthoceras sorbifolia is a bisdesmosidic polyhydroxyoleanene triterpenoidal saponin with a trisaccharide chain at c - 3 of the backbone and a monosaccharide moiety at c - 21 where two angeloyl groups were acylated at c - 3 and c - 4 position . the formula of compound y9 is c 63 h 98 o 26 , and the chemical name of y9 is : 3 - o -[ β - galactopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 3 )- β - g lucuronopyranosyl - 21 - o -( 3 , 4 - diangeloyl )- α - rhamnopyranosyl - 3β , 16α , 21β , 22α , 28 - pentahydroxyolean - 12 - ene . the chemical structure of compound y9 is presented in the following figure . see also fig3 . experiment 11 . determination of the chemical structure of compound y10 of xanthoceras sorbifolia extract the method for nmr and ms analysis for compound y10 is similar to the method described in experiment 5 . the profile of the h - nmr , c13 - nmr and 2d nmr ( hmqc ) are shown in fig4 - 46 . based on these data and analysis , compound y10 isolated from extract of xanthoceras sorbifolia is an oleanene triterpenoidal saponin with a trisaccharide chain attached at c - 3 of the aglycone and two angeloyl groups acylated at c - 21 and c - 22 . the formula of compound y10 is c 57 h 87 o 22 , and the chemical name of y10 is : 3 - o -[ β - galactopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 3 )- β - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 16α , 21β , 22α , 28 - pentahydroxyolean - 12 - ene . the chemical structure of compound y10 is presented in the following figure . see also fig4 . experiment 12 . purification of component r from xanthoceras sorbifolia extract ( a ) purification of xanthoceras sorbifolia extracts components with fplc and hplc the methods used are similar to the methods described in experiment 4 , section ( a ) and ( b ) except a 30 % acetonitrile isocratic elution was used in hplc for isolation of the compound r . fraction no . 39 - 41 from gradient elution of fplc were pooled and further purified with an open ods - c18 column with isocratic 30 % acetonitrile elution . six identifiable fractions in two groups were collected . fractions 6 - 13 were further characterized with hplc . these fractions were further separated into 4 - 5 components with the 30 % acetonitrile isocratic elution in a deltapak column . the fraction designated herein as “ r1 ”, is the major component . see fig6 a . the pure r1 was subsequently collected from the column elution . see fig6 b . the pure r1 appears as an amorphous white powder , soluble in aqueous alcohol , i . e ., methanol or ethanol , 50 % acetonitrile and 100 % pyridine . the nmr and ms analysis of r1 is similar to the method described in experiment 5 . the nmr spectra of pure r1 is presented in fig4 - 52 . based on chemical shift analysis , compound r1 isolated from extract of xanthoceras sorbifolia is a triterpenoid saponins with five sugars and one angeloyl group attached to the sugar moiety . the chemical structure of r1 is shown in following figure . see also fig4 . the formula of compound r1 is c 65 h 106 o 29 , and the chemical name of r1 is : 3 - o -[ angeloyl -( 1 → 3 )- β - d - glucopyranosyl -( 1 → 6 )]- β - d - glucopyranosyl - 28 - o -[ α - l - rhamnopyranosyl -( 1 → 2 )- β - d - glucopyranosyl -( 1 → 6 )- β - d - glucopyranosyl - 3β , 21β , 22α , 28 - tetrahydroxyolean - 12 - ene . ( a ) fractionation of xanthoceras sorbifolia extracts components with fplc and hplc the methods used are are similar to the methods described in experiment 4 , section ( a ) and ( b ) except a 20 % acetonitrile isocratic elution was used in hplc for isolation of the compound o . fractions obtained from fplc were analyzed with hplc . by comparison with the profiles of the original sample , a specific component , in this case fraction o , was identified (# 28 - 30 ). fraction o was collected for further purification . sixteen identifiable hplc fractions were observed in the elution profiles . see fig6 . fractions 28 , 34 and 54 were further purified . see fig6 - 63 . these purified components are named as compound o28 , o34 and o54 , respectively . the purified compound o23 and o34 are light yellow amorphous powder , soluble in aqueous alcohol , i . e ., methanol , ethanol , 50 % acetonitrile and 100 % pyridine . the purified compound o54 is a white amorphous powder , soluble in aqueous alcohol , i . e ., methanol , ethanol , 50 % acetonitrile and 100 % pyridine . the nmr and ms analysis of o54 is similar to the method described in experiment 5 . the nmr spectra of compound o54 is presented in fig5 - 56 . based on the chemical shift analysis , compound o54 isolated from extract of xanthoceras sorbifolia is a bisdesmosidic polyhydroxyoleanene triterpenoidal glycoside with a disaccharide chain [ βd - glucopyranosyl -( 1 → 6 )- β - d - glucopyranoside ] affixed to c - 3 and a trisaccharide chain [ a - l - rhamnopyranosyl -( 1 → 2 )- β - d - glucopyranosyl -( 1 → 6 )- β - d - glucopyranosyl ester ] attached to c - 28 . the chemical structure of compound o54 is presented in the following figure . see also fig5 . the formula of compound o54 is c 60 h 100 o 28 , and the chemical name of o54 is : 3 - o - β - d - glucopyranosyl -( 1 → 6 )]- β - d - glucopyranosyl - 28 - o -[ α - l - rhamnopyranosyl -( 1 → 2 )- β - d - glucopyranosyl -( 1 → 6 )- β - d - glucopyranosyl - 3β , 21β , 22α , 28 - tetrahydroxyolean - 12 - ene . although the present invention has been described in detail with particular reference to preferred embodiments thereof , it should be understood that the invention is capable of other different embodiments , and its details are capable of modifications in various obvious aspects . as is readily apparent to those skilled in the art , variations and modifications can be affected while remaining within the spirit and scope of the invention . accordingly , the foregoing disclosure , description , and figures are for illustrative purpose only , and do not in any way limit the invention which is defined only by the claims . 1 . carmichael , j ., degraff , w . g ., gazdar , a . f ., minna , j . d . and mitchell , j . b . : evaluation of a tetrazolium - based semiautomated calorimetric assay : assessment of chemosensitivity testing . cancer res . 47 : 936 - 942 ( 1987 ). 2 . chen , q . 1995 . methods of study on pharmacology of chinese medicines . press of people &# 39 ; s public health , beijing . p 892 . 3 . huang , zh . sh ., liu , m . p ., chen , ch . zh . 1997 . study on effects of yangshou dan on improving learning and retention . chinese journal of combination of chinese and west medicine , 9 ( 17 ): 553 . 4 . zhang , y ., zhang , h . y ., li , w . p . 1995 . study on effects of anjifu on improving intelligence , chinese bulletin of pharmacology , 11 ( 3 ): 233 . 5 . yang , j ., wang , j ., feng , p . a . 2000 . study on effects of naokkangtai capsule on improving learning and retention in mice , new chinese medicine and clinical pharmacology , 1 ( 11 ): 29 . 6 . yang , j ., wang , j ., zhang , j . ch . 2000 . study on effects of crude saponins of peonies on improving learning and retention in mice , chinese journal of pharmacology , 2 ( 16 ): 46 . 7 . xia , w . j ., jin , m . w ., zhang , l . 2000 . study on treatment of senile dementia caused by angio - aging with didang tang , pharmacology and clinical of chinese medicines , 16 ( 4 ). 8 . bian , h . m ., yu , j . z ., gong , j . n . 2000 . study on effects of tongmai yizhi capsule on improving learning and retention in mice , pharmacology and clinical of chinese medicines , 16 ( 5 ): 40 . 9 . wei , x . l ., zhang , y . x . 2000 . study of animal model for studying senile dementia , chinese journal of pharmacology , 8 ( 16 ): 372 . 10 . bureau of medicinal police , department of public health . guide line for study of effect of medicines for treatment of nervous system diseases , in guidebook of study of new medicine . p 45 . 11 . zhang , d . sh ., zhang , j . t . 2000 . effects of crude ginseng saponins on improving impairment induced by b - peptide , chinese journal of pharmacology , 8 ( 16 ): 22 .	2
referring first to fig1 there is illustrated a broken away portion of a prior art optical disk 6 . in the foreground the break is along a radial thereof . many different forms of optical disks 6 are known . thus , there are optical disks of the read - only , write - once / read - many , erasable , and the like forms . information readout by reflection from formations , magneto - optical processes , and the like from such disks are all contemplated . disk 6 has a reflective upper surface 6a with preformatted guide tracks 12 ( three , 12a , 12b , and 12c being shown ) machined or otherwise formed in substrate 6b thereof . the guide tracks 12 alternate with information tracks 14 ( two , 14a and 14b , being shown ). the information tracks are imaginary regions in a layer 6c atop substrate 6b and below surface 6a in which layer magneto - optic domains can be formed ( written ), recognized ( read ), and rewritten ( erased ) although other forms can also be utilized . in point of fact , guide tracks 12 and information tracks 14 may each simply be one continuous track , spiraling outward from a central axis ( not shown ) which would be to the right of disk 6 as illustrated in fig1 . although guide tracks 12 are illustrated as being depressed in fig1 they may , in fact , be raised or , said another way , information tracks 14 may be lowered or depressed into the disk surface 6a . the guide tracks , if they are depressed , and typically they are , are machined or replicated into surface 6a at the time of manufacture of the disk . because the forming process is not perfect , the edges such as 12 - 1 and 12 - 2 of the guide tracks and bottom 12 - 3 tend to be rough . as such , it is known in the prior art to provide a small guard space between the guide tracks 12 and the information tracks 14 as indicated by dashed lines 16 - 1 and 16 - 2 to allow the spot intensity to decrease before the edge of the guide track is encountered thus decreasing crosstalk . exemplary , though not limiting dimensions for disk 6 , are to have guide tracks of approximately 0 . 6 micrometers ( μm ), information tracks of approximately 0 . 8 μm micrometers and the spacing between the guide tracks and the information tracks of approximately 0 . 1 μm . thus , it will be understood that information tracks are 0 . 8 μm apart , or the full width of an information track apart , and that the track - to - track ( information track - to - information track or guide track - to - guide track ) spacing is typically 1 . 6 μm . for reasons which will become evident as the discussion proceeds , the depth of guide track 12 below surface 6a is somewhat critical . for tracking purposes it is desirable that the depth of track 12 be λ / 8n , where λ is the wavelength of an impinging light source to be described hereinafter and n is the index of refraction of the media of propagation . an exemplary value of λ is 830 nm and an exemplary value of n is 1 . 5 . for information reading purposes it is desirable that the depth be λ / 4n . as a compromise , typically the depth is made λ / 6n . a typical prior art so - called &# 34 ; two spot &# 34 ; tracker is illustrated in fig2 to which attention is now directed . in reality there are three focussed illumination spots labelled a , b , and c all from a source ( not shown ) and all directed toward surface 6a and normal thereto . spots a and b are utilized for tracking . spot c is used solely for reading , writing or erasing information in such a system . it should be understood that the various spots a , b , and c are not shown to the diameter of their full power , but rather shown to the diameter of half power . the half power dimension of spots a and b is typically equal to the width of an information track . the illumination spots are mechanically coupled together to be moved as indicated by arrow 7 in directions normal to the tracks ( 12 and 14 ) directions . at the indicated 50 % power level the spots touch a common line 8 parallel to the tracks and spot c is centered on that line . when a spot such as a is half over an information track 14 and half over a guide track 12 , reflected light as measured by a detector ( not shown ) which is functionally positioned along a line normal to surface 6a and in line with spot a is at a minimum due to diffraction caused by the λ / 6n depth of the guide track . this is illustrated in fig3 as waveform a where distance is on the horizontal axis and response ( r ) is on the vertical axis . if spot a moves either left or right from a position centered half over guide track 12 and half over information track 14 , as illustrated , the reflected light increases . a similar statement applies to spot b the reflection of which is identical in shape to that of spot a only displaced therefrom . the lower waveform in fig3 is the summation of waveform a with the inverse of waveform b . with spots a and b as illustrated in fig2 a zero crossing occurs at point 9 in the bottom waveform of fig3 . known servoing techniques can be used to position spots a and b so that spot c is centered over information track 14 . referring now to fig4 there is shown a broken away portion of an optical disk 11 in accordance with the present invention . as with the disk 6 of fig1 the foreground break is along a radial . as with the disk 6 in fig1 there is a top surface 11a , similar to surface to 6a , of a substrate 11b similar to substrate 6b . there are guide tracks 12 , two , 12a and 12b being shown by way of example , and there are information tracks 14 . it will be noted , however , that in fig4 there are , in fact , with two tracks information tracks 14 between successive guide tracks 12 . or said another way , there is an information track 14 flanking each guide track 12 that is not in common with any information track 14 that flanks any other guide track 12 as viewed along a radial of the disk . thus , by way of example , information tracks 14 - 1a and 14 - 2a flank guide track 12a while information tracks 14 - 1b and 14 - 2b flank guide track 12b . as with the disk of fig1 there may be a single guide track 12 and two flanking information tracks 14 which spiral outward relative to a central disk axis not shown but which would be to the right in fig4 . as was mentioned in connection with fig1 it is desirable to have a guard band between successive information tracks . in fig1 the guard band was provided by the guide track plus a small space on either side of each guide track . in fig4 however , because there are two information tracks between each successive pair of guide tracks , an additional spacing portion is needed . thus , between successive information tracks there is either a guard track 18 such as 18 - 1 , 18 - 2 , and 18 - 3 or a guide track 12 plus adjacent areas 16 . as with the disk of fig1 exemplary though not limiting dimensions are 0 . 6 μm for each guide track 12 plus a small guard track of 0 . 1 μm on either side thereof , 0 . 8 μm for each information track 14 , and also 0 . 8 μm for each guard track 18 . thus , an exemplary guide track - to - guide track spacing is on the order of 3 . 2 μm . as with the disk of fig1 the depth of the guide tracks is ideally λ / 8n for tracking purposes and λ / 4n for information reading and writing purposes . so , again , a good compromise is a depth of λ / 6n . referring now to fig5 tracking spots a and b are similar to tracking spots a and b in fig2 and are identical in shape to each other except that their spacing is such with reference to a line ( not shown ) normal to the track direction that when properly positioned they are centered over two information tracks 14 flanking a guide track 12 . the spots are mechanically coupled together to be moved in directions indicated by arrow 7 normal to tracks 12 and 14 . in fig5 the innermost circle represents the 50 % power level of illumination and successive larger circles represent power levels at 25 % and somewhat greater than 0 %, respectively . it will be noted that at the 25 % and at the somewhat greater than 0 % power levels that the light beam does extend into the intermediate guide track 12 . with reference now to fig6 the waveforms a and b correspond to responses received back from disk 11 as the spots track across the disk in the directions indicated by arrow 7 . the waveform indicated as - b + a is the sum of waveform a and the negative of waveform b and differs from the equivalent waveform in fig3 because the spacing of spots a and b are further apart than are spots a and b in fig2 . nevertheless , in the - b + a waveform in fig6 there is a pronounced null at point 9 which , as with the prior art , can be used to center spots a and b with regard to the center of a guide track 12 . however , unlike the prior art , spots a and b are also properly positioned to read , write , or erase information from information tracks 14 . thus , unlike the prior art in which a third spot , c , is required , no third spot is required with the present invention . a system 10 for tracking and reading / writing / erasing in accordance with the present invention is illustrated in fig7 to which attention is now directed . disk 11 is identical to disk 11 in fig4 . that portion of system 10 closest to disk 11 is a tracking and focus assembly 20 which includes a first lens means 22 , carried by a mechanically movable member 24 , movable for focusing purposes toward and away from the disk surface , in the directions of arrows f . member 24 is movable , by means well known but not shown , with respect to another member 26 which is itself movable in a radial direction with respect to the disk , and transverse to the focusing direction of arrows f , as shown by transverse arrows t . member 26 may carry additional lens means 28 and means 30 for redirecting the light beams impinging upon , or reflected from , disk 11 . as is well known in the art , optical assemblies in this form can be utilized to radially move from track to track of the disk , while still focusing the various light beams and changing the direction thereof . thus , a group of substantially parallel light beams generally labelled 36 , symmetrical about a central axis 36a , are provided by an array of illumination sources 34 , such as a laser diode array and the like , with the illumination source producing beams 36b and 36c symmetrical about central axis portion 36a . the substantially parallel , collimated beams 36b and 36c may be passed through a beam expansion means 40 to provide a set of output beams 42b and 42c about central axis portion 42a equal in number to the input beams 36b and 36c , but having smaller angular spacings s relative to axis portion 42a . the distance between the focussed beams 42b and 42c measured along a radial of the disk is determined by rotation of laser array 34 about the line of travel of beams 36b and 36c . axis 42a is coextensive with axis 36a . beams 42b and 42c impinge upon the disk 11 surface as spots 43b and 43c with a spacing equal to the information track - to - information track spacing which for the exemplary disk is 1 . 6 μm . the spots are reflected therefrom and pass back through lenses 22 and 28 , are redirected by means 30 , enter a beam splitting means 44 and are reflected to pass into a reading means 50 . for reading a magneto - optic disk ( m - o ), beam splitter 44 must be polarized and light source 34 must produce linearly polarized light , a small percent in amplitude of which is directed through beam splitter 44 to reading means 50 . means 50 may include a quarter - wave plate 52 , lens means 54 , a wollaston polarized prism 56 and the like for focusing two pairs of spaced apart read beams 57a1 / 57b1 and 57a2 / 57b2 , respectively , upon first and second pairs 58a1 / 58b1 and 58a2 / 58b2 of detectors elements 58 - 1 and 58 - 2 of a solid state optical detection means 58 . each of the detector elements provides a separate electrical output signal , e . g . detector element 58a1 providing an output signal vr1 and separate detector 58a2 providing a separate output signal vr2 , both for the left information tracks such as 14 - 1a , while detector elements 58b1 / 58b2 provide separate output signals v11 and v12 for the right information tracks such as 14 - 2a , all as viewed in fig7 . the track recovered information signal is the difference between the formation output signals , e . g . left track information is ( v11 - v12 ), and right track information is ( vr1 - vr2 ). further detail of one read process may be found , e . g . in challener and rinehart , &# 34 ; jones matrix analysis of magneto - optical media and read - back systems ,&# 34 ; applied optics , vol . 26 , no . 12 , pp . 3974 - 3980 , ( sep . 15 , 1987 ). an archival disk can be processed in an identical way except that only elements 58a1 and 58b1 ( or 58b2 and 58a2 ) are employed and the light beams need not be polarized . in accordance with the invention , the same output signals are also used for centering axis 42a over guide track 12 such as guide track 12a . this is accomplished by subtracting the sum of vr1 and vr2 from λ the sum of vl1 and vl2 . the resultant value , if not 0 , is used by feedback means well known to the art , to move assembly 20 in the direction of arrows to reacquire central guide track 12 and thus to position beams 42b and 42c over information tracks on either side of the central guide track 12 . thus , the system 10 just described using just two light spots can both track and read / write / erase . it will be understood that the reading , writing , and erasing functions are performed by a combination of the power produced by laser array 34 and the presence or absence of magnetic field ( not shown ) at disk 11 all as is well known to the practitioners in the art .	6
with reference to fig1 in an open mri system , an imaging region 10 is defined between an upper pole assembly 12 and a lower pole assembly 14 . a pair of magnetic flux sources are disposed adjacent to upper and lower pole pieces 16 , 18 generating a temporally constant , main magnetic field b 0 through the imaging region 10 . it is to be appreciated that the open mri apparatus may have a variety of pole pieces or , in some instances , no pole pieces at all . the magnets for generating the main magnetic field can be positioned at other locations . a ferrous flux return path 20 is provided between the pole assemblies remote from the imaging region 10 . the flux return path in the preferred embodiment is a c - shaped path that supports the upper pole assembly . alternately , the flux return path 20 could be an h - shaped arrangement , a four - poster arrangement , imbedded in the walls , or the like . the use of a pair of pole pieces with no defined flux path , just the ambient surroundings through which flux returns , is also contemplated . for imaging , magnetic field gradient coils 22 , 24 are disposed on opposite sides of the imaging region 10 adjacent the pole pieces 16 , 18 . in the preferred embodiment , the gradient coils are planar coil constructions which are connected by gradient amplifiers 26 to a gradient magnetic field controller 28 . the gradient magnetic field controller 28 causes current pulses which are applied to the gradient coils 22 , 24 such that gradient magnetic fields are superimposed on the temporally constant and uniform field b 0 across the imaging region 10 . the gradients of the fields aligned with the main field are typically oriented along a longitudinal or y - axis , a vertical or z - axis and a transverse or x - axis . for exciting magnetic resonance in selected nuclei , an upper radio frequency coil 30 and a lower radio frequency coil 32 are disposed between the gradient coils 22 , 24 adjacent the imaging region 10 . the coils 30 , 32 generate narrow spectrum rf magnetic fields in a band around a selected resonance frequency , typically denoted b 1 , within the imaging region . the coils 30 , 32 are connected to one or more rf transmitters 34 that transmits pulses designated by an rf pulse controller 36 . rf screens are disposed between the rf coils 30 , 32 and the gradient coils 22 , 24 to minimize the generation of rf eddy currents in the gradient coils 24 , 26 . the rf coils 30 , 32 transmit b 1 , magnetic field pulses into the imaging region . a sequence controller 40 accesses a sequence memory 42 to withdraw one or more rf and gradient pulse imaging sequences , which are implemented by the gradient controller 28 , and the rf pulse controller 36 in a coordinated relationship . typically , the sequence controller 40 causes the pulse controller and the rf transmitter to transmit pulses into the imaging region commensurate with the application . that is , different sequences are designed to illustrate different features of the subject . in applications in which the radio frequency coils 30 , 32 operate in both transmit and receive modes , magnetic resonance signals are picked up by the radio frequency coils 30 , 32 . the resonance signals are demodulated by one or more receivers 50 , preferably digital receivers . the digitized signals are processed by a reconstruction processor 52 into volumetric or other image representations which are stored in a volumetric image memory 54 . a video processor 56 , under operator control , withdraws selected image data from the volume memory and formats it into appropriate data for display on a human readable display 58 , such as a video monitor , active matrix monitor , liquid crystal display , or the like . in order to sense environmental disturbances that result in the vibration of the floor or any other support structure of the magnet assembly , a force transducer 60 is disposed underneath the lower pole assembly 14 between the lower pole assembly and the floor in the preferred embodiment . preferred sensors have accurate , readily anticipated responses to frequencies in the 2 - 70 hz range . the force transducer is preferably a strain gauge type transducer , and has approximately the same compressibility of hard rubber shoes previously used to dampen vibrations , which compressibility dampens vibrations in the 20 - 70 hz range . alternately , piezoelectric discs can be used . the force transducer produces an output voltage waveform at least in the 5 - 20 hz frequency range indicative of any vertical compressions experienced by the pole assemblies . the output waveform is processed by a vibration analyzer 62 which determines the corresponding changes in the distance between the upper pole assembly 12 and the lower pole assembly 14 due to the vibration , the attractions in the main b 0 field due to the changes , and ultimately the corrections to compensate . preferably , the signal may be processed by a digital signal processor to have a high degree of control intelligence before being fed to the vibration analyzer 62 . in the preferred embodiment , higher frequency vibrations are dampened by the transducer and do not affect the stability of the system . frequencies below 2 hz are filtered by high pass filters because their effect on the magnet is not significant . the effect of the voltage waveform components in the range of 5 - 20 hz on the b 0 field is measured during initial calibration and appropriate corrections are calculated . in one preferred embodiment , the analysis of the vibration waveform is used to correct the b 0 field strength . as the mr assembly is vibrated up and down , the massive upper pole assembly 12 has such inertia that the interpole spacing between pole pieces 16 , 18 expands and contracts . this variance causes the strength of the main field to vary . as the pole pieces come closer together , the field strengthens . conversely , as they move apart , the field weakens . given the vibration waveform from the transducer 60 , a variance of the distance with time is found by measurement during design and set up . mathematically it is relatively simple to take an instantaneous δd of the gap between pole pieces and convert it into a δb 0 . look up tables are also contemplated . at least one and preferably a pair of shim coils 70 , 72 controlled by a shim coil control 74 produces a magnetic field to counteract the calculated change in the magnetic field due to vibrations . for example , an activity waveform of the shim coil is inverted and scaled in comparison to the vibration waveform . the resultant effect of both the vibrations and shim coil counteract , resulting in a temporally constant main field . in a second preferred embodiment , the vibration waveform is used to adjust the spatial encoding gradient pulses . the resonant frequency is a function of the field strength . in one common mode , the rf pulse has a frequency which excites a whole slice or slab at the location where the sum of a slice select gradient and the b 0 field has a preselected strength . subsequent gradient fields vary the main field to shift the frequencies of the resonating dipoles to preselected frequencies at each spatial increment . however , when vibrations vary the main b 0 field , the spatial location at which expected resonant frequencies occur are shifted . the receiver 50 correlates frequency of received signals with spatial position in the read gradient dimension . thus , if dipoles are resonating at a shifted frequency under the read gradient , the reconstruction processor 52 assigns a shifted spatial position in that read direction . thus , if the b 0 field oscillates or varies with time , a ghosted , blurred image results . in this second embodiment , the vibration analyzer 62 uses the vibration waveform to variably shift at least the frequency sensitivity of the receiver , as ghosted in fig1 to hold the total magnetic field constant at each spatial location along the read direction constant . preferably , a local oscillator / synthesizer 80 generates an rf pulse modulated by the vibration waveform such that the receiver signal is substantially unaffected by the vibrations . this eliminates read direction ghosting . in a third preferred embodiment , the sensed vibrations or oscillations are correlated to oscillating shifts in the resonance frequency and phase . the reconstruction processor 52 is programmed to alter the phase encoding of the signal corresponding to the vibration induced force changes . optionally , a correction is made to spatial location as well as corresponding to frequency effects in the read direction . the transmitter and receiver may be adjusted , as necessary to transmit and demodulate in a frequency spectrum corresponding to the shifting resonance frequencies across the examination region . in an alternate embodiment , multiple force transducers are disposed underneath the mr assembly . their contributions are mathematically weighted according to their position . this embodiment is useful for non - uniform variations in the main magnetic field . if the distance between the sides of the pole pieces move less than the other sides , non - uniform changes in the b 0 field can be sensed and corrected . optionally , a hinge 80 supports the back of the magnet assembly , while the front of the magnet assembly under the pole is supported by the force transducer 60 . in another alternate embodiment , one or more force transducers adjacent to a firm support or accelerometers are placed on the vertical portion of the flux return path to measure horizontal displacement . the vibration analyzing processor 68 generates analogous corrections to those discussed above for horizontal vibration induced b 0 field variations . the invention has been described with reference to the preferred embodiment . modifications and alterations will occur to others upon a reading and understanding of the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof .	6
advantages of the present invention will become more apparent from the detailed description given hereinafter . however , it should be understood that the detailed description and specific examples , while indicating preferred embodiments of the invention , are given by way of illustration only , since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description . fig1 shows an ink jet printer that includes a platen 10 which serves to transport a recording paper 12 in a subscanning direction ( arrow a ) past a printhead unit 14 . the printhead unit 14 is mounted on a carriage 16 that is guided on guide rails 18 and is movable back and forth in a main scanning direction ( arrow b ) relative to the recording paper 12 . in the example shown , the printhead unit 14 includes four printheads 20 , one for each of the basic colors cyan , magenta , yellow and black . each printhead has a linear array of nozzles 22 extending in the subscanning direction . the nozzles 22 of the printheads 20 can be individually energized to eject ink droplets onto the recording paper 12 , thereby printing a pixel on the paper . when the carriage 16 moves in the direction b across the width of the paper 12 , a swath of an image can be printed . the number of pixel lines of the swath corresponds to the number of nozzles 22 of each printhead . when the carriage 16 has completed one pass , the paper 12 advances by the width of the swath , so that the next swath can be printed . the printheads 20 are controlled by a printhead controller 24 that receives print data in the form of a multi - level pixel matrix from an image processor 26 that is capable of high speed image processing . the image processor 26 may be incorporated in the printer or be in a remote device , e . g ., a print driver in a host computer . the printhead controller 24 and the image processor 26 process the print data in a manner that will be described in detail below . the discussion will focus on printing in black color , but is equivalently valid for printing in the other colors . fig2 a shows an array of 8 × 8 pixels 28 of a binary image 30 that is to be printed with the printer shown in fig1 . the print data representing the binary image 30 are created in or supplied to the image processor 26 . in the example shown , the image 30 comprises a thin horizontal line 32 having only a width of one pixel , and a thin diagonal line 34 . the pixels having a binary value “ 1 ”, i . e ., the pixels to be printed in black , are indicated by hatching . fig2 b shows a printed image that would be obtained by printing the binary image 30 when one of the nozzles 22 of the printhead 20 fails . in fig2 b , as in the rest of this specification , pixel lines are indicated by their line index ranging from i − 4 to i + 3 , and pixel columns are indicated by their column index ranging from j − 4 to j + 3 . individual pixels will be referred to by their coordinates , i . e ., a pair of a line index and a column index such as ( i , j ). it has been assumed in fig2 b that the nozzle 22 responsible for printing the line i is defective . as a result , the black line 32 of fig2 a is missing in the printed image . fig2 c shows a multi - level pixel matrix 38 , a three - level pixel matrix in this exemplary case , which is obtained by applying an image processing routine to the binary image 30 by means of the image processor 26 . in the pixel matrix 38 , each pixel may have one of three pixel values : “ 0 ”, “ 1 ” and “ 2 ”. the image data representing the pixel matrix 38 are transmitted to the printhead controller 24 and will be interpreted by the printhead controller as follows . a pixel value “ 0 ” means that the pixel shall not be printed , i . e ., shall be left blank or white . a pixel value of “ 2 ” means that the pixel shall be printed ( black ). a pixel value of “ 1 ” means that the pixel shall be treated as a “ 0 ”- pixel and shall not be printed , unless a nozzle failure occurs for one of the pixel lines immediately above and below this pixel . in the latter case , the pixel shall be treated as a “ 2 ” pixel and shall be printed . for example , the value “ 1 ” of the pixel ( i − 1 , j − 1 ) means that this pixel shall only be printed if either the nozzle needed for printing the line i or the nozzle needed for printing line i − 2 is defective . the printer may be arranged to automatically detect nozzle failures , as is generally known in the art . thus , the information needed to determine whether or not a nozzle is defective will be available in the printhead controller 24 which interprets the pixel matrix 38 . as an alternative , nozzle failures may be manually detected by an operator who will analyse a specific test image and will enter the information identifying the defective nozzles into the printhead controller 24 by using a suitable input . in the example shown in fig2 c , the pixel matrix 38 is derived from the binary image 30 by means of the following algorithm . every “ 1 ” ( black pixel ) in the binary image 30 is translated into a “ 2 ” in the pixel matrix 38 . for example , this leads to the pixel value “ 2 ” for the pixel ( i + 3 , j − 4 ) in fig2 c . in addition , the pixel immediately below this “ 2 ”- pixel is changed from “ 0 ” to “ 1 ”. this is the case , for example , for the pixel ( i + 2 , j − 4 ). if , however , the pixel immediately below the “ 2 ”- pixel was already a black pixel , then it will be changed to “ 2 ” similar to every other black pixel . an example of this is the pixel ( i − 1 , j ). fig2 d shows the printed image 40 obtained as a result of this image processing step and its interpretation in the printhead controller 24 . it can be seen that , thanks to the algorithm described above , the image information of the black line 32 is not lost , but is replaced by a black line 32 ′ immediately below the defective nozzle . in other words , the line 32 is shifted by one pixel , and this shift will be hardly perceptible to the human eye . in all the pixel lines that are not directly adjacent to the line i of the defective nozzle , ( lines i − 4 to i − 2 , i + 2 and i + 3 ) the original image information is preserved without any changes . in line i + 1 , an additional black pixel ( i + 1 , j − 3 ) occurs close to the position , where the diagonal line 34 crosses the horizontal line 32 ′. this additional black pixel stems from the “ 2 ”- pixel ( i + 2 , j − 3 ) fn fig2 c , in which this pixel has caused a “ 1 ” occurring immediately below . the main purpose of this “ 1 ” was to replace the “ 2 ”- pixel in line i + 2 if the nozzle for line i + 2 should fail . however , since the printhead controller 24 of this embodiment does not distinguish whether a line is located below or above a defective line , the pixel ( i + 1 , j − 3 ) will be printed black , even though there is no defect in the line i + 2 . this behaviour leads to a slight overcompensation of the nozzle defect , but is highly welcome here , because it camouflages , to some extent , the gap occurring in the diagonal line 34 in pixel line i . the algorithm illustrated in fig2 c is particularly useful for images , such as cad graphics , which include thin horizontal lines . of course , instead of shifting the line 32 one pixel downward , an equivalent strategy would be to shift this line one pixel upward . if a horizontal line has a width of two pixels and covers , for example , the lines i and i − 1 , then the algorithm shown in fig2 c would have the effect that the pixel is thinned from a width of two pixels to a width of one pixel ( the pixels in line i − 2 would be changed to “ 1 ”, but would not be printed , because the nozzle defect is two pixels away ). this would be quite an acceptable result . in this case , however , the alternative strategy , where a “ 1 ” is added above each “ 2 ”- pixel , would have the result that the two pixel wide line would be split into two one - pixel - lines separated by a one pixel gap . a similar gap and a one - pixel line would occur the line i forms the upper boundary of a solid black area in the original image 30 . in this case , the occurrence of a thin line isolated from the rest of the black area would be less favourable . another possible strategy would be to insert a “ 1 ” pixel alternately above and below each “ 2 ” pixel . this strategy would be suitable , for example , for images consisting of extended grey areas , but would be unfavourable for horizontal high - contrast boundaries , because the boundary would become jagged if a nozzle failure occurs right at the boundary . it will therefore be preferable to adopt the most suitable strategy depending on the contents of the image 30 to be processed . this can be achieved in a straightforward manner by a user defined setting or by employing image processing routines which comprise , for example , image segmentation in order to classify different types of image elements , such as thin lines , high - contrast boundaries , grey - shade areas and the like . in general , the image processing algorithm aims to obtain a printed image 40 that resembles as far as possible the original image 30 , regardless of the position where the nozzle failure occurs . fig3 a - c illustrate an embodiment , in which “ 1 ”- pixels are alternately added above and below each “ 2 ” pixel . as mentioned already , this embodiment is particularly suitable for a binary image 30 , as shown in fig3 a , in which the black pixels appear to be scattered randomly over the image area . the corresponding pixel matrix 38 shown in fig3 b is constructed almost in the same way as the pixel matrix in fig2 b , with the only difference that , for the “ 2 ”- pixels , the corresponding “ 1 ” pixels are alternately inserted above and below the “ 2 ” pixel , as is symbolised by arrows in fig3 b . the “ 1 ”- pixel that would be created by the “ 2 ” pixel ( i + 3 , j + 2 ) is not visible here , because it is outside of the image area . the printhead controller 24 interprets the pixel matrix 38 in the same way as in fig2 b - c . as shown in fig3 c , the resulting printed image 40 is hardly distinguishable from the original image 30 , in spite of the nozzle failure in line i . again , one observes that the sum of black pixels in the lines i − 1 , i , and i + 1 in fig3 c is slightly larger than in fig3 a , because “ 1 ”- pixels are also created by black pixels in the lines i − 2 and i + 2 . if this effect is not desirable , for example for image areas with a relatively high average density , the image processing algorithm may be modified by suppressing some of the additional “ 1 ”- pixels . for example , when the pixels are processed line by line , the first “ 2 ”- pixel may create a “ 1 ” pixel above , the second “ 2 ”- pixel creates a “ 1 ”- pixel below , and the third “ 2 ”- pixel does not create any “ 1 ” pixel at all , and then the sequence will be repeated . another possible modification that may be suitable for relatively dark image areas would be that the “ 1 ”- pixel is not always inserted immediately above or below the “ 2 ” pixel , but is shifted to an empty position in the vicinity of the “ 2 ” pixel . another embodiment of the invention will now be described in conjunction with fig4 a - d . the binary image 30 , shown in fig4 a , has the lines i − 2 to i + 1 forming an extended dark area with an average density of 50 %. an isolated black pixel is present at ( i − 4 , j ). fig4 b shows the corresponding printed image 36 that would be obtained if the nozzle failure in line i were not camouflaged . fig4 c shows a corresponding multi - level pixel matrix 38 , which in this case is a four - level matrix . here , the pixel value “ 3 ” means that a back pixel shall be printed unconditionally . the pixel value “ 0 ” stands again for pixels that are to be left blank , unconditionally . the pixel value “ 1 ” means that the pixel shall be printed in black if a nozzle failure occurs in the line immediately below . conversely , the pixel value “ 2 ” means that the pixel shall be printed in black on condition that a nozzle failure occurs in the line immediately above . when constructing the pixel matrix 38 of fig4 c , every black pixel in the original image 30 is changed to a “ 3 ”. the algorithm for assigning the conditional pixel values “ 1 ” and “ 2 ” becomes more complex in this case . since the lines i + 2 and i + 3 include no black pixels , the line i + 1 forms the upper boundary of a grey area . for this reason , no “ 1 ”- pixels are provided in line i + 2 . thus , even when a nozzle failure would occur for the line i + 1 , this would not be compensated by any black pixels in line i + 2 . nor would there be any additional black pixels in line i for compensating the nozzle failure , because the line i does not contain any “ 2 ”- pixels . thus , when the nozzle for line i + 1 fails , this line is simply left white without any compensation , with the result that the boundary between the dark and the white area shifts by one pixel . this has the advantage that a smooth appearance of the boundary is preserved . in line i of fig4 c , a first “ 3 ” occurs at the position j − 3 . for this reason , a “ 1 ” has been assigned to the pixel ( i + 1 , j − 3 ). thus , if the nozzle for line i fails , then an additional black pixel will be printed in the line i + 1 , as shown in fig4 d . the next “ 3 ”- pixel in line i is at the position j − 1 . here , the pixel value “ 2 ” is assigned to the pixel ( i − 1 , j − 1 ). thus , a nozzle failure in line i will in this case be compensated by an extra pixel in the line i − 1 below , as is also shown in fig4 d . for the subsequent “ 3 ”- pixels in line i , a “ 1 ” and a “ 2 ” are alternately inserted in lines i + 1 and i − 1 , respectively . the same algorithm is also applied to the “ 3 ”- pixels in line i − 1 . the line i − 2 forms the lower boundary of the grey area , and the smooth appearance of this boundary should be preserved . for this reason , similarly as for line i + 1 , there are no “ 2 ”- pixels in line i − 3 , and the pixels above the “ 3 ”- pixels at j − 3 and j + 1 are left at “ 0 ”. thus , if a nozzle failure should occur in the boundary line i − 2 , this failure would have no compensation at all . the isolated “ 3 ”- pixel in line i − 4 is treated in the same way as the pixels in lines i and i − 1 . thus , a “ 1 ” pixel is inserted at the position ( i − 3 , j ). in the occurrence of a nozzle failure for line i − 4 , the missing pixel would be shifted one position upwardly . when the algorithm described above for lines i and i − 1 in fig4 c is applied to a larger number of subsequent pixel lines , then , depending on the image contents , a conflict situation may occur for specific pixels . for example , a “ 3 ” above such a pixel may require the pixel value “ 2 ”, whereas a “ 3 ” below this pixel may require a pixel value “ 1 ” for the same pixel . this conflict may be resolved by giving priority to either the “ 2 ” or the “ 1 ”. in this case , however , a nozzle failure for one of the two adjacent lines may not be completely compensated . in view of this problem , a more elaborate embodiment of the invention may provide that all the black pixels in the original image 30 obtain the pixel value “ 4 ” instead of “ 3 ”. then , the pixel value “ 3 ” would indicate that a black pixel shall be printed on condition that a nozzle failure occurs in anyone of the adjacent upper and lower lines . thus , if a “ 2 ” is required because of a black pixel in the upper line , and at the same time a “ 1 ” is required because of a black pixel in the lower line , then the values “ 1 ” and “ 2 ” are added to give the conditional pixel value “ 3 ”. the embodiments described above require only minimal data processing in the printhead controller 24 . all that has to be done to print a given pixel is to decide whether a nozzle failure occurs in the line above or below this pixel , and then adopt the pertinent interpretation for the conditional pixel values . this can , for example , be achieved using a simple hardware implementation with a network of and and or gates . fig5 a - c illustrate a modified embodiment of the invention which requires slightly more processing capability of the printhead controller 24 . the image processor 26 constructs the pixel matrix 38 shown in fig5 b on the basis of the binary image 30 shown in fig5 a . the pixel matrix is again a three - level matrix , wherein the pixel value “ 2 ” is assigned to each of the black pixels in the image 30 . in addition , for each of the “ 2 ”- pixels in fig5 b , a “ 1 ” is inserted in the line immediately above and another “ 1 ” in the line immediately below . in the event of interference , as for example for the pixel ( i + 2 , j + 2 ) in fig5 b , the pixel value is left at “ 1 ”, although both the pixels ( i + 3 , j + 2 ) above and ( i + 1 , j + 2 ) below have the value “ 2 ”. when no nozzle failure occurs , the printhead controller 24 interprets the pixel value “ 2 ” as black and the pixel values “ 0 ” and “ 1 ” as white . when , however , a nozzle failure occurs in the line i , as shown in fig5 c , a special treatment is applied to the lines i − 1 and i + 1 . in the example shown , this special treatment consists of a simple one - dimensional error diffusion process with threshold 2 . starting with the first pixel ( j − 4 ) in line i + 1 , the pixel value “ 1 ” is below the threshold 2 , so that the pixel is left white in fig5 c . the residual ( 1 ) is added to the pixel value of the next pixel ( i + 1 , j − 3 ). since the latter pixel value is “ 0 ”, the sum is still below the threshold , and this pixel is left white as well . the residual ( 1 ) is then added to the pixel value “ 2 ” of the next pixel ( i + 1 , j − 2 ). since the sum ( 3 ) is now larger than the threshold 2 , the pixel is printed in black , and the sum is decremented by the threshold value 2 , giving a residual of 1 . the same procedure then applies to the next pixel ( i + 1 , j − 1 ), giving again a black pixel and a residual of 1 . for the next pixel ( i + 1 , j ) the sum reaches the threshold value 2 , so that this pixel will be printed in black ( although this pixel was white in fig5 a ). since there is no residual to be added to the next pixel ( i + 1 , j + 1 ), this pixel is left white . the procedure described above is iterated for the subsequent pixels in line i + 1 and then in line i − 1 , with the residual from the pixel ( i + 1 , j + 3 ) being carried over to the first pixel ( i − 1 , j − 4 ) in the next line . the resulting printed image 40 is shown in fig5 c . as a result of the error diffusion process and the selection of the threshold , the average optical density in the lines i − 1 , i , and i + 1 in fig5 c will approximately equal to the average optical density in the corresponding lines in fig5 a , so that the nozzle failure is compensated . compared to the previous embodiments , the embodiment described here has the advantage that the image information which has been spread from line i to the adjacent lines will not be lost , even when the position right above or below is already occupied by a black pixel . thanks to the error diffusion , the image information will instead be propagated to the next empty pixel position . this embodiment can of course be modified in various ways . for example , it is possible to adopt more complex error diffusion schemes , including also 2 - dimensional error diffusion ( where part of the error is diffused , for example , from line i + 1 to i − 1 ). the threshold employed in the error diffusion process does not have to be an integral number . it would be possible for example to adopt a threshold of 1 . 8 or 2 . 2 , resulting in a slight tendency towards overcompensation or undercompensation , respectively , of the nozzle failure . the error diffusion process may also be replaced by other suitable algorithms . for example , the pixel values in lines i − 1 and i + 1 may each be compared to a respective threshold which varies randomly between 0 and 2 , and a black pixel may be printed , when the threshold is exceeded . the result will be that a “ 1 ”- pixel will be printed as a black pixel with a probability of 50 %. since every “ 2 ” pixel in line i generates two “ 1 ” pixels , one in line i − 1 and one in line i + 1 , the average density will be preserved if each of these “ 1 ” pixels is printed with a probability of 50 %. the embodiments described above are adapted to a single - pass print mode , in which a nozzle failure leads to the loss of a complete pixel line , but the invention is also applicable to multi - pass printing , where multiple nozzles contribute to a given pixel line . in this situation , the failure of a single nozzle leads only to a loss of a fraction of the pixels of the line . if no substantial post - processing shall be performed in the printhead controller 24 , the methods for multi - pass printing will be analogous to what has been described in conjunction with fig2 to 4 . however , this application will possibly have the additional feature that , in the construction of the pixel matrix , a distinction is made as to which of the nozzles that contribute to the same line is defective . fig6 and 7 illustrate two embodiments that are specifically adapted to two - pass printing and involve some post - processing such as error diffusion in the printhead controller 24 . however , the invention also applies to higher multiple - pass printing . fig6 a shows a binary image that is processed in the image processor 26 so as to construct the pixel matrix 38 shown in fig6 b . this pixel matrix is a 8 - level matrix having the pixel values ranging from “ 0 ” to “ 8 ”. the construction scheme for the pixel matrix 38 is symbolically shown in fig6 c . every black pixel “ 1 ” of the original image 30 changes to a “ 4 ”, and the pixel values of the upper , lower , left and right neighbours of this pixel are increased by 1 . in case of interference , the increments of the pixel value are summed . thus , the pixel value “ 2 ” of the pixel ( i , j − 3 ) in fig6 b is obtained by adding a “ 1 ” from pixel ( i , j − 4 ) and another “ 1 ” from pixel ( i , j − 2 ). depending upon the configuration of black pixels in the image 30 , the sum may reach the maximum value of “ 8 ” ( a “ 4 ” for the central pixel plus four “ 1 ” s from four black neighbours ). the pixel matrix 38 is interpreted and post - processed in the printhead controller 24 . again , it shall be assumed for this illustration that a nozzle failure occurs in line i . however , in the two - pass mode , this will have the effect that every second pixel in line i can still be printed . the remaining pixels that cannot be printed , have been crossed out in fig6 b . by way of an example , it is assumed that these are the pixels at positions j − 4 , j − 2 , j and j + 2 . since three of these pixels happen to be black pixels in fig6 a , the loss of image information that needs to be compensated amounts to 3 pixels . the pixels in the lines i − 1 , i and i + 1 are subjected to error diffusion with a threshold of 5 . in this error diffusion process , the non - printable pixels in line i are skipped . when the “ 1 ”- pixels and “ 2 ”- pixels occurring in the lines i − 1 , i + 1 and at the printable positions in line i are summed , the result is 18 . because of the threshold of 5 , the number of additional pixels that will be printed in these lines is 18 / 5 = 3 with a remainder ( residual ) of 3 . thus , the three missing pixels in line i will be compensated by three extra pixels in the neighbourhood , and the residual of 3 will be discarded . the reason for selecting the threshold value 5 in this embodiment will be explained in conjunction with fig6 d . the upper block in fig6 d shows the lines i − 1 , i and i + 1 of an original binary image , where the lines i − 1 and i + 1 are white , i is a continuous black line , and black pixels are indicated by the pixel value “ 1 ”. here , the total number of black pixels in lines i − 1 to i + 1is 8 . the lower block in fig6 d shows the corresponding pixel matrix constructed in accordance with fig6 c . summing the pixel values “ 1 ”, “ 6 ”, and “ 5 ” of all the pixels that participate in the error diffusion gives 39 . with a threshold value 5 , the number of pixels that will actually be printed is 39 / 5 = 7 with a remainder ( residual ) of 4 , and this is the best match to the total number of 8 pixels that should have been printed in line i . the error diffusion technique is used very locally and requires less computing power , and the error diffusion scheme and the threshold value may therefore be varied as desired . the embodiment shown in fig6 a - d may in some rare cases lead to artefacts in the form of extra pixels that are added to the original image 30 , even when no nozzle failure occurs . as an example , consider the case that the pixel ( i , j ) is white in the original image 30 , but the four adjacent pixels ( i + 1 , j ), ( i , j − 1 ), ( i , j + 1 ) and ( i − 1 , j ) are black . then , the increments from the surrounding pixels will sum up to a pixel value of “ 4 ” for the pixel ( i , j ), and this pixel value would unconditionally be interpreted as black , so that a white pixel would be turned into a black one even when no nozzle failure occurs . this effect may be compensated by providing appropriate modifications in other image processing steps , such as halftoning , gamma correction , and the like . as an alternative , this embodiment may be modified as follows . instead of encoding an original black pixel by the pixel value “ 4 ”, it is encoded by the pixel value “ 5 ”. this pixel value or a higher pixel value can only be reached when the original pixel was already black . in the printhead controller 24 , only pixel values of “ 5 ” or higher will now be interpreted unconditionally as black , and the pixel value “ 4 ” is interpreted as white when no error diffusion is performed . in the error diffusion process , the pixel value of “ 5 ” will only be counted as 4 , a pixel value of “ 6 ” will be counted as 5 , and so on up to the highest possible pixel value of “ 9 ”, which will be counted as 8 . fig7 a and b illustrate another embodiment of the invention , which is also adapted to a two - pass print mode . the binary image 30 shown in fig7 a is the same as in fig6 a . however , as is shown in fig7 b , the black pixels of the binary image are in this case translated only into the pixel value “ 2 ”, and an increment of “ 1 ” is added only to one of its four neighbours . the selection of the neighbour , to which the increment of “ 1 ” is added , rotates counter - clockwise , when the “ 2 ”- pixels are processed line by line . this counter - clockwise rotation is indicated by arrows in fig7 b . thus , for the first “ 2 ”- pixel ( i + 3 , j + 2 ), an increment of “ 1 ” is added only to its right neighbour ( i + 3 , j + 3 ). for the next “ 2 ”- pixel ( i + 2 , j − 3 ) an increment is only added to its upper neighbour ( i + 3 , j − 3 ), and so on . in this case , the incremented pixel values may range from “ 0 ” to “ 4 ”, and the values “ 2 ”, “ 3 ” and “ 4 ” will be interpreted as black pixels , where no error diffusion is performed . the pixels in the line i of the nozzle failure and the lines immediately above and below are subjected to error diffusion with a suitable threshold value . a consideration similar to the one explained in conjunction with fig6 d shows that a threshold value of 3 would be suitable in this situation . in fig7 b , it has been assumed that the nozzle failure causes defects in the pixel positions ( i , j − 3 ), ( i , j − 1 ), ( i , j + 1 ), and ( i , j + 3 ). since these pixels happen to be white in fig7 a , no extra black pixels would have to be added in order to compensate for the nozzle failure . as can be seen in fig7 a , the total number of black pixels in the lines i − 1 , i and i + 1 is 5 . summing the pixel values of the printable pixels in these lines in fig7 b gives 14 , and the number of black pixels that will actually be printed , if the error diffusion threshold is 3 , will be 14 / 3 = 4 with a remainder ( residual ) of 2 , which is very close to the ideal number of 5 . on the other hand , if the other one of the two nozzles that are used for printing the line i becomes defective , then the non - printable pixels would be ( i , j − 4 ), ( i , j − 2 ), ( i , j ) and ( i , j + 2 ). this would be almost the “ worst case ” scenario because three of the four pixels happen to be black . in this case , the sum of the pixel values of the printable pixels would be 10 , and the number of pixels that are actually printed would be 10 / 3 = 3 rest 1 . this is smaller than the ideal number 5 but larger than the number ( 2 ) of black pixels that would be obtained without any failure compensation . in other words , at least one extra black pixel would be added in the three lines from i − 1 to i + 1 . one might assume from the above examples that the nozzle failure is somewhat undercompensated in this embodiment . it should be noted , however , that in these examples the black pixels in the lines i − 2 and i + 2 do not contribute to the pixel values in the lines i − 1 and i + 1 . this is because the “ 2 ”- pixel ( i + 2 , j − 3 ) accidentally leads to an increment in the upper line i + 3 , and the “ 2 ”- pixel ( i − 2 , j ) leads to an increment in the lower line i − 3 . the opposite result , leading to an extra “ 1 ” in each of the lines i − 1 and i + 1 could , however , have occurred with the same likelihood . thus , considering a larger image area , the average result would be better than in the specific examples that have been discussed here . of course , the modifications that have been explained in conjunction with fig6 can be equivalently applied to the embodiment of fig7 . moreover , it will be possible in both embodiments to consider not only the four neighbouring pixels , i . e ., the left and right , upper and lower neighbours , but to spread the pixel value of a given pixel to all its eight neighbours , including the “ diagonal ” neighbours such as the pixels ( i + 1 , j − 1 ), ( i + 1 , j + 1 ), ( i − 1 , j − 1 ) and ( i − 1 , j + 1 ) for the central pixel ( i , j ). it is to be understood that the foregoing descriptions and specific embodiments shown herein are merely illustrative of the best mode of the invention and the principles thereof , and that modifications and additions may be easily made by those skilled in the art without departing for the spirit and scope of the invention , which is therefore understood to be limited only by the scope of the appended claims .	6
this invention provides that the aav itr is independently able to influence gene expression . this reflects a previously unrecognized ability of aav itr to function as a fully competent transcription promoter . this is proven by constructing an aav vector in which the reporter gene , cat , is linked directly to the itr and is expressed when introduced into cells . aav vectors containing the full length cftr cdna are larger than wild type aav and are difficult to package into aav transducing particles . however , the invention provides that a cftr cdna expressed from an aav itr promoter is able to complement the cf defect and is regulated appropriately as indicated by functional assays . the invention also demonstrates that this truncated cftr cdna could be packaged into an aav vector and infected into ib3 cells such that the bulk culture could be complemented for the cf defect . therefore , the invention provides that it is possible to obtain efficient complementation of the cf defect with aav transducing vectors . therefore , the present invention provides an adeno - associated viral vector comprising the inverted terminal repeat ( itr ) sequences of adeno - associated virus and a nucleic acid , wherein the inverted terminal repeat sequences promote expression of the nucleic acid in the absence of another promoter . by &# 34 ; adeno - associated viral vector &# 34 ; is meant any vector which has the itr sequences necessary to package the viral genome , integrate into a host chromosome and promote transcription of additional sequences . thus , any changes in the itr which retain these essential functions is considered within the meaning of itr . the nucleic acid promoted by itr can be any desired sequence . in one embodiment , the nucleic acid can encode a polypeptide which has a desired function in the cell in which the vector is expressed . for example , the polypeptide can be a protein having a desired function in a cell , on the surface of the cell , or when secreted . one example of a protein is cftr . as described above and in more detail below , the vector is ideally suited for larger nucleic acids , like cftr , which approach the maximum packaging size for standard aav vectors and for therapy purposes should be integrated into the genome . alternatively , the nucleic acid sequence simply can encode an antisense rna for use in antisense related therapy . the viral vector can be contained in a suitable host . any cell can be a suitable host so long as the vector is capable of infecting the cell type . one example of a suitable host is an epithelial cell containing a non - functional cftr sequence for use when the vector contains a functional cftr sequence . the vector can contain additional sequences , such as from adenovirus , which aid in effecting a desired function of the vector . for example , the addition of adenovirus dna sequences enclosing the aav vector could provide an approach to packaging aav vectors in adenovirus particles . the vector can also be contained in any pharmaceutically acceptable carrier for administration or the like . examples of suitable carriers are saline or phosphate buffered saline . as used herein , aav means all serotypes of aav . thus , it is routine in this art to use the itr sequences from other serotypes of aav since the itrs of all aav serotypes are expected to have similar structures and functions with regard to replication , integration , excision and transcriptional mechanisms . the invention provides a method of delivering a protein to a subject comprising infecting the subject with the vector of the invention . while not limited to humans , most therapy uses of the vector will be applicable mainly to humans . in this regard , the invention provides a method of delivering a functional cystic fibrosis transmembrane conductance regulator to a human subject comprising infecting the subject with the cftr containing vector of the invention . this method thus can be utilized to treat cystic fibrosis . also provided is an isolated nucleic acid consisting essentially of the inverted terminal repeat sequences of adeno - associated virus . in addition , the invention provides a vector comprising this nucleic acid provided the vector is not an adeno - associated virus vector . this vector can be contained in a suitable host and in a pharmaceutically acceptable carrier . thus , as described in more detail below , the specific promoter sequences can be determined and utilized to promote expression in other vectors . the invention also provides a vector comprising a polya site that is capable of being translationally read in the reverse direction . the specific sequence disclosed below can be modified by standard procedures and still maintain this capability . the invention also discloses a viral vector comprising a polya site that is capable of being translationally read in the reverse direction ; the itrs of adeno - associated virus ; and a nucleic acid encoding a polypeptide . in this vector , the inverted terminal repeat sequences promote expression of the nucleic acid in the absence of another promoter . thus , this vector has the advantages of maximum packaging capabilities and the capability to be read in the reverse direction . finally , a functional cystic fibrosis transmembrane conductance regulator protein having a deletion of the amino terminal sequence is provided . while the particular deletion disclosed is in amino acids 1 through 118 , the invention provides the first documentation of an amino terminal deletion which maintains function . given this discovery , it would be routine to delete various alternative amino terminal deletions to accomplish the same purpose by following the methods set forth below . the cfbe ib3 - 1 cell line ( ib3 cells ) is a human bronchial epithelial cell line derived from a cf patient and immortalized with an adeno / sv40 hybrid virus ( luo et al ., 1989 , pflugers arch . 415 : 198 - 203 ; zeitlin et al ., 1991 , am . j . respir . cell mol . biol . 4 : 313 - 319 ). these cells retain characteristics of epithelial cells and are deficient in protein kinase a activation of chloride conductance . ib3 cells were grown at 37 ° c . in 5 % co 2 in lhc - 8 medium ( biofluids , inc . md ) plus 10 % fetal calf serum with added endothelial cell growth supplement ( 15 ug / ml ) in culture flasks or dishes coated with collagen ( 150 ug / ml ), fibronectin ( 10 ug / ml ) and bovine serum albumin ( 10 ug / ml ). the 293 - 31 cell line ( 293 cells ), originally derived from human embryonic kidney cells transformed with the adenovirus type 5 e1a and e1b genes , were grown at 37 ° c . in 5 % co 2 in eagle &# 39 ; s minimal essential medium with 10 % fetal calf serum and were used for transfection assays of cat vectors and for packaging aav vectors into virus particles ( tratschin et al ., 1984 , mol . cell . biol . 4 : 2072 - 2081 ). plasmids were constructed and grown using standard methods ( sambrook et al ., 1989 , molecular cloning , cold spring harbor laboratory , cold spring harbor , n . y .). the aav - cat plasmids were constructed as follows . the parental plasmid , pav2 , contains the entire 4681 nucleotide sequence of aav2 inserted in a pbr322 derived plasmid via a polylinker and bglii linkers ( laughlin et al ., 1983 , gene 23 : 681 - 691 ). from this a plasmid pyt45 was obtained which contained a prokaryotic cat gene immediately downstream of aav nucleotides 1 to 263 ( which placed the cat gene under control the aav p 5 promoter ) followed by aav nucleotides 1882 - 1910 and 4162 - 4681 ( containing the polya signal and right hand itr ) downstream of the cat gene . pro1472 was derived from pyt45 by first deleting a snabi / ndei fragment ( aav nucleotide 4498 to pbr322 nucleotide 2295 ) to yield pro45 . this removed the right hand aav itr but retained the aav polyadenylation ( polya ) site downstream of the cat gene . pro1472 was then constructed by insertion of a synthetic double - stranded oligonucleotide into the hindiii site of pro45 . the oligonucleotide consisted of aav nucleotides 266 - 321 flanked by hindiii overhangs such that only the 5 &# 39 ; end of the insert had a complete hindiii site after ligation . proper insertion was confirmed by sequencing . the final construct pro1472 contains aav nucleotides 1 - 321 upstream of the cat gene ( except that nucleotides 264 and 265 are changed from the wild type sequence cc to tt ) and aav nucleotides 1882 - 1910 and 4162 - 4492 ( containing the polya signal ) downstream . psa60 was derived from pyt45 . 1 ( which is a derivative of pyt45 obtained by filling in ( i . e ., inactivating ) the bamh - i site in the poly - linker sequence immediately upstream of the left - hand itr ) by cleaving pyt45 . 1 with kpni and snab to remove the region containing the aav polya signal ( aav nucleotides 4162 to 4495 ) and inserting a 60 base - pair synthetic oligonucleotide ( spa ) containing a synthetic polya site ( modified from levitt et al ., 1989 , genes and development 3 : 1019 - 1025 ) having kpni and snab compatible termini . this spa was obtained by synthesizing two single oligonucleotides having the following sequences : and annealing these two oligonucleotides to generate the 60 base - pair nucleotide with kpni and snab compatible termini . this spa was designed such that in the sense direction it is a functional polya site and in the other orientation it can be translated through as an open reading frame . the presence of the spa in psa60 was verified by dna sequencing . psa665 was derived from psa60 by inserting at the hindiii site a 54 base - pair oligonucleotide ( representing the 54 bases upstream of the initiation codon of the cftr gene , i . e ., nucleotides aa to bb in the cftr sequence of drumm et al ., 1990 ) via a hindiii site at one end and a hindiii compatible site at the other . this 54 base oligonucleotide was derived by synthesizing and annealing the two oligonucleotides : psa673 was derived in a similar fashion except that the inserted oligonucleotide contained only 27 nucleotides of the upstream cftr sequence ( i . e ., cftr cdna nucleotides aa to bb ). the 27 base - pair oligonucleotide was derived by synthesizing and annealing the two 27 base oligonucleotides : ptrf46 was derived by generating via the pcr reaction a 842 base - pair fragment of pro1472 comprising the region from the pbr322 pvui site to the nucleotide 145 of the aav itr using primers that gave a pvui site in the pbr322 region and a hindiii site adjacent to the aav itr . this was then inserted into psa60 that had been cleaved with pvui and hindiii . the effect of these operations was to generate ptrf46 that is identical to psa60 except that it is deleted for nucleotides 146 to 263 of aav ( i . e ., the entire p 5 promoter ) and places the cat coding region adjacent to the aav itr . the sequence of the entire aav itr region and junction with the cat sequence in ptrf46 was verified by dna sequencing . paavp 5 neo is analogous to pyt45 except that it has a neo coding sequence in place of the cat gene and the downstream aav nucleotides 1882 - 1910 and 4162 - 4492 ( the kpni / snab fragment ) were replaced 60 bp spa . psa313 is analogous to paavp 5 neo except that the neo sequence was replaced with the cftr coding sequence contained in a 4502 bp aval - ssti fragment excised from a plasmid pba - cftrbq ( drumm et al ., 1990 , cell 62 : 1227 - 1233 ). this cftr cdna sequence contains the three silent point mutations in exon 6a which eliminate the prokaryotic promoter sequence . in psa313 , the cftr gene is under control of the aav p 5 promoter . the plasmid psa315 is analogous to psa313 , except that the cftr cdna is inserted in the opposite direction . the plasmid psa306g is analogous to psa315 except that it has a deletion of the cftr nucleotides 131 to 486 . in both psa315 and psa306 the cftr gene is expressed from the aav itr as discussed below . the junction sequences between the cftr insert and the aav termini and spa regions of psa313 , psa315 , and psa306 were verified by dna sequencing . psa464 was derived from psa306 by cleaving with aflii at nucleotide of the cftr sequence and filling in and blunt - end ligation with t4 dna polymerase and t4 dna ligase . this generated a frameshift in the cftr sequence . the presence of this mutation was verified by dna sequencing . dna transfection in ib3 was performed in 6 - or 24 - well dishes using lipofection . thirty ug of lipofection reagent ( brl , gaithersburg , md .) was used for each 5 to 6 ug of dna transfected . lipofectin and dna were mixed in 1 . 0 ml of lhc - 8 serum - free medium and added to cells ( 5 × 10 5 to 5 × 10 6 in 35 mm wells ) already covered with 0 . 5 ml of medium . cells were exposed to dna for 4 hours , rinsed with pbs and then grown in 2 ml of fresh medium . dna transfection in 293 cells was performed by the standard dna - calcium phosphate precipitation procedure . ib3 cells used for stable neo expression were split 1 : 3 into 10 cm dishes at 24 to 48 hours after transfection and geneticin sulfate was added 72 to 96 hours after transfection at a concentration of 120 ug / ml . the amount of geneticin used was based on a minimal lethal dose titration . geneticin resistant ( gen r ) colonies were counted at 14 to 16 days after beginning selection . ib3 cells were plated at approximately 5 × 10 5 cells 35 mm dish . twenty - four hours after plating , cells were transfected using either 6 ug of paavp 5 neo or 1 ug of paavp 5 neo together with 5 μg of psa313 , psa315 , psa306 , or psa464 by lipofection , and geneticin selection was performed as described above . gen r colonies were isolated at 14 days after beginning selection from each of the other two sets of plates . each isolated colony was trypsinized using a cloning cylinder and expanded from 10 mm wells . after expanding each clone , cells were prepared for 36 cl - efflux assays and western blot analysis . chloride efflux assays were performed as described ( trapnell et al ., 1991 , j . biol . chem . 266 : 10319 - 10323 ) on individual clones at passage 4 to 8 . briefly , cells were grown in 35 mm dishes and loaded with 3 uci of 36 cl - in bicarbonate - free ringer &# 39 ; s balanced salt solution for 2 to 9 hours . initial experiments involving repeated assays on the same clone of cells did not reveal significant differences in efflux following different loading times and a 2 hr loading period was then used for subsequent experiments . after loading the cells were washed 2 to 3 times in ice cold 0 . 15 m nacl , 5 mm hepes , pi 7 . 4 . one ml of ringer &# 39 ; s solution was added and removed immediately ( time zero ) and replaced with 1 ml of ringer &# 39 ; s . this process was repeated at various time points over a 15 min period . the amount of radioactivity in each 1 ml sample of medium was determined by liquid scintillation counting . after the last sample was removed at 15 min , residual radioactivity remaining in the cells was determined by lysing the cells in 0 . 2 n naoh and scintillation counting . the total radioactivity from all time points and the final cell lysate was then summed and the efflux was expressed as a percent of total radioactivity remaining in the cells at each time point . effluxes were then repeated for each clone tested , using 10 um forskolin dissolved in the ringer &# 39 ; s efflux solution , starting at time zero . the relative stimulation by forskolin was then expressed by calculating the rate ( k a ) of efflux in the presence of forskolin and expressing this as a ration relative to the rate of efflux in the absence of forskolin . for ib3 cells which exhibit the cf defect this ratio is 1 . 0 or less . for cells complemented by cftr vectors this ration is greater than 1 . 0 . cells used for transient expression of cat vectors were harvested at 48 hours after transfection , lysed by three cycles of freezing and thawing , and assayed for cat activity ( tratschin et al ., 1984 , mol . cell . biol . 4 : 2072 - 2081 ). packaging of aav2 vectors was accomplished by first infecting 293 - 31 cells ( grown to semiconfluence in 100 mm dishes ) with adenovirus type 5 ( ad5 ) ( at a multiplicity of 5 to 10 infectious units / cell ) and then co - transfecting the vector plasmid , psa306 or psa464 ( 1 μg ) and the packaging paav / ad ( 5 μg ) using the capo 4 transfection procedure ( tratschin et al ., 1984 , mol . cell . biol . 4 : 2072 - 2081 ). medium was replaced 2 hr prior to transfection and ad5 was inoculated into the medium 1 hr prior to transfection . the medium was changed 4 hr after transfection . cells were grown for 3 to 4 days then harvested by gently scraping into the medium . for direct analysis of packaging , the lysates were frozen and thawed three times , debris was removed by low speed centrifugation , then heated at 60 ° c . for 15 min to inactivate adenovirus . for use of vectors in transduction of ib3 cells the scraped cells were concentrated by low - speed ( 4000 rpm ) centrifugation and resuspension in 10 mm tris - hcl buffer , ph 8 . 0 . cells were lysed by freezing and thawing three times and the virus was concentrated and purified using cscl density gradient ultracentrifugation ( carter et al ., 1979 , virology 92 : 449 - 462 ). fractions taken for transduction assays were then dialyzed against 1 × ssc three times for 1 h at room temperature and heat - treated at 60 ° c . for 15 minutes to inactivate any possible residual adenovirus . the titer of the vector preparation was determined by dna slot - blot hybridization ( samulski et al ., 1989 , j . virol . 63 : 3822 - 3828 ). virus particle - mediated neo transduction of ib3 - 1 cf bronchial epithelial cells was accomplished by infecting 10 3 to 4 × 10 4 cells in individual wells of a 24 well dish with a known number of aav - cftr vector particles per cell . the cells were grown for several weeks and assayed for complementation of the cf defect . to test the efficiency of the aav p 5 promoter in aav vectors in human cells ( flotte et al ., 1992 ) constructed several p 5 cat plasmids . the plasmid pro1472 contains the cat coding sequence positioned immediately downstream of aav nucleotides 1 to 321 ( fig1 ). this region of aav includes several notable features including an aav inverted terminal repeat ( itr ) from aav nucleotides 1 to 145 and the tata box of the p 5 promoter at nucleotide 255 . nucleotides 204 to 213 constitute a binding site for the mltf ( usf ) transcription factor and nucleotides 217 to 236 comprise a 10 bp repeat that constitutes a novel response element for the adenovirus transcription factor e1a ( chang et al ., 1989 ). a previous report indicated that an aav promoter consisting of nucleotides 190 - 310 had only minimal activity in hela cells unless activated by the e1a protein ( chang et al ., 1989 ). in contrast , an aav promoter comprising the nucleotides 145 - 310 had significant activity in hela cells in the absence of e1a ( beaton et al ., 1989 ). these differences may reflect the presence , between nucleotides 160 to 180 , of the sequence gtgacgtgaattacgtcatag [ seq id no : 7 ], which has homology to the camp response element ( cre ) and the binding site for the creb / atf transcription factor family ( hai et al ., 1988 ; montminy et al ., 1990 ). flotte et al . ( 1992 ) examined several aspects of the aav p 5 promoter vectors . the p 5 - cat plasmid , pro1472 was tested for cat expression after transfection into ib3 ( airway epithelial ) cells and cfpac ( pancreatic adenocarcinoma ) cells and showed efficient cat expression . furthermore , the activity of the p 5 promoter in pro1472 was nearly 10 - fold higher than that of the sv40 early promoter in psv2cat . the cre element mediated a positive response to stimulation with forskolin to activate camp . these results suggested that , in the context of the entire left hand terminus of aav in the complete p 5 promoter camp could mediate a modest induction of expression . the aav p 5 promoter was also efficient for stable expression of a gene , neo , which mediates resistance to the antibiotic geneticin ( gen r ) in mammalian cells . the plasmid aavp 5 neo had neo expressed from a p 5 promoter similar to that in pro1472 and was much more efficient than psv2neo for gen r colony formation when transfected into ib3 cells . also , when the aavp 5 neo vector was packaged into aav transducing particles and infected into cells up to 60 to 70 percent of the cells were transduced to the gen r phenotype . these experiments showed that the aav p 5 promoter was efficient for integration and stable expression of a selective marker in human cells when used in aav vectors . expression of a gene from a promoter comprised only of the aav itr the experiments of flotte et al . ( 1992 ), summarized above , showed that the aav p 5 promoter could function well in aav promoters and this is extremely useful . all aav vectors that are to be used as aav transducing vectors ( i . e ., by packaging into aav particles ) to promote efficient uptake must have an aav itr at each end of the packaged vector genome . that is because the itr sequences contain all of the cis - acting sequence that is required for the aav replication origin , for encapsulation of the genome into particles and for efficient integration into the host cell chromosome . in this context , the p 5 promoter is very useful because it forms a convenient cassette with the itr region and adds only about 120 additional nucleotides . this helps to maximize the amount of space available for packaging foreign dna into aav vectors . these considerations are particularly important for encapsulation of larger genes or cdnas which approach or exceed the packaging capacity of aav as discussed above . as noted above , one such example is the cftr cdna which encodes the gene product which is responsible for the defect in the genetic disease cystic fibrosis . in the course of constructing vectors that were designed to express genes such as cftr from the aav p 5 promoter , we inadvertently made one such plasmid construct in which the gene was inserted in the opposite direction . this vector plasmid would not have been expected to function because it did not have a known promoter in the correct orientation . however , due to a serendipitous mistake in a laboratory experiment , we tested this plasmid construct and discovered that it functioned to express the gene . this caused us to examine the construct carefully and we concluded that the itr may be functioning as a transcription promoter . as a result , we performed specific experiments detailed in this specification which demonstrate that the itr can act as a transcription promoter . thus , aav vectors need have only the itr sequences and a polya site in order to express a foreign gene . this is a new and novel finding and indeed is against the expectation based on previously taught work , in which there was a commonly accepted agreement that the itrs of aav are not transcriptionally active ( walsh et al ., 1992 , pnas [ in press ]). we show here that the aav itr is transcriptionally active in transient assays to express the cat gene and in stable integration assays to express a functional cftr cdna . fig1 shows the construction of several aav - cat vector plasmids . pro1472 has the complete aav p 5 promoter ( nucleotide 145 - 263 ) and itr ( 1 - 145 ) upstream of the cat gene as well as the aav rna start site ( 263 - 320 ) and the aav polya site downstream ( kpni / snab region ). psa60 has the polya site deleted and replaced with a smaller synthetic polya site which increases the packaging capacity of the vector . this polya site also has an additional property that it is translationally open in the reverse orientation ( i . e , reading from the right hand itr ). in psa665 and psa673 , respectively , an additional 54 or 27 nucleotides , derived from the cftr cdna sequence immediately upstream of the presumptive cftr initiation codon , is inserted immediately upstream of the cat gene . in ptrf46 , the cat gene is inserted immediately following the aav itr sequence . these aav - cat plasmids were transfected into human ( 293 ) cells and cat activity was measured in extracts prepared 48 hr later . as shown in table i , pro1472 efficiently expressed cat . also , the plasmid , psa60 , having a full p 5 promoter and a synthetic polya site was as efficient as pro1472 . psa665 and psa673 were about 1 . 5 fold more efficient presumably because the aug initiation codon for the cat coding region was moved away from the immediate proximity of the 5 &# 39 ; cap region of the mrna as compared to psa60 . surprisingly , ptrf46 , expressed cat as efficiently as pro1472 or psa60 , even though it contains none of the previously characterized p , promoter ( i . e ., nucleotides 145 to 320 ). this shows that the aav itr sequence is itself capable of acting as an efficient promoter for gene expression . this is an unprecedented and novel finding for aav that this region is also a promoter . table i______________________________________expression of gene activity from aav vectorsvector . sup . a cat activity (%). sup . b______________________________________pr01472 27 . 5psa60 28 . 2ptrf46 26 . 6psa665 43 . 1psa673 40 . 1control 0 . 02______________________________________ . sup . a human 293 cells ( 10 . sup . 6 cells per 35 mm dish ) were transfected with 5 μg of the indicated vector plasmid . the control culture was not transfected . . sup . b 48 hr after transfection cell lysates were prepared and cat activity was measured as the amount (%) of . sup . 14 cchloramphenicol which was acetylated by incubation with 20 μl of lysate ( equivalent to 1 . 3 × 10 . sup . 5 cells ) at 37 ° c . for 1 hr followed by separation of the acetylated and unacetylated substrate by silicagel thinlayer chromatography and scintillation counting to determine radioactivity . fig2 shows several aav - cftr vectors designed to express cftr either from the aav p 5 promoter as in psa313 or from the aav itr as in psa313 or psa306 . in psa313 , the cftr cdna of 4500 nucleotides is inserted downstream of the aav promoter analogous to that in psa60 , i . e , aav nucleotides 1 to 263 , at the left . in psa315 the cftr cdna was inserted in the opposite orientation such that it is downstream of the right - hand aav itr sequence and the synthetic polya site . in this configuration the cftr is expressed from the right - hand itr and the polya site can be read through translationally in the reverse direction as noted above . in psa306 , the construct is exactly analogous to psa315 except that 350 nucleotides of the amino terminal region of cftr cdna have been deleted . this results in expression from the right - hand itr of a fusion protein consisting of a n - terminally deleted cftr protein having a fusion region at its n - terminus derived from reading through the synthetic polya site in the reverse direction i . e ., from right to left in the orientation of fig2 . the plasmid psa464 is a control derived from psa306 by introducing a frameshift mutation such that it can not produce a functional cftr protein . expression of cftr and complementation of the cf defect in stable transfectants of cf airway cells to examine the efficiency of the aav - cftr vectors for expression of the cftr gene , the plasmids shown in fig2 were each transfected using cationic liposomes ( lipofectin reagent , brl , gaithersburg , md .) into ib3 cells , together with paavp 5 neo . control cells were transfected with paavp 5 neo alone . gen r colonies were picked from the original plates and expanded into stable cultures and characterized for functional expression of the cftr protein . all of these clones were stable for neo expression during repeated passage over several months in culture . expression of cftr can be detected in functional assays in ib3 cells which have the cystic defect a functional cftr protein should restore to these cells a cl - conductance which is regulated by camp and thus is stimulated by forskolin ( drumm et al ., 1990 , cell 62 : 1227 - 1233 , hwang et al ., science 244 : 1351 - 1353 ; li et al ., 1988 , nature ( london ) 331 : 358 - 360 ; li et al ., 1989 , science 244 : 1353 - 1356 ; rich et al ., 1990 , nature 347 : 358 - 363 ). examples of cl - efflux are shown in fig3 and a summary of the rate constants calculated from this data are shown in fig4 . both the parental ib3 cells and the control n6 clone ( transfected with paavp 5 neo alone ) exhibited a relatively slow cl - efflux rate that was not responsive to forskolin ( fig3 a and 3b ). in contrast , a number of the clones of aav - cftr transfectants , as shown in fig3 for clones c35 ( fig3 d ) and c38 ( fig3 c ) ( both derived from transfection of psa306 ), exhibited significantly increased basal rates of efflux but more significantly showed the characteristic additional increase in efflux in response to forskolin . as shown in the summary ( fig4 ) 28 % ( 4 / 14 ) of the psa313 transfectants , and 50 % ( 6 / 12 ) of the transfectants with either psa315 or psa306 were complemented for the defect . this shows that all three vector constructs were functional . the increased number of functional clones with psa313 or psa306 may indicate that the itr promoter in the vectors was more efficient than the p 5 promoter in psa313 . none of the clones transfected with the control vector psa464 were complemented . these results show two novel findings . first , the aav itr sequence functions efficiently also as a promoter when stably integrated into cells as shown by the function of both psa313 and psa306 . second , the truncated cftr protein expressed from psa306 is also functional for complementation of the cftr defect . in the psa306 vector the largest open reading frame expresses a fusion protein by reading through most of the synthetic polya sequence in the reverse direction . the observations with psa306 are especially pertinent because it was taught previously that the region of cftr that is deleted in psa306 was in fact essential for cftr function when cftr is expressed from various others vectors such as vaccinia ( andersen et al ., 1991 , science 251 : 679 - 682 ). also , the overall size of the aav - cftr vector in psa306 is equivalent to the size of wild type aav dna and thus this vector should be packageable into aav particles to use as a transducing vector . we examined packaging of the psa306 vector into aav particles . to examine packaging of aav - cftr vector psa306 into aav particles adenovirus - infected 293 cells were transfected with the aav - cftr vector ( psa306 ) in the presence (+) or absence (-) of the aav packaging plasmid ( paav / ad ). lysates of the cultures were prepared 72 hr after transfection and used to infect fresh cultures of adenovirus - infected 293 cells in the absence ( minus wt ) or presence ( plus wt ) of added wild type aav particles ( m . o . i 3 ). 40 hr after infection , hirt lysates of the cells were prepared and viral dna was electrophoresed in an agarose gel , blotted to nitrocellulose , and hybridized with a cftr 32 p - dna probe specific for the sa306 vector ( 306 ) or with aav 32 p - dna probe specific for wild - type aav ( aav ). replication of the sa306 vector was only detected in lysates that had been packaged in the presence of paav / ad and were subsequently infected in the presence of added wild - type aav particles . this showed that the aav - cftr vector could be packaged into aav transducing particles . to demonstrate the functionality of the sa306 aav - cftr transducing vector ib3 cell cultures were infected with vector preparations containing packaged sa306 or a control sa464 vector at a multiplicity of 400 vector particles per cell . the cultures were grown several weeks in culture and assayed for functional expression of the cftr . as shown in fig5 the culture infected with the sa306 vector ( a0 cells ) was functionally complemented for the cf defect as shown by the response to forskolin . in contrast the control culture infected with the control sa464 vector ( 2f2 cells ) was not complemented as shown by the lack of response to forskolin . the results shown in fig3 , and 5 have been confirmed by other functional assays including immunofluorescent detection of the cftr protein and electrophysiological assays using patch - clamp techniques . the results described above demonstrate complementation and stable correction of the cf defect in airway epithelial cells after cationic liposome mediated transfection with aav - cftr vector or after infection of the cells with aav - cftr transducing vector particles . these results demonstrate the utility of the aav vectors and the invention as practiced with aav vectors using an itr as the promoter and incorporating a synthetic polya site having special features . our studies with the aav - cftr vectors were performed as an initial step in evaluating the feasibility of using an aav vector for gene therapy . in this respect it is important that we have demonstrated stable complementation of the cf defect in cells derived from bronchial epithelium since this the site of the major clinical manifestation of the disease and is the most likely site for targeting of gene therapy vectors . the complementation experiments reported with a retroviral vector ( drumm et al ., 1990 , cell 62a : 1227 - 1233 ) were performed in cfpac cells which are pancreatic cells rather than airway cells . aav vectors , especially those expressing a gene from the itr , can be used to treat human patients in the following general way . if the vector is to be delivered as transducing particles , it can first be packaged into aav particles , in the general way described here for the aav - cftr vector sa306 , or using any other suitable packaging system . the aav transducing vector can be purified to remove and / or inactivate any adventitious agents or toxic compounds by banding in cscl or any other appropriate procedure . for aav vectors expressing a functional cftr gene , or any other gene for treating a pulmonary disease , the vector can be delivered directly in vivo to the lung either by intubation and bronchoscopy or by a nebulizer or by a nasal spray or by inhalation as an appropriate formulation of nose drops . for this or other diseases , the aav vector particles can be delivered in vivo by intravenous or enteric administration or perhaps subcutaneously . the vector can also be used in ex vivo gene therapy procedures by removal of cells from a patient that is then infected with the aav vector particles and the cells are returned to the patient after a period of maintenance and / or growth ex vivo . the aav vectors can also be administered in either in vivo or ex vivo gene therapy procedures in various other formulations in which the vector plasmid is administered as free dna either by direct injection or after incorporation into other delivery systems such as liposomes or systems designed to target by receptor - mediated or other endocytosis procedures . the aav vector can also be incorporated into an adenovirus , retrovirus or other virus which can be used as the delivery vehicle . an additional use of the present discovery is to utilize the sequences of itr which are responsible for promotion in other vectors . the itr region of aav does not have a normal tata motif common to many eukaryotic promoters and was not previously recognized to function within the context of an aav genome as a transcription promoter . it is likely that in the context of the aav genome this itr does not function as a promoter perhaps because of effects of the other known aav promoters downstream of this . however , not all eukaryotic transcription promoters require or possess the tata motif . after we demonstrated that the aav itr functions as a promoter we examined the itr sequence for elements that are likely to explain this function . inspection of the itr sequence shows two motifs that are likely to be important in its function as a promoter . first , in the region between aav nucleotide 125 and 145 ( commonly known as the aav d sequence ) there is the sequence 5 &# 39 ;- aactccatcact - 3 &# 39 ; [ seq id no8 ]. this is only one base different from similar sequences at the 5 &# 39 ; start site of the promoters for human terminal deoxynucleotidyl transferase gene and for the adenovirus major late gene promoter and matches closely the consensus sequence for an element described as an inr ( initiator ) element ( smale , s . t . and baltimore , d ., 1989 , cell 57 : 103 - 113 ; smale et al ., 1990 , proc . natl . acad . sci . u . s . a . 87 : 4509 - 4513 ). a second series of gc - rich elements is present in the itr region between nucleotides 1 and 125 including the elements , ggccgcccgggc [ seq id no9 ] from nucleotides 41 to 50 , aaagcccgggcgtcgggcgacc [ seq id no10 ] from nucleotides 51 to 73 , ggtcgcccggcctca [ seq id no11 ] from nucleotides 76 to 90 , and cagcggcgagag [ seq id no12 ] from nucleotides 101 to 112 which have strong homology with the series of consensus sites shown to be sites for the common transcription factor sp1 ( pitluck and ward , 1991 , j . virol . 65 : 6661 - 6670 ). finally , it is now known that an inr sequence in the presence of sites for other factors such as sp1 can function as a transcription promoter ( smale and baltimore , 1989 ; smale et al ., 1990 ). it is likely that these or other regions of the itr may be important in allowing it to function as a transcription promoter . it is now straightforward and obvious to others experienced in the field to perform standard mutagenesis techniques to alter the itr sequence ( for instance , in the context of the plasmid ptrf46 ) to determine precisely the controlling elements and to modulate the transcriptional activity of the itr either up or down . throughout this application various publications are referenced . the disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains . although the present processes have been described with reference to specific details of certain embodiments thereof , it is not intended that such details should be regarded as limitations upon the scope of the invention . __________________________________________________________________________ # sequence listing - ( 1 ) general information :- ( iii ) number of sequences : 13 - ( 2 ) information for seq id no : 1 :- ( i ) sequence characteristics :# pairs ( a ) length : 58 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 1 :- caggcctaat aaagagctca gatgcatcga tcagagtgtg ttggtttttt gt - # gtgtac 58 - ( 2 ) information for seq id no : 2 :- ( i ) sequence characteristics :# pairs ( a ) length : 62 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 2 :- gtacacacaa aaaaccaaca cactctgatc gatgcatctg agctctttat ta - # ggcctggt 60 # 62 - ( 2 ) information for seq id no : 3 :- ( i ) sequence characteristics :# pairs ( a ) length : 54 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 3 :- agctggtctt tggcattagg agcttgagcc cagacggccc tagcagggac cc - # ca 54 - ( 2 ) information for seq id no : 4 :- ( i ) sequence characteristics :# pairs ( a ) length : 54 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 4 :- agcttggggt ccctgctagg gccgtctggg ctcaagctcc taatgccaaa ga - # cc 54 - ( 2 ) information for seq id no : 5 :- ( i ) sequence characteristics :# pairs ( a ) length : 27 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 5 :# 27 gcag ggaccca - ( 2 ) information for seq id no : 6 :- ( i ) sequence characteristics :# pairs ( a ) length : 27 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 6 :# 27 aggg ccgtgtc - ( 2 ) information for seq id no : 7 :- ( i ) sequence characteristics :# pairs ( a ) length : 21 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 7 :# 21 cata g - ( 2 ) information for seq id no : 8 :- ( i ) sequence characteristics :# pairs ( a ) length : 12 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 8 :# 12 - ( 2 ) information for seq id no : 9 :- ( i ) sequence characteristics :# pairs ( a ) length : 12 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 9 :# 12 - ( 2 ) information for seq id no : 10 :- ( i ) sequence characteristics :# pairs ( a ) length : 22 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 10 :# 22cga cc - ( 2 ) information for seq id no : 11 :- ( i ) sequence characteristics :# pairs ( a ) length : 15 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 11 :# 15 - ( 2 ) information for seq id no : 12 :- ( i ) sequence characteristics :# pairs ( a ) length : 12 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 12 :# 12 - ( 2 ) information for seq id no : 13 :- ( i ) sequence characteristics :# pairs ( a ) length : 58 base ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 13 :- caggcctaat aaagagctca gatgcatcga tcagagtgtg ttggtttttt gt - # gtgtac 58__________________________________________________________________________	0
fig3 illustrates one embodiment of the present invention wherein the stator wafer 20 surface closest to the micro - mover 50 has upon it not only stator electrodes 80 but also a bumper 120 . although the bumper 120 is positioned adjacent to only one stator electrodes 80 , this configuration is not restrictive of the present invention . in fact , as shown in fig4 the bumper 120 can easily be position between any two of the stator electrodes 80 . fig5 illustrates another embodiment of the present invention with two bumpers , a first bumper 120 on the surface of the stator wafer 20 closest to the micro - mover 50 , and a second bumper 121 on the surface of the micro - mover 50 closest to the stator wafer 20 . although both bumpers 120 , 121 illustrated in fig5 are positioned to the outside of the electrodes 80 , 90 , either or both of the bumpers can be positioned between two electrodes 80 , 90 , as shown in fig4 . fig6 a and 6b illustrate yet other embodiments of the present invention wherein three and four bumpers 120 are present in a micro - machined actuator 10 . in fig6 a , the three bumpers 120 are arranged in a triangular configuration . dependent upon the particular embodiment of the present invention , each of the three bumpers 120 can be positioned either on the stator wafer 20 or on the micro - mover 50 . for example , a first and second bumper can be positioned on the stator wafer 20 while a third bumper can be positioned on the micro - mover 50 . also , each of the bumpers 120 can be positioned either adjacent to one electrode 80 , 90 or between two electrodes 80 , 90 . in fig6 b , four bumpers 120 are positioned in a square or rectangular configuration wherein each bumper 120 can be either on the stator wafer 20 or the micro - mover 50 . each of the bumpers 120 can be adjacent to one electrode 80 , 90 or positioned between two electrodes 80 , 90 . in addition to the configurations illustrated in fig6 a and 6b , more than four bumpers 120 can also be positioned between the stator wafer 20 and micro - mover 50 . regardless of how many bumpers 120 are present , no limitations are made regarding the geometric arrangement of the bumpers 120 . for example , although fig6 a shows the bumpers 120 to be in a triangular configuration , the three bumpers 120 can be in a linear , random , or other geometrical configuration . the same is true for the four bumpers 120 illustrated in fig6 b and for higher - bumper number embodiments of the present invention . according to the embodiments illustrated in fig3 - 6b , each of the bumpers 120 protrude a greater distance from the surfaces to which they are attached than the electrodes 80 , 90 protruding from those same surfaces . although no particular restrictions are placed on how far the bumpers 120 and electrodes 80 , 90 protrude from their respective surfaces , certain embodiments of the present invention provide for the electrodes 80 , 90 to protrude 75 % as far as the bumpers 120 . other embodiment of the present invention have electrodes 80 , 90 that protrude from the surfaces to which they are attached 90 %, 50 %, 10 %, 5 % and 1 % as far as the bumpers 120 attached to the same surfaces . the bumpers 120 can be made from many different materials and are not restricted in its geometry . hence , the bumpers 120 can be circular protrusions , square protrusions , or protrusions of other geometrical shapes . also , although the bumpers 120 discussed above have been either adjacent to one electrode 80 , 90 or positioned between two electrodes 80 , 90 , certain embodiments of the present invention include bumpers 123 that overlap at least portions of one or more electrodes 80 , 90 . such a configuration is shown in fig7 a and 7b , where fig7 a illustrates a cross - sectional view of an actuator 10 and fig7 b illustrates a top perspective view of the surface of the stator wafer 20 that contains stator electrodes 80 . the bumper 122 is shown in fig7 b as overlapping two stator electrodes 80 partially . for the purposes of simplicity , the bumpers described above are preferably made from the same material as the surface from which they protrude . however , this is in no way restrictive of the present invention and the bumpers , according to certain embodiments , can be made from materials different from those of the surfaces from which they protrude . for example , metal , insulator , dielectric , semiconductor or polymer bumpers could be formed on the surface of a semiconductor stator wafer 20 . according to certain embodiments of the present invention , electrically grounded metal bumpers are used . the overall dimensions of the bumper 120 are typically on the order of microns , though these dimensions are in no way limiting of the present invention . in fact , if the electrodes 80 , 90 were made from nanowires , the bumper 120 could have nanometer dimensions . although it was mentioned above that , without the bumper 120 positioned between the micro - mover 50 and the stator wafer 20 , the actuator electrodes 90 and stator electrodes 80 could fuse , the actual method of fusion was not described . for the sake of completeness , the fusion occurs as , when the electrodes 80 , 90 come in close enough contact to each other , a current path forms between the electrodes 80 , 90 and the electrodes 80 , 90 melt together . the actuator described above can be included in many types of devices . for example , any micro - machine or nano - machine having a suspended platform above a surface is within the scope of the present invention . this includes , but is not limited to , all sorts of sensors , data storage devices , and other devices that require micro - actuators . the distance separating the micro - mover 50 and stator wafer 20 is generally on the order of 1 - 10 microns . however , this is in no way limiting of the present invention and any actuator wherein the electrodes 80 , 90 can exert enough force on each other to move the micro - mover 50 without coming into such close contact that they fuse together are also within the scope of the present invention . one method of manufacturing some of the actuators within the scope of the present invention includes forming stator electrodes 80 on a first surface of a stator wafer 20 . then , a micro - mover 50 is formed and positioned adjacent to the first surface of the stator wafer 20 . on the surface of the micro - mover 50 closest to the stator wafer are formed actuator electrodes 90 . at least one bumper 120 is formed on either the first surface of the stator wafer 20 or of the micro - mover 50 . this bumper 120 can be formed by selective etching , deposition , or another method of forming a protrusion from a surface . the foregoing detailed description has been given for understanding exemplary implementations of the invention only and no unnecessary limitations should be understood therefrom as modifications will be obvious to those skilled in the art without departing from the scope of the appended claims and their equivalents .	7
fig1 and 2 depict preferred fuel filter embodiments containing adsorbent material in accordance with the present invention . for purposes of illustrating these preferred embodiments , al 2 o 3 impregnated with ag ions ( hereafter referred to as ag - ap - al 2 o 3 ) will be used as the adsorbent material . however , nothing in this illustration should be taken as a limitation upon the overall scope of the invention . turning now to fig1 which depicts a single - connector type fuel filter 10 comprising housing 12 having a plurality of sorbent ag - ap - al 2 o 3 pellets 14 located therein . the flow of incoming fuel into filter 10 is indicated by arrow 16 . the incoming fuel 16 enters the filter through a central orifice 18 and then flows through cylinder 20 and into chamber 22 where it contacts pellets 14 . as the fuel contacts pellets 14 , organosulfur contaminants in the fuel are adsorbed by the pellets . the purified fuel denoted by arrows 24 then leaves the chamber 22 ( and consequently filter 10 ) through a plurality of orifices 26 . filter 10 is equipped with a male threaded ring section 28 which may be received in a corresponding female threaded opening ( not shown ) of , for example , an engine block . additionally , solvent resistant gaskets ( not shown ) may be used with filter 10 in order to properly seal the filter orifices 18 , 26 with the engine block so as to avoid leaking . fig2 depicts another preferred fuel filter apparatus 30 which is suitable for in - line connection . like the embodiment of fig1 , filter 30 comprises a housing 32 having a plurality of sorbent ag - ap - al 2 o 3 pellets 34 located therein . the flow of fuel through the filter is depicted by arrows 36 , 38 . the fuel enters filter 10 through orifice 40 and enters chamber 42 whereupon it comes into contact with pellets 34 . again , as the fuel contacts pellets 34 , organosulfur contaminants in the fuel are adsorbed by the pellets . the purified fuel denoted by arrows 38 then leaves the chamber 42 through orifice 44 . filter 30 is configured for in - line placement in a fuel delivery system . filter 30 may be attached directly to the fuel line using connectors 46 , 48 . brackets 50 allow filter 30 to be fixedly secured to a solid portion of the vehicle in order to avoid damage to the fuel line or filter attributable to vehicle motion and vibrations . the following examples set forth preferred methods of synthesizing nanocrystalline mesoporous metal oxide compounds in accordance with the present invention . it is to be understood , however , that these examples are provided by way of illustration and nothing therein should be taken as a limitation upon the overall scope of the invention . in this example , nanosized al 2 o 3 particles were impregnated with silver ions . in a 250 ml round bottom flask , about 0 . 2 g of nanosized al 2 o 3 ( also referred to as ap - al 2 o 3 ) prepared by the aerogel method described by utamapanya et al ., chem . mater ., 3 : 175 - 181 ( 1991 ), incorporated by reference herein , 0 . 11 g of silver acetylacetonate ( aldrich ), and 25 ml of tetrahydrofuran ( fisher ) were combined . the resulting slurry was stirred at room temperature for about 24 hours and protected from exposure to light with aluminum foil . after stirring , the mixture was centrifuged , washed with tetrahydrofuran approximately 4 - 5 times to remove excess silver acetylacetonate , and dried in a drying cabinet for about 2 hours . the brown powder that remained was heated at 500 ° c . under an air atmosphere inside a muffle furnace for about 3 hours . the final product was a brownish black powder and was designated ag - ap - al 2 o 3 . this example describes the adsorption of thiophene using ag - ap - al 2 o 3 prepared according to example 1 . to about 0 . 1 g of ag - ap - al 2 o 3 , 10 ml of thiophene solution in pentane ( 9 . 9 × 10 − 5 m ) was added . the sorption of thiophene was allowed to proceed at room temperature for about 15 hours . the degree of thiophene sorption on ag - ap - al 2 o 3 was determined by measuring the uv - v is spectrum of the supernatant solution . analysis showed that the silver ion impregnated ap - al 2 o 3 was successful in scavenging thiophene from the pentane solution . this example relates to impregnation of nanocrystalline mgo with nickel ions ( ni 2 + ), the final product being designated ni 2 + - ap - mgo . in a 250 ml round bottom flask , 0 . 2 g of nanosized mgo ( also referred to as ap - mgo ) prepared by the aerogel method , 0 . 1 g of nickel acetylacetonate , and 25 ml of tetrahydrofuran are combined . the slurry is stirred at room temperature for about 24 hours . the mixture is centrifuged , washed with tetrahydrofuran , and dried in a drying cabinet for about 2 hours . the resulting powder undergoes calcination for about 3 hours inside a muffle furnace at 500 ° c . initially under an air atmosphere switching over to a vacuum . ni 2 + - ap - al 2 o 3 may be prepared in a similar manner by substituting ap - al 2 o 3 for mgo . similarly , cu + , au + , ga 3 + , and in 3 + may be substituted for ni 2 + in this process and the metal oxide impregnated therewith . this example describes impregnation of a nanocrystalline metal oxide with a second metal oxide which exhibits the properties of a lewis acid . specifically , this example describes the impregnation of al 2 o 3 with ga 2 o 3 ( the lewis acid ). in a 250 ml round bottom flask , 0 . 2 g of nanosized al 2 o 3 ( also referred to as ap - al 2 o 3 ) prepared by the aerogel method , 0 . 1 g of gallium acetylacetonate , and 25 ml of tetrahydrofuran are combined . the slurry is stirred at room temperature for about 24 hours . the mixture is centrifuged , washed with tetrahydrofuran to remove the excess gallium acetylacetonate , and dried in a drying cabinet for about 2 hours . the resulting powder undergoes calcination for about 3 hours inside a muffle furnace at 500 ° c . under an air atmosphere . it is important to note that mgo may be substituted for al 2 o 3 and indium acetylacetonate for gallium acetylacetonate with little modification of the overall method . this example pertains to the preparation of nanocrystalline ga 2 o 3 having a high surface area useful as a sorbent for thiophene removal from a fluid . in this procedure , 7 % by weight gallium ethoxide in ethanol solution is prepared and 63 % by weight toluene solvent is added . the solution is then hydrolyzed by the addition of 0 . 5 % by weight water dropwise while the solution is stirred and covered with aluminum foil to avoid evaporation . to ensure completion of the reaction , the mixture is stirred overnight . this produces a gel which is treated in an autoclave using a glass lined 600 ml capacity parr miniature reactor . the gel solution is placed in the reactor and flushed for 10 minutes with nitrogen gas , whereupon the reactor is closed and pressurized to 100 psi using nitrogen gas . the reactor is then heated up to 265 ° c . over a 4 hour period at a heating rate of 1 ° c ./ min . the temperature is equilibrated at 265 ° c . for 10 minutes ( final reactor pressure is about 900 psi ). at this point , the reactor is vented to release the pressure and vent the solvent . finally , the reactor is flushed with nitrogen gas for 10 minutes . the resulting ga ( oh ) 3 particles undergo calcination and are converted to ga 2 o 3 . the calcination proceeds for about 6 hours under an air atmosphere up to a maximum temperature of 500 ° c . the indium ethoxide may be substituted for gallium ethoxide in the preceding method for production of in 2 o 3 .	2
referring to fig1 shown generally at 10 is the motor starting device of the present invention . starting device 10 is shown connected to a capacitor - start , capacitor - run motor indicated generally at 12 . motor 12 includes a main or run winding 14 , a start or auxiliary winding 16 , a run capacitor c1 and a start capacitor c2 . starting device 10 includes a relay comprising a coil 18 and a set of normally - closed contacts 20 . one side of coil 18 is connected through the main terminals 22 and 24 of a triac q1 , a lead 26 and a lead 28 to one side of a conventional 240 volt alternating current power source at a terminal 30 . the other side of relay coil 18 is connected through a lead 32 and a lead 34 to the other side of the power source at a terminal 36 . the relay contacts 20 are connected in series with start winding 16 and start capacitor c2 between leads 28 and 34 . run capacitor c1 is connected between lead 34 and a junction 38 between relay contacts 20 and start winding 16 , and main winding 14 is connected between leads 28 and 34 . starting device 10 includes a microcomputer m1 which , in the preferred embodiment , is a motorola mc68hc705ko . for brevity , only those ports and bits therein necessary to disclose the present invention are shown . also for brevity , the various ports and bits therein are hereinafter referred to as pins . for example , port pa , bit 7 , will be referred to as pin pa7 . a filter capacitor c3 is connected at one end through lead 28 to terminal 30 , and at its other end through a lead 40 , a series pass resistor r1 , a controlled rectifier cr1 and lead 34 to terminal 36 . a voltage regulator vr1 is connected in parallel with capacitor c3 . lead 28 is also connected to pin v dd of microcomputer m1 , and lead 40 is also connected to pin v ss . capacitor c3 , regulator vr1 and resistor r1 function to provide a 5 volt unidirectional power source between pins v dd and v ss . a circuit for monitoring start winding voltage is indicated generally at 42 . circuit 42 comprises a pair of resistors r2 and r3 connected in series between lead 28 and junction 38 through a lead 44 and a controlled rectifier cr2 . a junction 46 between resistors r2 and r3 is connected by a lead 48 to pin pbo , and by lead 48 and a controlled rectifier cr3 to lead 40 . a circuit for monitoring main winding voltage is indicated generally at 50 . circuit 50 comprises a pair of resistors r4 and r5 connected in series between lead 28 and lead 34 through lead 44 , a lead 52 and controlled rectifier cr1 . a junction 54 between resistors r4 and r5 is connected by a lead 56 to pin irq . an oscillator circuit comprises a resistor r6 and a capacitor c4 connected in series between pin osc2 and lead v ss . the junction 58 between resistor r6 and capacitor c4 is connected by a lead 60 to pin osc1 . the oscillator circuit provides a clock frequency of 2 megahertz . with such clock frequency , the timing resolution is 4 microseconds . a gate terminal 62 of triac q1 is connected through a resistor r7 to pin pa4 . a resistor r8 is connected between main terminal 24 and gate 62 to prevent unwanted triggering of triac q1 . a snubber network comprising a resistor r9 and a capacitor c5 is connected across main terminals 22 and 24 of triac q1 . a resistor r10 is connected across start capacitor c2 . resistor r10 provides a discharge path for capacitor c2 . a resistor r11 and an led1 ( light emitting diode ) are connected in series between lead 28 and pin pa7 . led1 is energized in the event of a failure of specific hardware or software that is being monitored . in operation , when electrical power is initially applied to terminals 30 and 36 , the 5 volt power source established by capacitor c3 , regulator vr1 and resistor r1 is applied to pins v dd and v ss , causing microcomputer m1 to be initialized . concurrently , main winding 14 is energized . pin pa4 is held at a logic high so that triac q1 is off . with triac q1 off , relay coil 18 is de - energized so that its normally - closed contacts 20 remain closed . with relay contacts 20 closed , start winding 16 is energized through contacts 20 and start capacitor c2 . run capacitor c1 is also energized . under these conditions , the motor develops a starting torque which , if greater than the load requirements , causes the motor to start rotating . when power source terminal 30 is positive and increasing in value , the voltage at junction 54 between resistors r4 and r5 is also positive and increasing in value due to current flow through resistors r4 and r5 . when terminal 30 is negative , rectifier cr1 blocks current flow through resistors r4 and r5 so that the voltage at junction 54 is essentially zero . the voltage at junction 54 is applied through lead 56 to pin irq of microcomputer m1 . when junction 54 , and thus pin irq , is a few volts above zero and increasing , microcomputer m1 executes an interrupt and stores a value of time indicative of when the interrupt occurred . as the motor begins to rotate , the voltage across start winding 16 begins to increase . as the voltage across start winding 16 increases , the voltage at junction 46 between resistors r2 and r3 increases due to current flow through resistors r2 and r3 . rectifier cr2 prevents a reversal of current flow through resistors r2 and r3 . the voltage at junction 46 is applied through lead 48 to pin pbo . rectifier cr3 clamps pin pbo at a voltage slightly below the voltage at v ss so as to prevent an excessive voltage value from being applied to pin pbo . when junction 46 , and thus pin pbo , is a few volts above zero and increasing , microcomputer m1 stores a value of time indicative of when this condition occurred . resistors r2 and r4 are preferably 10k ohms and resistors r3 and r5 are preferably 720k ohms . with such voltage divider values , the times at which the voltages across windings 14 and 16 reach the &# 34 ; few volts above zero &# 34 ; voltage levels are very close to the repetitive times at which the voltages are zero and increasing . microcomputer m1 is programmed to monitor junctions 46 and 54 in the manner previously described and preferably every line - cycle , and to determine the difference in time between the times at which the main winding voltage and the start winding voltage reach the &# 34 ; few volts above zero &# 34 ; voltage level . such time difference defines a phase angle relationship between the two windings 14 and 16 . microcomputer m1 is further programmed to compare the time difference value relating to the instant one of such monitoring events with the time difference value relating to the monitoring event immediately prior to the instant monitoring event so as to determine whether the time difference ( phase angle ) is increasing or decreasing . as will hereinafter be described , the present invention utilizes changes in such time difference ( phase angle ) for determining when to disconnect start capacitor c2 . referring to fig2 a curve 70 illustrates the manner in which a phase angle between windings 14 and 16 changes with respect to motor speed in a particular motor tested , such motor being a 5 - horsepower motor of the capacitor - start , capacitor - run type . as shown , the phase angle is approximately 105 degrees when the motor speed is zero . as the motor speed increases , the phase angle decreases . at a speed s1 of approximately 3000 rpm , when the phase angle is approximately 62 degrees , the phase angle stops decreasing and begins to increase . microcomputer m1 responds to this increase in phase angle by disconnecting start capacitor c2 . specifically , microcomputer m1 monitors the phase relationship of main winding 14 and start winding 16 at its pins irq and pbo , respectively , in the manner previously described . when the phase angle stops decreasing and begins to increase , microcomputer m1 provides a logic low at pin pa4 . the logic low enables triac q1 to be gated on through resistor r7 . with triac q1 conducting , relay coil 18 is energized whereby its controlled contacts 20 open thereby disconnecting start capacitor c2 from start winding 16 . as previously described , it is desirable that a start capacitor be disconnected at approximately 80 percent of synchronous speed , which disconnecting speed would be 2880 rpm with a motor whose synchronous speed is 3600 rpm . while 3000 rpm is approximately 83 percent of the synchronous speed , it is sufficiently near the desired disconnecting speed . while normal fluctuations in applied line voltage cause the value of the voltage across start winding 16 to fluctuate , such fluctuations do not appreciably affect the phase angle motor speed relationship illustrated in fig2 . specifically , while curve 70 represents the phase relationship at a specific value of applied line voltage , the illustrated phase relationship remains essentially the same with any applied line voltage within the allowable limits of such fluctuations , such limits being , for example , plus 10 percent and minus 15 percent of 230 volts . curve 72 in fig2 illustrates the torque developed in the tested motor with respect to motor speed . it is noted that the maximum torque occurs at a speed slightly less than speed s1 . at speed s1 , the torque is just a few pound - feet less than its maximum value . thus , the torque being developed when the start capacitor c2 is disconnected is very near its maximum value . that the torque is at or near its maximum value when the start capacitor c2 is disconnected ensures that the motor will not stall but rather will continue to run properly . when start capacitor c2 is disconnected , the values of the torque and phase angle change . referring to fig3 curves 80 and 82 therein illustrate the phase angle and torque versus motor speed relationships , respectively , of the tested motor with start capacitor c2 disconnected . motor speed s2 is the same speed as the 3000 rpm speed s1 of fig2 . when start capacitor c2 is disconnected , the torque decreases from approximately 44 pound - feet indicated at t1 in fig2 to approximately 36 pound - feet indicated at t2 in fig3 ; the phase angle increases from approximately 62 degrees indicated at p1 in fig2 to approximately 73 degrees indicated at p2 in fig3 . typically , the motor has started properly so that the small drop in torque when start capacitor c2 is disconnected does not cause the motor to stall due to the load requirements exceeding the available torque . the motor increases its speed past speed s2 to a speed at which the torque produced by the motor equals the torque required by the load , such speed being slightly less than synchronous speed and sometimes being referred to as the slip speed . as previously described , relay coil 18 is initially energized in response to a reversal from a decreasing to an increasing phase angle . also as previously described , the phase angle increases abruptly when start capacitor c2 is disconnected at speed s2 . also , as shown in fig3 the phase angle continues to increase as the motor increases its speed past speed s2 . such increases in phase angle enable continued energizing of relay coil 18 and thus enable continued disconnection of start capacitor c2 . for the purpose of preventing start capacitor c2 from being damaged , microcomputer m1 includes an internal timer which provides a specific time period , such as 5 seconds , for limiting the amount of time that start capacitor c2 can be energized . if start capacitor c2 is not disconnected within 5 seconds of the motor 12 being energized , microcomputer m1 provides a logic low at pin pa4 to enable triac q1 to be gated on , thus enabling relay coil 18 to be energized and thus causing start capacitor c2 to be disconnected . preferably , microcomputer m1 is programmed to provide for reconnection of start capacitor c2 , and thereby provide an increase in torque , in the event that the motor begins to stall . it should be noted that this feature of providing for reconnection of start capacitor c2 can be omitted if it is not desired . the basic logic utilized in microcomputer m1 is to monitor the phase angle as previously described and to de - energize relay coil 18 when the phase angle reverses . accordingly , referring to curve 80 in fig3 as the motor speed decreases , the phase angle decreases . at a motor speed s3 of approximately 2000 rpm , the phase angle begins to increase . the phase angle at speed s3 is indicated as phase angle p3 . referring to curve 82 in fig3 the torque at motor speed s3 is indicated as torque t3 . at speed s3 , when the phase angle reverses , triac q1 turns off , thus effecting de - energizing of relay coil 18 . with coil 18 de - energized , its contacts 20 close thereby reconnecting start capacitor c2 . when start capacitor c2 is reconnected , the values of the torque and phase angle change . referring to fig2 motor speed s4 is the same speed as speed s3 in fig3 . when start capacitor c2 is reconnected , the torque increases from approximately 24 pound - feet indicated at t3 in fig3 to approximately 39 pound - feet indicated at t4 in fig2 ; the phase angle increases from approximately 66 degrees indicated at p3 in fig3 to approximately 70 degrees indicated at p4 in fig2 . if the increased torque is sufficient to satisfy the load requirements , the motor speed will then increase ; if not sufficient , the motor will stall . while a preferred embodiment of the present invention has been illustrated and described in detail in the drawings and foregoing description , it will be recognized that many changes and modifications will occur to those skilled in the art . it is therefore intended , by the appended claims , to cover any such changes and modifications as fall within the true spirit and scope of the invention .	7
fig1 shows the basic circuit of the pin card . the microcontroller 1 is a microcomputer system that contains control software and means to interface with the keypad 5 and ram 2 . it also contains software necessary to communicate with the authorization terminal and implement encryption . the keypad 5 might typically be a membrane type unit feeding directly into the microcontroller 1 . the ram 2 is used to store the matrix and other encryption parameters : i . e ., the user &# 39 ; s pin code and the random number , as they come in from their input points . in this case , the ram is a static ram and must be powered by a battery 26 so as not to lose the matrix . the battery might be a lithium button cell . the uart 4 ( which could be a usart ) is used to tailor data from the microcontroller 1 into a form required for communication with authorization terminals . the interface between the pin card and the authorization terminal is critical . if there is an electrical connection between the two units , as shown in fig9 and 10 , the system is subject to problems caused by contamination and static discharge . fig5 is a circuit which allows the pin card to communicate with the authorization terminal by means of induction . this allows communication without direct electrical contact thus rendering the system impervious to water , dirt , and static discharge . the pin card contains an input - output buffer / amp 6 as does the authorization terminal as shown by element 9 . the purpose of this unit is to condition signals received from the microcontroller 1 , for output , and to condition the output from the input / output coil 7 . these signals will be weak and must be amplified for good communication . the authorization terminal has an identical input / output pair including input / output coil 8 and input - output buffer / amp 9 . for error free communication , one input / output pair must be quiescent while the other pair is active and vice versa . communications protocols must schedule data flow so that both pairs are not in conflict with each other . fig6 shows a communication system based on opto - electric principles . the pin card has an on - board led 12 for data output and a photocell 14 for data reception . signals from the microcontroller would have to be conditioned by the buffer / amplifier 16 before being output . input signals from the photocell would have to be conditioned by a similar buffer / amplifier 17 before sending the data to the microcontroller 1 . the authorization terminal has a similar ( positionally opposite ) input / output pair . data from the pin card will be converted into a series of light impulses by the led 12 and will be picked up and converted into electrical signals by the photocell 14 in the authorization terminal . this weak electrical signal will have to be conditioned by the input buffer / amplifier 15 before it can be sent on to the authorization terminal microcontroller 10 . fig7 shows communications via hall effect devices . a hall effect device senses changes in magnetic flux density . in this application , the hall effect device serves as a data receptor while a coil might serve as the data transmitter . the pin card and the authorization terminal each contain a transmitter / receptor pair 18 and 19 . as in the previous cases , communications protocols must coordinate the timing of data transfer . the battery 26 ( fig1 ) is meant only to maintain ram and to allow non - connected entry of a user &# 39 ; s pin code . if a pin card is powered by an external source , while communicating with an authorization terminal , its on - board battery will have a greatly extended life . fig8 shows a non - contact method of powering the pin card while it is in the authorization terminal . the addition of outside power also makes the communication techniques shown in fig5 , and 7 more practical . fig8 shows the communication technique of fig5 teamed with an inductive power transfer method . a magnetic field , created by a coil 20 in the authorization terminal , cuts across a coil in the pin card 21 and induces an electrical current . the output driver 22 and the rectifier / filter 23 are needed to tailor the power for use by the microcontroller 1 . the advantage of inductive coupling is that the environment and the state of the card ( dirt , scratches , etc .) have no effect on system operation . this is not the case with cards that have electrical contacts . static discharge is also a problem with contact cards . if a user were to touch the contacts after building a static charge , ( by walking across a rug , for example ), he could damage the card &# 39 ; s on - board chip . fig9 shows a chip card to terminal connection as most cards are configured today . the interface 24 consists of simple metallic patches on the card and wiper contacts in the authorization terminal . fig1 shows a contact type communication interface paired with a contact type power transfer interface 25 . this is a common configuration for chip cards today and has all the liabilities of electrical contacts mentioned previously . the cgipin is generated in the following manner . fig4 is an example of a two dimensional matrix that might be carried in a pin card and a central computer . it consists of ten columns of twenty numbers each . the columns repeat themselves after the first ten digits . the central computer also contains the user &# 39 ; s pin code , in this example 2548 . as an example , when the central computer receives a signal indicating that an authorization is required , it generates and outputs a pseudo - random number that is one digit longer than the user &# 39 ; s pin code , in this case 48901 . the pseudo - random number may be generated by any seed . time of day was used in this example . the first digit of the pseudo - random number represents the offset used when working the matrix . in this example , the offset is 4 . the rest of the digits call out the numbers of the columns in the matrix to be used in generating the cgipin . in this example , column 8 is used first , column 9 is used second , etc . to work the matrix , one locates the first digit of the cardholder &# 39 ; s pin code in column 8 , then looks down 4 more numbers , ( the offset ), to come up with the digit 0 , the first digit of the cgipin . the process is followed through with the rest of the cardholder &# 39 ; s pin code and the resulting cgipin is 0182 . this process is being duplicated by the user &# 39 ; s pin card . the cgipin , 0182 , not the user &# 39 ; s pin , is output by the pin card to the central computer for comparison with the reference cgipin . referring to fig4 a , 4b and 4c , the pseudo - random number is 48901 , and pin code is 2548 , the offset , which is the first digit of the pseudo - random number , is 4 , and the direction of the offset is &# 34 ; down &# 34 ;. the encryption system is implemented in this manner : 1 ) the second number in the pseudo - random number is 8 . this is the column number for first digit of the cgipin . the first instance of the first number of the pin , 2 , is found in column 8 , ( see fig4 ). the offset is introduced by going down four numbers , ( see indicator line , fig4 ), and selecting 0 . thus the first digit of the cgipin is 0 . 2 ) this process is repeated with the next number of the pseudo - random number , 9 , and the next digit of the pin , 5 , ( see fig4 a ). the resulting number selection is 1 . this is the second digit of the cgipin . 3 ) this process is repeated with the fourth digit of the pseudo - random number , 0 , and the third digit of the pin , 4 , ( see fig4 b ), with 8 being the resulting selection . this is the third number of the cgipin , 8 . 4 ) the final digit of the pseudo - random number , 1 , and the final digit of the pin , 8 , are used to arrive at 2 , ( see fig4 c ). thus 2 is thus the final digit of the cgipin . 5 ) as a result of this procedure , the cgipin is 0182 . since the pseudo - random number is changed for each verification , tapping the communication lines would not allow intruder to determine the components needed to generate the cgipin . while the matrix used in this example is two dimensional , and the offset is simple , one could use a multi - dimensional matrix and a multipath offset to complicate the process . it should also be said that the algorithm and matrix could be changed at will . we have used the example of a restaurant . the card can be used in other situations such as gaining access to restricted areas and equipment . additionally , the user may enter an optional &# 34 ; mayday &# 34 ; pin code into the pin card in emergency cases , such as an access made under duress . thus , the system is alerted to the fact that an individual &# 39 ; s card has been taken and that the cardholder has been forced to reveal his pin . when the central computer determines that the pin code entered into the pin card matches the &# 34 ; mayday &# 34 ; pin code which was previously placed in the central computer , the central computer would take appropriate action , such as notifying the police . to protect the cardholder , the system would appear to operate normally until such time as the criminal is apprehended . other embodiments of this invention might include a pin card without a keypad . while the pin card system was designed with a card having an on - board keypad , an alternative embodiment of the invention includes a fixed keypad at the merchant &# 39 ; s place of business . with the embodiment using the fixed keypad system , the merchant would place the card in an authorization terminal and ask the customer to enter his pin on the fixed pad at the proper time . the user &# 39 ; s pin is sent to the card from the fixed keypad and then the system operates as has been previously described . as a further alternative , in addition to a fixed pin pad , a merchant might want to use a portable pin pad . this unit has a keypad that communicates with an authorization terminal by remote means such as infra - red . the user enters his pin on the keypad of the portable pin pad , then gives his pin card and the pin pad to the merchant . the pin card and the pin pad are inserted in the authorization terminal . the system then operates as has been previously described . in conclusion , the pin card system offers up to three levels of security . 1 . the top level of security for the pin card system uses a pin card with an on - board keypad . the user enters his pin directly into the card . there is no transmission of the pin from the card , so that there is no chance that a thief could get the user &# 39 ; s pin by tapping the authorization terminal &# 39 ; s communication line . a thief could steal the pin card , but without the pin , ( which is present in the card for only a short time ), there could be no access to a user &# 39 ; s account . 2 . a middle level of security involves the use of a keypad remote from the pin card . in this case , a sophisticated thief could obtain the pin by tapping the remote keypad . the thief would still have to steal the user &# 39 ; s pin card to gain access to accounts , but his knowledge of the pin removes a level of security from the system . 3 . the lowest level of security involves the use of a card without a user entered pin . in this case , the thief need only steal the card to gain access to a user &# 39 ; s account . all levels of security are immune to counterfeiting of the card because the encryption system is complex enough to render computerized interrogation of the card impractical . the card could be configured so as to self - destruct upon repeated interrogation within a set time . also , the matrix and the algorithm are kept in ram so any attempt to gain knowledge through card disassembly would be pointless . all levels are immune to tapping of communication lines to the central computer because the numbers sent back and forth change with every verification . in addition , at all three levels of security , it is impossible to gain authorization without use of the actual card . obviously , many modifications and variations of the invention are possible in light of the above description . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described .	6
the methods and systems of the present invention are described herein with reference to the rotational indexing of a print drum connected , by means of a timing belt and idler pulley , to a stepper motor . although the methods of the present invention are well suited to this type of drive system , they are not limited to this application . methods of the present invention may be utilized to generate and implement motion profiles for any system wherein one or more masses are driven by a common drive means . a conventional motor drive system for rotating a print drum during printing operations is illustrated in fig2 . motor drive 10 is preferably a two phase stepper motor . a two phase stepper motor may be controllably rotated by applying a sequence of current magnitudes to each motor phase . a typical stepper motor generates about two hundred whole steps per revolution . whole stepping is therefore a relatively crude method of driving a motor when precise motor movements are required . the technique known as microstepping facilitates more precise motor control by providing hundreds or thousands of positions per revolution . more specifically , input pulses are communicated to a microstep current driver which directs the advance of the phase currents of both phases of the motor by one microstep , as illustrated schematically in fig3 ( a ). for purposes of the present invention , a microstep current driver generating eight hundred ( 800 ) microsteps per revolution was utilized . the phase current advance therefore resulted in one eight - hundredth of a revolution per input pulse . the timing of these input pulses determines the motion profile of the system , as schematically illustrated in fig3 ( b ). the system of the present invention preferably employs an open loop control system and does not require more complex , closed loop control features . motor 10 is preferably controlled by a microprocessor ( not shown ) that can be programmed to start and stop the motor , as well as to implement desired motion profiles . the microprocessor controls the precise timing between microstep pulses . more specifically , a position v . time history can be generated by summing the microstep pulses , as shown schematically in fig3 ( b ). the three individual masses in the system illustrated in fig2 are connected by means of flexible members , such as timing belts . motor rotor 12 is connected via timing belt 14 to idler pulley 16 , and idler pulley 16 is connected , via timing belt 18 , to drive pulley 20 rigidly mounted on print drum 22 . the gear ratio of the timing belt drive is adjusted so that one whole step at the stepper motor rotor corresponds to one pixel at the drum surface . for the purposes of the present invention , the timing belts may be modelled as elastic springs arranged in parallel to damping elements , such as dashpots , as shown in fig4 . use of such a model captures the elastic properties as well as the energy dissipation properties of the timing belt . the position of each of the masses after the entire zero velocity position to zero velocity position movement must be consistent with that of the other masses and with the gear ratio of the timing belts , so that no energy is stored in the belts as a result of rotational indexing . if this position / gear ratio consistency is lacking , the belt will be stretched and will store strain energy . release of the stored strain energy will disrupt the final zero velocity condition of the three mass system . fig4 illustrates a mathematical model of the drive system dynamics for an exemplary system in which three masses -- the motor rotor , the idler pulley and the print drum -- are moved from one position to another . t a is the torque applied to the first mass , the rotor , by the motor . the first mass has a mass moment of inertia j 1 and the rotary position of the rotor is represented by θ 1 in the time domain . the second mass , the idler pulley , has a mass moment of inertia j 2 , torque t 2 , and its rotary position is represented by θ 2 in the time domain . the third mass , the drum , has a mass moment of inertia j 3 , a frictional torque t f , and its rotary position is represented by θ 3 in the time domain . b 12 and b 23 represent internal damping in the flexible belts between the rotor and idler pulley and the idler pulley and print drum , respectively . b 1 , b 2 and b 3 represent viscous damping to ground of each mass , respectively . n 12 and n 23 represent frictionless gear ratios for each timing belt , and k 12 and k 23 represent the elastic coefficients for each timing belt . equations of motion were written for each of the masses in the system based upon the following assumptions : ( 1 ) the system is frictionless , except for viscous damping represented by b 12 and b 23 , viscous damping represented by b 1 , b 2 and b 3 , and coulomb frictional torque t f ; ( 2 ) belts can be modelled by an elastic coefficient k and viscous damping parameter b combined with a frictionless gear ratio n ; and ( 3 ) motor command angle φ is changed instantaneously . the equations for rotary motion of the motor rotor , the idler pulley , and the print drum are as follows : ## equ1 ## where θ represents position , θ represents velocity ; and θ represents acceleration , all in the time domain . the above equations can be rewritten to eliminate &# 39 ; θ 1 and &# 39 ; θ 2 ( mass position adjusted for timer belt gear ratio ) using the equalities ## equ2 ## as follows : ## equ3 ## viscous damping for the second mass , the idler pulley in the system illustrated in fig2 was negligible and was therefore dropped from the system motion equations . in order to generate an optimum motion profile for a system of the type illustrated in fig2 the following conditions are preferably satisfied by the three mass system : ( 1 ) all three masses must have zero velocity at the initial and final time points ; ( 2 ) the motor motion profile ( position v . time ) is monotonic ; ( 3 ) the final positions of the three masses are consistent with their gear ratios to prevent storage and release of strain energy . the second condition is not a prerequisite for all motion systems , but it may be critical for particular applications . using the mathematics of state variable dynamics , a linear system of differential equations may be represented as a dynamic , linked system by a set of first order differential matrix equations . for the equations of motion of a multi - mass system , the dynamic equation is as follows : in this equation , x ( t ) is the generalized state vector for the system where suitable choices of states are the positions and velocities of each of the masses . thus , the following six states are required to describe a system involving movement of three masses at any time : also , u ( t ) is the input to the system which corresponds to the input profile to the microstep driver . the derivative of the state at any given time , designated x ( t ), is therefore a function of the system matrix a , the state vector x ( t ), an input matrix b and an input scalar u ( t ). such a dynamic equation is useful if the system behaves linearly or may be approximated as such . the linearity restriction of the state variable approach also requires that t f at the drum be approximated by b 3 , a viscous damping coefficient . the following mathematical equation , based upon the kalman controllability formulation , expresses the continuous input function u ( t ) required to transfer a system from an initial state x 0 = x ( t 0 ) to a desired state x 1 = x ( t 1 ) as follows : where k is a matrix expressed as follows : ## equ4 ## and φ ( t )= e at is the matrix exponential of a . the variables in the above equation are as follows : a = the system matrix , a 6 × 6 matrix in the exemplary , three mass embodiment superscript t is the matrix transpose ( e . g ., b t ) superscript - 1 indicates the inverse of a matrix ( e . g ., k - 1 ) a , the system matrix , uses the motion equations of the three system masses and is derived and defined as follows : the dynamic equation then becomes : ## str2 ## b , the input matrix , is expressed above . the non - zero value in the b matrix indicates that the input acts on the motor mass of the three mass system . an expression was then developed for the applied torque , t a . in general , for a locked rotor of a stepper motor , t = t h sin 50φ , where t h is the peak holding torque for the prevailing current in the motor , and φ is the motor command angle . in the system illustrated in fig4 both the command angle φ and the rotor position θ 1 are variable . the applied torque , t a , is therefore expressed as follows : t a = t h sin 50 ( φ - θ 1 ). as such , t a introduces non - linearity into the system . if the value of φ - θ 1 is small enough , however , sin 50 ( φ - θ 1 ) is approximately equal to 50 ( φ - θ 1 ). for example , if φ - θ 1 is 0 . 003 radians , sin 50 ( φ - θ 1 ) is 0 . 149 , and 50 ( φ - θ 1 ) is 0 . 150 . for small or negligible differences φ - θ , the system behaves in a manner approximating a linear system . the continuous input function , u ( t ), was determined for a system of the type shown in fig3 . values for system constants were as follows : ## equ6 ## the total motion time interval was set at 0 . 35 sec . the a and b matrices were as set forth above . the beginning and end position points were defined as follows : the x 11 , x 13 , and x 15 values are consistent with the values for the frictionless gear ratios n 12 and n 23 , as required . these values are first used to derive the continuous input function u ( t ) capable of driving the system from x 0 to x 1 . the continuous input function derived using these values is shown in fig5 . the kalman controllability formulation for a continuous input u ( t ) is then implemented using matlab software available from the math works inc ., 21 elliot street , south natick , ma 01760 . the analysis uses the equation : ## equ7 ## to determine the position and velocity profiles of the masses corresponding to the input function u ( t ). the ideal motor position and velocity profiles derived using this equation are shown in fig6 ( a ) and 6 ( b ), respectively . the intermediate idler position and velocity profiles are substantially the same as those for motor position velocity , except that the values are reduced as a result of the gear reduction . the ideal print drum position and velocity profiles are shown in fig7 ( a ) and 7 ( b ). these plots demonstrate that each mass would reach zero velocity at the end time point , 0 . 035 sec . using the ideal position and velocity profiles generated as described above , the actual delay lengths of microstep input pulses were apportioned to match the ideal profiles . curve fitting the ideal motor position and velocity profiles shown in fig6 ( a ) and 6 ( b ) is therefore a major factor in the choice of microstep delay times to serve as input in a numerical integration simulation of three mass system motion . additionally , the difference between the motor command angle φ and motor position θ is preferably monitored and maintained as small as possible , consistent with the ideal position and velocity profiles . derivation of the actual microstep input pulse delay lengths by curve fitting , for example , may be accomplished in any convenient manner . a numerical integration simulation of the differential system motion equations was conducted using the continuous system modeling program ( csmp ), available from california scientific software . the system constants used in the numerical integration were as described above for ideal input and motion profile generation , with the addition of t s , the microstep timing constant having a value of 6 . 25 × 10 - 5 seconds . also , since numerical integration simulations are not limited to linear systems , physical constants were developed to describe the influence of coulomb friction on the three mass system and were incorporated in the simulation . the controlling parameter for the friction effects was the sign of the velocity of the mass upon which the frictional torque is acting , x 3 ( t ). the frictional force applied for positive velocities , shown for t f in fig4 was valued at 2 . 4 lb - in . the frictional force for negative velocities was valued at - 2 . 2 lb - in . the frictional force acting when the mass is at rest was valued at 2 . 4 lb - in . these four parameters were input into a function switch function of the csmp system to generate a value for the frictional torque , t f . fig8 shows the simulated motor input microsteps ; fig9 ( a ) and 9 ( b ) show the simulated motor position and velocity profiles especially ; and fig1 ( a ) and 10 ( b ) illustrate the simulated drum position and velocity profiles based upon the motor input illustrated in fig8 . the ideal motor position profile generated using the kalman controllability formulation illustrated in fig6 ( a ) corresponds closely to the motor profile generated using the numerical integration simulation shown in fig9 ( a ) that is based upon the microstep delay times illustrated in fig8 . the microstep delay times approximating the ideal motor profile of fig4 a , x theoretical versus t , were implemented as microstep impulse inputs to a three mass system as illustrated in fig2 . oscilloscope photographs of the drum position v . time performance and the current wave form in one motor phase are presented in fig1 ( a ) and 11 ( b ). the actual drum position profiles shown in the oscilloscope photographs for a three mass system of the type illustrated in fig2 corresponds closely to both the ideal and simulated profiles . the system implementation resulted in smooth drum motion without ringing or overshoot at the inflection points . moreover , the system produced significantly reduced audible noise . although the methods and systems of the present invention have been described with reference to a three mass system for driving a print drum , it will be obvious that the methods may be applied to generate motion profiles for a wide variety of systems requiring precise movement of system components from one state ( position ) to another . while in the foregoing specification , this invention has been described in relation to certain preferred embodiments thereof , and many details have been set forth for purposes of illustration , it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention .	6
fig1 is a longitudinal sectional view showing an integrated circuit device in accordance with the present invention . the integrated circuit device 100 comprises an integrated circuit chip 1 of a wafer size , for example , which is fabricated using one semiconductor wafer , and a wiring substrate 2 . various logic circuits are formed inside the integrated circuit chip 1 . the integrated circuit chip 1 is connected to the wiring substrate 2 by solder bump terminals 6 , 6 &# 39 ;, etc , and the logic circuits inside the integrated circuit chip 1 can be mutually connected inside the wiring substrate 2 through a through - hole 4 , a signal wiring 5 inside the wiring substrate and a through - hole 4 &# 39 ;. this signal wiring 5 is connected to a termination resistor 9 on a far - end side through the wiring 7 and the through - hole 8 , so that signal transmission by a far - end termination system becomes possible . input / output pins 3 for signal connection between the integrated circuit device 100 and an external device ( not shown ) and for the supply for a power source voltage to the integrated circuit device are brazed to the back ( or rear face ) of the wiring substrate 2 . it is possible to use a ceramic as the material of the wiring substrate 2 and a cover , as the material of the input / output pins 3 , for example . fig2 is a plan view which shows a wiring method inside the integrated circuit chip and on the wiring substrate in the embodiment described above . fig2 a shows the signal wirings inside the integrated circuit chip 1 and fig2 b shows the signal wirings for connecting the logic circuits with one another inside the wiring substrate through the solder bump terminals 6 , 6 &# 39 ;. in fig2 a , reference numerals 10 , 10 &# 39 ;, 11 and 11 &# 39 ; represent the logic circuits inside the integrated circuit chip 1 . reference numerals 12 , 13 and 13 &# 39 ; represent the signal wirings of aluminum wirings , or the like , which are formed inside the integrated circuit chip 1 by the application of the present invention . reference numeral 14 represents the signal wiring for connecting the logic circuits 11 and 11 &# 39 ; without using the present invention . the logic circuits 10 , 10 &# 39 ; inside the integrated circuit chip 1 are disposed adjacent to each other and are connected mutually by the signal wiring 12 such as the aluminum wiring inside the integrated circuit chip . signal transmission between the logic circuits 10 and 10 &# 39 ; is made by the signal wiring 12 . a termination resistor is connected to the signal wiring 12 on its near - end side in the same way as in the connection method in accordance with the conventional near - end termination system . the termination resistor is formed as part of the logic circuit 10 on the nearend side inside the wafer by the use of a resistance made by diffusion process , though not shown in drawings . in contrast , the logic circuits 11 and 11 &# 39 ; are disposed in the spaced - apart relation with each other . the output of the logic circuit 11 is connected to the solder bump terminal 6 by the aluminum wiring 13 and is once taken outside the integrated circuit chip 1 . it is then connected to the signal wiring 5 inside the wiring substrate 2 through the solder bump terminal 6 and the through - hole 4 as shown in fig1 and 2b . similarly , the input of the logic circuit 11 &# 39 ; is connected to the solder bump terminal 6 &# 39 ; by the aluminum wiring 13 &# 39 ; and then to the signal wiring 5 inside the wiring substrate 2 through the solder bump terminal 6 &# 39 ; and the through - hole 4 &# 39 ;. in this manner , signal transmission between the logic circuits 11 and 11 &# 39 ; can be made by the signal wiring 5 inside the wiring substrate 2 . the far - end side of the signal wiring 5 is connected to the termination resistor 9 on the wiring substrate 2 through the wiring 7 and the through - hole 8 as shown in fig1 and is driven by the far - end termination system . unlike the logic circuit 10 , therefore , the termination resistor is not formed on the logic circuit 11 side . by the way , the amplitude of the output signal of the logic circuit 11 is so small that the signal wiring 5 inside the wiring substrate 2 cannot directly be driven . for this reason , a buffer for driving the signal wiring inside the substrate is practically connected between the logic circuit 11 and the solder bump terminal 6 , though it is not shown in the drawings . as described above , when the connection between the logic circuits 11 and 11 &# 39 ;, which are disposed in the mutually spaced - apart relation , is made by the use of the signal line 5 inside the wiring substrate 2 , the signal propagation time can be shortened much more than in the connection using the signal wiring 14 inside the integrated circuit chip 1 . next , the signal propagation delay time of the wiring portion in the near - end termination system and in the far - end termination system will be explained . for example , the far - end voltage waveform when a signal of a predetermined voltage is applied to the near - end of a transmission line and the far - end is opened is compared with the far - end current waveform when the far - end is short - circuited . it is known in this case that in comparison with the rise time of the far - end voltage waveform when the far - end is released , the rise time of the far - end current waveform when the far - end is short - circuited is smaller by 3 to 10 times . the conventional near - end termination system corresponds to the case where the far - end is released in the example described above , and can be said to be the most disadvantageous system as to the rise time of the signal waveform at the far - end . in contrast , the far - end termination system can accomplish the rise time between the rise time when the far - end is released in the example described above and the rise time when the far - end is short - circuited . the factor that determines the rise time is the termination resistor value at the far - end , and the smaller the resistor value , the smaller becomes the rise time . it could be therefore understood that the far - end termination system can make signal transmission at a higher velocity than the near - end termination system . the signal wiring 5 inside the wiring substrate 2 is not so thin as the signal wiring 12 inside the integrated circuit chip 1 , and a metal having low resitivity such as cu can be used as the wiring material . for this reason , the wiring resistance of the signal wiring 5 can be incomparably reduced than the wiring resistance of the signal wiring 12 inside the integrated circuit chip 1 . to make far - end termination , the wiring resistance must be sufficiently low ( below 0 . 5 ω / cm ) and in this point , the signal wiring 5 inside the wiring substrate 1 is advantageous . in contrast , the signal wiring inside the integrated circuit chip 1 has a wiring resistance of as large as about 10 ω / mm , and is therefore not suitable for the far - end termination system . therefore , the near - end termination system is applied to the signal wiring inside the integrated circuit chip 1 because it can transmit the signals without lowering the amplitude even by a wiring having a large wiring resistance , although it has a large signal propagation delay time . in the present invention , too , the near - end termination system is applied to the signal wiring 12 inside the integrated circuit chip 1 . however , since the signal wiring 12 inside the integrated circuit chip 1 in the present invention is used for short - range signal transmission , it has a short wiring length and the signal propagation delay time does not become a critical problem . next , an example of the design flow , which is employed for determining which of the signal wiring among the signal wiring 12 inside the integrated circuit chip 1 and the signal wiring 5 inside the wiring substrate 2 should be applied to the signal wiring for mutually connecting the logic circuits in the integrated circuit device in accordance with the present invention , will be illustrated . to begin with , a system is designed by the signal wiring inside the integrated circuit chip 1 in the same way as in the conventional integrated circuit device . next , the signal propagation delay time between arbitrary gates is checked by simulation . this simulation can be carried out by a delay check system which is known in the art as a design tool of a large scale computer available at present . the signal wiring which generates a delay exceeding a certain predetermined value is changed to the signal wiring of the far - end termination system through the signal wiring 5 inside the wiring substrate 2 in accordance with the results of simulation . the system designed in this manner is again checked by the delay check system and its effect is confirmed . besides the checking procedure using the simulation from the beginning as described above , higher design efficiency can be obtained by using the signal wiring 5 inside the wiring substrate 2 from the start for those signal wirings inside the integrated circuit chip 1 which have a large wiring length and can therefore be judged in advance as unsuitable for the signal wiring 5 . fig3 shows the relationship between the signal wiring inside the integrated circuit chip , the wiring length of the signal wiring inside the wiring substrate and the signal propagation delay time in the integrated circuit device in accordance with the present invention . the wiring length between the logic circuits which are to be mutually connected are plotted on the abscissa of the diagram in fig3 and the delay time required for the signal to propagate between the logic circuits is plotted on the ordinate . dash line represents the case where the signal wiring inside the integrated circuit chip in accordance with the near - end termination system is used and solid line does the case where the signal wiring inside the wiring substrate in accordance with the far - end termination system is used . in fig3 circuit constants of the signal wiring inside the integrated circuit chip include the wiring resistance r = 10 ω / mm and the wiring capacitance c = 0 . 2 pf / mm , by way of example . the dielectric constant of the wiring substrate is εr = 6 . here , the signal propagation delay time t1 of the signal wiring inside the integrated circuit chip can be expressed by the following equation : the signal propagation delay time t 2 of the signal wiring inside the wiring substrate can be expressed by the following equation : ## equ1 ## where a , b and d are constants depending on the design of the integrated circuit chip and packaging system . it can be understood from the diagram shown in fig3 that the signal wiring inside the integrated circuit chip and the signal wiring inside the wiring substrate may be used appropriately with the wiring length of about 3 cm being the boundary , for example . as already described , the wiring delay time increases in proportion to the square of the wiring length of the signal wiring in the signal transmission of the near - end termination system using the wiring inside the integrated circuit chip . therefore , when the wiring length of the signal wiring exceeds 5 cm , the wiring delay time increases drastically and a high signal propagation velocity cannot be expected any more . in contrast , in accordance with the far - end termination signal transmission system using the wiring inside the wiring substrate , the wiring delay time is proportional to the wiring length of the signal wiring ; hence , the increase in the wiring delay time is not very great as the wiring length increases . even when the wiring length is as great as about 15 cm , for example , the signal propagation delay time still remains at a relatively small level of about 2 ns , as can be appreciated from the diagram . if the wiring inside the wiring substrate is used , the wiring substrate cannot be directly driven by the signal having a low amplitude inside the integrated circuit chip , and a buffer circuit for driving the wiring inside the substrate is required . in the diagram shown in fig3 the signal propagation delay time when the signal wiring inside the wiring substrate in accordance with the far - end termination system is used is depicted while it includes about 1 ns of the delay time due to the delay time of this buffer circuit and to the increase in the delay time by the solder bump terminals . even when the increase in the signal propagation delay time due to the propagation delay in such a buffer circuit is taken into consideration , the present invention would maintain its superiority to the conventional integrated circuit device . the integrated circuit device in the embodiment given above has been explained about the integrated circuit chip of a wafer size by way of example , but the present invention is in no way limited thereto but can of course be applied to those integrated circuit devices which include an integrated circuit chip in which the wiring length of the signal wiring becomes large and the signal propagation delay time becomes a problem . in accordance with the present invention , the signal wiring inside the integrated circuit chip and the signal wiring inside the wiring substrate are used appropriately for the signal transmission between the logic circuits inside the integrated circuit chip . accordingly , the present invention provide signal transmission without increasing the signal propagation delay time . where the signal transmission distance becomes great , the present invention uses the signal wiring inside the wiring substrate . for this reason , it is not necessary to increase the width of the signal wiring in order to reduce the wiring resistance of the signal wiring inside the integrated circuit chip , and a higher integration density of the integrated circuit chip can therefore be accomplished . in other words , the present invention can accomplish a higher density and higher velocity integrated circuit device than the conventional semiconductor circuit devices .	7
currently , there is desire to mount cpus in area array interposer sockets . the manner of mounting a cpu in an interposer socket requires supporting the ceramic body at discrete locations around the periphery of the device . because the ceramic body of high performance processors is brittle , these support points can then become origins for cracks when the device is subjected to assembly and impact type forces . the present invention provides a positive means for controlling cracking in the ceramic body of the processor by providing assembly support and shock / vibration isolation through an energy dissipation device , or dynamic isolating mount . the preferred embodiment of the invention is described below in the context of a processor chip and heat sink combination mounted on a circuit board with an interposer socket . it should be noted , however , that the chip need not be a processor nor is the heat sink required . broadly , the invention is useful to reduce vibration for any type of component mounted to a circuit board . referring initially to fig1 system 100 includes a backing plate 10 with a plurality of recesses 20 , a pwb 30 , interposer socket 40 , a landgrid array ( lga ) or processor 42 , interposer columns 45 , a heat sink 55 , and at least one dynamic isolating mount 65 . when combined , interposer columns 45 and processor 42 are referred to as cpu assembly 50 . as is known in the art , heat sink 55 is held in place by an assembly 60 in such a manner as to achieve sufficient thermal contact therewith . if desired , a material such as thermal grease ( not shown ) can be used at the interface to enhance the flow of heat from cpu assembly into heat sink 55 . assembly 60 preferably comprises a standoff 90 , a helical coil spring 120 , and a capscrew 110 . each standoff 90 is mounted on or pressed into backing plate 10 and passes through a corresponding hole 57 in the base of heat sink 55 . standoff 90 each preferably comprise a generally cylindrical member having a threaded internal bore 92 . each capscrew 110 includes a head 112 and a male threaded body 114 sized to threadingly engage bore 92 . a plurality of interposer columns 45 connects pwb 30 to cpu assembly 50 . while this configuration has many benefits associated with it , interposer columns 45 transfer vibrational energy from pwb 30 to cpu assembly 50 . according to a preferred embodiment , dynamic isolating mount 65 is placed between pwb 30 and cpu assembly 50 . prior to engagement of cpu assembly 50 with pwb 30 , dynamic isolating mount 65 is placed on pwb 30 where pwb 30 contacts cpu assembly 50 . dynamic isolating mount 65 may comprise a continuous piece or small , fragmented pieces . dynamic isolating mount 65 is preferably somewhat taller than the space between pwb 30 and cpu assembly 50 when it is in its natural or non - compressed state . thus , when it is desirable to assemble system 100 , cpu assembly 50 is placed on top of dynamic isolating mount and secured in place by methods known by one of ordinary skill in the art . in this manner , a dynamic isolating force is applied to cpu assembly 50 to maintain it in contact with the pwb while simultaneously damping vibrations or shocks that would otherwise be transmitted from the pwb to the cpu . in order to describe the operation of the present invention , reference will briefly be made to fig2 a schematic of a simple spring - dashpot system . fig2 includes a kelvin element comprising a linear spring in parallel with a viscous damper . kelvin model 200 includes a spring component 210 , a dashpot component 220 , and a fixed origin 230 . in a kelvin model , spring component 210 functions according to hookean elastic behavior . for example , when a force is applied to spring 210 it deforms by an amount that is directly proportional to the applied force . the classical solid behavior is given by equation 1 . where f is force ( stress ), x is the extension distance ( strain ), and k is the proportionality constant . this constant is also called a modulus . the deformation is reversible when the stress is removed . however , if stress is continuously applied , a hookean solid does not deform any further ; it shows no time - dependant deformation . dashpot , or damper 220 , functions according to newtonian viscous behavior . for example , the applied force ( stress ) is proportional not to the distance ( strain ), but rather to the rate of strain . this classical viscous behavior is given by equation 2 . where f is force , dx is the rate of extension ( strain ), and k is the proportionality constant . in shear this equation is written : and the proportionality constant η is viscosity . the damping material continues to deform as long as force is applied . the deformation is not reversible ; when the force is removed , the damping material ceases to deform . it should be understood that the only material that exhibits true newtonian viscous behavior is a viscous liquid . in reality , a “ viscous ” solid displays viscous and elastic behavior . however , for explanatory purposes only , in the current invention , the interposer columns 40 are assumed to display purely elastic behavior and the dynamic isolating mount is assumed to display purely viscous behavior . when these two components are combined , the viscoelastic behavior of the system can be modeled using the elastic and viscous elements in parallel ; the strain of the two elements in parallel is the same and the total stress is the sum of the stress in the two elements . as the load is applied , the viscous element resists deformation but slowly deforms , transferring the applied stress to the elastic element . thus , the deformation of this two - element model is limited by the extensibility of the elastic element . when load is removed , the “ transient creep ” strain is recovered . more specifically , this model exhibits a “ delayed elastic ” or viscoelastic response to applied loads . after sudden imposition of a shear stress , spring 210 will eventually reach the expected strain , but is retarded in doing so by dashpot 220 . dashpot or dynamic isolating mount 65 of the present invention accordingly prevents column 45 from reaching its expected strain , thus limiting vibrational motion . in order to ensure that vibrational motion is minimized , dynamic isolating mount 65 should possess the following properties . it should be resistant to temperatures is below 130 ° c ., possess a loss factor of at least 0 . 010 , and be easily manufactured by companies such as sorbothane . examples of such materials include , but are not limited to , rubbers , silicones , and neoprenes . the simple kelvin model described above describes a simple spring - dashpot system which is useful to understanding the following model which more accurately models the behavior of dynamic isolating mount 65 . referring now to fig3 spring - mass - dashpot system 300 preferably includes a heat sink assembly - cpu package 57 , interposer columns 45 , a pwb 30 , and a dynamic isolator 65 . interposer columns 45 possess a total spring constant k ( lb / in ), heat sink assembly - cpu package 57 possesses mass w / g ( lb - sec 2 / in ), and dynamic isolator 65 possesses a damping value c ( lb - sec / in ). the magnification factor of a single degree of freedom spring - mass - damper system can be determined according to equation 4 : x / x 0 = 1 /[{ 1 −( ω / ω n ) 2 } 2 +{ 2ξ ( ω / ω n )} 2 ] 1 / 2 ( 4 ) n is the number of clamping springs , in this case 4 , g is a gravitational constant , or 386 in / sec 2 , and f 0 is the total static clamping force applied ( lb ). for a resonant , critically damped system ξ = 1 , and equation 4 becomes x / x 0 = 0 . 5 . thus , for a critically damped isolator , the dynamic amplitude will equal half of the static compression of interposer columns . since the columns will equal eventually compress approximately 0 . 010 ″, the above analysis suggests that a critically damped dynamic isolator will prevent dynamic motion greater than 0 . 005 ″. thus , using a critically damped isolator , 0 . 005 ″ of compression is attainable . the critical damping value of the dynamic isolator can be determined by equation 5 : thus , equation 5 defines the amount of damping necessary in the dynamic isolator to provide a critically damped system . critical damping refers to zero amplitude for a damped oscillator ; the body returns back to its equilibrium position at an optimum rate . critical damping is desirable because vibrational oscillations cease , preventing intermittent motion . by tuning the dynamic isolating mount 65 to equal approximately twice the product of the mass weight and natural frequency , critical damping is obtained . in order to tune a dynamic isolating mount , a critical damping value is mathematically projected , similar to that shown in equation 5 . a material possessing a damping value equal to a fraction of the projected critical damping value is then employed as the damper . for example , according to equation 5 , if the weight of the heat sink is 0 . 10 lb and the natural frequency of the system is 500 rad / sec , then the critical damping value , c 0 is 100 lb - rad / sec , because c 0 = 2wω n . if two dynamic isolating mounts are used , each mount should possess a damping factor c of approximately 50 lb - rad / sec . the dynamic isolating mount may be produced in the form of a picture - frame , square tabs , or any form capable of damping the interposer columns , including incorporating the dynamic isolating mount into the interposer socket . additionally , the dynamic isolating mount may be part of a kelvin system as described above ( e . g ., spring and dashpot in parallel ) or part of a maxwell system ( e . g ., spring and dashpot in series ) and the spring ( s ) and damper ( s ) need not necessarily be positioned adjacent to each other . it should be understood that the damping assemblies and systems described herein may be used in a computer system including a chassis , a system board , and an input device . in a preferred embodiment , the input device is either a mouse or a keyboard . the above discussion is meant to be illustrative of the principles and various embodiments of the present invention . numerous variations and modifications will become apparent to those skilled in the art once the above disclosure is fully appreciated . it is intended that the following claims be interpreted to embrace all such variations and modifications .	8
referring to fig1 there is illustrated a presently preferred embodiment of a spread spectrum radiotelephone 10 in accordance with this invention . as will become apparent , certain ones of the blocks of the radiotelephone 10 may be implemented with discrete circuit elements , or as software routines that are executed by a suitable digital data processor , such as a high speed signal processor . alternatively , a combination of circuit elements and software routines can be employed . as such , the ensuing description is not intended to limit the application of this invention to any one particular technical embodiment . in the preferred embodiment of this invention the spread spectrum radiotelephone 10 operates in accordance with the tia / eia interim standard , mobile station - base station compatibility standard for dual - mode wideband spread spectrum cellular system , tia / eia / is - 95 ( jul . 1993 ). however , compatibility with this particular interim standard is not to be considered a limitation upon the practice of this invention . the radiotelephone 10 includes an antenna 12 for receiving rf signals from a cell site , hereafter referred to as a base station ( not shown ), and for transmitting rf signals to the base station . when operating in the digital ( spread spectrum or cdma ) mode the rf signals are phase modulated to convey speech and signalling information . coupled to the antenna 12 are a gain controlled receiver 14 and a gain controlled transmitter 16 for receiving and for transmitting , respectively , the phase modulated rf signals . a frequency synthesizer 18 provides the required frequencies to the receiver and transmitter under the control of a controller 20 . the controller 20 is comprised of a slower speed mcu for interfacing , via a codec 22 , to a speaker 22a and a microphone 22b , and also to a keyboard and a display 24 . in general , the mcu is responsible for the overall control and operation of the radiotelephone 10 . the controller 20 is also preferably comprised of a higher speed digital signal processor ( dsp ) suitable for real - time processing of received and transmitted signals . the received rf signals are converted to base band in the receiver and are applied to a phase demodulator 26 which derives in - phase ( i ) and quadrature ( q ) signals from the received signal . the i and q signals are converted to digital representations by suitable a / d converters and applied to a three finger ( f1 - f3 ) demodulator 30 , each of which includes a local pn generator . the output of the demodulator 28 is applied to a combiner 30 which outputs a signal , via a deinterleaver and decoder 32 , to the controller 20 . the digital signal input to the controller 20 is expressive of speech samples or signalling information . the further processing of this signal by the controller 20 is not germane to an understanding of this invention and is not further described , except to note that the signalling information will include transmitter power control bits that are sent from the base station as a continuous stream to the radiotelephone 10 . the i and q signals output from the i - q demodulator 26 are also applied to a receiver agc block 34 which processes same to produce an output signal to an amplifier slope corrector block 36 . one output of the slope corrector block 36 is the rx gain set signal which is used to automatically control the gain of the receiver 14 . the output of the receiver agc block 34 is also applied to a tx open loop power control block 38 . a tx closed loop control block 40 inputs the received transmitter power control bits from controller 20 . an adder 42 adds the output of the tx open loop control block 38 to the output of the tx closed loop control block 40 and generates a sum signal which is the tx - gain signal that is selectively applied , via a limiter 43 ( fig7 and 8 ), to the transmitter 16 to control the output power thereof . preferably this signal is slope corrected as required for the transmitter amplifier . an input to the transmitter 16 ( vocoded speech and / or signalling information ) is derived from the controller 20 via a convolutional encoder , interleaver , walsh modulator , pn modulator , and i - q modulator , which are shown generally as the block 46 . fig2 is a high level block diagram of the spread spectrum agc system . a purpose of the receiver agc is to optimize the received signal level before a / d conversion , while having sufficient speed to follow signal fades . the transmitter power is linked to the received power accordingly to the formula : as a result , for the open loop power control case a 1 db increase in the received signal power level causes the tx power level to be decreased by 1 db . the tx - offset is used to change the tx power so that all mobile stations transmitting on the same channel are received at the base station at the same signal strength . to achieve the required closed loop control , the base station controls the offset of each mobile by sending a constant bit stream ( power control bits ) which command the mobile to increase or decrease the offset value . in accordance with the is - 95 interim standard the offset can be changed by ±- 1 db every 1 . 25 ms . the transmit power can be linked to the received signal level by using the same variable gain amplifier ( vga ) 50 in the transmitter as the vga 52 in the receiver . for this case , and for a 1 db increase in receiver gain , the tx gain is correspondingly increased 1 db . the 30 ms block 54 is an rc lowpass filter with a 30 ms time constant . the filter block 54 is used so that the transmitter can follow the average rx - level , and not the fast fading . a detector 56 is used to detect the received signal level , which is then integrated by block 58 to form the rx agc signal . the rx agc signal is also applied to the filter 54 , and the filtered agc signal is summed at block 60 with the tx offset signal that is derived from the power control bits . the output of the sum block is the tx agc signal which is applied to the tx vga 50 . in accordance with the is - 95 interim standard the specifications for the gain control system depicted in fig2 are as follows : rx - vga control range is minimum - 105 dbm to - 25 dbm ( 80 db ), tx - vga control range is minimum - 50 dbm to + 23 dbm ( 73 db , portable ), the open loop power estimate should be within ± 6 db and shall be within ± 9 db of the actual received power , the tx - offset range is a minimum of ± 32 db , the accuracy of the 30 ms time constant shall be better than ± 20 %. for a change ( dpin ) in the rx level of ± 20 db or less , the tx power must be within the limits : ( a ) upper limit : for 0 & lt ; t & lt ; 24 ms : max [ 1 . 2 \| dpin \|( t / 24 ), \| dpin \|( t / 24 )+ 0 . 5 db ] for t & gt ; 24 ms : max [ 1 . 2 \| dpin \|, \| dpin \|+ 0 . 5 db ] where dpin is in db and t is in milliseconds . as an example , for an received signal change = 20 db =& gt ; tx change = 20 db + 4 /- 4 . 5 db . the tx offset must change the tx power in 1 db steps , and the accuracy must be better than ± 20 % or ± 0 . 5 db within any 10 db tx offset range . by example , a 5 db tx offset change =& gt ; 5 db ± 1 db tx power change , and a 1 db tx offset change =& gt ; 1 db ± 0 . 5 db tx power change . and finally , following a 1 db step change in the tx offset , the tx - power must be within 0 . 3 db of the final value in less than 500 microseconds . this invention teaches an agc system ( rx and tx ) that meets the requirements imposed by the foregoing specification . a function of the signal strength detector 56 is to measure the power of the received spread spectrum signal . it is not required to directly measure the received power so long as the measurement has a constant relationship to the received power . the detector 56 preferably has a ± 20 db dynamic range in order to fulfill the step response specifications ( up to ± 20 db rx step ). the output of the amplifier 52 driving the detector also preferably has a ± 20 db dynamic range . with less than a ± 20 db dynamic range the step response will be delayed , although this may be acceptable for certain implementations . a number of different detector embodiments may be employed with this invention , including a logarithmic detector , an absolute value detector , an rms power detector , and an approximating detector . each is now described . the output of a logarithmic detector is : vdet = average ( log (\| vsignal \|)). this detector works well for signals without am modulation ( e . g ., fm modulation ). with am modulation the log - function will tend to distort the am information and , as a result , the detector 56 may measure too low a signal strength . the advantage of the logarithmic detector is that it has a wide dynamic range ( 80 - 100 db ). the logarithmic detector can be used at if ( not base band ) for receiving a spread spectrum signal with the following assumptions . with more than 10 - 20 users it can be assumed that the forward link i and q components are gaussian distributed ( without fading ). the am information (= sqrt [ i 2 + q 2 ]) will then be rayleigh distributed . the rayleigh distribution has a low density at low levels . as a result , the logarithmic distortion will not have a significant impact on accuracy . with fewer users the ratio between detector output and input power will change , and the detector will measure a lower power level . if the detector is used at base band , only the i or q channel is used for input to the detector . the output of the absolute value detector is given by the expression : vdet = average (\| vsignal \|). this detector works well with gaussian distributed signals such as the cdma i and q signals at base band ( forward link ). with a changing distribution ( fewer users ) the absolute value detector may out - perform the logarithmic detector . although this detector has a smaller dynamic range than the logarithmic detector , the range is sufficient for the spread spectrum application which is of the most concern to this invention . the output of the rms power detector is : vdet = average ( vsignal 2 ). this is an optimum detector because it measures true power , however it is difficult to implement in a practical manner . furthermore , the squaring function transforms a 40 db range to an 80 db range , which adversely impacts the noise performance of the detector . an approximating detector is presently preferred in the digital agc detector that is described below . this detector yields an optimum detector performance with a low gate count . reference is now made to fig3 for a description of a cdma analog agc system . the rx gain control is comprised of two loops . the first loop is essentially analog and comprises the rx - vga 52 , i / q demodulator 62 , detector 56 , and integrator 58 . the first loop is used for coarse agc setting . the second loop is essentially digital and comprises the rx - vga 52 , i / q modulator 62 , a / d converter 64 , digital control block 66 , agc - ref signal 68 , and the integrator 58 . the agc - ref signal 68 is a feedback signal from the digital loop to the integrator 58 . the second , digital loop is used to correct offset errors in the first , analog loop . in the circuit of fig3 the rx - vga 52 and tx - vga 50 each have a variable gain range of 80 db , the integrator 58 sets the time constant for the analog loop , and the detector 56 is implemented as a logarithmic absolute value detector where : where avg \| vin \| is the average of the absolute value of vin . the time constant for the detector 56 is 10 % of the time constant of the analog loop . the block rc - delay 70 is comprised of an rc circuit with a time constant of 30 ms . as a result , the tx - vga 50 tracks the rx - vga 52 with a 30 ms time constant delay . the tx -- gain -- adj signal 72 is used , in conjunction with the multiplier 61 and the tx -- slope signal 74 , to offset the gain of the tx - vga 50 from the gain of the rx - vga 52 . the magnitude of tx -- gain -- adj signal 72 is controlled by the base station by the power control bits . a minimum resolution of a d / a converter ( not shown ) that generates the tx -- gain -- adj signal is preferably equivalent to a 1 db gain change . the tx -- slope signal 74 is used to correct the slope of the tx - vga 52 in reference to the tx -- gain -- adj signal . this signal is required in order to accurately translate a given change in the tx -- gain -- adj signal 72 into a given change in tx power , and thus is useful in compensating for variations between vgas . the rx -- slope signal 76 is the complementary receiver - side signal to the tx -- slope signal 74 , and is used for compensation purposes for correcting the slope of the rx - vga 52 so that it essentially matches the slope of the tx - vga 50 . the multiplier 59 is used to multiply the rx -- slope signal 76 by the output of the integrator 58 . the multiplier 61 multiplies the tx -- slope signal by the tx -- gain -- adj signal , and supplies the product to the summer 60 for addition to the output of the rc - delay block 60 to form the tx -- agc signal , shown in fig3 as the transmitter gain control signal tx - gset . an input of the tx - vga 50 is supplied with information to be transmitted from a d / a converter 80 and an i / q modulator 82 . a bias control block 106 also receives the tx - gset signal and is used to generate a bias signal for a tx power amplifier 102 . the operation of the blocks 102 and 106 is described in greater detail in fig9 and 11 . fig4 is a block diagram that shows in greater detail the rx - agc circuits of fig3 . the transfer function for the exp block 58a is : rx -- out = ic rx -- in , where ic is the gain control signal , in db format : as a result , by measuring rx -- in and rx -- out in db ( log ), and by using the exp block 58a , the loop is made linear . the integrator 58 operates in such a manner as to set the gain so that vd = agc - ref . the transfer function for the integrator is : by combining the rx - vga 52 and the exp block 58a , and adding a scaling constant k2 , there is obtained : which is equivalent to a single pole high pass filter with a time constant of τ2 . reference is now made to fig5 and 7 for a description of the digital agc system . fig5 is a block diagram that illustrates a first embodiment of the digital agc system , specifically an all digital agc control system . the two variable gain amplifiers vgas 50 and 52 are controlled directly from the digital block 90 . in a presently preferred embodiment of this invention the digital block 90 is embodied within an application specific integrated circuit ( asic ). it should be realized that discrete integrated circuits could be used as well , as could a suitably programmed high speed processing device . the detector 56 , integrator 58 , multiplier 59 , summer 60 and delay 70 of fig3 are implemented as digital circuits within the digital block 90 . the vgas 50 and 52 may be either stepped vgas controlled digitally , or continuously variable vgas controlled by the outputs of suitable d / a converters . the latter approach , which is preferred , is illustrated in fig5 as the tx - vga - d / a 92 and the rx - vga - d / a 94 . the accuracy of gain of the each vga is set by the associated controlling d / a converter 92 and 94 , and by the linearity of the vga control slope . the slope nonlinearity is correctable by the digital block 90 . the gain increment size for the rx - vga 52 is determined by the dynamic range of the rx - a / d converter 64 , and is preferably not smaller than 1 db in order to limit the number of required bits for the rx - vga - d / a converter 94 . the gain increment size for the tx - vga 50 is a maximum of 0 . 75 db , in accordance with the current is - 95 interim specification . in order for the tx power level to track the rx power level , the rx power level is measured with better than 0 . 05 db resolution . correction of the vga slopes can be accomplished either by multiplication or by table look up . a look up table ( 90a ) is not presently preferred due to the required number of gates to implement the storage registers for the look up values . in the preferred embodiment the multiplier 90b can use either analog or digital techniques . analog multiplying requires a separate d / a to set the reference voltage for the primary d / a 92 . although a digital multiplier requires some number of gates to implement , a digital multiplier is presently preferred because of reduced complexity over the analog approach . correction of nonlinear slope ( change in slope vs . gain ) is accomplished for the vga 50 by using the three most significant bits of the tx gain word to select one of five scaling words . this provides five ranges of 16 db , each of which can be individually scaled . the number of bits for each scaling word is a function of the desired range and resolution . fig6 shows a further embodiment of the invention wherein the digital agc is provided with analog tx / rx tracking . compared to fig5 the delay block 70 and summer block 60 are moved outside the digital block 90 , and are implemented with analog circuits as in fig3 . as a result , the accuracy of rx - vga - d / a 94 does not contribute to the tx gain setting accuracy . the tx - vga - d / a 92 provides a minimum of 1 db resolution with ± 0 . 5 db accuracy over a ± 32 db range . the digital agc with analog tx / rx tracking embodiment of fig6 is similar to the analog agc system of fig3 . major differences are that the detector 56 and integrator 58 are implemented digitally ( as in fig5 ), and that the nonlinear slope of the tx - vga 52 is correctable . reference is now made to fig9 for showing in greater detail an embodiment of the transmitter circuitry , including the tx - vga 50 . the function of the transmitter output power control circuit , when operating in the spread spectrum cdma mode , is to limit the maximum output power so that the transmitter power amplifier 102 operates in the linear mode . for a dual mode ( cdma digital / fm analog ) radiotelephone the same circuitry is preferably also used to set the transmitter power level when operating in the analog mode . the output power is controlled by using the tx - vga 50 before the final transmitter power stage ( 102 ). this is shown in fig1 , wherein the rx - agc is not activated , the tx - vga 50 is controlled by an analog agc signal , and the i / q modulator 82 is not used . an audio signal is used to control the output frequency of an if phase locked loop ( pll ) 130 which generates a 90 mhz fm signal . the output of the if pll 130 is applied to the input of the tx - vga 50 . in this mode of operation the bias signal for the tx power amplifier 102 is changed only to compensate for temperature variations . this differs from the bias control employed when operating in the digital ( spread spectrum ) mode , as will be detailed below with respect to fig1 . referring again to fig9 when operating in the spread spectrum mode the maximum output power can be limited by limiting the vga 50 control voltage to a predefined level . this is a simple method but is inherently inaccurate , due to a possible large variation in gain for a given vga control level . alternatively , using a feedback control method a tx power indicator 104 generates an output signal txpi which is used to limit the maximum output power . when the magnitude of txpi is greater than a given set point the vga control signal is modified so that the tx output power is equal to the set point . this is preferably accomplished with nonlinear feedback . although this technique is relatively simple to implement for a continuously transmitted signal , for variable data rate spread spectrum transmissions this method is too slow to limit the maximum output power . that is , in the cdma mode each tx burst can be at a different power level than the previous burst , because of the open loop power control wherein the rx level is used to estimate the tx level . as a result , the tx power amplifier 102 may saturate in the beginning of each burst until the txpi indicator 104 settles the txpi signal . if the txpi signal response is made too fast , the tx power estimate may include excessive noise . a presently preferred technique to achieve transmitter output power control is shown in fig7 wherein the limiter 43 of fig1 is shown in greater detail . this technique is referred to herein as a direct control method with adaptive feedback . generally , when power limiting is activated the set point for limiting is modified until the magnitude of the txpi signal is approximately equal to a txpi set point . a direct control set point is used as a first estimate , and txpi is subsequently used to adaptively update this set point . although this method may saturate the tx power amplifier 102 ( fig9 ), this will only occur during the first few milliseconds of a new call . fig7 shows a digital implementation of the direct control method with adaptive feedback . the system clock signal is employed to synchronize all of the circuits . the tx - gain - set signal sets the gain of the transmitter vga 50 and , as a result , the transmitter output power . for this description it is assumed that an increase in tx - gain - set causes an increase in transmitter gain and power . as in fig9 the txpi signal is a measurement of the transmitter power at the output . for this description it is assumed that an increase in transmitter power causes an increase in the magnitude of txpi signal . the agc ctrl block 110 is a control circuit that sets the transmitter output power in the spread spectrum mode . the agc ctrl block 110 may function in a manner depicted in fig2 of commonly assigned u . s . patent application ser . no . 08 / 312 , 813 , filed sep . 27 , 1994 , entitled &# 34 ; digital agc for a cdma radiotelephone &# 34 ; by kjell ostman reference in this regard can also be made to u . s . pat . no . 5 , 107 , 225 which presents a different solution and implementation . in the preferred embodiment the tx - gain signal is derived from a combination of open loop power control circuit 38 and the closed loop power control circuit 40 , wherein the open loop portion generates a signal that is derived from the received signal level , and wherein the closed loop portion includes the contribution of the power control bits that are transmitted continuously from the base station ( see fig1 ). the tx - gain signal is applied to the limiter block 43 , which is shown and described herein with respect to fig7 and 8 . in fig7 the transmitted power is set by controlling the gain in the transmitter with the tx - gain signal . the tx limit register or counter 112 generates a signal tx - max which represents a maximum value of the tx - gain signal . the setup input is used to preset the counter 112 with a setup estimate of the maximum value of the tx - gain signal . when the signal tx -- on is active the counter 112 counts up or down on each system clock , depending on the state of count up / down signal provided from a comparator 114 . when the signal up - enable is not asserted , the counter 112 will only count down . when the signal up - enable is asserted , the counter 112 is enabled to also count up . the multiplexer ( mux ) 116 is employed to select either the tx - gain signal or the tx - max signal as the gain control for the tx - vga 50 , via the slope corrector ( shown generally in fig2 as the block 36 ) and the tx - vga - d / a 92 ( fig5 and 6 ). a digital comparator 118 operates in such a manner that when tx - gain is greater than tx - max : ( a ) the tx limit counter 112 is enabled ( with signal up - enable ) to count up , and ( b ) the select ( sel ) input of the mux 116 is controlled to select tx - max . otherwise the counter 112 only counts down , and the tx - gain digital signal is selected by the mux 116 . the before - mentioned comparator 114 determines if the tx limit counter 112 counts up or down . if txpi is higher than txpi - ref , the counter 112 counts down , otherwise , it counts up ( if enabled by tx - on ). the txpi and txpi - ref inputs to the comparator 114 are analog , and the output signal count up / down is digital ( high or low ). the d / a 120 is used to generate the analog reference level of txpi - ref . the mode control input signal forces the digital comparator 118 to enable the limit mode as if tx - gain was higher than tx - max . this input is useful when operating the radiotelephone in the fm analog mode , where the transmitter power is controlled by tx - max . tx - max settles to a value where txpi is equal to txpi - ref and , as a result , txpi - ref defines the transmitter power level . when the transmitter output power is less than the maximum , the power is controlled by the agc control block 110 ( power is set by the gain in the transmitter ). the power limiting is enabled either by txpi being greater than txpi - ref , or if tx - gain is higher than tx - max . if txpi is higher than txpi - ref the tx -- limit counter 112 counts down , thereby decreasing tx - max , until tx - gain is higher than tx - max . when tx - gain is higher than tx - max it is assumed that the transmitter power has passed the maximum limit . this condition causes the comparator 118 to switch the multiplexer 116 so that the transmitter power is set by the current value of tx - max , and it simultaneously enables the tx - limit counter 112 to also count up ( without the up - enable signal being asserted it can only count down ). tx - max is an estimate of the maximum gain needed to set maximum power . due to temperature variations of the transmitter gain tx - max is optimized for different temperatures to determine the relationship between gain and output power . the adaptive adjustment of tx - max is done with txpi , which is a measurement of the actual transmitter output power . if txpi is less than txpi - ref , the output power is less than maximum if tx - gain & gt ; tx - max . in this case the tx - limit counter 112 is incremented until txpi is higher than txpi - ref . in this manner tx - max is adaptively updated until it represents the maximum output power . if txpi is initially less than txpi - ref the tx - limit counter 112 counts down instead of up . the counter 112 does ] lot stop counting so long as tx - gain is higher than tx - max . as a result , and when the circuit has stabilized , the tx limit counter 112 oscillates between two levels . that is , if txpi is higher than txpi - ref the counter 112 counts down by one count and thereby decreases the transmitter power and txpi . on the next clock txpi may be lower than txpi - ref . as a result the counter 112 counts up by one count , bringing the counter 112 back to the previous state , and the cycle repeats . the tx - on signal is used to indicate if the txpi measurement is valid . if the transmitter is operated in burst mode ( transmitter turned on / off for short periods of time as in the tdma and cdma cellular standards ) the txpi indicator does not measure any power during an off period . tx - on is thus used to disable up / down counting when the transmitter is off . however , the previous tx limit count is maintained within the counter 112 during the transmitter off - time , and the counter 112 thus serves as a memory device that retains the transmitter power control state for initial use during a next burst . fig8 depicts an analog embodiment of the circuit shown in fig7 . in the analog embodiment the tx gain and tx max digital signals are converted to corresponding analog voltages with d / as 122 and 124 . the analog embodiment also uses a tx max - controlled analog limiter 126 in place of the digital multiplexer 116 and the digital comparator 118 . it can be appreciated that the teaching of this invention provides for the transmitter power feedback signal to be used for controlling a maximum transmitter power setting , and not for achieving a closed loop power control . that is , the txpi signal , in combination with txpi - ref , is employed to limit the gain of the transmitter so that it does not exceed a setpoint . reference is now made to fig1 which illustrates a presently preferred technique for controlling the operation of the tx - vga 50 and the tx power amplifier 102 . a fixed input power ( tx signal ) is fed to the input of the tx - vga 50 . the tx - gain set signal from d / a 92 ( fig7 ) is employed to set the gain of the tx - vga 50 and , through the bias control block 106 , to control the linearity of the transmitter power amplifier 102 . the bias control signal ( bcs ) is employed to control the dc bias point of the transmitter power amplifier 102 to keep the amplifier operating in a linear mode ( class a or class ab ). the linearity of the transmitter power amplifier is maintained by controlling the consumption of dc power ( volts and / or current ) from the dc power supply ( not shown ). when the tx - gain set signal increases the output power of the tx - vga 50 the dc power requirement of the transmitter power amplifier 102 increases accordingly . as such , the bias control 106 generates the bias signal so as to accommodate the increased dc power requirement of the transmitter power amplifier 102 , thereby maintaining the desired linearity of the transmitter power amplifier . this serves to optimize the current consumption and linearity of the transmitter power amplifier 102 over the required range of output power . the bias control block 106 may be implemented with an operational amplifier having suitable scaling resistors for generating the dc bias signal in an analog form . the bias control block 106 may also generate the bias signal in a digital form . for this latter case a digital to analog converter ( dac ) 107 can be employed to convert the digital bias signal to an analog form if such is required by the transmitter power amplifier 102 . in either case , the bias point of the transmitter power amplifier 102 is established in accordance with the tx - gain set signal that is applied to the tx - vga 50 . as will be recalled , the level of the tx - gain set signal is determined partly in accordance with the txpi signal which reflects the actual transmitted power . while the invention has been particularly shown and described with respect to preferred embodiments thereof , it will be understood by those skilled in the art that changes in form and details may be made therein without departing from the scope and spirit of the invention .	7
the system shown in fig1 is effective to produce significant quantities of nitrogen oxides which are converted into a fertilizer . the energy requirements for the formation of nitrogen oxides in the electric arc process are given by one or more of the following reactions : in the system shown and with optimum air flow rates , the principle end product in the electric arc reaction cell is nitrogen dioxide ( no 2 ). the nitrogen dioxide is readily trapped in water to form nitric acid ( hno 3 ) and nitrous ( hno 2 ) acids . the chemical progression of the process is : n 2 + o 2 → 2no ; no + 1 / 2o 2 → no 2 ; 2no 2 + h 2 o ⃡ hno 3 + hno 2 . by the addition of line , caco 3 to the water , these acids are converted primarily into calcium nitrate fertilizer ( caco 3 + 2hno 3 → ca ( no 3 ) 2 + co 2 + h 2 0 ). the nitrogen fertilizer may be used as it is produced by spraying , incorporating into a hydroponic system , or alternately , if an existing irrigation system exists at the site , the nitrogen fertilizer simply may be fed into the irrigation feed water . a third option is to store the fertilizer as calcium nitrate ( a very stable compound ) in tanks , open basins or plastic lined trenches , and used when needed . the system may consist of a small capacity system for the consumer market and which is designed to produce liquid fertilizer in a semi - permanent storage vessel from which it is syphoned into the water stream of a garden hose when the lawn , garden or other crop is watered . the system may also consist of a larger capacity field unit which utilizes either commercial or wind - electric generated power by manifolding a large number of smaller units to increase the capacity of fixed nitrogen production . electrical energy to drive the nitrogen fertilizer production system on a farm location may be obtained from a conventional 110 volt or 220 volt power source which incorporates a step - up transformer to obtain the higher voltages desirable for electric arc processes . a more economical , and generally available , power source can be the 7200 volt system commonly used for distribution of residential power by most utility companies in the united states . the following projected economic calculations are based on using power drawn from a 7200 volt transmission line power source to eliminate the need for a step - up voltage transformer . as indicated by the calculations , economic costs for the system , assuming 10 % efficiency of the overall process , are competitive based on present day costs of anhydrous ammonia . starting with theoretical energy requirements and assuming 10 % efficiency for the formation of nitrogen dioxide by the arc discharge through air process , electrical energy costs are projected based on a system to produce one ton of fixed nitrogen . all estimates and assumptions are believed to be conservative . assuming 10 % efficiency of the above reaction , one ton of fixed nitrogen would require 2000 × 4 . 690 = 9380 kwh per ton . based on a commercial rate of two cents per kwh , projected electrical energy costs per ton of fixed nitrogen would be : as stated previously , wind - electric or other forms of power generation may be used to drive the system in which case the cost per ton of fixed nitrogen would be more dependent on capital costs for equipment and maintenance requirements for the equipment . the liquid fertilizer generating system illustrated in fig1 includes a nitrogen generating unit 15 for producing nitrogen dioxide gas which is directed through a line 16 to a liquid fertilizer generating unit 18 . the nitrogen generating unit 15 incorporates a sheet metal cabinet 20 having sidewalls 23 and 24 ( fig2 ) rigidly connected by a bottom wall 26 , the cabinet 20 also includes a front wall 28 and a removable combined top and rear wall cover 29 . the cabinet 20 encloses a parallet - series air combustion unit 35 ( fig2 and 3 ) which includes an elongated metal bar or body 36 having a series of longitudinally spaced threaded counterbores 37 ( fig5 ) each of which receives a tubular fitting 38 . each of the fittings 38 encloses a combined combustion cylinder and electrode 41 which defines an hour - glass combustion chamber 42 formed by converging frusto - conical surfaces 43 and 44 connected by a circular restriction orifice 46 . a threaded hole 48 is formed within the body 36 concentrically with each of the orifices 46 and receives an electrode element 50 in the form of a sparkplug 50 . each of the sparkplugs 50 has an inner electrode tip 52 which is located concentrically within the orifice 46 , and the spark generated by the sparkplug or electrode 50 jumps across the annular gap between the electrode element 52 and the sharp edge defining the orifice 46 . compressed air is supplied to each of the combustion chambers 42 through a generally tangential passage 56 ( fig6 ) which connects with an air supply line 58 extending downwardly from an air supply manifold 62 ( fig3 ). the air supply manifold 62 is divided by an internal wall 64 into two chambers 66 and 67 . a pair of tie bolts 68 connect the manifold 62 to the bar or body 36 , and the manifold 62 supports a needle valve assembly 72 for each of the air supply lines 58 . each of the needle valve assembly 72 has an inlet 73 which connects with the corresponding chamber . compressed air is supplied to the chamber 66 ( fig3 ) of the manifold 62 through a t - fitting 74 connected by a line 76 to a combined motor driven air compressor 78 ( fig2 ) located within the bottom portion of the cabinet 20 . the compressed air flows from the chamber 66 of the manifold 62 through the corresponding two needle valves 72 and to the inlet passages 56 of the corresponding two air combustion chambers 42 . high voltage power , for example , on the order of 5 , 000 volts , is supplied to each of the electrodes 50 from the corresponding transformer 81 ( only one shown in fig2 ) located within the lower portion of the cabinet 20 and adapted to receive a power supply of 120 volts . as the compressed air flows into each of the combustion chambers 42 , the air spirals inwardly along the surface 43 and increases in velocity towards the orifice 46 where all of the air is required to pass through the orifice . the swirling air causes the arc to rotate rapidly and , in effect , produces an annular flame within the orifice . the combustion of the air produces oxygen which recombines with the nitrogen in the air to form nitrogen dioxide . this gas flows from the chamber 42 through a series of tangential outlet ports 84 ( fig7 ) and into an annular chamber 86 defined by the fitting 38 . as shown in fig5 a circular quartz lens 88 is retained within each of the tubular fittings 38 and is confined between the fitting 38 and the tubular electrode 41 adjacent the outlet ports 84 . the fittings 38 and corresponding lens 88 projects through corresponding holes 91 ( fig2 ) formed within the front wall 28 of the cabinet 20 and provide for visually observing the rotating spark and flame and the combustion of the air within each of the chambers 42 . while the flame is being observed , the needle valves 72 may be precisely adjusted to obtain maximum production of nitrogen dioxide . the combustion gases produced in the two combustion chambers 42 connected in parallel to the air manifold chamber 66 are directed through the corresponding outlet lines 94 ( fig3 and 5 ) to a chamber 96 defined within the right end portion of a tubular outlet manifold 98 ( fig3 ). from the chamber 96 , the gases are directed through a line 102 to the chamber 67 within the manifold 62 and from the chamber 67 , the gases are directed through the outer two parallel connected combustion chambers 42 at the left of the body 36 . this series connection of the two pairs of combustion chambers 41 provides for more complete combustion of the oxygen within the air and the formation of more concentrated nitrogen dioxide gas . the gas flowing through the two outlet lines 94 shown at the left in fig3 are collected within a second chamber 104 within the outlet manifold 98 , and the chamber 104 is separated from the chamber 96 by an internal wall 106 . as shown in fig2 the finger operated valve stems of the needle valves 72 project through corresponding holes 107 within the top cover 29 of the housing or cabinet 20 to facilitate convenient adjustment of each needle valve and thereby provide the desired flow rate of gas into each of the combustion chambers 42 for obtaining the optimum combustion within the chamber . the front panel 28 of the cabinet 22 also supports a set of control switches 108 , one of which controls the air compressor 78 and another of which controls the spark generators of power supplied to the transformers 81 . a control timer 110 is also supported by the front panel 28 and provides for selecting the desired operating time for the nitrogen generating unit 15 , for example , up to 24 hours . fig2 also shows a set of motor driven fans 112 which are mounted on the walls 24 and 28 and serve to cool the transformers 81 and the interior of the cabinet 20 . the nitrogen oxides or gases supplied to the chamber 104 within the outlet manifold 98 , are directed through a solenoid control valve 115 ( fig2 ) which is connected to a liquid collecting filter unit 117 . the gases flow from the liquid filter unit 117 into an aspirator 120 ( fig4 and 8 ) having a tapered venturi passage 122 defined by a coupling 123 . the aspirator 120 is located within a molded plastic tank 125 which forms part of the liquid fertilizer generating unit 20 . as illustrated in fig1 the tank 125 has a capacity of approximately fifty gallons of water and is closed by a removable lid or cover 126 which is also preferably formed of a plastics material . a submersible motor - pump unit 128 ( fig4 ) is located within the lower portion of the tank 125 and has an inlet line 129 adjacent the bottom of the tank . the outlet of the unit 128 is connected by a line 132 to the aspirator 120 where the nitrogen gases supplied through the flexible line 16 are aspirated into the water flowing upwardly through the line 132 and aspirator 120 . the third switch 108 on the front panel 28 controls the pump unit 128 . the upper end or outlet of the aspirator 120 is connected to a tubular sight - glass 134 which is confined between fittings 136 clamped between a set of plates 138 mounted on the cover 126 for the tank 125 . the sight - glass 134 provides for observing the flow of water and combined nitrogen gases to assure that the pump 128 is operating properly and that nitrogen oxides are being introduced into the water . a line 142 is connected to the upper end of the sight - glass 134 and extends downwardly to the bottom of the tank 125 . the line 142 connects with the lower end of a long plastic tube 144 which extends in a helical manner within the tank 124 ( fig4 ) to form a gas absorption coil 145 . preferably , the tube 144 has substantial length , for example , on the order of two hundred or more feet , and the upper end of the tube 144 connects with a line 147 which projects upwardly through the cover 126 to a fitting 148 positioned between a pair of valves 151 and 152 . a line 154 extends from the valve 152 back downwardly into the lower portion of the tank 125 so that when the valve 152 is open , the water within the tank 124 is recirculated by the motor - pump unit 128 through the aspirator 120 and the absorption coil 145 . this recirculation of the water and nitrogen dioxide progessively increase the concentration of the nitric acid and nitrous acid produced within the tank 125 . when it is desired to withdraw some of solution from the tank 125 , the valve 151 is opened and the valve 152 is closed . additional water may then be supplied to the tank 125 to maintain a water level within the upper portion of the tank . referring to fig1 and 4 , an air supply line 161 is connected to the fitting 74 mounted on the back of the air supply manifold 62 and extends outwardly from the cabinet 20 and downwardly through the cover 126 to the bottom of the tank 125 . the tube 161 connects to an air sparging or dispersing tube 162 which has fine holes so that air from the compressor 78 is introduced into the lower portion of the tank 125 , as illustrated by the bubbles in fig4 . calcium hydroxide or calcium carbonate , in the form of limestone or hydrabed lime , is added to the lower portion of the tank 125 and combines with the additional oxygen supplied through the tube 162 to release the calcium for combining with the nitrogen to produce calcium nitrate in the water solution within the tank 125 . the additional oxygen added to the water through the line 161 and tube 162 also cooperates in converting the unstable nitrous oxide gas ( no 2 ) produced by the combustion units into a more stable nitric acid solution ( hno 3 ). the desired reaction accomplished by introduction of additional oxygen is : hno 2 + 1 / 2o 2 → hno 3 . the cover 126 further limits the nitrous oxide gas ( no 2 ) from escaping from the tank to atmosphere thereby forcing it to continue in the above reaction to obtain a more concentrated solution of nitric acid . other materials , such as potash and phosphate rock , may also be added to the recirculating tank 125 according to the fertilizer characteristics desired within the water removed from the tank through the valve 151 . from the drawings and the above description , it is apparent that the method and apparatus of the invention for producing a liquid nitrate fertilizer , provides desirable features and advantages . for example , the portable apparatus shown in fig1 is adapted for on - sight , low cost production of a stable water - based nitrogen solution , and the concentration of the solution is determined by selecting the operating time of the apparatus through control of the timer 110 . as mentioned above , trace elements may also be conveniently added to the tank 125 to meet specific or customized plant requirements . while the apparatus illustrated is ideally suited for use by a small commercial operation such as a greenhouse operation , it is apparent that the apparatus may be constructed on a larger scale for use wherever a supply of water and a supply of electrical power are available . for example , in a larger system , two sets of the air combustion units 35 may be arranged in parallel to provide for a greater demand for nitrogen gases . in addition , the parallel - series arrangement of the combustion chambers 41 assures that all of the air flowing through the unit is required to pass through rotating arcs or flames within the orifices 46 , thereby obtaining a high efficiency of combustion . the compact liquid fertilizer generating unit 20 , including the tank 124 , cover 126 , aspirator 120 , recirculating pump 128 and absorbtion coil 145 , further provides for increasing the volume of hot nitrogen gases which go into solution before the gases have an opportunity to recombine . the recirculation also progressively increases the concentration of the nitric acid within the tank 124 , resulting in a more efficient production of nitrate fertilizer . in addition , the air supplied to the tank through the line 161 , provides more oxygen to the water for producing additional nitric acid , and the cover 126 inhibits the escape of the nitrous oxide to atmosphere prior to combining with the oxygen to form nitric acid . another feature is provided by the solenoid valve 115 which automatically closes when the air pump 78 stops to assure that no water or acid within the tank 124 can flow backwards in the line 16 and enter the combustion unit 35 and thereby damage the unit . while the method and form of liquid fertilizer generating apparatus herein described constitute a preferred embodiment of the invention , it is to be understood that the invention is not limited to the precise method and form of apparatus described , and that changes may be made therein without departing from the scope and spirit of the invention as defined in the appended claims .	1
an embodiment of a system of the invention is illustrated in the accompanying drawings , wherein like reference numerals refer to like elements throughout the drawings . although the drawings are intended to illustrate an embodiment of the present invention , the drawings are not necessarily drawn to scale . a calibration system of the invention may be used with an external drum imaging system that is configured to record digital data onto imaging media . although described below with regard to an external drum platesetter , many aspects of the present invention may be used in conjunction with a wide variety of other types of external drum , internal drum , or flatbed imaging systems , including imagesetters and the like , without departing from the intended scope of the present invention . as shown in fig1 in accordance with an embodiment of the invention , imaging media may be placed onto an input tray 30 of an image recorder , such as a platesetter 10 having a housing 2 . the imaging media is then imaged , and a portion of the imaged media may then be scanned by a calibration unit . the imaging system may then be adjusted responsive to the output of the calibration unit , and imaging of the media may continue . the media is then output from the platesetter 10 via output port 4 , passed to a processing station 6 , and then deposited onto a table 8 as shown in fig1 . the imaging system generally includes a front end computer or workstation ( not shown ) for the design , layout , editing , and / or processing of digital files representing pages to be printed , a raster image processor ( rip ) for further processing the digital pages to provide rasterized page data ( e . g ., rasterized digital files ) for driving an image recorder , and an image recorder , such as an external drum platesetter 10 , for recording the rasterized digital files onto a printing plate or other recording media . the external drum platesetter 10 records the digital data provided by the rip onto a supply of photosensitive , radiation sensitive , thermally sensitive , flexographic or other type of suitable printing plate . in the present embodiment , the printing plate is manually loaded onto a staging area of the external drum platesetter 10 by an operator . alternately , or in addition to manual loading , the printing plate may be provided and loaded onto the external drum platesetter 10 by a media supply or autoloading system , which may accept a plurality of the same size or different size printing plates . as shown in fig2 the external drum platesetter 10 includes an external drum 12 having a cylindrical media support surface 14 for supporting the printing plate 16 ( shown in fig3 ) during imaging . the external drum platesetter 10 further includes a writing and calibration system 18 , coupled to a movable carriage 20 , for recording digital data onto the imaging surface 22 of the printing plate 16 using a single or multiple imaging beams 24 ( shown in fig2 ). the carriage 20 rides along a stable base 26 , and the drum 12 rotates about a drum drive system 28 . the base 26 may be formed of heavy material , such as a polymer - concrete mixture , granite , or the like , to vibrationally isolate the external drum 12 and writing and calibration unit 18 from external vibrations . generally , during use a plate is positioned on an input tray 30 , and transferred to an imaging station in a direction as indicated at a . after imaging , the plate is transferred from the imaging station to an output tray in a direction as indicated at b using transfer belts 32 that are driven by pulleys 34 about pulley shafts 36 . from the output tray , the plate may be exited from the platesetter 10 in either of a direction as indicated at c or a direction as indicated at d by rollers 40 that contact the plate after the pulleys 34 and belts 32 are lowered with respect to the rollers 40 . in further embodiments , the plate may be exited from the platesetter 10 in a direction as indicated at e . as shown in fig2 the scanning system 18 is displaced by the movable carriage 20 in a slow scan ( axial ) direction along the length of the rotating external drum 12 to expose the printing plate 16 in a line - wise manner when a single beam is used or in a section - wise manner for multiple beams . other types of imaging systems may also be used in the present invention . the external drum 12 is rotated by a drive system 28 in a clockwise or counterclockwise fast scan direction , typically at a rate of about 100 - 1000 rpm . in an embodiment , the printing plate 16 is loaded onto the external drum 12 while rotating the drum in a first clockwise direction . the printing plate 16 is then imaged while the drum is rotated in the first , or in an opposite second , direction . finally , the printing plate 16 is unloaded from the external drum 12 while rotating the drum in the second direction . as shown in fig3 a plate 16 is positioned on the input tray 30 above a pair of resilient input nip rollers 50 , one of which may be driven by a drive assembly 52 . the leading edge 38 of the plate 16 is positioned by the input tray 30 to rest substantially between the input nip rollers 50 . the rollers 50 are positioned above the external drum 12 , and are oriented such that the common tangent of the rollers 50 is tangent to the media support surface 14 . the input tray 30 is oriented such that the loading path of the plate 16 extends along a line that is tangent to the external drum 12 at a leading edge clamping mechanism 40 . a curved input / output guide platen 54 , mounted to a frame member ( not shown ) of the external drum platesetter 10 may be provided to direct the leading edge 38 of the printing plate 16 toward the leading edge clamping mechanism 40 during the loading of the printing plate 16 onto the external drum 12 . in addition , the curved input / output guide platen 54 is configured to direct the printing plate 16 off of the external drum 12 toward the plate output area after imaging is complete . during loading of a plate 16 , the drum 12 is rotated until the leading edge clamping mechanism 40 is positioned to receive the leading edge 38 of the plate 16 . a clamping portion 54 of the clamping mechanism 40 is held in an open position by an actuator 56 , exposing registration pins 58 . a trailing edge clamping mechanism 44 is rotated by the drive system 28 , if necessary , to position a clamping bar 60 out of the way of the loading path of the plate 16 . an actuation system 62 for the trailing edge clamping mechanism 44 , and an ironing roller system 64 , may also be retracted away from the media support surface 14 of the external drum 12 out of the way of the loading path . after the leading edge 38 of the plate 16 is properly positioned against the registration pins 58 , the leading edge clamping mechanism is closed , thereby pinching the plate 16 against the external drum 12 while the leading edge 38 remains in contact with the registration pins 58 . after the leading edge clamping operation , the external drum 12 is rotated a few degrees by the drive system 28 . the ironing roller assembly of the stationary ironing roller system 64 is then extended and positioned against the plate 16 by an actuating system . the plate is drawn around the drum 12 until the trailing edge 42 of the plate 16 is positioned adjacent the trailing edge clamping mechanism 44 . the clamping bar 60 is then positioned over the trailing edge 42 of the plate 16 . if the size of the plate is not known and pre - programmed into the system , a sensor 68 may be used to detect the trailing edge of the plate 16 . the drum and clamping bar 60 are then rotated together , and the clamping bar 60 , which is normally biased away from the drum 12 , is then forced against the drum 12 by the actuation system 62 . vacuum may also be used to facilitate securing the plate to the drum . during imaging , the leading edge 38 of the plate 16 is held in position against the media support surface 14 by the leading edge clamping mechanism 40 . similarly , the trailing edge 42 of the printing plate 16 is held in position against the media support surface 14 by the trailing edge clamping mechanism 44 . both the trailing edge clamping mechanism 44 and the leading edge clamping mechanism 40 provide a tangential friction force between the printing plate 16 and the external drum 12 sufficient to resist the tendency of the edges of the printing plate 16 to pull out of the clamping mechanisms 40 , 44 , at a high drum rotational speed . in accordance with the present invention , only a small section ( e . g ., 6 mm ) of the leading and trailing edges 38 , 42 , is held against the external drum 12 by the leading and trailing edge clamping mechanisms 40 , 44 , thereby preserving as much of the available imaging area of the printing plate 16 as possible . as shown in fig4 a calibration image 80 is recorded on a portion of the surface 14 of the imaging media 12 by a writing illumination source 82 of the writing and calibration unit 18 . the calibration image 80 may then be viewed by a calibration detection unit 84 within the unit 18 as shown in fig5 . the calibration detection unit 84 may include , in particular , a dispersing filter 86 and a charge couple device ( ccd ) camera 88 . as shown in fig6 a and 6b , the calibration image 80 may include an checkerboard - type array of black and white boxes , and may , for example be about 1 inch by 1 inch in size . if the writing source 82 is improperly calibrated , then the individual boxes 90 may be slightly undersized as shown at 90 a in fig6 a , or slightly oversized as shown at 90 b in fig6 b . because the calibration detection unit 84 includes a dispersing filter 86 , the ccd camera 88 receives a blurred homogenous image of the calibration image 80 , rather than distinguishing between individual boxes . the blurred homogenous image will be recorded by the ccd camera and accompanying computer system as a shade having a particular shade value . if the calibration image includes undersized boxes as shown at 90 a in fig6 a , then the shade value of the image received by the ccd camera 84 will be lower than a desired target shade value . if the calibration image includes oversized boxes as shown at 90 b in fig6 b , then the shade value of the image received by the ccd camera 84 will be higher than the desired target shade value . finally , if the calibration image includes correctly - sized boxes as shown at 90 c in fig6 c , then the shade value of the image received by the ccd camera 84 will be equal to the desired target shade value . the position of the writing unit 82 may then be adjusted as indicated at 92 in fig5 responsive to the shade value of the received image to achieve an optimal calibration for that particular imaging media . in various embodiments , the system may adjust to any shade value , e . g ., 50 % as described above , or any value between 0 % and 100 %. further , the system may record and analyze either the brightness ( the white areas ) and / or the dark areas , and may record the brightness / darkness for a variety of shades ( e . g ., 25 %, 50 % and 75 %) and provide the appropriate ( linear or non - linear ) correction as needed . in other embodiments , the system may not blur the image , but rather may record the actual shapes ( e . g ., each square shape ) in the calibration image . moreover , the calibration image may form a part of the overall image being recorded on the plate . the calibration image may be written on a small portion of the media near an edge in order to preserve as much of the media as possible for imaging of the desired image during pre - press imaging . in further embodiments , the calibration image may be written over a large portion of imaging media that is used only for the calibration process . with reference again to fig3 during output of the plate 16 from the drum 12 , the drive system 28 rotates the drum 12 in a counterclockwise direction , the trailing edge clamping mechanism 44 is released , and the leading edge clamping mechanism 40 is released . the trailing edge 42 of the plate 16 is guided by the input / output platen 54 toward resilient output nip rollers 70 , one of which may include a drive system 72 . the plate 16 is then received in the output area 47 by the belts 32 that are rotated about pulleys 34 in a direction that causes the top surface of the belts 32 to travel with the plate as it emerges from the imaging area , and thereby carry the plate away from the imaging area . once the plate reaches a stop surface , the plate stops moving and the drive system for the pulleys 34 is turned off . in other embodiments , plate advancement may cease responsive to the output of a position sensor . those skilled in the art will appreciate that numerous modifications and variations may be made to the above disclosed embodiments without departing from the spirit and scope of the present invention .	7
the disclosure is illustrated by way of example and not by way of limitation in the figures of the accompanying drawings in which like references indicate similar elements . it should be noted that references to “ an ” or “ one ” embodiment in this disclosure are not necessarily to the same embodiment , and such references can mean “ at least one .” fig1 illustrates an array substrate 12 of an lcd panel of an exemplary embodiment . fig2 illustrates a cross - sectional view of the array substrate 12 . referring to fig1 and 2 , the array substrate 12 includes a substrate 120 , a first wiring layer 121 , a second wiring layer 122 , an insulating layer 123 , a semiconductor film 124 , a passivation layer 125 , a conductive film 126 , and a plurality of spacers 129 . the substrate 120 is transparent , for instance , made of glass . the spacer 129 is a laminating structure . the first wiring layer 121 is set on a surface of the substrate 120 and includes a gate line 130 extending along a first direction , a gate electrode 132 connected to the gate line 130 , and a first laminating layer 136 . in this embodiment , the gate electrode 132 protrudes from a side of the gate line 130 . a first photoresist layer 138 applied to the first wiring layer 121 is exposed and developed to form the gate line 130 , the gate electrode 132 , and the first laminating layer 136 . apart of the first photoresist layer 138 covering the first laminating layer 136 remains as one layer of the laminating structure of the spacer 129 . in this embodiment , the first laminating layer 136 is a first layer of the spacer 129 and the first photoresist 138 is a second layer of the spacer 129 . the insulating layer 123 is formed on the substrate 120 to cover the gate line 130 , the gate electrode 132 , the first laminating layer 136 , and the first photoresist layer 138 . the insulating layer 123 is used as a gate insulator . in this embodiment , a part of the insulating layer 123 which overlaps with the first photoresist layer 138 is a third layer of the spacer 129 . the semiconductor film 124 is formed on a surface of the insulating layer 123 . a second photoresist layer 148 applied on the semiconductor film 124 is exposed and developed to form a channel layer 140 and a second laminating layer 146 . the channel layer 140 is located to correspond to the gate electrode 132 . the second laminating layer 146 is stacked with the first photoresist layer 138 . a part of the second photoresist layer 148 which covers the second laminating layer 146 remains as one layer of the laminating structure of the spacer 129 . in this embodiment , the second laminating layer 146 is a fourth layer of the spacer 129 and the second photoresist layer 148 is a fifth layer of the spacer 129 . the second wiring layer 122 is formed on the semiconductor film 124 and the insulating layer 123 . the second wiring layer 122 is electrically isolated from the first wiring layer 121 . a third photoresist layer 158 applied to the second wiring layer 122 is exposed and developed to form a source line 150 , a source electrode 152 , a drain electrode 154 , and a third laminating layer 156 . the source electrode 152 and the drain electrode 154 overlap with the semiconductor film 124 . the third laminating layer 156 is stacked with the second photoresist layer 148 . a part of the third photoresist layer 158 which covers the third laminating layer 156 remains as one layer of the laminating structure of the spacer 129 . in this embodiment , the third laminating layer 156 is a sixth layer of the spacer 129 and the third photoresist layer 158 is a seventh layer of the spacer 129 . the source line 150 extends along a second direction different from the first direction . the source line 150 crosses with the gate line 130 to define a pixel area . the source electrode 152 is connected to the source line 150 . the source electrode 152 is electrically connected to the drain electrode 154 via the channel layer 140 . the source electrode 152 , the drain electrode 154 , and the channel layer 140 together comprise and function as a thin film transistor ( tft ) 159 . in this embodiment , the thin film transistor 159 is located at a corner where the source line 150 crosses the gate line 130 . the passivation layer 125 is formed on the substrate 120 to cover the insulating layer 123 , the semiconductor layer 124 , the second wiring layer 122 , and the third photoresist layer 158 formed on the third laminating layer 156 . in this embodiment , a part of the passivation layer 125 which covers the third photoresist layer 158 is an eighth layer of the spacer 129 . the conductive film 126 is formed on the passivation layer 125 . a fourth photoresist layer 168 applied to the conductive film 126 is exposed and developed to form a pixel electrode 160 and a fourth laminating layer 166 . the pixel electrode 160 is electrically connected to the drain electrode 154 via a connecting through hole 125 a defined in the passivation layer 125 . a part of the fourth photoresist layer 168 covering the fourth laminating layer 166 remains as one layer of the laminating structure of the spacer 129 . in this embodiment , the fourth laminating layer 168 is a ninth layer of the spacer 129 and the fourth photoresist layer 168 is a tenth layer of the spacer 129 . it is understood that a sequence of laminating layers of the spacer 129 can be changed according to a priority of manufacturing steps of the first wiring layer 121 , the second wiring layer 122 , the insulating layer 123 , the semiconductor film 124 , the passivation film 125 , and the conductive film 126 . the first photoresist layer 138 , the second photoresist layer 148 , the third photoresist layer 158 , and / or the fourth photoresist layer 168 can be omitted from the laminating structure of the spacer 129 . fig3 is a flowchart of an exemplary embodiment of an array substrate manufacturing method for an lcd panel . the spacer 129 of the array substrate 12 is formed with the tft 159 and the pixel electrode 160 of the array substrate 12 . in this embodiment , the tft 159 is a bottom gate type tft . it is understood that , in the other embodiments , the tft 159 can be different types of tfts , for instance , a top gate type tft . a priority of the manufacturing steps can be changed according to the structure of the tft 159 . in block 801 , referring also to fig4 , the substrate 120 is provided and the first wiring layer 121 is formed on the substrate 120 . the substrate 120 can be made of an insulating material , for example , glass , quartz , or a ceramic . the first wiring layer 121 can be made of a conductive material , for example , aluminum , molybdenum , chromium , tantalum , or copper . in block 802 , the first photoresist layer 138 is formed on the first wiring layer 121 to pattern the first wiring layer 121 . a first mask 300 is placed above the first photoresist layer 138 . the first mask 300 is a gray tone mask and includes a plurality of first areas 301 , two second areas 302 , and a third area 303 . transparencies of the first areas 301 , the second areas 302 , and the third area 303 gradually decrease . in this embodiment , the third area 303 is opaque , the first areas 301 of the first mask 300 are entirely transparent , and the second areas 302 allow a portion of light to pass through . the second areas 302 are respectively aligned with positions of the gate line 130 and the gate electrode 132 ( see fig1 ). the third area 303 is aligned with a position of the spacer 129 ( see fig1 ). the first areas 301 are aligned with the remaining portions of the array substrate 12 . ultraviolet light passes through the first mask 300 to irradiate the first photoresist layer 138 . the transparencies of the first areas 301 , the second areas 302 , and the third area 303 are different from each other , thus different parts of the first photoresist layer 138 aligned with the first areas 301 , the second areas 302 , and the third areas 303 are irradiated at different intensities . referring to fig5 , the first photoresist layer 138 is developed . a plurality of first parts of the first photoresist layer 138 aligned with the first areas are totally removed . two second parts of the first photoresist layer 138 aligned with the two second areas 302 are partially removed . a third part of the first photoresist layer 138 aligned with the third area 303 remains unremoved . a thickness of the third part of the first photoresist layer 138 aligned to the third area 303 is greater than a thickness of the second parts of the first photoresist layer 138 aligned to the second areas 302 . referring to fig6 , a part of the first wiring layer 121 uncovered by the first photoresist layer 138 is etched away . that is , the part of the first wiring layer 121 aligned to the first areas 301 is etched away . in block 803 , referring to fig7 , the first photoresist layer 138 is etched until the second parts of the first photoresist layer 138 aligned with the second areas 302 are totally removed . since the thickness of the third part of the first photoresist layer 138 aligned with the third area 303 is greater than the thickness of the second parts of the first photoresist layer 138 aligned with the second areas 302 of the first mask 300 , the third part of the first photoresist layer 138 aligned with the third area 303 of the first mask 300 remains unremoved when the second parts of the first photoresist layer 138 aligned with the second areas 302 of the first mask 300 are totally removed . a part of the first wiring layer 121 uncovered by the first photoresist layer 138 is used as the gate line 130 and the gate electrode 132 . the other parts of the first wiring layer 121 covered by the remaining third part of the first photoresist layer 138 is used as the first laminating layer 136 of the spacer 129 . in block 804 , also referring to fig8 , the insulating layer 123 is formed on the substrate 120 to cover the first wiring layer 121 and the remaining third part of the first photoresist layer 138 . a part of the insulating layer 123 covering the remaining third part of the first photoresist layer 138 is used as one layer of the laminating structure of the spacer 129 ( see fig2 ). in block 805 , the semiconductor film 124 is formed on the insulating layer 123 . the semiconductor film 124 can be made of a metal oxide semiconductor material . in block 806 , the second photoresist layer 148 is formed on the semiconductor film 124 to pattern the semiconductor film 124 . a second mask 400 is placed above the second photoresist layer 148 . the second mask 400 is a gray tone mask and includes a number of first areas 401 , a second area 402 , and a third area 403 . the respective transparencies of the first areas 401 , the second area 402 , and the third area 403 gradually decrease . in this embodiment , the third area 403 is opaque , the first areas 401 are transparent , and the second area 402 allows a portion of light to pass through . the second area 402 is aligned with a position of the channel layer 140 ( see fig1 ). the third area 403 is aligned with the position of the spacer 129 ( see fig1 ). the first areas 401 are aligned with the remaining portions of the array substrate 12 . ultraviolet light passes through the second mask 400 to irradiate the second photoresist layer 148 . referring to fig9 , the second photoresist layer 148 is developed . a number of first parts of the second photoresist layer 148 aligned with the first areas 401 are totally removed . a second part of the second photoresist layer 148 aligned with the second area 402 of the second mask 400 is partially removed . a third part of the second photoresist layer 148 aligned to the third area 403 remains unremoved . a thickness of the third part of the second photoresist layer 148 aligned with the third area 403 is greater than a thickness of the second part of the second photoresist layer 148 aligned with the second area 402 . referring to fig1 , a part of the semiconductor film 124 uncovered by the second photoresist layer 148 is etched away . that is , the part of the semiconductor film 124 aligned with the first area 401 is etched away . a part of the semiconductor film 124 aligned with the second area 402 is patterned to form the channel layer 140 . a part of the semiconductor film 124 aligned with the third area 403 is patterned to form the second laminating layer 146 of the spacer 129 . the second laminating layer 146 is stacked with the first laminating 136 layer . in block 807 , referring also to fig1 , the second photoresist layer 148 is etched away until the second part of the second photoresist layer 148 aligned with the second area 402 is totally removed . since the thickness of the third part of the second photoresist layer 148 aligned to the third area 403 is greater than the thickness of the second part of the second photoresist layer 148 aligned with the second area 402 , the third part of the second photoresist layer 148 aligned with the third area 403 remains unremoved when the second part of the first photoresist layer 148 aligned with the second area 402 is totally removed . the remaining third part of the second photoresist layer 148 is used as one layer of the laminating structure of the spacer 129 ( see fig2 ). referring to fig1 , in block 808 , the second wiring layer 122 is formed on the substrate 120 to cover the insulating layer 123 , the semiconductor film 124 , and the second photoresist layer 148 . in block 809 , the third photoresist layer 158 is formed on the second wiring layer 122 to pattern the second wiring layer 122 . a third mask 500 is placed above the third photoresist layer 158 . the third mask 500 is a gray tone mask and includes a plurality of first areas 501 , three second areas 502 , and a third area 503 . respective transparencies of the first areas 501 , the second areas 502 , and the third area 503 gradually decrease . in this embodiment , the third area 503 is opaque , the first areas 501 are transparent , and the second areas 502 allow a portion of light to pass through . the three second areas 502 are respectively aligned with positions of two branches of the source electrode 152 and the drain electrode 154 ( see fig1 ). the third area 503 is aligned with the position of the spacer 129 . the first areas 501 are aligned with the remaining portions of the array substrate 12 . ultraviolet light passes through the third mask 500 to irradiate the third photoresist layer 158 . referring to fig1 , the third photoresist layer 158 is developed . a plurality of first parts of the third photoresist layer 158 aligned with the first areas 501 are totally removed . three second parts of the third photoresist layer 158 aligned with the three second areas 502 are partially removed . a third part of the first photoresist layer 158 aligned with the third area 503 remains unremoved . a thickness of the third part of the third photoresist layer 158 aligned with the third area 503 is greater than a thickness of the second parts of the third photoresist layer 158 aligned with the second areas 502 . referring to fig1 , a part of the second wiring layer 122 uncovered by the third photoresist layer 158 is etched away . that is , the part of the second wiring layer 122 aligned with the first areas 501 is etched away . a portion of the second wiring layer 122 aligned with the second areas 502 is patterned to form the source line 150 ( see fig1 ), the source electrode 152 , and the drain electrode 154 . a portion of the second wiring layer 122 aligned with the third area 503 is patterned to form the third laminating layer 156 of the spacer 129 . the third laminating layer 156 is stacked with the first laminating layer 146 and the second laminating layer 136 . in block 810 , referring also to fig1 , the third photoresist layer 158 is etched away until the second parts of the third photoresist layer 158 aligned with the second areas 502 are totally removed . since the thickness of the third part of the third photoresist layer 158 aligned with the third area 503 is greater than the thickness of the second parts of the third photoresist layer 158 aligned with the second areas 502 , the third part of the third photoresist layer 158 aligned with the third area 503 remains unremoved the second parts of the third photoresist layer 158 aligned with the second areas 502 is totally removed . the remaining third part of the third photoresist layer 158 is used as one layer of the laminating structure of the spacer 129 ( see fig2 ). referring to fig1 , in block 811 , the passivation layer 125 is formed to cover the insulating layer 123 , the semiconductor film 124 , the second wiring layer 122 , and the third photoresist layer 158 . a part of the passivation layer 125 covering the remaining third part of the third photoresist layer 158 is used as one layer of the laminating structure of the spacer 129 ( see fig2 ). in block 812 , a conductive film 126 is formed on the passivation layer 125 . in this embodiment , the conductive film 126 is made of indium tin oxide ( ito ). in block 813 , the fourth photoresist layer 168 is formed on the conductive film 126 to pattern the conductive film 126 . a fourth mask 600 is placed above the fourth photoresist layer 168 . the fourth mask 600 is a gray tone mask and includes a plurality of first areas 601 , a second area 602 , and a third area 603 . respective transparencies of the first areas 601 , the second area 602 , and the third area 603 gradually decrease . in this embodiment , the third area 603 is opaque , the first areas 601 are transparent , and the second area 602 allows a portion of light to pass through . the second area 602 is aligned with a position of the pixel electrode 160 ( see fig1 ). the third area 603 is aligned with the position of the spacer 129 ( see fig1 ). the first areas 601 are aligned with the remaining portion of the array substrate 12 . ultraviolet light passes through the fourth mask 600 to irradiate the fourth photoresist layer 168 . referring to fig1 , the fourth photoresist layer 168 is developed . a number of first parts of the fourth photoresist layer 168 aligned with the first areas 601 are totally removed . a second part of the fourth photoresist layer 168 aligned with the second area 602 is partially removed . a third part of the fourth photoresist layer 168 aligned with the third area 603 remains unremoved . a thickness of the third part of the fourth photoresist layer 168 aligned with the third area 603 is greater than a thickness of the second part of the fourth photoresist layer 168 aligned with the second area 602 . referring to fig1 , a portion of the conductive film 126 uncovered by the fourth photoresist layer 168 is etched away . that is , the portion of the conductive film 126 aligned to the first area 601 is etched away . a portion of the conductive film 126 aligned with the second area 602 is patterned to form the pixel electrode 160 . a portion of conductive film 126 aligned with the third area 603 is patterned to form the fourth laminating layer 166 of the spacer 129 ( see fig2 ). the fourth laminating layer 166 is stacked with the first laminating layer 136 , the second laminating layer 146 , and the third laminating layer 156 . in block 814 , referring also to fig1 , the fourth photoresist layer 168 is etched away until the second part of the fourth photoresist layer 168 aligned with the second area 602 is totally removed . since the thickness of the third part of the fourth photoresist layer 168 aligned with the third area 603 is greater than the thickness of the second part of the fourth photoresist layer 168 aligned with the second area 602 , the third part of the fourth photoresist layer 168 aligned with the third area 603 remains unremoved when the second part of the fourth photoresist layer 168 aligned with the second area 602 is totally removed . the remaining third part of the fourth photoresist layer 168 is used as one layer of the laminating structure of the spacer 129 ( see fig2 ). it is believed that the present embodiments and their advantages will be understood from the foregoing description , and it will be apparent that various changes may be made thereto without departing from the scope of the disclosure or sacrificing all of its material advantages , the examples hereinbefore described merely being preferred or exemplary embodiments .	6
fig1 schematically illustrates a blow molding machine m for containers , e . g . a stretch blow molding machine for plastic bottles . a blow molding station b comprising a non - illustrated star - shaped rotor equipped with blow molds is connected to a production line f , which extends at least section - wise through a heater h for preforms p to be treated by exposing them to radiation or in any other way by externally heating them or treating them thermally . the conveying direction of the production line f is shown by an arrow 1 . the production line f comprises a plurality of mandrel devices d located closely adjacent to each other , each with a suspended holder 2 mounted thereon and at least one fitting g 1 in the form of a preform mandrel 3 , which is exchangeably mounted on the holder 2 and which is inserted into an orifice 4 ( fig2 ) of a respective preform p . in operation , the preform mandrels 3 are , if necessary , rotated about their axes , while they are thermally pretreated . the orifice 4 of the preform p comprises , for example , an external supporting ring 5 ( fig2 ) and an external thread 6 . specifically this portion ( supporting ring 5 and at least a portion of the external thread 6 ) must be shielded during the thermal pretreatment of the preform because it already has the later shape as in the finished blown container and could become damaged by the thermal pretreatment required by the other part of the preform p . to this end , a so - called shielding plate 7 having one or two plug - in feet 9 is mounted on the holder 2 as an additional exchangeable fitting g 2 , which shields this sensitive region of the orifice 4 of the preform p with an inner bore 8 . the plug - in foot 9 is inserted with a peg - shaped or tubular end portion 11 into a plug receptacle 10 of the holder 2 , which is formed as a blind hole , where it is secured by a quick - change element s . thus , the fitting g 2 cannot be detached from the holder 2 . to be able to remove the fitting g 2 from the holder 2 , the application of an external force to the quick - change element s is necessary , for example in the direction of an arrow 12 . then ( fig3 ) the fitting g 2 , i . e . the shielding plate 7 , can be separated by means of the plug - in feet from the holder 2 ( in the direction of an arrow 13 ) and can be replaced by another fitting g 2 which , upon another application of force to the quick - change element s in the direction of arrow 12 , is inserted into the plug receptacle 10 and automatically secured by the quick - change element s . the newly inserted fitting g 2 differs , for example , by another size and design from the shielding plate 7 and the inner bore 8 thereof , whereas its end portion 11 mates the plug receptacle 10 . the end portion 11 of the plug - in foot 9 additionally includes a circumferential cavity 16 for the form - closed engagement of the quick - change element s , expediently a circumferential groove 16 , which shall be explained in more detail by means of fig4 . an exchange can be accomplished manually , by exerting the force on the quick - change element s in the direction of arrow 12 with a finger or a tool and by manually removing or inserting the fitting g 2 , or mechanically by an automatic or semiautomatic quick - change machine , which performs all or at least some of the aforementioned steps . in the embodiment shown in fig2 to 4 , the quick - change element s must be displaced by the application of an external force to allow the insertion and the removal of the fitting . alternatively , it would be possible to shape the tip of the end portion 11 designated with 15 in fig4 conically or radiused in such a way that alone by introducing the end portion 11 the quick - change element s is temporarily pushed aside until the end portion 11 is seated in the plug receptacle 10 and is secured . in the embodiment shown in fig4 , the quick - change element s comprises a press - button head 17 , which is positioned on the holder 2 to be accessible from outside . a stop face 18 on the lower side of the press - button head 17 is oriented towards a stop face 19 on the holder and towards the opening of a channel 22 , respectively , which channel 22 passes through the holder 2 in a direction transverse with respect to the plug receptacle 10 . a pin - like shaft 20 is adjacent to the press - button head 17 , the free end of which projects out of the channel 22 and carries a limit stop 26 interacting with a stop face 24 of the holder so as to prevent the quick - change element s from falling out . a collar 21 is formed on the shaft 20 , while a collar 23 is formed in the channel 22 . a spring element 25 , e . g . a helical spring , is seated between the collars 21 and 23 , which prestresses the quick - change element s in the direction towards the secured position shown in fig4 and , without the end portion 11 in the plug receptacle 10 , makes the limit stop 26 rest against the stop surface 24 . the limit stop 26 is detachable , for example , for disassembling the quick - change element s . the shaft 20 passes through a passage 27 which , in a direction perpendicular to the plane of projection in fig4 , at least has a width in correspondence with the outer diameter of the end portion 11 and which , in the direction of adjustment of the quick - change element s in channel 22 , has a dimension x which may be greater than the outer diameter of the end portion 11 . expediently , the passage 27 is an oblong hole , as is shown in fig4 by the bent lines of intersection on the periphery of the shaft 20 . in the holder 2 , a clearance 28 is recessed in the crossing area between the channel 22 and the plug receptacle 10 , into which the collar 21 of the shaft 20 can be moved when the quick - change element s is displaced against the force of the spring element 25 to abut between faces 18 , 19 . expediently , the circumferential cavity 16 in the end portion 11 is a circumferential groove having a core diameter x 2 smaller than the outer diameter x 1 of the end portion 11 . the end portion 11 forms a collar 29 at plug - in foot 9 , which delimits the insertion depth into the plug receptacle 10 . the end portion 11 and / or the quick - change element s may be cylindrical or may have any other optional cross - sectional shape . in the secured position shown in fig4 , parts of the edges of the opening of passage 27 grip behind the boundaries of the circumferential cavity 16 . this position is secured by the spring element 25 . the plug - in foot 9 cannot be unplugged . if an external force is then applied to the quick - change element s , for example in the direction of arrow 12 shown in fig3 and 4 , which overcomes the force of the spring element 25 , the quick - change element s is displaced into its release position in which , for example , faces 18 , 19 contact each other . thus , the engagement between the edges of the opening of passage 27 and the boundaries of the circumferential cavity 16 is released . the plug - in foot 9 can be drawn out of the plug receptacle 10 by means of the end portion 11 . upon inserting the new fitting , again , the securing element s is moved into the release position against the force of the spring element 25 ( if appropriate , by the wedge effect of the tip 15 ) until the end portion 11 is properly placed in the plug receptacle 10 . upon releasing the press - button head 17 ( without any manipulation of the quick - change element s ) the spring element 25 then presses the quick - change element s into the secured position shown in fig4 . fig5 schematically illustrates an automatically operable quick - change system for the fittings g 2 and shielding plates 7 , respectively , in the production line f of the blow molding machine m . a stationarily arranged automatic changer 30 is provided at the production line f , which could be moved to the production line f and , if necessary , docked to the same , for example , for a changing procedure . in another alternative , the automatic changer 30 could be integrated in a star - shaped rotor , which operates in cycles according to the change cycles of the production line and exchanges one fitting g 2 after the other or a group of fittings at once . the automatic changer 30 , which is movable to the production line , for example , in the direction of arrow 36 , comprises at least one driven actuator 32 oriented toward the respective securing element s and applying the force to allow the removal or insertion of the fitting g 2 in the direction of the double arrow 13 , 14 . the removal and insertion , respectively , is accomplished by correspondingly controlled grippers 31 , 32 , 33 . moreover , the automatic changer 30 is provided with at least one magazine 35 , 34 , expediently a magazine 34 for removed fittings g 2 and a magazine 35 for fittings g 2 to be inserted . although the automatic changer shown in fig5 is only explained and illustrated in connection with the exchange of the fittings g 2 in the form of shielding plates 7 , it could in an alternative embodiment simultaneously also perform the exchange of other fittings , e . g . of the preform mandrels 3 . the respective automatic changer 30 could act as a semiautomatic machine , which means that one or the other manipulation is carried out by the automatic changer and / or an operator .	1
as described above , the mobile station may be used in a wireless embodiment which is shows schematically in fig1 . a cellular phone providing voice service could constitute such a station . a plurality of cells c 1 to c 12 are serviced by respective base station bs 1 to bs 12 . when the mobile station is in cell c 1 , it may be camped on to the control channel from base station bs 1 . the control channel bs 1 will transmit a list of neighboring control channels . the list will include control channels associated with base station bs 2 , base station bs 5 and base stations that service other cells adjacent to cell c 1 furthermore , the list of neighboring channels may include a list of control channels that are related to fax services or data services . in addition , the list may include a control channel associated with a private system such as that shown in cell c 1 . typically such a private system is overlaid by the public system so that the area covered by the private system is covered by both the public and private system , but access to the private system itself , for example , a wireless pbx on a party &# 39 ; s premises , is not permissible except by members of that private system . when the mobile station receives the neighbor list from the control channel on which it is camped , it stores that neighbor list in memory . the mobile station may be a cellular phone which complies with the is - 136 standards . such a mobile communications device 400 as illustrated if fig4 includes processing capabilities 410 and memory , both read only ( rom ) 420 and random access memory ( ram ) 430 . the rom 420 stores control programs for operating the device while the ram 430 stores dynamic information which can be updated over time , such as the neighbor list transmitted from a control channel on which the station is camped . in its memory the mobile station 400 would track the identification of the control channels included in the list . furthermore , in compliance with the is - 136 standard , the neighbor list would also provide certain parameter information which relates to the characteristics of the control channel . for example , the parameter information would indicate whether a control channel is associated with a private , a public , or a semi - private system . the identification of the particular system to which the control channel is associated would not necessarily be presented in the neighbor list . instead only the type of system to which the control channel is associated would be supplied . similarly , the parameter information could indicate whether the control channel is designed to provide voice service , data service , or fax service . other parameter information which defines the characteristics of the control channel could also be supplied with a neighbor list , ( e . g ., cell type , protocol version , cell sync , etc .). an example of a correlation of the information presented by the control channel , in which the mobile station is camped , is shown in fig2 . in this tabular representation of the data which might be stored in the mobile station , a first control channel in the list has an id of “ xxxxx ”. the parameter information indicates that this control channel is associated with a private system and provides voice services . the control channel identified by “ yyyyy ” is by contrast associated with the public system while still providing voice services . the control channel “ zzzzz ” is also associated with the public system , but provides fax services . similar information would be provided for each control channel identified in the neighbor list provided by the control channel on which the mobile station is camped . this parameter information can then be used to modify or control the process by which an alternative control channel can be selected . a flow chart illustrating the process for controlling re - selection using the received neighbor list is illustrated in fig3 . in step 300 , the mobile station 400 receives the neighbor list from the control channel on which it is presently camped . in step 301 , the mobile station 400 processor 420 scans the neighbor list in accordance with a stored control program and examines the entries in the list to determine whether any of the control channels ( the candidate control channels ) are ineligible because of a lack of compatibility between the mobile station and the control station . as an example , incompatibility could arise where the mobile station 400 does not have access to any private network or system . the mobile station memory 420 , 430 would store system ids for those systems with which the mobile station is allowed to communicate . it could also store a flag indicating whether the mobile station has access to any private system . under those circumstances where there is access to private systems , any control channel which is related to a private system is incompatible with the mobile station . similarly , if the mobile station seeks voice services , then any control channel associated with fax or data services would be incompatible with the mobile station . once a candidate control channel is detected or recognized to be ineligible in step 302 , then each of those ineligible control channels is marked as ineligible in the neighbor list . in particular , the processor in the mobile station modifies the neighbor list to somehow mark a control channel as ineligible . one way of doing this is to include an eligibility flag in the neighbor list . all control channels in the neighbor list would initially haste their eligibility flags set as indicated an eligible control channel . then , when a control channel is marked as ineligible the flag would be reset to an ineligible state . alternatively , it is possible that other steps could be taken to effectively remove the ineligible control channels from subsequent consideration in the re - selection process . in step 304 , a process , known in the prior art , is initiated for studying or analyzing candidate channels to try to select the optimal candidate channel for re - selection . this process is referred to in fig3 , as “ analyzing candidate control channels .” that step of analysis is limited to only those control channels which are deemed to be eligible . that is , if the eligibility status reflected in the neighbor list in step 303 indicated that a control channel is ineligible , then that control channel mill not be included in the analysis operation beyond that point . it will , in essence , be ignored and will not figure in the calculations of determining the best candidate control channel for the re - selection process . in the analysis operation , each of the eligible control channels will be tested for certain criteria such as rf level . once each of the eligible control channels is tested a primary candidate channel is selected ( step 305 ) as the processor identifies which of the eligible control channels is the best candidate for re - selection based on the test results obtained during the analysis of step 304 . this may arise under the circumstance where the processor will run tests on each of the eligible control channels . as an example a result of the tests on such things as the rf level in step 305 the processor may determine that one or more of the candidate control channel satisfy certain criteria to be selectable by the mobile station . then , in step 305 the processor could go through this subset of selectable candidate control channels and select the optimal or primary candidate control channel based on the parameters associated with that control channel . thus , a primary candidate channel could be as in step 305 . once such a primary candidate channel is identified , the mobile station attempts to re - select to the primary candidate channel in step 306 . if the re - selection attempt is successful as detected in step 307 , then the mobile station camps onto the primary candidate channel in step 308 and receives a new neighbor list from the primary candidate control channel identifying neighbors associated with that control channel . if , however , the attempt to re - select is unsuccessful , then the processor can make a determination as to why the re - selection attempt failed . if the failure is due to a mismatch of certain predetermined criteria as referred to in step 309 , then the channel identified as the primary candidate control channel could then be treated as an ineligible candidate channel . the eligibility status within the neighbor list would be modified to reflect this change of status and the processor could then resume the re - selection process from step 304 , where the processor could begin again the analysis of the candidate control channels focusing only on those which remain as eligible control channels . the system will then select another primary candidate and attempt to reselect to that second primary candidate channel . this process will continue until the mobile station camps onto an alternative control channel . as has been described above , a candidate channel could be ineligible because the control channel is associated with a private system , whereas the mobile station is not affiliated with any private system . furthermore , a control channel may be deemed ineligible because of the tyke of service that it provides and the lack of compatibility between that service and the service of the mobile station . the predetermined criteria referred to in connection with step 309 can be any condition that causes the failure of a reselect attempt . typically one such event would be where the primary candidate channel is associated with a private system and the mobile station is also associated with a private system . in that circumstance , then , the primary candidate channel would not then be marked ineligible in step 303 . then , during the reselect attempt the private system identifier associated with the primary candidate channel would be provided to the mobile station . if the mobile station private system identifier stored in memory does not match the private system id received from the primary candidate channel during the attempt to re - select , then the mobile station will not get access to the private system associated with that primary , candidate channel . therefore , there is an incompatibility between the mobile station and the system associated with that primary candidate channel . in view of this incompatibility , it is consistent with the exemplary embodiment to now mark this primary control channel as ineligible as in step 310 . then if it is necessary to analyze the neighbor list again ( step 304 ) to find a candidate channel for re - selection , the newly designated ineligible control channel will not be analyzed . in accordance with the alternative embodiments , other parameter information associated with a control channel could be used to determine whether the control channel is eligible for re - selection by this particular mobile station . furthermore , modifications to the process of fig3 are also possible . for instance , in one variation steps 301 , 302 and 303 would be eliminated , that is the processor would not do any preliminary examination of the neighbor list to determine if any candidate channels are ineligible . instead , the system would simply rely on marking primary candidate channels as ineligible for subsequent re - selection attempts . alternatively , the control method of an exemplary embodiment could rely simply on the ineligibility determination made at the beginning of the analysis process and not dynamically evaluate ineligibility based on whether an attempt to reselect a particular candidate channel was successful . thus steps 309 and 310 could be eliminated and benefits would still be obtained from the remaining process . since an exemplary embodiment includes a method by which the mobile station selects an appropriate re - selection candidate and since it is implemented using software running on a processor within the mobile station , it must be recognized that variations on the order in which certain steps are performed and the specific techniques or parameters involved in the process could be modified while still falling within the spirit of the disclosure . for example , it is conceivable that in one variation the station microprocessor could scan the entire list of neighbors and adjust the eligibility status where appropriate for all ineligible control channels before proceeding with the analysis of the eligible control channels . in an alternative embodiment , the first time through the neighbor list the processor could first determine whether a given control channel is eligible and then , if it is eligible , perform the analysis with respect to that control channel . then the microprocessor would turn to the next control channel on the list , determine whether it should be considered eligible and if so conduct the evaluation with respect to that control channel and so on . in this second configuration , the processor does not scan the entire list before beginning the evaluation process . instead , in combines the marking and evaluation steps . other modifications might include other techniques for marking a control channel as ineligible . in yet another embodiment it is conceivable that the mobile station could select for analysis a subset of the control channels form the neighbor list ; the subset being based on any one or combination of parameters . in accordance with an exemplary embodiment , a mobile station can more optimally control the process by which it selects alternative control channels . it provides the mobile station with a way to focus only on those candidate control channels with which the mobile station can effectively communicate .	7
before explaining the disclosed embodiments of the present invention in detail it is to be understood that the invention is not limited in its application to the details of the particular arrangements shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . “ seating device ” is used interchangeably with “ tripod stool ” and “ chair ” herein . however , it is readily apparent that the novel device is much more than a stool or chair and much more than a seating device , because it is multifunctional , including , but not limited to a seat , a cane , a protective covering from sun , rain , snow and the like . it can also provide relief from aching feet , legs and back muscles . in fig1 , the fully assembled seating device is shown with the umbrella 10 open and in a raised position . the shaft 15 supporting the umbrella 10 comprises a telescoping umbrella pole 11 , fitted with a socket - like connection 12 that receives the lower most portion of the umbrella pole 11 and the upper most end of a flexible tubing piece 14 . the gooseneck flexible tubing 14 is preferably 304 stainless steel tubing approximately 1 inch in diameter and available from a supplier of flexible metallic tubing , such as , armor associates , inc . in malvern , pa . the umbrella 10 and telescoping umbrella pole 11 are commercially available from any establishments selling umbrellas , such as sharper image or brookstone &# 39 ; s ( in usa ); it is preferable to use an umbrella that opens automatically and has a gust proof canopy construction . the umbrella canopy can be of any color , including the camouflage design and camouflage color used in military and outdoor activities such as hunting , bird - watching and the like . the socket - like connection 12 that receives the umbrella pole 11 on the upper end and the gooseneck flexible tubing piece 14 on the lower end can be formed of any rigid , break - resistant material , including , but not limited to , fiberglass , polyvinyl chloride , aluminum , titanium or other metal or even wood . the umbrella pole 11 and gooseneck flexible tubing 14 are secured in the socket - like connection 12 with glue , screws or other means to connect all segments of shaft 15 , so that there are no loose parts . referring again to fig1 , the remainder of the novel seating device includes a cane handle 16 , covered by a rubber gripping surface 17 with a plastic end cap 19 . the end cap 19 covers and provides an aesthetic appearance to the end of the tubular handle 16 on leg 22 . a yoke 18 forms an integral part of the lower most end of the gooseneck flexible tubing 14 and is secured by a clamping mechanism to cane handle 16 . the yoke 18 controls the overall position of shaft 15 , including the raising and lowering of the shaft and umbrella in a direction that is approximately 180 degrees to the left of the seat 20 and approximately 180 degrees to the right of seat portion 20 . the yoke 18 can rotate 360 degrees around handle 16 . thus , yoke 18 can rotate in two ways ; first , by loosening it from wherever it is attached or clamped and second , by rotating the handle as shown in fig1 a as discussed in greater detail below . details of the yoke 18 are also shown in fig1 to 23 and further discussed below . it is readily apparent that the yoke 18 with the unique clamping and rotating mechanism can be attached or clamped to any structure or chair wherein it can be clamped about a portion of the structure or chair , such as , but not limited to , a wheelchair , an electric cart and the like . the yoke 18 with umbrella 10 attached to a flexible and bendable gooseneck tubular segment or rod can provide hands - free , portable , adjustable shade and protection . the cane handle 16 is the uppermost end of a supporting leg 22 hinged to seat 20 , which is also hinged to additional supporting legs 24 and 26 . the cane handle 16 is preferably covered with a rubber grip 17 designed ergonomically for comfort and convenience when the seating device is in the collapsed position and used as a walking support . referring now to seat 20 , the shape can have any comfortable configuration with rounded edges , such as the substantially circular shape of a stool seat . the seat 20 can be made of any solid , break - resistant material , such as wood , metal or plastic , preferably a strong , lightweight material such as lightweight injection molded plastic . fig1 to 6 , 9 to 11 , 24 and 25 show the seat 20 with the optional removal seat cushion attached to the solid seat surface . turning now to the plurality of leg assemblies 22 , 24 , and 26 , these can be formed of hollow support tubes , or alternatively , formed of solid shafts or other suitable configuration , with the lower most end portion having an adjustable feature that is known in the art , and disclosed in u . s . pat . nos . 6 , 135 , 557 and 6 , 467 , 843 b1 , and incorporated herein by reference . the major requirement of the leg supports is that they be attached to communicating hinges or couplings on the seat 20 allowing the seat to fold in a flat vertical position when the seating device is collapsed . for some applications , hollow support tubes made of a lightweight and strong material , such as aluminum may be preferable to minimize the weight of the seating device . the diameter of the leg tubes and the tube wall thickness is preferably selected based on an expected support weight capability . it is desirable to obtain the maximum strength for a minimum tube wall thickness . in one embodiment , the hollow aluminum leg cylinders are approximately 1 inch in diameter and can support the weight of a person weighing approximately 325 pounds . a bottom end of each lower leg 22 , 24 , 26 includes a rubber cover 70 attached thereto . fig2 is a front view of the fully assembled seating device showing how the raised and opened umbrella 10 can be repositioned from left 10 a to right 10 b with reference to handle 16 because of the flexible metallic tubing 14 . additionally , the front view of the tripod leg assemblies shows one leg 22 with handle 16 is a long straight cylindrical leg while legs 24 and 26 are bent into a k shape and positioned as mirror images of each other using the straight cylindrical leg 22 and the vertical part of the k . each k - shaped supporting leg 24 and 26 has a compressed uppermost end attached to hinges or coupling means under the seat 20 . the waist 25 of each k - shaped leg 24 , 26 is pivotally attached to the long straight cylindrical leg 22 . the pivot joint is connected by threaded or riveted members to provide stability of the legs and prevent mobilization of the legs with respect to one another . the feet of the leg assemblies are angled radially outward from the waist connection 25 to maximize ground surface contact and further stabilize the seating device of the present invention . fig3 is a side view of the fully assembled seating device showing how the umbrella 10 can be repositioned from front 10 d to back 10 e because of the flexible metal tubing 14 , attached by yoke 18 to the uppermost portion of the long , straight cylindrical leg 22 . the long straight cylindrical leg 22 is attached to the seat 20 by a sleeved hinge 30 that allows the seat 20 to drop to a flat vertical position when the seating device is collapsed . fig4 is another perspective view of the seating device with the umbrella 10 raised and the umbrella canopy closed and secured with fasteners 41 and 42 . the fasteners used to secure the umbrella canopy or the umbrella attachment to the seating device when collapsed , can be made of material selected from the group consisting of nylon , string , leather , material with snaps , hooks and eyes and the like ; the preferred fastening means is a hook and loop fastener , such as velcro ®, a nylon fabric that can be fastened to itself . fig5 is a front view of fig4 showing the position of yoke 18 on handle 16 and the ergonomically curved handle at the upper most end of the long straight cylindrical leg 22 . also shown are the communicating hinges or couplings 50 and 52 that attach the k - shaped legs 24 and 26 respectively , to the bottom of seat 20 . fig6 provides a side view of fig5 with umbrella 10 flexed slightly forward by the flexible tubular connection 14 . also shown is the sleeve - like hinge 30 on leg 22 that is connected to seat 20 . fig7 shows the seating device being used as a chair by a person 500 who grasps the socket - like connection 12 to move the flexible tubular connection 14 and thereby position the umbrella 10 as desired . there are unlimited adjustments and positions that can be assumed with the novel arrangement of the umbrella shaft 15 for the present invention . fig6 shows person 500 with the umbrella closed and secured with fasteners 41 and 42 . the person can straddle the seat with the leg 22 between their legs . fig9 is a side view of the seating device with the umbrella 10 closed , secured with fasteners 41 , 42 and flexed slightly forward with the flexible tubular connection 14 . fasteners 41 and 42 are sewn into the seams of the umbrella 10 . the seat 20 is positioned to receive an occupant and a fastener strap 90 fits as a sleeve over the straight cylindrical leg 22 and extends downward . optionally , fastener 42 could be elongated and serve as a dual fastener for closed umbrella 10 and for securing the closed umbrella 10 to the straight cylindrical leg 22 . fig1 shows the seating device beginning to fold . the communicating hinges 50 ( not shown ), 52 under the bottom of the seat 20 are releasing in the direction of arrow a and urging the hinge or coupling 30 to move upward in the direction of arrow b , while supporting k - shaped legs 24 ( not shown ) and 26 move to a parallel position with leg 22 in the direction of arrow c . fig1 is a side view of the fully collapsed seating device with the closed umbrella 10 parallel to the seat 20 and leg assemblies 22 , 24 , 26 and fastener 90 is securing the closed umbrella 10 to the straight cylindrical leg 22 . fig1 – 15 provide the following views of the completely folded and collapsed seating device . fig1 is a view of folded , collapsed seating device when a user is holding the cane in the left hand for walking or hiking . fig1 is a side view of fig1 . fig1 is a view of the folded , collapsed seating device being held in the right hand of a user employing the device as a cane . fig1 is a plan view of the collapsed device showing how compact and portable it can be , without any loose parts . referring now to fig1 to 23 , the primary focus is on the clever and unusual yoke 18 that secures the umbrella 10 and shaft 15 to cane handle 16 , including an alternate embodiment for the umbrella shaft . in fig1 , the bottom of seat 20 shows the communicating hinges 50 and 52 and the placement of a u - shaped clip 54 to hold the long straight cylindrical leg 22 in the collapsed position . the location of yoke 18 on handle 16 is also shown . fig1 a shows a knob 110 that is spring loaded ( see 111 fig2 ) and used to tighten the gripping parts 112 and 114 to handle 16 . also molded into this yoke 18 is a socket 116 to hold the lower most end of the umbrella shaft 15 . the socket 116 is connected to a rotating mechanism with a button release 118 . another button 120 is used to release the handle 16 so that the yoke mechanism can rotate 360 degrees in the direction of arrow f . fig1 illustrates the rotation of yoke 18 and the attached umbrella 10 to a position that is perpendicular to handle 16 . fig1 shows the rotation of yoke 18 and the attached umbrella 10 to a position that is parallel with the straight cylindrical leg 22 in a fully collapsed position . fig1 , 17 and 18 show that by pressing a spring biased button or nipple 120 located at the upper most end of leg 22 and protruding through an engaging cavity on cane handle 16 , it allows handle 16 to rotate yoke 18 a total of approximately 180 degrees from the raised position in fig1 to the collapsed position in fig1 . thus , by depressing button 120 , the handle 16 which is an outer cylinder , covered by a rubber gripping surface 17 , is released and free to rotate 360 degrees around the inner , upper most tubular end of the straight cylindrical leg 22 . another embodiment of the yoke clamp is shown in fig2 to 23 show a fixed handle that allows the yoke clamp 18 to do the work of raising and lowering the umbrella . fig1 shows the function of button 118 , which is attached to socket 116 that receives the lower most end 120 of the flexible metal tubing 14 . when button 118 is pressed inward , it releases a locking mechanism that holds the umbrella shaft in a given position . thus , when button 118 is engaged , the yoke and attached umbrella can be rotated 180 degrees to the left in the direction of arrow g or 180 degrees to the right in the direction of arrow h . umbrella rotation can be stopped at any position along the 180 degree rotation arc because of there are notches in increments . and fig2 shows how yoke 18 is clamped to handle 16 . when knob 110 is turned in a tightening direction according to arrow j , the clamping jaws 112 and 114 are moved in the direction of arrow k . rotating knob 110 clockwise can move gripping part 112 and 114 against one another compressing spring 111 there between . rotating knob 110 counterclockwise reverses the operation and loosens the clamp portion 112 , 114 and allows rotation about or around handle 16 . fig2 to 23 show an alternate embodiment of the yoke 18 wherein the rotating mechanism controlled by button 118 ( shown in fig1 and 20 ) is replaced by a stationary female socket - like connection 216 with cavities 211 and 215 . the female socket - like connection can receive a male connection 218 attached to the lower most end of the flexible metal tubing 14 on the umbrella shaft 15 ( not shown ). a nipple 217 on male connection 218 can be a spring - biased protrusion that can be retracted under pressure and permitted to protrude and snap into a cavity such as , 211 and 215 when pressure is released . fig2 shows male connection 218 with nipple 217 snapped into female socket - like connection 216 at cavity 211 to position the umbrella shaft 15 ( not shown ) in an upward vertical position . fig2 shows male connection 218 with nipple 21 snapped into female socket - like connection 216 at cavity 215 to position the umbrella shaft 15 ( not shown ) in a downward vertical position . fig2 is a perspective view of the collapsed seating device of the present invention highlighting the position of the telescoping section 300 of the lower most end of the leg assemblies 22 , 24 , 26 . fig2 a shows an outer hollow tubular section held by an upper band 72 with an opposing rubber end cap 70 . the outer tubular section having a series of cavities or openings 75 is positioned over a slightly smaller hollow tubular section having a spring - biased nipple 74 that is retracted under pressure and allowed to protrude and snap into the cavity or opening 75 thereby extending or shortening the length of each leg in increments , as desired in the direction of arrow m . the telescoping function of each leg is not a limitation of the present invention and can be accomplished by a variety of means , such as disclosed in u . s . pat . nos . 6 , 135 , 557 and 6 , 467 , 843 b1 and incorporated herein by reference the overall vertical dimensions of the legs of the seating device are approximately 18 inches in height from a ground surface to the bottom of the seat 20 when fully retracted . the k - shaped legs are also approximately 18 inches in height from a ground surface to the bottom of the seat 20 when fully retracted . the incremental telescoping adjustments can be used to increase the length of each leg from approximately 1 inch up to approximately 6 inches in 1 inch increments for a total overall increase of 6 inches in height above a ground surface to the bottom of the seat 20 . thus , as can be recognized , any reasonable seating height can be selected , if desired , the seating height can be quite low to the ground , e . g ., for a child &# 39 ; s chair , or alternatively , a larger seating height can be provided for a tall person &# 39 ; s chair . in the preferred embodiment of the present invention , the telescoping legs are comprised of aluminum , due to its superior weight / strength characteristics , ease of fabrication and formation of the final product , and high resistance to atmospheric corrosion . aluminum requires no protective coating to prevent corrosion , thereby providing a long lasting seating device especially suited for outdoor use . fig2 depicts a person 500 using the left hand to grip handle 16 with the seat 20 facing away from the body and the seating device being used as a walking support or cane . it is appreciated that the seating device of the present invention has no loose parts . there is nothing to leave behind , nothing to unscrew , nothing to lose or forget . the seating device is of lightweight construction and weighs approximately six pounds , including the detachable cushion for the seat 20 , making it ideal for recreational activities such as , camping , hunting , fishing , spectator sports , including baseball , golf tournaments , parades and waiting in line at amusement parks . indoors and outdoors it can be used as a cane or footrest . further , the ease of set - up and collapsible folding provides a comfortable , durable , portable seating device . while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended .	0
in the following , embodiments of the present invention will be described . in the following embodiments , descriptions will be made with reference to an image stabilization apparatus equipped in a binocular . however , it should be understood that the present invention may also be applied to other optical apparatus . for example , the invention may be applied to a monocular apparatus such as a telescope etc . first , a description will be made of a binocular equipped with an image stabilization apparatus as a first embodiment of the present invention . referring to fig1 and fig2 a , the binocular equipped with an image stabilization apparatus according to the embodiment has a binocular optical system 10 , a housing 1 accommodating the binocular optical system , and an image stabilization apparatus 100 . the image stabilization apparatus 100 is adapted to detect vibration generated during use of the binocular , such as vibration applied to the housing 1 due to hand shake , and to suppress such vibration . as shown in fig1 , the binocular optical system 10 includes an objective optical system 11 , an eyepiece optical system 13 , an intermediate optical system 12 disposed between the objective optical system 11 and the eyepiece optical system 13 . as illustrated in fig1 and 3 , the objective optical system 11 includes objective lenses 11 r and 11 l . as shown in fig1 and 5 , the eyepiece optical system 13 includes eyepiece barrels 101 r and 101 l and eyepiece lenses 13 r and 13 l . the intermediate optical system 12 functions to direct a light flux from the objective optical system 11 to the eyepiece optical system 13 . the intermediate optical system 12 is provided for performing , when vibration occurs in the binocular , optical compensation to prevent an object from disappearing out of the field of view . in this embodiment , the intermediate optical system 12 includes erecting prisms 12 r and 12 l . the image stabilization apparatus 100 has a gimbal mechanism 110 . the gimbal mechanism 110 includes an outer gimbaled member 111 having a rotation axis parallel to x - axis and an inner gimbaled member 112 having a rotation axis parallel to y - axis . the inner gimbaled member 112 is supported by rotation shaft 112 a in such a way as to be rotatable relative to the outer gimbaled member 111 . the outer gimbaled member 111 is supported by rotation shaft 111 a in such a way as to be rotatable relative to the housing 1 . the inner gimbaled member 112 holds the erecting prisms 12 r and 12 l between two plate members 112 b and 112 c . the plate members 112 b and 112 c have openings 112 d and 112 e respectively at the positions of the left and right optical paths . with the above - described structure , when vibration or panning / tilting of the housing 1 occurs , the gimbaled members 111 and 112 are rotated relative to the housing respectively by inertial force so that the direction of the optical axes of the erecting prisms 12 r and 12 l would be kept unchanged with respect to the inertial system ( i . e . with respect to the earth ). on the outer gimbaled member 111 , there is mounted an angular velocity detector 121 for detecting the angular velocity ωx of the rotational movement about the rotation axis 111 a parallel to x - axis . on the inner gimbaled member 112 , there is mounted an angular velocity detector 122 for detecting the angular velocity ωy of the rotational movement about the rotation axis 112 a parallel to y - axis . each of the angular velocity detectors 121 and 122 may be composed , for example , of a piezoelectric vibration gyro sensor . in addition , an angular displacement detector 141 for detecting an angular displacement amount ( i . e . a change in the angular position ) θx caused by the rotation is attached to the rotation shaft 111 a for rotation about the axis parallel to x - axis . furthermore , an actuator 131 for rotationally driving the rotation shaft 111 a that has been rotationally displaced in the rotational direction for returning the rotation axis 111 a is also attached to the rotation shaft 111 a . similarly , to the rotation axis 112 a for rotation about the axis parallel to y - axis , there is attached an angular displacement detector 142 for detecting an angular displacement amount θy caused by the rotation and an actuator 132 for rotationally driving the rotation shaft 112 a that has been rotationally displaced in the rotational direction for returning the rotation axis 112 a . thus , the angular displacement of the rotation of the outer and inner gimbaled members 111 and 112 about axes parallel to x - axis and y - axis can be detected based on outputs of the angular displacement detectors 141 and 142 . the directions of rotational drive by the actuators 131 and 132 are such directions with which the optical axis of the erecting prism 12 r and 12 l mounted on the gimbaled member 111 and 112 that have been rotated by inertial force would be restored to the original position ( i . e . the optical axis of the objective optical system 11 ). each of the actuators 131 and 132 may include , for example , a servo mechanism . each of the angular displacement detectors 141 and 142 may include a rotary encoder . as shown in fig4 , the image stabilization apparatus 100 is further provided with a button 251 for turning on / off the vibration reduction function disposed on the top surface of the housing 1 , a sound generator 254 and a battery box 108 . in addition , as shown in fig5 , the image stabilization apparatus 100 is provided with a switch 107 for switching a navigation display disposed on the front surface of the housing 1 and a mode setting dial 105 . furthermore , referring to fig6 , the image stabilization apparatus 100 has a cpu ( central processing unit ) 601 , an amplifier section 602 , an a / d converter 603 , a reference value storing section 604 , a d / a converter 605 and a calculator section 606 . the control system as described above is accommodated in the interior of the housing 1 . the image stabilization apparatus 100 is further provided with a display within the field of view 201 disposed within the field of view of either one of the eyepiece lenses 13 r and 13 l . in addition , a display 109 and a focus knob 106 are also provided on the front side surface of the housing 1 . the mode setting dial 105 is a dial type switch used for selecting the vibration reduction mode of the image stabilization apparatus 100 . the apparatus according to this embodiment has two vibration reduction modes ( mode vr 1 and mode vr 2 ) and an automatic mode for switching the mode vr 1 and the mode vr 2 automatically . while the apparatus according to this embodiment is described to have two modes vr 1 and vr 2 by way of example , the apparatus may be adapted to have more than two modes to be switched . the mode vr 1 is a mode that is suitable for stabilizing the image at the occasion of performing observation on a steady ground or observation which involves frequent panning and tilting operations ( e . g . at the time of bird watching ). on the other hand , the mode vr 2 is a mode suitable for stabilizing the image at the occasion of performing observation on a swinging or wavering board of a conveyance ( e . g . a ship , a vehicle , an airplane or a helicopter etc .). the mode setting dial 105 has five positions to be switched , that is , “ power - off ” position 1051 , “ power - on ( vr auto : auto vibration reduction )” position 1052 , “ vr 1 ” position 1053 , “ vr 2 ” position 1054 and “ shift ” position 1055 . when the mode setting dial 105 is set to the “ power - off ” position 1051 , power supply from the battery box 108 to each section of the image stabilization apparatus 100 is turned off and disabled , so that the gimbal mechanism 110 is placed into a locked state in which the gimbal mechanism 110 is maintained at the position of the center of the optical axis without angular displacement . under this state , the binocular behaves as an ordinary binocular that is not provided with a vibration reduction function . when the mode setting dial 105 is set to the “ power - on ( vr auto )” position 1052 , the image stabilization apparatus 100 is turned on , and the vibration reduction mode is set to the automatic switching mode . when the mode setting dial 105 is set to the “ vr 1 ” position 1053 or the “ vr 2 ” position 1054 , the vibration reduction mode is set to the vibration reduction mode vr 1 or vr 2 respectively . the operation under the dial setting to the “ shift ” position 1055 will be described later . in the following , functions characterizing the present invention will be specifically described . as shown in fig1 , the display within the field of view 201 is composed , for example , of an led or other elements , and it is disposed in the field of view 200 of either one of the eyepiece lenses 13 r and 13 l . under the state in which a vibration reduction mode is selected by setting of the mode setting dial 105 to the “ vr 1 ” position 1053 or the “ vr 2 ” position , if it is determined , based on the level or degree of the external vibration actually applied to the housing 1 , that the selected mode is not the optimal mode , the display in the field of view 201 indicates with red light . this prompts the user to change the mode selected by the mode setting dial 105 to another mode . such a prompting function for changing the mode is referred to in this embodiment as a vibration reduction mode navigation function . referring to fig9 , a navigation display changing switch 107 has multiple positions to be switched , namely , a “ navi - off ” position 901 , an eye - mark position 902 and an ear - mark position 903 . when the navigation display changing switch 107 is set to the eye - mark position 902 , the prompt for changing the vibration reduction mode is performed by means of the display within the field of view 201 . on the other hand , when the navigation display changing switch 107 is set to the ear - mark position 903 , the indication by the display within the field of view 201 is not performed , but prompt for changing the vibration reduction mode is performed by beep sound or voice sound for prompting mode change generated by the sound generator 254 . when the beep sound is used , its sound duration time or its frequency may be modulated in accordance with the vibration reduction mode . when the navigation display changing switch is set to the “ navi off ” position 901 , the vibration reduction mode navigation function is disabled . the vibration reduction on / off button 251 is enabled when the mode setting dial 105 is set to either one of the “ power - on ( vr auto )” position 1052 , the “ vr 1 ” position 1053 , the “ vr 2 ” position 1054 or the “ shift ” position 1055 . when the mode setting dial 105 is set to either one of the “ power - on ( vr auto )” position 1052 , the “ vr 1 ” position 1053 or the “ vr 2 ” position 1054 , the state in which the vibration reduction mode is disabled and the state in which the vibration reduction mode is enabled are alternately switched by manipulation of the vibration reduction on / off button . under the state in which the vibration reduction mode is disabled , the gimbal mechanism 110 is placed in the locked state in which the gimbal mechanism is positioned at the original position without angular displacement . under the state in which the vibration reduction mode is enabled , the vibration reduction mode corresponding to the setting of the mode setting dial 105 ( i . e . either one of the auto switching mode , the vr 1 mode or the vr 2 mode ) is enabled . therefore , during observation under the vibration reduction mode ( i . e . either one of the auto switching mode , the vr 1 mode or the vr 2 mode ), the vibration reduction on / off button is useful for the user , when the user wants to disable the vibration reduction mode to lock the gimbal mechanism instantaneously for power saving or other reasons . on the other hand , when the mode setting dial 105 is set to the “ shift ” position 1055 , the vibration reduction mode is alternately switched between vr 1 and vr 2 by manipulation of the vibration reduction on / off button 251 . therefore , during observation under the mode vr 2 , the mode setting dial 105 may be set to the “ shift ” position in preparation for panning and tilting operation for following up an object such as a bird or an airplane that may possibly comes within the field of view , so that the vibration reduction mode can be changed to the mode vr 2 by manipulating ( or pressing ) the vibration reduction of / off button 251 . in connection with this , when the mode setting dial 105 is set to the “ shift ” position 1055 , the automatic vibration reduction mode change and the information by the display within the field of view 201 will not be enabled . the above - described navigation function is so adapted to prompt the user to change the vibration reduction mode selected by the mode setting dial 105 into another mode . however , it may be modified to inform the user of the optimal mode determined by the external vibration level actually applied to the housing 1 . if the function is so modified , the user can know the optimal mode determined by the apparatus , and therefore the user can be aware of the difference between the optimal mode and the mode selected by the user . in addition , if the mode selected by the user is also displayed together with the optimal mode determined by the apparatus , the user can recognize the difference in the modes easily . next , in the following , control operations by the cpu 601 of the image stabilization apparatus will be described . the cpu 601 reads a program stored in the reference value storing section 604 upon turning - on of the power supply and executes the program to operate in the manner described in the flow chart presented in fig8 . first , in step 801 , the cpu 601 receives , via the a / d converter 603 , signals vωx and vωy that have been obtained by amplifying angular velocity ωx and ωy detected by the angular velocity detector 121 and 122 by a predetermined gain in the amplifier section 602 . in addition , the cpu 601 also receives via the a / d converter 603 , signals vθx and vθy that have been obtained by amplifying angular displacement amounts θx and θy detected by the angular displacement detectors 141 and 142 by a predetermined gain by the amplifier section 602 . next in step 802 , the cpu 601 compares the received angular velocity signals vωx and vωy with reference angular velocity values ± vc 1 stored in the reference value storing section 604 in advance respectively . in addition , the cpu 601 compares the received angular displacement amount signals vθx and vθy with reference angular displacement values ± vc 2 stored in the reference value storing section 604 in advance respectively . based on the above - mentioned comparison , the cpu 601 determines whether the optimal mode is the mode vr 1 or the mode vr 2 . in the apparatus according to this embodiment , the angular velocity signals vωx and vωy are used as information for detecting vibration caused by conveyance . specifically , as will be seen from fig1 a , if at least one of the angular velocity signals vωx and vωy becomes larger than + vc 1 or smaller than − vc 1 , it is determined that the user is on a conveyance and so the mode vr 2 is appropriate . in addition , in order not to mistakenly interpret angular velocity signals vωx and vωy corresponding to an user &# 39 ; s unintentional action as those corresponding to vibration of a conveyance , a sampling time ts is set in the apparatus according to this embodiment as shown in fig1 a . if the state in which at least one of the angular velocity signals vωx and vωy becomes larger than + vc 1 or smaller than − vc 1 occurs more than once during the sampling time ts , it is determined that the optimal mode is the mode vr 2 . on the other hand , the angular displacement amount signals vθx and vθy are used as information for detecting panning and tilting operations . specifically , as will be seen from fig1 b , if at least one of the angular displacement amount signals vθx and vθy becomes larger than + vc 2 or smaller than − vc 2 , it is determined that the user is performing a panning or tilting operation and so the mode vr 1 is appropriate . as in the case of the angular velocity signals , in order to prevent erroneous interpretation of output corresponding to an user &# 39 ; s unintentional action , if the state in which at least one of the angular displacement amount signals vθx and vθy becomes larger than + vc 1 or smaller than − vc 2 occurs more than once during the sampling time ts , it is determined that the optimal mode is the mode vr 1 . in the case in which the determination of the optimal mode conflicts between vr 1 and vr 2 ( for example , when a user on a conveyance is performing panning or tilting operation ), in other words , in the case in which at least one of vωx and vωy becomes larger than + vc 1 or smaller than − vc 1 more than once within the sampling time ts and at least one of vθx and vθy becomes larger than + vc 2 or smaller than − vc 2 more than once within the sampling time ts , it is determined in the apparatus according to this embodiment that the mode vr 1 for panning / tilting is the optimal mode . the above - described criteria in step 802 are summarized as follows : ( 1 ) when during the sampling time ts , both vωx and vωy are within the range larger than − vc 1 and smaller than + vc 1 ( or deviate from this range only once ) and at least one of vθx and vθy becomes smaller than − vc 2 or larger than + vc 2 more than once , it is determined that the optimal mode is the mode vr 1 ; ( 2 ) when during the sampling time ts , both vωx and vωy are within the range larger than − vc 1 and smaller than + vc 1 ( or deviate from this range only once ) and both vθx and vθy are within the range larger than − vc 2 and smaller than + vc 2 ( or deviate from this range only once ), it is determined that the optimal mode is the mode vr 2 ; ( 3 ) when during the sampling time ts , at least one of vωx and vωy becomes smaller than − vc 1 or larger than + vc 1 more than once and at least one of v θx and vθy becomes smaller than − vc 2 or larger than + vc 2 more than once , it is determined that the optimal mode is the mode vr 1 ; and ( 4 ) when during the sampling time ts , at least one of vωx and vωy becomes smaller than − vc 1 or larger than + vc 1 more than once and both vθx and vθy are within the range larger than − vc 2 and smaller than + vc 2 ( or deviate from this range only once ), it is determined that the optimal mode is the mode vr 2 as per the above , in step 802 , it is possible to determine the vibration reduction mode vr 1 or vr 2 that is optimal to the vibration level applied to the binocular , by comparing the angular velocity signals vωx and vωy and angular displacement amount signals vθx and vθy with the reference values ± vc 1 and ± vc 2 respectively . next in step 803 , the cpu 601 reads to which position 1052 to 1055 the mode setting dial 105 is set . when the mode setting dial 105 is set to the “ power - on ( vr auto )” position 1052 , which means that automatic switching of the vibration reduction mode is selected , the process proceeds to step 804 . in step 804 , the cpu 601 controls to create outputs for causing the actuators 131 and 132 to rotationally drive the rotation shafts 111 a and 111 b of the gimbal mechanism 110 in accordance with the optimal vibration mode vr 1 or vr 2 determined in step 802 . specifically , in step 804 , if the vibration mode determined in step 802 is the mode vr 1 , the cpu 601 controls to amplify the angular velocity signals vωx and vωy at a predetermined gain α 1 and to amplify the angular displacement amount signals vθx and vθy at a predetermined gain 11 and to output them . the output signals α 1 × vωx , α 1 × vωy , β 1 × vθx and β 1 × v θy are converted by the d / a converter 605 into analog signals and then input to the calculation section 606 . the calculation section 606 performs predetermined calculation processing such as addition or integration on the output α 1 × vωx and the output β 1 × vθx and outputs the results to the actuator 131 for rotationally driving the rotation shaft 111 a about x - axis . thus , the actuator 131 rotationally drives the rotation shaft 111 a with a driving voltage reflecting the outputs of the angular velocity signal vωx and the angular displacement amount signal vθx so as to rotate the outer gimbaled member 111 in the direction for bringing the optical axis of the erecting prism 12 r and 12 l closer to the original position ( i . e . the optical axis of the objective optical system 11 ). in addition , the calculation section 606 also performs calculation processing such as addition or integration on the output α 1 × vωy and the output β 1 × vθy and outputs the results to the actuator 132 for rotationally driving the rotation shaft 112 a about y - axis . thus , the actuator 132 rotationally drives the rotation shaft 112 a with a driving voltage reflecting the outputs of the angular velocity signal vωy and the angular displacement amount signal vθy so as to rotate the inner gimbaled member 112 in the direction for bringing the optical axis of the erecting prism 12 r and 12 l closer to the original position ( i . e . the optical axis of the objective optical system 11 ). on the other hand , in the case in which the vibration reduction mode determined in step 802 is vr 2 , the cpu 601 also controls in step 804 to amplify the angular velocity signals vωx and vωy and the angular displacement amount signals vθx and vθy so as to output them , but the amplification is performed at gains α 2 and β 2 respectively . while gains α 1 and β 1 are predetermined values for realizing the vibration mode vr 1 that is suitable for panning and tilting operations , gains α 2 and β 2 are predetermined values for realizing the vibration reduction mode vr 2 that is suitable for the vibration of a conveyance . the gains α 1 and β 1 in the mode vr 1 are set in such a way that the gimbal mechanism 110 is restrained to the original position more strongly than in the mode vr 2 . in other words , the gains α 1 and β 1 for the mode vr 1 are so set that the field of view follows the movement of the housing upon panning and tilting operations . on the other hand , the gains α 2 and β 2 in the mode vr 2 are set in such a way that the restraint of the gimbal mechanism 110 to the original position is weaker than in the mode vr 1 . in other words , the gains α 2 and β 2 in the mode vr 2 are so set that the field of view is kept as constant ( or steady ) as possible relative to the inertial system ( i . e . relative to the earth ) even if the binocular vibrates due to vibration of a conveyance . specifically , the ratio of the gain α 1 for the angular velocity signal to the gain β 1 for the angular displacement amount signal in the mode vr 1 is made larger than the ratio of the gain α 2 for the angular velocity signal to the gain β 2 for the angular displacement amount signal in the mode vr 2 . as per the above , the automatic switching of the vibration reduction mode between vr 1 and vr 2 is realized in step 804 . on the other hand , when it is turned out in step 803 that the mode setting dial 105 is set to the “ vr 1 ” position 1053 or the “ vr 2 ” position 1054 , the process proceeds to step 805 . in step 805 , it is further determined whether the mode setting dial 105 is in the “ vr 1 ” position 1053 or in the “ vr 2 ” position 1054 . when it is determined that the mode setting dial 105 is in the “ vr 1 ” position 1053 , the process proceeds to step 806 . in step 806 , it is determined whether or not the optimal vibration reduction mode determined in step 802 is identical to the mode vr 1 set by the mode setting dial 105 . if they are not identical , the process proceeds to step 807 , in which information for prompting mode change is presented to the user , since the currently set vibration reduction mode is not appropriate . the way of informing the user is pursuant to the setting by the navigation information changing switch 107 . specifically , when the eye - mark position 902 is selected , the led in the display within the field of view 201 is turned on in red , while when the ear - mark position 903 is selected , a beep sound or a voice sound is generated from the sound generator 254 , and then the process proceeds to step 808 . in connection with this , when the navigation information changing switch 107 is set to the “ navi off ” position 901 , the information is not presented and the process proceeds to step 808 . in the process shown in the flow chart of fig8 , it is determined in step 806 whether or not the optimal vibration reduction mode determined in step 802 is identical to the mode set by the user , which is determined in step 805 . however , as described before , in the present invention the process may be modified in such a way as to inform the user of the optimal vibration reduction mode determined in step 802 . in that case , step 806 for determining whether or not the optimal vibration reduction mode determined in step 802 is identical to the mode set by the user is not necessary ( i . e . can be omitted ). therefore , the information made in step 807 will be information on the optimal vibration reduction mode determined in step 802 . in step 808 , in order to realize the mode vr 1 , the cpu 601 controls to amplify the angular velocity signals vωx and vωy at a predetermined gain α 1 and to amplify the angular displacement amount signals v θx and vθy at a predetermined gain β 1 and to output them in like manner as in step 804 . thus , the actuators 131 and 132 rotationally drive the rotation shafts 111 a and 112 a respectively with driving voltages reflecting the outputs of the angular velocity signals and the angular displacement amount signals so as to realize the vibration reduction mode vr 1 . in step 808 , the vibration reduction mode is switched to the optimal vibration reduction mode determined in step 802 automatically . however , in the present invention , whether or not the mode suggested by the information in step 807 is to be selected may be left to user &# 39 ; s discretion . in that case , step 808 is not necessary ( i . e . can be omitted ). therefore , if the user considers that observation under the mode selected by himself or herself is satisfactory , the user can continue the observation while maintaining the current mode without following the information . in addition , even if the user considers that observation under the current mode selected by himself or herself is satisfactory , the user can change the mode once when a mode different from the currently selected mode is suggested by the information and if the suggested mode provides better observation , the user would observe with the suggested mode . if the user finds , after changing the mode to the suggested mode , that observation under the mode selected by himself or herself is more preferable for him or her than observation under the suggested mode , the user would change the mode from the suggested mode to the mode previously selected by the user again . as per the above , the present invention can provide an apparatus that reflects user &# 39 ; s intention or taste to a greater degree . after the above - described steps , the process proceeds to step 812 , in which the cpu 601 detects whether or not the vibration reduction on / off button 251 has been manipulated within a predetermined time . when it is detected that the vibration reduction of / off button has been manipulated , the process proceeds to step 813 , in which the cpu 601 outputs a signal for commanding the actuators 131 and 132 to return the rotation shafts 111 a and 112 a to the original positions and to maintain ( or lock ) them at that state . that signal is sent to the actuators 131 and 132 via the d / a converter 605 , the calculation section 606 , and the actuators 131 and 132 return the rotation shafts 111 a and 112 a to their original positions to maintain ( or lock ) them in that state . thus , the gimbal mechanism 110 of the image stabilization apparatus 100 will not rotate from the original position , and therefore the binocular behaves as an ordinary binocular that does not have a vibration reduction function . the locking of the rotation shafts 111 a and 112 a is maintained until it is detected that the vibration reduction on / off button 251 is manipulated ( or pressed ) again . if it is determined in step 814 that the vibration reduction on / off button 251 is pressed again and the locking is released , or if it is determined in step 812 that the vibration reduction on / off button 251 has not been manipulated , the process returns to step 801 . referring back to step 805 , if it is determined in step 805 that the mode setting dial 105 is in the “ vr 2 ” position 1054 , the process proceeds to step 809 . in step 809 , it is determined whether or not the optimal vibration reduction mode determined in step 802 is identical to the mode vr 2 set by the mode setting dial 105 . if they are not identical , the process proceeds to step 810 , in which information for prompting mode change is presented to the user in like manner as in step 807 , since the currently set vibration reduction mode is not appropriate . as described before , the process may be modified in such a way as to inform the user of the optimal vibration reduction mode that is determined in step 802 . in that case , step 809 for determining whether or not the optimal vibration reduction mode determined in step 802 is identical to the mode set by the user determined in step 805 is not necessary ( i . e . can be omitted ). therefore , step 809 and step 810 are not necessary , and information of the optimal vibration reduction mode determined in step 802 is made only in step 807 . then the process proceeds to step 811 . in step 811 , in order to realize the mode vr 2 , the cpu 601 controls to amplify the angular velocity signals vωx and vωy at a predetermined gain α 2 and to amplify the angular displacement amount signals vθx and vθy at a predetermined gain 2 and to output them in like manner as in step 804 . thus , the actuators 131 and 132 rotationally drive the rotation shafts 111 a and 112 a respectively with driving voltages reflecting the outputs of the angular velocity signals and the angular displacement amount signals so as to realize the vibration reduction mode vr 2 . after that , the process proceeds to step 812 . as described before , whether or not the mode suggested by the information in step 810 is to be selected may be left to user &# 39 ; s discretion . in that case , step 810 is not necessary ( i . e . can be omitted ). referring back to step 803 , if the mode setting dial 105 is set to the “ shift ” position 1055 , the process proceeds to step 815 . in step 815 , it is determined whether the vibration reduction on / off button 251 has been manipulated ( or pressed ) within a predetermined time . in the state in which the mode setting dial 105 is set to the “ shift ” position , the vibration reduction mode is switched between vr 1 and vr 2 automatically . therefore , if it is determined in step 815 that the vibration reduction on / off button 251 has not been pressed , the process proceeds to step 816 , and in order to realize the vibration reduction mode same as the previously set mode , which is assumed here to be the mode vr 1 for example , if the mode set in the latest step 816 is vr 1 , the cpu 601 controls to amplify the angular velocity signals vωx and vωy at a predetermined gain α 1 and to amplify the angular displacement amount signals vθx and vθy at a predetermined gain β 1 and to output them . on the other hand , if it is determined in step 815 that the vibration reduction on / off button 251 has been pressed , the process proceeds to step 816 , and in order to realize the vibration reduction mode different from the previously set mode ( i . e . in order to realize the mode vr 2 , if the mode set in the latest step 816 is vr 1 ,), the cpu 601 controls to amplify the angular velocity signals vωx and vωy at a predetermined gain α 2 and to amplify the angular displacement amount signals vθx and vθy at a predetermined gain β 2 and to output them . thus , the actuators 131 and 132 rotationally drive the rotation shafts 111 a and 112 a so as to realize vibration reduction mode vr 1 or vr 2 . as per the above , in the binocular having the image stabilization apparatus 100 according to this embodiment , it is possible to realize a mode with which vibration reduction mode is automatically switched in accordance with the level or degree of vibration of the binocular . under this automatic mode , it is possible , by setting a sampling time ts , to distinguish movement of the binocular caused unintentionally by the user from intentional panning / tilting operations or vibration caused by conveyance . in addition , even if there is a time lag between detection of the angular velocity of the gimbal mechanism and detection of the angular displacement amount of the gimbal mechanism , it is possible to determine the optimal vibration reduction mode . in addition , when a vibration reduction mode is set by a user at his or her will , the apparatus can inform the user whether that mode is the optimal vibration reduction mode or not , based on the above - described determination of the optimal vibration reduction mode , to prompt the user to change the vibration reduction mode to the optimal mode . in this way , the user can notice whether or not the vibration reduction mode selected by him or her is appropriate , and even inexperienced user can appropriately select the mode . therefore , it is possible to bring out the performance of the image stabilization apparatus fully . in the apparatus according to the above - described embodiment , the optimal vibration reduction mode is determined based on whether the angular velocity signal or the angular displacement amount signal deviates from a reference range more than once within the sampling time ts . however , the frequency criterion is not limited to “ more than once ”, but it may also be “ more than twice ” or other desirable frequency . in steps 804 , 808 , 811 and 816 in fig8 , the gains are varied in accordance with the vibration reduction mode in order to realize modes vr 1 and vr 2 . but the apparatus may be modified in such a way that the modes vr 1 and vr 2 are realized not only by varying the gains but by performing calculation or other processing that is predetermined for each mode . next , as a second embodiment , an apparatus in which a modification is made to the displayed mark that appears , in accordance with the informing process of steps 807 and 810 , in the display 201 within the field of view 200 in the apparatus according to the first embodiment is modified . in the second embodiment , as shown in fig1 , a display within the field of view 200 includes a display 203 indicating an upward red triangle mark , a display 204 indicating a downward red triangle mark and a display 202 disposed between these displays indicating a green circular mark . these displays can be realized by leds or other devices . on the upper surface of a housing 1 of the binocular , as shown in fig1 , there is provided vibration reduction mode changing buttons 104 a and 104 b having the shapes corresponding to the shapes of the marks of the displays 203 and 204 . the button 104 a is to be operated upon changing the vibration reduction mode to mode vr 2 when the currently set mode is mode vr 1 , while the button 104 b is to be operated upon changing the vibration reduction mode to mode vr 1 when the currently set mode is mode vr 2 . when in step 807 ( in the process shown in the flow chart of fig8 ) the currently set mode vr 1 is not the optimal mode , the cpu 601 causes the upward triangle mark of the display within the field of view 203 to be turned on in red . if the user presses the changing button 104 a of the same shape in response to the turned - on mark , the cpu 601 causes the circular mark of the display within the field of view 202 to be turned on in green , and the process proceeds to step 811 , in which the process for the vibration reduction mode vr 2 ( that is the mode set after the mode change ) is performed . on the other hand , if the user does not press the changing button 104 a of the same shape in step 807 , the process proceeds to step 808 , in which the process for the vibration reduction mode vr 1 is continued without a mode change . similarly , when in step 810 the currently set mode vr 2 is not the optimal mode , the cpu 601 causes the downward triangle mark of the display within the field of view 204 to be turned on in red . if the user presses the changing button 104 b of the same shape in response to the turned - on mark , the cpu 601 causes the circular mark of the display within the field of view 202 to be turned on in green , and the process proceeds to step 808 , in which the process for the vibration reduction mode vr 1 ( that is the mode set after the mode change ) is performed . on the other hand , if the user does not press the changing button 104 b of the same shape in step 810 , the process proceeds to step 811 , in which the process for the vibration reduction mode vr 2 is continued without a mode change . the binocular provided with the image stabilization apparatus according to the second embodiment having the above - described structure realizes an advantageous effect that the user can change the vibration reduction mode to select the optimal mode by operating the button 104 a or 104 b by a finger in accordance with a figure indicated in the display within the field of view during observation without detaching the eyes from the eyepiece lenses 13 r and 13 l . in the process of providing information on the optimal mode determined in step 802 , the information may be provided by visual displays or sounds specific to the respective modes that are different from each other . it is preferable that the mode selected by user be indicated in the field of view to inform the user of the mode . when both the mode selected by the user and the optimal mode determined in step 802 are displayed , the user can conveniently recognize the difference between those modes at sight . the displays within the field of view 203 and 204 may be composed of leds or other elements that can emit a color light selected from more than two color lights . in that case , the comparison of the angular velocity signal and the angular displacement amount signal with the reference ranges may be arranged in such a way that the degrees of deviations of those signals from the respective reference ranges are classified into two or more levels . thus , in the process of informing the user in steps 807 and 810 , those levels ( or degrees ) of the deviation are represented by corresponding colors of light . for example , when the degree of the deviation is relatively low , the displays within the field of view 203 and 204 are caused to emit yellow light , while when the degree of the deviation is relatively high , the displays 203 and 204 are caused to emit red light . thus , the user can make a decision on the vibration reduction mode in a customized way in accordance with his or her intention , for example , in such a way as to change the vibration reduction mode only when the degree of the deviation is high . therefore , it is possible to enlarge the variety of use for user of the binocular . the apparatus according to the above - described embodiment has two vibration reduction modes ( vr 1 , vr 2 ), but the present invention is also applicable to more than two vibration reduction modes ( vr 1 , vr 2 , vr 3 , . . . , vrn ). the apparatus according to the above - described embodiment is provided with a gimbaled member on which prisms are mounted , angular velocity feedback control means and position feedback control means for controlling the position of the gimbaled member . however , the present invention is also applicable to other types of optical elements . for example , the present invention can be applied to an apparatus that uses a variable - angle prism for vibration reduction , which is composed of two glass plates and liquid having a high refractive index included between the glass plates in a sealed manner . ( the variable - angle prism itself has been already known , and described for example in japanese patent application laid - open nos . 10 - 319325 and 2000 - 10143 .) in that case , the present invention can be applied to an apparatus that has a variable - angle prism position detector that detects an inclination angle of one of the glass plates and a driving device such as a motor for driving that glass plate in a direction for correcting an inclination of the optical system based on the detection result . the present invention can be applied to various apparatus in which an inclination of the optical axis of an observation optical system having an erecting prism or other element is detected and the inclination is corrected based on a detection result . the apparatus according to the present invention may be provided with a mode selecting switch with which a user can select automatic mode switching and manual mode switching that allows the user to select desired mode . in this case , the user can select a desired mode at his or her will depending on circumstances and the user &# 39 ; s operation skill . as per the above , the present invention can provide an image stabilization apparatus having a good usability .	6
referring to fig1 , a continuous web printing press layout 10 includes a series of stations or printing towers 12 for printing different colors onto a moving web 14 . the web 14 is driven from a supply roll 15 on stand 16 onto a paper path that leads sequentially to print stations 12 . the four print stations define a print zone 18 in which ink is applied to the substrate . an optional dryer 17 may be placed after the final print station . after printing , the web is slit into sheets that are stacked at station 19 . for printing wide - format webs , such as newsprint , the print stations typically accommodates a web width of about 25 - 30 inches or more . a general layout for offset lithographic printing that can be adapted for ink - jet printing is further described in u . s . pat . no . 5 , 365 , 843 , the entire contents of which is hereby incorporated by reference . referring also to fig2 , each print station includes a print bar 24 . the print bar 24 is a mounting structure for printhead modules 30 which are arranged in an array and from which ink is ejected to render a desired image on the web 14 . the printhead modules 30 are mounted in print bar receptacles 21 such that the faces ( not shown in fig2 ) of the printhead modules from which ink is ejected are exposed from the lower surface of the print bar 24 . the printhead modules 30 can be arranged in an array to offset nozzle openings , thereby increasing print resolution or printing speed . in a printing condition , the print bar 24 is arranged above the web path to provide proper alignment and a uniform stand - off distance between the printhead modules 30 and the web 14 . the printhead modules 30 can be of various types , including piezoelectric drop on demand ink - jet printhead modules with arrays of small , finely spaced nozzle openings . examples of piezoelectric ink - jet printhead modules are described in hoisington u . s . pat . no . 5 , 265 , 315 ; fishbeck et al . u . s . pat . no . 4 , 825 , 227 ; hine u . s . pat . no . 4 , 937 , 598 ; bibl et al . u . s . patent application ser . no . 10 / 189 , 947 , entitled “ printhead ,” filed jul . 3 , 2002 , and chen et al . u . s . provisional patent application 60 / 510 , 459 , entitled “ printhead module with thin membrane ,” filed oct . 10 , 2003 , the entire contents all of which are hereby incorporated by reference . other types of printhead modules can be used , such as , for example , thermal ink - jet printhead modules in which heating of ink is used to effect ejection . continuous ink - jet heads , that rely on deflection of a continuous stream of ink drops can also be used . in a typical arrangement , the stand off distance between the web path and the print bar is between about 0 . 5 and one millimeter . in order to minimize drop placement errors , the printhead modules are accurately aligned relative to each other and relative to the web . in addition to having appropriate angular orientation , a properly aligned printhead module 30 has nozzles appropriately located with respect to three translational degrees of freedom relative to the web . these are represented by x -, y -, and z - positions in the cartesian co - ordinate system shown in fig2 . the web advances in the y - direction ( the process direction ) and the stand off distance corresponds to the nozzles &# 39 ; location along the z - axis . ideally , each nozzle is located at a nominal location from which a defect - free printhead module produces images with no drop placement errors . practically , however , printhead modules can be aligned with its nozzles within some range of their nominal locations and still provide adequate drop - placement accuracy . exact tolerances for printhead module alignment depend on the specific application , and can vary for different degrees of freedom . for example , in some embodiments , tolerances for x - axis placement should be smaller than z - and / or y - axis placement . for example , where nozzles from different printhead modules are interlaced to provide increased resolution , constraints on the relative alignment of printhead modules in the x - direction are more stringent that those in the y - and z - directions . in some embodiments , nozzles should be located within about 0 . 5 pixels ( e . g ., within about 0 . 2 pixels ) of their nominal locations in the x - direction , while alignment of the nozzles to within about 1 - 2 pixels of their nominal location in the y - direction can provide sufficient drop placement accuracy . in applications having 600 dpi resolution , for example , one pixel corresponds to about 40 microns . therefore , where an application demands alignment accuracy to within 0 . 5 pixels in one direction , a 600 dpi system should have its printhead modules aligned to within about 20 microns of their nominal positions . referring to fig3 a and fig3 b , in some embodiments , a print bar includes a frame 310 and other support elements 330 , 340 , and 350 . a number of openings 360 ( i . e ., 12 openings in the present embodiment ) are provided in frame 310 in which printhead modules 320 are mounted . also shown in fig3 a and 3b is inlet port 370 and outlet port 372 which couple to an ink supply ( not shown ). referring also to fig4 a , the edge of each opening 360 includes alignment datums 410 , 420 , and 430 , which form planar protrusions from opening edges 401 a and 401 b . in addition , frame 310 includes alignment datums 440 , 442 , and 444 that register frame 310 relative to neighboring frames or to other elements of the print bar . referring additionally to fig4 b , 4c , and 4 d , a printhead module 450 includes a printhead module frame 451 in which is mounted a nozzle plate 470 including a row of nozzles 475 . printhead module frame 451 includes alignment datums 455 , 460 , and 465 , which protrude from edges of printhead module frame 451 and each include a planar surface . when printhead module 450 is properly mounted in opening 360 , the planar surface of each of alignment datums 410 , 420 , and 430 in frame 310 contact corresponding planar surfaces of alignment datums 455 , 465 , and 460 on the printhead module . alignment datums 410 and 455 register printhead module 450 in the x - direction and alignment datums 420 , 430 , 460 and 465 register printhead module 450 in the y - direction . accordingly , once printhead module 450 is mounted in frame 310 with corresponding alignment datum surfaces in contact with one another , the printhead module is aligned relative to the frame in the x - direction and y - direction . assuming the frame is properly installed on the print bar , the printhead modules are ready for jetting without additional adjustment . the alignment datums provide accurate registration of the printhead module to the frame because distances between the planar surfaces of the printhead module alignment datums and the orifices are sufficiently close to a predetermined distance to accurately offset the orifices from the alignment datums of the frame . for example , referring specifically to fig4 d , an orifice 475 a is a predetermined distance x 475a from planar surface 455 a of alignment datum 455 . similarly , orifices 475 are a predetermined distance y 475 from a plane defined by surface 465 a of alignment datum 465 . accordingly , when printhead module 470 is mounted in the frame , orifice 475 a is offset a distance x 475a from surface 410 a of alignment datum 410 in the x - direction and a distance y 475 from surface 420 a from alignment datum 420 in the y - direction . when the locations of the frame alignment datums are made to similar accuracy , they allow accurate alignment of printhead modules relative to one another in the frame . similarly , accurate placement of the frame within the printing device aligns all the printhead modules in the frame relative to the substrate . the planar surfaces of the alignment datums ( also referred to as “ precision surfaces ”) should be sufficiently smooth to maintain accurate registration of the printhead module to the frame along an axis regardless of which portion of the planar surfaces of the printhead module alignment datums is in contact with the planar surfaces of corresponding frame alignment datums . in other words , the planar surfaces should be sufficiently smooth so that small shifts of the printhead module position in one direction , due to , e . g ., thermal expansion of the printhead module and / or frame , do not appreciably change the orientation of the nozzles or the location of the nozzles with respect to an orthogonal direction . typically , the printhead module frame is manufactured so that the planar surface portions of the alignment datums are smoother than adjacent portions of surfaces of the printhead module frame . this can reduce manufacturing time and complexity because , for a particular surface of the printhead module frame , only the alignment datum surfaces , which form only a portion of a printhead module surface , need to be manufactured to high accuracy . for example , for a printhead module having a surface extending for several centimeters or tens of centimeters in one direction , only a small fraction ( e . g ., a few millimeters ) of that surface needs to be precisely manufactured to provide the alignment datum . in some embodiments , the planar surfaces are prepared to have an arithmetical mean roughness ( r a ) of about 20 microns or less ( e . g ., about 15 microns or less , about 10 microns or less , about 5 microns or less ). the r a of a surface can be measured using a profilometer , such as an optical profilometer ( e . g ., wyko nt series profilometer , commercially available from veeco metrology group , tucson , ariz .) or a stylus profilometer ( e . g ., dektak 6m profilometer , commercially available from veeco metrology group , santa barbara , calif . ), for example . alignment datums can be made by placing a printhead module frame blank ( e . g ., a monolithic printhead module frame blank ) on a precision machining device ( e . g ., a dicing saw or a cnc mill ) and removing material from the printhead module frame blank to form the alignment datum . such manufacturing methods are particularly useful where at least one axis of the printhead module cannot easily be cost - effectively controlled using conventional manufacturing processes . alternatively , or additionally , an attachment including a precision surface can be bonded onto the printhead module frame . the frame can also be manufactured using a precision manufacturing process , such as wire electrical discharge machining ( edm ), jig grinding , laser cutting , computer numerical control ( cnc ) milling or chemical milling . the frame should be formed from a material that is rigid , sufficiently stable , and has a low thermal coefficient of expansion . for example , the frame can be formed from invar , stainless steel , or alumina . in the present embodiment , the jetting assemblies are aligned by slipping each into a corresponding opening such that the corresponding alignment datums contact each other . once a printhead module is inserted into a opening , it is clamped to the frame . in general , a clamp fastens a printhead module to a frame by pressing the printhead module against the frame or against an opposing portion of the clamp . typically , the clamp holds the printhead module in the frame until it is loosened or released . the type of clamp used to secure a printhead module can vary . one type of clamp that can be used is a c - clamp . in certain embodiments , clamps can be secured to the frame using adjustable fasteners ( e . g ., screws ). an example of a clamp is shown in fig5 a . clamp 530 secures a printhead module 520 in a opening 501 of a frame 510 . clamp 530 includes portions 532 which contact printhead module 520 and press the module against other portions of the clamp ( not shown in fig5 a ). clamp 530 is secured to frame 510 by a fastener 531 . when secured , alignment datums 521 , 522 , and 523 on printhead module 520 contact alignment datums 511 , 512 , and 513 on frame 510 , respectively , registering the printhead module with respect to the frame . frame 510 also includes openings 502 , 503 , and 504 , which are shown in fig5 a . in some embodiments , printhead modules can be clamped to the frame using one or more screws . the torque associated with screw tightening can be decoupled from the printhead module by providing an appropriate clamping element . an example of such a clamping element is a bracket as shown in fig5 b . printhead module 550 clamped to a frame 560 using a clamping bracket 570 . printhead module 550 includes alignment datum 551 that contacts corresponding alignment datum 561 on an edge of a opening in frame 560 . clamping bracket 570 is secured to frame 560 using a screw 575 which inserts through a hole 572 in bracket 570 into a threaded hole 565 in frame 560 . torque applied to screw 575 during clamping is decoupled from printhead module 550 by bracket 570 , and does not substantially affect alignment of the printhead module . in some embodiments , different portions of a printhead module can be clamped with varying force . for example , were thermal stresses are significant , a point near an alignment datum can be clamped with higher force than other points . such an arrangement can cause any induced slipped , due to thermal expansion , for example , to occur in a predictable / controllable manner , and in a manner that does not cause corresponding alignment datums to become disconnected . alternatively , or additionally , to fastening each printhead module to the frame , each printhead module can be loaded against the frame using , e . g ., one or more spring elements . a spring element refers to an element that spring loads the printhead module against the frame . examples of spring elements include coiled springs and flexures . referring to fig6 a , an example of a flexure is shown . a frame 610 includes four openings , 601 , 602 , 603 , and 604 , each having two flexures ( e . g ., flexures 640 and 642 in opening 601 ). in this example , the flexures are cantilevers that spring load the printhead module ( e . g ., printhead module 620 ) in the y - direction . flexures 640 and 642 load alignment datums 621 and 622 on printhead module 620 against frame datums 611 and 612 , respectively . printhead module 620 also includes an alignment datum 623 which contacts frame alignment datum 613 , registering the printhead module in the x - direction . a clamp 630 secures printhead module 620 to frame 610 . referring to fig6 b , in another embodiment , a frame 710 includes openings 701 , 702 , 703 , and 704 that have spring elements for loading printhead modules in the x - and y - directions . for example , opening 701 includes a flexure 730 that loads a printhead module against alignment datum 713 , which registers the printhead module in the x - direction . in addition , frame 710 includes flexures 720 and 722 which load a printhead module against alignment datums 711 and 712 for y - direction registration . in the foregoing embodiments shown in fig6 a and 6b the spring elements are incorporated in the frame . however , spring elements may also be discrete components that are attached to the frame . for example , referring to fig7 , in some embodiments , a printhead module 750 can be spring loaded against the edge of a opening 761 of a frame 760 using discrete coiled springs 770 and 772 . coiled springs 770 and 772 are attached to frame 760 by bolts 771 and 773 , respectively , and spring load printhead module 750 in the y - direction . each coiled spring has an arm ( i . e ., arms 775 and 776 ) that couple to frame 760 via holes 777 and 778 . the force each coiled spring applies to printhead module 750 can be adjusted by changing the hole to which its arm couples . a flexure 780 spring loads printhead module 750 against frame 760 in the x - direction . mounting printhead modules in a frame using spring elements can be advantageous because the spring elements accommodate volume changes in the printhead module relative to the frame &# 39 ; s opening , e . g ., due to thermal expansion , without substantially changing the amount of force applied to the printhead module . in contrast , where a printhead module is tightly clamped to the frame , an increased clamping force that can accompany an increase in the printhead module &# 39 ; s size due to thermal expansion can cause undesirable stress on the printhead module . in aforementioned embodiments that include alignment datums , the alignment datums are planar surfaces . however , in general , alignment datums can take other forms . in general , the alignment datum can take any form that provides sufficiently accurate registration of the printhead module to the frame in at least one degree of freedom . the alignment datums should also be sufficiently large and robust so as not to be deformed by mechanical mounting . in some embodiments , some alignment datums can be recessed ( e . g ., in the form of a bored hole ) and can mate with corresponding protrusions . for example , referring to fig8 a and fig8 b , a printhead module 800 can include alignment datums in the form of posts 830 and 832 , which insert into corresponding holes 841 and 842 in a frame 840 . these alignment datums register printhead module 800 with respect to the x - axis and y - axis . posts 830 and 832 can be adjusted during assembly of printhead module 800 so that they are correctly oriented with respect to nozzles 820 in nozzle plate 810 . furthermore , although the foregoing embodiments include alignment datums for registering a printhead module in the x - and y - directions , alignment datums can also be used to register a printhead module in the z - direction . referring still to fig8 b , for example , frame 840 includes alignment datums 853 and 855 which contact corresponding alignment datums 852 and 854 on printhead module 800 , respectively . these alignment datums offset the printhead module from the frame in the z - direction , positioning nozzles 820 a desired distance from a substrate ( not shown ). another embodiment of a frame is shown in fig9 . in this embodiment , frame 1100 has four openings 1101 - 1104 for mounting printhead modules . frame 1100 is a laminate structure and includes registration plates 1110 and 1130 , and a spacer 1120 . registration plate 1110 includes alignment datums 1111 , 1112 , and 1113 for registering a printhead inserted into opening 1101 in the x - and y - directions . in particular , alignment datums 1113 provide registration of a printhead in the x - direction , while datums 1111 and 1112 provide registration of a printhead in the y - direction . registration plate 1110 includes corresponding alignment datums for registering printheads in the x - and y - directions in openings 1102 - 1104 . registration plate 1130 includes alignment datum 1114 for registering a printhead inserted into opening 1101 in the z - direction . registration plate 1130 includes another alignment datum ( not shown in fig9 due to the perspective of the figure ) on the opposite side of opening 1101 from alignment datum 1114 . furthermore , registration plate 1130 includes corresponding alignment datums for registering printheads in the z - direction in openings 1102 - 1104 . furthermore , frame 1100 includes alignment datums for registration to other frames . alignment datums 1131 and 1132 , on the edge of registration plate 1130 , register the frame to another frame in the y - direction , while alignment datums 1135 and 1136 register the frame to another frame in the x - direction . registration plate 1130 also includes holes 1141 - 1143 for bolting the frame to a print bar or other structure of the printing system in which the frame is mounted . frame 1100 can be relatively thin ( i . e ., in the z - direction ). for example , frame 1100 can have a thickness of about 2 cm or less ( e . g ., about 1 . 5 cm or less , about 1 cm or less ). in embodiments , registration plates 1110 and 1130 can be formed from a rigid material , such as materials that include one or more metals ( e . g ., alloys , such as invar ). the material can have similar thermomechanical properties ( e . g ., coefficient of thermal expansion ( cte )) as the material ( s ) from which the printheads are formed . for example , the cte of the material ( s ) from which the registration plate materials are formed can be within about 20 percent or less ( e . g ., about 10 percent or less , about 5 percent or less ) over a range of temperatures at which the printheads usually operate ( e . g ., from about 20 ° c . to about 150 ° c .). registration plates 1110 and 1130 can be formed by sheet metal processing methods , such as stamping , and / or by edming . the alignment datums on registration plates 1110 and 1130 can be formed by gouging and / or edming , for example . spacer 1120 can be formed from a material having similar thermomechanical properties as the material ( s ) used to form registration plates 1110 and 1130 . in some embodiments , spacer 1120 can be formed from a material having a high thermal conductivity , and spacer 1120 can act as a thermal node . alternatively , or additionally , the material forming spacer 1120 can exhibit relatively low thermal expansion . furthermore , spacer 1120 can be formed from a material which has a high level of chemical inertness , to reduce any undesirable chemical reactions of the spacer with other materials in the frame and / or with the environment . in some embodiments , spacer 1120 can be formed from a material having a high electrical conductivity . high electrical conductivity can reduce build up of static charge on the frame . as an example , spacer 1120 can be formed form a liquid crystalline polymer ( lcp ) ( e . g ., coolpoly ® e2 commercially available from cool polymers inc ., warwick , r . i .). in some embodiments , spacer 1120 is injection molded . alternatively , the spacer can be machined from a blank sheet of material . spacer 1120 can include registration features which couple to corresponding features in other layers of frame 1100 ( e . g ., in the registration plates ), aligning the apertures in each layer to provide openings 1101 - 1104 . registration plates 1110 and 1130 are secured ( e . g ., bonded or screwed ) to either side of spacer 1120 . in some embodiments , an epoxy ( e . g ., a b - stage epoxy ) is used to bond registration plates 1110 and 1130 to spacer 1120 . in some embodiments , additional layers can be included in the laminate structure of frame 1100 . as an example , frame 1100 can include a heater layer . the heater layer can be bonded to a surface of registration plate 1110 or registration plate 1130 . a heater layer can be formed from a kapton flex circuit , for example . although the foregoing embodiments relate to printhead modules which do not require adjustment along various degrees of freedom due to registration using alignment datums , in other embodiments printhead modules can include one or more actuators that adjust the printhead module position with respect to one or more degrees of freedom . for example , referring to fig1 , a frame 910 includes an actuator 940 that is coupled to a surface 960 of a printhead module 920 in a frame opening 901 . printhead module 920 includes an orifice plate 925 having an array of orifices 930 . during operation , actuator 940 adjusts the position of printhead module 920 in the x - direction as necessary . printhead module 920 also includes alignment datums 921 and 922 which contact corresponding frame alignment datums 911 and 912 . actuator 940 can be an electromechanical actuator , such as a piezo - electric or electro static actuator . examples of piezo - electric actuators include stacked piezo - electric actuators that include multiple layers of piezo - electric material stacked to increase the actuators dynamic range compared to a single layer of piezo - electric material . stacked piezo - electric actuators are available commercially ( e . g ., from companies such as pi ( physik instrumente ) l . p ., auburn , mass .). the actuator should have a minimum range of motion on the order of the image pixel spacing . stacked piezo - electric actuators , for example , can have a dynamic range of about 5 to about 300 microns . actuator 940 responds to drive signals from an electronic controller 950 . in some embodiments , controller 950 causes actuator 940 to adjust the position of printhead module 920 in the x - direction in response to a signal from a monitoring system 970 ( e . g ., an optical monitoring system , such as including a ccd camera ). monitoring system 970 monitors images ( e . g ., test images ) printed using printhead module 940 for drop placement errors associated with misalignment of printhead module 940 in the x - direction . where a drop placement error is detected , electronic controller 950 determines the magnitude and direction of printhead module misalignment that gave rise to the error . based on this determination , the controller sends a signal to actuator 940 . the actuator changes the position of the printhead module in order to reduce or eliminate errors arising from printhead module misalignment . in some embodiments , actuator 940 can dither printhead module 920 back and forth in the x - direction during printing . this can reduce the effect of drop placement errors due to x - axis alignment on image quality by introducing controlled noise to the image which can mask the errors . preferably , the printhead module should be dithered a fraction of a pixel ( e . g ., about ½ a pixel or ¼ of a pixel ). dither frequency can be variable or fixed . preferably , dither frequency should be lower than jetting frequency ( e . g ., about 0 . 1 , 0 . 05 , 0 . 01 times the jetting frequency ). however , in embodiments where the dither frequency is comparable or higher than jetting frequency , dither frequency should not be at the jetting frequency or its harmonics . in embodiments where multiple printhead modules are interlaced , each printhead module can be actuator adjusted . in addition , or alternatively , to adjusting the x - direction alignment of each printhead module to mitigated alignment errors , the actuators can adjust the interlace pattern of the printhead modules . the actuators allow the interlace spacing and / or pattern to be varied rapidly and reliably . thus , the interlace pattern can be adjusted during printing ( e . g ., between images ) without down time of the printing press . while in the foregoing embodiments the printhead module alignment datums register the printhead module directly to the frame , in other embodiments alignment datums can be used to register printhead modules directly to other printhead modules . for many applications , particularly those in which printing is completed with a single pass of the substrate relative to the jetting assembly , several printhead modules are positioned along the process direction ( i . e ., the y - direction ) to achieve the requisite spatial density for the desired print quality . to reduce adverse effects of process variation on image quality , printhead modules should preferably placed very close together in the process direction . referring to fig1 a , in some embodiments , close printhead module spacing is achieved by stacking multiple printhead modules together to form a 2 - d jetting array 1000 . while jetting array 1000 includes six printhead modules ( i . e ., printhead modules 1010 , 1020 , 1030 , 1040 , 1050 , and 1060 ), in general , the number of printhead modules in a jetting array can vary as desired . adjacent printhead modules are registered in the y - direction via alignment datums . for example , printhead module 1010 has alignment datums 1013 and 1014 , which register it to printhead module 1020 via alignment datums 1021 and 1022 . in addition , printhead module 1010 includes alignment datums 1011 and 1012 , which register the printhead module in the y - direction to a frame ( not shown ). a clamp 1090 clamps the subassembly together once the printhead modules have been stacked with corresponding datums aligned ( e . g ., using a c - clamp ). the printhead modules in jetting array 1000 can share a common ink supply and temperature control system . corresponding nozzles in adjacent printhead modules can be offset along the x - axis to increase the print resolution of the jetting array . for example , referring to fig1 d , a jetting array 1200 includes three printhead modules 1210 , 1220 , and 1230 that are stacked together . corresponding nozzles in printhead modules 1210 and 1220 are offset by an amount approximately equal to d / n , where d is the spacing between adjacent nozzles ( e . g ., between nozzles 1211 a and 1211 b , 1221 a and 1221 b , and 1231 a and 1231 b ) in a nozzle array , and n is the number of printhead modules in stacked in the jetting array . similarly corresponding nozzles in printhead modules 1220 and 1230 are also offset by d / n in the x - direction . accordingly , the print resolution in the x - direction of the jetting assembly is reduced by a factor of n . as an example , a jetting array having a resolution of about 50 μm can be assembled from six printhead modules each having an individual resolution of about 300 μm . in some embodiments , the alignment datums on the printhead modules can include features that allow alignment of the printhead modules in the x - direction to provide the desired jet pitch . for example , referring to fig1 b , protruding alignment datums 1050 and 1060 can each include multiple precision surfaces which register the printhead modules relative to one another in both the x - and y - directions . in the present embodiment , alignment datum 1050 includes precision surfaces 1051 , 1052 , and 1053 . similarly , alignment datum 1060 includes precision surfaces 1061 , 1062 , and 1063 . surfaces 1051 and 1061 register the printhead modules in the x - direction , while surfaces 1052 , 1053 , 1062 , and 1063 register the printhead modules in the y - direction . another example of alignment datums that register printhead modules relative to two degrees of freedom are shown in fig1 c . in this example , a protruding alignment datum 1070 inserts into a recessed alignment datum 1080 . protruding alignment datum 1070 includes precision surfaces 1071 and 1072 . surface 1071 contacts surface 1081 of alignment datum 1080 , registering the printhead module in the x - direction . similarly , surface 1072 contacts surface 1082 of alignment datum 1080 , registering the printhead module in the y - direction . stacking printhead modules in a compact 2 - d jetting array can reduce the dimensions over which precision should be maintained in any given part . since the arrays are modular and can share common ink ports and temperature control , the size , cost , and complexity of the system can be reduced relative to systems in which individual jetting assemblies are each served by their own ink supply , temperature controller , and / or are individually mounted . furthermore , individual printhead modules can be replaced should they become defective instead of replacing an array . a number of embodiments of the invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . accordingly , other embodiments are within the scope of the following claims .	1
the following description of various embodiments implemented in the context of monitoring the volume or weight of feed bins and installing such monitoring systems is to be construed by way of illustration rather than limitation . this description is not intended to limit the invention or its applications or uses . for example , while various embodiments are described as being implemented in this context , it will be appreciated that the principles of the disclosure are applicable to other environments , as will be apparent to one of ordinary skill in the art . in the following description , numerous specific details are set forth in order to provide a thorough understanding of various embodiments . it will be apparent to one skilled in the art that some embodiments may be practiced without some or all of these specific details . in other instances , well known components and process steps have not been described in detail . embodiments of the bin monitoring system are illustrated in fig1 a - 6 . referring now in particular to fig1 a - 3c and 6 , a bin monitoring system 10 includes a frame 12 . in some embodiments , the frame 12 is a - shaped and has a top 14 and two supports 20 a and 20 b extending diagonally downward from the top 14 . in the illustrated embodiments , each support 20 a and 20 b has a respective flange 24 a and 24 b with at least one respective flange aperture 28 a and 28 b for anchoring the frame 12 to a foundation such as a concrete slab c , as most bins are installed on concrete slabs . the top 14 includes a bolt aperture 16 that receives a bolt 18 for securing the frame 12 to the top of a load cell 50 . in some embodiments , the frame 12 can be constructed of fabricated iron , as shown in fig1 a . alternatively , as shown at reference numeral 12 ′ in fig7 , the frame 12 ′ can be constructed of fabricated channel iron . in some embodiments , the load cell 50 is implemented as an s - type load cell for measuring the tension or changing weight of a bin b . the bin monitoring system 10 incorporates the load cell 50 to measure the weight and changes of weight of the bin b . an example implementation of the load cell 50 is disclosed in u . s . patent application ser . no . 11 / 422 , 910 of jaeger et al ., the teachings of which are herein incorporated by reference in their entirety . in some embodiments , the load cell 50 includes an electrical connection 52 that passes through an aperture 22 in one of the supports 20 a and 20 b to a transmitter ( not shown ) such that data collected from the load cell 50 can be accessed via a remote location such as , for example , by a wired , wireless , or mobile telephone or using a network such as the internet . it is further contemplated that the bin monitoring system 10 may be an element of a larger system in which the data transmitted may be compiled with other data , such as animal weights , so that multiple variables can be monitored and tracked in one central location . such a larger system can also include , for example , a component for generating reports , such as a bin status report , a configuration report , an alarm settings report , a feed usage report , and a bin summary report . the bin status report may illustrate an image of a feed bin showing the current weight , alarm settings , and alarm conditions . the configuration report may list the configuration for the setup menu , interface menu , and computer port . the alarm settings report may list the alarm settings for each indicator . the feed usage report may list daily feed usage sorted by date and the total feed delivered for a selected date range . the bin summary report may list the current bin weights and any alarm conditions for the feed bins . now also referring to fig4 a - c , the bin monitoring system 10 additionally includes a channel bracket 60 used to connect the bin monitoring system 10 to a leg l of the bin b . the channel bracket 60 may be generally u - shaped , being deeper at the top than at the bottom , to correspond to the shape of the bin leg l . in some embodiments , the bin monitoring system 10 includes a limiting mechanism 66 to restrict the upward movement of the channel bracket 60 . the limiting mechanism 66 prevents the bin b from lifting and blowing over when , for example , there is a gust of wind and the bin b is empty . as shown , the limiting mechanism 66 may be a stop strap having bolt apertures 68 for use with a bolt 69 to secure the strap to the frame 12 as shown in fig1 a - 1c . the channel bracket 60 further includes a slot 62 for supporting a load block 70 and is deep enough such that when the channel bracket 60 is bolted to the bin leg l and the frame 12 is secured to the concrete slab c , the channel bracket 60 extends beyond the stop strap 66 , allowing it to contact and be restricted by the stop strap 66 when the bin b is lifted too high . this configuration is also illustrated in fig2 a . in alternative embodiments , the channel bracket 60 may be replaced with a chain link suspension 80 attached to a clevis 82 , as shown in fig7 , or another similar system . now further referring to fig5 a - 5b , as previously mentioned , the bin monitoring system 10 further includes the load block 70 , which is received within the slot 62 of the channel bracket 60 and is supported by the channel bracket 60 . the load block 70 is illustrated in fig5 a - 5b as having a bolt aperture 72 . the load block 70 is placed in the slot 62 of the channel bracket 60 . a bolt 64 is then placed through a bolt aperture 72 of the load block 70 and threaded into the load cell 50 . the load block 70 can move within the slot 62 . this configuration allows for some misalignment of the channel bracket 60 . a typical feed bin has 4 , 6 , or 8 generally u - shaped legs . the bin monitoring system 10 may be placed alongside each leg l and bolted to the concrete slab c with an anchor bolt 30 through two of the flange apertures 28 a and 28 b . two more bolts 65 may be pressed through the bolt holes 64 of the channel bracket 60 to connect the bin monitoring system 10 to the bin leg l . as described above , the bin monitoring system 10 includes the bolt 18 , which secures the load cell 50 to the frame 12 . according to various embodiments , the bolt 18 also serves as a jack to lift and support the load cell 50 when the load cell 50 is suspended off of the concrete slab c . in some embodiments , the bin monitoring system 10 jacks up the bin b no higher than about 0 . 75 inches , preferably no higher than about 0 . 5 inches above the concrete slab c . because installing the bin monitoring system 10 does not require the bin b to be significantly lifted , existing bins may be retrofitted without having to empty the bin or disconnect flex augers and associated piping . to install the bin monitoring system 10 according to one example method , the load cell 50 , frame 12 , and limiting mechanism 66 are operatively connected to one another . the footpads are then disconnected from the bin legs l . next , two 0 . 5 inch holes are drilled into the bin legs l for the channel bracket 60 . in the next step , the channel bracket 60 is first mounted to the leg l such that any space in between the channel bracket 60 and the leg l is reduced . once the channel bracket 60 is attached to the leg l , the frame 12 is aligned to the bin leg l and is secured with concrete anchor bolts 30 . the channel bracket 60 further includes a threaded load cell 50 and a bolt 40 that is received in the channel bracket 60 and that functions as a jack . as the bolt 40 is rotated , e . g ., seven times , the load cell 50 is moved upwards and correspondingly moves the bin leg l upwards . in the next step , a summing box or the transmitter ( not shown ) is mounted to the bin b and is operatively connected to the load cells 50 . next , the summing box can be wired to the bin monitoring system 10 . next , wiring to the bin support frame is secured to the load cell 50 , e . g ., using one or more cable ties . the bin monitoring system 10 is then connected to the on - site network to enable communication with a remote monitoring system . next , three of the bin legs l are electrically grounded above each frame using the anchor bolts 18 . as described above , the bin monitoring system 10 can be used to determine how much feed enters and exits a feed bin . in this way , the bin monitoring system 10 facilitates the determination of when more feed should be ordered . in addition , the bin monitoring system 10 facilitates verifying how much feed is actually delivered when the bins are refilled and how much is being consumed . as a result , potential out - of - feed events can be monitored , animal performance based on feed consumption can be correlated , and future bin levels can be predicted accurately . as demonstrated by the foregoing discussion , various embodiments may provide certain benefits . for instance , the bin monitoring system 10 can greatly reduce monitoring costs . the required labor can be reduced because multiple bin feed levels can be quickly , simultaneously , and accurately monitored at a central location , as compared with the conventional approach of visually inspecting each bin individually . safety hazards can also be reduced because workers do not need to climb feed bins to inspect them . additionally , logistical savings can be realized by the bin monitoring system 10 . typically , feed mills have large demands on mondays and fridays . on these days , the mills run over capacity and often need to pay overtime to drivers and milling employees to fill tanks for the weekend or to catch up on empty tanks on mondays . on tuesdays , wednesdays , and thursdays , the mills run under capacity . the bin monitoring system 10 allows the feed mill to level its production flow out over the week by delivering feed early to some bins and just - in - time to others . accurate monitoring of feed bins allows producers to better predict and schedule when they will need to replenish the feed bins , which in turn will reduce the amount of expedited orders and allow the feed mill to plan their production . by allowing the feed mill to better plan its production , the feed mill can schedule the bottlenecks to the maximum increasing throughput . overtime is saved in both the feed mill and the trucking , and the incidence of empty compartments or “ air tons ” can be reduced . rush orders can be eliminated by better planning , thus greatly reducing the frequency of expedited orders and the associated expense . it will be understood by those who practice the embodiments described herein and those skilled in the art that various modifications and improvements may be made without departing from the spirit and scope of the disclosed embodiments . the scope of protection afforded is to be determined solely by the claims and by the breadth of interpretation allowed by law .	8
fig1 shows a portion of an exemplary network for enabling protected unidirectional communication between a source node ( s ) 10 and a destination node ( d ) 12 . the primary or working communication path includes a number of intermediate nodes designated “ primary ” nodes ( p ) 14 interconnected by working segments ( ws ) 16 . also shown are a set of backup nodes ( b ) 18 , each being associated with a corresponding one of the primary nodes 14 . the backup nodes 18 are interconnected between the source node 10 and the destination node 12 by a number of protection segments ( ps ) 20 . also , each backup node 18 is interconnected with the associated primary node 14 by a corresponding pair of shunt segments ( ss ) 22 . each pair 22 includes a first shunt segment 21 for carrying traffic from a primary node 14 to the associated backup node 18 , and a second shunt segment 23 for carrying traffic from a backup node 18 to the associated primary node 14 . the various segments 16 , 20 and 22 are established at the time of connection setup , in advance of carrying any user data traffic from the source node 10 to the destination node 12 . the path consisting of the working segments 16 through the primary nodes 14 is a unidirectional path for carrying working traffic from the source node 10 to the destination node 12 , and the protection segments 20 are designated to carry protection traffic in the same direction . it will be appreciated that the nodes 10 and 12 may exchange data traffic in the other direction as well ( i . e . from node 12 to node 10 ), for which a separate set of working and protection segments ( not shown ) must be established . in general , the segments utilized for traffic in the other direction may flow through a different set of primary nodes , although in practice it is generally advantageous for traffic in both directions to traverse the same set of nodes . also , a given shunt segment 22 may serve to protect traffic flowing in both directions . in one embodiment , the segments 16 , 20 , and 22 can be realized as label - switched paths ( lsps ) as known in the multiprotocol label switching ( mpls ) architecture . they may also be realized as virtual connections ( vcs ) such as defined in the asynchronous transfer mode ( atm ) architecture , or similar pre - established connections . fig2 shows circuitry used for protection switching within the primary nodes 14 . first selection circuit 24 selects the source for traffic sent from the primary node 14 on its downstream or output working segment 16 , shown as “ ws - out ”, and second selection circuit 26 selects the source for traffic sent from the primary node 14 on its output shunt segment 21 , shown as “ ss - out ”. the inputs to the first selection circuit 24 are ( 1 ) the upstream or input working segment 16 (“ ws - in ”), ( 2 ) the as “ nc ”) when no connection 28 is selected , the output working segment 16 is not being utilized to carry traffic . this case corresponds to the presence of a failure downstream of the primary node 14 , as explained below . the inputs to the second selection circuit 26 are ( 1 ) “ no connection ” 30 and ( 2 ) the upstream or input working segment 16 (“ ws - in ”). when no connection 30 is selected , the output shunt segment 21 is not being utilized to carry traffic . this case corresponds to the normal working condition , as explained below . fig3 shows circuitry used for protection switching within the backup nodes 18 . first selection circuit 32 selects the source for traffic sent from the backup node 18 on its downstream or output protection segment 20 , shown as “ ps - out ”, and second selection circuit 34 selects the source for traffic sent from the backup node 18 on its output shunt segment 23 , shown as “ ss - out ”. the inputs to the first selection circuit 32 are ( 1 ) “ no connection ” 36 , ( 2 ) the input shunt segment 21 (“ ss - in ”), and ( 3 ) the input protection segment 20 (“ ps - in ”). when no connection 36 is selected , the output protection segment 20 is not being utilized to carry traffic . this case corresponds to the normal working condition , as explained below . the inputs to the second selection circuit 34 are ( 1 ) “ no connection ” 38 and ( 2 ) the upstream or input protection segment 20 (“ ps - in ”). when no connection 38 is selected , the output shunt segment 23 is not being utilized to carry traffic . this case corresponds to the normal working condition , as explained below . the circuitry of fig2 and 3 is used for protection switching when necessitated by failures within the network . in general , a given backup node 18 and associated protection segments 20 and shunt segments 22 are utilized to route traffic around a failure at or near the primary node 14 with which the given backup node 18 is associated . specific examples of such failures are given below . from the perspective of a given primary node 14 , failures can be categorized as having occurred at the primary node 14 itself , “ upstream ” of the primary node 14 , i . e . toward the source node 10 , or “ downstream ” of the primary node 14 , i . e ., toward the destination node 12 . a failure of a primary node 14 itself is considered to be downstream of a working upstream primary node 14 , and upstream of a working downstream primary node 14 . this specific scenario is also described below . tables 1 and 2 summarize the operation of the switch circuits 24 , 26 , 32 and 34 at a primary node 14 and associated backup node 18 based on the existence of and relative location of a failure . the contents of these tables are explained below . tables 1 and 2 are explained as follows . at a primary node 14 , in the absence of a failure , the traffic from ws - in is passed along to ws - out , and no traffic is sent on ss - out , because protection is not active due to the absence of a failure . when a failure occurs upstream of the primary node 14 , traffic is still sent on ws - out , but the source is the associated backup node 18 via ss - in . when a failure occurs downstream of the primary node 14 , traffic is still received from ws - in , but is sent to the associated backup node 18 via ss - out rather than being forwarded along the working path via ws - out . recall that from the perspective of a given primary node 14 , the failure of another primary node 14 is either an upstream or downstream failure , depending on its relative location . at a backup node 18 ( table 2 ), in the absence of a failure , no traffic is sent on either ps - out or ss - out . this is an idle or standby condition . when a failure occurs upstream of the associated primary node 14 , the backup node 18 accepts traffic from ps - in and directs it to the associated primary node 14 via ss - out . when a failure occurs downstream of the associated primary node 14 , the backup node 18 accepts traffic from ss - in and directs it along the protection path via ps - out . when the primary node 14 associated with the backup node 18 fails , then traffic is accepted from ps - in and directed along the protection path via ps - out . fig4 depicts the operation of the network in the presence of a failure on the working segment 16 - 2 extending between two primary nodes 14 - 1 and 14 - 2 . at the primary node 14 - 1 , the traffic is directed from the input working segment 16 - 1 toward the backup node 18 - 1 along the shunt segment 21 - 1 . the backup node 18 - 1 accepts the traffic from the shunt segment 21 - 1 and directs the traffic toward the downstream backup node 18 - 2 along the protection segment 20 - 2 . from the perspective of the backup node 18 - 2 and the primary node 14 - 2 , the failure is an “ upstream ” failure . therefore , the backup node 18 - 2 directs traffic from the protection segment 20 - 2 toward the primary node 14 - 2 via the shunt segment 23 - 2 , and the primary node 14 - 2 accepts the traffic from the shunt segment 23 - 2 and directs it to primary node 14 - 3 via the working segment 16 - 3 . fig5 shows operation when a primary node such as primary node 14 - 2 fails . in this case , operation of nodes 14 - 1 and 18 - 1 is the same as for the situation of fig4 , and nodes 14 - 3 and 18 - 3 operate in the same fashion as do nodes 14 - 2 and 18 - 2 in the situation of fig4 . additionally , backup node 18 - 2 forwards traffic from its input protection segment 20 - 2 toward the downstream backup node 18 - 3 via output protection segment 20 - 3 . as a result , traffic is routed around failed primary node 14 - 2 . the preceding description has focused on point - to - point connections having one source node 10 and one destination node 12 . the disclosed protection technique can also be utilized in connection with point - to - multipoint connections having a single source and multiple destinations . fig6 shows an example of a point - to - multipoint connection on which the source node 10 sends data to two different destinations 12 a and 12 b . in this simple two - destination connection , the primary node 14 - 2 is responsible for replicating the traffic on two output working segments 16 - 3 a and 16 - 3 b , and likewise the backup node 18 - 2 is responsible for replicating the traffic on two output protection segments 20 - 3 a and 20 - 3 b . the nodes 14 - 2 and 18 - 2 are referred to herein as a “ branching primary node ” and “ branching backup node ” respectively . the nodes 14 - 2 and 18 - 2 operate as shown in fig2 and 3 with respect to both the traffic stream for destination 16 a and the traffic stream for destination 16 b . generally , it is preferred that the protection switching for these different streams be carried out independently , so that for example a failure of primary node 14 - 3 b would result in protection switching occurring for the traffic for destination 12 b but no protection switching occurring for the traffic for destination 12 a . fig7 shows the existence of a failure on the working segment 16 - 3 a of the “ a ” branch of the point - to - multipoint connection . in this case , the traffic destined for destination node 12 a is directed along shunt segment 21 - 2 to backup node 18 - 2 , then along protection segment 20 - 3 a to backup node 18 - 3 a , and then along shunt segment 23 - 3 a to primary node 14 - 3 a , which forwards the traffic to destination node 12 a along working segment 14 - 4 . the traffic destined for destination node 12 b is not affected by this failure , and continues to flow along working segments 16 - 3 b and 16 - 4 b . while in the illustrated embodiments , there is a different backup node 18 associated with each primary node 14 , in alternative embodiments a node may serve as a backup node 18 for two or more primary nodes 14 , as long as the necessary working segments , protection segments , and shunt segments can be established . it is generally preferred for reliability reasons that a primary node be directly connected to its associated backup node , although it is not strictly required . by “ directly connected ”, it is meant that there are no intervening nodes that terminate network segments such as lsps . a lower - level device such as an electrical repeater or hub would generally not qualify as an intervening node . as already mentioned , there may be additional nodes within one or more of the protection segments 20 that do not participate in the protection operation as a backup node 18 . additionally , it is possible that such additional nodes are also included within the working segments 16 , although such configurations are preferably avoided . generally , it is preferred that each node along the working path from source 10 to destination 12 be protected . it will be apparent to those skilled in the art that modifications to and variations of the disclosed methods and apparatus are possible without departing from the inventive concepts disclosed herein , and therefore the invention should not be viewed as limited except to the full scope and spirit of the appended claims .	7
queuing systems are found everywhere , from computing systems to networking systems to checkout lines at the supermarket . one place where queues are extensively used are inside of switches or routers . if there are more packets that want to use a resource than that resource can handle , some systems will queue those packets until the resource is able to handle them or until the packets need to be dropped for some reason . to avoid one slow or blocked resource blocking packets that do not depend on it , queuing systems will often have separate queues that can be individually enabled or blocked . by mapping independent resource sets to different queues , blocking one resource set and thus its set of queues will not block the other queues destined to other resource sets . even within a single resource set , there may be multiple queues representing different priorities . thus , in a standard queuing system , there may be many tens of thousands of queues or more . high performance queuing systems found in high performance systems such as routers are often implemented in special - purpose hardware to meet their performance requirements . in such systems , it is often the case that a single logical block that contains all of the queue state performs the entire enqueue and dequeue operations . the queue state needed by both enqueue operations and dequeue operations is the same and thus keeping a single copy of that state and implementing both operations around that single copy of the state is the obvious implementation . in these dedicated hardware cases , a sufficient number of resources are provided to support any combination of queuing operations . the required resources could include fast memories for queue state , additional contexts to tolerate long latencies to memory , combining buffers and bypasses that ensure multiple requests to the same queue are processed using the same access to the queue state and so on . such hardware systems , however , are difficult and expensive to develop . in addition , those that are hard - wired into an asic are inflexible . recently , there has been a trend towards programmable devices , such as the intel ixp network processors , that support such queuing systems in software , potentially with some hardware assist . in such devices , microcode runs on a set of small microprocessors to support almost arbitrary functionality ranging from packet classification and forwarding to queuing . such microcode is extremely difficult to write , since it must carefully manage a very restricted set of resources across several simultaneously executing threads . in addition , since such programmable devices must be general , they may not always have sufficient resources to support full - performance queuing within a single logical block . more hardware - based implementations may have similar constraints for a variety of reasons . thus , having the ability to split a queuing system into two parts has potential application in any queuing system . rather than implementing the queuing operations within a single logical block , this invention describes how to split the implementation across multiple logical blocks . this split reduces the amount of work in each logical block , thus potentially making the amount of work mappable to a physical resource , such as a micro - engine , that was not capable of supporting the entire queuing operation at the desired performance . note that it may be the case that the split duplicates some work and thus it may actually be less efficient than implementing the entire functionality in a single logical block . even in such cases , however , it is still worthwhile to perform the split if the desired functionality and performance cannot otherwise be achieved . enqueue and dequeue operations both generally require access to queue state to determine if the operation is correct and should be performed before the operation can be completed . in some systems , it is necessary or convenient to complete the check before the actual enqueue or dequeue is performed to ensure correctness . in addition , there may be additional work required that logically fits between performing the check and performing the enqueue or dequeue . in such cases , being able to split the total enqueue / dequeue operations into multiple parts can be very useful . thus , this invention is particularly useful for such systems . an example of this invention breaks the original single logical block into two blocks , block a and block b , that implement the queuing functionality . block a qualifies the operation , ensuring that the operation has the resources available to complete and is allowed to complete before passing the operation to block b that performs the operation . both blocks have their own copies of the queue information , though they may not be precisely coherent at all times . for example , on an enqueue operation , block a might read its own copy of the queue information , such as the head index , tail index and queue size , and determine whether the operation can complete . in addition , block a might also ensure that the appropriate information and resources ( perhaps that the queue state is already read into a queue state cache ) are available so that block b can complete its operation without performing any additional checks or work . if the operation can complete , block a updates its own state and passes the operation to block b for processing . the appropriate queue information ( such as the tail index to be used as the offset to write the data ) could also be passed from block a to block b . block b only needs to complete the operation and update its state . a dequeue operation might be performed in a similar fashion . block a reads its own copy of the queue information and determines whether the operation can complete . if the operation can legally complete , block a updates its own state and passes the dequeue operation to block b . block b performs the dequeue operation , reading and returning the appropriate value , and updates its queue state . block a can implement part of the enqueue operation and part of the dequeue operation , while block b can also implement part of the enqueue operation and part of the dequeue operation . another possibility is that only the enqueue operation needs to be sped up . in that case , block a may only have a count of the number of enqueue operations that can be legally completed . then , as enqueues arrive , block a uses the count to determine if the enqueue can complete , and decrements the count to ensure his information is up - to - date . as dequeues arrive , the count is checked and incremented . assuming a circular buffer to store the data , the count can also be used as an index into the circular buffer . by splitting the queuing operations into two logical blocks , each logical block has less work to do and thus potentially has more time and resources to perform other tasks . for example , red might be necessary between reading the queue state and the actual enqueue . splitting the queuing operation between two logical blocks may reduce the work one of the logical blocks needs sufficiently to allow it to perform the red operation . this invention is not limited to splitting the queuing operations into only two logical blocks . in some cases , queuing operations can be split across more than two logical blocks . for example , one logical block may perform the queue fetch into the queue state cache , the next stage may perform the correctness and any other checks , such as red , that need to be performed , and the following stage performs the actual enqueue . an example of this invention within a network processor is shown in fig5 . the queuing operations take four micro - engines : one 44 to determine if the queue state is in the queue cache , fetch the queue state into the queue cache if it is not , and perform correctness and red functions . once the enqueue has been allowed , it is passed to the enqueue micro - engine 46 that actually performs the enqueue . the next stage 48 decides which queue gets serviced and ensures that the appropriate queue state is available in the hardware queue engine cache before passing a trigger to the following stage 50 that actually performs the dequeue operation . such a structure to implement split queuing functionality is mappable to the intel ixp2400 and ixp2800 network processors . those network processors provide hardware - assisted queue engines that support a limited number of queues . when using those queue engines with a larger number of queues , the software must maintain knowledge of which queues reside in which queue resources . in addition , the software must use the interfaces provided by the queue engines that separate the correctness check from the actual operation . in such systems or similar systems it may be impossible or inconvenient to check and enqueue / dequeue in the same operation ; two operations in accordance with the present invention enable the full queuing process . in addition , other work such as determining quality of service ( qos ) operations , may need to take place between the queue state check operation ( using a “ check ” operation to the queuing engine ) and the actual enqueue / dequeue operation . such operations , for example , may block the enqueue operation , even though there is sufficient space in the queue for the value being enqueued , due to some condition such as that queue using too much bandwidth recently . such work can potentially be so expensive that it and the entire queuing operation cannot be completed by a single logical block while maintaining full performance , thus making a splitting of the queuing functionality necessary . it is also possible that some sub - operations of queuing are better implemented in different logical blocks . for example , one logical block may have easy access to a larger amount of local state but does not have fast access to the queuing engine . in such cases , the appropriate partitioning of functionality may improve performance on some metric . thus , implementing one part of a queuing operation in one logical block and another part of the queuing operation in another logical block ( and potentially further splitting the queuing operation across more logical blocks ) reduces the amount of work per block and thus potentially enables the functionality and / or enables higher performance and / or makes better use of resources by implementing the specific sub - operation in a more resource - logical place . this invention is useful in a variety of devices from pure hardware implementations such as in an asic or fpga , network processors , simultaneous multi - threaded ( smt ) processors and chip - based multi - processors ( cmp ). logical blocks are essentially separate threads of control that can be mapped to different hardware engines , micro - engines , threads or processors . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims .	6
an optical receiver monitors and outputs a voltage that represents the oma of a received optical signal at the optical receiver . the voltage is a diagnostic measure of the quality of the optical communication link defined by an upstream transmitter , an optical medium and the optical receiver . the voltage provides a direct measure of signal strength , rather than an indirect calculation that uses one or more measures of a point of reference and the er of the upstream transmitter to characterize the quality of the communication link . a direct measure of communication link quality provides the ability to track vertical eye closure due to inter - symbol interference ( isi ) caused by increased transmitter rise / fall times , reduced transmitter er and increased dispersion effects in a fiber medium , etc . as described above , diagnostic monitoring based on oma is better correlated to ber performance of an optical communication link than monitors that use a measure of average optical input power . this is especially the case for optical communication links that use bandwidth - limited transmitters , bandwidth limited and / or relatively high - loss fiber media like polymer optical fiber ( pof ) and hard - cladded silica ( hcs ) fiber . an optical receiver uses automatic gain control to support the dynamic range of pof and hcs communication media ( 1 mw to 1 μw or 0 dbm to − 30 dbm ) and provides a diagnostic measurement of oma at other than a signal output . two embodiments are presented . in a first embodiment , oma , based on signal swing at an input to a signal - limiting amplifier ( or post amplifier ) in combination with an actual transimpedance gain setting is provided at a dedicated receiver output . a low - speed circuit ( i . e ., a circuit operating at a rate in the khz range or slower ) records an average of the high signal peaks and an average of the low signal peaks . thus , the low - speed circuit provides a measure of the peak - to - peak signal swing at the input to the signal - limiting amplifier . the low - speed circuit combines the measure of the peak - to - peak signal swing with the gain of the transimpedance amplifier to generate an absolute measure of oma at the receiver . for example , if the light intensity at the optical detector is very low , the transimpedance gain setting will be at a maximum gain setting . under these operating conditions , the signal swing at the output of the transimpedance amplifier will be a representation of the optical signal swing at the optical detector . when the light intensity increases to a point where the automatic gain control of the transimpedance amplifier starts to attenuate the signal to ensure that the output of the transimpedance amplifier is not limited ( i . e ., the transimpedance amplifier is not saturated ), the output of the low - speed circuit is adjusted by the gain applied at the transimpedance amplifier to accurately track the optical signal swing at the optical detector . a driver provides an analog voltage at a non - data output of the receiver . the analog voltage can be related to a measure of link quality . thus , for a particular receiver , a relationship between the analog voltage and oma swing at the receiver can be established . in addition , once a measure of the receiver noise floor is recorded or characterized , a relationship between the oma swing and ber for the communication link can be provided . in a second embodiment , oma , based on signal swing at an input to a transimpedance amplifier is provided at a dedicated receiver output . a signal or current mirror is inserted between the optical detector and a transimpedance amplifier that applies automatic gain control to ensure that the output of the transimpedance amplifier is not limited . a first output of the signal mirror is coupled to the transimpedance amplifier . a second output of the signal mirror is coupled to a fixed gain amplifier having a gain such that the output of the fixed gain amplifier will not saturate over the dynamic range of the receiver and a low - speed circuit that generates an average peak - to - peak signal swing . an optical receiver in accordance with this second embodiment will be preferably constructed with the signal mirror , transimpedance amplifier , fixed - gain amplifier , the low - speed circuit and the buffer being formed on a single substrate . the low - speed circuit provides a measure of the peak - to - peak signal swing at the output of the fixed gain amplifier . a driver coupled to an output of the low - speed circuit provides an analog voltage at a non - data output of the receiver . the analog voltage can be related to a measure of link quality . turning now to the drawings , wherein like reference numerals designate corresponding parts throughout the drawings , reference is made to fig3 , which includes a schematic diagram of an embodiment of an improved optical receiver 300 . the optical receiver 300 includes a series arrangement of an optical detector 310 , a pre - amplifier 320 and a post - amplifier 330 . the optical receiver 300 receives an optical signal at a second or output end 24 of an optical medium 20 and generates a first electrical signal labeled data on connection 333 that is an amplified version of the optical data signal received at input 302 . the first electrical signal on connection 333 and the complement signal on connection 335 are limited or clamped between the logic high voltage and the logic low voltage . in addition to the first and second electrical signals , the optical receiver 300 generates a voltage on connection 339 ( labeled oma ) that is a measure of the optical modulation amplitude at the input 302 . the optical detector 310 is coupled to the input 302 via an optical coupling mechanism 305 . the optical coupling 305 can be a butt coupling , a refractive coupling , a fiber stub , etc . the optical detector 310 is further coupled to the pre - amplifier 320 via connection 315 . the optical detector 310 is an optical - to - electrical signal converter . that is , the current on connection 315 is responsive to the time - varying light signal received via the input 302 and the optical coupling mechanism 305 . the transimpedance amplifier 322 receives the current on connection 315 and converts the same to a time - varying voltage on pre - amplifier output connection 325 , which is coupled to a signal input of the post - amplifier 330 . an indication of the gain is provided on connection 323 to the post - amplifier 330 . the pre - amplifier 320 comprises a transimpedance amplifier 322 with automatic gain control . the pre - amplifier 320 is configured to dynamically apply the automatic gain control to ensure that the amplified voltage on connection 325 at the output of the pre - amplifier accurately reflects the time - varying optical signal swing at the input 302 without saturating the transimpedance amplifier 322 . the signal limiting post - amplifier 332 receives the amplified voltage on connection 325 and generates the first electrical signal labeled data on connection 333 and its complement ( i . e ., the second electrical signal ) on connection 335 . a relatively low - speed circuit 336 receives the amplified voltage on connection 325 and the indication of the gain applied by the transimpedance amplifier 322 on connection 323 . the low - speed circuit 336 generates the difference of a first signal level and a second signal level . the difference of the first signal level and the second signal level is forwarded via connection 337 to a driver or buffer 338 , which is coupled to the connection 339 . the low - speed circuit 336 operates in the khz range or slower . the low - speed circuit 336 determines the average high signal level at the output of the pre - amplifier 320 and the average low signal level at the output of the pre - amplifier 320 and forwards the difference of these average signal levels at its output . to provide an accurate representation of the optical signal swing at the input 302 of the optical receiver 300 , the output of the low - speed circuit 336 is adjusted by the gain applied at the transimpedance amplifier 322 . for example , if a gain factor of 0 . 1 is applied at the transimpedance amplifier 322 to ensure that the output voltage is not limited and the average peak - to - peak voltage swing measured by the circuit 336 is 40 mv , the circuit 336 multiplies the inverse of the gain by the peak - to - peak voltage swing and generates an output signal on connection 337 of 400 mv . the buffer 338 is provided to ensure that external monitoring equipment does not adversely affect the diagnostic measure of oma on connection 339 . fig4 is a circuit diagram of an alternative embodiment of an improved optical receiver . the optical receiver 400 includes an arrangement of an optical detector 310 , a signal mirror 410 , a pre - amplifier 420 and a post - amplifier 430 . the optical receiver 400 receives an optical signal at a second or output end 24 of an optical medium 20 and generates a first electrical signal labeled data on connection 433 that is an amplified version of the optical data signal received at the input 302 . the first electrical signal on connection 433 and the complement signal on connection 435 are limited or clamped between the logic high voltage and the logic low voltage . in addition to the first and second electrical signals , the optical receiver 400 generates a voltage on connection 429 ( labeled oma ) that is a measure of the optical modulation amplitude at the input 302 . the optical detector 310 is coupled to the input 302 via an optical coupling mechanism 305 . the optical detector 310 is further coupled to the signal mirror 410 via connection 315 . the optical detector 310 is an optical - to - electrical signal converter . that is , the current on connection 315 is responsive to the time - varying light signal received via the input 302 and the optical coupling mechanism 305 . the signal or current mirror 410 provides a first pre - amplifier input on connection 413 and a second pre - amplifier input on connection 415 . the signal mirror 410 is a circuit designed to copy a current through one active device by controlling the current in another active device of the circuit . the signal mirror 410 keeps the output current on connection 413 and the output current on connection 415 constant regardless of pre - amplifier and post - amplifier loading ( if any ). the signal mirror 410 provides a representation of the current provided by the optical detector 310 on the connection 413 and the connection 415 . the first pre - amplifier input on connection 413 is coupled to a transimpedance amplifier 422 that receives the current on connection 413 and converts the same to a time - varying voltage on pre - amplifier output connection 423 , which is coupled to a signal input of the post - amplifier 430 . the transimpedance amplifier 422 dynamically applies automatic gain control to ensure that the amplified voltage on connection 423 at the output of the pre - amplifier 420 accurately reflects the time - varying optical signal swing at the input 302 without saturating the transimpedance amplifier 422 . an optical signal monitoring path within the pre - amplifier 420 includes an arrangement of a fixed gain amplifier 424 , a low - speed circuit 426 , and a driver or buffer 428 . the fixed gain amplifier 424 receives the second pre - amplifier input on connection 415 and forwards a time - varying amplified voltage on connection 425 . the fixed gain amplifier 424 is configured to provide a time - varying amplified voltage that is not limited over the dynamic range of the optical receiver 400 . the low - speed circuit receives the amplified voltage on connection 425 and generates the difference of an average high signal level and an average low signal level . the difference of the average high signal level and the average low signal level is forwarded via connection 427 to the buffer 428 , which is coupled to the connection 427 . the low - speed circuit 426 operates in the khz range or slower . the buffer 428 provides a measure of the oma at other than a signal output of the optical receiver 400 . the buffer 428 further ensures that any external monitoring equipment does not adversely affect the diagnostic measure of oma on connection 429 . the signal limiting post - amplifier 432 receives the amplified voltage on connection 423 and generates the first electrical signal labeled data on connection 433 and its complement ( i . e ., the second electrical signal ) on connection 435 . in this way , the post amplifier 430 generates a limited or clamped version of the optical signal received at the input 302 . the first and second electrical signals on connection 433 and connection 435 are limited or clamped to the voltage levels corresponding to a logic high and a logic low , respectively . fig5 is a flow chart illustrating a method 500 for providing a diagnostic measure of oma in an optical receiver that uses automatic gain control . the method 500 begins with block 502 where a representation of an output of an optical detector is applied to a circuit that determines a difference between a first signal level and a second signal level . thereafter , as indicated in block 504 , the difference of the first signal level and the second signal level provided by the circuit is buffered . the buffered difference of the first signal level and the second signal level is a diagnostic measure of oma . fig6 is a flow chart illustrating an embodiment of a method 600 for providing a diagnostic measure of oma in an optical receiver that uses automatic gain control . the method 600 begins with block 602 where an output of an optical detector is applied to a transimpedance amplifier that uses automatic gain control . in block 604 , the optical receiver generates a measure of oma by applying the output of the transimpedance amplifier to a circuit that determines a difference between a first signal level and a second signal level . in addition , the circuit generates a measure of oma as a function of the gain applied at the transimpedance amplifier and the difference between the first signal level and the second signal level . as explained above , the product of a gain factor and the difference is a measure of oma at the optical detector of the receiver . thereafter , as indicated by block 606 , the oma as represented by an analog voltage , is buffered . in block 608 , the buffered oma signal is coupled to an external apparatus that compares the buffered oma signal to one or more thresholds . in block 610 calibration information that associates a voltage level with an absolute oma is provided . fig7 is a flow chart of an alternative embodiment of a method 700 for providing a diagnostic measure of oma in an optical receiver that uses automatic gain control . the method 700 begins as shown in block 702 , where an electrical signal responsive to the received light at an optical receiver is provided to a signal mirror that generates first and second signal mirror output signals . in block 704 , a first representation of the first signal mirror output signal is generated using a fixed gain amplifier that does not become saturated over the dynamic range of the optical receiver . in block 706 , a difference of an average high signal level and an average low signal level in the first representation of the first signal mirror is determined . thereafter , as indicated in block 708 , a measure of oma is generated by buffering the difference of the average high signal level and the average low signal level . in block 710 , a second representation of the second signal mirror output signal is generated using a transimpedance amplifier that applies automatic gain control . in block 712 , differential output signals , responsive to the electrical signal are generated by applying the second representation to a signal limiting amplifier . in block 714 , the measure of oma is coupled to an external device ( i . e ., an apparatus other than the optical receiver ) that applies one or more thresholds to generate a measure of optical communication link quality . in block 716 , calibration information that associates the measure of oma with an absolute oma at the optical receiver is provided . the particular sequence of the steps or functions in blocks 702 through 712 is presented for illustration . it should be understood that the order of the steps or functions in blocks 702 through 712 can be performed in any other suitable order . the steps or functions in block 714 and block 716 are optional . while various embodiments of the optical receiver systems and methods for providing a measure of oma at an optical receiver that uses automatic gain control have been described , it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible that are within the scope of this disclosure . accordingly , the described optical receiver systems and methods for providing a diagnostic measure of oma at an optical receiver that uses automatic gain control are not to be restricted or otherwise limited except in light of the attached claims and their equivalents .	7
referring to fig1 and 2 , the boring tool 1 is provided at its free end with two interchangeable hard metal cutting plates 2 . the shank 3 of the boring tool 1 has a central bore 4 for the passage of a cooling medium , which bore terminates , at the leading end of the boring tool , in two openings 5 . cooling medium is supplied through the bore 4 and the openings 5 directly to the region of the cutting plates 2 . instead of a liquid cooling medium , it may in some cases , be necessary to supply compressed air through the bore 4 and openings 5 . on the cylindrical shank 3 of the boring tool 1 is rotatably mounted a cooling medium supply ring 6 which is formed with an annular duct 27 connected to the cooling medium bore 4 by a transverse bore 8 . by providing an accurate fit between the cooling medium supply ring 6 and the shank 3 of the tool , these two parts are sealed with respect to each other . the cooling medium ring 6 is provided with a radially projecting coupling piece 7 . this coupling piece 7 is slidable radially in the direction r over a nipple 12 screwed into the cooling medium ring 6 and can be secured by means of a clamping screw 9 ( fig2 ). the coupling piece 7 has in addition a flat sealing surface 10 into which a substantially radially extending inlet bore 11 extends . this inlet bore 11 is connected with a bore through the nipple 12 and , via the latter , with the transverse bore 8 . rotatably mounted in a housing 13 of a working center is a drive spindle 14 . a supporting ring 15 may be subsequently fixed to the housing coaxially with the spindle 14 . this supporting ring 15 has an axially extending bore 16 in which the shaft 17a of a coupling head 17 is slidable in the direction a parallel to the axis a -- a of the shank 3 and can be secured by means of a screw 18 . the axis a -- a of the shank 3 is coaxially aligned with the central axis of the drive spindle 14 as soon as the boring tool 1 is inserted in the drive spindle 14 . on the shaft 17a of the coupling head 17 there is additionally rotatably mounted a coupling ring 19 to which is connected a supply pipe 20 for the cooling medium . the rotatable arrangement of the coupling ring 19 has been chosen in order to provide an arrangement which is as adaptable as possible . if desired , the supply pipe 20 could instead be fixedly connected to the shaft 17a . the coupling head 17 projects into the region radially outside the cooling medium supply ring 6 and in this region is provided with a substantially radially inwardly extending cooling medium outlet bore 21 . this cooling medium outlet bore 21 is either located in the same radial plane as the cooling medium inlet bore 11 or may be brought into the same radial plane as the latter by axial adjustment of the coupling head 17 . the coupling head 17 is also provided with a flat sealing surface 22 . the outlet bore 21 extends into this sealing surface 22 . the sealing surface 22 is inclined , circumferentially of the cooling medium supply ring 6 , with respect to a tangent line t ( fig2 ) extending through the outlet bore 21 approximately perpendicular thereto . in this case , it is a line question of a tangent to a circle k which is concentric with the axis a -- a of the tool shank 3 . the inclination of the sealing surface 22 circumferentially with respect to the tangent line t is at an acute angle α of about 2 ° to 10 °, preferably 6 ° to 8 °. the circumferential inclination of the sealing surface 22 is moreover such that the distance m thereof from the axis a -- a of the spindle 3 becomes progressively less in the rotational direction d of the boring tool . the sealing surface 22 , in the example shown , extends , in the direction of the axis a -- a of the tool shank 3 , parallel to the axis . if desired , however , the sealing surface could instead be inclined , as shown by the chain - dotted line 22a , toward the free end of the boring tool and away from the axis of the tool shank at an acute angle β , which angle may be as large as 10 °. the sealing surface 10 of the coupling piece 7 is inclined in the same directions and at the same angle as the sealing surface 22 , so that the two sealing surfaces 10 , 22 can , in the coupled condition , lie parallel to and in contact with each other in a good sealing relationship . the boring tool is inserted in the drive spindle 14 , together with the cooling medium supply ring which is arranged thereon so as to be freely rotatable , by means of a tool changer , the coupling piece 7 being disposed at any desired angle with respect to the coupling head 17 . when rotation is imparted to the boring tool 1 by the drive spindle 14 , the cooling medium supply ring 6 will also be caused to rotate by the friction between the tool shank 3 and the said ring 6 until the sealing surface 10 of the coupling piece 7 comes into engagement with the sealing surface 22 of the coupling head 17 . in connection with the choice of the angle α , it is important that this angle should be neither too great not too small , so that a predetermined contact pressure between the two sealing surfaces 10 , 22 will be attained . on the one hand , this contact pressure must be small enough to ensure that the stream of cooling medium discharged from the outlet bore 21 will not force the two coupling parts 7 , 17 apart from each other . on the other hand , the angle α must not be too small to ensure that the sealing surfaces 10 , 22 will also assume the correct relative position in which the two bores 11 , 21 are in alignment with each other . also , that edge of the coupling piece 7 which is the leading edge in relation to the direction of rotation should not be prematurely jammed against the coupling head 17 . an angle of from 6 ° to 8 ° has thus proved to be the most suitable in this connection . a positive adjustment of the relative position of the sealing surfaces 10 , 22 can also be effected by radially adjusting the coupling piece 7 after loosening the screw 9 . if the angle β is made greater than 0 °, a locking of the coupling piece 7 and the coupling head on the withdrawal of the boring tool 1 from the drive spindle 14 , should the boring tool not be withdrawn exactly in the axial direction , will be avoided . further , it is advantageous if the free end 17b of the coupling head 17 is made conical or wedge - shaped . due to this wedge - shaped construction , the coupling piece 7 , on insertion of the boring tool 1 into the drive spindle 14 , will be displaced in the direction of rotation or in the direction opposite to the direction of rotation if it should by chance strike directly against the coupling head 17 . for boring tools , the axis a -- a of the shank of which extends horizontally in operation , it is furthermore advantageous to mount a counter - weight 23 on the cooling medium supply ring 6 diametrically opposite the coupling piece 7 , which counter - weight should advantageously be radially adjustable . the radial adjustability may for example result from the counterweight 23 having a female screw - thread and being capable of being screwed on a screw - threaded stud 24 . a securing screw 25 prevents undesired rotation of both of these parts . by means of the counterweight 23 , the weight of the coupling piece 7 is balanced , so that even a small amount of friction between the tool shank 3 and the cooling medium supply ring 6 is sufficient to cause the latter to be rotationally entrained when the boring tool 1 is rotating . if no counter - weight 23 is provided , the coupling piece 7 may in certain circumstances be too heavy to be entrained for rotation in the direction d from a downwardly hanging position . in the case of vertically arranged boring tools , a counter - weight may be dispensed with . a second advantageous embodiment is illustrated in fig3 and 4 . in so far as the parts thereof have the same function as in the first constructional embodiment , they are indicated by the same references . the above description is correspondingly applicable . in the embodiment illustrated in fig3 and 4 , the coupling piece 7 &# 39 ; is secured by screws directly onto the outer circumference of the cooling medium supply ring . the coupling head 17 &# 39 ; advantageously consists of a holder 30 , which is adjustable axially with respect to the axis a -- a of the tool shank 3 and a tube 32 which is slidable in a transverse bore 31 in the holder 30 . the tube 32 can be clamped tight in the transverse bore 31 by means of a clamping screw 33 . the tube 32 can thus be adjusted approximately in the radial direction r1 , exactly at right angles to the two sealing surfaces 10 &# 39 ; and 22 &# 39 ;. for the axial adjustment of the coupling head 17 &# 39 ;, the holder 30 may have a screw - threaded stud 34 extending parallel to the axis a -- a of the tool shank 3 , which stud can be screwed into a female screw - threaded bore 35 provided in the supporting ring 15 &# 39 ; and can be fixed in position by means of a lock nut 36 . after loosening the lock nut 36 , the holder 30 can be adjusted by rotating it about its own central axis , whereby the indication of the sealing surface 22 &# 39 ; of the tube 32 can at the same time be adjusted to suit that of the sealing surface 10 &# 39 ; of the coupling piece 7 &# 39 ;. as regards the positions of the sealing surfaces 10 &# 39 ; and 22 &# 39 ; relatively to the central axis a -- a of the tool shank 3 , the information given in connection with the embodiment according to fig1 and 2 applies correspondingly . in the embodiment illustrated in fig3 and 4 , the two sealing surfaces 7 &# 39 ; and 22 &# 39 ; are inclined towards the free end of the boring tool and away from the axis a -- a of the tool shank 3 at an acute angle β of about 2 °. the central axis of the tube 22 is also correspondingly inclined at the angle β with respect to a radial plane at right angles to the said axis a -- a . the manner in which this embodiment operates when changing tools is the same as in the embodiment described previously . the flat end surface of the tube 32 at the same time constitutes the first sealing surface 22 &# 39 ;. in order to improve the sealing action between the two sealing surfaces 10 &# 39 ; and 22 &# 39 ; still further , an o - ring 37 may be arranged in a seating or annular recess in the flat sealing surface 22 &# 39 ; of the coupling head 17 &# 39 ;- which surface in this case is the lower end surface of the tube 32 -- the o - ring surrounding the outlet bore 21 of the said tube 32 and projecting only slightly from the flat sealing surface 22 &# 39 ;. the device according to the invention for supplying cooling medium is suitable for every kind of rotary cutting tool which operate with a cooling medium , and hence not only for boring tools but also , for example , for milling cutters , boring bars and inside turning tools .	8
fig2 shows the overall flow of the path abstraction based floorplanning in the context of an overall physical design methodology , according to the present invention . for clarity sake , the inventive steps are placed within the context of a conventional physical design flow ( fig1 ). the main steps are highlighted within a dashed box shown on the top right hand side of fig2 . from the input design netlist , an abstract / virtual model of the netlist is constructed . the floorplanning step uses the virtual model of the netlist ( instead of the detailed design netlist ) and constraints computed by the floorplan constraint generation step in order to determine locations for the floorplan objects of interest . the coordinates of the floorplan objects as determined by the floorplanner make use of the virtual model to update locations of the objects in the original design netlist . the remaining physical design steps , i . e ., placement and routing , utilize floorplan information from the updated design netlist . the virtual model of the design netlist will be referred to hereinafter as “ annotated abstract netlist ”, “ annotated abstract hypergraph ” or , simply , “ abstract netlist ”. objects are referred to as nodes or vertices , and the connections , hyper - edges . nodes of the “ annotated abstract hypergraph ” ( representing a virtual model of the design netlist ) are designated “ floorplan objects of interest ” and hyper - edges are referred to as connections between floorplan objects of interest . ( note : a hypergraph is a data structure that represents a set of objects and connections linking them ). the hyper - edge is also provided with annotations ( or attributes ) associated with it , with the annotations representing attraction and repulsion constraints ( which are used by the floorplan optimization algorithm ) between objects that are connected by the hyper - edge . ( the terms abstract netlist and abstract hypergraph may be used interchangeably ). referring to fig3 a that illustrates a sample design netlist , boxes referenced by l 1 , l 2 , l 3 and l 4 denote the “ floorplan objects of interest ”, whose locations on the chip are to be determined by floorplanning . circles identified as d 1 , d 2 , d 3 , d 4 , d 5 and d 6 denote the dust logic or leaf cells in the netlist . lines referenced by n 1 , n 2 , n 3 , n 4 , n 5 , n 6 , n 7 , n 8 and n 9 represent nets or connections between design objects in the netlist . referring back to the dashed box on the top right hand corner of fig2 the process of creating the virtual model of the detailed design netlist , consists of an abstract netlist generation step followed by net bundling . construction of the virtual model is initiated when the abstract netlist generation step is applied to the illustrative example design netlist . floorplan objects of interest are identified in the original design netlist , a process referred to as “ marking ”. for the example of fig3 a , the marked floorplan objects of interest are design objects l 1 , l 2 , l 3 , and l 4 . the abstract netlist generation step consists of a tracing algorithm that is executed on the original netlist . the tracing algorithm starts from a floorplan object of interest searching for a path leading to another object of interest . a path ( i . e ., a sequence of design objects , such as leaf cells or dust logic — cells other than the marked floorplan objects of interest ) and real interconnections ( or nets ) in the original netlist ) begins at a floorplan object of interest and ends on a second floorplan object of interest . in the present example , the path shown is a sequence starting in floorplan object of interest l 1 , proceeding through n 1 , d 1 , n 3 , d 2 , and n 5 , ending in the floorplan object of interest l 2 . the abstract netlist generation step identifies all the paths in the design netlist between marked floorplan objects of interest . all the paths that are identified as a result of the abstract netlist generation step for the example netlist in fig3 a are : path 1 : l 1 , n 1 , d 1 , n 3 , d 2 , n 5 , l 2 : path 2 : l 1 , n 1 , d 1 , n 3 , d 3 , n 6 , l 2 : path 3 : l 1 , n 2 , d 4 , n 4 , d 5 , n 7 , l 2 : path 4 : l 1 , n 2 , d 4 , n 4 , d 5 , n 7 , l 3 : path 5 : l 1 , n 2 , d 4 , n 4 , d 6 , n 8 , l 3 : path 6 : l 4 , n 9 , d 6 , n 8 , l 3 . the result of applying the abstract netlist generation step on the design netlist is shown in fig3 b . the step of identifying all the paths between floorplan objects of interest may result in multiple paths between the same two floorplan objects of interest . hereinafter , paths having the same starting and ending floorplan objects of interest will be referred to as “ parallel ” paths or connections . parallel paths can be advantageously grouped by way of net bundling to reduce the total number of connections in the abstract netlist that is generated . the task of net bundling is performed immediately following the execution of the tracing algorithm in the abstract netlist generation step . applying net bundling to the result of the abstract netlist generation step generates the final “ annotated abstract hypergraph ” or “ annotated abstract netlist ” as shown in fig3 c . multiple parallel connections ( paths ) existing between floorplan objects of interest ( fig3 b ) are collapsed into a single connection or abstract hyper - edge , having a width that corresponds to the number of individual paths that were merged . by way of example , in fig3 b , the three connections between l 1 and l 2 are merged into a single annotated abstract hyper - edge ( connection — with the corresponding path count and unique cell count annotations ). annotations on abstract hyper - edges consist of two parts and provide the following information : 1 ) the total number of paths between the two objects of interest , and 2 ) the number of cells on the longest path between objects of interest . the latter may contain information such as the total number of unique cells among all the paths between two objects of interest . still referring to fig3 c , the first abstract hyper - edge , denoted by an 1 connects cell l 1 and l 2 . the annotation (# paths = 3 , # cells = 5 ) on abstract net an 1 is formed by the previously described merging of paths 1 , 2 , and 3 . the second part of the annotation denoted by # cells = 5 denotes the list of cells d 1 , d 2 , d 3 , d 4 , and d 5 , resulting from merging paths 1 , 2 , and 3 . in an alternate representation , the second part of the abstract hyper - edge annotation , may also be expressed in terms of the total area of the cells instead of the count , without any loss of generality . the next step generates floorplan constraints using the abstract netlist created in earlier steps . as previously described , the goal of floorplanning is to find locations for all the floorplan objects of interest identified in the abstract netlist . connectivity between floorplan objects of interest serves as one aspect of the constraints for the floorplanner . these constraints dictate how close the floorplan objects of interest should be , i . e ., the “ attraction ” constraints between them . another aspect of the constraints is to model the space needed for the design objects not present in the abstract netlist . these space requirements are modeled as “ repulsion ” constraints between floorplan objects of interest . as mentioned earlier , the simulated annealing engine serves as a basis for the floorplanner . practitioners of the art will readily realize that other optimization techniques may be used for this purpose as well as for placing objects of interest . the objects are floorplanned such that the attraction constraints draws them in close proximity to each other when placed on the chip layout . each attraction constraint is modeled as a connection with a weight proportional to the number of paths between the objects of interest ( determined during the abstract netlist generation step ). the floorplanner then minimizes the length of the connections representing the attraction constraints . repulsion constraints are modeled by the artificial area expansion of the floorplan objects of interest . with reference to the abstract netlist shown in fig3 c , the area of the floorplan objects of interest l 1 and l 2 are expanded to account for the design objects : d 1 , d 2 , d 3 , d 4 , and d 5 , that were removed during the netlist abstraction step . information related to connections between floorplan objects of interest is provided to the floorplanner by the abstract netlist . this is illustrated in fig2 where the arrow leaving the oval represents the abstract netlist to the floorplanner . annotations on the abstract hyper - edges of the abstract netlist are used in the floorplan constraints generation step , to obtain the aforementioned attraction and repulsion constraints that are directly used by the floorplanner . in fig2 this is shown by the arrow between the output of the floorplan constraint generation step to the floorplanner . the output of the floorplanner are locations of the floorplan objects of interest on the chip layout . for the example illustrated in fig3 a , the floorplan is shown in fig3 d . therein , floorplan objects of interest l 1 , l 2 , l 3 and l 4 are assigned locations ( x 1 , y 1 ), ( x 2 , y 2 ), ( x 3 , y 3 ), and ( x 4 , y 4 ) on the two - dimensional layout of the chip . hereinafter , details pertaining the main objectives of the invention , such as abstract netlist generation , net bundling , floorplan constraint generation and floorplanning steps will be described . in this section , the main algorithm that creates an abstract netlist from a given design netlist will be explained with reference to the dashed box in the top right hand corner of fig2 . the abstract netlist generation step starts following a description of the algorithm . shown in fig4 is a top level view of the abstract netlist generation algorithm . there are two distinct phases in the abstract netlist creation process , namely : marking phase , where floorplan objects of interest are identified in the design netlist , and abstract network generation or tracing phase , wherein paths between floorplan objects of interest are identified as abstract or virtual interconnections between objects . the result of the marking phase is a list of design objects : the marked object of interest list . the network generation phase accepts the list of floorplan objects of interest and computes the set of paths among the floorplan objects of interest . the output of the abstract network generation phase is a list of abstract hyper - edges ( or abstract nets representing the paths ). the abstract hyper - edge is a data structure consisting of the following information : list of unmarked objects ( design objects in the netlist that are not floorplan objects of interest ), existing in the path between the source and destination floorplan objects of interest ; the abstract network generation phase performs a path enumeration starting from each of the marked floorplan objects of interest . path enumeration is known to be a problem that increases exponentially . in order to limit the complexity of the problem , the abstract network generation algorithm is provided with parameters to control the execution of the algorithm . these will be discussed hereinafter along with the abstract network generation algorithm . the marking phase refers to the process of identifying floorplan objects of interest in the original design netlist . classes of objects / individual objects are identified and marked on the original netlist . the classes of objects most commonly supported are : latches , ios , macros , large objects , and fixed objects . individual objects of interest may also be marked in a given design netlist ( i . e , an abstract netlist includes marked objects of interest falling into more than one of the categories ). the marking process can be static or dynamic . for the static case , objects of interest are predetermined and the subsequent network generation algorithm does not have any control over which objects of interest are to be marked ( i . e ., start / stop points for the abstract network tracing algorithm ). for the illustrative netlist shown in fig3 ( a ), the design objects l 1 , l 2 , l 3 , l 4 are identified as floorplan objects of interest . the output of the marking phase for this example is the list of floorplan objects of interest (& lt ; l 1 , l 2 , l 3 , l 4 & gt ;) which is used by the next phase of abstract network generation . this illustrates static marking , where the list of floorplan objects of interest are not changed , remaining the same throughout the process of floorplan object of interest identification ( marking ), abstract network generation ( tracing ), and the like . static marking is the most commonly used mode of performing the marking process . this function marks all the cells that fall within a particular type of cell . the function identifies a large object based on the number of circuit rows occupied by it ; a macro , by the presence of any child elements within ; io and latches based on their cell property . once identified , these cells are tagged in the design netlist to be objects of interest . the result of the marking process is shown on the top right hand side of fig4 b . therein is shown the illustrative design netlist introduced in fig3 a following the marking process . in fig4 b , the marked floorplan objects of interest , i . e ., l 1 , l 2 , l 3 , l 4 , are depicted by dashed boxes . cells are also individually marked . typically , for the floorplanning , i / os , macros and large objects are marked to be of interest . ( these are the objects whose location on the layout needs to be determined by the floorplanner ). in the case of static marking , the list of identified floorplan objects of interest are not modified during the marking process . in addition to the floorplan objects of interest , one may also determine that some design objects ( not identified to be a floorplan object of interest ) need to be marked as additional floorplan objects of interest in order to improve the abstract netlist being generated . the identification of these additional floorplan objects of interest based on properties of the design netlist is referred to as “ dynamic marking ”. the basic property used for identifying additional floorplan objects of interest requires that the total number of inputs and outputs from a single design object exceed a pre - defined threshold . ( if certain design objects in the netlist have a high number of pins associated with them ). if this property is satisfied and the design object satisfying this property has not already been marked , then the additional design object becomes a primary candidate for marking . this phase refers to the task of generating the abstract network between objects of interest that were marked in the previous phase . the basic network generation algorithm is a modified depth first search on the design netlist . the algorithmic process , generateabstractnetwork , addresses the main abstract netlist ( hypergraph ) generation as follows : i . hyper - edgevector = tracenets ( n , foi ) the algorithm ‘ generateabstractnetwork ’ accepts the design netlist and a vector of marked floorplan objects of interest . the vector is a standard data structure that contains a list of elements of a given type . it provides random access to elements , allows for a constant time insertion , removes elements at the end of the vector , and provides linear time insertion and removal of elements at the beginning or in the middle of the vector . a vector can , generally , be viewed as having the same meaning as a linked list . more information regarding vectors can be found in a c ++ text , like “ the c ++ programming language ” by bjarne stroustrup . steps 2 - 6 of the algorithm are initialization steps . each design object has a flag referred to as “ visited ” associated with it . the flag is set during the recursive tracing algorithm tracenet , if the particular design object was visited during the process . the nodevector is a vector of design objects ( which are not floorplan objects of interest ) that were abstracted in the process of searching for a path to other floorplan objects of interest from the starting floorplan object of interest ( foi ). this nodevector is constructed as a result of executing tracenet on each of the floorplan objects of interest belonging to the vector containing the objects of interest . step 7 addresses the main loop that encompasses the list of floorplan objects of interest , executing the tracenet for each net connected to the floorplan object of interest . the result of executing tracenet is the creation of a vector of abstract hyper - edges representing alternate paths from certain floorplan objects of interest to other floorplan objects of interest . the list of hyper - edges obtained from a single call to tracenets is merged into the global list of abstract hyper - edges , represented by the variable abstracthyper - edge vector . step 7 ii illustrates the merging step . for the example illustrated with reference to fig3 ( a ), following completion of the marking process , the input to generateabstractnetwork is a vector containing the four floorplan objects of interest l 1 , l 2 , l 3 , l 4 . tracenet is executed for each of the objects . for instance , for object l 1 ( fig3 a ), in step 7 of generateabstractnetwork , there are two calls made to tracenet , one to net n 1 , and the other to net n 2 . the first call tracenet ( l 1 , n 2 ) results in a vector of abstract hyper - edges . referring to fig3 b , the vector of abstract hyper - edges contains two paths : path 1 and path 2 . the second call to tracenet with floorplan object of interest l 1 , tracenet ( l 1 , n 2 ) ( i . e ., with net n 2 ) results in a vector of abstract hyper - edge containing path 3 . 6 . for each design object d belonging to net n do a . if d is a floorplan object of interest then c . else /* d is an unmarked design object in the the above process tracenet recursively traces the nets for each marked floorplan object of interest , with the intent of finding paths between objects of interest . certain controls exist with which the user controls the overall recursive tracing process . the user can opt to ignore tracing from special nets . clocks or scan nets having a very large fan - out are examples which the user may ignore while creating the abstract netlist . other commands may be used to control the tracing that imposes a limit on the logic depth . if this constraint is set by the user , then the tracing algorithm identifies only those paths ( between the floorplan objects of interest ) having the total number of unmarked design objects thereon to be less than the constraint specified by the user . steps 2 , 4 of tracenet implement these controls in the tracing process . the variable logicdepthconstraint in step 4 reflects the user defined logic depth constraint . if the current number of logic levels ( kept track of in the variable logiclevels by the tracing process in algorithm tracenet ) exceeds this constraint , then the tracing process is brought to a stop . the for loop in step 6 addresses each design object connected to the net . the if statement in step 6 a checks whether the design object is a floorplan object of interest . if the answer is yes , then an abstract hyper - edge ( path ) is established between startfoi ( the floorplan object of interest with which the tracing process started ) and d ( the current design object ). referring to fig3 b , this step of the algorithm creates an abstract hyper - edge ( path 1 in fig3 b ) between l 1 and l 2 , and sets the list of unmarked design objects ( that have been abstracted away ) on this abstract hyper - edge to be equal to d 1 and d 2 . the variable activepathvector denotes the set of unmarked design objects that are currently in the path ( abstract hyper - edge ) being constructed by the tracing process . each design object has a “ visited ” boolean attribute associated with it . this attribute indicates whether the design object was already reached and identifies that a loop was detected , which would then be ignored . the way of breaking loops among design objects is shown by the else if statement in step 6 ( b ) of tracenet . step 6 c shows the step of recursive stepping through unmarked design objects ( non - floorplan objects of interest ) of the netlist . the algorithm at step 6 c implies that the current design object d is not a floorplan object of interest , and that it is not a loop . in the sub - steps following step 6 c , the design object d is marked as visited , saved into activepathvector and nodevector , and a recursive call is made from each net connected to the design object d , thereby seeing through or ignoring the non - floorplan objects of interest during the tracing process . fig6 a shows an input hypergraph with marked vertices { a , b , c , d }. the top - level abstract network generation algorithm accepts such a hypergraph with marked vertices , invoking the recursive net tracing algorithm for each of the vertices a , b , c , d . each vertex has the attribute visited . if it is set , it is an indication that the particular design object was visited during the recursive tracing . saving design objects being recursively stepped through into a “ node vector ” and resetting their visited attribute before calling tracenet for the next marked floorplan object of interest in the top - level function ensures that all the paths between the floorplan objects of interest are represented in the final abstracted hypergraph . in the example of fig6 a , during the creation of abstract hyper - edges ( a , c ) and ( a , d ) in the first call of tracenet ( a , e 1 ), intermediate nodes 1 , 2 , 3 are marked visited . had the node vector color resetting not been used , then the path ( a , d ) through nets e 4 , e 6 and intermediate design object 4 , would not have be found . this is because the net tracing algorithm starting from node b stops at node 3 , as this node would already have been marked as visited . this example illustrates why a conventional depth first traversal is inadequate for the abstract hypergraph generation problem being solved by the abstract network generation algorithm presented herein . the result of the abstract network generation algorithm is a vector of abstract hyper - edges that are represented as path 1 , . . . , path 6 , in fig3 b . the annotations on these abstract hyper - edges are used by the floorplan constraint generation phase to generate the constraints that drive the floorplanner . thus , making the floorplanner aware of the intermediate logic that was abstracted allows the floorplanner to account for the real estate required to place the abstracted intermediate cells . the next section describes the net bundling technique . net bundling step identifies parallel connections and reduces the number of abstract hyper - edges in the network generated by the netlist abstraction process . furthermore , during this process it generates the final annotations on the abstract hyper - edges . once the abstract netlist is generated , other abstract nets or connections between the same sets of floorplan objects of interest may be put in place . for example , in fig3 b , the abstract netlist generation step created three abstract nets or interconnections between the floorplan objects of interest l 1 and l 2 . a widely used metric to drive / evaluate a floorplanner is provided by the total interconnect wirelength ( twl ). during the process of annealing , objects are moved around on the chip layout and the wirelengths are recomputed after each move to evaluate the quality of the floorplan . when a floorplan object is moved from its original position to a new position , the length of the nets connected to that object is no longer valid . in order to evaluate the goodness of this move , the length of the nets belonging to that object is recomputed . if the object contains a large number of terminals , then the process of recomputing the nets significantly increases the run - time . in order to reduce the run - time of the wirelength estimation and of the annealing algorithm , the concept of net - bundling is introduced . net - bundling identifies “ parallel edges ” ( connections ) in the abstract netlist ( or hypergraph ) of the given design and bundles them as a single edge . parallel connections are defined as connections in the netlist that link the same set of floorplan objects of interest . referring to fig3 b , paths p 1 , p 2 and p 3 span between floorplan objects l 1 and l 2 . thus , these paths are parallel edges . the three paths can be merged into one ( represented by abstractnet an 1 in fig3 c ). the formation of a single annotated hyper - edge : an 1 from three separate abstract nets denoted by path 1 , path 2 , and path 3 is shown in fig5 b and 5 c . assuming that each path pi is associated with a weight w pi . the weight reflects the criticality of the path . then , the total weighted wirelength for all the paths between the floorplan objects l 1 and l 2 is : where l p1 , l p2 and l p3 represent the length of the paths p 1 , p 2 and p 3 , respectively . in order to compute wl ( l1 , l2 ) without using net ( or path ) bundling , three multiplications and two additions are required . however , with net bundling , the three paths are represented as a single path bundle pb with a weight w pb such that the wirelength of path pb is the same as that of paths p 1 , p 2 and p 3 . thus , the total weighted wirelength using path bundling is calculated as : resulting in a only one multiplication . it can be seen that this result is the same as the one obtained by resorting to net bundling , except for certain redundant computations that were removed and which , in turn , reduced the time required for computing the wirelengths . output : list of abstract hyper - edges with updated annotations after bundling : olist the above algorithm provides an overview of net bundling . the input to this process is a vector of abstract hyper - edges that was created by the abstract netlist generation process . this is denoted by the variable ilist . the function isparallel accepts two abstract hyper - edges ( e . g ., path 1 , path 2 in fig5 b ) and checks whether the source and destination of both abstract hyper - edges is the same . if they are , it returns true ; otherwise , it returns false . the mergehyper - edges function in step 4 . i . 1 of the net bundling procedure accepts two abstract hyper - edges that are parallel , and increments the path count annotation between the source and destination floorplan objects of interest , merging the two lists of unmarked objects that occur on the hyper - edges being combined . merging is achieved by removing duplicate design objects between the hyper - edges being merged . the cell count is correspondingly set by the size of the merged list of abstracted design objects . referring to fig5 b and 5 c , net bundling results in generating the bundled abstract nets an 1 , an 2 , and an 3 along with the annotations from the list of paths : path 1 , path 2 , . . . , path 6 , that were generated by the abstract network generation step . the abstraction model modifies the original netlist in two ways . firstly , it reduces the number of objects seen by the floorplanner , i . e ., the number of objects requiring to be floorplanned are fewer than the number of placeable objects in the design . secondly , the abstraction model removes nets from the original netlist and adds new nets in the abstract netlist seen by the floorplanner . following is described a method of modeling changes so that the floorplanner can be driven effectively . the attraction between two floorplan objects depends on : 1 ) the number of paths between two objects , and 2 ) the number of objects abstracted out between them . the larger the number of paths , the higher the attractive force between the floorplan objects . however , if a large number of objects is abstracted between objects , then the attraction force loses some of its effectiveness . thus , the attractive force f a ( i , j ) between two objects i and j is directly proportional to the number of paths ( np ), and inversely proportional to the number of objects ( na ) abstracted between them . thus , if k a is a proportionality constant , then the force equation becomes : assuming k a = 1 , the attraction constraints for the example shown in fig3 c become objects that are abstracted are real design objects that share the placement area with the floorplan objects of interest when the chip is completed . ( an object in the design that is not a floorplan object of interest is referred to as an abstracted object ) thus , it is important to keep this factor in mind when floorplanning with an abstract netlist . if these objects were not considered , it is possible to generate a floorplan purely based on attraction constraints , and the floorplan objects may end being placed abutting with each other . this is an unsatisfactory solution and , thus , space must be allocated for the placement of objects that are abstracted out . allocation of space for abstracted logic is achieved by considering the area of design objects abstracted out . the total area of all the design objects that were abstracted in a path p is added , and proportionally distributed among the floorplan objects on that path . alternatively , one may temporarily increase the size of the floorplan objects to account for the area of the abstracted objects . the area increase of the floorplan objects is proportional to the respective original areas . since the abstracted objects appear in multiple paths , only a fraction of their areas for each path in which they appear will be distributed . otherwise , more space is allocated than needed for the objects abstracted out . thus , for e . g ., if an abstracted object ai having an area aai appears in three paths , then , an area is allocated equaling aai / 3 for each path where it appears . let a ( i , j ) be the sum total of the fractional area of all the objects abstracted out between floorplan objects i and j contained in path p . let ai and aj be the original areas of the objects i and j , respectively . the area of objects i and j increases as follows : the increased areas for the objects l1 and l2 from path 1 in fig3 b becomes where a is the fractional area of the two objects d1 and d2 abstracted out in the path 1 between objects l 1 and l 2 . each floorplan object thus get its area increased based on the objects abstracted out in each path which starts or ends with it . during floorplanning , the optimizer sees the increased size of the floorplan objects and generates a floorplan with spaces between them . a subsequent placement program can then place the abstracted out objects in the spaces created by the floorplanner . a solution to the floorplanning problem is positioning all the floorplan objects of interest on the chip layout . a multi - constrained floorplan optimization technique refers to a method of finding a placement solution for the floorplan objects of interest that optimizes a number of cost objectives . an important cost objective for a floorplanner is to minimize the total interconnection length . in the present case , attraction constraints introduced by the abstraction model are represented by weighted interconnection lengths . also , for a given solution , the arrangement of the floorplan objects can be such that two or more of them may overlap . it is typical for any floorplanner to model the overlap score into the set of cost functions that are minimized . overlaps are minimized as well . thus , the cost function has two objectives to be minimized , which are : 1 ) attraction constraints represented as weighted interconnection lengths , and 2 ) the total overlaps . the cost function c s is represented for a given floorplan solution s as where k l and k o are constants , l is the total weighted interconnection length ( of the abstraction constraints ) and o , the total overlap score . note that in this framework other constraints ( such as timing , displacement , and the like ) may be added to the cost function as well . simulated annealing can be advantageously used for the underlying floorplanner . its randomized optimization allows modeling multiple constraints to drive the solution process . the annealing process begins with a random initial solution . the solution is then perturbed a large number of times to converge on a better solution that minimizes the cost objective . the final converged solution is shown to be for many instances near - optimal . the annealer accepts all the solutions that improve their quality , although it may also accept with some probability solutions that degrade the quality . this is the main reason for the annealing process to succeed . during early stages of annealing , larger perturbations are made to the solution and larger degradations are accepted . as the technique progresses , the perturbations become smaller and the accepted degradations become more stringent as well . the resulting solution provides location information of all the objects of interest having a high quality for a given cost objective ( i . e ., the total weighted interconnection length and overlaps are minimal ). a subsequent verification step certifies the position ( remove any remaining overlaps ) of the floorplan objects . thus , simulated annealing achieves an optimal arrangement of the floorplan objects of interest obtained with an awareness of the intervening objects that were abstracted out . the floorplan objects are then fixed in the chip layout and the placement tool is invoked to place other design objects on the chip layout . the result of floorplanning for the example shown in fig3 a is the arrangement of the floorplan objects of interest on the layout illustrated in fig3 d . while the presented invention has been described in terms of a preferred embodiment , those skilled in the art will readily recognize that many changes and modifications are possible , all of which remain within the spirit and the scope of the present invention , as defined by the accompanying claims .	6
embodying examples of this invention will now be explained with reference to the accompanying drawings : referring to fig1 - 5 showing one embodying example thereof , numeral 1 denotes a letter paper for a bill , for instance , formed by printing out necessary descriptive matters such as an address 2 , amounts of money 3 , and others filled in the predetermined blank portions thereof by a thermal printer arranged to be operated in conjunction with a computer , and the printed letter paper 1 in an unfolded condition shown in fig3 is so folded in three that the address 2 may appear on its front side and the amounts of money 3 may be on its rear side , as shown in fig4 . this folded letter paper 1 is inserted , as shown in fig5 between a pair of long front and rear sheets 4a , 4b drawn out from respective rolls ( not illustrated ) for being covered therewith at its front and rear surfaces , and is heated by a pair of heating rolls 5 , 5 . in this case , the front sheet 4a is made of transparent paper 9 such as glassine paper which is laminated , at its rear surface , with a transparent and thermal adhering synthetic resin film 10 such as of hot melt type resin , thermoplastic resin , etc ., and the rear sheet 4b is made of transparent paper 11 which is laminated , at its front surface , with a transparent and thermal adhering synthetic resin film 12 . thus , by the foregoing heating operation , the synthetic resin films 10 , 12 at such peripheral portions of the front and rear sheets 4a , 4b that surround the folded letter paper 1 are adhered together by heat to form an enclosed sealed portion 6 , and thus there can be produced a sealed letter 8 as shown in fig1 . if , as shown in fig8 the printed letter paper 1 is interposed between the front sheet 4a and the rear sheet 4b which are formed by folding a single long sheet in two , there is produced the sealed letter 8 of such a type that out of the peripheral four sides thereof one side is lacking in the sealed portion 6 as clearly shown in fig6 and that the front sheet 4a and the rear sheet 4b are made of the same materials 9 and 10 . in any of the above embodying examples , a printed matter or the like can be enclosed together with the printed letter paper 1 in the enclosed sealed sheets 4a , 4b . the transparent paper 9 constituting the front sheet 4a is preferably made of glassine paper , so that characters or the like can be written thereon in water - color ink . the front sheet 4a may be modified so that the front surface of the transparent paper 9 thereof is also laminated with a transparent synthetic resin film 13 , as shown in fig9 so that a waterproof property thereof is improved and also the rigidity thereof is increased . further , in this case , if the front synthetic resin film 13 is thicker than the rear synthetic resin film 10 , breaking the sealed letter is facilitated . numeral 14 is a stamp mark affixed onto the front surface of the letter paper 1 . instead thereof , the front sheet 4a itself may be previously affixed , by printing , with a stamp mark 14 or the like , as shown in fig1 . in another embodying example shown in fig1 , the rear sheet 4b is made of opaque ordinary paper 11a such as kraft paper , roll paper or the like , and in a further another embodying example shown in fig1 , the rear sheet 4b is formed of a lamination of an opaque paper 11a and a thermal adhering synthetic resin film 12a applied to a front surface of the paper 11a . in the latter case , the paper 11a may be applied also on its rear surface with a synthetic resin film 12b , as shown by a chain line in the same figure . if the rear sheet 4b is opaque as shown in these examples , even when the printed letter paper 1 is folded so that the last section thereof including the correspondence contents may appear on its rear surface , as shown in fig1 , the rear surface thereof is covered with the rear sheet 4b and cannot be seen from outside and therefore the last section of the printed letter paper can be utilized effectively for correspondence description . referring to the drawings , numeral 15 denotes a folding line , and the folding line may be provided with perforations so that the letter paper may be formed of plural separable sections . thus , according to this invention , letter paper on which an address and any other necessary matters are printed by a printer of a computer is covered , at its front surface , with front sheet made of transparent paper applied with a transparent and thermal adhering synthetic resin film , and is covered , at its rear surface , with a rear sheet made of any paper material , and the front sheet and the rear sheet are adhered together by heat at their peripheral portions so as to form a sealed letter , so that any coating of an adhesive agent on the letter paper can be eliminated , and consequently there can be removed such a trouble as disorder of a thermal printer caused by the adhesive agent . additionally , the manner of folding the letter paper can be carried out in any manner provided that the printed address thereof should appear on the front surface . additionally , for the front sheet and the rear sheet are made chiefly of paper material , the sealed letter can be easily broken for opening the same , and for the front sheet has the synthetic resin film , it can prevent the sealed letter from getting wet with rain or the like .	1
a camshaft adjuster of an internal combustion engine according to the present invention , including a stator 1 and a rotor 2 , is apparent in fig1 . stator 1 has a cup - shaped design and is provided with a toothing 3 on its outside for the purpose of being driven by a crankshaft via a chain or toothed belt . rotor 2 is connectable to a camshaft in the known manner , e . g ., via a central screw , and is driven to a rotary motion with the aid of stator 1 . stator 1 furthermore includes a plurality of stator webs 20 , 21 , 22 , and 23 , including threaded bores 4 situated therein , which divide an annular space provided between stator 1 and rotor 2 into multiple pressure chambers i . rotor 2 includes a plurality of vanes 14 , 15 , 16 and 17 , which extend radially outwardly to the inner wall of stator 1 and divide each pressure chamber i into two working chambers a and b . a translucently represented sealing cover 5 is furthermore provided , which is screwed into threaded bores 4 of stator 1 with the aid of fastening screws and which includes four locking gates 6 , 7 , 8 and 9 . four locking pins 10 , 11 , 12 , 13 are also provided in rotor 2 , which are spring - loaded in the engagement direction of locking gates 6 , 7 , 8 and 9 and to which pressure medium may be applied via a common pressure medium channel 26 for the purpose of unlocking from locking gates 6 , 7 , 8 and 9 . during operation of the internal combustion engine , pressure chambers i are filled with pressure medium at least after a certain start phase , whereby the rotary motion of stator 1 is transmitted to rotor 2 . locking gates 6 , 7 , 8 and 9 are ring segment - like or circular arc - shaped recesses or indentations in sealing cover 5 , which are oriented and dimensioned in such a way that their center lines run on a common diameter . upper left vane 14 in the illustration is designed to be wider than remaining vanes 15 , 16 and 17 and is used as a stop for rotor 2 for the purpose of limiting the rotary motion of rotor 2 with respect to stator 1 in the “ advance ” and “ retard ” stop positions . in order for rotor 2 to rotate into the provided stop positions in a preferably controlled manner without it being blocked in its rotary motion , e . g ., by existing production radii , recesses 18 and 19 are provided on vane 14 on its outer edge sides extending into the illustration plane . for the same reasons , recesses 24 and 25 are provided on the two stator webs 20 and 21 , which delimit pressure chamber i in which vane 14 is situated , on the radially inner edge sides extending into the illustration plane . in the illustration in fig1 , rotor 2 is in the “ retard ” stop position , i . e ., rotor 2 rests with vane 14 against the right side of stator web 20 delimiting pressure chamber i . in this position of rotor 2 , working chamber a has the smallest volume and working chamber b to the right of vane 14 has the largest volume . in the event that the internal combustion engine is suddenly turned off in this position of rotor 2 or , e . g ., if it suddenly shuts down due to stalling , problems may arise when the internal combustion engine is restarted , which are to be eliminated by the automatic reverse rotation of rotor 2 , which is described below , into central locking position mvp apparent in fig7 . the alternating torques which act upon the camshaft when the camshaft adjuster is not yet completely filled with pressure medium , in connection with the design of locking gates 6 , 7 , 8 and 9 , locking pins 10 , 11 , 12 and 13 proposed according to the present invention , are used for the automatic reverse rotation of rotor 2 into central locking position mvp as described below . in the “ retard ” stop position illustrated in fig1 , first locking pin 10 already engages with locking gate 6 , while the other locking pins 11 , 12 and 13 still rest against the side wall of sealing cover 5 outside locking gates 7 , 8 and 9 . it is important that first locking pin 10 engages with locking gate 6 in such a way that rotor 2 is able to rotate relative to stator 1 at least clockwise in the direction of central locking position mvp . in the event that a torque acts upon rotor 2 in the clockwise direction in this position of rotor 2 , rotor 2 is rotated clockwise with respect to stator 1 into the position in fig2 , in which second locking pin 13 locks into adjacent locking gate 9 . if a subsequent torque occurs in the opposite direction , rotor 2 can no longer rotate back into the “ retard ” stop position . the next time a torque oriented in the clockwise direction acts upon the camshaft and thus on rotor 2 , the latter continues to be rotated in the clockwise direction into the position illustrated in fig3 , in which second locking pin 13 locks into locking gate 9 . locking pin 10 is also moved into locking gate 6 , so that it no longer rests against the radially oriented edge section of locking gate 6 . the reverse rotation of rotor 2 back to the “ retard ” stop position is blocked in this position of rotor 2 by locking pin 13 , which rests against the radial edge section of locking gate 9 . during another rotation of rotor 2 , locking pin 12 finally locks into locking gate 8 ( see fig3 ) in a next step , and last locking pin 11 finally locks into locking gate 7 in the central locking position mvp illustrated in fig7 . in central locking position mvp illustrated in fig7 , locking pins 10 and 11 rest against the radial edge sections of locking gates 6 and 7 , so that rotor 2 is locked with respect to stator 1 in both directions of rotation . the same camshaft adjuster having rotor 2 situated in the “ advance ” stop position is apparent in fig4 , in which rotor 2 rests with vane 14 against stator web 21 , which delimits pressure chamber i on the other side . locking pin 11 is already locked into locking gate 7 . if the internal combustion engine is started with the aid of a rotor 2 in this position , rotor 2 is gradually rotated counterclockwise into the position shown in fig5 and fig6 , based on the same principle of the active alternating torques , locking pins 12 and 13 consecutively locking until last locking pin 10 finally locks into locking gate 6 , and rotor 2 is blocked with respect to stator 1 in central locking position mvp illustrated in fig7 . the automatic reverse rotation of rotor 2 from the “ advance ” and “ retard ” stop positions is based on the same principle , with the difference that , during a rotation of rotor 2 from the “ advance ” stop position , locking pins 10 , 11 , 12 and 13 lock into locking gates 6 , 7 , 8 and 9 in the reverse order and from different directions than during a reverse rotation of rotor 2 from the “ retard ” stop position . the automatic reverse rotation of rotor 2 is thus implemented using the same locking pins 10 , 11 , 12 , 13 and locking gates 6 , 7 , 8 and 9 , so that no additional costs arise compared to the approach known from the prior art . fig8 shows two locking gates 6 , 7 , 8 , 9 in which the first and second locking pins 10 , 11 , 12 , 13 lock during a rotation of the rotor 2 from the “ advance ” or “ retard ” stop position are situated axisymmetrically to a middle axis x . sealing cover 5 , including locking gates 6 , 7 , 8 and 9 , is apparent in fig8 . a sectional representation along section line f - f of locking gate 8 is shown in the illustration on the right . locking gates 8 and 9 , in which second or third locking pin 12 or 13 locks during a rotation of rotor 2 from the “ advance ” and “ retard ” stop positions , are each provided with steps 27 on their edge sections of the base surface oriented in the circumferential direction , while locking gates 6 and 7 , into which first or last locking pin 10 or 11 locks , are provided with steps 27 only on their edge sections of the base surfaces facing each other . this is due to the fact that locking pins 10 and 11 always lock into locking gates 6 and 7 only from one side during the automatic reverse rotary motion , since one of locking pins 10 and 11 already engages with locking gate 6 or 7 in the “ advance ” and “ retard ” stop positions . steps 27 each form stop surfaces in the manner of a grid pattern , against which locking pins 10 , 11 , 12 and 13 rest in the circumferential direction in the intermediate positions between the “ advance ” and “ retard ” stop positions and central locking position mvp . as a result , the reverse rotation of rotor 2 is blocked in the direction of the “ advance ” and “ retard ” stop positions , and a continued rotation of rotor 2 in the direction of central locking position mvp is simultaneously facilitated .	5
fig1 illustrates a portion of an integrated circuit being fabricated showing a substrate 10 that will contain underlying layers , e . g . source / drain areas of planar transistors , other lower interconnect structures , the bulk silicon , etc , not shown in this figure . dielectric 20 is illustratively an interlayer dielectric such as silicon dioxide , a fluorinated silicon dioxide , a silicon oxycarbide material ( such as black diamond ™ from applied materials ), an organic material such as silk ™ or polyimide . the thickness of this material is typically in the range of 500 - 1000 nm , with preferred values of 600 - 800 nm . this material will be referred to as the pattern layer , since the result of the process is the formation of a pattern of apertures in this layer . a hard mask 30 such as nitride ( si3n4 ) or polysilicon will be patterned with a hole that is larger than the desired final size and , after processing according to the invention , serve as the mask to etch an aperture through dielectric 20 . preferably , the initial hole will be formed by conventional lithographic techniques . if the desired final size is so much smaller than the smallest conventional aperture , the initial hole may be formed by a sublithographic technique such as sidewall image transfer . a layer 40 containing si — oh bonds ( or having a fraction of oxide , sio2 ) has been deposited over the hardmask layer 30 . this layer 40 will serve as a seed layer for the selective deposition of silicon oxide from an aqueous solution . this oxide - containing material can be a conventional layer of cvd oxide such as teos , or a spin - on glass material , or a silsesquioxane material . layer 40 could also be a siloxane resist material that is photo sensitive and may be directly imaged with a contact hole pattern . layer 40 could also be an anti - reflective layer ordinarily used for a photoresist layer , e . g . hosp , available from honeywell . the seed layer 40 can range in thickness from 20 - 200 nm , with a range of 20 - 50 nm preferred for an oxide or antireflective layer and 100 - 200 preferred for a resist layer . typically , resist layer 50 is spun - on over seed layer 40 , exposed and developed to form the structure in fig1 , having aperture 52 with dimension 55 . dimension 55 may be sublithographic using a standard technique or it may be formed by a conventional lithographic process . a directional oxide etch ( illustratively with chf3 / o2 mixtures at 10 - 100 mtorr , with the wafer biased to create an ion - driven etch process at the wafer surface ), stopping on nitride 30 , is used to remove the oxide - containing seed layer 40 at the bottom of the aperture 52 to produce the result shown in fig2 . with the vertical sides of the oxide - containing seed layer 40 exposed ( and the top surface covered by the resist ) the wafer is immersed in a saturated hydrofluoro - silicic acid h2sif6 solution , as described in the us patents listed in the background section of the specification , and a film of oxide is grown on the exposed vertical surface through lpd . the thickness of the lpd - grown film can range from 5 - 50 nm or so , for high - density cmos applications , in which case the width 55 of the contact hole pattern in aperture 52 ′ is reduced by a corresponding 10 - 100 nm . the amount of oxide that is permitted to grow will depend on the desired width reduction and may preferentially be 20 - 30 nm for many applications . fig3 shows the result of the lpd step , in which an oxide film 45 has been formed on the vertical surfaces of seed layer 40 . the diameter of the aperture has been reduced to a value 47 , equivalent to the value 55 minus twice the thickness of film 45 . several options are available to achieve a selective oxide deposition process . if a high quality silicon nitride layer is used as the hardmask 30 , then it will not react with the hydrosilicic acid , in the case of ldp , or with trimethyl aluminum , in the case of the ald growth of silicon oxide . alternatively , if layer 30 is composed of polysilicon , it can be passivated with fluorine by exposing it to hf vapor prior to ldp or ald oxide growth . in another option , one can use a siloxane resist over nitride layer 30 , or over polysilicon layer 30 , or over an unreactive organic underlayer such as diamond - like carbon annealed in hydrogen , parylene , or bottom antireflective coating . these undercoat films may also be treated with hexamethyidisilazane prior to resist apply , as a means of masking any reactive chemical species on their surface . the siloxane resist is exposed and developed down to the unreactive organic underlayer , followed by growth of the lpd or ald oxide film directly onto the siloxane resist . in an alternative to the growth of the oxide film by lpd , one might also use an atomic layer deposition process , such as that disclosed in us 2004 / 0043149 ( incorporated by reference ). in this process , a vapor of trimethylaluminum reacts with active hydroxyl groups on the surface of silicon oxide or siloxane films to create a surface - bound aluminum catalyst species . then , a vapor of tris ( t - butoxy ) silanol is introduced to the substrate to grow films of 5 - 12 nm , depending on reaction time and temperature , at 200 - 300 c . the catalyst treatment can be repeated , followed by exposure to fresh silanol reagent , to grow films of the desired thickness . this process is highly uniform and conformal , due to its nature as a surface - limited reaction . fig4 shows the result of stripping resist 50 and etching through hardmask 30 and then through ild 20 . the lpd film 45 serves to define the dimension of the aperture formed in hardmask 30 . after the aperture in hardmask 30 is formed , the hardmask defines the width of aperture 100 . it does not matter , therefore , if the etch process used for ild 20 attacks the film 45 . fig5 illustrates in a partially pictorial , partially schematic view of an integrated circuit , in which substrate 10 represents a bulk or soi substrate , and a transistor 100 having source / drain 102 has been formed by conventional deposition , lithography and implantation techniques . a first level dielectric 20 has apertures formed according to the invention filled with a conductor 104 to form vias , one of which connects to block 400 that represents schematically the remainder of the integrated circuit . the preliminary steps of blanket implants , forming the various transistors will be referred to for purposes of the claims as preparing the substrate and the later steps after the sublithographic vias have been formed ; i . e . forming the interconnects and the remainder of the back end processing will be referred to as completing the circuit . the etching techniques and etch chemistry will depend on the material being etched and the underlying layer below that material . in an illustrative example , the material of layer 40 is oxide , the material of layer 30 is nitride , and the material of layer 20 is oxide . the etch process to form aperture 52 ′ is a conventional oxide etch that stops on nitride 30 . the etch process to form aperture 100 is also a conventional oxide etch that is resisted by hardmask 30 . advantageously , the thickness of layers 40 and 50 are set such that resist layer 50 and seed layer 40 are both consumed during the etch process that opens aperture 100 , so that a removal step for these layers is not required . if that is not practical in a particular example , then any remainder of layer 40 will be stripped . in a particular example in which layer 40 is a siloxane photoresist , layer 50 will not be used and aperture 52 ′ will be formed directly in layer 40 . while the invention has been described in terms of a single preferred embodiment , those skilled in the art will recognize that the invention can be practiced in various versions within the spirit and scope of the following claims .	7
referring to fig1 , model classes 14 implement or extend a duplicatable interface 11 which defines method required by a duplicatable model . the interface also ensures there are bi - directional references 12 , 13 between the duplicated and the duplicate instances so that updates may be sent from a duplicated instance to all duplicates , and changes may be synchronized from a duplicate to the duplicated instance . this architecture allows for the duplicate object to use the same class source as the duplicated object . duplicates of models may be created within a single process from a non duplicate model , or from a duplicate model as shown in fig2 . this object interaction diagram shows that a duplicate context object 23 is used to create and maintain a model object 21 which is a duplicate of a model object 20 . the arrows 25 , 26 show that changes flow from the duplicate object to the duplicated object and updates to the duplicated object flow back to the duplicate objects . this diagram also shows that a duplicate object 22 can be created from a duplicate object 21 using a different duplicate context instance 24 , allowing a tree of duplicate objects to be created . in fig3 , we are demonstrating a more complex and concrete object interaction diagram for a contact object which contains addresses and a name , and references a spouse contact . the contact duplicate 30 references a duplicate of a collection of address duplicates 31 , a duplicate of the referenced spouse contact 32 , and it references a copy of the name 33 since strings do not implement the duplicatable interface and therefor are assumed to be immutable . fig4 builds on this same scenario by showing how a duplicate of the contact and related objects can be created across process boundaries using proxies to the duplicated objects . here the contact duplicate 40 references a proxy 41 of the duplicated contact 42 which may exist on a remote process . fig5 shows the sequence of events that create a duplicate object . the user code first makes a call 50 to its duplicate context to create a duplicate instance , passing either a local reference or proxy to an object or collection that can be duplicated . the context first makes a call 51 to the duplicated object to register a new reflection . the register method fig1 , 11 is called resulting in a serializable package of duplication data used to setup the duplicate object . the context then creates a new instance of the same type as the duplicated object and then calls the initialize method fig1 , 11 passing the package of duplication data . the duplicate object then unpacks the duplication data , sets up the duplicate , and notifies the context of any additional duplicates that must be created to complete the process . the context then creates any additional duplicates 53 by repeating this process from 51 for each addition duplicate required . duplicate objects can be altered without affecting the duplicated object or other duplicate objects of the duplicated object until the user code synchronizes the changes as depicted in fig6 . the user can make any changes desired to the duplicate object 60 which will send updates 61 to any duplicates of the duplicate object . when the changes are complete , the user code can request that the duplicate context synchronize 62 the changes to the duplicate object or to any set of duplicate objects created by the context . the duplicate context identifies the altered duplicates within the requested set and requests 63 that they package those changes for delivery to the duplicated objects . the packages of changes are then delivered to the duplicated objects via a call 64 to their synchronize fig1 , 11 method . one at a time , each logical ( an individual or tree of part - of objects where one object may be part - of another object and thus share a lock ) duplicated object is locked , applies the changes , then sends updates 65 to any other duplicates other than the one requesting the changes . finally , if the duplicated object is not its self a reflection , it will be given an opportunity 66 to update optional repositories within the context of the lock . when the user code is done with its duplicate objects as in fig7 , it will release the duplicate context 70 . the duplicate context will call 71 destroy fig1 , 11 on each duplicate created by the context to mark the duplicate as no longer being active . the context will then notify each duplicated object that the duplicate is no longer active with a call 72 to unregister fig1 , 11 . the duplicated object will remove the meta - data for the duplicate and will stop sending updates .	6
referring to fig1 , a target tracking system 22 included within a platform 20 , such as without limitation a ground based facility , an aircraft , or a satellite , provides near continuous updating of inertial reference unit ( iru ) information while performing uninterrupted optical target tracking . in addition , the platform 20 includes platform information sources 26 , such as a flight data computer , and an inertial reference system ( irs ) that are coupled to the target tracking system 22 . in one embodiment , the target tracking system 22 includes a tracking processor 30 , a high signal light source component 32 , a first camera 34 , a second camera 36 , a first fast steering mirror ( fsm ) 38 , a second fsm 40 , a beam splitter 42 , and various reflecting mirrors 44 . the tracking processor 30 is operatively coupled to the high signal light source component 32 , the first and second cameras 34 and 36 , the first and second fsms 38 and 40 , and a database 46 . the database 46 stores starfield reference information for use by the processor 30 . the tracking processor 30 includes an inertial reference unit ( iru ) 50 . the iru 50 determines and adjusts inertial reference information received from the irs based on an optical output of an optical beam source 58 of the high signal light source component 32 and an image received by the second camera 36 . in addition , the tracking processor 30 includes a target tracking component 54 that tracks a target displayed within an image generated by the first camera 34 and determines inertial reference information of the tracked target based on the inertial reference information determined by the iru 50 and any information from the sources 26 . the target tracking component 54 generates an instruction to the second fsm 40 for stabilizing the tracked image , thereby allowing the second camera 36 to record a stabilized image of the starfield . the iru 50 may be located remote from the processor 30 or the target tracking system 22 . referring now to fig2 , a process 100 performed by the target tracking system 22 ( fig1 ) provides nearly continuous inertial reference information updating using starfield information stored in the database 46 without loss of contact of an optically tracked target . the process 100 begins after the target tracking system 22 has acquired a target in its view . in other words , the first camera 34 has acquired a target within its field of view and the target tracking component 54 has analyzed images generated by the first camera 34 and instructed the first fsm 38 to track the identified target . the process 100 begins at a block 102 where the target tracking component 54 determines the inertial angular rate of the target scan . the target scan inertial angular rate is the speed at which the first fsm 38 moves in order to track the target . at a block 106 , the starfield image received by the second camera 36 is stabilized based on the determined target scan rate . the determined target scan rate is sent to the second fsm 40 for de - scanning the starfield image received from the first fsm 38 . referring back to fig2 , at a block 108 the second camera 36 records the stabilized image over a predetermined period of time . at a block 112 , during the period of time that the second camera 36 records the starfield image , the iru optical beam generator 58 generates an optical beam that is pulsed over a finite period of time . at a block 114 , the tracking processor 30 or components thereof identifies the location within the stabilized image of when the iru optical beam was turned on and off during each optical beam pulse . referring to fig3 , time t 1 identifies the location within a stabilized image 300 where an optical beam pulse was initiated and time t 2 is the location within the image 300 that identifies when the iru optical beam pulse was turned off . referring back to fig2 , at a block 118 , centroids of each optical beam pulse are determined based on respective times t 1 and t 2 . at a block 120 , the processor 30 compares the centroids to one or more stars located within the stabilized image based on starfield information stored in the database 46 and adjusts inertial reference information received from the iru 50 based on the comparison . at a block 122 , the processor 30 determines inertial reference information for the target based on present target tracking information produced by the target tracking component 54 , the adjusted inertial reference information , and any information relating to the platform 20 , such as without limitation gps location information , pitch , roll , yaw , or other orientation information received from the other sources 26 . platform information may include position , velocity , and attitude from separate inertial navigation system for transforming target position into a platform body - fixed coordinate system . in one embodiment , the optical beam direction is referenced to the target based on target tracking information generated by the target tracking component 54 and sent to the light source component 32 . because the optical beam is referenced to the tracked target , the pulses track across a stabilized image . referring now to fig3 , a stabilized image 300 includes a plurality of stars 302 that are identified by a starfield analysis component included within the tracking processor 30 . the stabilized image 300 includes a plurality of optical beam pulses recorded by the second camera 36 . centroids 306 of each optical beam pulse 304 are identified based on identified t 1 and t 2 of the respective pulse 304 . the centroids 306 are simply the center location of each pulse 304 . the processor 30 determines the location of the centroids 306 relative to the starfield pattern 302 within the stabilized image 300 in order to generate highly accurate inertial reference update information of the target . fig4 illustrates an exemplary de - scanned ( stabilized ) image that is recorded by the second camera 36 . satellite 1 is a tracked target . the resulting series of pulses from the beam combined with the knowledge of the precise time of each pulse allows accurate measurement of the optical beam pointing direction relative to the starfield . this measurement is input to a kalman filter which estimates the iru errors , thereby allowing accurate reporting of the track object position in inertial frame coordinates . the kalman filter algorithm is a standard , recognized estimation algorithm for estimating iru errors . the kalman filter would be applied in the same manner as if the track were interrupted and the star measurements taken independent of the track process . the errors in the inertial system which would be estimated are the three components of inertial attitude , the three components of gyro bias , and the 3 components of gyro scalefactor . the kalman filter would therefore be at least a 9 state estimation algorithm . the equations for the kalman filter are given in the literature but are shown here for completeness : k n = p n ⁢ h n t ⁡ ( h n ⁢ p n ⁢ h n t + r ) - 1 kalman ⁢ ⁢ gain x n + 1 = x n + k n ⁡ ( z n - h n ⁢ x n ) state ⁢ ⁢ update p n + 1 = p n - k n ⁢ h n ⁢ p n co ⁢ ⁢ variance ⁢ ⁢ update k n = 9 × 9 initial co variance matrix ( identity ), h n = 2 × 9 measurement matrix , p 0 = 9 × 9 initial co variance matrix ( identity ), r = 2 × 2 measurement noise matrix x o = 9 × 1 state vector ( zero vector ) z n = 2 × 1 measurement vector ( inertial angles to each star observed ) the kalman filter equations are iterated over each exposure time of the streak camera 36 with a star measurement comprising the z n vector at each exposure time . the optical beam has a signal - to - noise ratio of approximately 100 . the beam can be very intense relative to the signal returned from the target , thereby allowing centroid measurement of the optical beam streaks to approximately 1 / 100 of the camera 36 pixel angular extent . referring to fig5 , a time graph 350 illustrates example on / off times of an optical beam . the following are exemplary system values associated with the graph 350 : aperture size : 50 cm ( mirror # 44 ) optical magnification = 10 x 1 ( mirror # 44 ) slew rate ( ω ): 1 degree / second 917 . 4 mrad / sec ) ( system # 22 ) second camera 36 optical beam pulse repetition frequency : 300 hz angular length of each streak ( pulse ): 10 pixels ( 42 . 5 μrads ) time length of each pulse : 42 . 5 × 10 − 6 / 17 . 4 × 10 − 3 = 2 . 4 msec de - scan time = 7 . 8 msec ( assuming two complete pulses in scan time ) required de - scan fsm 40 angle range = 7 . 8 × 10 − 3 × 17 . 4 × 10 − 3 ˜ 136 μrads ( output space ) while the preferred embodiment of the invention has been illustrated and described , as noted above , many changes can be made without departing from the spirit and scope of the invention . also , the steps in the process 100 may be performed in various order . accordingly , the scope of the invention is not limited by the disclosure of the preferred embodiment . instead , the invention should be determined entirely by reference to the claims that follow .	6
to supply nutrients to farm animals , high concentration nutrient granules are formed and combined with the bulk feed of the animals . these nutrient granules will generally include a high concentration of nutrients , a carrier and if necessary a lubricant and / or binder . the nutrients can be a variety of different compositions . generally these will include minerals and vitamins . these nutrients along with the range of concentration that would be incorporated in the pellets of the present invention in order to provide the total nutritional requirements for the animal are listed below according to nutrient concentration ( as compared to ingredient or actual mineral concentration ). these ranges are listed by nutrient concentration . the actual ingredient inclusion rate will depend upon the concentration of that nutrient that the ingredient contains . these will then be combined with a carrier . a carrier can be any of a large number of digestible or nondigestible edible and gras ( generally recognized as safe ) ingredients . these would , for example , include animal protein products , and forage products , grain products , plant protein products , processed grain by - products , roughage products . these are more fully listed below : possible products include dried blood meal , animal by - product meal , fish meal , dried fish solubles , hydrolyzed poultry feathers , hydrolyzed poultry by - products , meat and bone meal , meat meal , poultry by - product meal , dried whey , alfalfa meal , corn , oats , wheat , wheat bran , wheat middlings , soybean hulls , cottonseed meal , linseed meal , soybean meal , sunflower meal , yeast , brewers dried grains , corn flour , corn gluten feed , corn gluten meal , corn distillers dried grains , corn distillers dried grains with solubles , oat groats , feeding oat meal , wheat flour , wheat red dog , soybean mill feed and mixtures . clay or other fillers could be added if desired , but are not necessary . a lubricant may also be required . generally these will be a fat or oil source such as animal fat , vegetable oil or blended animal or vegetable fat , oilseed processing byproducts , soapstock , etc . in certain formulations , a binder may be required . suitable binders include lignin sulfate , bentonite , and gums as well as others . these are all combined in desired proportions and pelletized . generally the nutrient ingredients will form from about 1 to about 70 % of the product and more typically 4 to 40 %. if the supplement is primarily a vitamin and trace mineral supplement , it would form a relatively minor portion of the product if macro minerals are added these would form a relatively and substantially greater portion of the product . the upper limit , i . e ., about 70 %, is due to the inability to effectively bind a high mineral content pellet together . further , if the mineral content is too high , it may not be palletible or pellitable . generally , the product will include from , about 0 to about 5 % fat or oil as a lubricant . if the supplement does not include a significant amount of minerals , i . e ., greater than 20 %, the carrier itself will effectively lubricate and bind itself to form the pellet under the influence of steam used in the pelletizer . on the other hand , if the concentration of minerals exceeds 20 %, about 0 . 5 - 1 % fat per 10 % mineral above 20 % should be added . accordingly , if the product includes 40 % mineral ingredients ( as opposed to nutrient ), 1 to 2 % fat should be included . in producing the pellets of the present invention , the components are blended in any blending apparatus . the product is pelletized by running it through a pellet mill . pellet mills are , of course , very well known . several suitable pellet mills are those made by sproutwaldron and california pellet mill . the pellets can be formed of a variety of different sizes . generally , the dye size will be from { fraction ( 6 / 64 )} up to { fraction ( 32 / 64 )} of an inch . typically they will be from { fraction ( 8 / 64 )} to { fraction ( 12 / 64 )}. the formed pellets are cooled through coolers which are generally used with the pellet mill and manufactured by the same companies and ground with a roller mill or crumbler to form granules . these are all screened and separated for size . the coolers and roller mills and crumblers are likewise well known . generally the size of granules will depend upon the ultimate use but will generally be in the neighborhood of { fraction ( 1 / 64 )} up to { fraction ( 12 / 64 )} of an inch in diameter . these sizes , of course , are average sizes . the density of the formed granules should be equal to the density of the bulk feed to which they are expected to be added + 30 %. density can be controlled by increasing the carrier concentration , modification of the carrier concentration as well as adjusting parameters within the pelletizer itself such as pressure , steam and temperature as well as ultimate granule size . the formulated product will generally have 1 - 30 % crude protein , 1 - 15 % crude fat , and 1 - 15 % crude fiber . these can be formulated into pellets using an operating temperature of about 130 to 200 , preferably 160 to about 170 ° f ., with a steam pressure of 5 to 100 psi preferably , 30 to 60 psi . when the mineral concentration exceeds 20 % of the formulation higher steam pressure is usually used , i . e ., 40 to 80 psi . this improves the manufacturing process . depending on the size of the pellet mill , 1 - 30 tons can be processed per hour . of course , these are preferred parameters for this formulation and other formulations would be modified which is well within the skill of the art . finally , the end product is combined with the feed mix . generally , the appropriate nutrient granule may be modified to meet the needs of the particular bulk feed that it is combined with . the granule should have a size which is approximately equal to the average particle size of the bulk feed . further , it will have a density equal to (± 30 %) of the density of the bulk feed product ( about 30 to 55 pounds per cubic foot ). preferably , the nutrient composition will be added to the bulk feed composition , i . e ., starch source and protein source , at a rate of 0 . 25 to 7 . 5 % based on the weight of the combined nutrient and bulk feed . lesser amounts can be employed , again , depending on the nutrients in the nutrient granule as well as the concentration of the nutrient in the granule . generally the overall amount of nutrient supplement , of course , will be added in an amount designed to meet the dietary needs of the animal consuming the bulk feed . thus , by forming the nutrients into a nutrient pellet and preparing these in a size which will remain suspended in feed , one can supply these to an animal in a manner designed to reliably supply the nutrient needs of the animal without either overfeeding the animal or undersupplying the needs of the animal . further , due to the fact that this is a granular feed nutrient premix , a variety of different formulas can be prepared which are uniquely designed for the needs of particular animals based on both species and characteristics of the species such as lactation , pregnancy , age and size . these can then be added to the bulk feed by the farmer to ensure that all of his animals are properly supplied nutrients . further , and equally important , the nutrients themselves do not separate and remain evenly distributed in the granule .	0
in greater detail , fig1 and 3 show a common embodiment , and also the pivot member and cutting portion or blade thereof of fig4 being the same as that shown mounted pivotally in the structure of the outer side wall of the cylindrical corer of fig1 . in the discussion of the disclosed embodiments , of the different figures , for common parts identical or similar indicia will be utilized and the description not repeated for such elements for each figure . for the common embodiment of fig1 through 4 , there is disclosed the partial - coring device 1 having its cylindrically shaped outer side wall 2 , capped by a cap 3 at its upper end and the cap 3 fitting around the upper outer rim of the cylindrical outer side wall 2 and having inner cap plug 3a fitted supportingly and snugly within the upper end channel space formed within the cylindrically shaped outer side wall 2 . handle 4 is mounted on a neck shaft 5 that is mounted on the upper end of an elongated slide member 6 slidably mounted retainably within an elongated groove 6b shaped - into the outer surface of the cylindrically shaped outer side wall 2 , with the elongated groove extending axially along the longitudinal axis of the cylindrically shaped outer side wall 2 . the pivot member 7 has pivot arms 7d and 7d &# 39 ;, with the pivot arms 7d and 7d &# 39 ; respectively mounted in the apertures 7a and 7a &# 39 ; in the outer side wall 2 . mounted within the channel space 8 &# 39 ; at the upper end and slidable through the channel space to the lower open end of the cylindrically shaped outer side wall 2 , is the core ejection plug or core ejecter 8 having a shaft 9a mounted on and attached thereto and extending through slit - groove 10 to handle 9 . the shaft 9a is slidable within the axially extending longitudinally extending slit - groove 10 . by moving the handle 9 toward the open end at the lower end of the channel space 8 &# 39 ;, the core ejecter 8 moves to the open end to eject an core contained in the channel space 8 &# 39 ;; thereafter , movement of the handle toward the upper end of the corer causes the core ejector to move also to the upper end of the channel space as shown in fig3 and fig1 . by movement of the handle 4 , and thereby the slide member 6 , toward the lower and open end of the cylindrically shaped outer side wall 2 , the lower end of the elongated slide member 6 being pivotally attached to the ring structure 12 of the pivot member 7 , causes the cutting blade portion 7a to move outwardly along the movement path 7c to an ejected or extended position and state . return of the hande 4 to the position shown in fig1 causes the cutting blade portion 7a to return to the retracted position and state shown in fig3 . thus , for fig1 through 4 , the lower end of the elongated slide member 6 is pivotally linked to the link structure 12 . in fig4 a there is shown an additional link - member 6 &# 34 ; b that is an extension , in effect , of the slidable elongated slide member 6 , pivotally linked thereto at 11 , as link member 6 &# 34 ; b and elongated slide member 6 &# 34 ; a . in the fig1 through 4 embodiment , the lower end of the elongated slide member 6 flexibly and resiliently bends or flexes inwardly as the elongated slide member 6 is moved toward the pivot member at the open end location of the corer . it resiliently returns to its substantially straight form when moved upwardly toward the upper end of the corer 1 cylindrically shaped outer wall 2 . in fig4 b , an alternate arrangement and embodiment for the pivot member 7 &# 34 ; and the elongated slide member 6 &# 39 ; are shown in which the lower end of the elongated slide member 6 &# 39 ; is welded or otherwise fused to the upper end portion of the blade 7 &# 39 ;; in this embodiment also , the pivot member 7 &# 34 ; is rigidly and immovably fastened through hole 13 to the outer side wall 2 in juxtaposition to the through - aperture 12 &# 34 ;. thus , in this embodiment , when the handle mounted on the slide member 6 &# 39 ;, in the same manner as for the embodiment of fig1 moves toward the lower end of the corer 1 , the lower end of the elongated slide member flexes downwardly while simultaneously the cutting blade portion 7 &# 39 ; becomes also flexed inwardly , both resiliently . upon return of the handle ( not shown ) but the same as for the embodiment of fig1 through 4 to the upper end of the corer 1 , the lower end of the elongated slide member and the cutting blade portion both return to the retracted positions and states as shown in fig4 b . normally a person would grasp the upper capped end of the corer 1 and press downwardly thereon with the lower serrated end thereof pressed - against the surface of the fruit to be cored , and twist back and forth revolvably , until the serrated end reaches the desired depth within the fruit being partially cored . at that point , the handle 4 is moved toward the serrated end of the corer in a downward direction along the path 6a shown in fig3 thereby causing the cutting blade portion to move to the position 7b shown in phantom ; thereafter , the corer is revolved a full effective 360 degrees in order to fully sever the cored - portion of the fruit from the body of the fruit . thereupon the corer should be withdrawn from the fruit and the handle 4 moved to the upward end of the corer 1 . over an appropriate container for garbage , the handle 9 is moved downwardly toward the serrated end to eject the contained core portion of the fruit , and thereafter the handle 9 is returned to it upper position shown in fig1 and 3 . while this corer 1 has a special and easy use for merely partially coring a fruit , it may be obviously used also to fully core a fruit , by pressing and rotation thereof back and forth until it cores through the entire depth of the fruit . thereafter the procedure is the same as noted - above for ejecting the core . it is within the scope and spirit of the invention to make such variations and substitution of equivalents as would be apparent to a person of ordinary skill . it should be additionally noted that the squared - off or blunt open - end of the cylindrically shaped wall 2 of the corer 1 , prevents the serated end from slipping - off - of the fruit and from possibly gouging the worker or house wife with what in the prior art designs usually is a pointed and thus dangerous sharp end . this feature , in combination with other noted inventive aspects , is also a novel combination .	0
the present invention comprises an improved feedback limited amplifier circuit for use in conjunction with a sensor for detecting infrared energy radiating from a celestial body . the following description is presented to enable any person skilled in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the preferred embodiment will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention . thus , the present invention is not intended to be limited to the embodiment shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . referring to fig1 a schematic diagram of a presently preferred embodiment of an improved feedback limited electronic amplifier circuit 10 of the present invention is shown . the electronic amplifier circuit 10 receives on line 12 electronic signals generated in response to infrared radiant energy detected and preamplified by an infrared detector system 14 . the improved amplifier circuit 10 comprises a two - stage amplifier circuit including first and second amplifiers , 18 and 20 , respectively , which amplify the input signals and provide amplified versions of the input signals as output electronic signals at output node 16 . the improved amplifier circuit 10 includes a thresholding common base amplifier , shown substantially within the dashed lines labelled 22 , for detecting when the output signal reaches a prescribed threshold level . it also includes an analog signal inverter , shown substantially within the dashed lines labelled 24 , for providing a feedback signal on line 26 when the output signal reaches the prescribed threshold . finally , the improved amplifier 10 includes a summing resistor 28 for summing an opposing feedback signal with the input electronic signal on line 12 in response to the feedback signal on line 26 . more particularly , the infrared detector system 14 is electrically connected by line 12 to one terminal of the summing resistor 28 . the infrared detector system 14 forms no part of the present invention , and a description thereof is not essential to support the claims or to provide an adequate disclosure of the present invention . however , in the interest of completeness , the disclosure of u . s . pat . no . 3 , 920 , 994 , issued to donald r . cargille on nov . 18 , 1975 , which discloses an exemplary infrared detector system , is incorporated herein by this reference . the other terminal of the summing resistor 28 is connected to one terminal of a first coupling capacitor 30 which is connected in series with the summing resistor 28 . the other terminal of the first coupling capacitor 30 is electrically connected to the noninverting terminal of the first operational amplifier 18 . a first dc return resistor 32 has one terminal electrically connected between the first coupling capacitor 30 and the noninverting terminal of the first operational amplifier 18 , and has another terminal connected to electrical ground . the output of the first operational amplifier 18 is electrically connected to one terminal of a second coupling capacitor 36 . the other terminal of the second coupling capacitor 36 is connected to the noninverting terminal of the second operational amplifier 20 . a second dc return resistor 38 has one terminal electrically connected between the second coupling capacitor 36 and the noninverting terminal of the second operational amplified 20 , and has another terminal connected to electrical ground . first feedback resistor 42 and first feedback capacitor 44 are electrically connected in parallel with one another between the inverting terminal and the output terminal of the first operational amplifier 18 . a first stage gain set resistor 46 is electrically connected between the inverting terminal of the first operational amplifier 18 and electrical ground . second feedback resistor 48 and second feedback capacitor 50 are electrically connected in parallel with one another between the inverting terminal and the output terminal of the second operational amplifier 20 . a second stage gain set resistor 52 is electrically connected between the inverting terminal of the second operational amplifier 20 and electrical ground . power supply voltages + v and - v are provided to each of the operational amplifiers 18 and 20 to provide dc power to the amplifiers . the thresholding common base amplifier and the analog signal inverter , shown substantially enclosed within the dashed lines labelled 22 and 24 respectively , comprise an electronic feedback circuit electrically connected between the output node 16 and an input node 54 interposed between the series connected summing resistor 28 and the first coupling capacitor 30 . emitter resistor 56 has one terminal connected to output node 16 . its other terminal is connected to one terminal of threshold setting resistor 58 . node 61 is interposed between emitter resistor 56 and threshold setting resistor 58 which are connected in series . the other terminal of the threshold setting resistor 58 is electrically connected to a voltage source v s . the cathode of a protection diode 60 is electrically connected to a node 61 , and the anode of protection diode 60 is electrically connected to the emitter of an npn - type thresholding first transistor 62 . the base of the first transistor is electrically connected to ground , and its collector is connected to one terminal of turn - on transient limiting resistor 64 . the other terminal of the turn - on transient limiting resistor 64 is electrically connected to one terminal of collector resistor 66 . the other terminal of collector resistor 66 is electrically connected to the voltage source v s . node 67 is interposed between turn - on transient limiting resistor 64 and collector resistor 66 . components 56 - 66 substantially comprise the thresholding common base amplifier shown substantially enclosed within dashed lines 22 . the base of a pnp - type feedback second transistor 68 is electrically connected to a node 67 . the emitter of the feedback second transistor 68 is electrically connected to one terminal of emitter resistor 70 . the other terminal of emitter resistor 70 is electrically connected to voltage source v s . the collector of the feedback second transistor 68 is connected by line 26 to the input node 54 . components 26 , 28 , 68 and 70 substantially comprise the analog signal inverter shown substantially enclosed within dashed lines 24 . component values and supply voltages for the improved feedback limited amplifier circuit of the presently preferred embodiment are tabulated below . ______________________________________components values______________________________________resistors : 28 1k32 392k38 392k42 71k46 1k48 71k52 1k56 10k64 10k66 5k70 1k58 * capacitors : 30 6 μ f36 6 μ f44 10 nf50 10 nfoperational amplifiers : 18 op - 0220 op - 02transistors : 62 2n248468 2n2907adiode : 60 1n3600______________________________________ * the value is selected to achieve the desired limit level . the voltage source v s has a value of + 18 volts . the power supply voltages + v and - v are + 18 volts and - 18 volts , respectively . in operation , the infrared detector system 14 detects energy in the infrared spectrum radiating from celestial bodies and generates on line 12 a corresponding negative polarity input electronic voltage signal which is substantially proportional in magnitude to the intensity of the detected infrared energy . the graph of fig2 illustrates typical exemplary input signal waveforms generated by the infrared detector system 14 when the radiating bodies are the sun and the earth . the magnitude of the input signal generated as a result of relatively high intensity infrared radiation from the sun is approximately 100 mv ; while the magnitude of the input signal generated as a result of the relatively lower intensity infrared radiation from the earth is approximately 1 mv . the amplification applied to input signal on line 12 by the two stage amplifier circuit comprising the respective first and second amplifier circuits 18 and 20 will be appreciated from fig3 which illustrates an exemplary open loop bode plot of the two stage amplifier circuit . the midband gain is approximately 74 db . the upper frequency break point f u substantially is 1 / 2π ( 71 × 10 3 )( 10 × 10 - 9 ) or 224 hz , and the lower frequency break point f 1 substantially is 1 / 2π ( 392 × 10 3 )( 6 × 10 - 6 ) or 0 . 067 hz . the upper and lower frequency break points are selected to be consistent with the spin rate of a spinning satellite on which the improved amplifier circuit 10 is mounted , although the improved amplifier circuit 10 is not limited to use on spinning satellites . the upper and lower frequency rolloffs both are approximately 40 db / decade ; the first and second operational amplifiers 18 and 20 , respectively , contribute approximately 20 db / decade each to the respective high and the low frequency rolloffs . the operational amplifier break frequency f a is approximately 200 khz for the two - stage circuit . the flat horizontal portion of the bode plot between the upper break frequency f u and the op - amp break frequency f a shows a gain of substantially 0 db . this flat portion and the value of f a have negligible effect on signal amplification , but they are important to the closed loop limiter stability as will be discussed below . the thresholding common base amplifier shown in fig1 substantially within dashed lines 22 detects when the output signal reaches a prescribed threshold level at which feedback limiting is to begin . more specifically , the prescribed threshold output voltage measured at output node 16 at which limiting of the two stage amplifier circuit occurs is set by appropriate adjustment of the adjustable resistor 58 . for example , with the threshold setting resistor 58 set at 37k ohms the prescribed threshold voltage is approximately - 7 volts . when the output voltage is still less negative than the prescribed threshold level ( the two - stage amplifier circuit of the presently preferred embodiment is a negative polarity circuit ), the voltage source v s and the voltage divider action of the threshold setting resistor 58 and the emitter resistor 56 provide a reverse bias voltage to node 61 and to the cathode of the protection diode 60 . the protection diode 60 protects the emitter junction of the thresholding first transistor 62 from breakdown due to excessive reverse bias voltages when the output voltage is less negative than the threshold level . the reverse bias voltage applied at node 61 reverse biases the emitter - base junction of the thresholding first transistor 62 and substantially prevents current flow from the collector to the emitter of the thresholding first transistor 62 . furthermore , the reverse bias causes the emitter - base junction of the second transistor 68 to be zero biased ; so substantially no current flows from the collector to the emitter in the feedback second transistor 68 . therefore , substantially no feedback current flows on line 26 to the summing resistor 28 , and the improved feedback limited amplifier circuit 10 of the preferred embodiment operates as a two - stage amplifier circuit providing 74 db gain in the midband region . when the output voltage at output node 16 becomes more negative than the prescribed threshold level , the voltage applied at node 61 also falls . when the threshold setting resistor 58 is set substantially at 37k ohms , and the voltage at node 61 becomes more negative than approximately - 7 volts , the protection diode 60 and the emitter base junction of the first transistor 62 becomes forward biased . consequently , current begins to flow through collector resistor 66 and turn - on - transient limiting resistor 64 to the collector junction of the first transistor 62 . as a result , the emitter - base junction of the feedback second transistor 68 will move into the active region , and the feedback second transistor 68 will begin to conduct current from its emitter to its collector . current flowing from the collector of the feedback second transistor 68 on line 26 to the summing resistor 28 comprises a feedback signal which will cause a voltage drop across the summing resistor 28 opposite from the voltage drop due to the signal voltage received on line 12 from the infrared detector 14 . thus , the input signals at input node 54 will be limited as a result of the feedback signal on line 26 . the first transistor 62 is connected as a common base amplifier . the resistance ratio of emitter resistor 56 to collector resistor 66 is substantially 10k : 5k . therefore , the ratio of the voltage drop across the emitter resistor 56 to the voltage drop across the collector resistor 66 is approximately 2 : 1 . turn - on transient limiting resistor 64 is provided to limit potentially damaging current transients during turn - on of the respective first or second transistors 62 and 68 and has substantially no impact on the relative voltage drops across emitter resistor 56 and collector resistor 66 . the feedback second transistor 68 is connected as an analog signal inverter . since the resistance ratio of emitter resistor 70 to the summing resistor 28 substantially is 1 : 1 , the voltage drop across the summing resistor 28 due to the feedback signal on line 26 will be substantially one - half of the voltage drop across the emitter resistor 56 . therefore , the feedback ratio of the circuit comprising the thresholding common base amplifier within dashed lines 22 and the analog signal inverter within dashed lines 24 is substantially 1 / 2 or - 6 db . the feedback limiting applied by the thresholding common base amplifier within dashed lines 22 and the analog signal inverter within dashed lines 24 , will be appreciated from the drawings of fig4 which represent an exemplary bode plot of the closed loop circuit comprising the respective first and second amplifers 18 and 20 , the thresholding common base amplifier , and the analog signal inverter . the midband gain is approximately 68 db , reflecting the - 6 db gain contribution from the feedback limiting circuit . the upper frequency breakpoint f u substantially is 224 hz , and the lower frequency breakpoint f 1 is substantially 0 . 067 hz . the upper and lower frequency rolloffs each are approximately 40 db / decade . the op - amp break frequency f a for the two stage operational amplifier is approximately 200 khz . the flat substantially horizontal portion of the bode plot between the upper frequency breakpoint f u and the op - amp break , frequency shows a gain of - 6 db . the curve of fig5 illustrates exemplary feedback limited output signals generated in response to relatively high intensity infrared radiation from the sun and relatively lower intensity infrared radiation from the earth . comparing the graphs of fig2 and 5 , one will appreciate that times labelled t 1 , t 2 and t 3 on fig2 correspond in time to similarly labelled times in fig5 . the portion of the output signal curve generated in response to infrared energy radiated by the sun is substantially limited , for example , at - 7 volts to prevent saturation of the two - stage amplifier circuit . although the output voltage resulting from the sun extends to a peak approximately 200 mv below the - 7 volt limit level due to amplification of the 100 mv input signal by a factor of two due to the feedback ratio of 1 / 2 or - 6 db , the 200 mv peak is negligible . the portion of the curve which illustrates the output signal generated in response to infrared energy radiated from the earth is not limited because the output signal has a voltage level which is not negative enough to cause saturation of the negative polarity two - stage amplifier circuit comprising the respective first and second operational amplifiers 18 and 20 . the output voltage resulting from the earth is approximately - 5 volts . the advantage realized by the improved feedback limited electronic circuit 10 of the present invention will be understood from the drawings of fig6 and 7 and the following discussion . fig6 illustrates exemplary gain versus frequency and phase versus frequency curves for the open loop two - stage forward amplifier portion of the improved circuit 10 ; thus , it illustrates circuit performance absent the feedback limiting provided by the circuit components enclosed within dashed lines 22 and 24 . fig7 illustrates exemplary gain versus frequency and phase versus frequency curves for the entire improved circuit ; thus , it illustrates circuit performance with the limiting provided by the circuit components enclosed within dashed lines 22 and 24 . the curves of fig6 and 7 illustrate performance in the region of high frequency gain crossover ( where the gain curve crosses through 0 db ). the relatively steep slope of the gain versus frequency curve between 100 khz and 1 mhz is due to the finite bandwidth f a , of the operational amplifiers 18 and 20 . two well - known and generally accepted measures of stability for closed loop amplifier circuits of the general type disclosed in the present invention are the phase margin and the gain margin . any negative feedback loop , including the loop embodied in the present invention , will be unstable and experience unwanted oscillations if the phase at the gain crossover frequency is more negative then - 180 degrees . the gain crossover frequency is the frequency at which the gain is 0 db . the phase margin is defined as the actual phase at the gain crossover frequency plus 180 degrees . the gain margin is defined as the negative of the actual loop gain at a frequency at which the phase is - 180 degrees . in typical closed amplifier circuits of the type disclosed in the present invention , a phase margin of substantially 45 degrees or more and a gain margin of substantially 6 db or more represent satisfactory stability . referring to fig6 the phase at the high frequency gain crossover is approximately - 70 degrees . therefore , the phase margin is approximately (- 70 + 180 ) degrees or 110 degrees which is satisfactory . the gain margin , however , is approximately 1 . 5 db , indicating only marginal stability . thus , the open loop two - stage forward amplifier portion of the improved circuit 10 is not satisfactorily stable and may experience unwanted oscillations . referring now to fig7 the phase at the high frequency gain crossover is approximately - 105 degrees . therefore , the phase margin is approximately (- 105 + 180 ) degrees or 75 degrees which is satisfactory . furthermore , the gain margin is approximately 7 . 5 db which also is satisfactory . thus , the improved feedback limited amplifier circuit 10 exhibits satisfactory stability . one skilled in the art will appreciate that the feedback ratio of the components within dashed lines 22 and 24 of the circuit 10 illustrated in fig1 is selected such that the phase margin and the gain margin fall within acceptable limits within which the circuit 10 exhibits satisfactory stability . although the feedback ratio of - 6 db was selected for the circuit 10 of the preferred embodiment described above , one will appreciate that a deviation from the - 6 db feedback ratio of up to approximately ± 3 db will still provide a substantially stable circuit 10 . furthermore , the circuit components enclosed within dashed lines 22 and 24 in fig1 do not include reactive elements which could introduce phase shifts . therefore , for example , the values of the respective first and second feedback capacitors 44 and 50 and the values of the respective first and second feedback resistors 42 and 48 can be changed without adversely affecting the stability of the circuit 10 . thus , the circuit 10 may be modified , for example , to change the upper and lower frequency break points f u and f 1 , respectively , and / or the gain in the mid - band region , substantially without suffering reduced stability . it will be understood that the embodiment described above is merely illustrative of many possible specific embodiments which can represent the principles of the invention . numerous and varied other arrangements can readily be devised in accordance with these principles without departing from the spirit and scope of the invention . for example , although the presently preferred embodiment represents a negative polarity circuit , those skilled in the art will appreciate that the same principles will apply to a positive polarity circuit . thus , the foregoing description is not intended to limit the invention which is defined by the appended claims in which :	7
shown in fig1 a is a side view of the dense fluid centrifuge used to perform the various processes of the present invention generally designated ( 1 ). the dense fluid centrifuge ( 1 ) has a high pressure vessel ( 2 ) with high pressure centrifuge lid ( 4 ) which is operated using a hydraulic lift cylinder ( 6 ). the centrifuge lid ( 4 ), when closed as shown , is secured to and seals the high pressure vessel ( 2 ) using a rotating locking ring ( 8 ) which is rotated using a hydraulic ring closure cylinder ( 10 ). the high pressure vessel ( 2 ) contains several ports for filling and draining the dense fluid centrifuge under isobaric and isothermic conditions . a fill port ( 12 ) is located in the lower half of the pressure vessel ( 2 ). a first drain port ( 14 ) used during draining in the vertical orientation of the dense fluid centrifuge is located in the lower half of the pressure vessel ( 2 ). a second drain port ( 16 ) used during draining in the horizontal orientation is located in the lower half of the pressure vessel ( 2 ). a vent port ( 18 ) is located in the upper half of the pressure vessel ( 2 ) and is used to transfer gas saturated vapor during isobaric filling and draining operations of the present invention . when the pressure vessel ( 2 ) is optionally rotated between vertical and horizontal orientations , the vent port ( 18 ) remains above the liquid phase contained within the pressure vessel . within the pressure vessel ( 2 ) is housed a dense fluid centrifuge ( 1 ). forming the dense fluid centrifuge ( 1 ) is a magnetic or other suitable drive system ( 20 ) attached to the center of the bottom half of the pressure vessel ( 2 ) which contains a rotating shaft ( 20 a ) which feeds through a drive shaft seal ( 22 ) which is located and centered within and at the bottom of the pressure vessel ( 2 ) and into a slot ( not shown ) within the center of a specialized lower drum bearing ( 24 ). also connected to the magnetic drive system is a drive belt ( 20 b ) which is affixed to a drive motor ( 20 c ) and the drive motor system has both variable rotational speed and direction . the lower drum bearing ( 24 ) is formed in two sections — an upper bearing plate ( 24 a ) and a lower bearing plate ( 24 b ) sandwiching a self - lubricating bearing ( not shown ). the lower drum bearing design is necessary to carry and distribute eccentric and heavy loads which may be present in the dense fluid centrifuge drum ( 26 ) under high rotational velocities or during optional gimbal rotations ( fig2 a - 2 c ). the upper bearing plate ( 24 a ) rotates freely about the central axis — being directly connected to the rotating shaft ( 20 a ). the lower bearing plate is immobile and is affixed to the lower half of the pressure vessel ( 2 ). optionally , drum load springs ( 28 ) may be affixed to the top of the upper bearing plate parts which are used to interface with the dense fluid centrifuge drum ( 26 ). the dense fluid centrifuge drum ( 26 ), which may have various shapes and sizes ( fig1 a - 11 e ), is affixed to the upper bearing plate ( 24 a ), which then rotates freely , and at variable velocities , in a clockwise or counterclockwise direction as determined by the rotation of the rotating shaft ( 20 a ) powered by an external magnetic or other suitable drive motor system ( 20 ). a upper bearing assembly ( 30 ), similar in design and function to the lower drum bearing 24 , may be affixed to the upper half of the centrifuge drum ( 26 ) to support the centrifuge drum during high speed and eccentric load rotations and during optional gimbal rotations of the dense fluid centrifuge . within the interior of the dense fluid centrifuge ( 1 ) is a central centrifuge compartment ( 32 ) defined by a cylindrically shaped , but porous , stationary barrier , the centrifuge shield ( 34 , which circumscribes the centrifuge drum ( 26 ) segregating off the centrifuge compartment ( 32 ) which is thereby separate from the pressure vessel &# 39 ; s ( 2 ) interior walls and extends from the centrifuge lid ( 4 ) to the lower half of the pressure vessel ( 2 ) and contains the rotating centrifuge drum ( 26 ), lower drum bearing ( 24 ) and shaft seal ( 22 ). a second circumferential compartment is defined between the centrifuge shield ( 34 ) and inner wall of the pressure vessel ( 2 ) which defines a separation compartment or zone ( 36 ) which is baffled ( not shown ) to retard flow within this region . the centrifuge shield ( 34 ) both protects the pressure vessel ( 2 ) inner walls from potential impact by the rotating centrifuge and / or contents contained therein and provides zones of turbulent cleaning action ( centrifuge compartment ) and non - turbulent separation action ( separation compartment ). shown in fig1 a - 1 c is a multi - ported spray manifold ( 38 ) which is affixed to the centrifuge shield ( 34 ), and is connected to the fill port ( 12 ). the multi - ported spray manifold ( 38 ) is used to uniformly deliver dense fluid , admixtures , prewash agents and heating gas to the interior of the centrifuge compartment during the cleaning process . control of the phases of the carbon dioxide during the processes discussed herein using the dense fluid centrifuge is accomplished via optical sensors . shown in fig1 a are optical sensors which are used to detect the presence or substantial absence of a liquid carbon dioxide phase . a high level optical sensor ( 40 ) is located substantially in the uppermost region of the pressure vessel ( 2 ) and is used to detect when the centrifuge compartment is full of liquid carbon dioxide and / or prewash agent . a lower level optical sensor ( 42 ) is located substantially in the lowermost region of the pressure vessel ( 2 ) and is used to detect when the centrifuge compartment is substantially empty of liquid carbon dioxide or prewash agent . control of the pressure and temperature during the cleaning process is accomplished using a pressure and temperature sensor . a pressure transducer ( 44 ) is connected located to the pressure vessel and is used to measure pressure conditions within the dense fluid centrifuge ( 1 ). a temperature thermocouple ( 46 ) is connected to the pressure vessel and is used to measure temperature conditions within the dense fluid centrifuge ( 1 ) and / or the separation compartment ( 36 ). it should be apparent to those skilled in the art that a variety of pressure and temperature sensing and measuring devices may be interchangeably used to accomplish the pressure and temperature measurements within the dense fluid centrifuge ( 1 ) and such modifications are within the intended scope of this invention . although not essential to the device or process an optional vibration sensor ( 48 ) may be used to detect translated vibrations caused by eccentrically rotating loads contained within the centrifuge drum ( 26 ). the dense centrifuge drum ( 26 ) is shown in fig1 a contained within the interior of the centrifuge compartment ( 32 ) defined by the centrifuge shield ( 34 ). the centrifuge shield ( 34 ) has affixed to it baffles ( 34 a ), which may be solid or perforated and which retard fluid flow within a separation compartment ( 36 ) created between said centrifuge shield ( 34 ) and the inner wall of the pressure vessel ( 2 ). the multi - ported spray manifold ( 38 ), shown affixed to the centrifuge shield ( 34 ), sprays dense fluid , admixtures , prewash agents and hot air into the interior of the centrifuge compartment ( 32 ). the vent port ( 18 ) is located within the separation zone ( 36 ) as are first drain port ( 14 ) and the second drain port ( 16 ). [ 0059 ] fig1 c is a flow diagram of the cleaning and separation phenomenon associated with rotation of the centrifuge drum ( 26 ) in either direction and at various rotational velocities which imparts a centrifugal force ( 50 ) upon the substrates , dense fluid and / or admixtures contained therein ( all not shown ). moreover , rapid rotational velocity in either direction produces a fluid shearing force ( 52 ) which imparts scouring vortices to the substrates being cleaned . delivering dense fluid through the multi - ported spray manifold ( 38 ) during centrifugation also delivers additional cleaning and separation energy via the spray flow ( 54 ) from the multi - ported spray manifold ( 38 ) directed towards the substrates ( not shown ) which opposes the centrifugal and fluid shearing forces . the physicochemistry within the centrifuge compartment ( 32 ) is modified during centrifugation which determines the cleaning and / or separation phenomenon therein . the dense fluid centrifuge produces two simultaneous processes cleaning and separation . the cleaning action occurs within a cleaning zone which is very turbulent as indicated by a reynolds number ( nr ) of at least 1000 and more preferably in a range of 1000 to 10000 and most preferably above 10 , 000 and separation action within a separation zone which is highly non - turbulent with a nr & lt ; 1 , 000 and more preferably between 1000 and 0 . within the device during its contaminated fluids and solids are concentrated and segregated under centrifugal force , isolated from the processed substrates contained within the centrifuge compartment ( 32 ). contaminates are withdrawn from the separation compartment ( 36 ) and clean dense fluids are introduced into the centrifuge compartment via the multi - ported spray manifold ( 38 ). after placing a substrate for cleaning into the dense fluid centrifuge compartment ( 32 ) the centrifuge lid ( 4 ) is rotated down to the closed position using a hydraulic lid cylinder ( 6 ). following this , the locking ring ( 8 ) is rotated about the centrifuge lid ( 4 ) using a locking ring hydraulic cylinder ( 10 ). the high pressure lid , when in the closed position , defines and seals the uppermost half of the centrifuge compartment ( 32 ). an alternate embodiment of the dense fluid centrifuge ( 1 ) combined with a gimbal device ( 56 ), shown in fig2 a - c . a gimbal pivot assembly ( 58 ) is affixed to the dense fluid centrifuge ( 1 ) at two central but opposite connection points and movably anchored a gimbal base ( 62 ) a hydraulic cylinder ( 64 ) is used to rotate the gimbal pivot assembly ( 58 ) and connected dense fluid centrifuge ( 1 ). the gimbal device ( 56 ) provides a stable platform from which the dense fluid centrifuge ( 1 ) can be rotated to any orientation from vertical ( as shown ) to horizontal orientation . the dense fluid centrifuge may be used in an upright orientation ( fig2 a ), a barreling orientation ( fig2 b ), a tumbling orientation ( fig2 c ), or any combination thereof . a flow diagram of the integrated dense fluid cleaning and management system is provided in fig3 . the dense fluid cleaning and management system provides automatic isobaric filling and draining operations during dense fluid phase shift cleaning processes , carbon dioxide recovery and prewash agent delivery and recovery operations of the present invention . vapor and liquid phase fluid transfers are accomplished using a vapor transfer module ( 66 ) and liquid phase transfer module ( 68 ) located at the upper and lower halves , respectively , of a dense fluid clean liquid carbon dioxide storage module ( 70 ) and carbon dioxide recovery module ( 72 ) in relation to the upper and lower halves of the dense fluid centrifuge ( 60 ). also contained in the integrated dense fluid cleaning and management system is a pretreatment agent recovery module ( 74 ) and a separated waste management module ( 76 ). the dense fluid centrifuge module ( 60 ) contains the dense fluid centrifuge ( 1 ) and may also contain the optional gimbal device ( 56 ). vapor and liquid - phase dense fluid is exchanged , via ports , under isobaric and isothermal conditions between this module and the clean liquid c0 2 storage module ( 70 ) and c0 2 vapor recovery module ( 72 ) through a vapor port connect to a vapor zone within the upper half of the dense fluid centrifuge ( 1 ) and from the lower half of the dense fluid centrifuge ( 1 ) through a liquid port . pretreatment agent ( 74 ) and waste management modules ( 76 ) may also be added . the clean liquid c0 2 storage module ( 70 ) contains and maintains condensed - phase carbon dioxide under vapor - liquid equilibrium conditions . makeup carbon dioxide from an external supply source is delivered to this module as needed . an additive injection unit may also be connected to this module . the c0 2 recovery module ( 72 ) fractionates dirty dense fluid received from dense fluid centrifuge ( or clean liquid c0 2 storage module ) into liquid - and gas - phase constituents . a c0 2 vapor recovery pipe connects the vapor zone of this module to the vapor transfer module . a liquid recovery pipe connects the liquid zone to the pretreatment agent or waste management systems . the c0 2 vapor transfer module ( 66 ) houses the vapor transfer bridge , vapor pump , aerosol stripper and optional vapor treatment device . this module is located in the vapor zone of the fluid management system . a pipe connects the separated aerosols from the aerosol separator to the liquid zone of the c0 2 recovery module . this module connects to the vapor zones of the c0 2 recovery module ( 72 ) and dense fluid centrifuge module ( 60 ) via the vapor transfer bridge . this module maintains relatively constant pressure between all connected modules . optional catalytic and metal oxide treatment unit and supercritical ozonation unit ( both not shown ) can be used in - line on the vapor transfer bridge to increase the purity level of the resulting clean liquid c0 2 and provide additive chemistry to the dense fluid centrifuge module , respectively . the c0 2 liquid transfer module ( 68 ) houses the liquid transfer bridge , liquid pump and in - line filter . this module is located in the liquid zone of the fluid management system . this module connects to the liquid zone of the dense fluid centrifuge module and the liquid zone of the c0 2 recovery module via the liquid transfer bridge . the pretreatment agent management module ( 74 ) is an optional subsystem which houses the prewash agent , agent pretreatment devices , delivery and return pump , valves and level control devices for delivery of prewash agent to and from dense fluid centrifuge or return of additives back to the optional additive injection unit . a c0 2 vapor recovery line connects this module to the vapor transfer module . the waste management module ( 76 ) is another optional subsystem collects and stores the separated pre - spin waste , contaminants and spent prewash agent and residues . a pipe connects the liquid zone of this module to the liquid zones of the c0 2 recovery module and pretreatment agent recovery module . finally , an optional recirculation pump and filter element may be placed located in the liquid to perform a continuous centrifugal spray wash or centrifugal spray - under - immersion enhancement for the pretreatment and phase - shift extraction operations . high pressure high level optical sensors ( hlos ), located in the vapor zones , and low level optical sensors ( llos ), located in the liquid zones , are employed herein to measure dense fluid phase levels in the dense fluid centrifuge , clean liquid c0 2 storage and c0 2 recovery modules during phase - shifting , pre - wash , vapor recovery and recharge operations . a heat pump is used to remove heat from the clean liquid c0 2 storage module and input heat into the c0 2 recovery module . vapor and liquid are maintained under relatively equilibrium conditions and dense fluid transfers between modules are performed with less energy input . under these conditions , vapor and liquid transfers can be made without a mechanical pump , using only differences in density and vapor - liquid boundary elevations between modules to perform the transfer operations — as in during centrifugal phase - shift separation operations . for example , saturated liquid flows from the clean liquid c0 2 storage module into the dense fluid centrifuge module via the liquid transfer bridge as saturated vapor is returned from the vapor zone of the dense fluid centrifuge module back to the vapor zone of the clean liquid c0 2 storage module via the vapor transfer bridge . following which , saturated dirty liquid will flow from the dense fluid centrifuge module to the c0 2 recovery module ( provided that the liquid zone level therein has been distilled to a level that is lower than the dense fluid centrifuge module ) during which saturated vapor flows through the vapor transfer bridge into the vapor zone of the dense fluid centrifuge module . an overview of the dense fluid centrifugal cleaning and management process is illustrated in fig4 a which shows the five major sequences of the process . sequence i , is the load sequence ( 78 ) wherein substrates are placed into a basket ( fig1 c ) or other suitable centrifuging fixture and placed into the high pressure vessel and specifically into the centrifuge drum . the door or lid is closed and the process is ready to start . sequence ii , the “ centrifuge dense fluid sequence ” ( 80 ) is separated into four cycles a - d , some of which are optional . during cycle a ( 80 a ) the centrifuge begins to oscillate in a bi - directional rotation at a preset ramp rate between a maximum and minimum rotational speed and acceleration rate . this sequence continues throughout the rest of the sequence . alternatively , tumble and barrel cycles can be set at this point for subsequent and optional gimbal operations ( fig2 b and 2 c ). cycle b ( 80 b ) is an equalization step which may include an optional a pre - spin cycle to remove gross contaminants which are now being spun from the substrates following which an optional prewash cycle which can precondition , react with or otherwise modify the contaminants contained on the substrate may be added . these optional steps involve centrifugal froth flotation and multiphase cleaning ( liquid - gas , liquid - liquid and liquid - scf extractions ) to assist in scouring and scrubbing tough contaminants from substrates . after , or in the absence of , the above optional steps the equalization step is performed to equalize the vapor zone pressures between the vapor transfer module and dense fluid centrifuge module . cycle c ( 80 c ) is an optional cycle the phase shift extraction cycle which may contain an centrifugal froth flotation step . this step is similar to the cycle b optional prewash frothing step , although it uses only c0 2 pressure adjustments , to create scrubbing bubbles to assist with scouring and centrifuging fine particles from substrates . cycle d ( 80 d ) is another optional cycle wherein dense fluid is recovered . optional centrifugal gas heat up or thermal vacuum extraction processes are performed at this point . following these optional post - treatment operations , the centrifuge cycle is stopped ( no motion ). sequence iii , is the unload sequence ( 82 ) at this point the lid is opened . the substrates contained in the basket or fixture are removed from the centrifuge drum and the cleaning process is ended . sequence iv , the dense fluid management sequence ( 84 ) occurs in parallel with the three sequences described above , dense fluid , prewash agent and waste are managed in the background . using the modules previously described , dense fluids are distilled , filtered , transferred , chemicals added to , and vapor is purified and condensed . prewash agents and wastes are managed in separate operations . sequence v is the automation and control sequence ( 86 ) it occurs in parallel with the four sequences described above , electronic measurements are made continuously within each module and include phase determination , level determination , pressure , temperature , rotational speed , vibration , centrifuge orientation angle and lid closure state , among many others . electronic sensors , a plc or pc and software are required to perform the measurements and tasks described herein . a detailed illustration of the dense fluid centrifugal cleaning and management process is shown in fig4 b which further distills the five general sequence illustrated in fig4 a in to a sequence of steps . sequence i , ( also step 1 ) is the “ load sequence ” ( 78 ): during the “ load sequence ” the substrates are loaded into a suitable basket of fixture and placed into dense fluid centrifuge drum ( 26 ) and the centrifuge lid is closed and locked using hydraulic closure control and locking ring mechanisms ( fig1 a - d ). the system is now ready for prewash , extraction and recovery sequences . sequence ii , the “ centrifuge dense fluid sequence ” ( 80 ) is separated into four cycles a - d , some of which are optional . step 2 begins by rotating the centrifuge drum ( fig1 a , 26 ) containing substrates in the dense fluid centrifuge in a clockwise or counterclockwise direction at between about 50 and about 500 rpm , ramping up to between a pre - selected upper and lower centrifuge speed and acceleration rates that are as fast as permissible by the magnetic coupling of the drive ( i . e ., about 250 inch pounds torque ) and motor drive capabilities ( fig1 a ) after a predetermined period of time , stopping the dense fluid centrifuge completely , reverse direction , and begin speed ramp again . this is called the “ centrifuge cycle ”. the centrifuge cycle is operated continuously throughout the remainder of sequence ii . the action of the centrifuge cycle produces variable fluid shear in the centrifuge — does not allow the prewash agent or dense fluid within the chamber to reach an equilibrium velocity with the rotating substrates . during cycle a ( 80 a ) the centrifuge oscillates in a bi - directional rotation at a preset ramp rate between a maximum and minimum rotational speed and acceleration rate . this sequence continues throughout the rest of the sequence . alternatively , tumble and barrel cycles can be set at this point for subsequent and optional gimbal operations ( fig2 b and 2 c ). if the gimbal device ( 56 ) shown in fig2 a is used , the centrifuge drum ( 26 ) may be oriented to any angle from vertical to horizontal to allow for barrel finishing and tumble finishing . separate barrel - fuge and tumble - fuge cycles can be selected at this point , but are optional . barrel - fuge and tumble - fuge cycle operations have similar oscillation changes but always have a much lower and constant ( no ramping ) rotational velocity of between about 1 and about 20 rpm . prior to rotating from a vertical ( centrifuge ) to barrel ( about 45 degrees ) or tumble ( about 90 degrees ) orientation , the centrifuge automatically changes to the predetermined barrel - fuge or tumble - fuge cycle settings . step 3 is an optional step which may occur prior to vapor equalization , during which waste is recovered . the inclusion of this step in the process is dependant on the nature of substrate being cleaned . during this step excess oils and solid contaminants ( if present ) are wrung from the substrates located within the centrifuge drum ( 26 ) and transferred under centripetal force into the separation zone ( 36 ). a liquid transfer valve ( 88 ) is opened and a waste evacuation pump ( 90 ) is turned on to transfer separated contaminants from the dense fluid centrifuge module ( 60 ) through drain ports ( b or d , depending upon orientation of centrifuge ) through filter element ( 92 ) via liquid transfer pipe ( 94 ) through opened waste transfer valve ( 96 ) to the waste management module ( 76 ). step 4 is another optional step . during this step a pre - wash may be accomplished by using one or more of the following processes ( a ) centrifuge spray cleaning , ( b ) spray - under - immersion and ( c ) multiphase froth flotation with liquid - gas , liquid - liquid or liquid - scf multiphase extraction . generally , to begin , a prewash agent from a pretreatment agent management module ( 74 ) at a predetermined temperature of between about 20 and about 150 c . is transferred by opening a liquid transfer valve ( 100 ), using a liquid transfer pump ( 102 ), and liquid transfer pipe ( 104 ) into fill port ( a ) and delivered via the multi - ported spray manifold ( 38 ) to the substrates contained in the centrifuge drum ( 26 ). the substrates are then effectively centrifugally spray washed , scoured and thoroughly coated with prewash agent during the entire filling operation ( spray wash / wring operation ) with loosened and separated contaminants transferred under centripetal force from the centrifugal cleaning zone ( 32 ) to the separation zone ( 36 ). more particularly , a centrifugal spray cleaning operation may be used during which the pressure vessel ( 2 ) and perforated centrifuge drum ( 26 ) within are filled partially as determined by the low level optical sensor ( 42 ), whereupon a recirculation pump ( 106 ) with filter element ( 108 ) continuously sprays filtered prewash agent over centrifuged substrates via multi - ported spray manifold ( 38 ). this is performed by opening liquid transfer valve ( 110 ) and pumping filtered prewash agent from drain port ( d or b depending upon centrifuge orientation ) through recirculation pipe ( 112 ) into fill port ( a ) and through the multi - ported spray manifold ( 38 ) and the liquid transfer valve ( 100 ) is closed and the transfer pump ( 102 ) from the pretreatment agent management module ( 74 ) is turned off . or a centrifugal spray - under - immersion cleaning operation may be used during which the pressure vessel ( 2 ) and perforated centrifuge drum ( 26 ) within are filled completely as determined by high level optical sensor ( 40 ), whereupon a recirculation pump ( 106 ) with filter element ( 108 ) continuously sprays - under - immersion filtered prewash agent over centrifuged substrates via internal spray manifold . this is done by opening liquid transfer valve ( 110 ) and pumping filtered prewash agent from drain port ( d or b depending upon centrifuge orientation ) through recirculation pipe ( 112 ) into fill port ( a ) and through multi - ported spray manifold ( 38 ). in either case ( operation 4 a or 4 b ), and when prewash fill operation is completed and the liquid transfer valve ( 100 ) is closed and the transfer pump ( 102 ) from the pretreatment agent management module ( 74 ) is turned off . or a centrifugal froth flotation and multiphase cleaning operations may be used to increase pressure ( fluidize ) within dense fluid centrifuge by transferring clean liquid carbon dioxide stored in a storage tank ( 114 ) located in the clean liquid c0 2 storage module ( 70 ) via the liquid transfer pipe ( 116 ) located in the liquid transfer module ( 68 ) through opened liquid transfer valve ( 118 ) and through fill port ( a ) located in the liquid zone of the dense fluid centrifuge module ( 60 ) and through multi - ported spray manifold ( 38 ) to a pressure of between about 650 and about 2000 psi . a liquid booster pump ( 120 ) is used to fluidize the chamber to pressures greater than the equilibrium pressure within the clean c0 2 storage module ( 70 ) pressure ( typically & gt ; 900 psi ). following this , the booster pump ( 120 ) is turned off and the transfer valve ( 118 ) is closed . next a vent valve ( 121 ) located on vent return pipe ( 122 ) is opened which connects the vent port ( c ) to the c0 2 recovery module ( 72 ). this operation may be used to controllably reduce the pressure ( defluidizes ) within the dense fluid centrifuge by transferring vapor from the dense fluid centrifuge module ( 60 ) to dense fluid recovery tank ( 124 ), next the vent valve ( 121 ) is closed . the whole process to defluidize may be repeated as required . at the end of this step , ( step a ) the dense fluid centrifuge internal pressure should be returned to near ambient pressure conditions . this may be accomplished by first recovering dense fluid vapor through vent port ( a ), recovery pipe ( 122 ), opened vent valve ( 121 ) and into the c0 2 recovery tank ( 124 ) until pressure is equalized between the two modules . following this , the vent valve ( 121 ) is closed . this optional step produces several advantageous cleaning actions including co - solvency , emulsion cleaning and centrifugal shear , frothing or foaming , bubble shearing and scouring action and gas - solid flotation mechanisms and may be performed in the barrel - fuge and tumble - fuge operations . other advantages to using this optional step depending upon the temperature , as measured by temperature thermocouple ( 46 ), of prewash agent and fluidization pressure exerted , as measured by the pressure transducer ( 44 ) or other similarly functioning measurement or sensing devices , the dense fluid phase ( s ) present within the dense fluid centrifuge module ( 60 ) using liquid carbon dioxide and prewash agent may be controlled to be a combination of vapor , liquid or supercritical fluid — producing a range of prewash agent - dense fluid physical and chemical combinations . these include liquid - gas extraction , liquid - liquid extraction and liquid - supercritical fluid extraction . a non exhaustive list of pre - wash additive include oxidants such as ozone gas , supercritical ozone , sulfur dioxide gas , sulfur dioxide liquid , sulfur trioxide gas and hydrogen peroxide liquid , or reducing agents such as dimethyldithiocarbamate liquid , or liquid alcohols and glycols such as methanol , isopropanol , polyalcohols ( some solids may be dissolved in soy methyl esters as additives ), polyethylene glycol and tetrahydrofurfuryl alcohol ( thfa ), or esters such as soy methyl esters , or oils such as napthenic , paraffinic and aromatic oils , or alkanes such as propane , butane or hydrochlorofluorocarbons , or alkenes such as propylene carbonate , or liquefied gases such as liquid nitrogen , liquid ammonia , sulfur dioxide , butane , propane , sulfur hexafluoride or hydrofluorocarbons . in addition , prewash agents can be complexing agents , chelating agents , surfactants , detergents , dispersants , foaming agents , brighteners , softeners and bactericidal agents and combinations thereof . step 5 is another optional step . following the completion of any one or combination of the options detailed in step 4 the bulk of the prewash agent is removed from the dense fluid centrifuge module ( 60 ) and returned to the pretreatment agent management module ( 74 ) via drain port ( d or b depending upon orientation of centrifuge ) through opened liquid transfer valve ( 88 ) with liquid transfer pump ( 90 ) turned on and through liquid transfer pipe ( 94 ) and through opened valve ( 126 ). valve ( 88 ), valve ( 126 ) and transfer pump ( 90 ) remain on for a time period from 30 seconds to 3 minutes while the centrifuge cycle continues to separate residual prewash agent from pretreated substrates . following this , valve ( 88 ) and valve ( 126 ) are closed and pump ( 90 ) is turned off . step 6 follows the completion of steps 2 - 5 or any combination thereof , the vapor pressures between dense fluid centrifuge module ( 60 ) and clean liquid c0 2 storage module ( 70 ) are equalized through the vapor zones of each system using the vapor transfer bridge ( 128 ) located in the vapor transfer module ( 66 ). vent valve ( 130 ) located on vent line ( 122 ) is opened to the vent port ( c ) until the pressures between the two modules are approximately equal , determined by comparing a clean tank pressure sensor ( 132 ) with the dense fluid centrifuge module through the pressure transducer ( 44 ) cycle c is the “ phase shift extraction cycle ” wherein extraction and recovery of trace prewash agents , contaminants , particles or residues and dense fluid from substrates under isobaric and isothermal conditions occurs . step 7 is the initial phase change . it is a “ solvent phase ” during which the vapor bridge , connected to the vent valve ( 130 ), is opened . clean dense fluid ( liquid ) is transferred from storage tank ( 114 ) located in the clean liquid c0 2 storage module ( 70 ) via the liquid transfer bridge ( 116 ) located in the vapor transfer module ( 68 ) through opened liquid transfer valve ( 118 ) and through fill port ( a ) located in the liquid zone of the dense fluid centrifuge module ( 60 ) and through multi - ported spray manifold ( 38 ) and to a pressure of between about 650 and about 2000 psi . displaced dense fluid vapor returns through vent port ( c ) via vent line ( 122 ) through vent valve ( 130 ) and into vapor transfer module ( 66 ). during this operation , the substrates are being centrifugally scoured and spray washed . a liquid booster pump ( 120 ) is used to fluidize the chamber to pressures greater than the equilibrium pressure within the clean c0 2 storage module ( 70 ) pressure ( typically & gt ; 900 psi . ), to perform this , a booster pump ( 120 ) is turned on and the valve ( 118 ) is closed . step 8 is the second phase change . it is a “ non - solvent phase ” during which contaminated dense fluid is transferred through one of the two drain ports ( d or b depending upon centrifuge orientation ) from dense fluid centrifuge under isobaric and isothermal conditions ( vapor phase exchange ) through valve ( 134 ) and transfer pipe ( 136 ) and into the liquid zone of the recovery tank ( 124 ) while vapor from the clean storage tank ( 114 ) replaces evacuated contaminated dense fluid liquid within cleaning vessel under constant temperature and pressure through valve ( 130 ) and transfer pipe ( 122 ) and through vent port ( c ). alternatively , dirty dense may be returned back to the clean tank ( 114 ) if not grossly contaminated or if it contains special additives using liquid transfer pump ( 106 ) through transfer line ( 138 ) through transfer valve ( 140 ) and into clean storage tank ( 114 ). during this process , the liquid phase is receding within the dense fluid centrifuge causing the liquid - phase ( high density ) dense fluid containing contaminants to be wrung out of internal cavities as the vapor phase ( lower density ) dense fluid increases in volume — flushing particles and oily contaminants from internal cavities . using isobaric transfer greatly limits temperature drop during liquid carbon dioxide phase exchange , typical of conventional processes . step 9 is a cleaning operation which may take one or more of three forms ( a ) centrifugal spray , ( b ) centrifugal spray - under - immersion and ( c ) centrigal froth flotation . additionally , the cleaning operation ( s ) may occur during a variety of orientations of the centrifuge drum ( 26 ) via the gimbal device ( fig2 a - 2 c ) to tumble and / or barrel orientations and all orientations in - between . a centrifugal spray operation may be used during which the pressure vessel ( 2 ) and perforated centrifuge drum ( 26 ) within are filled partially as determined by the low level optical sensor ( 42 ), whereupon an optional recirculation pump ( 106 ) with filter element ( 108 ) continuously sprays filtered liquid carbon dioxide over centrifuged substrates via multi - ported spray manifold ( 38 ). this is done by opening liquid transfer valve ( 110 ) and pumping liquid carbon dioxide obtained from drain port ( d or b depending upon centrifuge orientation ) through recirculation pipe ( 112 ) into fill port ( a ) and through the multi - ported spray manifold ( 38 ). or a centrifugal spray - under - immersion cleaning operation may be used during which the pressure vessel ( 2 ) and perforated centrifuge drum ( 26 ) within are filled completely as determined by high level optical sensor ( 40 ), whereupon optional recirculation pump ( 106 ) with filter element ( 108 ) continuously sprays - under - immersion filtered liquid carbon dioxide over centrifuged substrates via internal spray manifold . this is done by opening liquid transfer valve ( 106 ) and pumping filtered liquid carbon dioxide obtained from drain port ( d or b depending upon centrifuge orientation ) through recirculation pipe ( 112 ) into fill port ( a ) and through the multi - ported spray manifold ( 38 ). or centrifugal froth flotation cleaning operation may be used . the pressure within the dense fluid centrifuge module ( 60 ) is increased pressure to between about 650 and about 2000 psi by transferring clean liquid carbon dioxide stored in a storage tank ( 114 ) located in the clean liquid c0 2 storage module ( 70 ) via the liquid transfer bridge located in the vapor transfer module ( 68 ) through opened liquid transfer valve ( 118 ) and through fill port ( a ) located in the liquid zone of the dense fluid centrifuge module ( 60 ) and through the multi - ported spray manifold ( 38 ). a liquid booster pump ( 120 ) is used to fluidize the chamber to pressures greater than the equilibrium pressure within the clean c0 2 storage module ( 70 ) ( typically & gt ; 900 psi ). following this , the booster pump ( 120 ) is turned off and the transfer valve ( 118 ) is closed . following this , vent valve ( 121 ) located on vent return pipe ( 122 ) is opened which connects the vent port ( c ) to the c0 2 recovery module ( 72 ). this operation reduces the pressure ( defluidizes ) within the dense fluid centrifuge by transferring back vapor to dense fluid recovery tank ( 124 ). following this , the vent valve ( 50 ) is closed . if required , the dense fluid centrifuge may be re - fluidized to the predetermined fluidization pressure and defluidized repeatedly as described above . at the end of this operation , equalize dense fluid centrifuge internal pressure with clean tank storage tank pressure by opening vapor transfer valve ( 130 ) connected to vent port ( c ) with vapor transfer pipe ( 122 ) and through vapor transfer bridge ( 128 ) into the vapor zone of a clean storage tank ( 114 ). finally , the centrifugal phase shift process can be using the gimbal device ( 56 ) ( fig2 a - c ) to the barrel orientation and / or to the tumble orientation and back to the vertical orientation , with the centrifuge cycle altered to a predetermined tumble - fuge or barrel - fuge cycle , respectively . dense fluid will separate from substrates during rotation into saturated vapor phase at top of rotation and saturated liquid phase at bottom of rotation . the phase shift extraction cycle concludes following the last isothermal - isobaric transfer from dense fluid centrifuge into either the clean tank or recovery tank — with only dense fluid vapor phase present within dense fluid centrifuge . steps 8 and 9 my be repeated sequentially as required to produce “ solvent ” and “ non - solvent ” phase conditions sequentially and instantly under isothermal and isobaric conditions while the substrates are continuously operating under the centrifugal cycle producing vigorous scouring , void filling and draining , frothing and variable solvency . step 10 , represents the recovery of the residual dense fluid vapor contained within dense fluid centrifuge . residual dense fluid is recovered through vent port ( c ), vapor transfer pipe ( 122 ), opened vapor transfer valve ( 130 ) through vapor transfer bridge ( 142 ) through vapor aerosol condenser ( 144 ) and using a gas booster pump ( 146 ), whereupon the vapor is compressed and condensed using a heat exchanger ( 148 ), is transferred into the clean storage tank ( 114 ). the dense fluid recovery operation is typically performed until internal dense fluid centrifuge pressure is lowered to about 300 psi as measured by pressure transducer ( 44 ). step 11 is an optional step . should heating and ionization of the substrates be necessary whether because the optional dense fluid froth flotation cycles are performed or the substrates must be outgassed to remove residual vapor and electrostatic charges . hot ionized gas is produced under pressure by heating and ionizing a gas from an external source ( i . e ., air ) or vapor from the clean c0 2 liquid storage tank ( 114 ), if c0 2 vapor is used , it is recycled into the vapor recovery module . using clean dry air , air is fed through a vapor transfer valve ( 150 ), using a heater - ionizer unit ( 152 ) and through transfer pipe ( 116 ) and into fill port ( a ) and through internal spray manifold ( 38 ) during which the dense fluid centrifuge cleaning vessel is continuously vented to the atmosphere through vent port ( c ) and through either vent valve ( 154 ) via vent pipe ( 156 ) and into the atmosphere or , if c0 2 is used , through vent valve ( 120 ) and into vapor zone of contaminated dense fluid storage tank ( 124 ). centrifugal hot ionized gas spraying continues until the internal temperature is greater than 20 c . the heated ionization cycle may also be performed using an internal infrared heating - ionization element ( not shown ) which traverses the vertical axis of the internal spray manifold ( 38 )— which uniformly exposes substrates to said internal heating - ionization element using the centrifuge with or without a negative pressure to expose all of the substrates . a combination of negative pressure with the infrared heater - ionization embodiment heats and neutralizes charges contained on the substrates more quickly . following this operation , the heater - ionizer unit ( 152 ) is turned off . step 12 is when the lowering of the residual gas pressure , within the dense fluid centrifuge , to ambient pressure conditions by leaving vent valve ( 154 ) open until internal pressure is less than about 20 psi as measured by pressure transducer ( 44 ). step 13 is an optional step . following the release of residual pressure , the dense fluid centrifuge may be placed under vacuum conditions with internal infrared heating to outgas and residual and trace vaporous contaminants . step 14 marks is the end of the “ dense fluid recovery cycle ” is stopped the centrifuge activity ceases and the motor is slowed to zero rotational velocity . sequence iii is the unload sequence which has one step . step 15 is when the centrifuge lid ( 4 ) is unlocked using hydraulic unlock and opened and the clean and finished , heated and ionized , substrates within the centrifuge drum ( 26 ) are removed . the system is now ready for another dense fluid cleaning and finishing process . sequence iv is the dense fluid management sequence . this sequence occurs in parallel and in combination with sequences i - iii . step 16 is when the vapor transfer and equalization operations occur . contaminated dense fluid contained in the recovery tank ( 124 ) is continuously separated by distillation into two phases : a saturated vapor phase comprising carbon dioxide and a liquid phase comprising prewash agent ( s ), carbon dioxide additive ( s ) and contaminant ( s ). heat required for constant pressure and temperature distillation is supplied preferably withdrawn from the clean storage tank ( 114 ) using a heat pump ( 158 ). the saturated vapor phase contained in the vapor zone of the recovery tank ( 124 ) is transferred through the vapor transfer bridge ( 142 ) using a gas pump ( 146 ) and through an aerosol vapor separator ( 144 ) and through a heat exchanger ( 148 ) and into the temperature - controlled clean storage tank ( 114 ). a combination of vapor transfer pump ( 146 ) and heat pump ( 158 ) maintain the pressure and temperature within the clean storage tank under vapor - liquid equilibrium conditions from about − 40 to about 70 f . and about 650 to about 850 psi , respectively . a vapor transfer bridge ( 142 ) maintains vapor pressure equilibrium between clean storage tank and - recovery tank to prevent supersaturation ( non - equilibrium ) conditions . aerosol contaminants scrubbed from the vapor using a high pressure aerosol separator ( 144 ) are returned to recovery tank liquid zone via aerosol transfer pipe ( 160 ). step 17 is an optional step . if prewash step 17 occurs this step allows for the recovery of prewash agent and contaminants . during this step , the liquid phase constituents separated and concentrated within the liquid zone of the recovery tank ( 124 ) are periodically transferred , under pressure , to the pretreatment agent management module ( 74 ) via a transfer pipe ( 162 ) and through an opened transfer valve ( 164 ) as required for treatment , reuse or disposal under the vapor pressure supplied in recovery tank ( blowdown recovery operation ). following this operation , prewash agent valve ( 164 ) is closed . the mixture of carbon dioxide gas and optionally heated prewash agent stored in the prewash agent storage tank ( 198 ) may be maintained under carbon dioxide gas pressure for subsequent operations within the dense fluid centrifuge module ( 60 ). a closed - loop filtration system ( 200 ) is used to maintain the quality of the prewash agent . an optional vacuum distillation system ( 202 ) may be used to further purify the prewash agent . prewash agent makeup is provided through valve ( 204 ) and wasting or controlled drag - out of prewash agent is provided via valve ( 206 ). collected wastes in the form of spent or residual prewash agents and contaminants stored within the waste storage tank ( 98 ) are transferred to a suitable waste facility via valve ( 208 ). step 18 , is the carbon dioxide ( co 2 ) supply recharge procedure . to re - supply c0 2 vapor lost during venting and blowdown operations are performed periodically using an external source of liquid carbon dioxide ( not shown ) transferred via a transfer pipe ( 166 ), opened valve ( 168 ) and transfer pump ( 170 ) into the liquid zone of the clean storage tank ( 114 ). step 19 , is the fluids management procedure . during this step the high level optical sensors ( 178 and 172 ) and low level optical sensors ( 176 and 174 ) located in the lower and upper halves the clean storage and recovery tanks , respectively , as well as pressure sensors ( 132 and 180 ) and temperature sensors ( 184 and 182 ) are used with a plc or pc and software to monitor and control distillation , liquids concentration , vapor recovery and carbon dioxide recharge operations in the dense fluid management systems as well as insure adequate availability of saturated dense fluid and maintenance of vapor - liquid equilibrium conditions for dense fluid phase shifting , fluidization , flotation and pre - washing cycles herein . step 20 , is an optional step for injecting additives into the clean dense fluid or for recharging the clean dense fluid with additives . if additives are injected into the clean dense fluid storage tank using the optional additive injection system ( fig3 ), using opened valve ( 186 ), injection pump ( 188 ) and in - line mixer ( 190 ) or if the clean dense fluid is used and returned several times during phase shift cycles described above for lightly contaminated loads , the clean storage tank contents must be periodically cleaned and recharged ( with additives if required ). this is accomplished as follows : clean storage tank dense fluid is transferred on a batch basis through the liquid transfer bridge ( 116 ) into the recovery tank ( 124 ) through opened valve ( 192 ), whereupon operations 16 through 19 above are performed . this may be performed during non - production periods in two ( 2 ) or three ( 3 ) large volume transfers or during production operations in multiple small volume transfer operations . this process maintains the “ quality ” desired for the cleaning storage tank dense fluid in terms of cleanliness or additive concentration . step 21 is an optional step and dependant on the cleaning parameters and the nature of substrate being if the quality requirement for the clean storage tank dense fluid is very stringent ( contaminant levels & lt ;& lt ; 1 ppm (& gt ; 99 % purity )), for example as with wafer cleaning applications ( fig1 ), an add - in treatment unit for the vapor phase is provided . the present invention provides both single stage distillation ( sequence steps 16 - 17 above ) for general industrial quality cleaning solvent ( 99 % pure ), multiple - distillation treatment capability ( step 20 above ) and an enhanced vapor treatment process for producing “ ultrapure ” dense fluid as follows : vapor may be transferred from recovery tank through vapor transfer bridge ( 142 ), using a vapor transfer pump ( 146 ) and into an optional vapor treatment unit ( 194 ) which contains a device to preheat the vapor to a temperature of approximately 200 c ., contacted with a catalytic bed and transferred through a regenerative metal oxide dryer . following this , the ultrapure vapor is transferred through a heat exchanger ( 148 ) and compressed as a saturated ultraclean liquid in clean storage tank ( 114 ). in these applications , special attention is observed with respect to the quality of construction materials for the dense fluid centrifuge and integrated fluid management system specifically , non - reactive materials should be used to avoid interaction with the cleaning . materials such as stainless steel , peek , fluorocarbons , and nylon . sequence v is also the “ automation and control of dense fluid cleaning and fluids management system ”. the dense fluid cleaning and dense fluid management apparatus and processes are preferably automated and electronically controlled using software , process logic controller ( plc ) or a personal computer ( pc ), pressure sensors or switches , temperature sensors or switches , position sensors , vibration sensors ( out - of - round centrifuge conditions ) and optical level sensors , among other electronic devices . electronic control devices which efficiently perform the phase shifting , centrifugation , recycling and recovery processes of the present invention six vapor zone and liquid zone optical liquid level sensors ( 40 , 42 , 176 , 178 , 172 , 174 ) which provide an electrooptical “ go ” and a “ no - go ” indicator of saturated c0 2 vapor and liquid phase levels present within the upper and lower halves of the three high pressure vessel of the dense fluid centrifuge module ( 60 ), clean storage tank ( 114 ) and within the vapor recovery tank ( 124 ). pressure transducers / sensors ( 44 , 132 , 180 ) and temperature thermocouple / sensors ( 46 , 182 , 184 ) located in all three pressure vessels described above ensure reliable vapor - liquid equilibrium control between systems . an overview and application of the within process is shown cleaning a substrate which is a contaminated machined ball point pen tip ( 300 ) in fig5 . the contaminated substrate contains a deep narrow void wherein at the bottom is a small ( 1 mm diameter ) stainless steel ball ( 310 ) which is swaged into the tip . this substrate body is machined from solid brass or stainless steel rod stock using precision swiss screw machine technology employing tiny drills and swaging devices and cutting fluids . substrates produced with this machining technology are soaked in oil and laden with metallic fines and chips ( contaminants ) ( 320 ) within the voids and cavities and the surface is coated with thin films of waxes ( not shown ) and extreme pressure agents ( machining oil additives ). moreover , because of their small size ( about 3 mm diameter by about 25 mm length ), virtually millions of ball point tips will pack a centrifuge drum having a 12 × 12 inch diameter . cleaning with the within method and apparatus has removed nearly 250 milliliters of oils , wax and chips in such a mass of pen tips . this ball point tip ( 300 ) application presents several problems that require innovative device and process adaptations not found in conventional dense fluid cleaning technology . unlike conventional dense fluid cleaning technology , the present invention addresses the above problems by providing five unique features . the ability to separate excess contaminants from heavy and densely packed loads excess contaminants prior to cleaning . the ability to provide a prewash step to emulsify wax films and remove metal chips (& gt ; 100 microns ) trapped in voids . the ability to precision clean the heavy and dense mass of parts to remove trace oils and small metal particles (& lt ; 100 microns ) trapped in deep voids and narrow interstitial spaces ( i . e ., ball - body interface ). the ability to perform the previous operations without causing the substrates to rust or corrode . finally , the ability to have the parts clean and dry ( warm ) following processing . one additional feature is to also prepare metallic ball point tips , subject to oxidation , for extended shelf - life . this is accomplished by using a rust inhibitor in the optional prewash step which binds to the active metal sites of the metallic parts ( complex formation ) and is not subsequently appreciably removed in the extraction step . the centrifugal froth flotation process is also illustrated in fig5 with respect to the ball pen tip ( 300 ). first voids filled with contaminants , prewash agent or dense fluid are pressurized ( 400 ) with dense fluid until it gas saturation or super - saturation conditions are created within cavities , voids and interstitial spaces of the pen tip , contaminants , prewash agent ( s ) and dense fluid , during which the substrate is subjected to a continuous bi - directional centripetal force . next the pressure is reduced which causes millions of microscopic scrubbing and scouring carbon dioxide vapor bubbles ( 410 ) to form in the cavities , voids and interstitial spaces therein forming a foam or froth ( 420 )— gas - liquid interfaces . finally , the froth under the influence of centripetal force creates various cleaning actions — shear , cavitation and flotation causes the contaminants ( 320 ) to separate from internal cavities , voids and interstitial spaces whereupon centripetal shear further separates contaminants from substrate and transfers them to the separation zone of the dense fluid centrifuge ( fig1 c ). [ 0132 ] fig6 a is a chart showing the dense fluid and gives physicochemical data that includes critical point , triple point , solubility , density and viscosity data . the phase - shift process described herein uniquely contributes both “ chemical ” and “ physical ” cleaning and separation energies . the entire process is performed under the constant physical influence of a centripetal force . therefore changes in physical state of the dense fluid can used to rapidly separate trapped or entrained contaminants dissolved or dispersed in solution or captured in gas - liquid or gas - solid interfaces . exchanging the two phases present at the vapor - liquid equilibrium boundary under isothermal and isobaric change accomplishes this . the centrifugal phase shifting pressure - temperature range is from about 50 to about 70 atm and about 10 to about 80 c ., respectively . the apparatus and procedures to perform this exchange have been previously described in detail above . under equilibrium conditions , the vapor phase exhibits under the same temperature and pressure a much lower density than the liquid phase . fluidization is illustrated in fig6 b and defludization is illustrated in fig6 c , at about 60 atm and about 20 c ., the instant the saturated liquid phase is present in the substrate being acted upon by a centripetal force several cleaning actions can be observed including fluid shear , vortexing and solvency because the density as risen more than 8 - fold , whereupon the very instant that the saturated liquid phase is withdrawn from the dense fluid centrifuge , replaced by saturated vapor , the voids are evacuated of saturated liquid phase which expels entrained , dissolved or otherwise captured contaminants from cavities , voids and interstitial spaces producing a non - solvent state the density has decreased by more than 8 - fold . the exchange process , whether fluidizing or defluidizing , creates significant frothing , vortexing and shearing action at the receding or rising phase boundary within the dense fluid centrifuge cavity . the present invention produces a much more rapid phase shifting process that occurs at constant temperature and pressure performed along the liquid - vapor phase boundary . this process produces a 2 - phase “ solvent spectrum ” that is altered between “ solvent phase ” ( solubility parameter — 22 mpa 1 / 2 ) and “ non - solvent phase ” ( solubility parameter —& lt ; 10 pa 1 / 2 ), respectively . [ 0136 ] fig7 provides a diagram of a conventional cleaning line for a substrate such as the ball point pen tips ( 300 ). the conventional cleaning line requires up to five ( 5 ) separate machines , five ( 5 ) independent substrate load and unload steps and a process time of over 100 minutes . fig8 provides a diagram of a conventional cleaning process for a substrate such as the ball point ( 300 ). the conventional cleaning process for the substrate requires up to nine ( 9 ) independent cleaning and finishing operations which cannot be combined because of solvent and equipment operational and process incompatibilities that cannot be resolved with conventional cleaning technology . the within apparatus and process invention ( fig9 ) can reduce the cleaning requirement for the substrate to one ( 1 ) machine , one ( 1 ) load and unload step , ( 1 ) cleaning process and a reduced processing time . shown in fig1 is a flow chart of a cleaning process for a wafer coated with photoresist ( a hard polymer coating ). for this wafer substrate a prewash agent , a soy methyl ester with other additives including amines and operating at a temperature of about 100 c . is sued . the resulting prewash process is a liquid - supercritical fluid extraction and the fluidization pressure and temperature ( imparted by prewash agent ) is greater than the critical parameters for carbon dioxide . following emulsification of the polymeric coating , the wafers may be extracted with liquid carbon dioxide . the examples of uses of this invention and the substrates listed within are not intended to provide an exhaustive list . the process and apparatus herein , may be useful for dry cleaning textiles , removing oily wastes from shop rags , treating hazardous waste , removing oil from spent oil filters , cleaning tube bundles or elongated substrates , removing organic coatings — removing mold varnish and stripping . shown in fig1 a - 11 e are a variety of centrifuge drum ( 26 ) alternate embodiments . a barreling drum ( 600 ) is a conical - shaped drum having an opening that has a larger diameter than its base and which attaches to the centrifuge bearing via the load springs ( 28 ) ( fig1 a ). the barreling drum ( 600 ) may have perforated walls in which case dense fluid flow is directed in a straight line from center point to the circumference of the centrifuge cavity ( vertical operation only ). alternatively the drum may have solid walls whereby the dense fluid flow is in a semicircle , flowing downward through the center point and upward along the walls of the drum . this design in useful for processing substrates which may be “ poured ” from the dense fluid centrifuge following processing . this design is a fill and pour design without using drum separate drum inserts such as baskets and trays . a vortexing drum ( 610 ) is a polygonal - shaped drum having a constant diameter and which attaches to the centrifuge bearing via the load springs ( 28 ) ( fig1 a ). the vortexing drum ( 610 ) has perforated walls and has various geometric and concentric shapes . fluid flow is highly turbulent due to the vortexing created by the irregular shape rotating at high velocity and is directed in a straight line from center point to the circumference of the centrifuge cavity . this design can accept a similarly shaped basket or tray filled with substrates . a cylindrical centrifuge drum ( 620 ) is a drum having a constant diameter and which attaches to the centrifuge bearing via the load springs ( 28 ) ( fig1 a ). the cylindrical centrifuge drum ( 620 ) has perforated walls . fluid flow is turbulent due to substrate - dense fluid interactions only and is directed in a straight line from center point to the circumference of the centrifuge cavity . in this design , substrates fill the entire drum cavity or , more efficiently , can accept a similarly shaped and sized basket ( 622 ) or several trays ( 624 ) filled with substrates . alternatively and as shown in fig1 c , the centrifuge may be compartmentalized about the center point ( shown ) or in horizontal segmented layers such as using several stacked trays . substrates fill individual compartments in relatively equal weight distribution that maintains balance during horizontal centrifugal processes about the central axis . a tumble drum ( 630 ) is a cylindrical - shaped drum having a constant diameter and which attaches to the centrifuge bearing via the load springs ( 28 ) ( fig1 a ). the tumble drum ( 630 ) has perforated walls and has triangularly - shaped baffles ( 635 ) affixed to the interior drum walls in a concentric manner . this design will thoroughly mix and blend substrates during extraction processes and is useful for cleaning textiles and granulated substrates subject to nesting or agglomerating . this design is for manual load and unload operations and may use a sliding inverter drum . an inverter drum ( 640 ) is a cylindrical - shaped drum having a constant diameter and which attaches to the attaches to the centrifuge bearing via the load springs ( 28 ) ( fig1 a ). the inverter drum ( 640 ) design will insert substrates into the center of a secondary centrifuge , tumble , vortex drum which then allows the substrates to be processed under turbulent mixing conditions . the substrates do not experience a centripetal force . this design is for manual load and unload operations and may be a basket ( 642 ) or a sliding tray ( 644 ) design . tests were conducted to determine how the new centrifugal phase shifting process performed in comparison to ( 1 ) standard dense fluid extractions with flow - through and fluidization operations and ( 2 ) conventional ultrasonic perchloroethylene cleaning ( boiling ). these results are shown graphically in fig1 a and 12 b . the results show that the present process produces cleaning and separation phenomenon , and equivalent cleaning results , analogous to those found in multi - stepped solvent cleaning processes in less time .	1
fig1 - 3 depict an intramedullary pin 1 in three views . the intramedullary pin 1 has a proximal end 14 and a distal end 15 . the shaft of the pin 1 is generally cylindrical in shape . the proximal end 14 may be curved in a lateral - posterior direction , while the distal end 15 may be straight or at least partly straight . proximal and distal end planes of the pin may be rotated about 60 °- 110 °, preferably 70 °- 90 ° and in particular 80 ° relative to one another . in one embodiment , the radius is between about 300 - 1300 mm , preferably about 900 - 1200 mm and in particular about 1100 mm . the length of the proximal radius corresponds to the lateral contact surface with the cortex which is about 300 - 1000 mm , preferably about 600 - 800 mm , and in particular 700 mm . the length of the distal straight section may correspond to the depth to which the distal pin end penetrates into the distal spongiosa structure . the length may be about 35 - 70 mm , preferably about 40 - 60 mm , and in particular about 52 mm . the pin 1 , at the proximal end 14 , may be designed with a 120 ° antegrade bore 2 compatible with a locking screw having a thickness between about 3 . 9 - 6 . 0 mm , a cranial 130 ° recon bore 3 compatible with a headless screw that is about 6 . 5 mm thick . the 130 ° recon bore 3 may coincide medially with the 120 ° antegrade bore 2 . the pin 1 may further be designed with a caudal recon bore 4 which is approximately 130 ° and compatible with a headless screw that is about 6 . 5 mm thick , and an oval bore 5 for static and dynamic positioning of a locking screw that is about 3 . 9 - 6 . 0 mm thick . furthermore , a lateral bevel 9 is recognizable at the proximal end 14 . the orientation of the three bores 3 , 4 , 5 allows for a combination of possibilities for locking the intramedullary pin , where antegrade locking has particular importance . a lateral opening 2 for the intramedullary pin approximately coincides with the insertion direction of the antegrade screw . if only one screw is set proximally , no further skin incision is therefore necessary . at the distal end 15 , two bores 6 and 7 extend transverse to the pin &# 39 ; s axis 18 and parallel to one another . an anterolateral bore 8 which is rotated through about 25 ° relative to the parallel bores 6 and 7 is shown at the distal end 15 . the angle formed between the anterolateral bore 8 and the parallel bores is preferably between about 45 ° and 10 °, where 0 ° corresponds to the frontal plane or the plane of two standard locking screws . a feature of the configuration of the three bores lies in the combination of the possibilities for locking . in addition to the generally known standard locking , the third bore 8 is present between the two standard bores . by locking the pin with three screws , axial stability is achieved . this ensures that the position of the distal pin end is fixed and the pin cannot be displaced on the screws . the 25 ° angle of the axial blocking screw may prevent the screw from injuring important soft tissues during insertion . this can occur , for example , if the screw is inserted in the sagittal direction ( 90 °). the locking screws may be present at a distance of about 30 mm away from one another . special formations at the tip 16 of the pin 1 allows the pin 1 to be tapped without rotation into the spongiosa in the distal femur region so as to be secured , preventing rotation even without locking by means of a screw . the tip 16 of the pin 1 may have , in a radial section , differing from the circular shape ( cylindrical ) of the body of the pin 1 , special tip surfaces , in particular concave notches or planar surfaces . in these embodiments , subsequent , arbitrary or involuntary rotation is not possible . fig4 a and 4 b depict an embodiment of the tip 16 at the distal end 15 of the pin 1 in two views . the tip 16 may have , in a radial section , differing from the circular shape , special tip surfaces 13 , in particular three planar surfaces , having a length of about 10 - 40 mm , preferably about 15 - 25 mm and in particular about 20 mm . the total length of the tip 16 may be about 20 - 50 mm , preferably about 25 - 35 mm and in particular 30 mm . bore 7 is shown near the tip 16 of the distal end 15 . fig5 a and 5 b depict another embodiment of the tip 16 at the distal end 15 of the pin 1 in two views . the tip 16 may have , in a radial section , differing from the circular shape , special tip surfaces 13 , in particular three concave notches , having a length of about 10 - 40 mm , preferably about 15 - 25 mm and in particular about 20 mm , and a radius 17 of about 4 - 10 mm , preferably about 5 - 8 mm and in particular about 6 mm . the total length of the tip 16 is about 20 - 50 mm , preferably about 25 - 35 mm and in particular about 30 mm . fig6 a and 6 b depict another embodiment of the tip 16 at the distal end 15 of the pin 1 in two views . the tip 16 may have , in a radial section , differing from the circular shape , special tip surfaces 13 , in particular four concave notches , which have a length of about 10 - 40 mm , preferably about 15 - 25 mm and in particular about 20 mm , and a radius 17 of about 4 - 10 mm , preferably about 5 - 8 mm and in particular about 6 mm . the total length of the tip 16 is about 20 - 50 mm , preferably about 25 - 35 mm and in particular about 30 mm . fig7 shows the proximal end 14 of the pin 1 viewed in a proximal to distal direction . a lateral bevel 9 , discussed previously , may form an angle at the lateral - proximal end relative to the axial pin axis 18 of between about 10 ° to 60 °, preferably about 40 °. a cylindrical recess 12 may have a thread 11 , and a positioning groove 10 on the medial side of the proximal end 14 , are shown . the bevel 9 which interrupts the transition and the contour matching between the target bow and pin 1 is preferably formed laterally at the proximal end 14 of the pin 1 . in the case of an anterior - posterior x - ray photograph , the end of the pin 1 can be easily and clearly detectable . this simplifies the surgery and leads to safer use and a shorter operation time . the pin &# 39 ; s entry point is on the lateral surface of the trochanter major . this lateral surface can be palpated particularly in slim patients . this means that the surface is covered only by a thin layer of skin . through the lateral entry point of the pin 1 , it is necessary to prevent the soft tissue from being irritated by the proximal end 14 of the pin 1 . an advantage of the bevel 9 is that the bevel 9 may ensure that the proximal end 14 fits the lateral cortex wall with a matching contour . this may prevent irritation of the soft tissue . while the distal pin section has , at least partly , no curvature at all , the proximal pin section may run in the lateral posterior direction when it is inserted into the medullary space through the lateral compacta of a trochanter major . the groove 10 which fixes the rotation of the pin 1 on the target bow is preferably present on the medial side of the proximal end 14 . the cylindrical recess 12 into which the diametrically opposite shaft of a connecting screw can penetrate between target bow and pin 1 is present at the proximal end 14 . consequently , the pin axis 18 is aligned coaxially with the target bow , and the thread 11 exerts only contact pressure . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps .	0
referring to fig1 a mercury - arc lamp 1 of a low pressure type is fixedly mounted on a base plate 3 constituting a part of a fluid - tight chamber by means of a lamp supporting member or socket 2 . light beams 5 and 6 assumed as emitted from a light extracting portion 4 located at a middle portion of the mercury - arc lamp 1 are collimated by a collimator lens 7 and subsequently pass through a flow cell composed of a cell body 9 and a cell window 8 . the light beams which have passed through the flow cell will then impinge on detector elements 12 and 13 after having passed through an optical filter 11 . the lens 7 is tightly in a light path cylinder 14 which is made of a material having a high thermal conductivity such as aluminium , copper or the like and which provides a light path . the cylinder 14 is closely fitted onto a glass bulb surface of the mercury - arc lamp 1 through a sealing member 15 provided at the abutting end of the cylinder . the cell window 8 is made of a quartz glass and welded to the opaque cell body 9 which in turn is formed with flow passages 16 and 17 through which a fluid or liquid to be measured is caused to flow . the flow cell is coupled to a cell holder 19 and the light path cylinder 14 through a packing 18 . the filter 11 destined to take out the monochromatic light is secured to a detector block 21 . a pair of detector elements 12 and 13 are secured to the detector block 21 by means of a fitting plate 22 and electrically connected to a lead wire cable 23 . a chamber 24 is formed in the detector block and maintained in a fluid - tight state by means of an o - ring 25 and a cover 26 secured by set screws 27 . the detector block 21 as well as the cell holder 19 are enclosed by a cover 29 which also serves to define a chamber 28 . a spiral metal pipe 32 having several turns is securedly held by a stationary plate 31 and functions to balance the temperature of liquid flowing into the flow cell with that of the cell body 9 . a partition plate 34 located in a chamber defined by the base plate 3 and a cover 33 shields the light extracting portion 4 of the source lamp from a heat generating portion 35 located in the vicinity of the lamp filament . in the structure described above , it will be understood that the portion of the mercury - arc lamp at which the highest temperature prevails is the heat generating portion 35 where the filament is located and the enclosing chamber 36 is subjected to the highest temperture . the partition plate 34 serves to reduce or suppress the heat transfer from the chamber 36 to the chamber 37 . the chamber 37 is located so as to enclose exteriorly the light extracting portion 4 and subjected to a high temperature next to that of the chamber 36 . the chamber 38 formed by the light path cylinder 14 and a lens 7 is tightly or closely fitted to the bulb glass surface of the mercury - arc lamp 1 by means of the sealing member 15 which may be formed of left or like material . the light path cylinder 14 is tightly fitted to the lamp surface to such degree that no gas flow may occur relative to the ambient exterior or atmosphere when the chamber 38 is at a normal pressure . in this connection , it is to be noted that the tight or close fitting of the chambers to the lamp surface which are inhibited from fluid communication with the exterior may be accomplished by directly closs - fitting the abutting ends of such chambers to the lamp surface or by closely fitting the end portions of such chamber to a supporting base portion formed integrally with the mercury - arc lamp . the chamber 39 located adjacent to the chamber 38 is maintained in a fluid - tight state at a normal pressure by means of the lens 7 , cell window 8 and the light path cylinder 14 . both chambers 41 and 42 are also fluid - tight closed so that fluid flow from or to the exterior is inhibited . in the above described embodiment , all the portions which constitute the light path extending from the light extracting portion of the source lamp to the detector elements are shielded from the ambient atmosphere . however , it will be appreciated that the portions which have negligible temperature difference relative to the ambient temperature such as the chambers 41 and 42 may be opened to the exterior because of their not incurring any appreciable increase of noise . in the case of the above described embodiment , each of the chambers 38 , 39 , 41 and 42 is placed in a tightly closed box so that these chambers are immune to the influence of the ambient temperature . in more particular , the chambers 38 and 39 are surrounded by the chamber 37 , while the chambers 41 and 42 are housed in the chamber 28 . this arrangement is effective to decrease the temperature difference relative to the ambient temperature , whereby the drift is especially reduced . since each of the chambers 38 , 39 , 41 and 42 is of a relatively small volume , a uniform temperature distribution will be likely to occur in the respective chambers . as a result , gas flow or movements will scarcely take place in these chambers . by virtue of the fact that the light path cylinder 14 is formed of a material having a high thermal conductivity , the chambers 38 and 39 are brought to a balnanced state in respect of the temperature in a short time , involving additionally an excellent heat radiation effect . fig2 a and 2b illustrate magnitude of noise produced in the apparatus according to the invention in comparison with the noise produced in a prior art apparatus . more specifically , fig2 a graphically illustrates the results of measurement performed by the prior art apparatus in which the light path cylinder 14 , the partition plate 34 and the cover 33 are not provided . it can be seen that the light absorbance change of the base line amounts to about 0 . 0005 absorbance units . on the contrary , the absorbance change of the base line is decreased to 0 . 000025 absorbance units in the case of the measurement carried out by the apparatus shown in fig1 as will be seen from fig2 b . in reality , the magnitude of noise shown in fig2 b is decreased to 1 / 20 of the noise shown in fig2 a . in either case , the measurement has been carried out by flowing methyl alcohol through a sample cell at a flow rate of 1 . 0 ml / min by means of a reciprocating piston pump . fig3 shows another embodiment of the invention in which a tungsten lamp 44 is employed as a light source . the tungsten lamp 44 is secured to a lamp base 46 by means of a lamp socket 45 . the light emitted from the lamp 44 passes through a heat shielding plate 48 which is provided in a light path cylinder 47 and constituted by an infrared ray absorbing filter of phosphate glass and a lens 7 and the light reaches a flow cell body 9 . the lamp chamber 49 is formed by a cover 51 and the base 46 and has a vent hole 52 through which either natural ventilation or enforced heat - radiating ventilation through a fan 52 is effected , as occasion requires . the partition wall 54 in combination with the light path cylinder 47 and the base plate 55 defines a chamber 58 which serves to decrease the temperature difference between the chambers 56 ; 57 and the ambient atmosphere . the flow cell is accommodated within a chamber 59 . in fig3 other components or parts similar to those of fig1 are indicated by the same reference numerals . in the case of the above described embodiment , each of the chambers 61 , 56 and 57 through which the light beams are transmitted is constructed in a tightly closed manner independently from one another . since the temperatures in the individual chambers are in a balanced state , the air flows in the chambers can be suppressed at a minimum . the light path cylinder 47 which also forms an exteriorly shielded chamber 61 in cooperation with the heat - shielding plate 48 is closely attached to the glass surface of the tungsten lamp 44 through a resilient seal 15 . in general , the tungsten lamp has the heat generating portion at the same location as the light extracting portion and generates a relatively large quantity of heat . accordingly , ambient air of the lamp will tend to more most easily under the influence of heat . in order to evade such phenomenon , the chamber 61 is maintained in a substantially tightly closed state with the aid of a seal made of a heat - resisting glass wool . the interior of the lamp 44 should preferably be evacuated thereby to prevent gas movement within the lamp 44 . in the above described embodiment , since the light path is constituted by a plurality of the tightly closed and partitioned chambers , the temperatures in the individual chambers are independently balanced thereby to prevent any fluid movement in the chambers . this structure is also effective to reduce the noise and drift remarkably . fig4 shows still another embodiment of the invention . lamp 63 is supported on a supporting mount 64 . a cover 65 is located so as to enclose the lamp 63 with the space between the cover 65 and the surface of the lamp 63 which is selected to be very narrow . the end portion of the cover 65 is tightly fitted to the supporting mount 64 through a sealing member 66 . a first closed chamber 67 tightly closed from the exterior is formed by a cover 65 and a shield plate 68 . it should be noted that the lamp 63 as well as the cover 65 are positioned in contact with a cooling block 69 which is adapted to be cooled by an appropriate coolant . a second closed chamber 71 is formed by a shield plate 68 , lens 72 and the cover 65 . further , a third closed chamber 73 is formed by the lens 72 , the cell body 74 and the cell window 75 . the embodiment shown in fig4 provides similar advantages as those of the preceding embodiments . gas flow into the first closed chamber 67 from the exterior is positively prevented . additionally , since the chamber 67 is so formed that the interior space thereof is made extremely small , movement of gas within the chamber 67 is essentially suppressed . fig5 shows a further embodiment of the invention . a light source lamp 77 is closely attached with an optical fiber 78 at the balb surface thereof by means of an end face fitting device 79 . the optical fiber 78 is divided at a branching point 81 and each of the divided branches of the optical fiber is secured to the cell window 8 of the cell body 9 by means of respective end face fitting devices 82 and 83 . since the light emitted from the light source is directly guided to the cell window 8 through a solid state optical conductor or the optical fiber without passing through chambers in which air is present , influence of air movements as caused by the heat generated from the light source is completely eliminated , whereby noise and drift are sharply decreased . it is also possible within the scope of the invention to connect optically the end face of the optical fiber to the light source through a chamber which is inhibited from fluid communication with the exterior . finally , referring to fig6 description will be made on a liquid chromatography in which a high sensitivity absorptiometer according to the invention is utilized as a detector for the chromatography . an eluting solution contained in an eluent reservoir 85 is caused to flow through a sample flow path and a reference flow path . the sample flow path is composed of a pump 86 , a sample injection device 87 , a separation column 88 and a sample flow cell 89 . on the other hand , the reference flow path includes a liquid feeding pump 91 , a reference column 92 and a reference flow cell 93 . the detector apparatus 94 includes a sample flow cell 89 through which effluent from the separation column 88 is caused to pass , a reference flow cell 93 through which elute from the reference column 92 is caused to pass , a light source 95 for illuminating both of the flow cells 89 and 93 and a photodetector 96 for sensing the light beams transmitted through the flow cells 89 and 93 . it will be appreciated that the flow cells 89 and 93 correspond , respectively , to the flow passages 16 and 17 composed of the cell body 9 and the cell window 8 as shown in fig1 . output signals from the photodetector 96 are processed by a suitable signal processor 97 . it has been ascertained that the liquid chromatographic system of the structure described above and incorporating an absorptiometer according to the invention allows analysis with an extremely high accuracy .	6
fig3 illustrates a perspective view of a jaw set 110 for demolition equipment having a bottom jaw 115 pivotally connected to a top jaw 125 . a bottom blade 120 is secured to the bottom jaw 115 . the bottom blade 120 has a first radial axis r 1 therethrough , wherein the first radial axis r 1 is within a rotational plane rp of the jaws 115 , 125 . the bottom blade 120 has two raised support rails 140 , 145 . each raised support rail 140 , 145 , as explained with respect to support rail 140 , includes planar surface segments 160 ( see also fig4 ), wherein the planar surface segments 160 are generally perpendicular to the rotational plane rp and extend along the bottom blade 120 parallel to the first radial axis r 1 ( fig3 ). each support rail 140 , 145 , as illustrated in support rail 140 , has recesses 165 between the planar surface segments 160 . the recesses 165 extend across the width w 1 of the raised support rail 145 . the recesses 165 of one support rail 140 are aligned with the corresponding recesses 170 of the other raised support rail 145 . a cavity 175 extends between and adjacent to the raised support rails 140 , 145 . relative pivotal motion between the bottom jaw 115 and the top jaw 125 is achieved when both jaws 115 , 125 rotatably move or when one jaw is stationary and the other jaw rotates relative to the stationary jaw . as an example , bottom jaw 115 may be stationary and top jaw 125 may rotate . a top blade 130 is secured to the top jaw 125 . the top blade 130 has a second radial axis r 2 running therethrough and within the rotational plane rp . the top blade 130 additionally includes a raised knife rail 155 having planar surface segments 180 ( fig3 a ) generally perpendicular to the rotational plane rp ( fig3 ) and extending parallel to the second radial axis r 2 . the raised knife rail 155 further includes recesses 185 between the planar surface segments 180 , wherein the recesses 185 extend across the width w 2 of the knife rail 155 . directing attention to fig5 , the width w 2 of the knife rail at the planar surface segment 160 is less than the overall width w 3 of the cavity 175 . the top blade 130 and the bottom blade 120 are symmetric about the rotational plane rp ( fig5 ). as illustrated in fig3 and 5 , the bottom blade 120 and the top blade 130 are u - shaped to provide overlapping matching surfaces on the respective bottom jaw 115 and top jaw 125 , such that the bottom blade and the top blade are supported by the jaws 115 , 125 on three sides . for example , directing attention to fig5 , the bottom blade 120 is supported by the bottom jaw 115 along support surfaces 122 a , 122 b , and 122 c . additionally , the top blade 130 is supported by the top jaw 125 along three support surfaces 132 a , 132 b , and 132 c . directing attention to fig6 , the width w 2 of the knife rail 155 at the planar surface 180 is between 10 - 40 % of the width w 3 of the cavity 175 and preferably , the width w 2 at the planar surface 180 of the knife rail 155 is approximately 20 % of the width w 3 of the cavity 175 . in addition to effectively breaking railroad rails , the subject jaw set 110 may also be used to hold one side of a railroad rail after it has been severed . in particular , fig7 a - 7d show the progression of severing a railroad rail 112 into two parts 112 a , 112 b . in fig7 a , the rail 112 is placed between the bottom jaw 115 and the top jaw 125 . as illustrated in fig7 b , the bottom jaw 115 and the top jaw 125 are urged toward each other at which time the rail 112 begins to deflect . as previously mentioned , the material used for the rail is relatively brittle and , as a result , the rail 112 will deflect only a small degree before the rail breaks as illustrated in fig7 c . briefly returning to fig5 and 6 , the rail 112 is supported by raised rail support 140 and raised rail support 145 and is unsupported along the width w 3 of the cavity 175 . the top jaw 125 applies a load to the rail 112 approximately midway between the width w 3 of the cavity 175 to produce maximum stresses on the rail 112 . it should be appreciated that the width w 3 of the cavity 175 is made possible because the bottom blade 120 is wider than the bottom jaw 115 supporting it . this is achieved by the u - shaped connections between the bottom blade 120 and the bottom jaw 115 . returning to fig7 c , with a sufficient force supplied by the top jaw 125 against the rail 112 , the rail breaks into two parts 112 a , 112 b , as illustrated in fig7 d . however , in the instances where the rail 112 is relatively long , then it is possible to configure the top blade 130 and the cavity 175 , such that after the rail 112 is severed , the longer remaining half 112 a may essentially be clamped between the top blade 130 and the bottom blade 120 so that the remaining rail section 112 a may be positioned for an additional cut , or in the alternative , may be transported to a different location . in particular and directing attention to fig6 , the width w 2 of the knife rail 155 extending away from the planar surface 180 remains generally constant in the region 187 , however , thereafter , the width increases , as illustrated by the width in region 189 adjacent to region 187 . furthermore , the width in the region 189 may increase linearly and may increase to the width w 4 equal to the width w 3 of the cavity 175 . the knife rail 155 in the region 189 as it increases linearly forms an angle a with a line perpendicular to the rotational plane rp of between 30 - 60 degrees and preferably 45 degrees . additionally , the cavity 175 may have a depth d 1 of approximately 50 - 150 % of the width w 2 of the knife rail 155 at the planar surface segment 180 . the cavity 175 may have a shape that is generally oval , however , regardless of the shape , it is important that the surfaces of the cavity 175 are continuous and do not intersect with sharp corners that produce high stress concentrations . directing attention to fig4 , each recess 165 associated with the bottom blade 120 has a depth d 2 that is approximately 20 - 70 % of the width w 1 ( fig5 ) of the rail support 145 . additionally , the length l 2 of the recess 165 is approximately 20 - 70 % of the width w 1 of the support rail 140 . it is important to note that the length l 4 of the planar recess segments 160 may be greater than the length l 2 of the recesses 165 . the purpose of this is to maximize the wear capacity of the bottom blade 120 . in a similar fashion , with respect to the top blade 130 , each recess 185 has a depth d 3 and the depth d 3 is approximately 20 - 70 % of the width w 3 ( fig5 ) of the planar surface segment 160 of the knife rail 155 . furthermore , the length l 3 of each recess is approximately 20 - 70 % of the width w 3 at the planar surface segment 160 of the knife rail 155 . finally , the length l 5 of the planar surface segments 180 of the top blade 130 may be greater than the length l 3 of the recesses 185 of the top blade 130 . once again , the purpose of this is to increase the longevity of the wear surfaces . again directing attention to fig4 , although in each instance the recesses 165 , 185 of the bottom rail 120 and the top rail 135 are radiused , they may have different shapes , however , any intersection of surfaces should have radiused corners to minimize stress concentration factors . as illustrated in fig4 , both the bottom rail and the top rail have recesses 165 , 185 that are generally arcuate in shape . fig8 illustrates a jaw set 110 with a bottom jaw 115 and a top jaw 125 in a closed position , such that the cavity 175 of the bottom blade 120 receives the radial knife rail 155 . it should be noted , however , that the recesses 165 of the bottom blade 120 are , for the most part , shifted along the radial axis r 1 relative to the recesses 185 of the top blade 130 with respect to the radial axis r 2 . under certain circumstances , this off - set feature may enhance the ability of the bottom blade 120 and top blade 130 to hold and secure railroad rails . fig4 and fig8 also illustrate the relative position of the bottom blade 120 and the top blade 130 in the partially opened position ( fig4 ) and in the completely closed position ( fig8 ). although the rail to be broken is brittle , depending upon the size of the rail 112 , the range of travel of the blades 120 , 130 toward one another may be more or less . to break the rail 112 , it must be sufficiently deflected to produce the stresses which cause failure and breakage . in certain instances , the rail 112 may be small and oriented such that the blades 120 , 130 are nearly closed when the rail 112 is initially grabbed by the blades 120 , 130 . under these circumstances , the travel of the blades 120 , 130 is such that they overlap , as shown in fig8 . in particular , the travel of the blades 120 , 130 may be so great in the closed position that the raised knife rail 155 enters the cavity 175 of the bottom blade 120 . with this arrangement , the raised knife rail 155 may compress a rail 112 within the cavity 175 . directing attention to fig3 and 9 , the bottom blade 120 is removably secured to the bottom jaw 115 and the top blade 130 is removably attached to the top jaw 125 . the arrangement for attaching each of these blades to its respective jaw is similar and , for that reason , the attachment of the bottom blade 120 to the bottom jaw 115 will be discussed with attention directed to fig6 and 9 . the bottom blade 120 includes holding lugs 190 and a stabilizer 195 protruding from the bottom blade 120 . extending through the holding lugs 190 are bores 192 adapted to accept bolts 230 . the bottom jaw 115 has receivers 200 to accept the holding lugs 190 and a cradle 205 to accept the stabilizer 195 . the holding lugs 190 extend on both sides of stiffening bars 210 extending along the lower jaw 115 . the stiffening bars also have bores 212 aligned with bores 192 to accept bolts 230 . additionally , as illustrated in fig6 , below the holding lugs 190 are stabilizer wings 215 having surfaces 220 which abut the lower jaw surfaces 225 ( fig9 ) to provide additional stiffness and to resist twisting between the bottom blade 120 and the bottom jaw 115 when forces are applied to the bottom blade 120 . as illustrated in fig6 , bolts 230 pass through the holding lugs 190 and the stiffening bars 210 to secure the bottom blade 120 to the bottom jaw 115 . it is possible to include sleeves around the bolts 230 for additional strength . it should be appreciated that this arrangement just discussed , with respect to the bottom blade 120 and its attachment to the bottom jaw 115 , is also applicable to the attachment of the top blade 130 to the top jaw 125 . as illustrated in fig7 c and 7d , when the railroad rail 112 is sufficiently stressed , due to the brittle nature of the rail 112 , it will bend only slightly before breaking . the energy released when the rail 112 breaks , typically manifests itself in energy transmitted to the severed parts . as shown in fig7 d , while segment 112 a is retained by the jaws 115 , 125 , segment 112 b becomes an airborne projectile moving in a direction away from the bottom jaw 115 . for that reason , during this cutting operation , for safety , the bottom jaw 115 of the jaw set 110 must be closest to the operator , while the top jaw 125 must be furthest from the operator . to insure this , the exterior surface 235 of the top jaw 125 is marked with indicia 240 to assist the operator in the proper orientation of the jaw set 110 during operation . in one embodiment , the indicia 240 may be a highly visible paint covering a substantial portion of the top jaw 125 , such that the highly visible paint and , therefore , the top jaw 125 should not be visible to the operator during a cutting operation . preferably , the highly visible paint is red paint . as a result , so long as during the cutting operation the operator does not see the indicia on the top jaw 125 , then there is assurance that the path of segment 112 b , as it becomes a projectile , will be directed away from the operator . a method of processing a railroad rail 112 using a rail breaker demolition tool having a jaw set 110 with a bottom jaw 115 having a bottom blade 120 , and a top jaw 125 having a top blade 130 , involves the steps as illustrated in fig7 a - 7d of holding the rail 112 between the bottom jaw 115 and the top jaw 125 , such that the bottom blade 120 of the bottom jaw 115 provides spaced - apart support using the raised support rail 140 and raised support rail 145 . as illustrated in fig7 b , the top jaw 125 and the bottom jaw 115 are advanced together , such that the top jaw 125 applies a load on the rail 112 midway between the spaced - apart support of the bottom blade 120 until the rail 112 breaks ( fig7 c ) and a severed portion 112 b ( fig7 d ) is ejected from the jaws 115 , 125 . the jaws 115 , 125 are further advanced together until the wider portion 189 of the top blade 130 compresses the remaining portion of the rail 112 a against the walls of the cavity 175 to retain the remaining portion 112 a within the clamped jaw set 110 . additionally , when the exterior surface 235 of the top jaw 125 is marked with indicia 240 , the method of processing may further include the step of orienting the jaw set 110 such that the indicia 240 of the top jaw 125 is furthermost away from the machine operator , such that any severed part 112 b may be expelled in a direction away from the operator . what has so far been described is the application of the jaw set 110 to break railroad rails . while this is the primary application for this jaw set 110 , it should be appreciated that the jaw set 110 may have other applications including , for example , compressing hollow pipe either before or after it is cut with a shear to minimize the volume the pipe occupies , thereby increasing the efficiency of stockpiling and transporting such parts . furthermore , it should be appreciated that while the bottom blade 120 has been described as removably attached to the bottom jaw 115 and the top blade 130 has been described as removably attached to the top jaw 125 , each blade and its respective jaw may be formed as a unified integral part , such that the jaw and blade would be integral with one another . while specific embodiments of the invention have been described in detail , it will be appreciated by those skilled in the art that various modifications and alternatives to those details could be developed in light of the overall teachings of the disclosure . the presently preferred embodiments described herein are meant to be illustrative only and not limiting as to the scope of the invention which is to be given the full breadth of the appended claims and any and all equivalents thereof .	4
referring now to fig1 the fume hood there shown is generally identified by the numeral 10 . as is the practice , the fume hood is provided with an air intake plenum chamber 12 that fits across the front of the fume hood . this chamber 12 is illustrated in fig1 in exploded relationship to the fume hood cabinet 14 that comprises a top 14a , sides 14b , supported on a bottom or base 16 . in the assembled configuration , the air intake plenum 12 is connected to the cabinet 14 as shown in fig2 to become an integral part thereof . mounted on the front of the fume hood 10 is a plurality of sliding sashes 18 . in the present configuration , four such sashes are shown and they are numbered 18a , 18b , 18c and 18d respectively . as the description of the invention proceeds , it will be apparent that any number of tracks with rows of such sashes may be utilized . in the present configuration , the sashes 18 are shown hung in two rows in a sliding bypass relationship . each sash is supported by two respective hangers 20 and , therefore , the hangers shown are numbered 20a , 20b , 20c and 20d with only 20a and 20b shown in fig2 connected with their respective sashes 18a and 18b . the hangers 20 are slidably carried by overhead channels 22 and 24 that are supported by a lintel 26 . a dust collar 28 is positioned above the plenum chamber 12 to provide a coupling to any conventional duct work ( not shown ) whereby the plenum chamber 12 is adapted to receive a supply of supplemental air from any external source such as atmospheric air . the plenum chamber immediately receives the air supply and directs the flow of air along the face of the cabinet 14 of the fume hood where the air enters the interior of the fume hood substantially under equal pressure throughout . each sash 18 is provided with an air guide diverter or panel 30 . thus , each sash 18 will have a respectively numbered diverter panel 30a , 30b , 30c and 30d . the diverter panel for each respective sash moves with the sash across the face of the fume hood cabinet 14 to open or close the same . from what has been described , the sash and its respective diverter move in a normally horizontal direction . by reason of the arrangement of the sashes 18 , they may be closed alongside each other so as to fully close the face of the cabinet 14 and fume hood 10 to prevent access to the interior of the cabinet by anyone standing in front of the same . in like manner , anyone or more of the sashes 18 may be moved horizontally with respect to any other sash to open a vertically disposed entrance to the fume hood interior . when the sashes are in their closed relationship across the front of the fume hood cabinet 14 , they essentially close off the flow of air from the room into the fume hood interior . the diverters or panels overly each other in the same manner as the sashes 18 overlying each other and , thus , only supplemental air will enter the fume hood by way of the collar 28 and the plenum chamber 12 in the direction depicted by the arrows a - 1 . this supplemental air flows into the cabinet through a louvered air by - pass 32 that is mounted directly behind the plenum chamber in an air intake opening . the air by - pass louvers 33 guide the flow of air into the hood so as to divert it downward along the inside face of the cabinet 14 behind the panels 30 and the sashes 18 and then along the bottom of the cabinet and finally upward along the back of the cabinet 14 . some air flows upward in the direction of arrows a - 4 to flow outward from the cabinet by way of an exhaust collar 36 extending through ceiling portion 37 . as is the practice in fume hoods , there is provided a baffle 34 the details of which are only diagrammatically illustrated . the air flowing in the direction a - 2 flows downward beneath the lower edge of the baffle 34 and then upward behind it to be exhausted from the cabinet through the air exhaust 36 which may be connected with an exhaust fan and a conventional exhaust duct work , not shown . in this way , there is a complete changeover and flow of air through the fume hood creating an air barrier behind the sashes 18 to prevent noxious fumes that are within the cabinet 14 from flowing outward into the room in which the fume hood is located . an additional precaution against the entry of such noxious fumes into the surrounding room is to provide a flow of air beneath the sashes into the cabinet 14 . this is accomplished by providing an air foil 38 at the bottom of the fume hood beneath the sashes 18 . in the same manner as the air guide louvers 32 are supported from a supporting means such as lintel 40 , the air foil 38 is supported above a working countertop 42 of the cabinet 14 on a suitably shaped brackets 44 that permit the flow of air into the lower portion of the cabinet beneath the air foil 38 as illustrated by the arrows a - 5 . in practice , the room and its contents including the technicians working therein are always protected from the seepage of noxious fumes that may be within the fume hood 10 by reason of the air barrier and air flow that is created within the fume hood as previously described . however , when a technician desires to use the fume hood 10 , it is merely necessary for him to slide one of the sashes 18 open in the area wherein he wishes to work within the fume hood . this is illustrated in fig1 wherein the sash 18b has been moved ajar behind the sash 18a thereby providing the worker an opportunity to manipulate within the fume hood . at such time , by reason of the connection of the air exhaust with the interior of the fume hood at 36 , conditioned air within the surrounding room will be drawn into the fume hood cabinet 14 at a minimum constant rate so as not to affect the balance of the building air handling system irrespective of the opening created by the sash 18b . the amount of air taken from the room remains constant and is totally irrelevant to the position of the sashes 18a , 18b , 18c and 18d . as the air is drawn into the cabinet 14 from about the worker , air is also forced downward from the plenum chamber 12 through the opening created by the diverter 30b exposing that portion of the plenum chamber 12 to the front of the fume hood cabinet . hence , a further air barrier illustrated by the air flow lines a - 3 is created in the front of the fume hood to bathe the front of the technician and thereby prevent the outward flow of noxious fumes into the room so that the technician is left unaffected by the fumes of the fume hood interior . shield 39 acts as an air guide . it will be recognized that by reason of the overlapping relationship of the diverter panels 30 , the plenum chamber 12 is isolated from the front of the fume hood when all of the sashes 18 close the fume hood entrance . however , when any one or more of the sashes 18 are moved to open the fume hood entrance , only that diverter panel which moves with its sash will permit the flow of air downward from the plenum chamber 12 across the front of the fume hood . as a consequence , the front of the fume hood is bathed with outside air which then flows into the fume hood so as to protect the room and its contents from that of the fume hood . thus there has been providing a fume hood utilizing horizontal sashes which enables the operator to open only so much of the fume hood as is needed for a particular operation . air guide panels prevent outside air from entering the room and then flowing into the fume hood . the panels direct the outside air directly into the fume hood in the area where the sashes are in the closed position , thus preventing outside air from mixing with and contaminating the room air . however , where the sash is open , its associated panel permits outside air to flow into the zone outside the hood face and then into the opening of the fume hood to assure that no gases back up into the room from the fume hood . this arrangement assures that outside air will not enter the room when the sash is closed , thus preventing disturbances to the air handling system of the room . the air guide panels , louvered air by - pass and sashes are compatibly designed to limit the flow of air through the fume hood and , in particular , near the working counter to reasonable velocity values to prevent interference with delicate chemical operations . while there have been shown and described and pointed out the fundamental novel features of the invention as applied to a preferred embodiment thereof , it will be understood that various omissions and substitutions and changes in the form and details of the device illustrated and in its operation may be made by those skilled in the art without departing from the spirit of the invention . it is the intention , therefore , to be limited only as indicated by the scope of the claims appended hereto .	1
referring to fig1 there is illustrated an intelligent hard disk drive subsystem referred to by the general reference character 10 incorporating the present invention . the subsystem 10 includes an input connection for connection to a host system referred to as an input bus 12 which is connected to an interface 14 . interface 14 is connected to an internal bus 16 which is a composite data bus , address bus and control bus . internal bus 16 is connected to an eight - bit microprocessor 18 , to a sector buffer 20 , to a sector buffer controller 22 , to a serdes ecc 24 , to a state machine 26 , to a stepper controller 28 , and to a spindle motor controller 30 . the spindle motor controller 30 is connected to a spindle motor 32 which is connected to a spindle 34 which is connected to a pair of double - sided hard disk magnetic media 36 capable of storing digital data by means of residual magnetism . the stepper controller 28 is connected to a stepper positioner 38 which is physically connected to a set of four magnetic read / write heads 40 in a manner which allows the positioner 38 to repeatably position the heads 40 at multiple predetermined positions very near to the surface of media 36 with the multiple predetermined positions differing in their distance from the center of the media . a preamplifier / driver 42 is connected to each of heads 40 , and is also connected to a read channel 44 and a write channel 46 . a data separator 48 is connected to read channel 44 and to serdes ecc 24 . an nrz - to - mfm converter 50 is connected to the serdes ecc 24 , and to a write precompensator 52 . fig2 illustrates the functional organization of the hard disk magnetic media 36 . each recording surface of the media 36 is broken up into three regions : an outside guard band 70 which comprises a small region on the surface of media 36 near its outside diameter ; a data band 72 which comprises the surface of the media 36 extending between the outside guard band 70 and an inside diameter 74 ; and an inside guard band 76 in the region inside diameter 74 . the location of diameter 74 is a function of the effective useable area of media 36 for effective data storage . fig3 illustrates a section of media 36 , and diagramatically represents the sector formatting which is used to store data . a plurality of sectors 80 are symbolically represented as curvalinear rectangles . each of the sectors 80 include a very small area referred to as an identification field 82 ( only a few are labeled in the drawing ) and reside at the leading edge of the sectors 80 . all of the sectors 80 located at the same diameter are referred to as being located on a track ; e . g ., a track 84 . ( only one such track is labeled on the drawing , and only part of that track is illustrated in the drawing .) the identification fields 82 contain data identifying the track , the sector , and specifying whether the particular sector is in outside guard band 70 , data band 72 , or inside guard band 76 . in operation , intelligent hard disk drive subsystem 10 receives and sends data and control signals to and from a host system through the input bus 12 . the bus 12 uses a standardized protocol which is a modified version of the sasi interface and is referred to in the industry as the xebec sasi interface . the interfacing between bus 12 and bus 16 , matching the protocols of the two busses to each other , is provided by interface 14 . the processor 18 , which is a z80 with associated rom in the preferred embodiment , interprets commands from the host system and manages , accordingly , the operation of the intelligent hard disk drive subsystem 10 . the sector buffer 20 , under the control of the sector buffer controller 22 , matches data transfer rates by buffering data transfers between the disk drive subsystem 10 and the host system . the serdes ecc 24 converts parallel data from bus 16 to serial data so that it can be stored sequentially on media 36 . the serdes ecc 24 also converts serial data received from media 36 via the read channel 44 and data separator 48 to parallel data which it places on bus 16 . in addition , serdes ecc 24 calculates error codes and appends them to data being written , and also checks error codes on read data , performing corrections when necessary . state machine 26 controls and synchronizes the operation of interface 14 , serdes ecc 24 , and sector buffer 20 . data separator 48 converts mfm data received from the head 40 via preamp / driver 42 and read channel 44 to nrz data . the read channel 44 conditions the signal from preamp / driver 42 for input into data separator 48 . nrz - to - mfm converter 50 receives nrz data from the serdes ecc 24 and converts it to mfm data . converter 50 also provides a pair of signals providing information about subsequent bits when forwarding a data bit to write precompensator 52 . depending on the sequence of bits , it may be necessary to slightly advance or delay the timing of a data bit in order to store the data in the proper location on media 36 . this occurs because the presence of other bits on media 36 constitute residual magnetic fields which interact with the magnetic field generated by head 40 when writing . the small adjustments in timing required to properly locate the data on media 36 are performed by the write precompensator 52 in response to signals provided to it by converter 50 . the need for , and the required amount of , precompensation is also influenced by the structure of the media 36 . if plated media rather than oxide media is used , write precompensation can be eliminated . the write channel 46 receives a signal from precompensator 52 , conditions it for input into the driver portion of preamp / driver 42 , and provides it thereto . the driver portion of preamp 42 then provides a signal to one of the heads 40 which records the data on media 36 as a residual magnetic field . the specific head of the heads 40 used at any time is selected by the preamp / driver 42 , which amplifies read signals when data is being read from media 36 , and amplifies write signals when data is being recorded on media 36 . the stepper / positioner 38 , which is controlled by the stepper controller 28 positions the heads 40 at the desired diameter position of media 36 of the particular track to which , or from which , data is to be transferred . positioner 38 increments heads 40 in discrete steps corresponding to track locations . formatting of media 36 must be done to identify the data on media 36 so that it is possible to retrieve the data that is desired rather than some randomly selected data . fig4 sets forth a process for formatting media 36 in a manner which eliminates the need for a track 0 sensing switch . the head 40 may be positioned anywhere on media 36 when the disk drive is first turned on . since it is unknown where the heads 40 are upon energization of an unformatted disk drive , the location of the heads must be considered to be random . the process set out in fig4 begins formatting wherever the head 40 happens to be located , and follows a sequence of formatting the track , including the steps of : writing an identifying datum in the identification field 82 of each sector on the track ; attempting to index the heads 40 one track to the outside , which can be done if head movement is not prevented by a mechanical stop ( not shown ) which is provided to prevent movement of head 40 off of the media ; reading the identification fields 82 to determine if the head did not move to a new track ; and continuing the sequence of format , index the heads one track to the outside , and read , until the heads have failed to move , at which point the heads are as far to the outside as possible . formatting is then started all over , moving from this now known position , from outside to inside formatting each track , and providing track , sector and band classification identification in each sector &# 39 ; s identification field 82 . a few outside tracks are designated as the outside guard band , the data tracks are designated sequentially beginning with data track 0 on the outermost data track , and a few inside tracks are designated as an inside guard band . in an alternate embodiment , the above formatting procedure can be reversed , locating the stop on the inside first and then formatting from the inside to the outside . if that procedure is utilized , then the data track numbering begins with a number one less than the desired number of tracks , and sequentially decrements with the last data track formatted being number zero . although the present invention has been described in terms of the presently preferred embodiments , it is to be understood that such disclosure is not to be interpreted as limiting . various alterations and modifications will no doubt become apparent to those skilled in the art after having read the above disclosure . accordingly , it is intended that the appended claims be interpreted as covering all alterations and modifications as fall within the true spirit and scope of the invention .	6
fig1 illustrates an embolic coil retrieval system 10 which includes a sheath 12 , an actuator wire 14 , and an embolic coil retriever 16 . the sheath 12 is approximately 60 inches in length and is preferably formed of a polymer material with a durometer in the range of about 50 d and 80 d . the outside diameter of the sheath 12 is about 0 . 038 inches while the lumen 18 of the sheath 12 has a diameter of approximately 0 . 021 inches . the actuator wire 14 is approximately 70 inches in length and is preferably made from a metallic material . the diameter of the actuator wire 14 is less than the diameter of the lumen 18 of the sheath 12 so that the actuator wire 14 may slide within the lumen 18 of the sheath 12 . the embolic coil retriever 16 is laser cut from a nickel - titanium alloy tube and is attached to the distal end 20 of the actuator wire 14 . fig2 illustrates the embolic coil retriever 16 in a normally open configuration . the embolic coil retriever 16 includes a cylindrical member 22 with a lumen 24 ( not shown ), a proximal section 26 , and distal section 28 . the cylindrical member 22 is approximately 0 . 040 inches in length and is preferably formed from a nickel - titanium alloy . the outside diameter of the cylindrical member 22 is about 0 . 018 inches while the diameter of the lumen 24 is approximately 0 . 012 inches . there are attachment holes 30 in the wall 32 of the cylindrical member 22 which allow the distal end 20 of the actuator wire 14 to be attached within the lumen 24 of the cylindrical member 22 . attached to the distal section 28 of the cylindrical member 22 is an elongated tubular member 34 which is approximately 0 . 12 inches in length and is also preferably made from a nickel - titanium alloy . the outside diameter of the elongated tubular member 34 and the diameter of the lumen 36 ( not shown ) of the tubular member 34 are generally the same as the cylindrical member 22 . a jaw member 38 is formed from the elongated tubular member 24 . preferably , the jaw member 38 is laser cut from the elongated tubular member 34 . the jaw member 38 includes a first jaw 40 , a second jaw 42 , and a third jaw 44 where each jaw 40 , 42 , and 44 takes the form of a longitudinal portion of the elongated tubular member 34 . each jaw 40 , 42 , and 44 has a distal end 48 , a proximal end 50 , a first longitudinal edge 52 , and a second longitudinal edge 54 . the distal ends 48 of the jaws 40 , 42 , and 44 are biased outwardly such that the distal ends 48 are approximately 0 . 008 inches from the longitudinal axis of the elongated tubular member 34 . the first jaw 40 , second jaw 42 , and third jaw 44 include longitudinal legs 56 having a proximal end 58 and a distal end 60 . the proximal ends 58 of the longitudinal legs 56 are attached to the distal ends 48 of the jaws 40 , 42 , and 44 . the longitudinal legs 56 are approximately 0 . 002 inches in length and may include a radiopaque marker 62 for use during fluoroscopic visualization . preferably , the longitudinal legs 56 are laser cut from the elongated tubular member 34 . attached to the first longitudinal edges 52 and second longitudinal edges 54 of the jaws 40 , 42 , and 44 are teeth 66 . these teeth 66 are described in more detail in the description of fig4 . fig3 illustrates the embolic coil retriever 16 in a closed configuration . the overall length of the embolic coil retriever 16 in the closed position is approximately 0 . 16 inches . the cylindrical member 22 includes attachment holes 30 ( one shown ) for the actuator wire 14 . the elongated tubular member 34 which takes the form of a jaw member 38 is attached to the distal section 28 of the cylindrical member 22 . the jaw member 38 includes a first jaw 40 , a second jaw 42 , and a third jaw 44 . as can be appreciated , each jaw 40 , 42 , and 44 takes the form of a longitudinal portion of the elongated tubular member 34 . at the distal ends 48 of the jaws 40 , 42 , and 44 , longitudinal legs 56 are attached which may include radiopaque markers 62 . each jaw 40 , 42 , and 44 of the jaw member 38 includes teeth 66 attached to the first longitudinal edge 52 and second longitudinal edge 54 . this configuration of the teeth 66 is described below . fig4 illustrates the teeth 66 of the embolic coil retriever 16 . the teeth 66 generally take the form of triangular members each having a base 68 attached to a longitudinal edge 52 and 54 of a jaw 40 , 42 , and 44 . preferably , the teeth 66 are laser cut from the elongated tubular member 34 . the teeth 66 may take the form of major teeth 70 which are generally obtuse triangular members having an obtuse angle 74 and a base 76 . the base 76 of each major tooth 70 has a proximal end 78 and a distal end 80 . the obtuse angle 74 of each major tooth 70 is located at the proximal end 78 of the base 76 . the teeth 66 may also take the form of minor teeth 82 which are generally acute triangular members having a base 86 . the base 86 of each minor tooth 82 is attached to a longitudinal edge 52 and 54 of a jaw 40 , 42 , and 44 . the configuration of the teeth 66 shown in fig4 includes a combination of major teeth 70 and minor teeth 82 . there is a pattern of alternating major teeth 70 and minor teeth 82 along the longitudinal edges 52 and 54 of each jaw 40 , 42 , and 44 . in addition , each major tooth 70 is generally aligned with a minor tooth 82 on an adjacent longitudinal edge 52 and 54 of an adjacent jaw 40 , 42 , and 44 , and each minor tooth 82 is generally aligned with a major tooth 70 on an adjacent longitudinal edge 52 and 54 of an adjacent jaw 40 , 42 , and 44 . this pattern forms a plurality of pockets 88 which are gaps between the major teeth 70 and the minor teeth 82 on the longitudinal edges 52 and 54 of the jaws 40 , 42 , and 44 . each pocket 88 is approximately 0 . 015 inches wide and 0 . 015 inches tall . however , the size of the pocket 88 may be varied so as to generally match the size of the pockets 88 with the size of the embolic coil 90 being retrieved . fig5 through 8 illustrate a preferred method of using the embolic coil retrieval system 10 to capture an embolic coil 90 . in fig5 , the embolic coil retrieval system 10 is inserted into the vasculature 92 of the human body . the embolic coil retriever 16 is attached to the actuator wire 14 and is disposed within the lumen 18 of the sheath 12 . the embolic coil retrieval system 10 is moved distally towards the embolic coil 90 to be retrieved . fig6 shows the actuator wire 14 being moved distally causing the embolic coil retriever 16 to exit the lumen 18 of the sheath 12 thereby causing the jaws 40 , 42 , and 44 of the jaw member 38 of the embolic coil retriever 16 to assume a normally open position . the jaw member 38 in the open position is aligned with the embolic coil 90 to be retrieved . in fig7 , the sheath 12 is moved distally causing the jaws 40 , 42 , and 44 of the embolic coil retriever 16 to assume a closed position around the embolic coil 90 . the embolic coil 90 is captured within the pockets 88 formed by the gaps between the alternating major teeth 70 and minor teeth 82 on the jaws 40 , 42 , and 44 . fig8 illustrates the embolic coil retrieval system 10 and the embolic coil 90 being removed from the vasculature of the body . as the embolic coil retrieval system 10 is moved proximally , the embolic coil 90 is held within the pockets 88 and is wedged behind major teeth 70 thereby preventing the embolic coil 90 from falling out of the jaw member 38 . a novel system has been disclosed in which an embolic coil retrieval system is introduced into the vasculature of the human body for retrieval of an embolic coil . although a preferred embodiment of the invention has been described , it is to be understood that various modifications may be made by those skilled in the art without departing from the scope of the present invention . for example , there may be variations to the jaw member of the embolic coil retriever . the jaw member may include four or more jaws formed from an elongated tubular member . each jaw may be a longitudinal portion of the elongated tubular member . in another alternative construction , the embolic coil retriever may be covered with a high density metallic coating , like gold . this coating may provide enhanced reflection during fluoroscopic visualization . in still another alternative construction , the pockets formed by the major teeth and minor teeth along the longitudinal edges of the jaws may vary in size . for example , at the distal end of the jaw member the pockets may be small for capturing small embolic coils , but pockets may gradually become larger towards the proximal end of the jaw member for capturing larger embolic coils . this construction would allow physicians to use one jaw member configuration for capturing various sized embolic coils . finally , the embolic coil retriever may be used for capturing other medical devices such as dilation balloons or stents . these and other modifications would be apparent to those having ordinary skill in the art to which this invention relates and are intended to be within the scope of the claims which follow .	0
referring now to the figures , and in particular to fig1 a data processing system 10 , in which the present invention can be employed is depicted . as shown , data processing system 10 comprises a number of components , which are interconnected together . more particularly , a microprocessor 12 is coupled to a memory storage unit 14 and an input / output ( i / o ) bridge 16 . a system bus 18 provides interconnection between microprocessor 12 and memory 14 and i / o bridge 16 . i / o bridge 16 further couples to an i / o bus 20 , which provides connection to i / o adapters 22 and a real time clock 24 . further connected to microprocessor 12 is a time base generation apparatus 26 , which is further connected to the i / o bus 20 . time based generation apparatus 26 is further illustrated in fig2 . data processing system 10 may comprise multiple microprocessors . fig2 illustrates a block diagram of an implementation of the system time base generation apparatus 200 according to the present invention . time base generation apparatus 200 further includes a system clock generate circuit 202 , which serves as a master clock for the entire computer system in which apparatus 200 is located . system clock generate circuit 202 is further connected to a clock buffer driver 204 , a time base buffer / divider 206 , clock prescalar circuit 208 , and a total count latch register 210 . clock buffer divider 204 is further connected to bus interface 212 , as is time base buffer / divider circuit 206 and total count latch register 210 . clock buffer / divider 204 provides signal amplification and driving from system clock generate circuit 202 to the bus interface 212 , which is further connected to the system co - processor , micro - processor , and other resource chips connected to the bus interface . a store instruction to the address decoded by the system bus interface as the total count latch register 210 is used to set the content of total count latch register 210 . the content of total count latch register 210 is used by the clock prescalar 208 to control whether the time base enable signal is asserted during a system bus cycle . the clock prescalar 208 , using a clock generated by the system clock generate 202 , increments an internal counter . when the internal counter of clock prescalar 208 reaches a count equal to the content of the total count latch register 210 , the internal counter is reset to zero and the time base enable signal is deasserted during the next system bus cycle . the operation of the clock prescalar 208 is further described . clock prescalar 208 is a 15 - bit programmable clock prescalar circuit that deletes one clock pulse enable each time a threshold count is achieved . the threshold count is determined and limited by the precision of the clock prescalar . specifically , 15 - bit programmable circuit provides a base count of 32 , 768 , of which 95 % is used to determine the base total count or 31 , 129 . this allows a maximum range adjustment of plus or minus 5 %. the adjustment granularity of one count out of the total base total count is 116 milliseconds per hour . the maximum skew rate , or time adjustment rate , is plus or minus 190 seconds per hour . the system writes zero to the total count latch register 210 to exhibit the generation of the time base enable signal , keeping it deasserted . when the time base enable signal is deasserted , the time clocks on all processors do not change or do not increment . this system would be used in a multi - processor system to synchronize all processor time clocks when the system is initialized . the prescalar can be made longer to increase precision or shorter to reduce costs . an optional divider , which may be programmable , provides a time base that is in the range of 3 - 12 % of the system clock frequency . processors in the system count system clocks upon the assertion of the time base enable , thereby allowing the time base to be independent of the system clock frequency . the time base generation apparatus allows the time clock in the processor to be adjusted without directly altering its content . this avoids the problem of multiple updates to adjust for a large error . clock prescalar 208 is adjusted to compensate for the error over some period of time such as until the next clock synchronization computation is performed over the network . if the clock is running fast , the system reduces the time base enable rate rather than attempt to set the time back in a series of small changes normally required to avoid the appearance of time running backwards . in a multi - processor system , one processor performs the clock synchronization chores with the network and then makes a single adjustment to adjust the clocks of all the processors . the only time a complete processor synchronization is performed is at power on reset . at power on reset , the time base enable signal is inhibited by writing zeros into the total count register , and all processors initialize their time clocks . next , the lead processor sets the prescalar to a default or calibrated value , thereby starting all the clocks . fig3 depicts a flow diagram of one processor performing clock synchronization in a multiprocessor system according to the present invention . first , in block 310 , a system wide reset is performed . in block 312 , after appropriate initialization by each processor , a lead processor is chosen using whatever means ( software protocol or hardware selection ) the system chooses to use . in step 314 , each processor determines whether it is the lead processor or one of the other processors . the lead processor performs blocks 316 - 322 and the other processor perform blocks 326 - 332 . all processors join in step 324 to continue other system initialization tasks . the barriers and singles described below are normally implemented using semaphors ( a software protocol for sharing information and synchronizing processors ) which are well understood by those skilled in the art . in block 316 , the lead processor waits until all other processors have reached barrier 1 before proceeding to block 318 . in block 318 , the lead processor gets the correct time that it then stores in memory before releasing barrier 1 and proceeding to block 320 . in block 320 , the lead processor waits until all other processors have reached barrier 2 before proceeding to block 322 . in block 322 the lead processor starts the time base , causing the time clocks of all processors to begin counting , and releases barrier 2 before continuing on to block 324 . as noted previously , all processors except the lead processor perform the actions described in blocks 326 - 332 . in block 326 , each processor in this group signals the lead processor that it has reached barrier 1 . then , in block 328 , all processors in this group wait for the lead processor to release barrier 1 . when the lead processor releases barrier 1 , the processors in this group proceed to block 330 . in block 330 , each processor in this group reads the time stored in memory by the lead processor , and then sets its time clock before signaling the lead processor that it is waiting at barrier 2 . in 332 , all processors in this group wait for the lead processor to release barrier 2 , indicating that the clock initialization process is complete and all processors can continue with other system initialization process is complete and all processors can continue with other system initialization as needed ( block 324 ). this system allows for clock drift to be reduced , thereby providing the user with a more precise time standard using standard precision crystals . the accuracy of the clock is then dependent on the stability of the crystal and the precision of the synchronization granularity of the time base generation apparatus , which is independent of the precision of the crystal . further , because the time base enable pin of the processor is treated as a normal data input , meeting the normal setup and hold requirements of the processor interface , there is no need for additional complex synchronization in the processor interface . while the invention has been particularly shown and described with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention .	6
embodiments of the present invention relate to a technique for optimizing decoupling capacitance on an integrated circuit while meeting leakage power constraints . embodiments of the present invention further relate to a technique for formulating a linear optimization problem for optimizing decoupling capacitance on an integrated circuit , where the linear optimization problem is solvable using a linear solver program . [ 0017 ] fig3 a shows an integrated circuit ( 20 ) that will be used as a reference for the discussion of the present invention . the integrated circuit ( 20 ) is made up of several regions 1 . . . n , where n represents the number of regions being considered . it is desired to optimize the amount of capacitance in each of these regions while meeting leakage power budgets of either the entire integrated circuit or each of the regions shown in fig3 a . determining an optimal decoupling capacitance arrangement involves determining a maximum value of the following term ( 1 ) subject to the constraint equation ( 2 ): ∑ k = 1 n  a k  x k  , ( 1 ) where a k represents the extra capacitance obtained by replacing thick - oxide capacitors with thin - oxide capacitors in the kth region , and where x k represents the percentage of thin - oxide decoupling capacitance in the kth region . those skilled in the art will understand that because x represents a percentage , the value of x is between 0 and 1 , inclusive . those skilled in the art will also understand that a k is normalized to the area of the kth region . further , those skilled in the art will appreciate that x can be a discrete value between 0 and 1 , inclusive . as stated above , the determination of the maximum value for term ( 1 ) is subject to the following constraint equation ( 2 ): ∑ k = 1 n  w k  x k ≤ c , ( 2 ) where w k represents the extra leakage current resulting from the replacement of thick - oxide capacitors by thin - oxide capacitors in the kth region , and where c represents the leakage power budget for the integrated circuit ( 20 ). in alternative embodiments , a leakage power constraint may be particular to a region instead of the entire integrated circuit ( 20 ), in which case the constraint equation for that particular region is : where w i represents the extra leakage current resulting from the replacement of thick - oxide capacitors by thin - oxide capacitors in that particular ith region , where x i represents the percentage of thin - oxide capacitors in the ith region , and where c i represents the leakage power budget for the ith region . equations / terms ( 1 ), ( 2 ), and ( 3 ) above form a linear optimization problem with linear constraints , and therefore , by solving for the maximum value of term ( 1 ) subject to equation ( 2 ) and / or possibly equation ( 3 ), a value for x may be determined , where x represents what percentage of thin - oxide capacitance that can be used in particular regions of the integrated circuit or in the integrated circuit as a whole . more particularly , the solved value of x represents an optimal amount of thin - oxide capacitance that can be used without violating leakage power constraints . those skilled in the art will appreciate that the linear optimization algorithm developed above may be solved using any number of linear problem solving techniques . for example , one or ordinary skill in the art will understand the aforementioned linear optimization problem may be solved using lagrange multipliers . in another example , linear programming software may be used to determine an optimal amount of thin - oxide capacitance given the formulation technique above . [ 0027 ] fig3 b shows a flow process describing a technique for optimizing decoupling capacitance on the integrated circuit ( 20 ) in accordance with an embodiment of the present invention . initially , a determination is made as to the percentage of thin - oxide capacitance based on the extra leakage current resulting in a region when the thick - oxide capacitance is replaced by the thin - oxide capacitance in the region ( step 22 ). this may be repeated for a desired number of regions ( step 24 ). thereafter , a determination is made as to the optimal value of capacitance based on the percentage of thin - oxide capacitance determined above and the capacitance resulting from the replacement of the thick - oxide with the thin - oxide capacitance ( step 26 ). this determination of the optimal value may be made based on a plurality of regions on the integrated circuit ( 20 ) ( step 28 ). [ 0028 ] fig4 shows an exemplary computer system ( 30 ) that determines an optimal decoupling capacitance in accordance with an embodiment of the present invention . input parameters ( 32 ) may include a circuit design or layout , an available capacitance area size for a particular area being considered , an amount of thin - oxide capacitors available for the area being considered , and leakage power budget information for the integrated circuit or particular regions thereon . one of ordinary skill in the art will understand that the input parameters ( 32 ) may include additional values , such as information relating to per unit areas of thin - oxide and thick - oxide capacitances present on the integrated circuit or particular regions thereon . the input parameters ( 32 ) serve as input data to the computer system ( 30 ) via some computer - readable medium , e . g ., network path , floppy disk , input file , etc . the computer system ( 30 ) then stores the input parameters ( 32 ) in memory ( not shown ) to subsequently determine ( via microprocessor functions ) an optimal decoupling capacitance using one of the linear problem formulation techniques discussed in the present invention . thereafter , the computer system ( 30 ) outputs the optimal decoupling capacitance information ( 34 ) via some user - readable medium , e . g ., monitor display , network path , etc ., where the optimal decoupling capacitance includes at least a percentage of the available capacitance area that can be used for thin - oxide capacitance instead of thick - oxide capacitance . the computer system ( 30 ) may additionally output the amount of leakage current resulting from the optimal decoupling capacitance determination . those skilled in the art will appreciate that in other embodiments , a software program capable of generating optimal decoupling capacitance information consistent with the linear optimization formulation techniques presented in the present invention may be used . the software program may also be capable of determining leakage current and power values corresponding to the generated optimal decoupling capacitance information . advantages of the present invention may include one or more of the following . in some embodiments , because decoupling capacitance on an integrated circuit may be optimized using a linear optimization formulation technique in accordance with the present invention , integrated circuit performance may be improved . in some embodiments , because a linear optimization formulation technique in accordance with the present invention may be used to determine an optimal assignment of thin - oxide and thick - oxide capacitance , valuable time that would otherwise be used to determine an optimal capacitance is saved . in some embodiments , because a linear optimization formulation technique in accordance with the present invention may be used to determine an optimal capacitance for an integrated circuit or regions thereon subject to leakage power constraints of the integrated circuit or regions thereon , capacitance may be maximized while meeting a leakage power budget of the integrated circuit or regions thereon . while the invention has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the cope of the invention as disclosed herein . accordingly , the scope of the invention should be limited only by the attached claims .	6
referring to fig1 , the general operation and structure of the system of the present invention will be described , it being understood that the operation of the system will be described in greater detail with reference to fig2 a - 2g , 3 and 4 . when a consumer calls into the telepay system 10 using a telephone 12 , the consumer is prompted by an interactive voice response unit within the system 10 to input certain necessary information , to wit , payee access code , debit card number , account number , and amount . the telepay system 10 then checks all of its internal files , including an account number velocity file 14 , a debit card velocity file 16 and a negative file 18 , to validate the access code entered , the card number presented , the validity of the account number , and if that card number and / or account number has ever processed a fraudulent transaction . if any of these internal checks into the telepay system 10 process indicate fraud , then the transaction is denied . if all of the checks are passed , then the telepay system 10 assembles the data into an authorization request message , which is electronically sent to a debit card network 20 for transmission to a financial institution 22 that issued the card for verification of balance on deposit . the debit card network 20 receives a response as to whether or not the there are sufficient funds on deposit to process the transaction requested by the consumer . the debit card network 20 prepares an appropriate deduction from the consumers account and prepares an appropriate deposit to the payee &# 39 ; s account to be processed later . in addition any fees that are due from the payor are also preprocessed at this time . the debit card network then sends a message to the telepay system 10 while the consumer is still on the telephone 12 line . the telepay system 10 will then translate the numeric data received into an audible verbal response transmitted to the consumer via the telephone 12 . settlement , as described in greater detail with reference to fig3 , is defined herein as the methodology of debiting and crediting the appropriate accounts affected by the above - described transaction . these accounts would affect the payor , the payee , and the telepay system 10 for any transaction fee . the debit card network 20 will initiate this process . the debit card network 20 , however will only deposit a total of the days transactions into the payee &# 39 ; s account . the network has no capability to discern which consumer paid how much . it then becomes the responsibility of the telepay system 10 to detail the specific account numbers and amount of payments that were made that day . this is accomplished by a computer dial - up link ( rje ) 24 from the telepay system 10 to the payee &# 39 ; s billing system 26 . the telepay system 10 will also bill the payee on a monthly basis for 800 telephone line usage ( if any ). the accounts receivable department of the payee is also provided with the capability to call into the telepay system 10 to inquire as to if and when a consumer initiated a payment . a single 800 number is used by the telepay system 10 . technology allows for a virtually unlimited number of telephone lines to terminate on the same number , limited only by the compliment of computer hardware and it &# 39 ; s capabilities that are running the system . the caller will be asked to enter the access code of the bill to be paid . this access code typically will be printed on the bottom of the statement in an obvious manner and is a requirement of all payees utilizing the service . the code will identify the payee within the telepay system 10 and will activate the telepay software to verbalize the customer &# 39 ; s selection in order to give positive re - enforcement as is the case with all customer input ( i . e . “ you have elected to pay florida power and light in miami , fla .” press 1 if this is correct an you wish to continue , or press 2 if incorrect ”). if incorrect , the customer will be asked to input another access code , or to terminate the call . assuming the proper access code is confirmed , the next step will be the entering of the account number of the bill to be paid , as this number also appears on the monthly statement . all selections will be verbally re - enforced . the next step will be the entering of the debit ( atm ) card number . various telepay system 10 checks will be done on this entry . verbal re - enforcement of the numbers entered is again given to the user (“ you have entered 5419 23485 4657 . please press 1 if correct or 2 if incorrect ”). the telepay system 10 will then instruct the user to enter the amount of the payment and verbal positive re - enforcement will be given . if all has been acknowledged positively up to this point , then the system will give a verbal summary of the transaction and give the customer a final opportunity to validate the entries (“ press 1 if correct , or press 2 if incorrect ”). when the transaction has been positively re - enforced by the user , the telepay system will then build an authorization request that will be sent out to the existing debit ( electronic funds transfer ) networks . when the transaction has been authorized , the system will once again give positive re - enforcement to the user (“ your payment to dallas gas and electric in the amount or $ 124 . 56 has been paid from your atm card account number 5419 23485 4657 . your authorization number for this transaction is xxxxxxx . please make a note of this authorization code for future reference . if you would like to hear the authorization code for this transaction again , press 1 . if you would like to pay another bill press 2 . if you are finished press 3 ”). if the user elects to pay another bill during the same session , then the system will retain the previously entered card number and ask the caller if the next bill being paid is to be paid with the same card , or allow the opportunity to enter a new card number . all of the debit ( electronic funds transfer ) networks are accustomed to the assessment , debiting and crediting of fees to the issuers and acquirers of debit ( atm ) and credit transactions . in many cases , a 75 ¢ fee for a customer to use an atm card at an atm that is not owned by the card issuing bank involves the dividing of that fee into increments as small as 5 ¢. in this manner all networks that are accessed are compensate to assist in the authorization and routing of the transaction . all of these fees are electronically credited to the entity that earned the revenue as a result of a contractual relationship with that particular network . this process happens every working day at a predetermined “ cut off ” period that separates business days and is refereed to in the industry as “ settlement ”. never before , however , has a transaction been presented to the debit networks for a real - time authorized bill payment initiated by the customer from a touch tone telephone with the - debit card used as the transaction vehicle . additionally , it has never been done without the requirement of a pin ( personal identification number ) and still maintain transaction security . in the telepay system 10 , when a transaction is entered by a consumer , and subsequently passed on to an outside debit card network for authorization , a number of things happen . assuming that the transaction is authorized , then any fee that the customer is paying , in addition to the actual bill payment , is automatically deducted from the payor &# 39 ; s account immediately and added to the amount that the debit card network will owe telepay and the payee at settlement . the amount of the bill that was paid is automatically added to the amount that will be credited to the payee at the end of the business day ( every payee is required to provide a bank account number that will be used to electronically credit the days receipts ). telepay &# 39 ; s bank account will , in a like manner , be automatically credited for the transaction fee . any network usage fees that have to be paid to process the transaction by the use of an debit card network will be electronically paid by the telepay system 10 to the appropriate service provider . once a day at telepay &# 39 ; s settlement time , each payee participating in the system will receive the electronic on - line detail summary of the days individual transactions for posting to the consumer &# 39 ; s account . a flowchart illustrating the operation of a bill payment transaction process of the telepay system 10 is shown in fig2 a - 2g . the process is initiated by a user &# 39 ; s calling into the system 10 . in step 200 , a general purpose welcome message that announces and instructs the caller in the manner with which the system can be used is transmitted to the user via the telephone 12 ( fig1 ). in step 202 , the user is prompted to enter a payee access code , which is assigned by the embodiment of the invention in the form of a service and the user is made aware of this code due to its printed presence on the monthly customer statement , statement stuffers or other printed handouts . this code is what distinguishes one payee from the other , and is the identifier that causes the system 10 ( fig1 ) to record the transaction in the appropriate payee record file . after the caller enters the access code , it is electronically checked against the list of authorized payees participating in the system 10 in step 204 . in step 206 , a determination is made whether the entered access code is valid . if the access code is invalid , in step 208 , the system 10 checks to determine whether this is the third incorrect entry of an access code . if this is not the third incorrect entry of the access code , in step 210 , the system 10 instructs the caller that the access code is invalid , and offers the caller to opportunity to re - enter the access code in step 202 . if this is the third incorrect entry of an access code , in step 212 , the system 10 instructs the caller to check the access code information and call again . if the access code is entered properly within three attempts , in step 214 , the caller is prompted to enter the account number of the bill that they are paying . in step 216 , the system 10 checks the account number for validity . the validity check is based on the methodology that the payee uses to verify account numbers and will vary according to payee . the system 10 will have all of the participating payees verification methodologies . this methodology could be a mod 10 or mod 11 check digit routine with or without a check digit in it &# 39 ; s most basic implementation . in a more sophisticated environment , the system would have in it &# 39 ; s database , a list of all the valid account numbers for that particular payee , commonly known to those skilled in the art as a “ shadow file .” in step 218 ( fig2 b ), a determination is made as to the validity of the account number entered . if the entered account number is not valid , in step 220 , a determination is made as to whether this is the third incorrect entry . if it is not the third incorrect entry , in step 221 ( fig2 a ), the caller is informed that the entry is invalid and is given an opportunity to reenter the account number . if the entry attempt is the third invalid attempt , in step 222 , the caller is instructed to check their information and call again . if a valid account number is entered within three attempts , in step 224 , the system 10 requests the caller to enter the debit card number . in step 226 , the debit card number is checked for validity . this validity check is done via the mod 10 algorithm that is the basis for debit card issuance used by financial institutions . using this method that is commonly used , and familiar to those skilled in the art , gives a great level of assurance that the number that was entered by the caller was entered properly . in step 228 , a determination is made whether the entered debit card number is valid . if the entered debit card number is not valid , in step 230 , a determination is made whether this is the third invalid entry if this is not the third invalid entry , in step 232 , the caller is instructed of the invalid entry and then , in step 224 , is requested to enter a debit card number . if this is the third invalid entry , in step 234 , the system 10 requests the caller to check their information and call again . once a valid debit card number is entered within three attempts , in step 236 ( fig2 c ), the caller is requested to enter the dollar amount ( without a decimal ) of the bill to be paid . in step 238 , the system 10 repeats the entered amount to the caller and , in step 240 , asks the caller to indicate whether the entry is correct by depressing a key on the keypad of the telephone 12 . in step 242 , a determination is made whether the caller responded that the entry is correct . if the entry is not correct , in step 244 , a determination is made whether this is the third incorrect entry . if this is not the third incorrect entry , in step 236 , the caller is requested to enter a new dollar amount . if this is the third incorrect entry , in step 246 , the caller is requested to check their information and call again . if the caller enters a correct amount within three attempts , in step 248 ( fig2 d ), the system 10 initiates a velocity file 14 check . the velocity file 14 is an internal file to this invention that restricts the number of times that a payor account number can be paid electronically using the system 10 over a 30 day period . the numerical value of the velocity file is individually selectable by each payee participating in the system 10 , and will prevent excessive payments from their customers that have the potential for fraud . in step 250 , if payments are located in the velocity file 14 that indicate to the system 10 a violation of the number of transactions permitted over a 30 day period by the payee , in step 252 , the caller is notified that their transaction cannot be processed , due to the excessive frequency of usage . if the transaction is within the number allowed by the payee over a thirty day period , in step 254 , the system 10 performs the velocity file check on the debit card number that the caller entered . the numerical value of the debit card velocity file 16 is determined by the system 10 based on , but not limited to , historical usage data of all payees and payors over a given period of time . this value is variable and is achieved generally by multiplying the total number of payees participating in the system times the total number of payments allowed by each payee over a 30 day period . if the system 10 determines that the transaction by the payor exceeds the debit card velocity file criteria , in step 256 , the caller is notified that the transaction cannot be processed due to the frequency of the number of uses of the debit card used to process transactions over a thirty day period . if the transaction by the payor does not exceed the debit card velocity file criteria , in step 258 ( fig2 e ), the system 10 determines whether either the payor account number or the debit card number is contained in the negative file 18 comprising a database of negative accounts stored on the system 10 . the purpose of the negative file 18 maintained by the system 10 is to prevent debit card numbers and account numbers that have been involved in fraudulent transactions from initiating another transaction . this file is updated by payees participating in the system by written notification to the service . an employee of the service would then update the system . if the system 10 determines that a match on either payor account number or debit card number has been found , in step 260 , the caller is informed that the transaction cannot be processed . if there is not a match found on the negative file 16 , then the details of the transaction are summarized to the caller verbally on the interactive voice response system in step 262 . in step 264 , the caller is prompted to begin the processing of the transaction by pressing one ( 1 ) on the telephone keypad , or by pressing two ( 2 ) on the telephone keypad to abort the transaction . in step 266 , the system 10 checks the caller &# 39 ; s response . if two has been depressed by the caller , in step 268 , the system 10 thanks the caller and terminates the call . if one has been depressed by the caller , in step 270 ( fig2 f ), the system 10 outdials via a normal telephone line to an appropriate debit card network , such as the network 20 for processing . a debit card network is a third party processor that will process the transaction for a fee , providing connectivity to either the financial institution that issued the debit card number , or another debit card network that has the capability to connect with the financial institution that issued the debit card number . those skilled in the art are aware that a debit card network , i . e . pulse in houston , tex ., most in washington , d . c ., honor in maitland , fla ., etc ., process primarily atm ( automated teller machine ) transactions , and do not rely on the automated clearing house ( ach ) to process individual transactions . in addition to the face value of the bill to be paid , the system adds a service charge that the caller will electronically pay for use of the convenience of the system . through the use of the debit card network , rather than the ach , the transaction is positively verified against funds on deposit prior to the processing of the transaction . in step 272 , while the system 10 is outdialing to the debit card network 20 , the system 20 plays a customized individually recorded marketing message for each payee utilizing the system 10 , that will promote a service of the payee while the caller is awaiting approval . if the debit card network and the subsequent transmission to other debit card networks ( if required ) make the determination that funds are not available in the caller &# 39 ; s account selected by the debit card number , then the transaction will be declined . in step 274 , the system 10 awaits a reply from the debit card network 20 . in step 276 , the system 10 then makes a determination on the disposition of the transaction based on the response received back form the debit card network 20 . if the response from the debit card network 20 indicates to the system 10 a declination , with which those skilled in the art are familiar , in step 278 , the system 10 informs the caller that the transaction was declined by the financial institution that issued their debit card number . if the response from the debit card network 20 indicates an approval , the caller will be verbally informed of the approval code in step 280 . in step 282 , the approved transaction is updated in a system transaction log file that will later become the basis for the transmission for payment data to each individual payee . the transaction log file contains the debit card number , payor account number of the bill paid , amount of the bill paid , time / date , and approval code . the log file is individually kept for each payee participating in the system for later electronic transmission for billing system update . in step 284 ( fig2 g ), when a transaction is successfully completed , the aforementioned debit card number velocity file that was checked as part of the pre - processing procedures is updated to reflect the transaction . in step 286 , the velocity file for the account number of the bill that was paid is updated to reflect the transaction . in step 288 , the system 10 asks the caller if he or she would like to pay another bill by requesting the caller to press one ( 1 ) to pay another bill , or two ( 2 ) to terminate the call . in step 290 , the system 10 makes a determination as to whether the caller would like to make another payment , based on the response indicated by the caller . if a one was pressed , the system 10 prompts the caller for another access code in step 202 ( fig2 a ). if a two is pressed , the system 10 terminates the call in step 292 . fig3 is a flowchart of the settlement process of the present invention . after close of the business day , by the debit card network 20 , the debit card network 20 begins to move the funds electronically ; a process with which those skilled in the art are familiar . at that point the system 10 is in a position to transmit the detail of the days transactions to the individual payees that will be receiving electronic credits from the debit card network 20 . the debit card networks transmit only the gross dollar amount of funds for crediting to each payee . the system 10 performs the actual detail of the electronic transmission of individually paid accounts . the system 10 will recognize the time of day by the internal clock common to most computer systems , and select the first payee in the aforementioned transaction log file . in step 300 , the system 10 will outdial using an ordinary telephone line into the first payee on the system in an effort to connect to the computer billing system 26 ( fig1 ). once a telephonic connection is established , in step 302 , the system 10 begins the process of transmitting the payor account numbers and amounts of the bills that were paid since the last settlement period using the system 10 . this process is known to those skilled in the art as remote job entry ( rje ). in step 314 304 , the system 10 determines whether there are other files to be transmitted . in step 306 , the system 10 outdials the appropriate telephone number established in advance to establish a telephonic rje link with the next payee in step 302 , in a manner similar to the aforementioned , the transactions that the system 10 performed in favor of that particular payee will be transmitted to that payee &# 39 ; s computer billing system 10 . once all the files have been transmitted , the settlement process is terminated in step 308 . fig4 is a flowchart of a payee inquiry process of the present invention , which provides a payee with the ability to initiate a telephone cell into the present invention operating as a third party to the transaction , in order that payment information can be discerned in conjunction with a touch tone telephone . the process is initiated by a payee calling into the system 10 . in step 400 , the system 400 will ask the caller to input a security code , which is assigned to each payee and is different for each payee . the input of a proper code will indicate to the system which payee payments are to be inquired upon . without a proper code , no inquiry access is permitted . it is important to recognize that this system capability is for the payee , and not for the actual payor of the bill . this system capability assists in past due collection activity . in step 402 , the system 10 checks its internal data files to ascertain the validity of the code entered . if an improper code is entered , in step 404 , the system 10 informs the caller that the code is invalid . if the entered code matches one that was contained in the system database , in step 406 , the system 10 requests the caller to enter the account number of the customer whose bill is being inquired upon . after the caller enters the account number , in step 408 , the system attempts to locate it on the system database . if the system 10 cannot locate the account number , in step 410 , the caller is informed that no payment exists for the entered account number and is given an opportunity to enter another account number in step 406 . if the entered account number is located , in step 412 , the system 10 informs the caller of the details of the transaction , to wit , time , date , amount , and authorization number of the payment . in step 414 , upon completion of the audio text information , the caller is asked whether he or she has another inquiry to perform . if so , in step 406 , the system 10 prompts the caller to enter the account number ; otherwise , the system 10 terminates the call in step 416 . the crux of this invention is that bill payment transactions have never been presented to the debit networks for a real - time authorization initiated by the consumer from a touch tone telephone with the debit card number used as the transaction vehicle . additionally , this process have never been done without the requirement of a pin ( personal identification number ) and still maintain an assemblage of transaction security . in the telepay system , when a transaction is entered by a consumer , and subsequently passed on to an outside debit card network for authorization , a number of things happen . assuming that the transaction is authorized , then any fee that the customer is paying , in addition to the actual bill payment , is automatically deducted from the payor &# 39 ; s account immediately and added to the amount that the debit card network will distribute between telepay and the payee at settlement . the amount of the bill that was paid is automatically added to the amount that will be credited to the payee at the end of the business day ( every payee is required to provide a back account number that will be used to electronically credit the days receipts ). telepay &# 39 ; s bank account will , in a like manner , be automatically credited for the transaction fee . any network usage fees that have to be paid to process the transaction by the use of an debit card network will be electronically paid by telepay to the appropriate service provider . once a day at telepay &# 39 ; s settlement time , each payee participating in the system will receive the electronic on - line detail summary of the days individual transactions for posting to the consumer &# 39 ; s account . the following criteria and conditions are part of the telepay method and unique process prior to the acceptance of a debit card number into the system in order to ensure a proper transaction has been presented and to add a level of usage security . first , a service address ( telephone number or residential electricity site , etc .) or payee account number can only be the recipient of a specific limited number of payments within 30 days that is selectable by the funds recipient and a velocity file by account number is kept at the telepay system tracking this limitation . in addition , a debit card number can only be used in the telepay system a specific limited number of times based on a recipient of funds selectable parameter and current recipient of funds ( payee ) negative files due to adverse experience are added to the telepay system prior to implementation . still further , any consumer chargebacks will prevent that customer &# 39 ; s telephone number / electricity service address number and that credit / debit card number to have system access . appropriate additions will be made to the negative file unless specific overrides are requested by the funds recipient . also , all transactions will be routed electronically to the card issuing entity / network by the telepay system for positive authorization as to card acceptability , credit limit guidelines , payment status , balance availability , and any and all criteria that the issuer deems appropriate . additionally , the telepay system will provide records of all declinations by card number and by telephone number , electric service account number , or payor account number , whichever is appropriate and a check will be done on all debit card numbers entered into the telepay system to ensure that the input number is an assigned number within the criteria of the issuing entities , as well as on service address account numbers to insure that the proper number and sequence of digits have been entered to add an additional level of accuracy to the numeric entry process . moreover , the customer will always be given positive audio reinforcement at critical steps during the data entry process to assist in the entry of accurate information and transaction declinations due to non - sufficient funds will be audio referred for the consumer to contact their card issuing institution . accordingly , it is clear that the telepay system is a technologically advanced and consumer convenient process . the consumer may use the telepay system to pay bills at will , spontaneously , without any personal investment in equipment , and any requirement of pre - registration . the use of the telepay system is not tied to a specific locations , as any touch tone telephone will suffice . use of this unique process will eliminate the use of stamps , envelopes , the u . s . postal service , and the necessity of going to a mailbox . personal computers and the lack of realistic portability are problems that do not exist in the present invention . receipt of payment is also assured and issues of “ lost in the mail ” or mail delays will no longer exist . debit cards will now have true utility as transaction vehicles in order to electronically present payment as opposed to paper checks . older technology of pre - registration and direct debit registration systems will become obsolete . it is understood that the present invention can take many forms and embodiments . the embodiments shown herein are intended to illustrate rather than to limit the invention , it being appreciated that variations may be made without departing from the spirit of the scope of the invention . for example , it is anticipated that the payor may be an individual or an institution , such as a corporation or association . although illustrative embodiments of the invention have been shown and described , a wide range of modification , change and substitution is intended in the foregoing disclosure and in some instances some features of the present invention may be employed without a corresponding use of the other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention .	6
embodiments of the present invention will be described in detail below with reference to the drawings , and the technical solutions of the invention will be further illustrated . however , the scope of the invention is not limited to these embodiments . in this embodiment , an integrated window has front and back window frames , as shown in fig1 - 12 . the front and back window frames have the same structural principle , for which the structures of the window frames will be specifically described as follows . two front frame bodies 2 are symmetrically located on both sides of the front window frame . the front frame body 2 has a front support portion 2 a and a front guide portion 2 b . the front frame body is configured as an elongated l - shape . that is to say , the front support portion 2 a is vertically connected with the front guide portion 2 b , and an indentation 2 e is formed above the front support portion 2 a and the front guide portion 2 b , in which the upper end of the front support portion is located higher than the front guide portion . in this embodiment , the front support portion 2 a is integrated with the front guide portion 2 b . a front window cover 1 is mounted on the front frame bodies 2 . the indentation 2 e formed between the front guide portion 2 b and the front support portion 2 a has a width identical to that of the window cover . in the process of mounting , the front window cover is fixed at the said front indentation 2 e , so that the front window cover 1 will not be lonely exposed and projected to the external environment . as such , the front portion of the window , i . e . the portion exposed at the external wall , is configured as a square shape , which provides the window with an overall attractive appearance . an upper slide 9 is provided between the upper ends of the support portions of the front frame bodies on both sides , and a lower slide 10 is provided between the lower ends thereof . the upper and lower slides are provided with corresponding slide ways , which are mainly used to facilitate horizontal movement of the sliding window between left and right . the bottom surface of the lower slide 10 is covered by the outer window frame sealing plate 23 . two back frame bodies 3 are symmetrically located on both sides of the back window frame . the back frame body 3 has a back support portion 3 a and a back guide portion 3 b . the back frame body is configured as an elongated l - shape . that is to say , the back support portion 3 a is vertically connected with the back guide portion 3 b , and an indentation 3 e is formed above the front support portion 3 a and the front guide portion 23 b , in which the upper end of the back support portion is located higher than the back guide portion . in this embodiment , the back support portion 3 a is integrated with the back guide portion 3 b . a back window cover 17 is mounted on the back frame bodies 3 . the indentation 3 e formed between the back guide portion 3 b and the back support portion 3 a has a width smaller than that of the back window cover 17 . as the back frame bodies 3 are faced to the interior of the room , the back frame bodies 3 can not extend out of the wall for the purpose of attraction and harmony of the whole product . the back window cover 17 shall have a relatively large area because a tubular motor 11 has to be mounted within the back window cover 17 . therefore , the width of the indentation 3 e formed between the back guide portion 3 b and the back support portion 3 a is configured to be smaller than the width of the back window cover 17 in the back frame bodies 3 , so that the back window cover 17 could individually extend beyond the wall . an upper slide 9 is provided between the upper ends of the support portions of the back frame bodies on both sides , and a lower slide 10 is provided between the lower ends thereof . the upper and lower slides are provided with corresponding slide ways , which are mainly used to facilitate horizontal movement of the sliding window between left and right . the bottom surface of the lower slide 10 is covered by the inner window frame sealing plate 24 . in this embodiment both the front window cover 1 and the back window cover 17 are respectively fixed to the upper part of the front frame bodies and the lower part of the back frame bodies by bolts . the front support portion 2 a is fixedly connected with the back support portion 3 a by means of a plastic bar 5 . in particular , a first groove 2 c is set on one side of the front support portion 2 a and a second groove 3 c is set on one side of the back support portion 3 a corresponding to the first groove 2 c . two long lateral edges of the plastic bar are respectively inserted into and fixed to the first groove 2 c and the second groove 3 c . the plastic bar 5 has an i - shape section . in the process of mounting , the front frame body 2 is firstly aligned with the back frame body 3 , the plastic bar 5 is then aligned with and inserted into the first groove 2 c and second groove 3 c , and two long lateral edges of the plastic bar 5 are fixed within the first groove 2 c and second groove 3 c to connect the front frame body 2 with the back frame body 3 . as such , the front frame bodies 2 can be readily mounted to the back frame bodies 3 . the window frames are integrally made from aluminum alloy materials . the front support portions 2 a of the front frame bodies 2 and the back support portions 3 a of the back frame bodies 3 are made of hollow plates that are transversely and circumferentially closed and have openings at both longitudinal ends . as such , on the one hand , the reliability of the whole product could be guaranteed ; and on the other hand , not only the production cost could be saved , but also good heat insulating performance could be obtained . when the front and back window frames are connected by using the plastic bars , the corresponding upper and lower slides thereof are fixedly connected with each other as well . particularly , said two upper slides are connected via a plastic bar which is heat insulating , and said two lower slides are connected via another plastic bar which is heat insulating . a front frame body limiting element 2 d is located on the inner side of one of the front support portions 2 a for positioning the sliding window , and a back frame body limiting element 3 d is located on the inner side of the back support portion 3 a on the opposite side for positioning another sliding window . as such , the sliding windows could be conveniently mounted and positioned by using said two limiting elements . each of the front window cover 1 and the back window cover 17 has a curtain cloth rolling mechanism located therein . in this embodiment , each of the curtain cloth rolling mechanisms has a tubular motor 11 mounted within the aluminum - made reel pipe 16 . the upper edges of the said both pieces of curtain cloth 4 are respectively fixedly connected to the wall of the corresponding aluminum pipes 16 . the curtain cloth 4 is wound around the outer surface of the aluminum pipe 16 . this way , the reel pipes 16 could be driven to rotate by actuating the tubular motors 11 to automatically move the curtain cloth 4 up and down , so that the curtain cloth 4 is unwound or wound . end caps 12 are provided on both ends of the front and back window covers and are rotatably matched with the reel pipe 16 . extension elements 12 b are provided on the end caps 12 . the end caps 12 could be fixedly connected with the window frame support portions by inserting the extension elements 12 b into the window frame support portions . as such , the overall reliability of the curtain could be guaranteed . the curtain cloth 4 mounted on the front window cover 1 which is located on the exterior wall , is made from sun - shading materials , and the curtain cloth 4 mounted on the back window cover 17 which is located within the room , is made from screen window cloth . therefore , the said two pieces of curtain cloth 4 could be respectively pulled down as required , which could respectively act to prevent sunshine entering into the room and shield mosquitoes and wind . heat dissipation holes could be provided on the end caps 12 . each of the front guide portions 2 b of the front frame bodies 2 and the back guide portions 3 b of the back frame bodies 3 has a track 7 located therein . in particular , the track 7 is integrated with the corresponding guide portion to facilitate the manufacturing process . a longitudinal opening is located on the side of the guide portion 2 b facing the curtain cloth 4 . the track 7 forms an open slot in the longitudinal direction and the opening of the open slot faces to one side of the curtain cloth 4 . the upper opening of the open slot is in communication with the window cover 1 . a guide rod 6 is located within the open slot in the longitudinal direction . two symmetrically disposed seal plugs 8 are mounted within the front guide portion 2 b and the back guide portion 3 b adjacent to the end of the track 7 . a gap 8 a is formed between said two seal plugs 8 and has a diameter smaller than the outer diameter of the guide rod 6 . both lateral edges of the curtain cloth 4 respectively pass through the longitudinal opening of the guide portion 2 b and the opening of the open slot on the same side , to extend into the open slot 21 and be transversely positioned at the guide rod 6 . both lateral edges of said two pieces of window cloth 4 are fixedly connected with a hem 4 a which passes through the gap 8 a between two seal plugs 8 to be covered on the guide rod 6 and moves up and down along the guide rod 6 . the hems 4 a are cloth made from ordinary nylon composite materials or ordinary chemical fiber materials , have a tensible feature and thus tend not to be broken . the hems 4 a can be folded in two to form a circumferentially closed space into which the guide rod 6 is inserted , so that the guide rod 6 is connected with the curtain cloth 4 . while the hem 4 a is wound up with the curtain cloth 4 , the hem 4 a is flattened , has a thickness identical to that of the curtain cloth 4 and constantly remains flat to prevent the window cloth 4 from being displaced . as such , when the wind blows to the window cloth 4 , the curtain cloth 4 is caught by two guide rods 6 through the hems 4 a and is pulled straight , which ensures the guide rod 6 be always restricted within the track 7 to prevent from being removed . the curtain cloth 4 and the hems 4 a can be welded together by using a heat sealing device under the temperature of 200 - 400 ° c . or sewed to each other by using a sewing machine . a bottom plug 13 is mounted at the lower end face of the window frame guide portion and a guide plug 14 is mounted at the upper end face of the guide portion . a positioning element 15 is mounted within the bottom plug 13 . one end of the guide rod 6 is inserted into the positioning element 15 and the other end thereof passes through the guide plug 14 . the impurities , such as dust , will be prevented from entering into the window frame guide portion by the bottom plug 13 and guide plug 14 . the track 7 within the window frame guide portion will be kept tidy to prevent too many impurities blocking the track 7 to make it difficult to move the curtain cloth 4 up and down . an elliptical groove 15 a is disposed on the positioning element 15 . the guide rod . 6 is inserted into the elliptical groove 15 a . the distance between said two guide rods 6 can be varied by locating the guide rods 6 in different positions within the elliptical groove 15 a , so that curtain cloth 4 of different widths can be mounted . meanwhile , when the wind is strong , the movement of said two guide rods 6 within the corresponding elliptical grooves 15 a ensures that the curtain cloth 4 can be smoothly moved . the curtain cloth 4 can be slightly and appropriately projected to prevent itself from being torn down by wind for over - straightening reasons . the lower edge of the curtain cloth is connected with a lower rod 20 . after passing through the longitudinal opening of the guide portion and the opening of the open slot on the same side , both ends of the lower rod 20 slidably extend into the open slot . the length of the lower rod 20 coincides with the distance between the guide rods on both sides . the lower rod is hollow and both ends thereof are sealed by a rod plug 2 respectively . a rubber strip 21 is mounted on the lower surface of the lower rod 20 along its length . a concave slot is formed on the lower surface of the lower rod 20 along its length . the slot is embedded into the rubber strip 21 and the rubber strip 21 partially projects from the lower surface of the lower rod 20 . this embodiment is different from the first embodiment in that one of the window frames does not have window covers , curtain cloth or other parts . the structure of the second embodiment will be described below . as shown in fig1 - 17 , the support portion 2 a is fixedly connected with a lateral seal via a plastic bar 5 . in particular , a first groove 2 d is provided on a side of the support portion 2 a and a second groove 4 a is provided on a side of the lateral seal 4 corresponding to the first groove 2 d . both ends of the plastic bar 5 are inserted into and fixed to the first groove 2 d and the second groove 4 a respectively . the plastic bar 5 has an i - shape section . in the process of mounting , the lateral seal 4 is firstly aligned with the frame body 2 , the plastic bar 5 is then aligned with and inserted into the first groove 2 d and second groove 4 a , and two long lateral edges of the plastic bar 5 are fixed within the first groove 2 d and second groove 4 a respectively to connect the lateral seal 4 with the frame body 2 , in which case the lateral seal is conveniently mounted to the frame body . both the window frames and the lateral seals are made from aluminum alloy materials . the front support portions 2 a of the frame bodies 2 and the lateral seals are made of hollow plates that are transversely and circumferentially closed and have openings at both longitudinal ends . as such , on the one hand , the reliability of the whole product could be guaranteed ; and on the other hand , not only the production cost could be saved , but also good heat insulating performance could be obtained . a lateral seal limiting element 4 b is located on the inner side of one of the lateral seals 4 for positioning the sliding window , and a frame body limiting element 2 e is located on the inner side of the support portion 2 a of the frame body 2 on the opposite side for positioning another sliding window . as such , the sliding windows could be conveniently mounted and positioned by using said two limiting elements . an upper slide 9 is provided between the upper ends of the lateral seals on both sides , and a lower slide 10 is provided between the lower ends thereof . the upper and lower slides are provided with corresponding slide ways , which are mainly used to facilitate horizontal movement of the sliding window between left and right . when the window frames are connected with the lateral seals by using the plastic bars , the corresponding upper and lower slides thereof are fixedly connected with each others as well . particularly , said two upper slides are connected via a plastic bar which is heat insulating , and said two lower slides are connected via another plastic bar which is heat insulating . in this embodiment , the window frame having the window cover is mainly applied to outer sun - shading windows , and thus the lateral seal 4 is located within the room and the frame body 2 is located outside of the room . in other words , the window cover 1 is positioned out of the room . the curtain cloth 7 is made from sun shading materials , in which case sunshine can be effectively prevented from entering the room when the curtain cloth 7 is pulled down . the other aspects of the second embodiment could refer to those described in the first embodiment . as shown in fig1 and 19 , the structures and principles of the third embodiment are substantially the same as those of the second embodiment . the third embodiment is merely different from the second embodiment in that the indentation 3 formed between the guide portion 2 b and the support portion 2 a has a width smaller than that of the window cover 1 , because the window frame of this embodiment is mainly applied to inner sun shading windows and the frame body 2 is located within the room and the lateral seal is located outside of the room . in other words , the window cover 1 is positioned inside the room in the third embodiment . as the lateral seals 4 and the frame bodies 2 are mounted within the wall , the frame bodies 2 can not extend beyond the wall for the purpose of attraction and harmony of the whole product . meanwhile , the area of the window cover 1 can not be overly small as it is provided with a tubular motor . consequently , the width of the indentation 3 formed between the guide portion 2 b and the support portion 2 a must be smaller than the width of the window cover 1 , so that the window cover 1 individually extends beyond the wall . in the meantime , in order to prevent mosquito entering into the room when the window is opened to circulate the air , the window cloth 7 is made from screen window cloth in this embodiment . the other aspects of the third embodiment could refer to those described in the second embodiment . the fourth embodiment is different from the first , second or third embodiment in that the windproof component of the window frames employs different positioning elements . in particular , the positioning element of the fourth embodiment is implemented by a flexible tape . both lateral edges of the curtain cloth are respectively fixedly connected with the flexible tape on the same side or both lateral edges are respectively covered on the exterior of the flexible tape on the same side , and the upper end of the flexible tape is wound around the reel pipe . a hook is provided on the bottom plug at the lower end of the guide portion . when the curtain cloth is unwound , the lower end of the flexible tape is engaged with the hook of the bottom plug to keep the curtain cloth constantly in the straightened condition . when the lower end of the flexible tape is disengaged from the hook of the bottom plug , the curtain cloth could be driven by the reel pipe to wind upwards . the other aspects of the third embodiment could refer to those described in the first , second or third embodiment . the fifth embodiment is different from the first , second , third or fourth embodiment in that the reel pipe is driven in a different manner . in particular , a rope is manually pulled to drive the curtain cloth instead of the aforesaid driving components , for example the tubular motor . in this embodiment , a bead plate is externally secured to one end of the reel pipe and is driven to rotate by a pull bead , thereby driving the reel pipe to rotate synchronously . the sixth embodiment is different from the first , second , third or fourth embodiment in that the reel pipe is driven in a different manner . in particular , a rocker is manually turned to drive the curtain cloth instead of the aforesaid driving components , for example the tubular motor . the driving mode by manually turning the rocker is well known to persons having ordinary skills in the art and thus is omitted herein for brevity . the other aspects of the third embodiment could refer to those described in the first , second , third or fourth embodiment . 1 . the front and back window covers are provided with curtain cloth , which meets the demand for sun shading outside of windows and the purpose for prevention of mosquito and sun shading . as such , the curtain cloth could be of multiple uses , meet multiple demands and have cost efficiency . 2 . the present invention has a more reasonable configuration , in which the guide portion for positioning the guide rod to guide the curtain cloth to move up and down is integrated with the support portion for locating the sliding window . in addition , the front frame body and back frame body respectively provided with sliding windows are connected with each other via the plastic bars . as such , good heat insulating performance could be achieved and the window could be conveniently manufactured and mounted in the invention . 3 . the window frames are made from aluminum alloy and / or plastic steel materials and have a long use life . 4 . the position and connection of the front frame body relative to the back frame body could be modified as required by actual circumstances . as such , the window frames could be classified into inner sun shading window frames and outer sun shading window frames , for which the window frames could be widely employed . 5 . when the wind is strong , the guide rods can be located and the hems can be covered on the guide rods and move up and down along the guide rods , which ensures and strengthens the overall windproof intensity of the window frames on the one hand , and guarantees the smoothness of the movement of the curtain cloth on the other hand . 6 . a piece of cloth can be folded in two to form hems having a circumferentially closed space . when the hems are wound by the tubular motor together with the curtain cloth , the hems are pressed flat . the hems have the same thickness as the curtain cloth and always remain flat . as such , the curtain cloth is entirely and flatly wound around the aluminium tube , which overcomes the problem of the curtain cloth being displaced when the windproof curtain is wound . the specific embodiments described herein are merely illustrative of the spirit of the invention . various variations , modifications and amendments can be made to these embodiments by those of ordinary skills in the art without departing from the spirit or scope defined by the appended claims .	4
the films of the invention may have incorporated therein additives which provide desired characteristics such as enhanced flexibility or strength , provided such additives do not interfere with or hinder the chiral nematic structure . such additives include plasticizers , reinforcing agents and polymer resins . in the manufacture of the film such additives would be incorporated , in an appropriate amount having regard to the desired function , in the aqueous dispersion , before , during or after formation of the chiral nematic liquid crystalline phase in the dispersion . a chiral nematic pitch of 0 . 1 μm to 1 μm in the helicoidal arrangement in the film results in the film reflecting left - circular polarized light over a spectrum from ultraviolet to near - infrared . in a preferred embodiment the chiral nematic pitch is about 0 . 4 / n μm to 0 . 8 / n μm , where n is the mean index of refraction of the material resulting in a film having a coloured iridescent appearance and reflecting left - circular polarized light without change of handedness i . e ., reflecting incident left - circular polarized light as left - circular polarized light , to provide reflected light in the visible spectrum from violet to red . the cellulose crystallites suitably bear charged groups , for example , sulfate groups or phosphate groups . the sulfate groups may be derived from the acid hydrolysis of the cellulosic materials , with sulfuric acid . groups such as phosphate groups may be incorporated by a variety of well - known methods to the surface of the crystallites produced by acid hydrolysis . these charged groups may be totally or partially removed from the resulting cellulose crystallites , for example , to alter the colour of the resulting film . the preferred hydrolyzing acid is sulfuric acid which results in sulfate groups esterified onto the crystallites . aqueous liquid - crystalline suspensions of cellulose crystallites bearing sulfate groups are produced by sulfuric acid hydrolysis of natural cellulosic materials , for example , wood pulp , cotton , bast fibres and bacterial cellulose . the acid concentration must be less than that at which dissolution of the crystals takes place and thus should generally be less than about 72 % w / w . the temperature must be high enough , usually from 30 ° to 60 ° c ., and the time of hydrolysis long enough , usually 5 minutes to 2 hours , so that a stable colloidal dispersion of crystallites can be obtained . this will be the case when the cellulose crystallites are short enough and have a high enough degree of sulfate groups that have been esterified onto their surface . the optimal conditions can vary considerably , depending on the source of cellulose . it is important for a homogeneous hydrolysis and for a good yield of colour - forming fractions that the cellulosic material be milled prior to the hydrolysis , usually to pass a 20 to 100 mesh screen . typically , bleached kraft pulp from black spruce is milled to pass a 100 mesh screen . ten grams of this pulp , with a water content of about 7 % is then added to 125 ml of 60 % sulfuric acid kept heated at 60 ° c . the fluid mixture is stirred for 25 minutes and the hydrolysis is stopped by diluting about tenfold in water . the hydrolyzed material is then centrifuged and washed until the ph is ≧ 1 and transferred to a dialysis bag . the removal of free acid is thus pursued until the dialysis water remains close to neutral . the material has then passed partly or wholly in suspension , forming a gel . this gel is treated in 10 ml aliquots with a branson model 350 micro tip sonifier and the resulting liquid is further polished by a mixed - bed ion exchange resin treatment . the final product spontaneously self - assembles to form a chiral nematic liquid - crystalline phase in a certain concentration range , from about 1 % to 20 % w / w , preferably 2 % to 10 % w / w . at lower concentrations the suspension is isotropic and at higher concentrations it is a viscous gel which prevents the formation of the chiral nematic structure . the yield is about 60 %. the product is now in its acid form so that sulfur content can be measured by titration . the sulfur content is suitably about 0 . 4 % to 1 %, and is typically found to be of the order of 0 . 7 %, by dry weight , of the solid , a measurement confirmed by elemental analysis . the salt forms of the liquid crystal can be obtained by neutralization with naoh , koh , etc . the ionic strength of the preparation can be adjusted by addition of electrolyte , but the suspension will precipitate or form a gel above a certain concentration ( a salting - out effect ), for example , at about 0 . 05m nacl . transmission electron microscopy of the colloidal suspension reveals that it is composed of rod - like crystalline fragments ranging in length from about 25 nm to 500 nm , preferably about 100 nm to 200 nm , more preferably about 100 nm ; and about 3 nm to 20 nm , preferably about 4 nm to 6 nm , more preferably about 5 nm wide . electron diffraction shows that the crystallites have retained the native cellulose i structure found in the starting material . if the colloidal suspension is allowed to dry , on a support surface , for instance in a petri dish at room temperature , it will form a solid in which the order of the liquid crystal has been preserved . this is revealed by microscopic analysis of the sample and by its optical properties , which are those of a liquid crystal . the preserved chiral nematic structure is found to be preferentially planar , i . e ., with the long axis of the crystallites preferentially parallel to the substrate on which the film was dried . when the pitch of the dried film is of the order of visible light divided by the mean index of refraction of the cellulose ( 1 . 55 ), about 0 . 25 μm to 0 . 6 μm , it appears coloured and the colours change with the angle of viewing . the reflected light is left - circular polarized as expected from a left - handed helicoid . different preparations will give different colours ; longer hydrolysis time , finer mesh , and sources of cellulose with smaller crystal width , for example , wood rather than cotton , will tend to give helicoids with shorter pitches and hence reflecting shorter wavelengths . the crystallite dimensions useful for preparing coloured films range , depending on the source , in width from 3 to 20 nm , preferably 5 nm and in length from 20 to 500 nm , preferably 100 nm . the final reflection band of a solid film obtained from a given preparation can be tuned within a spectrum spanning the near infrared to the ultraviolet . this can be done in several ways . a first is to change the ionic strength by adding an electrolyte such as nacl or kcl ; this will shift the colour towards the blue . another way of achieving the same result is to desulfate the preparation by heating it , ( de - esterification occurs more easily for the acid form ), and removing the freed acid before drying . a third approach to control the final pitch is to fractionate the preparation to obtain suspensions with shorter or longer average crystalline lengths . this can be achieved by fractional precipitation or simply by phase separation , since longer crystallite rods will tend to form the liquid - crystalline phase at lower concentrations than the small fragments . films dried from colloidal dispersions with crystallites of longer average lengths will be shifted towards the red , whereas those with shorter average lengths will be shifted towards the blue . the planar orientation of the films can be almost perfect if the drying is done in a strong magnetic field , above 2 t , which is perpendicular to the drying surface . this , however , is not necessary , as all drying substrates , be they glass , polyethylene , polystyrene , paper , etc ., yield a film with quasi - planar helicoidal texture . the adherence of the film on these substrates can be very poor , as for teflon ( trade mark for a polytetrafluoroethylene ), or very good , as for paper and glass . of course , as for other translucent reflective interference devices , the colour of the underlying substrate affects the perceived colour of the film . a black ( light - absorbing ) background gives a saturated reflection colour , whereas a white background gives a variable mixture of the transmitted ( complementary ) colour and the reflected colour . the effects that can be achieved by underlying patterns or shapes of various colours are similar to those possible with thin - layer interference devices . in addition to being optically variable , i . e ., reflecting different colours for different viewing angles , the new materials reflect left - circular polarized light of the wavelength equal to their pitch multiplied by the mean refractive index of the material without changing its handedness . this makes them easily and cheaply distinguishable from all other optically variable materials which are not helicoidal and thus reflect circular - polarized light with its handedness reversed . these non - helicoid materials will appear dull or black when illuminated and viewed through a right - circular analyzer , composed of a polarizer and of a sheet of oriented birefringent material , e . g ., polyethylene , of the proper thickness . the &# 34 ; solidified liquid crystals &# 34 ; will appear even more brightly coloured when viewed with the same simple apparatus . another exceptional feature of the films is that they can be made to swell again and redisperse in suspension , or be rendered stable and not reswellable , or be made to swell only partially while keeping the structure intact . this last possibility leads to another distinctive optical characteristic of the materials . a film which in the dry state appears blue may change to a green , yellow or red when in the wet state . this occurs because the pitch of the material is larger in the swollen state ; when the material is allowed to dry again the original colour reappears . the transition is always to longer wavelengths when the pitch is enlarged , so that transitions from an invisible ultraviolet to blue , or from yellow to red , or from red to an invisible infrared are possible . these partially reswellable films can be obtained by heating the dried helicoids in order to remove the sulfate groups to a degree such that it allows the crystallites composing them to bond to each other strongly enough that they do not allow penetration of water between layers . yet another exceptional feature of the films is that they can be composite films with better strength , flexibility and other desirable qualities than the purely cellulosic films . many materials , such as plasticizers , polymer resins , or reinforcing agents ( woven or non - woven fibers of glass , carbon , wood , etc .) can be added to the dispersion without hindering the formation of the helicoidal structures . for instance , a plasticizer such as glycerol will make the films more pliable ; a water soluble resin , such as a melamine resin will have the same effect , as well as a strengthening effect . such a resin may or may not be cross - linked to the crystallites . the invention also extends to man - made solidified liquid crystal films of rod - like particles of colloidal dimensions ( not molecules ) in a helicoidal ( chiral nematic ) arrangement exhibiting a chiral nematic pitch of about 0 . 1 μm to 1 μm ; said films reflecting circular polarized light over a spectrum from ultraviolet to near - infrared . in the examples of the invention , cellulose crystallites are the rod - like particles . the invention is , however , not limited to cellulose crystallites solely . any other rod - like particles of colloidal dimensions which are suspended in a liquid and which are colloidally stable ( non - flocculating ) will also self - assemble into ordered phases ( liquid crystals ) above a critical concentration . if a chiral interaction exists between the rods , be the said chiral interaction due to the rod geometry , to functional groups at the surface of the rods , to the liquid medium , or to the presence of any chiral agent in the liquid medium etc ., the liquid crystal will adopt a chiral nematic arrangement . if the length and the width of the rods are appropriate , a solidified liquid crystal film comprising the rod - like particles arranged in a chiral nematic fashion and exhibiting a chiral nematic pitch of about 0 . 1 μm to 1 μm could be produced ; such film will have the same optically variable properties as the films in the following examples . as long as a suspension of cellulose crystallites remains stable ( non - flocculating ) in water or another liquid vehicle , be the colloidal stability due to charged groups at the surface of the crystallites ( such as sulfates , phosphates , nitrates , etc . ), or to said chains attached to the crystallites , or to a stabilizing agent in the liquid vehicle , self - assemblies into liquid crystalline phases will be obtained above critical concentrations . if the chiral interaction between the rods is not hindered by the presence of the side chains or the stabilizing agent molecules , a chiral nematic arrangement will result in the liquid crystalline phases , and solidified liquid crystal film of cellulose with the same optically variable properties as those of the films given as examples in the present invention will be obtained . the films of the invention may be employed in articles , for example , the film may be supported on a substrate , especially a planar substrate such as paper , or may be embedded in a substrate , particularly to form a planar article ; in the latter case the article may take the form of small discs of the film embedded in the substrate , for example , paper , such embedded discs are known in the security papers industry as planchettes . data may be incorporated in the article , and for this purpose may , for example , be incorporated in or as a substrate , such as paper , on which the film is supported , or may be incorporated in a polymer sheet in which the film is embedded ; the data may also be incorporated in an additive which is incorporated in the film , such addition having been incorporated in the dispersion from which the film is formed . fig1 illustrates schematically helicoidal orientation in typical chiral nematic liquid crystals . with further reference to fig1 the short lines represent a helicoidally oriented substance . in prior art chiral nematic liquid crystals the short lines represent molecules of the substance , or fragments of such molecules . in contrast , in the chiral nematic liquid crystals of the invention the short lines are not molecules or fragments of molecules , but are crystallites of colloidal dimensions . the distance from top to bottom in the liquid crystal structure , schematically illustrated in fig1 is p / 2 , where p is the pitch of the chiral nematic structure . dissolving pulp from rauma repola , ref . 83120 ( a commercial pulp sample ), is milled in a wiley mill to pass a 40 mesh screen . 8 g of this milled pulp is added to 60 ml of h 2 so 4 at 60 % w / w . the mixture is hydrolyzed for 50 minutes in a 70 ° c . oven with stirring every 5 minutes . the reaction is stopped by diluting & gt ; 10 - fold with distilled water . the acid is removed , first by centrifuging and washing to ph ≈ 1 and then by dialysis . the product , a gel , is then sonicated in ≈ 10 ml aliquots for 2 minutes with a branson 350 cell disruptor . to the resulting liquid is added mixed - bed ion - exchange resin to remove all remaining free electrolyte . after the resin is removed , the mixture is a liquid suspension ( 4 . 09 % w / w ) of sulfated ( 0 . 73 % s w / w of solid ) cellulose microcrystals . this suspension phase - separates to give a cholesteric liquid crystal . when the anisotropic phase is placed in a glass petri dish and allowed to dry overnight in a vertical 7t magnetic field , the result is a film which is almost transparent when viewed at a 90 ° angle , but which takes on a red to bronze colour when viewed at progressively smaller angles . spectrophotometry reveals that the reflection at 90 ° is a very broad peak centered at 830 nm . the reflected light is left - circular polarized . fully bleached kraft pulp from 100 % black spruce is milled to pass a 100 mesh screen . it is hydrolyzed in 60 % h 2 so 4 at 60 ° c . for 20 minutes . it is then washed , dialyzed , sonicated and polished as in example 1 . it is then made into the salt form by adding naoh to an alkaline ph and dialyzing against neutral water . the resulting product has a ph of about 4 and is thus a mixture of the salt and acid forms . the concentration of the suspension is 3 . 85 % w / w , which is in the range in which phase separation occurs . the top , isotropic fraction is collected . when dried on a teflon surface in a vertical 7t magnetic field , this fractionated sample gives a solid film which appears deep red when viewed at 90 ° and yellow to green at sharper angles . when viewed with transmitted light it appears blue - green , which is the expected complementary colour . the reflection peak at 90 ° is a broad peak centered at 628 nm . the sample has the optical properties of liquid crystals . to 9 . 5 g of the suspension described in the previous example is added 0 . 5 g of 0 . 001m nacl . the mixture is then briefly sonicated and poured in a polystyrene petri dish which is placed in a vertical 7t magnetic field . the resulting dried film is very different from the one described above . when viewed at 90 ° it appears golden and at sharper angles it appears green and then blue . the complementary colours are seen in transmitted light viewing . the reflection peak is very broad and reaches a maximum at ≈ 580 nm . when the same sample described in example 2 is allowed to dry on the top and bottom surfaces of the disk of black paper , the result is a vividly coloured paper which is blue on top and golden on the bottom . the intensity of the colours is due to the fact that the background is black . the difference in colouration of the two sides is due to further fractionation which occurred during drying . when placed in water the colours of the film shift towards the red and then disappear . the film can then be redispersed by mechanical treatment or by ultrasounds . parts of this film - coated paper were placed in an 80 ° c . oven for 16 hours . this did not change the aspect of the film but affected its swelling properties . when wet , the colour on top changes from blue to gold and that on the bottom changes from gold to red , but the shift goes no further , even when left in water for a prolonged time . the film regains its original colours when dried . a new preparation of liquid crystals was made under the same conditions as described in example 2 , but this time the suspension is not fractionated . the preparation was then slowly desulfated to varying degrees by heating at 70 ° c . the sulfur content was then measured by titration and ≈ 3 ml of each of four preparations were allowed to dry on glass slides . the results were as follows : ______________________________________sulfur content colour of dried (% w / w solid ) film______________________________________0 . 89 none ( ir ) to red ( angled ) 0 . 74 red to gold0 . 69 orange to green0 . 61 gold to blue______________________________________ a new preparation was made , again under the same conditions as in example 2 , but the preparation was not fractionated . to four aliquots of the resulting suspension in its acid form , each containing 0 . 1 g of cellulose crystallites , are added 0 . 2 ml of a 0 . 01m nacl solution . the first of these is allowed to dry in a polystyrene petri dish and yields a brittle film with a peak absorbance at 640 nm . to the other three aliquots are added 0 . 1 , 0 . 2 and 0 . 4 ml of a 2 . 5 % w / v solution of glycerol and they are then also dried in petri dishes . they yield films with peak absorbances at 710 , 730 and 840 nm respectively , which are much more supple than the film without glycerol . glycerol does not prevent the formation of the helicoidal structure and acts as a plasticizer while increasing slightly the peak absorbance wavelength . addition of more salt can compensate this effect . thus a film prepared with 0 . 1 g of cellulose , 0 . 3 ml of 0 . 01m nacl and 0 . 5 ml of 2 . 5 % w / v glycerol has a peak absorbance of 670 nm . this is close to the 640 nm of the original film without glycerol , yet this new film is much less brittle . to each of three aliquots of the suspension described in example 6 , each containing 0 . 1 g of cellulose , are added 0 . 4 ml of 0 . 01 m nacl . a solution of 3 . 5 % nanoplast ( a registered trade mark for a water - soluble melamine resin used for embedding samples for microscopy ) is then added to the samples ; 0 . 1 ml to the first , 0 . 2 ml to the second and 0 . 3 ml to the third . they are then dried in petri dishes . the films obtained are , as for glycerol in example 6 , more supple than films to which no resin is added . a shift in peak absorbances occurs , but this time it brings them into the ultraviolet region , rather than towards the infrared as it did for glycerol . this can be compensated for by diminishing the amount of salt added . the melamine monomers seem to have polymerized , probably due to the catalytic effect of the acid groups present on the crystallite surface . this is indicated by the fact that swelling of the composite films in water is much more limited than for films without polymer . thus a composite film comprising a melamine resin and cellulose crystallites can be made without hindering the formation of the helicoidal structure .	2
referring initially to fig1 a rotary engine 11 , typically of the wankel type , is shown including a plurality of trochoidal combustion chambers 13 and a plurality of eccentrically rotated rotors 15 . each of the combustion chambers 13 is connected through an inlet conduit 17 to one or more barrels of a carburetor 19 . the present invention assumes the use of plural rotors 15 operating in plural combustion chambers 13 , and assumes further that the intake conduit 17 comprises plural conduits , each conduit supplying one or more combustion chamber 13 with fuel mixed with air , and each connected to independent barrels within the carburetor 19 . it will be understood that each of the rotors 15 creates a vacuum within its respective combustion chamber 13 during the intake cycle , generating a vacuum in its respective inlet conduit 17 , causing air and fuel to be mixed within the carburetor 19 in proper proportions to support combustion . referring now to fig2 the details of construction of the carburetor 19 of the present invention will be described . in this instance , the carburetor includes at least one manually controlled barrel 21 connected to a first intake conduit 17 ( manually controlled conduit ) of a first group of rotors and a second vacuum controlled barrel 23 connected to a second intake conduit 17 ( vacuum controlled conduit ) for supplying fuel and air to a second group of rotors 13 . each of the barrels 21 and 23 is constructed to provide a venturi passage 25 for increasing the velocity and thereby decreasing the pressure of airflow at this point in the carburetor . a main fuel jet 27 communicates with the barrel 21 at the venturi 25 to supply fuel to the manually controlled barrel 21 . similarly , a main fuel jet 29 communicates with the venturi 25 of the barrel 23 . the main jet 27 communicates through a metering orifice 31 with a fuel reservoir 33 . this fuel reservoir 33 , in a typical construction , is supplied fuel from a fuel pump ( not shown ) through a needle valve 35 which includes a needle 37 opened and closed by a float 39 to maintain the reservoir 33 filled with fuel at a predetermined level at all times . a similar needle valve 41 , needle 43 and float 45 maintains the level of fuel in a fuel reservoir 47 used to supply fuel to the main jet 29 of the barrel 23 . in addition , fuel is supplied to an idling jet 49 through the metering orifice 31 from the reservoir 33 to provide fuel for idling within the carburetor barrel 21 . a similar idling jet 51 is connected to the main jet 29 to provide idling fuel for the vacuum controlled barrel 23 . a pair of throttle valves 53 and 55 control the flow of air through the respective carburetor barrels 21 and 23 to control the flow of fuel and air into the respective combustion chambers 13 . the throttle valve 53 in the manually controlled barrel 21 is directly controlled by a mechanical linkage 57 connected to the accelerator pedal in the vehicle being driven . the throttle valve 55 is controlled in accordance with the vacuum in the intake manifold connected to the manually controlled barrel 21 in a manner which will be described in detail below . while in an unmodified carburetor , fuel flow to the main jet 29 and idle jet 51 will be controlled through a metering orifice similar to the orifice 31 , a modification is made according to the present invention to replace the metering orifice with a tubular fitting 59 which is rigidly secured , as by threading , into the wall of the fuel reservoir 47 . this fitting includes a tubular extension 61 which supports a conduit 63 , preferably made of resilient material of smaller diameter of the tubular extensions 61 such that the conduit 63 fits snugly over the tubular extension 61 to provide a fuel - tight connection . the conduit 63 is similarly connected to a tubular fitting 65 which is threaded through the exterior wall 67 of the fuel reservoir 47 at a position directly opposite the fitting 59 to provide a conduit for the flow of fuel to the fitting 59 from outside the carburetor 19 . a second conduit 69 , preferably of resilient polymeric material , is connected between the fitting 65 and a vacuum actuated fuel control valve 71 . as will be described in more detail below , the fuel control valve 71 is in fluid communication with fuel within the fuel reservoir 47 and supplies fuel from the reservoir 47 to the conduit 69 and thus to the fitting 59 and jets 29 and 51 in response to the vacuum in a vacuum sensing line 73 . when a relatively high vacuum is present in the conduit 73 , the valve 71 closes to prohibit flow of fuel from the fuel reservoir 47 into the conduit 69 . when the vacuum in the conduit 73 is reduced to a predetermined level , that is , the pressure within the sensing line 73 is increased , the valve 71 will open to admit fuel from the reservoir 47 to the jets 29 and 51 . the vacuum sensing line 73 is connected to a port 75 which opens at the off - idle position into the manually controlled barrel 21 . as used in this application , the off - idle position is a position upstream of the throttle valve 53 . when the throttle valve 53 is opened a substantial distance , the vacuum at the off - idle port 75 will be substantially the same as the vacuum within the intake conduit 17 leading to the manually controlled bank of rotors 15 , so that the port 75 will monitor engine demand . as the load on the engine increases in response to increased engine demand , the vacuum in the manually controlled intake conduit 17 will decrease , leading to a vacuum decrease in the conduit 73 and a resultant opening of the valve 71 to admit fuel to the jets 29 and 51 to permit operation of the vacuum controlled rotors connected to the barrel 23 . when the vacuum within the intake conduit 17 connected to the manually controlled rotors 15 and barrel 21 increases , as would occur , for example , at cruising speeds when engine demand is relatively low , the vacuum in the conduit 73 will increase accordingly , the vacuum at the port 75 being only slightly less than the vacuum in the intake conduit 17 , so that the valve 71 will close to prohibit the passage of fuel from the reservoir 47 to the jets 29 and 51 . this eliminates combustion in the vacuum controlled bank of combustion chambers 13 connected to the vacuum controlled barrel 23 so that only a portion of the rotors 15 are used to meet this relatively low engine demand . when the engine is idling , the throttle valves 53 and 55 are closed and fuel for idling is supplied through the idle jets 49 and 51 . lack of airflow through the venturi 25 eliminates the vacuum in the main jets 27 and 29 so that no fuel flows through the main jets . a vacuum is created , however , at the idle jets 49 and 51 in direct response to rotation of the rotors 15 , so that fuel is drawn through these idle jets 49 and 51 . by placing the vacuum port 75 at the off - idle position upstream of the throttle valve 53 , a relatively low vacuum will exist within the vacuum sensing line 73 when these idle conditions exist , since the vacuum port 75 is in direct communication with atmospheric pressure through the barrel 21 . this atmospheric pressure will cause the vacuum control valve 71 to open so that fuel is supplied to the idling jet 51 through the conduit 69 . thus , whenever the throttle valve 53 is completely closed , as at idle , the vacuum control valve 71 will operate in a manner identical to its operation at peak engine demand to supply fuel to the vacuum controlled barrel 23 . it will be understood by those skilled in the art that air for idling to be mixed with the fuel from the idle jets 49 and 51 is supplied by apertures through the carburetor which are not shown in fig2 . the details of the vacuum actuated fuel control valve 71 will be explained in reference to fig3 . as previously explained , this valve 71 passes through the wall 67 of the fuel reservoir 47 to control the flow of fuel between the fuel reservoir 47 and a flexible conduit 69 . the main body of the valve 71 is formed as an externally threaded tubular member 77 which is conveniently threaded through an aperture 79 in the wall 67 . the tubular member 77 includes a flange 81 of enlarged diameter which includes a hollow cavity 83 . an annular groove 85 surrounding the recess 83 supports a perimeter of a resilient diaphragm 87 which is sealed within the annular groove 85 . the exterior of the hollow cavity 83 is sealed by a flange 89 which is attached by any suitable means to the flange 81 . the flange 89 includes an extending tubular portion 91 which provides communication to the interior of the cavity 83 and support for the resilient vacuum sensing line 73 . the resilient diaphragm 87 includes a circular central aperture 93 which mounts one end of a reciprocating valve stem 95 . the valve stem is attached and sealed to the aperture 93 by any convenient means . the opposite end of the valve stem 95 is mounted on the tubular member 77 by means of a compression spring 97 which bears against a head 99 on the valve stem 95 and an internal annular shoulder 101 at one extremity of the tubular member 77 . the spring 97 biases the valve stem 95 to the right , as viewed in fig3 . a valve seat 103 is formed within the tubular member 77 and designed to interengage with a valve surface 105 formed as a protruding annular shoulder around the valve stem 95 . the spring 97 thus biases the valve stem 95 to the right , as viewed in fig3 so that the valve 105 is biased to an open position . when a predetermined vacuum exists within the vacuum sensing line 73 , a pressure differential is generated across the flexible diaphragm 87 which is sufficient to overcome the bias of the spring 97 , such that the valve stem 95 moves to the left , as viewed in fig3 engaging the valve surface 105 and valve seat 103 . a tubular member 107 is attached , as by threading , through the wall of the tubular member 77 outside of the wall 67 of the fuel reservoir 47 . this member 107 communicates with the interior of the tubular member 77 and supports the fuel supply conduit 69 . this fuel supply conduit 69 , as previously explained , communicates with the jets 29 and 51 of the vacuum control barrel 23 within the carburetor . the control valve 71 permits fluid flow between the fuel reservoir 47 and the jets 29 and 51 through the tubular member 77 when a relatively low vacuum is present on the vacuum sensing line 73 , so that the vacuum controlled rotors within the engine will be supplied with fuel . when the vacuum within the sensing line 73 is relatively high , however , the valve 71 will close , prohibiting fuel flow through the tubular member 77 , and thus from the fuel reservoir 47 to the vacuum controlled barrel 23 . referring once again to fig2 it should be noted that , once the vacuum actuated fuel control valve 71 has closed in response to increased vacuum at the off - idle vacuum port 75 , as would occur during vehicle cruising , for example , or any low power demand engine characteristic other than idling , all fuel flow to the jets 29 and 51 is discontinued , since both the main jet 29 and the idle jet 51 are controlled . thus , when the vacuum controlled barrel 23 is deactivated , sporadic engine firing cannot occur as would be the case , for example , if the idle jet 51 were not properly controlled . this control of both jets therefore eliminates misfiring in the controlled rotor bank and thus eliminates a possible cause of undesirable exhaust emissions from the engine . in further reference to fig2 the mechanism for controlling the flow of lubricating oil to the carburetor barrels 21 and 23 and thus to the engine rotors 15 will be described . as has been previously noted and will be described in more detail below , the throttle valve 53 is manually controlled through rotation of a shaft 107 by a linkage 57 connected to the accelerator pedal in the vehicle . in order to operate the throttle valve 55 independently of the throttle valve 53 , the throttle valve 55 is mounted on an independent rotating shaft 109 . each of the shafts 107 and 109 are conveniently rotatably mounted in a throttle housing 111 mounted by any convenient means to the main carburetor housing 113 and engine 11 . in order to provide lubrication for the rotors 15 , a pair of oil inlet ports 115 and 117 communicate with carburetor barrels 21 and 23 and are in communication with an oil pressure line 119 which is connected to an oil valve 121 . the oil valve 121 , conduit 119 and ports 115 and 117 are standard on rotary engines , as is an oil pump 123 which supplies oil under pressure to the lubricating system . the oil valve 121 is designed to control the flow of oil to the ports 115 and 117 in accordance with the throttle valve opening . thus , by using the throttle valve position , the amount of lubricant supplied to the ports 115 and 117 can be made to increase in response to both the rate of rotation of the rotary engine and engine load . in a typical carburetor configuration the oil valve 121 is controlled from the rotating shaft 109 rather than the rotating shaft 107 . in the modification of the present invention , the oil control valve 121 is connected directly , as through a linkage 125 , to an eccentric member 127 connected to the rotating shaft 107 . this eccentric 127 is connected in turn to the accelerator linkage 57 so that the oil valve 101 always operates in conjunction with the accelerator linkage 57 and the throttle 53 of the barrel 21 . as will be explained in detail below , under some circumstances the throttle valve 53 will be open while the throttle valve 55 will be closed . it has been found advantageous to supply oil through both of the ports 115 and 117 under these conditions , since the rotor 13 connected to the carburetor barrel 23 must receive increased oil quantities with increased rotational rates , regardless of whether combustion occurs in this combustion chamber . the modification of attaching the linkage 125 directly to the eccentric 127 accomplishes this result . referring now to fig4 and 5 , the mechanism for operating the throttle valve 53 and 55 will be explained . as previously noted , the throttle valve 53 is rigidly connected to a rotating shaft 107 which is mounted for rotation within the throttle housing 111 . the throttle valve plate 55 is likewise rigidly connected for rotation with a rotating shaft 109 mounted in the throttle housing 111 . the shafts 107 and 109 are interconnected through respective segmented ends 129 and 131 , the operation of which will be described in detail below . as is common in many carburetor configurations , each of the pair of inlet conduits of the intake manifold 17 is connected to a pair of barrels for changing the carburetor mixture in response to engine demand . thus , the first inlet conduit 17 which is connected to the carburetor barrel 21 is additionally in communication with a secondary carburetor barrel 133 . likewise , the second intake conduit 17 which is in communication with the carburetor barrel 23 is additionally in communication with a secondary carburetor barrel 135 . the carburetor barrels 133 and 135 are controlled by a pair of throttle valves 137 and 139 , respectively , each of which is rigidly mounted on a single rotating throttle control shaft 141 supported within the throttle housing 111 . the secondary throttle valves 137 and 139 are controlled by means of an eccentric 143 rigidly connected to the rotating shaft 141 . a tension spring 145 is mounted on the engine or carburetor housing to bias the eccentric 143 to open the throttle valves 137 and 139 . a pin 147 which connects the tension spring 145 to the eccentric 143 is additionally connected by means of an actuating arm 149 to a vacuum transducer 151 . this vacuum transducer 151 operates in response to vacuum supplied by a vacuum line 153 which terminates in a vacuum sensing port 155 positioned downstream of the throttle valve 55 in the carburetor barrel 23 . as engine demand decreases , the vacuum at the sensing port 155 increases , actuating the transducer 151 to rotate the rod 141 to close the throttle valves 137 and 139 , overcoming the bias of the tension spring 145 . the carburetor barrels 133 and 135 therefore operate in response to peak engine demand as sensed by a low vacuum at the vacuum port 155 to supply additional fuel and air to the pair of intake conduits 17 . in addition to this control of the secondary throttle valves 137 and 139 which is typically included in four barrel carburetors , a vacuum control is provided for operating the throttle valve 55 in the carburetor barrel 23 independent of the throttle valve 53 . in a manner similar to the vacuum control for the rod 141 , a tension spring 157 is connected to an eccentric 159 through a pin 161 . the tension spring 157 urges the eccentric 159 and its attached rotating rod 109 in a direction which tends to open the throttle valve 55 . a vacuum transducer 163 is connected through a linkage 165 to the pin 161 and is additionally connected to a vacuum line 167 which terminates in a port 169 positioned downstream of the throttle valve 53 . the port 169 is subjected to a relatively high vacuum when the engine is operating at low demand , so that the transducer 163 holds the throttle valve 55 closed . however , as engine demand increases , the vacuum downstream of the throttle valve 53 within the carburetor barrel 21 decreases , deactuating the transducer 163 to permit the spring 157 to rotate the rod 109 and throttle valve 55 to an open configuration as shown in fig4 . the segmented ends 129 and 131 of the rotating rod 107 and 109 permit this independent rotation of the throttle valves 53 and 55 within certain limitations . referring specifically to fig5 it will be noted that the segmented portion 129 of the manually controlled rotating rod 107 is formed as a semicircle , while the segmented portion 131 of the vacuum control rod 109 is formed as a smaller segment of a circle . as the rod 107 rotates in response to depression of the accelerator pedal and motion of the accelerator linkage 57 , the segmented end 129 rotates in the direction a shown in fig5 such that a first abutting surface 171 of the segmented portion 129 rotates away from a first abutting surface 173 of the segmented portion 131 . the segmented portion 131 can thus remain stationary as the segmented portion 129 rotates , permitting the throttle valve 53 to open while the throttle valve 55 remains closed . once the throttle valve 53 has opened to a predetermined degree , a second abutting surface 175 on the segmented portion 129 will contact a second abutting surface 177 on the segmented portion 131 to assure that , when the throttle valve 53 is opened to its fullest extent , the throttle valve 55 will be manually opened by engagement of the surfaces 175 and 177 to a slight degree . this operation assures that the throttle valve 55 cannot become lodged in the carburetor barrel 23 to a sufficient extent that the spring 157 cannot rotate the throttle valve 55 , without intermittently being dislodged manually when the throttle valve 53 is opened completely . similarly , abutment of the surfaces 173 and 171 assures that , when the engine is idling , that is , when the throttle valve 53 is completely closed , engagement of the segmented portions 129 and 131 will assure that the throttle valve 55 is likewise completely closed . this latter abutment therefore overcomes the operation of the spring 157 and transducer 163 under idle conditions . operation of the rotary engine 11 and the carburetor 19 described in reference to fig1 through 5 will now be explained . when the engine 11 is operating under relatively low power demand , such that the vacuum within the carburetor barrel 21 is relatively high and the throttle valve 53 is opened to some extent by the accelerator linkage 57 , the vacuum at both of the sensing ports 75 and 169 will be relatively high . this high vacuum closes the vacuum control valve 71 to prohibit the flow of fuel from the fuel reservoir 47 to the main jet 29 and idle jet 51 of the carburetor barrel 23 . simultaneously , the relatively high vacuum at the vacuum sensing port 169 activates the vacuum transducer 163 to maintain the throttle valve 55 in the carburetor barrel 23 closed . simultaneously , a high vacuum is created in the carburetor barrel 23 downstream of the throttle valve 55 which is sensed at the vacuum sensing port 155 , activating the vacuum transducer 151 to maintain the throttle valves 139 and 137 of the barrels 135 and 133 closed . thus , under these conditions , only the throttle valve 53 is opened so that only the carburetor barrel 21 operates to supply fuel to only one of the intake conduits 17 , and only that portion of the multiple rotors 13 in communication with this inlet conduit 17 will operate to produce output power . this operation on only a portion of the engine rotors 15 efficiently produces power with reduced emissions at low engine demand . as increased engine demand is produced through further actuation of the accelerator linkage 57 , the throttle valve 53 will open to a greater degree . this greater opening of the throttle valve 53 decreases the vacuum within the carburetor barrel 21 so that a decreased vacuum is sensed at the port 169 and vacuum transducer 163 . in response to this decreasing vacuum , the vacuum transducer 163 becomes deactivated , permitting the tension spring 157 to open the throttle valve 55 to permit operation of the carburetor barrel 23 and the remaining inlet conduit 17 connected to the previously deactivated rotors 15 . simultaneously , the vacuum sensing port 75 monitors this decreasing vacuum to actuate the vacuum actuated fuel control valve 71 to open and supply fuel from the fuel reservoir 47 to the main jet 29 and idle jet 51 . fuel is thus supplied to the carburetor barrel 23 , and the throttle valve 55 is opened so that the remaining rotors are activated . in response to further increases in engine demand , the vacuum within the carburetor barrel 23 will be reduced to a greater extent such that the vacuum sensed at the port 155 will deactivate the vacuum transducer 151 permitting the tension spring 145 to open the throttle valves 137 and 139 . the carburetor barrels 135 and 133 are supplied with fuel from the fuel reservoirs 33 and 47 by conduits and jets ( not shown ) which are independent from the conduits and jets which supply the barrels 23 and 21 . thus , the remaining carburetor barrels 135 and 133 supply increased amounts of air and fuel to the pair of inlet conduits 17 to produce peak power required under these characteristics . when the accelerator linkage 57 is moved to an idle position , closing the throttle valve 53 , engagement of the segmented portions 129 and 131 of the rotating rods 107 and 109 will force the throttle valve 55 to a closed or idle position overcoming the tension spring 157 and vacuum transducer 163 . the vacuum sensing port 155 located downstream of the throttle valve 55 will monitor a relatively high vacuum under idling conditions such that the vacuum transducer 151 will maintain the throttle valves 139 and 137 in a closed position so that the barrels 135 and 133 do not operate . thus , at idle , each of the throttle valves 53 , 55 , 139 and 137 is closed . the vacuum sensing port 75 , being positioned above the throttle valve 53 , is disassociated from the vacuum within the barrel 21 below the throttle valve 53 and is thus subjected to atmospheric pressure . this causes the vacuum actuated fuel control valve 71 to open , admitting fuel to the conduit 69 . since there is no airflow through the venturi portion 25 of the carburetor barrel 23 , fuel will not flow through the main jet 29 . fuel will be drawn by the vacuum below the throttle valve 55 through the idle jet 51 to support idling combustion in the rotors 15 connected to the carburetor barrel 23 . thus , under idle conditions , all of the combustion chambers 13 will be supplied with fuel from the carburetor barrels 21 and 23 so that normal idling characteristics are achieved . it should be recognized that , through a variation in the spring constant or pretension of the springs 157 and 145 the vacuum level at which the throttle valves 55 , 139 and 137 can be operated may be varied . similarly , through a variation in the spring constant or pretension of spring 97 in the vacuum control valve 71 , the vacuum at which the control valve 71 will close to prohibit fuel flow to the barrel 23 may be varied . thus , the spring tensions may be varied to produce a gradual transition from operation on one bank of rotors to both banks of rotors at a preselected engine demand and to then undergo a second transition at even more increased engine demand through the opening of the throttle valves 137 and 139 . in addition , it has been found advantageous to adjust the relative operating vacuums of the valve 71 and throttle valve 55 such that the valve 71 operates at a lower vacuum level . thus , as the vacuum decreases in the barrel 21 , the throttle valve 55 will initially close to eliminate flow of air to the secondary bank of rotors except through the idle jet 51 . sporadic combustion will not occur under these conditions and it is possible then to interrupt the fuel altogether through a closing of the fuel control valve 71 . if this operation were reversed , such that upon decreasing vacuum in the carburetor barrel 21 the vacuum actuated fuel control valve 71 closed prior to the closure of the throttle valve 55 , fuel left in the conduit between the main jet 29 and idle jet 21 would be sucked out of the main jet 29 to cause sporadic firing of the engine which would generate high emissions and uneven engine performance . the lubrication system which has been disclosed , wherein the rotors are lubricated regardless of whether fuel is admitted by controlling the oil valve from the accelerator linkage directly pg , 20 assures that the modification to the rotary engine resulting in a splitting of the rotors does not change the engine life . in addition , it should be understood that the amounts of oil normally admitted to a rotary engine combustion chamber are so small that no substantial oil buildup will occur in the deactivated rotor during cruising .	5
at the beginning of this document , i identified four attributes that were needed by an error - correcting resilience assembly , which i see as the “ missing link ” in the defenses of conventional systems , as reviewed in the preceding section . the basic error - correcting assembly , considered alone , is not the present invention ; rather , the invention here goes beyond the basic error - correcting assembly . that basic assembly , however , will be introduced first — in this section and sections 2 and 3 below . the basic error - correcting assembly should be generic , transparent to client software , compatible with defenses used by the client , and fully self - protected . it appears that an all - hardware assembly is most likely to meet those goals , since stored programs do not need to be protected . the assembly needs nonvolatile storage for record - keeping and rom microcode for sequencing operations . one way to appreciate the requirements and characteristics of my proposed error - controlling assembly is to analogize it to the immune system of the human body . to develop this reasoning , i use the following three analogies : 3 . the immune system is analogous to my novel error - controlling assembly , or resilience support architecture . 1 . it functions ( i . e ., detects and reacts to threats ) continuously and autonomously , independently of consciousness . 2 . its elements ( lymph nodes , other lymphoid organs , lymphocytes ) are distributed throughout the body , serving all its organs . 3 . it has its own communication links — the network of lymphatic vessels . 4 . its elements ( cells , organs , and vessels ) themselves are self - defended , redundant and in several cases diverse . now i can identify the properties that the error - controlling assembly must have in order to justify the immune - system analogy . they are as follows . 1b . the assembly is independent of ( requires no support from ) any software of the client platform , but can communicate with it . 1c . the assembly supports ( provides protected decision algorithms for ) multichannel computing of the client platform , including diverse hardware and software channels to provide design - fault tolerance for the client platform . 2 . the assembly is compatible with ( i . e ., protects ) a wide range of client platform components , including processors , memories , supporting chipsets , discs , power supplies , fans and various peripherals . 3 . elements of the assembly are distributed throughout the client platform and are interconnected by their own autonomous communication links . 4 . the error - controlling assembly is fully resilient itself , requiring no external support . it is not susceptible to attacks by intrusion or malicious software and is not affected by natural or design faults of the client platform . a different and independently devised analogy of the immune system is the “ artificial immune system ” ( ais ) of s . forrest and s . a . hofmeyr . its origins are in computer security research , where the motivating objective was protection against illegal intrusions . the analogy of the body is a local - area broadcast network , and the ais protects it by detecting connections that are not normally observed on the lan . immune responses are not included in the model of the ais , while they are the essence of my assembly . the unit error - correcting assembly is a system composed of four types of special - purpose controllers , modules 42 through 46 , 21 through 24 ( fig1 ). these modules are asics ( application - specific integrated circuits ) that are controlled by hard - wired sequencers or by read - only microcode . this assembly of correction modules serves and protects a primary - function module 41 that is essentially a conventional computing block such as a standard processor . the primary - function module 41 is a client system , in the sense that it this module that performs the computing work which the entire computing system exists to perform . in some of the appended claims , this protected conventional computing block 41 is treated as part of my invention itself , and in other claims it is instead treated as a part of the context or environment of my invention . redundant nodes ( not shown ) are provided for fault tolerance of the fti itself . one interface module 42 is provided for each primary - function module 41 . all error - signal outputs 32 and recovery - command inputs 33 of the primary - function module 41 are connected through its interface module 42 . within the assembly 42 - 46 , 21 - 24 , all interface modules 42 are connected to one errors / corrections cache module 44 via the errors / corrections bus 34 . each interface module also has a direct input ( the error - alert pin 45 ) to the errors / responses cache 44 . an interface module 42 conveys primary - function module error messages 32 to the errors / responses cache 44 . it also receive recovery commands 33 from the errors / responses cache 44 and issues them to the primary - function module 41 inputs . the error - alert pin 45 serves to request errors / corrections cache 44 attention for an incoming error message 32 on the errors / responses bus 34 . the cache module 44 stores in rom all error signals from every expected type of primary - function module 41 , and also all prepared responses to those known error types — as well as the sequences for its own recovery . the cache also stores system configuration and system time data , and its own activity records . as will be understood , the name “ cache ” for this module 44 is a slight simplification , since the cache 44 is not memory exclusively , but also performs associated logic functions . the cache 44 is also connected to the so - called “ hypothalamus ” module 46 . as will be seen , this module is named aptly in that it is one element of the assembly which never powers down completely , and it maintains function ( or nonfunction , as may be the case ) of all the other modules at a very fundamental level . more specifically , the functions of the hypothalamus 46 are to control power - on and power - off sequences for the entire system , to generate fault - tolerant clock signals and to provide nonvolatile , radiation - hardened storage for system time and configuration . the hypothalamus has a reserve electrical source ( a battery ) 23 and remains on at all times during the life of the error - controlling assembly 21 - 24 , 31 - 38 , 42 - 46 and the primary - function module 41 . the conflict - resolver module 43 provides resilient comparison and voting services for the other modules . if there are plural primary - function modules 41 , especially diverse processor types and perhaps operating multiversion software , then the resolver 43 includes decision algorithms for handling possibly divergent computation results from such diverse software or processors in the primary - function modules 41 . fast response of the resolver 43 is facilitated by hardware implementation of such algorithms . this same conflict - resolver module 43 also keeps a log of disagreements in the decisions . another function of the resolver 41 is to serve as a communication link between the software of the primary - function module or modules 41 and the cache 44 . primary - function modules 41 may request configuration and cache - activity data or send power - control commands , and some of these advantageously pass via the resolver 43 . the resolver 43 is linked by a built - in interface 42 to the cache 44 . another function of the resilient error - controlling assembly 21 - 24 , 31 - 38 , 42 - 46 is to provide resilient power management for the entire system , including individual command - resettable breakers ( essentially power switches ) for each primary - function module 41 . every module except the hypothalamus 46 has such a breaker . the upper - level modules of the assembly as a group have their own resilient operational electrical source 21 . the cache 44 and hypothalamus have a separate “ support ” source 22 . the partitioning of the error - correcting assembly is motivated by the need to make it resilient . the interface and resolver 42 , 43 are self - checking pairs , since high error - detection coverage is essential , while spare primary - function and resolver modules 41 , 43 can be provided for recovery under control of the error - response commands stored in the cache 44 . the cache 44 should be continuously available ; therefore the system advantageously uses triplication and voting ( tmr ), with spare cache modules added for longer life . the hypothalamus 46 manages cache replacement and also shuts the system down in case of catastrophic events ( temporary power loss , heavy radiation , etc .). the hypothalamus functions are advantageously protected by provision of two or more self - checking hypothalamus pairs ( not shown ), each with its own backup electrical source . in my development of this invention , i separated the hypothalamus from the cache to make the module that must survive catastrophic events as small as possible . the all - hardware implementation of the assembly makes it safe from software bugs and external attacks . the one exception is the power management command from the primary - function module 41 to the cache 44 ( via the resolver 43 ) which could be used to shut the system down . special protection is needed here . the adverse influence of any hardware design faults in the resilient assembly can be minimized by design diversity , both of self - checking pairs and of cache modules ; however , the logic of all the modules is very simple and their complete verification should be possible . when interconnected , the modules 42 - 46 , 21 - 24 of my assembly and the typically conventional primary - function module 41 form a computing system that is protected against most causes of system failure . this system is the first example of an implementation of the immune system paradigm . the use of the resilient support assembly is likely to be affordable for most computer systems , since the interface , cache , resolver and hypothalamus 42 , 44 , 43 46 have simple internal structure . some truly challenging missions can be justified only if their computers , together with my resilient assembly , have very high coverage as to design faults and as to catastrophic transients due to radiation . extensive sparing and efficient power management can also be provided by the resilient assembly . given that the mtbf of contemporary processor and memory chips is approaching 1000 years , missions that can be contemplated include the 1000 - day manned mission to mars with the dependability of a 10 - hour flight in a commercial airliner . another possibility is unmanned very - long - duration interstellar missions , using a fault - tolerant relay chain of modest - cost spacecraft — using my resilient assembly particularly as described in this document . one thrust of my error - controlling resilient assembly , described above , is to use hardware more extensively and more effectively than is done conventionally in providing resilience for very dependable high - performance platforms . my basic resilient - assembly invention , as set forth above , considered intel &# 39 ; s p6 family of processors and their supporting chipsets as the commercially available elements of the host platform . these elements were not designed to utilize my resilient assembly , which accordingly is introduced by a “ retrofit .” as noted earlier the basic , or unit , error - correcting assembly introduced just above — considered alone — is not itself the present invention . i shall now move on to describe preferred embodiments of the present invention . this invention is an extension of the basic resilient assembly . preferred embodiments incorporate the basic assembly into a hierarchical form , together with packaging of the entire hierarchical resilience support system into a single “ system on chip ” (“ soc ”). it is to be understood that the hierarchical configuration can be used without building the system as an soc . the two together , however , make the invention a particularly powerful combination . each primary - function module 1 a , 1 b . . . ( fig2 ) of the soc is provided with an interface 2 a , 2 b — similar to the interface 42 ( fig1 ) of the resolver 43 in the basic assembly . as mentioned earlier , use of resolver modules ( or interfaces , or both ) in my hierarchical assembly is by no means restricted to the upper - level modules that most directly protect and support primary - function computing systems . to the contrary , resolvers or interfaces , or both , provide a broad capability useful throughout preferred embodiments of my invention . for example they are advantageously used as well to compare , and make decisions about , results from any of the modules — e . g ., intermediate - or even lower - level caches — in my hierarchical system . not all protected activity begins at the first ( i . e . top ) level . for instance a monitor , or printer , or any number of other single replaceable items , may be found in a lower level — serving caches etc . in the lower tiers of either the primary apparatus hierarchy or my parallel protective hierarchical error - controlling system . cache modules 5 a , 5 b are separate blocks within the soc , and the errors / corrections bus 4 connects the cache modules , as a cluster , to each block of the soc that also has the individual error - alert pins 3 a , 3 b connected to the cache 5 a . the resolver 43 ( fig1 ) can also be replaced by a “ resolver port ” that is part of the soc block . the soc has a complete built - in basic resilient assembly , as described above . the hierarchical refinement of my resilient - assembly concept takes place as follows . the cache cluster 5 a of one soc 1 — i . e ., cache soc 4 — serves as the interface 42 ( fig1 ) of the soc , with respect to a lower - level cache cluster , cache board 8 that protects several soc packages located on the same board . this module cache board is a separate soc that serves as the interface 42 ( fig1 ) of the entire board — and is connected to every soc by the errors / corrections bus 7 for the board , as well as error - alert pins 6 a , 6 b from each soc . one chassis contains several boards and other subsystems : monitor , printer , hard disk , etc . each board has its cache board 8 serving as an interface 42 ( fig1 ) connected to a chassis - level cache cluster , cache chasis 12 . other subsystems of the chassis 9 also must be provided with interfaces 10 that are connected by error - alert pins 11 a , 11 b and the chassis errors / corrections bus 13 to the cache chassis , analogously to the boards . a further extension or refinement of the hierarchy applies to a group of chassis that yet again in turn has a cache cluster . the latter in turn is connected by an errors / corrections bus 14 of the chassis group and by individual error - alert pins 15 to all cache chassis modules 12 . a still - further refinement to a network of chassis groups is the next step . in some cases the provision of an errors / corrections bus and individual error - alert pins may be more difficult , especially if the chassis groups are widely separated physically . thus a hierarchical error - controlling system according to preferred embodiments of my invention has a nested kind of tiered structure . in this nested structure , each major element 2 a , 5 a or 8 in a given tier and of a certain type reports to and is controlled by a lower - level element 51 , 8 or 12 respectively , which is of that same certain type — but which controls a relatively large number ( i . e ., a plurality or preferably a multiplicity ) of like major elements 2 b , 5 b or 9 , respectively , in the given tier . more specifically the certain type of element is in the nature of a cache module 44 ( fig1 ). in preferred embodiments of my hierarchical system , however , that element type also performs the function of an interface 42 module for one or more elements in a higher tier . the hierarchical system of my present invention has important advantages , as compared with the unit error - controlling architecture introduced in section 2 above . these advantages particularly include very significant increases in practicality and effectiveness . it will be understood that just one single cache module 44 ( fig1 ) can serve for an entire chassis , but for best performance it would require interface 42 connections to virtually every chip and other device on the chassis . that in turn would call for many error - alert pins , and a potential excess of messages waiting for access to the error / corrections bus 34 . therefore a hierarchical structure is a more satisfactory solution . again , each board has its own cache cluster , and all of those report to a chassis - level cache group that watches for errors on all of the boards . the board cache group performs the role of the interface 12 for the entire board , and obeys commands received from the chassis cache cluster . as indicated above , the hierarchy can be extended further , based upon the same rationale . my novel hierarchical system is especially effective and advantageous if incorporated into a single “ system on chip ” or soc that itself includes several relatively large blocks — processors , memories , etc . that all fit on one package . therefore it makes sense to build in an error - controlling resilience support system for the soc . as it is built in , the overall arrangement has to be done during design — it cannot be retrofitted . every block now has an interface ( like interface 42 , fig1 ). the soc adds a cache cluster ( also designed as one soc block ) that serves as interface for the entire soc chip , and that communicates to the board - level cache group . the latter is most naturally a separate chip for the board . as a practical matter , error messages sent from the computing system to the hierarchical error - controlling system are of a sort that is very closely related to the kind of computing system in use , and its particular computing functions . likewise the corrective responses returned from the hierarchical error - control system to the computing system depend very specifically on the character and functions of the computing system . hence if the soc is intended to be generic , and to have many signal lines for connection to the computing system after manufacture of the soc , then preferably the soc includes a rom or prom section which can be filled ( or “ programmed ”, so to speak ) after manufacture of the rest of the soc . this arrangement customizes the soc to those computing functions and character — or in other words supplies the particular error messages and corrective responses required by the computing system . my new hierarchical system is suitable for future commercial processors as well as other commercial chips . they should accordingly be provided with an interface module . for present commercial chips , unfortunately no error - controlling resilience support system is available . a hierarchical overall architecture nevertheless can be made available by providing an interface module — or group of modules — as a separate chip . such a refined hierarchical error - control support system is highly resilient and provides — as further embodiments of my invention — major complexes of equipment , over a broad range of applications . these equipment complexes function based upon error - detection , - correction and - containment assemblies which are thereby made extremely dependable . these embodiments of my invention are advanced beyond any practical major equipment complexes of the present day . this is true because the computing functions of all such conventional major apparatus complexes are vulnerable to errors that are essentially undetectable , and therefore uncontrollable . such errors arise in catastrophic events ranging from natural disaster through simple malicious hacking to terrorist intervention . these forms of my invention are especially critical in cases where human lives depend on the continuous and correct operation of the incorporated computing system — with its in - turn incorporated , refined hierarchical resilience support system . thus one embodiment of the invention is a manned spacecraft 103 ( fig3 ) from earth 101 , on a long mission 102 such as exploration of the planet mars 104 . the craft 103 is a major apparatus or equipment complex . incorporated into the craft 103 of my invention is a computing system 105 which controls functioning of the craft , and which in turn includes ( or has associated ) a refined hierarchical error - controlling assembly 110 — according to my present invention — that protects the computing system 105 . another embodiment of the invention is the protected computing system 105 , with the associated or included hierarchical assembly 110 . yet another embodiment is the hierarchical assembly 110 itself . another embodiment of my invention is a human habitat 106 ( fig4 ) to be located on a planet 104 , e . g . mars , and including a computing system 107 , which in turn has associated or includes the hierarchical assembly 110 of my present invention . such a human habitat 106 is a major equipment or apparatus complex according to my invention . as will be understood , earthbound complexes such as skyscrapers , energy - generation facilities , and scientific research centers if protected by my novel hierarchical assembly 110 are likewise embodiments of my invention . still another embodiment of my invention is the included ( and protected ) computing system 107 that operates the habitat 106 or other major complex . yet another embodiment is the included or associated protective hierarchical assembly 110 . perhaps much simpler but also critical embodiments of my invention are vehicles such as an ocean liner 108 ( fig5 ) that incorporates a computing system 109 which controls the vehicle and is protected by the novel hierarchical assembly 110 of my present invention . likewise other embodiments are other kinds of vehicles for the transportation of humans on earth — such as automobiles , airplanes and railroad trains . further embodiments of my invention include the computing system 109 , as well as the hierarchical assembly 110 itself . at a smaller physical scale are other important types of hierarchical - assembly - protected apparatus including commodity computing systems such as a server or a desktop personal computer pc ( fig6 ). such a computer pc , which is an embodiment of my invention , includes or has associated a hierarchical assembly 110 . in certain of the appended apparatus claims , the term “ such ” is used ( instead of “ said ” or “ the ”) in the bodies of the claims , when reciting elements of the claimed invention , for referring back to features which are introduced in preamble as part of the context or environment of the claimed invention . the purpose of this convention is to aid in more distinctly and emphatically pointing out which features are elements of the claimed invention , and which are parts of its context — and thereby to more particularly claim the invention . the foregoing disclosures are intended to be merely exemplary , and not to control the scope of my invention — which is defined by the appended claims .	6
the present disclosure relates generally to consumer products and , in particular , to shaving systems . in one embodiment , the present disclosure features a consumer product system having a handle and a blade unit mounted on the handle . the blade unit comprises a housing that contains a plurality of blades , the edges of which are exposed on the bottom surface of the blade unit ( the surface that contacts the user &# 39 ; s skin during shaving ). the opposite surface , or top , of the housing includes a plurality of measurement elements which are configured to assist the user in obtaining a precise shave , as will be discussed further below . referring to fig1 , the handle 12 provides a manner in which the shaving system 10 can be manipulated and leverage can be applied to achieve desired shaving results . measurement elements 30 are positioned on the top surface of the blade unit 20 that is visible to the user during shaving , in a measured manner to allow the user to reference them while shaving . the measurement elements 30 provide a means for the user to more precisely gauge where to utilize the shaving system 10 when sculpting facial and body hair features , e . g . mustache , side burns , etc . for example , the measurement elements 30 , as well as the evenly spaced ruled lines 36 between the measurement elements ( fig1 a ), allow the user to easily determine whether opposite side burns or opposite sides of a mustache are even or whether one side or the other requires further trimming . as shown in fig1 , during shaving the user can use the measurement elements 30 to measure the width of a facial hair feature ( e . g ., a sideburn as shown ) and then compare that measurement to the width measured on the opposite side of the user &# 39 ; s face . referring to fig1 and 1a , in one embodiment the measurement elements 30 are etched on a strip 32 that is inserted in the top edge of the rear side of the housing of blade unit 20 . in this embodiment , the strip 32 may be metal or plastic . the measurement elements may be molded , etched , painted , or applied by any suitable technique . the measurement elements may be enhanced with color to allow for easy identification . the coloration of the measurement elements 30 could be accomplished by using a coating , e . g . pvd coating , plating , decoration , or another technique . referring to fig2 - 5 , in other embodiments , the measurement elements 30 can be integrally formed with the housing of the blade unit 20 . additionally , the measurement elements 30 can protrude from the top and / or right surface of the blade unit 20 . for example , the measurement elements 30 may be in the form of a raised rim surrounding a triangular measurement element aperture 31 ,. alternatively , the measurement elements 30 may be formed in a raised arrow or pointer shape that is defined by surrounding measurement element apertures 31 , as shown in fig6 - 9 . in addition , in an embodiment not shown in the figures the measurement elements may protrude from the right surface of the blade unit 20 , e . g ., out of the plane of the page , towards the viewer , when the blade unit is seen from the viewpoint shown in fig3 . the measurement elements 30 may have many other shapes , for example raised dots as shown in fig1 - 11 . in each of these embodiments , the ruled lines 36 can be formed integrally with the housing as raised or recessed hash marks disposed at regular intervals between the measurement elements . in any of the embodiments shown in fig2 - 10 , the measurement elements or measurement element apertures may be a different color than the housing . for example , in fig2 - 3 the raised rims of measurement element apertures 31 are colored , and in fig1 - 11 the raised dots 33 are colored , in each case to enhance identification of the measurement elements and make it easier for the user to see them . coloring can be accomplished by utilizing pad printing , a technique that is well known in the art , or by other methods such as pvd coating , over - molding or multi - material molding . referring to fig2 , 4 , 6 and 8 , in some embodiments a lubricating / conditioning element 32 is positioned along the trailing edge of the opposite ( skin contacting ) surface of the blade unit 20 and can be seen through the measurement element apertures 31 . ideally , the lubricating element 32 is colored in such a manner as to highlight the measurement element apertures 31 . additionally , as is well known in the shaving art , the lubricating element 32 , when exposed to water , provides a lubricant that is evenly distributed on the skin during shaving . referring to fig1 and 13 , the measurement elements 30 and ruled lines 36 can be positioned on various aspects of the handle 12 of the shaving device 10 , for example along a surface of the handle that is generally parallel to the long axis of the blade unit ( fig1 ), or along the length of the handle ( fig1 ) if a longer row of measurement elements is desired . the measurement elements 30 and ruled lines 36 can be printed , etched , engraved , integrally molded , applied as an adhesive graphic , or other means of attachment . as previously referenced , coloring can be utilized to highlight either or both the measurement elements 30 and the ruled lines 36 thereby uniquely distinguishing them from the other aspects of the handle 12 . in the embodiments shown in the figures , blade unit 20 is removable from handle 12 so that it can be replaced when the blades become dull from use . the handle 12 can be designed to interface with the blade unit 20 in such a manner that would enable easy removal and attachment . this could be accomplished in a number of manners , such as a mechanical locking mechanism , magnetic interaction , etc . for example , the blade unit 20 and handle 12 can interface in the manner discussed in u . s . ser . no . 61 / 651 , 732 , filed may 25 , 2012 , the full disclosure of which is incorporated herein by reference . the interface between the handle and blade unit may include an interface element , e . g ., interface element 14 ( fig2 ) which provides a pivoting attachment between the blade unit and handle . pivoting of the blade unit is about an axis that is generally parallel to the long axis of the blade unit and is generally positioned to allow the blade unit to follow the contours of a user &# 39 ; s skin during shaving . pivoting shaving systems include a mechanism to provide resistance during shaving and return the blade unit to a “ rest ” position when it is not in contact with the user &# 39 ; s skin . other , more basic embodiments , ( not shown ) feature a blade unit that is pivotable , but fixedly attached to the handle , or even integrally formed with the handle in a fixed position . such embodiments would be less expensive and disposable once the blades became dull from use . the handle 12 and the housing of blade unit 20 can be made of any suitable substantially rigid material including , for example , polyethylene terephthalate ( pet or pete ), high density ( hd ) pete , thermoplastic polymer , polypropylene , oriented polypropylene , polyurethane , polyvinyl chloride ( pvc ), polytetrafluoroethylene ( ptfe ), polyester , high - gloss polyester , metal , nylon polymer , antibacterial or antimicrobial materials , or any combination thereof . a number of embodiments have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the disclosure . for example , in other embodiments the measurement elements can be provided in a variety of colors or alternative shapes . additionally , although the measurement elements have been discussed as being raised , they could alternatively be recessed or combinations of raised and recessed features may be used .	1
fig1 is a side view of the apparatus of the instant invention . the apparatus employs a large volume settling tank 103 , a flow direction means 108 , an oil outlet means 105 , and a water outlet means 107 . ( an oil - water inlet pipe 122 is connected to the flow direction means and is not shown in fig1 ). the tank employed can be of a standard cone bottom design to facilitate settling of sediments contained in the fluids to be separated . fig1 also shows a tank fluid level 102 which indicates the oil level of the fluids in the tank . level 104 is the oil - water interface of the separated fluids in the tank . volume 106 is the water volume portion of the fluids in the tank . in the method of the instant invention an oil - water emulsion mixture is continually introduced into the tank through the flow direction means 108 so that the mixture enters the tank substantially tangential to the tank wall 120 . then , simultaneously with the introduction of additional fluid into the tank through the flow direction means , separated oil is continuously withdrawn through oil outlet means 105 and water is continuously withdrawn through the bottom - center located water outlet means 107 . in an alternate embodiment it is possible to introduce the fluid mixture into the tank substantially tangential to the tank wall through a plurality of flow direction means the tangential entry of the fluids creates a slow vortex - like flow pattern of fluid in the tank which interferes with adverse fluid channeling . the induced flow pattern establishes long circular - like flow paths in the tank which interfere with the direct channeling of the unseparated fluids from the mixture inlet to the water outlet . this in effect increases the reaction time of the fluid mixture in the settling tank . in addition , the desired gravity separation of oil and water in the settling tank requires a period of time . this required time period can be obtained by the induced slow vortex - like flow pattern thus allowing the desired gravitational separation . thus , this tangential entry of fluids into the tank , by avoiding fluid channeling and permitting the gravity separation to take place prevents formation plugging and the loss of saleable oil by subsequent reinjection of oil contained in the separated water and eliminates the need for additional separation treatment . the actual location of the flow direction means 108 can be at any height on the tank wall . it is preferable , however , that it is located so that it is approximately two - thirds to three - quarters of the distance between the top of the water outlet means 107 and the oil - water interface 104 . this interface level 104 is dictated in practice by the volume input of fluid to be separated , but is readily predicted . the height above the tank bottom of the water outlet 107 is dictated by the amount of sediment in the produced fluids . this sediment amount depends on the producing field , but , in general the top of the water outlet should be above the sediment level expected . the water outlet should also be located in approximately the center of the tank to ensure that the input emulsion while flowing in an induced vortex pattern will not prematurely reach the water outlet . the location of the oil outlet 105 depends on the height of the oil volume desired in the tank , and is located at the desired distance above the oil - water interface 106 . the oil outlet , however , is preferably located at least one foot below the top of the tank to prevent oil contamination of a well - known vapor recovery system which may be installed . fig2 shows a detail top view of the flow direction means 108 of the apparatus of the instant invention . through the use of this flow direction means , the oil - water emulsion mixture &# 39 ; s entry into the settling tank is substantially tangential to the tank wall 120 . fluid is shown entering an oil - water inlet means 122 . it then enters a diffuser means 124 for insuring the tangential to the tank wall entry of the fluids . the centerline 128 of the diffuser means , the centerline 126 of the oil water inlet means , the angle between the two center lines 130 and the angle between the two walls of diffuser means 124 are all indicated on fig2 . the angle 130 which the flow direction means 108 bends the flow of the introduced fluid is approximately 60 degrees to bring the flow tangential to the tank wall . the angle 132 between the inner walls of the diffuser means is approximately 15 degrees . fig3 shows a top view at a level below the oil outlet pipe 105 of the apparatus of the instant invention . the oil - water inlet 122 and the flow direction means 108 and indicated . the bottom - center located water outlet means 107 insures that water is withdrawn from the bottom center portion of the tank . fig4 shows a detailed drawing of the flow direction means 108 of the apparatus of the instant invention . the oil - water inlet means 122 runs through the tank wall 120 and is connected to a flow bending means 162 by a victaulic coupling clamp 158 ( victaulic is a trademark of victaulic company of america ). the parts of the flow direction means can also be connected by other suitable well - known connective methods such as threaded connections . the flow bending means 162 is a curved section of pipe wich bends the flow of the input fluids approximately 60 degrees and is connected by another victaulic clamp 158 to a flow straightening means 164 . the flow straightening means is then connected by victaulic clamp 158 to a diffuser means 124 for the actual entry of the fluids into the tank . the walls 180 of the diffuser means have an angle 157 between them of approximately 15 degrees . the flow diffuser means also contains a narrow throat 169 . the narrow throat is to improve the dynamic flow characteristics of the oil - water mixture through the diffuser means . the angle 159 between a centerline 171 of the diffuser means and the inner wall 180 of the diffuser is approximately 7 . 5 degrees . the flow straightening section 164 is to lessen the turbulence created by flow through the flow bending means 162 . it prevents the fluids &# 39 ; tendency to rotate in a circular manner as is customary after liquids are flowed through any type of curved pipe . this lessens the mixing effect caused by the forced flow through the curved pipe . the flow straightening section can be one of several well - known designs to eliminate the rotational flow tendency , and a preferred version utilizes lengths of smaller diameter pipe placed inside the larger pipe 160 of the flow straightening means . the length of the flow straightening section may be of any desired length , but it is preferred to make the length double that of the diameter of the input pipe 122 . the diameter of the flow straightening means is preferably the same as that of the input pipe 122 . the use of flow direction means as described also results in an overall reduction in the input fluid &# 39 ; s velocity . the actual reduction achieved is the ratio of the area of the diffuser means 124 outlet to the area of the oil - water input means 122 exit . it is preferable that this reduction be 3 : 1 , but other reductions will still permit the functioning of the instant invention . the purpose behind the velocity reduction is to lessen the mixing effects of the fluid entry into the tank but it is not believed necessary for the functioning of the method of the instant invention that any velocity reduction occurs . the materials used in the apparatus of the instant invention are well - known in the oil field fluid handling industry . it is important that the material be able to withstand a corrosive environment as the input fluids will contain brine and often h 2 s . suitable materials for use are stainless steels , plastics , and fiberglass . to decrease the cost of the apparatus of the instant invention , the diffuser means 124 is preferrably constructed of fiberglass with its inner wall 180 coated with gel - kote ( a trademark of the glidden - durkee div . of scm corp . ), a polyester resin coating , or other similar coatings such as an epoxy coating to give a smooth surface . the apparatus and method of the instant invention have been tested in several amoco production company oil field settling tanks . the apparatus has been installed in settling tanks of varying sizes from 1000 barrels up to 10 , 000 barrels . the size of the inlet pipe 122 has varied from 4 inches ( 10 . 16 centimeters ) up to 14 inches ( 35 . 56 centimeters ). the actual size of the tank 110 , inlet pipe 122 , the flow direction means 108 , the water outlet pipe 107 , and the oil outlet pipe 105 will depend on the quantity of production fluids that must be handled . tests of the apparatus and method of the instant invention were performed in a 6 , 000 barrel standard a . p . i . cone bottom tank with total throughput of 10 , 500 barrels of fluid per day and an input line diameter 122 of 10 inches ( 25 . 4 centimeters ). the tank has a diameter of 38 feet and 8 inches ( 11 . 78 meters ), and a height of 30 feet ( 9 . 14 meters ) above ground level . the oil - water inlet 122 is located 20 feet ( 6 . 1 meters ) above the ground level and the water outlet 107 extends 4 feet ( 1 . 22 meters ) above ground level . the oil outlet 105 is 2 feet ( 0 . 61 meters ) down from the top of the tank and has a diameter of 10 inches ( 25 . 4 centimeters ). the flow straightening section 164 was built by cei plastics of odessa , tx and is 20 inches ( 0 . 51 meters ) long . the diffuser means 124 was built as depicted in fig4 and is made from fiberglass . it is coated on the inside with gel - kote to give a smooth surface . the overall length of the diffuser is 45 . 5 inches ( 1 . 16 meters ). the throat 169 width is 7 . 18 inches ( 18 . 2 centimeters ) and the inside diameter of the input section of the diffuser is 10 . 15 inches ( 25 . 78 centimeters ) the inside diameter of the end of the diffuser is 17 . 58 inches ( 0 . 45 meters ) resulting in an overall velocity reduction of approximately 3 : 1 . the angles 157 and 159 are approximately 15 and 7 . 5 degrees , respectively . the flow bending means 162 is a standard 10 inch ( 25 . 4 centimeters ) pipe with a 60 degree bend in it . the apparatus was tested by using a radioactive tracer of iodine - 131 and then monitoring the separated water for iodine - 131 concentration . it was found that the actual retention time of this holding tank equipped with the apparatus and employing the method of the instant invention was 4 hours and 52 minutes . the test results are plotted in fig5 . the shape of the breakthrough curve ( fig5 ) also shows that the tracer breakthrough was quite steep . this indicates that channeling of the tracer directly from the inlet to the outlet was eliminated , as there was no increase in the tracer concentration at the outlet until 4 hours and 52 minutes after injecting the tracer . no input fluid velocity measurements were made during the tests . the method and apparatus of the instant invention were also tested in laboratory scale bench tests . the tests performed were to determine the input fluid velocity required to allow the tangential entry method and apparatus to work . in all tests the model tank was allowed to operate for a minimum seven hours to stabilize the flow patterns before velocity measurements were taken . the apparatus tested was as depicted in fig4 with a fluid velocity reduction ratio of 3 : 1 . the input fluids contained a water soluble dye to annouce the arrival of input fluids at the tank exit . the model tank had a radius of 15 inches ( 38 . 1 centimeters ) and a height of 24 inches ( 0 . 61 meters ). velocity measurements were taken 12 inches ( 30 . 48 centimeters ) from the center of the tank . these tests revealed that any fluid velocity as measured at the end of the oil - water inlet pipe 122 above 3 . 3 in / sec ( 8 . 38 cm / sec ) resulted in satisfactory functioning i . e ., elimination of fluid channeling , of the method and apparatus . this indicates that for an apparatus employing the tangential fluid entry technique it is preferable that the fluid input be above this velocity . however , these model velocities have not been confirmed in field side apparatus tests . it is thus possible that in a full size installation , a lower velocity rate will allow the method to function satisfactorily . it should be noted that the scope of the apparatus and method disclosed herein should be determined by the specification but rather its scope is determined by the extent of the appended claims .	1
referring first in detail to fig1 a motorcycle having an exhaust system constructed in accordance with an embodiment of the invention is identified generally by the reference numeral 21 . it is to be understood that a motorcycle is only a typical environment in which the invention may be employed and that the invention has utility in a wide variety of engine applications . however , the invention has particularly utility in connection with a motorcycle since such vehicles are extremely compact and readily illustrate the way in which the invention is adapted to such compact vehicles . because the motorcycle 21 is depicted for illustrative purposes only , its major components have been shown in phantom and will be described only generally . the motorcycle 21 includes a frame assembly 22 that mounts a fuel tank 23 and seat 24 . a handlebar assembly 25 is journaled at the front part of the frame assembly 22 for steering a front wheel 26 that is supported in any known manner . in addition , the frame assembly 22 supports a rear wheel 27 for suspension movement in any known manner . an internal combustion engine , indicated generally by the reference numeral 28 , is supported within the frame assembly 22 beneath the fuel tank 23 . the engine 28 includes a cylinder block assembly 29 and a combined crankcase transmission assembly 31 . the crankcase transmission assembly 31 affords a means for driving the rear wheel 27 , as by means of a driving chain 32 . the engine 28 is provided with an exhaust system , indicated generally by the reference numeral 33 and which embodies the invention . the exhaust system 33 may comprise either the exhaust system shown in the embodiments of fig2 through 4 , the exhaust system of fig6 through 11 , the exhaust system of fig1 , or the exhaust system of fig1 and 14 . in fig1 the exhaust system of fig2 through 5 is specifically illustrated . referring now to those figures ( 2 through 5 ), the engine 28 has its cylinder block 29 formed with four cylinder bores that are aligned transversely relative to the motorcycle 21 . it is to be understood that the invention may be employed in connection with engines of other cylinder number of configurations . however , the invention has particularly utility with engines that have at least two cylinders . because of its transverse disposition , the cylinder block 29 has four forwardly facing exhaust ports ( not shown ). inlet flanges 34 , 35 , 36 and 37 of respective exhaust pipes 38 , 39 , 41 and 42 cooperate with these exhaust ports for receiving the exhaust gases and carrying them downwardly and rearwardly . the exhaust pipes 38 and 39 and 41 and 42 are paired for tuning purposes and merge into respective collector sections 43 and 44 which also serve as expansion chambers . a reflective control valve arrangement , indicated generally by the reference numeral 45 , is interposed between the exhaust pipes 38 , 39 , 41 and 42 and the expansion chambers 43 and 44 for a purpose to be described . tail pipes 46 and 47 extend rearwardly from the expansion chambers 43 and 44 and deliver the exhaust gases to a pair of mufflers 48 and 49 that lie on opposite sides of the rear wheel 27 for discharge of the exhaust gases to the atmosphere . the tail pipes 46 and 47 are interconnected by a crossover pipe 50 . it should be noted that the exhaust pipes 39 and 41 lie at a slightly lower level than the exhaust pipes 38 and 42 so as to clear the transmission crankcase assembly 31 and to afford a compact nature . this arrangement also permits the rider to lean the motorcycle 21 through a greater bank angle than if the pipes 39 and 42 were at this lower position . this is significant in connection with the construction of the valve assembly 45 which will now be described by primary reference to fig4 and 5 . the valve assembly 45 includes a first valve body 51 that has a pair of exhaust passages 52 and 53 that extend horizontally and which are aligned with and connected to the trailing ends of the exhaust pipes 39 and 41 , respectively . a pair of reflective valve members 54 and 55 are supported within the passages 52 and 53 , respectively , and are affixed to a common valve shaft 56 that is journaled within the valve body 51 and which extends outwardly beyond its side edges . the valve elements 54 and 55 are of a butterfly type and it will be noted that in their fully closed position as shown in fig5 that they do not fully close off the exhaust passages 52 and 53 . they occupy , in an embodiment , approximately 50 % of the effective cross sectional area in this position . however , it is to be understood that the specific ratio may be varied depending upon engine parameters and in accordance with the principles set forth in aforenoted copending application ser . nos . 935 , 340 and 935 , 342 . a second valve body 57 lies on one side of the valve body 51 and is disposed slightly higher than it . the valve body 57 forms an exhaust gas passage 58 which is aligned with and coupled to the trailing end of the exhaust pipe 38 so as to receive exhaust gases from it . a reflective valve member 59 is rotatably supported in the exhaust passage 58 on the shaft 61 which extends through both sides of the valve body 57 , for a purpose to be described . in a similar manner , a third valve body 62 lies on the other side of the first valve body 51 and defines an exhaust passage 63 that is aligned with the connected to the tailing end of the exhaust pipe 42 so as to receive exhaust gases from it . it should be noted that the valve bodies 57 and 62 lie on substantially the same horizontal plane and that the axes of the exhaust passages 52 and 58 and 53 and 63 are aligned with each other and describe a v angle b - b due to the placement of the exhaust pipes . this places the valve in a protected location and permits a greater bank or leaning angle for the rider when maneuvering , as already noted . a reflective valve element 64 of the butterfly type is rotatably journaled in the valve housing 62 by means of a shaft 65 . the shaft 65 only extends through one end of the valve body 62 , this being the end adjacent to the valve body 51 . an arrangement is provided for rotating the valve members 59 , 54 , 55 and 64 simultaneously between a fully closed position wherein they present the maximum reflective area , as shown in fig4 and 5 , and a fully opoened position wherein they present the minimum reflective area . this mechanism includes a control that is responsive to an engine running condition , such as engine speed , and which is shown schematically in fig2 . this includes an engine speed sensor 66 that outputs a speed signal to a control device 67 . the control device 67 , in turn , positions an actuator such an electric motor 68 or the like which is coupled by means of a flexible cable 69 to a pulley 71 that is affixed to the extending end of the shaft 61 of the valve 59 . the actual timing or operating sequence for the valve 59 , as has been noted , depends upon a variety of factors and the logic may be understood by reference to aforenoted copending application ser . nos . 935 , 340 and 935 , 342 . the valve shaft 61 is coupled to the valve shaft 56 and the valve shaft 56 is coupled to the valve shaft 65 by respective motion transmitting mechanisms , indicated generally by the reference numeral 72 . each motion transmitting mechanism 72 includes a first lever 73 that is affixed to the respective shaft 61 or 65 and a second lever 74 that is affixed to the respective end of the shaft 56 . the levers 73 and 74 are coupled for simultaneous rotation by means of a link 75 that is pivotally connected at its opposite ends to the levers 73 and 74 . as a result of this interconnection , rotation of the shaft 61 will be accompanied by simultaneous rotation of the shaft 56 and shaft 65 so that the valve elements 54 , 55 , 59 and 64 will all operate in unison . it should also be noted that the valve bodies 57 and 62 are positioned slightly aft or rearwardly of the valve body 51 so that the valves 59 and 64 may be positioned slightly rearwardly of the valve elements 54 and 55 and so that all of the valve elements may be positioned at the appropriate axial location along the length of their respective pipes . in this way , maximum effect can be obtained for the valve system . also , it should be noted that the arrangement is such that no one long valve shaft is employed so that the likelihood of binding due to thermal expansion will be substantially minimized if not totally eliminated . in the embodiment of fig2 through 5 , the valve assembly 45 consists of three separate valve bodies . fig6 through 11 show another embodiment of the invention which differs from the embodiment of fig2 through 5 in the construction of the control valve , which is indicated generally by the reference numeral 101 . in all substantial regards , except for the relative locations of the exhaust pipes 38 , 39 , 41 and 42 where they merge into the valve assembly 101 and of the shape of the expansion chambers 43 and 44 , the construction of the exhaust system is the same as the previously described embodiment and , for that reason , components which are substantially the same or the same as those of the previously described embodiment have been identified by the same reference numerals and will be described again only in detail in this embodiment as is necessary to understand the embodiment . referring primarily to fig8 through 11 , the control valve assembly 101 includes a valve body 102 in which horizontally extending parallel exhaust passages 103 , 104 , 105 and 106 are formed . because these passages 103 through 106 are all horizontally disposed and have their axes lying in the same plane , it is necessary for the corresponding mating ends of the exhaust pipes 38 , 39 , 41 and 42 to be also so disposed at their point of attachment to the valve body 102 . reflective control valve elements 107 , 108 , 109 and 111 are positioned within the exhaust passages 103 through 106 , respectively . the valve elements 107 , 108 , 109 and 111 are of the butterfly type but unlike prior art constructions are not all affixed to a common valve shaft that is horizontally disposed . rather , each of the valves is affixed to a respective vertically extending valve shaft 112 , 113 , 114 and 115 each of which is journaled in the valve body 102 for rotation about parallel vertically extending axes . each of the shafts 112 , 113 , and 114 has affixed to it a respective lever 116 . the levers 116 are all interconnected for simultaneous rotation of their associated shaft by means of a common link 117 . the link 117 is disposed externally of the valve body 102 and hence will not be heated and subject to thermal expansion to any significant effect . as with the previously described embodiment , the shaft 112 is directly operated by the control device by means including a flexible transmitter 69 and pulley 71 . fig1 shows another embodiment of control valve , indicated generally by the reference numeral 151 . this embodiment is substantially the same as the embodiment of fig7 through 11 and for that reason only an end elevational view is shown . in this embodiment , like the previously described embodiment , includes a single valve housing 152 in which passages 153 , 154 , 155 and 156 are formed . unlike the previously described embodiment of fig7 through 11 , however , the passages 153 and 156 lie on a horizontal plane that is vertically above those of the passages 154 and 155 . hence , the passages 153 and 154 and 155 and 156 define a v shape configuration similar to the embodiment of fig2 through 5 and thus presents greater clearance for leaning when turning . however , in this embodiment , the passages 153 through 156 are all axially aligned . butterfly type throttle valves 157 , 158 , 159 and 161 are supported in the passages 153 through 156 , respectively , on individual vertically extending shafts 162 , 163 , 164 and 165 , respectively . the shafts 162 through 165 are all interconnected at their upper ends by means of a linkage system of the type shown in fig8 and 9 and thus this system will not be described again in detail . in the embodiments of the invention thus far described , the individual shafts of the valve elements were connected to each other by means of a linkage system . fig1 and 14 show a valve construction , indicated generally by the reference numeral 201 , which is generally similar to the previously described embodiments but wherein at least certain of the shafts of the valve elements are connected by a system other than a linkage system . in this embodiment , like the previously described embodiments , those elements which are common with the other embodiments have been identified by the same reference numerals and will not be described again . in this embodiment , the valve mechanism 41 is comprised of a pair of valve bodies 202 and 203 that are disposed at an angular relation to each other and wherein they are axially aligned . as with the embodiments of fig2 through 5 and 12 , this configuration permits greater leaning for maneuvering . the valve body 202 is formed with a lower exhaust gas passage 204 and an upper exhaust gas passage 205 which passages are parallel to each other . in a similar manner , the body 203 is provided with a lower exhaust gas passge 206 and an upper exhaust gas passage 207 . the passages 206 and 207 extend horizontally and are parallel to each other and also parallel to the passages 204 and 205 of the body 202 . individual butterfly type throttle valves 208 , 209 , 211 and 212 are journaled in the passages 204 , 205 , 206 and 207 , respectively . the valves 208 and 209 are supported on a common valve shaft 213 that is journaled in the body 202 while the valve elements 211 and 212 are affixed to a valve shaft 214 that is journaled within the valve body 203 . the shafts 213 and 214 are at an angle to each other and their inner ends are drivingly connected by means of a pair of intermeshing bevel gears 215 so that all of the valve elements will be operated in unison . it should be readily apparent from the foregoing description that a number of embodiments of exhaust control valves have been illustrated each of which permits an effective operation without detrimental effects due to thermal expansion while at the same time maintaining an effective and simple operation . in addition , the construction is such that the valves may all be controlled simultaneously and there is latitude permitted in the configuration of the associated exhaust pipes . although a number of embodiemnts of the invention have been illustrated and described , various changes and modifications may be made without departing from the spirit and scope of the invention , as defined by the appended claims .	5
the present invention is based on the automated composition of a raw media stream from multi media or plain still image material recorded by individuals or observation cameras , such as web cams . a typical composition method according to the present invention involves collecting media items offered in a category selected by the recording individual in a sequence according to recording time . the raw media stream is edited or refined according to actions of those individuals who view the material . a typical editing method according to the present invention involves a system that obtains information concerning the viewing actions of individual viewers . when an image or stream is displayed that is of a particular interest to an individual , the individual users can browse the multimedia stream in many ways . the viewing actions that are involved in the editing process can comprise typical implicit editing methods , and the outcome is based upon an analysis of the actions by those individuals who view the material . actions that can be used in the collaborative editing process include , but are not limited to , the use of an “ accelerated playback ” mode , viewing the stream at a normal playback speed , repeatedly viewing the same portion of content , adjusting the volume , bass , balance , fade , treble or other audio - related aspects of the content , zooming within the multimedia content , panning within the multimedia content , or viewing the content in slow motion . as used herein , “ panning ” refers to , if a picture ratio in a video is wider than a device &# 39 ; s display , adjusting the positioning of the video so that a selected portion of the video remains viewable by the user . all of the above actions can be considered as indications of interest to that portion of the media stream . information concerning all of these actions can be consolidated with a conventional data mining technique or similar method in order to refine the appears appearance of the media stream for subsequent users and / or viewers . fig4 is a representation showing a collaborative media stream editing process according to one embodiment of the present invention . as shown in fig4 , a recording device 100 is used to capture an image or a video stream , referred to herein generically as content 110 , and transmit the content 110 to a processing server 120 . the recording device 100 can take a variety of forms , including , but not limited to , a digital movie recorder , a conventional movie recorder , a digital camera , and a mobile telephone with built - in camera capabilities . the processing server 120 transmits the content 110 to at least one playback device 130 . the playback device 130 can also take a wide variety of forms , including virtually any device that includes some form of display unit . the playback device 130 can include either a built - in or an otherwise associated controller 140 that enables the viewer to manipulate the media stream . the controller 140 can include items such as a joystick , keyboard keys , touch pads , a touch - sensitive display , or a variety of other features that allow the viewer to manipulate the content 110 . in one embodiment of the invention , a mobile telephone serves as the controller 140 . the system depicted in fig4 also includes a voting engine 150 . the voting engine 150 is used to collect information concerning the activities of each individual viewer . the voting engine 150 keeps track of how many viewers perform particular actions around individual content segments , including whether viewers fast forward past a segment , whether a viewer watches a segment multiple times , etc . the voting engine 150 is incorporated into the processing server 120 in one embodiment of the invention . the voting engine 150 can also be a stand - alone device . in addition , the voting engine 150 can also be incorporated into the recording device 100 , into one or more playback devices 130 , or into one or more controllers 140 . in one embodiment of the invention , several individuals simultaneously view the media stream in a broadcast mode using respective playback devices 130 . the playback devices 130 can each include their own controller 140 or other mechanism , or a single playback device 130 can be connected to multiple controllers 140 , where individuals can view and control the content 120 through one of the controllers . each user or viewer can use a controller 140 to generate viewer actions . the viewer actions are processed by the voting engine 150 . this information can be used by the voting engine 150 to generate an altered or edited appearance of the media stream and to control the playback of the media stream . editing actions that can be implemented by a playback device 130 in order to alter the appearance of the content include , but are not limited to : adjusting the time to keep a still image on the display , selecting the part of a video clip to be exhibited at a slower speed , selecting a still image or frame to be shown from a video clip when browsing a video stream , adjusting the volume , bass , treble , balance , fade or other audio - related aspects of a content portion , zooming within the multimedia content , panning within the multimedia content , and skipping a portion of a video stream . editing actions , such as those discussed above , result in the generation of a modified appearance for the media stream for future viewing . for example , in the event that several viewers “ rewind ” a portion of a video stream in order to watch the portion more than one time , it may be determined that that particular portion should be given more prominence when exhibited to future users . as a result , the media processing server 120 may adjust the media stream for future users so that the particular portion is shown in slow motion . conversely , portions which are skipped over by users could be deemphasized for future viewers . other possibilities include the showing of a more detailed view of the content portion , an accelerated rate of exhibiting the piece of content , or other actions . in any event , the end result of this collaborative editing process is the subsequent display of the content in a modified fashion that is likely to be of more interest to the user than the content in an unmodified form . it should be noted that the media stream can include not only video and / or still images but also other media forms such as audio . in such situations , the different portions can edited independent from each other in one embodiment of the invention . for example , an audio portion of a media stream can be independently edited without editing the video or image portion of the content . in one particular implementation of the present invention , a basic mobile telephone with a built - in camera is used as a recording device 100 , which is used to post content 110 to a selected raw media channel . the media processing server 120 receives posts to the raw media channel and creates online and browsing media streams according to the actions of the individual viewers . a playback device , such as a multimedia playback - capable telephone or personal computer , is able to receive and play the stream . according to this embodiment of the invention , a number of the playback devices need to have the ability to obtain information regarding the viewer actions and to communicate information about the actions to the media processing server 120 . some playback devices may be able to react to viewer actions locally while , at the same time , consuming a media stream received from the media processing server 120 . fig5 is a flow chart showing the implementation of one embodiment of the present invention . at 200 , a recording device 100 records content 110 from a source . in a particular embodiment of the invention , this can be in the form of live - action recording of video , although it is also possible that the content 110 can take the form of a series of still images , or the content 110 can take other forms . at step 210 , the content 110 is transmitted to the media processing server 120 . it should be noted that the content 110 can be transmitted in real time to the media processing server 120 , or the content 110 can be stored in the recording device 110 and transmitted at a later time to the media processing server . at step 220 , the content 110 is transmitted to at least one playback device 130 . at step 230 , the content 110 is viewed by at least one user . at step 240 , each user uses his or her controller 140 to view the content 110 in a specific way , e . g ., by fast - forwarding through portions , playing portions in slow motion , etc . at step 250 , information concerning how the content 110 is viewed is transmitted to the voting engine 150 , which collects this information from each user that views the content 110 . at step 260 , the voting engine uses the information to generate modified content , which is transmitted to subsequent viewers at step 270 . the generation of modified content can occur according to predefined criteria . “ predefined criteria ” can be both relative and absolute and can be based upon the number of viewers of content , the number of consecutive viewers performing the same action , the frequency of performing a particular action by viewers or a wide variety of other suitable measures . for example , the predefined criteria can state that , if more than a certain percentage of viewers fast - forward through a particular segment , then the modified content should exhibit that portion of the content at an accelerated rate in the future . the content 110 then continues to be viewed and modified over time . the generation of modified content can occur through the use of an engine having an artificial intelligence . in this situation , the objective of the artificial intelligence is to generate content which would match the needs and tastes of an average consumer , or content which would match the needs of a “ key user ” of a specific target group . according to one embodiment of the invention , a particular playback device 130 may access the content 110 with an indication to view the content 110 only when it has been altered and edited such that the content has obtained a desired level of “ maturity ” quality . fig1 shows a system 10 in which the present invention can be utilized , comprising multiple communication devices that can communicate through a network . the system 10 may comprise any combination of wired or wireless networks including , but not limited to , a mobile telephone network , a wireless local area network ( lan ), a bluetooth personal area network , an ethernet lan , a token ring lan , a wide area network , the internet , etc . the system 10 may include both wired and wireless communication devices . for exemplification , the system 10 shown in fig1 includes a mobile telephone network 11 and the internet 28 . connectivity to the internet 28 may include , but is not limited to , long range wireless connections , short range wireless connections , and various wired connections including , but not limited to , telephone lines , cable lines , power lines , and the like . the exemplary communication devices of the system 10 may include , but are not limited to , a mobile telephone 12 , a combination pda and mobile telephone 14 , a pda 16 , an integrated messaging device ( imd ) 18 , a desktop computer 20 , and a notebook computer 22 . the communication devices may be stationary or mobile as when carried by an individual who is moving . the communication devices may also be located in a mode of transportation including , but not limited to , an automobile , a truck , a taxi , a bus , a boat , an airplane , a bicycle , a motorcycle , etc . some or all of the communication devices may send and receive calls and messages and communicate with service providers through a wireless connection 25 to a base station 24 . the base station 24 may be connected to a network server 26 that allows communication between the mobile telephone network 11 and the internet 28 . the system 10 may include additional communication devices and communication devices of different types . the communication devices may communicate using various transmission technologies including , but not limited to , code division multiple access ( cdma ), global system for mobile communications ( gsm ), universal mobile telecommunications system ( umts ), time division multiple access ( tdma ), frequency division multiple access ( fdma ), transmission control protocol / internet protocol ( tcp / ip ), short messaging service ( sms ), multimedia messaging service ( mms ), e - mail , instant messaging service ( ims ), bluetooth , ieee 802 . 11 , etc . a communication device may communicate using various media including , but not limited to , radio , infrared , laser , cable connection , and the like . fig2 and 3 show one representative mobile telephone 12 within which the present invention may be implemented . it should be understood , however , that the present invention is not intended to be limited to one particular type of mobile telephone 12 or other electronic device . the mobile telephone 12 of fig2 and 3 includes a housing 30 , a display 32 in the form of a liquid crystal display , a keypad 34 , a microphone 36 , an ear - piece 38 , a battery 40 , an infrared port 42 , an antenna 44 , a smart card 46 in the form of a uicc according to one embodiment of the invention , a card reader 48 , radio interface circuitry 52 , codec circuitry 54 , a controller 56 and a memory 58 . individual circuits and elements are all of a type well known in the art , for example in the nokia range of mobile telephones . the present invention is described in the general context of method steps , which may be implemented in one embodiment by a program product including computer - executable instructions , such as program code , executed by computers in networked environments . generally , program modules include routines , programs , objects , components , data structures , etc . that perform particular tasks or implement particular abstract data types . computer - executable instructions , associated data structures , and program modules represent examples of program code for executing steps of the methods disclosed herein . the particular sequence of such executable instructions or associated data structures represents examples of corresponding acts for implementing the functions described in such steps . software and web implementations of the present invention could be accomplished with standard programming techniques with rule based logic and other logic to accomplish the various database searching steps , correlation steps , comparison steps and decision steps . it should also be noted that the words “ component ” and “ module ” as used herein , and in the claims , is intended to encompass implementations using one or more lines of software code , and / or hardware implementations , and / or equipment for receiving manual inputs . the foregoing description of embodiments of the present invention have been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the present invention to the precise form disclosed , and modifications and variations are possible in light of the above teachings or may be acquired from practice of the present invention . the embodiments were chosen and described in order to explain the principles of the present invention and its practical application to enable one skilled in the art to utilize the present invention in various embodiments and with various modifications as are suited to the particular use contemplated .	7
an embodiment of the present invention is a process for preparing a compound having the formula ## str1 ## wherein r is an aryl group which comprises reacting a compound having the formula ## str2 ## with ( a ) sf 4 and ( b ) bf 3 or alcl 3 , in liquid hf at temperatures ranging from about - 80 ° c . to about 20 ° c . r is an aryl group exemplified by ## str3 ## preferred r groups are ## str4 ## the compounds of formula i and ii have a chiral center and may occur in optically active forms i . e ., as optical isomers . these isomers are designated conventionally by the symbols l and d , - and +, l and d , s and r and combinations thereof . where the compound name or formula has no isomer designation , the name of formula includes the individual isomers , mixtures thereof and racemates . the present process is preferably carried out at atmospheric pressure although pressures above atmospheric may be used . the reaction temperature ranges from about - 80 ° c . to about 20 °, - 80 ° c . to 0 ° c . being preferred . the present process may conveniently be carried out by introducing the sf 4 and bf 3 or alcl 3 into the formula ii / hf reaction system initially . the process may also be carried out by first adding the sf 4 to the reaction system , allowing the reaction to proceed for a period of time and then adding the bf 3 or alcl 3 and allowing the reaction to go to completion . the use of bf 3 or alcl 3 in the sf 4 / hf reaction system substantially improves the yield of formula i product . the formula i products have decarboxylase inhibiting activity and are useful as diagnostic tools to determine the presence and importance of the corresponding decarboxylase in relation to diseases as to functioning of biological systems . the products may also have chemotherapeutic utility which is a consequence of their decarboxylase inhibiting activity . for example , α - fluoromethylhistidine inhibits the biosynthesis of histamine from histidine and thus may be useful in preventing gastric lesions or in treating allergic conditions . α - fluoromethyl - 3 - hydroxytyrosine and α - fluoromethyl tyrosine also exhibit antihypertensive activity when administered to spontaneously hypertensive ( sh ) rats ; the compounds are thus indicated to be useful for treating hypertension in humans . the following examples illustrate the process of the present invention . all temperatures are in ° centigrade . melting points are determined in open capillary and are uncorrected . 50 g of 3 -[ 3 &# 39 ;, 4 &# 39 ;- diacetoxyphenyl ]- 2 - acetamino - 2 - acetoxymethyl - propionic acid is added into 204 ml of 4 m aqueous koh with stirring . after 1 hour of stirring ( under nitrogen ), the solution contains potassium salt of 3 ( 3 &# 39 ;, 4 &# 39 ;- dihydroxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic acid , formed in essentially quantitative yield . without isolation , by methylation with dimethyl sulfate , this compound is transformed into 3 -( 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic acid . this operation is performed at room temperature under n 2 gas by dropwise addition with vigorous stirring of dimethyl sulfate ( about 64 ml ) and 4 m aqueous koh solution ( about 148 ml ) over a period of about 1 hour . the reaction mixture was stirred for another hour , then left standing overnight . acidification ( at 5 °- 10 ° c . with 55 ml of conc . aqueous hcl ), extraction with ethyl acetate ( 12 × 300 ml ), drying over na 2 so 4 and evaporation in vacuo gave r , s - 3 ( 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - proionic acid . it was purified by recrystallization from 1325 ml of acetonitrile , m . p . 154 °- 6 ° c . ( dec ). twenty - nine and 1 / 10 g of strychnine was suspended in 1 . 12 l of ethanol 2ba , heated to reflux , then 26 . 1 g of r , s - 3 ) 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic acid was added . the solution thus obtained was allowed to cool down and left standing overnight at room temperature . crystals of the strychnine salt of antimer , &# 34 ; a &# 34 ; separate ; m . p . 193 °- 194 ° c . (&# 34 ; hm &# 34 ;). the mother - liquor of the above named precipitation was evaporated in vacuo to dryness and recrystallized from 270 ml of ethanol 2ba ; the hot solution is allowed to cool to room temperature and left standing at room temperature for ˜ 3 hours , then kept in the refrigerator for ˜ 4 hours . the crystals formed were collected on a filter and after drying , recrystallized from acetonitrile to give strychnine salt of antimer &# 34 ; b &# 34 ; of 3 -( 3 &# 39 ; 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic acid m . p . 130 °- 132 ° c . ( dec .). yield 17 . 5 g . seventeen g of this strychnine salt was decomposed by dissolving it first in 160 ml of water ; 31 ml of 1 m aq . naoh solution was added . the strychnine separated was removed by filtration and the solution evaporated to small volume in vacuo and applied onto a small ion exchange resin column ( 150 ml of ag - x 2 cation exchange dowex 50 resin , 200 / 400 mesh ). elution with water , followed by evaporation in vacuo of the fractions which showed absorption , as indicated by an lkb uv absorption monitor ( uvicord ii - 8300 ). this compound , antimer &# 34 ; b &# 34 ; of 3 -( 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic - acid showed [ α ] d : 78 . 3 + 0 . 5 ° ( c , 1 . 425 in 0 . 1 m aq . naoh ). transformation of the above compound into the corresponding stereo - isomer of α - hydroxymethyl - 3 - hydroxytyrosine : four and 43 / 100 g of antimer &# 34 ; b &# 34 ; of 3 -( 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethylpropionic acid is dissolved in 100 ml conc . hcl and sealed and heated for 90 minutes in a fisher - porter tube immersed into an oil bath of 130 ° c . the solvent was eavporated in vacuo and the above hcl treatment repeated . the residue thus obtained represents r - α - hydroxymethyl - 3 - hydroxy tyrosine hydrochloride . 8 g of r - α - hydroxymethyl - 3 - hydroxytyrosine . hcl is charged to a 1 l . reactor . the reactor is immersed into a dry - ice acetone bath and 80 ml of liquid hf is condensed on top of the substrate . to remove the hcl present , the cooling - bath is removed and the hf solvent removed by passing in a stream of n 2 gas . the reactor is immersed into the cooling bath again a stream of hf gas is passed in until a liquid volume of ˜ 250 ml collects . 6 . 2 ml of sf 4 ( 17 . 6 mmol / ml : ˜ 109 mmol ) is then bubbled in , the solution aged for 1 hour , the cooling bath exchanged for an ethylene - glycol bath kept at - 16 ° c . and the solution aged for ˜ 22 hours . boron trifluoride gas is passed in until saturation and the solution aged again at - 16 ° c . for 46 hours . the cooling bath is removed and the solvent evaporated by passing through it a vagorous steam of n 2 gas . the residue is quenched in ˜ 100 ml of ice - cold aqueous hcl ( 2 . 5 m ), evaporated in vacuo , the residue dissolved in water and added onto a column of cation - exchange resin . 2 . 2 l of ag - 50 - x - 8 resin ( 200 / 400 mesh ) was employed . elution with 0 . 25 m aq . hcl , containing 5 % methanol ; in ˜ 8 . 5 hours , 7 . 2 l of this solvent is pumped through the column . this is followed by 7 . 2 l of 0 . 4 m aq . hcl with 7 . 5 % methanol in 8 . 5 hours , then concluding with 0 . 6 m aq . hcl with 10 % methanol . 22 ml fractions are collected , 10 tubes per rack . tubes in racks nos . 45 - 66 contained the desired compound . evaporation in vacuo gave hcl salt of s isomer of α - fluoromethyl - 3 - hydroxytyrosine . for liberation of the free amino acid , 4 . 826 g of this compound was dissolved in 90 ml of isopropanol , filtered through celite . 6 . 2 ml of propylene oxide was added to the filtrate and the suspension kept at room temperature for 3 . 5 hours , then at ˜ 5 ° c . for another 2 . 5 hours . the s α - fluoromethyl - 2 - hydroxy - tyrosine thus formed was collected by filtration , washed with isopropanol and dried overnight in vacuo at 76 °. [ α ] d : + 9 . 3 °± 0 . 5 , c , 1 . 82 in 1 : 1 mixture of trifluoroacetic acid and water . for preparation of the above named compound the strychnine salt of the antimer of 3 ( 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic acid ( example 1 &# 34 ; hm &# 34 ;) was carried through steps analogous to those in example 1 . the final product of the sequential steps was r - α - fluoromethyl - 3 - hydroxy - tyrosine , with [ α ] d : - 9 ° ( c , 2 . 5 in a 1 : 1 mixture of h 2 o - trifluoroacetic acid ). one and 5 / 100 g ( 0 . 005 mol ) of r , s - α - hydroxymethyl - tyrosine is charged into a reactor . the reactor is immersed into a dry - ice - acetone bath and ˜ 50 ml of liquid hf is collected by passing in a stream of hf gas . under continuing cooling , sf 4 gas ( 4 ml , measured in liquid state at - 78 ° c .) is passed in , then bf 3 gas until saturation at - 78 ° c . ( stirring with magnetic stirrer ). the deep - red solution thus obtained is aged overnight at - 78 ° c . ; the cooling bath is removed then , and the solvent evaporated to dryness in vacuo . the residue is dissolved in water and applied to a strong acid cation - exchange resin column , prepared with 100 ml of ag50 - x - 8 resin ( 200 / 400 mesh ). the column is first washed with water ( 1 . 8 l ), followed by 0 . 5 m aq . hcl . 20 ml fractions of the effluent are collected and the course of the elution is followed by uv monitor of lkb , model uvicord ii . the fractions corresponding to the main peak in the uv curve are combined and evaporated to dryness in vacuo , to yield hydrochloride salt of r , s - fluoromethyltyrosine . 400 mg of this salt is dissolved in 6 ml of water ; after a few minutes , crystallization of r , s - fluoromethyl - tyrosine begins . after standing overnight at 5 ° c ., the product is filtered , washed with water , ethanol and diethyl - ether and dried in vacuo at 76 ° c ., to give r , s - α - fluoromethyl tyrosine . thirty g of n ( im ) benzyl - l - histidine is dissolved in 600 ml h 2 o and the solution heated in a high - pressure autoclave at 200 ° c . for 8 hours with shaking . the autoclave is cooled to room temperature , the clear supernatant solution evaporated in vacuo to dryness to give the r , s - α - fluoromethyl - histidine as a colorless crystal . twenty g of rac . n ( im ) benzyl - histidine is dissolved in 1 l of hot water , then 40 g of basic cupric carbonate is added in portions and the mixture refluxed with stirring for 1 hour . the mixture is filtered while hot and the filtrate is evaporated in vacuo to give cu chelate of racemic n ( im ) benzyl - histidine as a blue solid . a mixture of 31 ml of formalin ( 38 % h 2 co ), 3 . 1 ml of pyridine and 2 . 13 g of na 2 co 3 is heated with stirring to 70 ° c . then 20 g of the above named cu - chelate is added and the system heated and stirred at 75 ° for 90 minutes . evaporation in vacuo gives a blue solid residue . this is dissolved in a mixture of 50 ml of h 2 o with 50 ml of conc . nh 4 oh and charged onto a cation - exchange resin column ( dowex 50 - x - 8 , 300 ml resin in the nh 4 - form ) and eluted with 2 m aq . nh 4 oh solution . the effluent is monitored with lkb uvicord ii uv absorption monitor and the 1 . 1 l . portion of the effluent with uv absorption is combined , evaporated in vacuo to a solid . the residue is dissolved in a mixture of 60 ml of h 2 o with 5 ml of conc . aq . nh 4 oh and charged onto an anion exchange resin column ( 300 ml of dowex 1 - x - 2 resin in the oh - form ). the column is washed with water ( 2 l .) and eluted with 2 m aq . hcl , monitored with a uvicord ii for uv absorption . the effluent fractions with ultraviolet absorption were combined and evaporated to dryness , to give substantially pure hcl salt of n ( im ) benzyl - α - hydroxymethylhistidine ( ii ) ( new compound ). this compound is transformed into α - hydroxymethyl - histidine ( iii ) in the following way : 12 . 5 g of ii is dissolved in 200 ml of liquid nh 3 ( 3 - neck flask , equipped with &# 34 ; cold - finger &# 34 ; condenser filled with dry - ice - acetone ), then sodium is added ( 5 . 5 g , cut in small pieces ) until the blue color persists for ˜ 10 minutes . nh 4 cl is added then to consume the excess the excess na ( indicated by decolorization ) and the nh 3 solvent is allowed to evaporate under a stream of n 2 . the product iii thus obtained is purified by chromatography on a cation - exchange resin column ( 2 . 2 l . of dowex - 50 - x - 8 , 200 / 400 mesh ). crude iii is dissolved in 100 ml of h 2 o and applied onto the resin column . the column is washed first with water ( 4 l .) then developed with aq . hcl ( 1 . 5 m , then 2 m ). 20 ml fractions are collected , flow rate 600 ml / h . ______________________________________fraction no . pauly reaction______________________________________ 1 - 400 1 . 5m hcl - 401 - 670 2m hcl - 671 & amp ; later + ______________________________________ fractions 671 - 760 are combined and evaporated in vacuo to dryness , to give iii : r , s - α - hydroxymethylhistidine 2 hcl ( new compound ). two and 73 / 100 g of r , s - α - hydroxymethylhistidine . 2 hcl ( iii ) is dissolved in 70 ml of liq . hf , then evaporated to dryness by passing in a stream of n 2 . the residue thus obtained represents the hydrofluoride salt of α - hydroxymethylhistidine . it is redissolved in 200 ml of liq . hf ( dry - ice - acetone cooling bath ), then 9 ml sf 4 is passed in ( measured as liquid at - 78 ° c .). the solution is stored overnight , while being kept in a cooling bath of - 12 ° c . the solution is saturated then with bf 3 gas , left standing for 5 hours , saturated then with bf 3 gas , left standing for 5 hours , saturated again at - 12 ° c . and left aging at the same temperature for 66 hours . the cooling - bath is then removed and the solvent evaporated by passing in a stream of n 2 . the residue represents mainly hbf 4 salt of α - fluoromethyl - histidine . this is dissolved in 100 ml of 2 . 5 m aq . hcl , evaporated to dryness and transformed into the hcl salt as follows : it is redissolved in h 2 o and applied onto a cation - exchange resin column ( 100 ml of ag50 - x - 2 , 200 / 400 mesh ), eluted with h 2 o until effluent is neutral and free of f - . the product is released then from the column by 3 m aq . hcl , evaporated to dryness in vacuo , to result in a residue , consisting mainly of dihydrochloride of iv . for final purification , this is rechromatographed on another ag - 50 - x - 2 column ( 900 ml resin ). elution with : the desired product iv was located by pauly test . fractions 390 - 470 are combined , evaporated to dryness in vacuo , to give pure dihydrochloride of iv . recrystallization from water - isopropanol ( 1 : 9 v / v ) gives the crystalline monohydrochloride salt of α - fluoromethyl - histidine , m . p . 226 °- 7 ° ( dec .). copper chelate of r , s - δ - n - benzoylornithine ( 7 . 995 g ) is added in small portions onto a mixture made of formalin ( 38 % h 2 co ; 12 . 45 ml ), pyridine ( 1 . 25 ml ), and sodium carbonate ( 0 . 81 g ) at ˜ 70 ° c ., under mechanical stirring . after further 90 minutes stirring at 75 ° c ., it is evaporated to dryness in vacuo , the dark blue residue dissolved in a mixture of 30 ml of h 2 o and 30 ml of conc . aq . nh 3 solution and charged to a cation - exchange resin column ( 130 ml of dowex 50 - x - 8 in the nh 4 + form ) to remove cu 2 + . the column is eluted with 250 ml of 2 m aq . nh 3 and the effluent evaporated to dryness in vacuo . the residue is redissolved in h 2 o and applied onto an anion exchange resin column ( dowex 1 - x - 2 , oh - form , 130 ml resin ). the column is washed with h 2 o ( 250 ml ) and eluted with 3 m aq . hcl . the hcl effluent is concentrated in vacuo to give r , s - α - hydroxymethyl - δ - n - benzoyl - ornithine . three and 5 / 10 g of the product obtained in ( a ) is dissolved in 40 ml of 6 m aq . hcl and refluxed for 21 hours . the solution is extracted with toluene ( 2 × 40 ml ) and the aqueous phase evaporated in vacuo to dryness , to give r , s - α - hydroxymethyl - ornithing dihydrochloride ( new compound ). one and 1 / 10 g of the product obtained under ( b ) is placed into a reactor , the reactor immersed into a dry - ice - acetone bath and hf gas passed in until hf solution of ˜ 25 ml volume is formed in the reactor . the cooling bath is removed and the solvent evaporated by passing in a stream of n 2 . the residue thus obtained represents the hf salt of r , s - α - hydroxymethyl - ornithine . this residue is redissolved in hf , by cooling the reactor in the dry - ice - acetone bath and passing in hf gas until 50 ml volume is reached . sf 4 gas is passed in ( 4 ml as measured in liquid state at - 78 ° c . ), the dry - ice - acetone cooling bath removed and replaced by a bath kept at - 15 ° c . after aging for 16 hours at - 15 ° c ., bf 3 gas is passed in for saturation . after 5 hours further aging , the cooling bath is removed and the solvent evaporated by passing in a stream of n 2 . the residue is dissolved in 6 m aq . hcl , evaporated to dryness in vacuo and redissolved in h 2 o ( 10 ml ). this solution is applied onto a dowex 50 - x - 8 cation - exchange resin column ( 400 ml resin , 200 / 400 mesh , h + form ). the column is first washed with h 2 o ( 800 ml ); elution with 2 m aq . hcl , 15 ml fractions are collected . flow rate 600 ml / h . every 5th fraction is spotted on tlc plate and developed with ninhydrin spray . fractions no . 171 - 220 are combined and evaporated to dryness in vacuo , to deliver a mixture of amino acids , the main component being r , s - α - fluoromethyl - ornithine 2 hcl . for further purification , this product is rechromatographed on another column , made of dowex 50 - x - 8 cation exchange resin ( 200 / 400 mesh ). for development , the dolumn is first washed with water , then eluted with 1 . 5 aq . hcl , flow rate 0 . 6 l ./ h . 20 - ml fractions are collected . the residue obtained on evaporation of fractions no . 521 - 540 represents pure r , s - α - fluoromethyl - ornithine dihydrochloride .	2
fig1 depicts a closed circuit system consisting of a compressor 1 with casting 1 a , suction line 8 , condenser 2 , evaporator 3 , suction accumulator 7 with inlet 5 connected to said evaporator 3 by line 4 , two outlets 6 and 9 , said outlet 6 connected to said compressor 1 by said suction line 8 , said outlet 9 connected to said casting 1 a by oil return line 10 , and controller 11 placed on said oil return line 10 to adjust the oil - refrigerant mixture flow . regulator 13 with set - point adjustment 14 is connected to said compressor 1 by line 15 and electrically connected to said controller 11 by line 12 . refrigerant vapor compressed in the compressor 1 enters the condenser 2 where it becomes a liquid and enters the evaporator 3 where it is boiled . the refrigerant vapor containing oil enters the suction accumulator 7 through line 4 and then through inlet 5 . the mixture is separated in said suction accumulator 7 into a vapor and a liquid part containing mainly oil and some liquid refrigerant . the mixture containing oil and liquid refrigerant is drawn to the compressor 1 from the suction accumulator 7 through outlet 9 by return line 10 . when the initial part of this mixture , containing an excess of liquid refrigerant , enters said casting 1 a of said compressor 1 , the oil pressure in said compressor 1 immediately decreases to a level that is still above the minimum level allowed for the bearings ( not shown ) of said compressor 1 to work safely . regulator 13 monitors the oil pressure value of the compressor 1 and compares this pressure value to that installed on set - point adjustment 14 . when this first reduction of oil pressure occurs , the controller 11 closes the line 10 and prevents the entrance of liquid oil - refrigerant mixture into the compressor 1 . in a short period of time liquid refrigerant in the compressor 1 evaporates , the oil pressure increases , the regulator 13 opens the controller 11 , and the oil continues to return to the compressor 1 . this system provides an uninterrupted safe operation of the compressor . fig2 depicts a closed circuit system consisting of compressor 1 with casting 1 a , suction line 16 , condenser 2 , evaporator 3 connected by said suction line 16 to said compressor 1 and to said condenser 2 , and controller 11 which is placed on said suction line 16 . regulator 13 with set - point adjustment 14 is connected to said compressor 1 by line 15 and electrically connected to said controller 11 by line 12 . refrigerant vapor becomes compressed in the compressor 1 and enters the condenser 2 where it becomes a liquid and enters the evaporator 3 where it is boiled . the refrigerant vapor containing oil is drawn to the compressor 1 by suction line 16 . when the initial part of this mixture containing an excess of liquid refrigerant enters the casting 1 a of said compressor 1 , and the oil pressure in said compressor 1 immediately decreases to a level that is still above the minimum level allowed for the bearings ( not shown ) of said compressor 1 to work safely . the regulator 13 monitors the oil pressure value of the compressor 1 , comparing this pressure value to the one established on set point adjuster 14 . controller 11 closes the line 16 when the target pressure is reached . this prevents the entrance of liquid oil - refrigerant mixture into the compressor 1 . in a short period of time liquid refrigerant in the compressor 1 evaporates , the oil pressure increases , the regulator 13 opens the controller 11 and the oil continues to return to the compressor 1 . this system provides uninterrupted safe operation of the compressor . fig3 depicts a closed circuit system consisting of compressor 1 with casting 1 a , suction line 16 , condenser 2 , evaporator 3 connected by said suction line 16 to said compressor 1 and connected to said condenser 2 by line 17 , and controller 11 which is placed on said line 17 . regulator 13 connected to said compressor 1 by line 15 , and electrically connected to said controller 11 by line 12 . refrigerant vapor compresses in the compressor 1 and enters the condenser 2 where it becomes a liquid and enters the evaporator 3 where it is boiled . the refrigerant vapor containing oil is drawn to the compressor 1 by suction line 16 . when the initial part of this mixture containing an excess of liquid refrigerant enters the casting 1 a of said compressor 1 , the oil pressure in said compressor 1 immediately decreases to a level that is still above the minimum level allowed for the bearings ( not shown ) of said compressor 1 to work safely . the regulator 13 monitors the oil pressure value of the compressor 1 , comparing this pressure value to the one installed on the set - point adjuster 14 , and closes the line 17 by means of controller 11 . controller 11 closes the line 16 when the target pressure is reached . this prevents the entrance of liquid oil - refrigerant mixture into the compressor 1 . in a short period of time liquid refrigerant in the compressor 1 evaporates , the oil pressure increases , the regulator 13 opens the controller 11 , and the oil continue to return to the compressor 1 . this system provides an uninterrupted safe operation of the compressor . while this invention has been illustrated and described in accordance with the preferred embodiments , it is recognized that variations and changes may be made therein without departing from the invention as set forth in the claims .	5
the present invention provides an acetabular cup for canine hip replacements . the acetabular cup comes in a range of sizes comprising 24 mm , 26 mm , 28 mm , 30 mm and 32 mm , which are adapted for association with a common femoral head having a diameter of 17 mm . the surgeon may choose the size of the acetabular cup based on the bone size of the dog . if for any reason , a sized acetabular cup will not fit properly into an existing reamed cavity the next size of acetabular cup may be used by selecting the next reamer size , creating a hip implant that matches the femoral head and femoral prosthesis . in this manner , the canine acetabular cup system provides a variety of acetabular cup sizes that match precisely with a 17 mm femoral head , enabling reliable hip replacement procedures . in addition , each of the acetabular cups has a 45 degree cutout truncated section in one side thereof . advantageously , the truncated cutout section enables extended hip motion in the cutout direction , allowing the dog to sit on its stomach while extending the hind legs . the present canine acetabular cup is especially suited for use in cementless hip replacement procedures wherein an acetabular cup composed of an outer ti — al — v shell with a porous coating and an inner polyethylene liner is interference press fitted into a bone cavity using a cementless fixation procedure . the interference is carefully controlled so that the porous coating of the implanted acetabular cup makes intimate contact with the bone encouraging long term bone ingrowth . due in part to the carefully controlled interference between the reamed bone cavity and the acetabular cup , and the reduced body weight of a dog , the implanted device is available for use immediately after surgery . based on clinical and research results , it has been established that during this initial stability phase there must be less than 150 μm of motion between the acetabular cup and the bone to allow the bone an opportunity to grow into the pores of the outer surface of the shell . motion exceeding this threshold during the initial stability phase of the procedure has been shown to result in fibrous tissue ingrowth in the porous outer surface . this , in turn , can result in loosening of the joint components and revision surgery . the motion of the acetabular cup in the acetabular cup system is limited to well below the 150 μm limit due to the carefully controlled interference fit and the friction provided by the porous coating of sintered chemically pure titanium beads on the outer surface of the ti — al — v acetabular cup shell . long term stability is thus assured by intimate contact between the porous surface of the implanted device and the underlying bone . the convex outer surface of the ti — al — v shell is coated with titanium beads , typically 250 μm ± 50 μm ( 0 . 01 ± 0 . 0025 inches ), which are sintered to the ti — al — v cup shell , maintaining porosity between the beads . the coating typically has a thickness of 0 . 8 mm ( 0 . 030 inches ). the ti — al — v shell is typically 2 mm thick with the sintered titanium beads attached . the outer dimensions of the ti — al — v shell is chosen so that it produces an interference fit with a specially milled cavity in the bone where the ti — al — v shell will be placed , with an interference of 0 . 75 to 1 . 2 mm across the diameter . the outer convex surface of the ti — al — v shell is multiply curved to bring the above interference from zero at an angular location of 50 degrees from the apex to 0 . 75 to 1 . 2 mm at 90 degrees from the apex . this increasing interference along the distance from the apex allows intimate contact between the bonded chemically pure sintered ti beads and the bone , resulting in rapid bone ingrowth development . this interference as well as the rough outer surface of the ti — al — v shell increases the friction between the bone and the ti — al — v shell , preventing the movement of the implant within the bone cavity , and permits use of canine legs immediately after surgery . the articular inner surface of the acetabular cup comprises an uhmw polyethylene astm f - 648 insert that is permanently pre - assembled at the factory and is held in place within the acetabular cup without any possibility of rotational , lateral or vertical displacement . the uhmw polyethylene insert also provides for long - term success by providing sufficient thickness for wear and an assembly , which resists disassociation . if insert assembly is inadequate , it can lead to excessive motion between the insert and shell , producing wear debris and eventual loosening through wear debris - induced osteolysis . the mechanical lock between the insert and shell must resist torsional fatigue and offset loading , which could be induced through neck impingement with the femoral stem in extreme ranges of motion . the uhmw polyethylene insert has a typical thickness of 2 . 4 mm to 6 . 4 mm ( 0 . 1 to 0 . 25 inches ) based on the size of the acetabular cup . insert thickness is sufficient to withstand wear during normal operation of the acetabular cup over the dog &# 39 ; s lifetime . the uhmw polyethylene insert is locked into the ti — al — v shell by use of an elongated post , which is not circular in cross section . the elongated post , which is 0 . 24 inches long and 0 . 155 inches wide having full radius in the uhmw polyethylene insert , mates with a corresponding elongated opening located in the dome of the ti — al — v cup shell , thus preventing relative rotational movement of the uhmw polyethylene insert within the ti — al — v cup shell . in addition , a retaining groove milled into the uhmw polyethylene insert , mates with a corresponding interior projection in the ti — al — v shell preventing lateral or vertical movement of the uhmw polyethylene insert with respect to the ti — al — v shell , even when high loads are applied during the lifetime use of the canine acetabular cup . insertion of the uhmw polyethene insert into the ti — al — v cup shell is possible due to the elastic compliance of the uhmw polyethylene insert which can be pressed into the ti — al — v cup shell . also , the dimensions of the uhmw polyethylene insert are chosen so that a general interference fit exists between the outer surface of the uhmw polyethylene insert and the concave inner surface of the ti — al — v cup shell . the uhmw polyethylene insert essentially has a lip that completely surrounds the outer edge of the ti — al — v cup shell , preventing metal to metal contact between the ti — al — v cup shell rim and a femoral head that is placed within the uhmw polyethylene insert . the lip also adds to the stability of retention of the uhmw polyethylene insert against the ti — al — v cup shell . the face of the ti — al — v shell and the uhmw polyethylene insert are chamfered at 51 °. this avoids point contact between the acetabular cup and the femoral stem in extreme ranges of motion as demanded by certain motions such as when a dog spreads his hind legs while lying on his stomach . the manufactured canine acetabular cup , which has the uhmw polyethylene insert permanently attached to the ti — al — v cup shell at the factory , is produced in various sizes that match the requirements of dogs . typically , the outer diameter of the canine acetabular cup is 24 , 26 , 28 , 30 , or 32 mm . the inner diameter of the uhmw polyethylene insert is always maintained at 17 mm to allow mating with a 17 mm femoral head . since the thickness of the ti — al — v shell is always 1 . 2 mm , the thickness of the uhmw polyethylene insert is a function of the diameter of the canine acetabular cup and varies from 2 . 4 to 6 . 4 mm , the larger thickness corresponding to a larger diameter canine acetabular cup . bone drilling cutters are provided for each size of the canine acetabular cup , and result in interference of 0 . 75 mm to 1 . 2 mm across the diameter . larger interference is used for a larger diameter bone cavity . the cutting tool for creating the cavity in the bone has four tool inserts , which cut out the spherical bone cavity to the required dimensions ., fig1 a is a schematic view depicting the side view and fig1 b is a schematic view depicting the top view of the canine acetabular cup in an assembled condition , illustrating the basic features of the cup . the ti — al — v shell 1 is shown with chemically pure sintered titanium beads 3 on the surface of the ti — al — v shell . a uhmw polyethylene insert 4 is placed within the ti — al — v shell , pre - assembled at the factory . fig2 is a schematic diagram depicting the canine acetabular cup in an assembled condition . a truncated section 5 of the canine acetabular cup is created for increased abduction of the hip joint , a feature that provides enhanced movement of the hip joint which is necessary to accommodate the movement requirements of a dog . a groove 6 on the uhmw polyethylene insert 4 mates with a interior projection 9 on the ti — al — v shell preventing lateral or vertical movement of the uhmw polyethylene insert with respect to the ti — al — v shell . a non - circular post 10 in the uhmw polyethylene insert mates with an elongated opening 7 in the t — al — v shell preventing rotational movement of the insert within the shell . the uhmw polyethylene insert has a lip 8 on the basal plane surface of the polyethylene insert preventing contact between femoral components and the ti — al — v shell . fig3 a is an engineering drawing detailing the dimensions and construction of a typical ti — al — v shell 1 . fig3 b is the frontal view of the canine acetabular cup of fig3 a taken along line xx , detailing the non - circular cylindrical opening at the apex of the ti — al — v shell . the shell is manufactured with an outer dimension to mate with a reamed bone cavity having a diameter of approximately 24 , 26 , 28 , 30 and 32 mm , with an interference of 0 . 75 to 1 . 2 mm ( 0 . 03 inches to 0 . 05 inches ) measured at the basal plane of the canine acetabular cup , with larger interference associated with larger diameter canine acetabular cups . the interference is zero at 50 degrees from the apex of the ti — al — v shell and increases to full value at 90 degrees from the apex . thus , the outer surface of the shell has multiple curvatures with the maximum interference occurring closer to the basal plane of the canine acetabular cup . the shell is made from ti — al — v or cobalt chrome , tantalum alloy with typical wall thickness of 1 . 2 mm ( 0 . 05 inches ). the chemically pure titanium beads , sintered on the outer surface of the shell and held in between the circumferential ribs has a dimension of 250 ± 50 μm ( 0 . 01 ± 0 . 0025 inches ). the apex of the ti — al — v shell comprises an elongated cylindrical opening , which is 6 by 3 . 8 mm ( 0 . 240 inches by 0 . 152 inches ). this opening is adapted to receive a cylindrical post in the polyethylene insert to prevent the rotational movement of the polyethylene insert with respect to the ti — al — v shell . in addition , the inner surface of the shell has an interior projection at a distance of 4 mm ( 0 . 159 inches ) from the base surface of the ti — al — v shell that mates with a groove in the polyethylene insert and locks it , preventing horizontal or vertical movement . the edge of the shell at the bottom surface is tapered to accept the polyethylene insert . the right side of the cup is cut out to produce a truncated section at the 45 degree angle , as shown , to provide increased movement of the hip joint in the plane of the drawing . fig4 a is an engineering drawing detailing the dimensions and construction of a typical uhmw polyethylene insert 4 . fig4 b is a frontal view of fig4 a taken along line zz , depicting the design and dimensions of the uhmw polyethylene insert and the details of the non - circular cylindrical post at the apex . the polymeric insert has a cylindrical post at the apex which is 6 mm by 3 . 8 mm ( 0 . 236 inches by 0 . 155 inches ) and is designed to mate with the elongated opening in the ti — al — v shell . the external surface of the polyethylene insert has a groove which mates with the circumferential rib or projection on the interior surface of the shell . the inner surface of the polyethylene insert has a dimension of 17 mm ( 0 . 68 inches ) regardless of its outer dimension or shell size and is designed to engage with a 17 mm femoral head . the polyethylene insert has a wear thickness of 2 . 4 to 6 . 4 mm ( 0 . 1 to 0 . 2 inches ) depending on the overall size of the canine acetabular cup . a larger size canine acetabular cup has a larger polyethylene insert wear thickness , since it mates with a common diameter femoral head of 17 mm ( 0 . 68 inches ). the bottom edge of the polyethylene insert has a lip which mates with the taper in the ti — al — v shell , thus covering the entire surface of the shell and preventing metal to metal contact between the femur hardware and the ti — al — v shell . the right side of the polyethylene insert is cut out to create a truncated section at 45 degrees as shown in fig4 . there is a corresponding truncated section at 45 degrees cut out of the ti — al — v shell . the truncated section provides extended movement of the canine femur . fig5 diagrammatically depicts parameters required to achieve an interference fit . the figure shows a cross section perpendicular to the sheet of the drawing of fig3 a , 3 b , 4 a and 4 b , taken along the lines x — x and z — z . the reamed bone cavity precisely matches the 26 mm ti — al — v shell for 50 degrees from apex with no interference . the interference increases from this zero value to 1 mm interference as the angle is increased from 50 to 90 degrees from the apex , 1 mm being the interference value for a 26 mm ti — al — v shell . the ti — al — v shell has a 3 mm cylindrical section where the interference is fully maintained . fig6 is a diagram illustrating the head of an acetabular spherical reamer . reamers are provided for each size of the canine acetabular cup , and are especially shaped to precisely machine out spherical cavities of 24 , 26 , 28 , 30 and 32 mm . these cutters overlap and ream out a spherical bone cavity . 1 . a canine acetabular cup having a cutout truncated section at 45 degrees , for increased abduction to provide enhanced movement of the canine hip joint that meets the movement requirements of a dog ; 2 . a spherical dome of the t - al — v shell encompassing a 50 ° arc to either side of centerline ; which mates with a line - to - line fit with the bone preparing spherical reamer ; 3 . a section below the dome , which is composed of multi - conical sections adapted to provide a gradually increasing interference fit with the spherically prepared bone ; each of the sections beginning at 50 ° and continuing through 90 °, and the interference beginning at zero and increasing to 0 . 75 mm to 1 . 2 mm depending on the tolerances between the implant and instruments ; 4 . a section below the conical sections , which is a cylinder and has a designed interference with the bone preparation of 0 . 75 mm to 1 . 2 mm , depending on the tolerances between the implant and instruments ; 5 . a truncated section of the conical and cylindrical sections , which provides for increased abduction ( i . e . increased range of motion when the dog spreads his hind legs and lies on its stomach ); and 6 . a circumferential groove disposed within the cylindrical section , that assists the insert to lock onto the cup and provides for a stable and controllable insertion of the polyethylene insert . having thus described the invention in rather full detail , it will be understood that such detail need not be strictly adhered to , but that additional changes and modifications may suggest themselves to one skilled in the art , all falling within the scope of the invention as defined by the subjoined claims .	0
the claimed subject matter is now described with reference to the drawings . in the following description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the claimed subject matter . it may be evident , however , that the claimed subject matter may be practiced with or without any combination of these specific details , without departing from the spirit and scope of this invention and the claims . the inventive method is a segment of an overall systems approach to health care . this systems approach to health care can be envisioned as a pyramid with the systems approach as the tip of the pyramid . underneath this systems approach to health care is systems integration diagnostics and treatment . systems integration diagnostics and treatment is the concept that all human systems are connected ( i . e . the endocrine system is connected to the nervous system is connected to the circulatory system ). the diagnosis and treatment of one system cannot be performed in isolation of other systems . a physician should consider information and readings of all distinct systems when diagnosing and treating an issue presented by a patient . under the systems integration diagnostics and treatment are brain and organ remapping neuroplasticity treatments . these treatments are separate treatments which are utilized to effect brain remapping and neuroplasticity in a patient . under the brain and organ remapping neuroplasticity treatments are organ remapping and brain remapping . the procedures falling under organ remapping are neurovisceral applications which are a specific set of applications which affect remapping and neuroplasticity related to the patient &# 39 ; s organs . the procedures falling under brain remapping are brain based applications which are a specific set of applications which affect remapping and neuroplasticity in the patient &# 39 ; s brain . the procedures of neurovisceral applications and brain based applications produce restoration of function through neurogenesis . underlying this restoration of process is the concept that the end product of these procedures is functional neurology . this is the concept that many problems and issues presented in a patient can be fixed through restoring the proper function of the nervous system . underneath all of these is the concept of modern neuroscience treatment procedures and protocol . this concept is a shift in paradigm from the method of treating a patient &# 39 ; s health problems in distinct and isolated segments . under current medical philosophy a physician treats only the current issue presented by the patient at the moment of treatment . sidt procedures and protocols in modern neuroscience treatment changes this to the philosophy that the patient cannot be treated in increments but instead that the physician must treat the entire patient , considering all systems of a patient when diagnosing and treating the health issue presented . the inventive method is easiest to understand when viewed in light of knowledge of the anatomy and physiology of the human nervous system . the human nervous system comprises the central nervous system and peripheral nervous system . the brain and the spinal cord make up the central nervous system . the largest mass of the brain is the cerebrum . the cerebrum comprises the outer gray matter that is the cortex and several deep nuclei that are split into functional groups . within the cerebrum is the limbic cortex which is part of the limbic system . the hypothalamus , a part of the limbic system , is involved in regulating homeostasis . the hypothalamus is the region of the brain in charge of the autonomic nervous system and the endocrine system . the peripheral nervous system is everything that is not the central nervous system . the nerves of the peripheral nervous system can have structures called ganglia . a ganglion is a group of neuron cell bodies in the periphery . ganglia can be categorized as either sensory ganglia or autonomic ganglia . the most common type of sensory ganglion is a dorsal ( posterior ) root ganglion . these ganglia are the cell bodies of neurons with axons that are sensory endings in the periphery , such as in the skin , and that extend into the cns through the dorsal nerve root . the other major category of ganglia are those of the autonomic nervous system , which is divided into the sympathetic and parasympathetic nervous systems . the sympathetic chain ganglia are a row of ganglia along the vertebral column that receive input from the lateral horn of the thoracic and upper lumbar spinal cord . superior to the chain ganglia are three paravertebral ganglia in the cervical region . three other autonomic ganglia that are related to the sympathetic chain are the prevertebral ganglia , which are located outside of the chain but have similar functions . they are referred to as prevertebral because they are anterior to the vertebral column . the neurons of these autonomic ganglia are multipolar in shape , with dendrites radiating out around the cell body where synapses from the spinal cord neurons are made . the neurons of the chain , paravertebral , and prevertebral ganglia then project to organs in the head and neck , thoracic , abdominal , and pelvic cavities to regulate the sympathetic aspect of homeostatic mechanisms . in addition , there are a group of terminal ganglia that receive input from cranial nerves or sacral spinal nerves and are responsible for regulating the parasympathetic aspect of homeostatic mechanisms . these two sets of ganglia , sympathetic and parasympathetic , often project to the same organs — one input from the chain ganglia and one input from a terminal ganglion — to regulate the overall function of an organ . for example , the heart receives two inputs such as these ; one increases heart rate , and the other decreases it . the terminal ganglia that receive input from cranial nerves are found in the head and neck , as well as the thoracic and upper abdominal cavities , whereas the terminal ganglia that receive sacral input are in the lower abdominal and pelvic cavities . nerves are fibers of nerve cells extending from the central nervous system and are categorized as either cranial nerves extending from the brain or spinal nerves connected to the spinal cord . cranial nerves are primarily responsible for the sensory and motor functions of the head and neck . of the cranial nerves , the vagus nerve is responsible for contributing to homeostatic control of the organs of the thoracic and upper abdominal cavities . the vagus nerve primarily targets autonomic ganglia in the thoracic and upper abdominal cavities . the nerves connected to the spinal cord are the spinal nerves . all of the spinal nerves are combined sensory and motor axons that separate into two nerve roots . the sensory axons enter the spinal cord as the dorsal nerve root . the motor fibers , both somatic and autonomic , emerge as the ventral nerve root . the dorsal root ganglion for each nerve is an enlargement of the spinal nerve . referring to fig1 , there are 31 spinal nerves , named for the level of the spinal cord at which each one emerges . there are eight pairs of cervical nerves designated c1 to c8 , twelve thoracic nerves designated t1 to t12 , five pairs of lumbar nerves designated l1 to l5 , five pairs of sacral nerves designated s1 to s5 , and one pair of coccygeal nerves . the nerves are numbered from the superior to inferior positions , and each emerges from the vertebral column . spinal nerves extend outward from the vertebral column to enervate the periphery . the nerves in the periphery are not straight continuations of the spinal nerves , but rather the reorganization of the axons in those nerves to follow different courses . axons from different spinal nerves will come together into a systemic nerve . this occurs at four places along the length of the vertebral column , each identified as a nerve plexus . of the four nerve plexuses , two are found at the cervical level , one at the lumbar level , and one at the sacral level . the cervical plexus is composed of axons from spinal nerves c1 through c5 and branches into nerves in the posterior neck and head , as well as the phrenic nerve , which connects to the diaphragm at the base of the thoracic cavity . spinal nerves c4 through t1 reorganize through the brachial plexus to give rise to the nerves of the arms . the lumbar plexus arises from all the lumbar spinal nerves and gives rise to nerves enervating the pelvic region and the anterior leg . the sacral plexus comes from the lower lumbar nerves l4 and l5 and the sacral nerves s1 to s4 . spinal nerves of the thoracic region , t2 through t11 , are not part of the plexuses . these plexuses contain fibers that serve sensory functions or fibers that serve motor functions . some fibers extend from cutaneous or other peripheral sensory surfaces and send action potentials into the central nervous system . those are axons of sensory neurons in the dorsal root ganglia that enter the spinal cord through the dorsal nerve root . other fibers are the axons of motor neurons of the anterior horn of the spinal cord , which emerge in the ventral nerve root and send action potentials to cause skeletal muscles to contract in their target regions . sensory receptors help us learn about the environment around us , or about the state of our internal environment . stimuli are received and changed into the electrochemical signals of the nervous system . this occurs when a stimulus changes the cell membrane potential of a sensory neuron . the stimulus causes the sensory cell to produce an action potential that is relayed into the central nervous system , where it is integrated with other sensory information to become a conscious perception of that stimulus . stimuli in the environment activate specialized receptor cells in the peripheral nervous system . different types of stimuli are sensed by different types of receptor cells . physical stimuli , such as pressure and vibration , as well as the sensation of sound and body position ( balance ), are interpreted through a mechanoreceptor . another physical stimulus that has its own type of receptor is temperature , which is sensed through a thermoreceptor that is either sensitive to temperatures above ( heat ) or below ( cold ) normal body temperature . physical touch on the skin can be subdivided into pressure , vibration , stretch , and hair - follicle position , on the basis of the type of mechanoreceptors that perceive these touch sensations . other overlooked senses include temperature perception by thermoreceptors and pain perception by nociceptors . somatosensation is the group of sensory modalities that are associated with touch , proprioception , and interoception . these modalities include pressure , vibration , light touch , tickle , itch , temperature , pain , proprioception , and kinesthesia . many of the somatosensory receptors are located in the skin , but receptors are also found in muscles , tendons , joint capsules , ligaments , and in the walls of visceral organs . two types of somatosensory signals that are transduced by free nerve endings are pain and temperature . these two modalities use thermoreceptors and nociceptors to transduce temperature and pain stimuli , respectively . temperature receptors are stimulated when local temperatures differ from body temperature . some thermoreceptors are sensitive to just cold and others to just heat . nociception is the sensation of potentially damaging stimuli . mechanical , chemical , or thermal stimuli beyond a set threshold will elicit painful sensations . stressed or damaged tissues release chemicals that activate receptor proteins in the nociceptors . low frequency vibrations are sensed by mechanoreceptors called merkel cells , also known as type i cutaneous mechanoreceptors . merkel cells are located in the stratum basale of the epidermis . deep pressure and vibration is transduced by lamellated ( pacinian ) corpuscles , which are receptors with encapsulated endings found deep in the dermis , or subcutaneous tissue . light touch is transduced by the encapsulated endings known as tactile ( meissner ) corpuscles . follicles are also wrapped in a plexus of nerve endings known as the hair follicle plexus , which detect the movement of hair at the surface of the skin . stretching of the skin is transduced by stretch receptors known as bulbous corpuscles . bulbous corpuscles are also known as ruffini corpuscles , or type ii cutaneous mechanoreceptors . in summary : free nerve endings in the dermis respond to the stimuli of pain , temperature , and mechanical deformation ; mechanoreceptors in the dermis respond to the stimulus of vibration ; bulbous corpuscles in the dermis respond to the stimulus of stretch ; tactile corpuscles in the dermis respond to the stimuli of light touch and vibration ; lamellated corpuscles in the dermis respond to the stimuli of pressure and vibration ; hair follicle plexi in the dermis respond to the stimulus of movement of hair . a sensory pathway that carries peripheral sensations to the brain is referred to as an ascending pathway , or ascending tract . the various sensory modalities each follow specific pathways through the central nervous system . tactile and other somatosensory stimuli activate receptors in the skin , muscles , tendons , and joints throughout the entire body . however , the somatosensory pathways are divided into two separate systems on the basis of the location of the receptor neurons . somatosensory stimuli from below the neck pass along the sensory pathways of the spinal cord , whereas somatosensory stimuli from the head and neck travel through the cranial nerves — specifically , the trigeminal system . the dorsal column system and the spinothalamic tract are two major pathways that bring sensory information to the brain . the axons in the dorsal column terminate in the nuclei of the medulla , where each synapses with the second neuron in their respective pathway . the second neuron in the system crosses the midline of the medulla and continues to ascend the brain stem . these axons terminate in the thalamus , where each synapses with the third neuron . the third neuron in the system projects its axons to the postcentral gyms of the cerebral cortex , where somatosensory stimuli are initially processed and the conscious perception of the stimulus occurs . the spinothalamic tract also begins with neurons in a dorsal root ganglion . these neurons extend their axons to the dorsal horn , where they synapse with the second neuron in their respective pathway . axons from these second neurons then ascend to the brain and enter the thalamus , where each synapses with the third neuron in its respective pathway . the neurons in the thalamus then project their axons to the spinothalamic tract , which synapses in the cerebral cortex . the dorsal column system is primarily responsible for touch sensations and proprioception , whereas the spinothalamic tract pathway is primarily responsible for pain and temperature sensations . the sensory pathways of the trigeminal pathway each involve three successive neurons . these nuclei receive information like that carried by the dorsal column system , such as touch , pressure , vibration , and proprioception . in the thalamus , each axon synapses with the third neuron in its respective pathway . axons from the third neuron then project from the thalamus to the primary somatosensory cortex of the cerebrum . the nervous system can be divided into two parts : the somatic nervous system and the autonomic nervous system . the somatic nervous system is associated with voluntary responses , and the autonomic nervous system is associated with involuntary responses , such as those related to homeostasis . the autonomic nervous system regulates many of the internal organs through a balance of two aspects , or divisions . the autonomic nervous system is instrumental in homeostatic mechanisms in the body . the two divisions of the autonomic nervous system are the sympathetic division and the parasympathetic division . the sympathetic system is associated with the fight - or - flight response , and parasympathetic activity is referred to by the epithet of rest and digest . homeostasis is the balance between the two systems . at each target effector , dual innervation determines activity . for example , the heart receives connections from both the sympathetic and parasympathetic divisions . the sympathetic system increases the heart rate and the parasympathetic system decreases the heart rate . to respond to a threat — to fight or to run away — the sympathetic system causes divergent effects as many different effector organs are activated together for a common purpose . more oxygen needs to be inhaled and delivered to skeletal muscle . the respiratory , cardiovascular , and musculoskeletal systems are all activated together . the digestive system shuts down so that blood is not absorbing nutrients when it should be delivering oxygen to skeletal muscles . to coordinate all these responses , the connections in the sympathetic system diverge from a limited region of the central nervous system to a wide array of ganglia that project to the many effector organs simultaneously . the complex set of structures that compose the output of the sympathetic system make it possible for these disparate effectors to come together in a coordinated , systemic change . the sympathetic division of the autonomic nervous system influences the various organ systems of the body through connections emerging from the thoracic and upper lumbar spinal cord . the majority of ganglia of the sympathetic system belong to a network of sympathetic chain ganglia that runs alongside the vertebral column . the ganglia appear as a series of clusters of neurons linked by axonal bridges . the sympathetic nerve projects to the chain ganglion at the same level as the target effector ( the organ , tissue , or gland to be innervated ). collateral ganglia , also called prevertebral ganglia , are situated anterior to the vertebral column and receive inputs from splanchnic nerves as well as central sympathetic neurons . they are associated with controlling organs in the abdominal cavity , and are also considered part of the enteric nervous system . an axon from the central neuron that projects to a sympathetic ganglion is referred to as a preganglionic fiber or neuron , and represents the output from the central nervous system to the ganglion . a postganglionic fiber — the axon from a ganglionic neuron that projects to the target effector — represents the output of a ganglion that directly influences the organ . as a response to a threat , the sympathetic system would increase heart rate and breathing rate and cause blood flow to the skeletal muscle to increase and blood flow to the digestive system to decrease . sweat gland secretion should also increase as part of an integrated response . all of those physiological changes are going to be required to occur together to run away from a threat . the neurons involved in the sympathetic system branch off in different pathways . a single preganglionic sympathetic neuron may have upwards of twenty targets that it innervates . for instance , when a fiber exits the spinal cord , one branch will synapse on a neuron in the adjacent chain ganglion . other branches will innervate collateral ganglion . all of these branches means that one preganglionic neuron can influence different regions of the sympathetic system very broadly , by acting on widely distributed organs . the sympathetic system causes changes in the body in preparation for fight or flight mechanisms of the body . the sympathetic system stimulates secretion of the sweat glands , constricts the blood vessels , dilates the pupils , decreases salivation , accelerates the heartbeat , relaxes the airways , inhibits digestion , stimulates secretion of epinephrine and norepinephrine , inhibits gut motility and secretions , and relaxes the urinary bladder . referring fig2 , the connections of the human sympathetic nervous system is illustrated . the main part of the sympathetic nervous system is the spinal cord 102 . at the higher end of the spinal cord 102 is the pons 104 and the medulla 106 . emanating from the spinal cord 102 are a plurality of spinal nerves . the spinal nerves connect into a right chain ganglia 108 and a left chain ganglia 110 . nerves emanating from the right chain ganglia 108 innervate separate sections of their respective dermatomes 100 . nerves emanating from the left chain ganglia 110 innervate separate organs . nerves emanating from the superior cervical ganglia innervate the eye 200 , lacrinal gland 202 , mucous membrane — nose and palate 204 , submaxillary gland 206 , sublingual gland 208 , mucous membrane — mouth 210 , and parotid gland 210 . the t1 through t4 spinal nerves innervate the heart 214 or larynx , trachea , or bronchi 216 . the t5 through t11 spinal nerves combine into the celiac ganglion 242 . nerves emanating from the celiac ganglion 242 innervate the esophagus / stomach 216 , the abdominal blood vessels 220 , the liver and bile duct 222 , the pancreas 224 , the adrenal gland 226 , and the small intestine 228 . a nerve from the celiac ganglion 242 innervates the superior mesenteric ganglion 244 , which then innervates the large intestine 230 . the t12 through l3 spinal nerves combine into the inferior mesenteric ganglion 246 . nerves from the inferior mesenteric ganglion 246 innervate the rectum 232 , kidney 234 , bladder 236 , gonads 238 , and external genitalia 240 . the connections of the parasympathetic division are similar to the general layout of the sympathetic division . parasympathetic preganglionic fibers primarily influence the heart , bronchi , and esophagus in the thoracic cavity and the stomach , liver , pancreas , gall bladder , and small intestine of the abdominal cavity . the postganglionic fibers from the ganglia activated by the vagus nerve are often incorporated into the structure of the organ , such as the mesenteric plexus of the digestive tract organs and the intramural ganglia . the autonomic nervous system is important for homeostasis because its two divisions compete at the target effector . the balance of homeostasis is attributable to the competing inputs from the sympathetic and parasympathetic divisions . organ systems are balanced between the input from the sympathetic and parasympathetic divisions . when something upsets that balance , the homeostatic mechanisms strive to return it to its regular state . for each organ system , there may be more of a sympathetic or parasympathetic tendency to the resting state , which is known as the autonomic tone of the system . the parasympathetic system causes changes in the human body to calm the fight or flight mechanism . the parasympathetic system slows the heartbeat , constricts the airways , stimulates digestion , stimulates intestine activity , stimulates exocrine secretions , stimulates the gallbladder to excrete bile , stimulates gut motility , stimulates urinary bladder contraction , constricts the pupil , stimulates secretion from the lachrymal gland , stimulates salivation , and stimulates sexual arousal . referring to fig3 , the human parasympathetic system is illustrated . cranial nerve iii emanates from the eddinger - westphal nucleus in the pons 104 , passes through the ciliary ganglion , and innervates the eye 200 . cranial nerve vii emanates from the super salivatory nucleus in the medulla 106 and innervates the pterygopalatine ganglion and submandibular ganglion . nerves from the pterygopalatine ganglion innervate the lacrinal gland 202 and mucous membrane — nose and palate 204 . nerves from the submandibular ganglion innervate the submaxillary gland 206 and sublingual gland 208 . cranial nerve ix emanates from the inferior salivatory nucleus in the medulla 106 and innvervates the octic ganglion . nerves from the octic ganglion innervate the mucous membrane — mouth 210 and parotid gland 212 . cranial nerve x emanates from the dorsal nucleus of the vagus nucleus ambigus in the medulla 106 and innervates the heart 214 , the larynx , trachea , and bronchi 216 , the esophagus / stomach 218 , the abdominal blood vessels 220 , the liver and bile duct 222 , the pancreas 224 , the adrenal gland 226 , the small intestine 228 , and the large intestine 230 . a nerve from the s4 level innervates the large intestine 230 , rectum 232 , kidney 234 , bladder 236 , gonads 238 , and external genitalia 240 . the nervous system comprises the brain and nerves that extend throughout the body outward from the brain . the main nerves travel down the spinal cord . nerves branch off from the spinal cord . the spinal cord has several vertebra segmenting the spinal cord , as shown by fig1 . from the top of the spinal cord are the cervical vertebrae which are designated as c1 , c2 , c3 , c4 , c5 , c6 , c7 , and c8 . connected to these are the thoracic vertebrae which are designated as t1 , t2 , t3 , t4 , t5 , t6 , t7 , t8 , t9 , t10 , t11 , and t12 . connected to these are the lumbar vertebrae which are designated as l1 , l2 , l3 , l4 , and l5 . connected to these are the sacral vertebrae which are designated as s1 , s2 , s3 , s4 , and s5 . the nerves which branch out from the spine at each vertebra innervate separate organs within the body . additionally , the nerves branching out from the spine at each vertebra also innervate a separate sections or areas of the skin , known as dermatomes . this is known as dermatomal segmentation . the location of dermatomes 100 is illustrated in fig4 a and fig4 b . nerves from c2 vertebra innervate the face and top of the back of the head . nerves from the c3 vertebra innervate the neck and portions of the arm . nerves from the c4 vertebra innervate the collar bone area and back of the neck . nerves from the c5 vertebra innervate the upper chest and base of the back of the neck . nerves from the c6 vertebra innervate the upper back and portions of the arm . nerves from the c7 vertebra innervate the back , portions of the arm , and fingers . nerves from the c8 vertebra innervate the back , portions of the arm , and fingers . nerves from the t1 vertebra innervate the back , the chest , and portions of the arm . nerves from the t2 vertebra innervate the back , the chest , and portions of the arm . nerves from the t3 vertebra innervate the back and the chest . nerves from the t4 vertebra innervate the back and the chest . nerves from the t5 vertebra innervate the mid - back and the mid - chest . nerves from the t6 vertebra innervate the mid - back and the upper abdomen . nerves from the t7 vertebra innervate the mid - back and the upper abdomen . nerves from the t8 vertebra innervate the mid - back and the mid - abdomen . nerves from the t9 vertebra innervate the mid - back and the mid - abdomen . nerves from the t10 vertebra innervate the mid - back and the mid - abdomen . nerves from the t11 vertebra innervate the lower - back and the lower - abdomen . nerves from the t12 vertebra innervate the lower - back and the lower - abdomen . nerves from the l1 vertebra innervate the upper pelvis and lower back . nerves from the l2 vertebra innervate the upper legs and lower back . nerves from the l3 vertebra innervate the upper legs and lower back . nerves from the l4 vertebra innervate the legs and lower back . nerves from the l5 vertebra innervate the legs and lower back . nerves from the s1 vertebra innervate the buttocks and legs . nerves from the s2 vertebra innervate the buttocks , genitals , and legs . nerves from the s3 vertebra innervate the buttocks and genitals . nerves from the s4 innervate the buttocks . nerves from the s5 vertebra innervate the buttocks . neuroplasticity , also known as brain plasticity , is the change of the central nervous system . neuroplastic change can occur at small scales , such as physical changes to individual neurons , or at whole - brain scales , such as cortical remapping in response to injury . behavior , environmental stimuli , thought , and emotions may also cause neuroplastic change . one component of neuroplasticity is synaptogenesis . synaptogenesis is the formation of synapses between neurons in the nervous system . activation of n - methyl - d - aspartate ( nmda ) receptor in neurons of the central nervous system initiates synaptogenesis through activation of downstream products . the heightened level of nmda receptor activity during development allows for increased influx of calcium , which acts as a secondary signal . synaptic signaling during synaptogenesis is not only activity - dependent , but is also dependent on the environment in which the neurons are located . the special structure found in the central nervous system that allows for multiple inputs is the dendritic spine , the site of excitatory synapses . this morphological dynamism is due to the specific regulation of the actin cytoskeleton , which in turn allows for regulation of synapse formation . dendritic spines exhibit three main morphologies : filopodia , thin spines , and mushroom spines . the filopodia play a role in synaptogenesis through initiation of contact with axons of other neurons . filopodia of new neurons tend to associate with multiple synapsed axons , while the filopodia of mature neurons tend to sites devoid of other partners . the dynamism of spines allows for the conversion of filopodia into the mushroom spines that are the primary sites of glutamate receptors and synaptic transmission . through a comprehensive neurological examination ( after an extensive case history and patient / doctor consultation ), regions of the nervous system that have become dysfunctional are identified . also targeted are neurological pathways that are well intact ( viable ), which connect with dysfunctional regions . these viable pathways are then manipulated ( non - surgically and non - pharmaceutically ) through various modalities that utilize various myotomal and dermatomal regions to strengthen connections with faulty regions , causing neuroplasticity and regulation and normalization of function . using these methods , the organ systems , neurological pathways that have become dysfunctional , and brain regions that have become dysfunctional are targeted and through various non - invasive procedures , electrochemical signaling between brain regions and between regions of the brain and the body is regulated and normalized . by regulating and normalizing the function of the brain and neural pathways and regulating and normalizing organ function and metabolism , symptoms and conditions are resolved in an overwhelming number of patients with a wide variety of conditions , including breathing disorders , regardless of the underlying mechanism ( however , the underlying mechanisms must be first targeted through extensive and comprehensive testing and case history analysis ). the process begins when a patient is examined by a physician . first , the patient provides information to the physician . the physician can obtain information from the patient through a number of means , such as by presenting a questionnaire to the patient . the physician determines the location of the anatomical lesion in the nervous system of the patient . the physician gets the history of the patient , including the onset of the symptoms complained of , the chronology of the symptoms presented , the quality of the patient &# 39 ; s health the severity and effect of the symptoms on the activities of the patient &# 39 ; s life , any previous treatment that the patient has undergone , medical records and imaging records , and the overall health goals of the patient . the physician also obtains the past health history of the patient , including information related to serious illnesses , hospitalizations and surgeries , any general trauma or injury , whether the patient is in menopause or is pregnant , if the patient is taking medication , whether the patient has allergies , any past diagnostic imaging such as x - ray , mri , cat - scan , doppler , or mra , prior physician care , and the results of past physical or neurological exams . the physician also obtains family and personal health history including family health problems , the patient &# 39 ; s living and environment situation , the patient &# 39 ; s amount of regular exercise , the patient &# 39 ; s interests , diet , sleep pattern , bowel habits , urinary habits , stress factors , and emotional support system . the physician also performs a general review of the systems of the patient . the physician reviews the general status of the patient &# 39 ; s systems , including weight , and any weakness , fatigue , fever , sweats , chills , anorexia , or insomnia experienced by the patient . the physician also reviews other systems of the patient including the patient &# 39 ; s skin , head , eyes , ears , nose , sinuses , throat and mouth , neck , and breasts . the physician also reviews the respiratory , cardiovascular , gastrointestinal , and genitourinary systems . the physician also reviews the female / male sexual organs and endocrine , musculoskeletal , neurological , hematologic , and psychiatric systems of the patient . after obtaining all of the prior information from the patient the physician performs a comprehensive neurological examination of the patient . the neurological examination includes reviewing the emotional attitude , orientation , attention span , speech , memory , and cognition of the patient . the physician next reviews the patient &# 39 ; s vitals and reflexes , such as deep tendon reflexes and pathological reflexes . the physician next performs a sensory exam of the patient , determines muscle strength of the patient , performs orthopedic examinations of the patient , and performs a palpation examination of the patient . the physician also performs a head and neck examination of the patient . this includes an otoscopic exam , opthalamascopic exam , chest exam , abdominal exam , and vascular exam . the physician performs a cranial nerve exam of the patient , including reviewing : blepherospasticity / clonus ; olfactory perception ; rapid eye movement ; optic alignment ; hyper / hypo ; lidlag / ptosis ; pupil size ; corectasia ; cormiosis ; pupillary reflex ; optokinetic tape ; parietal pursuit ; refixation saccade ; cerebellar termination ; cardinal gazes ; hypometria ; hypermetria ; convergence ; exophoria / esophoria ; cover / uncover ; facial paresis ; voluntary motion ; lacrimal function ( eyes / mouth ); weber &# 39 ; s ; rhinne &# 39 ; s ( mastoid ); air cond ; palatal paresis ; gag reflex ; swallowing ; head rotation ; shoulder shrug ; hypoglossal ; and corneal reflex . the physician performs celebellar and cortical testing of the patient , including reviewing : titubation ; romberg &# 39 ; s ; direction of sway ; piano ; supination / pronation ; finger to nose ; heel to toe walk ; direction of sway ; past pointing ; heel down shin ; heel tap ; rapid movement of hands ; rapid movement of thumb / index ; rapid movement of feet ; alternating sup pro ; two point disc . ; graphesthesia ; joint position sense ; heel walk ; and toe walk . the physician performs orthopedic examination of the patient , including reviewing : lower left leg ; lower right leg ; straight leg raise ; bilateral leg raise ; soto hall , leg drop ; braggard &# 39 ; s ; bilateral leg lowering ; goldthwait &# 39 ; s ; lasegue &# 39 ; s sign ; well leg raising ; kemp &# 39 ; s ; ely &# 39 ; s ; and fabere patrick &# 39 ; s . the physician performs posture analysis of the patient including reviewing : head tilt ( roll ); head rotation ( yaw ); head flexion ( positive pitch ); head extension ( negative pitch ); high shoulder ; high hip ; wt . bearing ( center of pressure ); deviation ; ellipse ( r anterior - l posterior / l anterior - r posterior ); gait ; and arm swing . the physician then performs a somatosensory evoked potential ( sep ) test . an sep test studies the relay of body sensations to the brain and how the brain receives those sensations . a stimulating electrode is placed on the patient &# 39 ; s arm or leg . the stimulating electrode then generates an electrical signal . recording electrodes are placed on the patient &# 39 ; s head and / or spine . the information received from these electrodes can be utilized to diagnose the patient &# 39 ; s issue . the sep test evaluates the health of a patient &# 39 ; s peripheral nerves and spinal cord . the sep test also tests how the patient &# 39 ; s spinal cord and / or brain transmits information about body sensations through the patient &# 39 ; s peripheral nerves . the sep test can localize a “ signal blockage ” in the patient &# 39 ; s peripheral nerves , brain , or spinal cord . when recording seps , the physician may seek to study peripheral , spinal , brainstem , and early cortical seps during the same run . recording electrodes placed on the scalp pick up both seps generated in the cortex and thalamocortical fibers ( which are picked up as near - field responses located in restricted areas ) and far - field positivities reflecting the evoked activity generated in peripheral , spinal and brainstem somatosensory fibers . the results of the sep test can be used to determine and define an anatomical level of impairment along a neural pathway or otherwise determine the existence of silent lesions . in the inventive method the physician may begin by performing a series of sep tests on the patient . in each instance , the physician may place the stimulating electrodes on a separate dermatome of the patient . the physician then causes the stimulating electrodes to generate an electrical signal which is recorded by the recording electrodes on the patient &# 39 ; s scalp . after ensuring that sufficient information is received for the first dermatome , the physician then places the stimulating electrodes on another dermatome and repeats the process . the physician repeats this testing process for all dermatomes to ensure that all neural lesions are located . through the results obtained in the testing and medical history , the physician diagnoses the cause of the symptoms . the physician is able to determine the location of the lesion in the nervous system of the patient . the method of the invention provides for treating neurological lesions by instructing the neurological pathways to bypass lesions in the neurological pathway and strengthen connections through synaptogenesis of collateral branches of the neurological pathway . these connections are strengthened by applying a physical application to a chosen dermatome . the process may be utilized in the following ways : the dermatome for c1 can be used to strengthen connections to the coronary , myocardial , and intestinal systems . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the c1 dermatome in this instance . the dermatome for c2 can be used to strengthen connections to the respiratory system and the kidneys . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the c2 dermatome in this instance . the dermatome for c3 can be used to strengthen connections to the gallbladder , gastric , and ileocecal systems . in this instance the location of the neurological lesion is primarily in the celiac ganglion , enteric nervous system or brainstem . a physician applies a chosen modality to activate the c3 dermatome in this instance . the dermatome for c4 can be used to strengthen connections to the pancreas or cecum . in this instance the location of the neurological lesion is primarily in the celiac ganglion , superior mesenteric ganglion , or enteric nervous system . a physician applies a chosen modality to activate the c4 dermatome in this instance . the dermatome for c5 can be used to strengthen connections to the spleen and glandular system . in this instance the location of the neurological lesion is primarily in the hemispheric microglia or celiac ganglion . a physician applies a chosen modality to activate the c5 dermatome in this instance . the dermatome for c6 can be used to strengthen connections to the liver and colon . in this instance the location of the neurological lesion is primarily in the nucleus solitarius brainstem or liver ganglion . a physician applies a chosen modality to activate the c6 dermatome in this instance . the dermatome for c7 can be used to strengthen connections to the adrenals and gonads . in this instance the location of the neurological lesion is primarily in the hypothalamus or pituitary axis . a physician applies a chosen modality to activate the c7 dermatome in this instance . the dermatome for c8 can be used to strengthen connections to the pinkie finger . in this instance the location of the neurological lesion is primarily in the c8 nerve root . a physician applies a chosen modality to activate the c8 dermatome in this instance . the dermatome for t1 can be used to strengthen connections to the coronary system . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the t1 dermatome in this instance . the dermatome for t2 can be used to strengthen connections to the myocardial system . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the t2 dermatome in this instance . the dermatome for t3 can be used to strengthen connections to the respiratory system . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the t3 dermatome in this instance . the dermatome for t4 can be used to strengthen connections to the gallbladder . in this instance the location of the neurological lesion is primarily in the celiac ganglion , enteric nervous system , or brainstem . a physician applies a chosen modality to activate the t4 dermatome in this instance . the dermatome for t5 can be used to strengthen connections to the gastric system . in this instance the location of the neurological lesion is primarily in the celiac ganglion , enteric nervous system , or brainstem . a physician applies a chosen modality to activate the t5 dermatome in this instance . the dermatome for t6 can be used to strengthen connections to the pancreas . in this instance the location of the neurological lesion is primarily in the celiac ganglion , superior mesenteric ganglion , or enteric nervous system . a physician applies a chosen modality to activate the t6 dermatome in this instance . the dermatome for t7 can be used to strengthen connections to the spleen . in this instance the location of the neurological lesion is primarily in the hemispheric microglia or celiac ganglion . a physician applies a chosen modality to activate the t7 dermatome in this instance . the dermatome for t8 can be used to strengthen connections to the liver . in this instance the location of the neurological lesion is primarily in the nucleus solitarius brainstem or liver ganglia . a physician applies a chosen modality to activate the t8 dermatome in this instance . the dermatome for t9 can be used to strengthen connections to the adrenal system . in this instance the location of the neurological lesion is primarily in the hypothalamus or pituitary axis . a physician applies a chosen modality to activate the t9 dermatome in this instance . the dermatome for t10 can be used to strengthen connections to the intestinal system . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the t10 dermatome in this instance . the dermatome for t11 can be used to strengthen connections to the kidneys . in this instance the location of the neurological lesion is primarily in the brain and enteric nervous system . a physician applies a chosen modality to activate the t11 dermatome in this instance . the dermatome for t12 can be used to strengthen connections to the kidneys . in this instance the location of the neurological lesion is primarily in the brainstem and enteric nervous system . a physician applies a chosen modality to activate the t12 dermatome in this instance . the dermatome for l1 can be used to strengthen connections to the ileocecal valve . in this instance the location of the neurological lesion is primarily in the celiac ganglion , enteric nervous system , or brainstem . a physician applies a chosen modality to activate the l1 dermatome in this instance . the dermatome for l2 can be used to strengthen connections to the celiac ganglion , superior mesenteric ganglion , and enteric nervous system . in this instance the location of the neurological lesion is primarily in the . a physician applies a chosen modality to activate the l2 dermatome in this instance . the dermatome for l3 can be used to strengthen connections to the glandular system . in this instance the location of the neurological lesion is primarily in the hemispheric microglia or celiac ganglion . a physician applies a chosen modality to activate the l3 dermatome in this instance . the dermatome for l4 can be used to strengthen connections to the colon . in this instance the location of the neurological lesion is primarily in the nucleus solitarius brainstem or liver ganglia . a physician applies a chosen modality to activate the l4 dermatome in this instance . the dermatome for l5 can be used to strengthen connections to the gonads . in this instance the location of the neurological lesion is primarily in the hypothalamus or pituitary axis . a physician applies a chosen modality to activate the l5 dermatome in this instance . the dermatome for s1 can be used to strengthen connections to the gallbladder and gastric system . in this instance the location of the neurological lesion is primarily in the celiac ganglion , enteric nervous system , or brainstem . a physician applies a chosen modality to activate the s1 dermatome in this instance . the dermatome for s2 can be used to strengthen connections to the pancreas and cecum . in this instance the location of the neurological lesion is primarily in the celiac ganglion , superior mesenteric ganglion , or the enteric nervous system . a physician applies a chosen modality to activate the s2 dermatome in this instance . the dermatome for s3 can be used to strengthen connections to the rectal sphincter . in this instance the location of the neurological lesion is primarily in the frontal lobe or pelvic plexus . a physician applies a chosen modality to activate the s3 dermatome in this instance . the dermatome for s4 can be used to strengthen connections to the liver or colon . in this instance the location of the neurological lesion is primarily in the nucleus solitarius brainstem or the liver ganglia . a physician applies a chosen modality to activate the s4 dermatome in this instance . the dermatome for s5 can be used to strengthen connections to the perianal area . in this instance the location of the neurological lesion is primarily in the frontal lobe or pelvic plexus . a physician applies a chosen modality to activate the s5 dermatome in this instance . the physician can choose a selected modality to activate each dermatome . the chosen modality may be any type of stimuli applied to the surface of a dermatome . the chosen modality may activate mechanoreceptors , thermoreceptors , nocireceptors , or otherwise activate the firing of nerves from the chosen dermatome . in one modality , the physician may choose to activate mechanoreceptors in the dermatome by applying physical pressure , vibration , or stretch stimuli . for instance , a physician can use a reflex hammer , such as that disclosed in u . s . pat . no . 3 , 515 , 125 ( ruskin ), u . s . pat . no . 4 , 324 , 261 ( mark et al . ), or u . s . pat . no . 5 , 657 , 763 ( schneider ) each of which is hereby fully incorporated by reference , to apply pressure to the chosen dermatome . the physician may also use the reflex hammer to stretch the patient &# 39 ; s skin at the chosen dermatome . the physician may use the reflex hammer to manually apply vibrations to the chosen dermatome . alternatively , the physician may use a tuning fork , such as that disclosed in u . s . pat . no . 1 , 880 , 923 ( eisenhour ), which is hereby fully incorporated by reference , to apply pressure or vibrations to the selected dermatome . alternatively , the physician may perform these actions utilizing a stylus of a chiropractic adjusting instrument , also known as a chiropractic activator , such as that disclosed in u . s . d269 , 812 ( lancellotti ) or u . s . pat . no . 6 , 379 , 375 ( fuhr ) each of which is hereby fully incorporated by reference . alternatively , the physician may utilize an electrical vibration device , known as an arthrostim device , such as that disclosed in u . s . pat . no . 4 , 841 , 955 ( evans et al .) or u . s . pat . no . 6 , 228 , 042 ( dungan ) each of which is hereby full incorporated by reference , to apply vibration stimuli to the chosen dermatome . the electrical vibration device has a pressure sensitive stylus which vibrates longitudinally . the electrical vibration device produces a rapid recoiling of the stylus . the electrical vibration device activates the patients &# 39 ; proprioceptors and mechanoreceptors without recruiting the nocioceptors . in another modality , the physician may choose to activate thermoreceptors in the dermatome by applying heat or a cold press to the patient &# 39 ; s skin surface . for instance , the physician could activate the thermoreceptors of a chosen dermatome with heat by applying a heating pad to the patient &# 39 ; s skin . a physician may also use cold to activate the thermoreceptors by applying ice or a cold press to the patient &# 39 ; s skin . in another modality , the physician may choose to activate nociceptors in the dermatome by presenting pain inducing stimuli to the patient &# 39 ; s skin surface . the physician may do this by applying a sharp point of a needle to the patient &# 39 ; s skin . in addition , the physician may apply a pinwheel , such as that disclosed in u . s . pat . no . 5 , 433 , 212 ( greenfield ) which is hereby fully incorporated by reference , to the patient &# 39 ; s skin at the chosen dermatome . in another modality , the physician may apply an electrical microcurrent to the dermatome . the electrical microcurrent activates the firing of nerves from the dermatome . the physician may utilize a transcutaneous electrical nerve stimulation unit ( tens unit ), such as that disclosed in u . s . pat . no . 4 , 989 , 605 ( rossen ) which is hereby fully incorporated by reference , to activate the neurons in a chosen dermatome . in this modality the physician would apply two or more electrodes to the patient &# 39 ; s skin at the chosen dermatome . the tens unit applies a high frequency series of electrical stimuli ( greater than 50 hz ) at an intensity lower than that required to initiate motor contraction . alternatively , the physician may choose to utilize a somatosensory evoked potential ( sep ) unit and method , such as that disclosed in u . s . 20060276720 ( mcginnis et al .) which is hereby fully incorporated by reference . in this modality the physician applies one or more stimulating electrodes on the chosen dermatome . the physician places one or more recording electrodes on the patient &# 39 ; s head or spine . the physician then causes the stimulating electrodes to generate an electrical signal which travels from the stimulating electrodes through a patient &# 39 ; s neural pathway and is captured by the recording electrodes . these modalities target neurological pathways that are well intact ( viable ), which connect with dysfunctional regions . these viable pathways are then manipulated ( non - surgically and non - pharmaceutically ), through the various modalities applied to various myotomal and dermatomal regions , to strengthen connections with faulty regions , causing neuroplasticity and regulation and normalization of function . the modalities operate to stimulate the neural network connected to the chosen dermatome . this stimulation produces neuroplasticity via synaptogenesis in the collateral nerve branches of the activated neural network . through repeated application of the modalities to the chosen dermatome , the collateral branches of the neural pathway are strengthened , thereby bypassing any lesion blocking normal pathway processes . the physician may apply any number or type of these modalities of treatment to the chosen dermatome ( s ). to ensure improvement of the neural network and that the modality has caused a bypass of the neural lesion , the physician repeats the initial testing . this repeated testing may include full testing or solely a repeated sep test procedure . the repeated testing allows a physician to determine an improvement in the patient &# 39 ; s position and ensure that the chosen modality is clinically effective . referring to fig5 , an example of an application of the invention is illustrated . in this example a neural lesion 300 exists in a spinal nerve emanating from t1 and innervating the a - v node 306 of the heart 304 . the neural lesion 300 may make itself known through a number of symptoms , such as arrhythmia . to compensate for this neural lesion 300 , the physician applies a chosen modality to the t2 dermatome . applying the modality to the t2 dermatome activates neuroplasticity via synaptogenesis between the t2 nerve and t1 nerve along collateral branches at a synaptogenesis point 302 . signals traveling along the t1 nerve can thus bypass the lesion 300 by traveling along the t2 nerve and crossing over at the synaptogenesis point 302 . this bypass can resolve any symptoms presented by the patient . the example is further illustrated in fig6 at the systems level . as shown in fig6 , the heart 304 has a neural lesion 300 at the connection of the spinal nerve . the spinal nerve carries somatosensory information from the heart 304 , through the spinal cord 102 , and into the brain 308 . based on information received by the brain 308 , the brain 308 will send a motor signal to the heart 304 , controlling the actions of the heart . if the brain 308 is not receiving correct information about the status of the heat 304 due to the neural lesion 300 , then the brain 308 is sending a motor signal to control the heart 304 that is incorrect . for instance , due to the neural lesion 300 the brain may believe that the heart 304 is beating slower than it is in reality and therefore send a motor signal to increase heart rate when an increase is not needed . such a motor signal would therefore lead to arrhythmia in the patient . the inventive method seeks to cause integration in the brain 308 by changing the sensory signals received by the brain 308 . in this instance , a physician applies a chosen modality to a selected dermatome 100 . the modality causes a somatosensory signal to be sent from the dermatome 100 , through the spinal cord 102 , and to the brain 308 . because the somatosensory signal from the dermatome 100 is received by the brain 308 in the same manner as that from the heart 304 , the brain bases its motor signal response based on the combination of signals - essentially interpreting the somatosensory signal from the dermatome 100 as having come from the heart 308 . by applying the chosen modality to the dermatome 100 , the brain 308 is now integrating all sensory input and resetting the motor signal it generates , thereby correcting for deficiencies created by the neural lesion 300 . the method of the invention is illustrated by fig7 . first the physician performs neurological diagnostic testing of the subject 400 . then the physician determines the existence and the location of a neural lesion in the subject 402 . the physician selects a dermatome on the subject that is innervated by a nerve that is connected to a neural pathway containing the neural lesion 404 . the physician then applies a therapeutic modality to the selected dermatome 406 . the physician may then perform diagnostic testing of the subject to ensure efficacy of the therapeutic modality 408 . the inventive methodology can be used to treat the causes of addiction . standard models treat addiction in a number of ways but primarily target the symptoms of addition rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of addition . the inventive methodology can be used to treat the causes of adhd . standard models treat adhd in a number of ways but primarily target the symptoms of adhd rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of adhd . the inventive methodology can be used to treat the causes of alzheimer &# 39 ; s . standard models treat alzheimer &# 39 ; s in a number of ways but primarily target the symptoms of alzheimer &# 39 ; s rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of alzheimer &# 39 ; s . the inventive methodology can be used to treat the causes of als . standard models treat als in a number of ways but primarily target the symptoms of als rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of als . the inventive methodology can be used to treat the causes of anxiety . standard models treat anxiety in a number of ways but primarily target the symptoms of anxiety rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of anxiety . the inventive methodology can be used to treat the causes of autism . standard models treat autism in a number of ways but primarily target the symptoms of autism rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of autism . the inventive methodology can be used to treat the causes of balance disorders . standard models treat balance disorders in a number of ways but primarily target the symptoms of balance disorders rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of balance disorders . the inventive methodology can be used to treat the causes of breathing disorders . standard models treat breathing disorders in a number of ways but primarily target the symptoms of breathing disorders rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of breathing disorders . the inventive methodology can be used to treat the causes of carpal tunnel . standard models treat carpal tunnel in a number of ways but primarily target the symptoms of carpal tunnel rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of carpal tunnel . the inventive methodology can be used to treat the causes of celiac disease . standard models treat celiac disease in a number of ways but primarily target the symptoms of celiac disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of celiac disease . the inventive methodology can be used to treat the causes of cerebral palsy . standard models treat cerebral palsy in a number of ways but primarily target the symptoms of cerebral palsy rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of cerebral palsy . the inventive methodology can be used to treat the causes of chronic fatigue . standard models treat chronic fatigue in a number of ways but primarily target the symptoms of chronic fatigue rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of chronic fatigue . the inventive methodology can be used to treat the causes of chronic neck and back pain . standard models treat chronic neck and back pain in a number of ways but primarily target the symptoms of chronic neck and back pain rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of chronic neck and back pain . the inventive methodology can be used to treat the causes of dangerous diet . standard models treat dangerous diet in a number of ways but primarily target the symptoms of dangerous diet rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of dangerous diet . the inventive methodology can be used to treat the causes of diabetes . standard models treat diabetes in a number of ways but primarily target the symptoms of diabetes rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of diabetes . the inventive methodology can be used to treat the causes of dysauntonomia . standard models treat dysauntonomia in a number of ways but primarily target the symptoms of dysauntonomia rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of dysautonomia . the inventive methodology can be used to treat the causes of dystonia . standard models treat dystonia in a number of ways but primarily target the symptoms of dystonia rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of dystonia . the inventive methodology can be used to treat the causes of esophageal disorders . standard models treat esophageal disorders in a number of ways but primarily target the symptoms of esophageal disorders rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of esophageal disorders . the inventive methodology can be used to treat the causes of fibromyalgia . standard models treat fibromyalgia in a number of ways but primarily target the symptoms of fibromyalgia rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of fibromyalgia . the inventive methodology can be used to treat the causes of headaches . standard models treat headaches in a number of ways but primarily target the symptoms of headaches rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of headaches . the inventive methodology can be used to treat the causes of homeostasis . standard models treat homeostasis in a number of ways but primarily target the symptoms of homeostasis rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of homeostasis . the inventive methodology can be used to treat the causes of hypertension . standard models treat hypertension in a number of ways but primarily target the symptoms of hypertension rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of hypertension . the inventive methodology can be used to treat the causes of hyperthyroidism . standard models treat hyperthyroidism in a number of ways but primarily target the symptoms of hyperthyroidism rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of hyperthyroidism . the inventive methodology can be used to treat the causes of hypothyroidism . standard models treat hypothyroidism in a number of ways but primarily target the symptoms of hypothyroidism rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of hypothyroidism . the inventive methodology can be used to treat the causes of inflammatory bowel disease . standard models treat inflammatory bowel disease in a number of ways but primarily target the symptoms of inflammatory bowel disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of inflammatory bowel disease . the inventive methodology can be used to treat the causes of kidney disease . standard models treat kidney disease in a number of ways but primarily target the symptoms of kidney disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of kidney disease . the inventive methodology can be used to treat the causes of liver disease . standard models treat liver disease in a number of ways but primarily target the symptoms of liver disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of liver disease . the inventive methodology can be used to treat the causes of multiple sclerosis . standard models treat multiple sclerosis in a number of ways but primarily target the symptoms of multiple sclerosis rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of multiple sclerosis . the inventive methodology can be used to treat the causes of parkinson &# 39 ; s disease . standard models treat parkinson &# 39 ; s disease in a number of ways but primarily target the symptoms of parkinson &# 39 ; s disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of parkinson &# 39 ; s disease . the inventive methodology can be used to treat the causes of peripheral . standard models treat peripheral in a number of ways but primarily target the symptoms of peripheral rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of peripheral . the inventive methodology can be used to treat the causes of psoriasis . standard models treat psoriasis in a number of ways but primarily target the symptoms of psoriasis rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of psoriasis . the inventive methodology can be used to treat the causes of restless leg syndrome . standard models treat restless leg syndrome in a number of ways but primarily target the symptoms of restless leg syndrome rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of restless leg syndrome . the inventive methodology can be used to treat the causes of stoke . standard models treat stroke in a number of ways but primarily target the symptoms of stroke rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of stroke . the inventive methodology can be used to treat the causes of tremor . standard models treat tremor in a number of ways but primarily target the symptoms of tremor rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of tremor . the inventive methodology can be used to treat the causes of vascular disease . standard models treat vascular disease in a number of ways but primarily target the symptoms of vascular disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of vascular disease . what has been described above includes examples of the claimed subject matter . it is , of course , not possible to describe every conceivable combination of components or methodologies for purposes of describing the claimed subject matter , but one of ordinary skill in the art can recognize that many further combinations and permutations of such matter are possible . accordingly , the claimed subject matter is intended to embrace all such alterations , modifications and variations that fall within the spirit and scope of the appended claims . furthermore , to the extent that the term “ includes ” is used in either the detailed description or the claims , such term is intended to be inclusive in a manner similar to the term “ comprising ” as “ comprising ” is interpreted when employed as a transitional word in a claim . the foregoing method descriptions and the process flow diagrams are provided merely as illustrative examples and are not intended to require or imply that the steps of the various embodiments must be performed in the order presented . as will be appreciated by one of skill in the art the order of steps in the foregoing embodiments may be performed in any order . words such as “ thereafter ,” “ then ,” “ next ,” etc . are not intended to limit the order of the steps ; these words are simply used to guide the reader through the description of the methods . further , any reference to claim elements in the singular , for example , using the articles “ a ,” “ an ” or “ the ” is not to be construed as limiting the element to the singular . the preceding description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the following claims and the principles and novel features disclosed herein .	0
in the following detailed description , numerous specific details are set forth to provide a full understanding of the present invention . it will be apparent , however , to one ordinarily skilled in the art that the present invention may be practiced without some of these specific details . in other instances , well - known structures and techniques have not been shown in detail to avoid unnecessarily obscuring the present invention . the word “ exemplary ” is used herein to mean “ serving as an example , instance , or illustration .” any embodiment or design described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments or designs . fig1 is a schematic diagram illustrating an exemplary eamr head 100 comprising a slider 101 and a near field transducer 158 according to one aspect of the subject technology . the slider 101 comprises a substrate 110 , a recorder / reader layer 120 disposed over the substrate 110 , and an overcoat layer 130 disposed over the recorder / reader layer 120 . in the illustrated example , the substrate 110 comprises altic and the overcoat layer 130 comprises alumina . the slider 101 has a leading edge 107 and a trailing edge 109 , and an air - bearing surface ( abs ) 105 facing a magnetic recording medium 103 . the recorder / reader layer 120 of the slider 101 includes a writer 122 for recording or erasing information on the medium 103 by focusing a magnetic field on a spot on the medium 103 , a coil 124 for generating the magnetic field , a reader 126 for reading a magnetic bit recorded on the medium 103 , and a waveguide structure 150 . the waveguide structure 150 is configured to couple incident laser beam 171 from a laser diode 102 into a waveguide core layer 154 disposed in the coupler 150 . the waveguide structure 150 includes a first clad layer 152 and a second clad layer 156 surrounding the waveguide core layer 154 . disposed at an interface between the second clad layer 156 and the waveguide core layer 154 is a grating 128 having a period and a depth selected to couple incident laser beam 171 into waveguide core layer 154 . the waveguide structure 150 further includes a near field transducer ( nft ) 158 formed at a distal end of the waveguide structure 150 proximate the abs 109 . the nft 158 is configured to concentrate energy from the laser beam to a nano - sized spot on the recording medium 103 well below the so - called “ diffraction limit ” imposed on standard focusing lenses . the nft 158 is typically formed of a metal such as gold ( au ), silver ( ag ), aluminum ( al ), copper ( cu ), or a combination ( alloy ) thereof . the eamr head 100 can also includes a laser diode 102 configured to generate a laser beam in response to an electrical power applied thereto . in certain embodiments , the laser diode is affixed to the slider 101 . in some embodiments , the laser diode can be a vertical - cavity - surface - emitting laser ( vcsel ). in other embodiments , the laser diode 102 can be a separate structure disposed at a certain distance from the slider 101 and transmitting light to the waveguide structure 150 via an airgap . during the operation of a hard disk drive comprising the eamr head 100 , the magnetic recording medium 103 rotates at high speed , and air flowing at high speed between the abs 105 and the magnetic recording medium 103 provides an upward force to the slider 101 such that the slider 101 is maintained at a certain height from the magnetic recording medium 103 . a portion of the incident laser beam 171 emitted by the laser diode 102 and arrived at the waveguide structure 150 is coupled into the waveguide core layer 154 by means of the grating 128 to form a coupled laser beam 172 traveling down the waveguide core layer 154 toward the abs 105 . the coupled laser beam 172 is concentrated onto a nano - sized spot on recording medium 103 by means of the nft 158 . the nano - sized heated spot on the magnetic medium 103 is subsequently subjected to a pulse of write magnetic field from the writer 122 . viewed from the perspective of a power flow , a portion of an electrical energy provided to the laser diode 102 is converted into an incident optical power by the laser diode 102 in the form of the incident laser beam 171 . a portion of the incident optical power is coupled into the waveguide core layer 154 as a coupled optical power in the form of the coupled laser beam 172 . a portion of the coupled optical power is transmitted to the magnetic recording medium 103 as near field radiation 173 , which is absorbed by a nano - sized spot on the magnetic recording medium 103 to generate heat therein . typically , an optical conversion efficiency of the nft 158 — the percentage of the coupled optical power converted into the focused optical power using the above - defined terminologies — is in the range of 1 - 10 %. a portion of the coupled optical power not converted into the focused optical power generates heat at the nft and a surrounding region . the heat at nft 158 and the surrounding portion of the slider may cause the region to protrude above the abs 105 . fig2 is a graph showing a simulated trace 201 of such a heat - induced protrusion as a function of a distance measured from the left edge of the substrate 110 ( fig1 ), with the + direction being towards the trailing edge 109 of the slider 101 . the trace 201 shows a sharp protrusion at a region comprising the nft and a portion of the slider surrounding the nft , with its peak occurring at the center of the nft . this simulation is performed with the assumption that 20 mw of optical power is applied to a volume of 273 nm × 180 nm × 100 nm at the write gap ( wg ). it can be seen that the protrusion is very localized due to the small size of the heat source . in the simulation embodiment , the maximum protrusion beyond the abs is seen to be 50 nm at 20 mw . even if the optical power is reduced by half , e . g ., to 10 mw , the nft protrusion above the abs is still in the range of 20 - 30 nm . considering that the slider can float at a height in the range of few nanometers above the magnetic recording medium , such a heat - induced nft protrusion may result in the chipping or cracking of the nft and damage to the recording media . to reduce or eliminate such a heat - induced nft protrusion , a fabrication process of the eamr head can be configured to modify a shape of a region of the abs surrounding the nft to compensate for the heat - induced nft protrusion , according to one aspect of the subject technology . in particular , the process can involve iteratively applying increasingly larger levels of optical power to the nft , thereby generating heat in the nft and the surrounding region , and removing a corresponding heat - induced protrusion at the nft and the surrounding slider portion . fig3 is a flowchart illustrating an exemplary iterative heat - and - remove process 300 for producing an eamr head . the iterative heat - and - remove process 300 begins at state 310 and proceeds to a state 320 , in which a first level of optical power ( p opt ) is applied to the nft . as explained above , the optical power is delivered to the nft in the form of a laser light ( e . g ., the coupled laser beam 172 of fig1 ), and the optical power generates heat in the nft and a surrounding portion of the slider . the laser light and its associated optical power can be coupled from a laser source ( either affixed to the slider or separate ) into a waveguide ( e . g ., the waveguide structure 150 of fig1 ) formed in the eamr head and directed to the nft . alternatively , the laser light can be applied directly to the nft from an external laser source during the fabrication process . regardless of the chosen channel , the first level of optical power carried by the laser light generates heat at the nft , which heat , in turn , induces a first localized protrusion in a region comprising the nft and the surrounding slider portion as described above . the process 300 proceeds to a state 330 , in which the first localized protrusion is removed by , e . g ., a bar lapping process . in one embodiment , the bar lapping process is a chemical - mechanical polishing ( cmp ) process . in certain embodiments , the removal process is performed while a constant optical power is applied to the nft . in other embodiments , the optical power is increasing while the removal process is in progress . in yet other embodiments , the optical power is temporarily turned off during the removal process . the process 300 proceeds to a decision state 340 , in which a query is made as to whether p opt has reached a preset final optical power . in certain embodiments , the preset final optical power corresponds to an operational level of optical power for use during a recording operation of the eamr head . in other embodiments , the preset final optical power can be a level of optical power different from the operational level due to the need to compensate for a thermal variation caused by the removal process or due to the fact that the optical power is being delivered by an external laser source during the fabrication process in which case the optical power required to produce the same amount of heat at the nft may be different from the operational optical power delivered via the waveguide structure . if the answer to the query at the decision state 340 is yes , the process 300 ends at state 390 . on the other hand , if the answer is no , the process 300 continues at a state 350 , in which the optical power is increased to a next level , and then proceeds to the state 320 , in which the next level of optical power is applied to the nft . the next level of optical power generates a next level of heat at the nft , which heat , in turn , induces a next localized protrusion in the region comprising the nft and the surrounding slider portion . the next localized protrusion is removed at the state 330 . the heat - and - remove process of the states 320 , 330 , 340 , and 350 is repeated until the optical power has reached a preset final optical power . it shall be appreciated that many variations to the iterative heat - and - remove process 300 described above are possible without departing from the scope of the present disclosure . for example , in those embodiments in which a constant or increasing optical power is applied during the removal process , the states 320 and 330 may be combined into a single state , in which the localized protrusion is removed while the constant or increasing optical power is applied to the nft . in the latter case in which the optical power is increased during the removal process , the state 350 may not be performed as a separate step . the iterative heat - and - remove process 300 described above is terminated when the optical power reaches a preset final optical power . for example , according to one aspect of the subject technology , the process may complete after a preset number of steps ( e . g ., 10 of 2 mw increments for an exemplary final optical power of 20 mw ). alternatively , the process may be terminated after a certain other condition is satisfied . for example , the temperature of the abs near the nft can be measured by a contact or remote measurement method , and the process can be terminated when the measured temperature reaches a preset final temperature . an iterative heat - and - remove process such as the one described above with respect to fig3 is superior to a single ( non - iterative ) heat - and - remove process in which a preset maximum optical power is applied to the nft and the corresponding heat - induced protrusion is removed in a single step , because such a single heat - and - remove process can lead to an abrupt breakage in the nft protrusion and cause an attendant damage to the nft during the removal process . by iteratively applying increased levels of heat to the nft and removing corresponding incremental protrusions , the iterative heat - and - remove method described herein can prevent breakage of the nft and also produces a smooth surrounding concave surface in the slider at the end of the removal process . fig4 a and 4b are cross - sectional views of a slider 401 having a near field transducer ( nft ) 410 modified by an iterative heat - and - remove process such as the one described above . fig4 a corresponds to a case in which no optical power is applied to the nft 410 , and fig4 b corresponds to a case in which an operational optical power ( e . g ., the optical power to be used during a recording operation ) is applied to the nft 410 . the shown section of the slider 401 has an abs 405 . the nft 410 has a distal end 412 proximate the abs 405 . the distal end 412 of the nft 410 is recessed from the abs 405 when no optical power is applied to the nft 410 as shown in fig4 a , and is co - planar with the abs 405 when a predetermined amount of optical power ( e . g ., an operational optical power ) is applied to the nft 410 as shown in fig4 b . a portion of the slider 401 surrounding the distal end 412 of the nft 410 forms a concave surface 430 a having a continuously varying slope when no optical power is applied to the nft 410 as shown in fig4 a , and a substantially flat surface 430 b coplanar with the abs 405 and the distal end 412 of the nft 410 when the predetermined optical power is applied to the nft 410 . as shown in fig4 a , for example , there is a smooth transition from the abs 405 to the concave surface 430 a without a sharp edge such as a 90 - degree bend . similarly , there is a smooth transition from the concave side surface to the bottom of the recess without a sharp edge such as a 90 - degree bend . put another way , a region 407 comprising the concave surface 430 a and its surrounding abs portion has a continuously - varying slope ( e . g ., continuously differentiable without a discontinuity ). a recess having such a smooth surface with a continuously - varying slope caused by the iterative heat - and - remove process described herein has several advantages over a recess having sharp 90 - degree edges at the top and bottom of the recess . for example , the smooth surface reduces the risk of having debris particles stuck in the recess after the fabrication and causing aberrations ( e . g ., absorption , attenuation , diffraction , divergence ) in the focused laser beam pattern . in addition , as fig4 b illustrates , the smoothed - surface recess turns into a flat surface co - planar with the abs 405 and the distal end 412 of the nft 410 when an operational optical power is applied to the nft 410 . in contrast , a recess having 90 - degree edges at the top and bottom when no optical power is applied turns into an irregular surface not coplanar with the abs and the nft when an operational optical power is applied to the nft . such a non - coplanar surface can produce a portion of the slider slightly protruding beyond the abs or the distal end of the nft slightly below the abs with the attendant degradation in the focusing ability of the nft . the description of the invention is provided to enable any person skilled in the art to practice the various embodiments described herein . while the present invention has been particularly described with reference to the various figures and embodiments , it should be understood that these are for illustration purposes only and should not be taken as limiting the scope of the invention . there may be many other ways to implement the invention . various functions and elements described herein may be partitioned differently from those shown without departing from the spirit and scope of the invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and generic principles defined herein may be applied to other embodiments . thus , many changes and modifications may be made to the invention , by one having ordinary skill in the art , without departing from the spirit and scope of the invention . a reference to an element in the singular is not intended to mean “ one and only one ” unless specifically stated , but rather “ one or more .” the term “ some ” refers to one or more . underlined and / or italicized headings and subheadings are used for convenience only , do not limit the invention , and are not referred to in connection with the interpretation of the description of the invention . all structural and functional equivalents to the elements of the various embodiments of the invention described throughout this disclosure that are known or later come to be known to those of ordinary skill in the art are expressly incorporated herein by reference and intended to be encompassed by the invention . moreover , nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the above description .	8
in accordance with an exemplary embodiment , conductive ink based circuits , which are embedded as part of an electronic smoking article are disclosed . the conductive ink based circuits permit the operation of the electronic smoking article only when used with genuine or approved parts . in accordance with an exemplary embodiment , a conductive ink circuit can be embedded across a two - piece design or among a three - piece design such that the circuit , that activates the power supply and the aerosol generation unit , can be activated only when genuine parts are connected together . in accordance with an exemplary embodiment , a conductive ink based circuit can be placed between the flavor unit ( or cartridge ) and aerosol generation unit or power supply unit , to activate the article when a genuine or approved flavor unit or cartridge is connected to the electronic smoking article . in accordance with an exemplary embodiment , the conductive ink based circuit can be used to initiate pre - heating of the heater of the electronic smoking article when the user picks up the smoking article for smoking . the preheating of the heater can help to reduce the latency and improve quantity of aerosol delivered during the initial puffs . in addition , control measures can be incorporated to cut off the power supply to the heater , if a puff is not detected , using a puff detector , within a set time period after the initial handling of the smoking article . fig1 shows an electronic smoking article 100 in accordance with an exemplary embodiment . as shown in fig1 , the electronic smoking article 100 includes a housing 110 having a mouth end 112 and an upstream end 114 . in the upstream end 114 , there is provided an electric power supply in the form of power supply 120 and electric circuitry in the form of circuitry 122 . in the mouth end 112 , the smoking article 100 includes a cartridge 140 , a heater 144 , and a capillary wick ( or capillary tube ) 146 . the cartridge 140 , the heater 144 , and the capillary wick ( or capillary tube ) 146 can form the aerosol generation unit 148 . in operation , the cartridge 140 delivers a liquid material 152 from a liquid supply reservoir ( or fluid reservoir ) 150 to the capillary wick 146 , which is surrounded by the heater 144 . in accordance with an exemplary embodiment , one end of the capillary wick 146 extends to the cartridge 140 and the other end of the capillary wick 146 is surrounded by the heater 144 . the heater 144 is connected to the electric circuitry 122 via connections ( not shown ). the housing 110 also includes an air inlet 160 , an outlet 162 at the mouth end 112 , and an aerosol forming chamber 170 . in use , the liquid material 152 is supplied from the fluid reservoir 150 to the capillary wick 146 , which as shown in fig1 is surrounded by the heater 144 . when a user draws on the electronic smoking article 100 at the air outlet 162 , ambient air can be drawn through air inlet 160 . in accordance with an exemplary embodiment , the electronic smoking article 100 can include a puff detection system ( not shown ), which is part of the circuitry 122 on the upstream end 114 of the smoking article 100 . the puff detection system can sense the puff and can activate the heater 144 and supply the liquid material to the capillary wick 146 . the power supply 120 supplies pulses of energy to the heater 144 to heat the end of the capillary wick 146 surrounded by the heater 144 . the liquid material 152 in the outlet end 147 of the capillary wick 146 is vaporized by the heater 144 to create a supersaturated vapor . at the same time , the liquid material 152 being vaporized is replaced by addition liquid material 152 moving along the capillary wick 146 . in accordance with an exemplary embodiment , the supersaturated vapor created is mixed with and carried in the air flow from the air inlet 160 . in the aerosol forming chamber 170 , the vapor condenses to form an inhalable aerosol , which is carried towards the outlet 162 and into the mouth of the user . the circuitry 122 and the puff detection system ( not shown ) are preferably programmable . in accordance with an exemplary embodiment , the circuitry 122 and puff detection system can be used to manage the operation of the electronic smoking article 100 . in use , once the capillary wick 146 is heated , the liquid material contained within a heated portion of the capillary wick 146 is volatilized and ejected out of the outlet 147 where it expands and mixes with air and forms an aerosol in a mixing chamber 170 . the electronic smoking article 100 also includes at least one air inlet 160 operable to deliver air to the mixing chamber 170 . preferably , the air inlets 160 to the mixing chamber 170 can be arranged downstream of the capillary wick 146 so as to minimize drawing air along the capillary and thereby avoid cooling of the capillary wick 146 during heating cycles . in use , the volatilized material expands out of the wick 146 and into the mixing chamber 170 where the volatized material can mix with air to form an aerosol which is then drawn through the outlet 162 . in an exemplary embodiment , the at least one air inlet 160 includes one or two air inlets 160 . alternatively , the air inlets 160 can be three , four , or five or more . in accordance with an exemplary embodiment , the size and number of air inlets 160 can also aid in establishing the resistance to draw of the electronic smoking article 100 . the power supply 120 can be a lithium - ion battery or one of its variants , for example a lithium - ion polymer battery . alternatively , the power supply 120 may be a nickel - metal hydride battery , a nickel cadmium battery , a lithium - manganese battery , a lithium - cobalt battery or a fuel cell . in accordance with an exemplary embodiment , the electronic smoking article 100 is usable by a smoker until the energy in the power supply is depleted . alternatively , the power supply 120 may be rechargeable and can include circuitry ( not shown ) allowing the battery to be chargeable by an external charging device . for example , the circuitry , when charged , can provide power for a pre - determined number of puffs , after which the circuitry must be re - connected to an external charging device . the electronic smoking article 100 can also include control circuitry 122 , which can be on a printed circuit board having a processor . in accordance with an exemplary embodiment , the liquid material 152 includes a tobacco - containing material including volatile tobacco flavor compounds which are released from the liquid upon heating . the liquid material 152 may also be a tobacco flavor containing material or a nicotine - containing material . alternatively , or in addition , the liquid material 152 may include a non - tobacco material . for example , the liquid material 152 may include water , solvents , ethanol , plant extracts and natural or artificial flavors . preferably , the liquid material further includes an aerosol former . examples of suitable aerosol formers are glycerine and propylene glycol . in accordance with an exemplary embodiment , the aerosol generation unit includes the liquid supply reservoir 150 and a capillary wick 146 for holding liquid received from the liquid reservoir . in accordance with an exemplary embodiment , rather than a capillary wick 146 , the aerosol generation unit 148 can include a capillary tube ( not shown ) having an inlet and an outlet , the inlet being in communication with the outlet of the liquid supply reservoir , and the at least one heater 144 is operable to heat the capillary tube to a temperature sufficient to at least initially volatilize the liquid material contained within the capillary tube . the control circuitry 122 can also include a heater activation light ( not shown ) at an upstream end of the smoking article 100 , which is operable to glow when the heater 144 is activated . the control circuitry 122 can also include a timer operable to limit the time for which power is supplied to the heater 144 . the time - period of the electric current supply to the heater 144 may be pre - set depending on the amount of liquid material 152 desired to be vaporized . for example , the control circuitry 122 can be programmable for this purpose . in accordance with an exemplary embodiment , when activated , the heater 144 heats a portion of the wick 146 for less than about 10 seconds , more preferably less than about 7 seconds . thus , the power cycle ( or maximum puff length ) can range in period from about 1 second to about 10 seconds . fig2 is a side view of an electronic smoking article 100 in accordance with an exemplary embodiment having a first section 210 and a second section 220 , which forms a conductive ink circuit upon assembly thereof . as shown , the electronic smoking article 100 includes a first section 210 , which includes an aerosol generation unit 211 and a second section 220 , which includes a power supply portion 221 , which can be coupled together at a threaded joint ( not shown ) or by other convenience such as a snug - fit , snap - fit , detent , clamp and / or clasp . in accordance with an exemplary embodiment , the aerosol generation unit 211 can include the at least one heater 144 , a liquid reservoir 150 having a liquid material 152 therein , and a capillary wick ( or capillary tube ) 146 . the power supply section 221 includes a power supply 120 and circuitry 122 , which is operable to apply voltage to the at least one heater 144 for heating the liquid material 152 in at least a portion of the aerosol generation unit 148 to form an aerosol . in accordance with an exemplary embodiment , a portion 212 , 222 of the conductive ink circuit is embedded within the first and second sections 210 , 220 , respectively , and the power supply and the aerosol generation unit 148 can be activated upon formation of a circuit formed by connecting or coupling the first and second sections 210 , 220 to one another . the portions 212 , 222 of the conductive ink circuit can be embedded within the outer housing 216 , 226 as shown in fig2 . alternatively , the portions 212 , 222 can form part of the electrical circuit within the smoking article 100 . for example , in accordance with an exemplary embodiment , the conductive ink circuit can be formed by the connection of the first and second sections 210 , 220 to form the electrical circuit , which provides power from the power supply 120 to the at least one heater 144 within the aerosol generation unit . alternatively , the conductive ink circuit formed by the connection of the first and second portions 212 , 222 can form a circuit in communication with the circuitry 122 of the smoking article 100 , and upon establishing the conductive ink circuit , the circuitry 122 enables the power supply 122 to provide power to the at least one heater 144 . in accordance with an exemplary embodiment , the conductive circuit can be formed by bringing into contact , an end portion 214 , 224 of each of the first and second sections 210 , 220 to complete the conductive ink circuit . in accordance with an exemplary embodiment , upon forming the circuit , a pre - heating process of the at least one heater 144 of the smoking article 100 can be initiated . in addition , the pre - heating of the smoking article 100 can also be configured based on detection of a user picking up the smoking article 100 . for example , a smoking article 100 having a conductive ink circuit on an outer portion thereof upon detection of being handled by a user , the smoking article 100 can begin a pre - heating process , which can reduce the latency and improve quantity of the aerosol delivered during the initial puffs . in accordance with an exemplary embodiment , the first section 210 and the second section 220 each comprise an outer cylindrical housing 216 , 226 extending in a longitudinal direction , and wherein each of the outer cylindrical housings has a portion 212 , 222 of the conductive ink circuit embedded therein . fig3 is a side view of an electronic smoking article 100 in accordance with an exemplary embodiment having a two - piece first section 210 , which includes an aerosol generation portion 240 and a liquid supply portion 230 , and a second portion 220 , which forms a conductive ink circuit upon assembly thereof . in accordance with an exemplary embodiment , the first section 210 includes an aerosol generation portion 240 and a liquid supply portion 230 , and wherein the conductive ink circuit 242 , 232 is embedded within an outer cylindrical housing 241 , 231 of the aerosol generation portion 240 and the liquid supply portion 230 . the at least one heater 144 housed within the aerosol generation portion 240 is activated only when the conductive ink circuit is formed by connecting the aerosol generation portion 240 , the liquid supply portion 230 and the second portion 220 , and wherein the aerosol generation portion 240 , the liquid supply portion 230 and the second section 210 each has a portion 242 , 232 , 222 . 224 , 234 , 236 , and 244 of the conductive ink circuit and upon assembly thereof forms the circuit . in accordance with an exemplary embodiment , for example , the conductive ink circuit can be embedded in parts manufactured by an authorized manufacturer of the first and second sections 210 , 220 for a two - piece electronic smoking article 100 , or an authorized manufacturer of the aerosol generation portion 240 , the liquid supply portion 230 , and the second portion , for a three - piece electronic smoking article 100 . for example , if a user attempts to place a non - authorized part within the smoking article 100 , the smoking article 100 will not function . for example , in the absence of the conductive ink circuit , the power supply 120 will not provide power to the heater 144 . fig4 is an end view of the first portion 210 and the second portion 220 of an electronic smoking article in with an exemplary embodiment , wherein each of the first and second portions 210 , 220 includes a portion of a complete conductive ink circuit therein . as shown in fig4 , the conductive ink circuits 212 , 222 can be embedded within the end portions 213 , 223 , and upon connecting the first and second portions 210 , 220 of the smoking article 100 , the conductive ink portions 212 , 222 complete the circuit . in accordance with an exemplary embodiment , the conductive ink circuits 212 , 222 can be elongated line , pattern or completely covered area forming a contact and / or contact pads . the electronic smoking article 100 is preferably about the same size as a conventional cigarette . in some embodiments , the electronic smoking article 100 can be about 80 mm to about 88 mm long and about 7 mm to about 8 mm in diameter . the outer cylindrical housing 110 of the electronic smoking article 100 may be formed of any suitable material or combination of materials . examples of suitable materials include metals , alloys , plastics or composite materials containing one or more of those materials , or thermoplastics that are suitable for food or pharmaceutical applications , for example polypropylene , polyetheretherketone ( peek ), ceramic , and polyethylene . in an exemplary embodiment , the heater 144 includes a coil of wire at least partially surrounding the capillary wick 146 . in an exemplary embodiment , the heater 144 is a metal wire and / or a metal alloy wire . the heater 144 can be a coil , which can extend fully or partially along the length of the capillary wick 146 . the electronic smoking article 100 can include a puff indicator ( not shown ) for indicating when the heater 144 is activated . in the embodiment in which the electric circuitry includes a sensor to detect air flow indicative of a user taking a puff , the indicator , such as an led , may be activated when the sensor senses air flow indicative of the user taking a puff . in the embodiment in which the electric circuitry includes a manually operable switch , the indicator may be activated by the switch . in addition , control measures can be incorporated to cut off the power supply to the heater if a puff is not detected by a puff detector , within a set time period after the initial handling of the smoking article . when the word “ about ” is used in this specification in connection with a numerical value , it is intended that the associated numerical value include a tolerance of ± 10 % around the stated numerical value . moreover , when reference is made to percentages in this specification , it is intended that those percentages are based on weight , for example , weight percentages . moreover , when the words “ generally ” and “ substantially ” are used in connection with geometric shapes , it is intended that precision of the geometric shape is not required but that latitude for the shape is within the scope of the disclosure . when used with geometric terms , the words “ generally ” and “ substantially ” are intended to encompass not only features , which meet the strict definitions , but also features , which fairly approximate the strict definitions . it will now be apparent that a new , improved , and nonobvious electronic smoking article has been described in this specification with sufficient particularity as to be understood by one of ordinary skill in the art . moreover , it will be apparent to those skilled in the art that numerous modifications , variations , substitutions , and equivalents exist for features of the electronic smoking article , which do not materially depart from the spirit , and scope of the invention . accordingly , it is expressly intended that all such modifications , variations , substitutions , and equivalents , which fall within the spirit and scope of the invention as defined by the appended claims , shall be embraced by the appended claims .	2
as illustrated in fig1 the armature attachment end 1 of a printing needle 1 is prestamped into a wave like configuration providing variations in the radial positioning of the surface of the needle from the axial center line along the axial length of the portion of the needle end which is received in the armature . the wave shape formation of the needle end preferably occurs before insertion of the needle end into a bore hole in the armature of a plunger type armature magnet system such as used in mosaic needle printing heads . the bore hole of the armature 2 is originally cylindrical having a constant diameter as indicated by the broken line of fig1 . in the course of calibration of the external dimensions of the armature , it is placed into a mold having the desired dimensions and is thereafter axially cold forged . during this cold press operation , the material of the plunger type armature 2 will flow not only to the exterior of the armature into contact with the mold walls , but also to the interior into mating surface contact with the needle . thus upon completion of the cold press forging operation , the external surfaces of the armature will properly correspond to the inner surfaces of the mold or die and the inner bore wall will mate with the deformed surface of the printing needle 1 . in this manner a positive lock connection will be created between the end of the printing needle and the armature without the necessity of any heat treatment . as illustrated in fig2 a cylindrical tube member 4 can be inserted over the end of the needle which is to be inserted into the armature . the insertion of a cylindrical tube over the cylindrical needle is carried out as a first work step and as a second work step the insertion end of the needle and tube can be stamped or coined into the desired wave shaped configuration such that the end of the printing needle 3 and the end of the tube 4 will assume a complimentary shape . thereafter the tube - needle end can be inserted into the cylindrical bore of the armature . the cylindrical bore , indicated by the broken line of fig2 can be formed with a larger diameter than would otherwise be the case if the diameter reducing tube 4 were not utilized . thereafter the material of the armature 5 can be formed in to configuration with the external surface of the tube by means of the cold shaping described above during the step of external dimension calibration of the armature . a third embodiment is illustrated in fig3 . in that figure , the printing needle 6 has an end portion 7 formed with a diameter increase . the diameter increase can be created by bending the needle end back upon itself as illustrated to create a bulbous ended needle . this needle is received , preferably , into a blind hole bore in the armature . the original relatively large diameter of the blind hole bore , as illustrated by the broken line of fig3 is thereafter reduced to a diameter in conformity with the diameter of the needle 6 by means of the aforementioned cold shaping processes . it can therefore be seen from the above that our invention provides an armature - printing needle connection for use in the construction of mosaic printing needle writing head subassemblies wherein the needle has an external varying radius shaped end received in a bore hole in an armature with the bore hole thereafter reduced into mating surface contact with the needle end by means of a cold pressing operation . this effectively locks the needle in the armature at the same time the armature is being properly calibrated for external size dimensions . the resultant joint between the armature and the needle is sufficiently strong to withstand working conditions of the mosaic needle print head while at the same time being relatively inexpensive to achieve due to the production method involved . although the teachings of our invention have herein been discussed with reference to specific theories and embodiments , it is to be understood that these are by way of illustration only and that others may wish to utilize our invention in different designs or applications .	1
fig1 and fig2 shows a child &# 39 ; s safety seat with a five point web harness as found in conventional safety seats fitted within a motor vehicle . the upper shoulder straps 1 and 1 a are enclosed within a pair of sleeves 2 and 3 , fitted such as frictional contact between the interior of the sleeve and the web hold the sleeve in a pre selected position . positioned on the lower portion of sleeves 2 and 3 , are two magnets 4 and 5 , ( fig3 / fig6 ) facing topside , are set within plinths 6 and 7 . these magnets may be covered by a thin membrane ( not shown ) to prevent access by a child . two metallic strips 8 and 9 are embedded within each side of the seat proper 10 , proximate the chest / shoulder area of a child , and enclosed by a material isolating contact with a child , yet allowing magnetic attraction when coupled to aforementioned sleeve magnets 4 and 5 ( this connection explained fully later ) these longitudinally placed metallic strips are sized to accommodate a range of adjustments of the sleeves made over time . it will be noted that magnetic strips may be substituted for metallic strips 8 and 9 . fig4 . the lower portions of the web harness are connected at a buckle 11 , achieved through inserting a pair of tangs 12 and 13 into buckle 11 . each tang is free to move along its web 1 , and 1 a and falls into the depression within the seat as stated previously . to counteract this , tang 12 is attached to a web clamp 14 by narrow strip 15 , similarly tang 13 is attached to web clamp 16 by narrow strip 17 , securing the tangs to a desired position along the web . to position web clamp 14 along web 1 , an attached clip 14 a , is lifted slightly , relieving compression on web 1 , allowing web clamp 14 to slide along web 1 . the same adjustment applies to web clamp 16 . narrow strips 15 and 17 enable some freedom of movement to insert the tangs 12 and 13 , into buckle 11 without adjusting the positions of web clamps 14 and 16 . fig8 , fig9 , fig1 . the upper portions of both webs 1 and web 1 a are required to be connected laterally to offer protection against separation of the webs in the event of a sudden deceleration . two portions of a connecting mechanism are therefore provided , both positioned on the topside of sleeves 2 and 3 . attached to sleeve 2 a circular wall 18 , is provided with an open area 18 a , positioned adjacent to a similarly positioned connector 20 located and connected on sleeve 3 . the distal end of connector 20 has a circular member 21 with a descending encasing flange 22 , sized to fit closely within circular wall 18 . contained on circular member 21 , having an outer facing area , and an inner facing area , a slide 23 is fitted to the outer facing area , having on one end a finger grip 24 , the distal end having a protruding planer member 25 and a descending elongated connector 26 a , engaged within slot 27 , terminating in an elongated flange 26 , ( now within the inner facing area ) with one end having a tapered opening 26 b . at the end of its travel , elongated flange 26 , and tapered opening 26 b springs apart and snaps back engaging descending protrusion 26 c , requiring additional finger force to fully engage these members . ( the resulting pressure required to secure or retract slide 23 would therefore be greater than a child could produce to eliminate accidental opening ) slide 23 is used to alternate positions between a first retracted position , and a second extended position , whereby planer member 25 is engaged within circular wall 18 . fig1 illustrates circular member 21 fitted within circular wall 18 , having opening 18 a providing a slot 29 one end and slot 30 the opposing end , cooperating to engage planer member 25 when positioned in the extended position , thereby securing circular member 21 within circular wall 18 . in this configuration , lateral force applied to sleeves 2 and 3 will be resisted by the interaction between circular member 21 , captured within circular wall 18 . as previously stated buckle 11 will fall into a position underneath a child in a conventional safety seat . therefore this invention provides an attached handle 31 providing a grasping opportunity to locate and manipulate buckle 11 to a desired storage position . fig5 illustrates such a handle 31 having on one end a yoke 31 a , terminating in pivotal connectors 31 a - 1 , and 31 a - 2 , with the distal end having two metallic discs , 31 b and 31 c , surrounded by an ascending flange 31 d . handle 31 is rotoratably connected to buckle 11 through interaction with pivot points 11 a and 11 b , inserted into connectors 31 a - 1 , and 31 a - 2 . it may be beneficial to describe the actions required to position the elements of the present invention in a first , closed , fastened position , to secure a child within a safety seat . and to further describe a second , open , unfastened and stored position required to remove a child from a safety seat , and prepare the elements of this present invention positioned such as to more easily replace a child within the seat . after placing a child within a safety seat , web 1 and 1 a , being overlaid with sleeves 2 and 3 are placed over a child &# 39 ; s shoulders , with sleeves 2 and 3 positioned at a child &# 39 ; s chest area . connector 20 , attached to sleeve 3 , positions circular member 21 proximate circular wall 18 , on sleeve 2 , whereupon circular member 21 is inserted into circular wall 18 . at this point slide 23 , set upon circular member 21 , is in a retraced position , and offers no interference to the insertion process . ( fig9 ) placing a finger on finger member 24 , and applying a small force in the direction of sleeve 3 , move slide 23 , together with planer member 25 , toward the open area of circular wall 18 a . planer member 25 ( fig1 ) is inserted into slot 29 on one side of open area 18 a , and into slot 30 on the opposite side . this action also moves elongated flange 26 and tapered connector 26 b toward descending protrusion 26 c . applying additional force , protrusion 26 c is captured within tapered connector 26 b . circular member 21 is now secured within circular wall 18 thereby securing sleeves 2 and 3 together . at a lower point , buckle 11 is positioned and tangs 12 and 13 are inserted and secured within buckle 11 . handle 31 ( fig1 ) is located and rotated upwards toward the lower portion of sleeves 2 and 3 , whereupon metallic disc 31 b is attracted to magnet 4 , and metallic disc 31 c is attracted to magnet 5 , connecting and attaching in a releasable yet secured connection . ascending flange 31 d is covering portions of magnet plinths 6 and 7 in close proximity , restricting lateral movement , thereby providing secondary protection against lateral forces separating sleeves 2 and 3 . at this point a child is securely seated within the five point safety harness seat utilizing the components of this present invention , the procedure for removing a child from the safety seat is as follows . handle 31 is lifted , breaking the magnetic connection between magnet 4 and metallic disc 31 b and magnet 5 , and metallic disc 31 c . the handle 31 is rotated through approximately 180 degrees , giving access to a push button 11 c , whereby tangs 12 and 13 are removed from buckle 11 . fig8 . using slide 23 to retract planer member 25 breaking a connection from within circular wall slots 29 and 30 , frees circular member 21 from within circular wall 18 , wherein circular member 21 is lifted out and removed , thereby separating sleeve 2 from sleeve 3 . sleeve 2 ( fig2 ) is inverted as it is lifted free of a child and moved toward the outside edge of seat 10 . sleeve 2 , together with magnet 4 , now being inverted or turned over is positioned over metallic strip 8 . magnet 4 is attracted to , and makes contact thereby attaching sleeve 2 to the side of the seat 10 . web 1 is now in a stored position along an upper outer aspect of seat side 10 , prevented from falling into the seat depression as described previously through the interaction of metallic strip 8 , and magnet 4 . web clamp 14 connected to tang 12 , through narrow strip 15 is also secured to the side of the seat 10 , connected by web 1 through interaction with sleeve 2 and the magnetic connection so formed . the same method is used to reposition sleeve 3 , connecting magnet 5 with metallic strip 9 , therefore securing web 1 a , with web clamp 16 and tang 13 also captured in a stored position . fig6 . the underside of both sleeves 2 and 3 are visible , revealing a foam or gel like material 2 a and 3 a attached to sleeves 2 and 3 , offering additional protection in the event of a sudden deceleration of a vehicle , to enhance the safety and comfort of a child . fig2 . handle 31 being rotated to a lower point , attached to buckle 11 , is grasped and pulled further in a downward direction , such that buckle 11 is pulled away from the previously described seat depression , toward an outer lower edge of seat 10 . buckle 11 , with handle 31 ( fig7 ) acting as a cantilever , is positioned and stored at a seat edge , away from interference with extracting the child , yet available for grasping when next required . at this point , all the elements provided for by this present invention are captured and positioned on seat 10 as illustrated in fig2 , giving a unobstructed space in which to place and more easily secure a child within seat 10 . fig1 in a second embodiment of the present invention , providing a similar operating function to the preferred embodiment , accordingly provides a child safety seat installed within a motor vehicle , including both upper portions of a harness web designated by the numerals 1 , and 1 a in the aforementioned preferred embodiment , threaded through a pair of sleeves 32 and 33 surrounding that portion of the web proximate a child &# 39 ; s chest area , manufactured from a suitable pliable , soft plastic . sleeves 32 and 33 are sized to fit over webs 1 and 1 a so that frictional contact between the interior of the sleeve , and the mating surface of the web , is sufficient to hold a sleeve in a preset position . sleeve 32 terminates at an approximate midpoint along the length and transitions into an open web guide member 38 , sleeve 33 similarly transitions to open guide member 39 . fig1 guide member 38 is enclosed on each side by a narrow curled flange , with projections 38 a and 38 b providing additional web securing . the distal end terminating in an integral strip 40 attached to a web tang 41 . guide member 39 , with projections 39 a and 39 b , are likewise attached to integral strip 43 , together with web tang 44 . on the underside of sleeves 32 and 33 continuing through the underside of guide member 38 and 39 a backing member 38 c , is attached , manufactured from a foam or gel like material , along the total length , providing some additional comfort and protection to a child secured within the seat . after placing a child within a safety seat , designated in the preferred embodiment by the numeral 10 web 1 and 1 a , being overlaid with sleeves 32 and 33 are placed over a child &# 39 ; s shoulders , proximate a child &# 39 ; s chest area . fig1 a depicts the previous description of fig1 with the addition of a handle 46 , attached to a buckle 47 , overlaying a portion of the sleeves 32 and 33 , and web guides 38 and 39 . the operation of handle 46 , with buckle 47 may be better explained by reference to fig1 . provided on buckle 47 , are two protuberances 47 a and 47 b set near an edge , spaced apart to accommodate a stem portion 46 f of handle 46 . an upper end of handle 46 terminates in a tee type member , the distal end terminating in a round shaft like member 46 e , extending beyond the width of handle stem 46 f , interacting within pivot points 46 c and 46 d , attached to buckle 47 near an opposite edge . positioned at a point along its length handle 46 has two elongated holes 46 a and 46 b , having narrow wall strips 46 a - 1 , and 46 b - 1 protruding from the nominal width of handle stem 46 f placed adjacent to protuberances 47 a and 47 b . with handle 46 in a first closed position handle stem 46 f , cooperating with the two protuberances 47 a and 47 b causes inward compression of the narrow wall strips sides 46 a - 1 and 46 b - 1 , in cooperation with elongated holes 46 a and 46 b , thereby securing the handle within the aforementioned protuberances . at a lower point , buckle 47 is positioned and tangs 41 and 44 are inserted and secured within buckle 47 . handle 46 is rotated upward to connect with buckle protuberances 47 a and 47 b , so that handle 46 is in a stored position overlaying a portion of web guides 38 and 39 . fig1 . the upper portions of both webs are required to be connected laterally to offer protection against separation in the event of a sudden deceleration . connecting members are therefore provided on both sleeves topside . set on an upper portion of sleeve 32 connector 34 having an open end 34 c , mounted such that open end 34 c is opposite and facing an attached insert member 35 , attached to sleeve 33 . insert member 35 is inserted into connector 34 , causing a spring like action to occur at two protruding members 35 a and 35 b , having a separated extension 35 e , terminating in finger grips 35 c and 35 d , being forced inward through interaction with contoured edge members 34 a and 34 b , and spring back to their normal position once inserted , engaging within a recessed portion of 34 a and 34 b locking insert member 35 in place within connection 34 . sleeves 32 and 33 , and by extension web guides 38 and 39 are now connected together . with both upper and lower connections made , web 1 and la are in a closed secured position around a child strapped within a safety seat . to remove a child from within the safety seat the upper connection 34 and 35 are disconnected by removing insert member 35 from connector 34 . finger grips 35 c and 35 d are squeezed together to separate protrusions 35 a and 35 b from within the recessed areas 34 a and 34 b . insert member 35 is now withdrawn from connector 34 , thereby separating sleeves 32 and 33 , together with web guides 38 and 39 . at a lower connection handle 46 is rotated away from an overlaying position over sleeves 32 and 33 , and web guides 38 and 39 , allowing tangs 41 and 44 to be extracted from buckle 47 by pressing in a push button as provided by a conventional seat harness . it will be noted that the push button set within the buckle cannot be accessed and operated with the handle in a closed position offering a further advantage by resisting opening by a child . handle 46 being rotated to a lower point , attached to buckle 47 , is grasped and pulled further in a downward direction , such that buckle 47 is pulled away from the previously described seat depression , toward an outer lower edge of a seat . buckle 47 , with handle 46 acting as a cantilever , is positioned and stored at a seat edge , away from interference with the child , yet available for grasping when next required . with connection 34 and 35 separated , and a lower connection separated at buckle 47 the actions remaining to remove a child from within a seat are exactly as described and set out within the aforementioned preferred embodiment narrative . reference is hereby made to fig2 containing numerals 8 and 9 , to describe metallic strips , and numeral 10 , to describe a safety seat . a combined sleeve 32 , and web guide 38 is inverted as it is lifted free of a child and moved toward the outside edge of seat 10 . sleeve 32 , with attached magnet 36 , now being inverted or turned over is positioned over metallic strip 8 , magnet 36 is attracted to , and makes contact thereby attaching sleeve 32 and web guide 38 to the side of seat 10 . similarly sleeve 33 and combined web guide 39 , is inverted and is positioned over metallic strip 9 magnet 37 is attracted to , and makes contact thereby attaching sleeve 33 and web guide 39 to the side of seat 10 . fig1 , included for reference , is provided to illustrate a sleeve , for example , 32 , may be separated longitudinally , and by means of a natural hinge to open into two connected parts , and to close around a web , secured by a flange extension 32 w and 32 w - 1 by spaced apart bulbous members 32 x passing through spaced apart holes 32 y in a tight fitting relationship , so as to reestablish the continuity of the sleeve 32 . thus a sleeve may be opened along its length to be fitted to a web and not require threading through . the particular embodiments of the invention described above for the purpose of disclosing and illustrating the principals involved , are not intended to put limitations on this invention . it may be apparent to those skilled in the art that various changes may be made without departing from the spirit and principles of the invention .	1
referring now to the drawings wherein like reference characters designate like parts throughout the several views , an identity card 1 is shown in fig1 . the front shows the photograph of the cardholder , his surname and christian name , and an identification number . furthermore , the front of the card 1 can be provided with the signature ( not shown ) of the cardholder . the identity card 1 includes a card core 2 which is at least one layer . in the card core 2 , there is a window 5 in which one or more grid images 3 appear . the card core 2 is covered or laminated , respectively , on the front and on the rear with films 4 &# 39 ; and 4 &# 34 ;. these films serve to protect the identity card 1 in use and to secure it against forgeries or unauthorized alterations of the data . these films 4 &# 39 ;, 4 &# 34 ; are transparent and in general are of the same fusible polymers , for example polyolefines , polyamides , polyvinyl chloride or the like , as the card core 2 . compared with the total area of the front of the identity card 1 , the grid images 3 include only a small area . as a rule , they contain the information therefore on a reduced scale , in a similar manner as does conventional microfilm . microfilm images could be used in the identity card 1 as one of the security markings if , for example , they store the identity card 1 as a reduced image or store additional information or data about the cardholder . but , compared with the conventional microfilm images , the use of grid images provides better security against forgery , since the production of grid images is more difficult than that of microfilm images . holograms recorded on a holographic film could also be used by inserting an appropriately sized portion into the window . in this situation , an image of the front of the identity card 1 might be holographically produced on the piece of holographic film by appropriately controlling the path of a laser beam for recording a hologram . the hologram obtained in this manner would then be thermally developed and fixed by cooling and inserted into the card . however , the characteristic distinguishing holograms from grid images is that a hologram stores the information of the entire recorded area on each image dot . therefore , all information of the recorded area could be reproduced from a small portion of the holographic film in the card window . the grid image recordings would be safer because they cannot be divided in the same manner as hologram recordings , because only a part of the original information would be present in the corresponding portion of the grid image recording . the grid images 3 for an identity card can be produced by forming an optical image of grid structures on top of an image present on a recording material , that is to say by superposing a grid structure on an image . this technique of image recording is known as carrier frequency photography and is described , for example , in the journal &# 34 ; optik &# 34 ;, volume 28 , 1968 / 69 , pages 263 - 287 . photographic layers based on silver halides , and also other light - sensitive layers , such as photolacquers or photoconductive , thermoplastic layers , are suitable for recording the image . the following discussion is not complete and is only exemplary of this method of image recording . there is a distinction between absorption grids and phase grids or absorption images and phase images . in carrier frequency photography , recording is effected by modulation with a spatial frequency , that is to say the periodic fluctuation of density or light path length within the photographic layer due to the grid structure reproduced in the image . the spatial frequency would have a local density distribution or optical path length distribution representing the image signal . the image - modulated spatial frequency results in density differences in the silver grains in the photographic layer or density differences due to the toner in the development of the photoconducting layer . these density differences yield an absorption grid which is reconstructed by diffraction on the spatial carrier frequency . better results in reconstruction are obtained with rehalogenated , for example rechlorinated , silver images as phase images . here the information - carrying structure provides an optical path length image which is composed of an external relief in the gelatine and an internal relief in the differences in refractive index , which are caused by the different levels of silver halide concentrations . in the case of bleached silver film , the gelatine produces both periodic differences in the refractive index and periodic changes of the layer thickness . unbleached silver film is accordingly a mixed form of absorption grids and phase grids . grids produced in thermoplastic photoconducting layers or grids in photolacquer layers are largely pure phase grids having relief structures . the relatively light - sensitive silver halide layers and the likewise light - sensitive photoconducting and , if appropriate , thermoplastic layers , which are electrostatically charged , exposed and either developed with toner or heated until a relief image has formed , are suitable for recording individual grid images of , for example , the entire identity card with all the data including a photograph of the cardholder . the less light - sensitive layers from photolacquers , especially from positive - working photolacquers with o - quinone - diazide as the light - sensitive substance , are particularly suitable for the recording of very high - grade grid structures which have a high line density per millimeter and are thus relief images which are difficult to imitate and which contain general security markings , such as , for example , emblems , code numbers , code words and the like . this relief grid image technology has reached a very high technical state which makes it possible to produce relief grids having up to 600 lines per millimeter with a sine - shaped or oblong - shaped grid profile which can be determined beforehand . from these relief grid images , nickel masters are produced by means of which duplicates are prepared by embossing thermoplastic films , for example polyvinyl chloride films . these grids are particularly suitable for producing general security markings , such as emblems , coats of arms and the like , which sometimes are complemented by an item allocated to a relatively large number of cards , such as a series main number . grids of this type are described in the journal &# 34 ; optics communications &# 34 ;, volume 18 , 1976 , no . 3 , pages 292 - 303 . in principle , the line spacings in the production of grid images are not limited on the side of either large or small dimensions . however , an image can be called a grid image only if at least one grid period extends over the recording area . in the case of grid images which are read out by light reflection , this is the entire card and , in the case of grid images which are read out by light transmission , this is the diameter of the window opening . preferably , grid periods are selected which are substantially smaller than the diameter of the card or of the window opening , in order to obtain a clear diffraction effect on the grid . for example , the grid images can contain from ten lines per millimeter to several hundred lines per millimeter . typical effects , based on the diffraction , then occur , as in the case of colored grid images which have an oblong - shaped cross section of the relief structures . viewing with the naked eye is possible at about one hundred lines per millimeter of the grid image , and these effects are particularly clear above about four hundred lines per millimeter . such line structures are produced on the photographic layer by contact exposure , projection of an image or by interference of laser light . the reconstruction of the absorption image or phase image , modulated with a carrier frequency , is effected as a diffraction process on the spatial carrier frequency , as shown in fig2 by the arrangement in principle . a part of the incident light l e is deflected on the grid structure a as diffracted light l g , since the grid structure acts as a diffraction grating even in imagewise distribution . by means of a lens system 18 indicated diagrammatically , the reconstructed image 7 can be reproduced in the direction of the axis of the incident light l e . moreover , reconstructions 8 &# 39 ;, 8 &# 34 ; in the direction of the diffracted light beam l g are possible . since the line spacing will be known and the line orientation relative to the image will be known , it is possible to set a multiplicity of deflection angles . superposed grid images can be read out separately with diffracted light if each image is superposed by a characteristic line structure . this leads to a large number of possible combinations of angle settings and image superpositions so that the selection and fixing to one or several angle settings , possibly superposed by blank settings , that is to say grid images without any information content , will constitute a security marking . the reconstruction must then be carried out accurately under the fixed angles so that exact readout is possible by means of the corresponding diffraction on the particular grid . in &# 34 ; optics communications &# 34 ;, volume 18 , 1976 , no . 3 , pages 292 - 303 , sine - shaped relief grids for black and white projection images and oblong relief grids for colored projection images are described . as a result of the color and the combination possibilities thus provided , a further security stage is reached , since it is evident that the relief grid depths for particular colors must be accurate to a few hundredths μm and cannot be duplicated without a knowledge of the technique required for producing them . colored projection images can also be produced by the superposition of the grid images , corresponding to color separation images , under different grid structures and by projection through appropriate filters which are arranged in the paths of the rays concerned , as can be seen from the journal &# 34 ; optik &# 34 ;, volume 28 , 1968 / 69 , page 278 . special schlieren projectors are required for projection . in the case of oblong - shaped relief grids of a defined relief depth , colored projection images can be reproduced with normal projection lens systems (&# 34 ; optics communications &# 34 ;, volume 18 , 1976 , no . 3 , pages 292 - 303 ) or the colored images can be visually observed , which enhances the practicability . the build - up of an identity card 1 , the reconstruction of which gives a multi - colored image from oblong - shaped relief grids , is described by reference to fig3 . although the application of grid structures to identity cards is unknown , the superposition of three layers of grid structures ( where each layer has a constant grid depth ) is well known . three color separation images are mutually superposed on three grid layers in the window 5 of the card core 2 . these composite grid layers consist of part images 9 , 10 , 11 for yellow , magenta and cyan respectively . the front and rear of the card core 2 are each laminated with a transparent film 4 &# 39 ; and 4 &# 34 ; respectively . it is obvious that the insertion in a true fit of three grid layers or grid images into the opening of the window 5 is difficult . instead , it is possible to use a technique in which oblong relief grid structures of different depths are produced in such a way that they are intercalated in one plane , as is described , for example , in west german patent applications nos . p 26 57 246 . 3 , p 27 34 581 . 9 and p 27 34 580 . 8 corresponding to copending u . s . application ser . nos . 861 , 491 , 928 , 700 , and 928 , 701 , filed dec . 16 , 1979 , july 27 , 1978 and july 27 , 1978 , respectively . these relief grid structures in one plane are advantageously complemented by irregular relief structures for representing black , as is explained in west german patent application no . p 25 51 741 . 5 which corresponds to copending u . s . application ser . no . 961 , 440 filed nov . 16 , 1978 . the identity card 1 shown in fig4 has a grid image 3 with oblong relief grid structures of different depths in the opening of the window 5 , which grid image is complemented by irregular relief grid structures 12 . the space above the grid image 3 can be occupied by one or more transparent film inserts 13 which are not capable of lamination . in fig4 two such film inserts 13 are drawn , but it is also possible that only one film insert 13 or more than two film inserts fill up the window zone above the grid image 3 . as an experiment , a single - layer grid image was integrated in an identity card 1 built up in this way , which grid image is multi - colored in reconstruction and , when reproduced , shows the black west german federal eagle on a black / red / golden - yellow background . the reconstructed image could be viewed using a conventional slide projector or a microfilm reader , but it was also possible to discern the image even with visual observation in approximately vertically transmitted light . in reflected light , however , neither a black and white image nor a colored image was visible . it is therefore impossible , solely on the basis of the optical impression , to carry out a forgery of a relief grid image of this type in such a way that the latter is replaced by a color photograph . a security mark , such as a colored relief grid image , should be incorporated , as much as possible , in the particular identity card in such a manner that it cannot readily be taken out of the card and inserted into another card . one step in this direction consists of inserting the grid image not in the form of a platelet into the opening of the window of the card core , but in producing it integrally in the identity card on a continuous card layer which functions as a grid image carrier . for this purpose , the card core can partially be coated with a photo - emulsion , in particular in the window zone . similarly , it is possible to apply a photoconductor layer for the production of toner images or to apply a thermoplastic , photoconducting recording layer for the production of relief images . it is also possible directly to form a toner image , on a core film or on the inside of one of the cover films , by transfer or electrographically via a charge image produced by means of recorder electrodes . a further possibility consists in embossing a grid image into the window zone of a transparent continuous film . fig5 shows a further embodiment of an identity card 1 in which the card core consists of two matt films 2 which enclose a continuous grid image carrier 14 of transparent film . the grid image 3 was embossed onto the grid image carrier 14 beforehand . experiments have shown that it is virtually impossible to cut the grid image 3 out of a continuous grid image carrier 14 of this type without damage and to insert this grid image into another card in such a way that no cut edges are visible . fig6 a and 6b show an embodiment which has a card construction which is particularly stable in use . the manufacture of this identity card takes place in two stages . initially , the two - ply card core 2 which already contains the personal data of the cardholder and encloses the continuous grid image carrier 14 , that is to say a transparent interposed film , is laminated with the film 4 &# 34 ;. in the window zone , the lower core film 2 receives a transparent film insert 15 capable of lamination . the window zone in the upper core film 2 is initially left open , for example using a laminating press of corresponding shape or an inserted disc 16 which is not capable of lamination and is shown in fig6 a . the disc 16 can , for example , consist of a polyester film of appropriate thickness . in the case of an identity card consisting of polyvinyl chloride films , lamination is effected at temperatures of 130 ° c . to 160 ° c . and under pressures of about 10 to 30 bars ( approximately 10 to 30 kp / m 2 ) with press times of 5 to 10 minutes . subsequently , the disc 16 is removed and one or more grid images 3 are impressed into the exposed grid image carrier 14 by means of a forming punch heated to about 140 ° c . finally , a transparent film insert 13 , not capable of lamination , is inserted as a thickness compensation disc in place of the disc 16 and the upper film 4 &# 39 ; ( fig6 b ) is laminated on , while the grid image 3 located in the interior is protected . although the invention has been described relative to a specific embodiment thereof , it is not so limited and many modifications and variations thereof will be readily apparent to those skilled in the art in light of the above teachings . it is , therefore , to be understood that , within the scope of the appended claims , the invention may be practiced otherwise than as specifically described .	1
fig4 , 5 and 12 show a linking member 10 having two opposing arm members 11 that are interconnected by two opposing , intermediate , looped end portions 12 , said linking member being substantially symmetrical about both its longitudinal and transverse axes . the arm members 11 diverge outwardly and away from the looped end portions 12 and whereby the enclosed angle between opposing arm members is approximately 20 degrees . consequently the distance separating the opposing arm members is greatest in the mid portion of the linking member and smallest adjacent the looped end portions . each looped end portion 12 includes an inner or wear surface 13 that in use is to be protected against wear resulting from engagement with another linking member by a wear crutch 14 that is adapted to cover said inner surface . on either side of the looped end portion 12 there is provided a crescent shaped recess 15 ( see shaded areas of fig4 and 5 ) that is formed in the inner surface 13 . each looped end portion 12 also includes two opposing , somewhat elongate , recesses or key seats 16 , each having a rectangular shaped opening . the key seats 16 are formed in the inner surface 13 , midway between opposing sides of the linking member 10 and partway along the length of the arm members 11 . each looped end portion 12 also includes a centrally located slot 17 formed in the inner surface 13 that extends from one side of the linking member 10 to an opposing side of the linking member . the slot 17 has a substantially square shaped transverse cross - section . the looped end portions 12 each also include two elongate grooves 18 that are each formed in a respective side face of the linking member 10 . the grooves 18 each have a longitudinal axis and whereby these axes lie in the same plane containing the both the longitudinal axis of the linking member 10 and a longitudinal axis of the slot 17 . fig7 to 11 show a wear crutch 14 having two substantially parallel , somewhat plate like , guides 19 having an arcuate edge portion 20 . the guides 19 are connected by an intermediate wear body 21 . the wear body 21 includes a first or outer , curved , surface 22 and a second or inner , curved , surface 23 . the outer and inner curved surfaces 22 and 23 are located on opposite sides of the body 21 and whereby the two curved surfaces intersect one another at opposite ends of said body along common edge portions 24 . the common edge portions 24 and the outer surface 22 are located between the guides 19 , said guides being substantially perpendicular to a plane containing said edge portions . the outer and inner surfaces 22 and 23 define a wear thickness there between that is thickest midway between the common end portions 19 . the wear crutch 14 also includes two , somewhat rectangular shaped , keys 25 that protrude out from the outer surface 22 , said keys being located on opposite ends of the wear body 21 adjacent a common edge portion 24 . the wear crutch 14 also includes a square shaped peg 26 that protrudes out from the outer surface 22 . the peg 26 is located midway between the common edge portions 24 . fig6 and 12 show the linking member 10 two which there has been attached two opposing wear crutches 14 . the outer surface 22 , of each wear crutch 14 , in use abuts against a respective inner surface 13 of the linking member 10 . each wear crutch 14 is retained on a respective looped end portion 12 of the linking member 10 by a rolled steel pin 27 that is frictionally threaded through aligned guide apertures 28 formed in respective guides 19 and an aperture 29 formed in the looped end portion . the guides 19 , receivable within respective recesses 15 , and the keys 25 , receivable within respective key seats 16 , aid in the correct location of the wear crutch 14 on the looped end portion 12 during the bedding process . further , when the wear crutch 14 is correctly bedded on the looped end portion 12 , the common edge portions 18 shall engage a respective one of the adjacent arm members 11 in a manner whereby said edge portions and abutting inner surfaces of the arm members are substantially flush , as illustrated in fig6 . it will be appreciated that the location of the guides 19 within respective recesses 15 ; the location of the keys within respective key seats 16 , and the location of the peg 26 within the slot 17 all assist in preventing movement of the wear crutch 14 relative to the looped end portion 12 arising from engagement of the linking member 10 with another linking member , or such like , during use . it is also believed that these multiple locating means will not only spread the load applied on the locating means but also prevent accidental movement of the wear crutch 10 during its removal . in use , the inner surface 23 , of the wear crutches 14 shall provide a sacrificial wear surface and whereby the inner surfaces 13 of the looped end portions 12 will be protected from wear . further , it is envisaged that worn wear crutches 14 will be replaced by fresh wear crutches and that the replacement of worn wear crutches could be undertaken on a regular basis as part of a maintenance program that is intended to prolong the working life of the linking members 10 and thereby a chain , or such like comprising a plurality of interconnected linking members . when the wear crutch 10 is properly located on the linking member , the respective common edge portions 15 of the wear crutch 10 are flush with an inner surface of the respective side arms of the linking member as illustrated in fig6 and 14 in the region indicated as “ y ”. the linking member used with the wear crutch 10 of the present invention is preferably specifically configured in order to ensure this flush fit . an alternative linking member 30 , in the form of a shackle , is illustrated in fig1 and 14 . the shackle 30 includes two opposing arm members 11 and a single looped end portion 12 that is located between and is connected to adjacent ends of said arm members , while the opposing ends of the arm members are adapted to receive a pawl ( not shown ) to open and close the shackle . like the linking member 10 , the arm members 11 of the shackle 30 diverge outwardly from the looped end portion 12 and whereby the enclosed angle between the opposing arm members is approximately 20 degrees . fig1 and 16 show a combination wear crutch displacement apparatus 100 and a wear crutch bedding apparatus 101 located side by side one another . the wear crutch displacement apparatus 100 includes displacement support means 102 , that is capable of providing support for one or more linking members 10 ; linking member restraining means 103 for preventing relative movement of a selected one of the linking members 10 during the process of displacing a wear crutch 14 that is mounted on said linking member , and a wear crutch displacing tool 104 . the displacement support means 102 includes a rectangular shaped , plate like , support 105 having a substantially flat support surface 106 . the support 105 is mounted on a plurality of wheels 107 that are each capable of rotational movement about an axle , not shown , within a channel 108 of a base 109 . the linking member restraining means 103 includes two opposing flanges 110 , each having a free end portion 111 . the flanges 110 are interconnected by an intermediate mounting portion 112 that is itself affixed to an elongate side rail 113 that is rigidly attached to the base 109 . the wear crutch displacing tool 104 includes a bifurcated head portion 114 consisting of two opposing terminal members 115 each having a free end portion 116 . the opposing ends of the two members 115 are interconnected by an intermediate bridging member 121 that is itself mounted on one end of a hydraulic ram consisting of a stem 117 that is capable of reciprocal movement in the direction of arrow 118 and whereby the stem is powered by a power source 119 that is rigidly mounted on a second elongate rail 120 that is substantially parallel and spaced from the first side rail 113 . the side rail is also rigidly attached to the base 120 . the support 105 is located between the opposing side rails 113 and 120 and is capable of reciprocal movement along the length of the channel 108 . the wear crutch bedding apparatus 101 includes bedding support means 130 for supporting a linking member 10 or a plurality of interconnected linking members 10 , such as a chain 200 , during a wear crutch bedding process , a first linking member engagement means 131 and a second linking member engagement means 132 that is spaced from said first linking member engagement means . the bedding support means 130 includes a plurality of cylindrically shaped rollers 133 , each capable of rotational movement about a longitudinal axis . the rollers 133 are located between two opposing , substantially parallel side rails 134 and whereby each roller is connected to both side rails by an axle 135 about which said roller rotates . the first linking member engagement means 131 includes a body 136 that is slidably mounted on both of the side rails 134 and whereby the body includes an aperture 137 formed therein that in use may be selectively aligned with one of a plurality of apertures 138 formed in a plate like member 139 that is located at a first end of the bedding apparatus , said plate like member being also located between and attached to the side rails 134 . the first linking member engagement means 131 also includes a post 140 having a lower end that is capable of being received in aligned apertures 137 and 138 so as to thereby fix the location of said first linking member engagement means relative to the bedding support means 130 . the upper end of the post 140 extends above the body 136 . the second linking member engagement means 132 also includes a body 141 that is slidably mounted on both of the side rails 134 and is located at an opposite end of the bedding apparatus to that of the first linking member engagement means 131 . further , the body 141 includes a centrally located post 142 that stands proud of the body . the body 141 is connected to two hydraulically operated ram assemblies 143 that when actuated shall move the second linking member engagement means 132 along the rails 134 and away from the first linking member engagement means . in use , a chain 200 , constructed in accordance with the present invention , consisting of a plurality of interconnected linking members 10 , each having two opposing wear crutches 14 fitted to respective , adjacent , looped end portions 12 , may be placed lengthwise on the support 205 such that adjacent linking members are substantially orthogonal , as illustrated in fig1 and 17 . beginning with say the first linking member 10 ′ of the chain 200 , a first looped end portion 12 ′ is positioned between the opposing flanges 110 such that each flange is at least partially received within a respective groove 18 and whereby the distal or free end of each flange 121 abuts against an arcuate edge portion 20 of a guide 19 . the opposing end portion 12 ″ of the same linking member 10 ′ is positioned between terminal members 115 such that each member is at least partially received within a respective groove 18 and whereby the distal end 116 of each member abuts against an arcuate edge portion 20 of a guide 19 . actuation of the power source 119 shall cause the stem 117 to advance towards the restraining means 103 whereby the resulting force applied by the members 115 directly to the edge portions 20 of the wear crutch 14 ″ shall be sufficient to displace said wear crutch relative to the looped end portion 12 ″. once this has occurred , subsequent engagement of the bridging member 121 with the looped end portion 12 ″ shall result in a force applied by the flanges 110 to the wear crutch 14 ′ sufficient to displace said wear crutch from the looped end portion 12 ′. having disengaged the linking member 10 ′ from the restraining means 103 and the displacing tool 204 , the displaced wear crutches 14 ′ and 14 ″ of the first linking member 10 ′ may be removed and replaced with fresh wear crutches . this process may be repeated for every second one of the linking members in the chain by moving the displacement support means along the channel 108 such that the said linking members in turn are aligned with the retraining means 103 and the displacement tool 104 . once the wear crutches on every second linking member have been displaced and subsequently replaced , the chain 200 may be repositioned on the displacement support such that the linking members that were previously lying substantially parallel to the rails 113 and 120 are now substantially orthogonal thereto and visa versa . once all of the worn wear crutches have been replaced by fresh wear crutches , said fresh wear crutches being only partially located on the linking members , the adjacent bedding apparatus may be used to bed said fresh wear crutches . the chain 200 is therefore moved across and placed on the bedding support means 130 , such that it is generally supported lengthwise on the rollers 133 , as shown in fig1 . the first linking member 20 ′″ is placed over the upstanding end of the post 140 such that it is retained on said post . the last linking member 10 ″″ of the chain 200 is placed over the upstanding post 142 such that it is retained on said post . the operator then actuates the ram assemblies 143 such that the distance separating the first and second linking member engagement means 131 and 132 is increased whereby as a consequence of the forces applied to the linking members by said engagement means the linking members are generally aligned with one another and the wear crutches are pulled into their bedded position . it is believed that by providing wear crutches 14 that are made of a material that is harder than the material from which the linking members are made from , the resulting chain will last longer than prior art chains and that the use of the replaceable wear crutches will significantly reduce the time and labour previously required to rebuild a worn chain .	5
in accordance with one embodiment of the present invention , one or more cmut patches are adhered to the mother &# 39 ; s abdomen . each cmut patch comprises a two - dimensional ultrasound transducer array that is steerable in three - dimensional space . the cmut patches are electrically connected to a bedside instrument . when the instrument is powered on , a search is performed to acquire the doppler signal of the fetal heart . an initial coarse search , using wide beams and long range gates , will be followed by higher - resolution searches that will successively locate the fetal heart to a greater precision . once the fetal heart has been located precisely , its position will be tracked using multiple sample volumes surrounding the heart &# 39 ; s location . the sample volume that is directly over the heart &# 39 ; s location will produce a doppler waveform that can be processed to extract the fetal heart rate . based on acoustic data from the cmut patch probes , a processor incorporated in the bedside instrument autonomously computes various parameters , including the estimated fetal heart rate . in addition , the processor forms and steers ultrasound beams over the volume of space in front of each cmut patch probe . the cmut patch probes can be electrically coupled to the processor ( or processors ) by means of cables . alternatively , a wireless electrical coupling could be provided . the foregoing concepts can be easily extended to monitor multiple - birth patients using multiple cmut patches . even for a single birth , the use of multiple cmut patches will produce redundant fetal heart signatures , allowing for enhanced reliability . note that multiple cmut patches can be employed in a multiple - birth situation in a mode where each cmut patch is tracking multiple fetal hearts . this is possible because electronic beam steering allows the ultrasound “ look directions ” to be changed without any delay . in accordance with one embodiment of the invention shown in fig1 , the dsp 34 controls two cmut patch probes 30 and 32 . the reason for having two probes is to have some redundancy in measuring the fetal heart signal . if the mother moves , it is hoped that one or the other probe will remain locked onto the fetal heart . more than two cmut patch probes can be used . however , it should be understood that the broad concept of the invention also encompasses the use of a single cmut patch probe . referring to the embodiment shown in fig1 , the cmut patch probes 30 and 32 will each operate in a pulsed - wave ( pw ) doppler mode . when acquiring the fetal heart , the range gates will be long ; this is the standard mode of operation of known ultrasound fetal heart rate monitors . however , the use of cmut patch probes in conjunction with an instrument operating in the pw doppler mode provides a beam steering capability that is absent from known fetal heart rate monitoring systems . the fetal heart signature will be obtained by scanning the beams laterally until the fetal heart is detected . this detection occurs because the valves of the fetal heart cause a doppler shift in the reflected ultrasound . the fetal heart rate is much higher than the maternal heart rate , which makes it easy to recognize . in accordance with one embodiment of the invention , the dsp 34 is programmed to perform an automatic recognition algorithm for the fetal heart signature . for example , the dsp can be programmed to detect an oscillating mean frequency of the doppler shift in a certain frequency range . lateral scanning could be accomplished by translating the transmit aperture or by changing the beam direction from a stationary transmit aperture or a combination of both . however , the use of translation but not beam steering would require the cmut patch be large enough for a translated aperture to cover a sufficient range of positions . once both cmut patch probes 30 and 32 have acquired the fetal heart , the dsp 34 will begin to decrease the length of the pw range gates . the basic mode of operation will be to decrease the length on one probe until that probe starts to lose signal . a smaller range gate encompassing the heart will give a better signal - to - noise ratio ( snr ). it is possible to use the beam steering angles from the multiple patch probes to guide the process of decreasing the range gate length . for example , if two cmut patch probes are properly positioned on the mother &# 39 ; s abdomen so that two ultrasound beams originate from two points , with the beams at an angle relative to each another and with both beams producing a respective fetal heart signal , then the fetal heart will be located within the spatial intersection of the beams . ( the two probes do not have to be transmitting simultaneously in order for this to happen .) if the dsp ( or other processor ) knew their respective beam steering angles and their relative positions , then the distance of the fetal heart from either probe could be computed , at least approximately , from the geometry of the data collection set - up . the estimated range to the fetal heart could then be used to define a shorter range gate centered around the newly estimated range . however , using the beam steering angles from multiple patch probes to guide the process of decreasing the range gate length is not necessary to practice of the broad concept of the present invention . the process of adjusting the range gate to optimize the snr will be in continuous operation as a method of tracking fetal heart range . the method would be a search algorithm based on the doppler signal power . the range gate would be modified in both size and depth , and changes that resulted in a higher doppler signal power would be retained . the instrument can identify doppler signal power because it is the power of that part of the input signal that gets past the high - pass filter used for stationary clutter rejection . lateral tracking will occur on one probe at a time . the beam will be steered away from the initial beam steering angle in eight directions , i . e ., the eight range gates will surround the range gate of the initial beam in a 3 × 3 spatial relationship . that direction and range giving the best signal ( i . e ., highest snr ) will be the new beam steering angle and range gate depth . extrapolating this principle , one could steer 27 successive beams to acquire data from a cube of range gate positions surrounding the nominal range rate position in three - dimensional space . the implementation of this scheme would require formation of three range gates for each of nine ( eight plus the nominal ) beam steering angles . more specifically , the cmut patch probes can be used to track the location of a fetal heart using a method comprising the following steps : ( a ) scanning a volume inside the abdomen with beams of pulsed ultrasonic wave energy ; ( b ) acquiring acoustic data by transducing ultrasound wave energy returned from the abdomen after each transmission in step ( a ), the acoustic data being acquired using range gates centered in different sample volumes ; ( c ) determining the signal - to - noise ratio of the acquired acoustic data for each different range gate ; and ( d ) determining which one of the different range gates had the acoustic data which produced a maximum signal - to - noise ratio . this determined range gate will then be used to acquire additional acoustic data from which the fetal heart rate will be calculated . typical frequencies for existing fetal heart rate monitoring probes lie in the range of 1 to 2 mhz . in accordance with one embodiment of the present invention , higher frequencies in the range of about 3 to 5 mhz could be used . in some known monitors , a speaker is provided and the probe is manually manipulated until the operator hears the fetal heart . the cmut patch probes disclosed herein can used in conjunction with an instrument operating in such an audio mode . this feature can be utilized to locate the patch probes more accurately at the time of their attachment to the patient &# 39 ; s abdomen . for example , the processor may be programmed with a mode whereby the cmut patch probe is controlled to transmit a series of beams of ultrasonic wave energy in a direction normal to the face of the probe . acoustic data is acquired by transducing the ultrasound wave energy returned from the abdomen of the patient after each beam transmission . the acquired acoustic data is then converted into audible signals using a speaker 38 ( see fig1 ) connected to the processor 34 . the clinician or attending nurse can then attach each cmut patch probe to the abdomen of the patient at a respective location where the respective audible signals produced using each probe sound like or mimic the fetal heart beat . in accordance with a further embodiment of the invention , multiple cmut patch probes can be used to monitor more than one fetus , e . g ., twins , inside a patient . the system will monitor twins by assigning a subset of the probes to one fetus and the rest of the probes to the other fetus . if only two cmut patch probes are used , then each probe will be placed as nearly as possible in positions overlying the respective fetal hearts . when two probes have acquired the same fetal heart , their doppler mean - frequency traces will be in phase . in general , a second fetal heart will result in a mean - frequency trace that is out of phase . the disclosed embodiment will operate on complex baseband signals , and will thus be able to track the fetal heart valve motion through a complete cardiac cycle . for example , the dsp will be programmed to compute the mean doppler frequency on a continuous ( every pulse ) basis , as is done in color m - mode and using the same computations as those used by a color flow mapper ( imaging system ). this will produce a simple signed function of time representing the motion that is being sensed within the range gate . as seen in fig1 , the instrument further comprises a display screen 36 for displaying the fetal heart rate and an image of a pw doppler flow signal taken from the fetus . the spectrogram is similar to that acquired from an adult heart , except that the signal will evidence a higher heart rate . the pw doppler spectrogram shows frequency versus time , in which the mean frequency and bandwidth of the signal vary in a periodic manner . the dsp 34 is programmed to locate the fetal heart signal in space by steering the successively transmitted beams until a doppler signal is acquired that is sufficiently close to being a match of the “ signature ” signal . there is some ambiguity because the shape of the spectral doppler output will change with the angle at which the beam intersects the heart , but the rate will always be higher than that of the mother and accordingly it is believed that an automated search would be feasible . because the cmut patches will be adhered to the mother &# 39 ; s body , and because the fetal heart is tracked in three - dimensional space as it moves relative to the cmut patches , the fetal heart rate should be continuously available without any operator intervention . this arrangement has the following advantages . first , operator intervention is eliminated for operation of the fetal heart rate monitor . second , the mother is allowed free motion while being monitored . third , the heart rate measurement should be more reliable because the relatively smaller ( as compared to current systems ) doppler sample volume will allow a higher doppler signal - to - noise ratio in the measured ultrasound data . although similar capabilities will also be available with standard ( non - cmut ) two - dimensional arrays and real - time three - dimensional imaging , the cost of these devices is likely to be so high as to rule them out for this application . additionally , such transducers are too bulky and heavy to be made to adhere to the skin . furthermore , the use of cmuts permits a relatively easy and low - cost implementation of concepts such as the mosaic annular array . the use of ultrasound measurements in the continuous fetal heart rate monitoring application is enabled by micromachined ultrasonic transducer patch probe technology , which allows ultrasound data to be taken using a thin , lightweight probe that adheres to the patient &# 39 ; s skin . recently semiconductor processes have been used to manufacture ultrasonic transducers of a type known as micromachined ultrasonic transducers ( muts ), which may be of the capacitive ( cmut ) or piezoelectric ( pmut ) variety . cmuts are tiny diaphragm - like devices with electrodes that convert the sound vibration of a received ultrasound signal into a modulated capacitance . for transmission the capacitive charge is modulated to vibrate the diaphragm of the device and thereby transmit a sound wave . one advantage of muts is that they can be made using semiconductor fabrication processes , such as microfabrication processes grouped under the heading “ micromachining ”. as explained in u . s . pat . no . 6 , 359 , 367 : micromachining is the formation of microscopic structures using a combination or set of ( a ) patterning tools ( generally lithography such as projection - aligners or wafer - steppers ), and ( b ) deposition tools such as pvd ( physical vapor deposition ), cvd ( chemical vapor deposition ), lpcvd ( low - pressure chemical vapor deposition ), pecvd ( plasma chemical vapor deposition ), and ( c ) etching tools such as wet - chemical etching , plasma - etching , ion - milling , sputter - etching or laser - etching . micromachining is typically performed on substrates or wafers made of silicon , glass , sapphire or ceramic . such substrates or wafers are generally very flat and smooth and have lateral dimensions in inches . they are usually processed as groups in cassettes as they travel from process tool to process tool . each substrate can advantageously ( but not necessarily ) incorporate numerous copies of the product . there are two generic types of micromachining . . . 1 ) bulk micromachining wherein the wafer or substrate has large portions of its thickness sculptured , and 2 ) surface micromachining wherein the sculpturing is generally limited to the surface , and particularly to thin deposited films on the surface . the micromachining definition used herein includes the use of conventional or known micromachinable materials including silicon , sapphire , glass materials of all types , polymers ( such as polyimide ), polysilicon , silicon nitride , silicon oxynitride , thin film metals such as aluminum alloys , copper alloys and tungsten , spin - on - glasses ( sogs ), implantable or diffused dopants and grown films such as silicon oxides and nitrides . the same definition of micromachining is adopted herein . the systems resulting from such micromachining processes are typically referred to as “ micromachined electromechanical systems ” ( mems ). the use of a mut patch allows the obstetrician to stick the transducer to the mother &# 39 ; s skin . the mut patch is lightweight and flat . in accordance with one embodiment of the invention , the cmut patch probes can be attached to the patient &# 39 ; s skin with an acoustically transparent layer of adhesive . for the purpose of illustration , a transducer patch will be described that is made up of capacitive micromachined ultrasonic transducers ( cmuts ). however , it should be understood that the patch could instead employ pmuts . the concept of the invention can be extended to cover piezoceramics as well as piezoelectric materials . an embodiment will now be described that incorporates a mut patch . however , it should be understood that the present invention encompasses not only a device , but also methods for continuous non - invasive fetal heart rate monitoring . referring to fig2 , a typical cmut transducer cell 2 is shown in cross section . an array of such cmut transducer cells is typically fabricated on a substrate 4 , such as a heavily doped silicon ( hence , semiconductive ) wafer . for each cmut transducer cell , a thin membrane or diaphragm 8 , which may be made of silicon nitride , is suspended above the substrate 4 . the membrane 8 is supported on its periphery by an insulating support 6 , which may be made of silicon oxide or silicon nitride . the cavity 16 between the membrane 8 and the substrate 4 may be air - or gas - filled or wholly or partially evacuated . typically , cmuts are evacuated as completely as the processes allow . a film or layer of conductive material , such as aluminum alloy or other suitable conductive material , forms an electrode 12 on the membrane 8 , and another film or layer made of conductive material forms an electrode 10 on the substrate 4 . alternatively , the bottom electrode can be formed by appropriate doping of the semiconductive substrate 4 . the two electrodes 10 and 12 , separated by the cavity 16 , form a capacitance . when an impinging acoustic signal causes the membrane 8 to vibrate , the variation in the capacitance can be detected using associated electronics ( not shown in fig2 ), thereby transducing the acoustic signal into an electrical signal . conversely , an ac signal applied to one of the electrodes will modulate the charge on the electrode , which in turn causes a modulation in the capacitive force between the electrodes , the latter causing the diaphragm to move and thereby transmit an acoustic signal . the individual cells can have round , rectangular , hexagonal , or other peripheral shapes . a cmut cell having a hexagonal shape is shown in fig3 . hexagonal shapes provide dense packing of the cmut cells of a transducer subelement . the cmut cells can have different dimensions so that the transducer subelement will have composite characteristics of the different cell sizes , giving the transducer a broadband characteristic . unfortunately , it is difficult to produce electronics that would allow individual control over such small cells . while in terms of the acoustical performance of the array as whole , the small cell size is excellent and leads to great flexibility , control is limited to larger structures . grouping together multiple cells and connecting them electrically allows one to create a larger subelement , which can have the individual control while maintaining the desired acoustical response . so a subelement is a group of electrically connected cells that cannot be reconfigured . for the purpose of this disclosure , the subelement is the smallest independently controlled acoustical unit . one can form rings or elements by connecting subelements together using a switching network . the elements can be reconfigured by changing the state of the switching network . however , individual subelements cannot be reconfigured to form different subelements . for the purpose of illustration , fig4 shows a “ daisy ” transducer subelement 24 made up of seven hexagonal cmut cells 2 : a central cell surrounded by a ring of six cells , each cell in the ring being contiguous with a respective side of the central cell and the adjoining cells in the ring . the top electrodes 12 of each cell 2 are electrically coupled together by connections that are not switchably disconnectable . in the case of a hexagonal array , six conductors 14 ( shown in both fig3 and 4 ) radiate outward from the top electrode 12 and are respectively connected to the top electrodes of the neighboring cmut cells ( except in the case of cells on the periphery , which connect to three , not six , other cells ). similarly , the bottom electrodes 10 of each cell 2 are electrically coupled together by connections that are not switchably disconnectable , forming a seven - times - larger capacitive transducer subelement 24 . subelements of the type seen in fig4 can be arranged to form a two - dimensional array on a semiconductive ( e . g ., silicon ) substrate . these sub - elements can be reconfigured to form elements , such as annular rings , using a switching network . fig5 is a drawing showing a mosaic array 40 comprising eight annular elements . the drawing has been simplified by representing each subelement as a square , the squares being aligned in mutually orthogonal rows and columns . however , it should be understood that the subelements could be of the type shown in fig4 , in which case the subelements would be aligned along three axes separated by 60 - degree angles . reconfigurability using silicon - based ultrasound transducer sub - elements was described in u . s . patent application ser . no . 10 / 383 , 990 . one form of reconfigurability is the mosaic annular array , also described in that patent application . the mosaic annular array concept involves building annular elements by grouping subelements together using a reconfigurable electronic switching network . the goal is to reduce the number of beamforming channels , while maintaining image quality and improving slice thickness . to reduce system channels , the mosaic annular array makes use of the fact that for an unsteered beam , the delay contours on the surface of the underlying two - dimensional transducer array are circular . in other words , the iso - delay curves are annuli about the center of the beam . the circular symmetry of the delays leads to the obvious grouping of those subelements with common delays and thus the annular array is born . the reconfigurability can be used to step the beam along the larger underlying two - dimensional transducer array in order to form a scan or image . in accordance with one embodiment of the present invention shown in fig6 , an array of cmut subelements is built on one silicon wafer and conventional complementary metal oxide semiconductor ( cmos ) switches and preamplifier / buffer circuits are formed on a second silicon wafer to provide a cmut patch having reconfigurable beamforming elements . an acoustic backing layer 18 is preferably sandwiched between the cmut wafer 2 / 4 and the cmos wafer 20 with vias 22 for passage of electrical connections between the wafers . the acoustic backing material 18 should have a composition that is acoustically matched to the cmut substrate 4 , to prevent reflection of the acoustic energy back into the device . in the case where the substrate is made of silicon , one example of a suitable backing material comprises a mixture of 96 . 3 % ( by mass ) tungsten ( of which 85 % was 10 micron and 15 % was 1 micron particle size ) and 3 . 67 % polyvinyl chloride ( pvc ) powders , as disclosed in u . s . patent application ser . no . 10 / 248 , 022 entitled “ backing material for micromachined ultrasonic transducer devices ”. the person skilled in the art will recognize that the composition of the acoustic backing material can be varied from the example given above , however , the acoustic impedance of the resulting backing material should be matched to that of the substrate material . for example , if the substrate is silicon , the acoustic impedance should be approximately 19 . 8 mrayls ± 5 %. the cmos electronics preferably includes the transmit and receive circuits ( including a respective transmit / receive switch for each cmut subelement ) and at least a portion of the beamforming circuits . the cmos electronics also include switches that enable reconfiguration of the subelements , allowing an aperture to be translated over the two - dimensional active area of the transducer . the shape of the apertures is determined by the desired steering angle for the ultrasound beam . the beams can be translated across the cmut patch by translating the annular array of activated subelements ( seen in fig5 ) across the patch as shown in fig7 . a uniform translation of the beamforming coefficients produces a new beam at a different location . repeated frequently , this generates a rectilinear two - dimensional image . an additional bilinear term in the beamforming coefficients produces a beam directed away from the normal , as seen in fig8 . while the invention has been described with reference to preferred embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation to the teachings of the invention without departing from the essential scope thereof . therefore it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims . as used in the claims , the term “ data processing means ” means one or more digital signal processors , one or more microprocessors , one or more computers , one or more computer or processor chips , any combination thereof , and any functionally equivalent circuitry , as well as any associated memory device or memory chip for storing executable instructions or data . as used in the claims , the term “ different sample volumes ” means sample volumes that either overlap only partially or do not overlap ( i . e ., occupy the same space ) at all . while only certain features of the invention have been illustrated and described herein , many modifications and changes will occur to those skilled in the art . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention .	0
in accordance with one aspect of the invention , ion implantation can be used to improve the uniformity and controllability of a timed etch . as described below , this ion implantation can advantageously enhance the etch rate within a depth range that reaches down to a desired etch depth . fig2 illustrates exemplary steps for improving the uniformity and controllability of a timed etch . in step 201 , a wafer having patterned silicon and dielectric areas can be positioned for an etching process . this wafer could have a simplified cross - section similar to that shown in fig1 a . in step 202 , an ion implantation process can be performed . the implantation effectively “ damages ” the upper portions of the silicon and dielectric areas . in other words , much like spraying a plaster wall with bullets can facilitate the subsequent removal of the plaster , ion implantation can accelerate the subsequent removal of the implanted material during a subsequent timed etch . as shown in fig3 , damaged region 301 ( shown by the dotted , semi - transparent area ) has a depth 302 within the dielectric areas . note that the depth of the damaged region 301 within the silicon areas may be different than depth 302 . depth 302 is determined by the implant species ( e . g . argon ), the dose of the implant ( e . g . 1e14 per square centimeter ), and the energy of the implant . notably , ion implantation is an extremely uniform process ( e . g . dose and energy of an implant species can be controlled within 1 % across a wafer and from wafer to wafer ). as a result , depth 302 can be controlled to a precise depth range . therefore , referring back to fig2 , when a timed etch ( e . g . a wet etch such as a diluted hydrofluoric acid solution or a dry etch such as a plasma etch including fluorine radicals ) is performed in step 203 , the etch depth of the dielectric areas can be precisely controlled . specifically , as shown in fig4 , the etched dielectric areas 401 have an etch depth 402 that is substantially identical to the depth 302 ( fig3 ) of damaged region 301 within the dielectric areas . this is because the etch rate of the damaged dielectric is significantly enhanced as compared with the etch rate of the underlying undamaged dielectric . thus , once the timed etch reaches the undamaged dielectric , i . e . the dielectric areas below depth 302 , the etching rate dramatically slows . advantageously , by accelerating the etch rate by a factor of x ( greater than 1 ), the amount of time needed to etch the damaged dielectric areas can be reduced by a factor of 1 / x . therefore , the over - etch time needed to ensure that all dielectric areas on the wafer are etched to at least the desired etch depth can also be reduced by a factor of 1 / x . reducing the over - etch time can significantly minimize etch depth variations across the wafer . thus , by enhancing the etch rate within a precise depth range that reaches down to the desired etch depth , the uniformity and controllability of a timed dielectric etch process can be significantly improved . note that damaged region 301 also includes portions of patterned silicon layer 101 . the damage within the silicon can be easily repaired by thermal annealing at a temperature greater than approximately 500 degrees celsius to re - crystallize the silicon epitaxially from the underlying undamaged portions . such a thermal annealing process , which is called solid phase epitaxial re - crystallization ( sper ), is well known to those in the integrated - circuit manufacturing industry . it can be performed either before or after the timed dielectric etch , preferably the latter to avoid partial healing of the intentional damage in the dielectric areas . the sper temperature and duration should ideally be sufficiently low so as to minimize diffusion of any dopant atoms ( e . g . boron , indium , phosphorus , arsenic , antimony ) within the silicon . by forming metal - oxide - semiconductor field effect transistors ( mosfets ) over a substrate having precisely - formed and regularly - spaced stripes ( ridges of semiconductor material ( s )), both high performance ( i . e . high on - current ) and low static power consumption ( i . e . low source - to - drain leakage current ) can be achieved with good uniformity . the stripes , which can be formed with the aid of an ion implantation process as described below , enable the formation of segmented channel regions that accommodate a wide range of gate - electrode configuration options and also provide greater performance consistency between devices . fig5 a shows a top view of an exemplary transistor 500 that includes a segmented channel region . transistor 500 is formed on a substrate 590 and is surrounded by device isolation material 593 ( e . g . shallow trench isolation ), and includes a source 510 , a drain 530 , a gate 550 , sidewall spacers 561 and 562 , a source contact region 571 , and a drain contact region 572 . gate 550 ( with a gate length lg ) is located between source 510 and drain 530 and is formed over a channel region 520 in substrate 590 . sidewall spacers 561 and 562 lie over at least a portion of source 510 and drain 530 , respectively , and serve to offset the gate 550 from source contact region 571 and drain contact region 572 , respectively . as indicated by the dotted lines , channel region 520 includes multiple ridges 591 that run between source 510 and drain 530 . ridges 591 are formed from at least one semiconductor material and may be homogenous structures ( e . g . silicon ). ridges 591 are formed on an elevated base region 595 that rises from substrate 590 , as shown in fig1 b . fig1 b is a cross - sectional view of transistor 500 through view location a - a ( rotated 90 ° for clarity ). each ridge 591 has a width w , and is spaced from adjacent ridges by a spacing sp . furthermore , each ridge 591 extends a height hr above elevated base region 595 , which itself rises a height hb from the adjacent surfaces 590 - s of substrate 590 . note that because ridges 591 are identified relative to substrate 590 , ridges 591 continue to exist as “ ridges ” even covered with other materials ( e . g . even though ridge isolation material 592 , device isolation material 593 , gate dielectrics 540 , and gate 550 completely cover ridges 591 , ridges 591 are still considered to be ridges .) as described in greater detail below , each of ridges 191 is a highly precise structure that therefore provides highly quantifiable performance measures . transistor 500 is isolated from adjacent devices by device isolation material 593 ( e . g . silicon dioxide ), which extends down to surfaces 590 - s of substrate 590 ( i . e . down to the bottom of elevated base region 595 ). ridge isolation material 592 ( which can be formed from the same material ( s ) or different material ( s ) than device isolation material 593 ) fills the inter - ridge regions to a distance hg below the top of ridges 591 . gate 550 is formed over the top portions of ridges 591 , separated from those top portions by gate dielectric 540 ( which can be formed from any dielectric material ( s )). thus , when appropriate voltages are applied to gate 550 and between source 510 and drain 530 , each of ridges 591 conducts a portion of the total on - current that flows through transistor 500 . note that gate dielectric 540 and gate 550 “ wrap ” around the top portions of ridges 591 ( i . e . gate dielectric 540 and gate 550 extend down the sides of ridges 591 ). this wrapping configuration allows gate 550 to more effectively control the electric potential distribution within channel region 520 , and can therefore enhance on - current while minimizing source - to - drain leakage current . fig5 c shows a cross - sectional view of transistor 500 through view location b - b indicated in fig5 a . view location b - b provides a cross - sectional view running parallel to the direction of current flow between source 510 and drain 530 and through one of ridges 591 , and therefore indicates the full doping profiles in and around channel region 520 . as indicated in fig5 c , source 510 and drain 530 are doped regions within ridge 591 . note that while depicted as extending below the bottom of ridges 591 for exemplary purposes , the depth d of source 510 and drain 530 below the surface of ridge 591 can alternatively be less than the overall height hr of ridge 591 ( i . e . depth d is less than ridge height hr ), so that ridge isolation material 592 ( shown in fig5 b ), which starts from the base of ridge 591 , can effectively reduce the area of the junction between the source 510 and substrate 590 , and the area of the junction between the drain 530 and substrate 590 , thereby reducing junction leakage and capacitance . fig5 d shows a cross - sectional view of transistor 500 through view location c - c indicated in fig5 a . view location c - c runs between two ridges 591 , parallel to the direction of current flow between source 510 and drain 530 . therefore , fig5 d depicts gate 550 ( and sidewall spacers 561 and 562 ) extending down below the top surface of ridge 591 . specifically , gate 550 extends down to the level of ridge isolation material 592 . note that because view location c - c runs between ridges 591 , the portions of source 510 and drain 530 on either side of gate 550 ( and sidewall spacers 561 and 562 , if present ) are actually fill regions 591 - f ( i . e . regions formed by filling the space between the exposed portions of adjacent ridges 591 ). u . s . patent application ser . no . 11 / 173 , 237 , entitled “ segmented channel mos transistor ” and filed on jul . 1 , 2005 by synopsys , inc ., describes transistor 500 in greater detail and is incorporated by reference herein . table 1 shows sample data for comparing the performance ( on - state drive current and off - state source - to - drain leakage current , each normalized to the transistor layout width ) of various n - channel implementations of transistor 500 ( rows 1 , 2 , 3 , and 4 ) against the performance specifications with no carrier mobility enhancement as published in the international technology roadmap for semiconductors ( itrs ), 2003 edition ( rows 7 and 8 ). each of the implementations of transistor 500 is based on a fundamental set of implementation values , including a single ridge 591 in the channel region , a 20 nm spacing between ridges 591 ( i . e . the total layout width of the simulated transistor 500 is the ridge width w plus 20 nm ), a thickness for gate dielectric 540 equivalent to 1 . 2 nm of sio 2 , an undoped channel , a heavily p - type doped ( 2 × 10 19 cm − 3 boron ) pulse doped region starting precisely at the end of the gate overlap ( i . e . at a distance x recess below the surface of the ridge ), no stress - based mobility enhancement , and singly doped source / drain regions . as indicated in table 1 , design number 1 , which incorporates a ridge width of 20 nm , a gate length of 20 nm , and a recess distance x recess of 5 nm ( a “ slight recess ”), provides an on - state drive current i on of 0 . 5 ma / μm and an off - state source - to - drain leakage current i off of 3 × 10 − 6 na / μm . note that i on and i off are listed in terms of current per micron layout width ( in the direction transverse to the direction of current flow ) to normalize the current values . increasing the recess distance x recess to 10 nm in design number 2 provides an increase in i on to 0 . 6 ma / μm , at the trade - off of increasing i off to 0 . 4 na / μm . further increasing recess distance x recess to 15 nm in design number 3 provides a significant jump in ion to 0 . 98 ma / μm , but increases i off to 500 na / μm . thus , implementing transistors using values similar to design number 3 would generally be best for high performance circuits , whereas implementing transistors using values similar to design number 1 would be best for ultra - low power circuits . as indicated by the performance values provided for design numbers 1 - 3 , the relationship between on - current i on and off - current i off can be adjusted via recess distance x recess , i . e . the depth of the heavily p - type doped region . in contrast , the i n / i off relationship in conventional transistors is typically modified by adjusting the doping concentration within the channel region to achieve a particular threshold voltage . because dimensional control ( i . e . control over recess distance x recess and depth of the heavy channel doping profile ) can be more precise than dopant concentration control ( i . e . control over the number of dopant atoms in the channel region ), transistors having a corrugated channel made using the above - described ion implantation process and a subsequent timed etch can significantly ease the difficulties associated with achieving a particular combination of on - current i on and off - current i off . advantageously , ion implantation can be used to control etching depth in materials other than oxide . for example , fig6 illustrates a cross - sectional view of an inverted t - channel field - effect transistor ( itfet ) 600 . itfets are described in “ inverted t channel fet ( itfet )— fabrication and characteristics of vertical - horizontal , thin body , multi - gate , multi - orientation devices , itfet sram bit - cell operation . a novel technology for 45 nm and beyond cmos ”, which was authored by l . mathew et al . and published by ieee in 2005 . in itfet 600 , fin channel 602 a and planar channel 602 b , which are formed on a buried oxide ( box ) layer 604 , provide both vertical and horizontal channel regions ( hence the “ inverted t ” designation ). after formation of fin channel 602 a and planar channel 602 b , a thin gate dielectric 603 can be formed on fin channel 602 a and planar channel 602 b . then , a polycrystalline - silicon layer can be deposited and patterned to form a gate 601 for itfet 600 . notably , the thickness of planar channel 602 b ( i . e . the horizontal portions of the channel ) determines the threshold voltage of itfet 600 . therefore , the etching of the silicon layer to form fin channel 602 a and planar channel 602 b is critical to the performance of itfet 600 . advantageously , the above - described ion implantation process can precede the timed etch of the silicon to provide a precise silicon etch depth 605 . in one embodiment , the dopant species used in this ion implantation can include germanium at a dose greater than or equal to 1e14 per square centimeter . the depth to which a threshold level of damage can be precisely controlled by adjusting the dose and energy of the implanted species . by enhancing the silicon etch rate within a precise depth range , the uniformity and controllability of the silicon etch process can be substantially improved , thereby minimizing itfet performance variations across a wafer . the use of an ion implantation process to improve etch depth uniformity can be applied to various types of devices having vertical surfaces . for example , fig7 illustrates an exemplary dynamic random access memory ( dpam ) cell 700 including an access transistor 701 and a capacitor 702 fabricated in a semiconductor substrate 703 . capacitor 702 is partially formed in a cavity of a shallow trench isolation ( sti ) region 704 , which is adjacent to a sidewall region of substrate 703 . a patterned polycrystalline - silicon layer 706 can be used to form the electrodes of access transistor 701 and capacitor 702 . the portion of capacitor 702 formed in the sidewall region can increase its capacitance with a minimum of layout area . notably , the junction of this sidewall portion with the horizontal portion of capacitor 702 may result in some undesirable leakage . however , the depth of the sidewall portion can compensate for such leakage . a recess depth 707 of sti region 704 in which this sidewall portion of capacitor 702 is formed can significantly affect the final capacitance of capacitor 702 . therefore , the etching of sti region 704 ( e . g . a field oxide ) to form capacitor 702 is critical to its performance . advantageously , the above - described ion implantation process can precede the timed etch of sti region 704 to accurately and uniformly provide recess depth 707 . by enhancing the etch rate of sti region 704 within a precise depth range , the uniformity and controllability of the sti region etch process can be substantially improved , thereby minimizing variations of capacitances across a wafer . although illustrative embodiments of the invention have been described in detail herein with reference to the accompanying figures , it is to be understood that the invention is not limited to those precise embodiments . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed . as such , many modifications and variations will be apparent . for example , in one application , the fin height of finfets ( transistor structures with fin - like channel regions ) made on bulk silicon wafers can be determined by using the above - describe ion implantation and timed etch to provide precise control of etch depth , thereby minimizing finfet performance variations . accordingly , it is intended that the scope of the invention be defined by the following claims and their equivalents .	7
the pressure gas engine 10 of the embodiment illustrated has a casing 11 including a portion 12 in which are located vent openings 13 that communicate between an exhaust chamber 14 of large cross sectional dimensions for essentially unrestricted gas flow and an auxiliary chamber 15 defined by a peripheral wall 16 containing gas flow openings 17 leading to a space 20 defined on the outer side by a wall 21 similar to the wall 16 and also containing gas flow openings 22 . these openings lead to a further chamber 23 defined by an outermost wall 24 in which are located in circular series large exhaust openings 25 to the atmosphere . the engine 10 includes an interior rotor 26 mounted for rotation with an axle 27 that is supported on spaced ball bearing structures 30 and 53 . the rotor 26 is surrounded by a wall 31 that operates as a stator nozzle plate 32 and contains an arcuate series of converging - diverging nozzles 33 each having ( fig3 ) a converging entrance 34 , a throat 35 and a diverging exhaust end 36 for creating sonic or supersonic gas flow 134 through the nozzles . as shown in fig3 each nozzle 33 is located in an opening 38 that is aligned on the chord of the circle defining the inner periphery 40 of the plate 32 . as shown in fig4 the rotor 26 contains a peripheral series of outwardly opening buckets 41 that have arcuate impulse surfaces 42 extending substantially between the opposite sides 28 and 29 of the rotor 26 . each adjacent pair of buckets is separated by a knife edge 43 so that the high velocity gas will be divided by the knife edges without substantial restraint into the buckets as the buckets pass each nozzle . the relationship of the exhaust end 36 of each nozzle to the bucket surface 42 is shown at the top of fig4 . as is shown there , the nozzle exhaust enters the bucket at one side 44 thereof and then sweeps around in a smooth unobstructed arc to exhaust at the opposite side 45 . this provides a smooth wiping action on the impulse surfaces 42 that converts pressure energy of the sonic or supersonic gas flow to rotational energy of the rotor . thus the nozzles 33 comprise first energy conversion means for converting gas pressure to gas velocity while the series of buckets 41 comprise second energy conversion means for converting gas velocity to power . the stator plate 32 containing the nozzles 33 also includes a peripheral portion 46 for directing the gas flow into the nozzles in the fixed stator plate 32 . the casing 11 has extending therefrom a tube 47 that is hollow as shown at 50 to serve as a handle and a conduit for pressurized gas flow 51 which can conveniently be compressed air . the one end 52 of the axle 27 is provided with a second ball bearing structure 53 similar to the first structure 30 . opposite this end 52 of the axle 27 is a positioning lock nut 54 . mounted on the axle 27 between the bearings 30 and 53 is a small circular gear 55 which meshes with a large circular gear 56 mounted on , for rotation with , a stub shaft 57 so that the combination is rotatable within the casing portion 60 on a pair of spaced ball bearing structures 61 . the shaft 57 is provided with a projecting end portion 62 that is sealed to the casing portion by a seal plate 63 and gasket 58 . this end 62 of the shaft 57 has mounted thereon in the illustrated embodiment a grinding disc 64 that is partially enclosed in the customary manner by a guard 65 mounted on the end of the casing portion 60 through which the shaft 62 extends . leading from the hollow chamber 50 in the conduit and handle 47 for flow 51 of the pressurized gas such a compressed air is a passage 66 that is normally closed by a valve piston 67 usually held in closed position by a compression spring 70 . this spring is retained in a chamber 71 in a threaded closure 72 . the piston 67 may be moved from its normally closed position as shown in fig1 to an open position as shown in fig2 by a hinged lever 73 including a handle position 74 . gas in the passage or chamber 66 presses against the end 75 of a slidable piston 76 . this piston 76 is normally urged to its closed position which is the extreme left position in the illustrated embodiment of fig1 by a helical compression spring 77 ( fig2 ). this spring together with gas pressure in a manner to be explained hereinafter holds the piston 76 in the left or closed position of fig1 until the forces in the chamber 66 acting on the end 75 are sufficient to move the piston as to the partially open or right position of fig2 . the piston end 75 operates as a gas valve blocking flow of gas from the chamber 66 when the end 75 bears against an annular valve seat 80 as shown in fig1 . surrounding the valve seat 80 and the corresponding annular valve edge portion of the end 75 is a second gas chamber 81 . when compressed air , for example , is admitted to this chamber 81 from the chamber 66 by the open piston valve 76 , as illustrated by the air flow arrow 82 , this air immediately is free to flow through the series of nozzles 33 ( of which only one is shown in fig1 and 2 ) to sweep through the impeller buckets 41 , as indicated by the arrow 83 , to impart rotational forces to the rotor 26 and thereby to the axle 27 to rotate the grinding disc 64 by way of the gears 55 and 56 and the stub shaft 62 . the exhaust gas 83 from the buckets passes unhindered from the exhaust sides 45 ( fig4 ) of the buckets directly into the relatively large chamber 14 in a direction that is generally radial to the rotor 26 as shown at 83 in fig2 and from there through the openings 13 , chamber 15 , openings 17 , chamber 20 , openings 22 , chamber 23 and openings 25 into the ambient atmosphere . the piston 76 , its end surface 75 and the annular valve seat 80 are all parts of the governor system for controlling the speed of rotation . this speed control is accomplished by metering the incoming gas between the end surface 75 and the valve seat 80 by increasing and decreasing the pressure of the gas in the piston area . in order to minimize the change in force exerted on the bellows 93 by the variation in gas pressure surrounding the outside of the bellows , the bellows is surrounded by a chamber 85 which is pressurized by gas bled through a passage 84 from the main gas supply chamber 66 . chamber 66 has much less pressure variation than chamber 81 during normal governed turbine operation . an o - ring gasket 86 seals one end of the chamber 85 from outside pressure effects . the piston 76 at the end adjacent to the valve seat 80 is provided with a gas passage 87 that extends inwardly through a small chamber 90 and an inner passage 91 to an interior chamber 92 within the extensible bellows 93 . the chamber 90 is provided with a filter 94 for intercepting foreign material carried by the incoming gas whose flow is indicated by the arrow 95 . the interior 92 of the bellows 93 communicates with a passageway 96 in a guide pin retainer 97 which retains an axial guide pin 98 that is slidably attached to the guide post 115 for guiding the longitudinal movement thereof . the passageway 96 communicates with a passageway 101 which joins with a continuous passageway 102 and 103 ( indicated by the broken line in fig2 ) to a trigger adjuster insert 122 and into chamber 105 which is sealed at each end by sealing gasket o - rings 106 . the chamber 105 is provided with exit openings 107 that lead through the trigger adjuster screw 110 and into the internal chamber 111 . from this chamber 111 the gas exits by way of a small axial passage 112 as indicated by the flow arrows 113 . flow through this passage 112 is metered by the movable trigger pin 114 . a guide post 115 at the piston 76 is press fitted into the piston at the end 75 thereby holding the filter 90 in position . the bellows 93 is attached in gas tight relationship to the movable piston 76 in an annular section 116 into which the guide post 115 is press fitted . a larger o - ring 117 is provided at the fixed retainer 97 adjacent to the end o - ring 86 ( that seals the retainer 97 and housing 11 ) to form a gas tight seal at this fixed end of the bellows 93 and thereby seal the interior 92 of the bellows from the exterior chamber 85 . the guide pin 98 is provided with a bushing 120 that provides a bearing surface for a slip fit to the guide pin 98 thereby preventing the assembly of guide post 115 and annular section 166 of piston end 75 from angling and jamming against the cylinder wall portion 121 of the casing 11 . at the opposite end of the air flow passageways 96 and 101 - 103 the trigger adjuster insert 122 provides a convenient mounting for the trigger adjuster screw 110 . this adjuster insert 122 is press fitted into the housing 104 and an outer closure plug 123 is press fitted into screw 110 to provide a closure to the internal chamber 111 . the speed governor trigger structure is illustrated in fig1 and 2 in association with the rest of the embodiment and in fig5 - 8 in enlarged detail . this trigger mechanism comprises a main body 124 that is attached to the rotor axle 27 by means of screw threads 125 that engage a similarly shaped axle recess in the end of the drive shaft 27 . a backing ring 126 forms a part of the body 124 and this ring provides a support for a leaf spring 127 that has diametrically opposite upstanding arms 130 that are centrifugally responsive for movement outwardly away from each other . at increasing speeds of rotation 131 the arms 130 flex outwardly under increasing centrifugal forces as indicated by the arrows 132 and at maximum desired outward movement corresponding to highest governed speed these arms 130 contact and are supported by an inclined annular surface 133 located on the interior of the backing ring 126 to prevent accidental damage to the arms at extremely high speed such as those resulting from the misadjustment or failure of the governor . since the limitation of outward movement of the arms 130 by the annular surface 133 also limits the motion of trigger pin 114 toward surface 172 , contact between pin 114 and the surface 172 of the trigger adjuster screw 110 can be prevented if desired . as explained earlier , the trigger pin 114 serves as a metering device to meter and control the gas flow 113 from the chamber 111 through the metering orifice or passage 112 . the pressure gas engine 10 embodied in the illustrated air turbine includes an overspeed safety device that is illustrated most clearly in fig2 and 10 . this device provides a positive braking action in the event of a governor failure tending to produce excessive speeds . where the engine is used to power an abrasive wheel , for example , such a safety device is of very great importance as excessive centrifugal forces can of course cause a violent disintegration of the grinding wheel . in addition , the device of this invention also prevents the engine from commencing rotation after it has been stopped by the safety device until the engine has been disassembled and reactivated as when making repairs . as is shown in fig1 and 2 the rotor 26 having a series of buckets as shown in fig4 normally is rotated by pressurized gas indicated by the arrow 134 entering the buckets in the rotating rotor 26 from the nozzles 33 as previously described . the rotor is located in a chamber 135 that is considerably wider in vertical direction as shown in fig1 and 3 than is the thickness of the rotor 26 itself . the rotor 26 is longitudinally slidable on the axle 27 between the normal operating position of fig1 and 2 and the non - operating or raised position as illustrated in fig9 . when in the raised position a peripheral side surface 136 of the rotor 26 comes in contact with friction pads 137 ( or a single pad if desired ) which may be of any material exerting a friction braking action on the side surface 136 and thus may be leather , asbestos or any desired material . if less than the maximum braking effect is desired , the normal force between the friction pads 137 and surface 136 of the rotor 26 must be limited . for this purpose surrounding the end of the axle 27 that is adjacent to the trigger body 124 previously described is a helical compression spring 140 the outer end of which bears against an inverted dish - shaped mechanical stop 141 that abuts against the trigger body base 142 and the other end of which bears against a shoulder 143 . the stop 141 is provided so that as the rotor 26 moves from the operating position of fig1 and 2 to the braked position of fig9 the rotor contacts the stop 141 after contacting the yielding spring loaded pads 137 but before contacting the surface 173 of chamber 135 . in this way the spring loaded pads apply a controlled braking force to the rotor 26 . the operating portion of the overspeed safety device comprises a plurality of steel balls 144 , here shown as three , each located in a recess 145 each having an upwardly and outwardly inclined outer surface 146 . during normal rotation the balls 144 are located deep within their recesses as shown in fig2 allowing proper rotor - to - nozzle alignment so that the pressurized gas 134 from the nozzles 33 sweeps the buckets , as previously described , and rotates the rotor 26 and the parts attached thereto . the recesses 145 in which are located the balls 144 are formed in one side of a ring 147 that is attached to the drive axle 27 . this ring is keyed to the shaft 27 by a key lock 150 as illustrated in fig1 . the ring 147 also includes tapered openings 151 of a generally frustoconical shape with the taper widening toward the rotor 26 . in the embodiment illustrated there are three of these openings 151 each receiving a similarly tapered end 152 of a pin 153 . when the engine or turbine 10 is at rest as shown in fig1 the main control valve piston 76 is in closed position with the surface 75 held against the annular valve seat 80 by the spring 77 . then , to operate , the lever 73 is moved about its fulcrum 154 as to the position shown in fig2 which raises the control valve piston 67 away from its seat 155 thereby admitting compressed air or other pressurized gas flow 51 into the piston chamber 66 in a volume flow that is dependent on the positioning of the lever 73 and thus the position of the valve 67 . air from the chamber 66 is bled into the interior chamber 92 in the bellows 93 through the series of bleed lines 87 , 90 and 91 . this air then flows out through passages 96 , 101 , 102 , 103 , 105 , 107 and 111 , through orifice 112 past wide open valve 114 to atmosphere . since exit orifice 112 is much larger than air entrance orifice 91 , only a relatively low pressure is maintained in bellows chamber 92 . at the same time , air from chamber 66 flows through the bleed line 84 to the chamber 85 surrounding the bellows 93 . since the passage 84 is much larger in cross sectional area than a cylindrical gap 166 that exists between the piston 76 and the cylinder wall 121 , the pressure in the chamber 85 is nearly equal to that in chamber 66 . the air pressure in chamber 66 exerts a force on the exposed surface 75 of valve 76 . this surface 75 is made large enough for air pressure acting on it from chamber 66 to overcome the total combined forces on its opposite side generated by the helical spring 77 and air pressure in chambers 92 and 85 . therefore , the opening of valve piston 67 to introduce air pressure into the chamber 66 immediately causes this pressure acting on the surface 75 to open the control valve 76 as described . as can be seen in fig1 and 2 , the extent of movement of the valve 76 is limited between the fully closed position of fig1 where the surface 75 bears against the annular valve seat 80 and the fully open position in which an annular surface 156 on the piston bears against an annular stopping surface 157 . as can be seen in fig2 the surfaces 75 and 156 of the control valve piston 76 are on opposite sides of an annular flange 148 . when the control valve piston 76 is either partially or completely open , the air for example flows into the surrounding chamber 81 as illustrated by the arrow 82 in fig2 . this air then flows through the converging - diverging nozzles 33 in the annular wall 31 which functions as a stator plate or nozzle plate 32 . this air 134 from the nozzles 33 wipes across the surfaces 42 of the buckets 41 thereby causing rotation in the rotor 26 . this type of sonic or supersonic nozzle and bucket arrangement is disclosed and claimed generically in prior u . s . pat . no . 3 , 930 , 744 also assigned to the same assignee . the air exiting from the buckets 41 during rotation of the rotor 26 then enters the large chamber 14 under low back pressure . from there the air flows through the large openings 13 into the correspondingly large chamber 15 and from there to ambient through the successive plurality of holes 17 , 22 and 25 . in order to maintain the speed of the turbine 10 the flow of air 82 to the nozzles 33 striking the turbine bucket surfaces 42 must be varied so that the torque applied to the turbine rotor 26 will substantially balance the opposite load torque exerted on the rotor shaft 27 through the gears 55 and 56 by varying external loads applied to the shaft 62 . this is done by moving the piston 76 ( the surface 75 ) relative to the valve seat 80 . the movement of piston 76 is caused by changes of the gas pressure in chamber 92 . for example , as the pressure in chamber 92 decreases , the force of air pressure acting on the surface 75 of the piston 76 overcomes the forces acting on the bellows side of the piston 76 causing the surface 75 to move away from the seat 80 allowing more air 82 from passage 66 to flow through nozzles 33 . this increases the torque developed by the turbine 26 on the shaft 27 . conversely , if the pressure in chamber 92 increases , the valve 76 closes reducing the air flow 82 to the nozzles 33 and consequently the turbine torque . the governing of the turbine torque is controlled by the speed sensitive bleed control valve 112 . this valve 112 varies the back pressure in the bellows chamber 92 and thus changes the turbine torque to match the load torque allowing the turbine to reach quickly a predetermined no load speed . the valve 112 also decreases the back pressure in the bellows chamber 92 as the speed of the turbine drops due to increased loads . the decrease in the bellows chamber pressure allows greater torque to be developed by the turbine 26 to counterbalance the increased load torque . this prevents excessive speed drop and efficiency losses of the turbine motor . to allow the speed sensitive bleed control valve 112 to vary the back pressure in the bellows chamber 92 , there is provided a passage 91 of piston 76 to allow a metered flow of air 84 to pass into bellows chamber 92 and from there flow through passages 96 , 101 , 102 , 103 , annular chamber 105 , central chamber 111 , through the series of openings 107 to the axial orifice passage 112 opposite the speed control valve piston 114 of the speed responsive device 158 . as shown in greater detail in fig5 - 8 , this speed responsive device 158 comprises a trigger body 124 that is mounted on the end of the drive shaft or axle 27 on which the rotor 26 is mounted so that the two rotate as a unit under the force developed in the nozzle and bucket combination as described . this trigger body 124 in general comprises a hexagonal plate 159 from which projects the annular backing ring 126 . this trigger body 124 has mounted on it the flat spring 127 having projecting arms 130 arranged substantially parallel to the axis of rotation 160 . the spring 127 ( of which the centrifugally responsive arms 130 are a part ) is mounted on a circular insert 162 within a recess in the trigger body 124 by a pair of screws 163 . actually , in the illustrated embodiment , these arms 130 are not exactly parallel but are bowed outwardly to a small extent . these arms when subjected to the centrifugal forces of rotation 131 tend to move outwardly as shown at fig6 by the arm movement arrows 132 . the spring arms 130 are always returned to their normal position shown in fig5 when the turbine stops . simultaneously a helical spring 164 retained in a recess 165 returns the piston 114 . the outward movement of the arms under increasing speeds of rotation bows the central portion 161 of the centrifugally responsive spring 127 to move the trigger pin 114 closer to the axial bleed orifice passage 112 as can be seen by a comparison of fig5 and 6 . this partially blocks the orifice and reduces the flow of the bleed air 113 thereby increasing the pressure in the chamber 92 . this increase in back pressure moves the piston 76 closer to the seat 80 reducing the torque of the turbine 26 as previously described until equilibrium of the turbine torque and load torque results in a constant steady speed . an increase in the load torque will result in a corresponding loss in turbine speed . this speed drop reduces the centrifugal force 132 acting on the arms 130 of the speed responsive device 158 . this drop in force 132 on the arms 130 allows the arms to move together reducing the amount of bow in the central portion 161 of the centrifugally responsive spring 127 and allows the helical spring 164 to withdraw the trigger pin 114 to a position further from the orifice 112 . this movement of the pin 114 reduces the restriction of the bleed air 113 flowing from the orifice 112 . the resulting increased flow of bleed air from the bellows chamber 92 causes the pressure in the chamber 92 to decrease . as previously described , this allows more air to flow to the turbine 26 thereby increasing the turbine torque . these changes continue until once again the torque developed by the turbine is substantially equal to the combined load torques . once this equilibrium exists , the turbine operates at a constant and somewhat lower speed . as the load torque varies during the operation of the turbine , the governing system responds as described to maintain the balance of air flow 82 past the control valve 76 necessary to minimize the changes in turbine speed with load . the pressure gas engine also includes an overspeed safety apparatus that not only interrupts the pressure gas flow into the turbine buckets during overspeed but also automatically moves and holds the rotor in contact with the braking means embodied in the braking pad or preferably pads 137 . this braking apparatus operates as follows . during normal operation of the turbine with the parts normally in the position of fig1 before rotation begins and then in the position of fig2 after rotation begins , the air flows to the nozzles 33 and from there through the buckets 41 on the rotor 26 . however , if the speed control or any other portion of the apparatus malfunctions tending to increase the speed to dangerous levels , the centrifugally responsive balls 144 will move outwardly and forwardly on the inclined surfaces 146 of the pockets or recesses 145 in which they are located . this upward and outward movement as indicated by the arrow 167 in fig2 causes the force of the balls to slide the rotor 26 against the force of retaining spring 140 . when the balls 144 are at their maximum outward positions they have moved the rotor 26 so that the air 134 ( fig9 ) from the nozzles 33 cannot enter the buckets . the movement of the rotor 26 in this manner not only prevents the nozzle air 134 from entering the rotor buckets 41 but also permits this pressurized gas or in this embodiment air 134 to enter the large chamber 135 behind the rotor 26 on the side thereof opposite the friction surfaces 168 of friction brake pads 137 . this then means that the full force and pressure of the gas 134 operates against the rotor to press the rotor against the pads 137 and provide an immediate stopping to the rotation of the rotor . in order that this stopping of rotation will not be too abrupt which might tend to throw the illustrated grinding disc 64 from the shaft end 62 , there is also provided the dish - shaped stop 141 which is contacted by the rotor before the rotor contacts the housing adjacent surface 173 . before the rotor contacts this stop 141 , it contacts the spring loaded friction pads 137 as described . this allows the springs 171 to apply a controlled normal force to the friction pads 137 causing a controlled frictional braking force to act on the rotor surface 136 . thus , the overspeed safety device brakes the rotor relatively gently to a complete stop so as to avoid damage . in order to permit this axial movement of the rotor 26 relative to the axle 27 , the rotor 26 is releasably connected to the axle 27 by way of the ring 147 through a plurality of connecting pins 153 of which there are three in number in the illustrated embodiment . these pins 153 each had a conical end 152 that are held in similarly conical recesses 151 in the ring 147 during normal operation as is illustrated in fig1 and 2 . however , during these excessive speeds and the axial movement of the rotor 26 to the fully braked position of fig9 these conical ends 152 are almost completely removed from the recesses 151 ( fig9 ). in order that the engine cannot again be operated until the malfunction condition is corrected , the balls 144 are then positioned between the ring 147 and the rotor body 26 as shown in fig9 so that the rotor 26 cannot be moved back to operating position until the engine has been dismantled and the condition corrected at which time the balls 144 can be moved back to their normal position within the recesses 145 and essentially out of contact with the rotor 26 .	5
the device 1 according to the invention shown in the drawing serves for ventilating a fuel tank 2 of an internal combustion engine 3 which for example can be the internal combustion engine of a motor vehicle with hybrid drive or of a motor vehicle with automatic start - stop mechanism , or the device can be the internal combustion engine of a plug - in motor vehicle which is driven by an electric motor , which combustion engine serves as an auxiliary motor for charging a vehicle battery . the device 1 includes an activated carbon filter 4 , which is connected to the interior of the fuel tank 2 by a first gas 5 line which is also referred to as tank venting line , to the environment or the atmosphere by a second gas line 6 also referred to as ventilation line , and to an intake tract 9 by a third gas line 8 also referred to as regeneration line . the first and the third gas lines 5 , 8 lead into the activated carbon filter 4 at one side , while the second gas line 6 leads into the activated carbon filter at the opposite side . a tank shut - off valve 10 is inserted into the first gas line 5 , while a ventilation and aeration valve 11 is inserted into the second gas line 6 and a regeneration valve 12 into the third gas line 8 . each valve 10 , 11 and 12 is a controllable proportional valve with an actuator in the form of an electromagnet 14 , 15 , 16 . the opening cross section of the valves 10 , 11 , 12 is controlled in the opened state by an engine control unit 13 of the internal combustion engine 3 in dependence on the loading condition of the activated carbon filter 4 . the valves 10 , 11 , 12 can be active valves , whose opening cross section respectively corresponds to the amperage of the exciting current which is conducted to the electromagnet 14 , 15 , 16 of the valve 10 , 11 , 12 under the control of the engine control unit 13 , or passive valves , whose opening cross section is changed by the engine control unit 13 by changing the exciting current to the electromagnet 14 of the valve 10 , 11 , 12 , and is maintained when the current supply to the electromagnet 14 , 15 or 16 respectively is interrupted by the engine control unit 13 . the activated carbon filter 4 is equipped with two loading sensors 17 , 18 , to determine the loading of the activated carbon filter 4 with hydrocarbons . the first sensor 17 is arranged near the site of entry of the second gas line 6 in the activated carbon filter 4 , while the second sensor 18 is arranged at a defined distance to the site of entry of the first and the third gas lines 5 , 8 in the activated carbon filter 4 . both sensors 17 , 18 determine the presence of hydrocarbons and are connected to the engine control unit 13 for analyzing the sensor signals . because the activated carbon filter 4 is loaded with hydrocarbons from the junction of the first gas line 5 and unloaded or rinsed with fresh air , respectively , from the opposing junction of the second gas line 6 , the load factor of the activated carbon filter is high when the sensor 17 and the sensor 18 respond , moderate when only sensor 18 responds and low when neither of the sensors 17 , 18 responds . the tank is further equipped with a pressure sensor 19 , which measures the pressure in the fuel tank 2 and transmits it to the engine control unit 13 , where the pressure is compared with a permissible pressure range . when the pressure in the fuel tank 2 exceeds the upper limit of the permissible range , the engine control unit 13 opens the two valves 10 and 11 to conduct gas from the fuel tank 2 through the activated carbon filter 4 into the environment or the atmosphere 7 and thereby relieves the pressure in the fuel tank 2 . when the pressure in the fuel tank 2 falls below the lower limit of the permissible range , the engine control unit also opens the two valves 10 and 11 , to conduct air from the environment or atmosphere 7 through the activated carbon filter 4 into the fuel tank 2 and to thereby achieve pressure compensation . when the load factor of the activated carbon filter 4 determined by means of the sensors 17 , 18 is high , the opening pressure of the valve 10 is increased by the engine control unit 13 when the tank shut - off valve is opened as a result of overpressure in the fuel tank 2 , so that the valve 10 only opens at a higher pressure , which prevents hydrocarbons to enter the activated carbon filter 4 before the opening pressure is reached . as soon as the activated carbon filter 4 is regenerated and the load factor determined by the sensors 17 , 18 is moderate or low , the engine control unit 13 opens the valve 10 to relieve an overpressure that may still persist . when opening the valve 10 the engine control unit 13 reestablishes the lower opening pressure . to prevent that an impermissible overpressure or negative pressure builds up in the fuel tank 2 , a bypass line 20 with an overpressure protection valve 21 and a negative pressure protection valve 22 can be provided , which branches off from the first gas line between the fuel tank 2 and the valve 10 and leads into the first gas line 5 behind the valve 10 as shown in the drawing . in contrast , when the valve 10 is opened the opening pressure of the valve 10 in the first gas line 5 , as a result of a negative pressure in the fuel tank 2 , is decreased by the engine control unit 13 when the load factor of the activated carbon filter 4 determined by the sensors 17 , 18 is high . this may allow a somewhat better flushing of the activated carbon filter 4 by ambient air which flows into the fuel tank 2 and is further flushed by the inflowing ambient air rather continuously and not intermittently . in this case , the opening pressure of the ventilation and aeration valve 11 in the second gas line 6 is also decreased by the engine control unit 13 . when the load factor of the activated carbon filter 4 is high , the opening cross section of the regeneration valve 12 in the third gas line 8 is decreased when the activated carbon filter is regenerated , to prevent too much fuel from being added into the intake manifold . at the same time the opening pressure of the ventilation and aeration valve 10 in the second gas line 6 is decreased as much as possible and the regeneration valve 12 is opened as long as possible in dependence on the load condition of the internal combustion engine , to achieve a complete regeneration of the activated carbon filter 4 in spite of the smaller opening cross section . when the load factor of the activated carbon filter 4 is low , the regeneration valve 12 in the third gas line 8 is controlled according to the desired amount of fuel to be fed from the activated carbon filter 4 into the intake manifold , while the opening pressure of the tank shut - off valve 10 in the first gas line 5 and the ventilation and aeration valve 11 in the second gas line 6 are decreased as much as possible . a desired opening pressure or a desired opening cross section can be set beforehand at the valves 10 , 11 and 12 .	1
in accordance with a governing principle of the invention , an improved prestressed composite laminate may be fabricated by applying a load to the fibers during cure of the matrix material . the applied load must be high enough to achieve desired stress modification in the cured composite , but not high enough to fracture the fibers . in the practice of the invention , load is applied to the fibers by a combination of mechanical prestressing during filament winding and thermal expansion of the mandrel during cure in order to stress the fibers uniformly , determinably and reproducibly . referring now to the drawings , fig1 a and 1b show respective top and edge views of a representative mandrel useful in applying mechanically or thermally induced load to fibers wound thereon . in fig1 a , 1b , mandrel 11 includes first female member 12 having lengthwise slot 13 for receiving second male member 14 . mechanical expander 16 is disposed within slot 13 between members 12 , 14 for selectively positioning member 14 within slot 13 . expander 16 may , in an exemplary configuration comprise a pair of triangular blocks 17 , 18 having a lengthwise slot 19 for receiving connecting bolt 20 . expander 16 is adjusted in width within slot 13 by tightening bolt 20 which results in movement of blocks 17 , 18 along their oblique contacting surfaces . member 14 can thereby be selectively positioned along slot 13 , and when fiber ( not shown in fig1 a , 1b ) is wound on mandrel 11 , adjustment of expander 16 as just described results in outwardly movement of member 14 and resultant tension on the wound fiber . it is noted that tension on the wound fiber may result both from mechanical adjustment of expander 16 and from thermal expansion of the component pans of mandrel 11 . particularly members 12 , 14 , during cure of the composite , in an alternative embodiment , members 12 , 14 may comprise a material having a very small coefficient of thermal expansion so that tens ion in the wound fiber is applied substantially only mechanically . in another alternative , expander 16 may be replaced with a block or bar of known ( high ) coefficient of thermal expansion for thermal - only control of fiber tension . the maximum tension which may be applied to a fiber without breakage through mechanical adjustment and thermal expansion of mandrel 11 will vary widely depending on fiber material selection and may be determined by a skilled practitioner guided by these teachings in consideration of the tens fie strength of the selected material . tensions of up to about 350 kpsi may be obtained . tension applied to the wound fiber as suggested in relation to fig1 a , 1b may be applied in two or more directions using mandrel 21 such as that suggested in fig2 wherein first member 22 is slotted on two or more sides to receive a corresponding number of male members 24a , 24b and mechanical expanders 26a , 26b . the mandrel may therefore , within the scope of these teachings , be configured to accommodate fiber winding and tensioning in two or more directions , and the mandrel configurations described herein are not considered limiting of the invention . fig3 shows a representative system 30 useful in applying resin matrix material 31 to tow 33 comprising a fiber bundle and in winding tow 33 onto mandrel 35 with preselected tension according to the invention . matrix 31 may be any suitable material as might occur to one skilled in the applicable art , such as epoxy ( such as hercules 3501 - 6 or other commercially available epoxy ), bmi , glass , ceramic , polyimide or thermoplastic . tow 33 may comprise a bundle of up to 1000 to 12000 fibers of any suitable material such as carbon ( such as that available commercially as as - 4 from hercules ), graphite , glass , silicon carbide or aramid ( kevlar ®). although the invention may be most applicable to filament winding in the fabrication of cylindrical structures , such as pressure vessels and tubes , system 30 was configured to utilize flat mandrel 35 of aluminum of known thermal expansion coefficient so that uniaxial testing of composite specimens could be performed in demonstration of the invention . it is noted that in filament winding cylindrical structures , the fibers and matrix tend to self - compact , so that pressure need not be applied during cure . but because only the wound portion at the rounded edges of a wound flat plate self - compact , external pressure was applied during cure ( e . g . conventional graphite / epoxy cure cycle at 100 psi and 350 ° f .). in the demonstration system , winding tension in tow 33 was selected to avoid fiber slack on wound mandrel 35 and was attained using tensioning mechanism 37 including dram 38 contacted by brake 39 , the inertia of drum 38 along with friction of brake 39 providing the desired tension . tow 33 from spool 41 was drawn over pulleys 42 through resin bath 43 ( for impregnation with matrix material ) and twice around drum 38 , substantially as shown in fig3 and into winding system 45 . substantial tension in tow 33 had to be maintained during winding , so it was preferable to impregnate tow 33 with resin prior to inducing tension because the tension reduces liquid resin migration toward the center of tow 33 and may result in a composite product having resin - starved areas and high fiber volume . pulleys 42 and other rollers used in system 30 for guiding tow 33 comprised teflon ® and delrin ® to avoid the contacted surfaces becoming gummed with resin . winding system 45 of the demonstration system comprised two independently controlled motors 47 , 48 for rotating mandrel 35 and controlling traverse of tow 33 across mandrel 35 in producing fiber layers having the desired respective fiber orientations . it is noted that other winding systems for tow 33 may be used as would occur to the skilled artisan guided by these teachings , the specific system shown not being considered limiting of the invention . impregnation of tow 33 with resin 31 may be performed using any suitable means as would occur to the skilled artisan , such as a hot melt procedure wherein resin 31 is melted and tow 33 is passed through pure resin , or dissolution of the resin in suitable solvent and passing tow 33 through the solution . the solution impregnation techniques are preferred because the length of travel of the hot melt impregnated tow 33 allows for resin 31 to harden which interferes with the winding process . however , the length of travel of the solution impregnated tow 33 allows for an unacceptable amount of solvent evaporation so that the pulleys and dram become sticky with resin which fractures individual fibers . this problem was resolved by using a hybrid solvent obtained by mixing two different solvents . the hybrid solvent minimized solvent evaporation and also lubricated pulleys 42 . solvents useful for the resin 31 materials listed above include methylethyl ketone , acetone or others as would occur to the skilled artisan practicing the invention ; in a ceramic or glass matrix , the solvent required may be water . in demonstration of the invention , wherein hercules 3501 - 6 epoxy resin was used as matrix 31 material , a mixture of acetone and isopropyl alcohol was used as the hybrid solvent . solvent entrapment problems which may cause high porosity in the laminate product were avoided by debulking the composite prior to cure using a vacuum and a slightly elevated temperature in an autoclave or vacuum oven at about 125 ° f . for about 4 hours or more depending on the thickness of the winding . resin / solvent solution viscosity was monitored to maintain an optimum resin content in the solution . as shown in fig4 a monitoring and solution content control system used in conjunction with system 30 included a micromet eumetric system ii microdielectrometer 51 ( micromet instruments , inc ., cambridge mass .) and an idex sensor 53 ( micromet instruments , inc ., newton centre mass . ), controlled by computer 55 , which measured the solution phase angle , and pump 57 powered by power supply 59 for circulating solvent through lines 61 to bath 43 as needed to keep the resin / solvent solution adequately mixed and at the desired preselected concentration . tests on as - 4 / 3501 - 6 ( fiber / resin ) prestressed composite specimens fabricated according to the invention and corresponding conventional composite specimens showed that , for the geometry of composite specimens tested , the prestressed specimens showed an approximate 15 % increase in tensile strength and that damage due to loading was delayed in the prestressed materials . theoretical models ( see , e . g ., rose et al . &# 34 ; effect of prestressed fibers upon the response of composite materials &# 34 ;, proc am soc for composites , 8th technical conference on composite materials ( october 1993 )) predict that for some laminate geometries , onset of damage ( first ply failure ) in prestressed materials can be substantially reduced or eliminated , which is important because cracks associated with first ply failure are believed to be initiation sites for fatigue cracking in dynamic structures . the invention therefore provides an improved composite fabrication process including fiber prestressing . it is understood that modifications to the invention may be made within the scope of the appended claims as might occur to one with skill in the field of the invention . all embodiments contemplated hereunder which achieve the objects of the invention have therefore not been shown in complete detail . other embodiments may be developed without departing from the spirit of the invention or from the scope of the appended claims .	1

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.