Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
referring now to fig1 - 4 , a planar permanent magnet 1 is magnetized with a plurality of polarities in the plate thickness direction , and this permanent magnet 1 is divided into four blocks 1a - 1d . the polarity of each block is arranged to be opposite that of the adjoining block , as shown in fig4 . a coil 2 is formed with a conductor wound around a core 3 having a hexagonal shape . the coil 2 has long sides af and cd and short sides ab , bc , de and ef . the relationship of these sides or segments is as shown below : furthermore , points c and f are aligned with a boundary line between adjacent blocks of the magnet 1 , as shown in fig1 when the electromagnetic drive device starts its movement . the points a and d are aligned with the boundary line between blocks of the magnet 1 , as shown in fig2 when the electromagnetic drive device completes its movement . when either pair of these points are aligned with the boundary line , the segments ab , bc , de and ef , which include these points , are located outside of a magnetic field formed by the magnet 1 . the segments af and cd of the coil 2 have midpoints g and h . the core 3 is provided with a support shaft 3a which is secured to the center of rotation of the core 3 . the support shaft 3a is mounted for rotation in a shutter base plate 4 and a yoke 5 . the core 3 is provided with transmission pins 3b and 3c , which are arranged at symmetrical points relative to the center of rotation of the core 3 and which are arranged for transmitting the rotation of the core 3 to shutter blades 6 and 7 . the shutter blade 6 is rotatably supported by the support shaft 3a while the transmission pin 3b engages one end of the shutter blade 6 . meanwhile , the shutter blade 7 is rotatably supported by a support shaft 12 . a linking lever 8 has one end thereof connected to the core 3 through the transmission pin 3c while the other end thereof is connected to the shutter blade 7 through a pin 11 . the linking lever 8 is provided with an aperture 8a , which forms an auxiliary stop 9 for light measurement in combination with an auxiliary stop window 9a . the auxiliary stop 9 has a quantity of light incident upon a light sensitive element 10 corresponding to that of light incident upon the main stop of a photograph taking optical system . a return spring 13 is provided , which constantly urges the linking lever 8 in the direction of closing the shutter stop blades 6 and 7 . the maximum stop of the photograph taking optical system is defined by an aperture 14 . a magnetic circuit is composed of the permanent magnet 1 , the shutter base plate 4 and the yoke 5 . the shutter base plate and the yoke 5 are made of soft iron , low carbon steel and are thus arranged to have good efficiency . the description of the operation follows . each of the four blocks 1a - 1d of the permanent magnet 1 is of a different polarity from that of the adjoining block , as shown in fig4 . the force exerted on each part of the coil is in accordance with the left - hand rule of fleming . when a current is supplied to the coil 2 in a counterclockwise direction in response to a release operation on the camera . the direction in which a current flows to the coil 2 and the direction of the magnetic flux of a magnetic field through which the current flows determine the direction of the resulting force . therefore , under the condition shown in fig1 each of the segments ab , ch , hd , de , fg and ga of the coil 2 produces a force including a component force which causes the coil to rotate counterclockwise . meanwhile , the segments bc and ef of the coil do not produce any force because they are located outside of the magnetic field of the permanent magnet 1 . furthermore , the magnitude of the component force produced to rotate the coil 2 by the current flowing to each segment of the coil 2 due to a force of the magnetic field is as follows : the component force at the segment gab is proportional to the difference ( ob - og ) between the respective distances from the support shaft 3a of the core 3 ( that is , the center of rotation 0 of the core 3 ) to the point b and to the point g . the component force at the segment ch is proportional to the difference ( oc - oh ) between the respective distances from the center of rotation 0 of the core 3 to the point c and to the point h . the component force at the segment hde is proportional to the difference ( oe - oh ) between the respective distances from the center of rotation 0 of the core 3 to the points h and e . at the segment fg , the value of the component force is proportional to the difference ( of - og ) between the respective distances from the center of rotation 0 of the core 3 to the points f and g . therefore , the sum of the component forces exerted on the whole coil 2 in the direction of rotation is proportional to a linear extent obtained by subtracting a value twice as much as the distance between the points h and g from a value obtained by adding the distance between the points c and f to a distance between the points b and e . assuming that the sum of the component forces is fb and the proportional constant is ki , the above can be expressed by the following formula : when the coil 2 is energized , this rotating force causes the core 3 to rotate counterclockwise on the support shaft 3a . this in turn causes the shutter blade 6 , which is also supported by the support shaft 3a , to rotate counterclockwise by means of the transmission pin 3b . meanwhile , the rotation of another transmission pin 3c is transmitted to the pin 11 through the linking lever 8 to cause the shutter blade 7 to rotate counterclockwise on the support shaft 12 . as a result of this , the shutter blades 6 and 7 open the photograph taking optical path from the middle portion of the maximum shutter aperture window 14 . furthermore , in proportion to the opening action of the shutter blades 6 and 7 on the photograph taking optical path , the aperture 8a provided in the linking lever 8 overlaps the auxiliary stop window 9a to give light to the light sensitive element 10 . the light sensitive element 10 , which is connected to a shutter control circuit ( not shown ), then charges a capacitor with a current having a value corresponding to the quantity of the light received . when the capacitor is charged to a predetermined value , the shutter control circuit works to cut off the current supplied to the coil 2 . then , the bias of the return spring 13 causes the shutter blades 6 and 7 to rotate in a direction which closes off the photograph taking optical path . an exposure is completed when the optical path is thus closed . as described in the foregoing , the points c and f of the coil 2 are disposed on the magnetization boundary line of the permanent magnet 1 when the coil 2 is in its initial position and the points a and d of the coil 2 are disposed on the magnetization boundary line of the permanent magnet 1 when the coil 2 is in the movement ending position thereof . with this arrangement , the coil 2 is prevented from producing a force in the direction of offsetting the driving action thereof , so that the permanent magnet 1 can be efficiently used . as will be clearly understood from the formula ( 2 ) given in the foregoing , the value of the output of the coil 2 increases according to the sum of the lengths of the segments cf and be . the length of the segment hg is assumed to be unvarying . however , the ratio of the length of the segment ad or cf to that of the segment hg is determined when the rotation angle is set . therefore , in order to have the above stated value increased , the segment be must be lengthened . on the other hand , however , the resistance of the coil 2 increases in proportion to the increase of the sum of sides of the hexagonal shape connecting the points a through g . it is not desirable to lengthen the segment be to an extent which is more than necessary . in view of this , in accordance with this invention , the current of the coil 2 is efficiently used by arranging the length of the segment be to have the segments bc and ef approximately coincide with the end faces of the permanent magnet 1 when the coil 2 is in its initial position and to have the segments ab and de approximately coincide with the end faces of the permanent magnet 1 when the coil 2 is in its movement ending position . furthermore , assuming that the angle of rotation of the coil 2 is 2θ , the work w which can be represented by the product of the force produced by the coil 2 and the extent of the movement thereof can be approximately expressed , from formula ( 2 ), as shown below : ## equ1 ## since the output drops during the rotating process of the coil 2 when the value of ( 1 / cos θ ) becomes a certain large value , the angle of rotation for obtaining the maximum degree of the work w may be obtained by selecting an angle of rotation that gives the largest value of the following formula within the range of ( 1 / cos θ )≈ 1 : ## equ2 ## another embodiment of the invention , shown in fig5 differs from the foregoing amendment in that the permanent magnet 1 used in this case is provided with cutaway parts which are arranged to facilitate placing the permanent magnet 1 within the camera body . more specifically , parts of the magnet 1 , which are not participating in applying a magnetic flux to the coil 2 , are cutaway in an arcuate shape along the circumference of the aperture window 14 . this arrangement permits placement of the permanent magnet 1 within the camera body without increasing the size of the camera body . in accordance with this embodiment , a space for accommodating the permanent magnet 1 can be decreased without any adverse effect on the lorentz force to be developed at the coil 2 , so that it can be used for a compact camera . the arrangement and operation of the other parts of the embodiment shown in fig5 are identical with the foregoing embodiment . in accordance with the invention , an electromagnetic drive device is composed of a square magnet , which can be easily placed in a space available within a camera , and a hexagonal coil , which is capable of effectively producing a torque when energized within the magnetic flux of the square magnet . the torque required for driving the shutter stop blades can be efficiently obtained to produce a sufficient force for operation of the shutter stop blades . the drive device , according to the invention , uses a small permanent magnet for control over the shutter blades to prevent the blades from making an erroneous action and is very easily utilized in a compact camera .	6
an exemplary embodiment of the uv irradiation apparatus according to the present invention and as applied to sterilization of a liquid containing bacteria will be explained . as illustrated in fig1 a flow route is formed for the sterilization of a liquid in a uv irradiation unit by horizontally ( or vertically ) arranging therein a light transmission tube 2 made of quartz glass and internally fitted with a light irradiation lamp such as for example a uv irradiation lamp 1 . a scraper ring 3 with a cover 4 is slidably fitted to light transmission tube 2 internally having a uv irradiation lamp 1 . more specifically , said scraper ring 3 is capable of being slid horizontally along the circumference of said light transmission tube 2 . this scraper ring 3 has an internal cleaning solution chamber 6 which contains a cleaning solution such as a phosphoric acid solution and which communicates with a cleaning solution feed piping 5 . as indicated earlier , said light transmission tube 2 made of quartz glass and internally fitted with a light irradiation lamp may also be aligned vertically with said scraper ring 3 being slid up and down ( reciprocally ) along the circumference of said light transmission tube 2 . additionally stated , any friction between the quartz uv ray transmission tube 2 internally fitted with a uv ray lamp ( s ) 1 and the scraper ring 3 may be reduced by coating the surface of the quartz uv ray transmission tube 2 with fluorocarbon resin to eliminate concave pits or , distortions on said surface , thereby enhancing the smoothness and slidability of said surface . fep ( tetrafluoroethylene - hexafluoropyrene copolymer ) is the fluorocarbon resin of choice . any other fluorocarbon resin may be used for the coating of the surface of the uv ray transmission tube 2 as long as the fluorocarbon resin is permeable to uv rays and the like , not liable to deterioration due to uv rays and the like and has adequate physical stability . the thickness of the coating in a range of 0 . 3 to 0 . 5 mm will suffice . the fluorocarbon resin may be coated on the surface of uv ray transmission tube 2 by known methods , for example , by covering this tube with a tubular , heat contraction fluorocarbon resin and then by heating this resin to contract it . alternatively , this film of the fluorocarbon resin may by affixed to the surface of the uv ray transmission tube 2 . any concave pits and / or distortions on the uv ray transmission tube 2 may also be eliminated by polishing the surface of the uv ray transmission tube 2 . when it is made of a elastic material such for example as rubber as mentioned earlier , said scraper ring tightly comes in contact with the outer circumference surface of said light transmission tube 2 , especially because the tip 7 of said scraper ring is elastic , thereby preventing the solution such as a phosphoric acid solution stored in said cleaning chamber 6 from leaking from any interstice between said scraper ring 3 and said cleaning solution chamber 6 . when the scraper ring 3 is made of a nonelastic material such as teflon ® and stainless steel , any leakage of cleaning solution from the interstice between said scraper ring 3 and said cleaning chamber 6 can be prevented by fitting sealing materials 8 such as o - rings at the ends 7 of said scraper ring 3 or at positions where said scraper ring 3 comes in contact with said light transmission tube 2 and adjacent to said cleaning solution chamber 6 . even when said scraper ring 3 is made of a elastic material such as rubber , sealing materials 8 such as o - rings may be fitted at the ends 7 of said scraper ring 3 and adjacent to said cleaning solution chamber 6 thereby securely preventing any leakage of cleaning solution from the interstice between said scraper ring 3 and said cleaning chamber 6 . the scraper ring 3 may be made of natural or synthetic rubber . most preferable is a scraper 3 made of teflon ®, especially teflon ® comprised of tetrafluoroethylene - perfluoroalkylvinyl ester copolymer resin which contributes much to reducing the friction between the scraper 3 and the uv ray transmission tube 2 . said scraper ring 3 is reciprocally slid over the circumference of said light transmission tube 2 , thereby bringing about a synergetic effect of said scraper ring 3 and the cleaning solution stored in said cleaning solution chamber to dislodge and clean off not only scale comprising of hardness components deposited on the circumference surface of said light transmission tube 2 but also scale comprising of fine particulate hardness components which has penetrated into concave pits on the surface of said light transmission tube 2 . said scraper ring 3 may be reciprocally slid either manually or automatically by any known sliding means such as a hydraulic cylinder . for instance , as illustrated in fig2 it offers convenience automatically to move reciprocally ( back and forth ) said scraper rings 3 along the circumferences of said light transmission tubes 2 by connecting said scraper rings 3 to a sliding frame 12 which is in turn slidably fitted to a rotating screw stem 11 rotated normally and reversely by means of a drive unit 10 . when a plurality of light transmission tubes 2 internally fitted with uv irradiation lamps are installed in a uv ray irradiation unit , said scraper ring 3 is slidably fitted to each light transmission tube or fitted to each light transmission tube so that said scraper rings 3 as one member are slid reciprocally ( back and forth ) over the circumference of light transmission tubes 2 , while a plurality of said slide rings 3 are fitted to a support 13 of said sliding frame 12 which is slidably fitted to the aforementioned revolving screw stem 11 . examples of uv lamps which can be used include low pressure sterilization lamps with a dominant wave length of 254 nm , low pressure ozone lamps with dominant wave length &# 39 ; s of 185 and 254 nm , and medium - and high - pressure lamps with dominant wave length lengths of 185 , 254 and 365 nm . in addition , sunlight lamps , chemical lamps , black light lamps , metal halide lamps , sodium lamps and other lamps with wave lengths of 700 nm or longer can also be used depending upon the application or the purpose of light irradiation treatment . quartz glass which is less expensive is often used as the material of construction of light transmission tubes 2 . as mentioned earlier , teflon ® can also be used as this material of construction . in addition , any materials that have higher transmissivities and do not release any leachables such as fluorocarbon resins may be used as this material of construction . as the material of construction of scraper rings 3 , elastic materials such as rubber and teflon ®, and stainless steel may be used as mentioned earlier . in addition , plastics or ceramics may be employed which are resistant to chemicals may be used . for example , polypropylene and polyethylene may be used . as mentioned earlier , the scraper ring 3 has an internal cleaning chamber 3 which communicates with a cleaning solution feed line 5 . the scraper ring 3 is fitted to the light transmission tube 2 having internal uv lamp 1 so that the scraper ring 3 can be slid reciprocally ( back and forth ) along the circumference of the tube 2 . a phosphoric acid solution which is less expensive comes in handy as the cleaning solution to be fed automatically to the cleaning solution chamber 6 of the scraper ring 3 . besides a phosphoric acid solution , a solution of any weak acid such as citric acid may be used . in addition , a solution of any chemical which can wash out and remove scale comprised of hardness components , etc . may be used as the cleaning solution . an optimum concentration of these cleaning solutions ranges from 5 to 10 % in the case , for example , of a phosphoric acid solution . the cleaning solution should preferably fill , under pressure , the cleaning solution chamber 6 of the scraper ring 3 , and come in contact with the entire circumference surface of the light transmission tube 2 . the frequency of the cleaning of the light transmission tube 3 should be determined depending upon the quantity of scale comprised of hardness components , etc . which has deposited on the circumference surface of the light transmission tube 2 , especially the quantity of scale of fine particles comprised of hardness components , etc . which has penetrated into concave pits on the circumference surface of the light transmission tube 2 , the kind and concentration of the cleaning solution and so forth . usually , it suffices to slide the scraper ring 3 to clean the circumference of the light transmission tube 2 twice to thrice a day . the manner of operation of the uv ray irradiation 9 equipment with the scraper ring ( s ) 3 fitted on the light transmission tube ( s ) 2 according to this invention will be explained . when untreated water containing bacteria has been fed to the uv ray irradiation equipment 9 to sterilize the water , scale comprised of hardness components such as iron and calcium is deposited on the circumference surface of the light transmission tube ( s ) 2 and concave pits on the circumference surface of the light transmission tube ( s ) 2 are clogged with scale of fine particles comprised of hardness components , etc . with the result that the uv ray irradiation dose transmitted through the uv ray transmission tube ( s ) 2 drops . in order to cope with such drop in the uv ray irradiation dose , the circumference of the light transmission tube ( s ) 2 is cleaned by reciprocally sliding the scraper ring ( s ) 3 over the circumference surface of the light transmission tube ( s ) 2 by means of the moving frame 12 reciprocally moved by virtue of the revolving screw stem 11 driven by the drive unit 10 such as a motor while a cleaning solution such as a phosphoric acid solution is fed from a cleaning solution storage tank ( not shown ) to the cleaning solution chamber 6 of the scraper ring ( s ) 3 via the cleaning solution feed pipe 5 . the cleaning solution in the cleaning solution chamber 6 may be recirculated by connecting the cleaning solution chamber 6 and the cleaning solution tank via a cleaning solution outlet pipe ( not shown ). alternatively , the cleaning solution tainted with foulants may be discharged to a cleaning solution waste tank ( not shown ) without recirculating the cleaning solution waste . that is to say , this invention provides uv ray irradiation equipment capable of continuously , without suspending its operation , dislodging and washing out not only scale comprised of hardness components , etc which is deposited on the circumference surface of the light transmission tube 2 but also scale comprised of fine particles of hardness components , etc . which clogs concaved pits on the circumference surface of the light transmission tube 2 by virtue of a synergistic effect of dislodging action created by sliding the scraper ring 3 over the circumference surface of the light transmission tube 2 and cleaning action of a small quantity of cleaning solution such as a phosphoric acid solution which is stored in the cleaning solution chamber 6 of the scraper ring 3 . in this way , any drop in the dose of uv rays transmitted through the uv transmission tube 2 is made up for . the cleaning of the light transmission tube 2 by reciprocally ( back and forth ) sliding the scraper ring 3 over the circumference surface of the light transmission tube 2 may be automatically initiated in response to any drop in the uv irradiation dose transmitted through the light transmission tube 2 as detected by means of a known uv ray dose meter . alternatively , the cleaning of the light transmission tube 2 may be started periodically and intermittently by means of a timer which is to be preset after confirming the number of bacteria in the treated ( uv ray irradiated ) water , sterilization conditions and so forth . when untreated water is sterilized by uv irradiation using the uv ray transmission tube 2 coated with fluorocarbon resin , the number of fine particles of scale of hardness components and the like which penetrate into concave pits on the uv ray transmission tube 2 is much smaller than the case where the uv ray transmission tube 2 not coated with fluorocarbon resin is used as the coating of the uv ray transmission tube 2 with fluorocarbon resin minimizes concave pits on its surface . what is more , as its surface is coated with fluorocarbon resin to enhance its smoothness , thereby making it difficult for scale of hardness components and the like in water to attach to and deposit on said surface , the uv ray transmission tube 2 is less susceptible to fouling . however , as the uv irradiation of untreated water proceeds , fine particles of scale of hardness components and the like penetrate into any residual , trace concave pits on the uv ray transmission tube 2 and these particles also begin to deposit on the surface of the uv ray transmission tube 2 , with the result that the uv irradiation dosage level drops . to cope with such drop in the uv ray irradiation dosage scale of hardness components and the like which have penetrated into concave pits on the surface of the ltv ray transmission tube and also scale of hardness components and the like which have deposited on said surface are dislodged or dissolved by virtue of a synergistic effect of the scraper ring 3 which slideableness is enhanced and which friction resistance is reduced , and the cleaning solution in the cleaning chamber 6 . thereby easily and surely restoring the uv ray irradiation dosage level , thereby increasing the throughput of the uv irradiation treatment . three sets of uv ray irradiation equipment each having a light transmission tube internally fitted with a 100 v low pressure mercury lamp made of quartz glass and having 253 . 7 nm wave length ( product no . ay4 manufactured by japan photo science co ., ltd .) were installed . the first set in accordance with the present invention was equipped with a slidable scraper ring made of rubber and having an internal cleaning solution chamber with a capacity of holding 5 cc of chemical solution . the second set had a conventional scraper ring made of rubber and slidably equipped . the third set was also a conventional uv ray irradiation unit without a scraper ring . secondary sewage effluent containing 103 n / ml of e . coli was sent to each set of the uv ray irradiation equipment at a flow rate of 0 . 08 - 1 . 1 m / s . and uv ray was irradiated at a dose level of 4 mw / cm 2 . to sterilize e . coli in the secondary sewage effluent . while a 5 % phosphoric acid solution was fed to the cleaning solution chamber of the scraper ring of the first set , the scraper ring was slid twice a day to clean the light transmission tube . the scraper ring of the second set was also slid twice a day to clean the light transmission tube . the light transmission tube of the third set was not cleaned . as an embodiment of this invention , six uv ray transmission tubes made of quartz glass and charged with 160 w uv lamps emitting uv rays of wave lengths in the neighborhood of 254 nm ( product no . ay - 10 manufactured by japan photo science co ., ltd .) were installed in an enclosed uv ray irradiation vessel , with the surface of each uv ray transmission tube being coated with a film ( about 0 . 5 mm thick ) of the copolymer resin of tetrafluoroethylene - hexafluoropyrene ( fep ) and also each uv ray transmission tube being slidably fitted with a scraper ring having a protrusion at each of its ends and made of the copolymer resin of tetrafluoroethylene - perfluoroalkylvinyl ester . the scraper ring was fitted with a 5 - cc cleaning solution chamber . as a conventional uv ray irradiation equipment , the same equipment as mentioned above was used , excepting that the uv ray transmission tubes were not coated with fep and that the scraper rings made of rubber were slidably fitted to the uv ray transmission tubes . to each of the uv ray irradiation equipment in accordance with this invention and the conventional one was fed sea water containing 10 5 pcs ./ ml of bacteria at a flow rate of 30 m 3 / hour . the rpm of the rotating screw driving the scraper rings was 18 and the sliding speed of the scraper rings was 9 cm / min . the scraper rings were operated two reciprocation &# 39 ; s per day . under these conditions , the sterilization by uv ray irradiation was carried out , and treated wafer containing less than 10 2 pcs ./ ml of bacteria was obtained from two pieces of equipment compared . in the uv ray irradiation equipment in accordance with this invention , the above mentioned uv ray irradiation was carried on for one year , during which time no hardness components , iron on the like in the sea water adhered to the surface of uv ray transmission tubes nor the uv ray transmission efficiency dropped with the result that a constant sterilization cost of the sterilization was no more than 1 . 94 yen / m 3 . by contrast , the uv ray transmission tubes of the conventional uv ray irradiation equipment were fouled with deposits of hardness components , iron and the like in three months after the start of the above - mentioned uv irradiation treatment . as a result , the uv ray transmission efficiency dropped to 60 % and the number of bacteria in the treated water increased to 10 5 ˜ 10 4 pcs ./ ml . hence , the uv ray irradiation had to be suspended at bimonthly intervals to disassemble the equipment and to remove the uv ray transmission tubes , from which scale deposits had to be dislodged and cleaned off . the running cost of the sterilization increased to 2 . 25 yen / m 3 . the sterilization of the secondary sewage effluent as mentioned above was carried out for six months using the three sets of uv ray irradiation equipment . as a result , the following sterilization performance data were obtained . ______________________________________uv ray transmission rate * flow rate to achieve 99 % power sterilization perlamp ** consumption power efficiency______________________________________1st set ( this invention ) 98 % 9 . 8 m . sup . 3 / hr . 10 . 2 w / m . sup . 3 2 . 332nd set ( conventional ) 65 % 6 . 5 m . sup . 3 / hr . 15 . 4 w / m . sup . 3 1 . 553rd set ( conventional ) 42 % 4 . 2 m / hr . 23 . 8 w / m . sup . 3 1 . 00______________________________________ * rate of uv ray transmission through light transmission tube ** flow rate of the secondary sewage effluent per one lamp that allowed 99 sterilization the present invention provides uv ray irradiation equipment capable of bringing about a synergistic effect of dislodging action of a scraper ring ( s ) and cleaning action of a small quantity of cleaning solution stored in a cleaning solution chamber ( s ) of the scraper ring ( s ) thereby dislodging and washing out not only scale comprised of hardness components , etc . which is deposited on the circumference surface of a light transmission tube ( s ) but also scale comprised of fine particles of hardness components , etc . which clogs concave pits on the circumference surface of the light transmission tube ( s ). in this way , the uv ray irradiation equipment in accordance with the present invention brings about such beneficial effects as easily and surely restoring ( by about 98 %) the irradiation dose lost through the light transmission tube ( s ), increasing the uv ray irradiation flow rate ( 1 . 5 to 2 times ), and the power efficiency of uv ray lamp thereby enhancing the overall light irradiation efficiency . unlike the conventional chemical cleaning using a weak acid solution , a scale dispersant solution or the like , the present invention also permits easily and surely washing out scale composed of hardness components , etc . and deposited on a light transmission tube ( s ) without disassembling a uv ray irradiation unit and taking out the light transmission tube ( s ). hence , the present invention also confers a benefit of not necessitating any suspension of the uv ray irradiation , and permits equipment automation . these benefits of the present invention leads to an enhanced uv ray irradiation efficiency . in the uv ray irradiation equipment in accordance with the present invention , the scraper ring ( s ) can be slid reciprocally over the circumference surface of the light transmission tube ( s ) by rotating , through a drive unit , a revolving screw stem which is connected to the scraper ring ( s ) via a moving frame . this drive configuration facilitates automation of the cleaning operation . this driving configuration also permits use of a plurality of light transmission tubes each internally fitted with a light irradiation lamp to cope with large throughput requirements . in the uv ray irradiation equipment in accordance with the present invention , a sealing material ( s ) such as an o - ring ( s ) may be fitted on the circumference surface of the light transmission tube with which the scraper ring comes in contact and adjacent to the cleaning chamber of the scraper ring . in this way , any leakage of the cleaning solution from the interstice of the scraper ring and its cleaning solution chamber can be prevented without fall . coating uv ray transmission tubes with fluorocarbon resin and the like thereby enhancing the smoothness of the surface of the tubes in accordance with this invention results in ( 1 ) making it much less likely for scale of hardness components and the like to adhere to the surface of uv ray transmission tubes or making it very easy to dislodge any scale attached thereto , ( 2 ) enhancing the slidability and reducing the friction resistance of scraper rings thereby making it possible to effectively dislodge the scale , and ( 3 ) completely dislodging and washing off the scale penetrated into , adhered to , and / or deposited on the surface of uv ray transmission tubes with a synergistic effect bough about by the cleaning solution in the cleaning chambers of scraper rings which cleaning solution has access to scale in every nook and comer . thus , coating uv ray transmission tubes with fluorocarbon resin and the like in accordance with this invention permits restoring to about 99 % of the original value the light irradiation dosage level which has dropped , increasing the light irradiation treatment flow rate 1 . 8 - to 2 . 3 - fold as compared with the case of the conventional equipment , enhancing the electricity efficiency of uv ray lamps ( 1 . 7 - to 2 . 5 - fold ) and improving on the overall uv ray irradiation efficiency to a great extent .	2
in the following detailed description of exemplary embodiments of the invention , reference is made to the accompanying drawings that form a part hereof , and in which is shown by way of illustration specific exemplary embodiments in which the invention may be practiced . these embodiments are described in sufficient detail to enable those skilled in the art to practice the invention . other embodiments may be utilized , and logical , mechanical , electrical , and other changes may be made without departing from the spirit or scope of the present invention . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined only by the appended claims . fig1 shows a diagram 100 of a concept 102 , its key phrases 104 , and its associated web site 106 , or other associated data entities . the concept 102 is one or more concept words that are the title of the concept that a user may wish to search for for with a search engine . a concept may be a topic , for example . it is typically manually determined . the key phrases 104 for the concept 102 are other phrases of one or more words that a user may enter as a search query to find information regarding the concept 102 . the key phrases 104 may be alternative key words for the concept 102 , misspellings of the concept 102 , shorthand notation for the concept 102 , or other phrases for the concept 102 . the key phrases 104 are typically manually determined or edited , by examining , for example , query logs of past search queries to determine how users search for the concept 102 . the associated web sites 106 are the the data entities that are returned to the user when he or she searches for the concept 102 . they can be links to web sites related to the concept 102 , or other types of data entities . for example , they may be music file links , image file links , or other types of files or links . the associated web sites 106 are typically manually determined or edited as well . an example of a concept 102 may be the popular singer britney spears . the title of the concept 104 are the words britney spears . the key phrases 104 for this concept may be just the word britney , britneyspears . com , the name of her albums , as well as misspellings of her name , such as brittney , brittany , and so on . the associated web sites 106 may include the official britney spears web site , as well as various fan sites , and sites at which fans can purchase her music . the web sites 106 may also be edited , to ensure that no inappropriate , adult - oriented web sites are included , so that the web sites 106 are children friendly . fig2 is a flowchart of a method 200 showing the overall process followed by an exemplary embodiment of the invention . this process is described in summary , with a detailed description provided for each stage in subsequent sub - sections . in the popularity calculation stage 202 , query logs that provide frequency of occurrence of each query on a historical basis , as well as a list of concepts and their associated key phrases , are used to determine the popularity of each key phrase of each concept . this popularity is used in turn to determine the popularity of each concept . the popularity of a concept is based on the queries that match the key phrases associated with the concept , and the occurrence of each of those queries within the query log . in the imaging stage 204 , the output of the refinement stage is indexed , and added to the data image , or database , used by the search engine to answer queries entered by users . both the refinement stage 202 and the imaging stage 204 occur before a user has entered a query . that is , they are offline stages . they can be performed on a periodic basis to update the popularity of concepts based on newly generated query logs . the query stage 206 is performed each time a query is entered by a user , and is considered an online stage . a search query is a query phrase that includes one or more words entered by the user . the search engine searches the database for related concepts by textually matching the words of the query phrase against the key phrases of the concepts , as well as the words in the concept titles , resulting in zero or more matching concepts . a concept is said to match a query if the query matches a keyphrase and / or one or more words in the title . note that the keyphrases and the title words may be matched in different ways to the query . for example , we may use exact string match on the keyphrases , while we may require each of the words in the query to be contained ( as a whole word ) in the title without regard to order . the use of of different matching schemes is not a required part of finding matching concepts . the returned list of matching concepts is sorted by decreasing popularity , such that the most popular choice is listed first . the associated data entities of these concepts may also be shown , or may be displayed when the user selects a concept . a visual measure of the relative popularity of a concept as compared to the other concepts may also be displayed , as well as a preferred search query for each concept . fig3 is a flowchart showing the refinement stage 202 of fig2 in more detail . first , the concept words of the concepts and the key phrases are matched against the query phrases of the query log ( 300 ). an example query log is shown fig4 . the query log 400 has a number of queries 400 a , 400 b , and 400 m . each query is a query phrase that includes one or more words . a query may appear more than once in the query log 400 . alternatively , each query in the query log 400 may be a unique query , and have associated therewith the number of times the query was entered during the logging period . for example , in the former case , if the query golf balls was entered 700 times during the logging period , it would appear 700 times in the query log 400 . in the latter case , however , the query would appear once , along with the number 700 to indicate that it was entered 700 times during the logging period . the term query log is used generally . a query log may be a historical log of queries that have been entered by users during a logging period , and this is how it is predominantly used . however , a query log may also be modified to actively affect the popularity of concepts . for example , a query log may be populated with queries that were not actually entered so that the popularity of concepts are predictively modeled . for example , if it is known that the super bowl will be a popular search query in the coming months , the query log may be modified to add this query a large number of times to the log . other ways to affect the ensuing popularity of concepts , for other predictive modeling , or for demographic or for other reasons , are also encompassed within the term query log . referring back to fig3 , a popularity point is added to a concept for the number of times each query phrase appears in the query log that matches a key phrase unique to the concept ( 302 ). that is , a popularity point is added to a concept for the number of times each query phrase matches the concept words of a concept or a key phrase that is unique to the concept . for example , the query brittany may appear 350 times in the query log . for the concept britney spears , there may be a key phrase brittany that is unique to this concept , such that no other concept has this key phrase . therefore , 350 popularity points are added to the concept britney spears . as another example , the query britney spears may appear 200 times in the query log . because this query matches the concept words of the concept britney spears , 200 popularity points are added to the concept . next , for query phrases in the query log that match key phrases of more than one concept , a number of popularity points equal to the number of times such a query phrase appears in the query log is divided among such concepts ( 304 ). for example , the query tiger may appear 400 times in the query log . there may be two concepts that have the key phrase tiger , the concept tiger woods , and the concept wild tiger . therefore , the 400 popularity points for the query tiger are apportioned between these two concepts . one way to apportion the popularity points is to proportionally divide the points among the concepts based on their amassed popularity points resulting from 302 . for example , the concept tiger woods may have 900 popularity points so far , and the concept wild tiger may have 100 popularity points so far . therefore , 90 % of the 400 popularity points for the query tiger are added to the concept tiger woods , and 10 % are added to the concept wild tiger . other ways to apportion the popularity points can also be used , however , such as equally dividing the points among the concepts that have such matching key phrases . the result of 300 , 302 , and 304 is that each concept has a number of popularity points added thereto , based on the matching of query phrases to the key phrases of the concept . this is shown in the diagram 500 of fig5 . the concept 102 has a number of popularity points 502 . each key phrase 104 a , 104 b , . . . , 104 n contributes a number of popularity points 502 a , 502 b , . . . , 502 n , respectively , to the number of popularity points 502 of the concept itself . adding the popularity points 502 a , 502 b , . . . , 502 n together yields the number of popularity points 502 of the concept 102 itself . referring back to fig3 , two other parts of the refinement stage 202 may be performed , but are optional . first , a relative popularity measure of each concept may be determined ( 306 ). this popularity measure reflects the popularity of each concept as compared to the other concepts , as the concepts appear in the query log by their concept words and key phrases . this popularity may be calculated in many different ways . for example , the popularity measure may be measured on a scale from zero to five , where zero means the concept is least popular , and five means the concept is most popular . in such a case , the popularity measure of a concept can be determined in this implementation as five times the log of the popularity points attributed to the concept divided by the log of the popularity points attributed to the most popular concept . second , a preferred search query for each concept may be determined ( 308 ). this is the search query that is most likely to result in useful search results for a concept . the preferred search query may be determined for a concept by selecting a key phrase that is unique to the concept , and which has the greatest popularity as compared to any other unique key phrase for the concept and the concept words of the concept . the popularity of a key phrase is indicated by the number of popularity points added to the concept as a result of the key phrase matching a query phrase within the query log . for example , if for the concept britney spears the key phrase britney is unique to the concept and has more popularity points than the concept words britney spears and the other unique key phrases do , then the key phrase britney is selected as the preferred search query . if no unique keyphrase is identified by this method , editorial means may be used to add such a keyphrase . fig6 is a flowchart showing the imaging stage 204 of fig2 in more detail . first , the output of the refinement stage is indexed ( 600 ). the output may also then be compressed . the output of the refinement stage is the list of concepts and their determined popularity , as well as their key phrases and associated data entities . this output is indexed and optionally compressed in such a way that it is compatible with the data image or database that is used by the search engine at query time , to run a search query entered by the user . the resulting indexed and optionally compressed output is then added to the database or data image used by the search engine at query time ( 602 ). the database or data image may also include other ways to find relevant data entities for search queries . for example , the database or data image may include the data for the techniques used by current search engines as described in the background section . fig7 is a flowchart showing the query stage 206 of fig2 in more detail . first , a query is received ( 700 ). for example , a user may enter a search query , such that the user wishes to receive relevant data entities , such as web page links , for the search query . the received query is next matched against words in the concept title and / or associated key phrases of concepts , to determine concepts that match the query ( 702 ). as mentioned earlier , a concept is said to match a query if the query matches a keyphrase and / or one or more words in the titles . note that the keyphrases and the title words may be matched in different ways to the query an exact string match on the key phrases may be used , while each of the words in the query may be required to be contained ( as a whole word ) in the title without regard to order . for example , if the search query is the word tiger , the query may match the key phrase tiger for the concept tiger woods , as well as the key phrase tiger for the concept wild tiger . the matching concepts are sorted by and in descending order of their popularity ( 704 ). their popularity is measured by the number of popularity points that were added to each concept . the sorted matching concepts are then output ( 706 ). if there are a large number of matching concepts , only a predetermined number , such as the first two or three , may be output , or alternatively all the concepts may be output . the output may also include the relative popularity of each of the matching concepts , and / or the preferred search query for each of the matching concepts . fig8 is a flowchart of a method 800 showing how the output of the query stage 206 of fig2 can be presented to the user , where the associated data entities of the concepts are web page links . first , the matching concepts and their relative popularity are displayed ( 802 ). where the relative popularity is a number from zero to five , this may be indicated to the user by displaying an equal number of icons , such as shaded stars . one or more featured web sites may optionally next be shown ( 804 ). one or more web sites , that is , web page links , associated with one or more of the matching concepts may also optionally be displayed ( 806 ). for example , there may be ten places reserved for showing such web page links . an equal number of associated web page links may be shown from each matching concept , or the places may be divided proportionally among the matching concepts based on their popularity . finally , one or more web pages returned from other types of search engines may be optionally displayed ( 808 ). such web pages may have been returned by current search engines as have been described in the background section . fig9 is a diagram of a window 900 that shows an example of the output resulting from the method 800 of fig8 . the user &# 39 ; s search query is shown in the box 901 . the matching concepts and their relative popularities that are displayed by performing 802 are shown in section 902 of the window 900 . the featured web site or sites that are displayed by performing 804 are shown in section 904 . the web sites , that is , web page links , associated with the matching concepts that are displayed by performing 806 are shown in section 906 of the window 900 . finally , any other relevant web pages that are displayed by performing 808 are shown in section 908 . if one of the matching concepts displayed in section 902 is selected by the user , another window may appear , as shown as the window 1000 of fig1 . the preferred search query for the selected concept is shown in the box 1002 . the associated web sites , or web page links , for the selected matching concept are then displayed in section 1006 of the window 1000 . fig8 , and 10 only depict an example of the display of associated data entities of matching concepts that can be used in accordance with the invention . other manners by which associated data entities of matching concepts can be displayed are also contemplated by the invention . fig1 is a diagram of a system 1100 that can implement the invention as has been described . the concepts , key phrases , and associated data entities 1102 , as well as the query log 1104 , are used by the popularity tool 1106 to perform the refinement stage 202 of fig2 as has been described . the output of the popularity tool is used by by the imaging tool 1108 to perform the imaging stage 204 of fig2 as has been described . the imaging tool 1108 results in a data image or a database that can be integrated into the search engine database 1112 , along with other search engine data 1110 . the query run time tool 1114 runs a search against the search engine database 1112 for the search query 1116 , as has been described as the query stage 206 . the output of the query run time tool 1114 includes query results 1118 based on the query 1116 . the query 1116 can also be added to the query log 1104 , for future periodic use of the popularity tool 1106 , and so on . each of the tools 1106 , 1108 , and 1114 may be a separate computer or computerized device , a separate computer program , or part of the same computer program . fig1 is a diagram of an environment 1200 in which the invention can be used . a client 1202 and a server 1206 are both communicatively connected to the internet 1204 . the server 1206 has access to the search engine database 1112 . a user enters a search query on the client 1202 , which is sent to the server 1206 over the internet 1204 . the server 1206 performs the query stage 202 of fig2 as has been described , matching the search query received from the client 1202 against the database 1112 . the results are then returned back to the client 1202 over the internet 1204 , where they can be displayed for the benefit of the user . fig1 illustrates an example of a suitable computing system environment 10 on which the invention may be implemented . for example , the environment 10 may implement the client 1202 , the server 1206 , and / or the system 1100 that have been described . the computing system environment 10 is only one example of a suitable computing environment and is not intended to suggest any limitation as to the scope of use or functionality of the invention . neither should the computing environment 10 be interpreted as having any dependency or requirement relating to any one or combination of components illustrated in the exemplary operating environment 10 . in particular , the environment 10 is an example of a computerized device that can implement the servers , clients , or other nodes that have been described . the invention is operational with numerous other general purpose or special purpose computing system environments or configurations . examples of well known computing systems , environments , and / or configurations that may be suitable for use with the invention include , but are not limited to , personal computers , server computers , hand or laptop devices , multiprocessor systems , microprocess or systems . additional examples include set top boxes , programmable consumer electronics , network pcs , minicomputers , cell phones , mainframe computers , distributed computing environments that include any of the above systems or devices , and the like . the invention may be described in the general context of computer instructions , such as program modules , being executed by a computer . generally , program modules include routines , programs , objects , components , data structures , etc . that perform particular tasks or implement particular abstract data types . the invention may also be practiced in distributed computing environments where tasks are performed by remote processing devices that are linked through a communications network . in a distributed computing environment , program modules may be located in both local and remote computer storage media including memory storage devices . an example of a system for implementing the invention includes a computing device , such as computing device 10 . in its most basic configuration , computing device 10 typically includes at least one processing unit 12 and memory 14 . depending on the exact configuration and type of computing device , memory 14 may be volatile ( such as ram ), non - volatile ( such as rom , flash memory , etc .) or some combination of the two . this most basic configuration is illustrated by dashed line 16 . additionally , device 10 may also have additional features / functionality . for example , device 10 may also include additional storage ( removable and / or non - removable ) including , but not limited to , magnetic or optical disks or tape . such additional storage is illustrated in by removable storage 18 and non - removable storage 20 . computer storage media includes volatile , nonvolatile , removable , and non - removable media implemented in any method or technology for storage of information such as computer readable instructions , data structures , program modules , or other data . memory 14 , removable storage 18 , and non - removable storage 20 are all examples of computer storage media . computer storage media includes , but is not limited to , ram , rom , eeprom , flash memory or other memory technology , cdrom , digital versatile disks ( dvd ) or other optical storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium which can be used to store the desired information and which can accessed by device 10 . any such computer storage media may be part of device 10 . device 10 may also contain communications connection ( s ) 22 that allow the device device to communicate with other devices . communications connection ( s ) 22 is an example of communication media . communication media typically embodies computer readable instructions , data structures , program modules , or other data in a modulated data signal such as a carrier wave or other transport mechanism and includes any information delivery media . the term “ modulated data signal ” means a signal that has one or more of its characteristics set or changed in such a manner as to encode information in the signal . by way of example , and not limitation , communication media includes wired media such as a wired network or direct - wired connection , and wireless media such as acoustic , rf , infrared and other wireless media . the term computer readable media as used herein includes both storage media and communication media . device 10 may also have input device ( s ) 24 such as a keyboard , mouse , pen , voice input device , touch input device , etc . output device ( s ) 26 such as a display , speakers , printer , etc . may also be included . all these devices are well known in the art and need not be discussed at length here . the methods that have been described can be computer - implemented on the device 10 . a computer - implemented method is desirably realized at least in part as one or more programs running on a computer . the programs can be executed from a computer - readable medium such as a memory by a processor of a computer . the programs are desirably storable on a machine - readable medium , such as a floppy disk or a cd - rom , for distribution and installation and execution on another computer . the program or programs can be a part of a computer system , a computer , or a computerized device . it is noted that , although specific embodiments have been illustrated and described herein , it will be appreciated by those of ordinary skill in the art that any arrangement that is calculated to achieve the same purpose may be substituted for the specific embodiments shown . this application is intended to cover any adaptations or variations of the present invention . therefore , it is manifestly intended that this invention be limited only by the claims and equivalents thereof .	8
in fig1 and 2 , a photosensitive drum 1 rotates in the direction of an arrow while in operation . disposed below the photosensitive drum 1 is a developing liquid tank 2 containing a developing liquid which is supplied by means of a pump 3 to a trough - shaped developing electrode 4 and by means of a pump 5 to a cleaning station , subsequently to be described , through a conduit 6 . the developing liquid supplied to the developing electrode 4 performs the function of converting an electrostatic latent image formed on the photosensitive drum 1 into a visible image . the numeral 7 designates a squeezing roller arranged posterior to the developing electrode 4 . as is well known , charging , exposing , transfer - printing and other stations are located around the photosensitive drum 1 in addition to the aforesaid developing station . however , since these stations do not form a part of the invention , they are not shown in the drawings and a cleaning station will only be shown as being located above the photosensitive drum 1 . in the cleaning station , a cleaning roller 8 made of foamed polyurethane rubber is rotatably supported by a support lever 9 which is in the form of a two - arm lever pivotally supported by a side plate 10 through a support shaft 11 . a tension spring 12 is mounted between the end of an arm opposite to an arm which supports the cleaning roller 8 and a pin attached to the side plate 10 . the spring 12 normally urges the support lever 9 to pivotally move clockwise about the support shaft 11 in the figure by its biasing force . a pressing pin 13 is attached to the end of the arm of the support lever 9 which supports the cleaning roller 8 . arranged posterior to the cleaning roller 8 with respect to the direction of rotation of the photosensitive drum 1 is a cleaning blade 14 which is fixedly supported by a blade support member 15 having a rotatable shaft 16 extending outwardly from either end thereof . the rotatable shaft 16 shown in fig2 is rotatably supported by a blade support side plate 17 detachably attached to the side plate 10 . the blade support member 15 has fixedly secured thereto a pressure applying lever 18 formed with a shoulder 18a against which the pressing pin 13 of the support lever 9 is positioned . the rotatable shaft 16 shown in fig2 is formed with an axial cut 16a extending axially from its forward end and having fitted therein a blade rotating lever 19 for free movement . the blade rotating lever 19 , which is pivotally movable about a support shaft 20 attached to the forward end portion of the rotatable shaft 16 , is in the form of a three - arm lever including a first arm pivotally connected to the support shaft 20 , a second arm inserted in the axial cut 16a and a third arm formed with a riser 19a . a solenoid 21 has a plunger 22 having pivotally connected thereto one end of a solenoid lever 23 which has attached to the other end thereof a pin 24 which engages a free end of the riser 19a of the third arm of lever 19 . the numeral 23a designates a pivot of the solenoid lever 23 . upon the apparatus being switched off , the photosensitive drum 1 stops rotating and the pumps 3 and 5 are rendered inoperative , so that the supply of the developing agent in liquid form to the developing electrode 4 and the supply of the developing liquid as a cleaning liquid to the cleaning station are terminated . at this time , no current is passed to the solenoid 21 , so that the plunger 22 projects outwardly as shown in fig3 and the solenoid lever 23 angularly rotates clockwise about the pivot 23a . this causes the pin 24 to move downwardly . since the support blade 15 and the blade rotating lever 19 are under the influence of the spring 12 through the support lever 9 and the pressing pin 13 , the riser 19a of the blade rotating lever 19 moves downwardly as the pin 24 moves downwardly as aforesaid . thus the blade support member 15 , and hence the cleaning blade 14 and the pressing lever 18 , are caused , through the rotatable shaft 16 , to angularly rotate counterclockwise . at this time , the pressing pin 13 moves upwardly as the pressure applying lever 18 rotates counterclockwise , with a result that the support lever 9 is pivotally moved clockwise about the support shaft 11 by the biasing force of the spring 12 . thus the cleaning blade 14 and the cleaning roller 8 are both out of contact with the photosensitive drum 1 as shown in fig3 . fig4 shows , on an enlarged scale , the relative positions of the cleaning blade 14 and the photosensitive drum 1 which are out of contact with each other . if a main switch , not shown , is depressed to turn on the copying apparatus , a current is passed to the solenoid 21 which is energized and withdraws the plunger 22 thereinto . accordingly the cleaning blade 14 and the cleaning roller 8 are brought into contact with the surface of the photosensitive drum 1 through a process which is reversed to the process described hereinabove , and the developing liquid is supplied to the cleaning station through the pump 5 and conduit 6 . the photosensitive drum 1 rotates in the direction of the arrow , and cleaning roller 8 carries out preliminary cleaning of the surface of the drum 1 immediately after the visible image has been printed therefrom on a copy sheet by transfer printing . then , as shown in fig5 the surface of the drum 1 is cleared of the residual toner particles by the cleaning blade 14 which is in pressing contact with the surface of the drum 1 , the toner particles thus collected together being carried away from the cleaning station by the developing liquid supplied from the developing liquid tank 2 . if the main switch is manipulated to turn off the copying apparatus , the current passed to the solenoid 21 is interrupted as aforesaid , so that the cleaning blade 14 and the cleaning roller 8 are brought out of contact with the photosensitive drum 1 again . from the foregoing description , it will be appreciated that the cleaning device according to the present invention is capable of satisfactorily carrying out cleaning of the surface of the photosensitive member by means of the cleaning blade which is brought into pressing engagement with the photosensitive member while the apparatus in operation , and that the cleaning blade is brought out of contact with the photosensitive member when the apparatus is rendered inoperative . accordingly the cleaning device in accordance with the invention causes no or little damage to the surface of the photosensitive member and minimizes the possibilities of defective copies being made from originals . also , when the photosensitive member or photosensitive drum , for example , is mounted in or removed from the apparatus for servicing or replacement , the cleaning blade is out of contact with the surface of the drum , so that no damage will be caused to the photosensitive drum by the cleaning blade on such occasions .	6
the present invention is a solid barrier system , for use as a privacy fence , which fence replaces an existing cyclone fence while reusing the preexisting fence posts of the cyclone fence . the present privacy fence system allows the user to remove the wire mesh fencing from an installed cyclone fence but leave the cement anchored fence posts in their original places . the privacy fence is adapted to fit onto the preexisting fence posts . the solid barrier system is not limited to the embodiments discussed below but may also be used for any solid barrier or sound partition . fig1 depicts an environmental , perspective view of a privacy fence system 10 according to the present invention . the privacy fence system 10 comprises a plurality of fence panels with at least one end of the fence panels being adapted to fit around the preexisting fence posts . fig2 depicts a perspective view of a linear segment of a first embodiment of the privacy fence system 10 depicting adjacent fence panels connected to an existing fence post . adjacent fence panels 30 and 40 are fit around a fence post 20 . the seam 22 between the fence panels 30 , 40 defines the connection point of the adjacent fence panels 30 , 40 around the fence post 20 . a first end of each fence panel 30 , 40 is adapted to securely fit around the fence post 20 . the distal end 42 of the fence panel 40 is not adapted to fit around a fence post 20 . the distal end 42 is adapted to releasably attach to the distal end of another adjacent fence panel . [ 0048 ] fig3 is an exploded , perspective view of the linear segment of the privacy fence system 10 depicting the fence panel attachment means according to one embodiment of the present invention . a first end 34 , 44 of each fence panel provides respective post receiving slots 36 , 46 , which slots are adapted to fit the fence panels 30 , 40 around the fence post 20 . the first ends 34 , 44 of each fence panel further comprise an attachment means for releasably securing adjacent fence panels 30 , 40 together around the existing fence post 20 . as shown in fig3 the attachment means comprises an interlocking attachment mechanism . the interlocking attachment mechanism on panel 30 is a plurality of connector projections 35 , 37 . the interlocking mechanism on an adjacent fence panel 40 is a plurality of connector slots 45 , 47 , which slots are adapted to receive the connector projections 35 , 37 of panel 30 . to connect the fence panels , the first fence panel 30 is raised above the top of the adjacent fence panel 40 so that the connector projections 35 , 37 are aligned with and can slide into the connector slots 45 , 47 . only the first ends 34 , 44 of each fence panel are equipped with the attachment means . the distal ends 32 , 42 of each fence panel are adapted to be secured to the distal ends of other adjacent fence panels . [ 0049 ] fig4 is a perspective view of a corner segment of the first embodiment of the privacy fence system 10 depicting adjacent corner fence panels 30 , 40 attached to the existing fence post 20 . the attachment means for the corner fence panels 30 , 40 is identical to that of the linear segments discussed above . the only difference between the corner and linear segments is the position of the attachment means . at a corner fence post , the attachment means are positioned at a different angle so that the adjacent fence panels 30 , 40 provide a corner for the fence system 10 . [ 0050 ] fig5 is a perspective view of a linear segment of the preferred embodiment of the privacy fence system 10 depicting adjacent fence panels 30 , 40 connected to an existing fence post 40 . in the preferred embodiment each fence panel 30 , 40 is equipped with an attachment means for releasably securing the adjacent fence panels 30 , 40 around a fence post 20 . the attachment means in the present embodiment comprises a plurality of threaded fasteners 50 . [ 0051 ] fig6 is a perspective view of a corner segment of the preferred embodiment of the privacy fence system 10 depicting adjacent corner fence panels 30 , 40 attached to the existing fence post 20 by the threaded fasteners 50 . the threaded fasteners 50 are positioned along the entire height of each fence panel 30 , 40 . the threaded fasteners 50 are preferably conventional 2 inch wood screws . the fasteners , however , are not limited to conventional wood screws but may take the form of any appropriate fastener . [ 0052 ] fig7 is a top view of the connection point 22 between adjacent corner fence panels 30 , 40 according to the second embodiment of the privacy fence system 10 depicting the location of the threaded screws 52 , 53 through the fence panels 30 , 40 . the adjacent fence panels 30 , 40 are fitted to a fence post 20 in the same manner as was described in the earlier embodiments . once the adjacent panels 30 , 40 are positioned around the fence post 20 they are releasably secured by the plurality of threaded fasteners 50 . each of the holes created by threaded fasteners 50 is filled with a respective decorative plug 54 , 55 . [ 0053 ] fig8 is a side view of a fence panel 40 according to the present privacy fence system 10 . the panel surface is configured to define horizontal corrugations therealong . the corrugated surface provides additional support for the fence panel 40 making it sturdier than if the panel 40 were flat . fig8 a is illustrative of an embodiment wherein the fence panel 40 a has a flat , vertical configuration and is provided with a vertical reinforcing strut 40 b . the privacy fence system 10 optionally comprises a plurality of fence post caps located on the top of the fence posts . fig9 is a perspective view of a post cap 60 according to the present privacy fence system . fig1 is a side view of the post cap depicted in fig9 . fig1 is a top view of the post cap depicted in fig9 . the fence post cap 60 is a rain cap that has a circular base 64 and a plurality of sidepieces 67 that come to a point 69 forming a pyramidal top portion . the circular base is equipped with a snap - in retainer lip 66 and a compression relief slit 68 that allows the fence post cap 60 to be releasably secured to the top of the fence posts 20 . side members 62 , 63 fit around the top portion of each fence panel 30 , 40 and hold the fence post cap 60 in place . [ 0055 ] fig1 depicts an alternate embodiment of the interlocking mechanism . in this embodiment the first end 94 of a fence panel 90 is equipped with connector slots 97 and connector projections 98 . the connector slots 97 are located on the top half portion 95 of the first end 94 of the panel 90 . the connector projections 98 are located on the bottom half portion 96 . an adjacent fence panel ( not depicted ) would be equipped with connector projections on the top half portion of the panel and connector slots on the bottom half portion of the panel . the interlocking mechanism depicted in fig1 provides a more secure attachment of the adjacent fence panels around the fence post 20 . the present embodiment also allows for easier assembly of the privacy fence system 10 . in the present embodiment the fence panel 90 only has to be raised to half of the height of the adjacent fence panel . the projections 96 on each fence panel then slide into the slots 97 of the adjacent panel . [ 0056 ] fig1 is a perspective view displaying the overlapping connection of two adjacent fence panels 40 , 80 of the horizontal corrugated design . the distal end 42 of fence panel 40 is not adapted to fit around a fence post 20 . the distal end 42 of the fence panel 40 is adapted to be releasably secured to the distal end 82 of another adjacent fence panel 80 . the fence panel 40 overlaps the adjacent fence panel 80 and is releasably secured to the adjacent panel 80 by an overlapping securing means . the overlapping securing means is preferably a plurality of typical pop rivets , which rivets are located along the entire height of each fence panel . the pop rivets are located on the fence panels at position 70 . the overlapping securing means allows the length of the linear segments to be adapted to irregularities in the placement of the original fence posts . the adjacent fence panels 40 , 80 can be altered in the distance that they overlap to compensate for fence post misplacements . if two of the original fence posts were positioned too close to one another , the adjacent fence panels 40 , 80 will overlap a greater distance to effectively shrink the privacy fence system to accommodate the misplacement of the posts . in fig1 a , the overlapping feature is illustrated in fence panels 40 a and 80 a having a vertical design . [ 0057 ] fig1 is a perspective view of a molded linear segment 100 of the privacy fence system . the segment 100 is formed by pouring material into a mold to form the shape of the segment . the front portion 102 of each segment 100 includes a plurality of mold receiving slots 106 . the mold receiving slots 106 receive projections inside of the mold that form the shape of the segment 100 . [ 0058 ] fig1 is a perspective view similar to fig1 but illustrating the flat panel design as discussed above . the fence panels are preferably made from a light - weight , one piece , molded construction . the fence panels are preferably six feet high and have a length of 67 inches . the height of six feet allows for ten pop rivets to be positioned along the distal end of the fence panel . these dimensions , however , are only illustrative and are not meant to limit the present privacy fence system . it is to be understood that the present invention is not limited to the sole embodiments described above , but encompasses any and all embodiments within the scope of the following claims .	4
the following detailed description of the invention refers to the accompanying drawings . while the description includes exemplary embodiments , other embodiments are possible , and changes may be made to the embodiments described without departing from the spirit and scope of the invention . fig2 a describes the structure of an organic light emitting diode according to the invention . in such an oled light is emitted downward , i . e ., through a transparent substrate ( 240 ) made for example of glass which also provides a mechanical support to the device . the metal anode ( 230 ) is deposited directly on the substrate . the anode is , e . g ., made of a layer of silver ( ag ) thin enough ( a few tens of nanometers ) to be semitransparent in the wavelength range of the visible light : 400 - 700 nanometers ( nm ). the anode ( 230 ) is the lower mirror of the microcavity ( 220 ) that will be formed after deposition of the upper electrode ( 210 ). optionally , as shown in fig2 b , the anode may also include a layer of transparent ito ( 232 ) previously deposited by sputtering on the substrate ( 240 ). although this is not mandatory , this helps further reducing the sheet resistance of the anode if necessary , e . g ., for the fabrication of very large devices or for devices having a form factor detrimental for the electrical properties . together , the layer of silver ( 231 ) and the underlying layer of transparent ito ( 232 ) then constitute the anode ( 230 ). because ito is deposited first on the glass substrate , prior to the thermal vacuum deposition of the organic layers , they cannot be disturbed by the sputtering processing step . hence , this alternate fabrication process of a bottom - emitting oled remains compatible with the objects of the invention . the upper electrode ( 210 ), i . e ., the cathode of the device is made , e . g ., by thermal vacuum deposition of aluminum or silver thick enough to be fully reflective ( several hundred nanometers ). between the anode ( 230 ) and cathode ( 210 ), the successive following layers of organic materials are deposited in a vacuum chamber by thermal evaporation : the first organic layer ( 229 ), a few tens of nanometers thick , is used to facilitate transport of holes that are injected by the anode ( 230 ) when this latter is tied to a positive voltage . it is placed immediately above the anode . the material is doped ( p - type doping ) to enhance conduction by holes ( i . e . : by lack of electrons ). in conjunction with the layer of silver below , and optionally that of ito ( 232 ) the electrical resistance of the anode layer ( 230 ) may be very low . the following organic layer ( 227 ) with a thickness of about ten nanometers is used to block the electrons that could come from the upper layers and would recombine otherwise in the underlying organic layer used to facilitate transport of holes ( instead of normally recombining in the electroluminescent layer ). the middle layer ( 225 ) is the organic layer where electrons and holes recombine and from where light is emitted . the thickness depends on the material used according to the color of light to emit . the layer ( 223 ) located directly above the light - emitting layer is used to block the holes coming from the lower layers . this layer plays a role equivalent of that of layer ( 227 ) which serves to block electrons . it is about of the same thickness . together , the blocking layers help to confine the recombination of electron - hole pairs in the intermediate light - emitting layer ( 225 ). the top organic layer ( 221 ) is used to facilitate the transport of electrons that are injected by the cathode when tied to a negative voltage . the material is doped ( n - type doping ) to enhance a conduction by excess of electrons . in conjunction with the metal layer forming the reflecting cathode ( 210 ) the electrical sheet resistance is very low and independent of its thickness . like the lower doped layer its thickness is below a few tens of nanometers . the structure of the above organic layers ( omitting the blocking layers of electrons and holes ) which combines : a p - type doped layer , a non - doped ( intrinsic ) layer made of a luminescent material , and an n - type doped layer , is said to form a pin structure . the materials used for this organic structure , doped or not , must have preferably a same refractive index ( close to 1 . 7 ) in order not to create internal reflections that would affect the transmission of the light emitted from the intermediate light - emitting layer ( 225 ). all these materials are commercially available . they can easily be deposited by vacuum thermal evaporation . following gives a list of commercially available materials that can be used to realize oleds according to the invention : above materials are used as indicated in following exemplary oled structure : alpha - npd layer doped with ir ( piq ) 3 in a ratio of 15 %, bphen layer doped with cs in a ratio of one atom of cs for one molecule of bphen , giving to the layer a while doping of the organic layers cannot explain alone the observed improvement of luminance efficiency the use of doped transport layers indeed allows sheet resistance of these layers to remain low even though they need to be thin . hence , the thickness of the layers can be freely adjusted to enhance the optical properties of oleds in order to obtain a microcavity ( 220 ) best adapted for the light color to generate . thus , the height of the microcavity ( 220 ) can be adjusted so that a resonance occurs for the wavelength of the light to emit . in addition , the light - emitting layer ( 225 ) can be vertically placed ( that is with an orientation according to the height of the micro cavity ) exactly where within the microcavity ( 220 ) it produces a maximum of light . this is achieved by independently controlling thickness of each of the different layers forming the organic structure ; mainly the p and n doped layers ( 221 , 229 ). this can be done irrespective of the electrical parameters , i . e ., the sheet resistance of the cathode ( 210 ) and of the anode ( 230 ) which can be kept low due to the use of doped organic materials so that voltage drops and heat dissipation remain negligible . moreover , the deposition of a doped organic layer directly on the anode metal does not create a barrier to the injection of holes unlike the case of the deposition of an intrinsic organic material as reported in the background section . the same applies to the injection of electrons in the doped area from the cathode . this is a major contributor to obtaining high luminance efficiency . all layers , organic and metallic , are advantageously deposited by vacuum thermal evaporation of corresponding materials . fig3 illustrates the action of the microcavity on the reduction of the range of wavelengths emitted by a device as described in the previous fig2 a and 2 b ). the reflectivity of such a layered system can be analyzed so as to obtain an optimal optical setting of the organic and metallic layers . fig3 shows the results obtained with an aluminum cathode ( 320 ) and a silver cathode ( 330 ). in both cases the semi transparent anode is made of silver . the silver cathode gives a narrower spectrum of color closer to producing a pure primary color , red in this case , with a minimum reflectivity of the layered structure close to 610 nm ( and thus a maximum transmission for that color ). fig3 also shows the reflectivity of a comparable structure ( 310 ) that does not benefit of the action of the microcavity though . this would be the case of a device as described in fig2 but without the semi reflective anode . this is obtained , for example , by replacing silver , or the couple silver - ito , by ito . no reduction of the range of emitted wavelengths is then observed . fig4 shows the results obtained with an oled structure of the invention as described in fig2 . this serves to illustrate the magnitude of the technical progress achieved . the curves plot the luminance output efficiency , in candela per ampere ( cd / a ), obtained as a function of the luminance level reached , in candela per square meters ( cd / m2 ). the best luminance efficiency figure is obtained with a device having a silver cathode ( 410 ). the one with an aluminum cathode ( 420 ) has a luminance efficiency figure of half the value . as far as the comparison device ( 430 ) is concerned , the one without microcavity , it is significantly worse . the following table also shows what voltages must be applied between anode and cathode to obtain the reported luminance output efficiency for two standard values of luminance level . voltages necessary to operate an oled of the type of fig2 are fully compatible with the standard values of power supplies used by the microelectronics industry ( 3 - 5 volts ). the maximum luminance efficiency obtained in the red ( 42 cd / a ) with the oled structure using a silver cathode is close to the best results reported for devices emitting in the green and is significantly better than any previous results reported for oleds emitting in the red .	7
hereinafter , an exemplary embodiment of the present disclosure will be described in detail with reference to the accompanying drawing . a configuration of the present disclosure and an operation and an effect according to the configuration of the present disclosure will be clearly understood by the detailed description below . in the following description , the same elements will be designated by the same reference numerals although the elements are illustrated in different drawings , and a detailed explanation of known related constitutions may be omitted so as to avoid unnecessarily obscuring the subject matter of the present disclosure . fig3 is a conceptual diagram of a power supply device for hybrid construction machinery according to the present disclosure . the power supply device of fig3 is different from the power supply device for hybrid construction machinery in the related art of fig1 b in that the existing starting motor 10 and alternator 20 are removed . that is , the starting motor 10 used for starting an engine is removed , and instead , the engine starts by using an engine auxiliary motor 103 . further , a first charge storing means ( dc link capacitor ) 150 storing energy generated by the engine auxiliary motor 103 is directly connected to a power conversion means ( dc / dc converter ) 290 . the power conversion means ( dc / dc converter ) 290 performs charging of the battery 101 instead of the alternator , and supplies energy to an electric system 106 , instead of the battery 101 . further , the switching means 291 makes the battery 101 and a second capacitor means 105 be electrically conducted only when a voltage of the second capacitor means ( uc ) 105 is smaller than a reference voltage necessary for initially starting the engine when the hybrid construction machinery starts , so that the power supply device for hybrid construction machinery charges the second capacitor means 105 by the battery 101 . further , the power supply device for hybrid construction machinery may also include a current control means ( diode ) 292 , and when the power conversion means ( dc / dc converter ) 290 has a defect , the current control means 292 makes the battery 101 instead of the power conversion means ( dc / dc converter ) 290 supply electric energy to the electric system 106 . hereinafter , an exemplary embodiment of the present disclosure will be described in detail with reference to fig4 a and 4b . detailed descriptions of the same contents as those of the related art are omitted , and different matters will be mainly described . fig4 a illustrates an exemplary embodiment of the present disclosure for a converter method , and fig4 b illustrates an exemplary embodiment of the present disclosure for a converterless method . the converter method of fig4 a is different from the converter method in the related art illustrated in fig2 a in that the existing starting motor 10 and alternator 20 are omitted . that is , the starting motor 10 used for starting the engine is removed , and instead , the engine starts by using the engine auxiliary motor 103 . further , the converter method of fig4 a is different from an existing converter method in that the power conversion means ( dc / dc converter ) 290 is provided . the power conversion means ( dc / dc converter ) 290 is directly connected to the first capacitor means ( dc link capacitor ) 150 storing energy generated by the engine auxiliary motor 103 . the power conversion means ( dc / dc converter ) 290 performs charging of the battery 101 instead of the alternator , and supplies energy to the electric system 106 , instead of the battery 101 . further , the switching means 291 makes the battery 101 and the second capacitor means ( uc ) 105 be electrically conducted only when a voltage of the second capacitor means ( uc ) 105 is smaller than a reference voltage necessary for initially starting the engine when the hybrid construction machinery starts , so that the second capacitor means ( uc ) 105 is charged by the battery 101 . in the meantime , when the voltage of the second capacitor means ( uc ) 105 is equal to or larger than the reference voltage necessary for initially starting the engine , the switching means 291 is off , and instead , the second capacitor means 105 supplies electric energy to the engine auxiliary motor 103 to start the engine . the aforementioned control is performed by a controller 280 . that is , when the voltage of the second capacitor means ( uc ) 105 is smaller than the reference voltage necessary for initially starting the engine when the hybrid construction machinery starts , the controller 280 controls the battery 101 to supply charging energy to the second capacitor means 105 , and when the voltage of the second capacitor means 105 is equal to or larger than the reference voltage necessary for initially starting the engine , the controller controls the second capacitor means 105 to supply electric energy to the engine auxiliary motor 103 to start the engine 30 . the converterless method of fig4 b is different from the converterless method in the related art illustrated in fig2 b in that the existing starting motor 10 and alternator 20 are omitted . the power conversion means ( dc / dc converter ) 290 is directly connected to the first capacitor means ( dc link capacitor ) 150 storing energy generated by the engine auxiliary motor 103 . the power conversion means ( dc / dc converter ) 290 performs charging of the battery 101 instead of the alternator , and supplies energy to the electric system 106 , instead of the battery 101 , which is similar to the converter method of fig4 a . further , the switching means 291 makes the battery 101 and the second capacitor means ( uc ) 105 be electrically conducted only when a voltage of the second capacitor means ( uc ) 105 is smaller than a reference voltage necessary for initially starting the engine when the hybrid construction machinery starts , so that the second capacitor means ( uc ) 105 is charged by the battery 101 . in the meantime , in the converterless method of fig4 b , a current control means ( diode ) 292 may be further provided , differently from the converter method of fig4 a . when the power conversion means ( dc / dc converter ) 290 has a defect , the current control means 292 makes the battery 101 supply electric energy to the electric system 106 , instead of the power conversion means ( dc / dc converter ) 290 . the current control means 292 makes a voltage of the uc 105 correspond to a voltage of the dc link capacitor 250 according to an operation of a large capacitor contactor ( mc ) 280 - 1 for high current conduction . the aforementioned control is performed by a controller 280 . that is , when the voltage of the second capacitor means ( uc ) 105 is smaller than the reference voltage necessary for initially starting the engine when the hybrid construction machinery starts , the controller 280 controls the battery 101 to supply charging energy to the second capacitor means 105 , and when the voltage of the second capacitor means 105 is equal to or larger than the reference voltage necessary for initially starting the engine , the controller controls the second capacitor means 105 to supply electric energy to the engine auxiliary motor 103 to start the engine 30 . fig5 is a flowchart for describing a power supply method by the power supply device for hybrid construction machinery according to the present disclosure . when a driver initially turns a key to an on - position ( s 10 ), the controller 280 checks a charging state of the second capacitor means ( uc ) 105 ( s 20 ). when a voltage of the uc 105 is equal to or larger than a reference voltage that is a minimum voltage necessary for initially starting the engine as a result of the check in operation s 20 , and energy of the uc 105 is sufficient to start the engine 30 , the controller 280 immediately enters to an engine starting mode and starts the engine 30 by using power of the uc 105 ( s 40 ). by contrast , when the voltage of the uc 105 is smaller than the reference voltage that is a minimum voltage necessary for initially starting the engine as the result of the check in operation s 20 , the controller 280 charges the uc 105 by using energy of the battery 101 ( s 30 ), and then performs operation s 20 of checking the charging state of the uc 105 again . then , when the voltage of the uc 105 reaches the reference voltage , the controller 280 drives in the engine starting mode ( s 40 ). in the meantime , when the engine 30 is started , the controller 280 supplies energy stored in the dc link capacitor 150 and 250 to the electric system 106 by using the dc / dc converter 290 as necessary power having of + 24 v ( s 50 ), and normally operates an excavator ( s 60 ). fig6 and 7 are diagrams for describing an operation state for each operation mode of the device according to the present disclosure . as described above , the power supply device according to the present disclosure includes a total of five operation modes including a uc charging mode ( fig6 a and 7a ), an engine starting mode ( fig6 b ), a normal operation mode ( fig6 c and 7b ), a battery charging mode ( fig7 c ), and a defect mode ( fig7 d ). the uc charging mode will be described with reference to fig6 a and 7a . fig6 a and 7a illustrate the uc charging mode , and when the uc is discharged during an initial start , so that the voltage of the uc is smaller than the reference voltage that is the minimum voltage necessary for starting an engine , the switching means 291 is on , and the uc is charged via the uc converter through the dc / dc converter 290 and the dc link 150 by using energy of the battery 101 . the engine starting mode will be described with reference to fig6 b . fig6 b illustrates the engine starting mode , and when the voltage of the uc is equal to or larger than the reference voltage , power is supplied to the inverter and the power generator through the uc converter and the dc link by using energy of the uc in order to start the engine , and the engine 30 is rotated through the supplied power to start the engine . the normal operation mode will be described with reference to fig6 c and 7b . fig6 c and 7b illustrate the normal operation mode after the engine starts . in the normal operation mode , the switching means 291 is off , and energy of the dc link 150 is converted into the necessary voltage (+ 24 v ) via the dc / dc converter 290 and then necessary power is generated and supplied to the electric system 106 . the battery charging mode will be described with reference to fig7 c . fig7 c illustrates the battery charging mode , and the switching means 291 is turned on , energy stored in the dc link capacitor 150 is converted into necessary voltage (+ 24 v ) via the dc / dc converter 290 , and then the battery 101 is charged with the necessary voltage (+ 24 v ). the defect mode will be described with reference to fig7 d . fig7 d illustrates a defect mode , and a case where the dc / dc converter 290 has a defect . in this case , energy of the battery 101 is automatically supplied to the electric system 106 through the current control means 292 , instead of the dc / dc converter 290 . from the foregoing , it will be appreciated that the exemplary embodiments of the present disclosure have been described herein for purposes of illustration , and that various modifications may be made by those skilled in the art without departing from the scope and spirit of the present disclosure . the exemplary embodiments disclosed in the specification of the present disclosure do not limit the present disclosure . the scope of the present disclosure shall be construed on the basis of the following claims in such a manner that all of the technical ideas included within the scope equivalent to the claims belong to the present disclosure .	1
once the object of the invention has been outlined , specific non - limitative embodiments are described hereinafter . all the embodiments of the invention are located in the outer ftac ( 4 ). an embodiment of an aircraft is represented in fig1 a and its left wing is shown in fig1 b where the locations where the ftacs ( fig1 c ) are located are shown . in fig1 d a sectional view of the inner area of the wing wherein the fuel tank ( 1 ) is located is represented . besides , in fig1 d and 1e the relative position of the ftacs to the fuel tank ( 1 ) is shown . the inner ftac ( 3 ) is in the fuel tank ( 1 ) and it is sealed with fuel seals ( 17 ) to the lower wing skin ( 16 ). the outer ftac ( 4 ) is fixed to the lower wing skin ( 16 ) by means of a plurality of mounting holes peripherally distributed . the fixing means , in an embodiment of the invention , are bolts . the different embodiments of the invention are located in the outer ftac ( 4 ). in a first embodiment of the invention the outer ftac ( 4 ) comprises relief means which is a disk ( 5 ) which is ruptured once a predetermined level of pressure is reached . in fig2 the disk ( 5 ) is a rupture disk . the rupture disk ( 5 ) is designed to provide a replaceable leak - tight seal within a vessel until the internal pressure rises to a predetermined level . the rupture disk ( 5 ) in the embodiment shown in fig2 is riveted to the outer ftac ( 4 ). in an embodiment it comprises a circular region ( 6 ) wherein the thickness is smaller the rest of the disk ( 5 ). the thickness of the centre ( 6 ) of the rupture disk ( 5 ) is such that it is the point with the highest stress when the rupture disk ( 5 ) is pressurized . this high stress point ruptures beyond a predetermined pressure . in the case of rupture , only the rupture disk ( 5 ) has to be replaced when it is damaged and the rest of the outer ftac ( 4 ) remains undamaged . in one embodiment the disk ( 5 ) is manufactured using a high strain material , such as a ceramic material . in one embodiment the region ( 5 ) is sized according to an average detonation pressure . this pressure varies depending on the ftac size and typical values are within the range of 1 - 4 atm . the outer ftac ( 4 ) comprises relief means which is a frangible line ( 8 ) represented in fig3 a . fig3 b shows a sectional zoomed view of the frangible line ( 8 ). this pressure relief concept is considered in the form of a fusible feature / device to evacuate the pressure caused by the detonation of fuel / air gases . the frangible line ( 8 ) is calibrated to rupture once a predetermined pressure level due to explosion gases is reached . the outer ftac ( 4 ) itself is a fusible component , so once damaged , it must be replaced . rip - stop features are also required to limit the crack propagation to the mounting holes of the outer ftac ( 4 ) to avoid ftac detachment from the lower wing skin and to ensure that the sealing requirements are still fulfilled . in an embodiment the outer ftac ( 4 ) comprises relief means which are a door ( 9 ) which pops - off once a predetermined pressure level due to explosion gases is reached . the pop - off door ( 9 ) comprises clipping means ( 10 ), as it can be seen in fig4 , for fixing the pop - off door ( 9 ) to the outer ftac ( 4 ) wherein such clipping means ( 10 ) are adapted to be broken or deflected once a predetermined level of pressure due to explosion gases is reached . the clipping means ( 10 ) are designed to deflect / fracture at the minimum detonation pressure along with a conservative reserve factor . in an embodiment the outer ftac ( 4 ) comprises clipping means ( 10 ) designed for a detonation pressure of 1 - 4 atm . in an embodiment the pop off door ( 9 ) is made of metal . in an embodiment the pop off door ( 9 ) is made of molded plastic . this embodiment has the advantage of being lighter and more economical to manufacture than the metal one . in an embodiment of the invention , the outer ftac ( 4 ) comprises relief means which are open vent means such that the void area ( 2 ) of the manhole is in communication with the atmosphere or the outside environment of the outer ftac ( 4 ). in this concept , the outer ftac ( 4 ) is open to atmosphere , so that air - fuel gases , either before the explosion or after it , are let outside . this is called the open vent concept . in an embodiment of the invention , the open vent means comprise at least one orifice ( 12 ) on it . in an embodiment of the invention , the solution of the pop - off door ( 9 ) is used in with a fire trap ( 11 ) to provide a barrier if the door is exposed to fire and it melts , in case of having a pop - off door made with a material that can melt . it is also used to prevent direct flame from touching the inner ftac ( 3 ). in an embodiment of the invention , a number of orifices ( 12 ) are located in such a way that they follow a direction according to the streamlines of the air flow ( 18 ) when the aircraft is flying under cruise conditions in order to minimize the aerodynamic drag . these orifices ( 12 ) provide an open door venting path between void area and the atmosphere . the size and shape of the orifices will depend on the volume and shape of the void area between the inner ftac ( 3 ) and outer ftac ( 4 ). in an embodiment , the outer ftac ( 4 ) is elongated showing two ends wherein it comprises two pluralities of orifices ( 12 ), preferably six orifices ( 12 ). each plurality of orifices ( 12 ) is a cluster distributed as a line according to the stream lines the air flow close to one end , providing a two hole pattern , one pattern at each end . this solution is represented in fig5 . in an embodiment the size of the orifices ( 12 ) is in the range from 0 . 3 cm to 0 . 8 cm . these sizes depend on the gas velocity inside the void area . in an embodiment of the invention , the outer ftac ( 4 ) comprises an inner cover ( 15 ) located in the inner side of the outer ftac ( 4 ) following a diagonal direction ( 18 ) according to the streamlines of the air flow when the aircraft is flying under cruise conditions . between the inner cover ( 15 ) and the outer ftac ( 4 ) a chamber ( 19 ) is enclosed such that : the orifices ( 12 ) are in communication with the chamber ( 19 ); and , the chamber ( 19 ) is also in communication with the void area ( 2 ) by means of an opening ( 13 ). the inner cover ( 15 ) prevents any possible flame , in case of an external fire when the aircraft is on earth , from travelling towards the fuel tank ( 1 ). in an embodiment the inner cover ( 15 ) or the outer ftac ( 4 ) comprises a pressure baffle ( 14 ) to reduce shock waves due to the explosion , as it is represented in fig6 , such that the chamber is divided at least in two sub - chambers : a first sub - chamber ( 19 . 1 ) in communication with the void area ( 2 ) through the opening ( 13 ); and , a second sub - chamber ( 19 . 2 ) in communication with the first sub - chamber ( 19 . 1 ) and also in communication with the open vent means . in the embodiment represented in fig6 , the pressure baffle ( 14 ) has a predetermined length and it is shaped in such a way that one end is parallel and in contact with the inner cover ( 15 ) and the other end forms a predetermined angle with the inner cover ( 15 ) towards the direction of the opening ( 13 ). pressure baffles ( 14 ) are used to reduce the shockwave velocity to sub - sonic speeds so that the flow is not choked at the exit ports . therefore , super - sonic conditions are avoided . fig7 represents a perspective view of the inner part of an outer ftac ( 4 ) where an embodiment of the open vent concept is shown . the different elements for this embodiment can be differentiated : outer ftac ( 4 ), orifices ( 12 ), inner cover ( 15 ) riveted to the internal surface of the outer ftac ( 4 ), pressure baffle ( 14 ), inlet ( 13 ). the elements located inside of the inner cover ( 15 ) are represented using a slashed line .	1
the term implantable medical devices as used herein is defined to have its conventional meaning and refers to any device or implant made from a biocompatible material for insertion or implantation into the body of a human or animal subject , including but not limited to stents ( e . g ., coronary stents , vascular stents including peripheral stents and graft stents , urinary tract stents , urethral / prostatic stents , rectal stents , esophageal stents , biliary stents , and pancreatic stents ), surgical sutures , surgical needles , meshes , electrodes , catheters , leads , implantable pacemakers , cardioverter or defibrillator housings , joints , screws , rods , ophthalmic implants , femoral pins , bone plates , grafts , anastomotic devices , perivascular wraps , sutures , staples , shunts for hydrocephalus , dialysis grafts , colostomy bag attachment devices , ear drainage tubes , leads for pace makers and implantable cardioverters and defibrillators , vertebral disks , bone pins , suture anchors , hemostatic barriers , clamps , screws , plates , clips , vascular implants , tissue adhesives and sealants , tissue scaffolds , various types of dressings ( e . g ., wound dressings ), bone substitutes , intraluminal devices , vascular supports , etc ., and equivalents thereof . the implantable medical devices may be formed from any suitable conventional biocompatible material , including but not limited to polymers ( including stable or inert polymers , organic polymers , organic - inorganic copolymers , inorganic polymers , and biodegradable polymers ), metals , metal alloys , inorganic materials such as silicon , glasses , and composites thereof , including layered structures with a core of one material and one or more coatings of a different material . the materials may be bioabsorbable , partially bioabsorbable , or nonabsorbable . the term bioabsorbable as used herein is defined to have its conventional meaning as being essentially a polymeric material that is absorbed from the locus of implantation in less than three years . wherein the bioabsorbable polymer may be biodegradable whereby the backbone or sidechains degrade or dissolve into lower molecular weight polymers that are metabolized and / or excreted from the body . the bioabsorbable polymers may include conventional biocompatible bioabsorbable polymers including , but not limited to , polyethers such as polyethylene glycol or polyethyleneoxide , polyvinylpyrroldine , polyvinylalcohol , polyhydroxy acids , polylactides , polyglycolides , polyhydroxy butyrates , polyhydroxy valeriates , polycaprolactones , polydioxanones , synthetic and natural oligo - and polyamino acids , polyphosphazenes , polyanhydrides , polyorthoesters , polyoxaesters , polyphosphates , polyphosphonates , polyalcohols , polysaccharides , polyethers , polyamides , aliphatic polyesters , aromatic polyesters , copolymers of polymerizable substances thereof , and resorbable bioglasses . the nonabsorbable polymers may include conventional biocompatible polymers including , but not limited to , polyalkenes , polypropylene , polyethylene , partially halogenated polyolefins , wholly halogenated polyolefins , fluorinated polyolefins , polytetrafluorethylene , polyvinylidene fluoride , polyisoprenes , polystyrenes , polysilicones , polycarbonates , polyarylether ketones , polymethacrylic acid esters , polyacrylic acid esters , polyimides , non degradable polysaccharides such as cellulose , bacterial cellulose , and copolymers of polymerizable substances thereof . the components of the antimicrobial compositions of the present invention include a methylol - containing compound such as taurolidine and protamine , or preferably a particular a protamine salt such as protamine sulfate or protamine hydrochoride , optionally in a solvent or coating solution . by “ methylol - containing compound ,” or “ methylol transfer agent ,” is meant a compound which contains or is capable of producing a methylol molecule under physiological conditions . a methylol - containing compound is characterized as having a r — ch2 - oh group in which r is an alkyl , aryl or hetero group . the invention also includes the use of compounds capable of producing or being converted into a compound containing an r — ch2 - oh structure . taurolidine ( bis ( 1 , 1 - dioxoperhydro - 1 , 2 , 4 - thiadiazinyl - 4 )- methane ) is a derivative of the amino acid taurine and has antimicrobial properties . taurolidine is believed to act via a chemical reaction with bacterial cell wall structures . bacteria exposed to the compound are killed and released toxins are inactivated . taurolidine has been shown to be safe and well tolerated at systemic doses exceeding 40 g / day and cumulative doses up to and exceeding 300 g . taurolidine has been used to treat patients with peritonitis and used as a catheter lock solution for the prevention of central venous catheter - related infections . compared to other known antimicrobial compositions used on medical devices , the antimicrobial properties of taurolidine are relatively weaker , therefore more dosing is needed for efficacy . even though the quantities of taurolidine required to achieve efficacy on a particular medical device may be safe and biocompatible , the physical properties of a coating on the medical device containing such a relatively high dose might be adversely impacted and affected . therefore , a highly effective composition having reduced amounts of the antimicrobial agent is needed for taurolidine use on medical devices . taurolidine - like compounds like taurultame ( 38668 - 01 - 8 ), cyclotaurolidine ( 220928 - 22 - 3 ) or similar acting molecules like cilag 61 ( 531 - 18 - 0 ) or noxiflex s ( 15599 - 39 - 0 ) may be used alternatively or in combination with taurolidine in the practice of the present invention . protamine is a small arginine - rich , highly cationic peptide . protamine was discovered combined with nucleic acids in the sperm of certain fish , and has the property of neutralizing heparin . protamine sulfate is usually administered to reverse a large dose of heparin administered during certain surgeries . protamine may also be used in its free form and in the form of a salt . a suitable protamine useful in the practice of the present invention is , for example , protamine sulfate or protamine hydrochloride . in the practice of the present invention it is preferred that pharmagrade - approved protamine ( usp grade ) sources are used . protamine is also used as a mixture of peptides . according to hvass ( 2005 ), hvass a and skelbaek - pedersen b , j . pharm biomed anal 37 ( 3 ): 551 - 7 ( 2005 ), commercially available protamines are usually obtained as the sulphate salt , and for insulin formulations , salmine protamine from fish of the family salmonidae is normally used . salmine protamine may be classified as a mono - protamine as only one basic amino acid , arginine , is present . the four major peptides , which constitute almost the entire nitrogen containing material in salmine protamine , have been fully characterized . according to block ( 1937 ), yale j biol med . 1937 may ; 9 ( 5 ): 445 - 503 , the protamines have been divided into four groups depending on their content of the major or basic amino acids ; those containing examples of protamines and hydrolizates or fragments thereof that are useful are described below . additional protamine - like molecules which are acting as anti - heparin agents such as polybrene , terlipressin , romiplostim , eltrombopag , or condensed dna like polyarginine , polylysin and finally protamine - like proteins or protamine - like peptides which are a group of sperm nuclear basic proteins ( snbps ) together with protamine type and histone type . protamine - like snbps represent the most structurally heterogeneous group , consisting of basic proteins which are rich in both lysine and arginine amino acids . additional protamine - like peptides are described sometimes according to u . s . pat . no . 5 , 614 , 494 as are synthetic protamine - like polycationic peptides having a total cationic charge which is less than that of n - protamine . additional protamine like molecules can have the same mode of action in the case of sustained insulin formulations like surfen ( dihrochloride 5424 - 37 - 3 or base 3811 - 56 - 1 ), globin optional with a trace of zink . the amount of taurolidine and protamine in the antimicrobial compositions of the present invention will be sufficient to provide effective antimicrobial activity without exhibiting any significant levels of toxicity . typically the amount of taurolidine present in the antimicrobial compositions will be about 50 wt . % to about 99 wt . %, more typically about 60 wt . % to about 90 wt . %, and preferably about 70 wt . % to about 90 wt . %. the amount of protamine or protomine salt present in the antimicrobial compositions will typically be about 1 wt . % to about 50 wt . %, more typically about 5 wt . % to about 50 wt . %, and preferably about 10 wt . % to about 50 wt . %. the antimicrobial compositions of the present invention may be utilized with medical devices to provide an antimicrobial effect in a variety of ways . the compositions may be included in coating compositions and coated onto surfaces of medical devices using conventional coating processes including dipping , brushing , and spraying . the antimicrobial compositions may also be incorporated into medical devices in other conventional manners , including compounding into a resin , and then extruding or molding a medical device from the resulting compounded resin . conventional techniques and processes may be used to apply the compositions and coatings of the present invention onto the surfaces of medical devices and implants . the techniques include , but are not limited to , dip coating , spraying , inkjet ( solvent jet ) application , swelling , powder coating with sintering , injection molding , and plasma or laser deposition coating , etc . as mentioned previously above , if desired , the antimicrobial compositions of the present invention may be compounded or blended with polymeric materials , which are then used as mixtures or blends in solid or semi - solid form as granules or powders . such polymeric mixtures or blends may then be processed in conventional manners including , but not limited to , compressed into tablets , extruded , injection molded , etc . in one preferred embodiment , the antimicrobial coatings of the present invention are applied as liquid coating compositions . the liquid coating compositions will typically utilize one or more liquid solvents or carriers , and depending upon the indication , different solvent systems may be used . the conventional solvents that are optionally included in the antimicrobial coating compositions of the present invention include , but are not limited to , water for injection , ethanol / water mixtures , isopropanol water mixtures , glycerol / water mixtures , protein solutions , and blood and serum . if desired , additional conventional biocompatible components may be included in the antimicrobial compositions of the present invention when used as a coating composition including surfactants , thickeners , polyvinylpyrrolidones , polyethyleneglycols , carboxymethylcellulose , hydroxyethylstarch , hydroxypropyl starch , dextrane , polyoxypropylene - polyoxyethylene copolymers , polyethoxylated castor oils , etc ., and combinations thereof . the antimicrobial coatings of the present invention will contain a sufficient amount of the antimicrobial compositions of the present invention to provide an effective antimicrobial effect without exhibiting significant levels of toxicity . for example , the amount of the antimicrobial compositions of the present invention contained in the coating compositions will typically be about 0 . 1 wt . % to about 10 wt . %, more typically about 2 wt . % to about 4 . 5 wt . %, and preferably about 2 wt . %, with the remainder being solvent or solvents and other optional additives . those skilled in the art will appreciate that these amounts may vary depending upon several factors including the size and shape of the medical device , the location of the implanted device in the body , the composition of the implanted device , the age and weight of the patient , the duration of the length of time that the implant will remain in the patient &# 39 ; s body , the surface area of the implant , etc . when using the antimicrobial compositions of the present invention in an antimicrobial coating composition , the coating compositions can be prepared in a conventional manner . for example , a required amount of the antimicrobial composition is admixed with solvent in a conventional mixing vessel in the following manner . a suitable , conventional vessel is provided with a stirring device such as a magnet stirring bar or a paddle stirrer . a solvent or solvent mixture is added to the vessel and a defined amount of protamine or protamine salt such as protamine sulfate is added to the vessel under stirring . the mixture is warmed if or as needed , and a defined amount of taurolidine is added . any additional solvent / solvent mixture as needed is added to adjust the final concentration of said mixture . those skilled in the art will appreciate that additional conventional biocompatible components may be added to the coating compositions including resins , surfactants , pigments , etc . for injection or internal use such as intraperitoneal lavage basically water - based systems are preferred , e . g ., ringer , isotonic nacl or glucose . the ph can be adjusted with hcl , h2so4 or phosphoric acid for a ph of 5 - 7 . viscosity enhancers such as pvp , hes or cmc may be optionally added . acceptable injectable preserving agents such as methyl - 4 - hydroxybenzoate or propyl - 4 - hydroxybenzoate can also be added . such solutions might be also used to treat an implantable medical device just before use by dipping or washing or rinsing . depending upon the indication , dispersions of one or more compounds might be used . heparin / protamine particles could prepared according to mori ( 2010 ) in the presence of taurolidine or by adding tauroldine in a separate step , mori et al . ( 2010 ), mori y , nakamura s , kishimoto s , kawakami m , suzuki s , matsui t , ishihara m , international journal of nanomedicine vol 5 , 147 - 155 ( 2010 ). for topical application , a certain amount of alcohol such as , for example ethanol or isopropanol , without inducing flocculation of the protamine may be added , preferably below 40 % ( v / v ) of the alcohol component if a solution is needed . otherwise water for injection , hydrochloric acid to adjust the ph , macrogol 4000 and nacl are preferred . additional ingredients optionally include ( 3 - amidopropyl cocoate ) dimethylammonium acetate , sodium d gluconate , glycerol 85 %, sodium chloride , and purified water . protamine sulfate solution 1 % is compatible in 1 to 9 to 1 : 1 ratios with lavasept concentrate ( 20 % polyhexanid and 1 % macrogol 4000 ) or with octenisept . taurolidine can be dissolved in the mixture to give a final concentration of 2 % taurolidine . in order to coat an implantable medical device before packaging to provide a coated device of the present invention , several types of coating solutions may be utilized containing the antimicrobial compositions of the present invention depending upon the desired results , coating processes , application , etc . a coating composition without a binder or with a water soluble binder such as pvp , peg , cmc , hes , dextran , pluronics , chremophors can be utilized and made from a mixture of taurolidine / protamine in water . if a coating concentration greater than 2 % wt . % taurolidine is required , taurolidine can be dissolved in acetone / water 90 / 10 - 70 / 30 for up to 4 % wt . % and then the implant is initially coated with taurolidine . if a polymeric binder is desired or required such as pla or plga , the polymer may be additionally dissolved in the acetone / water mixture . in a second step the protamine solution is coated basically from water . the coating steps might be switched and an interim drying step might be added . the amount of optional polymeric binder used in the coating compositions will be sufficient to provide effective release of the taurolidine and additionally ensure sufficient mechanical stability during handling . compounding of the antimicrobial compositions of the present invention with resins may be performed whereby the ratio of taurolidine to bulk polymer ( e . g ., polydioxanone ) for a surgical mesh should be higher than 30 % wt . % to 70 % wt . %, preferably higher than 50 wt . % to 50 wt . % drug to polymer to ensure a sufficient high release rate . for bone implants , higher polymer ratios might be used to ensure a slower release and prolonged action . a mixture of taurolidine / protamine is preferably compounded with polydioxanone below 150 ° c . and preferably under a protective gas atmosphere such as nitrogen or argon . the compound can be transformed into different shapes , including medical devices , using conventional processes such as injection molding and extrusion , or applied to a medical device by conventional processes such as gluing , stitching , knitting , melting , etc . one preferred formulation technique is according to ep1251794 , incorporated by reference , in example 16 , where small balls are introduced into an implantable cord . 1 mm to 3 mm balls can be prepared either by compounding , by tableting or incorporating into capsules . the implant is preferably absorbable and may be used , for example , as an alternate antibiotic - free form for the septopal chain ™ system for osteomyelitis . in another embodiment of the present invention , the antimicrobial compositions of the present invention are encapsulated between two films , which may have pores of appropriate sizes to contain the antimicrobial composition and ensure a sufficiently effective release . the antimicrobial compositions of the present invention may be contained in a fabric pouch made from absorbable polymers , preferred are woven or non woven materials having tiny pores to prevent powdering out of the containment . for some indications it is beneficial to optionally use additional active agents in combination with the antimicrobial compositions of the present invention . selection and utilization of an active agent in combination with the compositions of the present invention depends upon the desired benefit intended to be derived . for example , it may be advantageous to provide an implant ( either coated or compounded ) comprising an antimicrobial composition according to the invention that has at least one additional biologically active ingredient or agent , which can optionally be released locally after the implantation . substances which are suitable as active agents may be naturally occurring or synthetic and include and are not limited to , for example , antibiotics , antimicrobials , antibacterials , antiseptics , chemotherapeutics , cytostatics , metastasis inhibitors , antidiabetics , antimycotics , gynaecological agents , urological agents , antiallergic agents , sexual hormones , sexual hormone inhibitors , haemostyptics , hormones , peptide - hormones , antidepressants , vitamins such as vitamin c , antihistamines , naked dna , plasmid dna , cationic dna complexes , rna , cell constituents , vaccines , cells occurring naturally in the body or genetically modified cells . the active agent may be present in an encapsulated form or in an adsorbed form . with such active agents , the patient prognosis can be improved according to the application or a therapeutic effect can be achieved ( e . g ., better wound healing , or inflammation inhibition or reduction ). preferred as active agents are conventional antibiotics that include such agents as gentamicin or zevtera ™ ( ceftobiprole medocaril ) brand antibiotic ( available from basilea pharmaceutica ltd ., basel switzerland ). most preferred is the use of highly effective , broad band antimicrobials against different bacteria and yeast ( even in the presence of bodily fluids ) such as octenidine , octenidine dihydrochloride ( available as active ingredient in octenisept ® disinfectant from schulke & amp ; mayr , norderstedt , germany as ), polyhexametliylene biguanide ( phmb ) ( available as active ingredient in lavasept ® from braun , switzerland ), triclosan , copper ( cu ), silver ( ag ), nanosilver , gold ( au ), selenium ( se ), gallium ( ga ), n - chlorotaurine , alcohol based antiseptics such as listerine ® mouthwash , n alpha - lauryl - l - arginine ethyl ester , ethyl - n - alpha - lauroyl - l - arginate hydrochloride , ( lae ), myristamidopropyl dimethylamine ( mapd , available as an active ingredient in schercodine ™ m ), oleamidopropyl dimethylamine ( oapd , available as an active ingredient in schercodine ™ o ), and stearamidopropyl dimethylamine ( sapd , available as an active ingredient in schercodine ™ s ), and most preferably octenidine dihydrochloride ( hereinafter referred to as octenidine ) and phmb . the amounts of the optional active agents that may be present in the antimicrobial compositions of the present invention will be sufficient to effectively provide additional inhibition of bacterial colonization , biofilm formation thus reduce the risk of infection . additionally , a conventional contrast agent may optionally be incorporated into the antimicrobial compositions or antimicrobial coatings of the present invention . such a contrast agent may be a biocompatible dye to create a visual marker as described in the ep1392198b1 or an agent such as a gas or gas creating substance for ultrasound contrast or mri contrast , such as metal complexes like gddtpa or superparamagnetic nanoparticles ( resovist ™ or endorem ™) as taught in the ep 1324783 b 1 . x - ray visible substances ( radiopaque ) may optionally be included as shown in the ep1251794b 1 including pure zirconium dioxide , stabilized zirconium dioxide , zirconium nitride , zirconium carbide , tantalum , tantalum pentoxide , barium sulphate , silver , silver iodide , gold , platinum , palladium , iridium , copper , ferric oxides , not very magnetic implant steels , non - magnetic implant steels , titanium , alkali iodides , iodated aromatics , iodated aliphatics , iodated oligomers , iodated polymers , alloys of substances thereof capable of being alloyed , and the like . the following examples are illustrative of the principles and practice of the present invention , although not limited thereto . synergistic mixture of taurolidine + protamine sulfate on a poly - g - caprone film containing hernia mesh a poly - g - caprone film laminate mesh comparable to ethicon &# 39 ; s physiomesh hernia mesh product ( available from ethicon , inc , somerville , n . j . usa ) but without a marker was prepared and punched out into 1 . 5 cm disks . taurolidine was dissolved at 4 % wt ./ vol . in a 70 % acetone 30 % water vol ./ vol . mixture . protamine sulfate was dissolved at 10 % wt ./ vol . in water under warming . 50 μl of the taurolidine ( tu ) solution and 20 μl of the protamine ( ps ) solution were applied to each mesh disk using a pipette and allowed to dry at 50 ° c . until the majority of the liquid was gone and then stored under vacuum . first the taurolidine solution was applied , and then immediately thereafter the protamine sulfate solution was applied . the in vitro bacteria attachment assay was developed for its utility of indicating biofilm prevention potential of prototype mesh . since bacterial attachment to a surface is the first step of biofilm formation , a surface treatment that inhibits bacterial attachment would reduce the chance of subsequent biofilm formation . the assay was conducted in sst ( serum saline tsb ) medium to mimic in vivo and clinical conditions . the formulation of sst is tryptic soy broth ( tsb ): serum : saline in the ratio of 1 : 2 : 7 . each test article was incubated in sst inoculated with staphylococcus aureus actt 6538 or escherichia coli atcc 25922 at about 6 log cfu / ml . after incubation with rotation of 60 rpm for 4 hours at 37 ° c ., the mesh discs were washed in saline 3 times to remove unattached bacteria . bacteria attached to the mesh were collected by sonication in saline with neutralizing agent . viable bacteria populations were measured by plate count on tsa ( tryptic soy agar ) medium contain neutralizing agents . the use of neutralizing agents in bacteria suspention and plate count medium was to eliminate any carry over antimicrobial effect from the coating . the plates were incubated at 37 ° c . for 24 hours . the number of attached viable bacteria was reported as cfu / disc . the data in table 1 indicated that mesh surfaces treated with the combination of tu and ps completely inhibited the attachment by s . aureus and e . coli in a serum containing media , while mesh surfaces treated with tu alone at the same dosage showed less inhibition than the combination . concentration gradients of tu and ps were diluted in an sst medium and made into a two - dimensional matrix . bacteria of interest were inoculated to the matrix at about 10e6 cfu / ml . s . aureus actt 6538 or e . coli atcc 25922 were used for this example 2 . after incubation at 37 ° c . for 24 hours , viable bacteria populations were measured by plate count . log reduction ( lr ) was used as the end point for efficacy and was defined as : log cfu / ml of untreated control − log cfu / ml of treated . synergistic index ( si ) was defined as lr of a given combination − sum of lr of single component at the same concentration as in the combination . si = 0 indicated additive effect , si = 1 , indicated 90 % more bacterial cidality , si = 2 indicated 99 % more bacterial cidality , si = 3 , indicated 99 . 9 % more bacterial cidality , etc ., by combination than its stand alone compositions at the same usage , thus synergy . a significant synergy was observed for the combination of protamine sulfate ( ps ) with taurolidine ( tu ) in serum - containing medium . when used alone , tu at 100 ppm showed no efficacy ( lr = 0 ) and ps at 10 ppm showed some efficacy ( lr = 3 . 5 ) against s . aureus . when combined 10 ppm ps with 50 ppm or 100 ppm tu , significant efficacy of 6 log reduction was achieved , as seen in the graph of fig1 . also , a highly synergistic effect was shown for the mixture of tu + ps against e . coli , as seen in the graph of fig2 . in accordance with example 1 , surgical mesh discs coated with different stand alone and combinations of taurolidine + protamine sulfate were prepared . protocols of mesh coating and in vitro attachment assay as in example 1 were used for this example 3 . the data is presented in table 2 . the data in table 2 showed a mild onset of a synergistic effect at a low tu dose of 0 . 5 mg / disc , the synergy is pronounced at higher loadings of 1 . 0 mg or 2 mg tu with 50 μg ps . an lr & gt ; 6 and si & gt ; 3 at 1 mg and 2 mg tu plus 50 mg ps indicated that the combination completely inhibited s . aureus attached to the surface and the efficacy was shown to be & gt ; 99 . 9 % more than the sum of stand - alone efficacy . the range of the ratios of the components of the synergistic antimicrobial compositions of the present invention was obtained by an in vitro mbc ( minimum bactericidal concentration ) study . the study was conducted in sst medium inoculated with about 10 6 cfu / ml staphylococcus aureus actt 6538 . in vitro efficacy was evaluated for different ratios of ps and tu combinations along with the stand alone ( i . e ., individual ) compositions at the same concentrations as in the combination composition . after incubation at 37 ° c . for 24 hours , viable bacteria populations were measured by plate count . log reduction ( lr ) was used as the end point for efficacy and was defined as log cfu / ml of untreated control − log cfu / ml of treated . the synergistic index ( si ) was defined as the lr of a given combination − sum of lr of single component at the same concentration as in the combination . an si = 0 indicated additive effect , si = 1 , indicated 90 % more bacterial cidality , si = 2 indicated 99 % more bacterial cidality , si = 3 , indicated 99 . 9 % more bacterial cidality , etc ., by a combination than its stand alone components at the same usage , thus synergy . the data for this testing is presented in table 3 and showed that synergistic combinations of ps and tu was in the range of 1 : 1 to 1 : 100 . ratios of tu and ps outside this range showed no synergy or less than its stand alone controls . a biofilm is an accumulation of microorganisms embedded in a polysaccharide matrix and adherent to a solid surface . biofilms are clinically important , accounting for about eighty percent of hospital acquired infections . biofilms are known to be extremely resistant to both immunological and antibiotic therapy . microbial biofilms develop when microorganisms irreversibly adhere to a surface and produce extracellular polymers that facilitate adhesion and provide a structural matrix . the matured matrix is highly functional to protect microorganisms from adverse conditions while continually dispersing free cells to spread and colonize new surfaces . therefore , inhibiting adhesion of bacteria to surfaces is important . a medical device such as a mesh having an effective antimicrobial coating would effectively inhibit bacterial attachment to the surfaces of the devices , thus preventing or substantially inhibiting biofilm formation . the data in examples 1 and 3 demonstrated the effectiveness of a synergistic composition of the present invention against bacteria attachment to a mesh prototype in a serum - containing medium . the data suggests promising benefits of using the synergistic composition to protect a medical device against biofilm formation . the antimicrobial compositions of the present invention and medical devices coated with or containing such compositions have many advantages . the advantages include providing a synergistic antimicrobial composition with improved efficacy along with reduced usage . the reduced usage increases the safety margin , improves biocompatibility , improves physical device characteristics , and reduces material costs . a broader spectrum provided by the compositions of the present invention results in the compositions being an effective treatment against a wide range of microorganisms . the compositions of the present invention effectively inhibit bacteria attachment to surfaces of medical devices and help to prevent biofilm formation and related infections . there is no known bacterial resistance to taurolidine , and it is non - antibiotic . in addition , the compositions of the present invention are non - toxic , and approved for internal use . although this invention has been shown and described with respect to detailed embodiments thereof , it will be understood by those skilled in the art that various changes in form and detail thereof may be made without departing from the spirit and scope of the claimed invention .	0
although the following detailed description contains many specifics for the purposes of illustration , anyone of ordinary skill in the art will readily appreciate that many variations and alterations to the following exemplary details are within the scope of the invention . accordingly , the following preferred embodiment of the invention is set forth without any loss of generality to , and without imposing limitations upon , the claimed invention . as described above , our invention describes a method for coordinating the renting of parking spaces ( see schematic view of the system in fig1 ). the rental transaction is coordinated automatically using a software application tied into a database and accessible through communication means that includes the internet ( for example , through a web page ), the phone system , and gps devices . potential parking providers access the electronic reservation system , where they then are required to either log in ( if they are previously registered users ), or register for the parking service ( if they are new users ). as part of the registration process , the providers enter the following information : ( 1 ) name , ( 2 ) address , ( 3 ) e - mail address , and ( 4 ) phone number . as part of the registration , the parking provider provides financial information that is used to make payments to the provider or reimbursements to the customer . one possibility is using a system like paypal for the financial transactions . once the potential parking provider has logged into the system , they provide the following information : date , time , location and price of parking that they wish to rent , along with a description of the parking space ( s ), including the type of space ( e . g . garage , driveway , etc ) and any other information that might determine the desirability of the parking space or the ability of the customer to find the parking space . all of the information entered is kept in a database accessible by the electronic reservation system &# 39 ; s software application . potential parking customers start off by going through a similar registration process , in which they provide their name , address and financial information ( to be used for automated payments for the parking ). once registered as users of the system they are able to log on , and after doing so provide information that includes : ( 1 ) location near where they would like parking , ( 2 ) the start and end times for the parking , ( 3 ) the maximum distance between the parking and the location that they specify , ( 4 ) the license plate of the car for which they would like parking , ( 5 ) any additional relevant information . based on the information provided by the parking providers and the customer , the parking system will search the database for parking matches ( parking spaces within the specified distance and that are available at the desired time ). if there is no match , the system will say so and will offer the possibility of expanding the search to different times or to a bigger distance between desired and actual location of the parking . if there is a match , the system will return a map that is centered at the customer - specified location and that shows the location of all available parking spaces . the customer will then examine each parking space in detail to see all relevant information about that space . if the customer decides to choose a given parking space , he or she confirms the desired time . once confirmed , the parking software confirms all relevant information about the chosen parking space , including a map showing both the specified location and the location of the chosen parking , a description of how to get from the parking space to the specified location , the time for which the parking is being reserved , the price for the parking , and the license plate number of the car that is being parked . at that point , the customer can choose to confirm the transaction and , if confirmed , the financial transaction will take place automatically between customer and provider , with some percentage going to the parking service . in addition , the parking provider will be notified of the transaction , probably through e - mail or through a text message . the description above outlines the basic functioning of the invention . other additional parts of the system are included to minimize any difficulties that might arise due , for example , to parking spaces not being available when specified or due to customers overstaying their reservation . to deal with these issues the invention incorporates a feedback feature , where both the customers and providers can provide feedback on each parking transaction . providers or customers with consistent problems could be temporarily or permanently banned from using the system . in addition , the system could keep track of the rating of each renter and provider and this information could be provided for each potential parking transaction . parking customers and providers could each have the option of rejecting a parking transaction based on rating . the provider could specify that he / she will only rent to customers with a threshold rating . in this case , only those customers with a rating better than the threshold will even see the corresponding parking spots . similarly , a renter could specify that he / she only wants to see spaces provided by providers with a threshold rating . finally , providers could block specific renters in such a way that those individual renters do not see his / her parking spots . in the same way , renters could block individual providers so that the corresponding parking spaces do not appear in their search results . there are several extensions to the previously described invention that are included in subsequent embodiments of our invention . in addition to mediating the renting of parking spaces for automobiles , one could expand the system to mediate the “ parking ” of the following items : boats ( including but not limited to sailboats , powerboats , canoes , kayaks , and house boats ). this requires additional specifications in terms of the length and size of the boat as well as any required utility hookups . rvs and trucks . this requires additional information regarding the size of the rv / truck and hookups required . planes motorcycles bicycles any other vehicle that requires permanent or temporary parking types of communication interfaces between the customer and system of the invention include : web site pda cell phones ( using voice messaging , text messaging , internet access and or bluetooth ) gps devices equipped with the ability to receive information interface through web services ( see details below ) direct interfaces ( see details below ) web services refer to a set of application program interfaces ( apis ) that could permit external systems to access the infrastructure provided by our invention . web services allow outside groups to provide their own interfaces to the current invention . for example , they are able to tap into our parking database without having to pass through our user interface . allowing outside individuals or organizations to make use of our infrastructure without passing through our user interface is essential for many of the extensions that we plan for our invention . in general , this allows outside organizations to use the functionality of the invention web site while providing their own user interface , branding , marketing , etc . in these cases , a fee is still charged for the user of our data and database . several examples of this are given below : a restaurant could offer parking through its own web site . the restaurant would use our invention to track parking spaces and could either make use of parking spaces from our general pool of spaces or could find their own set of spaces that could be tracked through our invention but reserved for the restaurant &# 39 ; s use . the parking service would be mostly mediated by our invention , but the process would be transparent to the restaurant patron . a company could essentially re - rent our spaces through their own interface with their own customers , marketing , branding , etc ., while making use of our infrastructure to keep track of customers and to mediate the transaction . a large organization with its own parking ( e . g . a city government , a commercial establishment , etc ) could rent out their parking through our system . in mediating parking transactions , one embodiment of the invention mediates the parking transaction but not serve as the direct conduit between parking provider and customer . more specifically , the possibility exists of having the provider directly contact the parking customer while using the invention to keep track of the parking transaction and to mediate the financial transaction . several examples are listed below , but are not limiting to the scope of the invention : in the most basic scenario , the provider could directly advertise a parking space ( using a sign posted on his / her driveway , for example ), along with any relevant information about pricing , time limits , etc . the provider would specify that the transaction takes place with the help of our system and would specify a parking transaction code . customers could then access our invention , go directly to the code - specified parking transaction and could pay in the normal way . this type of system is an advantage to the customer who did not reserve a parking space in advance . from the provider &# 39 ; s point of view , this system could simply provide another and , in some cases better , way of advertising their site . in addition , providers could seek to rent their site both in the originally - specified way ( by allowing the renter to reserve the spot ), as well as directly to the customer . if a customer reserves a site by either means , our database could be updated to indicate that the spot was occupied . if the site is reserved through our online system , the sign would be removed during the reserved time slot . the advertisement through a posted sign represents the simplest scheme but any direct advertising system is feasible . renters could also signal the availability of parking through bluetooth , text messaging , etc . in addition , the method by which the parking transaction is agreed upon and the information is relayed to our system could be changed . for example a system could be used that would use bluetooth or rfid communication to signal the customer &# 39 ; s agreement with the conditions of the provider ( in this implementation , both parties would need communication devices ). the information on parking could be passed from the provider to the customer through bluetooth onto the customer &# 39 ; s cell phone . the customer could review the terms and if there is agreement , transmit that information to our system ( the communication could either go through a text message from the user or could get transmitted to the provider , who would then automatically forward it to our system ). in this situation , the customer would not necessary have to agree to a fixed length of time . he / she could signal agreement with the start of the parking period and later signal the end of the period . one of the outcomes of the invention is that the method / system knows where our customers will be at certain times . in some cases , based on the desired location , the invention is also able to identify the reason for their visit . this information will be used in two ways : suggestions for things to do in area during the relevant time period . for example , if we can tell that a given customer is going to the museum , we can suggest other museums or cultural sites that are nearby . similarly , if a customer is attending the opera ( or any location at a time that matches breakfast , lunch or dinner times ), we can suggest nearby restaurants . advertisements specific to time / location . similar to the ideas described above , we will include paid advertisements for establishments that are in the vicinity of the parking location . the present invention has now been described in accordance with several exemplary embodiments , which are intended to be illustrative in all aspects , rather than restrictive . thus , the present invention is capable of many variations in detailed implementation , which may be derived from the description contained herein by a person of ordinary skill in the art . for example this parking method will include one - time parking as well as ongoing parking ( weekly , monthly , indefinite , etc .). the system will alert users ( e . g . using text messaging or other digital messaging systems ) when their space is about to expire . if they wish to extend parking and if the parking space is available beyond the originally specified time , the renter will be given the option of extending parking ( see below ). the invention will allow the renter to extend a reservation , assuming that the space is available beyond the time period that they have reserved . the renter would communicate their intent to extend the reservation by sending some form of communication to the system , such as sending a text message with an identification code and the amount of time by which they would like to extend the reservation . we also may provide a cancel feature that would allow the renter to cancel the reservation if they are done with the space before their reservation period has ended . all such variations are considered to be within the scope and spirit of the present invention as defined by the following claims and their legal equivalents .	6
with reference now to the drawings , and in particular to fig1 thereof , a new and improved boat dolly embodying the principles and concepts of the present invention and generally designated by the reference numeral 10 will be described . more specifically , it will be noted that the first embodiment 10 of the invention includes a plurality of connected support braces 12 , 14 and 16 . these support braces are connected by conventional means such as welding , riveting or threaded fasteners to a first side frame rail 18 . a second , parallel side frame rail 40 has attached support braces 38 , 15 and 54 . spaced parallel transverse support struts 20 , 24 , 34 and 62 extend between the side frame rails 18 and 40 . a first diagonal brace 22 extends between the transverse support struts 20 and 24 and a second diagonal support brace 36 extends between the transverse support struts 34 and 62 . a connecting brace 32 extends between the transverse support struts 24 and 34 . a channel shaped mounting bracket 26 is secured to the transverse support braces 24 and 34 , between the side frame rails 18 and 40 . the mounting bracket 26 has a side portion 42 adapted to be received over the stern wall of a boat . a first rectangular adjustable mounting plate 27 is welded to a pair of adjustable swivel set screws 28 and 30 which extend through the mounting bracket 26 , for engagement with the exterior outboard motor mount on a boat . a first pair of wheels 44 and 46 are mounted for rotation on an axle 48 . a first wheel mount frame is formed by a pair of wheel support bars 50 and 52 which are end portions of the transverse support struts 24 and 34 , respectively . in use , the first pair of wheels 44 and 46 are used to transport a boat in a horizontal orientation , with the boat inverted and supported by engagement of the outboard motor mount of the boat with the mounting bracket 26 of the dolly 10 . a second pair of wheels 72 and 74 are mounted for rotation on an axle 70 . a second wheel mount frame is formed by a pair of parallel frame rods 56 and 58 connected by transverse rods 64 and 66 . a first wheel frame brace 60 extends generally parallel to the frame rod 58 and a second wheel frame brace 68 extends generally parallel to the frame rod 56 . the wheel frame rods 58 and 56 are adapted to be removably received within the side frame rails 18 and 40 of the dolly frame 10 . by this construction , the second pair of wheels 72 and 74 may be selectively attached at either end of the dolly frame 10 , or may be removed entirely for transportation and storage purposes . with reference now to fig2 a perspective view of the opposite side of the boat dolly 10 is illustrated . the mounting bracket side wall 42 supports a second rectangular adjustable mounting plate 29 which is welded to four adjustable swivel set screws 43 and 45 for engagement with the interior stern wall of a boat . it should be noted that while two swivel set screws 28 and 30 have been illustrated in conjunction with the mounting bracket 26 and first plate 27 ( fig1 ), and four swivel set screws 43 and 45 are shown in conjunction with mounting bracket side wall 42 and second plate 29 , it is contemplated that as many swivel set screws as desired may be utilized in either of these locations . a first retaining pin 69 is attached by a small chain 71 to the wheel mount frame rod 56 . ( fig5 ) the retaining pin 69 extends through aligned apertures in the frame rail 40 and wheel frame rod 56 , thus securing these elements together in a telescoping arrangement . a second retaining pin 65 in conjunction with a chain 67 performs an identical function with respect to the wheel frame rod 58 and dolly side frame rail 18 . a pair of apertures 21 and 23 are provided at opposite ends of the dolly side frame rails 18 and 40 for reception of the retaining pins 65 and 69 . thus , it may now be readily understood that the wheels 72 and 74 may be selectively positioned at either end of the dolly 10 . with reference now to fig3 an end view of the dolly 10 is provided . a portion of a boat b , mounted on the dolly 10 , is shown in dotted lines . the stern end wall of the boat is received in the channel shaped mounting bracket 26 , between the first 27 and second 29 adjustable mounting plates . each of these swivel set screws 43 , 45 , 30 and 28 ( fig1 ) are provided with a swivel tip 39 which is welded to the associated plate 27 or 29 . the surfaces of the plates 27 and 29 which face away from the attached set screw swivels 39 are surfaced with rubber or other adherent material for engagement with the outboard motor mount of the boat . this arrangement allows the boat dolly 10 of the present invention to adapt for use with any outboard motor mount , regardless of the angle thereof . in fig4 a side view of the boat dolly 10 of the present invention is provided . in fig5 a top view of the boat dolly 10 of the present invention is provided . it is contemplated that the various frame elements of the boat dolly 10 will be formed from a tubular metal material . some of the frame braces may be omitted and a lighter weight achieved if a high strength alloy material is utilized , although this will add to the production costs . even utilizing a relatively inexpensive metal conduit material , the weight of the boat dolly 10 of the present invention is approximately twenty five pounds . the boat dolly 10 of the present invention does away with the complexities of launching a non - trailered boat . launching is accomplished simply by rolling the boat in an on edge vertical position into the water and turning it upright . the length of the wheel frame mounts 56 and 58 keeps the boat from getting any water inside . the entire launching can be accomplished by one person . after the boat is launched , the dolly is removed and stored in the boat or transportation vehicle until needed . the design of the boat dolly 10 of the present invention makes it very versatile in moving the boat around . due to the fact the boat may be moved in a vertical position , the dolly 10 allows movement through any doors or gates large enough to accommodate a person and along narrow trails or openings to streams . as in the launching procedure , movement of the boat can be accomplished by one person . the boat dolly 10 makes it possible to store a boat in small spaces and where access to a storage space is limited . a boat stored on it &# 39 ; s side with the dolly 10 attached occupies only two feet of stand up space . through the use of the boat dolly 10 of the present invention , a boat can be stored in the average garage and still accommodate a vehicle , or in a side yard while still allowing room to walk past . the city dweller who lives in the apartment , condominium , mobile home park or any home without side access will now be able to conveniently store a boat . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	1
in loran and other range hyberbolic navigation systems that determine position from the precise measurement of the time difference of arrivals of signals transmitted synchronously from two or more different fixed locations , the lines of position obtained from the measurement of any signal pair are hyperbolae generated about the source locations as foci . fig1 shows the existence of a family of hyperbolic curves 10 within a defined channel 11 . one special case that is important to this system design is the straight line 10a defined as the locus of all points where the acoustic travel time difference is zero . this line 10a , the conjugate axis of the hyperbola , is the exact perpendicular bisector of the line 12 connecting the centers of the signal sources 14 and 16 . the conjugate axis is a plane in three dimensional space . a ship 17 is shown following this conjugate axis 10a . the channel 11 can be easily marked between side 18 and 20 by placing acoustic projectors in pairs to provide sound sources at intervals near the channel sides 18 and 20 such as 14 and 16 , 14a and 16a , etc . fig2 is another view of the arrangement of fig1 with the ship 17 shown traveling the conjugate axis . in such a case t1 , the travel time of a signal from source 14 to the ship 17 , is equal to t2 , the travel time of a signal from the source 16 to the ship 17 . this zero time differential defines the hydroway . the hydroway system is shown in fig3 and utilizes all state - of - the - art components . clock 30 is a precision time standard that generates 1000 pulses per second to a pulse controller 32 . the pulse controller 32 is made up of two separate channels a and b , that each receive the signals from clock 30 . channels a and b each count the pulse train . channel b starts conducting a single pulse to dual waveform generator 34 after receiving 915 pulses and inhibits conduction following the 945th pulse . channel b resets its count to 000 on the 1000th pulse and starts conducting a single pulse following the 055th pulse and inhibits conduction following the 085th pulse . channel a starts conducting a single pulse following the 975th count and inhibits conduction following the 025th count after resetting to 000 on the 1000th count . a plot of the conduction to waveform generator 34 for the significant part of a single pulse train of 1000 counts from clock 30 is shown in fig4 beginning with the first conduction of channel b . a plot of a multitude of pulse trains conducted to waveform generator 34 is shown in fig5 . it is to be noted that in time sequence there is a lull of 30 milliseconds both before and after the transmission of pulses from channel a in which time neither channel a nor channel b transmits . more specifically channel b ends a first pulse 30 milliseconds before the start of transmission from channel a and channel b starts a second pulse 30 milliseconds after the end of transmission of channel a . referring again to fig3 the dual waveform generator 34 converts the signals it receives into a - c signals and transmits the signals to respective power amplifiers 36 and 38 . following amplification the signals are conducted to respective acoustic projector a 14 and acoustic projector b 16 over submarine cables 40 and 42 . while in the present embodiment the signals are handled separately from the pulse controller 32 through to the acoustic projectors 14 and 16 , obviously the signals if presented at differing frequencies could be transmitted over a single line with suitable filtering devices at projectors 14 and 16 to select the proper signal . the acoustic projectors 14 and 16 send acoustic signals through the water medium . projector a 14 transmits frequencies of 5 khz for periods of 50 milliseconds . projector b 16 transmit intermittent pairs of 2 . 5 khz signals . each signal in the pair has a time duration of 30 milliseconds and a lull of 110 milliseconds separates the first and second signal in the pair . aboard ship 17 a broadband omnidirectional receiving hydrophone 44 converts the received acoustic signals to electrical signals . these electrical signals are transmitted to a receiver 46 that is pretuned for the frequency of the signals from projectors 14 and 16 . the signal from receiver 46 is then transmitted to steering display and recorder 48 . when the ship 17 is underway , the traces made by display and recorder 48 will appear as shown in fig6 . the traces 50 and 52 are received from channel b projector 16 and the traces 54 are received from channel a projector 14 . the slants of the traces in fig6 show that the ship is approaching the location of the projectors 14 and 16 . this gives the effect of subsequent signals being received earlier than if the ship 17 were at zero speed . this gives no problem , however , since it is only the spacing between signals that is important and the effect on these is negligible . the inflection point of this recording indicates the closest point of approach to projectors 14 and 16 thus providing the navigator with a check point on the channel 11 . the spacing between the channel b traces remains constant due to the signals being received from the same point . however , should the ship 17 approach the side of the channel where the acoustic projector a 14 is located the time differential on receiving the signals will change . this is shown at location 56 on the traces . when this is observed corrective steering of ship 17 is employed . the above description is only for one pair of acoustic projectors . in the majority of cases the channel 11 will be of such length that a plurality of pairs of projectors a and b are required , spaced along the length of channel 11 . fig7 shows in block diagram form an arrangement for a plurality of pairs of projectors . much duplication of components can be avoided . the single electronic clock 30 can be utilized , as can the dual channel pulse controller 32 . the waveform generator , however , must send out a plurality of different frequency signals for each pair of projectors to be used . in the above embodiment a plurality of different frequencies must be generated , one for each acoustic projector 14 , 14a , 14b , 16 , 16a and 16b . each projector has a respective filter 41 , 41a , 41b , 43 , 43a or 43b to insure that only the preselected frequency for that particular projector is generated . receiving hydrophone 44 and receiver 46 of fig7 are identical with those of fig3 . the receiver 46 must be capable of handling all ranges of frequency used . a network 60 has a plurality of filters 62 , 62a and 62b for channel a and 64 , 64a and 64b for channel b , with each filter conducting only one of the respective frequencies generated and inhibiting the others . manual switch 66 then selects which pair of signals are to be applied to steering and display recorder 48 . the operation is very similar to fig3 with the only difference being the manual selection of the pair of projector signals closest to the ship at any particular time . normally the terminals in switch 66 are in sequence for selection as a ship traverses a channel . alternative embodiments of the present invention could include various other alignments of the same components shown and / or duplication of components to receive a similar result . for instance individual lines could be run from generator 34 to respective projectors . another embodiment could include a detector network to select the strongest pair of signals so that manual switching would be obviated . there has therefore been shown a system enabling a ship to maintain a position in mid - channel utilizing projectors connected to shore based power amplifiers by submarine cables . a different system that could be used would be to have on the vessel a fixed hull mounted projector for transmitting an acoustic signal that is synchronized with the start of a display recorder . when this signal reaches transponders located on opposite sides of the channel , the transponders transmit their own signals . similarly to the cable connected embodiment of hydroways , the vessel will then receive the appropriate signal sequence to enable steering in mid - channel . in this system a spacing regulation between vessels would be advantageous along the channel to preclude the activation of the transponers by more than one vessel at a time . it will be understood that various changes in the details , materials , steps and arrangement of parts , which have been described and illustrated in order to explain the nature of the invention , may be made by those skilled in the art within the principle and scope of the invention as expressed in the appended claims .	6
fig1 is a full front view of a semicircular lens 1 of this invention , which is the preferred configuration herein . shown therein for purposes of clarification and orientation is the left semi - circular edge 2 , which has two attachment recesses 22 for attachment of the lens 1 to a range finder sight ( described infra ) using an attachment means also described infra . the use of the word “ left ” herein is only for purposes of orientation , as there is contemplated within the scope of this invention a lens that has a mirror image of that shown in fig1 , one being for right - handed archery shooters and the other being for left - handed archery shooters . the lens can be formed from any clear material , that is , visually clear material such as plastic or glass , or the like . the lens can actually be cut from such materials , or can be formed from such materials , such as by extruding , casting , molding , or the like . preferred is an extruded plastic material . formed near the vertical center point p of the semi - circular lens 1 is the range finding capability of the lens 1 , generally denoted as 50 . the range finding capability 50 is configured such that there is a first horizontal line 3 that forms the base line for the range finding capability 50 located towards the bottom 5 of the semi - circular lens 1 . thereafter , there is a series of interconnected horizontal and vertical lines that make up a step - wise configuration . for example , first vertical line 4 is connected to the internal termination point 6 of the first horizontal line 3 and the top 7 the first vertical line 4 . thereafter , a second horizontal line 8 is connected to the top 7 of the first vertical line 4 , a second vertical line 9 is connected to the second horizontal line 8 at the end 10 , opposite of the end 7 . further , vertical line 9 is connected at end 10 and connects at point 11 with a third horizontal line 12 . the horizontal line 12 connects at point 13 with a third vertical line 14 and vertical line 14 connects at point 15 with a fourth horizontal line 16 . fourth horizontal line 16 then terminates at point 17 . thereafter , the vertical line 18 completes the leading edge of the lens 1 . it should be understood that the vertical and horizontal lines of the range finding capability 50 are predetermined such that the line 4 is longer than line 9 that is longer than line 14 and in this manner , using the bottom line 3 as a reference point , it can be determined how far away the target is from the shooter . it is contemplated within the scope of this invention to provide all horizontal lines in the lens with bevel cuts , dyed , or painted lines in order to make such lines stand out from the lens per se . the bevel cuts provide a prism effect . as mentioned , the partial window 70 formed by the lines 3 , 4 , and 8 has the widest view , that is when the bottom line 3 is placed on the bottom belly line of the intended target , the line 8 will fall on the top back line of the target if the target is 10 yards away from the shooter . likewise , lines 3 , 9 and 12 form a second partial window 80 in which the vertical line 9 is shorter than the vertical line 4 and when the shooter places the bottom line 3 on the bottom belly line of the target , and line 12 falls on the top back line of the target , this denotes a target that is about 20 yards from the shooter . still further , the line 3 , 14 and 16 form a third partial window 90 in which the vertical line 14 is shorter than the line 9 and when the shooter places the bottom line 3 on the bottom belly line of the target , and line 16 falls on the top back line of the target , this denotes a target that is about 30 yards from the shooter . it is contemplated within the scope of this invention that the lens 1 can have a fourth and a fifth level to show yardages of 40 and 50 yards . it is also contemplated within the scope of this invention that these yardages can be predetermined and the lens 1 so manufactured that they encompass a range of from about 5 yards to about 70 years by adjusting the partial window sizes relative to the bottom line 3 . although , distances to target game are usually handled in yards , it is contemplated within the scope of this invention to use feet in lieu of yards . in fig2 , the yardage is denoted and marked directly on the lens 1 , for example 20 yards , 30 yards , and 40 yards and this is optional in this invention , although it is preferred . elk due to their enormous size generally have a pre - set range of from 30 to 60 years , caribou generally have a pre - set range of from 30 to 60 yards , antelope are generally set from 20 to 40 yards , and mule / whitetail deer are set generally from 20 to 50 yards . the lens 1 of this invention is mounted in a holder or support 19 for the lens 1 and the holder 19 is then mounted in an archery sight 25 having pins 26 . thus , fig2 shows one embodiment of a holder and support component 19 that is used to mount the lens 1 . the holder and support component 19 consists of a ring or circular configuration 23 that has essentially the same circumferential line as the lens 1 . the holder 19 is placed on the surface of the lens 1 and small plates 20 are bolted or screwed down on the lens 1 using bolts 21 . in this manner , if one wishes to change from a 20 yard to 40 yard lens 1 , to say , a 40 to 70 yard range lens 1 , then it is readily accomplished . fig3 is a cross sectional view thorough line 3 - 3 of fig2 to show an enlarged view of the attachment . this is the preferred attachment means , however other means can be used as long as the ring 23 is substantially held in place and the ring 23 or its attachment means does not interfere with the view through the lens 1 . as indicated supra , the lens 1 can have a semi - circular configuration , a triangular configuration , a square configuration , or a rectangular configuration . fig4 shows an archery sight containing a semi - circular lens 1 , fig5 shows a rectangular configuration , fig6 shows a square configuration and fig7 shows a triangular configuration . the range finder lens of this invention provides a hands - free full draw archery range finder that is designed to fit virtually any bow sight , both left and right hand models . the distances to target are pre - set and thus , there is no need to make any mechanical changes in the range finder during use , nor is it required that the shooter “ sight in ” such a range finder as the distances are all pre - determined and built into the lens . turning now to the archery sight having a semi - circular lens 1 , there is shown in fig4 , a rear view of an archery sight 25 containing the semi - circular lens 1 , a holder 24 for the lens 1 , sight pins 26 , attachment 27 of the sight pins 26 to the sight 25 . this archery sight 25 is for a right handed shooter . in addition , there is shown an attachment means 28 for attachment of the archery sight 25 to an archery bow ( not shown ). the sight pins 26 , pin attachment 27 , and attachment means 28 are known in the art and are conventional . also shown as an optional component of this invention is a level gage 29 for leveling the bow and the sight 25 . in a like manner , shown in fig5 is a rectangular configuration of a lens 1 wherein like numbers in fig5 have the same meanings as in fig4 . in a like manner , shown in fig6 is a square configuration of a lens 1 wherein like numbers in fig6 have the same meanings as in fig4 . in a like manner , shown in fig7 is a triangular configuration of a lens 1 wherein like numbers in fig7 have the same meanings as in fig4 . turning now to the ring range finder of claim 9 , there is shown in fig8 one such range finder 30 , showing the solid ring 31 , and the range finding apparatus , generally at 32 . also shown on fig8 and 9 is are indentions 42 in the face of the solid ring 31 that can be used to facilitate a mechanical means to attach the range finder 30 to an archery sight . the indentions can be for example , holes drilled through the solid ring 31 to accommodate pins or screws to fasten the range finder to the archery sight . the range finding apparatus 32 is comprised of the horizontal belly bar 33 , its support 34 , and the step - wise configuration 35 . the step - wise configuration 35 is comprised of a series of horizontal bars 36 , 37 , and 38 and a series of vertical bars 39 , 40 , and 41 , all of which are connected together . the numbers 36 to 41 have been described as “ bars ”, but they could be thins lines of metal or plastic , or flat plates ( which are shown herein in fig9 and 10 by way of illustration ). each range finder is pre - set by predetermining the size of the target from belly line to back line that fits into each partial window ( in fig8 , largest is denoted at 100 , the middle is denoted as 200 , and smallest is denoted as 300 ) created by the vertical and horizontal lines 36 to 41 using the horizontal belly bar 33 as the base line . these dimensions differ depending on the size of the animal and therefore , range finders are manufactured with markings that describe the particular animal that the range finder is designed for . then , each of the partial windows can be marked to indicate such sizes , for example in fig8 wherein the largest partial window is indicated as 20 yards , the next largest indicated as 30 yards , and the smallest partial window indicated as 40 yards . it is not necessary to mark the partial windows , but it helps the novice hunter find the range much more readily . the ring range finder is manufactured from metal or plastic , and more preferred is metal such as aluminum . also preferred for the step - wise configuration are flat plates rather than thin metal lines . the ring range finders can be attached to an archery sight by either mechanical or adhesive means and preferred is using mechanical means , especially mechanical means that can be easily removed to change range finders from one animal size to another animal size .	5
referring now to the drawings , and more particularly to fig1 a block diagram is shown of a laser beam delivery and eye tracking system referenced generally by the numeral 5 . the laser beam delivery portion of system 5 includes treatment laser source 500 , projection optics 510 , x - y translation mirror optics 520 , beam translation controller 530 , dichroic beamsplitter 200 , and beam angle adjustment mirror optics 300 . by way of example , it will be assumed that treatment laser 500 is a 193 nanometer wavelength excimer laser used in an ophthalmic prk ( or ptk ) procedure performed on a movable workpiece . e . g ., eye 10 . however , it is to be understood that the method and system of the present invention will apply equally as well to movable workpieces other than an eye , and further to other wavelength surface treatment or surface eroding lasers . the laser pulses are distributed as shots over the area to be ablated or eroded , preferably in a distributed sequence . a single laser pulse of sufficient power to cause ablation creates a micro cloud of ablated particles which interferes with the next laser pulse if located in the same or immediate point . to avoid this interference , the next laser pulse is spatially distributed to a next point of erosion or ablation that is located a sufficient distance so as to avoid the cloud of ablated particles . once the cloud is dissipated , another laser pulse is made adjacent the area prior eroded so that after the pattern of shots is completed the cumulative shots fill in and complete said pattern so that the desired shape of the object or cornea is achieved . in operation of the beam delivery portion of system 5 , laser source 500 produces laser beam 502 which is incident upon projection optics 510 . projection optics 510 adjusts the diameter and distance to focus of beam 502 depending on the requirements of the particular procedure being performed . for the illustrative example of an excimer laser used in the prk or ptk procedure , projection optics 510 includes planar concave lens 512 , and fixed focus lenses 514 and 516 as shown in the sectional view of fig2 . lenses 512 and 514 act together to form an a - focal telescope that expands the diameter of beam 502 . fixed focus lens 516 focuses the expanded beam 502 at the workpiece , i . e ., eye 10 , and provides sufficient depth , indicated by arrow 518 , in the plane of focus of lens 516 . this provides flexibility in the placement of projection optics 510 relative to the surface of the workpiece . an alternative implementation is to eliminate lens 514 when less flexibility can be tolerated . after exiting projection optics 510 , beam 502 impinges on x - y translation mirror optics 520 where beam 502 is translated or shifted independently along each of two orthogonal translation axes as governed by beam translation controller 530 . controller 530 is typically a processor programmed with a predetermined set of two - dimensional translations or shifts of beam 502 depending on the particular ophthalmic procedure being performed . for the illustrative example of the excimer laser used in a prk or ptk procedure , controller 530 may be programmed in accordance with the aforementioned copending patent application entitled “ laser sculpting system and method ”. the programmed shifts of beam 502 are implemented by x - y translation mirror optics 520 . each x and y axis of translation is independently controlled by a translating mirror . as shown diagrammatically in fig3 the y - translation operation of x - y translation mirror optics 520 is implemented using translating mirror 522 . translating mirror 522 is movable between the position shown and the position indicated by dotted line 526 . movement of translating mirror 522 is such that the angle of the output beam with respect to the input beam remains constant . such movement is brought about by translation mirror motor and control 525 driven by inputs received from beam translation controller 530 . by way of example , motor and control 525 can be realized with a motor from trilogy systems corporation ( e . g ., model t050 ) and a control board from delta tau systems ( e . g ., model 400 - 602276 pmac ). with translating mirror 522 positioned as shown , beam 502 travels the path traced by solid line 528 a . with translating mirror 522 positioned along dotted line 526 , beam 502 travels the path traced by dotted line 528 b . a similar translating mirror ( not shown ) would be used for the x - translation operation . the x - translation operation is accomplished in the same fashion but is orthogonal to the y - translation . the x - translation may be implemented prior or subsequent to the y - translation operation . the eye tracking portion of system 5 includes eye movement sensor 100 , dichroic beamsplitter 200 and beam angle adjustment mirror optics 300 . sensor 100 determines the amount of eye movement and uses same to adjust mirrors 310 and 320 to track along with such eye movement . to do this , sensor 100 first transmits light energy 101 - t which has been selected to transmit through dichroic beamsplitter 200 . at the same time , after undergoing beam translation in accordance with the particular treatment procedure , beam 502 impinges on dichroic beamsplitter 200 which has been selected to reflect beam 502 ( e . g ., 193 nanometer wavelength laser beam ) to beam angle adjustment mirror optics 300 . light energy 101 - t is aligned such that it is parallel to beam 502 as it impinges on beam angle adjustment mirror optics 300 . it is to be understood that the term “ parallel ” as used herein includes the possibility that light energy 101 - t and beam 502 can be coincident or collinear . both light energy 101 - t and beam 502 are adjusted in correspondence with one another by optics 300 . accordingly , light energy 101 - t and beam 502 retain their parallel relationship when they are incident on eye 10 . since x - y translation mirror optics 520 shifts the position of beam 502 in translation independently of optics 300 , the parallel relationship between beam 502 and light energy 101 - t is maintained throughout the particular ophthalmic procedure . beam angle adjustment mirror optics consists of independently rotating mirrors 310 and 320 . mirror 310 is rotatable about axis 312 as indicated by arrow 314 while mirror 320 is rotatable about axis 322 as indicated by arrow 324 . axes 312 and 322 are orthogonal to one another . in this way , mirror 310 is capable of sweeping light energy 101 - t and beam 502 in a first plane ( e . g ., elevation ) while mirror 320 is capable of independently sweeping light energy 101 - t and beam 502 in a second plane ( e . g ., azimuth ) that is perpendicular to the first plane . upon exiting beam angle adjustment mirror optics 300 , light energy 101 - t and beam 502 impinge on eye 10 . movement of mirrors 310 and 320 is typically accomplished with servo controller / motor drivers 316 and 326 , respectively . fig4 is a block diagram of a preferred embodiment servo controller / motor driver 316 used for the illustrative prk / ptk treatment example . ( the same structure is used for servo controller / motor driver 326 .) in general , drivers 316 and 326 must be able to react quickly when the measured error from eye movement sensor 100 is large , and further must provide very high gain from low frequencies ( dc ) to about 100 radians per second to virtually eliminate both steady state and transient error . more specifically , eye movement sensor 100 provides a measure of the error between the center of the pupil ( or an offset from the center of the pupil that the doctor selected ) and the location where mirror 310 is pointed . position sensor 3166 is provided to directly measure the position of the drive shaft ( not shown ) of galvanometer motor 3164 . the output of position sensor 3166 is differentiated at differentiator 3168 to provide the velocity of the drive shaft of motor 3164 . this velocity is summed with the error from eye movement sensor 100 . the sum is integrated at integrator 3160 and input to current amplifier 3162 to drive galvanometer motor 3164 . as the drive shaft of motor 3164 rotates mirror 310 , the error that eye movement sensor 100 measures decreases to a negligible amount . the velocity feedback via position sensor 3166 and differentiator 3168 provides servo controller / motor driver 316 with the ability to react quickly when the measured sensor error is large . light energy reflected from eye 10 , as designated by reference numeral 101 - r , travels back through optics 300 and beamsplitter 200 for detection at sensor 100 . sensor 100 determines the amount of eye movement based on the changes in reflection energy 101 - r . error control signals indicative of the amount of eye movement are fed back by sensor 100 to beam angle adjustment mirror optics 300 . the error control signals govern the movement or realignment of mirrors 310 and 320 in an effort to drive the error control signals to zero . in doing this , light energy 101 - t and beam 502 are moved in correspondence with eye movement while the actual position of beam 502 relative to the center of the pupil is controlled by x - y translation mirror optics 520 . in order to take advantage of the properties of beamsplitter 200 , light energy 101 - t must be of a different wavelength than that of treatment laser beam 502 . the light energy should preferably lie outside the visible spectrum so as not to interfere or obstruct a surgeon &# 39 ; s view of eye 10 . further , if the present invention is to be used in ophthalmic surgical procedures , light energy 101 - t must be “ eye safe ” as defined by the american national standards institute ( ansi ). while a variety of light wavelengths satisfy the above requirements , by way of example , light energy 101 - t is infrared light energy in the 900 nanometer wavelength region . light in this region meets the above noted criteria and is further produced by readily available , economically affordable light sources . one such light source is a high pulse repetition rate gaas 905 nanometer laser operating at 4 khz which produces an ansi defined eye safe pulse of 10 nanojoules in a 50 nanosecond pulse . a preferred embodiment method for determining the amount of eye movement , as well as eye movement sensor 100 for carrying out such a method , are described in detail in the aforementioned copending patent application . however , for purpose of a complete description , sensor 100 will be described briefly with the aid of the block diagram shown in fig2 . sensor 100 may be broken down into a delivery portion and a receiving portion . essentially , the delivery portion projects light energy 101 - t in the form of light spots 21 , 22 , 23 and 24 onto a boundary ( e . g ., iris / pupil boundary 14 ) on the surface of eye 10 . the receiving portion monitors light energy 101 - r in the form of reflections caused by light spots 21 , 22 , 23 and 24 . in delivery , spots 21 and 23 are focused and positioned on axis 25 while spots 22 and 24 are focused and positioned on axis 26 as shown . axes 25 and 26 are orthogonal to one another . spots 21 , 22 , 23 and 24 are focused to be incident on and evenly spaced about iris / pupil boundary 14 . the four spots 21 , 22 , 23 and 24 are of equal energy and are spaced evenly about and on iris / pupil boundary 14 . this placement provides for two - axis motion sensing in the following manner . each light spot 21 , 22 , 23 and 24 causes a certain amount of reflection at its position on iris / pupil boundary 14 . since boundary 14 moves in coincidence with eye movement , the amount of reflection from light spots 21 , 22 , 23 and 24 changes in accordance with eye movement . by spacing the four spots evenly about the circular boundary geometry , horizontal or vertical eye movement is detected by changes in the amount of reflection from adjacent pairs of spots . for example , horizontal eye movement is monitored by comparing the combined reflection from light spots 21 and 24 with the combined reflection from light spots 22 and 23 . in a similar fashion , vertical eye movement is monitored by comparing the combined reflection from light spots 21 and 22 with the combined reflection from light spots 23 and 24 . more specifically , the delivery portion includes a 905 nanometer pulsed diode laser 102 transmitting light through optical fiber 104 to an optical fiber assembly 105 that splits and delays each pulse from laser 102 into preferably four equal energy pulses . assembly 105 includes one - to - four optical splitter 106 that outputs four pulses of equal energy into optical fibers 108 , 110 , 112 , 114 . in order to use a single processor to process the reflections caused by each pulse transmitted by fibers 108 , 110 , 112 and 114 , each pulse is uniquely delayed by a respective fiber optic delay line 109 , 111 , 113 and 115 . for example , delay line 109 causes a delay of zero , i . e ., delay = ox where x is the delay increment ; delay line 111 causes a delay of x , i . e ., delay = 1x ; etc . the pulse repetition frequency and delay increment x are chosen so that the data rate of sensor 100 is greater than the speed of the movement of interest . in terms of saccadic eye movement , the data rate of sensor 100 must be on the order of at least several hundred hertz . for example , a sensor data rate of approximately 4 khz is achieved by 1 ) selecting a small but sufficient value for x to allow processor 160 to handle the data ( e . g ., 160 nanoseconds ), and 2 ) selecting the time between pulses from laser 102 to be 250 microseconds ( i . e ., laser 102 is pulsed at a 4 khz rate ). the four equal energy pulses exit assembly 105 via optical fibers 116 , 118 , 120 and 122 which are configured as a fiber optic bundle 123 . bundle 123 arranges the optical fibers such that the center of each fiber forms the corner of a square . light from assembly 105 is passed through an optical polarizer 124 that outputs horizontally polarized light beams as indicated by arrow 126 . horizontally polarized light beams 126 pass to focusing optics 130 where spacing between beams 126 is adjusted based on the boundary of interest . additionally , a zoom capability ( not shown ) can be provided to allow for adjustment of the size of the pattern formed by spots 21 , 22 , 23 and 24 . this capability allows sensor 100 to adapt to different patients , boundaries , etc . a polarizing beam splitting cube 140 receives horizontally polarized light beams 126 from focusing optics 130 . cube 140 is configured to transmit horizontal polarization and reflect vertical polarization . accordingly , cube 140 transmits only horizontally polarized light beams 126 as indicated by arrow 142 . thus , it is only horizontally polarized light that is incident on eye 10 as spots 21 , 22 , 23 and 24 . upon reflection from eye 10 , the light energy is depolarized ( i . e ., it has both horizontal and vertical polarization components ) as indicated by crossed arrows 150 . the receiving portion first directs the vertical component of the reflected light as indicated by arrow 152 . thus , cube 140 serves to separate the transmitted light energy from the reflected light energy for accurate measurement . the vertically polarized portion of the reflection from spots 21 , 22 , 23 and 24 , is passed through focusing lens 154 for imaging onto an infrared detector 156 . detector 156 passes its signal to a multiplexing peak detecting circuit 158 which is essentially a plurality of peak sample and hold circuits , a variety of which are well known in the art . circuit 158 is configured to sample ( and hold the peak value from ) detector 156 in accordance with the pulse repetition frequency of laser 102 and the delay x . for example , if the pulse repetition frequency of laser 102 is 4 khz , circuit 158 gathers reflections from spots 21 , 22 , 23 and 24 every 250 microseconds . the values associated with the reflected energy for each group of four spots ( i . e ., each pulse of laser 102 ) are passed to a processor 160 where horizontal and vertical components of eye movement are determined . for example let r 21 , r 22 , r 23 and r 24 represent the detected amount of reflection from one group of spots 21 , 22 , 23 and 24 , respectively . a quantitative amount of horizontal movement is determined directly from the normalized relationship ( r 21 + r 24 ) - ( r 22 + r 23 ) r 21 + r 22 + r 23 + r 24 ( 1 ) while a quantitative amount of vertical movement is determined directly from the normalized relationship ( r 21 + r 22 ) - ( r 23 + r 24 ) r 21 + r 22 + r 23 + r 24 ( 2 ) note that normalizing ( i . e ., dividing by r 21 + r 22 + r 23 + r 24 ) reduces the effects of variations in signal strength . once determined , the measured amounts of eye movement are sent to beam angle adjustment mirror optics 300 . the advantages of the present invention are numerous . eye movement is measured quantitatively and used to automatically redirect both the laser delivery and eye tracking portions of the system independent of the laser positioning mechanism . the system operates without interfering with the particular treatment laser or the surgeon performing the eye treatment procedure . although the invention has been described relative to a specific embodiment thereof , there are numerous variations and modifications that will be readily apparent to those skilled in the art in the light of the above teachings . it is therefore to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described .	0
an exemplary embodiment of a machine tool according to the invention , represented in fig1 , comprises a machine frame , which is designated as a whole by 10 , can be placed with a foot 12 on a base area and comprises a machine bed body , which is designated as a whole by 20 and is preferably formed in a way similar to a plate . on this machine bed body 20 there are , for example , two headstocks 22 , 24 , in which workpiece spindles 30 , 32 are disposed coaxially in relation to a spindle axis 26 , lie opposite each other and are provided with workpiece receiving means 34 , 36 for workpieces ws , which represent first receiving means and are disposed facing one another . however , instead of workpiece spindles 30 , 32 , it would also be conceivable to provide tool spindles with tool receiving means . in the case of this exemplary embodiment of the machine tool according to the invention , the headstock 22 is disposed on the machine bed body 20 in a stationary manner , while the headstock 24 can for example be made to move in the direction of the spindle axis 26 . however , it would also be conceivable to arrange for both headstocks 22 , 24 to be movable in relation to the machine bed body 20 . for machining the workpieces ws disposed in the workpiece receiving means 34 , 36 , a tool carrier 38 , which can only be made to move transversely in relation to the spindle axis 26 and is associated with the workpiece spindle 32 , and also tool carriers 40 , 42 , which are associated with the workpiece spindles 30 , 32 , are provided , each of which comprises a multiplicity of tool receiving means 44 , 46 for tools wz , representing second receiving means . in order to allow the tool carriers 40 , 42 , and consequently the tool receiving means 44 , 46 , to be moved in relation to the workpiece receiving means 34 , 36 , the tool carriers 40 , 42 are disposed on for example identically constructed compound slide systems 50 , 52 , each of which comprises a first slide element 60 on the machine bed side , which is formed for example as a plate 62 with an aperture 64 in a central region of the same and has around the aperture 64 surfaces 66 , 68 running substantially parallel to one another , the surfaces 66 being front surfaces and the surfaces 68 being rear surfaces of the plate 62 . as an alternative to this , instead of the plate 62 , it is also conceivable to provide on both sides of the aperture 64 guiding strips , which lie with their two surfaces 66 , 68 respectively in the same plane . on this first slide element 60 on the machine bed side , a second slide element 70 on the tool carrier side is movably guided , to be precise by the latter sliding with guiding bodies 72 , 74 on the surfaces 66 , 68 . consequently , the surfaces 66 , 68 of the first slide element 60 running parallel to one another define a compound slide movement area , parallel to which the respective second slide element 70 is movable in relation to the machine bed body 20 , both in the x direction , that is to say transversely in relation to the spindle axis 26 , and in the z direction , that is to say parallel to the spindle axis 26 . further details and embodiments of compound slide systems 50 , 52 of this type , in which the respective second slide element 70 is movable in the direction of both compound slide movement axes x , z , are described in german patent application de 100 19 788 a1 , to which reference is made with regard to the embodiments of the various compound slide systems . the tool carriers 40 , 42 are preferably also in each case rotatable with respect to the corresponding second slide element 70 about a b axis , which is perpendicular to the x / z plane . for moving the respective second slide element 70 in relation to the respective first slide element 60 , as represented in fig2 , associated with each compound slide system 50 , 52 is a drive device 80 , which acts on the respective slide element 70 at two spaced - apart points of application 82 , 84 , in order to position the respective second slide element 70 in relation to the first slide element 60 in the x and z directions in the respective compound slide movement plane . as shown enlarged in fig3 and 4 , the drive device 80 comprises altogether four drive struts 90 , 92 , 94 , 96 , the drive struts 90 and 92 acting by means of pivot joints 100 , 102 at the point of application 82 , formed by a bearing pin 86 , and the drive struts 94 and 96 acting by means of pivot joints 104 and 106 on a bearing pin 88 defining the point of application 84 . furthermore , each of the drive struts 90 , 92 , 94 , 96 is pivotally connected by means of a pivot joint 110 , 112 , 114 , 116 to in each case a guiding slide 120 , 122 , 124 , 126 , the guiding slides 120 , 122 , 124 , 126 being guided along a guideway 132 , which fixes a common guiding direction 130 and is formed for example by a guiding rail 134 . the guiding rail 134 is preferably disposed on a rear side 136 of the machine bed body 20 and is held by the machine bed body 20 . disposed in this way , the drive struts 90 , 92 , 94 , 96 always extend with their longitudinal directions 140 , 142 , 144 , 146 transversely , in particular obliquely , in relation to the guiding direction 130 , irrespective of the position of the guiding slides 120 to 126 along the guideway 132 , and the longitudinal directions 140 , 142 , 144 and 146 run parallel to a central plane 154 . furthermore , in the case of the exemplary embodiment represented , the drive struts 90 , 92 , 94 , 96 are formed in such a way that their length between the respective pivot joints 100 and 110 , 102 and 112 , 104 and 114 and also 106 and 116 is of the same size . in addition , the guiding slides 120 and 122 and also 124 and 126 are positioned in relation to one another in such a way that the longitudinal directions 140 and 144 of the drive struts 90 and 94 and also the longitudinal directions 142 and 146 of the drive struts 92 and 96 run parallel to one another . this can be achieved in particular by the guiding slides 120 and 124 being rigidly coupled to one another by connecting struts 150 and 152 , the connecting struts 150 and 152 running between the guiding slides 120 and 124 , for example on both sides of the central plane 154 of the drive device 80 , to be precise at such a spacing from the guiding slide 122 that the latter can move freely between the connecting struts 150 and 152 and also along the guideway 132 between the guiding slides 120 and 124 . the connecting struts 150 and 152 in this case preferably lie in such a way that they act on side faces 156 and 158 of the guiding slides 120 and 124 , the side faces 156 and 158 being side faces of the guiding slides 120 and 124 that run for example approximately parallel or obliquely in relation to the central plane 154 . furthermore , the guiding slides 122 and 126 are likewise rigidly coupled to one another by connecting struts 160 and 162 , the connecting struts 162 and 164 acting on the guiding slides 122 and 126 in the region of upper sides 166 and 168 running transversely in relation to the central plane 154 , and consequently running in a collision - free manner in relation to the connecting struts 150 and 152 , and the connecting struts 160 and 162 being disposed with such a spacing from one another that a pivot joint flange 174 of the guiding slide 124 is freely movable between the connecting struts 160 and 162 . otherwise , all the pivot joint flanges 170 , 172 , 174 and 176 supporting the pivot joints 110 , 112 , 114 and 116 are formed in such a way that the pivot joints 110 , 112 , 114 and 116 can be moved at the same spacing from the guiding rail 134 and parallel to the guiding direction 130 by moving the guiding slides 120 , 122 , 124 and 126 . the parallel alignment of the longitudinal directions 140 and 144 of the drive struts 90 and 94 and also of the longitudinal directions 142 and 146 of the drive struts 92 and 96 is ensured in every relative position of the guiding slides 120 and 124 with respect to the guiding slides 122 and 126 by the rigid connection of the guiding slides 120 and 124 and also 122 and 126 by means of the connecting struts 150 and 152 or 160 and 162 , respectively . consequently , the drive struts 90 and 92 , the pivot joints 110 and 112 of which are always spaced apart from one another while the pivot joints 100 and 102 of which act on the same bearing pin 86 , form the sides of an isosceles triangle , which on the one hand uniquely fixes the position of the point of application 82 in the guiding direction 130 , which preferably runs parallel to the z direction of the machine tool , and on the other hand also uniquely fixes its spacing from the guideway 132 , which corresponds to the x direction whenever — as provided in the case of the exemplary embodiment represented — the central plane 154 of the drive device 80 runs parallel to the compound slide movement plane , and consequently parallel to the surfaces 66 and 68 of the first slide element 60 . consequently , the z position of the point of application 82 on the slide element 70 can be uniquely fixed by the absolute position of the guiding slides 120 and 122 in the guiding direction 130 , and the x position of the point of application 82 on the slide element 70 can be uniquely fixed by the relative position of the guiding slides 120 and 122 . the single degree of freedom of the movement of the slide element 70 when the point of application 82 is fixed in such a way consists in the slide element 70 having the possibility of turning about the point of application 82 on account of the pivot joints 100 and 102 , and the bearing pins 86 that are consequently rotatable in relation to the latter . altogether , the drive struts 90 and 92 , the longitudinal directions 140 and 142 of which run transversely in relation to one another , preferably in a v - shaped manner with respect to the point of application 82 , consequently form a drive group 180 , which fixes the x and z positions of the point of application 82 of the slide element 70 . in the same way , the drive struts 94 and 96 form a drive group 182 , since these drive struts 94 and 96 also form the sides of an isosceles triangle and , on the basis of the spaced - apart pivot joints 114 and 116 and the pivot joints 104 and 106 , acting together on the bearing pin 88 , uniquely define the point of application 84 in relation to the z direction and in relation to the x direction of the machine tool for the same reasons as described in connection with the first drive group 180 , so that the slide element 70 would only be left with the possibility of rotating about the point of application 84 . however , the position of the slide element 70 with regard to its position in the x direction and the z direction is likewise uniquely fixed by the unique fixing of both points of application 82 and 84 , and furthermore this drive device 80 only allows the slide element 70 to be displaced in positions in which the slide element 70 always maintains the same alignment in relation to the z direction and the x direction , which is evident from the fact that a connecting line 184 between the points of application 82 and 84 always remains aligned parallel to the guiding direction 130 , irrespective of the position of the guiding slides 122 and 126 in relation to the guiding slides 120 and 124 , since the drive struts 90 and 94 and also 92 and 96 also always remain aligned parallel to one another on account of the rigid mechanical coupling of the guiding slides 120 and 124 and also 122 and 126 , and consequently there is double parallel guidance for the slide element 70 . as represented in fig2 , the movement of the guiding slides 120 and 124 takes place by means of a first linear drive 190 , which could be formed for example as an electric linear motor , but is preferably a spindle drive , and comprises an adjusting spindle 192 , on which there is a spindle nut 194 , which is for example fixedly connected to the bearing flange 170 of the first guiding slide 120 . the adjusting spindle 192 is for its part mounted in a bearing support 196 fixedly connected to the machine bed body 20 in such a way that it is non - displaceable in the direction of its longitudinal axis 198 but rotatable , so that turning of the adjusting spindle 192 leads to a displacement of the spindle nut 194 in the direction of the longitudinal axis 198 . furthermore , the adjusting spindle 192 can be driven in a rotating manner about the longitudinal axis 198 by a drive 200 . consequently , the guiding slides 120 and 124 can be moved together in the guiding direction 130 by the linear drive 190 . in the same way , a second linear drive 210 is provided for moving the guiding slides 122 and 126 , which drive comprises an adjusting spindle 212 , a spindle nut 214 and a bearing support 216 , the adjusting spindle 212 being accommodated in the bearing support 216 in such a way that it is immovable in the direction of its longitudinal axis 218 but rotatable . since it is also provided in the case of the second linear drive 210 that the spindle nut 214 is fixedly connected to one of the guiding slides , in this case the guiding slide 126 , both the guiding slide 126 and the guiding slide 122 can be displaced in the guiding direction 130 by turning the adjusting spindle 212 , for example driven by a drive 220 . depending on the absolute position of the guiding slides 120 and 124 or 122 and 126 , and depending on the relative position of the guiding slides 120 and 124 or 122 and 126 , the position of the second slide element 70 can consequently be fixed with the required rigidity both in the z direction and in the x direction . the absolute position of the guiding slides 120 and 124 or 122 and 126 can be detected in this case by rotary encoders which are associated with the linear drives 190 and 210 and detect the rotational positions of the adjusting spindles 192 and 212 . furthermore , as already represented in fig3 , the relative position of the guiding slides 120 and 124 or 122 and 126 that are connected to one another can be detected by a measuring system 230 , which comprises a first element 232 , disposed for example on the connecting strut 150 , and a second element 234 , disposed on the connecting strut 160 , so that the two elements 232 and 234 are displaceable with respect to one another , one of the elements carrying a glass scale , with which the relative position of the guiding slides 120 and 124 and also 122 and 126 that are coupled to one another can be detected , this relative position representing a measure of the position of the second slide element 70 in the x direction of the machine tool . in order to minimize the effects of thermal displacements on the position of the slide elements 70 1 and 70 2 , the guiding rails 134 of the drive devices 80 are preferably disposed in such a way that they lie on a side of the points of application 82 , 84 that is facing the spindle axis 26 , in particular near a reference plane 240 of the machine tool which runs through the spindle axis 26 and perpendicularly in relation to the x direction , that is to say parallel to the y direction . consequently , the thermal displacements caused by the drive devices 80 according to the invention are minimal , in particular since the drive struts 90 , 92 , 94 , 96 do not have their own heat - dissipating drives , but instead the heat - dissipating drives , namely the drives 200 and 220 , can be disposed at a sufficient distance from the drive device 80 , so that heat only enters the drive devices 80 1 and 80 2 according to the invention indirectly via the drives 200 , 220 , and consequently the resultant thermal displacements are likewise minimal . furthermore , the guiding rail 134 associated with the respective drive device 80 1 and 80 2 is fixedly connected directly to the machine bed body 20 near the reference plane 240 , so that thermal displacements of the reference plane 240 itself , for example caused by heating of the machine bed body 20 , do not have any effect on the positional accuracy of the respective second slide element 70 1 or 70 2 , since its position relates substantially to the relative position in relation to the reference plane 240 , the absolute position of which is immaterial . the drives 200 , 220 of each of the drive devices 80 1 and 80 2 can be controlled by means of a control which is designated as a whole by 250 , positions the respective slide element 70 in the x direction by synchronous displacement of the guiding slides 120 and 124 or 122 and 126 that are coupled to one another and converts the desired position of the slide element 70 in the x direction into a relative position between the slide elements 120 and 124 or 122 and 126 that are coupled to one another .	8
including by reference the figures listed above , applicant &# 39 ; s sulfurous acid generator comprises a system which generates sulphur dioxide gas and keeps the gas substantially contained and in contact with water for extended periods of time substantially eliminating any significant release of harmful sulphur dioxide gas from the system as shown in fig1 , 2 , and 3 . the principal elements of the present invention are shown in fig1 - 8 . the sulphur hopper 20 comprises enclosure 24 with a lid 26 . lid 26 may define a closeable aperture , not shown . enclosure 24 may be of any geometric shape ; square is shown , cylindrical may also be employed . lid 26 of enclosure 24 is readily removable to allow sulphur to be loaded into hopper 20 . enclosure 24 defines a hopper outlet 30 . hopper 20 is configured such that sulphur in hopper 20 is directed toward hopper outlet 30 by the pull of gravity . hopper outlet 30 allows sulphur to pass through and out of hopper 20 . fig1 a illustrates a plan view of open hopper 20 . hopper 20 comprises a base or floor 22 . in the preferred embodiment , a cooling ring 28 is disposed about ½ inch above base 22 . as shown in fig1 , untreated irrigation water is circulated through cooling ring 28 . see also fig1 b . fig1 a and 1b also disclose vertical standing baffles 29 . in practice of the invention it has been discovered that baffles 29 assist in directing the dry sulphur to hopper outlet 30 . practice of the invention has also revealed that cooling ring 28 is most effective when placed closer to hopper outlet 30 rather than the middle of base 22 or farther away from hopper outlet 30 . the effect cooling ring 28 has on molten sulphur will be discussed below . a passageway conduit 36 communicates between hopper outlet 30 and burn chamber inlet 50 of burn chamber 40 . burn chamber 40 comprises floor member 42 , chamber sidewall 44 and roof member 46 . roof member 46 is removably attached to chamber sidewall 44 supporting roof member 46 . roof member 46 defines an ignition inlet 52 as having a removably attached ignition inlet cover 54 . an air inlet 56 defined by chamber sidewall 44 has a removably attached air inlet cover 58 . the air inlet 56 preferably enters the chamber sidewall 44 tangentially . an exhaust opening 60 in the burn chamber 40 is defined by the roof member 46 . as shown in fig2 , 3 , and 4 , roof member 46 also defines a downwardly extending annular ring 48 . in the preferred embodiment , ring 48 extends downwardly into burn chamber 40 at least as low as air inlet 56 is disposed . it is understood and believed that this configuration causes not only inlet air to swirl in a cyclone effect into burn chamber 40 but induces a swirling or cyclone effect of the combusted sulphur dioxide gas as it rises in burn chamber 40 and passing up through exhaust opening 60 and gas pipeline 70 . roof member 46 is secured to sidewall 44 of burn chamber 40 by either bolting roof member 46 to burn chamber to the top of sidewall 44 in any conventional fashion , or as shown in fig4 , by employing removable c - clamps 49 . hopper 20 , passageway conduit 36 and bum chamber 40 may be constructed of stainless steel . in such case , roof member 46 could be removably bolted to bum chamber 40 . in an alternative embodiment shown in fig4 , hopper 20 , passageway conduit 36 and burn chamber 40 as well as a platform or legs 10 may be constructed of saggregate ™ concrete . saggregate ™ concrete is a unique blend of cement and other components . the saggregate ™ concrete comprises a cement component , two aggregate components , and a water component . the preferred cement component is lumnite mg ® (“ lumnite ® cement ”), heidelberger calcium aluminate cement from heidelberger calcium aluminates , inc ., allentown , pa ., united states of america . the preferred lumnite ® has a 7000 pound crush weight nature . the first aggregate is preferably a pea - sized medium or granular shale sold by utelite corp ., wanship , utah , 84017 , united states of america . a second aggregate is preferably a crushed mesh or crushed fines inorganic aggregate . the preferred fine - sized aggregate is pakmlx ® lightweight soil conditioner produced by utelite corp ., wanship , utah , 84017 , united states of america . the pakinix ® aggregate comprises no . 10 crushed fines of shale capable of bearing temperatures up to 2000 degrees fahrenheit . the mixing ratio of the cement , first aggregate , second aggregate and water are as follows . the ratio of lumnite ® cement to combined aggregates is 1 : 3 by volume . the ratio of water to lumnite ® cement by weight is 0 . 4 : 1 . operational results are achieved when the volume ratio of pea - sized medium shale aggregate to lumnite ® cement ranges from about 0 : 1 to about 3 . 0 : 1 and where the volume ratio of crushed mesh / crushed shale fines aggregate to lumnite ® cement ranges from about 0 : 1 to about 3 . 0 : 1 . more satisfactory results are achieved when the volume ratio of pea - sized medium shale aggregate to lumnite ® cement ranges from about 1 : 1 to about 1 . 5 : 1 and where the volume ratio of crushed mesh / crushed shale fines aggregate to lumnite ® cement ranges from about 1 . 5 : 1 to about 2 . 0 : 1 . the most favorable results occur when the pea - sized medium shale aggregate is mixed in a ratio to lumnite ® cement in a range from about 1 . 2 : 1 to about 1 . 3 : 1 by volume and wherein the crushed mesh / crushed shale fines aggregate component is present in a ratio to lumnite ® cement in a range from about 1 . 7 : 1 to about 1 . 8 : 1 by volume . embodiments of the saggregate ™ concrete of the present invention discussed above and illustrated in fig4 were made in the following manner : component amount lumnite ® cement one volume unit pea - sized medium shale 1 . 5 × one volume unit crushed fine shale 1 . 5 × one volume unit water . 4 × weight of one volume unit of lumnite ® for example , one cubic foot of lumnite ® cement is measured and weighed , the weight of one cubic foot of lumnite ® cement being noted . measure one and one - half cubic feet of pea - sized medium shale . measure one and one - half cubic feet of crushed fine shale . mix the lumnite ® cement , pea - sized medium shale and crushed fine shale together to create a dry mix . measure an amount of water equal to 0 . 4 times the weight of the one cubic foot of lumnite ® cement . add the amount of water to the dry mix to create saggregate ™ concrete . mix , handle , pour , cure and treat the saggregate ™ concrete like conventional concrete . in the context of the present invention , saggregate ™ concrete was used with suitable molds to form the desired hopper - burn chamber assembly capable of withstanding the heat of burning and molten sulphur in use . other embodiments of the saggregate ™ concrete of the present invention discussed above and illustrated in fig4 may be made in the following manner : component amount lumnite ® cement one volume unit pea - sized medium shale 3 . 0 × one volume unit crushed fine shale none water . 4 × weight of one volume unit of lumnite ® cement for example , one cubic foot of lumnite ® cement is measured and weighed , the weight of one cubic foot of lumnite ® cement being noted . measure three cubic feet of pea - sized medium shale . use no crushed fine shale . mix the lumnite ® cement and pea - sized medium shale together to create a dry mix . measure an amount of water equal to 0 . 4 times the weight of the three cubic feet of lumnite ® cement . add the amount of water to the dry mix to create saggregate ™ concrete . mix , handle , pour , cure and treat the saggregate ™ concrete like conventional concrete . in the context of the present invention , saggregate ™ concrete is used with suitable molds to form the desired hopper - burn chamber assembly capable of withstanding the heat of burning and molten sulphur in use . component amount lumnite ® cement one volume unit pea - sized medium shale none crushed fine shale 3 . 0 × one volume unit water . 4 × weight of one volume unit of lumnite ® cement for example , one cubic foot of lumnite ® cement is measured and weighed , the weight of one cubic foot of lumnite ® cement being noted . use no pea - sized medium shale . measure three cubic feet of crushed fine shale . mix the lumnite ® cement and crushed fine shale together to create a dry mix . measure an amount of water equal to 0 . 4 times the weight of the one cubic foot of lumnite ® cement . add the amount of water to the dry mix to create saggregate ™ concrete . mix , handle , pour , cure and treat the saggregate ™ concrete like conventional concrete . in the context of the present invention , saggregate ™ concrete is used with suitable molds to form the desired hopper - burn chamber assembly capable of withstanding the heal of burning and molten sulphur in use . component amount lumnite ® cement one volume unit pea - sized medium shale . 4 × one volume unit crushed fine shale 2 . 6 × one volume unit water . 4 × weight of one volume unit of lumnite ® cement for example , one cubic foot of lumnite ® cement is measured and weighed , the weight of one cubic foot of lumnite ® cement being noted . measure 0 . 4 cubic foot of pea - sized medium shale . measure 2 . 6 cubic feet of crushed fine shale . mix the lumnite ® cement , pea - sized medium shale and crushed fine shale together to create a dry mix . measure an amount of water equal to 0 . 4 times the weight of the one cubic foot of lumnite ® cement . add the amount of water to the dry mix to create saggregate ™ concrete . mix , handle , pour , cure and treat the saggregate ™ concrete like conventional concrete . in the context of the present invention , saggregate ™ concrete is used with suitable molds to form the desired hopper - burn chamber assembly capable of withstanding the heat of burning and molten sulphur in use . component amount lumnite ® cement one volume unit pea - sized medium shale one volume unit crushed fine shale 2 . 0 × one volume unit water . 4 × weight of one volume unit of lumnite ® for example , one cubic foot of lumnite ® cement is measured and weighed , the weight of one cubic foot of lumnite ® cement being noted . measure one cubic foot of pea - sized medium shale . measure two cubic feet of crushed fine shale . mix the lumnite ® cement , pea - sized medium shale and crushed fine shale together to create a dry mix . measure an amount of water equal to 0 . 4 times the weight of the one cubic foot of lumnite ® cement . add the amount of water to the dry mix to create saggregate ™ concrete , mix , handle , pour , cure and treat the saggregate ™ concrete like conventional concrete . in the context of the present invention , saggregate ™ concrete is used with suitable molds to form the desired hopper - burn chamber assembly capable of withstanding the heat of burning and molten sulphur in use . component amount lumnite ® cement one volume unit pea - sized medium shale 1 . 1 × one volume unit crushed fine shale 1 . 9 × one volume unit water . 4 × weight of one volume unit of lumnite ® for example , one cubic foot of lumnite ® cement is measured and weighed , the weight of one cubic foot of lumnite ® cement being noted . measure one and one - tenth cubic feet of pea - sized medium shale . measure one and nine - tenths cubic feet of crushed fine shale . mix the lumnite ® cement , pea - sized medium shale and crushed fine shale together to create a dry mix . measure an amount of water equal to 0 . 4 times the weight of the one cubic foot of lumnite ® cement . add the amount of water to the dry mix to create saggregate ™ concrete . mix , handle , pour , cure and treat the saggregate ™ concrete like conventional concrete . in the context of the present invention , saggregate ™ concrete is used with suitable molds to form the desired hopper - burn chamber assembly capable of withstanding the heat of burning and molten sulphur in use . component amount lumnite ® cement one volume unit pea - sized medium shale 1 . 2 × one volume unit crushed fine shale 1 . 8 × one volume unit water . 4 × weight of one volume unit of lumnite ® for example , one cubic foot of lumnite ® cement is measured and weighed , the weight of one cubic foot of lumnite ® cement being noted . measure one and two - tenths cubic feet of pea - sized medium shale . measure one and eight - tenths cubic feet of crushed fine shale . mix the lumnite ® cement , pea - sized medium shale and crushed fine shale together to create a dry mix . measure an amount of water equal to 0 . 4 times the weight of the one cubic foot of lumnite ® cement . add the amount of water to the dry mix to create saggregate ™ concrete . mix , handle , pour , cure and treat the saggregate ™ concrete like conventional concrete . in the context of the present invention , saggregate ™ concrete is used with suitable molds to form the desired hopper - burn chamber assembly capable of withstanding the heat of burning and molten sulphur in use . component amount lumnite ® cement one volume unit pea - sized medium shale 1 . 3 × one volume unit crushed fine shale 1 . 7 × one volume unit water . 4 × weight of one volume unit of lumnite ® for example , one cubic foot of lumnite ® cement is measured and weighed , the weight of one cubic foot of lumnite ® cement being noted . measure one and three - tenths cubic feet of pea - sized medium shale . measure one and seven - tenths cubic feet of crushed fine shale . mix the lumnite ® cement , pea - sized medium shale and crushed fine shale together to create a dry mix . measure an amount of water equal to 0 . 4 times the weight of the one cubic foot of lumnite ® cement . add die amount of water to the dry mix to create saggregate ™ concrete . mix , handle , pour , cure and treat the saggregate ™ concrete like conventional concrete . in the context of the present invention , saggregate ™ concrete is used with suitable molds to form the desired hopper - burn chamber assembly capable of withstanding the heat of burning and molten sulphur in use . component amount lumnite ® cement one volume unit pea - sized medium shale 1 . 4 × one volume unit crushed fine shale 1 . 6 × one volume unit water . 4 × weight of one volume unit of lumnite ® for example , one cubic foot of lumnite ® cement is measured and weighed , the weight of one cubic foot of lumnite ® cement being noted . measure one and four - tenths cubic feet of pea - sized medium shale . measure one and six - tenths cubic feet of crushed fine shale . mix the lumnite ® cement , pea - sized medium shale and crushed fine shale together to create a dry mix . measure an amount of water equal to 0 . 4 times the weight of the one cubic foot of lumnite ® cement . add the amount of water to the dry mix to create saggregate ™ concrete . mix , handle , pour , cure and treat the saggregate ™ concrete like conventional concrete . in the context of the present invention , saggregate ™ concrete is used with suitable molds to form the desired hopper - burn chamber assembly capable of withstanding the heat of burning and molten sulphur in use . the dry mix of lumnite ® cement and aggregates can be pre - mixed and bagged together . this greatly simplifies construction for the user because all components of the saggregate ™ concrete are provided except water which can be provided on site . when mixed and cured , the saggregate ™ concrete is easily capable of withstanding the 400 to 600 degree fahrenheit temperature of the burning and molten sulphur in burning chamber 40 . in the preferred embodiment using saggregate ™ concrete to construct base 22 and sidewall 24 of hopper 20 should be 2½ to 3 inches thick . similarly , the walls of the conduit passageway 36 and base 42 and sidewall 44 of burn chamber 40 should also have saggregate ™ concrete in the thickness of about 2½ to 3 inches . in the configuration shown in fig4 , lid 26 may be constructed of virtually any material , including wood , plastic , or any other material . due to the extreme heat generated in burn chamber 40 , roof member 46 must be made of a material that will withstand such extreme temperatures . preferably , roof member 46 is constructed of stainless steel . as shown in fig4 , feet 10 may also be constructed of saggregate ™ concrete . feet 10 are used to permit air to radiate under the bottom of hopper 20 and burning chamber 40 to dissipate radiant heat . as shown in fig1 a , 1 b and 4 , an additional advantage of placing cooling ring 28 in the hopper near passage conduit 36 results in a physical barrier and temperature barrier of any molten sulphur flowing from burning chamber 40 through conduit passageway 36 into hopper 20 . in other words , the physical location of cooling ring 28 and the temperature gradient caused thereby , impedes the flow of any molten sulphur out of conduit passageway 36 so as to confine molten sulphur between cooling ring 28 and fluid conduit passageway 36 . in a preferred embodiment , the hopper is in a square shape that has a cross - section of about 18 inches by 18 inches and is about 30 inches high in its inside dimensions . if a cylindrical shaped hopper is employed , an inside diameter of about 18 inches is preferred . in such a case , the inside height dimension of conduit passageway 36 is about 5 inches in inside height and about 10 inches in inside width with the burning chamber 40 being about 12 inches in height and having an inside diameter of 10 inches . this embodiment burns about 5 pounds of sulphur or less per hour and is capable of treating about 15 to 100 gallons of water per minute . in another larger embodiment , the hopper , if square , could have inside dimensions of about 32 inches by 42 inches , with a height of about 48 inches with the inside height dimension of conduit passageway 36 being about 6 inches in inside height and about 11 inches in inside width with a burn chamber having a height of about 16 inches and an inside diameter of about 18 inches . in this embodiment , tests have revealed that about 20 pounds of sulphur or less per hour is burned and the amount of water being treated may range from about 20 gallons per minute to about 300 gallons per minute . the present invention also contemplates a means for controlling the burn rate of sulphur in burn chamber 40 . fig8 a through 8e represent different means for dampening air intake through air inlet 56 . fig8 a illustrates a curved and / or occluded end of air inlet 56 . tests have revealed that a substantially centered hole having a diameter of about 1 to about 2 inches permits effective control of the burn of sulphur in chamber 40 . fig8 b illustrates a conventional gate valve which can be placed along air inlet 56 to selectively dampen the flow of air into burn chamber 40 . similarly , fig8 c illustrates a conventional ball valve effective in restricting flow . use of such a ball valve permits selective dampening or control of air through air inlet 56 into burn chamber 40 . fig8 d illustrates another embodiment in which a bend in air inlet 56 is followed by a ring disposed within air inlet 56 defining an opening 61 substantially perpendicular to the direction of flow of air . air inlet 56 also has a second bend . the preferred means for dampening the flow of air into burn chamber 40 is illustrated in fig8 e . air inlet 56 has a curve or bend and is packed with stainless steel mesh or wool 63 . in all the embodiments of fig8 a through 8e , air inlet 56 comprises a pipe or conduit having a diameter of about 3 inches . sulphur supplied to the burn chamber 40 through the conduit inlet 50 can be ignited through the ignition inlet 52 . the air inlet 56 allows oxygen , necessary for the combustion process , to enter into the burn chamber 40 and thus permits regulation of the rate of combustion . the exhaust opening 60 allows the sulphur dioxide gas to pass up through the exhaust opening 60 and into the gas pipeline 70 . the gas pipeline 70 has two ends , the first end 78 communicating with the exhaust opening 60 , the second end terminating at a third conduit 76 . the gas pipeline or first conduit 70 may comprise an ascending pipe 72 and a transverse pipe 74 . the ascending pipe 72 may communicate with the transverse pipe 74 by means a first 90 degree elbow joint . disposed about and secured to the ascending pipe 72 is a protective grate 90 to prevent unintended external contact with member 72 which is hot when in use . water is conducted through a second conduit 282 to a point at which the second conduit 282 couples with the first conduit 70 at a third conduit 76 . conduit 76 comprises a means 100 for bringing the sulphur dioxide gas in the first conduit 70 and the water in second conduit 282 into contained codirectional flow . water and sulphur dioxide gas are brought into contact with each other whereby sulphur dioxide gas dissolves into the water . the codirectional flow means 100 shown in fig2 , 3 , and 5 comprises a central body 102 , central body 102 defining a gas entry 104 and a sulfur dioxide gas exiting outlet 114 , central body 102 further comprising a secondary conduit inlet 106 , and a water eductor 112 . eductor 112 generates a swirling annular column of water to encircle gas exiting outlet 114 . the water flow , thermal cooling and reaction are believed to assist in drawing sulphur dioxide gas from burn chamber 40 into gas pipeline 70 where the gas is brought into contact with water to create sulphurous acid . the codirection flow means 100 allows water to be introduced into the third conduit 76 initially through a second conduit inlet 106 . the water entering the codirectional means 100 passes through the eductor 112 and , exits adjacent the sulphur dioxide gas outlet 114 . the water enters the third conduit 76 and comes into contact with the sulphur dioxide gas by surrounding the sulphur dioxide gas where the sulphur dioxide gas and water are contained in contact with each other . the water and sulphur dioxide gas react to form an acid of sulphur . this first contact containment portion of conduit 76 does not obstruct the flow of the sulphur dioxide gas . it is believed that a substantial portion of the sulphur dioxide gas will react with the water in this first contact containment area . after the acid and any host water ( hereafter “ water / acid ”) and any remaining unreacted gas continue to flow through third conduit 76 , the water / acid and unreacted sulphur dioxide gas are mixed and agitated to further facilitate reaction of the sulphur dioxide with the water / acid . means for mixing and agitating the flow of water / acid and sulphur dioxide gas is accomplished in a number of ways . for example , as shown in fig2 , mixing and agitating can be accomplished by changing the direction of the flow such as a bend 84 in the third conduit 76 . another example includes placing an object 77 inside the third conduit 76 to alter the flow pattern in the third conduit 76 as shown in fig5 . this could entail a flow altering wedge , flange , bump or other member 77 along the codirectional flow path in third conduit 76 . by placing an object in the flow path , a straight or substantially straight conduit may be employed . the distinction of this invention over the prior art is mixing and agitating the flow of water / acid and sulphur dioxide in an open codirectionally flowing system . one embodiment of the present invention can treat between 20 and 300 gallons of water per minute coursing through third conduit 76 being held in contained contact with the sulphur dioxide gas . after the water / acid and sulphur dioxide gas have passed through an agitation and mixing portion of third conduit 76 , the water / acid and unreacted sulphur dioxide gas are again contained in contact with each other to further facilitate reaction between the components to create an acid of sulphur . this is accomplished by means for containing the water / acid and sulphur dioxide gas in contact with each other . one embodiment is shown in fig2 as a portion 85 of third conduit 76 . portion 85 acts much in the same way as the earlier described contact containment portion . as shown in fig2 , additional means for mixing and agitating the codirectional flow of water / acid and sulphur dioxide gas is employed . one embodiment is illustrated as portion 86 of third conduit 76 in which again the directional flow of the water / acid and sulphur dioxide gas is directionally altered . in this way , the water / acid and sulphur dioxide gas are forced to mix and agitate , further facilitating reaction of the sulphur dioxide gas to further produce or concentrate an acid of sulphur . in the embodiment shown in fig2 , third conduit 76 also incorporates means for discharging the water / acid and unreacted sulphur dioxide gas from third conduit 76 . one embodiment is shown in fig2 as discharge opening 80 defined by third conduit 76 . discharge opening 80 is preferably positioned approximately in the center of the pooling section , described below . in the preferred embodiment , discharge 80 is configured so as to direct the discharge of water / acid and unreacted sulphur dioxide gas downward into a submersion pool 158 without creating a back pressure . in other words , discharge 80 is sufficiently close to the surface 133 of the fluid in the submersion pool to cause unreacted sulphur dioxide gas to be forced into the submersion pool , but not below the surface of the fluid in the submersion pool , thereby maintaining the open nature of the system and to avoid creating back pressure in the system . as illustrated in fig2 , one embodiment of the present invention also utilizes a tank 130 having a bottom 132 , a tank sidewall 134 , and a lid 164 . tank 130 may also comprise a fluid dispersion member 137 to disperse churning sulphurous acid and sulphur dioxide gas throughout tank 130 . dispersion member 137 may have a conical shape or any other shape which facilitates dispersion . a weir 148 may be attached on one side to the bottom member 132 and is attached on two sides to the tank sidewall 134 . the weir 148 extends upwardly to a distance stopping below the discharge 80 . the weir 148 divides the mixing tank 130 into a submersion pool 158 and an outlet section 152 . the third conduit 76 penetrates either tank sidewall 134 or lid 164 ( not shown ). an outlet aperture 154 is positioned in the tank sidewall 134 near the bottom member 132 in the outlet section . the drainage aperture 154 is connected to a drainage pipe 156 . drainage pipe 156 is adapted with a u - trap 157 . u - trap 157 acts as means to trap and force undissolved gases in a submersion zone , including sulphur dioxide gas , back into chamber 130 to exit through lid 164 into vent conduit 210 . sulphurous acid exits pipe 156 or primary discharge . as sulphurous acid flows out of the third conduit 76 , the weir 148 dams the water / acid coming into the mixing tank 130 creating a churning submersion pool 158 of sulphurous acid . sulphur dioxide gas carried by but not yet reacted in the sulphurous acid is carried into submersion pool of acid 158 because of the proximity of the discharge 80 to the surface 133 of the pool 158 ; the carried gas is submerged in the churning submersion pool 158 . the suspended gas is momentarily churned in contact with acid in pool 158 to further concentrate the acid . as unreacted gas rises up through the pool , the unreacted gas is held in contact with water and further reacts to further form concentrate sulphurous acid . the combination of the discharge 80 and its close proximity to the surface 133 of pool of acid 158 creates a means for facilitating and maintaining the submersion of unreacted sulphur dioxide gas discharged from the third conduit into the submersion pool of sulphurous acid to substantially reduce the separation of unreacted sulphur dioxide gas from contact with the sulphurous acid to promote further reaction of the sulphur dioxide gas in the sulphurous acid in an open system without subjecting , the sulphur dioxide gas discharged from the third conduit to back pressure or system pressure . that is , discharge 80 positions below the level of the top of weir 148 is contemplated as inconsistent with the open system illustrated by fig2 . however , discharge 80 may be positioned below the level of the top of weir 148 or below the surface of submersion pool 158 . as sulphurous acid enters the mixing tank 130 from the third conduit 76 the level of the pool 158 of sulphurous acid rises until the acid spills over the weir 148 into the outlet section 152 . sulphurous acid and sulphur dioxide gas flow out of the mixing tank 130 into the drainage pipe 156 . drainage pipe 156 is provided with a submersion zone in the u - trap 157 in which sulphur dioxide gas is again mixed into the sulphurous acid and which prevents sulphur dioxide gas from exiting the drainage pipe or primary discharge 156 in any significant amount . referring to the embodiment illustrated in fig3 , first conduit 70 and second conduit 282 are coupled as discussed above . however , in this embodiment , third conduit 76 may have a bend 84 to transition to length 85 and define a discharge opening 80 into mixing tank 130 . as shown in this embodiment , the water / acid and undissolved sulphur dioxide enter the mixing tank in a downward angle direction . another embodiment , not shown , contemplates third conduit 76 entering directly into the top of mixing chamber 130 through lid 164 . mixing tank 130 of the embodiment of fig3 comprises a bottom member 132 defining an outlet aperture 154 . mixing tank 130 has a diameter of about 6 to 8 inches . as a result , the inside volume of mixing tank 130 is such that as water / acid begins to fill tank 130 and interacts with u - trap 157 , the level of water / acid rises and falls in a flushing action . as water / acid discharges from third conduit 76 into mixing tank 130 , it results in a turbulent washing machine effect forcing undissolved sulphur dioxide gas into the churning water / acid in mixing tank 130 . as depicted in fig3 , u - trap 157 extends vertically a distance up into mixing tank 130 through floor member 132 . this configuration provides a further agitation zone 131 in which descending waters / acid must change its direction and ascend in tank 130 before exiting out u - trap 157 . as a result , submersion pool 158 in use represents a churning pool wherein undissolved sulphur dioxide is contained hi water / acid for further dissolution and / or in u - trap 157 acts to trap and direct undissolved gases back up through submersion pool 158 to escape out exhaust vent 202 and enter into vent conduit 210 . on the other hand , sulphurous acid exits the system through drainage pipe or primary discharge 156 . for the embodiments shown in both fig2 and 3 , any free floating sulphur dioxide gas in mixing tank 130 rises up to the lid 164 . the lid 164 defines an exhaust vent 202 . exhaust vent 202 may be coupled with a vent conduit 210 . the vent conduit 210 has a first end which couples with the exhaust vent 202 and a second end which terminates at a fourth conduit 220 . the vent conduit 210 may consist of a length a pipe between vent 202 and the fourth conduit 220 . the fourth conduit 220 comprises auxiliary means 240 for bringing sulphur dioxide gas in the vent conduit and substantially all the water in a supplemental water conduit 294 into contained , codirectional flow whereby remaining sulphur dioxide gas and water are brought into contact with each other . as shown in fig2 , 3 and 6 , the auxiliary means has a body 240 defining a gas entry 244 , a gas outlet 252 , a supplemental water conduit inlet 246 , and water eductor 250 . water enters the auxiliary means 240 through the supplemental water conduit 294 at inlet 246 . the water courses through inlet 246 and eductor 250 as discussed earlier as to the codirectional means . water eductor 250 draws any free floating sulphur dioxide gas into the exhaust vent conduit 210 . water and sulphur dioxide gas are brought into contact with each other in fourth conduit 220 by surrounding the gas exiting gas outlet 252 with water exiting eductor 250 . the water and gas are contained in contact with each other as the gas and water flow down through fourth conduit 220 to react and form an acid of sulphur . this contact containment area does not obstruct the flow of the sulphur dioxide gas . it is believed that substantially all of the remaining sulphur dioxide gas in vent conduit 210 reacts with the water in this contact containment area . in fourth conduit 220 , the water / acid and unreacted or undissolved sulphur dioxide gas also experience one or more agitation and mixing episodes . for example , as fluid and gas divert in fourth conduit 220 at elbow 262 , the flow of water / acid and sulphur dioxide gas is mixed and agitated . the water / acid and sulphur dioxide gas are again contained in contact with each other thereafter . as a result , like the water / acid and sulphur dioxide gas in the third conduit 76 , the water / acid and sulphur dioxide gas in fourth conduit 220 may be subject to one or more contact containment portions and on or move agitation and mixing portions . the fourth conduit may have a u - trap 267 . u - trap 267 acts as means to cause bubbles of unabsorbed diatomic nitrogen gas or undissolved sulphur dioxide , if any , to be held or trapped on the upstream side of u - trap 267 in a submersion zone . secondary discharge 264 may also be configured with a vent stack 265 . remaining diatomic nitrogen gas in the system is permitted to escape the system through vent stack 265 . operation of the system reveals that little , if any , sulphur dioxide escapes the system . it is believed that gas that is escaping the system is harmless diatomic nitrogen . this configuration of a sulphur acid generator eliminates the dependence upon use of a countercurrent absorption tower technology of the prior art to effect production of sulphurous acid . nevertheless , as an added safety feature to , and to further diminish any possible sulphur smell emitting from a device , vent stack 265 may comprise a limited exhaust scrubbing tower . as shown in fig2 , 3 , and 7 , vent stack 265 encases two substantially horizontally placed vent screens 269 . in the preferred environment , vent stack 265 is severable and connectable at joint 271 . this facilitates construction shipment and maintenance . the upper vent screen 269 acts to contain path diverters 263 within vent stack 265 . the source of water 295 is disposed to enter vent stack 265 at or near the top of vent stack 265 . a water dispersion device 261 is attached to the end of water conduit 295 inside vent stack 265 above the column of path diverters 263 . the preferred water dispersion device 261 is an i - mini wobbler distributed by senninger irrigation , inc ., orlando , fla ., 32835 , united states of america . in the present invention the water dispersion device 261 is , contrary to its intended use , inverted 180 °. experimentation has shown that the i - mini wobbler is the most effective in an inverted fashion because it duplicates rain in large droplets rather than a mist or spray and due to the wobbling affect of the device , it creates a randomly dispersed water flow thereby more effectively wetting the column of path diverters 263 . this creates a water saturated tortuous path through which any undissolved gases trapped by u - trap 267 and venting out of discharge 264 must filter . in the preferred embodiment , the path diverters 263 are flexrings ® diverters 263 . in this configuration , the only countercurrent flow of water and any undissolved gases is in the exhaust scrubbing tower of vent stack 265 . experimentation has shown that the majority of water entering the system of the present invention enters at inlet 106 . a lesser amount of water enters the system at inlet 246 with only a fraction of the water entering the system through conduit 295 . the flow of sulphur dioxide gas and water through the apparatus / system is depicted in flow diagram fig9 . fig1 , 2 and 3 show a primary pump 280 supplying water through a primary hose 282 to the secondary conduit water inlet 106 at codirectional means 100 . in fig2 , a supplemental or secondary pump 290 supplies water to auxiliary means 240 through a supplemental water conduit hose 294 and to conduit 295 . it will be appreciated that any pump capable of delivering sufficient water to the system may be utilized and the pump may be powered by any source sufficient to run the pump . a single pump with the appropriate valving may be used or several pumps may be used . it is also contemplated that no pump is necessary at all if an elevated water tank is employed to provide sufficient water flow to the system or if present water systems provide sufficient water pressure and flow . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .	2
with reference now to the drawings wherein the showings are for purposes of illustrating the example embodiments only and not for purposes of limiting same , using the variety of methods of the exemplary embodiments of the invention , the example embodiments described herein are directed to improved algal cells and at improving the extraction of desirable compounds from algal cells . the example embodiments are particularly applicable to magnetic separation of microalgae modified to safely assimilate iron in the form of paramagnetic particles from liquid media . ferritin , a protein existing in nearly all living organisms that store iron , is expressed in microalgae . ferritin is an iron storage protein complex consisting of & gt ; 4000 iron atoms arranged such that the complex becomes paramagnetic . however , the amount of ferritin naturally occurring in microalgae is conditionally variable but typically insufficient to permit magnetic separation of algae from liquid media under normal growing conditions . cells containing sufficient amounts of ferritin bound iron ( either internally or externally labeled ) demonstrate a response when exposed to a magnetic field . in a suspension , this response is to move toward one pole or another of the magnetic field . as discussed above , magnetic separation of algae from their liquid medium is desirable because it is less costly and time - and labor - intensive than conventional separation methods . to employ this method of separation , however , the amount of iron in algal cells must be increased such that the cells are sufficiently magnetically susceptible . a specific range of intracellular iron levels is required for normal growth and reproduction . if iron levels fall outside this range , either above or below , growth is slowed . to buffer the bioavailability of intracellular iron , ferritin complexes capture and store excess iron , and subsequently release iron as necessary for optimal growth . iron homeostasis under normal conditions is controlled by ferritin , iron transporters , and iron reductases . with reference now in particular to fig1 a and 1 b , ferritin is nuclear encoded in algae and transported to the chloroplast for incorporation into ferritin complexes . photosynthetic iron requirements in the chloroplast are high , giving the storage of iron in the chloroplast an evolutionary advantage over nuclear , cytoplasmic or mitochondrial localization as it permits a faster response to homeostatic iron levels . the nuclear fer1 gene encodes ferritin in chlamydomonas reinhardtii ( long & amp ; merchant , photochemistry and photobiology , 84 : 1395 - 1403 ( 2008 )). increased storage of iron , over wild type cells , can be therefore achieved by expressing the fer1 gene from chlamydomonas reinhardtii in the chloroplast genome under the control of the rubisco large subunit promoter and atpb 3 ′ utr as seen in fig1 a . in this case , the described fer1 gene encoding ferritin is located on a plasmid adjacent to a selective marker . together these two elements are flanked by regions of sequence homology to an insertion site in the chloroplast genome of interest enabling double crossover homologous recombination . this recombination will successfully insert the selectable marker and the targeted ferritin gene into the chloroplast genome . other potential promoters and terminators may be used such as those for photosynthesis core proteins , 16s rrna , and chlorophyll biogenesis . further alternative promoters may be inducible such that the magnetic properties only present themselves when necessary to reduce the burden of the increased iron requirements . these inducible promoters may be activated by light , specific carbohydrates , salt shock , heat stress , or other signal molecules that could be applied to a production environment . the iron homeostasis is then balanced by increased activity of the iron transporter and coupled iron reductase . ferritin production in cells can also be increased by overexpressing the genes for iron transporters and iron reductases from the constitutively active highly expressed actin promoter . known chlamydomonas reinhardtii iron transporters include ftr1 , fea1 , fea2 , irt1 , and irt2 ( fei et al ., j . of biomedicine and biotechnology , 2010 , 1 - 9 ( 2010 ); allen et al ., eukaryotic cell , vol . 6 , no . 10 : p . 1841 - 1852 ( 2007 )). iron reductases include fre1 which may encode a ferrireductase that aides the transport of iron by reduction of fe 3 + to fe 2 + ( long et al ., genetics soc . of am ., 179 : p . 137 - 147 ( 2008 )). these genes can use their own native terminator or a terminator native to the target host . as shown in fig1 b , fea1 is expressed from the constitutively active highly expressed actin promoter . as with the fer1 example embodiment of fig1 a , alternative promoters , such as those that are activated by the presence of certain compounds or stressors , may make this system inducible . chloroplast genomes of chlamydomonas reinhardtii have been transformed by biolistic bombardment with gold particles containing linearized plasmids carrying at least two kinds of genes and two flanking elements . the two flanking elements are regions of dna taken from the host strain that allow double crossover homologous recombination . this is a naturally occurring process in algal chloroplasts that permits the introduction or recombination of dna elements into a targeted site . for instance these two flanking regions may come from a contiguous region between genes . in this case , the insertion of the genetic material between the two flanking regions on the plasmid will be inserted into a “ neutral region ” on the chromosome . in another scenario it may be necessary to interrupt or “ knock out ” a gene by using two flanking regions comprised of dna sequence identical to sequence from a target gene or from flanking regions around a target gene to be displaced . based on scientific literature , roughly 600 nt of identical sequence in both flanking regions is sufficient for efficient transformation . the first of the two genes used for inducing magnetic susceptibility is a selectable marker . this marker gene can be comprised of an antibiotic resistance gene such as the aada gene conferring resistance to spectinomycin or it could be the reintroduction of a previously displaced gene such as psba or other required native gene . this selectable marker allows the easy identification of colonies after transformation through growth on selective medium ( containing spectinomycin or under photoautotrophic growth respectively for the two example marker genes ). regardless of the gene used as a marker it will be necessary to ensure moderate expression . this is achieved through the use of chloroplast appropriate 5 ′ and 3 ′ utrs . native genes expressed from a chloroplast genome use a typical prokaryotic promoter element with or without a − 35 region . typical 5 ′ utrs contain a − 10 region ( tataatat ) around 10 nucleotides upstream of the + 1 nt of the transcript ( transcript initiation site ) followed closely by a ribosome binding site ( ggcc ). a 5 ′ utr roughly 100 nt in length is sufficient for moderate expression . typically 5 ′ utrs from native genes such as atpa , atpb , psba , psbb , rpoa , or other specific gene are used as promoter elements . 3 ′ utr regions contain a stop codon ( or pair of stop codons ) followed by an at rich region of ˜ 20 nt and a hairpin forming region of dna of roughly 25 nt in length . this stops translation and transcription and stabilizes the transcript for full activity . stopping transcription is required when there are concerns of read through of downstream genes . the second gene used for this construct is the gene conferring the magnetic property . in this example that target gene is ferritin . the native ferritin from the c . reinhardtii nuclear genome is sufficient but will require trimming of the n terminus sequence to its mature form for expression from the chloroplast and codon optimization to that preferred by the target chloroplast . ( joanne c . long , 2008 ). in this case the ferritin gene is expressed using the rbcl 5 ′ utr and atpb 3 ′ utr for expression at high levels in the chloroplast as seen in fig1 . over - expression of the fer1 protein produces ferritin complexes in abundance allowing significantly enhanced iron storage capability . use of native ferritin allows normal iron homeostasis , but with increased storage capacity . iron stored in ferritin complexes are paramagnetic and thus confer the magnetic properties necessary for separation , and magnetic hysteresis . the dna sequence used to generate the fer1 over - expression strain 100 illustrated in fig1 a and described above is , in the example embodiment , as set out as follows ( in fasta format ). & gt ; fer1 overexpression vector sequence for transformation of chlamydomonas reinhardtii chloroplastic genome : with reference to fig1 b , the fea1 over - expression construct for chlamydomonas reinhardtii using the psad promoter and terminator with aphvii as the selective marker in accordance with a further embodiment ( in fasta sequence ) is as set out below . the vector for over - expression of the fea1 gene in chlamydomonas reinhardtii is based on psl18 derived from the work of dèpege et al . ( role of chloroplast protein kinase stt7 in lhcii phosphorylation and state transition in chlamydomonas in science 7 mar . 2003 pages 1572 - 1575 ). this vector contains an aphvii antibiotic resistance gene driven by the hsp / rbcs2 promoter and rbcs2 terminator for selection on paromomycin . the fea1 gene was pcr amplified from cdna of chlamydomonas reinhardtii and cloned in a topo bluntii vector and subsequently sub - cloned in between the psad promoter and terminator sequences of psl18 as shown in fig1 b . the plasmid was linearized and introduced into chlamydomonas reinhardtii strain cc2137 through biolistic transformation . transformants were selected on modified high salt agar plates with paromomycin as the selective agent . isolated colonies were picked and screened for the presence of the introduced fea1 gene ( the introduced fea1 gene can be differentiated from the wild type by the lack of intronic sequences ). positive transformants were then assayed for growth under low iron conditions . the sequence for the two dna elements contained within the transformation vector required for conferring fea1 expression and supplying a positive selection marker in c . reinhardtii is as follows below . & gt ; fea1 nuclear expression vector sequence for the two components required for transformation of chlamydomonas reinhardtii 102 is shown in fig1 b . & gt ; fea1 over - expression construct for chlamydomonas reinhardtii using the psad promoter and terminator with aphvii as the selective marker : in addition to the above , to express the dps gene ( sync — 2856 from the synechococcus strain cc9311 ) in the chloroplast of the green alga chlamydomonas reinhardtii the gene sequence is positioned between the rbcl promoter and atpb terminator such as that described for the fer1 gene . this is then situated within a plasmid construct adjacent to a selective marker gene with a promoter and terminator sequence . these two elements are then situated between two regions of sequence of & gt ; 600 nt in length showing identical sequence to two closely linked sequences in the targeted chloroplast genome . these two regions of sequence homology permit site directed insertion of the dps and selective marker gene ( aada in this example ) into the chloroplast genome of chlamydomonas reinhardtii . an example of how this sequence could be assembled is included in fasta format : gcccttttggcaggacgtccctttccccttacgggatatttatatactc ccatgttttgccctttacgggacgccagtggacgtccccttccccttcc gggcaagtaaacttagggattttaatgcaataaataaatttgtcccctt acgggaatataaatattagtggcagttgcctgccaactgccgaggcaaa taaattttagtggacaaatttatttattgttgcctgccaactgccgata tttatatactccgaaggaggcagttgccggccaactgcctgccccgcag tattaacataagcagtgtcggtaccattgccactggcgtcccgttaggt gttcgtagcaggcagtgtcctgccactgcctcctgtggagtatataaat atccctaagtgtacttgcccgtaaagggaaagggaagggtattttattt actttttaggtttagtaataaatgaatcacaggtaatttcactttacat gccataaactctctaatatacgtaaagcttcgctctgcgcaagactaaa gtgcccaagctcaaagaaccttttcaagagtaaataaattcccttaagg gctaatgagcaaatttaatggttatagttttgtcaagaaacgttagcac tgttagtaccaggtttaaaacatttttaatttttaataatgccaacaaa caatgtcgatgtaagaaatggatttatttttttaataaatttaatttta tgcgtgaatcaattcgaagcgaatatgaagtgagcggttcaaaaagaac aactaactatggctttagatatgtgaaatatctatataactaaattgca cacccttttgtaaatagaacctaaaaaggaaaaaaattgaatttaataa atgacccctcagccaaaaggtatgattggcagtgcctttactcgataaa ccctttggagatttaattgcccttaaaagaaaagactaaaaatgtttgc tacccaggcagtagcgggatttgaaatactccgtacagcagacgtcccc ttacgggacgtcagtggatatttatatactccgaaggaggcagttgcct gccaactgccgatatttatatactgcgataaactttagttgcccgaagg ggtttacatactaggcagtggcggtaccactgccactggcgtcctcctt cggagtatgtaaactacttgcccgaaggggaaggaggaagcaggcagtg gcggtaccactgccccttacgggatccaattgacgggatccgaattccg tgagctcacgcgatcgcgaggtacccatatgactagtcatctagataaa tttgctagtttacattattttttatttctaaatatataatatatttaaa tgtatttaaaatttttcaacaatttttaaattatatttccggacagatt attttaggatcgtcaaaagaagttacatttatttatataaatggcccaa agctccgccatcgatatcggcatcaccagcgcacaacgggaggaaatcg ctgctgaactcagccgcctcctcgcagatacgtacgtgttgtacggcaa aacccacggtttccactggaacgtgaccgggccgatgttcaacacattg cacctgatgttcatggaccagtacaccgagttgtggaacgccctggatg tgatcgctgaacgcatacgcgcccttggcgttttggcgccccatggagg ttccaccctggccggtttggcctcgatccaagaagcagagcaacagcct gccgcgctcgacatggtgcgtgagctggtaaccggccatgaggccgttg cccgtacggcacggagcatctttcctctggcagaggctgccaacgacga acccactgctgacctgctcacccaacgacttcagatccacgaaaaaaca gcctggatgctgcgcagcctgctggaaaactaataactcgagcccggga tgtgtaattaaaataaatatttggacaccattaagttgttttcttctta aagagccaatttattttaattacacatacattatatatgtcatattagc tatttaatctatttactttaaaataaaggacgccgttaaacgtgtacgc gtgcatcggctggtaccatgcatgcggccgcagtagactttattagagg cagtgtttatatacctaaacgtcaaaagtcatttttataactggtctca aaatacctataaacccattgttcttctcttttagctctaagaacaatca atttataaatatatttattattatgctataatataaatactatataaat acatttacctttttataaatacatttaccttttttttaatttgcatgat tttaatgcttatgctatcttttttatttagtccataaaacctttaaagg accttttcttatgggatatttatattttcctaacaaagcaatcggcgtc ataaactttagttgcttacgacgcctgtggacgtcccccccttcccctt acgggcaagtaaacttagggattttaatgcaataaataaatttgtcctc ttcgggcaaatgaattttagtatttaaatatgacaagggtgaaccatta cttttgttaacaagtgatcttaccactcactatttttgttgaattttaa acttatttaaaattctcgagaaagattttaaaaataaacttttttaatc ttttatttattttttcttttatggcaatgcgtactccagaagaacttag taatcttattaaagatttaattgaacaatacactccagaagtgaaaatg tccatggctcgtgaagcggtgatcgccgaagtatcgactcaactatcag aggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgt acatttgtacggctccgcagtggatggcggcctgaagccacacagtgat attgatttgctggttacggtgaccgtaaggcttgatgaaacaacgcggc gagctttgatcaacgaccttttggaaacttcggcttcccctggagagag cgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatc attccgtggcgttatccagctaagcgcgaactgcaatttggagaatggc agcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacat tgatctggctatcttgctgacaaaagcaagagaacatagcgttgccttg gtaggtccagcggcggaggaactctttgatccggttcctgaacaggatc tatttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccga ctgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttgg tacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgact gggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagc tagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgca gatcagttggaagaatttgtccactacgtgaaaggcgagatcactaagg tagttggcaaataacagcttgtactcaagctcgtaacgaaggtcgtgac cttgctcgtgaaggtggcgacgtaattcgttcagcttgtaaatggtctc cagaacttgctgctgcatgtgaagtttggaaagaaattaaattcgaatt tgatactattgacaaactttaatttttatttttcatgatgtttatgtga atagcataaacatcgtttttattttttatggtgtttaggttaaatacct aaacatcattttacatttttaaaattaagttctaaagttatcttttgtt taaatttgcctgtgctttataaattacgatgtgccagaaaaataaaatc ttagctttttattatagaatttatctttatgtattatattttataagta ataaaagaaatagtaacatactaaagcggatgtaactcaatcggtagag tgcgatcgctagcactagtctcgaggtttaaacatgtacaagcttggat caattgattggctgctgtgcagccccaaagtagaagggtacgccagtgg acgtcagtggcaggcaactgcctccttcggagtatataaatattggcag ttggcaggcaactgccactgacgtccacttaaatttatttgcccgaagg ggacgtccactggcgtaccgtaaggggaaggggacacccactggcgtcc cgaaaggattagccaatgggcgaggccactgcttcagctactaaagttt taaagtggtctgttggaccatcaaattcatatggcatgtaatactccta acgctaatgcctggctttagggtcagtttactgacccaaaaacctgtta atagcttgttaaacccttctttcccttttggagtatatcactatcacaa aggggcgtcagatggagttagtaaactttttaaagtgaacaagaatcac agatgtaataagcttattaagtaaagcttagaaaaattgttttaataac taacaaaactttaaaagttcaaaaattttaatgttatgtataatatttt aattaaaaaaaccataactatgtaaaccttctccaattaaatttacacc taaataacaaaaccaaacaactaaaaaaccaacagcagcaataattgcc ggtttttcaccttcccaacc enhanced contamination control and separation efficiency through precise iron dosage and feeding strategies strategic periodic iron dosing can be used to both improve contamination control and enhance both magnetic and gravimetric separation techniques . under this method , a minimal threshold iron requirement is temporarily exceeded through periodic dosing of soluble iron in chelated form . the soluble iron concentration in solution is periodically elevated above the minimal threshold until it is assimilated into algal biomass . the moderate to high cell density of algae with over - expressed high affinity iron transporters out - competes wild - type strains and contaminants for the brief period that iron is available . over time , iron is assimilated into algal biomass and accumulated to increasing levels . just prior to harvesting , iron is dosed to very high levels , and is assimilated into algal biomass . this induces the over - accumulation of ferritin complexes thus achieving the conditions for magnetic separation of the algal biomass . the process of harvesting the biomass removes the iron from solution ( assimilated in algal biomass ) and the process continues while maintaining low iron concentrations . this dosing strategy may also allow ferritin to accumulate in the genetically modified algae in sufficient amounts to permit separation using gravimetric techniques . enhanced lipid extraction using heat produced from rapid magnetic field polarity reversal on modified microalgae the energy required for lipid extraction for algae genetically modified to over - accumulate ferritin complexes can be reduced through the use of magnetic hysteresis . in the presence of a field of reversing magnetic polarity the dipole moment of paramagnetic particles switches orientations . at increased frequencies the internal resistance to this switching results in heat generation . at a frequency of or around 100 khz , magnetic particles contained within or on the surface of algae could produce enough heat to cause cell deterioration and lysis . this is illustrated in fig6 . cell lysis aids in the lipid extraction process as it liberates the oil from within the cell . cell lysis through magnetic hysteresis would reduce the energy requirements for lipid extraction . this is achieved by focusing the energy expenditure on the target magnetically susceptible cells and not on the rest of the water and contaminating species . enhancement of ma g netic susce s tibilit and contamination control throu h iron dosin strategies iron homeostasis is a significant constraint on the welfare of all forms of life . it is absolutely required in several protein complexes and is toxic when exposed to oxygen in the presence of a reduced metabolic state where many forms of reactive oxygen species can be produced . as a result , a mechanism for storing iron and controlling its availability is highly desirable . surprisingly few mechanisms have been identified . instead a nearly ubiquitous mechanism of storing iron in ferritin or bacterioferritin complexes is present . a variety of iron transporters and reductases act to contribute to the iron pool , but ferritin and bacterioferritin are largely responsible for regulating the availability of that iron pool . one way to take advantage of the iron homeostasis mechanism for improved algal biofuels production is to grow the algae in excess iron . iron concentrations at or in excess of 200 micromolar are inhibitory to photoautrophic growth of c . reinhardtii under full sunlight . however , it is not inhibitory to growth under low light or heterotrophic growth . growth conditions where iron is spiked into the medium in the evening when the light levels are low permit optimal growth . the natural process of capturing iron and storing it enables photoautrophic growth when iron levels return to low levels . this condition enhances iron storage in the form of ferritin complexes . this increase in ferritin enhances magnetic susceptibility of the cell which enables magnetic manipulation . with reference next to fig2 , an algal cell 200 is surrounded by chelated ferric / ferrous iron molecules 202 in solution 204 . a ferric iron transporter 210 is illustrated . ferritin complexes 220 and ferric reductases 222 are illustrated schematically . as shown , iron homeostasis under normal conditions is controlled by the ferritin , the iron transporters 210 , and the iron reductases 222 . the embodiments of the disclosure assist in promoting elevated iron homeostasis by enhancing the storage of iron in ferritin , and improving the iron transporters 210 and the iron reductases 222 mechanisms in manners to be described below . in particular , with reference next to fig3 , a schematic representation of iron homeostasis of an algal cell 300 in accordance with an example embodiment having enhanced magnetic susceptibility is shown . in accordance with the embodiments , high iron homeostasis is preferably achieved through at least three ( 3 ) routes , namely an over - expression of the ferritin gene 350 and resulting complexes , an over - expression of the iron transporter 360 and required iron reductase 370 , and an increased availability of iron 380 in the surrounding media either continuously or in sporadic dosing . fig4 presents a schematic illustration of a process 400 for separation of algae 402 with enhanced magnetic susceptibility from liquid media 404 and other organisms 406 . as shown , the algae with enhanced magnetic susceptibility 402 are disposed in a flow 410 of a liquid such as , for example , a water flow . a magnetic field 420 is generated in a direction substantially transverse to a direction 412 of the water flow . under these conditions , high ferritin algae 430 formed in accordance with any of the embodiments herein are reactive to the magnetic field and migrate in a direction transverse to the flow . on the other hand , under these conditions , low ferritin algae 440 not being formed in accordance with any of the embodiments herein , together with any other contaminants 450 are non - reactive to the magnetic field and therefore follow along without significant deviation with the fluid flow 410 . accordingly , by this process and system , high ferritin algae 430 formed in accordance with any of the embodiments herein are easily and efficiently separated from low ferritin algae 440 not being formed in accordance with any of the embodiments herein , together with any other contaminants 450 . fig4 a is a chart illustrating mean velocities of algae cells in a uniform magnetic field such as the field of fig4 . with reference in particular to fig4 a , algae strains in accordance with the embodiments are placed in a fluid bath and the mean velocity of the modified algae cells when exposed to a uniform magnetic field is measured . in accordance with another embodiment , an associated cell tracking velocimetry ( ctv ) instrument is preferably used to help characterize the magnetic moment of selected one or more particle types in the solution . ( chalmers , et . al . quantification of non - specific binding of magnetic micro - and nanoparticles using cell tracking velocimetry : implication for magnetic cell separation and detection , biotechnology and bioengineering , vol . 105 , no . 6 , apr . 15 , 2010 ). as illustrated in the chart , it is demonstrated in accordance with data collected that all of the cells move in the direction of the magnetic field . however only the fer1 strain in accordance with the example embodiment herein moved fast enough to overcome their inherent random motility and gravitational settling . in the plots of fig4 a , it is to be appreciated that the error bars are greater than the mean velocity , except for the fer1 strain 460 grown in elevated iron . while any of these strains could be separated using a stronger magnet than what is in this particular system , the most magnetically susceptible strain and condition was fer1 grown in 3 × the iron content of normal mhs . fig5 shows a schematic illustration of a magnetic separator 500 in accordance with a further embodiment . as shown there , material 502 from a growth pond ( not shown ) is introduced to a rotating magnetic wheel 510 via a fluid chute 504 . the high ferritin algae 530 are attracted to the wheel 510 because of the mutual magnetic properties of the wheel and algae . as discussed in connection with the embodiment of fig4 , high ferritin algae 530 formed in accordance with any of the embodiments herein are easily and efficiently separated from low ferritin algae 540 not being formed in accordance with any of the embodiments herein , together with any other contaminants 550 wherein the contaminants and low ferritin algae 540 pass by the wheel and continue on to a discharge chute 560 to be carried to a treatment plant or otherwise returned to the pond . in addition to the separation technology described above it is also potentially feasible in accordance with the embodiments to use other forms , systems or technologies of magnetic separation including for example superconducting electromagnetic filter separation or high intensity rare earth magnetic drum systems which can handle the high volumes and small particle sizes required for algal biofuels production . fig6 is a schematic comparative illustration 600 showing magnetically induced cell lysis 602 of algae 610 genetically modified in accordance with the embodiments herein to over - accumulate ferritin complexes 620 in accordance with the example embodiments . fig7 illustrates a graph 700 showing enhancement of contamination control and separation efficiency through precise iron dosage and feeding strategies . a minimal threshold iron requirement 710 ( dashed line ) is temporally exceeded through periodic dosing of soluble iron in chelated form . the soluble iron concentration in solution 720 ( black line ) is periodically elevated above the minimal threshold until it is assimilated into biomass . the moderate to high cell density of algae with over - expressed high affinity iron transporters outcompetes wild type strains and contaminants for the brief period that iron is available . iron is assimilated into algal biomass 720 ( gray line ) and accumulated to increasing levels . just prior to harvesting , iron is dosed to very high levels , and is assimilated into algal biomass inducing the over - accumulation of ferritin complexes thus achieving the conditions for magnetic separation of the algal biomass . the process of harvesting the biomass removes the iron from solution ( assimilated in algal biomass ) and the process continues while maintaining low iron concentrations . this dosing strategy may also allow ferritin to accumulate in the genetically modified algae in sufficient amounts to permit separation using gravimetric techniques . with reference next to fig8 , it is to be appreciated that the availability of iron in the growth media is a common constraint for both algae and contaminants in an open pond algal production scenario . the development of algal strains with enhanced iron uptake and storage makes it possible to inhibit growth of contaminants by limiting the bioavailability of iron . algal strains with improved iron uptake or storage can be produced through the over - expression of ferritin , or iron transporters , and their corresponding reductase components . this is demonstrated in fig8 where , as shown , several fea1 over - expression isolates were screened for growth under low iron conditions . in particular , it is to be noted that over - expression of the fea1 gene permits enhanced growth under low iron and low light conditions and can approximate growth of the wild - type under normal iron conditions with low illumination . in this example , the high affinity iron storing algae are grown in medium with iron concentrations below the threshold required to maintain growth of the contaminating species . periodically , additional iron is added to the medium to supply enough iron for algal growth . in a relatively short amount of time , however , this iron is biologically removed from the medium and assimilated into biomass as iron storage particles ( ferritin complexes ). due in part to the high abundance of algae in the medium and largely to the high activity iron transport and storage of the engineered strain , it is able to out - compete contaminating strains and bacteria . the result is a scenario diagrammed in fig7 where genetically modified algae are able to scavenge the trace iron and the temporarily excessively available iron that enables their growth while limiting the growth of competitors . as demonstrated in fig9 a and 9 b , the modified strain over - expressing the fea1 gene under control of the psad promoter and terminator shows improved growth under iron limiting conditions with reduced bacterial contamination when in open containers grown in a greenhouse environment ( full sunlight ). in this case , both strains were grown in open top vessels for a period of nine days . samples were taken to measure optical density at 750 nm to demonstrate growth . after day six , samples were serially diluted and spread plated on tryptic soy agar to isolate single colonies . after one day &# 39 ; s incubation , the colonies formed on the surface of the agar plates were counted ( cfu / ml ). error bars represent the standard deviation across three replicate cultures of each strain at each condition . in fig9 b , as shown , bacterial contamination is reduced by growing cultures under low iron conditions . further improvements result when the algal strain is over - expressing the iron transporter gene fea1 whose gene product scavenges any iron introduced through airborne dust particle contamination or other methods . with reference to fig6 , engineered strains of algae formed in accordance with any of the example embodiments herein are capable of producing excess ferritin complexes and storing iron in abundance inside these complexes making them paramagnetic . this can be achieved through any one or more of the examples provided above . magnetically susceptible cells are then exposed to a magnetic field of reversing polarity of around 100 khz . this field induces magnetic hyperthermia and cell damage . the result is damaged cell walls , which liberate the lipids contained within the cell . when used in combination with magnetic separation , this method reduces the energy requirements for cell lysis as energy is only applied to the target algae species , not contaminating species and excess water . ferritin complexes of the novel algae of the embodiments are susceptible to magnetic hysteresis induced heat generation . under conditions where ferritin complexes are present at high levels , it is possible to induce cell lysis from the heat generated from their resistance to rapid magnetic dipole switching . cell lysis aids the lipid extraction process in the example embodiment by liberating the oil within the algal cells . fig1 , 11 a , and 11 b are charts with examples of one measure of increased productivity of modified strains grown under conditions of depleted iron and under excess iron . in both cases growth enhancement is demonstrated by increases in optical density which is often accepted as increases in biomass on a per volume basis . in fig1 the fer1 overexpression strain 1003 tolerates the switch to low iron media and grows for several generations before inernal iron stores are depleted and growth becomes limited while the wild type strains growth 1004 is limited immediately upon transfer to low iron media . note that the greater lag demonstrated by the wild - type strain 1002 is likely a result of the edta washes used to remove iron from the external surface of the cells . the actual growth maximum approximates that of the fer1 overexpression strain 1001 . the impact of an extended lag period in growth is uncertain , whereas the impact of maximal growth rate is a certain impact on productivity . fig1 a and 11 b demonstrate the additive or even synergistic impact of overexpression of multiple genes involved in iron assimilation on growth in media containing elevated iron . fig1 a illustrates a strain comparison graph 1100 in media containing 28 micromolar iron and fig1 b illustrates a strain comparison graph 1102 in media containing 96 micromolar iron . the ff7 strain 1110 co - expresses both fea1 and fer1 and confers greater tolerance to growth at high iron concentrations than either of the fea1 1112 or fer1 1114 overexpression lines , both of which are arguably better than wild - type 1116 at growth under elevated iron conditions .	2
for purposes of the present invention , a carboxylic acid includes a polycarboxylic acid . toxicity is the highest concentration at which a substrate can be added to a culture broth of candida sp . without causing undue inhibition of growth , unacceptable amounts of cell death or undue interference with the bioconversion process . this invention provides a process for introducing hydroxyl , aldehyde and / or carboxylic acid functionalities into organic substrates by fermentation with by candida sp . examples of suitable particular candida sp . useful herein include c . albicans , c cloacae , c . guillermondii , c . intermedia , c . lipolytica , c . maltosa , c . parapsilosis , and c . zeylenoides and c . tropicalis . while it is known that certain alkane and fatty acid substrates with terminal methyl groups can be oxidized to form alcohols or carboxylic acids and that fatty acids possessing one or more internal double bonds or secondary alcohol functionality are capable of undergoing ω - oxidation , the effects of additional functionality , such as double bonds , alcohol groups , etc . were unknown in the biooxidation process . according to the present invention , it has been determined that the overall capability of candida sp . to perform biochemical oxidations on a variety of chemical substrates is dependent on the presence of at least one methylene group between a terminal methyl group and the rest of a substrate molecule . in the first phase of this testing , substrates were selected because they contained a terminal methyl group . in addition , they possessed additional functionality such as a double bond , alcohol group , etc . classes of substrates tested included primary and secondary alcohols , α - olefins , ketones , epoxides , alkenes , alkynes , sulfur compounds , branched - chain fatty acids , guerbet alcohols , fatty acid esters , natural oils , and sterols . a second phase of testing was conducted on additional substrates , including a homologous series of varying aliphatic chain lengths attached to a cyclohexane ring . the second series of tests obtained additional information about the oxidation products using analysis by gas chromatography - mass spectrometry ( gc / ms ) in addition to ir and nmr analyses . a preferred species of candida sp . is c . tropicalis . although wild - type c . tropicalis may be utilized to convert substrates , according to the present invention strains in which the β - oxidation pathway is partially blocked , are preferred . for example , genetically modified c . tropicalis having chromosomal pox4a , pox4b and pox5 genes disrupted to block β - oxidation pathway may be utilized . examples of strains of c . tropicalis which are partially β - oxidation blocked include , h41 , h41b , h51 , h45 , h43 , h53 , h534 , h534b and h435 as described in aforementioned u . s . pat . no . 5 , 254 , 466 . an example of a completely β - oxidation blocked strain of c . tropicalis wherein all pox4 and pox5 genes are disrupted is h5343 ( atcc 20962 ) as described in u . s . pat . no . 5 , 254 , 466 . the sequence in which the four pox genes are disrupted is immaterial . when all of these pox genes are disrupted , they no longer encode the functional acyl - coa oxidase isozymes necessary for the β - oxidation pathway . therefore , the substrate flow in this strain is redirected to the ω - oxidation pathway as the result of functional inactivation of the competing β - oxidation pathway by pox gene disruption . in another preferred embodiment , c . tropicalis strains having one or more cytochrome p450 genes and / or reductase genes amplified may be utilized . for example , c . tropicalis strains which have a greater number of cpr genes than the wild type strain have shown increased productivity of carboxylic acids as described , e . g ., in aforementioned u . s . pat . no . 5 , 620 , 878 . specific examples of cpr genes include the cpra and cprb genes of c . tropicalis 20336 as described , e . g ., in u . s . application ser . no . 09 / 302 / 620 and international application no . pct / us99 / 2097 , each incorporated herein by reference . these strains provide an increase in the amount of rate - limiting ω - hydroxylase and an increase in the rate of substrate flow through the ω - oxidation pathway . preferred strains of c . tropicalis are h5343 ( atcc accession no . 20962 ), ar40 ( atcc no . 20987 ) and r24 . see u . s . pat . nos . 5 , 620 , 878 and 5 , 648 , 247 . the genetically β - oxidation blocked strain of c . tropicalis used in a preferred embodiment has been shown previously to perform a ω - oxidation reaction on the terminal methyl group of long - chain fatty acids and alkanes . while the preferred strain of c . tropicalis is a β - oxidation - blocked strain , any c . tropicalis strain , no matter whether the strain can perform β - oxidation or not , may be used . a complete or partial block in β - oxidation only decreases the probability that the substrates tested or their oxidation products will be degraded , and increases the likelihood of detecting biooxidation products , if formed . with some substrates , there is also the possibility that degradation might occur through pathways other than β - oxidation . therefore , some observed loss of starting material might be due to degradation rather than volatility , although volatility of substrates is the most likely cause for low recoveries . in one embodiment of the invention , the substrate to be converted is solubilized in a solvent . in a preferred embodiment , the solvent is an organic solvent such as acetone , ethanol , or hexane , with acetone being most preferred . the solvent is utilized in amounts that are not toxic to candida sp . but still capable of solubilizing the substrate . substrates themselves should be tested for their toxicity prior to bioconversion . the data obtained from these experiment is useful in three ways : 1 ) it ensures that candida sp . remain viable after induction and can adequately perform the biooxidation process ; 2 ) the volatility of test substrates can be assessed ; and 3 ) knowing the toxicity of a test substrate ensures that the maximum amount of sample can be added . the organic substrate is any organic compound having at least one terminal methyl group attached to at least one methylene group . examples of organic substrates which can be used in the process according to the invention include but are not limited to ch 3 ch 2 - ethers , ch 3 ch 2 - epoxides , ch 3 ch 2 - saturated primary alcohols , ch 3 ch 2 - alkoxy , ch 3 ch 2 - diols and ch 3 — ch 2 diol esters . in addition to the above , the organic substrate which can be used in the process according to the invention include but are not limited to ch 3 ch 2 - cycloalkyl , ch 3 , ch 2 - aryl and the like . the fermentation step is preferably carried out in two stages . in the first stage , a culture medium is inoculated with an active culture of candida sp . such as β - oxidation blocked c . tropicalis strain where a period of rapid exponential growth occurs . in the second stage , which occurs as the cell growth of the first stage enters stationary phase , the substrate is added wherein the biooxidation described herein takes place . since energy can no longer be produced from the substrate in β - oxidation blocked strains , it is necessary to add a cosubstrate . the cosubstrate is a fermentable carbohydrate such as glucose , fructose , maltose , glycerol and sodium acetate . for larger industrial fermentations , the preferred cosubstrate is glucose , preferably a liquid glucose syrup , for example , 95 % dextrose - equivalent syrup , or even lower dextrose - equivalent syrups . for shake flask experiments , the preferred cosubstrate is glycerol . such materials contain small amounts of disaccharides , trisaccharides , and polysaccharides which can be hydrolyzed during the fermentation by the addition of an amylase enzyme such as α - amylase , glucoamylase and cellulase . thus glucose can be provided in situ in a reaction simultaneous with the biooxidation . the fermentation conditions and procedures are similar to those disclosed in u . s . pat . no . 5 , 254 , 466 . the fermentation step can be modified by utilizing a triglyceride fat or oil as the source of both the organic substrate and cosubstrate . a lipase , formulated with the fermentation broth , hydrolyzes or splits the fat or oil into fatty acids and glycerine . glycerine consumption by the organism serves to drive the splitting reaction to completion while supplying the energy necessary to convert the free fatty acids to their corresponding alcohols or acids . lipases that are oleo - specific are particularly preferred . oleo - specific lipases exhibit a high selectivity for a triglyceride having a high oleic acid content and selectively catalyze the hydrolysis of the oleate ester groups . examples of such oleo - specific lipases include but are not limited to the lipases produced by pseudomonas sp , humicola lanuginosa , candida rugosa , geotrichum candidum , and pseudomonas ( burkholderia ). a particularly preferred lipase is unlipase from geotrichum candidum atcc no . 74170 described in u . s . pat . no . 5 , 470 , 741 , the entire contents of which are incorporated herein by reference . after the substrates were added to candida sp . and biooxidation occurred , samples were obtained , dried and analyzed . those skilled in the art are familiar with many techniques for purification and analysis of alcohols , aldehydes and carboxylic acids . in the present case , the dried samples were weighed and dissolved in an nmr appropriate solvent . c 13 and h - nmr were performed on an adequate amount of recovered sample using a varian unity 400 ( varian , inc .). however , analysis via nmr - spectroscopy has its limitations . it can only estimate what changes occurred and identify functional groups , but not identify the actual compounds that have been synthesized . in complex mixtures , particularly , nmr may miss a small amount of oxidation product altogether . additionally the extraction process solubilized a number of cellular components , such as cell membrane lipids and other fatty acids produced from the added carbon source ( glycerol ). antifoam was also detected . therefore , for complex mixtures with only small amounts of product formation , it might be useful to use ir , gc / ms , lc / ms , hplc / ms or other analytical techniques for a more accurate and precise analysis . ir can be performed using , for example , a nicolet magna - ir 560 . in a preferred embodiment , gc / ms is also performed . samples are silylated prior to gc / ms analysis , but acetylation and methylation may also be performed with certain samples , to make derivatives . derivatives aid in interpretation of the mass spectra by making the compound better suited for structure elucidation , particularly for identification of hydroxy derivatives by silylation . these molecular weight differences assist in assigning structures to components of samples . samples may be separated using any procedure known to those skilled in the art , such as a j & amp ; w db - 5ms ( 60m × 0 . 25 mm × 0 . 25 um ) column ( j & amp ; w scientific , folsom , calif .). gc / ms can be performed on any suitable apparatus that permits accurate readings following the manufacturer &# 39 ; s protocol , such as an autospec x015 vg ( micromass ltd ., manchester , england ) triple sector mass spectrometer ( e - b - e configuration ). the results indicate that candida sp . possess significant genetic and biochemical variability , since they have the capability to oxidize methyl groups attached to a variety of r - groups . tests with a homologous series of aliphatic chains attached to cyclohexane ( methylcyclohexane , ethylcyclohexane , propylcyclohexane , and butylcyclohexane ) indicate that the methyl group must be part of an aliphatic chain of at least two carbons ( ethyl group ). to date , no evidence of oxidation of a secondary , tertiary , or aromatic methyl group has been observed . most substrates tested herein have the general formula : r —( ch 2 ) n — ch 3 , where r is an epoxide , alkoxy , ether , saturated primary alcohol , cycloalkyl , aryl , diol , or diol ester . substrates were selected that allowed the determination of the minimum chain length required for oxidation ( n in the formula ). other substrates were selected to determine what types of functional groups ( r in the formula ) are compatible with biooxidation . the results of the experiments clearly indicate that the terminal methyl groups of propyl and butyl chains ( or larger ) attached to a variety of functional groups can be oxidized by candida sp . overall , oxidation was seen where a terminal methyl group was adjacent to a methylene group . accordingly , depending upon the number of such groups , monoacids , diacids , triacids , etc . could be produced . likewise , the number of oh groups and cho groups generated by biooxidation will vary based on the number of suitable terminal methyl groups . oxidation of substrates having branched structures which provides multiple terminal methyl groups will produce greater numbers of oxidized species . in addition , the results with ethylcyclohexane indicate that the terminal methyl group of the ethyl chain can also be oxidized . the successful oxidation given the bulkiness of the cyclohexyl moiety would indicate that ethyl groups attached to other functionalities are oxidizable at the terminal methyl group as well . the evidence available indicates that n in the previously described formula is 1 or higher . the results indicate that an aliphatic chain can be attached to a variety of functional groups without preventing biooxidation of the terminal methyl group as long as a methylene separates the terminal methyl group from the rest of the molecule . if substrates and / or products contain both an acid and alcohol functionality , esterification between acid and alcohol groups is observed to occur to a certain extent . without wishing to be bound by any theory , this is likely catalyzed by either internal or external lipases , which are known to catalyze esterification reactions in hydrophobic environments . epoxy groups are opened to form diols . all epoxy groups of the soybean oil plastolein 9232 ( epoxy soya ) were opened . this observation has now been confirmed by finding that 1 , 2 - epoxytetradecane is oxidized to yield the corresponding ( ω , ω − 1 )- hydroxyfatty acid . primary aliphatic alcohols are oxidized at the terminal methyl to yield alcohols or diacids . shorter chain alcohols , such as dodecanol , show an unusually low degree of reaction that may be due to the inhibition of growth due to lauric acid product formation . the series butylcyclohexane , propylcyclohexane , ethylcyclohexane , and methylcyclohexane , was tested to determine the minimal aliphatic chain length needed for oxidation of the terminal methyl group to occur . the results described below indicate that the minimal chain length is two ( ethyl group ). no oxidation of aliphatic chain lengths shorter than two ( methyl group ) has been observed . in order to achieve a higher yield of oxidation product or to allow the oxidation to go to completion (— ch 3 —→— ch 2 oh —→— cho —→— cooh ), the process of biooxidation could be prolonged to 72 hours or more . one method for doing this would be to add another batch of carbon source and / or sample after the initial time period . very volatile samples should be added more often during the biooxidation process as well as samples that can only be added at lower concentrations ( to avoid toxicity ). the following examples are merely illustrative of certain aspects of the invention and should not be construed as limiting the invention in any manner . toxicity tests of organic solvents since some of the substrates were solid at room temperature or were added at low concentrations , they were first solubilized in an organic solvent , prior to their addition to the yeast culture . since some solvents exhibit toxicity to candida sp ., one of the first steps was to evaluate the toxicity of four potential organic solvents : acetone , chloroform , ethanol and hexane . these solvents were chosen because of their potential for solubilizing the majority of the test substrates . acetone in particular was considered to be a good solvent , since it could solubilize most of the organic substrates to be tested , yet was itself soluble in the aqueous culture medium . the concentration at which a test solvent became lethal to candida sp . was determined by testing its ability to grow in the presence of different solvents at different concentrations . cell growth in the presence of the different solvents was monitored spectrophotometrically using a shimadzu uv160a uv - visible recording spectrophotometer . for each solvent tested , ypd was added to five autoclaved glass tubes . 6 ml was transferred to the first and 3 ml to the rest . 4 % solvent was added to the first tube . then the solvents were serially diluted to give concentrations from 4 % to 0 . 25 % by pipetting 3 ml from one tube to another . the tubes were mixed well between transfers . to achieve the serial dilution for chloroform and hexane , which are not soluble in aqueous solutions , it was necessary to pipette up and down or vortex until a uniform suspension formed . after completing the dilutions , 10 ml of an overnight grown ypd culture of c . tropicalis was added to each tube and the culture was allowed to grow in the presence of the solvents . as a positive control , one culture was inoculated in ypd alone . after 24 h in a 30 ° c . shaker at 220 rpm the cultures were sampled . the samples were then diluted in ypd 1 : 100 and the absorbance ( abs ) measured spectrophotometrically at a wavelength of 600 nm as an indicator for growth . each culture was also examined under the microscope . the results of this test are shown below in table 1 . three out of four solvents were found to be useful . in addition to being a very good solvent , acetone was found to be nontoxic at concentrations of 4 % or lower . because of this , it was the solvent of choice for the majority of the substrates . both ethanol , which was found to be nontoxic at 4 %, and hexane , which was found to be nontoxic at 2 %, were found to be suitable solvents . chloroform was not an acceptable solvent , since it was found to be lethal at concentrations greater than 1 % and it precipitated various components of the broth at these concentrations . growth of c . tropicalis strain h5343 was measured by absorbance at 600 nm . this experiment examined the toxicity of test substrates . the data collected from example 1 was used to help prepare a stock solution of the test substrate in one of the solvents . stock solutions of most substrates in concentrations from 100 g / l to 500 g / l were made using acetone as a solvent . aqueous solutions of polyethylene glycol were prepared . in the few cases that the substrate could not be dissolved in any of the tested solvents , it was added neat . the toxicity test used here was similar to that used for the solvents described in example 1 . the goal was to determine the highest concentration at which a substrate could be added to a culture broth without being toxic , inhibiting growth , or interfering with the bioconversion process . c . tropicalis strain h5343 was grown in the presence of the substrate at different concentrations and growth was monitored spectrophotometrically . in order to determine if the substrate was lethal or was simply inhibiting growth , the cultures were examined under the microscope and streak plates of ypd and lb agar were prepared . contamination of the culture with an unwanted organism could also be detected using this approach . table 2 lists the substrates that were tested along with their source . for each substrate tested , ypd was added to five autoclaved glass tubes . 6 ml was transferred to the first tube and 3 ml to the rest . 1 % substrate was added to the first tube and then serially diluted to give concentrations from 1 % to 0 . 015 %. since the last tube was initially empty , the concentration in the last two tubes was the same . except for the last tube , 10 ml of an overnight ypd culture of c . tropicalis was added to each tube , the last tube was a control for contamination . the cultures were then allowed to grow in the presence of the substrates . as a growth - control one culture without substrate was inoculated . after 48 h in a 30 ° c . shaker at 220 rpm the cultures were sampled . the samples were then diluted in ypd 1 : 100 and growth was measured spectrophotometrically at a wavelength of 600 nm . to determine if contamination had occurred , each culture was examined under the microscope and streak plates of both ypd and lb were made from the 1 % and the inoculated 0 . 015 % tube . table 3 below shows that most substrates were not toxic at a concentration of 1 % or less . some , however , were found to be highly toxic to c . tropicalis and were not suitable for further testing . the maximum non - toxic concentration of each substrate , as determined from the toxicity testing in example 2 , was employed for the bioconversion testing in shake flask experiments . since the majority of substrates tested were not toxic at 1 %, the experiments were carried out in a volume of 50 ml in a 500 ml baffled shake flask . the test substrate was added as a stock solution dissolved or diluted in an appropriate solvent ( generally acetone ). polyethylene glycol and its derivatives , however , were dissolved either in water or were added neat , depending - on viscosity and solubility . each experiment was done in duplicate . a control without the organism was run for each substrate to verify that chemical modifications were the result of the bioconversion by candida . the uninoculated controls were run under the same conditions as the inoculated flasks . the bioconversion tests were undertaken following a shake flask protocol . on the first day , 100 ml of ypd was inoculated with a fresh colony of c . tropicalis h5343 in a 1000 ml baffled shake flask . the ypd contained 3 g / l bacto ® yeast extract ( difco ), 20 g / l bacto ® peptone ( difco ), and 20 g / l bacto ® dextrose ( difco ). one drop of sag471 ( commercially available from witco ) concentrate was added as an antifoaming agent . the culture was then incubated in a 30 ° c . shaker at 300 rpm for 20 hours . after a growth phase of 20 hours , the 100 ml ypd culture was transferred to 900 ml ym - broth . the ym - broth contained 3 g / l bacto ® yeast extract , 3 g / l bacto ® malt extract , 5 g / l bacto ® peptone , and 10 g / l bacto ® dextrose . the 1000 ml was dispensed to five 2000 ml baffled shake flasks in 200 ml aliquots . again , one drop of sag471 concentrate was added to each flask . the cultures were then allowed to grow for 30 hours in a 30 ° c . shaker at 300 rpm . the cells were then centrifuged for 5 min . at 4068 g at room temperature . the supernatant was discarded and the cells were resuspended in 1000 ml dca3 . dca3 is a 0 . 3 m potassium phosphate buffer , ph 7 . 5 , containing 50 g / l glycerol and 6 . 7 g / l yeast nitrogen base . after resuspension , 50 ml was transferred to 500 ml baffled shake flasks . the substrate was then added at the optimal concentration determined in the toxicity test described above in example 2 . one drop of sag 471 concentrate was added to each flask prior to incubation for 48 hours in a 30 ° c . shaker at 300 rpm . after 48 hours , the cultures were transferred to 50 ml falcon tubes and stored frozen at − 20 ° c . until analyzed . in the standard procedure for extraction , the whole sample was poured into a separation funnel and acidified with 5 ml hcl [ 12n ]. a mix of 30 ml diethyl ether and 20 ml petroleum ether was added and the separation funnel was extracted using standard extraction protocols . the water phase was removed to another separation funnel . again , a mix of 30 ml diethyl ether and 20 ml petroleum ether was added and the separation funnel shaken in the usual manner . the water phase was then discarded . water was added to both separation funnels , which were shaken again . the water phase was discarded and both ether phases were combined and filtered into preweighed beakers through sodium sulfate to remove any remaining water . the solvent was then allowed to evaporate in the hood to leave the dried sample behind . due to its water - solubility , polyethylene glycol and its derivatives . required a different extraction method . 10 ml of sample broth was diluted with 90 ml hplc - grade acetone and anhydrous magnesium sulfate was added to remove the water . the suspension was stirred for 1 - 2 min and was subsequently filtered into a preweighed beaker . the filter residue was rinsed with hplc - grade acetone and the pooled acetone fractions were allowed to evaporate in the hood . the dried sample was weighed and dissolved in an nmr appropriate solvent . c 13 and h - nmr were performed with an adequate amount of recovered sample on a varian unity 400 ( commercially available from varian , inc .). the bioconversion of dodecene was tested following the procedures set forth in example 3 . a low amount of sample was recovered , about 10 % of the starting weight , part of which was the sag 471 antifoam . the recovered material had significantly reduced α - olefin and terminal ch 3 . the nmr on the sample obtained showed that one major functionality is carboxylic acid . another is 1 , 2 - diol . it is not certain from the spectra whether there is any c 2 di - acid or if the product is predominantly 11 , 12 - dihydroxydodecanoic acid . interestingly , a little fatty type unsaturation and polyunsaturation was seen . a minor amount of some unknown aromatic was also seen . the bioconversion of 1 - tetradecene was tested following the procedures set forth in example 3 . recovery was 0 . 16 g ( 32 %). the nmr analysis was very similar to example 4 . again , ch 3 and α - olefin were reduced significantly ( not necessarily on the same molecules ). again , significant acid was formed , and the 1 , 2 - diol was more distinct , indicating 13 , 14 - dihydroxytetradecanoic acid . some internal unsaturation was also seen , indicating undesired microbial fatty acid modification . no triglyceride was seen , despite glycerin being utilized as a nutrient . the bioconversion of 2 - heptylundecanoic acid was tested following the procedures set forth in example 3 . recovery was 0 . 38 g ( 76 %). nmr analysis showed approximately 25 % reduction of the chain terminal ch 3 . a significant part of this reduced ch 3 is present as primary hydroxyl and ester of primary hydroxyl . products formed include hydroxylated 2 - heptylundecanoic acid and carboxy - 2 - heptylundecanoic acid . interestingly , a small amount of unsaturation , typical of fatty unsaturation , was also seen , plus the ch 2 between olefin groups of fatty polyunsaturation , indicating the organism can convert some of this branched acid to oleic and linoleic acids . samples from the control showed nmr peaks as expected for the title substrate , along with a small amount of ester of the incompletely oxidized residual alcohol . the bioconversion of 1 - dodecanol was tested following the procedures set forth in example 3 . recovery was 0 . 22 g ( 44 %). ir analysis showed acid , ester , and hydroxyl . nmr analysis showed little , if any reduction of the terminal ch 3 to dodecanedioic acid . apparently approximately 25 % of the alcohol functionality oxidized to dodecanoic acid , some of which then esterified . also , some of the alcohol was oxidized to the n - aldehyde . approximately 0 . 4 % of the product was n - aldehyde , 4 . 5 - 5 % was dehydrated aldol condensate , and approximately 12 % was aldehyde di - alkyl acetal . products seen include dodecanal , dodecanoic acid , and 1 , 12 - dodecanedioic acid . in the control , only the starting 1 - dodecanol was detected . the bioconversion of 6 - undecanol was tested following the procedures set forth in example 3 . only 0 . 14 g , about 28 % of the starting weight , was recovered in the extract , indicating that most of the substrate was either totally consumed by the organism , lost to evaporation , or somehow lost in extraction . the extract recovered was nearly identical to the starting material , with the addition of a little sag 471 antifoam containing polypropylene glycol . the bioconversion of 1 2 - hydroxystearic acid was tested following the procedures set forth in example 3 . the starting material is about 4 % self - esterified , and contains about 4 % 12 - ketostearic acid . 0 . 39 g or 78 % of sample was recovered . nmr analysis on the control showed no reaction . the finished extract showed a slight decrease of the keto group , a slight decrease in ester , and a slight increase in unsaturation , from about 1 % to about 2 %. of most significance , however , is that the presence of terminal ch 3 dropped about 25 %, apparently by oxidation to the acid , 7 - hydroxyoctadecanedioic acid . the bioconversion of castor oil was tested following the procedures set forth in example 3 . recovery was 0 . 20 g ( 40 %). nmr analysis on the products showed that the terminal ch 3 was about 25 % gone , to 7 - hydroxy - 9 - octadecene - 1 , 1 8 - dioic acid , since no primary alcohol or ester of primary alcohol was seen . however , the triglyceride functionality and the chain secondary hydroxy have undergone an apparent random transesterification , yielding a mix of mono -, di -, and triglycerides , plus an ester of secondary oh and residual free secondary oh . also seen at a minor level was the ester of 2 - enoic acid , possibly formed by oxidation at the secondary hydroxyl . a few other small nmr peaks were unidentified . nmr analysis of the control reaction showed only peaks expected for castor oil , with a little random transesterification ( 1 , 2 and 1 , 3 - diglycerides and esterified chain secondary oh ), much lower than in the bio - oxidized product . the control sample also showed none of the 2 - enoate observed in the bio - oxidized product . the bioconversion of plastolein 9232 ( epoxidized soybean oil ) was tested following the procedures set forth in example 3 . 0 . 17 g of the initial sample ( 34 %) was recovered . nmr analysis showed terminal ch 3 was nearly all gone , apparently oxidized to polycarboxy polyhydroxy soybean oil . the epoxy groups were nearly completely opened to diols , some of which were esterified to the newly formed acids , and some possibly transesterified with glyceride . triglyceride appeared to be only partially intact and may be partially transesterified with the new acids and diols . in contrast , the control reaction showed only the unreacted starting material . the bioconversion of 2 - hexyldecanol ( eutanol g - 16 ) was tested following the procedures set forth in example 3 . recovery was 0 . 34 g or 70 %. nmr analysis showed the starting hydroxyl remained unoxidized . the terminal ch3 were depleted approximately 15 %, forming primary oh or acid . products found were carboxy - 2 - hexyldecanol and hydroxylated 2 - hexyldecanol . nmr analysis of the control sample showed only peaks expected for the product , with a few minor components , including a vinylidene olefin and an α - branched aldehyde , both still present in the oxidized product . analysis ofthe control revealed no oxidation ofthe terminal methyl group . the bioconversion of hexadecyl acetate was tested following the procedures set forth in example 3 . recovery was 0 . 24 g or 28 %. nmr analysis showed that the acetate was completely gone , either lost in extraction or utilized by the organism as an energy source . the resulting primary oh was 85 % gone , and the terminal ch 3 was 95 % gone , oxidized to 1 , 16 - hexadecanedioic acid . the rate of oxidation appeared higher than for simple alcohols , such as the dodecanol and oleyl alcohol , with hexadecamediac acid as the product . interestingly , again some unsaturation was present . no triglyceride was seen . the bioconversion of hexadecyl pelargonate was tested following the procedures set forth in example 3 . recovery was 0 . 24 g ( 48 %). the nmr results showed the terminal ch 3 was reduced about 50 %, and the expected 1 , 16 - hexadecanedioic acid was formed . also , some ester of primary oh , about 25 % of the starting ester linkages , and some free primary oh were observed . significant hydrolysis and oxidation had occurred . the bioconversion of sclareol was tested following the procedures set forth in example 3 . recovery was 0 . 39 - g ( 78 %). proton and c13 apt nmr analysis showed no differences from the starting material . ( the sclareol was not pure , showing an unidentified impurity , estimated at about 10 %.) the bioconversion of polyethylene glycol was tested following the procedures set forth in example 3 . this sample was water - soluble and thus not ether extractable . therefore , the total sample was acidified with hcl , diluted 5 : 1 in acetone , and the precipitated salts filtered out . the liquid was allowed to evaporate in a hood at room temperature . the residue was then rinsed with acetone - d6 for nmr analysis . surprisingly this showed some oleic acid , some polypropylene glycol from the sag - 471 , and polyethylene glycol . there was no evidence of any peg ester or terminal acid . thus any peg oxidized was not recoverable with the acetone . the bioconversion of trans - 2 - nonene was tested following the procedures set forth in example 3 . recovery was very low . nmr analysis showed some evidence of a non - 2 - enoic acid , possibly non - 2 - enedioic acid , but also triglyceride , internal chain unsaturation , and some much longer chain length material that might be a simple fatty triglyceride . the bioconversion of 7 - trans - tetradecene was tested following the procedures set forth in example 3 . nmr analysis showed that only 3 . 5 % of the starting terminal ch 3 remained . most was converted to 7 - trans - tetradecenedioic acid and 14 - hydroxytetradeceneoic acid , with a small amount of free primary hydroxyl and approximately 0 . 2 - 0 . 3 % esterified primary hydroxyl . interestingly , about 20 - 25 % of the sample contained fatty type cis unsaturation . nmr analysis of the starting olefin showed a similar cis / trans isomer mix . the bioconversion of 2 - ethylhexanoic acid was tested following the procedures set forth in example 3 . a very small sample was recovered the ch 3 : ch 2 cooh ratio appeared to be about 1 : 1 . unsaturation was also present , and the ch 2 chain length was closer to oleic acid than to the shorter starting material or to the desired oxidation products . thus , this material appears to have been nearly totally consumed or lost in extraction . the bioconversion of 6 - dodecyne was tested following the procedures set forth in example 3 . another very low recovery sample ( possibly because of volatility during reaction ). nmr analysis showed some normal fatty olefinic unsaturation . some triglyceride and terminal ch 3 amounts were rather high , indicating the recovered sample was high in normal fat , and very low in reaction product . some residual alkyne and some ester of primary hydroxyl was present . the bioconversion of ocenol oleyl alcohol was tested following the procedures set forth in example 3 . nmr analysis showed that the terminal ch 3 was 80 % gone , apparently replaced by 1 , 18 - octadecenedioic acid and 18 - hydroxyoctadeceneoic acid . in addition , primary oh was significantly reduced , with only 13 % remaining as free oh and 4 % present as an ester , as well as esters of oleyl alcohol . thus the sample appears to be high in octadecanedioic acid , but with some 18 - hydroxyoleic acid and its esters , as well as esters of oleyl alcohol . this sample was the first to show a little triglyceride ( about 1 %). the bioconversion of a generol 122n sterol mix was tested following the procedures set forth in example 3 . nmr analysis showed only unreacted starting materials . additional substrates were to be tested for bioconversion following a slightly different protocol than the one noted above in example 3 . those substrates also had to be tested for toxicity similar to the test described in example 2 , to determine the highest concentration at which a substrate could be added to a culture broth without being toxic , inhibiting growth , or interfering with the bioconversion process . c . tropicalis was grown in the presence of the substrate at three different concentrations and growth was monitored spectrophotometrically . in contrast to example 2 , all test substrates were added directly to the culture medium without dissolving in solvent . the tests were completed as follows : on the first day , h5343 was grown in ypd medium ( 25 . 0 ml seed culture ) overnight on a rotary shaker at 30 ° c . and 250 rpm . the next day 1 . 0 ml of the seed culture was used to inoculate a new flask of 50 ml ypd . this culture was grown overnight on a rotary shaker at 30 ° c . and 250 rpm . 25 ml of the ypd broth was added to each of three 250 ml baffled shake flasks to which either 1 %, 0 . 5 % or 0 . 1 % ( either w / v or v / v , depending upon the state of the test substrate ) of the test substrate had been added . two control flasks were each inoculated with h5343 in 25 ml ypd . all flasks were incubated on a rotary shaker at 30 ° c . and 250 rpm . after 24 hours incubation , the absorbance at 600 nm of the test and control flask cultures was determined , using uninoculated ypd broth as blank . cultures were diluted so that the od 600nm measured between 0 . 15 and 0 . 3 . table 4 shows that many of the substrates to be tested were not toxic at a concentration of 1 % or less . other substrates were found to inhibit growth at high concentration , but not at lower concentrations , while some inhibited fairly strongly even at the lowest concentration . for strongly inhibitory substrates , a concentration of 0 . 1 - 0 . 2 % was chosen for the bioconversion tests . the concentration used in the bioconversion tests is shown in table 4 . using the data generated in example 23 , the bioconversion testing was performed using substrate concentrations determined to be neither lethal nor inhibitory in concentrations noted above in table 4 . the test substrate was added directly to a shake flask , either as a solid or as a liquid . a revised shake flask protocol was utilized for the evaluation of yeast strains for diacid production activity . a single isolated colony was inoculated into 50 ml ypd broth in a 500 ml baffled shake flask . the mixture was then incubated 24 hours at 30 ° c . and 300 rpm on a rotary shaker - incubator . 15 ml of the ypd - grown culture was then transferred into 135 ml dca2 medium in a 1000 ml baffled shake flask for a total volume of 150 ml . ( the dca2 medium was prepared by combining 3 g bacto ® peptone , 6 g yeast extract , 3 g sodium acetate , 7 . 2 g k 2 hpo 4 , and 9 . 3 g kh 2 po 4 with milli - q ® water to produce 1l . then , 117 ml of the dca2 mix was added to 15 ml 50 % ( w / v ) glycerol in a 1000 ml baffle flask and autoclaved . the mixture was then allowed to cool and added to 3 ml 50 × ynb ( 334 g / l ).) 100 μl of sterile 1 : 10 sag 471 antifoam solution was added to each flask . the mixture was then incubated for 24 hours at 30 ° c . and 300 rpm on a rotary shaker - incubator . cells from the dca2 - grown culture were then harvested by centrifugation at 5000 rpm for 5 minutes . the spent broth was poured off and each cell pellet resuspended in 150 ml dca3 without glycerol ( approximately 1 . 1 times concentration of dca2 culture ). ( the dca3 was prepared by adding 975 ml 0 . 3 m khpo4 buffer , ph 7 . 5 ( 0 . 3 m k 2 hpo4 solution adjusted to ph 7 . 5 with 0 . 3 m kh 2 po 4 solution ), to 25 ml ynb . the mixture was increased to 1 l with milli - q ® water , mixed , and filter sterilized .) a 50 ml aliquot of this dca3 suspension was added to a 500 ml baffled shake flask containing appropriate amount of substrate , as determined by toxicity analysis . 100 μl of a 1 : 10 dilution of sag 471 antifoam was added to each flask . the flask was then incubated at 30 ° c . and 300 rpm on a rotary shaker - incubator . one hour after initial induction , 2 ml of a sterile 50 % ( w / v ) glycerol solution was added to each flask . eight hours after induction , an additional 1 ml of the glycerol solution was added to each flask . the reaction was stopped after 24 - 30 hours in all flasks by placing the flasks in a − 20 ° c . freezer . for the extraction of the product , the frozen shake flask sample was first thawed in a 37 ° c . water bath . 5 ml 12n hcl was added to the sample flask and well mixed . the acidified sample was poured into a 250 ml separatory funnel . 60 ml ethyl ether and 40 ml petroleum ether were combined into the empty sample shake flask and swirled well to mix and rinse flask . this was added to the separatory finnel , which was capped and shaken for 1 minute , pausing occasionally to release gas pressure . after standing for 5 minutes , the water layer was removed by decanting into the empty shake flask . the upper solvent layer was decanted into 50 ml centrifuge tubes and centrifuged for 15 minutes in a tabletop centrifuge at 3500 rpm . the ether layer was transferred by pipette to a collection beaker for evaporation . this extraction procedure was repeated on the aqueous layer with the exception that 30 ml ethyl ether and 20 ml petroleum ether were added to the aqueous layer prior to extraction . the two ether extracts were combined in the beaker and the solvents were allowed to dry at ambient temperatures , leaving product behind . the product was redissolved in a small amount of ethyl ether and was transferred to a tared hplc vial and the solvent was allowed to evaporate . the sample weight was taken by calculating the difference between the weigh of the sample + hplc vial and the tared weight of the vial itself . the percent recovery was determined by dividing the weight of the recovered sample by the weight of the sample originally added to the flask and multiplying the result by 100 . the sample was then submitted first for nmr analysis and , if evidence of oxidation was observed , was later submitted for gc / ms analysis . the bioconversion of butylcyclohexane was tested following the procedures set forth in example 24 . recovery was low ; 0 . 05 g was recovered from 0 . 537 g starting material ( 9 . 3 % recovery ). this low recovery reflects the volatility of the test substrate . the nmr results obtained for this sample indicate that of the sample recovered , a small but significant portion was determined to be the polypropylene glycol from the sag 471 antifoam . it was found to contain considerable carboxylic acid . some portion of that carboxylic acid was thought to be the anticipated product . the sample was found to contain material that was far more linear than expected , and demonstrated chain unsaturation and polyunsaturation . it also showed a little triglyceride . finally , the sample demonstrated an oxygen bearing ch , indicating oxidation of the chain off the ring , to cyclohexyl ester or ether . the products noted were 2 - butylcyclohexanone , 4 - cyclohexylbutanol , 4 -( 2 - hydroxycyclohexyl ) butanol , 4 -( 2 - hydroxycyclohexyl ) butanoic acid , cyclohexylbutanoic acid , and 4 - cyclohexyl - 2 - hydroxybutanoic acid . the gc / ms results indicated that the expected reaction product , cyclohexylbutyrate , as well as the intermediate alcohol , was formed . surprisingly , oxidations of the cyclohexane ring were also found . additionally , some oxidation of the alpha carbon on the butyl group was observed as well . since recovery was low , the individual reaction products represented only small quantities , but indicated additional oxidation capabilities for this organism besides ω - oxidation . as these results were obtained in shake flask experiments , the product type and quantity might be influenced by a controlled substrate feed in a fermenter vessel . the bioconversion of propylcyclohexane was tested following the procedures set forth in example 24 . recovery was only 0 . 049 g from 0 . 252 g starting material ( 19 . 4 % recovery ). this low recovery reflects the volatility of the test substrate . the nmr results obtained for this sample indicate that of the sample recovered , a small but significant portion was determined to be the polypropylene glycol from the sag 471 antifoam . the sample , however , was found to contain considerable carboxylic acid , with a portion of that carboxylic acid was thought to be the anticipated product . the sample was found to contain material that was far more linear than expected , and contained chain unsaturation and polyunsaturation . the methyl to acid ratio indicates considerable di - acid in the sample . as with the butylcyclohexane reaction , an oxygen bearing ch , indicating oxidation of the chain off the ring to cyclohexyl ester or ether , was observed . the products found were 3 -( 2 - hydroxycyclohexyl ) propanoic acid , cyclohexylpropanoic acid and 3 - cyclohexyl - 2 - hydroxypropanoic acid . the gc / ms results were similar to what was observed with butylcyclohexyane in that the expected product , cyclohexylpropionic acid ( the main product ), was detected . oxidation of the cyclohexane ring was also found in small amounts . additionally , some oxidation of the alpha carbon on the propyl group was observed as well . the bioconversion of ethylcyclohexane was tested following the procedures set forth in example 24 . recovery was 0 . 052 g from 0 . 100 g starting material ( 52 % recovery ). the nmr results obtained for this sample indicate the presence of a little bht and polypropylene glycol , plus the same unknown aromatic . it is a predominantly linear carboxylic acid , higher in di - acid than the methylcyclohexane product . also present was some triglyceride , a 1 , 3 - diglyceride , and the same sterol as above , though at a lower level . no starting material remained . however , a little cyclohexylacetic acid has also apparently been made , but far less than the fatty derived material . the results of the gc / ms analysis were in agreement with the nmr data in detecting the expected product , cyclohexylacetate , in small amounts . in this case , however , neither oxidations of the cyclohexane ring nor of the alpha carbon of the acetyl group were detected . the bioconversion of methylcyclohexane was tested following the procedures set forth in example 24 . recovery was 0 . 055 g from 0 . 150 g starting material ( 36 . 7 % recovery ). the nmr results obtained for this sample indicate that the vast majority of the small sample recovered was a fatty triglyceride with some 1 , 3 - diglyceride and some carboxylic acid . also seen was some highly branched material , possibly some type of sterol like ergosterol ( though not with a double bond at position 5 ). a little polypropylene glycol ( antifoam ), bht ( from extraction solvent ), and some unidentified aromatic were also found . no methylcyclohexane was seen . any product was minor , if present at all . because of these results , this sample was not submitted for gc / ms . the bioconversion of naringenin ( 4 ′, 5 , 7 - trihydroxyflavanone ) was tested following the procedures set forth in example 24 . naringenin was selected for testing to determine if c . tropicalis was capable of oxidizing it to the corresponding isoflavone . recovery was 0 . 222 g from 0 . 503 g starting material ( 44 . 1 % recovery ). because of solubility problems , the nmr for this sample was examined in acetone - d6 instead of cdcl 3 . the recovered sample was nearly identical to the starting material . the only loss was that of a minor ethyl acetate contaminant in the starting material , probably a crystallization solvent . new peaks were only a minor amount of residual ethyl ether , trace sag 471 antifoam , and a small amount of unsaturated fatty acid , possibly partly oxidized to . diacid . this is probably a fatty acid made by the organism . no new aromatic components were seen . low recovery was probably due to poor extraction due to partial solubility in water , though it is possible the material may have been metabolized . the conclusion from this test is that naringenin is not oxidized by c . tropicalis . the gc / ms results confirmed the nmr analysis , indicating nothing but starting material in the extracted sample . the bioconversion of 2 - hexyl - 1 - decanol ( guerbet alcohol ) was tested following the procedures set forth in example 24 . this substrate was selected to determine how easily the terminal methyl of the hexyl moiety is oxidized . it is also another example of a guerbet alcohol and offers another test of the capability of c . tropicalis to oxidize a primary alcohol attached to a one - carbon chain on a branched compound . recovery was good , 0 . 244 g from 0 . 255 g starting material ( 95 . 7 % recovery ). the nmr results obtained for this sample indicate that none of the starting alcohol functionality had oxidized to acid ( or ester ). however , about 16 % of the alcohol had esterified . significant carboxylic acid functionality was seen . approximately 9 % of original terminal ch 3 had oxidized to alcohol , of which 18 % was esterified . about 55 - 60 % of terminal ch 3 had oxidized to acids , part of which were esterified . residual ch 3 was still significant . interestingly , there was a little unsaturation . the gc / ms profile demonstrated that both the c - 8 and the c - 6 side chain methyl groups were oxidized to the alcohol and then the acid , as expected . products found were 2 -( 6 - hydroxyhexyl )- 1 - docanol , 2 - hexyl - 1 , 10 - decanediol , 7 - hydroxymethyl - pentadecanoic acid , 10 - hydroxy - 9 - n - hexyl - decanoic acid , 15 - hydroxy - 7 - hydroxymethyl - pentadecanoic acid , 15 - hydroxy - 9 - hydroxymethyl - pentadecanoic acid , and 7 - hydroxymethyl - 1 , 15 - pentadecanedioic acid . there was no evidence of any oxidation of the initial primary alcohol , however . the bioconversion of 2 - hexyldecanoic acid was tested following the procedures set forth in example 24 . this substrate was chosen to determine if a triacid product could be made from the branched acid starting material . recovery was 0 . 469 g from 0 . 528 g starting material ( 88 . 8 % recovery ). the nmr results obtained for this sample indicate that slightly over half the starting terminal ch 3 groups remained , while less than half were oxidized to acid or hydroxyl . some was esterified to branched acid , and some to linear . it was not certain if there was any tri - acid , or only mono and di - acids . again , some chain unsaturation was seen . the products found were 2 -( 6 - hydroxyhexyl )- 1 - decanoic acid , 10 - hydroxy - 2 -( 6 - hydroxyhexyl )- decanoic acid , 7 - carboxy - pentadecanoic acid , 9 - carboxy - pentadecanoic acid , 15 - hydroxy - 7 - carboxy - pentadecanoic acid , and 15 - hydroxy - 9 - carboxy - pentadecanoic acid . the gc / ms profile showed that both the c - 8 and the c - 6 side chain methyl groups were oxidized to the alcohol and at least one side chain was oxidized to acid . unfortunately there was no evidence of any formation of the triacid . in principle , since the analogous guerbet alcohol described previously showed oxidation of both terminal methyl groups to the acid , this material should also oxidize both . the bioconversion of 1 - hexadecene was tested following the procedures set forth in example 24 . a longer - chain α - olefin than was previously tested was chosen to confirm that the ( ω , ω − 1 )- dihydroxy fatty acid could be produced . recovery was 0 . 358 g , from 0 . 502 g starting material ( 71 . 3 % recovery ). the diols made may have been slightly water soluble and partially lost in extraction . the nmr results obtained for this sample indicate that about 70 % of terminal ch 3 was oxidized to 15 , 16 - dihydroxyhexadecanoic acid . about 50 % of vinyl unsaturation remained , 50 % oxidized to diol . ir indicated the presence of some ester . again , some chain unsaturation was seen , indicating the organism may be making fatty acids . the gc / ms data confirmed the results of the nmr . the ( ω , ω − 1 )- dihydroxy fatty acid was formed as the major product in the reaction . the bioconversion of 2 - butyl - 1 - octanol was tested following the procedures set forth in example 24 . this guerbet alcohol was selected to determine if the terminal methyl of the butyl group could be oxidized to the acid . recovery was 0 . 201 g from 0 . 254 g starting material ( 79 . 1 % recovery ). ir examination showed some carboxylic acid , and residual oh , plus a little ester . nmr indicated about half the ch 3 groups had oxidized , mostly to acid , but a little to terminal oh . the alpha branched oh appears to be un - oxidized , but about 10 - 15 % of these starting oh groups were esterified . again , a significant amount of unsaturated fatty material was seen . the products found were 2 -( 6 - hydroxybutyl )- 1 - docanol , 2 - propyl - 1 , 8 - octanediol , 7 - hydroxymethyl - undecanoic acid , 8 - hydroxy - 7 - n - propyl - octanoic acid , 11 - hydroxy - 5 - hydroxymethyl - undecanoic acid , 11 - hydroxy - 7 - hydroxymethyl - undecanoic acid , and 7 - hydroxymethyl - 1 , 11 - undecanedioic acid . the gc / ms profile showed that both the c - 4 and the c - 6 side chain methyl groups were oxidized to the alcohol and then the acid , as expected . as with 2 - hexyl - 1 - decanol , there was no evidence of any oxidation of the initial primary alcohol . the bioconversion of hexyl ether was tested following the procedures set forth in example 24 . this substrate was chosen for testing to determine if the r - group attached to the aliphatic chain could be an ether . recovery was 1 . 049 g from 0 . 261 g starting material ( 402 % recovery ). the sample was diluted in acetone - d6 for nmr examination . as with other samples , there was a little unsaturated fatty acid , some polypropylene glycol ( sag 471 ), and a minor amount of triglyceride . of primary concern , however , was the ether bond remaining intact , and about 80 % of the ch 3 oxidizing to carboxylic acid . the gc / ms data confirmed that the expected diacid , 7 - oxa - 1 , 13 - tridecanedioic acid , was the major product . the bioconversion of dodecylvinyl ether was tested following the procedures set forth in example 24 . this substrate was selected for testing to determine the fate of the terminal diol attached directly to the ether functionality . it was also of interest to determine if the terminal methyl group could be oxidized . recovery was 0 . 233 g from 0 . 260 g starting material ( 89 . 6 % recovery ). the nmr results obtained for this sample indicate that the vinyl group was missing . also , about 60 % of the terminal ch 3 had oxidized to dodecanedioic acid , with a small amount of primary oh . however , the peaks demonstrating carboxylate were stronger than expected , indicating c 12 diacid formation . other major functionalities noted included an alkyl alkoxy glycolate ( ether - ester ), and surprisingly , an acetaldehyde di - alkyl acetal . the gc / ms profile demonstrated that although there appears to be a tiny amount of the expected ( ω , ω − 1 )- dihydroxy fatty acid the major product was the c 12 diacid . it appears that the terminal diol was cleaved and the ether group was oxidized to the acid , with the alcohol intermediate detected as well . the bioconversion of dibutyl sulfone was tested following the procedures set forth in example 24 . recovery was 0 . 209 g from 0 . 26 g starting material ( 80 . 4 % recovery ). nmr showed a little sag 471 , a little unsaturated fatty acid , and minor unidentified material , but predominantly unreacted dibutyl sulfone . no gc / ms analysis was performed . the bioconversion of butylmalonic acid was tested following the procedures set forth in example 24 . recovery was 0 . 325 g from 0 . 253 g starting material ( 128 % recovery ). this sample was dissolved in acetone - d6 for nmr analysis , which indicated considerable unreacted starting material remained , with some normal unsaturated fatty acid , a little sag 471 , and little or no desired tri - acid . no gc / ms analysis was performed . the bioconversion of butyl sulfoxide was tested following the procedures set forth in example 24 . recovery was 0 . 152 g from 0 . 259 g starting material ( 58 . 7 % recovery ). the nmr results obtained for this sample indicate that a small amount of unsaturated fatty acid was present , along with some sag 471 . the main components however were approximately 80 % dibutylsulfoxide and approximately 20 % dibutyl sulfone . no gc / ms analysis was performed . the bioconversion of 2 - butyloctanoic acid was tested following the procedures set forth in example 24 . recovery was 0 . 114 g from 0 . 144 g starting material ( 79 . 2 % recovery ). nmr showed predominantly unreacted starting material , with a little polypropylene glycol ( antifoam ), bht , and minor ether peroxides and other by - products . based on data from the corresponding guerbet alcohol , one would have expected this material to be oxidized to some degree . the bioconversion of 3 - hexylthiophene was tested following the procedures set forth in example 24 . recovery was 0 . 109 g from 0 . 122 g starting material ( 89 . 3 % recovery ). nmr indicated the material was mostly unreacted starting material . several minor peaks were seen , which remain unidentified , but did not indicate the expected oxidation of the terminal ch 3 to acid . instead , it appears some polyhydric material was formed , possibly from the solubilization of a sugar adduct to an organically soluble material . a small amount of polypropylene glycol and minor unsaturatedlfatty acid or ester was also seen . no gc / ms analysis was performed . the bioconversion of 1 - octadecene was tested following the procedures set forth in example 24 . recovery was 0 . 287 g from 0 . 502 g starting material ( 57 . 2 % recovery ). the nmr results obtained for this sample indicate that some fatty acid was present , and some residual α - olefin , but about half the olefin had oxidized to 1 , 2 - diol , and about 80 % of the terminal ch 3 had oxidized to acid , indicating that the expected ( ω , ω − 1 )- dihydroxy fatty acid , 17 , 18 - dihydroxyoctadecanoic acid was formed . no gc / ms analysis was performed . the bioconversion of pentyl ether was tested following the procedures set forth in example 24 . like the hexyl ether , this substrate was tested to determine if the terminal methyl groups of the pentyl chains could be oxidized . recovery was 0 . 100 g from 0 . 123 g starting material ( 81 . 3 % recovery ). nmr results indicate the ether remained intact , and about 50 % of the terminal ch 3 was oxidized to 6 - oxa - 1 , 11 - undecanedioic acid . some intermediate primary oh and an ester of primary oh was also seen . this result confirmed that the terminal methyl on the c 5 chain could be oxidized to the acid . no gc / ms analysis was performed . the bioconversion of 3 - octanone was tested following the procedures set forth in example 24 . this substrate was tested to determine if c . tropicalis could oxidize the terminal methyl group ( either the c 4 or c 2 ) attached to a ketone functionality . recovery was 0 . 069 g from 0 . 135 g starting material ( 51 % recovery ). nmr showed some of the product to be fatty acid . some ppg and some bht ( ether stabilizer ) was also seen . interestingly , the 3 - octanone was nearly completely gone , with 3 - octanol being seen . product loss was likely due to volatility during solvent evaporation after extraction . no gc / ms analysis was performed . the bioconversion of 1 , 2 - epoxytetradecane was tested following the procedures set forth in example 24 . this substrate was selected to confirm the results of the tests on epoxy soya , where it was found that the epoxy rings were split to form a diol . recovery was 0 . 349 g from 0 . 534 g starting material ( 65 . 4 % recovery ). the nmr results obtained for this sample indicate that epoxy was completely gone , replaced by diol . most of the terminal ch 3 ( about 80 %) was oxidized to the acid 13 , 14 - dihydroxytetradecanoic acid . since the nmr results were fairly convincing , no gc / ms analysis was performed . the bioconversion of 1 , 2 - hexadecanediol was tested following the procedures set forth in example 24 . this substrate was tested to demonstrate the ability to form a ( ω , ω − 1 )- dihydroxy fatty acid . recovery was 0 . 138 g from 0 . 253 g starting material ( 54 . 5 % recovery ). nmr shows the 1 , 2 - diol to be unchanged , as expected from olefin studies . but , interestingly , ch 3 oxidation to the 15 , 16 - dihydroxyhexadecanoic acid was lower than seen with octadecene , because the starting material was solid . conversion was only about 30 %. some fatty unsaturation and minor polypropylene glycol were also seen . since the nmr results were fairly convincing , no gc / ms analysis was performed . the bioconversion of di - isobutylene was tested following the procedures set forth in example 24 . this substrate was tested because it is a potential solvent for use in the c18 : 1 diacid recovery process . it was important to determine the fate of any residual dib that might be left in recovery side streams that could potentially be recycled back to later fermentations . recovery was 0 . 029 g from 0 . 125 g starting material ( 23 . 2 % recovery ). the nmr results showed long chain linear unsaturated mono and di - acids , about 15 % of which were present as triglycerides . also seen was a little polypropylene glycol ( from the sag 471 antifoam ) along with some trace bht , possibly a stabilizer in the extraction solvent . there was little evidence of any branched materials , indicating the test substrate was either degraded or was lost during testing or extraction . it also indicated that no non - volatile oxidation products were formed in the process . because of this result , no gc / ms analysis was performed . the bioconversion of vmlp naptha was tested following the procedures set forth in example 24 . recovery was 0 . 024 g from 0 . 125 g starting material ( 19 . 2 % recovery ). the nmr results obtained for this sample indicate that little or no vmlp oxidation product appeared to have been formed . the product was predominantly a mix of linear unsaturated mono and di - acids , with a small amount of polypropylene glycol . interestingly , little or no triglyceride was present . because of this result , no gc / ms analysis was performed . the bioconversion of 2 - methyl - 3 - heptanone was tested following the procedures set forth in example 24 . this was another test for the ability of c . tropicalis to oxidize the terminal methyl group of an aliphatic chain attached to a semi - complex ketone functionality . recovery was 0 . 062 g from 0 . 050 g starting material ( 124 % recovery ). the nmr results obtained for this sample indicate the presence of a blend of triglyceride , 1 , 3 - diglyceride , possible ergosterol , bht , and polypropylene glycol . some residual starting material was detected . in such a mix , it is difficult to say if desired product has been formed or not . this was not submitted for gc / ms analysis . the bioconversion of 3 - butyl - 2 ( 1 - ethylpentyl ) oxazolidine was tested following the procedures set forth in example 24 . recovery was 0 . 021 g from 0 . 100 g starting material ( 21 % recovery ). the nmr results obtained for this sample indicate the presence of some apparent fatty derived material , though less than the other samples . bht , other minor aromatics and polypropylene glycol seen in the other samples were again seen . no residual starting material was seen . also , the branched carbon between the oxygen and nitrogen of the starting material was totally absent . the low level of the oxidation product in this complex mix made identification difficult . but some significant ch 3 was seen , indicating something from the starting material , but ring degradation rather than acid formation . it is also possible that some desired product , may have been made , but being amphoteric , was more soluble in water than in extraction solvent . this sample was not submitted for gc / ms analysis . nmr on the sample obtained showed considerable long chain unsaturated fatty material was formed , which was partially oxidized to di - acid . considerable sterol was also present , plus polypropylene glycol , and a little bht . other major aromatic compounds were present , but the starting 1 , 4 - diethyl benzene appeared to be mostly reacted . the predominant product was 4 - ethylphenylacetic acid . there appeared to be little or no 1 , 4 - phenylenediacetic acid , the possible di - oxidized product . a summary of the results of the bioconversion testing described in the above examples is set forth below in table 5 . it will be understood that various modifications may be made to the embodiments disclosed herein and that the above description should not be construed as limiting , but merely as exemplifications of preferred embodiments . those skilled in the art will envision other modifications within the scope and spirit of the claims appended hereto .	2
reference is now made in detail to the description of the embodiments as illustrated in the drawings . while several embodiments are described in connection with these drawings , there is no intent to limit the invention to the embodiment or embodiments disclosed herein . on the contrary , the intent is to cover all alternatives , modifications , and equivalents . several embodiments of the invention are described below , in which additional training symbols may be used to further estimate channel characteristics . thus , unlike prior systems and methods , which required enormous processing power or additional presumptions about a multi - branch transmitter - diversity system , the embodiments below provide for simpler calculations and fewer presumptions in characterizing multi - branch transmitter - diversity systems . fig3 a and 3b are diagrams illustrating one embodiment of a system for estimating channel characteristics . fig3 a is a diagram showing symbols to be transmitted from a first transmitter , while fig3 b is a diagram showing symbols to be transmitted from a second transmitter . fig3 a and 3b show a physical layer convergence procedure ( plcp ) preamble field for use in synchronization ( sync ) is shown for one embodiment of the invention . as shown in fig3 a and 3b , the plcp preamble includes a short - training period 310 , a long - training period 320 following the short - training period 310 , a signaling period 330 following the long - training period 320 , and a plurality of data periods 340 , 342 , 344 that follow the signaling period 330 . the long - training period 320 , the signaling period 330 , and the plurality of data periods 340 , 342 , 344 each include a guard interval as defined in the ieee 5 ghz standard . thus , as shown in fig3 a , the first transmitter transmits symbols during the short - training period 310 in accordance with the ieee 5 ghz standard . once the short - training symbols have been transmitted , long - training symbols x 355 a and x 365 a are transmitted during the long - training period 320 . here , the capital symbol x denotes a set of the frequency domain quantities in an orthogonal frequency division multiplexing ( ofdm ) system . thus , x can be viewed as a vector containing n elements , where n is the number of sub - carriers in the ofdm system . each element x ( k ) of x is carried by its corresponding kth sub - carrier . it should be appreciated that x is inverse fourier transformed to a time domain signal , added with a cyclic prefix , and converted to a radio - frequency ( rf ) analog signal by an rf module prior to being radiated from a transmit antenna . the duplicative transmission of x is followed by transmission of signaling information s 370 a during the signaling period 330 . upon transmitting the signaling information s 370 a , a complex conjugate x * 385 a of the long - training symbol is transmitted during a first data period 340 . since , as described above , each element in x is real , it is axiomatic that each element in x * is also real . additionally , since each element in x is real , it is also axiomatic that x * is identical to x . it should , however , be understood that , outside of the context of the ieee 5 ghz standard , x need not be wholly real - valued , and that x may contain complex numbers having imaginary components . similarly , as shown in fig3 b , the second transmitter transmits symbols during the short - training period 310 in accordance with the ieee 5 ghz standard . once the short - training symbols have been transmitted , long - training symbols x 355 b and x 365 b are transmitted during the long - training period 320 . the duplicative transmission of x is followed by transmission of signaling information s 370 b during the signaling period 330 . upon transmitting the signaling information s 370 b , a negative complex conjugate − x 385 b of the long - training symbol is transmitted during a first data period 340 . since each element in x is real , each element in − x * is also real . again , it should be understood that , outside of the context of the ieee 5 ghz standard , x need not be wholly real - valued and may contain complex numbers having imaginary components . in this regard , if x is generally complex - valued , then the training symbols transmitted during 385 a and 385 b may be the symbol pairs of (− x , x ), ( x , − x ), (− x , x ), or ( x , − x ). for simplicity , the description below show non - limiting examples using symbol pairs (− x , x ) and ( x , − x ). as described here , rather than merely duplicating the transmission of x , the system of fig3 a and 3b supplements the duplicative transmission of x with x * at the first channel , and supplements the duplicative transmission of x with − x * at the second channel . several advantages of supplementing the long - training symbols with x * and − x * are described below with reference to fig4 . fig4 is a diagram illustrating a two - branch transmitter - diversity ofdm system as a wireless device 470 and a receiver 405 . the wireless device 470 may be a wireless local area network ( lan ) access point unit , a wireless lan card , a cellular telephone , a wireless personal digital assistant ( pda ), a portable computer having wireless transmission capabilities , etc . as shown in fig4 , the wireless device 470 comprises two transmitters 460 , 465 that are adapted to transmit data in an orthogonal frequency - division multiplexing ( ofdm ) environment . the receiver 405 is adapted to receive signals from the two transmitters 460 , 465 . as shown in fig4 , a first channel transfer function h a alters signals that are transmitted from the first transmitter 460 while a second channel transfer function h b alters signals that are transmitted from the second transmitter 465 . thus , if the first transmitter 460 and second transmitter 465 transmits x ( i . e ., inverse fourier transforms x to generate a time domain signal x , adds a cyclic prefix to generate x cp , converts x cp to a radio - frequency ( rf ) analog signal x rf by an rf module , and radiates x rf at the transmit antenna ), then the received symbol y 1 is represented in the frequency domain by : y 1 =( h a · x )+( h b · x )+ z 1 [ eq . 12 ]. where z 1 represents the noise for first received symbol . since the same training symbol x is transmitted from both branches of the two - branch transmitter - diversity system , eq . 12 may be simplified to : y 1 =( h a + h b )· x + z 1 [ eq . 13 ]. similarly , since the same training symbol is transmitted again , the second transmission from the two transmitters 460 , 465 may be seen as : y 2 =( h a + h b )· x + z 2 [ eq . 14 ]. also , if signaling information 370 a is transmitted as a third transmitted symbol t 3 , then : y 3 =( h a + h b )· s + z 3 [ eq . 15 ], where s represents the frequency - domain signaling information . in one embodiment , upon transmitting the signaling information s , the complex conjugate x * 385 a of the long - training symbol is transmitted from the first transmitter 460 as the fourth symbol t 4 , and a negative complex conjugate − x * is transmitted from the second transmitter 465 as the fourth symbol t 4 . as described above , since x is real , both the complex conjugate x * and the negative complex conjugate − x * are real . additionally , since x is real : thus , in the context of the ieee 5 ghz standard , the fourth received symbol may be represented as : y 4 =( h a · x )+( h b ·(− x ))+ z 4 [ eq . 19 ], y 4 =( h a − h b )· x + z 4 [ eq . 20 ]. combining eqs . 13 and 20 provides an approach in which h a and h b may be isolated . in other words , unlike prior - art approaches in which an aggregate effect h c = h a + h b of the channels is calculated , individual channel characteristics of h a and h b may be calculated since : ( y 1 + y 4 ) · x * = ( ( h a + h b ) · x + z 1 ) · x * + ( ( h a - h b ) · x + z 4 ) · x * ⁢ ⁢ = 2 ⁢ ⁢ h a ′ ⁢  x  2 + ( z 1 + z 4 ) · x * . [ eq . ⁢ 21 ] it should be appreciated that each item in eq . 21 is a frequency domain representation of an ofdm symbol . from the perspective of the sub - carrier , eq . 21 may be rewritten as : ( y 1 ( k )+ y 4 ( k ))· x ( k )= 2 h a ( k )·\| x ( k )\| 2 +( z 1 ( k )+ z 2 ( k ))· x ( k ), k = 1 , n [ eq . 22 ], where n represents the number of ofdm sub - carriers , and k represents the sub - carrier index . the channel transfer function h a ( k ) may be obtained by : h a ⁡ ( k ) = ( y 1 ⁡ ( k ) + y 4 ⁡ ( k ) ) · x ⁡ ( k ) 2 - ( z 1 ⁡ ( k ) + z 4 ⁡ ( k ) ) · ( k ) 2 . [ eq . ⁢ 23 ] thus , based on eq . 23 , h a can be estimated as : h a ⁡ ( k ) ≈ ( y 1 ⁡ ( k ) + y 4 ⁡ ( k ) ) · x ⁡ ( k ) 2 , k = 1 , ⋯ ⁢ , n , [ eq . ⁢ 24 ] h a ≈ ( y 1 + y 4 ) · x 2 . [ eq . ⁢ 25 ] it should be appreciated that an estimation error proportional to the noise term ( z 1 + z 4 ) x / 2 is inherent in eqs . 24 and 25 . generally , the mean of the estimation error is equal to e ( z 1 + z 4 )/ 2 = 0 , where e represents the statistical - expected - value function . correspondingly , the variance of the estimation error is equal to var (( z 1 + z 4 ) x / 2 )= var (( z 1 + z 4 )/ 2 )= var (( z 1 + z 4 )/ 2 )= σ z 2 / 2 , where var () represents the statistical - variance function , and z 1 and z 4 are presumed to have variance σ z 2 . the characteristics of the second channel h b may similarly be obtained using : ( y 1 - y 4 ) · x * = ( ( h a + h b ) · x + z 1 ) · x * - ( ( h a - h b ) · x + z 4 ) · x * ⁢ ⁢ = 2 ⁢ ⁢ h b ′ ⁢  x  2 + ( z 1 - z 4 ) · x * , [ eq . ⁢ 26 ] h b = ( y 1 - y 4 ) · x 2 - ( z 1 - z 4 ) · x 2 . [ eq . ⁢ 27 ] h b ⁡ ( k ) = ( y 1 ⁡ ( k ) - y 4 ⁡ ( k ) ) · x ⁡ ( k ) 2 - ( z 1 ⁡ ( k ) - z 4 ⁡ ( k ) ) · x ⁡ ( k ) 2 , ⁢ k = 1 , ⁢ … ⁢ , n . [ eq . ⁢ 28 ] similar to eqs . 24 and 25 , an estimation error proportional to the noise term ( z 1 − z 4 ) x / 2 is inherent in eqs . 28 and 29 . thus , the mean of the estimation error is equal to e (( z 1 − z 4 ) x / 2 )= 0 , and the variance of the estimation error is equal to var (( z 1 − z 4 ) x / 2 )= var (( z 1 − z 4 )/ 2 )= σ z 2 / 2 . thus , as seen from eqs . 12 through 29 , each individual channel may be accurately characterized by transmitting x and − x * during one of the data periods . hence , rather than merely characterizing the aggregate of the channels , estimates of each individual channel may be derived from the approach outlined above . in another embodiment , greater signal integrity and lower estimation error may be achieved by combining eqs . 13 , 14 , and 20 . since eqs . 13 and 14 represent duplicative transmissions of the same training symbol x , combining eqs . 13 and 14 may be seen as a further signal averaging . thus , by exploiting the snr improvement gained by the duplicative transmission of the training symbol x , the channels may be isolated according to : ( y 1 + y 2 + 2 y 4 ) x = 4 h a ·\| x \| 2 +( z 1 + z 2 + 2 z 4 )· x [ eq . 30 ], h a = ( y 1 + y 2 + 2 ⁢ y 4 ) · x 4 - ( z 1 + z 2 + 2 ⁢ z 4 ) · x 4 , [ eq . ⁢ 31 ] h a ⁡ ( k ) = ( y ⁡ ( k ) 1 + y 2 ⁡ ( k ) + 2 ⁢ y 4 ⁡ ( k ) ) · x ⁡ ( k ) 4 - ( z 1 ⁡ ( k ) + z 2 ⁡ ( k ) + 2 ⁢ z 4 ⁡ ( k ) ) · x ⁡ ( k ) 4 , ⁢ k = 1 , ⁢ … ⁢ , n , [ eq . ⁢ 32 ] h a ⁡ ( k ) ≈ ( y ⁡ ( k ) 1 + y 2 ⁡ ( k ) + 2 ⁢ y 4 ⁡ ( k ) ) · x ⁡ ( k ) 4 , k = 1 , ⁢ … ⁢ , n . [ eq . ⁢ 33 ] thus , unlike eqs . 24 , 25 , 28 , and 29 , the estimation error induced by the noise term for eq . 32 is ( z 1 + z 2 + 2z 4 ) x / 4 . here , the mean of the estimation error is equal to e (( z 1 + z 2 + 2z 4 ) x / 4 )= 0 , and the variance of the estimation error is equal to var (( z 1 + z 2 + 2z 4 ) x / 4 )= var (( z 1 + z 2 + 2z 4 )/ 4 )= 3σ z 2 / 8 , where z 1 , z 2 , and z 4 are assumed to have variance σ z 2 . as seen from eq . 32 , the variance of the estimation error is reduced , thereby improving the accuracy of estimation . similarly , the characteristics of the second channel h b may be obtained by : h b ⁡ ( k ) ≈ ( y 1 ⁡ ( k ) + y 2 ⁡ ( k ) - 2 ⁢ y 4 ⁡ ( k ) ) · x ⁡ ( k ) 4 , k = 1 , ⁢ … ⁢ , n , [ eq . ⁢ 34 ] thereby resulting in the mean of the estimation error being equal to e (( z 1 + z 2 − 2z 4 ) x / 4 )= 0 , and the variance of the estimation error being equal to var (( z 1 + z 2 − 2z 4 ) x / 4 )= var (( z 1 + z 2 − 2z 4 )/ 4 )= 3σ z 2 / 8 , where z 1 , z 2 , and z 4 are assumed to have variance of σ z 2 / 8 , where z 1 , z 2 , and z 4 are assumed to have variance of σ z 2 . in a more general sense , the variance of the estimation error can be further reduced with the transmission of additional long training symbols x or the transmission of additional complex conjugates x * and negative complex conjugates − x * of the long training symbol x . while multiple - branch transmitter - diversity systems have been shown above , another embodiment of the invention may be seen as a method for estimating channel characteristics . embodiments of such a method is shown in fig5 and 6 . fig5 is a flowchart showing method steps that are performed by the wireless device 470 in a two - branch transmitter - diversity ofdm system . if the signal transmission follows the ieee standard , then the transmission of the signals during the guard interval is implicit in the embodiment of fig5 . as shown in fig5 , a training symbol is transmitted ( 520 ) over both the first and second channels during a first period . in one embodiment , the wireless device 470 comprises first channel transmit logic 555 and second channel transmit logic 565 , which are adapted to transmit information over the first and second channels , respectively . after transmitting ( 520 ) the training symbol during the first period , a complex conjugate of the training symbol is transmitted ( 530 ) over the first channel during a second period . substantially simultaneously , during the second period , a negative complex conjugate of the training symbol is transmitted ( 540 ) over the second channel . if the channel estimation is performed in accordance with the ieee 5 ghz standard , then the first period is one of the long - training periods in the preamble of the physical layer convergence procedure ( plcp ), and the second period is one of the subsequent data periods . fig6 is a flowchart showing a method for estimating channel characteristics , which is performed by the receiver 405 . as shown in fig6 , the symbols are received ( 620 ) at a receiver 405 . upon receiving ( 620 ) the symbols , individual channel effects are isolated ( 630 ) from the received symbols . these isolated ( 630 ) individual channel effects are used to estimate ( 640 ) characteristics of the individual channels . in one embodiment , the receiver 405 comprises receive logic 625 , isolate logic 635 , and estimate logic 645 , which are adapted to perform the receiving ( 620 ), isolating ( 630 ), and estimating ( 640 ) steps , respectively , as shown in fig6 . also , in an example embodiment , the received symbols may be analogous counterparts to the transmitted signals as shown in fig5 . thus , for an n - branch transmitter - diversity system , the receiver 405 receives ( 620 ) n symbols , each of which has a different permutation of training symbols to form a true n - equation n - unknown system , thereby permitting isolation of each channel as described with reference to eqs . 12 through 34 . as seen from fig5 and 6 , the embodiments of the method permit more accurate estimates of the individual channel characteristics , rather than merely estimating the aggregate characteristics of the channel , or making additional presumptions that affect the channel characteristics . although exemplary embodiments have been shown and described , it will be clear to those of ordinary skill in the art that a number of changes , modifications , or alterations to the invention as described may be made . for example , while a two - branch transmitter - diversity system has been shown for purposes of illustration , it will be clear to one of ordinary skill in the art that the disclosed approach may be extended to multiple - branch transmitter - diversity systems having three , four , or more branches . additionally , while fig4 simply shows antennas in a wireless device 470 , it will be clear to one of ordinary skill in the art that the transmitters may be a part of a wireless lan access point unit , a wireless lan card , a cellular telephone , a wireless personal digital assistant ( pda ), or other similar wireless devices that are adapted to transmit and receive data . furthermore , while one embodiment of the invention shows an additional training symbol being transmitted during the time period allotted for d 1 , it will be clear to one of ordinary skill in the art that the additional training symbol may also be transmitted during any of the subsequent data periods . also , while only one additional training symbol ( e . g ., the complex conjugate of the long - training symbol , the negative complex conjugate of the long training symbol , etc .) is shown in fig3 a and 3b , it will be clear to one of ordinary skill in the art that additional training symbols may be transmitted to increase the signal - to - noise ratio in channel estimation , or , additionally , to characterize multiple - branch transmitter - diversity systems having more than two branches . also , while several embodiments of the invention are described within the framework of the ieee 5 ghz standard , it will be clear to one of ordinary skill in the art that the methods and systems described herein may be extended to any environment in which orthogonal frequency - division multiplexing ( ofdm ) is used . additionally , while the ieee 5 ghz standard is used to more clearly describe several aspects of the invention , it should be understood that the systems and methods described above are compatible with the ieee 2 . 4 ghz standard ( ieee 802 . 11g ) or other similar wireless standards , regardless of the operating frequency band . these , and other such changes , modifications , and alterations , should therefore be seen as being within the scope of the disclosure .	7
fig1 illustrates a load lifting vehicle or forklift 10 which embodies the invention and which is preferably capable of traveling over rough or uneven terrain such as may be encountered at a construction site . the forklift 10 includes a main frame 12 which has a right side 14 and a left side 16 , a rear pair of axle mounting members 18 , and a front pair of axle mounting members 20 ( fig6 ). axle mounting members 18 and front member 20 each extend between the right side 14 and the left side 16 of the main frame 12 . in the illustrated arrangement , the main frame 12 also includes a leveling cylinder support member 21 located on the front of the main frame 12 and adjacent the right side 14 of the main frame 12 . as shown in fig1 , forklift 10 also includes means for manipulating a load 22 . while various means for manipulating can be employed , in the illustrated arrangement , the means for manipulating includes a hydraulically - operated telescoping boom 24 which is connected at one end to the rear of the main frame 12 and which is pivotable relative to the main frame 12 about a generally horizontal axis 26 between a lowered position ( shown in solid lines in fig1 ) and a raised position ( shown in broken lines in fig1 ). the means for manipulating also includes a carriage 28 which is attached to the other end of the boom 24 and which includes forks 30 for supporting the load 22 . the carriage 28 is pivotable relative to the boom 24 about a generally horizontal axis 32 and is also preferably pivotable relative to the boom 24 about a generally vertical axis 34 . the means for manipulating a load 22 also includes hydraulic cylinder assemblies 38 , 40 and 42 , which respectively rotate or pivot the boom 24 , telescope the boom 24 , and tilt the carriage 28 about the horizontal axis 32 . a pressurized hydraulic fluid source 44 is provided for supplying hydraulic fluid to the cylinder assemblies 38 , 40 and 42 . as shown in fig2 , the fluid source 44 includes , a fluid reservoir 46 , a main valve 48 which directs fluid flow to the various hydraulic components , and a pump 50 between the reservoir 46 and the main valve 48 . the forklift 10 also includes means for supporting the main frame 12 for movement along the ground . as shown in fig7 , the means for supporting the main frame 12 includes a front axle assembly 52 which includes a center section 53 having an upwardly extending center portion 54 , and right and left end sections 55 and 56 pivotally connected to the opposite ends of the center section 53 by vertically disposed pins 57 and 58 , respectively . the end sections 55 and 56 are respectively pivotable about the axes of the pins 57 and 58 . means 63 ( fig6 ) which are known in the art are provided for pivoting the end sections 55 and 56 to steer the forklift 10 . a first horizontal pin 59 extending through the upper part of the front axle assembly center portion 54 and through the front axle mounting members 20 connects the front axle assembly 52 to the main frame 12 so that the front axle assembly 52 is shiftable or pivotable about the axis of the first horizontal pin 59 relative to the main frame 12 . the front axle assembly 52 also includes right and left front wheels 60 and 61 for supporting the front axle assembly 52 . the means for supporting the main frame 12 also includes a rear axle assembly 62 which has opposite right and left ends each respectively including a plate 64 and 66 secured to the upper surface thereof . the rear axle assembly 62 includes a center portion 68 extending upwardly between the rear axle mounting members 18 . a second horizontal pin 70 extends through the upper part of the rear axle assembly center portion 68 and through each of the rear axle mounting members 18 to connect the rear axle assembly 62 to the main frame 12 . the rear axle assembly 62 is shiftable or pivotable about the axis of the second horizontal pin 70 relative to the main frame 12 . right and left rear wheels 72 and 74 each respectively support the right and left ends of the rear axle assembly 62 . each of the axle assemblies 52 and 62 is preferably coupled through a drive train ( not shown ) to a forklift engine ( not shown ) to drive the forklift wheels 60 , 61 , 72 and 74 . the forklift 10 also includes means for leveling the main frame 12 . while various means for leveling can be employed , in the illustrated arrangement , the means for leveling includes a double - acting , hydraulic leveling cylinder assembly 76 which is pivotally interconnected between the support member 21 and one end of the center section 53 of the front axle assembly 52 ( fig7 ). the leveling cylinder assembly 76 includes a leveling cylinder 78 and a reciprocable rod 80 at least partially disposed within the leveling cylinder 78 . the leveling cylinder assembly 76 is supplied with hydraulic fluid from the fluid source 44 . fluid flow to and from the leveling cylinder assembly 76 is preferably manually controllable by the operator , such as by a conventional joy stick control . thus , the operator can selectively extend or retract the rod 80 to level the main frame 12 to compensate for hillsides and the like . while in the illustrated arrangement the leveling cylinder assembly 76 is secured between the front axle assembly 52 and the support member 21 , in other arrangements , the leveling cylinder assembly 76 could be positioned in the rear of the forklift 10 between the rear axle assembly 62 and the main frame 12 . as shown in fig2 , the forklift 10 also includes means for reducing tipping or tilting , or for stabilizing the main frame 12 . the means for stabilizing includes a stabilizer apparatus 82 . the stabilizer apparatus 82 includes right and left stabilizing assemblies 84 and 84 ′ respectively positioned on the right side 14 and the left side 16 of the main frame 12 . although each of the stabilizing assemblies 84 and 84 ′ may have an arrangement different from that of the other , in the illustrated arrangement , the structure of the stabilizing assemblies 84 and 84 ′ is substantially identical , except for being mirror images of one another , and operation of each of the stabilizing assemblies 84 and 84 ′ is also substantially identical . thus , only the right stabilizing assembly 84 will be described in detail . common elements of the stabilizing assemblies 84 and 84 ′ will be given the same reference numerals , except numerals associated with the left stabilizing assembly are identified with a prime (′) notation . the stabilizing assembly 84 includes a stabilizing cylinder assembly 86 which includes a cylinder 88 , a cylinder cap 90 which is on the top of the cylinder 88 and which includes fluid ports 92 and 94 , and a reciprocable ram 96 extending out from the bottom of the cylinder 88 and at least partially disposed within the cylinder 88 . the ram 96 includes a rounded end 98 engaging the plate 64 on the right end of the rear axle assembly 62 . the ram end 98 remains in constant , or nearly constant contact with the plate 64 during operation of the forklift 10 as will be further explained below . likewise , the ram end 98 ′ also remains in constant , or nearly constant contact with the plate 66 during operation of the forklift 10 . while in the illustrated arrangement the stabilizing cylinder assemblies 86 and 86 ′ are located toward the rear of the main frame 12 and engage the rear axle assembly 62 , in other arrangements , the stabilizing cylinder assemblies 86 and 86 ′ could be located elsewhere , such as toward the front of the main frame 12 , and could engage the front axle assembly 52 . the stabilizing assembly 84 also includes means for mounting the stabilizing cylinder assembly 86 on the main frame 12 . while various means for mounting can be employed , in the illustrated arrangement , the means for mounting includes means for fixedly connecting the stabilizing cylinder assembly 86 to the main frame 12 . in the illustrated arrangement , the means for fixedly connecting includes fasteners such as bolts 100 . the rear axle assembly 62 is capable of exerting upwardly directed loads on the stabilizing cylinder assembly 86 through the ram 96 so that the stabilizing cylinder assembly 86 acts as a load - bearing member for transferring a load from the rear axle assembly 62 to the main frame 12 . to accommodate the load which the stabilizing cylinder assembly 86 bears , the means for mounting the stabilizing cylinder assembly 86 on the main frame 12 also includes load carrying means for transferring at least part of the upwardly directed load on the stabilizing cylinder assembly 86 directly to the main frame 12 . in the illustrated arrangement the load carrying means includes a shoe 102 which is preferably integrally formed . the shoes 102 and 102 ′ are preferably identical and will be described with respect to shoe 102 ′. as shown most clearly in fig5 , the shoe 102 ′ includes a body portion 104 ′ which is fixed to the cylinder 88 ′ by means such as welding , and which is secured to the main frame 12 by at least one of the bolts 100 ′. the shoe 102 ′ also includes a flange portion 106 ′ projecting from the body portion 104 ′ and extending under and engaging a portion of the main frame 12 . an upwardly directed load transmitted through the ram 96 ′ is at least partially mechanically transferred directly to the main frame 12 through the flange portion 106 ′, thereby reducing the shear load on the bolts 100 ′. as shown in fig2 , pressurized hydraulic fluid for operating the stabilizing cylinder assembly 86 is supplied by the pressurized hydraulic fluid source 44 through a main fluid line 108 leading from the mean valve 48 , and also through a second fluid line 110 leading from the main line 108 . fluid returning to the fluid reservoir 46 from the stabilizing cylinder assembly 86 bypasses the pump 50 and the main valve 48 via fluid return line 112 . a first filter 114 located in the return line 112 preferably includes a bypass valve 116 to maintain a constant pressure in the lines 108 and 110 of approximately 25 - 50 psi . a one way or check valve 118 is located between the second fluid line 110 and the fluid port 92 . fluid flow to the cylinder 88 through the check valve 118 is permitted , while fluid flow from the cylinder 88 through the check valve 118 is prevented . in the event the rear axle assembly 62 moves in a direction away from engagement with the ram end 98 ( fig3 ), fluid flow through the check valve 118 to the cylinder 88 facilitates extension of the ram 96 to maintain contact between the ram end 98 and the plate 64 . the stabilizing assembly 84 is provided with means for restricting fluid flow from the cylinder 88 . the means for restricting is in parallel with the check valve 118 and is located between the second fluid line 110 and the fluid port 94 . while various means for restricting can be employed , in the illustrated arrangement , the means for restricting includes a restriction orifice 120 . the restriction orifice 120 restricts fluid flow from the cylinder 88 to substantially slow retraction of the ram 96 within the cylinder 88 . in the event the rear axle assembly 62 attempts to move against the ram 96 , thereby exerting an upwardly directed force on the ram 96 , slowed retraction of the ram 96 will impede movement of the rear axle assembly 62 , so that the rear axle assembly 62 becomes generally rigid and shifts only very slowly with respect to the main frame 12 . the restriction orifice 120 is preferably of a size which does not interfere to any appreciable degree with the leveling of the frame 12 by the leveling cylinder assembly 76 . a second fluid filter 122 , is provided between the restriction orifice 120 and the port 94 . while in some arrangements the means for restricting can include only the restriction orifice 120 , such as is preferred in arrangements wherein the carriage 28 is not pivotable relative to the boom 24 about a generally vertical axis such as the axis 34 , in the illustrated arrangement , the means for restricting also includes a flow control valve 124 which is positioned between the restriction orifice 120 and the second fluid line 110 . the use of a flow control valve 124 is preferred in arrangements which include a carriage 28 that is pivotable relative to the boom 24 about a generally vertical axis , such as the axis 34 , as will be further explained below . the flow control valve 124 is shiftable between a first position wherein fluid flow through the flow control valve 124 is blocked ( fig2 ), and a second position wherein fluid flow through the flow control valve 124 is permitted ( fig3 ). when the flow control valve 124 is in the first position , fluid flow is prevented both to and from the stabilizing cylinder assembly 86 through the flow control valve 124 , so that the ram 96 cannot retract into the cylinder 88 in response to movement of the rear axle assembly 62 . thus , when the flow control valves 124 and 124 ′, are each in the first position the rear axle assembly 62 becomes rigid and generally immoveable relative to the main frame 12 . when the flow control valve 124 is in the second position , fluid flow from the stabilizing cylinder assembly 86 is permitted so that the ram 96 can retract into the cylinder 88 at the rate permitted by the restriction orifice 120 . while in the illustrated arrangement the restriction orifice 120 and the flow control valve 124 are separate , in other arrangements , the restriction orifice 120 could be incorporated into the flow control valve 124 such that the orifice 120 is in use when the flow control valve 124 is in the second position . means are provided for shifting the flow control valve 124 between the first and second positions . while various means for shifting can be employed , in the illustrated arrangement , the means for shifting includes a solenoid 126 . although the solenoid 126 can be actuated to shift the flow control valve 124 in response to a variety of conditions , and although actuation of the solenoid 126 can be automatic or manual , in the illustrated arrangement , the solenoid 126 is automatically actuated to shift the flow control valve 124 to the first position in response to movement of the boom 24 to the raised position . preferably , the solenoid 126 is activated to shift the flow control valve 124 to the first position when the boom 24 forms an angle of about 10 degrees or more with the horizontal . when the boom 24 is in a lowered position and forms an angle of less than 10 degrees with the horizontal , the solenoid 126 is deactivated and the flow control valve 124 remains in , or is returned to the second position by a spring 128 . fig2 illustrates the operation of the stabilizer apparatus 82 when the rear axle assembly 62 encounters an obstruction such as a bump 130 . in fig2 , the flow control valves 124 and 124 ′ are shown in the first or blocked position , i . e ., the boom 24 is in the raised position , and the right rear wheel 72 is shown on the bump 130 while the surface beneath the left rear wheel 74 is relatively flat . blocking the exit of fluid from the stabilizing cylinder assembly 86 prevents retraction of the ram 96 when the bump 130 is encountered so that the rear axle assembly 62 is maintained in a fixed position relative to the main frame 12 and tipping , tilting or rocking of the main frame 12 is reduced or prevented . the rear wheels 72 and 74 rise and fall together when an obstruction is encountered and the forklift 10 is supported on the three wheels 60 , 61 and 72 until the wheel 72 moves off the bump 130 . had the flow control valves 124 and 124 ′ of fig2 been in the second position rather than in the first position as shown , the rear axle assembly 62 would still have been maintained in a generally rigid position relative to the main frame 12 as the right rear wheel 72 passed over the bump 130 . as fluid flow from the cylinder 88 is severely restricted by the restriction orifice 120 , retraction of the ram 96 within the cylinder 88 is severely impeded , thereby preventing or at least significantly slowing rotation of the rear axle assembly 62 when the wheel 72 travels over the bump 130 . thus , when the flow control valves 124 and 124 ′ are in the second position and one of the rear wheels 72 and 74 encounters a transient obstruction such as the bump 130 , the rear axle assembly 62 is maintained in substantially the same position it was in prior to encountering the bump 130 so that the main frame 12 is not caused to tip . if the forklift 10 had come to rest with the right rear wheel 72 on the bump 130 , the rear axle assembly 62 would pivot very slowly relative to the main frame 12 until the left rear wheel 74 contacted the ground . fig3 shows the rear axle assembly 62 on an inclined surface when the flow control valves 124 and 124 ′ are in the second position , i . e . when the boom 24 is in the lowered position . referring specifically to stabilizing cylinder assembly 86 ′ in fig3 , as the inclined surface urges the rear axle assembly 62 to rotate in a clockwise direction ( as viewed in fig3 ) against the ram 96 ′, fluid is permitted to exit the cylinder 88 ′ through the flow control valve 124 ′ and the restriction orifice 120 ′, thereby allowing the ram 96 ′ to very slowly retract within the cylinder 88 ′. the very slow retraction of the ram 96 ′ allows the rear axle assembly 62 to adapt to contour changes in the terrain which are not merely transient , such as hillsides for example . referring specifically to stabilizing cylinder assembly 86 in fig3 , as the rear axle assembly 62 rotates in a clockwise direction ( as viewed in fig3 ), fluid flow through the check valve 118 permits the ram 96 to extend from the cylinder 88 so that the ram end 98 remains in constant or nearly constant contact with the plate 64 . the rounded end 98 of the ram 96 facilitates sliding contact with respect to the plate 64 so that only a generally upwardly directed load is exerted on the ram 96 by the rear axle assembly 62 . when the forklift 10 is being driven from place to place , it is desirable that the boom 24 be in the lowered position so that the flow control valves 124 and 124 ′ are in the second position and the rear axle assembly 62 is permitted to slowly shift relative to the main frame 12 to follow the contour of non - transient terrain features . allowing the rear axle assembly 62 to slowly shift to conform to hillsides and the like reduces the risk of forklift roll over . at the same time , when the flow control valves 124 and 124 ′ are in the second position , the rear axle assembly 62 remains generally rigid relative to the main frame 12 when one of the rear wheels 72 and 74 travels over transient terrain features such as holes or the bump 130 . this reduces or prevents tipping of the main frame 12 . when the flow control valves 124 and 124 ′ are in the second position the leveling cylinder assembly 76 can be operated to maintain the main frame 12 in a level position . before the boom 24 is elevated to the raised position to raise a load 22 or to pick up a load 22 which is already raised , the main frame 12 can be leveled by manually operating the leveling cylinder assembly 76 . leveling of the main frame 12 when the boom 24 is elevated and the rear axle assembly 62 is rigid relative to the main frame 12 can cause undue stress on the leveling cylinder assembly 76 , can possibly raise one of rear wheels 72 and 74 off the ground , or can twist the main frame 12 . once the main frame 12 is leveled the boom 24 can be raised . the leveling cylinder assembly 76 can be operated to substantially fix the front axle assembly 52 relative to the main frame 12 . if the rear axle assembly 62 is shiftable relative to the main frame 12 and the front axle assembly 52 is in a fixed position relative to the main frame 12 , the main frame 12 will be generally supported against tipping to the left or right by the front axle assembly 52 . in addition , the weight of the main frame 12 , the boom 24 , and the load 22 will be supported by the front axle assembly 52 and also by the rear axle assembly 62 at the point of attachment of the rear axle assembly 62 to the main frame 12 . if the carriage 28 and the load 22 is supports are pivoted about the generally vertical axis 34 , the center of gravity of the load 22 will be shifted so that the load 22 may be supported predominantly by only one end of the front axle assembly 52 and by the rear axle assembly 62 at its point of attachment to the main frame 12 . shifting of the rear axle assembly 62 under these circumstances could cause the main frame 12 to tip , or even roll over in severe cases where the load 22 is very heavy . when the rear axle assembly 62 is fixed relative to the main frame 12 , as is the case when the flow control valves 124 and 124 ′ are in the first position , the main frame 12 is further stabilized against tipping . thus , the possibility that the main frame 12 will tip as a result of an eccentric load 22 which is created by the pivoting of the carriage 28 about the vertical axis 34 is reduced . in the event the carriage 28 is not pivotable about the generally vertical axis 34 and the stabilizer apparatus 92 does not include flow control valves 124 and 124 ′, the main frame 12 can be leveled when the boom 24 is in either of the raised or lowered positions . the forklift 10 also avoids the risk of tipping which is caused by an eccentric load 22 on the end of the boom 24 and which could result if the carriage 28 were otherwise pivotable about the vertical axis 34 . fig8 shows an alternate embodiment of the invention wherein the stabilizing apparatus includes a first double - acting frame tilt cylinder 150 pivotally connected to one end of the front axle assembly 52 and a second double - acting frame stabilizer cylinder 152 is pivotally connected to the opposite end of the rear axle assembly 62 . accordingly , the cylinders 150 and 152 are connected to the axle assemblies 52 and 62 at the diametrically opposite corners of the frame 12 . it will be appreciated that the base ends of each of the cylinders 150 and 152 are pivotally connected to the frame 12 in the manner illustrated in fig6 and 7 , for example . a hydraulic circuit 154 having first and second modes couples the cylinders 150 and 152 to a source of hydraulic pressure , such as a pump 156 . in its first mode , such as , for example , when the boom 28 is below a predetermined vertical angle , the frame tilt cylinder 150 locks the front axle assembly 52 unless manually operated and the frame stabilizer cylinder 152 , coupled to the opposite end of the rear axle assembly 62 , is free to float . in its second mode , when the boom 28 is elevated above the predetermined angle , the hydraulic circuit 154 is in its second mode wherein both cylinders 150 and 152 are locked unless manually operated to tilt frame 12 . however , in its latter mode , under normal operation , tilting movement of the frame 12 is at a substantially lower speed than when the hydraulic circuit 154 is in its first mode . when the ignition of forklift 12 is turned “ on ”, and the boom 24 is below a predetermined angle , each of the solenoids of valves 191 , 192 and 193 are energized to connect their through passages to its ports while the valve 173 is de - energized so that its ports are connected directly by through passages thereby connecting conduit 170 to conduit 185 and conduit 201 to conduit 202 . unless manually operated , the valve 158 is centered by springs so that its ports are disconnected . this is the condition of the hydraulic control 154 as shown in fig8 . as a result , cylinder 150 is locked while cylinder 152 is floating so that axle assembly 62 can tilt . assume that while the hydraulic circuit is in its first mode , so that cylinder 152 is floating , the rear axle assembly 62 is tilted counter - clockwise as a result of wheel 74 hitting a bump or wheel 72 a depression , for example . this moves the piston in cylinder 152 upwardly , forcing hydraulic fluid to flow from the base end through conduit 206 , valve 193 , conduit 207 , and to the conduit 201 . a first portion of the fluid will pass upwardly through conduit 202 , valve 192 , conduit 203 and to the rod side of cylinder 152 . however , because the rod side of cylinder 152 cannot accept all of the hydraulic fluid from the base side , a second portion of the hydraulic fluid will pass through valve 191 , pressure relief valve 215 , conduit 212 and to the sump 178 . on the other hand , should the axle 62 be pivoted clockwise , fluid forced from the rod side of the cylinder 152 will flow through conduit 203 , valve 192 , conduit 202 , valve 173 , conduit 207 , valve 193 , and conduit 206 to the base side of cylinder 152 . however , because the base side of cylinder 152 can accept more hydraulic fluid than that discharging from the rod side , make - up fluid will flow from pump 156 through conduit 195 , pressure reducing valves 197 and 198 and valve 191 to conduit 207 and thence to the base side of cylinder 152 . the pressure reducing valves 197 and 198 will sense a drop in pressure because base side of cylinder 152 can receive more hydraulic fluid than that flowing from the rod side . as a result , conduit 201 will be connected to the pump through valve 191 and pressure reducing valves 197 and 198 so that the requisite make - up oil to the base side of cylinder 152 will be provided . if it is desired to pivot the front axle assembly 52 relative to the frame 12 , the frame tilt valve 158 is manually operated . movement of the valve 158 to the left will connect the pump 156 to the base side of cylinder 150 through conduit 161 , valve 158 , conduits 181 and 170 , valve 173 , conduit 185 , check valve 187 and orifice 186 . the rod side of cylinder 150 is connected to the sump 178 through conduits 164 and 176 , orifice 167 , check valve 166 ( piloted open by the pressure in conduit 185 ). this will tilt the axle assembly 52 counter - clockwise as viewed in fig8 . movement of the valve 158 to the right connects port 163 to port 182 , port 169 to port 175 and port 160 to port 180 . as a result , the pump 156 is connected to the rod side of cylinder 150 and the base side of cylinder 150 is connected to the sump 178 . this tilts the axle assembly 52 clockwise as viewed in fig8 . in this manner , when the hydraulic circuit is in its first mode , that is , when the boom 28 is below the predetermined vertical angle , the front axle assembly 52 may either be locked or tilted relative to the frame 12 while the rear axle assemble 62 is free to float . this allows the frame to tilt as the vehicle 12 moves over uneven terrain and with the boom 28 down . the speed at which the front axle 52 tilts is controlled by the orifices 167 and 186 . when the boom 28 is elevated above the predetermined angle , such as 40 ° for example , an interlock ( not shown ) de - energizes the solenoids of valves 191 , 192 and 193 so that each of the valves is moved by their respective springs to a position wherein check valves are disposed between their ports . in addition , valve 173 is energized so that it is moved to the right as viewed in fig8 . this connects conduit 170 to conduit 202 and conduit 185 to conduit 201 . however , when the valve 158 is in its neutral position , cylinder 150 is disconnected from the pump 156 , while the check valve in valves 192 and 193 prevent the flow of hydraulic fluid between the rod and base sides of cylinder 152 . as a result , both cylinders are locked to the frame . in this mode , the center of gravity is less likely to move outside the base formed by the wheels 60 , 61 , 72 and 74 than if the axle assembly 62 is free to tilt . with the boom 28 elevated , it may be necessary to tilt the frame 12 , such as , for example , if it is necessary to shift the load slightly in the horizontal direction for alignment purposes . this is accomplished by operating the frame tilt valve 158 . specifically , movement of the valve 158 toward the right connects the rod side of cylinder 150 to the pump 156 through orifice 167 , valve 166 , conduit 164 , valve 158 , conduits 181 and 161 . the base side of cylinder 150 is connected to the base side of cylinder 152 through a path defined by orifice 186 , check valve 187 , conduit 185 , valve 173 , conduits 201 , conduit 207 , check valve 210 , orifice 211 and conduit 206 . the rod side of cylinder 150 is connected to the sump 178 through a path defined by conduit 203 , orifice 206 , check valve 205 ( which is piloted opened by the pressure in conduit 207 ), conduit 202 , valve 173 , conduit 170 , valve 158 and conduit 176 . this will rotate both of the axle assemblies 52 and 62 clockwise as viewed in fig8 . if it is desired to rotate the axle assemblies 52 and 62 in the counter - clockwise direction , the frame tilt valve 158 is moved to the left as viewed in fig8 . this connects the pump 56 to the rod side of cylinder 152 through a path defined by conduit 161 , valve 158 , conduit 181 , conduit 170 , valve 173 , conduit 202 , check valve 205 , orifice 206 , and conduit 203 . the base side of cylinder 152 is connected to the base side of cylinder 150 through a path defined by conduit 206 , orifice 211 , check valve 210 ( which is piloted open by the pressure in conduit 202 ), conduit 207 , conduit 201 , valve 173 , conduit 185 , check valve 187 and orifice 186 . the rod side of cylinder 152 is connected to the sump through orifice 167 , check valve 166 ( which is piloted open by the pressure in conduit 185 ), conduit 164 , valve 158 and conduit 176 . it can be seen that in the second mode of operation , when the boom 28 is above the critical angle , flow through each of the valves 191 , 192 and 193 is checked so that the hydraulic fluid must pass through orifices 206 and 211 . these orifices are sized to restrict fluid flow so that in the second mode , tilting movement of the axle assemblies 52 and 62 is about one - third the speed that axle assembly 62 tilts in the first mode . this is possible because one of the cylinders 150 or 152 is slaved to the other depending upon the position of valve 158 . as a result , frame tilting motion is relatively slow , thereby minimizing the possibility of tipping . while the embodiment shown in fig8 includes two double - acting cylinders , 150 and 152 , those skilled in the art will appreciate that a pair of single - acting cylinders coupled to each axle may also be employed . fig9 and 10 show an alternate embodiment of the invention which includes a hydraulic control system 254 for controlling frame tilting speed and rear axle tilting depending upon the angular position of the boom 24 and whether the vehicle &# 39 ; s braking system is engaged . moreover , frame tilting is overridden if the vehicle tilts a predetermined angle from the vertical . the hydraulic system 254 controls the flow of hydraulic fluid from a pump 256 to the double - acting frame tilt cylinder 150 connected to one end of the front axle assembly 52 and a second double - acting frame stabilizer cylinder 152 connected to the opposite end of the rear axle assembly 62 . as seen in fig9 , the hydraulic circuit 254 includes a manually operable , two - way , three - position tilt valve 258 having a first port 260 connected by a conduit 261 to the pump 256 ; a second port 263 connected by conduit 264 to the rod side of cylinder 150 through check valve 266 ; a third port 269 connected by conduit 270 to a first port of a solenoid - operated control valve 273 ; and a fourth port 275 connected by conduit 276 to the sump 278 . the base side of cylinder 150 is connected through check valve 287 and conduit 288 to a second port of control valve 273 . the hydraulic control circuit 254 also includes one - way , two - position solenoid - operated valves 291 , 292 , 293 , 294 and 295 for controlling the flow of hydraulic fluid to the frame stabilizer 152 . valves 292 , 293 , 294 and 295 are normally closed , that is , when energized , each provides a through passage between their inlet and outlet ports and when de - energized are returned by their respective springs to an alternate position wherein there is a check valve between said ports . valve 291 is normally open so that , when de - energized , it provides a through passage and when energized a check valve is positioned between its ports . valve 273 provides parallel flow when de - energized and cross flow when energized . a first conduit 295 connects one port of valve 291 to the pump 256 through pressure - relief valve 298 and second and third conduits 301 and 302 , respectively , connect the other port of valve 291 to a second port of valve 273 and to a first port of valve 292 , the other port of which is connected by conduit 303 to the rod side of cylinder 152 . a check valve 305 and an orifice 306 are connected between conduits 302 and 303 . the base side of cylinder 152 is connected by conduit 306 to a first port of valve 293 while its other port is connected by conduit 307 to a fourth port of valve 273 . a check valve 310 and orifice 311 connect conduit 306 to conduit 307 and bypass valve 293 . valve 294 and orifice 320 are connected between conduits 302 and 303 , and valve 295 and orifice 321 are connected between conduits 302 and 303 . fig1 is an electrical schematic for the embodiment of fig9 . here , it can be seen that the coils of solenoid valves 273 and 291 are connected in parallel , as are the coils of valves 292 and 293 and the coils of valves 294 and 295 . for purposes of identification , the coils of these valves will be identified by the same reference numeral as that used for the valve , but will be distinguished by a prime (′). the parallel combination of coils 273 ′ and 291 ′ is connected to a first contact 324 of solenoid - operated stabilizer lock switch sw 1 and the parallel combination of coils 294 ′ and 295 ′ is connected to the second contact 325 of stabilizer lock relay sw 1 . one end of the parallel combination of relay coils 292 ′ and 293 ′ is connected to a first contact 327 of a boom switch relay sw 2 . the other ends of each of the coils 273 ′ and 291 ′- 295 ′ are connected to the negative bus 329 . the movable contact 330 of switch sw 1 is connected to the second stationary contact 332 of relay sw 2 and the movable contact 333 of switch sw 2 is connected to the positive supply bus 334 . the coil 336 of relay sw 1 is connected between the negative bus 329 and one terminal 338 of a service brake switch sw 3 . the other terminal 340 of switch sw 3 is connected to the positive bus 334 . connected in parallel with sw 3 is a neutral switch sw 4 and the wiper 342 and stationary contact 343 of double - pole double - throw park brake switch sw 5 . a parking brake valve coil 345 is connected between the negative bus 329 and a second contact 346 of switch sw 5 . the vehicle 10 may be stopped by operation of the service brake or the parking brake in a manner well - known in the art . in either case , operation of the service brake or the parking brake will close the respective switches sw 3 or sw 4 . the wiper 347 of the other pole of switch sw 5 is operative to connect and disconnect a starter solenoid to the ignition switch sw 6 . operation of the ignition switch couples the positive bus 334 to the positive terminal of the battery b . finally , the boom relay switch coil 348 is coupled to the negative bus 329 and to the positive bus 334 through a proximity switch 350 . the proximity switch 350 is normally open and is closed when the boom is elevated above a predetermined angle . when the boom 29 is down , the boom relay switch sw 2 and the stabilizer lock relay sw 1 are both de - energized so that the movable contacts 330 and 333 are in the position shown in fig1 . as a result , solenoid valve coils 292 ′ and 293 ′ are energized and coils 273 ′, 291 ′, 294 ′ and 295 ′ are de - energized , whereby the valves are in the position shown in fig9 with valves 292 , 293 , and 291 open to flow , valve 273 set for parallel flow , and valves 294 and 295 are closed . as a result , the opposite ends of the rear cylinder 152 are connected through the path defined by conduit 306 , valve 293 , conduit 307 , valve 273 , conduits 301 and 302 , valve 292 , and conduit 303 . the front cylinder 150 may be manually frame - tilted by operation of the valve 258 in the manner discussed with respect to the embodiment of fig8 . if the boom is elevated above a predetermined angle while the vehicle is in motion , proximity switch 350 is closed to energize the coil 348 of switch sw 1 . this will actuate the solenoid to move wiper 333 from contact 327 to contact 332 . as a result , solenoid coils 292 ′ and 293 ′ are de - energized and solenoid coils 294 ′ and 295 ′ are energized . this opens valves 294 and 295 to flow and sets valves 292 and 293 to block flow . the opposite ends of cylinder 152 are thus connected through a path which includes orifices 320 and 321 so that while the rear axle remains free to float , its movement is dampened . the tilting of the front axle may be achieved by operation of valve 258 as described above . the vehicle 10 may be stopped either by operating the service brake , which closes the service brake switch sw 3 ; actuating the parking brake switch , which steps switch sw 5 ; or placing the vehicle &# 39 ; s transmission in neutral , which closes switch sw 4 . in any event , the stabilizer lock relay is stepped from contact 325 to contact 324 . this de - energizes coils 294 ′ and 295 ′ to close valves 294 and 295 . if the boom 24 is down so that movable contact 333 of switch sw 2 is on contact 327 , coils 273 ′ and 291 ′ remain de - energized so that valve 273 is in parallel flow mode and valve 291 is open . the rear axle 62 remains free to react to the terrain and the front axle 52 may be tilted by operation of valve 258 . if the vehicle is stopped when the boom is up , that is , when proximity switch 350 is operated to energize coil 348 of switch sw 2 so that movable contact 333 is on stationary contact 332 , and relay coil 336 is energized so that movable contact 330 of switch sw 1 is on contact 324 as a result of the closure of switches sw 3 , sw 4 or sw 5 . in this condition , valves 291 - 295 will all be closed , that is , with a check valve between their outlet ports , and valve 273 will be set for cross flow . with the valves set in this position , the rear cylinder 152 is locked in position , since flow between its opposite ends is blocked by check valve 311 , valves 292 - 295 , and the cross - flow position of valve 273 . if the front axle is tilted by operation of valve 258 , the rear cylinder 152 is slaved to the front cylinder 150 through a path defined by conduit 288 , valve 273 , valve 311 , orifice 310 , conduit 303 , orifice 306 , valve 305 , conduits 302 and 301 , and valve 273 . as a result , both frame tilting of the front and rear axles 52 and 62 are dampened . an inclination switch sw 7 is connected between terminal 330 of sw 1 and ground 329 and “ e ” of inclination relay “ iri ”. the switch sw 7 is of a well - known type which closes when the vehicle tilts at a predetermined angle , such as 3 °- 4 °, for example . as a result , if the vehicle tilts when the boom is up so that proximity switch 350 is closed and the vehicle is moving , switch sw 7 will close to energize coil iri . this moves contact “ c ” to contact “ a ” energizing swi moving contact 330 to contact 324 , closing valves 291 ′- 295 ′ and placing valve 273 in its cross flow position so that the rear axle is locked . in this manner , if the angle of inclination approaches a critical value , the rear axle is locked to provide a more stable platform and thereby minimized the tendency for the vehicle to tip . various features of the invention are set forth in the following claims .	1
as illustrated , ultrathin circular glass element 1 , containing preformed central part 2 and an essentially flat flange 3 , is placed on annular support 4 , for example , made of polytetrafluoroethylene ( teflon ®), so that it rests on said support only by its flange . before pouring , one positions , on the periphery of central part 2 , wedges 6 of appropriate thickness , four for example , equidistant from each other . then one pours an appropriate quantity of thermosetting epoxy resin 5 into the concavity of central part 2 . one then applies onto the mass of thermosetting composition counterform 7 , for example made of glass or polytetrafluoroethylene , whose lower surface serves to give the posterior surface of the lens the desired shape . this can be a counterform whose lower surface 8 is flat , if one wishes to produce a semi - finished lens intended to be machined later , or it can be provided with a spherical or other profile , if one wishes to produce a finished lens . fig1 illustrates the case of the production of a finished lens with positive power , in which case the curvature of lower surface 8 of counterform 7 must be less than the curvature of central part 2 . fig2 illustrates the case of the production of a finished lens with negative power , in which case the curvature of lower surface 8 of counterform 7 must be more accentuated than that of central part 2 . the surface condition of lower surface 8 of the counterform must be as perfect as possible , and this lower surface 8 must have anti - sticking properties resulting , for example , from a treatment applied to the counterform , for example , with a teflon ® dispersion or a silicone solution , in order to facilitate removal of the counterform after hardening of composition 5 . as a variant , the counterform could be produced entirely out of a material with anti - sticking properties , for example , out of polytetrafluoroethylene . the hardening of composition 5 can be brought about by heating the whole assembly consisting of the support 4 , the glass element , the thermosetting composition , and the counterform in a furnace or oven according to a program of heating and cooling appropriate for the material used . after curing , one removes the counterform and the wedges , and one trims the edges of the composite lens to eliminate the flange and possible burrs of resin . the aromatic epoxy resins which constitute the organic part of the composite lenses of the invention have good properties of light transmission , an index of refraction of at least 1 . 58 and frequently on the order of 1 . 6 , a good natural adhesion with regard to glass , a moderate volume contraction upon hardening , a relatively low thermal expansion coefficient , a low absorption of water , a low sensitivity to u . v . radiation , a high degree of hardness , and a temperature of vitreous transition usually over 100 ° c ., which makes them eminently useful in the application envisaged . the glass element must have a thickness of at most 0 . 3 mm and preferably a thickness of 0 . 20 to 0 . 25 mm , if one wishes to avoid breaking this element during hardening of the thermosetting epoxy resin composition . thus , this composition , although its contraction with curing is moderate , when compared with other resins used in the field of optics , in any case undergoes a certain amount of shrinkage which causes thicker elements to break , for example , 0 . 8 mm thick elements . at thicknesses of 0 . 3 mm or less , however , it was surprisingly observed that the glass element acquired sufficient flexibility to bend without breaking with the geometric deformations generated by the shrinkage of the hardening epoxy resin . the glass element will usually consist of a sheet of ultrathin glass ( called &# 34 ; microsheet &# 34 ;), of essentially constant thickness or &# 34 ; plano &# 34 ; that is to say , devoid of optical power . this glass element can be made of a colorless , colored , or photochromic mineral glass . a &# 34 ; microsheet &# 34 ; made of photochromic glass and its production are described in u . s . pat . no . 4 , 168 , 339 ( kerko et al .). one can also produce a photochromic glass sheet of suitable thickness (≦ 0 . 3 mm ) from a thicker body by removal of material so as to reduce its thickness to the desired value by means of grinding and polishing . it is this last technique which is used to obtain the photochromic microsheet used in example 3 below . the microsheet , originally flat , is cut in the form of a disk whose central part is preformed to the desired shape , which can be a spherical , non - spherical , or progressive shape , for example , by a process of hot forming under the action of an under pressure , until the disk is brought in contact with a perfectly polished mold . the glass must be formed while it is very viscous ( 10 9 to 10 11 pa . s ) in order to avoid glass - mold sticking . the operation is done under dust - free conditions to avoid or minimize surface defects . the resulting shaped disk then has a central part with the desired profile surrounded by an essentially flat flange which is intended to serve for support in the following operations . other forming techniques could be used , for example , by application of centrifugal force . all glasses and photochromic glasses of optical quality are suitable . one can use , for example , transparent glass sold under the designation 0211 by the company corning incorporated , corning , new york or photochromic glass sold under the designation photogray extra ® by the same company . although the epoxy resin has a good natural adhesion to the glass element , it is advantageous and recommended , in order to obtain the best results , to pretreat the surface of the glass element which is supposed to receive the thermosetting resin composition with an adhesion promoter . such adhesion promoters are well known in the art and are available in commerce . the most current ones are silanes , particularly epoxyalkylalkoxysilanes such as glycidoxypropyltrimethoxysilane ( sold under the commercial name a187 by the company union carbide , danbury , connecticut ) or aminoalkylalkoxysilanes such as gamma - aminopropyltriethoxysilane ( sold under the commercial designation all00 by the company union carbide ). the following non - limiting examples are given for the purpose of illustrating the invention . in examples 1 , 2 , and 4 - 11 , circular transparent glass elements cut from a microsheet made of corning 0211 glass and then preformed were used ; whereas in example 3 a preformed circular photochromic glass element with a thickness of 0 . 2 - 0 . 25 mm obtained by removal , using abrasives , of material from a semi - crude disk with the desired curvature made of photogray extra ® photochromic glass with a thickness of 2 - 2 . 5 mm was used . the preformed glass elements had an overall diameter of 118 mm ; the useful central part had a diameter of 70 mm . three types of elements were prepared , of which the central parts had a radius of curvature of 69 . 5 , 105 . 6 , and 170 mm , respectively . all the elements were covered , after careful cleaning , by centrifugal coating of 2900 rpm for 20 seconds , with an adhesion promoter obtained by mixing 1 wt % &# 34 ; a 187 &# 34 ; silane sold by the company union carbide , 98 wt % ethanol , and 1 wt % distilled water , and aging of the resulting mixture for 2 hours in order to hydrolyze it . the cleaning operation consisted of brushing the glass element with an aqueous solution of a surfactant , of rinsing by brushing with distilled water , of additionally rinsing the element by immersing it in distilled water , and of drying the element by centrifugation . after the covering operation , the hydrolysate applied on the glass element was condensed by heating to 100 ° c . for 2 hours . thermosetting aromatic epoxy resin compositions a ) to c ) were prepared by carefully mixing the ingredients indicated at 40 ° c . and under vacuum , until homogeneity was obtained . a ) 3 . 65 parts by weight 4 , 4 &# 39 ; - diaminodiphenylsulfone with an equivalent weight of amino groups of 62 ; and 10 parts by weight dgeba ( diglycidyl ether bisphenol a ) sold under the commercial name der 332 by the company , dow chemical co ., midland , michigan ; b ) 2 parts by weight xylylenediamine ; and 10 parts by weight of the dgeba described in a ). c ) 10 parts by weight of the dgeba described in a ), 7 . 5 parts by weight phthalic anhydride , and 0 . 01 parts by weight dimethylbenzylamine ( catalyst ) . compositions a ) and c ) of example 1 were used to manufacture composite lenses by the process described above in reference to fig1 and 2 . the quantities of poured composition ranged from 6 . 5 g for the least corrective lenses to 25 g for the most corrective lenses . immediately after pouring , the counterform which had previously received an application of silicone rtv 141 ( sold by company rhone - poulenc , courberole , france ) by centrifugal coating , followed by hardening by heating , in order to give it anti - sticking properties , was positioned . the poured material was then thermoset . the following table indicates the type of composite lenses produced , the conditions of curing of the epoxy resin , the properties of the hardened epoxy resin , and the results of certain tests conducted on the resulting lens . these tests were the following : this test , developed by the american food and drug administration ( fda ), consists of dropping a 16 g steel ball from a height of 1 . 27 m onto the convex surface of the lens . if the lens gets through the test without breaking , it successfully passes the test . this test consisted of maintaining the composite lens samples in a climatic enclosure at 50qc and 98 % relative humidity for 2 weeks . this test consisted of putting the composite lens samples for the indicated period of time in an enclosure in which the temperature varied from - 40 to + 80 ° c . and returned to - 40 ° c . in the space of 2 hours . this test consisted of putting the samples in a water bath at room temperature , which was progressively brought to a boil , and of then keeping the samples for 2 hours in the boiling water . table__________________________________________________________________________ example no . 1 2 3 4 5__________________________________________________________________________poured composition b b b b btype of lens sf sf f , - 6 , 8d f , + 2d f , + 3 , 5dlens thickness ( mm ) max . 8 max . 10 1 . 65 at center 3 . 0 at center 4 . 6 at centerhardening conditions hold 36 hr hold 16 hr at hold 16 hr at hold 16 hr at hold 16 hr at at 105 - ta +, hold 5 hr ta +, hold 5 hr ta +, hold 5 hr ta +, hold 5 hr 110 ° c . at 110 ° at 110 ° c . at 110 ° c . at 110 ° c . properties of epoxyresin : refractive index 1 . 623 1 . 597 1 . 597 1 . 597 1 . 597shore hardness d 88 88 88 88 88vitreous transition 118 122 122 122 122temperature ° c . shrinkage with 0 . 3 - 0 . 4 0 . 3 - 0 . 4 0 . 3 - 0 . 4 0 . 3 - 0 . 4 0 . 3 - 0 . 4polymerization % results of tests : resistance to atmos - x x x x x ( 1 mo . ) pheric agentstemperature cycle x x x x xtestboiling water test nd nd x nd nddrop ball test nd nd nd nd nd__________________________________________________________________________ example no . 7 8 9 10 11__________________________________________________________________________poured composition b b b c btype of lens f , + 5d f , - 2d toric , - 1 , 7 , + 2 , sf f , - 6d 9d cylinder 4 , 6lens thickness ( mm ) 7 . 5 at center 1 . 6 at center 3 . 7 at center 4 . 8 at center 1 . 6 at centerhardening conditions hold 16 hr at hold 16 hr at hold 16 hr at hold 16 hr at hold 16 hr at ta +, hold 4 hr ta +, hold 5 hr ta +, hold 5 hr 96 ° c . + hold 2 10 ° c . + hold 1 hr at 10 ° c .+, hold at 110 ° at 110 ° c . at 150 ° c . at 50 ° c . + hold 2 2 hr at 130 ° c . hr at 100 ° c . properties of epoxyresin : refractive index 1 . 597 1 . 597 1 . 597 1 . 597 1 . 597shore hardness d 88 88 88 88 88vitreous transition 122 122 122 150 118temperature ° c . shrinkage with 0 . 3 - 0 . 4 0 . 3 - 0 . 4 0 . 3 - 0 . 4 nd 0 . 3 - 0 . 4polymerization % results of tests : resistance to atmos - x x x x xpheric agentstemperature cycle x x x x xtestboiling water test x x x nd nddrop ball test x x nd nd nd__________________________________________________________________________ abbreviations : sf = semifinished f = finished max = maximum thickness in mm for a semifinished lens d = diopter ta = room temperature x = successfully passes the test nd = not determined hr = hours the composite lenses of the invention are finer and lighter than the composite lenses that can be obtained according to the teachings of french patent no . 2 , 407 , 898 , supra or u . s . pat . no . 4 , 227 , 950 , supra . they are in fact capable of rivaling the classical lenses made of plastic material with a high index ( n = 1 . 6 ) with regard to weight , and the classical glass lenses with high index ( meeting the european standards in force ) with regard to the thickness in the center ( positive lenses ) or the thickness at the edge ( negative lenses ). it goes without saying that the embodiments described are only examples and that one could modify them , particularly by substitution of equivalent techniques , without consequently leaving the scope of the invention .	6
referring now to fig1 there is shown a modular valve housing unit 10 which includes a valve orifice 12 , the opening and closing of which is controlled by an electromagnetic device 14 , e . g . a solenoid . valve unit 10 includes a housing 16 in which there are defined both a male plug 18 and a female receptacle 20 adapted to plug into , or receive , a corresponding part in a second valve unit 10 . typically , these projections and receptacles carry fluids , such as air , or hydraulic substances , into passageways , ( not shown ) cast or machined into the interior of housing 16 . each housing 16 further includes both a male plug 22 and a female receptacle 24 to establish electrical connection between the correspond parts of an identical valve unit 10 . housing 16 further defines female receptacles 26 , each of which is provided with a plurality of male plug connectors 28 to provide a second electrical connection as will be further described below . when two identical valve units 10 are plugged together , in the direction of the arrow a , the male prongs 28 can be linked by a female connector jumper ( not shown ). within each valve housing 16 , there is a control circuit board 30 having its own , independent , electrical ground 32 and the control circuit board 30 is connected to the plurality of connectors 28 by a bus 28a . each control circuit board 30 provides signals , by way of an isolator circuit , such as an optoisolator , 34 to a driver board and amp circuit 36 , having its own , independent , electrical ground 38 . when a driver board and amp circuit is triggered by a control circuit board 30 , it provides an actuating signal over line 40 so as to actuate the electromagnetic device 14 to admit hydraulic fluid from a line 42 into the valve orifice 12 . it is clear than any desired number of valve units 10 may be plugged together to thereby create a multiple valve system . each driver board and amplifier 36 is powered by a power supply 44 which provides each of the driver boards 36 with power over an electrical connection 46 . it is noted that power supply 44 has sufficient voltage and current delivery capability to actuate each electromagnetic device 14 in each valve unit 10 . as noted before , the circuit including power supply 44 and each one of the driver boards , 36 has its own independent electrical ground 38 which is physically and electrically separate from the electrical ground 32 of the control circuit boards 30 . control circuit boards 30 are supplied by a second power supply 48 which supplies a much lower voltage and lower current ( than does power supply 44 ) to each of the control circuit boards 30 . in addition to being provided with power from power supply 48 , each control circuit board 30 , which is preferably a printed circuit board have multiple electrical connections etched thereon by known means , is also supplied with control signals from a control signal generator 52 which communicates with each one of the control circuit boards 30 through a control signal bus 54 . when multiple valve units 10 are plugged together in the above - described manner , the control circuit boards 30 will carry control signals from control signal generator 52 ( which may be a personal computer ) to each one of the control circuit boards 30 by way of the circuits printed thereon to provide the control signals to trigger driver boards 36 . it is noted that the isolation devices 34 , which are preferably of the optoisolator type , function to electrically separate the two power supply circuits , provided by power supply 44 and 48 , one from the other . the isolator 34 can of course also be constituted by a common relay . with reference to fig2 there is shown a side , sectional view of how the functional units , described with reference to fig1 may preferably be physically assembled within a valve unit . fig2 shows a printed circuit board 56 having located thereon a plurality of plugs 58 designed to mate with an equivalent number of receptacles in a connector box 60 which , in turn , fits into a series of openings 62 contained within the valve unit 10 . the electrical circuits previously described with reference to fig1 in functional terms including the control circuit board 30 , the isolator 34 , and the driver and amp board 36 , may be contained on a printed circuit board 56 . likewise , while a connector box 60 is shown as being interposed between the connectors 58 and receptacles 62 in valve unit 10 , the connector block 60 may be eliminated entirely and the connectors 58 may be fitted directly into the receptacles 62 . thus , it is easy to assemble a system comprising multiple electromagnetically actuable valves by plugging together of series of modular valve units 10 each of which has the required driver and control circuity to actuate a desired one or more of the valves contained in each valve unit . while the invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and detail may be made therein without departing from the spirit and scope of the invention as defined in the claims appended hereto .	5
in the preferred embodiments of the present invention to be described below , the arrangements described above are applied by which a gas which may contain only a very small quantity of impurities , causing depositions , can be blown against a limited portion of the surface of an optical element , facing a surrounding ambience , or can be caused to flow to produce a laminar flow . thus , an ambience with a very small quantity of impurities can be produced adjacent to the surface of the optical element , and adhesion of deposition thereto can be suppressed . as a result , contamination of the surface of the optical element , facing the surrounding ambience , can be prevented efficiently . further , gas supply ports and gas discharging ports may be provided symmetrically . this enables a revolutionally symmetrical gas flow , such that the influence to the imaging performance is small and that the impurity concentration at the lens surface can be decreased effectively . a gas supply port may be provided at one side of the lens surface while a gas discharging port may be disposed at the opposite side of the lens surface , so that a gas flows along the lens surface . this enables that a clean ambience is locally produced at the lens surface only by use of a small flow rate of the gas . preferred embodiments of the present invention will now be described with reference to the accompanying drawings . fig1 a and 1b are schematic views of a first embodiment of the present invention . this is a typical example of the present invention as applied to a bottom lens of a projection system in a semiconductor exposure apparatus . fig1 a is a schematic and sectional view of a projection barrel and fig1 b is a schematic view of the bottom of the barrel . as shown in fig1 a , the projection system of the semiconductor exposure apparatus comprises a plurality of lenses 2 . the whole optical system is accommodated in a barrel 1 which is closed ( and purged ) so that an ambient gas in a chamber ambience enters into the barrel . along the light path , the top of the projection system , that is , the lens closest to a reticle , and the bottom of the projection lens , that is , the lens 3 closest to a wafer , serve to intercept the ambience . the barrel is provided with a gas supply port 4 and a gas discharging port 6 so that a clean gas without containing impurities can be supplied to the inside of the barrel . however , one face of the top - most lens and one face of the bottom lens are exposed to be the ambience of the exposure apparatus chamber . in consideration of it , a plurality of gas supply ports 13 are provided around the bottom - most lens of the projection system , about the lens optical axis , to surround the lens . gases 15 discharged from these gas supply ports flow along the lens surface toward the center of the lens . adjacent to the center , the gases flow as a downward stream , and they are diffused . in order to produce an effective flow , the flow rate and the flow speed , for example , should be controlled . to this end , an optimum shape of the discharging port 15 as well as an optimum flow rate and pressure of the gas are determined in accordance with the shape and size of the lens , for example . further , in order to prevent mixture of a surrounding ambient gas and to aid the flow of the supplied gas , a cover 16 may effectively be provided at the lens bottom surface . as regards the gas to be used , it should be a clean gas free from contamination causal substances . since organic substances , sox , nox , ammonia and the like are sources of contamination , an organic substance removing filter for removing these organic substances or , alternatively , a chemical filter for removing inorganic substances , may be used as required . exposure apparatuses may be individually equipped with impurity removing devices such as filters . however , a gas supplied from a factory or experimental equipment , having an impurity removing function , may be used . the type of gas to be used may be chosen in accordance with the wavelength of ultraviolet rays , for example , to be used in the exposure apparatus . an atmosphere may be used where i - line or a krf laser is used . when light of a shorter wavelength is used , an inactive gas such as nitrogen or he , for example , may be used . when an inactive gas is supplied directly from a commercially available high purity cylinder , for example , since substantially no impurity is contained therein , the impurity removing device may be omitted . with the procedure described above , there occurs substantially no adhesion of depositions on the lens surface . since the gas is supplied toward a limited area on the lens surface , there arises substantially no influence to the wafer position measurement . in the case of a scan type exposure apparatus , the influence of resist gas diffusion due to the motion of the wafer stage , for example , can be made small . a valve 14 for adjusting the flow rate of the supplied gas may be controlled so as to adjust the gas flow rate in accordance with the state of exposure operation . this enables a more effective supply of a clean gas to the lens surface . for example , during an alignment process , during an imaging position measuring process or during an exposure process , the flow of a gas applies a large influence to the imaging performance . therefore , the gas flow rate should be restricted . on the other hand , during a wafer conveying process , for example , the gas flow can be increased . thus , when a new wafer is conveyed onto a wafer stage , the supplying flow rate may be increased , thereby to effectively remove an impurity gas , produced from a resist , away from the lens . during the alignment and exposure process , the flow rate may be decreased to prevent adverse influence to the imaging performance . when a gas of the same type as that of the gas used inside the barrel can be used and caused to flow along the lens surface , as shown in fig3 , the gas may be supplied from a gas discharging port of the projection barrel . fig4 is a schematic view of a second embodiment of the present invention . in the gas supplying method of the first embodiment , there may be cases wherein , depending on the size or shape of the lens , for example , the gas that flows form the lens to the wafer surface is diffused of a resist gas . in consideration of it , as shown in fig4 , a gas discharging port 17 may be provided below the supply port . this is effective to produce a gas flow . also , in this case , there may be a plurality of gas discharging ports disposed revolutionally symmetrically with respect to the optical axis , like the gas supply ports . further , the shape and position of these gas supply ports and gas discharging ports should be determined so that the gas flows appropriately . moreover , the gas supplying pressure and flow rate as well as the gas discharging pressure from the gas discharging port should be adjusted appropriately . the pressure inside the projection barrel is maintained constant , and usually , the pressure difference thereof with the surrounding ambience is small . as compared therewith , from the gas discharging port 17 , the gas should be discharged with a pressure difference of a certain level or more , with respect to the surrounding ambience . in consideration of this , an exhausting system 33 separate from the projection barrel may be provided as required . fig5 a and 5b are schematic views of a third embodiment of the present invention , wherein fig5 a is a schematic and sectional view of a projection system lens barrel and fig5 b is a schematic view of the lens bottom face . a gas supply port 18 and a gas discharging port 20 are provided in the neighborhood of the bottom - most lens of the projection system , that is , the lens 3 closest to the wafer , and the lens surface of the barrel 22 at the top of the projection system , facing the chamber ambience side , such that a clean gas is caused to flow . as shown in fig5 b , the gas supply port 18 is provided at one of lens side faces while the gas discharging port 20 is provided at the opposite lens side face , by which an effective gas flow is produced locally upon the lens surface . particularly , plural gas supply ports and plural gas discharging ports may preferably be provided . on that occasion , a gas flows uniformly along the lens surface . further , in accordance with the shape of the lens ( concave , convex or flat ) and the curvature thereof , an optimum gas flowing angle at the gas supplying port may be selected to assure that the gas flows along the lens surface . moreover , a cover 16 may be provided at the chamber ambience side of the lens , by which the influence or a surrounding gas flow or mixture thereof can be prevented . a flow rate adjusting valve 19 may be used to adjust the flow rate and flow speed of the gas so that a laminar flow is produced . in this method , although the gas flow is only in one direction , the ambience at the lens surface can be effectively kept clean with use of only a limited flow rate of the gas . therefore , the influence to the imaging performance or imaging position measurement is small . further , there is an advantage that only a relatively narrow space is required . moreover , since a gas flows only locally on the lens surface , in the case of a scan type exposure apparatus , the influence of resist gas diffusion due to the motion of the stage , for example , can be made small . between a projection optical system and a wafer , a probe light for focus position measurement passes . if there occurs non - uniformness of pressure or temperature in the ambience through which the probe light passes , it causes a measurement error . in consideration of this , usually , a gas of the same type as that of the chamber ambience is used . in this embodiment , however , since the gas flow is stable , a gas having a refractive index different from that of the ambience gas may be used . for example , in a case wherein the chamber ambience is atmosphere , a nitrogen gas may be caused to flow . when the barrel inside space is purged by the same type of gas , the same gas line may be used . if a different type of gas is to flow , a separate line is necessary . when the same gas line as that of the chamber ambience is used , since the gas must be sufficiently clean , gas purifying means such as a filter may be used , as required . this embodiment is applicable not only to a projection system but also to a portion of a separate optical system such as an illumination system , for example , as shown in fig6 . fig6 is a schematic and sectional view of an optical system , wherein an optical system 23 is accommodated inside a barrel 22 being isolated from a surrounding ambience . along the optical path , the ambience is isolated by means of a seal glass 24 which comprises a parallel flat plate . the inside of the barrel is purged by a clean gas , through a gas supply port 25 and a gas discharging port 26 . in order that a clean gas flows along the surface of the seal glass 24 , being in contact with the surrounding ambience , a gas supplying port 27 is provided at one side face while a gas discharging port 28 is provided at the opposite side face . by adjusting the flow rate and the pressure , a gas is caused to flow along the seal glass surface . like the third embodiment described above , the first and second embodiments described hereinbefore are applicable also to an optical system other than a projection system . further , they can be applied not only to an exposure apparatus but also to an optical system which uses ultraviolet rays . in accordance with the embodiments of the present invention described hereinbefore , a clean gas is efficiently supplied to the surface , or adjacent thereto , of the surface of an optical element isolated from a surrounding ambience , which surface faces the surrounding ambience . this assures that the surface of the optical element is kept clean , and adhesion of the depositions can be prevented effectively . thus , contamination prevention , which is particularly suitably applicable to a semiconductor exposure apparatus , is accomplished . further , in accordance with the present invention , plural gas supply ports and plural gas discharging ports may be disposed revolutionally symmetrically , for example . namely , a structure harmonized with the direction or the flow rate of a gas flow is chosen . this assures that the influence to the imaging performance is small and that the impurity concentration at the lens surface is lowered effectively . further , in accordance with the present invention , a gas supply port may be provided at one side face of the lens surface while a gas discharging port may be provided at the opposite side face thereof , to ensure that a gas flows along the lens surface . with this arrangement , a clean ambience is kept locally on the lens surface even with use of a very low rate of the gas flow . furthermore , when the present invention is applied to a scan type exposure apparatus , the influence of the scan motion of a mask or a stage can be reduced effectively . while the invention has been described with reference to the structures disclosed herein , it is not confined to the details set forth and this application is intended to cover such modifications or changes as may come within the purposes of the improvements or the scope of the following claims .	6
the following description is merely exemplary in nature and is in no way intended to limit the disclosure , its application , or uses . for purposes of clarity , the same reference numbers will be used in the drawings to identify similar elements . as used herein , the term module , circuit and / or device refers to an application specific integrated circuit ( asic ), an electronic circuit , a processor ( shared , dedicated , or group ) and memory that execute one or more software or firmware programs , a combinational logic circuit , and / or other suitable components that provide the described functionality . as used herein , the phrase at least one of a , b , and c should be construed to mean a logical ( a or b or c ), using a non - exclusive logical or . it should be understood that steps within a method may be executed in different order without altering the principles of the present disclosure . referring now to fig1 , an exemplary hard disk drive ( hdd ) system 100 that implements the calibration system is shown to include a hdd printed circuit board ( pcb ) 102 . a memory module such as buffer 104 stores read , write and / or volatile control data that is associated with the control of the hdd system 100 . the buffer 104 usually employs volatile memory having low latency . for example , sdram , double data rate ( ddr ), or other types of low latency memory may be used . nonvolatile memory such as flash memory may also be provided to store critical data such as nonvolatile control code . the buffer 104 communicates with an oscillator 105 . a processor 106 arranged on the hdd pcb 102 performs data and / or control processing that is related to the operation of the hdd system 100 . a hard disk control ( hdc ) module 108 communicates with an input / output interface 110 , with a spindle / voice coil motor ( vcm ) driver or module 112 , the oscillator 105 , and / or a read / write channel module 114 . the hdc module 108 coordinates control of the spindle / vcm module 112 , the read / write channel module 114 , and the processor 106 and data input / output with a host 116 via the interface 110 . a hard disk drive assembly ( hdda ) 120 includes one or more hard drive platters 122 that include magnetic coatings that store magnetic fields . the platters 122 are rotated by a spindle motor that is schematically shown at 124 . generally the spindle motor 124 rotates the hard drive platters 122 at a controlled speed during the read / write operations . one or more read / write arms 126 move relative to the platters 122 to read and / or write data to / from the hard drive platters 122 . the spindle / vcm module 112 controls the spindle motor 124 , which rotates the platters 122 . the spindle / vcm module 112 also generates control signals that position the read / write arm 126 , for example using a voice coil actuator , a stepper motor or any other suitable actuator . during write operations , the read / write channel module 114 encodes the data to be written with a read / write device 128 . the read / write channel module 114 processes the write signal for reliability and may apply , for example , error correction coding ( ecc ), run length limited coding ( rll ), and the like . during read operations , the read / write channel module 114 converts an analog read signal output of the read / write device 128 to a digital read signal . the converted signal is then detected and decoded by known techniques to recover the data that was written on the platters 122 . the read / write device 128 is located near a distal end of the read / write arm 126 . the read / write device 128 includes a write element such as an inductor that generates a magnetic field . the read / write device 128 also includes a read element ( such as a magneto - resistive ( mr ) element ) that senses the magnetic field on the platters 122 . the hdda 120 includes a preamplifier circuit or module 130 that amplifies the analog read / write signals . when reading data , the preamplifier module 130 amplifies low level signals from the read element and outputs the amplified signal to the read / write channel module 114 . while writing data , a write current is generated that flows through the write element of the read / write device 128 . the write current is switched to produce a magnetic field having a positive or negative polarity . the positive or negative polarity is stored by the hard drive platters 122 and is used to represent data . the data is stored on the platters 122 in sectors . each sector is byte structured and includes various fields according to a sector format . typically , a sector format includes a logical block address ( lba ) field followed by a data field , a cyclic redundancy check ( crc ) checksum field , and / or an ecc field . for example , the lba field may include 4 bytes data , the data field may include 512 bytes of data , the crc checksum field may include 4 bytes of data , and the ecc field may include 40 - 80 bytes of data . the lba includes position information such as cylinder , head , and / or sector numbers . portions of the hdd system 100 may be implemented by one or more integrated circuits ( ic ) or chips . for example , the processor 106 and the hdc module 108 may be implemented by a single chip . the spindle / vcm module 112 and / or the read / write channel module 114 may also be implemented by the same chip as the processor 106 , the hdc module 108 and / or by additional chips . alternatively , most of the hdd system 100 other than the hdda 120 may be implemented as a system on chip ( soc ). referring now to fig2 , the hdc module 108 is shown in more detail . the hdc module 108 communicates with the buffer 104 , the oscillator 105 , the processor 106 , the host 116 , and the hdda 120 as described in fig1 . the hdc module 108 includes a buffer control module 140 , an ecc module 142 , a disk formatter module 144 , and a clock distribution module 146 . the buffer control module 140 ( e . g . a direct memory access ( dma ) controller ) connects the buffer 104 to the clock distribution module 146 , the disk formatter module 144 , the ecc module 142 , the host 116 , the processor 106 , and the hdda 120 . the buffer control module 140 regulates data movement in and out of the buffer 104 . the clock distribution module 146 communicates with the oscillator 105 and the buffer control module 140 . the clock distribution module 146 manages clock variations and generates a buffer clock signal ( bcclk ). the buffer control module 140 of the present disclosure includes a calibration module 148 . the calibration module 148 communicates with the clock distribution module 146 and the buffer 104 . the calibration module 148 receives the bcclk from the clock distribution module 146 and a dqs signal from the buffer 104 . the calibration module 148 calculates a dqs delay value based on the bcclk or another clock signal and delays the dqs signal based on the dqs delay value . for example , the calibration module 148 uses the bcclk to calculate the dqs delay value during dqs calibration cycles . in the present implementation , dqs calibration cycles may coincide with idle periods of the buffer 104 . during normal operation , the calibration module 148 outputs a delayed dqs based on the dqs delay value . the buffer control module 140 uses the dqs delay signal as a clock signal to meet the timing requirements between the dqs signal and data . the dqs delay signal serves as a data sampling delay with respect to the read and / or write commands to the buffer 104 . in various embodiments , the calibration module 148 delays the dqs signal by ¼ of a frequency ( i . e . ½ of a high clock width of the dqs signal ) of the dqs signal . in various embodiments , the calibration module 148 may be implemented by an existing integrated circuit and / or by additional integrated circuits . alternatively , the calibration module 148 may be implemented as a soc . the host 116 sends read and write commands to the hdc module 108 . the hdc module 108 stores the read and write commands in the buffer 104 . the processor 106 receives the read and write commands from the buffer 104 and executes firmware to control the hdc module 108 accordingly . during read operations , the hdc module 108 reads data corresponding to the read commands from the hdda 120 . the buffer control module 140 and the ecc module 142 receive the data from the hdda 120 . the ecc module 142 provides an ecc mask for errors that may have occurred during read operations while the data is still in the buffer control module 140 . after any errors in the data are corrected , the data is transferred to the buffer 104 . the data is then transferred from the buffer 104 to the host 116 . during write operations , the disk formatter module 144 controls writing of data to the hdda 120 . the buffer 104 receives data corresponding to the write commands via the hdc module 108 . the disk formatter module 144 receives the data from the buffer 104 via the hdc module 108 . the disk formatter module 144 formats the data for writing to the hdda 120 . for example , the disk formatter module 144 adds error correction codes to the data , monitors a position of the read / write heads , and writes the data to the read / write heads as described in fig1 . referring now to fig3 , an exemplary embodiment of the clock distribution module 146 is shown in more detail . the clock distribution module 146 communicates with the buffer control module 140 and the oscillator 105 . the clock distribution module 146 includes a phase locked loop ( pll ) module 160 , a voltage regulator ( vco ) module 162 , and a clock distribution logic ( cdl ) module 164 . the pll module 160 controls the oscillator 105 in order to maintain a constant phase angle ( i . e . lock ) on a frequency of an input or reference signal . the pll module 160 communicates with the vco module 162 and the cdl module 164 . the cdl module 164 generates and outputs the bcclk . referring now to fig4 a , an exemplary embodiment of the calibration module 148 is shown . the calibration module 148 receives the dqs signal and data from the buffer 104 . the calibration module 148 includes a logic module 182 ( such as a multiplexer ), a programmable delay module 184 , a pulse detection module 186 , and a delay calculation module 187 . the calibration module 148 determines the dqs delay value during a calibration cycle . the programmable delay module 184 applies the dqs delay value to the dqs signal . the calibration module 148 delays the dqs signal based on the dqs delay value that is based on one of a calculated delay value or a state machine delay value . in the present implementation , the calibration module 148 determines an optimal delay that is compatible with worst - case ( e . g . 3 nanoseconds ) and best - case ( e . g . 1 . 5 nanoseconds ) delay conditions by dynamically adjusting the dqs delay value . the dynamic adjustment allows for increased transfer rates to and / or from the buffer 104 . for example , the logic module 182 receives the dqs and the bcclk , as well as a calibration cycle ( cc ) select signal . during read operations , the cc select signal selects the dqs and the logic module 182 outputs a dqs input signal ( dqs in ) accordingly . the programmable delay module 184 delays dqs in based on the programmable delay value and outputs a delayed dqs output signal ( dqs out ). during calibration cycles ( e . g . during idle periods of the buffer 104 ), the cc select signal selects the bcclk and the logic module 182 outputs dqs in based on the bcclk . in other words , during idle periods , the buffer 104 does not generate the dqs and the calibration module 148 calibrates the programmable delay based on the bcclk . those skilled in the art can appreciate that other clock signals may be used . the programmable delay module 184 delays dqs in and outputs dqs out . the pulse detection module 186 receives and compares phases of dqs in and dqs out and outputs a pulse detection signal pd c based on a delay between dqs in and dqs out . the delay calculation module 187 receives the pulse detection signal pd c and can program the programmable delay module 187 with a calculated delay value based on pd c . in other words , the delay calculation module 187 can calculate the dqs delay based on feedback from the pulse detection module 186 . referring now to fig4 a and 4b , an exemplary embodiment of the delay calculation module 187 is shown in more detail . the delay calculation module 187 includes a logic module 188 ( such as a multiplexer ), a state machine module 190 , a counter module 192 , a register module 194 , and a calculator module 196 . a register module 180 receives and stores the data . the programmable delay module 184 delays dqs in based on the dqs delay value received from the logic module 188 . the logic module 188 outputs the dqs delay value based on one of a calculated delay value c d received from the calculator module 196 and a state machine delay value received from the state machine module 190 . for example , the logic module 188 selectively outputs one of the calculated delay value c d and the state machine delay value based on a control signal sm a received from the state machine module 190 . in other words , the state machine module 190 may override the calculated delay value c d with the state machine delay value . as such , the state machine module 190 determines the delay of the dqs signal . in the present implementation , the state machine module 190 cycles through a plurality of delay values ( e . g . 0 to 31 ) during each calibration cycle . the calibration cycle is complete after the calibration module 148 tests the maximum delay value of the plurality of delay values . in the present implementation , the calibration module 148 executes calibration cycles to compensate for process , voltage , and / or temperature variations of the hdd system 100 . upon initiation of a calibration cycle , the state machine module 190 transmits an enable signal en to the pulse detection module 186 . as described above with respect to fig4 a , the pulse detection module 186 receives and compares phases of dqs in and dqs out . more specifically , the pulse detection module 186 determines the delay of dqs out with respect to dqs in . the pulse detection module 186 determines whether the delay is above or below a threshold value . the threshold value represents a desired delay of the dqs ( e . g . one - half clock period ). for example , the pulse detection module 186 generates the pulse detection signal pd c when there is an overlap between pulses of dqs in and dqs out ( i . e . the delay is less than one - half clock period ). when there is no overlap between the pulses ( i . e . the delay is approximately one - half clock period ), the pulse detection module 186 does not generate the pulse detection signal pd c . the pulse detection module 186 transmits the pulse detection signal pd c to the counter module 192 . the counter module 192 increments a count value based on the pulse detection signal pd c . for example , the counter module 192 increments the count value when the counter module 192 receives a stream of the pulse detection signal pd c during a particular calibration cycle . conversely , the counter module 192 does not increment the count value when the pulse detection signal pd c is not generated by the pulse detection module 186 during a calibration cycle . the state machine module 190 may reset the operation of the calibration module 148 by transmitting a reset signal ( sm r ) to the counter module 192 . the register module 194 stores the count value received from the counter module 192 and transmits the count value to the calculator module 196 . the register module 194 may also store delay values calculated in a particular calibration cycle for future use by the calibration module 148 during subsequent calibrations . the calculator module 196 calculates the calculated delay value c d by dividing the count value by a divide value ( e . g . 2 ). in various embodiments , the calculator module 196 can add or subtract a bias value ( e . g . 1 or 2 ) to the calculated delay value c d to compensate for nonlinearities of the calculated delay value c d based on inequalities in wiring delays . referring now to fig5 , a timing diagram illustrates a calibrated dqs signal 200 centered within a valid data window 202 . the dqs signal 200 controls the sampling of data from the buffer 104 . centering the data read operation within the dqs signal window 202 allows for improved data transfer rates to and / or from the buffer 104 and prevents false readings . referring now to fig6 , a method 300 for executing a calibration cycle is shown in more detail . the method 300 begins at step 302 . in step 304 , the state machine module 190 enters a calibration cycle after counter module 192 is cleared from a previous calibration cycle . in step 306 , the state machine module 190 transmits a state machine delay value to the programmable delay module 184 . in step 308 , the state machine module 190 enables the pulse detection module 186 . in step 310 , the pulse detection module 186 compares the dqs out with a threshold value . in step 312 , the counter module 192 increments a count value based on a pulse detection signal pd c generated by the pulse detection module 186 . in step 314 , the calibration module 148 determines whether the calibration cycle is complete . if the calibration cycle is not complete , the calibration module 148 proceeds to step 316 . in step 316 , the state machine module 190 increments the state machine delay and returns to step 306 . if the calibration cycle is complete , the calibration module 148 proceeds to step 318 . in step 318 , the calculator module 196 calculates a calculated delay value c d based on the count value . in step 320 , the programmable delay module 184 generates dqs out based on the calculated delay value c d . the method 300 ends in step 318 . referring now to fig7 a - 7f , various exemplary implementations of the calibration system are shown . as shown in fig7 a , the calibration system can be implemented in a digital versatile disc ( dvd ) drive 410 . the dvd drive 410 includes either or both signal processing and / or control circuit , which are generally identified in fig7 a at 412 , mass data storage 418 and / or a power supply 413 . the mass data storage 418 may implement the calibration system . the signal processing and / or control circuit 412 and / or other circuits ( not shown ) in the dvd drive 410 may process data , perform coding and / or encryption , perform calculations , and / or format data that is read from and / or data written to an optical storage medium 416 . in some implementations , the signal processing and / or control circuit 412 and / or other circuits ( not shown ) in the dvd drive 410 can also perform other functions such as encoding and / or decoding and / or any other signal processing functions associated with a dvd drive . the dvd drive 410 may communicate with an output device ( not shown ) such as a computer , television or other device via one or more wired or wireless communication links 417 . the dvd drive 410 may communicate with mass data storage 418 that stores data in a nonvolatile manner . the mass data storage 418 may include a hard disk drive ( hdd ). the hdd may have the configuration shown in fig1 . the hdd may be a mini hdd that includes one or more platters having a diameter that is smaller than approximately 1 . 8 ″. the dvd drive 410 may be connected to memory 419 such as ram , rom , low latency nonvolatile memory such as flash memory and / or other suitable electronic data storage . referring now to fig7 b , the calibration system can be implemented in a high definition television ( hdtv ) 420 . the hdtv 420 includes either or both signal processing and / or control circuit , which are generally identified in fig7 b at 422 , a wlan interface 429 , mass data storage 627 , and / or a power supply 423 . the mass data storage 427 may implement the calibration system . for example , the mass data storage 427 may include one or more buffer memories that temporarily store data that is transmitted to and from the hdtv 420 . the memory controller module that manages the buffer memories may implement the calibration system . the hdtv 420 receives hdtv input signals in either a wired or wireless format and generates hdtv output signals for a display 426 . in some implementations , signal processing circuit and / or control circuit 422 and / or other circuits ( not shown ) of the hdtv 420 may process data , perform coding and / or encryption , perform calculations , format data and / or perform any other type of hdtv processing that may be required . the hdtv 420 may communicate with mass data storage 427 that stores data in a nonvolatile manner such as optical and / or magnetic storage devices including , but not limited to , dvd drives and hdds . at least one hdd may have the configuration shown in fig1 and / or at least one dvd drive may have the configuration shown in fig7 a . the hdd may be a mini hdd that includes one or more platters having a diameter that is smaller than approximately 1 . 8 ″. the hdtv 420 may be connected to memory 428 such as ram , rom , low latency nonvolatile memory such as flash memory and / or other suitable electronic data storage . the hdtv 420 also may support connections with the wlan via the wlan interface 429 . referring now to fig7 c , the vehicle 430 includes a powertrain control system 432 , a wlan interface 448 , mass data storage 446 and / or a power supply 433 . the mass data storage 446 may implement the calibration system . for example , the mass data storage 446 may include one or more buffer memories that temporarily store data that is transmitted to and from the powertrain control system 432 . the memory controller module that manages the buffer memories may implement the calibration system . in some implementations , the powertrain control system 432 receives inputs from one or more sensors 436 such as temperature sensors , pressure sensors , rotational sensors , airflow sensors and / or any other suitable sensors and / or that generates one or more output control signals 438 such as engine operating parameters , transmission operating parameters , and / or other control signals . the calibration system may also be implemented in an other vehicle control system 440 of the vehicle 430 . the control system 440 may likewise receive signals from input sensors 442 and / or output control signals to one or more output devices 444 . in some implementations , the control system 440 may be part of an anti - lock braking system ( abs ), a navigation system , a telematics system , a vehicle telematics system , a lane departure system , an adaptive cruise control system , a vehicle entertainment system such as a stereo , dvd , compact disc system and the like . still other implementations are contemplated . the powertrain control system 432 may communicate with mass data storage 446 that stores data in a nonvolatile manner . the mass data storage 446 may include optical and / or magnetic storage devices such as hard disk drives ( hdds ) and / or dvd drives . at least one hdd may have the configuration shown in fig1 and / or at least one dvd drive may have the configuration shown in fig7 a . the hdd may be a mini hdd that includes one or more platters having a diameter that is smaller than approximately 1 . 8 ″. the powertrain control system 432 may be connected to memory 447 such as ram , rom , low latency nonvolatile memory such as flash memory and / or other suitable electronic data storage . the powertrain control system 432 also may support connections with a wlan via the wlan interface 448 . the control system 440 may also include mass data storage , memory and / or a wlan interface ( all not shown ). referring now to fig7 d , the calibration system can be implemented in a cellular phone 450 that may include a cellular antenna 451 . the cellular phone 450 includes either or both signal processing and / or control circuit , which are generally identified in fig7 d at 452 , a wlan interface 468 , mass data storage 464 and / or a power supply 453 . the mass data storage 464 of the cellular phone 450 may implement the calibration system . for example , the mass data storage 464 may include one or more buffer memories that temporarily store data that is transmitted to and from the cellular phone 450 . the memory controller module that manages the buffer memories may implement the calibration system . in some implementations , the cellular phone 450 includes a microphone 456 , an audio output 458 such as a speaker and / or audio output jack , a display 460 and / or an input device 462 such as a keypad , pointing device , voice actuation and / or other input device . the signal processing and / or control circuit 452 and / or other circuits ( not shown ) in the cellular phone 450 may process data , perform coding and / or encryption , perform calculations , format data and / or perform other cellular phone functions . the cellular phone 450 may communicate with mass data storage 464 that stores data in a nonvolatile manner such as optical and / or magnetic storage devices including hard disk drives ( hdds ) and / or dvd drives . at least one hdd may have the configuration shown in fig1 and / or at least one dvd drive may have the configuration shown in fig7 a . the hdd may be a mini hdd that includes one or more platters having a diameter that is smaller than approximately 1 . 8 ″. the cellular phone 450 may be connected to memory 466 such as ram , rom , low latency nonvolatile memory such as flash memory and / or other suitable electronic data storage . the cellular phone 450 also may support connections with a wlan via the wlan interface 468 . referring now to fig7 e , the calibration system can be implemented in a set top box 480 . the set top box 480 includes either or both signal processing and / or control circuit , which are generally identified in fig7 e at 484 , a wlan interface 496 , mass data storage 490 and / or a power supply 483 . the mass data storage 490 of the set top box 480 may implement the calibration system . for example , the mass data storage 490 may include one or more buffer memories that temporarily store data that is transmitted to and from the set top box 480 . the memory controller module that manages the buffer memories may implement the calibration system . the set top box 480 receives signals from a source such as a broadband source and outputs standard and / or high definition audio / video signals suitable for a display 488 such as a television , a monitor and / or other video and / or audio output devices . the signal processing and / or control circuit 484 and / or other circuits ( not shown ) of the set top box 480 may process data , perform coding and / or encryption , perform calculations , format data and / or perform any other set top box function . the set top box 480 may communicate with mass data storage 490 that stores data in a nonvolatile manner . the mass data storage 490 may include optical and / or magnetic storage devices such as hard disk drives ( hdds ) and / or dvd drives . at least one hdd may have the configuration shown in fig1 and / or at least one dvd drive may have the configuration shown in fig7 a . the hdd may be a mini hdd that includes one or more platters having a diameter that is smaller than approximately 1 . 8 ″. the set top box 480 may be connected to memory 494 such as ram , rom , low latency nonvolatile memory such as flash memory and / or other suitable electronic data storage . the set top box 480 also may support connections with a wlan via the wlan interface 496 . referring now to fig7 f , the calibration system can be implemented in a media player 500 . the media player 500 includes either or both signal processing and / or control circuit , which are generally identified in fig7 f at 504 , a wlan interface 516 , mass data storage 510 and / or a power supply 513 . the mass data storage 510 of the media player 500 may implement the calibration system . for example , the mass data storage 510 may include one or more buffer memories that temporarily store data that is transmitted to and from the media player 500 . the memory controller module that manages the buffer memories may implement the calibration system . in some implementations , the media player 500 includes a display 507 and / or a user input 508 such as a keypad , touchpad and the like . in some implementations , the media player 500 may employ a graphical user interface ( gui ) that typically employs menus , drop down menus , icons and / or a point - and - click interface via the display 507 and / or user input 508 . the media player 500 further includes an audio output 509 such as a speaker and / or audio output jack . the signal processing and / or control circuit 504 and / or other circuits ( not shown ) of the media player 500 may process data , perform coding and / or encryption , perform calculations , format data and / or perform any other media player function . the media player 500 may communicate with mass data storage 510 that stores data such as compressed audio and / or video content in a nonvolatile manner . in some implementations , the compressed audio files include files that are compliant with mp3 format or other suitable compressed audio and / or video formats . the mass data storage 510 may include optical and / or magnetic storage devices such as hard disk drives ( hdds ) and / or dvd drives . at least one hdd may have the configuration shown in fig1 and / or at least one dvd drive may have the configuration shown in fig7 a . the hdd may be a mini hdd that includes one or more platters having a diameter that is smaller than approximately 1 . 8 ″. the media player 500 may be connected to memory 514 such as ram , rom , low latency nonvolatile memory such as flash memory and / or other suitable electronic data storage . the media player 500 also may support connections with a wlan via the wlan interface 516 . still other implementations in addition to those described above are contemplated . those skilled in the art can now appreciate from the foregoing description that the broad teachings of the disclosure can be implemented in a variety of forms . therefore , while this disclosure includes particular examples , the true scope of the disclosure should not be so limited since other modifications will become apparent to the skilled practitioner upon a study of the drawings , the specification and the following claims .	6
drams are , in their simplest form , arrays of cells each including a capacitor for holding a charge and a transistor acting as a switch for accessing the charge held in the capacitor . dram arrays are typically arranged in columns and rows . fig1 shows four dram cells 102 a , b , c , d ( four cells are shown merely for illustrative purposes ). each row of cells 104 a and 104 b is called a word . the transistor of each cell in a word is connected to a shared wl 106 a or 106 b . wls 106 a and 106 b control the on / off state of transistors 108 a , b , c , d , which allow information to be read from or written to capacitors 110 a , b , c , d . the information to be read or written is transferred via bit lines 112 a , b . when a wl is activated , it drives the coupled transistors conductive ( i . e ., turns the transistors on ). fig2 shows a representative activation / deactivation architecture for a dram with four wls . the two - bit address signal specifying which wl to activate is input into an address decoder 202 . decoder 202 has one output for each wl . it determines which wl is specified by the address and activates the corresponding output . the address decoder &# 39 ; s outputs are then processed by row address latches 204 . each row address latch has three inputs , the addr signal from the decoder , a shared active signal , and a shared pre - charge signal . each row address latch has one output , which is connected to a specific wl . for example , the top row address latch has output signal w 0 , which is connected to wl 0 . the pre - charge signal deactivates all wls in a section of a dram chip by connecting them to the vwln node . the active signal is pulsed after the address decoder &# 39 ; s outputs have settled in order to activate only the target wl . during the pulse , each row address latch activates its output w and connects the wl to the vccp node if its addr signal is active . after a wl has been activated , it can ordinarily only be deactivated by asserting the pre - charge signal . fig3 shows a typical row address latch 300 . latch 300 includes p - type transistor 302 , n - type transistors 304 and 306 , and inverters 308 , 310 , 312 , and 314 . node 301 can be coupled to vccp or another voltage level . inputs pre - charge and addr 0 are active low ( i . e ., activated by a logical 0 signal ), while active is active high ( i . e ., activated by a logical 1 signal ). when pre - charge is driven to a logical 0 , it activates transistor 302 , which drives w 0 low . note that after pre - charge is asserted low , transistor 306 becomes conductive . when the active signal is a high pulse , it drives transistor 304 conductive . during the pulse , if addr 0 is active ( i . e ., low ), it drives output w 0 high and activates the corresponding wl . when w 0 is high , transistor 306 is non - conductive ( its input from inverter 312 is low ), and subsequent pulses on the active input will have no effect on the w 0 output . to deactivate this wl , the pre - charge signal is asserted low , which also simultaneously deactivates all other wls in the same section of the dram chip . as described above , this can have an adverse effect on other wls depending on the number of wls being simultaneously deactivated . fig4 shows a timing diagram 400 in which three row address latches of fig3 are used to respectively activate and deactivate three wls . signal clk is a system clock signal . when pre - charge is pulsed low at signal transition 402 , all three wls are deactivated . signal active is then pulsed three times in conjunction with signal address at signal transitions 403 - 405 , activating w 0 , w 1 , and w 2 in turn . finally , when signal pre - charge is again pulsed low at signal transition 406 , all three wls are simultaneously deactivated in transition 408 , causing the three associated wls to be connected to the vwln node . this simultaneous deactivation can result in a substantial amount of positive charge flowing into the vwln node , causing the node &# 39 ; s voltage to drift upwards undesirably . an exemplary embodiment of the invention is shown in fig5 . row address latch circuit 500 includes p - type transistors 502 and 516 , n - type transistors 504 and 506 , inverters 508 , 510 , 512 , and 514 , delay element 518 , and logic 520 . nodes 501 can be coupled to vccp or another voltage level . logic 520 controls transistor 516 via signal deac and preferably includes nor gate 522 and inverters 524 , 526 , and 528 . the swld input signal is active high and enables latch circuit 500 to selectively deactivate its wl . circuit 500 responds to a pre - charge pulse by deactivating its output w 0 in the same fashion as latch circuit 300 . when the active signal is pulsed high while signal addr 0 is low , output w 0 will be asserted high . note that during this assertion phase , transistor 516 is non - conductive , because the deac signal is a logical 1 when the active pulse arrives . when active is again pulsed high while swld is high and addr 0 is low , logic 520 outputs the deac signal low , driving transistor 516 conductive and de - asserting w 0 . thus , the row address latch according to the invention allows a specific wl to be deactivated , without using the pre - charge signal which is shared across all wls . delay element 508 assures that the active pulse passes before output signal open becomes high , driving transistor 506 conductive ( signal open is also fed to nor gate 522 ). note that until the next pulse of the pre - charge signal resets latch circuit 500 , each time active is pulsed high while swld is high and addr 0 is low , the value of w 0 will toggle ( i . e ., alternate between a logical 1 and a logical 0 ). fig6 shows a timing diagram 600 of signals applied to latch circuit 500 according to the invention . similar to latch circuit 300 , transition 602 of signal pre - charge deactivates all wls . following this deactivation , the active signal is pulsed three times in transitions 603 - 605 to activate all three wls . advantageously , however , the wls can each be deactivated without asserting the pre - charge signal , and the deactivation of each wl need not be simultaneous with the deactivation of other wls . rather , the three successive pulses of the active signal shown in transitions 606 a , 607 a , and 608 a deactivate the three wls in turn , illustrated in transitions 606 b , 607 b , and 608 b . this non - simultaneous deactivation results in smaller transient spikes on the vwln node than that caused by the simultaneous deactivation of all wls at transition 408 of timing diagram 400 . note that circuit 500 and timing diagram 600 are both merely illustrative . other latch circuits that toggle the w 0 output independently of the pre - charge signal can be used . for example , p - channel field effect transistor 516 could be replaced with an n - channel field effect transistor if inverter 528 were removed . similarly , if the pre - charge signal were active high , transistor 502 could be replaced with an n - channel field effect transistor . another possibility would be to force the output w 0 to swing between ground and vccp , rather than between vwln and vccp , by setting the voltage range of inverter 514 appropriately . also , the number of row address latches controlling each wl can vary from that shown . for example , fig7 shows an activation / deactivation architecture where each wl is controlled by two row address latches . architecture 700 includes address pre - decoders 702 , row address latches 500 , row address latches 300 , and logical and gates 706 . in this example , decoding of a four - bit address occurs in two stages . in the first stage , the address &# 39 ; two most significant bits address_msb and its two least significant bits address_lsb are separately decoded . each address pre - decoder 702 outputs one addr signal low , and the others high . these outputs are then processed by row address latches 500 or 300 according to the invention . in the final stage of decoding , each wl is tied to the outputs of two row address latches by an and gate 706 , one latch output for each address pre - decoder 702 . these two latch outputs represent the combination of address_msb and address_lsb values that correspond to a particular wl &# 39 ; s address . thus , a given wl can only be activated if both its corresponding latch outputs are high . note that , in fig7 , any given row address latch 500 is tied to more than one wl . thus , in contrast with the architecture of fig2 , the architecture shown in fig7 makes it possible to activate or deactivate multiple wls with a single active pulse . for instance , suppose the four wls tied to signals w 0 - w 3 were activated . if latch output ra 0 were subsequently driven low , then those four wls would all be simultaneously deactivated . the number of row address latches could alternatively depend on other considerations as well . timing diagram 600 could also vary , depending on the particular application required . for example , circuit 500 could be used to deactivate only wl 0 and wl 1 , and the pre - charge signal could have been pulsed to deactivate wl 2 . other operation sequences are possible , depending on , for example , the task to be performed and the limitations of the hardware . fig8 shows a system that incorporates the invention . system 800 includes a plurality of dram chips 801 , a processor 880 , a memory controller 882 , input devices 884 , output devices 886 , and optional storage devices 888 . dram chips 801 each include one or more latch circuits 500 . data and control signals are transferred between processor 880 and memory controller 882 via bus 881 . similarly , data and control signals are transferred between memory controller 882 and dram chips 801 via bus 883 . input devices 884 can include , for example , a keyboard , a mouse , a touch - pad display screen , or any other appropriate device that allows a user to enter information into system 800 . output devices 886 can include , for example , a video display unit , a printer , or any other appropriate device capable of providing output data to a user . note that input devices 884 and output devices 886 can alternatively be a single input / output device . storage devices 888 can include , for example , one or more disk or tape drives . note that the invention is not limited to dram chips , but is applicable to other integrated circuit chips having a circuit or group of circuits where the simultaneous activation or deactivation of certain signal lines is undesirable . thus it is seen that circuits and methods are provided to deactivate multiple wls individually or in small selectable numbers , thus reducing the total number of wls deactivated simultaneously . one skilled in the art will appreciate that the invention can be practiced by other than the described embodiments , which are presented for purposes of illustration and not of limitation , and the present invention is limited only by the claims which follow .	6
the following is a detailed description of example embodiments of the invention depicted in the accompanying drawings . the example embodiments are in such detail as to clearly communicate the invention . however , the amount of detail offered is not intended to limit the anticipated variations of embodiments ; but , on the contrary , the intention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the present invention as defined by the appended claims . the detailed descriptions below are designed to make such embodiments obvious to a person of ordinary skill in the art . generally speaking , a method and apparatus for reducing the aerodynamic drag of a vehicle is disclosed . more particularly , a method and apparatus is disclosed for increasing the pressure of air behind the vehicle so as to reduce pressure drag . one embodiment provides one or more fans attached to a vehicle , wherein at least one fan is positioned to direct air towards the lower pressure region created behind the vehicle when the vehicle is moving forward . air directed into the lower pressure region raises the pressure in the lower pressure region , lowering the pressure drag partially created by the lower pressure region . in one embodiment , one or more ducts are adapted to be attached to the vehicle and to direct air to the at least one fan . turning now to the drawings , fig1 depicts a prior art motor vehicle 100 subjected to an airflow , such as is created when moving forward . motor vehicle 100 is shown moving left in fig1 , with rear surface 104 being located at the rear of the motor vehicle 100 . when the motor vehicle 100 is moving forward , air flows along the outer surface of the motor vehicle ( from left to right on the page and as shown by the arrows ), as depicted by the air streams 102 in fig1 . the air streams 102 begin as parallel streams in front of the vehicle 100 , progress and bend along the surface , and usually separate from the surface near the rear of the vehicle 100 . for motor vehicle 100 of fig1 , the air streams 102 separate approximately near the top of the rear surface 104 and become roughly parallel again well behind the vehicle . a lower pressure region 106 is created between the rear surface 104 and the separated air streams 102 and is generally located behind the vehicle 100 . the pressure in the lower pressure region 106 is lower than the pressure near the front of the motor vehicle 100 , resulting in a net drag force on the vehicle 100 . this pressure drag ultimately results in lower fuel efficiency and increased fuel consumption for a motor vehicle 100 . the effect of pressure drag is magnified in vehicles that have poor aerodynamic shapes , such as suvs , vans , trucks , pick - up trucks , etc . a rear surface 104 that is generally perpendicular to the ground is usually indicative of a poor aerodynamic shape , especially when compared to sports cars or other vehicles with relatively tapered rear ends . for these vehicles with poor aerodynamic shapes , the lower pressure region 106 has a lower pressure ( closer to a true vacuum ) than in smaller , more aerodynamic vehicles , resulting in a larger pressure ( and force ) differential — and thus more drag . the size of the lower pressure region 106 and its actual pressure ( i . e ., how close it is to a vacuum ) depend on many factors . besides vehicle 100 shape , the lower pressure region 106 will enlarge , and the pressure will go down , as vehicle 100 speed increases . other variables , such as air pressure , wind speed and direction , weather , etc . will also impact the physical configuration of the lower pressure region 106 . fig2 - 4 depict a rear view , a top view , and a side view , respectively , of a motor vehicle equipped with a fan and ducts according to one embodiment . vehicle 200 has a body with a top surface 202 , rear surface 204 , bottom surface 206 , side surfaces 208 , and a front surface 218 . vehicle 200 typically has a chassis ( not shown ) with a plurality of wheels 216 rotatably attached to the chassis so as to facilitate movement . an optional rear bumper 214 may be included to provide protection in the event of an accident or for aesthetic purposes . vehicle 200 includes a pressure drag reduction system 230 , which includes a fan 210 and one or more air ducts 212 in the embodiment depicted in fig2 . in one embodiment , the fan 210 is used to direct air into the lower pressure region 106 that is formed behind a vehicle 200 when in motion . air ducts 212 may optionally provide additional airflow for the fan 210 . the air from the fan 210 enters the lower pressure region 106 and spreads out , serving to attenuate or eliminate the lower pressure region 106 . attenuation of the size or difference in pressure associated with the lower pressure region 106 will reduce the pressure drag of the vehicle , thus reducing the cd and increasing fuel efficiency . vehicle 200 may be any type of vehicle , such as automobile , truck , suv , tractor - trailer rig , boat , aircraft , hydrofoil , train , etc . vehicle 200 may be propelled by any sort of engine , such as an internal combustion engine , natural gas powered vehicle , fuel cell powered vehicle , solar - powered vehicle , etc ., or a vehicle without propulsion , such as a glider . the pressure drag reduction system 230 is suitable for any shape of the vehicle 200 that incurs any amount of pressure drag when moving through a fluid such as air or water . the pressure drag reduction system 230 may also be designed to reduce pressure drag created from any anticipated direction of movement of the vehicle 200 . in one embodiment , the fan 210 includes a fan blade rotatably mounted on a fan body . air enters the fan 210 through an optional fan inlet and is then propelled by the fan blade through a fan outlet . the optional fan inlet directs air towards the fan blade while the fan outlet , which is also optional , directs the airflow from the fan blade away from the fan 210 . the fan 210 may be powered by any source , such as a motor powered by the battery of the vehicle 200 , by power generated from the engine of the vehicle 200 , by internal battery or other power source , solar power , fuel cell , etc . the fan 210 may also include a shroud or the like to minimize any safety risk associated with the rotating blade and / or to further channel or direct air into lower pressure region 106 . a shroud may also improve the aesthetic qualities of the fan 210 . the fan 210 may be attached to the vehicle 200 in any way , such as a permanent mounting , temporary mounting , welding , bolting , magnets , glue , etc . the fan 210 may desirably be mounted to the rear surface 204 , facing generally away from the rear surface 204 . in an alternative embodiment , the fan 210 may be attached to the top surface 202 , side surfaces 208 , bottom surface 206 , bumper 214 , to a spare tire , spoiler , etc ., as long as the fan 210 is able to potentially direct air towards lower pressure region 106 . in one embodiment , the fan 210 is positioned to direct air towards the center of the lower pressure region 106 . the center , or pinnacle , of the lower pressure region 106 may serve as a rough approximation of the most effective location in which to direct air from the fan 210 . the fan 210 may be located flush with a vehicle surface , such as the rear surface 204 , or may alternatively be located at enough distance so that ducting may be attached to the fan 210 . any distance between the fan 210 and vehicle may be used , though the fan 210 is desirably near the rear surface 204 so as to maximize the effect of directed air . if the fan 210 is used without ducting , the fan 210 may desirably located in a location with sufficient ambient air for adequate operation of the fan 210 . in another alternative embodiment , the fan 210 may be mounted within the bumper 214 so as to provide a lower profile alternative . in this embodiment , the fan blade and inlet may be mounted within the bumper 214 , hiding them from view and reducing the chances of an injury from the fan blades , while the fan outlet ( if any ) would be pointing away ( either behind the vehicle , upwards , or another direction ) from the bumper 214 . the fan outlet could also be within the bumper 214 . the fan 210 may also have the ability to direct air in any direction . in one embodiment , the fan 210 is able to pivot to point in a variety of directions . if the fan 210 has an outlet , the outlet may pivot instead in order to provide the ability for the fan 210 to direct air in different directions . this may be useful , for example , in conjunction with a control strategy that optimizes fan direction based on vehicle speed , sensed regions of lower pressure , etc . in one embodiment , the fan 210 is directed towards the center of the lower pressure area 106 in order to maximize the effect of the fan 210 . in alternative embodiments , the fan 210 may be pointed in any direction that will direct air into the lower pressure area 106 and serve to increase the pressure . the optimal location or locations to direct air within the lower pressure region 106 depends on a variety of factors . as a vehicle accelerates , for example , the center of the lower pressure region 106 moves backwards . a vehicle 200 navigating a curve or subjected to a crosswind might have an offset lower pressure region 106 , and the fan 210 that can be directed towards either side of the vehicle 200 may offer improved performance . the fan 210 with the ability to pivot in different directions provides many options to optimize performance under any conditions . the fan 210 may also have the ability to have different rotational speeds for the fan blade . the fan 210 may have a pre - defined fixed speed , a user - configurable fixed speed , a controllable speed , etc . in one embodiment , a driver or passenger could choose different speeds for the fan 210 , such as by a switch located in the cabin . in another embodiment , a controller ( such as a microprocessor - based controller ) may control the fan speed based on any type of input , such as vehicle speed , sensed air pressure , fan performance , etc . in yet another embodiment , the physical configuration of the fan 210 , such as fan blade angle of attack , may be changed in order to optimize or improve performance . the fan 210 may be composed of any materials . it is desired that the fan 210 be made of a durable , inexpensive , lightweight , rustproof , etc . an optional fan cover ( not shown ) may also be included to cover the fan 210 when not in use . in particular , the fan cover could advantageously be deployed or retracted depending on whether the fan 210 is in use or not . in fig2 - 4 , two air ducts 212 are attached to the top surface 202 of the vehicle 200 . each air duct 212 includes an inlet 222 , a body 220 , and an outlet 224 . air is brought into the duct 212 through the inlet 222 and transported to the outlet 224 via the body 220 . in one embodiment , the air duct inlet 222 is substantially perpendicular to the flow of air when the vehicle 200 is moving forward so as to minimize additional drag created by the air duct 212 . the air duct outlet 224 may be attached to ( and in fluid communication with ) the inlet of the fan 210 so as to facilitate the smooth transition of air from the air duct 212 to the fan 210 . a filter to trap particulates or other objects may optionally be included within the air duct 212 . the air ducts 212 may be attached to the vehicle 200 in any way , such as by bolts , magnets , welding , glue , rope , etc ., or any method or system that is stable and secure at the maximum speed of the vehicle 200 . air ducts 212 may be integral to the body of the motor vehicle 212 and built into the sheet metal or other material , or may be added at a later time . the use of the fan 210 to control airflow entering the lower pressure region 106 may be controlled automatically , by a user , by optimized control algorithms , etc . in one embodiment , the fan is turned on when a certain condition is reached . for example , the fan could turn on at a certain velocity ( such as from the speedometer ) or a certain pressure ( as provided from a pressure sensor that would measure the pressure of the lower pressure region 106 ). a velocity - based trigger may be useful as the fan 210 will be potentially more effective at higher speeds , as the pressure drag generally increases with velocity . similarly , a pressure - based trigger allows for the fan 210 to be used only when the benefit of the fan 210 outweighs the extra drag and power associated with operation of the fan 210 and duct 212 system . in another embodiment , a person in the vehicle 200 may turn any fans 210 on or off or control any other aspect of the fans 210 via a user control , such as a switch . it is believed that the coefficient of drag may be reduced by five to ten percent utilizing one or more fans 210 to direct airflow into the lower pressure region 106 . the exact reduction in coefficient of drag will depend on many factors , including the number and type of fans , shape of the vehicle , vehicle speed , etc . other aspects of the pressure drag reduction system 230 may also be controlled or optimized . in one embodiment , the aspects of the fan 210 such as fan speed or the fan blade angle may be changed to optimize performance . in another embodiment , the airflow through the ducts 212 may be controlled ( such as moving ducts or interior surfaces ) to provide an optimal amount of air to the fan 210 . optimization may include any aspects of the pressure drag reduction system 230 , including fan speed , fan size , fan direction , fan blade angle of attack , duct configuration , number of fans turned on , duct configuration , etc . optimization may be taken into account during initial design or construction , and is advantageously performed during operation . optimization or any controls during operation may be controlled by an on - board controller , vehicle computer / control system , remote control , controls within the vehicle 200 cabin , etc . one control example may be based on vehicle speed . while the vehicle 200 is moving at a slow speed ( such as stuck in traffic or in the city ), the lower pressure region 106 may be relatively small , and the power cost , complication , noise , etc . of the fan 210 may outweigh the benefits of running the fan 210 . but as the motor vehicle 200 gets on the highway , the size and pressure differential of the lower pressure region 106 increases , making the ability of the fan 210 to direct air into the lower pressure region 106 more advantageous . in this embodiment , a typical vehicle speed may be calculated and the fan 210 may advantageously be turned on when the vehicle reaches that speed . in another example , a pressure sensor could be located so as to sense a pressure indicative of the pressure of the lower pressure region 106 . in this embodiment , when the pressure in the lower pressure region 106 falls below a certain pressure ( such as when the vehicle 200 accelerates ), one or more fans such as the fan 210 could be turned on . in this way , the fans need only be turned on when there is a benefit to doing so . alternatively , the number of fans or the particular configuration of fans ( when there are two or more fans like fan 210 ) may also be optimized based on the sensed pressure . in an alternative embodiment , a similar control scheme could be based on a pressure differential between the lower pressure region 106 and ambient air pressure , pressure from the front of the vehicle 200 , a speed of a crosswind , a radius or angle of a curve on which vehicle 200 is traveling , and / or any other measurement indicative of the characteristics of the lower pressure region 106 . fig5 depicts a rear view of a vehicle equipped with a pressure drag reduction system 530 according to an alternative embodiment . as shown in fig5 , vehicle 200 has two fans 510 for directing air behind the vehicle . in one embodiment , each fan 510 has a separate fan inlet and receives air from the outlet 524 of the corresponding air duct 212 . in another embodiment , the two fans 510 share a fan inlet , and air from the outlets 524 of both air ducts 212 enters the joint fan inlet for use in the two fans 510 . in an alternative embodiment , more than two fans 510 may be used to direct air behind the vehicle 200 . for example , a series of smaller fans 510 could provide advantages in system power consumption , effectiveness , noise , aesthetics , cost , redundancy , etc . a larger number of fans 510 could also provide finer control over the amount of air being blown through each fan 510 . any combination of number , size , outlet direction , type , material , speed , or other design considerations for the fans 510 may be used and be within the scope of the invention . fig6 - 8 depict a rear , top , and side view , respectively , of a vehicle equipped with a pressure drag reduction system 630 including a fan , side ducts and top ducts according to an alternative embodiment . the vehicle 200 of fig6 - 8 includes both top air ducts 212 and side air ducts 602 . both the top air ducts 212 and side air ducts 602 may feed into the inlet of fan 210 . by utilizing both top and side air ducts , each duct may be sized to smaller dimensions , which may result in lower drag created by the ducts themselves as well as an improved aesthetic effect . side air ducts 602 may be attached to the side surface 208 in any way and may extend any distance along side surface 208 . in an alternative embodiment , top air ducts 212 and side air ducts 602 merge before reaching the fan 210 so that fewer ducts need to interface with the inlet of fan 210 . any combination of ducts may be utilized , including combinations of top , side , bottom , and internal ducts . fig9 depicts a rear view of a vehicle equipped with pressure drag reduction system 930 including two fans and no ducts according to another alternative embodiment . in this embodiment , fans 910 draw air from the space between the fans 910 and the rear surface 204 of the vehicle 200 . air may be located adjacent the rear surface 204 even when the lower pressure region 106 exists behind the vehicle 200 . in this embodiment , fan speed is preferably limited so as to minimize over - rotation of the fan blade in the event that insufficient air is present , as over - rotation could result in burnout of the motor of the fans 910 . in an alternative embodiment , air is transferred to the inlet of the fans 910 via internal ducting instead of external ducts . in this embodiment , an air inlet could be located on , for example , the front surface 218 of the vehicle . air could be ducted from the inlet to the inlet of the fans 910 via internal ducts , ducts that may be much less obtrusive than external ducts . internal ducts may also have reduced drag when compared to external ducts , as they do not add additional area to create drag . in one embodiment , air may be ducted from a radiator near the front surface 218 or any other source of air from within the vehicle 200 . in another alternative embodiment , a vehicle 200 may use internal ducts to deliver air to one or more fans 910 utilizing the bumper 214 . in this embodiment , internal space within the bumper 214 may be used to contain the internal ducts and / or the inlets of the fans 910 . this embodiment may provide structural and / or aesthetic advantages , as the fan / duct interface may be hidden within the bumper 214 . in another alternative embodiment , one or more fans 910 may be located within any of the ducts 212 , whether external or internal . this may provide the benefits of reducing any drag associated with the fans as well as minimizing any safety risk . in this embodiment , the air duct outlet 224 may serve as the outlet for the fans 910 . the fans 910 in this embodiment must be small enough to fit within the duct 212 , limiting the physical size of each of the fans 910 . the method and apparatus for reducing pressure drag of a vehicle disclosed herein may be provided as part of a vehicle when manufactured , bought or leased . in this embodiment , the pressure drag reduction system , such as pressure drag reduction system 230 , including fans and / or ducts , may be provided as an option for the vehicle 200 . this may allow the fan and / or ducts to be more fully integrated into the vehicle 200 , such as by using internal ducts , integrating the ducts or fans with body work , matching colors and materials , etc . alternatively , any fans may be designed to appear as a bumper guard ( such as a black or chrome bumper guard ) in order to provide a more “ rugged ” appearance . integration with the vehicle 200 is a particularly attractive option for manufacturers of suvs , trucks , vans , tractor - trailer rigs , or other high - cd vehicles , where fuel efficiency is increasingly desired ( and where the benefits of reducing pressure behind the vehicle are greater ) and any aesthetic disadvantage may be reduced . in another embodiment , the pressure drag reduction system 230 may be provided as a retrofit system . in this case , for example , a vehicle owner could purchase pressure drag reduction system 230 in order to improve the fuel efficiency of their vehicle 200 . an easily attachable / detachable pressure drag reduction system 230 may be particularly attractive to a rental agency , who could rent them to drivers who are , say , about to embark on a cross - country trip and want to improve their vehicle &# 39 ; s fuel efficiency . for a retrofit system , it may be desirable to provide an independent power source , such as a battery , small fuel cell , solar cells , etc ., but the vehicle 200 power source may also be used . as will be recognized , the pressure drag reduction system 230 may add complexity , cost , weight , and drag to a vehicle 200 , resulting in a higher upfront cost and a weight / drag penalty . the operation of the pressure drag reduction system 230 , however , will serve to reduce operating costs of the vehicle 200 dramatically by overcoming the added weight and drag associated with the system by reducing the pressure drag of the vehicle 200 . fig1 depicts a flowchart 1000 for optimizing the pressure drag reduction system 230 of a vehicle 200 according to one embodiment . the method of fig1 may be implemented by any type , or combinations of type , of processor , such as hardware , software , firmware , etc . flowchart 1000 begins with optional step 1002 , receiving input from the vehicle 200 . if input is received from the vehicle 200 , it may include vehicle speed , time of day , pressures from different locations on the vehicle , environmental conditions , vehicle angle ( e . g ., such as tilt during a turn ), duct configuration , air velocity from different locations near the vehicle , vehicle type or configuration , ambient noise level , etc . input from the vehicle could also include user inputs such as power on commands , power off commands , requests for fan speed or fan configuration , pre - defined profiles ( e . g ., a profile optimized for low noise or city driving , etc . ), or any other type of information . flowchart 1000 continues in optional step 1004 , receiving input from sensors . the input from sensors may include any type of information discussed in relation to step 1002 , as well as information derived from sensors related to the pressure drag reduction system 230 , such as fan speed , fan blade angle of attack , fan direction , pressure , duct configuration , noise level , or any other type of information . flowchart 1000 continues in step 1006 , determining an improved pressure drag reduction system 230 configuration . in this step , an improved or optimized configuration is determined based on the inputs received in step 1002 and / or step 1004 . the improved or optimized configuration may include turning fans on or off , changing the direction of fans , changing the speed or blade angle of attack for fans , changing the duct configuration , or any other aspect or output characteristic of the system . a determination may be made by calculations , algorithms , look - up tables , or any other means . as one example , a decision to turn on a fan 210 may be made in step 1006 if a vehicle speed over a predefined amount is received as an input in step 1002 . the flowchart 1000 then proceeds to step 1008 , transmitting a command based on the determined improved system configuration to the pressure drag reduction system 230 . the flowchart may then terminate , or redirect to step 1002 for repeated improvement or optimization cycles . unless the context clearly requires otherwise , throughout the description and the claims , words using the singular or plural number also include the plural or singular number , respectively . additionally , the words “ herein ,” “ hereunder ,” “ above ,” “ below ,” and words of similar import , when used in this application , shall refer to this application as a whole and not to any particular portion . while certain aspects of the invention are presented below in certain claim forms , the inventors contemplate the various aspects of the invention in any number of claim forms . accordingly , the inventors reserve the right to add additional claims after filing the application .	1
the following is a description of a first embodiment of the invention , taken in conjunction with fig1 to 4 . a machine 1 for the manufacture of a web of single - face board 2 comprises a liner web delivery unit 3 , with a liner web 4 being passed around several deflection rollers 5 and around a preheating roller 6 also designated as a pre - heating cylinder for heat - up of the liner web 4 . then the liner web 4 is led through a web - tension - regulating unit 7 that serves for regulating the tension of the liner web 4 and will be described in detail below . then the liner web 4 is fed , via further deflection rollers 5 , to a corrugated - board - manufacturing unit 8 . a web of board termed the medium 10 is supplied to the corrugated - board - manufacturing unit 8 by a medium delivery unit 9 . in the medium delivery unit 9 , the medium 10 is passed over several deflection rollers 5 as well as two preheating rollers 11 , also called pre - heating cylinders , and is then delivered to the corrugated - board - manufacturing unit 8 . this comprises a fluted unit 12 for the medium 10 to be corrugated . then the corrugated medium 10 is passed along the adhesive applicator unit 13 and , in a nip pressure unit 14 , united with the liner web 4 that is trained over a pre - heating roller 15 ( also pre - heating cylinder ) and a web tension sensor 16 . the finished web of single - face board 2 is discharged upwards via a discharge unit 17 and temporarily stored in a place of deposit 18 . the units 3 , 8 , 9 , 12 , 13 , 14 , 17 are elements of a corrugating machine 1 that have been known for a long time . the following is a detailed description of the design of the web - tension - regulating unit 7 . the unit 7 comprises a main roller 21 which is vapor - heated from inside and rotatably mounted in bearings 20 relative to a machine frame 19 . the roller 21 has bearing journals 22 that project from its ends and are mounted in the bearings 20 . the roller 21 rotates about an axis of rotation 23 . between the machine frame 19 and the roller 21 , a pulley 25 is rotatably mounted on both bearing journals 22 by way of a bearing 24 , having two radially projecting arms 26 and 27 that make between them an angle b of b ≈ 60 °, it being possible also to use other angles b . a front roller of web contact 28 and a rear roller of web contact 29 are rotatably mounted between the two opposing arms 26 and 27 of the two pulleys 25 . the rollers 28 and 29 rotate about corresponding axes of rotation 30 and 31 . the axes of rotation 23 , 30 and 31 are parallel to each other . the pulleys 25 , inclusive of the rollers 28 and 29 , are mounted for pivoting relative to the axis of rotation 23 by a chain drive 32 . to this end , the pulleys 25 have an encircling gear rim 33 of a diameter dz . passed around each gear rim 33 is a chain 34 which , at the driving end , is passed over two gear rims 36 that are connected to a drive shaft 35 . the drive shaft 35 is run by both ends in bearings 37 in relation to the machine frame 19 . the shaft 35 is drivable by a motor 38 that is joined to it . the gear rims 36 have an outside diameter d k . the transmission ratio that the small gear rim 36 bears to the great gear rim 33 is d z / d k ≈ 4 , other transmission ratios being conceivable too . the main roller 21 is driven for rotation by a motor 39 that is connected to the bearing journal 22 , with the tangential outer peripheral velocity of the roller 21 being v w . the unit of the two pulleys 25 inclusive of the arms 26 and the rollers 28 and 29 is designated as a supporting device . a humidifier unit 40 is provided where the liner web 4 is delivered to the unit 7 , spraying water vapor on the side of the liner web 4 — the upper side in fig3 and 4 — that is subsequently turned towards the main roller 21 . the liner web 4 , prior to reaching the main roller 21 , has a velocity termed v b . the liner web 4 , while passing around the rollers 21 , 29 and 30 , is trained through the nip between the roller 29 and the roller 21 and then through the nip between the roller 28 and the roller 21 . the liner web 4 rests on the main roller 21 by a variable angle of contact a . for web tension determination , the web tension sensor 16 is provided in the unit 8 between the pre - heating roller 15 and the nip pressure unit 14 , taking the tension of the liner web 4 and transmitting a corresponding signal via a line 41 to a central control unit 42 . via lines 43 and 44 , the control unit 42 is connected with the motors 38 and 39 . the following is a description of how the web - tension - regulating unit 7 works . the tension of the liner web 4 downstream of the unit 7 is affected by two variables , one of them consisting in how rapidly the main roller 21 is driven . for braking the liner web 4 i . e ., for increasing the web tension downstream of the unit 7 , the peripheral velocity v w of the main roller 21 is lower than the velocity v b of the liner web . in the extreme , the main roller 21 does not rotate . another possibility of web tension modification resides in modifying the angle of contact a of the liner web 4 around the main roller 21 , which changes the frictional force between the surface of the main roller 21 and the liner web 4 . the position of the rollers 28 and 29 seen in fig3 shows the smallest angle of contact a , to which a ≈ 10 ° applies . in this arrangement , the liner web 4 is supplied by the liner web delivery unit 3 to the web - tension - regulating unit 7 , first passing the humidifier unit 40 which sprays water vapor on the upper side of the liner web 4 , thus increasing the friction between the liner web 4 and the main roller 21 as compared to a dry liner web 4 . then the liner web 4 is slightly deflected by the roller 29 and passed along the main roller 21 by an angle of contact a , after which it is deflected on the roller 28 and led towards the corrugated - board - manufacturing unit 8 . the web tension sensor 16 continuously takes the tension of the liner web 4 . if the tension is too low , the control unit 42 transmits corresponding signals to the motors 38 and / or 39 . for web tension increase , the velocity v w of the main roller 21 may be reduced . if this is not sufficient , the rollers 28 and 29 are pivoted clockwise by way of the motor 38 and the chain drive 32 , with the angle of contact a increasing . fig4 shows a position with a great angle of contact a . the supply of water vapor augments the friction between the liner web 4 and the main roller 21 , which is in particular desirable for web tension regulation . water vapor is supplied to the side of the liner web 4 that is turned towards the main roller 21 . moreover , the liner web 4 must have a certain humidity for adhesion to the medium 10 in the nip pressure unit 14 to be produced impeccably . the web - tension - regulating unit 7 enables the tension of the liner web 4 to be kept constant near the web tension sensor 16 i . e ., directly prior to adhesion to the medium 10 . typically , the angle of contact a must be increased as the velocity v b of the liner web 4 increases for constant web tension to be maintained at the web tension sensor 16 . it is also possible to determine the web tension by the current of the motor 38 of the pivoting drive . the higher the web tension , the greater is the energy to be mustered up by the motor 38 — and thus the current needed — for keeping a certain angle of contact a . there is no need of a web tension sensor in the case of this simple type of web - tension measuring . the following is a description of a second embodiment of the invention , taken in conjunction with fig5 to 7 . identical parts have the same reference numerals as in the first embodiment , the description of which reference is made to . parts of identical function that differ in construction have the same reference numeral provided with a prime . the essential difference from the first embodiment resides in that the liner web 4 is passed over the main roller 21 instead of substantially below the main roller 21 as in the first embodiment . correspondingly , the humidifier unit 40 ′ is disposed underneath the liner web 4 in order for the side turned towards the main roller 21 to be moistened by vapor as with the first embodiment . fig6 shows a position , corresponding to fig3 of the rollers 28 and 29 , in which the angle of contact a is minimal . in the case of the arrangement according to the second embodiment , it is possible , as seen in fig6 to obtain an angle of contact of a = 0 ° i . e ., the liner web 4 does not at all contact the main roller 21 and is passed only around the roller 28 and led off through the nip between the roller 29 and the roller 21 . in the case of this arrangement , there is the lowest frictional resistance as compared to all the other positions of the rollers 28 and 29 . pivoting the rollers 28 and 29 counter - clockwise about the axis of rotation 23 will increase the angle of contact a . fig7 illustrates a situation with a great angle of contact of a ≈ 270 °. advantages of the second embodiment as opposed to the first embodiment reside in that there is a wide range of angles of contact that can be set , in the present case 0 °≦ a ≦ 270 °. it is possible to set even greater angles of contact a .	1
fig1 depicts an overall speaking valve for laryngectomized and tracheotomized persons according to the invention with the reference sign 10 with a housing 12 , which can be attached to a retainer ( not depicted ), like e . g . a baseplate or a plaster that can be worn on the neck of the patient , or to a trachea cannula . the housing 12 consists of an outer wall 13 as well as a proximal first opening 14 , which is arranged in close proximity to the body of the patient , and a distal second opening 16 , which is arranged facing away from the body with reference to the patient . for the most part , a filter 38 is arranged inside of housing 12 , with a side wall 44 that is made of an open - pored synthetic material , which is made in an elastic manner . housing 12 features a distal end face 24 . on the outer wall 13 , in the area of the distal second opening 16 of housing 12 , an enlarging aid 26 is arranged in form of a circulating flange . the surface 25 of this flange is arranged at flush with the end face 24 of housing 12 . on one inner wall 22 of housing 12 , a fixing aid 18 is arranged that is formed as a circular flange , whereby the distal upper surface of it can come or does come in contact with a proximal surface 40 of filter 38 . furthermore , a total of six additional fixing aids 20 . 1 to 20 . 6 ( see fig3 ) are arranged on the inner wall 22 of housing 12 , which are formed in a cone - shaped way and which reach into the elastic material of filter 38 with their pointed ends . these additional fixing aids 20 are distributed equally along the inner wall 22 of housing 12 , and are aligned within one plane that is perpendicular to an imaginary center axis of the filter and approx . parallel to e . g . the proximal surface 40 of filter 38 . advantageously , at least two further , preferably three , more preferably four , five , six or eight or more of such fixing aids 20 are arranged on the inner wall 22 of housing 12 . these further fixing aids 20 prevent that filter 38 can slip out of an inner compartment 11 of housing 12 . alternatively and in the sense of the present invention , it can also be intended that further fixing aids 20 are left out , and that fixing aid 18 is instead equipped e . g . with hook - like means on its distal surface or that at least partially , but preferably on the entire surface , an adhesive is applied , which provides or produces a tight connection with the elastic material of filter 38 . in this way , a slipping of filter 38 out of the inner compartment 11 is prevented . housing 12 further consists of a bottom part 28 , which can be arranged in star - shape with three arms , as it can be derived from fig3 . the ridges of the bottom part 28 connect to the inner wall 22 of housing 12 . advantageously , a proximal surface of bottom part 28 is arranged approximately at flush with a proximal end face of housing 12 . in an alternative embodiment of the present invention it would be e . g . possible that the bottom part 28 directly functions as fixing aid 18 or 20 . in that case e . g . an embodiment could be presented in the form that filter 38 would be connected with the distal surface of bottom part 28 , at least partially , e . g . by means of applying an adhesive on it or by means of providing means for hooking , which could reach into the elastic material of filter 38 . thus , fixing aids 18 and 20 could be omitted , whereas fixing aid 20 could still be intended , whereby it would now be arranged in such a way that it can reach into the elastic material of filter 38 . the speaking valve 10 according to fig1 further consists of a cover 46 , which features a lower surface 47 , onto which filter 38 is attached with its distal end 42 and with its surface 39 at least partially , but preferably fully , e . g . by means of welding , gluing or by means of arranging for respective means for hooking . when an adhesive is intended , it can also just be intended for only a partial section between the distal end 42 with the surface 39 of filter 38 and the lower surface 47 of cover 46 , as long as a sufficiently firm grip of cover 46 to filter body 38 can be produced in this way . cover 46 basically consists of an even plate , which can be made e . g . of a plastic material , which is advantageously relatively hard , but which at the same time features a certain flexibility , in order that it can eventually produce a secure interruption of the air stream in closed position of speaking valve 10 . on the distal surface of cover 46 , an operating device 60 is arranged approximately in the center , which makes it easier for the patient to find the right pressure point by palpation in order to reach the ideal closing effect for the interruption of the air stream in order to produce a speaking . cover 46 features an edge 48 with a lower surface 50 . the lower surface 50 can be addressed as ring - shaped area , edge 48 as arranged in a ring - shape . filter 38 protrudes beyond end face 24 of housing 12 by approximately 15 % of its overall height . if now a patient applies pressure onto cover 46 in the direction of the proximal first opening 14 of housing 12 , then filter 38 is compressed , and the lower surface 50 of edge 48 of cover 46 comes into contact with end face 24 as well as the distal surface 25 of enlarging aid 26 . hereby an airstream from the outside of the housing , as it is symbolized e . g . by arrow 64 . 1 , into the inner compartment 11 , as well as an airstream in the opposite direction , as it is symbolized by arrow 64 . 2 , is prevented . in the sense of the present invention , it can e . g . also be possible that there is a central opening in the area of the operating device 60 , so that the patient can also breathe air , and air can reach into the inner compartment 11 of housing 12 through this opening , or in opposite direction , that air can also leave the speaking valve through it . by means of the interruption of the airstream due to the contacting of the cover with the housing , speaking is made possible to the patient . fig1 depicts the speaking valve 10 in the initial position , which means in a position , in which the patient is able to breathe , in that air can stream in and also out through a sideways opening 36 and possibly also through a central opening in the area of the operating device 60 that is intended in the cover , into or out of the inner compartment 11 of housing 12 . opening 36 is arranged in a circular - shape all around , without any interruptions . in order to improve the contacting and thus also the interrupting of the airstream , sealing gaskets 32 or 62 are arranged on the cover piece 46 and at housing 12 . sealing gasket 32 is hereby arranged on the end face 24 of housing 12 as well as on the distal surface 25 of enlarging aid 26 . on the respective opposite side there is a sealing gasket 62 on the lower surface 50 of edge 48 of cover 46 . sealing gasket 32 as well as sealing gasket 62 are made of silicone or of another sufficiently soft , that means elastic synthetic material , which is arranged in a medically harmless way . fig2 depicts the closed position of speaking valve 10 according to fig1 in detail , and hereby in particular the contacting of sealing gasket 32 and 62 . fig3 depicts a bottom view of the first embodiment of speaking valve 10 according to fig1 , from which in particular the formation of the bottom part 28 as a three - armed star and its attaching to the inner wall 22 of housing 12 can be seen . the radially symmetrical embodiment of speaking valve 10 can also clearly be derived from fig3 , as well as the six fixing aids 20 . 1 , 20 . 2 , 20 . 3 , 20 . 4 , 20 . 5 and 20 . 6 . fig4 to fig6 now depict a second , third and fourth embodiment of speaking valve 10 in a detailed depiction concerning the distal end section of housing 12 . hereby , same parts are described with the same reference signs as in the first embodiment according to fig1 to fig3 . fig4 depicts a housing 12 with an enlarging aid 26 that is arranged on an outer wall 13 of the housing , which features a first elevation 30 . when viewed in cross section , it has a rectangular , almost square shape . on the distal surface of the first elevation 30 and on the end face 24 of housing 12 that was created hereby , a sealing gasket 32 is arranged , whereby the sealing is also arranged on the area between the first elevation 30 and the distal end face 24 of housing 12 within the area of ledge 33 that is arranged there . fig5 depicts a third embodiment of the speaking valve 10 according to the invention with a housing 12 and an enlarging aid 26 that is arranged on an outer wall 13 of the housing , which features a first elevation 30 , whereas in contrast to the second embodiment according to fig4 , this one features a sloped ledge 33 , which is inclined towards a not really depicted inner compartment 11 of housing 12 . the sloped ledge 33 hereby runs from the distal surface of the first elevation 30 downwards to the distal end face 24 of housing 12 . a sealing gasket 32 is arranged over the entire surface of the first elevation 30 and of the distal end face 24 of housing 12 , which is facing towards the ( not depicted ) cover 46 . fig6 depicts a fourth embodiment of the speaking valve 10 according to the invention with a housing 12 and an enlarging aid 26 that is arranged on an outer wall 13 of the housing with a first elevation 30 . when viewed in cross section , the first elevation 30 features a surface with an almost sigmoidal course of a curved component 35 , which is facing towards a not depicted cover 46 , which goes over into a distal end face 24 of housing 12 . fig7 depicts an embodiment of a cover 46 that is associated to the fourth embodiment of the present invention , with a second elevation 54 , which is arranged on a lower surface 50 of edge 48 of cover 46 , and which features a curved component 37 when viewed in cross section , with an almost sigmoidal course at least along a partial section of this second elevation 54 , whereby there is a more or less even course of this surface close to a filter 38 or of its filter side wall 44 , which more or less corresponds to the distal end face 24 of housing 12 . fig6 and fig7 illustrate that there is an adaption between the outer contour of the lower surface 50 of cover 46 and that of an outer contour of end face 24 of housing 12 as well as between an outer contour of the first elevation 36 and that of the second elevation 54 . thus , when pressure is applied from the initial position onto cover 46 by the patient , a centering of cover 46 with the filter 38 in housing 12 is accomplished and thus a secure interruption of the airstream in order to accomplish a speaking . fig8 depicts in a fifth embodiment a detailed formation of the distal end section of housing 12 with a distal end face 24 and an enlarging aid 26 that is arranged on an outer wall 13 of the housing 12 , which carries a first elevation 30 . this first elevation features recesses 34 that are more or less arranged in semicircular shape . fig9 hereby depicts a complementary arrangement of a cover 46 for this fifth embodiment with a lower surface 50 of edge 48 with pin - like centering aids 56 that are arranged onto it , which can be accommodated by recesses 34 in the distal end section of housing 12 . fig1 illustrates in a top view onto housing 12 according to fig8 , that a total of eight semicircular recesses 34 are intended in the area of the enlarging aid 26 with the first elevation 30 , in which a corresponding amount of pin - like centering aids 56 , which are arranged onto cover part 46 , can be accommodated . the recess 34 can hereby be addressed as the first centering aid in the sense of the present invention , the pin - like centering aid 56 as the second centering aid , whereby the first and the second centering aid work together in order to achieve the centering . the arrangement of first and second centering aids 34 or 56 is also combinable with the formations according to fig4 to fig6 of the second to fourth embodiments , and can of course also be combined with the first embodiment . in conclusion it should be noted that the formations that are depicted in the figures of the first to the fifth embodiment of the speaking valve according to the invention , are not to be interpreted as limiting or restricting . rather , the characteristics that are described there can be combined with each other and with the characteristics of the present invention that were described before the figures for further development . furthermore , it should be noted that the reference signs in the figure descriptions do not limit the scope of protection of the present invention , but that they should merely refer to the embodiments that are depicted in the figures . it may be noted in particular , that the first embodiment that is depicted and described in fig1 , can also be arranged in a different way , and that in particular the bottom part 28 can also function as fixing aid 18 or 20 , so that eventually also a reduction of the construction height of the speaking valve according to the invention can be accomplished .	0
a method for controlling and concentrating flux during dispensing from a metal refining apparatus and process comprises disposing an induction heater assembly on a discharge guide tube with a gap defined therebetween . the metal refining apparatus and process comprise any appropriate metal refining apparatus and process , such as , but not limited to , an electroslag refining apparatuses and processes , vacuum - induction metal apparatuses and processes , induction melt apparatuses and processes , electron beam cold hearth apparatuses and processes , plasma arc apparatuses and processes , vacuum arc remelting apparatuses and processes , and others . the following description will refer to electroslag refining apparatuses and processes as exemplary refining apparatuses and processes in which refined metal is dispensed therefrom . this refining apparatus and process is merely for description purposes , and other metal refining apparatuses and processes are within the scope of the invention . the discharge guide tube comprises an interior discharge guide tube flux concentration configuration concentrating electromagnetic flux and consequent heating of a stream of refined metal flowing through a central orifice in the discharge guide tube . the method , as embodied by the invention , will be described hereinafter with respect to a configuration of an electroslag refining apparatus 10 and discharge guide tube 22 . an electroslag refining apparatus 10 for conducting the method , as embodied by the invention , is schematically illustrated in fig1 and 2 . the electroslag refining apparatus 10 comprises a cylindrical crucible 12 in which an ingot 14 ( also known in the art as a “ consumable electrode ”), which is to undergo electroslag refining , is suspended . a feed device 16 is provided for feeding the consumable electrode 14 into the crucible 12 at a suitable feed rate , as known in the art . the feed device 16 includes , but is not limited to , a suitable drive motor and transmission 16 a , that rotate a screw 16 b that in turn lowers , or translates downwardly , a support bar 16 c that is fixedly joined at one end to the top of the consumable electrode 14 . although the illustrated configuration of the electroslag refining apparatus 10 illustrates a consumable electrode 14 as the source of metal to be electroslag refined , the scope of the invention comprises other suitable sources , such as but not limited to a powder source or a liquid metal source . the consumable electrode 14 comprises a suitable alloy to be electroslag refined , in which the alloy comprises nickel -, iron -, iron - nickel -, or cobalt - based alloy or superalloy . a slag 18 is provided inside the crucible 12 . the slag 18 comprises any suitable composition for refining the consumable electrode 14 . a heater device 20 is provided for melting the tip of the consumable electrode 14 as the consumable electrode 14 is fed into the crucible 12 . the heater device 20 includes a suitable electrical current power supply 20 a that is electrically connected to the consumable electrode 14 . the heater supply 20 a is connected to the consumable electrode 14 through the supporting bar 16 c , for example by an electrical lead 20 b . electrical current is carried through the consumable electrode 14 , and through the liquid slag 18 to the crucible 12 . therefore , the slag 18 is resistively heated to a temperature that is suitable to melt the bottom end of the consumable electrode 14 . although the illustrated configuration of the electroslag refining apparatus 10 illustrates a consumable electrode 14 as the source of electrical current , the scope of the invention comprises other suitable sources , such as but not limited to an unconsumed electrode . a copper discharge melt guide 22 is removably attached to a bottom 12 a of the crucible 12 . the discharge melt guide 22 comprises a central orifice 32 that includes a configuration to concentrate electromagnetic flux in the central orifice 32 , so as to more efficiently heat metal therein , as described hereinafter . the discharge melt guide 22 encloses the bottom of the crucible 12 . an electrical path can be provided between the power supply 20 a by an electrical lead 20 c . the slag 18 is heated by the power supply 20 a , and this heating causes a bottom tip of the consumable electrode 14 to be correspondingly heated and melted . liquid refined melt of molten metal , or simply liquid refined melt 14 a from the consumable electrode 14 is formed . the liquid refined melt 14 a falls through the slag 18 and collects in a liquid metal pool or reservoir 24 , which is disposed at the bottom of the crucible 12 . the electroslag refining apparatus 10 includes a cooling system 26 that cools the crucible 12 during operation of the electroslag refining apparatus 10 . the cooling system 26 can comprise a coolant supply 26 a that is effective for pumping a coolant 26 c , such as , but not limited to water , through a cooperating cooling jacket 26 b that is disposed around the crucible 12 . the crucible 12 and cooling jacket 26 b may be an integral assembly . alternatively , the crucible 12 and cooling jacket 26 b may be discrete components connected together in thermal cooperation . the cooling jacket 26 b includes suitable channels or conduits that extend therethrough , and coolant 26 c is circulated for removing heat from the crucible 12 during operation of the electroslag refining apparatus 10 . a solid slag skull 18 a can form inside the crucible 12 around the liquid slag 18 . the solid slag skull 18 a can isolate the crucible 12 from the liquid slag 18 and the metal that can fall through the electroslag refining apparatus 10 . electroslag refining of the consumable electrode 14 occurs as the metal liquid refined melt 14 a are exposed to the slag 18 . the slag 18 dissolves inclusions , such as but not limited to oxide inclusions and nitrogen inclusions , from the liquid refined melt 14 a . the crucible 12 , which typically comprises copper , is isolated from the refining process by the solid slag skull 18 a . therefore , the crucible 12 does not contaminate the ingot melt 14 a . the refined melt collects in the reservoir 24 at the bottom of the crucible 12 . the ingot skull 14 b isolates the refined melt from the crucible 12 and prevents contamination of the melt by the crucible 12 . during operation , the liquid slag 18 floats atop the pool of refined melt that is collected above the discharge melt guide 22 . the discharge melt guide 22 is illustrated in fig2 is configured to generate , electromagnetic flux intensity and concentration of heating when compared to conventional melt guides , such as in u . s . pat . no . 5 , 809 , 057 , to benz , which is assigned to the assignee of the instant invention and fully incorporated herein . it has been determined that the amount of induction heating in the discharge guide tube is generally proportional to the square of the applied electromagnetic field , and that with the interior discharge guide tube flux concentration configuration , as described hereinafter , provides electromagnetic flux in a substantially constant levels with changes in coil position . fig2 provides an enlarged view of the discharge melt guide 22 enclosing the bottom 12 a of the crucible 12 . in fig2 the crucible 12 comprises a solid cylindrical member , with its bottom 12 a formed as an annular radial flange . the coolant jacket 26 b comprises a double - walled cylinder that surrounds the crucible 12 . the coolant jacket 26 b is hollow for receiving the coolant 26 c for cooling the crucible 12 . the discharge melt guide 22 comprises a substantially flat base plate 28 . the base plate 28 can be formed from an appropriate heat and electrically conductive material , such as but not limited to , copper . the base plate 28 comprises a circular disk that is complementary to the configuration of the crucible 12 , and comprises an upper perimeter 28 a with a diametrical portion that engages the crucible bottom 12 a . thus , the discharge guide tube 22 can form a sealed attachment to the crucible 12 . also , fasteners 30 , for example a plurality of circumferentially spaced apart bolts and cooperating nuts , can removably attach and seal the base plate 28 to the crucible bottom 12 a . in fig2 the fasteners 30 extend through apertures in the perimeter of the base plate 28 that are aligned with apertures disposed in a suitable annular flange around the base of the coolant jacket 26 b . a gasket , or other such sealing element , may be provided between the base plate 28 and the crucible bottom 12 a to be compressed therebetween upon assembly of the fasteners 30 that secure the base plate 28 to the bottom of crucible 12 . the base plate 28 of the discharge guide tube 22 comprises an upper surface 28 b , which together with the crucible 12 , defines the reservoir 24 for receiving and pooling liquid refined melt 14 a . the base plate 28 also comprises an external or lower surface 28 c that is spaced below the upper surface 28 b . in fig2 both surfaces 28 b and 28 c are illustrated as substantially flat and parallel to each other . this illustrated configuration is merely exemplary and is not intended to limit the invention in any way . the scope of the invention includes other configurations of these features , such as not limited to , concave , convex , arcuate , and combinations thereof , with or without flat and parallel features . the base plate 28 also comprises includes a central orifice 32 ( also known in the art as a “ discharge guide tube orifice ”) formed in an extension 29 that extends to an outlet 100 . the central orifice 32 extends generally vertically through the base plate 28 between its upper and lower surfaces , 28 b and 28 c respectively . the central orifice 32 allows refined melt 14 a to be drained from the reservoir 24 , for example , and in no way limiting of the invention , by at least one of gravity flow , pressure - induced flow , and vacuum - induced flow on the bottom of the refined melt 14 a . the discharge melt guide 22 comprises a central orifice 32 that includes an interior discharge guide tube flux concentration configuration to enhance heating , by concentrating electromagnetic flux in the central orifice 32 , as described hereinafter . the base plate 28 comprises at least one slot 34 formed therein , as illustrated in fig3 . each slot 34 can extend vertically through the base plate 28 . each slot 34 directs the electromagnetic flux in the electroslag refining apparatus , as described hereinafter . the base plate 28 may alternatively comprise a plurality of spaced apart slots 34 , for example slots that are equiangularly , circumferentially spaced from each other , and that extend radially outwardly from the orifice 32 toward the perimeter of the base plate 28 . a plurality of equiangularly , circumferentially spaced slots 34 are illustrated in fig4 . in fig4 four slots 34 are illustrated as being disposed about 90 degrees apart from each other , however , this configuration is merely exemplary of the slot configurations within the scope of the invention . the scope of the invention comprises any suitable number of slots 34 in the base plate 28 . the slots 34 may also be formed using electrodischarge machining ( edm ). alternatively , other known metallurgical processes may be used to form the slots 34 , and are within the scope of the invention . the slots 34 can be gas filled , or filled with an electrical insulation 36 , such as , but not limited to , an epoxy polymer . the slots 34 define a plurality of arcuate segments or fingers 28 d . the illustrated configuration ( fig4 ) shows four fingers 28 d ( alternatively referred to as “ segments ”) defined between the slots 34 . the cooling system 40 for the base plate 28 can comprise channels 40 a that extend inside each of the fingers 28 d for circulating a coolant 26 c therethrough . the cooling system 40 can be provided with its own source of coolant . alternatively , the cooling system 40 may be disposed in parallel with the cooling supply 26 a , and use the coolant that cools the crucible 12 . this configuration is merely exemplary of the scope of the invention and is not intended to limit the invention in any manner . each finger 28 d can comprise an approximate 90 - degree corner . the cooling channels 40 a in the discharge guide tube 22 may be formed by drilling cylindrical holes radially inwardly from the outer perimeter of the base plate 28 . adjacent channels 40 a may be disposed therein to converge radially inwardly and intersect near the central orifice 32 , thus providing supply and return paths for coolant flow . in the illustrated exemplary embodiment of fig2 and 4 , the cooling system 40 also includes a pair of coolant manifolds 40 b and 40 c , which may be integrally formed with the base plate 28 . alternatively , the manifolds 40 b and 40 c may be attached around the perimeter of the base plate 28 , with the supply manifold 40 b being disposed in communication with a channel 40 a for supplying the coolant . the return manifold 40 c may be disposed in communication with channels 40 a for receiving return coolant . the manifolds 40 b and 40 c can be connected to the coolant supply 26 a for circulating the coolant . the discharge melt guide 22 comprises an induction heater system 38 . the induction heater system 38 is disposed proximate and below the base plate lower surface 28 c for induction heating the refined melt 14 a . the term “ proximate ” means near or close to , and is used with a meaning as understood by those of skill in the art with its conventional meaning . the electromagnetic flux generated by the induction heater system 38 can be transmitted to those and other elements of the electroslag refining apparatus 10 , resulting in heating as desired . the induction heater system 38 may take any conventional configuration including , but not limited to , an annular or spiraling induction heater system configuration . the coils of the induction heater system 38 can be disposed coaxially about the central orifice 32 and can extend radially over the slots 34 . as illustrated in fig1 the induction heater system 38 can include one or more suitable power supplies 38 p that provide electrical current that is sufficient for induction heating . the induction heating coils can comprise hollow coils that circulate a suitable coolant , such as , but not limited to , water . the induction heater system 38 can comprise primary coils 38 a , which are generally co - axial with the central orifice 32 along the extension 29 , and secondary coils 38 b that are generally disposed on surface 28 c of the base plate 28 . the induction heater system 38 is disposed on the extension 29 of the discharge melt guide 22 to define a gap therebetween . the disposition of the induction heater system 38 on the extension 29 allows movement of induction heater system 38 in the direction of arrow 500 ( fig6 ) with the gap remaining constant . the constant nature of the gap allows generated heat , and electromagnetic flux from the induction heater system 38 to be substantially unaffected by movement of the induction heater system 38 in the direction of arrow 500 . the term “ substantially ” is used with its normal meaning as understood by those of skill in the art . the primary coils 38 a and secondary coils 38 b of the induction heater system 38 may define independent primary and secondary coils , 38 a and 38 b , respectively . alternatively , the primary coils 38 a and secondary coils 38 b may be connected to create an integral coil structure for the induction heater system 38 . the primary coils 38 a and secondary coils 38 b may take any appropriate coil configuration and structure , such as , but not limited to , water - cooled , current - carrying conduit coils . for example , the primary coils 38 a and secondary coils 38 b may be overlapped at at least one portion , such as but not limited to , coiled onto themselves . the illustrated configurations are merely exemplary of the structures within the scope of the invention , and are not intended to limit the invention in any manner . the primary coil 38 a of the induction heater device 38 p can be disposed adjacent to and surrounding the central orifice 32 for heating the refined melt 14 a that is discharged therethrough , as embodied by the invention . the primary coil 38 a may also control a thickness of the corresponding skull 14 b that is disposed proximate the central orifice 32 . the secondary coils 38 b can be spaced radially outwardly from the primary coil 38 a , and may radially overlap ( not illustrated ). the secondary coil 38 b can comprise a sufficient number of turns for sufficiently heating the refined melt 14 a around and in the central orifice 32 . the secondary coils 38 b can also control a thickness of the ingot skull 14 b , as described above . the central orifice 32 of the discharge guide tube ( also known as a “ discharge guide tube ”) 22 comprises an internal configuration with a profile that concentrates heat , electromagnetic field , and electromagnetic flux ( hereinafter “ heat and electromagnetic flux ” since the electromagnetic flux is produced by the electromagnetic field ) to the stream of liquid melt that flows therethrough . as illustrated in fig2 and in detail in fig5 and 6 , the central orifice 32 comprises an angled and stepped profile about a central longitudinal axis 138 of the central orifice 32 . the stepped and angled profile can be formed by an inclined ( first ) central orifice ramp portion 130 that extends from a first central orifice portion 131 to a reduced diameter central orifice portion 132 , which defines a constriction 133 , and then to another ( second ) inclined central orifice ramp portion 134 , which in turn leads to a further ( second ) central orifice portion 135 . the diameter of the second central orifice portion 132 is less that the diameter of the first central orifice portion 131 . in other words , the ramp portion leads to a constriction 133 in the central orifice 32 at which point the flux concentration in the central orifice 32 is higher than at other portions of the central orifice 32 , such as at the first central orifice portion 131 . the configuration of the central orifice 32 at which the constriction 133 is formed can comprise any appropriate configuration that can produce the concentrations of electromagnetic flux , as embodied by the invention . the angles for the inclined central orifice ramp portion 130 and 134 can comprise any angles that form the constriction 133 . the lengths of the inclined central orifice ramp portions 130 and 134 can be equal . alternatively , lengths of the inclined central orifice ramp portions 130 and 134 need not be equal . further , the length of the second central orifice portion 132 may vary . also , the positioning of the second central orifice portion 132 , and thus the constriction , in the central orifice 32 may vary . for example , the positioning of the second central orifice portion 132 and the constriction in the central orifice 32 may equi - spaced in the central orifice 32 , be disposed closer to the electroslag refining apparatus 10 than an exit from the central orifice 32 , or be disposed closer to the exit from the central orifice 32 than to the electroslag refining apparatus 10 . accordingly , the positioning and configuration of the features of the central orifice 32 to produce the heat and electromagnetic flux can vary , as long as the intended purpose of the invention is accomplished . the central orifice 32 , including the ramp portion 130 that extends from a first central orifice portion 131 to a second central orifice portion 132 , may be formed by any metallurgical machining suitable process . the scope of the invention includes forming the central orifice 32 by a machining processes , such as , but not limited to , at least one of drilling , lathe turning , and electrodischarge machining ( edm ). if drilling is used to form the central orifice 32 , a drilling process provides a passage , which has a diameter that generally equal to that of the constriction 133 , and larger diameters at the first central orifice portion 131 may be provided by further drilling . thus , the central orifice 32 is formed to be generally perpendicular to the upper and lower surfaces , 28 b and 28 c respectively , of the base plate 28 . therefore , the liquid refined melt 14 a can flow straight downwardly by gravity from the central orifice 32 during electroslag refining operations . the above - described drilling is merely exemplary of formation processes within the scope of the invention , and other formation processes can be used herein . the induction heating system 38 is disposed along the lower surface 28 c of the base plate 28 in a generally concentric configuration to be disposed around the central orifice 32 . the coils of the induction heating system 38 are also disposed over the radial extent of the slots 34 for transmitting electromagnetic energy into the melt 14 a . the heat and electromagnetic flux are transmitted to the constriction 133 in the central orifice 32 in amounts sufficient to maintain the stream of refined liquid melt 14 a that is flowing through the central orifice 32 in a liquidus state for continued flow through the central orifice 32 , as embodied by the invention . further , the heat and electromagnetic flux can control the flow of refined liquid melt through the central orifice 32 , as embodied by the invention . for example , if higher heat and electromagnetic flux is applied to the electroslag refining apparatus 10 , more refined liquid melt 14 a will remain in a liquidus state , and less liquid refined melt 14 a will solidify into the skull 14 b . further , some of the skull 14 b proximate the central orifice 32 will melt , by the application of the heat and electromagnetic flux , so restrictions around the central orifice 32 will be reduced . thus , flow through the central orifice 32 will be facilitated , and less skull 14 b will be formed . conversely , the flow through the central orifice 32 can be lessened by reducing the amount of heat and electromagnetic flux that is applied to the electroslag refining apparatus 10 , as embodied by the invention . with less electromagnetic field generating less heat , there will be less concentrated electromagnetic flux at the constriction 133 in the central orifice 32 . less electromagnetic flux at the constriction 133 will slow flow of the liquid refined melt 14 a through the central orifice 32 . thus , an amount of time that the liquid refined liquid melt 14 a is in contact with the skull 14 b increases , and with more time in contact with the skull 14 b , the refined liquid melt 14 a may solidify against the skull 14 b . accordingly , more skull 14 b may form around the area at the central orifice 32 and restrict flow into and through the central orifice 32 , thereby controlling the flow in the electroslag refining apparatus 10 . the heat melts the skull may reach a limit that is bounded by the generated electromagnetic flux . at a point in the generation of the heat , the electromagnetic flux may cause a field constriction in the central orifice 32 that may limit flow . the configuration of the central orifice 32 and the interior discharge guide tube flux concentration configuration defines the electromagnetic flux amount at which point the electromagnetic flux will cause restriction in the central orifice 32 . thus , further control on the flow through the central orifice 32 can be realized . for example , and in no way limiting the invention , the flow of the refined melt 14 a through the central orifice 32 may also be controlled , so as to be approximately equal to the melt rate of metal from the consumable electrode 14 . accordingly , a generally steady - state flow in the electroslag refining apparatus 10 can be provided . the induction heating of the liquid refined melt 14 a through the slots 34 , and cooling of the base plate 28 around the central orifice 32 , can be provide a balanced flow relationship during startup and steady - state operations of the electroslag refining apparatus 10 . fig7 is a part - sectional illustration of another central orifice 232 within the scope of the invention . in fig7 similar reference characters that are used in the above figures are used to reference like features . the central orifice 232 is formed in a base plate 128 of a discharge guide tube 22 and comprises an internal configuration with a profile that concentrates electromagnetic flux and heat , to the stream of liquid melt that flows therethrough . the central orifice 232 comprises an angled and stepped profile about a central longitudinal axis 138 of the central orifice 232 . the base plate 128 comprises and is formed in a similar manner as the above - described base plate 28 , however , the base plate 128 includes an extension 129 that defines a base plate chamber 150 . the base plate chamber 150 is bounded by an upper wall 151 and side walls 152 . the central orifice 232 extends from the electroslag refining apparatus 10 to the wall 151 of the base plate 128 . the stepped and angled profile of the central orifice 232 can be formed by an inclined central orifice ramp portion 230 that extends from a surface 128 ′ of the base plate 128 to a constriction 233 in the central orifice 232 . the constriction 233 may comprise a single constriction portion 235 ( solid lines in fig7 ) that extends over the entire central orifice 232 length and may terminate at the wall 151 . thus , the stream 114 a flows into the chamber 150 . alternatively , the constriction 233 may comprise a constriction portion 235 that extends partially down the central orifice 232 length , and widens into an inclined portion 234 ( broken lines in fig7 ) that in turn terminates at the wall 151 . the configuration of the central orifice 232 at which the constriction 233 is formed can comprise any appropriate configuration that can produce the concentrations of electromagnetic field . the angles for the inclined central orifice ramp portion 230 and 234 can comprise any angles that form the constriction 233 . the lengths of the inclined central orifice ramp portions 230 and 234 can be equal . alternatively , lengths of the inclined central orifice ramp portions 230 and 234 need not be equal . further , the length of the constriction portion 235 may vary . also , the positioning of the constriction portion 235 in the central orifice 232 may vary . for example , the positioning of the constriction portion 235 may be equi - spaced in the central orifice 232 , be disposed closer to the electroslag refining apparatus 10 than an exit from the central orifice 232 , or be disposed closer to the exit from the central orifice 232 than to the electroslag refining apparatus 10 . accordingly , the positioning and configuration of the features of the central orifice 232 to produce , electromagnetic flux and heating can vary , as long as the intended purpose of the invention is accomplished . the discharge guide tube 22 may be used in cooperation with an electroslag refining apparatus 10 , as illustrated in fig1 . the discharge guide tube 22 can be used in conjunction with any subsequent processing of the stream of liquid refined melt 14 a that is discharged from the electroslag refining apparatus 10 . for example , and in no way limiting of the invention , atomizing structure may be provided for injecting a suitable atomizing gas from a gas supply to atomize the stream 114 a of liquid refined melt 14 a discharged from the central orifice 32 , as embodied by the invention . alternatively , the discharge guide tube 22 may be used in cooperation with device as set forth in u . s . pat . no . 5 , 381 , 847 to ashok et al . fig8 is a graph of field intensity versus guide tube axial distance for a discharge melt guide , as embodied by the invention . the discharge guide tube that is graphed in fig8 comprises a four - turn induction heater coil structure . the coils carry about 87 ma at about 143 , 000 hz . the generated electromagnetic field along the axis 138 is measured with a search coil in order to determine the field in the central orifice 32 . in the figure , alternating current magnetic fields are measured for a simple coil , a straight un - constricted discharge guide tube configuration as set forth in u . s . pat . no . 5 , 809 , 057 , and a discharge guide tube configuration , as embodied by the invention . as illustrated in fig8 the discharge guide tube configuration provides a clear enhancement of the generated electromagnetic field . while various embodiments are described herein , it will be appreciated from the specification that various combinations of elements , variations or improvements therein may be made by those skilled in the art , and are within the scope of the invention .	2
spherules of enhanced product quality containing mixtures of uranium , plutonium , thorium , and mixtures thereof are derived by control of the crystallite size of the phases therein by heat treatment of the hmta - urea feed solution to be used in the formation of the spherules . the product spherules are suitable for formation of nuclear - reactor fuels capable of being directly loaded into fuel elements by vibration - packed or gel - derived - pellet technologies . preferably , it has been found that high density spherules with small crystallites make the best vibra - packed fuel forms and that moderate density spherules with large crystallites make the best gel - derived - pellet fuel forms . the method of the present invention is directed to the optimization of crystallite growth in mixed - fuel spherules of nuclear - reactor fuels and is effected by heat treating the concentrated hmta - urea feed solutions . basically , three steps are combined in the heat - treating procedure . the first step comprises heating the feed solution to boiling , i . e ., about 104 ° c ., within about thirty minutes . the second step comprises maintaining this boiling temperature for a sufficient duration without causing excessive urea decomposition . heating the solution to a temperature less than boiling will not provide the desired control of the crystallite size . the third step comprises cooling the boiled solution from boiling down to about ambient temperature . preferably , the heating step takes place within about thirty minutes so that the solution is taken very rapidly from about ambient temperature to boiling . typically , the duration at which the solution then boils will vary according to the desired end use of the product spherules and will normally be in the range of about 0 to 60 additional minutes yielding a total heating and boiling duration of about 30 to 90 minutes . the shorter durations are preferred for denser spherule formation , hence , the vibra - packed fuels , while the longer durations are preferred for the moderately dense spherules . total durations for heating and boiling of much below about 30 minutes accomplish little or no benefit and total durations in excess of about 90 minutes are unnecessary to cause the desired effect and may result in excessive urea decomposition . the third step of the heat - treating procedure comprises cooling the resultant solution in about 30 to 40 minutes to approximately ambient temperature , i . e ., 25 ° c .± 5 ° c . before mixing with the metal solution . it has been found that the heat - treatment , or boiling - cooling procedure , of this invention significantly and beneficially effects the control of the crystallite size of the phase or phases present in the resultant air - dried spherules . for example , crystallites of about 1200 å to 3000 å may be derived in urania - plutonia spherules ( pu / u + pu = 0 . 25 ), by simply heating and boiling the hmta - urea feed solution for about 90 minutes . the resultant spherules have been found to have a tap density of about 0 . 92 g / cc and are especially suited for forming gel - derived pellets of about 93 to 95 % theoretical density . micrographic examination of such pellets have revealed good - quality ceramic pellets characterized by the absence of visible voids and defects or structural remnants of the spherules . in comparison , urania - plutonia spherules prepared without heat treatment of the hmta - urea feed solution have been found to be characterized by crystallites within the range of about 500 å to 1400 å and by high tap densities of about 1 . 31 g / cc . pellets prepared from these denser spherules were of about 84 % theoretical density . since 88 % theoretical density is considered to be the absolute minimum density for loadable fuel pellets for nuclear - reactor applications , heat - treated spherules prepared herein are more suitable for making gel - derived - pellet fuel forms . in a series of experiments , the effect of heat treatment on hmta - urea feed solutions provided to an internal gelation process was evaluated . spherules were tailored within a range of hmta - urea preparations to establish the relationship between duration and extent of heat treatment as well as ultimate calcined pellet density . the first experiment was designated a control test wherein the hmta - urea feed solution was not heat - treated prior to deployment in spherule forming operations of the aforementioned copending patent application of assignee . the prepared spherules were found to have a tap density of about 1 . 29 ± 0 . 02 g / cc after air drying at 110 ° c . electron micrographs of specimens of these high - density spherules revealed a large population of crystallites within the size range of about 500 å to 1400 å with a maximum urania crystallite size of about 1500 å . sintered pellets prepared from these spherules were not of good ceramic quality and were only of about 83 . 7 % theoretical density . micrographic examination of sections of these pellets revealed structural remnants of the pressed spherules which is undesirable . in a second experiment , the hmta - urea feed solution was heated to boiling ( 104 ° c .) in about thirty minutes but not maintained at that temperature for any duration . the prepared spherules were of about 1 . 24 g / cc tap density . thus , little difference can be effected in spherule density by heat treatment of the feed solution without sustained boiling . in each subsequent experiment , a 500 ml solution of 3 . 2m hmta and 3 . 2m urea was heat treated under reflux conditions to the solution boiling point of about 104 ° c . for varying periods of measured time within the range of about 30 to 90 minutes and then rapidly cooled to about ambient temperature in about 30 minutes . a standard heat - up time of about thirty minutes to boiling was applied in each experiment so that only the actual time of boiling was varied . thereafter , each hmta - urea feed solution was combined with a solution containing a metal selected from the group consisting of uranium , plutonium , thorium , or mixtures thereof . the results of boiling durations as a function of sphere density are graphically depicted in the figure of the drawing . as demonstrated in the figure , the effect of heat treatment produces an almost linear function in spherule tap density with more boiling time producing spherules of lower densities . when the feed solution was heat treated for about 40 minutes , the product spherules were found to have a tap density of about 1 . 04 g / cc which is much below that found in the first and second tests with no or only minimal heat treatment . electron micrographs of these spherules revealed a large population of crystallites within the size range of about 1200 å to 3000 å with a maximum urania crystallite size of about 3000 å . sintered pellets prepared from these spherules appeared to be of good ceramic quality and of about 95 . 4 % theoretical density . visual examination of the microstructures of these pellets revealed no voids or defects and the complete absence of structural remnants from the pressed spherules . from the foregoing , it can readily be concluded that tap density of air - dried spherules to be used in the manufacture of nuclear - reactor fuels may be varied within the range of about 1 . 31 to 0 . 92 g / cc by heat treating the hmta - urea feed solution for a duration in the range of about 30 minutes to 90 minutes , respectively . by varying spherule tap densities within this range , the ultimate quality of the nuclear - reactor fuel form may be effectively determined . in addition to a better understanding of the reasons for variant product qualities heretofore encountered in the art , the method of the present invention has the added advantages of providing greater process flexibility to the method described in the aforementioned copending application including the probability for commercial production of high plutonium content mixed fuels ( pu / u + pu = 0 . 35 ) in pellet form , a highly tolerant system for nh 4 no 3 present in nuclear fuel reprocessing streams which formerly required pretreatment for removal , and a simplified system with minimal reagent requirements for processing or waste treatment .	8
detailed descriptions of the preferred embodiment are provided herein . it is to be understood , however , that the present invention may be embodied in various forms . in accordance with the present invention , fig1 shows a mop with a handle 20 , a body 21 containing cleaning solution , a mopping material 23 and a foot lever 22 for rotation of the mopping material 23 . in accordance with the present invention , fig2 shows a mop with a handle 20 , a body 21 containing cleaning solution , a mopping material 23 and a foot lever 22 for rotation of the mopping material 23 , a foot lever return spring 24 and a filler cap 25 for refilling the body 21 . in accordance with the present invention , fig3 shows a drain plug 26 for emptying any cleaning solution . in accordance with the present invention , fig4 shows a perspective view of the mop with the number and direction of section 1 - 1 . in accordance with the present invention , fig5 shows a mop with a body 21 , a mopping material 23 , a scraper 27 for scraping dirt from the mopping material 23 , and a filter 28 for filtering dirt particles to remain within the dirt chamber 35 and not the clean chamber 36 . in accordance with the present invention , fig6 shows a mop with a body 21 , a mopping material 23 , a filler cap 25 refilling the body 21 , a scraper 27 for scraping dirt from the mopping material 23 , and a filter 28 for filtering dirt particles to remain within the dirt chamber 35 and not the clean chamber 36 , a front roller 29 for aiding the rotation of the mopping material 23 , wringing gates 30 for removing cleaning solution from the mopping material 23 , a rear roller 31 for aiding the rotation of the mopping material 23 , a rear support 32 that the device rests on when the cleaning material 23 is rotated . in accordance with the present invention , fig7 shows a foot lever 22 in the depressed position , a rack 33 and pinion 34 . the rack 33 is linked by a connection to the foot lever 22 so that when the foot lever is depressed the rack 33 forces a clockwise rotation of the pinion 34 . in accordance with the present invention , fig8 shows a foot lever 22 in the at - rest position , a rack 33 and pinion 34 . in accordance with the present invention , fig9 shows a foot lever 22 in the at rest position , a rack 33 , a foot lever return spring 24 and a rear roller 31 . in accordance with the present invention , fig1 shows a foot lever 22 in the depressed position , a rack 33 , a pinion 34 , and a rear roller 31 . the rack 33 is linked by a connection to the foot lever 22 so that when the foot lever is depressed the rack 33 forces a clockwise rotation of the pinion 34 thus causing a rotation of the rear roller 31 . while the invention has been described in connection with a preferred embodiment it is intended to cover such alternatives , modifications , and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims .	0
as starting materials to produce the urethane - functional s - triazine crosslinking agents of this invention , there can be used the triazines , such as cyanuric chloride , and / or obvious chemical equivalents thereof known in the art . many of the starting materials are commercially available , and they can be made by well known procedures . in accordance with the present invention , the starting materials are reacted with a bis - hydroxyalkyl iminodiethylene dicarbamate made , for example , by reacting a cyclic alkylene carbonate with a polyalkylenepolyamine , such as diethylenetriamine . the preparation of the bis - hydroxyalkyl iminodiethylene biscarbamates is described in u . s . patent application ser . no . 581 , 006 , filed feb . 17 , 1984 now abandoned .) the above - cited valko patent describes making 2 - hydroxyalkyl carbamates by reacting 1 , 2 - diols with isocyanates . the mole ratio of beta - hydroxyalkyl carbamate to triazine compound is selected to provide the desired degree of substitution . as will be seen by the examples herein , the reactants are mixed in suitable media , such as water - acetone - alkanol mixtures , preferably in the presence of an acid acceptor , such as sodium hydroxide , if , for example , cyanuric chloride is used as the source of the triazine ring . low temperatures , e . g ., below about 20 ° c . promote the formation of mono - substituted products , higher temperatures , e . g ., between about 25 ° and 70 ° c . favor the formation of di - substituted products ; and still higher temperatures , e . g ., above about 100 ° c . favor tri - substitution . recovery of the product is conventional , e . g ., by precipitation and washing free of any acidic byproduct or basic acid acceptor . the monomeric products of the process can be self - condensed to produce oligomeric compounds , suitable such compounds , e . g ., monochlorotriazines can also be dimerized , e . g ., by reacting with diamines , such as piperazine , and they can also be functionalized with amines , such as piperidine , as will be exemplified . transesterification with alochols , polyols , monoamines and polyamines also produce useful derivatives , as will be shown . the substituents defined by a 1 , a 2 , q 1 and q 2 , as well as r -- r 7 in the formulae above can vary widely in carbon content , and the groups can be straight chain , branched chain and alicyclic . representative compounds will be exemplified hereinafter . typical of groups r 4 , r 5 , r 6 are c 1 - c 30 radicals such as -- ch . sub . 2 ( ch . sub . 2 ). sub . 18 ch . sub . 3 ## str14 ## r being hydrogen or alkyl , and the like . the composition containing the crosslinking agents , polymers , and , optionally , catalyst , is heated to an elevated temperature at which the hydroxyalkyl carbamate groups of the cross - linker react with active functional groups of the polymer to cross - link the polymer and produce diol leaving groups of low toxicity , such as propylene glycol or ethylene glycol . a typical reaction sequence of , for example , a hydroxy functional group containing polymer is shown in equation ( 1 ) and that for an amine functional group containing polymer is shown in equation ( 2 ). ## str17 ## with carboxyl functional group polymers , amide groups are formed in the reaction and the reaction products of the cross - linking reaction are co 2 and the corresponding 1 , 2 - diol . generally , the leaving groups in the cross - linking reaction are , as illustrated above , diols of low toxicity , such as propylene glycol or ethylene glycol . any attempt to prepare the above described hydroxyalkyl carbamate compounds by reaction of a diisocyanate with a di - or polyol would be difficult or impossible inasmuch as the formation of polyurethane polymers or gelation would occur . the amount of hydroxyalkyl carbamate selected in a typical formulation will of course depend on the cross - linking density desired . typically , the proportion and compositions of resin and cross - linker are selected to provide from about 0 . 2 to about 5 moles of hydroxyalkyl carbamate groups per mole of active functional group on the polymer . if larger proportions of cross - linker carbamate groups to functional sites on the polymer are used , the cross - linker will also undergo some self - condensation , as shown in equation ( 3 ). ## str18 ## the cross - linkable resins utilizable in the present invention may comprise any suitable polymer containing active hydrogen functional groups , i . e ., suitable functional groups which will react , upon heating , preferably upon heating in the presence of a catalyst , with the urethane functional groups on the cross - linker of the invention . such active groups comprise hydroxyl , amine , amide , thiol and carboxyl groups and , accordingly , resins containing such groups are utilizable in the practice of the invention . the functionality of the polymers employed can be as low as 2 but is preferably 3 or higher , and the molecular weight may range , for example , from about 300 to about 10 , 000 . for example , acrylic polymers useful in the invention usually have a molecular weight range of from about 1 , 000 to about 50 , 000 . a typical functional group content of , for example , hydroxyl resins utilizable in the invention is from about 0 . 5 to about 4 milliequivalents (&# 34 ; meq &# 34 ;) hydroxyl per gram of resin solids . an illustrative , but by no means exhaustive , list of polymers which may be usefully employed in the invention includes acrylic , polyester , vinyl , epoxy , polyurethane , polyamide , cellulosic , alkyd and silicone resins . acrylic resins useful in the invention can be derived from the acrylic acid or methacrylic acid esters of c 1 to c 18 aliphatic alcohols . optionally , acrylonitrile , styrene or substituted styrene can be incorporated into the polymer . additional comonomers suitable for such use are maleic or fumaric acid esters or half esters . functional groups can be derived from the hydroxyalkyl esters of acrylic , methacrylic , maleic or fumaric acid . carboxyl functionality can be derived from alpha and beta unsaturated carboxylic acids such as those mentioned below . polyester and alkyd resins suitable for use with the urethane - functional triazine cross - linker can be derived from diols , polyols , mono -, di -, and polybasic acids . examples of such suitable diols or polyols are ethylene glycol , propylene glycol , 1 , 3 - butylene glycol , diethylene glycol , dipropylene glycol , neopentyl glycol , trimethylpentane diol , cyclohexanedimethanol , trimethylolpropane , trimethylolethane and glycerine pentaerythritol . typical carboxylic acids useful in preparing hydroxy and carboxyl functional polyester and alkyds are c 8 to c 18 aliphatic monocarboxylic acids , c 4 to c 10 aliphatic dicarboxylic acids , aromatic mono -, di , and tricarboxylic acids such as benzoic acid , o -, m -, p - phthalic acids , or tri - metallic acid , dimeric fatty acids , and hydroxy carboxylic acids such as dimethylol propionic acid or caprolactone . vinyl polymers particularly suitable for use in the invention are hydroxy and carboxyl functional group - containing polymers containing either vinyl chloride or vinyl acetate as one of the comonomers . epoxy resins particularly suitable for use in the invention are hydroxy or amine functional resins . these are normally derived from bisphenol - a , bisphenol - f , or phenol formaldehyde resins and epichlorohydrin . the epoxy resins may also be formed from cycloaliphatic epoxies . polyurethanes particularly suitable for use in the invention may be hydroxyl , carboxyl , or amine functional and may be derived either from polyester or polyether polyols and a polyisocyanate . polyamides particularly suitable for use in the invention may be either amine or carboxyl functional and can be obtained by the conventional techniques of condensing polybasic acids with polyamines or by reacting polyamines with caprolactam . cellulose based hydroxyl functional resins such as cellulose acetobutyrate , and hydroxyethyl cellulose can also be reacted with the hydroxyalkyl carbamate - containing amines of the invention . hydroxy functional silicones can also be cross - linked with the hydroxyalkyl carbamate cross - linker and are therefore well - suited for use in the invention . all of the above mentioned active functional group - containing resins can be used in either organic solvent solution , as a powdered solid , or as dispersions in water or organic co - solvent aqueous solutions . depending on resin structure , these uncross - linked polymers will be preferably used in one of the above mentioned forms . blends of two or more of the above polymers can also be used . further , the polymer and carbamate cross - linking agent blend may be pigmented , as is known in the art , to achieve a desired appearance of the coating . depending on the application process , either a solid powder or a liquid is applied onto the substrate to be coated and after evaporation of any solvent present , the system is cured for a sufficient period of time , e . g ., from several minutes to several hours , at temperatures sufficient to effect cure , e . g ., from about 200 ° to about 400 ° f . ( about 93 ° to 204 ° c .). a cross - linking catalyst may be used to promote cross - linking of the thermosetting composition of the invention . the catalyst may be an external catalyst or it may be incorporated as an internal catalyst during preparation of the functional group - containing resin , as is known in the art . for example , quaternary ammonium hydroxide groups may be incorporated into the resin . any suitable crosslinking catalyst may be utilized ( such as known metal - containing catalysts , e . g ., lead , tin , zinc , and titanium compounds ) as well as ternary or quaternary compounds as described below . benzyltrimethyl ammonium hydroxide , dibutyltindilaurate , tetrabutyl diacetoxy stannoxane and similar compounds are good catalysts for achieving cross - linking at elevated temperatures in the range of from about 100 ° to about 175 ° c . ( about 212 ° to about 347 ° f .) for a period of a few seconds to about 30 minutes . a catalyst may be present in a formulation in the amount of from about 0 . 1 to about 10 % by weight of the polymer , preferably from about 1 to about 5 % by weight of the polymer . the catalyst may comprise ternary or quaternary catalysts such as known compounds of the formula : ## str19 ## respectively , where r p , r q , r r and r s may be equivalent or different and may be a c 1 to c 20 aliphatic , aromatic , benzylic , cyclic aliphatic and the like , where m may be nitrogen , phosphorus , or arsenic ( to provide , respectively , quaternary ammonium , phosphonium or arsonium compounds ), where s is sulfur ( to provide a ternary sulfonium compound ) and where x - may be hydroxide , alkoxide , bicarbonate , carbonate , formate , acetate , lactate , and other carboxylates derived from volatile organic carboxylic acids or the like . such salts of carboxylic acids are effective to promote the low temperature cure provided that the carboxylic acid portions of the salt are volatile . a typical composition of the present invention contains , in weight proportions , based on the weight of resin solids for the resinous components , from about 15 to about 50 parts of the cross - linking agent of this invention , from about 50 to about 85 parts of the polymer containing two or more active hydrogen functional groups and , when present , from about 0 . 1 to about 5 parts of the cross - linking catalyst . the compositions of the present invention are stable at ambient temperature and must be heated to an elevated temperature in order to cause the cross - linking reaction to occur at an appreciable rate . generally , an elevated temperature of about 200 ° f . ( about 93 ° c .) or more is required to effectuate the cross - linking reaction at an appreciable rate . as used herein and in the claims , an &# 34 ; elevated &# 34 ; temperature is one which is sufficient to cure the deposited composition by causing the cross - linking reaction to occur at a desired rate , usually a rate sufficient to effectuate cure within a period of 1 hour or less . in many instances a pigment composition and various conventional additives such as antioxidants , surface active agents , coupling agents , flow control additives , and the like , can be included . the pigment composition may be of any conventional type , such as , one or more pigments such as iron oxides , lead oxides , strontium chromate , carbon black , titanium dioxide , talc , barium sulfate , cadmium yellow , cadmium red , chromic yellow , or the like . after deposition on a substrate , such as a steel panel , the coating composition is devolatilized and cured at elevated temperatures by any convenient method such as in backing ovens or with banks of infrared heat lamps or in microwave ovens . curing can be obtained at temperatures in the range of from 120 ° c . to about 300 ° c ., preferably from 150 ° c . to about 200 ° c . for from about 30 minutes at the lower temperatures to about 1 minute at the higher temperatures . the following examples illustrate the compounds and compositions of the present invention . they are not to be construed as limiting the claims in any manner . all parts are by weight . to 50 g water in a 3 - neck flask equipped with stirrer and a thermometer , were added 9 . 2 g ( 0 . 05 m ) of cyanuric chloride , dissolved in 50 g acetone below 10 ° c . to the white slurry of cyanuric chloride , 27 . 9 g of bis ( 2 - hydroxyethyl )( iminodiethylene ) biscarbamate ( hec ), nh ( ch 2 ch 2 nhco 2 ch 2 ch 2 oh ) 2 dissolved in 50 g of water was added over a period of 15 minutes . during the addition , the reaction temperature was maintained below 12 ° c . after complete addition of hec , the slurry turned into a clear solution . to this was added 10 % caustic to maintain the reaction ph at about 7 and the reaction mixture was allowed to warm up to 25 ° c . at 25 ° c ., as the reaction progressed , a white crystalline solid slowly separated out . after 4 hrs . at 25 °- 35 ° c ., the solids were separated by filtration , washed with water and recrystallized from ethanol . the product yield was 24 g and m . p . 174 ° c . the structure of the product was confirmed by nuclear magnetic resonance ( nmr ) and fast atomic bombardment ( fab ), mass spectrometry to be that of formula i : ## str20 ## to 6 . 7 g of ( i ) ( example 1 , tect ) were added 2 . 8 g hec , 0 . 84 g sodium bicarbonate and 25 g ethylene glycol . the reaction mixture was then heated to 115 ° c . in an oil bath for 4 hours , after which most of the hec had reacted with tect as indicated by amine titration of the reaction mixture . ethylene glycol was distilled off under reduced pressure . the residue was poured into methanol . separated solids were filtered and recrystallized from methanol . yield 5 . 6 g ( 60 % of theoretical ), m . p . 192 ° c . the nmr and fab mass spectra confirmed the product to be of formula ii : ## str21 ## as in example 1 , 9 . 2 g ( 0 . 05 m ) of cyanuric chloride was slurried into water in a suitably equipped 3 neck flask . to the slurry was added 78 g ( 0 . 02 m ) of bis ( 2 - hydroxypropyl )( iminodiethylene ) bis carbamate ( hpc ), an isomeric mixture of nh ( ch 2 ch 2 nhco 2 ch ( ch 3 ) ch 2 oh ) 2 and nh ( ch 2 ch 2 nhco 2 ch 2 ch ( ch 3 )-- oh ) 2 , ( 80 % by weight in isobutanol ) below 10 ° c . after complete addition of hpc to the reaction mixture , the temperature of the mixture was allowed to rise to 25 ° c . a clear , pale yellow solution was obtained . the clear solution after several hours at 25 ° c . was treated with dowex ® 1x8 ( oh - ) anion exchange resin to remove hcl . the hcl free solution was then stripped under reduced pressure to remove acetone and water . the water - free syrupy residue , 90 g , and 100 g of propylene glycol were heated on an oil bath to 115 ° c . for 4 hours . the total free amine in the mixture was 36 meq . the reaction mixture in methanol was treated first with dowex ® 1x8 ( oh - ) and subsequently with dowex ® 50wx8 ( h + ) ion exchange resins to remove cl - and free hpc . after removal of methanol and ethylene glycol under reduced pressure a white solid product was obtained . its structure was confirmed by spectroscopy to be of formula iii : ## str22 ## wherein r 1 , r 2 and r 3 are -- n ( ch 2 ch 2 nhco 2 ch ( ch 3 ) ch 2 oh ) 2 or -- n ( ch 2 ch 2 nhco 2 ch 2 ch ( ch 3 ) oh ) 2 the product ( iii ) as shown by the above formula was an isomeric mixture of compounds containing primary and secondary hydroxy groups . the yield was 32 g ( 64 % of theory ), and the melting point was 110 °- 120 ° c . in a suitably equipped 3 - neck flask , 9 . 2 g ( 0 . 05 m ) of cyanuric chloride solution in 50 g of acetone was slurried in 50 g of water below 10 ° c . to this was added slowly 38 . 8 g of hpc ( 80 % in isobutanol ) dissolved in 50 g of water below 10 ° c ., maintaining temperature of the reaction mixture . at the complete addition of hpc , the reaction mixture turned into a clear , pale yellow solution . the batch temperature was allowed to rise while maintinaing the ph of 6 - 7 by slow addition of 10 % caustic solution to the batch . after completion of the reaction ( after 3 - 4 hours at 25 °- 30 ° c .) water was removed from the reaction mixture by azeotroping with n - butanol under reduced pressure . the separated sodium chloride was filtered off . the clear filtrate was vacuum stripped to remove butanol . after the removal of butanol , a syrupy product was obtained , which on long standing , solidified . the mass spectrum of the syrup product indicated it to be of formula iv : ## str23 ## the solidified product ( tpct ), which is an isomeric mixture as shown by the above formula , was crystallized from acetone . the yield was 6 g and the melting point was 135 °- 140 ° c . in a suitably equipped round bottom flask were charged 6 . 7 g of the product of example 1 ( tect ) ( 0 . 01 m ), 0 . 85 g ( 0 . 01 m ) of piperidine and 0 . 84 g of sodium bicarbonate and 25 g of ethylene glycol . the mixture was heated on an oil bath to 115 ° c . for 4 hours . the total free base after this reaction period was 1 . 4 meq . ethylene glycol was removed by distillation under reduced pressure below 150 ° c . the resinous product was dissolved in methanol . the separated sodium chloride was filtered off and washed with small amounts of methanol . after removal of methanol from the reaction product , a glassy solid was obtained . mass spectra of the product indicated it to be of formula v : ## str24 ## in a suitably equipped round bottom flask were charged 43 . 5 g ( 0 . 06 m ) of the product of example 4 ( tpct ), 11 . 5 g ( 0 . 13 m ) of piperidine , 5 . 43 g ( 0 . 06 m ) of sodium bicarbonate , and 96g of propylene glycol mono - methyl ether . the mixture was heated at 120 ° c . for 5 hours . sodium chloride was separated from the product by filtration . dowex ® 50wx8 ( h +) ion exchange resin was added to the solution and stirred 30 minutes to remove excess amine . the resin beads were separated from the product by filtration . the propylene glycol mono - methyl ether was stripped from the product under vacuum at 110 ° c . the product was a resinous material . mass spectra indicated the compound to be of formula vi : ## str25 ## in a reaction vessel were charged 16 . 6 g ( 0 . 02 m ) of the product of example 4 ( tpct ), 8 . 5 g ( 0 . 04 m ) of dodecylamine , 1 . 9 g ( 0 . 02 m ) of sodium bicarbonate , and 50 g of propylene glycol monomethyl ether . the mixture was heated at 115 ° c . for 2 . 5 hours . sodium chloride was separated from the product by filtration . dowex ® 1x8 ( oh -) ion exchange resin was added and the mixture was stirred 30 minutes to remove free chloride ions . the resin beads were filtered out and dowex ® 50wx8 ( h +) ion exchange resin was added . the mixture was stirred 30 minutes to remove excess amine and then the resin beads were removed by filtration . the propylene glycol monomethyl ether was stripped from the product under vacuum at 110 ° c . the product was a resinous material . mass spectra indicated the compound to be of formula ( vii ): ## str26 ## in a suitably equipped round bottom flask were charged 14 . 85 g ( 0 . 02 m ) of the product of example 1 ( tect ), 0 . 97 g ( 0 . 01 m ) of piperazine , 1 . 89 g ( 0 . 02 m ) of sodium bicarbonate , and 53 g of propylene glycol mono - methyl ether . the mixture was heated at 115 ° c . for 5 hours . the propylene glycol monomethyl ether was stripped from the product under vacuum at 110 ° c . the solid product was washed with water to remove sodium chloride . the product was finally dried to remove water . mass spectra indicated the product to be of formula viii : ## str27 ## in a suitably equipped round bottom flask were charged 32 . 6 g ( 0 . 045 m ) of the product of example 4 ( tpct ), 1 . 3 g ( 0 . 15 m ) of piperazine , 3 . 8 g ( 0 . 045 m ) of sodium bicarbonate , and 61 g of propylene glycol monomethyl ether . the mixture was heated at 115 ° c . for 4 hours . sodium chloride and sodium bicarbonate were separated from the product by filtration . the propylene glycol monomethyl ether was stripped from the product under vacuum at 110 ° c . the product was a resinous material . mass spectra confirmed the structure to be of formula ix : ## str28 ## to a reaction vessel is added 15 . 6 g ( 0 . 05 m ) of bis ( 2 - hydroxypropyl )( iminodiethylene ) bis carbamate dissolved in 50 g of n - butanol . to this solution is added 4 . 2 g of sodium bicarbonate . then , at 0 °- 5 ° c ., is added slowly 9 . 2 g ( 0 . 05 m ) of cyanuric chloride dissolved in 75 g of ethyl acetate . the reaction mixture is allowed to stir at 0 °- 5 ° c . and progress of the reaction was monitored by thin layer chromatography ( tlc ). as soon as all the cyanuric chloride is converted to monosubstituted product , the reaction mixture is filtered and washed with ethyl acetate to separate sodium chloride from the filtrate . the product is isolated by removing ethyl acetate and n - butanol under reduced pressure . this compound is prepared by the same procedure as in example 10 except that cyanuric chloride ( 0 . 05 m ) is reacted with bis ( 2 - hydroxyethyl )( iminodiethylene ) biscarbamate ( 0 . 05 m ). in a suitably equipped round bottom flask were charged 21 . 75 g ( 0 . 03 m ) of the product of example 4 (( tpct ), 4 . 65 g ( 0 . 036 m ) of di - n - butylamine , 2 . 52 g ( 0 . 03 m ) of sodium bicarbonate , and 200 g n - butanol . the mixture was heated to reflux ( 118 °- 120 ° c .) for 4 . 5 hours . the reaction was followed by thin layer chromatography ( tlc ). the reaction was stopped when practically all of iv was converted to the product . the reaction mixture was filtered to remove sodium chloride . the trace amount of di - n - butyl amine was removed by dowex ® 50wx8 ( h +) ion exchange resin . after removal of n - butanol the product was recrystallized from ethyl acetate . yield : 17 g ( 69 % of theory ) mp 125 °- 130 ° c . n . m . r . of the product confirmed the structure as shown below . the product is soluble in common organic solvents used in coatings . ## str29 ## in a suitably equipped round bottom flask were charged 21 . 5 g ( 0 . 03 m ) of the product of example 4 ( tpct ), 4 . 65 g ( 0 . 036 m ) of diisobutylamine , 2 . 52 g ( 0 . 03 m ) of sodium bicarbonate , and 60 g 2 - propoxypropanol . the mixture was heated to reflux for 7 hours . tlc shows practically all product and only a trace amount of iv . the reaction mixture was worked up as in example 12 . after removal of solvent a sirupy product was obtained . on complete drying a glassy solid was obtained m . p .˜ 55 ° c . the yield was quantitative . the n . m . r . confirmed the structure as shown below . the product is soluble in common organic solvents such as methyl ethyl ketone , toluene , ethyl acetate , n - butanol , etc . it is insoluble in water . ## str30 ## this compound is prepared in two steps . first the compound described in example 10 is prepared without isolating it . then , to this product 8 . 4 g nahco 3 , and 12 . 9 g ( 0 . 1 m ) of di - n - butylamine are added and the reaction temperature is raised slowly to 115 ° c ., after distilling off ethyl acetate . the reaction temperature is maintained at 115 ° c . for several hours to complete the substitution of chlorine atoms by dibutylamine . after the reaction is complete , sodium chloride formed during the reaction is filtered off . after removal of n - butanol the desired product is obtained . this compound is prepared by following the procedure of example 14 , but instead of di - n - butylamine , aniline ( 9 . 2 g , 0 . 1 m ) is used . to a suitably equipped 3 - necked flask , are added 15 . 6 g ( 0 . 05 m ) of bis ( 2 - hydroxypropyl )( imino diethylene ) bis carbamate dissolved in 50 g of n - butanol . to this solution are added slowly 9 . 2 g ( 0 . 05 m ) of cyanuric chloride dissolved in 75 g of ethylacetate . the reaction mixture is allowed to stir at 0 °- 5 ° c . and progress of the reaction is monitored by tlc . after all the cyanuric chloride is reacted to the mono substituted product , 8 . 4 g of sodium bicarbonate and 3 . 65 g ( 0 . 05 m ) of n - butylamine are added . the reaction temperature is raised to 35 °- 45 ° c . and maintained there until most of the n - butylamine has reacted . at this point 4 . 7 g ( 0 . 05 m ) aniline are added and the reaction temperature raised to 115 ° c . after distilling out ethyl acetate . after about 5 - 6 hours , sodium chloride is filtered off . after removal of n - butanol and reaction work up the above - described product is obtained in high yields . ## str31 ## in an autoclave were charged 100 g ( 0 . 1 m ) of the compound of example 3 ( hpcm )( iii ), 225 g ( 3 . 0 m ) of n - butanol , and 1 . 2 g of dibutyltindilaurate catalyst . the autoclave was heated in an oil bath on a magnetic stirrer hot plate to 155 ° c . the reaction mixture was kept in the oil bath at 155 ° c . for 5 hours . the pressure in the autoclave was about 40 psi . the resulting product mixture was a clear yellow solution . it was soluble in common organic solvents at room temperature . it was also miscible with commercially available acrylic resins and polyesters . the clear solution was concentrated to 45 % solids . the proton n . m . r . of the product showed that about 40 % of hydroxypropylcarbamate groups were transesterified with n - butanol . the average distribution of the hydroxypropylcarbamate to butylcarbamate was 2 : 3 . the transesterification reaction is shown below : ## str32 ## in an autoclave were charged 100 g ( 0 . 1 m ) of the compound of example 3 ( hpcm )( iii ), 320 g ( 2 . 7 m ) of 2 - propoxypropanol , and 1 . 2 g of dibutyltindilaurate catalyst . the autoclave was heated in an oil bath on a magnetic stirred hot plate to 155 ° c . the reaction mixture in the autoclave was stirrer with a magnetic stirrer . the reaction mixture was kept in the oil bath at 155 ° c . for 6 hours . after this period the resulting product mixture was a pale amber solution . it was soluble in common organic solvents it was also misible with commercially available polyesters and acrylic resins such as joncryl ® 500 ( s . c . johnson and son , inc .). the proton n . m . r . of the product showed that about 50 % of hydroxypropylcarbamate groups were transesterified with 2 - propoxypropanol . the average distribution of the hydroxypropyl carbamate to 2 - propoxypropyl carbamate was 1 : 1 . the product solution was concentrated to 45 . 3 % by partial removal of 2 - propoxypropanol . 2 . 2 g of the reaction product of piperidine and tect ( compound v from example 5 ) was dissolved in n - butanol . to this butanol solution were added 2 drops of benzyltrimethylammonium hydroxide ( 40 %) and a drop of 1 % solution of fluorocarbon surfactant fc 431 in n - butanol . the clear , pale yellow blend was cast as a film on a zinc phosphate treated cold rolled steel panel and baked at 150 ° c . for 20 minutes . the resulting film was very hard and glass - like , and had excellent resistance to acetone . the film thickness was 0 . 6 mil , knoop hardness was 37 , pencil hardness was greater than 5h and it passed the 1 / 8 &# 34 ; mandrel bend test . a hydroxy - functional acrylic resin was prepared by copolymerizing a blend of n - butyl acrylate ( 60 wt %), styrene ( 20 wt %), and 2 - hydroxyethyl methacrylate ( 20 wt %), using dicumyl peroxide initiator and n - dodecyl mercaptan chain transfer agent . the polymerization was carried out in 2 - ethoxyethanol at reflux temperature ( 135 °- 140 ° c .). ten grams of 75 % solution of a hydroxy functional acrylic resin was blended with 2 . 5 g of crosslinker of formula iii ( hpcm ), 0 . 3 g tetrabutyl diacetoxy stannoxane catalyst and 5 g n - butanol . the blend was warmed to make it homogeneous . the well - mixed homogeneous blend was cast on a zinc phosphate treated cold rolled steel panel using # 22 wirecator ®. the films were baked at 150 ° c . and 175 ° c . for 20 minutes respectively . the film properties are shown in table 1 . table 1______________________________________properties of acrylic coatings a b______________________________________bake schedule 20 &# 39 ;/ 150 ° c . 20 &# 39 ;/ 175 ° c . film thickness 0 . 8 mil 0 . 9 milpencil hardness 2b - b hb - fimpact resistance ( reverse ) 80 in . lbs . 80 in . lbs . mek resistance ( double rub ) 100 + 100 + humidity resistance ( 140 ° f .) passes 2 wks . passes 3 wks . ______________________________________ four formulations were prepared by blending a commercially available polyester resin multron ® 221 - 75 ( mobay ), crosslinker formula iii ( hpcm ) and a tin catalyst . amounts of each component are shown in table 2 . the 175 ° c . baked films obtained from formulation e and f were essentially crosslinked as indicated by mek rubs . films from formulations c and d required 200 ° c . bake to achieve crosslinking . films from formulations e and f had 200 °+ mek rubs . these results show that tetrabutyl diacetoxy stannoxane ( tbdas ) is a more effective catalyst than dibutyltin dilaurate ( dbtl ) in these formulations . table 2______________________________________properties of polyester - hpcm coatings c d e f______________________________________multron ® 221 - 75 16 g 15 g 15 g 16 gcrosslinker iii 4 5 5 4dtl 0 . 2 0 . 2 -- -- tbdas -- -- 0 . 2 0 . 2n - buoh 8 8 8 8bake schedule175 ° c ./ 20 &# 39 ; no cure 35 175 100 ( mek rubs ) 200 °/ 20 &# 39 ; 70 85 200 + 200 +( mek rubs ) ______________________________________ the results reported in tables 1 and 2 demonstrate that the compound of formula iii ( hpcm ) functions as a cross - linker to cross - link acrylic and polyester thermoset resins with pendant hydroxy groups . the reduced cure response of the polyester resin versus that of the acrylic resin is due to the fact that the polyester resin has residual acid ( acid number 10 ) while the acrylic resin is free of any acid ( acid number 2 ). the presence of nonvolatile acid in the film results in retardation of cure rate of transesterification reaction required for cross - linking . modification of formula iii ( hcpm ) for use as cross - linker for cathodic electro coating ( ec ) compositions 9 . 96 g ( 0 . 01 m ) of hpcm ( example 3 ) and 65 g ( 0 . 05 m ) of 2 - ethylhexanol were heated together to 155 °- 160 ° c . in the presence of 2 g of tetrabutyl diacetoxy stannoxane for 61 / 2 hours . after this period , 2 - ethylhexanol was distilled off under reduced pressure at 150 °- 160 ° c . a white creamy solid residue was obtained ( 17 g ) which dissolved in n - butanol ( 4 . 7 g ) to a clear amber colored solution . mass spectra of the product indicated the product mainly to be a mixture of the following : ## str33 ## the product was insoluble in water and very hydrophobic . these properties make the product a suitable cross - linker for cathodic ec compositions . similar hydrophobic cross - linkers can be prepared by oligomerization and by transesterification of formula iii ( hpcm ) with hydrophobic alcohols . other hydrophobic s - triazine compounds with pendant hydroxyalkylcarbamate groups , carbamate groups or mixture of hydroxyalkyl carbamate groups can be used in cathodic electrocoating as crosslinking agents . the cross - linking ability of the product of this example 22 is demonstrated in example 23 by cross - linking a cationic resin suitable for cathodic electrocoating . nine and three - tenths grams of a cationic resin ( prepared according to u . s . pat . no . 3 , 984 , 299 , adduct c ) was blended with 6 g of the product of example 22 ( 50 % solution ) along with 0 . 1 g of dibutyltin dilaurate catalyst . the blend was cast on a steel panel and baked at 175 ° c ./ 20 &# 39 ;. the film after the bake had a film thickness of 1 mil ; a pencil hardness of 3h ; and a mek rub resistance of 75 - 100 . to show efficacy of crosslinking agents of formulae xii , xiii , xvii , and xviii , clear formulations were prepared using hydroxy functional acrylic and polyester resins as shown in table 3 . a formulation was also prepared with an acrylic resin and methylated melamine - formaldehyde resin , used widely in many industrial coatings ( control no . 7 ). table 3__________________________________________________________________________coating formulations formulation 1 2 3 4 5 6 7composition ( this invention ) ( control ) __________________________________________________________________________acrylic resin . sup . 1 -- -- 3 . 6 7 . 6 10 9 . 3 57 . 2joncryl ® 500 . sup . 2 3 . 3 -- -- -- -- -- -- cargill 5776 . sup . 3 -- 2 . 9 -- -- -- -- -- crosslinker xii -- 0 . 9 -- -- -- -- -- crosslinker xiii . sup . 4 -- -- -- -- 3 . 4 4 -- 75 % solutioncrosslinker xvii . sup . 5 -- -- 1 . 65 4 . 2 -- -- -- crosslinker xviii . sup . 6 1 . 7 -- -- -- -- -- -- cymel ® 303 . sup . 7 -- -- -- -- -- -- 12 . 5tbdas . sup . 8 0 . 03 0 . 03 0 . 036 0 . 1 0 . 1 0 . 1 -- n - ddbsa . sup . 9 -- -- -- -- -- -- 0 . 3resin / crosslinker 77 / 23 75 / 25 75 / 25 75 / 25 75 / 25 70 / 30 75 / 25ratio__________________________________________________________________________ . sup . 1 acrylic polymer prepared by copolymerizing nbutyl acrylate ( 50 wt %), styrene ( 30 wt %), and 2hydroxy ethyl methacrylate ( 20 %). hydroxy no . 94 , 75 % solution in 2propoxypropanol . . sup . 2 a commercially available resin from johnson wax . . sup . 3 a commercially available polyester resin from cargill . . sup . 4 75 % solution in 2methoxypropanol . . sup . 5 45 % solution in nbutanol . . sup . 6 48 . 5 % solution in 2propoxypropanol . . sup . 7 methylated melamineformaldehyde resin available commercially from american cyanamid company ( control ). . sup . 8 tetrabutyl diacetoxy stannoxane . . sup . 9 ndodecylbenzenesulfonic acid , 70 % solution . the formulations were cast on zinc phosphate pretreated steel panels and the films were baked at 150 ° c . and 175 ° c . respectively . in case of formulation 2 , the films were cast on aluminium panels and baked at 260 ° c . for 60 seconds , commonly used in coil coating . the results of testing are set forth in table 4 : table 4__________________________________________________________________________film propertiesformulation 1 2 * 3 4 5 6 7__________________________________________________________________________bake schedule 175 260 150 175 150 175 150 175 150 175 150 175 ° c ./ min . 20 20 20 20 20 20 20 20 20 20 20 20film thickness 0 . 7 0 . 6 1 . 0 0 . 7 0 . 8 0 . 8 0 . 7 0 . 6 0 . 7 0 . 5 1 . 0 1 . 0 ( mils ) knoop hardness 11 . 8 -- 11 . 2 11 . 0 4 . 8 11 . 5 8 . 6 11 . 0 8 . 3 13 . 2 10 . 9 12 . 6pencil hardness 2h 2h f - h h f 2h h 2h h 2h h hhumidity resistance 3 wks -- -- -- -- -- 3 wks 3 wks 3 wks 3 wks 3 wks 3 wks ( 140 ° f .) n . c . ** -- -- -- -- -- n . c . n . c . n . c . n . c . 8b 7bsalt spray 10 ; 6 ; 9 ; 6 ; 9 ; 5 ; 5 ; resistance 0 mm -- -- -- -- -- 3 mm 0 mm 2 mm 0 mm 10 mm 10 mm ( 240 hrs ) mek double rub 200 + 200 + 200 + 180 200 + 200 + 200 + 200 + 200 + 200 + 200 + 200 + t - bend t3 passesimpact ( rev .) 0 - 10 50 50 50 50 30 - 40 50 50 50 50 0 - 10 0 - 10in . lbs . __________________________________________________________________________ * films were cast on aluminum panels alodine ® 1200s ** n . c . no corrosion film properties in table 4 show that crosslinked films obtained by utilizing crosslinking agents of formulae xii , xiii , xvii and xviii have good solvent resistance , excellent hardness , and good flexibility . the humidity and salt spray resistance of these films is also superior to the films obtained from the acrylic - methylated melamine - formaldehyde crosslinking agent based control formulation . the other advantage is that the formulations are formaldehyde free . experiments have also shown that , in unpigmented coatings , crosslinked films obtained by using the novel urethane - functional s - triazine crosslinker xvii had better corrosion resistance , humidity resistance and better post - forming properties as compared with films obtained with commercially available alkylated melamine formaldehyde crosslinkers as in control formulation 7 . 50 g ( 0 . 05 m ) of hpcm ( iii , example 3 ) and 295 g of 2 - butoxyethanol were heated to reflux at 160 ° c . in the presence of 5 g of tetrabutyl diacetoxy stannoxane for four hours . the excess 2 - butoxyethanol and propylene glycol formed during the reaction were removed under reduced pressure . the viscous residue was dissolved in methanol . on standing , the tin catalyst separated from the solution . it was filtered off and an amber colored residue was dissolved in n - butanol , solids , content , 50 . 4 %. the product was insoluble in water . the expected structure of the product having pendant 2 - butoxyethylcarbamate groups is shown below . the infrared spectrum was consistent with a product of formula xxv . ## str34 ## a cationic acrylic polymer with pendant hydroxy groups ( hydroxy number 90 ) was prepared according to u . s . pat . no . 4 , 026 , 855 ( 1977 ), described as cationic polymeric material e in column 8 . there were three minor changes ( i ) instead of 2 - hydroxyethyl acrylate , 2 - hydroxyethyl methacrylate was utilized ; ( ii ) the monomer - acrylic acid ester of methoxy polyethylenoxyglycol ( 55 ) was eliminated ; and ( iii ) the final resin solids were 76 %. thirty - five grams of the cationic acrylic resin , 23 g of crosslinking agent of example 25 , 12 . 5 g rutile titanium dioxide or ® 600 , 0 . 5 g acetic acid , and 0 . 5 g of tetrabutyl diacetoxy stannoxane were blended together on high speed stirrer to obtain good dispersion and wetting of the pigment . to this was slowly added deionized water to make up the final volume of the paint dispersion to 500 ml . the final paint solids were 10 %, the bath ph was 4 . 9 and bath conductivity was 440 ohm - 1 cm - 1 . the bath was allowed to age overnight at room temperature . next day phosphate coated steel panels ( bo 100 ®) were electrocoated using stainless steel anode . the deposition characteristics and film properties after baking for 20 minutes are shown in table 6 . table 5__________________________________________________________________________electrodeposited cross - linked acrylic coatings time film impact mek rubdeposition ( deposit - bake thickness knoop ( rev .) resist - voltage ( v ) ing ( secs ) temp . ° c . ( mil ) hardness in . lb . ance__________________________________________________________________________100 60 150 0 . 62 11 . 2 -- 200 + 100 90 150 0 . 6 11 . 2 -- 200 + 100 90 175 0 . 6 12 . 0 -- 200 + 200 60 150 1 . 0 6 . 8 40 + 200 + 200 60 175 1 . 0 12 . 5 20 - 30 200 + 250 30 150 1 . 0 6 . 9 40 + 200 + 250 30 175 1 . 0 12 . 6 20 - 30 200 + __________________________________________________________________________ the results in table 6 show that the bath had good electrodeposition characteristics and films were completely crosslinked at 150 ° c . in 20 minutes . however , the electrocoating bath showed signs of instability after two weeks of aging at room temperature . a coating composition is prepared comprising an acrylic resin which is a copolymer of n - butyl acrylate , styrene and 2 - hydroxyethyl methacrylate in 2 - ethoxyethanol ( solids 75 %, hydroxy number , 85 ), 18 . 7 g , compound of formula iii ( hpcm ), ( 40 % in cellosolve ), 15 g , and 0 . 2 g of tetrabutyl diacetoxy stannoxane catalyst were blended together to form a clear resinous solution . films were cast onto phosphate treated steel panels and baked at 150 ° c . for 20 minutes . the films were completely cured as indicated by resistance to 200 + mek rubs . a coating composition is prepared comprising the reaction product of 1 mole of bisphenol a and 6 moles of ethylene oxide ( hydroxyl number 212 , dow chemical co . xd - 8025 polyol ), 10 g , compound of formula iii , ( hpcm ) example 3 , 6 g , tetrabutyl diacetoxy stannoxane catalyst , 0 . 2 g , butanol , 5 g , water 2 g , blended together until clear and homogeneous . the solution was cast onto phosphate treated steel panels and baked at 150 ° c . for 20 minutes . the film thickness was 0 . 7 mil ; pencil hardness fh ; knoop hardness was 5 , reverse impact resistance was 80 + in . lbs . ; humidity resistance at 60 ° c . was 21 + days ; and the mek double rub test was 200 +. the above - mentioned patents and publications are incorporated herein by reference . many variations of this invention will suggest themselves to those skilled in this art in light of the above , detailed description . for example , instead of hydroxyfunctional polyesters and polyacrylates , epoxy resins , such as the polyglycidylethers of bisphenol a and the reaction products thereof with amines and ammonia can be used . or , for example , the s - triazine cross - linkers of this invention may be used in other types of coating compositions , such as high solids coatings , cathodic electrocoatings and powder coatings formulations . they may also be used in polyurethane rim ( reaction injection molding ) and foam formulations as one of the polyol components . all such obvious modifications are within the full intended scope of the appended claims .	2
the preferred embodiment of the invention involves the use of an electronic object or token , hereinafter called transaction object , that is exchanged between two devices at the point of interaction as part of a transaction between them . the two devices are interactively coupled by wireless or wired link , such as by using a usb connector directly from one to another , or by establishing a personal area network on which the devices can communicate directly . the transaction object records details of the transaction that occurs between the devices , as well as any related conditions that may be appropriate to the transaction . corresponding control processes are also provided for generating such objects , transferring them between devices during transactions , and controlling the devices in response . the preferred transaction object and control processes are implemented in an object oriented programming language such as c ++ or java , though any other suitable programming language may be employed . fig2 schematically illustrates the structure of the data fields within the transaction object 20 of the preferred embodiment . the object has a header 22 that both identifies it as a transaction object , and that contains a unique identifier for reference purposes . the identifier may , for example , be a globally or universally unique id ( guid or uuid ) as are known in the art . the object also contains a time and / or date field 24 for storing the date on which the transaction occurred , one or more descriptor fields 26 for defining the nature of the transaction , and one or more condition fields 28 for storing any appropriate conditions that have a bearing on the transaction or exchange . the descriptor fields shown in fig2 allow the object to store an indication of the transaction type , and the two devices involved in the interaction . a field indicating a third device may also be included , as will be explained below . the condition fields may be used to express any conditional statements that relate to the object , such as a time limit field for monitoring further action or validity . the fields shown in fig2 are purely for illustration , and are not intended to be limiting . the data stored in the fields of the transaction object is arranged to be at least computer readable by corresponding software or code on a receiving or issuing electronic device . in this way , the data in the fields may be used to produce operational effects within the devices once it is read by a device and interpreted by a device . additionally , the data stored in the transaction object may be human - readable , such as ascii text , so that a user of an electronic device can view the transaction object and recall a description of the transaction , and any conditions relating to it . the human readable data itself need only be stored in the transaction object if the transaction object is to be viewed using standard ascii text based programs , such as word processing based systems . alternatively , special viewing software may be provided , that simply translates the computer readable data in the transaction object into meaningful data for a user . thus , it will be appreciated that information such as the date of the transaction could be stored as part of the identifier 22 , and that this date field could be omitted from the transaction object . the transaction object is intended to cooperate with dedicated control processes or software provided in one or all of the electronic devices . the control software is necessary to create the transaction objects , and to read instances of such objects to determine if any actions are necessary . the details of the transaction stored in the object can include descriptive parameters describing properties of the transaction or data being transferred , parameters that identify the devices involved in the transaction , and conditions such as time periods that run from the time the object is created . in one embodiment of the invention , transaction objects may be used as authorisation or authentication tokens to securely identify one device to another device . this embodiment will be described with reference to fig3 . a portable computing device 6 is used by a user to interact with a personal computer 16 , as indicated by the arrow 30 , by bluetooth . data is exchanged during this transaction which identifies the portable device 6 to the pc 16 . a password is required so that the pc can recognise the portable device as a trusted device . in this example , the portable device is a mobile phone of an employee of a company , and the pc 16 is the employee &# 39 ; s desktop computer in his office . the employee enters information into his phone to specify certain requests . here , he identifies particular document to which he requires access . when the pc has successfully recognised the employee &# 39 ; s password , it generates a token (“ transaction object ”) which it sends to the phone . the token contains details of the time and date of the authentication as well as information about the employee &# 39 ; s permissions , including access to the specified document . some time later , the employee carries his phone to a different building owned by the employer , in which he has access to a different computer 2 . this second computer is connected to pc 16 by means of a network indicated in fig3 by the arrow 31 . the employee wishes to obtain a copy of the latest version of the specified document from the network 21 . to achieve this , he connects his phone by bluetooth to the computer 2 ( arrow 32 ), locates the previously acquired token on his phone , and transfers it ( or a copy of it ) to the computer . when the computer receives the token , it analyses it to determine details of the first transaction with the pc 16 . it recognises that the employee has requested access to the specified document , and automatically arranges for the latest version of the document , as stored on the network , to be transferred to the employee &# 39 ; s phone . in this way , the employee has conveniently received an up - to - date copy of the document which he can read or amend using his phone . in a preferred embodiment , the present invention is employed in technology that facilitates electronic payment methods . an electronic wallet , for example , is a known electronic device that acts as a repository for electronic cash and that interacts with special point of sale ( pos ) devices in stores to make a payment . the actual cash that an electronic wallet holds may be stored in a remote account that the electronic device accesses at the point of sale , or it may be encoded on the device so that the pos device simply deducts the amount paid for goods or services from the sum stored at the end of the transaction . wallet phones are one example of such electronic devices . these are mobile or cellular phones that allow a user to pay by wirelessly connecting their phone to a point of sale ( pos ) terminal in the store . the transaction object can be advantageously used in this environment to record details of a monetary transaction that has occurred , and act as an electronic receipt which may be stored on both the electronic wallet and the pos device . fig5 is a flowchart illustrating basic steps performed in accordance with the present invention . thus , in the first interaction between the electronic wallet and the pos device , an electronic sale takes place , and a transaction object is created ( step 502 ). in this example , a relatively expensive item is bought , such as a digital camera . the transaction object is populated with the date , the device details of the electronic wallet , an identifier of the issuing pos terminal , the address of the issuing store , details of the camera , price information , and conditions under which the camera may be returned to the retailer for an exchange or refund ( step 504 ). when the sale is completed ( step 506 ), a copy of the transaction object is transferred to the electronic wallet and stored for later reference . in the store terminal , a copy of the transaction object is stored for stock management and auditing purposes ( step 508 ). it is understood that the population information referred to above is for purposes of example and any information concerning the transaction and item ( s ) involved in the transaction can be included , and that other copies can be stored at other locations . at step 510 , it is determined if a post - sale transaction , e . g ., a refund , warranty request , etc ., is desired by the user . in this example , after the purchase has been made the customer decides that he wishes to perform a post - sale transaction , in this case , to return the camera to the store from which he bought it and obtain a refund ( step 510 ). he returns to a different branch of the store and connects ( wirelessly , or if unavailable , wired ) his electronic wallet to a pos terminal ( step 512 ). he sends a copy of his electronic receipt to the pos terminal , which is configured to read the receipt and determine whether the camera is being returned within the agreed return period ( steps 514 and 516 ). since in this example the refund period is still active , the pos terminal automatically initiates a refund to be transferred to the account from which the customer originally made the purchase ( step 518 ). in this example , a sales assistant is present to receive the camera from the customer and verify that it is still in good condition . if the refund period is not still active , this is identified at step 516 and the requested post - sale transaction is refused ( step 520 ). using the transaction object in this way gives the store assurance that the purchase was legitimate , and allows the details of the refund to be processed automatically to ensure that the correct amount of money is returned . often , for example , product / service prices will have changed in the period between the customer purchase and the refund , so that a store operator has to override the price that appears on the pos terminal automatically if only the product details are entered . once the automatic refund has taken place , the transaction object can be deleted from the electronic wallet , and the object on the pos terminal updated to show that a refund has taken place . for the customer , the transaction object acts as an electronic receipt that provides distinct functional advantages over a traditional paper copy . first , as the user of the electronic wallet is likely to have it with him at all times , the transaction object receipt is difficult to misplace . further , if a control process is provided on the electronic wallet for interacting with the receipt , other functions can be realised , as will be described below . one such enhancement is to automatically notify the customer when the period for refunding the product or services is about to expire . the transaction object acting as receipt stores the date of its creation , and if the electronic wallet has a date or appointment / organiser function , the control process can monitor how much time has elapsed since the transaction occurred , and issue a notification accordingly . the notification can be issued by the control process itself , or can be issued as a reminder in the appointment / organiser application . furthermore , once the transaction object is no longer necessary , because the time period for a refund has expired , the control process in the electronic wallet can either automatically delete the transaction object , so that it no longer takes up space in memory , or ask the user to confirm whether or not it should be deleted . the transaction object also allows different refund policies to be accommodated , in an easy to understand to manner for both the consumer and for the retailer . in comparison to a mere digital receipt , the transaction object in the electronic payment system may be configured to store the relevant refund policy and expiry date for the product or services purchased in a form that can be easily readable by the user of the electronic wallet via its resident control process . for example , it may contain the address of the store and specific constraints or rules about obtaining a refund in another store . where stores operate under a franchise system , the refund policies in different stores may be different , and this information is advantageously stored in the refund object so that it can be viewed by the user via the electronic wallet , and so that if the user presents the refund object at a store under the same franchise , that store can either effect the refund , or decline based on the stored refund policy . as noted above , the transaction object can have descriptors for storing conditions on which any further actions associated with the transaction object are based . one such condition that has been presented is a time limit . another condition , that is appropriate to this example , might be that no refund is allowed . for example , if a product is sold at a greatly reduced price because it is defective in some way , the store might wish to prohibit the user from applying later for a refund . at the pos terminal , where the transaction object is created , it is therefore preferable if the retailer is provided with the option of adding conditions to the object , such as ‘ no refund ’ condition . thus , if the user tries later to obtain a refund , they will be prohibited from doing so , by means of a data stored in the transaction object itself . a schematic representation of an application of the transaction object in the context of electronic payment systems is provided in fig4 . it should be noted that the transaction object could be used in a similar way to store and process warranty or guarantee information . the warranty information for a particular product can be included in the transaction object , thus enabling this information to be immediately available to any entity involved in the transaction in which one attempts to exercise the terms of a warranty . just as with the refund information , the warranty information can be used to update calendars , issue reminders , etc ., so that the user is made aware of the warranty expiration date and it &# 39 ; s approach , if desired . further , warranty conditions will also be immediately available to all parties involved in the transaction . a further application of the concept of the transaction object can be envisaged in the context of subscriptions to electronic journals , magazines , newspapers or other informative products . in this example , a customer could identify himself to a provider of such subscriptions , provide electronic payment , and receive an transaction object specifying that a corresponding number of issues of a magazine are available to him . then , when the customer subsequently wishes to receive an issue of the magazine , he can send a copy of his transaction object to the provider and receive an electronic ( or paper ) copy of the magazine in return . this arrangement offers the advantage that the customer need not receive issues of the magazine on a regular basis . instead , he can receive a fixed number of issues at times he chooses . for example , he may choose only to receive the magazines while he is not too busy at work or when he is travelling . the transaction object described can also be used to ensure that an electronic or mechanical device such as a vehicle is operating correctly , by storing details of maintenance or service actions carried out to maintain the device at a first interaction , monitoring a time period set at the first interaction , and prompting a user to return to the device for a second interaction , in which a follow up action is taken . in the example of vehicle maintenance a first interaction between a customer &# 39 ; s phone and a pos terminal at a garage could occur to arrange payment for a vehicle test such as an mot . an transaction object could be created by the pos terminal specifying the vehicle registration plate , the time and date of the test , and any further work carried out by the garage . the garage could offer a guarantee that any inadequate work carried out will be rectified free of charge if the resulting fault occurs within a certain time period after the initial work . this period could be specified in the transaction object . after a service , if the customer &# 39 ; s vehicle needs follow - up work to rectify inadequate work by the garage , the customer &# 39 ; s phone could communicate with the pos terminal at the garage ( or a different garage run by the same company ) to transfer the transaction object holding details of the original service . the garage could thereby determine whether the further work needs to be carried out free of charge . in the context of this example , the customer &# 39 ; s phone could be arranged to read the transaction object to the extent necessary to issue a reminder at a particular time that , say , a next mot is due , or a further service is required . in the context of maintenance of electronic devices , the transaction object may be used to by a service engineer to monitor the internal state of a computer or network device . a portable electronic device carried by the engineer can be used to store , at a first interaction , a token including details of maintenance or configuration parameters applied to a computer , such as downloads , virus checking , memory defragmentatlon , inventory analysis and so on , and set goals for repeat checks . in this way , the engineer may be reminded that he should return to a computer for further servicing , and may also be prompted as to the nature of that servicing . returning to the computer for a second interaction , the transaction object stored on the engineer &# 39 ; s portable electronic device may be sent to the computer after connection , and may automatically cause the computer to initiate pre - installed servicing software . in a network environment , the transaction object may be used to store details of an interaction between the engineer and a network device in which the configuration settings of the network device are altered . the transaction object may be stored at either the network device or the engineer &# 39 ; s portable device , so that at a second interaction , the engineer can reset the network settings automatically using the transaction object . on connecting the portable electronic device to the network device , the respective control processes would identify the relevant prior transaction object using the unique device identifiers so that the configuration could be carried out automatically without much intervention from the engineer . from the above examples it can be seen that many advantages can be achieved by using embodiments of the present invention in different contexts . the general inventive concept can enable convenient and secure transactions between devices , which may result in , among other things , the transfer of data , the sale or refund of goods or services , and the identification of required maintenance work . other applications of the inventive concept may be conceived by the skilled person , all of which are within the scope of the present invention . the above - described steps can be implemented using standard well - known programming techniques . the novelty of the above - described embodiment lies not in the specific programming techniques but in the use of the steps described to achieve the described results . software programming code which embodies the present invention is typically stored in permanent storage . in a client / server environment , such software programming code may be stored with storage associated with a server . the software programming code may be embodied on any of a variety of known media for use with a data processing system , such as a diskette , or hard drive , or cd rom . the code may be distributed on such media , or may be distributed to users from the memory or storage of one computer system over a network of some type to other computer systems for use by users of such other systems . the techniques and methods for embodying software program code on physical media and / or distributing software code via networks are well known and will not be further discussed herein . it will be understood that each element of the illustrations , and combinations of elements in the illustrations , can be implemented by general and / or special purpose hardware - based systems that perform the specified functions or steps , or by combinations of general and / or special - purpose hardware and computer instructions . these program instructions may be provided to a processor to produce a machine , such that the instructions that execute on the processor create means for implementing the functions specified in the illustrations . the computer program instructions may be executed by a processor to cause a series of operational steps to be performed by the processor to produce a computer - implemented process such that the instructions that execute on the processor provide steps for implementing the functions specified in the illustrations . accordingly , the figures support combinations of means for performing the specified functions , combinations of steps for performing the specified functions , and program instruction means for performing the specified functions . while there has been described herein the principles of the invention , it is to be understood by those skilled in the art that this description is made only by way of example and not as a limitation to the scope of the invention . accordingly , it is intended by the appended claims , to cover all modifications of the invention which fall within the true spirit and scope of the invention .	6
fig1 shows a perspective view of a cable support 1 according to an exemplary embodiment of the invention . the cable clamp 1 is secured in an eyelet 2 of a transverse carrier 3 , e . g ., in order to support the lines running through the eyelet 2 . the cable clamp 1 has a basic unit 4 and a wedge 5 . as shown on fig1 , two v - shaped cable guides 6 are formed on a side facing the eyelet 2 of the transverse carrier 3 according to the exemplary embodiment . these cable guides may be integrated with the basic unit . as an alternative , however , they can be attached or slipped on , and have a different shape . on the side of the transverse carrier 3 accommodating the wedge 5 , the basic unit 4 has a web 7 extending away from the eyelet 2 , which web 7 is preferably integrated with the basic unit 4 . the lateral surfaces of the web 7 each have guide rails 8 a , 8 b , which guide the wedge 5 while it is pushed from the bottom up in the figure between a surface of the transverse carrier 3 and the web 7 of the basic unit 4 . pushing the web 5 in the figure from the bottom up along the guide rails 8 a , 8 b of the web 7 exerts a clamping effect depending on the thickness ( width ) of the transverse carrier 3 when the wedge 5 is inserted far enough between the surface of the transverse carrier 3 and an inside surface of the web 7 . according to the exemplary embodiment , the side of the wedge 5 facing the transverse carrier 3 is completely in contact with the transverse carrier 3 with the cable support fixed in place ( i . e ., when the cable support 1 is securely clamped with the transverse carrier 3 ), in order to ensure a reliable clamping . fig2 a to 2 c show the cable support 1 according to fig1 demounted into its individual components , and after assembled . fig2 a shows the basic unit 4 of the cable support 1 according to the invention . as shown on fig2 a , the basic unit 4 has a projection 9 , which is essentially longer in design than the web 7 . one end area of the projection 9 has a pin 10 on the surface that essentially extends perpendicularly away from the projection 9 in the direction of the web 7 . the web 7 and projection 9 are arranged relative to each other in such a way as to generate a space 11 between them serving to accommodate the transverse carrier 3 according to fig1 . fig2 a also shows the guide rails 8 a and 8 b formed on lateral surfaces of the web 7 . according to the exemplary embodiment , the projection 9 extends essentially perpendicularly away from the basic unit 4 , and the web 7 preferably extends away from the basic unit 4 at an angle . hence , the projection 9 and the web 7 may be not parallel to each other . fig2 b shows the wedge 5 with wedge guide rails 12 a , 12 b , which are designed according to the guide rails 8 a , 8 b of the web 7 to be guided therein . the wedge 5 may be designed as a single piece , e . g ., fabricated via injection molding technology . the side of the wedge 5 facing away from the wedge guide rails 12 a , 12 b has a surface 13 that is in contact with a surface of the transverse carrier 3 when the cable support 1 is clamped to the transverse carrier 3 . the wedge surface 13 preferably is structured in such a way as to prevent the cable support 1 from spontaneously detaching , or the rigidly fixed wedge 5 from slipping out . fig2 c shows the basic unit 4 according to fig2 a with wedge 5 according fig2 b slipped on . as evident from fig2 c , a joining element 14 , e . g ., a cable binder , is additionally provided to prevent the wedge 5 from sliding out of the guide rails 8 a , 8 b of the web 7 , e . g ., due to vibrations , and lifting a clamping effect on the transverse carrier 3 . other joining elements are possible , e . g ., screws , pins , etc . fig3 shows a cross sectional view of the cable support 1 secured to the carrier 3 according to fig1 . as evident from fig3 , the pin 10 of the basic unit 4 extending away from the projection 9 is inserted through an installation hole 15 formed in the transverse carrier 3 with the cable support 1 in an assembled state . the pin 10 is a molded - on , split wedge pin according to the exemplary embodiment . the installation hole 15 can be used to easily fix the cable support 1 in a specific position . as shown on fig3 , an end area of the transverse carrier 3 facing the transverse carrier eyelet 2 is located inside the space 11 defined by the projection 9 and the web 7 . in this case , an essentially flat surface of the projection 9 is in complete contact with the surface of the transverse carrier 3 . the wedge 5 is introduced into the space 11 in fig3 , and with the cable support 1 clamped with the transverse carrier 3 , the surface 13 of the wedge 5 is essentially in contact with a surface of the transverse carrier 3 lying opposite the surface of the transverse carrier that contacts the surface of the projection 9 . with the cable support 1 securely fixed to the transverse carrier 3 , the wedge 5 is additionally secured with a cable binder 14 in the exemplary embodiment to prevent the wedge 5 from unintentionally detaching , i . e ., slipping out . fig4 a shows a side view of the cable support 1 in a state secured to a first transverse carrier 3 a . in order to arrive at the clamped state of the cable support 1 shown on fig4 a , the cable support 1 with secured wedge 5 and detached cable binder 14 is inserted and fixed in the installation hole 15 of the transverse carrier 3 a . fixation takes place with the molded - on , split wedge pin 10 . the wedge 5 is then pulled up with the cable binder 14 , i . e ., until the surface 13 of the wedge 5 tightly abuts the transverse carrier 3 a . the wedge 5 here moves along the guide rails 8 a , 8 b , which are laterally formed on web 7 , as described above . the wedging effect and latching cam or stop cam on the side of the basic unit fixes the support in place . hence , the wedge moves along an inclined plane at an angle α relative to web 7 , and becomes fixed in place at a varying height , depending on the web thickness 3 a . in the case shown on fig4 , the wedge 5 is fixed at height h 1 , for example . for comparison purposes , fig4 b shows a transverse carrier 3 b that is less wide than the transverse carrier 3 a shown on fig4 a . therefore , the web of the transverse carrier 3 b according to fig4 b is less thick than the web of the transverse carrier 3 a shown on fig4 a . as clearly evident from fig4 b , the wedge 5 is also moved up at an angle α relative to the web according to the invention , wherein the wedging effect only sets in significantly later than for the transverse carrier 3 a according to fig4 a . the cable support 1 only becomes clamped or fixed in place at height h 2 , which exceeds height h 1 according to fig4 a . hence , the wedge according to the invention becomes clamped at varying heights depending on the web thickness . fig4 a and 4 b each show a cable 16 supported and guided by the cable support according to the invention . fig5 shows a perspective view of the web 7 of the basic unit 4 of the cable support 1 . in fig5 , the wedge 5 is directed along the guide rails 8 a and 8 b of web 7 , and arranged within the space 11 formed between the web 7 and projection 9 . even though the invention was described above drawing reference to an exemplary embodiment , it goes without saying that the person skilled in the art can introduce changes and modifications in this area without departing from the scope of protection of the invention . further , it goes without saying for an expert in this area that the cable support according to the invention can also be used in other areas than aircraft construction , e . g ., in automobiles , or where reliably mounting and guiding cable looms or lines is important . the support according to the invention can also be used to mount and guide not just cables , cable looms and the like , but also pipes and tubes or other objects . it should be noted that the term “ comprising ” does not exclude other elements or steps and the “ a ” or “ an ” does not exclude a plurality . also elements described in association with different embodiments may be combined . it should also be noted that reference signs in the claims shall not be construed as limiting the scope of the claims .	7
in the present invention , the inherently flame resistant fiber is first made into a fabric . any of the known methods of doing so , including weaving , knitting and non - woven fabric formation can be used . other techniques such as tufting may also be adopted . once the fabric is formed , it is scoured prior to the application of the chemical treatments . scouring removes residual processing aids , which may be present on the textile material , as well as dirt and / or oily materials . the scouring of the textile material to remove any residual textile processing aids , dirt , oil residues , and the like , can be readily accomplished by passing the textile material through an aqueous detergent . after passing the textile material through the aqueous detergent , it should be in order to remove any residual detergent . the amount of the detergent constituent employed in the aqueous detergent containing solution can vary widely as can the type of detergent . generally , desirable results can be obtained when the amount of the detergent constituent employed is from about 0 . 10 to about 1 . 0 weight percent , based on the total weight of the detergent solution . the detergent to be employed is typically selected from a group that does not react negatively with the fabric to be scoured or with the fabric &# 39 ; s flame resistant properties . typical examples of suitable detergents that can be employed in the detergent scouring of the textile material , include solpon 1159 , solpon spi , and picoscour jet . after the fabric has been scoured and rinsed , the scoured material may then be subjected to a chemical treatment step . the chemical treatment of the present invention comprises exposing the inherently fr textile material to an aqueous solution of a wetting agent and a flame retardant and one or more of : an antimicrobial agent , a water repellant agent , or a soil resistance agent . while , not wishing to be bound to a particular theory , a flame retardant may be added to the chemical treatment composition to ensure that the inherent flame retardant remains chemical coupled with the polyester fiber . it is thought that the presence of the flame retardant in the chemical coating composition may help to kinetically drive the inherently coupled flame retardant to remain chemically bound within the polyethylene terephthalate chain of the polyester fibers . the flame retardant in the chemical coating composition is preferably the same flame retardant that comprises the inherently flame retardant fabric . typical examples of suitable flame - retardants include cyclic phosphonate , apex flameproof # 1525 , pyron n - 75 , and antiblaze nt . the flame retardant to be added to the chemical treatment preferably comprises about 2 % to about 10 % by weight of the chemical treatment composition . more preferably , the flame retardant comprises about 4 . 8 % by weight of the chemical treatment composition . the wetting agent of the chemical coating composition reduces the hydrophobicity of the dry fabric and to ensure that the entire fabric is sufficiently contacted with all the chemical treatments . the wetting agent to be added to the chemical treatment preferably comprises between about 0 . 5 % to about 2 . 0 % by weight of the chemical treatment composition . more preferably , the wetting agent comprises about 0 . 96 % by weight of the chemical treatment composition . preferably , the wetting agent is an alcohol . more preferably , the wetting agent is an aliphatic alcohol such as isopropanol . typical examples of suitable wetting agents include nonionic ethylene ether condensates , such as dexopal 555 , or aqueous cationic non - rewetting surfactants solutions , such as mykon nrw - 3 . for those cases where antimicrobial properties are desired , an antimicrobial agent is added to the chemical treatment to reduce the growth of microorganisms on the inherently flame resistant fabric . by “ antimicrobial agent ” is meant any substance or combination of substances that kills or prevents the growth of microorganisms , and includes antibiotics , antifungal , antiviral and antialgal agents . the antimicrobial agent can be either a “ leaching ” antimicrobial agent or a “ molecularly bonded ” antimicrobial agent . leaching antimicrobials work by leaching or moving from the surface of the fabric to contact and kill a nearby microorganism . molecularly bonded antimicrobial agents work by remaining affixed to the fabric and kill the microorganism as it contacts the surface to which the bonded antimicrobial has been applied . see white et al ., “ a comparison of antimicrobials for the textile industry ”, www . microbeshield . com . the antimicrobial agent to be added to the chemical treatment composition preferably comprises about 0 . 2 % to about 2 . 0 % by weight of the chemical treatment composition . more preferably , the antimicrobial agent comprises about 0 . 48 % by weight of the chemical treatment composition . typical examples of suitable antimicrobial agents include ultrafresh dm - 25 , an octhilinone or bioshield am 500 , an organosilane . preferably , the antimicrobial agent is a “ molecularly bonded ” antimicrobial agent . more preferably , the antimicrobial agent is an organofuctional silane . even more preferably , the antimicrobial agent is an organosilane composition comprising about 16 % by weight of chloropropyltrihydroxysilane and about 84 % by weight of octadecylaminodimethyltrihydroxysilylpropyl ammonium chloride , available from aegis under the trademark aem 5700 ™. for those cases where fluid or soil repellent properties are desired , a fluid or soil repellent agent is added to the chemical treatment composition to improve the fabric &# 39 ; s water repellency and the fabric &# 39 ; s resistance to staining . also , a combination fluid repellent / soil resistant agent may be added to the chemical treatment composition . preferably , in the present invention , the fluid repellent agent and soil resistant agent is added as a combination fluid repellent / soil resistant agent . more preferably , the fluid repellent / soil resistant agent is a fluorochemical . even more preferably , the fluid repellent / soil resistant agent is a fluorochemical available from dupont under the trademark zonyl 7040 ™. the combination fluid repellent / soil resistant agent to be added to the chemical treatment preferably comprises about 2 % to about 10 % by weight of the chemical treatment composition . more preferably , the fluid repellent / soil resistant agent comprises about 3 . 6 % by weight of the chemical treatment composition . the chemical treatment may be applied by various methods known in the art , such as by spraying , dipping or pad application . in a preferred embodiment , the chemical treatment is applied to the scoured fabric using a pad applicator . the pressure of the squeeze rollers is controlled to achieve a wet pick - up of between about 25 % and about 60 % of the chemical treatment . preferably , the pressure of the squeeze rollers is controlled to achieve a wet pick - up of approximately 45 % of the chemical composition . the chemically treated fabric is then dried through exposure to between about 320 ° f . and 420 ° f . for between about 20 seconds and 60 seconds in a hot air oven . preferably , the fabric is dried through exposure to 380 ° f . for 30 seconds in a hot air oven . the following is a description of one preferred method of the present invention . by way of example , an inherently flame resistant fiber , such as that marketed by kosa , inc ., trademarked as avora ™, is woven into a fabric and treated with a chemical composition comprising an antimicrobial agent , a fluid repellent agent , a stain resistant agent and a flame retardant such that the chemically treated fabric has a flame resistance substantially similar to untreated inherently flame resistance fabric . in example 1 , large - scale plant trials were conducted . the avora ™ inherently flame resistant fibers were made into a woven fabric having the properties in table 1 was first scoured with an aqueous detergent prior to the application of chemical treatments . after thoroughly rinsing the scoured fabric , it was dried in a hot air oven . a chemical treatment composition was then prepared in an aqueous - based solution comprising 0 . 96 % by weight of isopropanol , 4 . 8 % by weight of flame retardant 50 , 3 . 6 % by weight of zonyl 7040 ™ and 0 . 48 % by weight of aem 5700 ™ as seen in table 2 . the chemical treatment composition was applied to the scoured avora ™ fabric using a pad applicator . the pressure of the squeeze rollers was controlled to achieve a wet pick - up of approximately 45 % of the chemical treatment composition . the fabric was then dried through exposure to 380 f for 30 seconds in a hot air oven . after drying , the finished fabric was tested according to standard published test protocols to assess its properties . these properties are summarized in table 3 . as summarized in table 3 , the post - weave chemical treatment that includes the flame retardant 50 has a flame resistance substantially similar to the untreated inherently flame resistance fabric . it is thought that the presence of the flame retardant in the chemical coating composition may kinetically drive the inherent flame retardant to remain chemically bound within the polyethylene terephthalate chain of the polyester fibers . the fluid repellency has an excellent spray rating resistance . finally , the test for the presence of the antimicrobial agent also passed . in example 2 , another large - scale plant trial was conducted . the avora ™ inherently flame resistant fibers were made into a woven fabric having the properties in table 1 was first scoured with an aqueous detergent prior to the application of chemical treatments . after thoroughly rinsing the scoured fabric , it was dried in a hot air oven . the chemical treatment composition in table 4 was applied to the scoured fabric using a pad applicator . the pressure of the squeeze rollers was controlled to achieve a wet pick - up of approximately 45 % of the chemical treatment composition . the fabric was then dried through exposure to 380 f for 30 seconds in a hot air oven . after drying , the finished fabric was tested according to standard published test protocols to assess its flame resistance properties . as summarized in table 5 , the post - weave chemical treatment in table 4 , which omits the flame retardant 50 , failed the nfpa 701 — 1996 edition flame resistance test . ( the fill data is not required for nfpa 701 test ) as taught by the kosa , “ avora ™ fr ” publication , the inherently flame resistance properties of the avora ™ fabric degrade after a post - weave chemical treatment . however , the present inventor has found that if a flame retardant is added during the chemical treatment coating process , the fabric retains a flame resistance substantially similar to untreated inherently flame resistance fabric . in example 3 , a small - scale lab trial was conducted . the avora ™ inherently flame resistant fabric having the properties in table 1 was first scoured with an aqueous detergent prior to the application of chemical treatments . after thoroughly rinsing the scoured fabric , it was dried in a hot air oven . the chemical treatment composition in table 6 was applied to the scoured avora ™ fabric using a pad applicator . the pressure of the squeeze rollers was controlled to achieve a wet pick - up of approximately 45 % of the chemical treatment composition . the fabric was then dried through exposure to 375 f for 1 minute in a hot air oven . after drying , the finished fabric was tested according to standard published test protocols to assess its flame resistance properties . several further small - scale lab trials were then conducted . the lab procedures followed were identical to that in example 3 . the only differences between examples 4 - 8 were the types of chemical treatments applied . the treatments for each example in 4 - 8 are summarized in tables 7 - 11 . the results of the nfpa 701 — 1996 edition flame resistance tests are also summarized in tables 7 - 11 . while not wishing to be bound by any particular theory , after summarizing the small - scale experiments in tables 7 - 11 , it was thought that the addition of flame retardant to the chemical treatments does not harm the flame resistant properties of untreated inherently fr fibers and may , in some cases with heavy chemical loading , assist in kinetically driving the inherent flame retardant to remain chemically bound within the polyethylene terephthalate chain of the polyester fibers . but , it is not a requirement for the present invention to require the addition of flame retardant to the desired chemical treatment in order for the treated fabric to have an equal flame resistance to the untreated inherently fr fibers . therefore , the present invention , unlike the prior art teachings , has unexpectedly found that the addition of chemical treatments to inherently fr fibers , has substantially equal flame resistance as compared to untreated inherently fr fibers . another inherently resistant fiber , trevira cs is similar to avora , the two fibers having previously been available as european and american versions of the product from the same manufacturer , which has recently been divided into two separate organizations , each selling its own inherently fr fiber . accordingly , trevira cs fibers was also tested in a woven fabric having the following construction : warp filling denier 165 denier 165 filaments 64 filaments 64 x - section trilobal x - section trilobal luster bright luster bright textured no textured no fiber polyester fiber polyester without finishing the fabric had these nfpa 701 bum test results : % weight loss afterburn & lt ; 2 sec . warp 9 . 3 % afterflame & lt ; 2 sec . pass fill 10 . 9 % pass an additional sample of trevira cs of the same construction was finished with : general chemical name description treatment amount zonyl 7040 fluorochemical fluid / stain 30 g / 400 ml repellent aem 5700 organosilane antimicrobial 4 g / 400 ml the fabric was dried through exposure to 375 ° f . for 1 minute in a hot air oven . the pad pressure was 6 psi and the air flow set at 100 %. characteristic tested test method units results flammability nfpa 701 - 1996 % weight warp - 12 . 6 % edition loss & amp ; afterflame & lt ; 2 sec . afterburn passed time fill - 10 . 4 % afterflame & lt ; 2 sec . passed fluid repellency aatcc test 22 spray rating 100 presence of bromo blue pass / fail pass antimicrobial internal pfg agent it should now be understood by those skilled in the art that the amounts and ratios of the chemical treatment compositions as well as the type of treatment desired may be varied depending on the desired result of the chemical coating treatment . it should also be understood that all such modifications and improvements have been deleted herein for the sake of conciseness and readability but are properly within the scope of the following claims .	8
the present invention provides relatively simpler methods of forming microarrays based on noncovalent fluorous - based interactions . in contrast to the production of microarrays from compounds made on solid - phase that require multiple solution - phase and deprotection and derivation steps , the present invention allows direct array formation , a property that oligomer synthesis methods on solid phase or with lipid or polyethylene glycol tags do not share . the microarray substrate is prepared having fluorous surfaces to noncovalently attach fluorous tagged compounds . the substrate of the invention can be made of various materials . the substrate is required to be capable of immobilizing the particular probes used , or the substrate must be capable of modification ( for example , by coating ) so that it is capable of such immobilization . preferred materials for the substrate of the present invention include silica , glass , metals , plastics , and polymers . any microarray substrate having fluorous surfaces is suitable for use in the invention , including teflon ® coated slides ( such as those manufactured by precision lab products ) or any other teflon ® coated surfaces . as used herein , the term “ fluorous surface ” is defined as sufficient fluorocarbons for water to form beads on the surface of the substrate and / or a surface having sufficient fluorocarbons to bind the fluorous tags chosen by the user . in the alternative , substrates having fluorinated surfaces can also be readily manufactured . preferably , the slides or other substrate are first cleaned using ethanol or other conventional means . the substrate is then immersed in a fluorous solution to coat the substrate , which is then dried and washed . in a preferred manufacturing method , the substrate is immersed at least once in a solution of rf8 - reagent , such as rf8 - ethyl - sicl 3 . in a most preferred method , the slides are immersed multiple times , with three times being most preferred , with periods of drying for a few minutes each time in between . in an alternative but less preferred method of the invention , commercially available fluorous amine can be reacted with maleic anhydride on the surface of the substrate . alternatively , the corresponding fluorous thiol can be reacted with commercially available maleimide activated plates to produce glass slides or wells with fluorous surfaces , as shown below . as noted above , when properly coated , water will bead up on the fluorous surfaces . once the microarray substrate is prepared , fluorous - tagged molecules ( probes ) are spotted on the coated substrate . fluorous tags are perfluoroalkyl modified versions of traditional protecting groups that are soluble in most organic solvents , such as dmf , thf , ch 2 cl 2 etc . the tag needs to survive the necessary sequential reaction conditions and also be removed if desired . suitable fluorous tags for use in the present invention include , but are not limited to , f - boc - on , f - thiol , f - cbz - osu , f - silanes , fluorous benzyl alcohol , f - fmoc - osu , f - pmb - oh , fluomarg , fluorous trityl chlorides , fluorous t - butanols ( i . e . c 4 f 9 , c 6 f 13 , etc . ), 4 -[ 3 -( perfluorooctyl )- propyl - 1 - oxy ]- thiophenol , fluorous - ter - butyldiphenylsilyl , fluorous - para - methyoxybenzyl , fluorous - fluorenylmethoxycarbonyl , otf ( f - tbdps trifuloromethanesulfonate ), fluorous levulinate ( f - lev ), fluorous allyl groups ( f - allyl ), and fluorous trityl alcohols . fluorous tags are well known in the art and are commercially available from such companies as fluorous technologies incorporated ( fti ). the fluorous tags preferably have a general formula of r — c x f ( 2x + 1 ) , whereby r comprises one or alkyl groups and x is an integer . c 8 f 17 tags are preferred for reasons of convenience , i . e . readily accessible commercial availability . the present invention also includes unique fluorous tags , fluorous levulinate ( f - lev ) and fluorous allyl ( f - allyl ). f - lev may be synthesized by formation of the grignard reagent from 2 -( perfluorohexyl ) ethyl iodide followed by addition of succinic anhydride . an allyl group works well with standard trichloroacetimidate coupling conditions and deprotection conditions . reaction of cis - 1 , 4 - butenediol with 1h , 1h , 2h , 2h - perfluorodecyl iodide using mild base conditions ( manzoni 2004 ) produces an alcohol with the requisite alkene spacer for use in glycosylations . the present inventors developed a means of synthesizing a modified version of this tag on a larger scale . an additional methylene spacer between the leaving group and the electron - withdrawing fluoroalkane was added to reduce the acidity of the hydrogen beta to the leaving group . to this end , commercially available 3 -( perfluorooctyl ) propanol was mixed with methanesulfonyl chloride to provide mesylate derivative quantitatively . this electrophile was then reacted with cis - 1 , 4 - butenediol to produce fluorous - tagged alcohol in 70 % yield for use in subsequent glycosylation reactions . the procedure for tagging molecules having protecting groups is well known in the art . the conditions will vary depending upon the tag ( s ) chosen , substrate used , etc . an exemplary and well known reference in this respect is t . w . green , p . g . m . wuts , protective groups in organic synthesis , wiley - interscience , new york , 1999 , the contents of which are specifically incorporated herein by reference . this book provides detailed information to persons skilled in the art regarding the tagging conditions / procedures to use depending on the protecting group selected . the tagged molecules or “ probes ”, are immobilized on the substrate in accordance with the invention by noncovalent attachment . the probes are specifically bound to a target material to be detected , and may be , but are not limited to , proteins or fragments of proteins , nucleotides ( rna , dna , etc . ), or carbohydrates ( i . e . polysaccharides , oligosaccharides , or monosaccharides ), molecular complexes ( e . g ., nucleic acid hybrids , protein complexes , cell components ), reactive complexes ( e . g ., complexes undergoing chemical or enzymatic reactions ), lipids and fatty acids , steroids , drugs , cells , tissue , and other small molecules ( i . e . having a molecular weight of about or less than 10 , 000 daltons ). more particularly , the probes may be dnas , rnas , antibodies , antigens , ligands , substrates , or inhibitors . the set of probes chosen depends on the use of the apparatus . for example , if the apparatus uses polynucleotides as probes , if one is performing sequence analysis , one would prefer a complete or nearly complete set of n - mers ; the use of such sets is more fully described in u . s . pat . nos . 5 , 700 , 637 and 6 , 054 , 270 , which are hereby incorporated herein by reference in their entirety . on the other hand , if a device is to be used to analyze mutations or polymorphisms in a gene or set of genes , polynucleotides representing a complete or chosen set of mutations , such as substitution , deletion , and insertion mutations , for sections of the particular gene or genes of interest may be preferred . these examples are merely illustrative of the various custom sets of probes that might be selected for a particular apparatus and focus on polynucleotides because these are the types of probes now most commonly in use ; it is to be understood that other types of probes and other sets of polynucleotides will be readily apparent to the skilled worker in the field . the samples being deposited on the microarray substrate using the technology disclosed herein can take or be carried by any physical form that can be transported by a robotic pin or through a capillary . these include but not limited to fluid , gel , paste , bead , powder and particles suspended in liquid . established robotic spotting techniques use a specially designed mechanical robot , which produces a probe spot on the microarray by dipping a pin head into a fluid containing an off - line synthesized dna or other molecule and then spotting it onto the slide at a predetermined position . washing and drying of the pins are required prior to the spotting of a different probe in the microarray . in current designs of such robotic systems , the spotting pin , and / or the stage carrying the microarray substrates move along the xyz axes in coordination to deposit samples at controlled positions of the substrates . in addition to the established robotic spotting technologies , there are a number of microarray fabrication techniques that are being developed . these include the inkjet technology and capillary spotting . the fluorous - tagged molecules are preferably dissolved in an appropriate solvent to form a solution , then spotted on the fluorinated substrate using the means described above . the substrate is then dried in a humidifying chamber or by other conventional drying means . the sample spot sizes in microarrays are typically less than 200 microns in diameter , and each array usually contains thousands of spots . once the probes are attached to the substrate , the sample containing the target material is contacted with the probes , typically by simply pouring the sample over the tagged substrate . generally , the sample of a liquid phase contacts with the probes in a condition appropriate to induce the reaction between the target material and the probes . for example , in the case of detecting a carbohydrate target material , probes and target carbohydrates are incubated in a condition of optimal temperature and salt concentration that can induce the binding of the carbohydrate and carbohydrate binding proteins . when specific reaction between the target material and the probes is completed , unreacted reactants can removed by washing or other conventional means . to generate data from microarray assays some signal is detected that signifies the presence of , or absence of , the sequence of , or the quantity of the assayed compound or event . detection of the reaction between the target material and the probes may be carried out by various methods , such as confocal fluorescent scanner , low luminescence detector , isotope imager , etc . a method of detecting an optical , electrical , or color signal may be used . according to an optical detection method , the target material is generally labeled with an optically detectable element . the reaction results between the target material and the probes can be detected by measuring light emitted from a reaction product of the target material and the probes by irradiation of excitation light . the invention is also intended to encompass technology and detection methods yet to be developed . fluorous - based microarray methods allow the facile formation of a range of carbohydrate chips for the plant and other sciences using synthetic carbohydrates produced with the aid of fluorous - tagged synthesis . this approach is especially valuable for the production of arrays containing compounds , such as glycosaminoglycan fragments , that contain nucleophiles that complicate current defined covalent attachment strategies . the following examples are offered to illustrate but not limit the invention . thus , they are presented with the understanding that various modifications may be made and still be within the spirit of the invention . tetrasaccharide synthesis and fluorous coating of substrate surface in preparation for microarray formation as shown below , coupling between 1 and 2 was conducted using a catalytic amount of trimethylsilyl triflate ( tmsotf ) or triflic acid as a promoter . even if the reaction is incomplete , the desired disaccharide 3 can be separated from the rest of the materials by automated fluorous flash chromatography under optimized conditions . the acetate ( ac ) group in 3 was then removed by sodium methoxide to give 4 that was purified by reverse phase spe , or fluorous flash chromatography . with disaccharide 4 as a glycosyl acceptor , the same glycosylation - deprotection reactions is repeated two more times to give tetrasaccharide 5 . tetrasaccharide 5 , as well as the corresponding mono -, di -, and trisaccharide intermediates , were deprotected by hydrogenation with pd / c . these compounds were taken up in aqueous methanolic solutions and drops deposited in the fluorous - phase 96 - well microtiter plates . the methanol was then removed by slow evaporation to promote alignment of the fluorous - tagged compounds with the carbohydrate portion on the surface as reported for lipid interactions with hydrophobic wells ( fazio 2002 ). the commercially available lectin conconavalin a , which is known to bind to mannose ( for example see : weatherman , 1996 ), was then added to the wells . the hydrogenated allyl linker was used as an initial control compound . after rinsing of the solution with aqueous buffer , the amount of protein still bound will be measured by a bradford assay ( bradford , 1976 ). the lectin bound to the wells containing the mannose sugars . these experiments serve to establish experimental parameters for forming compound arrays using fluorous tags as a foundation for phase ii work in making oligosaccharide arrays . reaction solvents were distilled from calcium hydride for dichloromethane and from sodium metal and benzophenone for diethyl ether . amberlyst 15 ion - exchange resin was washed repeatedly with methanol before use . all other commercial reagents and solvents were used as received without further purification . the reactions were monitored and the r f values determined using analytical thin layer chromatography ( tlc ) with 0 . 25 mm em science silica gel plates ( 60f - 254 ). the developed tlc plates were visualized by immersion in p - anisaldehyde solution followed by heating on a hot plate . silica gel flash chromatography was performed with selecto scientific silica gel , 32 - 63 mm particle size . fluorous phase chromatography was performed using fluorous solid - phase extraction cartridges containing silica gel bonded with perfluorooctylethylsilyl chains ( fluoroustechnologies , inc . ; pittsburgh , pa .). all other fluorous reagents were also obtained from fluorous technologies , inc . all moisture - sensitive reactions were performed in flame - or oven - dried glassware under a nitrogen atmosphere . bath temperatures were used to record the reaction temperature in all cases run without microwave irradiation . all reactions were stirred magnetically at ambient temperature unless otherwise indicated . microwave heating was carried out with a cem - discover continuous wave microwave . 1 h nmr and 13 c nmr spectra were obtained with a bruker drx400 at 400 mhz and 162 mhz respectively . 17 f spectrum was obtained with a varian vxr400 at 376 mhz . 1 h nmr spectra were reported in parts per million ( δ ) relative to cdcl 3 ( 7 . 27 ppm ) as an internal reference . 13 c nmr spectra were reported in parts per million ( δ ) relative to cdcl 3 ( 77 . 23 ppm ) or cd 3 od ( 49 . 15 ppm ). 19 f nmr spectra were reported in parts per million ( δ ) relative to hexafluorobenzene c 6 f 6 ( 0 . 00 ppm ). cleaning of glass slide . glass slides were cleaned by immersion for 2 h in 60 % ethanol containing naoh ( 10 g / 100 ml ). the slides were washed twice in distilled water and then submerged in 95 % ethanol . formation of fluorous - derivatized glass slides . cleaned slides were immersed three times in a solution of rf8 - ethyl - sicl 3 ( 3 % solution 100 ml in methanol ) and then dried for a few minutes ; the process was repeated two more times . the slides were then washed twice by immersion in milliq - filtered water and then dried in a dessicator at room temperature . formation of carbohydrate microarrays . fluorous - tagged carbohydrate compounds were dissolved in 60 % methanol in water and spotted on the fluorinated glass slide using a robotic spotter ( cartesian pixsys 5500 arrayer , cartesian technologies , inc ., irvine , calif .) at 30 % humidity . the glass slide was dried in a humidifying chamber at 30 % humidity for 2 h . detection of protein - carbohydrate binding . for con a , fitc - labeled con a in hepes buffer ( ph = 7 . 5 , 10 mm ) 1 mm cacl 2 , 1 mm mncl 2 , 100 mm nacl , 1 % bsa ( w / v ) or without bsa , and for eca , fitc - labeled eca in pbs buffer ( ph = 6 . 8 ), 1 . 0 % tween 20 , eca ( 25 μg ml - 1 ; ey laboratories , inc ., san mateo , calif .) were used in the detection of protein - carbohydrate interactions . for protein incubation , 0 . 5 ml of protein solution was applied to the printed glass slide . the arrays was incubated by using a pc500 cover well incubation chamber ( grace biolabs , bend , oreg .) and gently shaken every 5 min for 30 min . the slides were then washed three times with the incubation buffer followed by three washes with distilled water . the slides were subsequently dried for 30 min in a dark humidity chamber . the glass slide was scanned using a general scanning scanarray 5000 set at 488 nm . cis - 1 , 4 - butenediol ( 140 mg , 1 . 59 mmol ) was dissolved with dmf ( 20 ml ). tbab ( 153 mg , 48 . 0 mmol ) and 1h , 1h , 2h , 2h - perfluorodecyliodide ( 1 . 8 g , 3 . 18 mmol ) were added to the solution . the reaction mixture was heated at 50 ° c . for 10 min ; koh ( 267 mg , 4 . 77 mmol ) then was added into the mixture . the reaction mixture was heated at 70 ° c . for 30 min . the reaction mixture was poured into ice water . the organic layer was extracted with diethyl ether ( 100 ml × 2 ) and dried over mgso 4 . the mixture was filtered and the solvent removed under reduced pressure . the crude product was purified by solid - phase extraction using a fluorous solid - phase extraction cartridge . the crude product was dissolved in dmf ( 0 . 5 ml ) to load onto the fluorous solid - phase extraction cartridge . the crude product was absorbed onto the column and then 80 % meoh / water ( 10 ml ) was used to wash the nonfluorous compounds through the column . the desired product was obtained by elution with 100 % meoh to yield , upon solvent removal , the alcohol as a colorless oil ( 1 . 12 g , 1 h nmr ( cdcl 3 , 400 mhz ): δ ( ppm ) 5 . 87 - 5 . 81 ( m , 1h ), 5 . 69 - 5 . 65 ( m , 1h ), 4 . 26 - 4 . 24 ( m , 2h ), 4 . 26 - 4 . 20 ( m , 4h ), 2 . 40 - 2 . 35 ( m , 2h ). 13 c nmr ( cdcl 3 , 160 mhz ): δ ( ppm ) 132 . 8 , 127 . 5 , 66 . 2 , 61 . 9 , 61 . 8 , 58 . 7 , 46 . 8 . 19 f nmr ( cdc 3 , c 6 f 6 , 376 mhz ): δ ( ppm ) 80 . 9 , 49 . 3 , 44 . 0 , 40 . 3 , 39 . 8 , 39 . 0 , 35 . 6 . to a solution of 2 , 3 , 4 , 6 - tetra - o - acetyl - α / β - d - mannopyranosidetrichloroacetimidate ( 165 . 0 mg , 0 . 34 mmol ) and cis - 1h , 1h , 2h , 2h - perfluorodecyloxybutenyl alcohol ( 140 . 0 mg , 0 . 25 mmol ) in dichloromethane ( 5 ml ) were added powdered 4 å molecular sieves ( 10 mg ) and the mixture was cooled down to 15 ° c . tmsotf ( 40 μl , 0 . 17 mmol ) was added and the reaction mixture was stirred at − 15 ° c . for 30 min . the reaction was quenched with triethylamine ( 0 . 1 ml ) and concentrated . the crude product was purified by solid - phase extraction using a fluorous solid - phase extraction cartridge . non - fluorous compounds were eluted with 80 % meoh / water and the desired product was eluted by 100 % meoh . the solvent was removed under reduced pressure and 1h , 1h , 2h , 2h - perfluorodecyloxybutenyl - 2 , 3 , 4 , 6 tetra - o - acetyl - α - d - mannopyranoside was obtained as a colorless oil ( 207 . 1 mg , 24 . 0 mmol , 93 %). 1 h nmr ( cdcl 3 , 400 mhz ): δ ( ppm ) 5 . 74 - 5 . 69 ( m , 2h ), 5 . 32 ( dd , 1h , j = 10 . 0 , 3 . 2 hz ), 5 . 26 ( t , 1h , j = 9 . 6 hz ), 5 . 21 - 5 . 20 ( m , 1h ), 4 . 83 - 4 . 81 ( m , 1h ), 4 . 26 - 4 . 18 ( m , 3h ), 4 . 10 - 4 . 02 ( m , 5h ), 3 . 99 - 3 . 95 ( m , 1h ), 2 . 14 ( s , 3h ), 2 . 07 ( s , 3h ), 2 . 01 ( s , 3h ), 1 . 97 ( s , 3h ). 13 c nmr ( cdcl 3 , 160 mhz ): δ ( ppm ) 171 . 4 , 170 . 9 , 170 . 2 , 170 . 0 , 129 . 7 , 128 . 9 , 98 . 5 , 71 . 6 , 69 . 3 , 68 . 5 , 66 . 3 , 66 . 2 , 63 . 1 , 62 . 4 , 62 . 0 , 21 . 0 , 20 . 9 ( 2 ), 20 . 8 . 1h , 1h , 2h , 2h - perfluorodecyloxybutanyl - α - d - mannopyranoside . cis - 1h , 1h , 2h , 2hperfluorodecyloxybutenyl - 2 , 3 , 4 , 6 - tetra - o - acetyl - α - d - mannopyranoside ( 184 . 0 mg , 0 . 21 mmol ) was dissolved in meoh ( 5 ml ) and 5 % pd / c ( 10 mg ) was added . the reaction mixture was put under hydrogen atmosphere and stirred for 1 h . it was then filtered over celite and ethanol was removed under reduced pressure to give the hydrogenated product in quantitative yield . to a solution of the resulting compound ( 184 . 0 mg , 21 . 3 mmol ) in methanol ( 10 ml ) was added k 2 co 3 ( 117 . 0 mg , 0 . 85 mmol ) and the reaction mixture was stirred for 2 h . the mixture was then neutralized using amberlyst - 15 ion - exchange resin and filtered . the solvent was removed under reduced pressure and the desired product was obtained as a white solid ( 146 mg , 0 . 21 mmol , 100 %). 1 h nmr ( meod , 400 mhz ): δ ( ppm ) 4 . 71 ( br , 1h ), 3 . 80 ( dd , 1h , j = 12 . 0 , 2 . 4 hz ), 3 . 75 - 3 . 72 ( m , 2h ), 3 . 70 ( d , 1h , j = 5 . 6 hz ), 3 . 67 - 3 . 65 ( m , 1h ), 3 . 62 - 3 . 60 ( m , 2h ), 3 . 58 3 . 53 ( m , 2h ), 3 . 50 - 3 . 47 ( m , 2h ), 3 . 45 - 3 . 40 ( m , 1h ), 2 . 06 - 2 . 01 ( m , 2h ), 1 . 64 - 1 . 58 ( m , 4h ). 13 c nmr ( meod , 160 mhz ): δ ( ppm ) 100 . 2 , 73 . 3 , 71 . 3 , 70 . 9 , 70 . 5 , 67 . 2 , 66 . 9 , 61 . 4 , 61 . 3 , 27 . 4 ( 2 ), 26 . 1 ( 2 ). cis - 1h , 1h , 2h , 2h - perfluorodecyloxybutenyl - 3 , 4 , 6 - tri - o - acetyl - 2 - deoxy - 2acetylamino - β - d - glucopyranoside . to a solution of 3 , 4 , 6 - tri - o - acetyl - 2 - deoxy - 2acetylamino - α / β - d - glucopyranoside trichloroacetimidate ( 148 . 8 mg , 0 . 30 mmol ) and cis - 1h , 1h , 2h , 2h - perfluorodecyloxybutenyl alcohol ( 110 . 0 mg , 0 . 25 mmol ) indichloromethane ( 5 ml ) were added powdered 4 å molecular sieves ( 10 mg ) and the mixture was cooled to − 15 ° c . tmsotf ( 34 μl , 0 . 15 mmol ) was added and the reaction mixture was stirred at − 15 ° c . for 30 min . the reaction was quenched with triethylamine ( 0 . 1 ml ) and concentrated . the crude product was purified by solid - phase extraction using a fluorous solid - phase extraction cartridge . non - fluorous compounds were eluted with 80 % meoh / water and the desired product was eluted by 100 % meoh . the solvent was removed under reduced pressure and the product was obtained as a colorless oil ( 150 . 3 mg , 0 . 17 mmol , 86 %). 1 h nmr ( cdcl 3 , 400 mhz ): δ ( ppm ) 5 . 82 - 5 . 63 ( m , 2h ), 5 . 25 ( dd , 1h , j = 10 . 0 , 9 . 6 hz ), 5 . 03 ( t , 1h , j = 10 . 0 hz ), 4 . 68 ( d , 1h , j = 8 . 4 hz ), 4 . 35 - 4 . 30 ( m , 1h ), 4 . 25 - 4 . 18 ( m , 4h ), 4 . 12 - 4 . 08 ( m , 1h ), 4 . 00 - 3 . 98 ( m , 2h ), 3 . 85 - 3 . 78 ( m , 1h ), 3 . 67 - 3 . 63 ( m , 1h ), 2 . 04 ( s , 3h ), 1 . 99 ( s , 3h ), 1 . 98 ( s , 3h ), 1 . 90 ( s , 3h ). 13 c nmr ( cdcl 3 , 160 mhz ): δ ( ppm ) 170 . 9 , 170 . 7 , 170 . 3 , 169 . 4 , 129 . 3 , 128 . 9 , 99 . 6 , 72 . 3 , 71 . 9 , 68 . 6 , 66 . 4 , 64 . 4 , 62 . 1 , 61 . 9 ( 2 ), 54 . 7 , 23 . 3 , 20 . 7 ( 2 ), 20 . 6 . 1h , 1h , 2h , 2h - perfluorodecyloxybutanyl - 2 - deoxy - 2 - acetylamino - β - dglucopyranoside . cis - 1h , 1h , 2h , 2h - perfluorodecyloxybutenyl - 3 , 4 , 6 - tri - o - acetyl - 2deoxy - 2 - acetylamino - β - d - glucopyranoside ( 138 . 0 mg , 0 . 16 mmol ) was dissolved in meoh ( 5 ml ) and 5 % pd / c ( 10 mg ) was added . the reaction mixture was put under hydrogen atmosphere and stirred for 1 h . it was then filtered over celite and ethanol was removed under reduced pressure to give the hydrogenated product in quantitative yield . to a solution of the resulting compound ( 138 . 0 mg , 0 . 16 mmol ) in methanol ( 10 ml ) was added k 2 co 3 ( 66 . 0 mg , 0 . 48 mmol ) and the reaction mixture was stirred for 2 h . the mixture was then neutralized using amberlyst - 15 ion - exchange resin and filtered . the solvent was removed under reduced pressure and the product was obtained as a white solid ( 118 . 0 mg , 0 . 16 mmol , 100 %). 1 h nmr ( meod , 400 mhz ): δ ( ppm ) 4 . 41 ( d , 1h , j = 8 . 4 hz ), 3 . 89 - 3 . 83 ( m , 2h ), 3 . 84 ( dd , 1h , j = 12 . 4 , 1 . 6 hz ), 3 . 67 - 3 . 63 ( m , 2h ), 3 . 47 - 3 . 38 ( m , 5h ), 3 . 24 - 3 . 21 ( m , 2h ), 2 . 08 - 2 . 01 ( m , 2h ), 1 . 95 ( s , 3h ), 1 . 61 - 1 . 52 ( m , 4h ). 13 c nmr ( meod , 160 mhz ): δ ( ppm ) 172 . 3 , 101 . 4 , 78 . 2 , 77 . 9 , 77 . 6 , 74 . 7 , 70 . 7 , 64 . 2 , 61 . 4 , 56 . 0 , 25 . 9 , 25 . 8 , 21 . 6 ( 2 ). cis - 1h , 1h , 2h , 2h - perfluorodecyloxybutenyl - 2 , 3 , 4 , 6 - tetra - o - acetyl - β - d galactopyranoside . 2 , 3 , 4 , 6 - tetra - o - acetyl - α / β - d - galactopyranoside trichloroacetimidate 8 ( 77 . 0 mg , 0 . 16 mmol ) and cis - 1h , 1h , 2h , 2h perfluorodecyloxybutenyl alcohol ( 69 . 0 mg , 0 . 13 mmol ) were dissolved in dichloromethane ( 2 ml ) and the mixture was cooled to − 15 ° c . tmsotf ( 12 μl , 0 . 065 mmol ) was added and the reaction mixture was stirred at − 15 ° c . for 30 min . the reaction was quenched with triethylamine ( 0 . 1 ml ) and concentrated . the crude product was purified by solid - phase extraction using a fluorous solid - phase extraction cartridge . non fluorous compounds were eluted with 80 % meoh / water and the desired product was eluted by 100 % meoh . the solvent was removed under reduced pressure and the product was obtained as a colorless oil ( 99 mg , 0 . 11 mmol , 90 %). 1 h nmr ( cdcl 3 , 400 mhz ): δ ( ppm ) 5 . 69 - 5 . 74 ( m , 2h ), 5 . 38 ( d , 1h , j = 3 . 3 hz , h - 1 ), 5 . 21 ( dd , 1h , j = 10 . 5 , 2 . 7 hz ), 5 . 01 ( dd , 1h , j = 10 . 5 , 3 . 3 hz ), 4 . 48 ( d , 1h , j = 7 . 8 hz ), 4 . 36 - 4 . 41 ( m , 1h ), 4 . 04 - 4 . 26 ( m , 6h ), 3 . 86 - 3 . 91 ( m , 1h ), 2 . 14 ( s , 3h ), 2 . 04 ( s , 3h ), 2 . 05 ( s , 3h ), 1 . 97 ( s , 3h ). 13 c nmr ( cdcl 3 , 160 mhz ): δ ( ppm ) 170 . 5 , 170 . 4 , 170 . 3 , 169 . 6 , 129 . 4 , 128 . 9 , 100 . 3 , 71 . 1 , 70 . 9 , 68 . 9 , 67 . 2 , 66 . 5 , 64 . 9 , 62 . 1 , 62 . 1 , 61 . 4 , 20 . 9 , 20 . 8 ( 2 ), 20 . 7 . 1h , 1h , 2h , 2h - perfluorodecyloxybutanyl - β - d - galactopyranoside . cis - 1h , 1h , 2h , 2hperfluorodecyloxybutenyl - 2 , 3 , 4 , 6 - tetra - o - acetyl - β - d - galactopyranoside ( 50 mg , 0 . 058 mmol ) was dissolved in ethanol ( 3 ml ) and 5 % pd / c ( 10 mg ) was added . the reaction mixture was put under hydrogen atmosphere and stirred for 1 h . it was then filtered over celite and ethanol was removed under reduced pressure to give the hydrogenated product in quantitative yield . to a solution of the resulting compound ( 45 mg , 0 . 052 mmol ) in methanol ( 3 ml ) was added kco 3 ( 4 mg , 0 . 03 mmol ) and the reaction mixture was stirred for 2 h . the mixture was then neutralized using amberlyst - 15 ion - exchange resin and filtered . the solvent was removed under reduced pressure and the product was obtained as a white solid ( 40 . 0 mg , 0 . 058 mol , 100 %). 1 h nmr ( meod , 400 mhz ): δ ( ppm ) 4 . 17 ( d , 1h , j = 5 . 4 hz ), 3 . 44 - 3 . 91 ( m , 12h ), 2 . 01 ( m , 2h ), 1 . 60 - 1 . 70 ( m , 4h ). 13 c nmr ( meod , 160 mhz ): δ ( ppm ) 103 . 6 , 75 . 2 , 73 . 7 , 71 . 2 , 69 . 2 , 69 . 1 , 68 . 9 , 61 . 4 , 61 . 3 , 28 . 8 ( 2 ), 25 . 9 ( 2 ). allyl - 2 - o - benzyl - 3 , 4 - di - o - carboxybenzyl - α - d - fucopyranoside . allyl - 2 - o - benzyl - αd - fucopyranoside ( 917 mg , 3 . 12 mmol ) was dissolved in methylene chloride ( 15 ml ) and cooled to 0 ° c . tmeda ( 434 mg , 3 . 74 mmol ) and benzylchloroformate ( 1 . 20 g , 6 . 86 mmol ) were added . the reaction mixture was stirred at 0 ° c . for 45 min and quenched with water ( 10 ml ). the organic layer separated and the aqueous layer was extracted with methylene chloride ( 2 × 40 ml ), washed with hcl ( 2n , 20 ml ), brine ( 20 ml ), and dried over mgso 4 . after removal of the solvent under reduced pressure , the crude product was purified by flash column chromatography on silica gel using 25 % etoac / hexane as eluent . the product was obtained as a clear oil ( 1 . 7 g , 3 . 0 mmol , 92 %). 1 h nmr ( cdcl 3 , 400 mhz ): δ ( ppm ) 7 . 25 - 7 . 40 ( m , 15h ), 5 . 88 - 5 . 94 ( m , 1h ), 5 . 15 5 . 36 ( m , 8h ), 4 . 82 ( d , 1h , j = 4 hz , h - 1 ), 4 . 70 ( d , 1h , j = 12 hz ), 4 . 53 ( d , 1h , j = 12 hz ), 4 . 13 - 4 . 17 ( m , 2h ), 3 . 98 ( dd , 1h , j = 12 . 8 , 6 . 4 hz ), 3 . 90 ( dd , 1h , j = 9 . 6 , 3 . 6 hz ), 1 . 17 ( d , 3h , j = 6 . 8 hz ). 13 c nmr ( cdcl 3 , 160 mhz ): δ ( ppm ) 155 . 3 , 154 . 4 , 138 . 2 , 135 . 3 , 135 . 1 , 133 . 7 , 128 . 6 , 128 . 6 , 128 . 5 , 128 . 5 , 128 . 4 , 128 . 1 , 127 . 9 , 127 . 8 , 117 . 9 , 96 . 3 , 75 . 6 , 74 . 3 , 73 . 7 , 73 . 4 , 69 . 9 , 69 . 9 , 68 . 6 , 64 . 3 , 15 . 8 . 2 - o - benzyl - 3 , 4 - di - o - carboxybenzyl - α - d - fucopyranose . palladium chloride ( 685 mg , 3 . 87 mmol ) and sodium acetate ( 635 mg , 7 . 74 mmol ) were dissolved in an acoh / water mixture ( 5 : 1 , 36 ml ). the mixture was heated in commercial microwave oven at 80 ° c . for 5 min . the reaction was then put on an 80 ° c . oil bath and allyl - 2 - o - benzyl - 3 , 4 - di - ocarboxybenzyl - α - d - fucopyranoside ( 1 . 45 g , 2 . 58 mmol ) in acoh was added slowly . the reaction mixture was heated for 5 min and allowed to cool down to ambient temperature . the mixture was poured into water and extracted with ether ( 2 × 60 ml ). the combined organic layer was washed with nahco 3 ( 2 × 40 ml ), water ( 40 ml ), and brine ( 20 ml ) and dried over mgso 4 . the solvent was removed under reduced pressure and the crude product was purified by flash column chromatography on silica gel using 32 % etoac / hexane as eluent . the product was obtained as a mixture of anomers ( 1 . 19 g , 2 . 27 mmol , 88 %). 1 h nmr ( cdcl 3 , 400 mhz ): δ ppm ) 7 . 15 - 7 . 36 ( m , 19h ), 5 . 12 - 5 . 22 ( m , 8h ), 4 . 81 - 4 . 90 ( m , 1h ), 4 . 50 - 4 . 74 ( m , 3h ), 4 . 31 - 4 . 49 ( m , 0 . 5h ), 3 . 82 - 4 . 24 ( m , 3h ), 1 . 21 ( d , 0 . 6h , j = 6 . 4 hz ), 1 . 15 ( t , 3h , j = 6 . 4 hz ). 13 c nmr ( cdcl 3 , 160 mhz ): δ ( ppm ) 137 . 7 , 135 . 2 , 129 . 2 , 129 . 2 , 128 . 7 , 128 . 7 , 128 . 7 , 128 . 7 , 128 . 7 , 128 . 7 , 128 . 6 , 128 . 6 , 128 . 5 , 128 . 5 , 128 . 5 , 128 . 5 , 128 . 4 , 128 . 4 , 128 . 3 , 128 . 3 , 128 . 3 , 128 . 3 , 128 . 2 , 128 . 1 , 128 . 0 , 128 . 0 , 128 . 0 , 97 . 8 , 91 . 8 , 75 . 6 , 75 . 5 , 75 . 5 , 75 . 2 , 74 . 7 , 74 . 5 , 74 . 3 , 74 . 2 , 74 . 1 , 73 . 9 , 73 . 6 , 73 . 6 , 72 . 7 , 70 . 2 , 70 . 2 , 70 . 2 , 70 . 1 , 69 . 1 , 65 . 0 , 64 . 7 , 64 . 6 , 62 . 6 , 43 . 4 , 26 . 8 , 21 . 9 , 16 . 1 , 16 . 0 . 2 - o - benzyl - 3 , 4 - di - o - carboxybenzyl - α / β - d - fucopyranoside trichloroacetimidate . to a solution of 2 - o - benzyl - 3 , 4 - di - o - carboxybenzyl - α / β - d - fucopyranose ( 1 . 17 g , 2 . 24 mmol ) in dichloromethane ( 10 ml ) were added powdered 4 å molecular sieves ( 100 mg ) and trichloroacetonitrile ( 2 . 2 ml , 22 . 4 mmol ). the reaction was stirred for 30 min and cs 2 co 3 ( 802 mg , 2 . 46 mmol ) was added . the reaction mixture was further stirred for 45 min and filtered over celite . the eluent was concentrated and the crude product was purified by flash column chromatography on silica gel using 28 % etoac / hexane as eluent to provide the product as a white solid ( 1 . 43 g , 2 . 1 mmol , 92 %). 1 h nmr ( cdcl 3 , 400 mhz ): δ ( ppm ) 8 . 68 ( s , 1h ), 7 . 19 - 7 . 39 ( m , 15h ), 5 . 78 ( d , 1h , j = 8 . 1 hz ), 5 . 15 - 5 . 29 ( m , 6h ), 4 . 96 ( dd , 1h , j = 9 . 9 , 3 . 3 hz ), 4 . 83 ( d , 1h , j = 11 . 0 hz ), 4 . 67 ( d , 1h , j = 11 . 0 hz ), 3 . 94 - 4 . 00 ( m , 1h ), 1 . 27 ( d , 3h , j = 6 . 3 hz ). 13 c nmr ( cdcl 3 , 160 mhz ): δ ( ppm ) 161 . 3 , 155 . 4 , 154 . 5 , 137 . 9 , 135 . 2 , 135 . 1 , 128 . 8 , 128 . 8 , 128 . 8 , 128 . 81 , 128 . 8 , 128 . 5 , 128 . 5 , 128 . 4 , 127 . 9 , 127 . 9 , 98 . 1 , 77 . 1 , 75 . 6 , 75 . 4 , 74 . 5 , 70 . 4 , 70 . 3 . 69 . 9 , 16 . 2 . cis - 1h , 1h , 2h , 2h - perfluorodecyloxybutenyl - 2 - o - benzyl - 3 , 4 - di - o - carboxybenzyl - αd - fucopyranoside . to a solution of 2 - o - benzyl - 3 , 4 - di - o - carboxybenzyl - α / β - dfucopyranoside trichloroacetimidate ( 185 . 0 mg , 0 . 28 mmol ) and cis - 1h , 1h , 2h , 2hperfluorodecyloxybutenyl alcohol ( 123 . 0 mg , 0 . 23 mmol ) in dichloromethane ( 5 ml ) were added powdered 4 å molecular sieves ( 10 mg ) and the mixture was cooled down to 15 ° c . tmsotf ( 42 μl , 0 . 23 mmol ) was added and the reaction mixture was stirred at − 15 ° c . for 30 min . the reaction was quenched with triethylamine ( 0 . 1 ml ) and concentrated . the crude product was purified by solid - phase extraction using a fluorous solid - phase extraction cartridge . non - fluorous compounds were eluted with 80 % meoh / water and the desired product was eluted by 100 % meoh . the solvent was removed under reduced pressure and the product was obtained as a colorless oil ( 215 mg , 20 . 7 mmol , 90 %). 1 h nmr ( cdcl 3 , 400 mhz ): δ ( ppm ) 7 . 26 - 7 . 36 ( m , 15h ), 5 . 72 - 5 . 84 ( m , 2h ), 5 . 15 - 5 . 23 ( m , 6h ), 4 . 44 - 4 . 81 ( m , 4h ), 4 . 05 - 4 . 23 ( m , 6h ), 3 . 66 - 3 . 78 ( m , 1h ), 1 . 15 - 1 . 27 ( dd , 3h , j = 6 . 4 hz ). 13 c nmr ( cdcl 3 , 160 mhz ): δ ( ppm ) 155 . 3 , 154 . 4 , 138 . 1 , 135 . 2 , 135 . 1 , 128 . 9 , 128 . 7 , 128 . 6 , 128 . 6 , 128 . 6 , 128 . 4 , 128 . 3 , 128 . 3 , 128 . 2 , 128 . 0 , 127 . 8 , 127 . 7 ( 2 ), 96 . 5 , 73 . 3 , 75 . 5 , 74 . 2 , 73 . 6 , 73 . 5 , 70 . 0 , 69 . 9 , 66 . 4 , 64 . 4 , 63 . 2 , 61 . 9 ( 2 ), 26 . 12 ), 15 . 7 . 1h , 1h , 2h , 2h - perfluorodecyloxybutanyl - α - d - fucopyranoside . cis - 1h , 1h , 2h , 2hperfluorodecyloxybutenyl - 2 - o - benzyl - 3 , 4 - di - o - carboxybenzyl - α - d - fucopyranoside ( 81 mg , 0 . 078 mmol ) was dissolved in ethanol ( 3 ml ) and 5 % pd / c ( 20 mg ) was added . the reaction mixture was put under hydrogen atmosphere and stirred overnight . the mixture was then filtered over celite and ethanol was removed under reduced pressure to give the hydrogenated product in quantitative yield ( 81 mg , 0 . 078 mmol , 100 %). 1 h nmr ( meod , 400 mhz ): δ ( ppm ) 4 . 15 - 4 . 31 ( m , 1h ), 3 . 45 - 3 . 98 ( m , 1h ), 1 . 62 - 1 . 68 ( sn , 4h ), 1 . 23 ( dd , 3h , j = 16 . 8 , 6 . 4 hz ). 13 c nmr ( meod , 160 mhz ): δ ( ppm ) 99 . 1 , 72 . 3 , 70 . 6 , 70 . 3 , 68 . 6 , 67 . 4 , 66 . 1 , 64 . 3 ( 2 ), 26 . 1 ( 2 ), 15 . 2 . this study describes the tagging of rabinose , rhamnose , lactose , maltose , and glucosamine with a single c 8 f 17 - tail , incorporation of these tags into expanded carbohydrate microarrays , and screening of this microarray against two lectins to test the scope of a fluorous - based microarray method . to obtain a flexible glucosamine building block , the n - p - nitrobenzyloxycarbonyl - protected glucosamine donor 12 was selected . this donor can be readily obtained , easily deprotected by hydrogenolysis to provide a free amine , and also transformed directly to the desired n - acetamido modified analog in one pot by addition of acetic anhydride during the hydrogenolysis reaction . thus , the glycosylation reaction of 3 , 4 , 6 - tri - o - acetyl - 2 - deoxy - 2 ( p - nitronitrobenzyloxycarbonylamino )- α / β - d - glucopyranosyl trichloroacetimidate ( 12 ) with fluorous alcohol with trimethylsilyl triflate as an activator gave the desired fluorous - tagged compound ( 13 ) in 84 % yield . compound 13 was deacetylated under basic conditions to give compound 14 , which upon hydrogenolysis in methanol provided the 3 -( perfluorooctyl ) propanyloxybutanyl - 2 - deoxy - 2 - amino - β - d - glucopyranoside ( 4 ) in 94 % yield ( scheme 2 ). alternately , the hydrogenolysis of 14 when performed using acetic anhydride in methanol resulted in the formation of 3 -( perfluorooctyl ) propanyloxybutanyl - 2 - deoxy - 2 - acylamino - β - d - glucopyranoside ( 5 ) in 82 % ( scheme 2 ). similarly , the glycosylation reactions of fluorous alcohol 3 were performed with the known tricholoroacetimidate donors of d - mannose 15 [ 19 ], d - galactose 16 [ 20 ], l - arabinose 17 [ 21 ], l - rhamnose 18 [ 22 ], d - lactose 19 [ 23 ], and d - maltose 20 [ 24 ] to provide fluorous - tagged glycosides 21 - 26 . alkene hydrogenation of all the intermediates followed by global deacylation resulted in the formation of the desired compounds 6 - 11 ( scheme 3 ) for formation of microarrays . with the fluorous - tagged carbohydrates in hand , the ability of the single c 8 f 17 tail to anchor these mono - and disaccharides to a glass slide surface even after repeated washes was examined . the fluorous - tagged carbohydrates 4 - 11 were dissolved in 80 % methanol / water and were spotted onto fluoroalkylsilane - derivatized glass slides employing a standard robot used for dna arraying . the slides then were incubated for 30 minutes with the commercially available fitc ( fluorescein isothiocyanate )- labeled lectins from triticum vulgaris ( wheat germ , fitc - wga ) in phosphate buffered saline ( pbs buffer ) ( 0 . 25 m ) and arachis hypogaea ( peanut , fitc - pna ) in pbs buffer ( 0 . 5 m ) and rinsed repeatedly with the assay buffer followed by distilled water . after drying , the slide was scanned with a standard fluorescent slide scanner at 488 nm to reveal the carbohydrate - binding specificities of these two lectins . as expected the wheat germ lectin wga bound only to the fluorous - tagged n - acetylglucosamine ( 5 ). in contrast , the peanut lectin pna bound to both galactose ( 7 ) and lactose ( 10 ) in the array experiment . this lectin is known to bind to galactose both alone and in the context of the lactose disaccharide . this experiment clearly shows that the disaccharide is retained on the fluorous - derivatized glass slides under the conditions required for screening of proteins for their carbohydrate - binding specificities . in conclusion , the new method described herein for the facile fabrication of carbohydrate microarrays by using the noncovalent immobilization of carbohydrates on fluorous derivatized glass slides clearly can be extended beyond monosaccharides . screening of these carbohydrate microarrays against two lectins demonstrates that the noncovalent fluorous - fluorous interaction is sufficient to retain not only mono - but also disaccharides under biological assay conditions . as the fluorous tag also facilitates purification during synthesis , this microarray approach should be particularly valuable for screening of synthetic carbohydrate libraries . dichloromethane was distilled from calcium hydride before use . amberlyst 15 ion - exchange resin was washed repeatedly with methanol before use . all other commercial reagents and solvents were used as received without further purification . the reactions were monitored and the r f values determined using analytical thin layer chromatography ( tic ) with 0 . 25 mm em . science silica gel plates ( 60f - 254 ). the developed tlc plates were visualized by immersion in p - anisaldehyde solution followed by heating on a hot plate . flash chromatography was performed with selecto scientific silica gel , 32 - 63 μm particle size . fluorous phase chromatography was performed using fluorous solid - phase extraction cartridges containing silica gel bonded with perfluorooctylethylsilyl chains ( fluorous technologies , inc . ; pittsburgh , pa .). all other fluorous reagents were also obtained from fluorous technologies , inc . all moisture - sensitive reactions were performed in flame - or oven - dried glassware under a nitrogen atmosphere . bath temperatures were used to record the reaction temperature . all reactions were stirred magnetically at ambient temperature unless otherwise indicated . 1 h nmr , and 13 c nmr spectra were obtained with a bruker drx400 at 400 mhz , 100 mhz , and 162 mhz respectively . 1 h nmr spectra were reported in parts per million ( δ ) relative to cdcl 3 ( 7 . 27 ppm ) and cd 3 od ( 4 . 80 ) as an internal reference . 13 c nmr spectra were reported in parts per million ( δ ) relative to cdcl 3 ( 77 . 23 ppm ) or cd 3 od ( 49 . 15 ppm ). fluorous - tagged carbohydrate compounds were dissolved in 80 % methanol / water ( 2 mm ) and spotted on clean fluorinated glass slides using a robotic spotter ( cartesian pixsys 5500 arrayer , cartesian technologies , inc ., irvine , calif .) at 30 % humidity . the glass slide was dried in a humidifying chamber at 30 % humidity for 2 h . fitc - labeled pna or wga ( ey laboratories , san mateo , calif .) in pbs buffer ( ph = 7 . 3 - 7 . 4 , 2 . 35 mm cacl 2 , 0 . 85 nm mgcl 2 , 114 mm nacl , 4 mm kcl , 1 mm na 2 hpo 4 , 15 mm nahco 3 , 11 . 1 mm glucose ; 0 . 5 m for pna and 0 . 25 m for wga assay ) were used for the detection of protein - carbohydrate interactions . the arrays were incubated with the protein solution ( 0 . 1 ml ) by using a pc500 coverwell incubation chamber ( grace biolabs , bend , oreg .) and gently shaken every 5 min for 30 min . the slides were then washed three times with the incubation buffer followed by three washes with distilled water . the slides were subsequently dried for 30 min in a dark humidity chamber . the glass slides were scanned using a general scanning scanarray 5000 set at 488 nm . to a solution of 3 -( perfluorooctyl ) propanol 1 ( 2 . 0 g , 4 . 2 mmol ) in dichloromethane ( 20 ml ) was added triethylamine ( 1 . 20 ml , 8 . 36 mmol ) and the mixture was cooled to 0 ° c . mesyl chloride ( 0 . 64 ml , 8 . 4 mmol ) was added dropwise over 5 min and the reaction was allowed to warm to ambient temperature over 2 h . the reaction was diluted with dichloromethane ( 100 ml ), washed with water ( 40 ml ), hcl ( 2n , 40 ml ), and brine ( 30 ml ), and dried over mgso 4 . the solvent was removed under reduced pressure to obtain 2 ( 2 . 32 g , 100 %) as a solid . 1 h nmr ( 300 mhz , cdcl 3 ): δ 2 . 05 - 2 . 13 ( m , 2h ), 2 . 20 - 2 . 36 ( m , 2h ), 3 . 04 ( s , 3h ), 4 . 31 ( t , j = 6 hz , 2h ) to a solution of cis - 1 , 4 - butenediol ( 0 . 48 g , 5 . 4 mmol ), 3 -( perfluorooctyl ) propanyl methyl sulfonate ( 2 . 3 g , 4 . 16 mmol ), and tetrabutylammonium bromide ( 0 . 27 g , 0 . 83 mmol ) in dmf ( 20 ml was added powdered koh ( 0 . 47 g , 8 . 32 mmol ). the reaction mixture was heated at 70 ° c . for 1 h and then poured into water ( 20 ml ). the aqueous layer was extracted with ethyl acetate ( 2 × 60 ml ), washed with water ( 30 ml ) and brine ( 30 ml ), and dried over mgso 4 . the solvent was removed under reduced pressure . the crude product was purified by flash column chromatography on silica gel using 27 % etoac / hexane as eluent to obtain 3 ( 1 . 57 g , 70 %) as a yellow oil . 1 h nmr ( 300 mhz , cdcl 3 ): δ 1 . 78 - 1 . 88 ( m , 2h ), 2 . 04 - 2 . 19 ( m , 2h ), 2 . 99 ( s , 1h ), 3 . 45 ( t , j = 6 . 0 hz , 2h ), 4 . 0 ( d , j = 6 . 3 hz , 214 ), 4 . 13 ( d , j = 6 . 3 hz , 2h ), 5 . 57 - 5 . 65 ( m , 1h ), 5 . 70 - 5 . 78 ( m , 1h ). 13 c nmr ( 75 , mhz , cdcl 3 ): δ 20 . 8 , 28 . 0 , 58 . 4 , 66 . 4 , 68 . 9 , 127 . 9 , 132 . 3 . to a solution of 3 , 4 , 6 - tri - o - acetyl - 2 - deoxy - 2 ( p - nitronitrobenzyloxycarbonylamino )- α / β - d - glucopyranosyl trichloroacetimidate ( 12 ) ( 1 . 68 g , 2 . 7 mmol ) and 3 -( perfluorooctyl ) propanyloxybutenyl alcohol ( 3 ) ( 1 . 0 g , 1 . 8 mmol ) in dichloromethane ( 20 ml ) was added tmsotf ( 0 . 16 ml , 0 . 9 mmol ) at − 15 ° c . the reaction mixture was stirred at − 15 ° c . for 30 min . the reaction was quenched with triethylamine ( 0 . 2 ml ) and concentrated . the crude product was purified by solid - phase extraction using a fluorous solid - phase extraction cartridge . nonfluorous compounds were eluted with 80 % meoh / water and the desired product was eluted by 100 % meoh . the solvent was removed under reduced pressure to obtain 13 ( 1 . 53 g , 84 %) as a solid . 1 h nmr ( 300 mhz , cdcl 3 ): δ 1 . 50 - 2 . 40 ( m , 4h ), 1 . 98 , 2 . 02 , 2 . 08 ( 3s , 9h ), 3 . 50 ( t , j = 6 . 0 hz , 2h ), 4 . 00 ( d , 1h , j = 5 . 0 hz , 2h ), 4 . 04 - 4 . 40 ( m , 4h ), 4 . 66 ( s , 1h ), 4 . 94 ( s , 1h ), 5 . 06 ( t , j = 9 . 4 hz , 1h ), 5 . 14 - 5 . 30 ( m , 3h ), 5 . 50 - 5 . 70 ( m , 2h ), 7 . 48 ( d , j = 8 . 3 hz , 2h ), 8 . 20 ( d , j = 8 . 8 hz , 2h ). 13 c nmr ( 75 mhz , cdcl 3 ): δ 20 . 6 , 20 . 7 , 20 . 8 , 20 . 9 , 28 . 0 , 56 . 3 , 62 . 3 , 65 . 4 , 66 . 5 , 68 . 9 , 69 . 0 , 71 . 9 , 72 . 3 , 99 . 7 , 123 . 8 , 128 . 0 , 130 . 5 , 144 . 1 , 147 . 7 , 155 . 6 , 169 . 6 , 170 . 8 . ms ( esi ) m / z 1037 ( m + na ) + . to a solution of 3 -( perfluorooctyl ) propanyloxybutenyl - 3 , 4 , 6 - tri - o - acetyl - 2 - deoxy - 2 ( p - nitrobenzyloxycarbonylamino )- β - d - glucopyranoside ( 13 ) ( 1 . 4 g , 1 . 4 mmol ) in methanol ( 15 ml ) was added naome ( 70 mg ); the reaction mixture was stirred at ambient temperature for 3 h . the reaction was neutralized with amberlyst - 15 ion - exchange resin and filtered . the solvent was removed under reduced pressure to obtain 14 ( 1 . 2 g , 98 %) as a solid . 1 h nmr ( 300 mhz , cd 3 od ): δ 1 . 70 - 1 . 90 ( m , 2h ), 2 . 10 - 2 . 40 ( m , 2h ), 3 . 10 - 3 . 50 ( m , 7h ), 3 . 54 - 3 . 66 ( m , 1h ), 3 . 90 ( d , j = 10 . 4 hz , 1h ), 4 . 06 ( d , j = 5 . 0 hz , 1h ), 4 . 20 - 4 . 50 ( m , 3h ), 5 . 10 - 5 . 40 ( m , 2h ) 5 . 50 - 5 . 80 ( m , 2h ), 7 . 60 ( d , j = 8 . 2 hz , 2h ), 8 . 20 ( d , j = 8 . 5 hz , 2h ). 13 c nmr ( 75 mhz , cdcl 3 ): δ 21 . 0 , 28 . 0 , 58 . 1 , 61 . 9 , 64 . 7 , 65 . 1 , 66 . 7 , 68 . 8 , 71 . 3 , 75 . 1 , 77 . 2 , 101 . 0 , 123 . 6 , 128 . 1 , 128 . 6 , 130 . 0 , 145 . 4 , 147 . 9 , 157 . 7 , 169 . 5 . ms ( esi ) m / z 911 ( m + na ) + . to a solution of 3 -( perfluorooctyl ) propanyloxybutenyl - 2 - deoxy - 2 ( p - nitrobenzyloxycarbonylamino )- β - d - glucopyranoside ( 14 ) ( 60 mg , 0 . 07 mmol ) in methanol ( 2 ml ) was added 5 % pd / c ( 7 mg ). the reaction mixture was stirred at ambient temperature under hydrogen atmosphere for 2 h . the reaction was then filtered over celite and the solvent was removed under reduced pressure to obtain 4 ( 45 mg , 94 %) as a solid . 1 h nmr ( 300 mhz , cd 3 od ): δ 1 . 60 - 1 . 90 ( m , 6h ), 2 . 10 - 2 . 40 ( m , 2h ), 2 . 50 - 2 . 80 ( m , 2h ), 3 . 30 - 3 . 70 ( m , 12h ), 3 . 86 ( d , j = 11 . 4 hz , 1h ), 3 . 92 - 4 . 08 ( m , 1h ), 4 . 34 ( d , j = 8 . 2 hz , 1h ). 13 c nmr ( 100 mhz , cd 3 od ): δ 20 . 7 , 26 . 2 , 26 . 3 , 27 . 7 , 57 . 2 , 61 . 5 , 68 . 8 , 69 . 3 , 70 . 5 , 70 . 6 , 76 . 5 , 76 . 9 , 103 . 5 . ms ( esi ) m / z 734 ( m + na ) + . to a solution of 3 -( perfluorooctyl ) propanyloxybutenyl - 2 - deoxy - 2 ( p - nitrobenzyloxycarbonylamino )- β - d - glucopyranoside ( 14 ) ( 40 mg , 0 . 04 mmol ) in methanol ( 0 . 5 ml ) and acetic anhydride ( 1 . 0 ml ) was added 5 % pd / c ( 4 mg ). the reaction mixture was stirred at ambient temperature under hydrogen atmosphere for 13 h . the reaction mixture was then filtered over celite and the solvent was removed under reduced pressure to obtain 5 ( 28 mg , 82 %) as a solid . 1 h nmr ( 300 mhz , cd 3 od ): δ 1 . 40 - 1 . 74 ( m , 4h ), 1 . 80 - 1 . 90 ( m , 2h ), 1 . 98 ( s , 3h ), 2 . 10 - 2 . 40 ( m , 4h ), 3 . 20 - 3 . 80 ( m , 14h ), 3 . 80 - 4 . 10 ( m , 2h ), 4 . 38 ( d , j = 8 . 4 hz , 1h ). 13 c nmr ( 100 mhz , cd 3 od ): δ 20 . 7 , 21 . 8 , 26 . 0 , 26 . 1 , 26 . 2 , 27 . 7 , 29 . 2 , 56 . 2 , 61 . 6 , 61 . 7 , 68 . 8 , 68 . 9 , 69 . 1 , 70 . 5 , 70 . 6 , 70 . 9 , 74 . 9 , 76 . 8 , 101 . 5 , 172 . 8 . to a solution of 2 - o - acetyl - 3 , 4 , 6 - o - benzyl - α / β - d - mannopyranosyl trichloroacetimidate ( 15 ) ( 0 . 37 g , 0 . 58 mmol ) and 3 -( perfluorooctyl ) propanyloxybutenyl alcohol ( 3 )( 0 . 21 g , 0 . 38 mmol ) in dichloromethane ( 4 ml ) was added tmsotf ( 14 μl , 0 . 077 mmol ) at 5 ° c . the reaction mixture was stirred at 5 ° c . for 30 min . the reaction was quenched with triethylamine ( 0 . 05 ml ) and concentrated . the crude product was purified by solid - phase extraction using a fluorous solid - phase extraction cartridge . nonfluorous compounds were eluted with 80 % meoh / water and the desired product was eluted by 100 % meoh . the solvent was removed under reduced pressure to obtain 21 ( 0 . 36 mg , 92 %) as a viscous yellow oil . 1 h nmr ( 300 mhz , cdcl 3 ): δ 1 . 80 - 1 . 88 ( m , 2h ), 2 . 11 - 2 . 27 ( m , 2h ) ( s , 3h ), 3 . 43 ( t , j = 6 . 0 hz , 2h ), 3 . 75 - 3 . 92 ( m , 4h ), 4 . 01 - 4 . 04 ( m , 3h ), 4 . 07 - 4 . 15 ( m , 1h ), 4 . 19 - 4 . 26 ( m , 1h ), 4 . 45 - 4 . 58 ( m , 31 - 1 ), 4 . 70 ( dd , j = 9 . 9 hz , 12 . 0 hz , 2h ), 4 . 88 ( dd , j = 6 . 6 hz , 8 . 4 hz , 2h ), 5 . 35 - 5 . 41 ( m , 1h ), 5 . 64 - 5 . 77 ( m , 2h ), 7 . 15 - 7 . 36 ( m , 15h ). 13 c nmr ( 75 mhz , cdcl 3 ): δ 20 . 1 , 61 . 7 , 65 . 4 , 67 . 6 , 67 . 7 , 67 . 9 , 70 . 5 , 70 . 7 , 72 . 4 , 73 . 3 , 74 . 2 , 77 . 2 , 95 . 8 , 126 . 6 , 126 . 7 , 126 . 8 , 126 . 8 , 126 . 9 , 126 . 9 , 127 . 0 , 127 . 3 , 127 . 4 , 129 . 3 , 136 . 9 , 137 . 1 , 137 . 2 , 169 . 4 . to a solution of 3 -( perfluorooctyl ) propanyloxybutenyl - 2 - o - acetyl - 3 , 4 , 6 - o - benzyl - α - d - mannopyranoside ( 21 ) ( 0 . 36 g , 0 . 352 mmol ) in methanol ( 4 ml ) was added naome ( 40 mg ) and the reaction mixture was stirred at ambient temperature for 1 h . the reaction was neutralized with amberlyst - 15 ion - exchange resin and filtered . the solvent was removed under reduced pressure to obtain 27 ( 0 . 35 g , 100 %) as a yellow oil . 1 h nmr ( 400 mhz , cdcl 3 ): δ 1 . 78 - 1 . 87 ( m , 2h ), 2 . 08 - 2 . 23 ( m , 2h ), 2 . 53 ( s , 1h ), 3 . 40 ( t , j = 6 . 0 hz , 2h ), 3 . 68 - 3 . 92 ( m , 5h ), 4 . 0 - 4 . 12 ( m , 4h ), 4 . 18 - 4 . 24 ( m , 1h ), 4 . 50 ( d , j = 10 . 8 hz , 1h ), 4 . 53 - 4 . 65 ( m , 2h ), 4 . 68 ( d , j = 2 . 4 hz , 2h ), 4 . 82 ( d , j = 10 . 8 hz , 1h ), 4 . 92 ( d , j = 1 . 6 hz , 1h ), 5 . 60 - 5 . 75 ( m , 2h ), 7 . 15 - 7 . 34 ( m , 15h ). 13 c nmr ( 100 mhz , cdcl 3 ): δ 20 . 8 , 28 . 0 , 62 . 5 , 66 . 4 , 68 . 3 , 68 . 7 , 69 . 0 , 71 . 2 , 72 . 0 , 73 . 5 , 74 . 3 , 75 . 2 , 80 . 2 , 98 . 3 , 127 . 6 , 127 . 7 , 127 . 8 , 128 . 0 , 128 . 1 , 128 . 3 , 128 . 4 , 128 . 6 , 130 . 2 , 137 . 9 , 138 . 2 . to a solution of 3 -( perfluorooctyl ) propanyloxybutenyl - 3 , 4 , 6 - o - benzyl - α - d - mannopyranoside ( 27 ) ( 60 mg , 0 . 061 mmol ) in methanol ( 3 ml ) was added 10 % pd / c ( 20 mg ). the reaction mixture was stirred at ambient temperature under hydrogen atmosphere for 12 h . the reaction mixture was then filtered over celite and the solvent was removed under reduced pressure to obtain 6 ( 44 mg , 100 %) as a solid . 1 h nmr ( 400 mhz , cd 3 od ): δ 1 . 60 - 1 . 69 ( m , 4h ), 1 . 80 - 1 . 89 ( m , 2h ), 2 . 18 - 2 . 33 ( m , 2h ), 3 . 40 - 3 . 88 ( m , 12h ), 4 . 74 ( m , 1h ). 13 c nmr ( 100 mhz , cd 3 od ) δ 20 . 8 , 26 . 2 , 26 . 4 , 27 . 6 , 61 . 6 , 67 . 1 , 67 . 4 , 68 . 8 , 70 . 5 , 71 . 1 , 71 . 4 , 73 . 5 , 101 . 2 . to a solution of 2 , 3 , 4 , 6 - tetra - o - acetyl - α / β - d - galactopyranosyl trichloroacetimidate ( 16 ) ( 100 mg , 0 . 20 mmol ) and 3 -( perfluorooctyl ) propanyloxybutenyl alcohol ( 3 ) ( 75 mg , 0 . 14 mmol ) in dichloromethane ( 3 ml ) was added tmsotf ( 5 μl , 0 . 027 mmol ) at − 15 ° c . the reaction mixture was stirred at − 15 ° c . for 30 min . the reaction was quenched with triethylamine ( 0 . 05 ml ) and concentrated . the crude product was purified by solid - phase extraction using a fluorous solid - phase extraction cartridge . nonfluorous compounds were eluted with 80 % meoh / water and the desired product was eluted by 100 % meoh . the solvent was removed under reduced pressure to obtain 22 ( 97 mg , 80 %) as a syrup . 1 h nmr ( 400 mhz , cdcl 3 ,): δ 1 . 82 - 1 . 89 ( m , 2h ), 1 . 95 , 2 . 02 , 2 . 03 ( 3s , 9h ), 2 . 08 - 2 . 24 ( m , 2h ) ( s , 3h ), 3 . 46 ( t , j = 6 . 0 hz , 2h ), 3 . 86 ( t , j = 5 . 2 hz , 1h ), 4 . 01 ( t , j = 5 . 2 hz , 1h ), 4 . 10 - 4 . 23 ( m , 4h ), 4 . 34 ( dd , j = 5 . 6 , 10 . 0 hz , 1h ), 4 . 75 ( d , j = 8 hz , 1h ), 4 . 99 ( dd , j = 3 . 6 , 10 . 4 hz , 1h ), 5 . 19 ( dd , j = 8 . 0 , 10 . 4 hz , 1h ), 5 . 36 ( d , j = 3 . 6 hz , 1h ), 5 . 60 - 5 . 76 ( m , 2h ). 13 c nmr ( 100 mhz , cdcl 3 ): δ 20 . 5 , 20 . 6 , 20 . 7 , 20 . 8 , 20 . 9 , 61 . 2 , 64 . 7 , 66 . 5 , 67 . 0 , 68 . 7 , 68 . 8 , 70 . 7 , 70 . 9 , 76 . 7 , 100 . 1 , 127 . 8 , 130 . 2 , 169 . 4 , 170 . 1 , 170 . 2 , 170 . 3 . to a solution of 3 -( perfluorooctyl ) propanyloxybutenyl - 2 , 3 , 4 , 6 - tetra - o - acetyl - β - d - galactopyranoside ( 22 ) ( 97 mg , 0 . 110 mmol ) in methanol ( 3 ml ) was added 5 % pd / c ( 25 mg ). the reaction mixture was stirred at ambient temperature under hydrogen atmosphere for 2 h . the reaction mixture was then filtered over celite and the solvent was removed under reduced pressure . the product was used directly in the next step . to a solution of 3 -( perfluorooctyl ) propanyloxybutanyl - 2 , 3 , 4 , 6 - tetra - o - acetyl - β - d - galactopyranoside ( 97 mg , 0 . 110 mmol ) in methanol ( 3 ml ) was added naome ( 15 mg ) and the reaction mixture was stirred at ambient temperature for 2 h . the reaction was neutralized with amberlyst - 15 ion - exchange resin and filtered . the solvent was removed under reduced pressure to obtain 7 ( 75 mg , 98 %) as a solid . 1 h nmr ( 300 mhz , cd 3 od ): δ 1 . 62 - 1 . 71 ( m , 4h ), 1 . 79 - 1 . 87 ( m , 2h ), 2 . 11 - 2 . 36 ( m , 2h ), 3 . 22 - 3 . 34 ( m , 1h ), 3 . 41 - 3 . 63 ( m , 6h ), 3 . 70 - 3 . 74 ( m , 3h ), 3 . 81 - 3 . 99 ( m , 2h ), 4 . 20 ( d , j = 6 . 9 hz , 1h ). 13 c nmr ( 75 mhz , cd 3 od ): δ 26 . 1 , 26 . 2 , 26 . 3 , 53 . 3 , 61 . 9 , 69 . 2 , 69 . 3 , 69 . 4 , 71 . 1 , 72 . 6 , 74 . 1 , 76 . 2 , 114 . 4 . to a solution of 2 , 3 , 4 - tri - o - acetyl - α / β - l - arabinosyl tricholoroacetimidate ( 17 ) ( 0 . 27 g , 0 . 64 mmol ) and 3 -( perfluorooctyl ) propanyloxybutenyl alcohol ( 3 )( 0 . 15 g , 0 . 28 mmol ) in dry dichloromethane ( 5 ml ) was added tmsotf ( 0 . 025 ml , 0 . 14 mmol ) at ambient temperature . the reaction mixture was stirred at ambient temperature for 15 min . the reaction was quenched with triethylamine ( 0 . 5 ml ) and concentrated . the crude product was purified by solid phase extraction using a fluorous solid - phase extraction cartridge . nonfluorous compounds were eluted with 50 % meoh / water and the desired product was eluted by 100 % meoh . the solvent was removed under reduced pressure to obtain 23 ( 0 . 2 g , 89 %) as a solid . 1 h nmr ( 300 mhz , cdcl 3 ): δ 1 . 80 - 1 . 95 ( m , 2h ), 2 . 0 - 2 . 3 ( m , 2h ), 2 . 00 , 2 . 02 , 2 . 11 ( 3s , 9h ), 3 . 46 ( t , j = 6 . 0 hz , 2h ), 3 . 61 ( d , j = 1 . 9 hz , 1h ), 3 . 97 - 4 . 03 ( m , 3h ), 4 . 20 ( dd , j = 6 . 3 , 12 . 6 hz 1h ), 4 . 36 ( dd , j = 5 . 7 , 12 . 6 hz , 1h ), 4 . 41 ( d , j = 6 . 9 hz , 1h ), 5 . 02 ( dd , j = 3 . 6 , 9 . 3 hz , 1h ), 5 . 13 ( dd , j = 4 . 2 , 6 . 6 hz , 1h ), 5 . 23 ( m , 1h ), 5 . 60 - 5 . 75 ( m , 2h ). 13 c nmr ( 75 mhz , cdcl 3 ): δ 20 . 9 , 21 . 0 , 21 . 1 , 19 . 9 , 61 . 6 , 64 . 7 , 66 . 7 , 67 . 8 , 69 . 0 , 69 . 3 , 70 . 3 , 91 , 92 , 100 . 0 , 128 . 2 , 130 . 1 , 169 . 7 , 170 . 4 , 170 . 6 . to a solution of 3 -( perfluorooctyl ) propanyloxybutenyl - 2 , 3 , 4 - tri - o - acetyl - α - l - arabinopyranoside ( 23 ) ( 0 . 1 g , 0 . 12 mmol ) in methanol ( 10 ml ) was added 5 % pd / c ( 0 . 25 g ). the reaction mixture was stirred at ambient temperature under hydrogen atmosphere for 2 h . the reaction mixture was then filtered over celite and partially concentrated under reduced pressure . to this solution , k 2 co 3 ( 67 mg ) was added and the mixture was stirred at ambient temperature for 3 h . the reaction mixture was neutralized with amberlyst - 15 ion - exchange resin and filtered over celite . the solvent was removed under reduced pressure to obtain 8 ( 68 mg , 80 %) as a solid . 1 h nmr ( 300 mhz , cd 3 od ): δ 1 . 80 - 1 . 95 ( m , 2h ), 2 . 1 - 2 . 3 ( m , 2h ), 3 . 4 - 3 . 9 ( m , 14h ), 4 . 17 ( d , j = 4 . 8 hz , 1h ). 13 c nmr ( 75 mhz , cd 3 od ): δ 13 . 2 , 19 . 6 , 20 . 6 , 21 . 5 , 48 . 8 , 56 . 7 , 60 . 3 , 66 . 7 , 67 . 8 , 69 . 0 , 69 . 3 , 102 . 8 . ms ( esi ) m / z 682 , m + h ) + . to a solution of 2 , 3 , 4 - tri - o - acetyl - α / β - l - rhamnopyranosyl tricholoroacetimidate ( 18 ) ( 0 . 2 g , 0 . 46 mmol ) and 3 -( perfluorooctyl ) propanyloxybutenyl alcohol ( 3 ) ( 0 . 13 g , 0 . 23 mmol ) in dry dichloromethane ( 5 ml ) was added tmsotf ( 0 . 02 ml , 0 . 11 mmol ) at ambient temperature . the reaction mixture was stirred for 15 min . the reaction was quenched with triethylamine ( 0 . 5 ml ) and concentrated under reduced pressure . the crude product was purified by solid phase extraction using a fluorous solid - phase extraction cartridge . nonfluorous compounds were eluted with 50 % meoh / water and the desired product was eluted by 100 % meoh . the solvent was removed under reduced pressure to obtain 24 ( 0 . 15 g , 76 %) as a solid . 1 h nmr ( 300 mhz , cdcl 3 ): δ 1 . 24 ( d , j = 6 . 3 , 3h ), 1 . 80 - 1 . 95 ( m , 2h ), 2 . 0 - 2 . 3 ( m , 2h ), 1 . 98 , 2 . 04 , 2 . 14 ( 3s , 9h ), 3 . 46 ( t , j = 6 . 0 hz , 2h ), 3 . 9 ( m , 1h ), 4 . 05 ( d , j = 5 . 1 hz , 2h ), 4 . 06 ( d , j = 6 . 9 hz , 1h ), 4 . 15 ( dd , j = 4 . 9 , 11 . 7 hz , 1h ), 4 . 74 ( d , j = 3 . 0 hz , 1h ), 5 . 06 ( t , j = 9 . 9 hz , 1h ), 5 . 21 ( m , 1h ), 5 . 28 ( dd , j = 0 . 2 , 3 . 6 hz , 0 . 2 1h ), 5 . 65 - 5 . 8 ( m , 2h ). 13 c nmr ( 75 mhz , cdcl 3 ): δ 17 . 6 , 20 . 9 , 21 , 21 . 01 , 21 . 1 , 63 . 3 , 66 . 6 , 66 . 7 , 69 . 3 , 69 . 5 , 70 . 5 , 71 . 2 , 97 , 128 , 130 . 5 , 170 . 2 , 170 . 4 . to a solution of 3 -( perfluorooctyl ) propanyloxybutenyl - 2 , 3 , 4 - tri - o - acetyl - α - l - rhamnopyranoside ( 24 ) ( 0 . 1 g , 0 . 12 mmol ) in methanol ( 5 ml ) was added 5 % pd / c ( 250 mg ). the reaction mixture was stirred at ambient temperature under hydrogen atmosphere for 2 h . it was then filtered over celite and partially concentrated . to the solution , k 2 co 3 ( 66 mg ) was added and the mixture was stirred at ambient temperature for 3 h . the reaction mixture was neutralized with amberlyst - 15 - ion - exchange resin and filtered over celite . the solvent was removed under reduced pressure to obtain 9 ( 70 mg , 82 %) as a solid . 1 h nmr ( 300 mhz , cd 3 od ): δ 1 . 20 ( d , j = 6 . 3 hz , 3h ), 1 . 80 - 1 . 95 ( m , 2h ), 2 . 1 - 2 . 3 ( m , 2h ), 2 . 9 ( d , j = 4 . 8 hz , 1h ), 3 . 0 ( d , j = 7 . 2 , 1h ), 3 . 30 - 3 . 70 ( m , 11h ), 3 . 75 ( m , 1h ), 4 . 65 ( m , 1h ). 13 c nmr ( 75 mhz , cd 3 od ): δ 16 . 7 , 26 . 2 , 26 . 4 , 67 . 2 , 68 . 6 , 68 . 9 , 70 . 5 , 71 . 1 , 71 . 2 , 72 . 7 , 100 . 4 ; ms ( esi ) m / z 696 ( m + h ) + . to a solution of 4 - o -( 2 , 3 , 4 , 6 - tetra - o - acetyl - β - d - galactopyranosyl )- 2 , 3 , 6 - tri - o - acetyl - β - d - glucopyranosyl trichloroacetimidate ( 19 ) ( 0 . 17 g , 0 . 22 mmol ) and 3 -( perfluorooctyl ) propanyloxybutenyl alcohol ( 3 ) ( 0 . 1 g , 0 . 17 mmol ) in dichloromethane ( 5 ml ) was added tmsotf ( 0 . 16 ml , 0 . 9 mmol ) at − 15 ° c . the reaction mixture was stirred at − 15 ° c . for 30 min . the reaction was quenched with triethylamine ( 0 . 2 ml ) and concentrated . the crude product was purified by solid - phase extraction using a fluorous solid - phase extraction cartridge . nonfluorous compounds were eluted with 80 % meoh / water and the desired product was eluted by 100 % meoh . the solvent was removed under reduced pressure to obtain 25 ( 0 . 12 g , 52 %) as a solid . 1 h nmr ( 400 mhz , cdcl 3 ): δ 1 . 80 - 1 . 90 ( m , 2h ), 1 . 93 , 1 . 98 , 2 . 00 , 2 . 02 , 2 . 08 , 2 . 11 ( 7s , 21h ), 1 . 90 - 2 . 30 ( m , 2h ), 3 . 44 ( t , j = 6 . 0 hz , 2h ), 3 . 52 - 3 . 60 ( m , 1h ), 3 . 76 ( t , 1h , j = 9 . 2 hz , 1h ), 3 . 83 ( t , j = 6 . 8 hz , 1h ), 3 . 94 - 4 . 20 ( m , 6h ), 4 . 30 ( dd , j = 5 . 6 , 12 . 8 hz , 1h ), 4 . 42 - 4 . 52 ( m , 3h ), 4 . 85 , 4 . 87 ( 2d , j = 8 . 0 hz , 1h ), 4 . 92 ( dd , j = 3 . 2 , 10 . 4 hz , 1h ), 5 . 06 , 5 . 08 ( 2d , j = 8 . 0 hz , 1h ), 5 . 15 ( t , j = 9 . 2 hz , 1h ), 5 . 30 ( d , j = 2 . 8 hz , 1h ), 5 . 56 - 5 . 78 ( m , 2h ). 13 c nmr ( 100 mhz , cdcl 3 ): δ 20 . 2 , 20 . 3 , 20 . 4 , 20 . 5 , 20 . 6 , 20 . 7 , 20 . 8 , 27 . 9 , 60 . 8 , 61 . 9 , 64 . 8 , 66 . 5 , 66 . 5 , 69 . 1 , 70 . 6 , 71 . 0 , 71 . 6 , 72 . 7 , 72 . 8 , 76 . 2 , 76 . 7 , 99 . 3 , 101 . 1 , 127 . 8 , 130 . 3 , 169 . 1 , 169 . 6 , 169 . 8 , 170 . 1 , 170 . 18 , 170 . 3 , 170 . 4 . to a solution of 3 -( perfluorooctyl ) propanyloxybutenyl - 4 - o -( 2 , 3 , 4 , 6 - tetra - o - acetyl )- β - d - galactopyranosyl )- 2 , 3 , 6 - tri - o - acetyl - β - d - glucopyranoside ( 25 ) ( 0 . 1 g , 0 . 1 mmol ) in methanol ( 5 ml ) was added 5 % pd / c ( 250 mg ). the reaction mixture was stirred at ambient temperature under hydrogen atmosphere for 2 h . the reaction mixture was then filtered over celite and partially concentrated under reduced pressure . to this solution , k 2 co 3 ( 66 mg ) was added and the mixture was stirred at ambient temperature for 3 h . the reaction mixture was neutralized with amberlyst - 15 ion - exchange resin and filtered over celite . the solvent was removed under reduced pressure to obtain 10 ( 75 mg , 99 %) as a solid . 1 h nmr ( 400 mhz , cdcl 3 ): δ 1 . 50 - 1 . 70 ( m , 4h ), 1 . 80 - 1 . 90 ( m , 2h ), 2 . 10 - 2 . 40 ( m , 2h ), 3 . 10 - 4 . 00 ( m , 20h ), 4 . 26 ( d , j = 8 . 0 hz , 1h ), 4 . 33 ( d , j = 7 . 2 hz , 1h ). 13 c nmr ( 100 mhz , cdcl 3 ): δ 25 . 9 , 26 . 1 , 27 . 4 , 60 . 6 , 61 . 1 , 68 . 6 , 68 . 9 , 69 . 2 , 70 . 3 , 71 . 1 , 73 . 4 , 73 . 5 , 75 . 0 , 75 . 1 , 75 . 7 , 102 . 8 , 103 . 7 . to a solution of 4 - o -( 2 , 3 , 4 , 6 - tetra - o - acetyl - x - d - glucopyranosyl )- 2 , 3 , 6 - tri - o - acetyl - α - d - glucopyranosyl trichloroacetimidate ( 20 ) ( 0 . 16 g , 0 . 18 mmol ) and 3 -( perfluorooctyl ) propanyloxybutenyl alcohol ( 3 )( 1 . 0 g , 1 . 8 mmol ) in dichloromethane ( 20 ml ) was added tmsotf ( 0 . 13 ml , 0 . 15 mmol ) at − 15 ° c . the reaction mixture was stirred at − 15 ° c . for 30 min . the reaction was quenched with triethylamine ( 0 . 2 ml ) and concentrated under reduced pressure . the crude product was purified by solid - phase extraction using a fluorous solid - phase extraction cartridge . nonfluorous compounds were eluted with 80 % meoh / water and the desired product was eluted by 100 % meoh . the solvent was removed under reduced pressure to obtain 26 ( 0 . 12 g , 54 %) as a solid . 1 h nmr ( 400 mhz , cdcl 3 ): δ 1 . 80 - 1 . 90 ( m , 2h ), 1 . 96 , 1 . 97 , 1 . 98 , 1 . 99 , 2 . 00 , 2 . 06 , 2 . 10 ( 7s , 21h ), 1 . 94 - 2 . 40 ( m , 2h ), 3 . 45 ( t , j = 6 . 0 hz , 2h ), 3 . 60 - 3 . 70 ( m , 1h ), 3 . 84 - 34 . 08 ( m , 5h ), 4 . 10 - 4 . 26 ( m , 3h ), 4 . 30 ( dd , j = 5 . 6 , 12 . 8 hz , 1h ), 4 . 46 ( dd , j = 2 . 4 , 12 . 0 hz , 1h ), 4 . 52 ( d , j = 8 . 0 hz , 1h ), 4 . 74 - 4 . 86 ( m , 2h ), 5 . 02 ( t , j = 10 . 0 hz , 1h ), 5 . 20 ( t , j = 9 . 2 hz , 1h ), 5 . 38 ( d , j = 4 . 0 hz , 1h ), 5 . 40 - 5 . 80 ( m , 2h ). 13 c nmr ( 100 mhz , cdcl 3 ): δ 20 . 2 , 20 . 3 , 20 . 4 , 20 . 5 , 20 . 6 , 20 . 7 , 20 . 8 , 20 . 9 , 27 . 7 , 27 . 9 , 61 . 5 , 62 . 7 , 64 . 7 , 66 . 5 , 68 . 0 , 68 . 5 , 68 . 8 , 69 . 3 , 70 . 0 , 72 . 0 , 72 . 1 , 72 . 2 , 72 . 6 , 75 . 4 , 76 . 7 , 95 . 5 , 99 . 0 , 127 . 6 , 130 . 4 , 169 . 4 , 169 . 6 , 169 . 9 , 170 . 2 , 170 . 4 , 170 . 5 . to a solution of 3 -( perfluorooctyl ) propanyloxybutenyl - 4 - o -( 2 , 3 , 4 , 6 - tetra - o - acetyl )- α - d - glucopyranosyl )- 2 , 3 , 6 - tri - o - acetyl - β - d - glucopyranoside ( 26 ) ( 0 . 12 g , 0 . 1 mmol ) in methanol ( 5 ml ) was added 5 % pd / c ( 0 . 25 g ). the reaction mixture was stirred at ambient temperature under hydrogen atmosphere for 2 h . the reaction mixture was then filtered over celite and partially concentrated under reduced pressure . to this solution , k 2 co 3 ( 66 mg ) was added and the mixture was stirred at ambient temperature for 3 h . the reaction mixture was neutralized with amberlyst - 15 - ion - exchange resin and filtered over celite . the solvent was removed under reduced pressure to obtain 11 ( 90 mg , 98 %) as a solid . 1 h nmr ( 400 mhz , cdcl 3 ): δ 1 . 52 - 1 . 70 ( m , 4h ), 1 . 74 - 1 . 90 ( m , 2h ), 2 . 10 - 2 . 40 ( m , 2h ), 3 . 10 - 3 . 38 ( m , 4h ), 3 . 40 - 3 . 70 ( m , 121 - 1 ), 3 . 72 - 4 . 00 ( m , 4h ), 4 . 24 ( d , j = 8 . 0 hz , 1h ), 5 . 12 ( d , j = 3 . 2 hz , 1h ). 13 c nmr ( 100 mhz , cdcl 3 ): δ 20 . 4 , 25 . 9 , 26 . 1 , 27 . 4 , 27 . 6 , 60 . 8 , 61 . 3 , 68 . 6 , 69 . 2 , 70 . 1 , 70 . 3 , 72 . 7 , 73 . 3 , 73 . 4 , 75 . 2 , 76 . 4 , 79 . 9 , 101 . 5 , 102 . 9 . for the above - stated reasons , it is submitted that the present invention accomplishes at least all of its stated objectives . having described the invention with reference to particular compositions and methods , theories of effectiveness , and the like , it will be apparent to those of skill in the art that it is not intended that the invention be limited by such illustrative embodiments or mechanisms , and that modifications can be made without departing from the scope or spirit of the invention , as defined by the appended claims . it is intended that all such obvious modifications and variations be included within the scope of the present invention as defined in the appended claims . the claims are meant to cover the claimed components and steps in any sequence which is effective to meet the objectives there intended .	6
fig3 a and 3b illustrate the basic concept of an ampoule as used in connection with the present invention . a cylindrical ampoule 10 , which is preferably made of quartz , is illustrated as surrounding a cylindrical rod 14 , which may be composed of a polycrystalline mixture of gaas . three or more centering rods , struts or weave 12 are positioned between the interior surface of ampoule 10 and the radially outward surface of rod 14 . the present invention will discuss the utilization of three centering rods . however , this is considered a minimum and more centering rods , spaced from one another even to the extent of a weave , may be employed . as will be seen from fig3 a , annular space 13 is provided between the ampoule 10 and the gaas due to the spacing effect of the centering rods so that a vapor passage becomes created through the annular space 13 . as will be explained in greater detail hereinafter , this vapor passage is employed for the diffusion of arsenic gas ( dopant ) into the gaas ingot 14 when the polycrystalline gaas ingot 14 is in a melt condition , as was previously explained in connection with the bridgman method ( fig1 a ). the centering rods 12 provide support for the ingot 14 when the entire configuration is launched into space and likewise provides support for a transformed ingot ( polycrystalline - single crystal ) upon landing back on earth . the annular space 13 which provides a vapor passage can be used to maintain proper dopant vapor pressure to assure proper stoichiometry of a processed material . these passages also provide room for the crystalline material to expand if it is of a type that increases in volume upon solidification . when the ingot 14 is melted in a micro - gravity environment , surface tension will urge the melted crystalline material to assume a spherical shape . however , the rods 12 will constrain the melt and keep it in a nearly cylindrical shape . the amount of surface contact between the melt and the ampoule 10 is limited to one line contact per rod thereby minimizing the surface area available for contamination by diffusion from the ampoule . thus , the present invention provides dimensional control of a finished single crystal ingot and avoids the other disadvantages associated with stoichiometry , stresses and contamination discussed in connection with the prior art . it is also possible to process the material by the zone refinement technique . the solid ingot 14 is contained within the centering rods and only a small section is melted . the melted portion may contract and shrink away from the rods further minimizing contact . the melted portion is supported front and back by adhesion to the remaining solid portions of the ingot . this melted zone may then be allowed to progress axially through the material until a finished ingot is produced . fig4 a illustrates an ampoule assembly 16 axially disposed along the interior of an available furnace 18 which is capable of establishing different temperature zones along the furnace length . a quartz cylindrical ampoule 10a forms an outer housing for the ampoule assembly 16 and has its ends closed by closures 20 and 22 after the internal components to be discussed have been inserted therein . as illustrated in fig4 a , a solid dopant 24 is contained within ampoule 10a and the right - illustrated end of the solid dopant is contained by a cup - shaped mesh retainer 26 . a central cavity 30 exists in the interior of the ampoule 10a and to the right end of this cavity is a conically shaped mesh retainer 28 . the purpose of mesh retainers 26 and 28 is to permit the diffusion of dopant gas across the central chamber 30 to be mixed with the solid crystalline ingot 14a located to the right of mesh retainer 28 . the diffusion of dopant into the crystalline material is therefore similar to the previously discussed bridgman method of fig1 a . as in that method , a seed 34 is positioned adjacent a tapered end 40 of crystalline ingot 14a . however , instead of using the boats of the bridgman method , the system indicated in fig4 a utilizes centering rods 12a , which are linearly deformed to follow the surface of seed 34 and tapered end 40 of crystalline rod 14a . only one centering rod 12a is shown in fig4 a in order to add clarity to the figure . however , in reality , there are a minimum of three such centering rods , as shown in fig6 and 7 . referring to these latter - mentioned figures , each centering rod 12a is seen to include an elongated section which is positioned in parallel spaced relationship to the axis of ampoule 10a . the elongated section 44 of rod 12a tapers down along section 46 to contact mating tapered end 40 of crystalline ingot 14a . each centering rod then continues along a central section 48 which supports seed 34 and a final left end tapered section 50 of each centering rod contacts a confronting surface of mesh retainer 28 . the outward ends 52 of each centering rod section 50 contact the inner surface 54 of ampoule 10a . as indicated in fig4 a , the central cavity 30 permits vapor from solid dopant 24 to diffuse across both mesh retainers 26 and 28 , then space 13a , filling the cavity surrounding the material being processed ( 14a ). as indicated by the temperature profile of fig4 b , the solid dopant 24 is maintained at a constant temperature that yields a desired vapor pressure in cavity 30 . as in the case of the simplified explanation given in connection with fig1 a and 1b , an annular space is provided around the solid ingot 14a to permit the passage of vapor around the circumference of the ingot . with the temperature profile illustrated in fig4 b , the right end of ingot 14a transforms to the liquid state and allows diffusion with the dopant gas . this gradient is moved until the entire crystalline ingot 14a becomes melted . then , as in the previously discussed bridgman method , the melted ingot is cooled in an axial direction and the seed 34 causes transformation of the melted ingot 14 into a single crystal ingot . however , as previously explained in connection with fig1 a and 1b , when the ingot is melted in a micro - gravity environment , surface tension of the melted crystalline material would cause the material to assume a spherical shape without the centering rods . however , by including the centering rods 12a of the present invention , the melted ingot is constrained and kept in a nearly cylindrical shape under the influence of surface tension . the amount of surface contact between the melt of the ingot and the ampoule 10a is limited to one line contact per rod , thereby minimizing the surface area available for contamination by diffusion from the ampoule . it should be noted that tapering of centering rods 12a to conform to the surface of ingot 14a is useful for supporting the seed 34 and ingot 14a during launch and landing in a space craft . this taper may be eliminated if the ingot is inserted and removed in a microgravity environment and also if there is no seed required or if the gradual buildup in ingot diameter during growth is not required . fig5 is an alternate embodiment of the invention . this eliminates the need for tapered ends 50 on rods 12b . corresponding numerals are used for corresponding parts of fig5 and 4a . the figure indicates the use of centering rods 12b in a sealed ampoule zone wherein no dopant zone is included . accordingly , the configuration shown in fig5 is similar to the ampoule configuration in the furnace zone of fig4 a , with the exception that the mesh retainer 28 is replaced with a solid retainer 56 which also serves as a sealing closure for the ampoule 10b . the embodiment of fig5 requires a shortened ampoule 10b and this embodiment is useful where there is no requirement for diffusion of a dopant in the environment of a carefully controlled vapor pressure . thus , the transformation of ingot 14b will occur from polycrystalline to single crystal with the dopant included in the solid mixture of the ingot . this ampoule configuration would not be appropriate for gaas since the pressure - temperature relationship of the two materials are incompatible . however , the ampoule configuration would be quite useful for other materials . it should be understood that the invention is not limited to the exact details of construction shown and described herein for obvious modifications will occur to persons skilled in the art .	8
with reference now to fig2 in accordance with one embodiment of the present disclosure , a psel unit 50 and a csel unit 52 are provided for performing procedures or functionalities currently performed by a sel ( selector ) unit of a cdma system . in accordance with the present disclosure , the functionalities of the sel are been divided into first and second parts , respectively . in the first part , a first unit ( or units ) carries out the selection of frames and power control ( psel ) 50 . in the second part , a second unit ( or units ) carries out the call processing management ( csel ) 52 . in this embodiment , the psel unit 50 or equipment for performing the selection of frames and power control is physically placed proximate , within a prescribed close distance , to the location of a respective bts 16 . on the other hand , the csel unit 50 or equipment for performing call processing management is placed proximate , within a prescribed close distance , to respective dsp equipment . the dsp equipment may reside within the csel unit or outside a respective csel unit . psel 50 can also be structured at multiple levels , for example , including first level psel units 50 a and a second level psel unit 50 b operatively coupled to the first level psel units 50 a as shown in fig2 . the multiple level psel further includes providing a bypass for already selected frames , for example , for bypassing the second level psel 50 b when a first level psel 50 a has selected given compressed packets or frames for transmission via the router to the csel 52 . that is , the architecture 60 allows the psel 50 to transmit the selected compressed packets ( after psel selection ) from the psel site to the csel site . this will minimize a transport bandwidth required between the psel 50 and csel 52 . the psel 50 is not restricted to a ( 1 ) carrier type , ( 2 ) frequency band , or ( 3 ) transport type . fig2 is thus an illustration of one embodiment of a msc - cdma architecture 60 according to the present disclosure , the architecture 60 including a switch or msc 62 multi - level distributed frame - selection and power control . fig2 further illustrates the usage of t1 links 64 and / or satellite links 66 with the msc - cdma multi - level distributed frame selection and power control architecture 60 of the present disclosure . the present embodiments further include a method of forming a multi - level distributed frame - selection and power control cdma architecture . a first part of the method performs method selection of frames and power control using a psel 50 . a second part performs call processing management using csel 52 . for implementing this method , the psel unit 50 is placed as close as possible to a respective bts 16 ; whereas a csel unit 52 is placed in close proximity to vocoder digital signal processor ( dsp ) units which are used for compression / decompression of data packets for a given phone call . in further discussion of the above , the psel 50 performs frame selection , frame multicast , power control , packing and unpacking ( certain type ) voice and signaling traffic in one frame , soft handoff between btss , softer handoff between sectors within a cell , involved in hard handoff , handoff between psel layers ( 50 b , 50 a ), bypass of selected frames , etc ., mainly relating to the selection of frames and power control . the csel 52 , on the other hand , performs call setup , call release , vocoder switching , frame sequencing , timing and synchronization managements between csel and vocoder ( dsp ), acting as a health monitor for psel , logging and diagnosis , packing and unpacking certain voice and signaling traffic in one frame , etc ., mainly relating to call processing managements and interfacing to the dsp . some functionality can also be interchanged between psel and csel for optimal performance and according to the particular situation . when a call associated with a given first level ( lower layer - level ) psel 50 a enters into soft handoff with a cell associated with a different first level psel 50 a , then the frame selection and power control for the particular mobile unit phone call moves to the second level ( i . e ., the higher layer - level ) psel 50 b . in such an instance , the second level psel 50 b functions for handling the soft handoff and controlling the previous two lower layer psels to operate in a pass - through mode . the router still receives only one packet . the lower level psels will not do any selection with respect to the performance of a soft handoff between two lower level psels . if a mobile station is talking through one psel and moves into an area of another psel , the functionality is moved from the first psel to the second psel . the second level psel 50 b can generally operate in a pass - through mode until needed for effecting a soft handoff between two or more first level psels 50 a . the system architecture of fig2 involves providing a group of cells coupled to a router via t1 links . there can be another group of cells coupled to the router via a satellite link 66 . for each grouping of cells , there is a psel 50 a . the psels are coupled to the router 54 , as discussed . if on a remote island or area , the psel 50 a is coupled via satellite link 66 to the router 54 and the csel 52 is proximate the msc 62 . this is made possible through the dividing out of the functionality of the selector , i . e ., with power control and selection in the psel 50 a and the call setup / release , call management , interfaces to a dsp in the csel 52 . a benefit of the psel is that one packet per sequence number of a call is sent via the t1 link between the psel and the router , in comparison to two or more packets required with the prior cdma architecture , the two or more packets having been required for passing of handoff packets . with the new architecture , the router now has more available capacity to handle additional voice call packets , subscribers , via the expanded capability of the system to handle a higher volume of usage . this is a result of the power control and frame selection and the call management , setup / release being established as two separate elements , where psel is located proximate a prescribed group of cells and csel is located proximate a given msc . soft handoff t1 link volume usage with the prior cdma system can now be reduced by at least fifty percent of whatever percentage of soft handoff there was , using the multi - level distributed frame selection and power control cdma architecture of the present disclosure . the number of t1 lines required is also reduced because of the lessened packet demand going to a particular router . call management can be used to inform a lower level psel to enter a pass through mode during a soft handoff by a higher level psel . if there is a handoff between first and second cells , where a first bts knows that the bts is seeing a pilot or a sector and it needs to handoff , what the bts can do is that the corresponding psel can inform the higher level psel in the following manner . the lower level psel can inform the higher level psel that there is a problem here , the lower level psel is not reaching the bts of the neighboring cell . the higher level psel responds with an indication that it can handle the problem and for the lower level psel to pass the packet information onto the higher level psel . the higher level psel thus takes over control for the lower level psel . a situation may arise that a mobile station can be communicating with several btss at any one time period of time , for example , when the mobile station is in a region proximate a boundary area of several cells . in one instance , the mobile station may be communicating with several btss within a region controlled by a particular psel . in another possibility , the btss are between adjacent regions controlled by different psels , wherein control goes to a higher level psel for handling soft handoffs between two neighboring lower level psels . referring now to fig3 in accordance with another embodiment of the present disclosure , compressed packets are transmitted ( after psel selection ) from one msc site to another ( alternatively one switch 62 to another 68 ) over an unchannelized t1 . this maximizes a capacity of the system t1 links 64 and reduces their required number . further in connection with fig3 the coupling between the router and a destination csel can include any type of available public network , e . g ., fiber or internet protocol ( ip ) networks or any network that provides service at the destination or target . during delivery over the public network , the voice packet data in accordance with the embodiments of the present disclosure is in a compressed state . the public network is thus used for transmission of compressed data packets . at the destination or target , a csel will handle call management and interfacing to a dsp . as a result of implementation of the present embodiments , t1 operation costs are estimated to decrease or be reduced on the order of twenty - five percent ( 25 %). this estimate is further based upon the assumption that a two stage selection is used and that the distance of t1 links between stages are equal . the present embodiments still further provide for increased main router 54 capacity . for example , in a prior system having 36 sels and 132 btss per router ( 40 % traffic with calls having 2 - way soft handoff and 30 % traffic with calls having 3 - way soft handoff , i . e ., an aggregate of two links per call requirement ), the expected number of btss when using the present embodiments can be increased to 200 btss per router . the new and enhanced psel and csel units can be used without a limitation on the number of links connecting the router and the psel and csel units . the system can be re - provisioned as follows ( assuming that the port limitation of the router is taken care of by the multi - level psel ): 50 enhanced - csel cards ; and 200 btss . with respect to delaying compression as illustrated in fig3 since selection is done at an early stage ( i . e ., by psel 50 a proximate the bts 16 ), the voice compression / decompression can be delayed to a later stage without limitation of backhaul delay ( i . e ., by csel 52 proximate a dsp ). this provides additional flexibility on software and hardware design since the constraint of delay is softened in accordance with use of the present embodiments . the csel regulates the sequencing and timing in the delivery of cdma frames from the psel to the dsp . in regard to satellite - based networks , the functionality transfer between two satellite areas can now be handled in a manner similar to the one discussed herein above with respect to terrestrial t1 - based cdma networks . a multi - level satellite psel can be used to manage soft handoff calls and functionalities between multiple coverage areas . it is re - emphasized that with current bsc - centered management of power control and soft handoff frame selection , it is not possible to support very remote btss via satellite - based backhaul transport , i . e ., due to excessive delays causing diversity frames to arrive at the bsc beyond the 20 millisecond time - frame required for soft handoff selection . this problem is eliminated with the implementation of the present embodiments , i . e ., the new architecture , since frame selection / combining and power control take place earlier on in the communication process via a psel 50 ( i . e ., as close to the btss as possible ), and once this is done , there is no hard limit ( e . g ., 20 milliseconds ) on the backhaul transport delay , except as may be customary in general telephone networks . as mentioned above , psel performs power control and frame selection . power control is for the maintaining of the mobile unit transmit power at a desired level . psel works in conjunction with the bts to control the power . the psel - to - bts link is referred to as a forward link , whereas the bts - to - psel is referred to as a reverse link . frame selection of psel relates to the performing of a soft handoff . the functions of power control and frame selection are known in the art , for example , as discussed in the cdma system standard . further as discussed above , psel is placed as close as possible to a bts or group of btss . the distance between a bts and the psel is relatively short in comparison to the distance between the bts and the csel . the bts communicates with the psel , the psel then communicates with the router via a t1 link ( or other suitable link ). the router communicates with the csel , the csel communicates with the dsp , and lastly , the dsp communicates with the msc . when a selection is done between packets by psel , only one packet is thereafter sent from psel to the router , then on to csel , furthermore , without any additional soft handoff packet being transmitted beyond the psel . in contrast , under the prior cdma system , two t1 links were required for transmitting respective packets from one or more btss to the router , then to the selector . in the latter instance , t1 link call capacity was undesirable consumed . with the present embodiments , only one packet is required to be transmitted to the router , since psel makes the selection between btss , as induced by a given mobile station ( ms ). the present embodiments further provide for eliminating the hard limit due to backhaul transport delay . in addition , after a selection by psel , there is no longer the 20 milliseconds variable delay limitation as was required in the prior cdma system . as a result , a satellite link can be advantageously placed between a psel and the router . in other words , as a result of the selection being carried out prior to the signal or packet transmission to the router , it is no longer necessary to be as concerned with all components together meeting the 20 milliseconds variable delay limitation of the prior cdma system . in the past , some of the 20 milliseconds has been consumed , for example , by the t1 link , router , and sel , which consumed approximately 11 milliseconds . in such an instance , what remained of the 20 milliseconds was 9 milliseconds ( 20 − 11 = 9 ), i . e ., the remainder of a variable delay . referring now to fig4 for example , if a phone call were being carried out using the system of the present disclosure to a person in new york , n . y ., from dallas , tex ., then instead of changing the compressed packets to uncompressed packets in dallas , tex ., on system - 1 the packets would be changed from compressed to uncompressed packets at the destination , i . e ., by a dsp in newyork , n . y . on system - 2 . the present embodiments allow the cdma system or other system to make use of the concept of placing the msc closer to the destination ( e . g ., placing the dsp as close as possible to new york , n . y . in this example ). with the present embodiments , a control message is provided to the psel when the destination csel is somewhere other than the csel belonging to the local msc - cdma system . the control message includes , for example , the necessary routing information necessary to route the compressed voice data packets to the destination csel and dsp . after dsp , the packet data is decompressed . with the present embodiments , it is not required to have the destination csel positioned locally to the psel , but can be remote to whatever the destination may be . voice packet data stays compressed until after digital signal processing at the destination . in the example above , further with reference to fig4 the router ( router - 1 ) sends compressed data packets to a remote csel ( csel - 2 ) in new york , n . y . the local csel ( csel - 1 ) would be involved in the call setup , however , may not be required further once the call setup is established between the origination and the destination . the links used for the communication could include fiber optic , t1 link , etc ., as established by the router ( router - 1 ). a dsp ( dsp - 2 ) in the locality of the destination will be used for performing compression / decomposition of data packets . subsequent to the call being setup , the call will be routed from the origination psel ( psel - 1 ) to a csel ( csel - 2 ) in a proximity to the destination . the router utilizes routing information of the data packets to determine where to route the call . during call setup , a dialing phone communicates a phone number with a msc . the msc has a home location register ( hlr ), the hlr for performing a search to determine where is the person being called . based on the hlr determination , there will be some routing , from a first switch to a second switch . the router can have an output to the pstn , as well as to a csel of a given msc . with reference now to fig5 caller usage volume in any particular geographic area can vary over time . the present embodiments enable the use of a dsp pool 70 , in which capacity can be shared over a larger coverage area , i . e . between systems d 1 , d 2 , and fw , thereby saving on a total number of required dsps . with the present embodiments , once the call processing has been delayed to a later stage , in particular , the decompression , a pool of dsps 70 can be assembled from all places within a given msc system 72 and , furthermore , in locations remote from a given psel 74 . separation of frame selection and call management , with the use of psel 74 and csel 76 , facilitates the pooling of dsps . to illustrate further , assume for a moment , a major metropolitan area is serviced by three mscs , each msc having 3 , 000 dsps . one msc may be operating at full capacity in the morning , while another may be under utilized . in addition , another msc may be utilized to its maximum capacity in the evening , whereas it was under utilized in the morning . in such an instance , the prior network architecture prevents a maximum efficiency of dsp usage to be carried out . the present embodiment , however , enables the dsps to be positioned at respective locations proximate a corresponding msc . the present embodiments thus advantageously facilitate dsp pooling for a cdma system . in the prior cdma system , the dsp was previously required to be in close proximity to the selector , as a function of , and in accordance with , the 20 milliseconds variable delay limitation . with the present embodiments , the dsps are msc independent , and thus a single msc will now be able to support multiple currently known mscs . the present embodiments also enable cdma to receive the benefit of other known techniques . the following listing summarizes various aspects of the present embodiments . it is estimated that the transport links operating cost can drop by an order of 25 %. an amount of traffic or number of btss supported can be increased by a factor close to the amount of soft handoff traffic for a particular cdma router . the new architecture eliminates or softens the cdma hard limit for backhaul transport delay . the multi - level distributed frame selection and power control cdma architecture 60 can thus advantageously support satellite - based networks , remote - based networks , and land - based networks on the same “ super ” msc switch . the present embodiments furthermore facilitate the use of cdma in a distributed architecture where voice compression is moved as far as possible away from the selection and power control of psel 50 , close to the destination and corresponding csel 52 and dsp proximate the destination . the present embodiments still further facilitate the use of cdma with pooling of dsp resources for a large area . the present embodiments also reduce software and hardware design limits . the new architecture of psels furthermore provides for a continuous coverage of soft handoff , in comparison with hard handoff , wherein the handoffs are accomplished by means of handoff between psels . the cdma system may thus also include a bts positioned within a remote cell wherein the remote bts communicates with the router via a satellite and appropriate satellite links . while the invention has been particularly shown and described with reference to the preferred embodiment thereof , it will be understood by those skilled in the art that various changes in form and detail maybe made therein without departing form the spirit and scope of the invention , as set forth in the following claims .	7
in fig1 and 2 , show the bottom plate of the terminal box which is made of plastic . numeral 1 designates the plate itself which is provided with devices 2 for carrying a socket outlet or a similar apparatus . in the illustrated embodiment , the devices consist of two tubes internally formed with the bottom of the box and said tubes are provided with external longitudinal stiffenings 3 which extent crosswise with respect to the longitudinal direction of the box and run the entire length of the tube and constitute together with the end surface of the tube , a surface on which the socket outlet is intended to be mounted . the casing 4 of the terminal box which is shown in fig3 and 4 has an opening 5 which is large enough to allow the casing to be brought in place after an insert of a socket outlet or other apparatus is mounted on the bottom plate . the sides of the casing are provided in known manner , with thinner parts 6 which are easy to cut away in order to make it possible to pull the wires into the box . in fig5 a terminal box is shown which is fastened on a frame and on which a socket outlet is mounted comprising cover 7 and insert 10 . the bottom plate 1 of the box is fastened to the frame by screws 8 which also serve as binding screws for the insert 10 of the socket outlet . after the bottom of the box and the insert have been mounted incoming and outgoing wires 11 are run to and into the box where they are held by means of a clamp 13 which is fastened by utilizing a pair of the eight holes 12 in the bottom plate , which holes are shown in fig2 . the conductors which are actually used for the connection in the socket outlet are connected to the insert while the other conductors are connected together by means of a wire connector of a conventional type . when the connections are finished the casing 4 of the box is mounted in place to surround the bottom plate 1 and the side wall is cut at 6 for the wires 11 . the end surfaces of the tubes 2 and the upper side of the casing of the box are situated in the same plane which implies that when the cover 7 of the socket outlet is mounted , this fixes the casing of the box to the frame as well as closes the opening 5 of the casing of the box . fig6 shows in plan view of a terminal box with a mounted socket outlet and incoming as well as outgoing wires . naturally , the incoming and outgoing wires can be placed one each side of the terminal box and in those cases when 3 - phase feeding of the electrical power is used , the connection of the unused phase conductor is effectuated inside the box .	7
many commonly used mammalian expression systems are based on stably transfected chinese hamster ovary ( cho ) cells . stable clones producing high levels of recombinant protein are obtained after transfection of cells with an expression vector encoding the desired gene of interest and a dominant genetic marker . a search for random high producing clones may , however , be time - consuming and labour - intensive . in an effort to reduce the time and labour involved in the screening for high producers , we constructed a system in which an amplifiable nucleic acid is linked to a reporter nucleic acid and used for efficient screening of cells for an alteration in copy number of a nucleic acid of interest and / or an alteration in the level of production of a product encoded by the nucleic acid of interest . in the system exemplified below , selection and amplification can be visually monitored , thus allowing efficient screening of recombinant gene - positive clones and resulting in selection of clones having a high level of expression of a product of interest following amplification . the representative amplifiable nucleic acid used was the human metallothionein ( mt ) gene and the reporter nucleic acid chosen was the green fluorescent protein ( gfp ) gene . the genes were linked by fusing the nucleic acids in frame to allow production of a fusion protein , mtgfp ( referred to as “ the fusion marker ”). the use of the fusion marker facilitates the screening of high - producing clones expressing a nucleic acid of interest by using flow cytometry . the method is demonstrated below by the expression of either human growth hormone ( hgh ) or chloramphenicol acetyl transferase ( cat ). the fluorescence - activated cell sorter ( facs ) can easily screen a million cells and sort those cells producing higher levels of fluorescing protein — in the present example mtgfp . when amplification of the nucleic acid of interest is correlated with amplification of the mtgfp construct , those cells having amplified nucleic acid of interest can be identified by facs screening relying on detection of fluorescence from the gop comprised in the mtgfp fusion marker . since the level of production of a product of interest is often a direct function of the copy number of the nucleic acid encoding the product of interest , selection of clones producing mtgfp is likely to provide clones producing the product of interest at high levels . cells transfected with the mtgfp construct respond to successive stepwise cadmium selection and amplification with increasing fluorescence that can be monitored using a flow cytometer or a fluorometer ( a microtitre plate reader equipped with the appropriate filters to measure gfp fluorescence ). using clones isolated from increasing cadmium - resistant pools , we have demonstrated that the increase in fluorescence correlates linearly with increasing levels of recombinant product . an increase in fluorescence is evidence for an increase in productivity . clones in microtitre plates can be screened using the fluorometer without disturbing the integrity of the cultures and high - producers can be immediately identified . a high - throughput screening process using the mtgfp - encoding expression vector reduces dramatically the time and labour involved in screening large numbers of recombinant clones , especially if the procedure is adapted to robotic handling or automated procedures . expression of mtgfp gene acts as a dominant selectable marker allowing rapid and more efficient selection of clones at defined metal concentrations than the antibiotic g418 . the mtgfp gene can be used as a selectable and amplifiable gene for the amplification of foreign gene expression . using the protocol described below it was possible to isolate cell lines reaching specific productivities of & gt ; 30 μg / 10 6 cells / day within four weeks of selection / amplification in metal and fluorescence screening . in the past , the isolation of those few clones supporting such high levels of productivity were possible only after screening thousands of clones requiring years of person - hours . such a screening method can be easily adapted to automated procedures using robotic handling systems , capable of managing tens of thousands of transfected clones in a fraction of time and effort that is required at present . a preferred embodiment of the invention will now be described by way of example only , with reference to the accompanying figures . the coding sequence for the enhanced green fluorescent protein ( egfp , clontech ) was cloned in frame to the 3 ′ end of the human metallothionein iia gene ( mt )( 15 ) using primer overlap extension pcr ( 16 ). for this purpose , four oligonucleotides were synthesized and are described as follows : mtgfp - 1 : 5 ′ tac tct tcc tcc ctg cag tct cta 3 ′; mtgfp - 2 : 5 ′ cac cat ggg ccc ggc gca gca gct gca 3 ′; mtgfp - 3 : 5 ′ gcc ggg ccc atg gtg agc aag ggc gag 3 ′; mtgfp - 4 : 5 ′ att tac gcc tgc aga tac at 3 ′ mtgfp - 1 anneals − 758 to − 735 nt of the gene encoding mt relative to the translation start and includes the psti site ( 5 ′ ctgca / g 3 ′). mtgfp - 2 anneals to + 630 to + 656 relative to the mt transcription start site . the stop codon tga is replaced by the sequence 5 ′ cccggg 3 ′ encoding two additional amino acids proline and glycine as well as the recognition sequence for the restriction enzyme apai mtgfp - 3 anneals to − 9 to + 18 relative to the transcription start site of the coding sequence of egfp . the atg start codon is in frame with the mt gene sequence and is located within a 15 nucleotide tag homologous with mtgfp - 2 . mtgfp4 anneals to + 954 to + 973 relative to the transcription start site of the coding sequence of egfp , and includes the recognition site for the restriction enzyme psti . the egfp gene was pcr amplified using mtgfp - 3 and mtgfp - 4 primers in a reaction mix containing taq polymerase ( gibco - brl ), dntps ( progen ), 2 mm me 2 + ions and 10 % dmso at an annealing temperature of 50 ° c . as described ( 16 ). similarly , the mtiia gene was amplified using the primers mtgfp - 1 and mtgfp - 2 . the amplified products were gel purified and primer overlap extension was used to amplify the fusion mtgfp using primers mtgfp - 1 and mtgfp - 4 .. the reaction required 2mm mg 2 + and 10 % dmso for the gc - rich mt - encoding template dna . the specificity was increased after 3 cycles by raising the annealing temperature from 50 ° c . to 55 ° c . the reaction yielded a 3281 base pair fragment of dna . the 2381 bp fragment containing the mtgfp coding sequence was digested with psti to enable cloning into the expression vector pnk ( 12 ). after gel extraction the mtgfp containing fragment was cloned into pnkδmt ( mt gene deleted from pnk using psti ) to make pmtgfp . to construct pmtgfp / hgh , a 2223 bp ecori / kpni fragment containing the genomic sequences of hgh ( nt − 559 to + 2094 relative to the translational start site ) was ligated to pmtgfp previously digested with the respective enzymes ecori and kpni and transformed into dh5 bacteria . to construct pmtgfp / cat , a 714 bp dna fragment containing the coding region of cat was obtained by digesting pnkcat with hindiii and kpni ( 12 ) and inserted into the respective sites in pmtgfp . dna was isolated and purified from positive clones using anion exchange plasmid purification columns ( qiagen ). chok1 cells used to establish cell lines were derived from chok1 atcc ccl61 . all cells were grown in a complete medium ( dmem / coons f12 mix ( csl ) supplemented with 10 % fcs ( csl ). cells were seeded into 35 mm plates 24 hours prior to transfection . for transactions , lipofectamine 2000 ( life technology ) was used to transfect cells using optimum conditions for dna and reagent mixes according to the manufacturer &# 39 ; s protocol . medium was removed 24 hours following transfection and replaced with fresh complete medium and plates were incubated for an additional 24 hours . the cells were then detached using edta / pbs and transferred to a t75 flask in fresh complete medium containing 400 μg / ml g418 . cells from g418 r pools ( surviving selection in 400 μg / ml g418 for x days ) were grown in stepwise increasing amounts of metal ( 12 ) at an initial concentration 2 . 5 μm cdcl 2 and 50 μm znso 4 . the cells were passaged at 90 % confluence 4 times before the concentration of cdcl 2 was doubled . fresh znso 4 was added to the medium at a concentration of 50 μm at all times . at each level of cadmium resistance the fluorescence of each pool was monitored using the flow cytometer and specific productivity was determined using elisa . following transfections of pmtgfp containing plasmids , cho cells were passaged into 100 mm plates containing 7 mls of complete medium and were allowed to attach for six hours . metal ( 1 - 10 μm cdcl 2 and 100 μm znso 4 ) was added to the medium in the presence or absence of 400 μg / ml g418 . the cells were monitored daily for emergent colonies of metal - resistant cells . approximately 6 days after metal was added , the medium was removed and replaced with complete medium containing 100 μm znso 4 and 2 μm cdcl 2 . once cultures reached confluence fluorescence was analysed using flow cytometry and recombinant protein levels were determined by elisa . flow cytometry was performed using a moflo cytometer ( cytomation , colo ., usa ) equipped with a multi - line argon laser emitting light at 488 nm . analysis was performed using the cyclops summit operating system . when sorting was required sortmaster software was used to determine correct drop delay and cyclone software that controlled a robotic arm to sort cells into microtitre plates . the flow cytometer was calibrated and optically aligned using flow - checks fluorospheres ( beckman coulter ) before each analysis . cells to be sorted were trypsinized and resuspended in complete medium and filtered through nylon mesh . cells were analyzed at a flow rate of 1000 cell / s . single , viable cells were determined using forward and side scatter . typically , cells were sorted one cell per well into 96 - well microtitre plates containing 100 μl of 50 : 50 fresh and conditioned complete medium with 200 μg / ml g418 and 50 μm znso 4 . the fluorescence intensity of cells could also be determined using a fluorescent plate reader or fluorometer ( fmax , molecular devices , sunnyvale , calif .). this fluorometer equipped with a quartz halogen lamp has a filter set of 485 nm and 538 nm sufficient to detect the excitation and emission spectra of gfp . softmaxpro software was used to perform analysis on microtitre plates . to measure hgh , the conditioned media from cells grown in 96 microtitre plates for 10 days was centrifuged and hgh was quantified using elisa ( roche , mannheim , germany ). cat protein levels were determined using elisa ( oche , mannheim , germany ) as previously described ( 12 ) the expression of the fusion protein mtgfp was examined in cho cells transfected with the plasmid vector pmtgfp ( fig1 ). the expression vector pmtgfp was constructed from the vector pnk ( 12 ) and differs from pnk in that the dna encoding metallothionein iia was replaced by that of the fusion gene retaining the entire promoter region of the metallothionein iia gene . the modified metallothionein m2 . 6 promoter drives expression of a target gene cloned into the multiple cloning site ( mcs ). pools of cells surviving selection in either the neomycin analogue , g418 or in metal were analysed using flow cytometry . fluorescence was measured from pools of cells surviving various concentrations of cd ++ ( 1 - 10 μm ) in the presence or absence of g418 . fig2 shows the mean relative fluorescence of selected pools as a function of increasing metal selection . each pool represents 10 , 000 single viable cells following 8 days selection in media containing the indicated metal concentrations in the presence or absence of g418 . at low ( 100 μm zn ++ ) or no metal selection there exists a 2 - fold difference in mean fluorescence depending on whether g418 was used for selection . it appears that the addition of g418 alone is more effective at enriching a selected population than at low concentrations of metal ( 100 μm zn ++ + 1 - 2 μm cd ++ ). however , when cells are selected in metal containing 100 μm zn ++ + 4 μm cd ++ , mean fluorescence increases 3 orders of magnitude above background levels . background fluorescence seen in flow cytometry profiles of untransfected cho cells appears as a peak corresponding to an average fluorescence of 7 relative fluorescent units ( rfu ) fig2 inset . following 8 days under selection at this concentration of metal , all cells in the population are fluorescing at 10 4 rfus regardless of whether g418 was present in the media . there is in fact no peak corresponding to background fluorescence . results were similar for cells selected at higher concentrations of metal . however , selection in 8 and 10 μm cd ++ resulted in considerable cell death and therefore necessitated recovery of surviving cells in medium containing 100 μm zn ++ and 2 μm cd ++ in order to obtain enough cells to analyse in the flow cytometer . it was sometimes necessary to attenuate light without discriminating wavelengths . this was done using a neutral density filter nd 1 . 3 ( company ), which absorbed light over the entire visible spectrum . by using a filter that limits light reaching the photo multiplier tube , it was possible to reduce the signal considerably , thus obtaining values for those cells exhibiting fluorescence beyond 10000 rfus ( data not shown ). these results indicate that mtgfp can be used as an effective dominant selectable marker and that cells transfected with the expression vector encoding the mtgfp fusion protein can be efficiently and rapidly selected . selection in 4 μm cd ++ resulted in a pool of cells having 100 times more fluorescence than if selection was in g418 alone . the mtgfp fusion can be used as a dominant and visual selectable marker for co - expressed genes to evaluate the use of mtgfp fusion protein as a selectable marker for enriching high producing clones the reporter gene , chloramphenicol acetyl transferase ( cat ) was co - expressed with mtgfp under the control of the modified m2 . 6 metallothione promoter ( 17 ). the cat gene was cloned in the multiple cloning site of the expression vector pmtgfp and named pmtgfp / cat . cho cells were transfected with pmtgfp / cat and selected in medium containing various concentrations of metal with or without g418 as described in the previous section . a graph representing the flow cytometry profiles of surviving transfected pools following 8 days of selection is shown in fig3 a . again , as seen in the previous section , a dramatic enrichment of fluorescent pools was accomplished in concentrations of 4 μm cd ++ + 100 μm zn or higher . cat expression levels from each pool under different selective pressure was analysed using a cat elisa ( roche , australia ) and the results are shown in fig3 b . cat protein levels rose 20 times higher in those cells selected in media containing 4 μm cd ++ + 100 μm zn reflecting the fluorescent measurements from the flow cytometer and 50 times higher when g418 was included in the media these results indicate that cells transfected with the gene encoding mtgfp fusion protein can be efficiently selected in metal for the enrichment of pools with high fluorescence and high productivity . due to the cytotoxicity of cadmium at high concentrations , selection was carried out in 4 μm cd ++ and 100 μm zn ++ for all subsequent experiments . expression of mtgfp can be used to visually monitor gene amplification in increasing metal in addition to providing a marker for cadmium resistance , the amplification of the recombinant gene expression can be continued with stepwise increases of cadmium , which leads to increased expression beyond the initial levels . we have previously demonstrated the increase in cat production in progressively higher levels of cadmium resistant pools of cho cells tansfected with the expression vector pnk which encodes the metallothionein gene ( 12 ). pools of transfected cells resistant to 120 μm cadmium resulted in over 500 - fold increase in cat gene expression over initial levels . however , it has been shown that stepwise selection reaching such high levels of cadmium gives rise to resistant cell populations resulting in a decline in productivity ( data not shown ) and ( 11 ). a similar pattern of expression is also seen when the dhfr system is used where an increase in mtx concentration often results in the loss of specific productivity wurm ( 1990 ), kaufman et al ( 1985 ). studies using the dhfr amplification system suggest that there is an upper limit for mtx amplification and differs for each recombinant cho cell line . the presence of a green fluorescent metallothionein gene enables the visual screening of highly amplified and cadmium resistant clones using the flow cytometer and / or the fluorometer . the appearance of cells that lose fluorescence was detected at high concentrations of cadmium . loss of fluorescence clones in a pool of highly amplified cadmium - resistant transfected cho cells can be easily sorted from the rest of the fluorescent population before their possible growth advantage results in the dilution of a promising high - producing pool . cho cells were tansfected with pmtgfp / hgh and subjected to selection in either g418 ( 400 μg / ml ) or metal ( medium containing 100 μm zn ++ and 4 μm cd ++ ). after five days in selection media , the cells were analysed using the flow cytometer and gated according to their relative fluorescence intensities of 10 1 , 10 2 , 10 3 and 10 4 as shown in fig4 a . the flow cytometry profiles reveal that metal selection results in an average relative fluorescence of 4500 , whereas a g418 - resistant pool is comprised of cells with varying fluorescence intensities averaging 345 rfus . this again indicates that metal selection is faster and more efficient at selecting high fluorescing cells than g418 alone . cells were sterile sorted into 96 - well microtitre tissue culture plates , one cell per well from within the gated regions indicated in the profiles in fig4 a . twelve clones of various fluorescence intensities were isolated after facs sorting and grown to confluence in microtitre plates . the gfp fluorescence of each clone was measured using a fluorometer and plotted against the respective hgh levels in the conditioned media as measured by an elisa ( roche , australia ). fig4 b shows hgh productivity of each clone as a function of gfp fluorescence . it was observed that the measured fluorescence of individual clones that had been sorted from within one gated region by flow cytometry could be differentiated according to their fluorescence levels . more importantly , mean fluorescence of a clonal population of cells measured by flow cytometry corresponded well with fluorescence as measured by the fluorometer . a trend emerging from multiple replicates of each clone indicates that the fluorescence of gfp as detected by the fluorometer showed a linear relationship with respect to specific hgh productivity of each clone . that is to say that clones that were sorted with high fluorescence intensities by flow cytometry analysis were relatively high producers of hgh and vice versa . regardless of facs sorting , if clones exhibited high fluorescence detected by the fluorometer , they were in turn relatively high producers of hgh . subsequent rounds of flow cytometry analysis were done to confirm that each clone displayed a well - defined fluorescence peak at the intensity that it was originally sorted . the flow cytometry profiles of these clones remained the same after two weeks in culture and did not change when they were frozen and recultured . an experiment was done to demonstrate the potential for using the fluorometer to measure differences in fluorescence of clonal isolates . sterile facs sorting into microtitre plates is a rapid and convenient method for obtaining clones from a transfected population . after allowing individual clones to expand , a second measurement of fluorescence was done simply by scanning the microtitre plate in a fluorometer . this second round of selection was done to confirm the fluorescent nature of individual clones and allowed a further measure of comparison among clones in culture . for the application of a rapid screening process , it was important to establish that the fluorescence of clones determined by the flow cytometer was reproducible in the fluorometer . fig5 is a plot of average fluorescence values obtained from clones examined in the flow cytometer compared to that of the fluorometer following isolation in different selection media these results demonstrate that although units of fluorescence are different as measured using the flow cytometer compared to that of the fluorometer , average fluorescence correlates very well between the two . a very quick method can be employed for the selection of very high producing clones . a flow diagram depicting the process of rapid selection is shown in fig6 . this method is based on the correlation of gfp fluorescence and specific recombinant protein productivity . cho cells are transfected with the plasmid vector pmtgfp expressing the desired gene . following selection in metal ( a recommended concentration would be 100 μm zn ++ and 4 μm cd ++ with or without g418 ) a pool of metal resistant cells is obtained which can be further amplified in increasing concentrations of cd ++ . highly fluorescent cells are identified and sorted using facs into one or several microtitre plates . alternatively , clones can be obtained by limit dilution plating into microtitre wells . after 10 days in culture , cells in the microtitre plates are then scanned in the fluorometer . since fluorescence resulting from the expression of mtgfp is a reliable indicator of productivity , the highest fluorescing clones can be picked for clonal expansion and further analysis . at this stage , conditioned media can be analysed using elisa to determine recombinant protein expression . alternatively , after selection / amplification in metal , limiting dilution into one or several microtitre plates can be performed , thus avoiding the requirement for expensive facs equipment . using the protocol as depicted in fig6 , it was possible to isolate cell lines with specific productivity & gt ; 30 μg / 10 6 cells / day . a fusion mtgfp gene with which selection and amplification properties have been combined allows an efficient visual screening process of foreign gene positive clones with high levels of expression . the fusion protein is a dominant and visible marker for the selection and amplification of expression . fluorescence correlates not only with amplification of the nucleic acid but also with productivity and therefore , high expressors can be identified according to their fluorescence levels . this work describes a high throughput screening method to identify high producing clones using a metallothionein - green fluorescent protein marker gene and flow cytometry . the method can be adapted for automation using robotic systems capable of selecting the highest producing clones among tens of thousands of transfected cells . although the invention has been described with reference to specific examples , it will be appreciated by those skilled in the art that the invention may be embodied in many other forms . ( 1 ) alt , f . w . ; kellems , j . r . ; bertino , j . r . ; schimke , r . t . selective multiplication of dihydrofolate reductase genes in methotrexate - resistant variants of cultured murine cells . j biol chem 1978 , 253 , 1357 - 1370 . ( 2 ) cockett , m . i . ; bebbington , c . r . ; yarranton , g . t . high level expression of tissue inhibitor of metalloproteinases in chinese hamster ovary cells using glutamine synthetase gene amplification . bio / technology 1990 , 8 , 662 - 667 . ( 3 ) urlaub , g . ; chasin , l . a . isolation of chinese hamster cell mutants deficient in dihydrofolate reductase activity . proc natl acad sci usa 1980 , 77 , 4216 - 4220 . ( 4 ) brown , m . e . process development for the production of recombinant antibodies using the glutanine synthetase ( gs ) system . cytotechnology 1992 , 9 , 231 - 236 . ( 5 ) bebbington , c . r . high - level expression of a recombinant antibody from myeloma cells using a glutamine synthetase gene as an amplifiable selectable marker . bio / technology 1992 , 10 , 169 - 175 . ( 6 ) cockett , m . i . ; bebbington , c . r . ; yarranton , g . t . high level expression of tissue inhibitor of metalloproteinases in chinese hamster ovary cells using glutamine synthetase gene amplification . bio / technology 1990 , 8 , 662 - 667 . ( 7 ) gounari , f . ; banks , g . r ; khazaie , k . ; jeggo , p . a . ; holliday , r . gene reactivation : a tool for the isolation of mammalian dna methylation mutants . genes dev 1987 ,- 1 , 899 - 912 . ( 8 ) harris , m . high frequency induction by 5 - azacytidine of proline independence in cho k1 cells . somatic cell mol genet 1984 , 10 , 615 - 624 . ( 9 ) stallings , r . l . ; crawford , b . d . ; tobey , r . a . ; tesmer , j . ; hildebrand , c . e . 5 - azacytidine - induced conversion to cadmium restance correlates with early s phase replication of inactive metallothionein genes in synchronized cells . somatic cell mol genet 1986 , 12 , 423 - 432 . ( 10 ) beach , l . r . ; palmiter , r . d . amplification of the metallothionein - l gene in cadmium - resistant mouse cells . proc natl acad sci usa 1981 , 78 , 2110 - 2114 . ( 11 ) kushner , p . j . ; hort , b . ; shine , j . ; baxter , j . d . ; greene , g . l . construction of cell lines that express high levels of the human estrogen receptor and are killed by esstrogens . mol endocrinol 1990 , 4 , 1465 - 1473 . ( 12 ) bailey , c . j . ; baig , m . ; gray , p . p . ; sunstrom , n .- a . a rapid selection / amplification procedure for high - level expression of recombinant protein in a metal - amplifiable mammalian expression system . biotechnol techniques 1999 , 13 ( 9 ), 615 - 619 . ( 13 ) chalfie , m . ; tu , y . ; euskirchen , g . ; ward , w . w . ; prasher , d . c . green fluorescent protein as a marker for gene expression . science 1994 , 263 , 802 - 805 . ( 14 ) mosser , d . d . ; caron , a . w . ; bourget , l . ; jolicoeur , p . ; massie , b . use of a dicistronic expression cassette encoding the green fluorescent protein for the screening and selection of cells expressing inducible gene products . biotechniques 1997 , 22 , 150 - 154 . ( 15 ) karin , m . ; richards , r . i . human metallothionein genes : molecular cloning and sequence analysis of the mrna nature 1982 , 299 , 797 - 802 . ( 16 ) pcrprimer a laboratory manual . plainville , n . y . : cold spring harbor , 1995 . ( 17 ) mcneall , j . ; sanchez , a . ; gray , p . p . ; chesterman , c . n . ; sleigh , m . j . hyperinducible gene expression from a metallothionein promoter containing metal - responsive elements . gene 1989 , 76 , 81 - 88	2
as shown in fig1 a system for performing the method of the present invention includes a printer controller 10 having access to a job ticket file 12 a page description language (“ pdl ”) file of a template 14 , a plurality of pdl files for sub - templates 15 , a source of variable data such as a merge file 16 and an optional printer configuration file 18 . the system also contains an operator control terminal 20 for providing operator controls such as indicating the name and path of the job ticket file 12 for the specific print job . the job ticket file 12 contains the guidelines for the print job which can include the names and locations of the pdl files 14 , 15 , the merge files 16 , the configuration files 18 , etc . ; and may also include special instructions pertaining to the print job such as identifying and locating sub - templates , defining additional graphical attributes for variable data areas identified during the process , and the like , all of which is described in greater detail below . the pdl files 14 , 15 are preferably postscript ® specifications created by an application program such as a wordprocessor , illustrator , or computer aided design system . the merge file 16 contains platform independent data , such as text data , image data , bar - code data and the like , which is to merged into a template bitmap defined by the pdl template specification 14 or the pdl sub - template specifications 15 during the merging task , as will be described in detail below . the configuration file 18 , defines the print engines and the post processing equipment and other options to be executed . initially , the path and name of the job ticket file 12 is specified by the operator using the operator control terminal 20 . the printer controller 10 retrieves the job ticket file 12 and then retrieves the pdl files 14 , 15 specified in the job ticket file . next , the controller 10 initiates a control task 22 in conjunction with a page description language interpreter program . the control task 22 interprets the pdl specifications from the pdl files 14 , 15 and monitors data areas defined in the pdl specifications to watch areas defined by the specifications to become variable . if the control task identifies a data area as being a variable data area , it reserves the graphic states and / or other associated graphic attributes 23 of that variable data area in a cache or memory 24 and then moves on to the next data area defined by the particular pdl specification , usually without allowing any data defined by the variable data area to be added to the template bitmap . the control task also looks for predetermined attributes defined in the data areas to determine if the data area is defining the importation of a sub - template bitmap . if the control task detects such an attribute , rather than storing the graphic states associated with the data area in the cache 24 , it stores a placeholder 23 ′ in memory , which will instruct the merge task that a sub - template is to be incorporated into the present template or sub - template bitmap during the merge task 28 , and will also include information identifying the one or a group of the sub - templates that may be merged into the present template or sub - template bitmap . once the control task completes its processing of the particular pdl specification , the control task saves the template display list 25 or sub - template display list 27 in memory 26 . the template and sub - template display lists 25 , 27 will include a plurality of rendering commands for the static data defined in their respective pdl specifications . each rendering command designates a particular static data area or object to be rendered , the graphic states and / or graphic attributes to be applied to the static data area and the offset address at which the rendered object , if any , in the static data area is to be over written onto the final bitmap . next , a merge task 28 , having access to the variable data records 17 from the merge file 16 is executed to apply the reserved graphic states and / or graphic attributes 23 to the variable data records 17 , creating rendering commands for that variable data record as defined by the graphic states . the merge task 28 retrieves a copy 25 ′ of the template display list from the memory 26 and merges the variable data rendering commands with the template display list to create a merged display list 30 . the merge task will also look for place holders 23 ′ among the graphic states stored in the memory 24 during this merging operation . if a place holder 23 ′ is detected , the merge task will access a copy 27 ′ of the display list of the sub - template corresponding to the place holder and will then merge the rendering commands from the display list of the sub - template 27 ′ with the merged display list 30 . it is noted that the sub - template may also include an associated cache of graphic states and / or graphic attributes corresponding to variable data areas ( or even additional levels of sub - templates ) defined within the sub - template . therefore , if such a cache is present with a particular sub - template , the merge task will apply such stored graphic states and / or graphic attributes to the present variable data fields in the variable data record 17 linked to the graphic states to therefore create rendering commands for such variable data fields . these rendering commands are also merged into the display list 30 . once the merged display list 30 is created , the controller 10 performs a rendering task 32 to render the merged display list 30 into a plurality of bitmap bands 34 for dispatching to at least one print engine 36 . a general method for performing the above control task is described in u . s . pat . no . 5 , 729 , 665 , the disclosure which is incorporated herein by reference . a method and system architecture for performing the above merging , banding and dispatching operations are respectively described in u . s . pat . nos . 5 , 594 , 860 and 5 , 796 , 930 , the disclosures of which are also incorporated herein by reference . as shown in fig2 a graphical flow diagram representation of the control task is illustrated . as discussed above , the primary function of the control task is to monitor a pdl interpreter program which interprets the pdl specifications for the template ( 14 ) and the sub - templates 15 to create display lists 25 , 27 , containing the rendering commands for the static data in the pdl specifications , and a cache of graphic states and / or graphic attributes corresponding to the variable data areas identified by the pdl specifications . while the pdl specifications are typically in the form of a list of pdl commands ( as described above ) the specifications 14 , 15 a and 15 b shown in fig2 are shown , for clarity , as they would have appeared to the artist using the application program ( such as quarkxpress ®) to create such pdl specifications . as shown in fig2 the template pdl file 14 includes a plurality of static data areas 38 and a plurality of variable data areas 40 . the variable data areas are identified by the control task as a text string surrounded by special characters , “& lt ;& lt ;” and “& gt ;& gt ;”. the phrase or word within the special characters corresponds to the field name for the particular variable data area . these strings may also be followed by an attribute command string 42 , which may define special attributes to be applied to the particular variable data area . with respect to the template pdl file shown in fig2 the variable data identifier with the field name “ picture ” is followed by the attribute command string “ select ”, which , as will be discussed below , informs the control task that the particular variable data area corresponds to the insertion of a sub - template . as discussed above , the rendering commands for the static data areas 38 in the template pdl file are stored in a template display list 25 and the graphic states 23 of the variable data areas 40 are stored in a cache 24 . as also discussed above , and as will be discussed in detail below , the graphic state stored in the cache for the variable data area having the “ select ” attribute string is merely a place holder 23 ′, which will instruct the merge file to insert a sub - template bit map into the template bit map being rendered . the control task will also interpret the sub - template pdl files 15 a , 15 b , shown as sub - template “ a ” and sub - template “ b ” in fig2 . sub - template “ a ” 15 a includes two static data areas 38 , and therefore a sub - template display list 27 a is created for the sub - template “ a ” pdl file , including the rendering commands for such static data areas . the sub - template “ b ” pdl file 15 b includes a static data area 38 and a variable data area 40 . therefore , the control task will create a sub - template display list 27 b , including the rendering command for the static data area and will cache the graphic states 23 ′ for the variable data area . it is noted here that the variable data identifiers in the sub - template pdl specifications may also include attribute strings for special processing , such as specifying additional levels of sub - template files . for the purposes of simplicity , the present example is shown with only one level of sub - templates . as shown in fig3 the merge task will access a copy 25 ′ of the template display list and will also access a first record 46 from the merge file 16 . note that the first record has record fields , in the form of text strings , for each of the field names var1 , var2 , var3 and var4 . for the field name picture , the record includes a name ( in this example either a or b ) corresponding to the sub - template to be inserted for the variable data identifier having the field name “ picture .” the merge task accesses the rendering commands from the copy of the template display list 25 ′ to add to a merged display list 30 . such rendering commands will be processed by the rendering task 32 to generate the bit maps 48 for the static data areas from the template pdl specification 14 to appear in the merged bitmap 52 . the merge task will link the cached graphic states 23 to the to the record fields by matching the field names associated with the cached graphic state to the field names in the merge file . for example , the cached graphic states for the variable data identifier 40 having the field name “ var1 ” will be linked to the record fields in the merge file under the field name “ var1 .” once linked , the merge task will apply the graphic states 23 to the data in the associated record field to create rendering commands for such data , which are to merged into the merged display list 30 . such rendering commands will be processed by the rendering task 32 to generate the bit maps 50 in the merged bitmap 52 . this is done for each of the graphic states in the cache . when the merge task reaches the place holder 23 ′ in the template graphic states cache , it will link the place holder 23 ′ to the to the record fields by matching the field name associated with the the place holder 23 ′ to a field name in the merge file . for example , the he place holder 23 ′ for the variable data identifier 40 having the field name “ picture ” will be linked to the record fields in the merge file under the field name “ picture .” the field name in the record will identify which of the sub - templates to merge into the merged display list 30 and eventually into the merged bitmap 52 . because the merge record 46 indicates that the sub - template “ b ” is to be used , the merge task accesses the sub - template display list 44 b and merges its rendering commands into the merged display list 30 . such rendering commands will be processed by the rendering task 32 to generate the bit maps 54 in the merged bitmap 52 . the merge task also accesses the associated cache of graphic states for the sub - template , and applies the graphic states to the record fields linked to the graphic states so as to generate rendering commands for the data of the record fields that are to be merged into the merged display list 30 . such rendering commands will be processed by the rendering task 32 to generate the bit maps 56 in the merged bitmap 52 . note that if this sub - template “ b ” included a further level of sub - templates , the cache graphic states for the sub - template would also include a place holder , and the merge task would access the sub - templates associated with this place holder for another level of sub - template processing . the final merged big map 52 includes the static data bitmaps 48 defined by the template pdl file 14 , the static data bitmaps 54 defined by the sub - template “ b ” pdl file 15 b , the variable data bitmaps 50 having the graphic attributes corresponding to the cached graphic states for the variable data identifiers 40 in the template pdl file 50 , and the variable data bitmaps 56 having the graphic attributes corresponding to the cached graphic states for the variable data identifiers 40 in the sub - template “ b ” pdl file 15 b . the location of the bit maps 54 , 56 from the sub - template “ b ” pdl specification can be defined by the job ticket file ( see the appendix to this disclosure ). furthermore , it is within the scope of the invention to include a graphic state or graphic attribute with the place holder that corresponds to the location of the variable data identifier ( this graphic attribute may also include other information such as orientation , size , etc .). this additional graphic attribute may be stored with the place holder and applied to the bit map data from the sub - template file during the merging operation . for example , a graphic state corresponding to the location of the variable data identifier having the attribute 42 corresponding to the sub - template may be stored with the place holder in the graphic state cache to direct the merge task to place the bit maps from the sub - template in the merge bit map 52 in the location directed by the stored graphic state . an embodiment of the present invention is illustrated by way of example in fig4 - 8 . as illustrated in fig4 the job ticket file 12 contains a group header 60 “[ pagedescriptionlanguagefile ]” indicating that the phrases below that group header 60 are the names of page description language files to be processed by the control task . in the present example , there are two page description language files : a file “ letter_master ” 62 and a file “ all_maps ” 64 . the job ticket file 12 includes a group header 66 “[ letter_master ],” under which are defined the location and attributes for that pdl file . note that with this pdl file no attributes are defined and only the path location for the file is indicated . another group header “[ all_maps ]” defines the path and attributes for the all_maps pdl file . note that an attribute string 70 “ subtemplate = true ” indicates that this file is a sub - template file and the attribute string 72 “ templates = south , east , west , midwest ” indicates that the file includes four sub - templates , named south , east , west and midwest . the job ticket also includes a group header 74 “[ mergefiles ]” identifying the names of the merge files to be used in the merge task . in the present case a single merge file is named “ merge .” below that , a group header 78 “[ merge ]” is given , under which the attributes and location of the merge file is set forth . the attribute strings for this merge file indicate that the merge file is delimited and includes merge headers . the attribute strings also indicate that the records are delimited by a carriage - return / line - feed character and the particular fields in each record are delimited by a tab character . a complete description of the different attributes that can be defined for the pdl files is described in detail in the appendix below . as illustrated in fig5 the merge file 16 has a platform - independent data file that contains the “ variable ” data to be merged into the path defined in the pdl specification , and also includes names associated with the sub - templates to be merged into the pdl specification during the merge task . the merge file in the present example includes a plurality of rows of merge records separated by carriage - return / line space characters , where each record includes the following fields : “ fname ,” “ lname ,” “ prefix ,” “ title ,” “ company ,” “ address ,” “ zip ,” “ region ,” “ city ” and “ state .” as will be described below , the data in the field “ region ” doubles as variable data and also as a name of a sub - template to be merged into the final bit maps . as illustrated in fig6 the designer will utilize an application program to create a document containing static data and variable data identifiers . the application program will then be directed to create a pdl specification of the document by the designer . the variable data identifiers 80 each include a field name surrounded by special characters , “& lt ;& lt ;” and “ & gt ;& gt ;”, and may also include an attribute string 82 following the field name and special characters . the attribute string will be described below . the pdl specification generated by the application program will include the graphic states of the variable data identifiers 80 . these graphic states can include the font size ( i . e ., 12 point ), the type - font ( i . e ., helvetica ), the orientation ( i . e ., horizontal ), the location such as x and y coordinates , and the like . as discussed above , the control task will create a display list with the rendering commands for the static data in the pdl specification and will cache the graphic states for the variable data identifiers without transferring the rendering commands for the variable data identifiers to the display list . the variable data identifier in the bottom center portion of the page includes the “ select ” attribute , indicating to the control task that a sub - template bit map is to be inserted into the document . the field name “ region ” associated with this variable data identifier indicates that the sub - template name will be under the heading “ region ” in the merge file . referring to fig5 the regions named in the merge file are south , east , west and midwest . therefore , referring to fig4 the sub - templates having the name south , east , west and midwest are found in the pdl file defined under the “ all_maps ” group header ( 68 ) in the job ticket . note that the attributes defined under the “ all_maps ” group header do not include an attribute directing the location of the sub - template . therefore , the lower left - hand corner of the sub - template merged into the final document will be directed by the locational graphic states of the variable data identifier stored along with the place holder in the graphic state cache . [ 0046 ] fig7 illustrates the sub - template pdl file 15 , including the four sub - templates : south 84 a , east 84 b , west 84 c and midwest 84 d . the merge task will access a variable data record 86 from the merge file 16 and a copy of the display list for the template pdl file 25 . as discussed above , the merge task will generate rendering commands for the variable data records in the merge file by applying the cached graphic states linked to the variable data records . these rendering commands will be merged into the merged display list along with the rendering commands from the display list for the template pdl file . the merge task will also merge the rendering commands from the display list of the sub - template named by the variable data records into the merged display list . the rendering task will process the rendering commands in the merged display list to generate the final merged bit map for the present variable data record 86 . this bit map appears in fig8 . referring to fig5 and 8 , the merge task will apply the cached graphic states linked to the variable data fields in the variable data record 86 as follows . the first graphic state in the cache will be for the first variable data identifier 80 a . the field name for this variable data identifier 80 a is “ fname ,” which in the particular variable data record , corresponds to “ shannon .” therefore , the final merged bit map will include a bit map of the text , “ shannon ” 88 a , having the graphic states for the variable data identifier 80 a . likewise , the second cached graphic state will be for the variable data identifier 80 b which includes a field name “ lname ,” corresponding to the term “ janzen ” in the particular variable data record 86 . therefore , the final merged bit map will include a bit map of the text , “ janzen ” 88 b , - 15 having the graphic states for the variable data identifier 80 b . correspondingly , the remaining graphic states , except for those of variable data identifier 88 m , which is the variable data identifier including the sub - template attribute 82 , will be processed in the same way resulting in bit maps 88 c - 88 n in the merged bitmap . when the merge task reaches the place holder in the graphic state cache associated with the variable data identifier 80 m , it will refer to the merge record for the name of the sub - template under the field name “ region ,” which in the present example is “ south .” referring to fig7 the sub - template having the name “ south ” is sub - template 84 a . accordingly , the merge file will then merge the rendering commands from the display list of the sub - template 84 a into the merged display list . some or all of these rendering commands will also be modified by a graphic attribute corresponding to the location that the sub - template is to be merged into the merged bit map . as discussed above , this graphic attribute may be taken from the graphic state of the variable data identifier 80 m or may be defined in the job ticket file . the present invention also provides for the flowing of sub - templates into a path defined by the template specification . such a feature is based upon the invention disclosed in u . s . patent application ser . no . 08 / 897 , 467 , filed jul . 18 , 1997 . specifically , the feature includes the steps of : associating a path defined by the template pdl specification with the variable data identifier with the “ sub - template ” attribute string ; and merging the sub - template ( s ) into the path according to the path boundary and according to a predefined flow rule ( as will be defined in the job ticket ). the path may be associated with the attribute string , for example , by having the pdl command for the path immediately follow the pdl command for the attribute string in the pdl specification , or by having the pdl command for the path “ grouped ” with the pdl command for the attribute string using a group command provided by the application program . the following appendix provides a preferred compilation of commands and parameter definitions that can be specified in the job ticket file 12 for the sub - template application as described above . each entry provides a particular command header , the syntax for the command , any relevant remarks for the use of the command , examples , etc . as will be appreciated by one of ordinary skill in the art , the present invention includes any and all additional functions , features and attributes detailed in the appendix . appendix [ pagedescriptionlanguagefile ] a group that provides a list of tags which you create to describe the pdl file ( s ) to be used in the print job . each tag will become a user - defined group to give additional information about a specific pdl file . syntax [ pagedescriptionlanguagefile ] pdl file tag a pdl file tag b remarks required the number of tags listed equals the number of pdl files that variscript is to interpret during the job . every tag that appears under this initial [ pagedescriptionlanguagefile ] group will become a new group name in succeeding sections of the job ticket . explanation pdl file tag a create a descriptive name for the first pdl file used in the print job . this tag is for use within the job ticket only and is not used outside of that context . pdl file tag b create a descriptive name for the next pdl file used in the print job . this tag is for use within the job ticket only and is not used outside of that context . example [ pagedescriptionlanguagefile ] cover form contents form letter form a user - defined tag name for a group that provides information about a pdl file and corresponds to a descriptive tag that you created under the initial [ pagedescriptionlanguagefile ] group . syntax [ pdl file tag ] file path = & lt ; other host access parameters & gt ; & lt ; variscript rendering parameters & gt ; templates = sub template = sub template area = see also templates remarks a separate [ pdl file tag ] group is required for each descriptive tag listed under the initial [ pagedescriptionlanguagefile ] group . case sensitivity of the values that you define depends on the host operating system . explanation [ pdl file tag ] take the descriptive tag under the initial [ pagedescriptionlanguagefile ] group and write it here as a group name within brackets []. file path = write the drive , path , and file name for the pdl file being described . the format of your notation is dependent on your host computer . see the filepath element description in chapter 3 . & lt ; other host access parameters & gt ; define values for any other host access parameter for which the default value is not accurate for access to this pdl file . see the element descriptions in chapter 3 . & lt ; variscript rendering parameters & gt ; define a value for any variscript rendering parameter which will be applied to all of the templates in this specific pdl file . these elements include psanchor , pslength , psn planes , psorientation , psresx , psresy , psrotation , psscale , psscalex , psscaley , pstranslatex , pstranslate y , and pswidth . see the element descriptions in chapter 4 . applying a variscript rendering parameter here will override the definition of the same parameter in the configuration file and in the [ jobsetup ] group this definition , in turn , can be overridden by the definition of the same parameter in the [ template tag ] group . templates = see the templates element description . subtemplate = see the sub template element description . subtemplate area = see the sub template area element description . example [ cover form ] file pate = forms / cover . ps templates = tempa , tempb , tempc , tempd templates an element that provides a list of descriptive tags which you create to represent the names of the templates in a pdl file . syntax templates = template tag a , template tag b , template tag z remarks templates is an element within the user - defined [ pdl file tag ] group . note : each descriptive template tag that you create is for use within the job ticket only and is not used outside of that context . the template tags must be unique within the print job and must appear in the order in which the templates are defined in the pdl file ( s ). a template that requires no further definition can be represented by a blank tag . each tag that appears as a parameter of templates may become a user - defined group name listed elsewhere in the job ticket . the templates statement simply lets variscript know that it is to look for user - defined groups and then provides the names ( tags ) of these groups . therefore , in theory , a pdl file with ten pages could have up to ten template tags listed within the templates element . if any templates need not be named , the order of templates can be preserved by inserting blank template tags into the list . explanation template tag a create a descriptive name for the first template in this pdl file . this tag is for use within the job ticket . template tag b create a descriptive name for the next template in this pdl file . this tag is for use within the job ticket . and so on . example templates = tempa , tempb , , tempd subtemplate an element that identifies the templates within the specified pdl file as being subtemplates . syntax subtemplate = { true \| false } remarks optional . a subtemplate is a template or pdl page that is used as an object to be inserted on another page . a default value for subtemplate is false . explanation { true \| false } if all ( or most ) of the templates within the specified pdl ffie are to be identified as subtemplates , type true . if all ( or most ) of the templates within the specified pdl file are not subtemplates , type false . example subtemplate = true subtemplate area an element that assigns a subtemplate name and describes the portion of a template to be used as a subtemplate . syntax subtemplate area = name “& lt ; subname & gt ;” x & lt ; units & gt ; & lt ; unit type & gt ;\ y & lt ; units × unit type & gt ; width & lt ; units & gt ; & lt ; unit type & gt ;\ height & lt ; unit & gt ; & lt ; unit type & gt ; see also subtemplate remarks optional if subtemplate = true . ignored if subtemplate = false . this element may be used to specify what part of a template should be used as a subtemplate and to give that extracted portion a subtemplate name . when this element is defined at a pdl file level , the system will recognize the same extracted portion of each template in the file as being a subtemplate . explanation name “& lt ; subname & gt ;” this value assigns a specific name to the subtemplate . type the word name followed by a space . for “& lt ; subname & gt ;”, type the name to be assigned to this subtemplate . enclose the subtemplate name in double quotation marks (“”). note : a subtemplate will be known by the official name of the template , unless it is given another name through the subtemplate area element . the official template name is defined by the method of highest precedence . the template name of lowest precedence is the default system - generated template name , followed by the template name you physically define on the pdl template . of highest precedence is the template name defined using the newname element in the [ template tag ] group . example : name “ mysub1 ” x & lt ; unit & gt ; & lt ; unit type & gt ; this value identifies the subtemplate &# 39 ; s offset , the horizontal distance between the left side of the template and the area to be extracted . type the character x followed by a space . for & lt ; units & gt ;, type the horizontal distance from the template &# 39 ; s left side to the beginning of the area to be extracted . an x value of 0 represents a location flush along the left side of the template . increasing the value of x locates the area to be extracted the defined distance to the right . this value is expressed in unitized format if the unit type is different from the default unit type defined in the units element . possible & lt ; unit type & gt ; values are : cm for centimeters dm for decimeters dots for dots ft for feet in for inch ( default value ) m for meters mils for mils mm for millimeter nm for nanometers pixels for pixels pts for points pulses for pulses yds for yards the default value for x is 0 . y & lt ; units & gt ; & lt ; unittype & gt ; this value identifies the vertical distance between the bottom of the template and the area to be extracted . type the character y followed by a space . for & lt ; units & gt ;, type the vertical distance from the bottom of the template to the beginning of the area to be extracted . a y value of 0 represents a location flush along the bottom of the template . increasing the value of y locates the area to be extracted the defined distance above the bottom of the template . the y value is expressed in unitized format if the unit type is different from the default unit type defined in the units element . possible & lt ; unit type & gt ; values are listed above . the default value for y is 0 . width & lt ; unit & gt ; & lt ; unit type & gt ; this value identifies the width of the portion to be extracted ( starting at the x , y coordinates ). type the word width followed by a space . for & lt ; units & gt ;, type the width of area to be extracted from the template . this measurement is the x ( horizontal ) dimension of the area to be extracted . this default value for width is equal to the width of the template . heights & lt ; units & gt ; & lt ; unit type & gt ; the value identifies the height ( length ) of the portion to be extracted ( starting at the x , y coordinates ). type the word height followed by a space . for & lt ; units & gt ;, type the height of the area to be extracted from the template . this measurement is the y ( vertical ) dimension of the area to be extracted . this value is expressed in unitized format if the unit type is different from the default unit type defined in the units element . possible & lt ; unit type & gt ; values are listed above . the default value for height is equal to the width of the template . example [ pagedescriptionlanguagefile ] ps1 ps2 [ ps1 ] file path = / mydir / mypsfile . ps templates = temp1 , temp2 psscale = . 8 [ ps2 ] file path = / mydir / mysubtmp . ps subtemplate = true templates = temp3 , temp4 , temp5 , temp6 subtemplate area - x 1in y 2in width 3in height 4in this example depicts two pdl files . file ps1 is a “ normal ” pdl file containing two “ normal ” templates file ps2 is identified as a subtemplate file ( subtemplate = true ). the same area ( subtemplatearea ) on each template is ps2 will be defined as a subtemplate . this area represents a 3 - inch wide by 4 - inch long portion starting from 1 inch to the right and 2 inches above the lower left corner of the template . since no name & lt ; subname & gt ; value is given , each subtemplate will take the official name of its template . [ template tag ] a user - defined tag name for a group that provides information about a template and corresponds to a descriptive tag that you create within the templates element . syntax [ template tag ] & lt ; variscript rendering parameters & gt ; new name = & lt ; template new name & gt ; sub template = sub template area = see also templates remarks optional . a separate [ template tag ] group is required for each descriptive tag listed in the templates element which you will identify as a subtemplate or assign a new template name or a template - level marketing parameter . explanation [ template tag ] take the descriptive tag within the templenames element and write it here as a group name within brackets []. & lt ; variscript rendering parameters & gt ; define a value for any variscript rendering parameter which will be applied to this specific template . these elements include psanchor , pslength , psnplanes , psorientation , psresx , psresy , psrotation , psscale , psscalex ; psscale y , pstranslater x , pstranslate y , and pswidth . see the element descriptions in chapter 4 . a rendering parameter applied within this group has the highest precedence . it will override the definition of the same parameter in the configuration file , in the [ jobsetup ] group , and in the [ pdlfiletag ] group . newname = see the newname element description subtemplate = see the subtemplate element description . subtemplate area = see the subtemplate area element description . example [ tempa ] newname = lotto_tikt psscale = 0 . 8125 subtemplate = true newname an element that defines a new name for the specified template . this new name overrides the system - generated default template name or the template name that you may have placed directly on this template within the pdl file . syntax newname = & lt ; templatenewname & gt ; remarks optional . the template receives its name in one of three ways : the system automatically generates a default template name . ( lowest precedence ) you can physically name the template when you are working in your design application ( for example , quarkxpress ) before you output to a pdl file . you can define a new template name in the job ticket within the newname element . ( highest precedence ) variscript will recognize only one template name for each template . therefore , a template name assigned by using a method of higher precedence will overwrite a name of lower precedence . for example , a name defined directly on the template will overwrite the system - generated default , and , in turn , be overwritten by a name defined using the newname element . the newname element does not have a default value . explanation & lt ; templatenewname & gt ; specify the template &# 39 ; s new name . example newname = lotto_tikt subtemplate an element that identifies this templates as being a subtemplate . syntax subtemplate = { true \| false } remarks optional . a subtemplate is a template or pdl page that is used as an object to be inserted on another page . the default value for subtemplate is false . explanation { true \| false } if this template is to be identified as a subtemplate , type true . if this template is not a subtemplate , type false . example subtemplate = true while the forms of apparatus and procedure herein described constitute preferred embodiments of the invention , it is to be understood that the invention is not limited to such precise embodiments , and that variations can be made therein without departing from the scope of the invention .	6
the present invention relates to a bone core channel filling prosthesis and method for implanting same . although the present invention is especially suited for use in core channels created by a core decompression of the femoral head , persons of ordinary skill in the art will recognized that the present invention can be used as a bone core channel filling prosthesis in any other type of bone or clinical indication . referring to fig1 a , there is shown an exemplary preferred embodiment of the bone core channel filling prosthesis made in accordance with the present invention designated by the numeral 10 . the filling prosthesis 10 comprises a machined cylindrical rod - shaped member 12 having a first end 14 and a second end 16 . the rod - shaped member 12 has a preferred diameter of approximately 10 mm and a preferred length of approximately 100 mm . one of ordinary skill in the art will recognize , however , that in order to accommodate a broad patient population , the rodshaped member can also be manufactured in other diameters and length combinations . the filling prosthesis 10 includes fixation means for affixing the prosthesis within the core channel . in the preferred embodiment shown , the fixation means comprises a single helical thread 18 having approximately four 360 ° thread rotations , disposed on the outer surface of the rod - shaped member 12 . as shown in fig1 b , the thread 18 defines a major diameter 20 of approximately 12 mm and a minor diameter 22 of approximately 10 mm . the pitch 24 of the thread 18 is approximately 3 mm . each thread rotation includes a substantially flat inclined leading face 26 , a substantially flat inclined trailing face 28 , a substantially flat crest 30 and a substantially flat root 32 . the inclined leading face 26 and the inclined trailing face 28 define an angle 34 of approximately 30 . 0 °. the trailing end of the thread 18 starts approximately 10 mm from the second end 16 of the rod - shaped member 12 and extends therealong approximately 20 mm . the thread 18 of the filling device 10 cuts into the wall of the core channel 46 as shown in fig2 to provide immediate intraoperative stability to the femoral head 42 and neck 44 and to prevent the filling prosthesis 10 from dislodging from the core channel 46 . referring again to fig1 a , the first end 14 of the rodshaped member 12 has a full spherical radius 36 which allows the first end 14 of the rod - shaped member 12 to be easily inserted into the core channel to reside in the femoral head . the second end 16 of the rod - shaped member 12 includes turning means for screwing the filling prosthesis 10 into its final seating position in the core channel of the femoral head . in the preferred embodiment shown , the turning means comprises a slot 38 which extends diametrically along the second end of the rod - shaped member 12 and a pair of opposing recesses 40 as best seen in fig1 a and 1c . the slot 38 and the pair of opposing recesses 40 are adapted to receive a filling prothesis driving tool ( not shown ). the filling prosthesis 10 described above , should be made from a highly porous material having a structure of interconnecting pores which accommodates tissue ingrowth , revascularization and deposition of new bone . the material chosen should allow for accurate machining to enable the filling prosthesis to properly fill the cored channel . the use of a material having a volumetrically large porous structure is important in the present invention because such a structure is complementary to the microstructure of natural cancellous bone and thus , enables the filling prosthesis 10 of the present invention to operate as a matrix for the biological ingrowth of bone . the porous structure of the filling device of the present invention , operates as a conduit from the healthy , vascularized bone into the avascularized bone of the necrotic area . the pores of the filling prosthesis 10 should form a three dimensional network of continuously connected never - ending channels which define a bulk volume porosity of approximately 50 - 90 percent and preferably greater than 80 percent . such a network provides optimal permeability and a high surface area which encourages tissue ingrowth , vascularization , and deposition of new bone . the material used in the present invention should also have a high corrosion and crack resistance , and be biocompatible . in the preferred embodiment of the present invention , the filling prosthesis is made from an open - celled lattice tantalum - carbon composite material available from implex corporation , the assignee herein , under the tradename hedrocel . hedrocel is well known in the art as a composite of reticulated vitreous carbon foam and tantalum metal . the tantalum metal provides the carbon foam with the requisite mechanical properties which the carbon foam does not , by itself , possess . the composite is made by applying tantalum metal to a reticulated vitreous carbon foam construct in a chemical vapor infiltration process ( cvi ), which is a variation of chemical vapor deposition ( cvd ). tantalum has a long history of use as an implant material in bone tissue since it possesses good mechanical a properties , excellent corrosion resistance and demonstrated biocompatibility . the following method viewed in conduction with fig2 describes how the filling prosthesis of the present invention is used to treat a necrotic region in the femoral head 42 . the method comprises removing a core of bone from an anterolateral segment of the femoral head 42 to provide an open channel 46 therein . the first end 14 of the filling prosthesis 10 of the present invention is then inserted into the open channel 46 until the threads 18 contact the external lateral femoral bone 47 . then , a filling prosthesis driving tool ( not shown ) is used to turn the filling prosthesis into its final position in the bone as depicted in fig2 . in hard bone , a tapping instrument can be used in a preparation to receive the threads of the filling prosthesis . the filling prosthesis of the present invention overcomes the problems associated with the bone grafting techniques described earlier which provide insufficient structural stability to the bone . further , the filling prosthesis of the present invention possesses the needed biological interface characteristics that are lacking in the prior art solid metal drills and threaded pins . it should be understood that the embodiment described herein is merely exemplary and that a person skilled in the art may make many variations and modifications to the embodiment utilizing functionally equivalent elements to those described herein . any and all such variations or modifications as well as others which may become apparent to those skilled in the art , are intended to be included within the scope of the invention as defined by the appended claims .	0
in order to increase processing speed of color correction for computer image , the present invention provides a method of color correction . main principle , particular process and advantageous effects that should be achieved by embodiments of the present invention will be described in detail with reference to the drawings . in an embodiment of the present invention , a computer image is divided into several smaller image blocks , if various color component values of all pixels in an image block are equal , only one pixel needs color correction processing , and the processing result of the color correction is suitable for other pixels in the image block ; on the other hand , if the values are not equal , color component values and the color correction processing result of a previous pixel or a previous row / column of pixels are cached , and if color component values of the next pixel or the next row / column of pixels are equal to the color component values of the previous pixel or the previous row / column of pixels , the processing result of the color correction on the previous pixel or the previous row / column of pixels is suitable for the next pixel or the next row / column of pixels . in an embodiment , a particular process of color correction applied to an input computer image as shown in fig2 , comprising the following steps : step 101 , the input image is virtually divided into image blocks with a width of m pixels and a height of n pixels . in order to achieve a better effect , the value of m may be equal to the value of n and both of them are power of 2 . at this time , values of the same color surface of a plurality of pixels or values of different color surfaces of one pixel may be combined into a large unit to compare , so that times of comparing can be reduced effectively . step 102 , if all color component values of all pixels in an image block are equal , that is , the image block is composed of pixels with a single color , such an image block is a simple block ; otherwise , the image block is not a simple block , and it is referred to as a complex block . finally , the detection result is recorded . here is an example of an image data stored in color surfaces , effect of the whole detection process of a simple block is described by way of pseudo codes : // w represents an actual width of the image block in unit of // h represents an actual height of the image block in unit of // the width of image blocks in the rightmost column may be // the height of image blocks in the lowest row may be less // pc points to cyan version data of a pixel at the upper left corner of the input image , p points to cyan version data // pixel at the upper left corner of a image block at the i th row // determining whether cyan version data of the image block is equal to the cyan version data of the pixel at the upper left // if it is determined that the current image block is not a if the image data is stored in pixels , the above process may need changing accordingly . the meaning of signblock can be seen in table 1 . in the table , true represents that a specified image block is a simple block , and false represents that a specified image block is not a simple block . in order to make the present invention have a better effect , adjacent simple blocks with the same color value may be combined into a large simple block . similarly , adjacent complex blocks may be combined into a large complex block . in this way , the number of blocks of the whole image may be reduced , and the processing speed may be increased . for example , the image blocks shown in table 1 may be combined into the image blocks in table 2 . step 103 , for the simple blocks , steps 1 - 5 in the process of the color correction of the prior art can be simplified significantly . there is no need to complexly calculate pixel - by - pixel . only a certain pixel needs calculating , and the calculating result can be copied to all pixels of the simple block after all processing is finished . since the process of dithering will cause a simple block no longer to be a simple block , in order to make the present invention have a better effect , the simple blocks may not be involved into the process of dithering , that is , during the process of dithering , all component values of all pixels in a simple block stay constant . step 104 , for the complex blocks , color component values and the processing result of a previous pixel are stored during the process of the color correction . step 105 , the various color component values of the next pixel are compared to those of the previous pixel . step 106 , if the various color component values of the next pixel are equal to those of the previous pixel , no process is needed , and the stored processing result of the color correction on the previous pixel is directly copied . here is an example of a process of total volume of ink controlling by proportionally reducing color components , and an effect of above buffering technique is described by way of pseudo codes , wherein prevdot represents color values of a previous pixel before the process , procdot represents processed color values of the previous pixel , and p is a pointer pointing to color values of the current pixel , which is assumed to be stored in pixels . // if the color values of the current pixel are consistent with the above method is a buffer applied for a single pixel , so it is referred to as a point buffer . due to a strong relativity between adjacent pixels in an image , the solution of the point buffer reduces complex calculation , and makes a good effect of speeding up . as a special example of the point buffer , a line buffer method may also be applied . the line buffer method means that color component values and the processing result of a previous row / column of pixels are stored during the process of the color correction ; in this way , a pixel in the next row / column with the same color component values as those of a pixel in the previous row / column at the same position does not need processing , and the stored processing result of the color correction on the pixel in the previous row / column is directly copied to the pixel in the next row / column at the same position . here is an example of steps of color space transformation in the process of the color correction , and an effect of the line buffer method is described by way of pseudo codes . wherein prevline represents color values of the previous row / column of pixels before the process , procline represents processed color values of the previous row / column of pixels , p is a pointer pointing to color values of the first pixel in the current row / column which is assumed to be stored in pixels , and w is the width of the current image . // if values of a pixel are equal to those of the pixel in the // the color values of the current pixel is copied to a // performing icc conversion , please be noted that the index is process and using it at the time of processing the next row / column further , if the relativity between the two adjacent rows / columns is small during the process of comparing , abandon the comparing and directly process the current row / column of pixels ; however , the good environment ( prevline and procline ) needs reserving so that it can be used at the time of processing the next row / column . if there are three rows of image data , the relativity between the first row and the second row is small , but the relativity between the second row and the third row is large ( such a situation is common in data image ). the process is in such a way : after detecting that the relativity between the first row and the second row is small , an optimized process of the color correction is no longer performed to the second row of data . at this time , prevline is very likely unchanged ( pointing to the image data in the first row ). however , prevline must point to the image data in the second row before processing the third row of image . in this way , the relativity between the second row and the third row may be used when processing the image data in the third row . see the following schematic codes : the same as the point buffer method , the line buffer method can effectively use the strong relativity between adjacent pixels in an image to achieve the goal of reducing the amount of computation . in order to make the present invention have a better effect , after the detecting step of the simple block , if the input image data is not stored in pixels , the image is rearranged to be stored in pixels . the reason for arranging it after detecting the simple block is that there is no need to store a simple block in pixels . in other words , performing rearrangement is only applied to complex blocks . the effect of the method is shown in the following pseudo codes : // first , determining whether the current image block ( the i th row // w and h are width and height of the current image block pnew is a pointer pointing to the image block data stored in pixels after the process . by rearranging the image , for certain steps in the process of the color correction , especially for the step of color space transformation , speed of processing image data arranged in pixels is much higher than that of processing image data arranged in color surfaces . another embodiment of the present invention provides a device for color correction . as shown in fig3 , the device comprises a dividing unit 201 , a determining unit 202 , a processing unit 203 , and a storage unit 204 . wherein , the dividing unit 201 is used for dividing an image into image blocks and sending data of the image blocks to the determining unit 202 and the processing unit 203 , and further combining adjacent image blocks to form new image blocks ; the determining unit 202 is used for determining whether various color component values of all pixels in a image block are equal , and further determining whether the color component values of the next pixel in a complex block are equal to those of a previous pixel stored in the storage unit 204 ; the processing unit 203 is used for processing color correction on pixels and storing processing results of the color correction in the storage unit 204 . the storage unit 204 is used for storing the results from the process of the color correction on pixels and sending the results to the determining unit 202 . with the above color correction device , a goal of increasing processing speed can be achieved by performing simplified processing for certain image parts with special features , and the processing speed of the color correction can be increased without substantially influencing the present color correction effect . obviously , various modifications and variations can be made by those skilled in the art without departing from the spirit and the scope of the present invention . the present invention intends to cover all these modifications and variations if they fall in the scope claimed by the claims of the present invention and their equivalence .	7
in fig1 and 2 , the reference numeral 1 designates a device for feeding in succession stacks 2 of substantially flat cutouts 3 to a packaging machine 4 ( which is partially shown ). the machine 4 comprises a case 5 which in turn comprises two vertical plates 6 and an inclined plate 7 for connecting the top ends of said plates 6 . two l - shaped wings 9 are rigidly coupled to an outer surface 8 of the plate 7 ( fig1 to 6 ), extend at right angles to said plate 7 , and are arranged in mutually spaced positions along a direction orthogonal to the plates 6 . the wings 9 are angular wings comprising respective plates 10 that face one another and are parallel to the plates 6 and respective plates 11 which are mutually co - planar and extend towards each other starting from the associated plate 10 and at right angles thereto . the wings 9 and the plate 7 form a magazine 12 which is part of the device 1 and is suitable to accommodate a plurality of stacked cutouts 3 to be fed to an input ( not shown ) of the machine 4 normally formed through the plate 7 , which acts as a base plate for the magazine 12 . again with reference to fig1 and 2 , the device 1 furthermore comprises an input conveyor 13 arranged above , and adjacent to , an upper end of the plate 7 to cause the stacks 2 to advance to a loading station 15 in succession and in a direction 14 substantially horizontal and parallel to the plates 6 , and comprises a transfer conveyor 16 which causes the stacks 2 to advance in succession in a direction 16a to transfer said stacks 2 from the loading station 15 to an unloading station 15a which is formed by the magazine 12 and is offset in a downward direction with respect to said station 15 . the conveyor 13 comprises two mutually adjacent belts 17 and 18 which are wound in a loop around respective rollers 19 and 20 ( only two of which are shown in fig2 and 3 ) and form a transport plane p parallel to the direction 14 and forming a non - zero angle a ( fig5 ) with the surface 8 . the rollers 19 and 20 , adjacent to the case 5 , are keyed on a common hollow motorized supporting shaft 21 which is arranged at the station 15 and lies along an axis 22 . the shaft 21 is at right angles to the direction 14 , is parallel to the surface 8 and to the plane p , and is supported by two posts 23 extending vertically upwardly from said case 5 . the transfer conveyor 16 comprises a supporting bracket formed by two arms 24 which lie at right angles to the axis 22 . each arm 24 lies on the outside of an associated post 23 and has a respective end portion keyed on a common actuation shaft 25 which is coaxial and internal to the shaft 21 and can rotate about the axis 22 under the action of a motor 26 supported by one of the posts 23 . the arms 24 have respective end portions which are opposite to those keyed on the shaft 25 and are rigidly connected to a beam 27 which is parallel to the axis 22 . respective end portions of two mutually parallel and spaced cylindrical rods 28 are rigidly connected to the opposite ends of the beam 27 , said rods extending in a cantilevered manner from said beam 27 in the direction 16a which is at right angles to the axis 22 and to the arms 24 and having respective opposite ends mutually rigidly connected by an additional beam 29 which is parallel to the beam 27 . the rods 28 can oscillate , under the action of the motor 26 and about the axis 22 , between a first stroke limit position , shown in fig1 in which the direction 16a is parallel to the direction 14 , and a second stroke limit position , shown in fig6 in which the direction 16a lies parallel to the surface 8 of the plate 7 . the rods 28 form a guide 28a for a slider 30 that comprises two sleeves 31 ; each sleeve is coupled to an associated rod 28 so that it can slide axially , and said sleeves are mutually connected by a beam 32 which is parallel to the beams 27 and 29 . the slider 30 can move along the rods 28 between two extreme stroke limit positions under the action of a screw - and - nut transmission 33 ( fig2 ) comprising a nut 34 formed through the beam 32 and a screw 35 which lies between the rods 28 parallel thereto , engages the nut 34 , and is actuated by its own actuation means constituted by a motor 36 , supported by the beam 27 . a fork 37 for picking up the stacks 2 in the station 15 and transferring said stacks 2 to the magazine 12 is rigidly connected to the slider 30 . the fork 37 is substantially l - shaped and comprises a plate 38 and a post 39 which are mutually perpendicular and rigidly connected ; their width , measured parallel to the axis 22 , is smaller than the distance between the belts 17 and 18 , than the distance between the plates 11 of the magazine 12 , and than the width of the stacks 2 . the plate 38 lies parallel to the rods 28 , whereas the post 39 is rigidly connected to the beam 32 by a pair of brackets 40 . the length of the brackets 40 and of the arms 24 chosen so that when the rods 28 are arranged in their first stroke limit position and the fork 37 is arranged inside the station 15 , the plate 38 of said fork 37 lies between the belts 17 and 18 in a position which is co - planar to the plane p ; whereas when the rods 28 are arranged in their second stroke limit position and the fork 37 is arranged proximate to the magazine 12 , said fork 37 lies in the space between the rods 28 and the surface 8 so that its plate 38 lies at a distance from the surface 8 ( fig5 and 6 ) which is smaller than the length of the wings 9 . the operation of the device 1 is now described starting from the condition in which the guide 28a arranged in its first position , a stack 2 is arranged the station 15 , the slider 30 is arranged in an intermediate position between the beams 27 and 29 , and a presence sensor , which is known and not shown and is located proximate to the magazine 12 , detects that a stack 2a placed in said magazine 12 is about to end . starting from this condition , a known control unit , not shown , activates the motor 36 so as to move the slider 30 towards the beam 27 until the plate 38 of the fork 37 lies between the belts 17 and 18 and is in contact with a first cutout 3 of the stack 2 and the post 39 is in contact with a lateral surface of said stack 2 . at this point said control unit not shown , deactivates the motor 36 and activates the motor 26 , which rotates the arms 24 counterclockwise in fig1 about the axis 22 until the guide 28a reaches its second stroke limit position and accordingly the plate 38 lies parallel to the surface 8 . then said control unit ( not shown ) deactivates the motor 26 and activates the motor 36 , which by virtue of the transmission 33 gradually moves the slider 30 towards the beam 29 . during this movement , the fork 37 advances through the magazine 12 , passing between the wings 9 , whereas the stack 2 being transferred initially occupies the space between the plates 10 and is then stopped by the plates 11 , which retain it inside the magazine 12 , allowing the extraction of the plate 38 and the consequent resting of the stack 2 on the remaining cutouts 3 of the stack 2a ( fig6 ). once the stack 2 has been released , the fork 37 continues in its motion , moving beyond the magazine 12 , and stops in a stroke limit position in which the slider 30 arranges itself adjacent to the beam 29 . when the height of the stack 2 arranged in the magazine 12 reaches a limit value , said sensor ( not shown ) sends a signal to the control unit ( not shown ) which , in response to the received signal , first of all activates the motor 26 , which returns the guide 28a to its first operating position by means of the arms 24 , and subsequently activates the motor 36 , which moves the fork 37 into the station 15 . as an alternative to what has been described above , a stack 2 can be moved from the station 15 to the magazine 12 by removing said stack 2 from the conveyor 13 by moving the slider 30 along the guide 28 , kept in its first stroke limit position , and by subsequently activating the motor 26 before the fork 37 has covered , along the guide 28a , a distance that makes it interfere with the stack 2a before the guide 28a reaches its second position . naturally , the motors 26 and 36 can be activated simultaneously so that the rotation of the guide 28a about the axis 22 and the movement of the slider 30 in the direction 16a along the guide 28a occur simultaneously . in any case , whatever the activation sequence of the motors 26 and 36 is , it is important to note that the transferred stack 2 arranges itself in any case in a clearly defined position above the plate 38 and in contact with the post 39 before the fork 37 performs any transfer movement , and maintains this position , which is fixed with respect to the fork 37 , throughout its transfer towards the magazine 12 , thus avoiding any uncontrolled movement that might cause its breakup .	1
the invention can be described in more detail with the help of the accompanying drawings wherein fig1 shows a conventional dual - chain , cockroft - walton , or greinacher , circuit of the prior art ; fig2 shows a modified dual - chain multiplier circuit in accordance with a preferred embodiment of the invention ; fig3 shows the voltage and current wave forms as a function of time in a single ideal stage of the circuit of fig2 ; fig4 shows the voltage and current wave forms as in fig3 wherein the input r - f voltage has shorter voltage pulses ; fig5 shows a single stage of the circuit of fig2 but with two protection diodes added ; and fig6 shows a further alternative embodiment of the input portion of the circuit of fig2 . as mentioned above , fig1 shows a basic dual - chain , greinacher circuit of the prior art in which each of the stages includes side - string capacitances 10 and middle - string capacitances 11 and bridge rectifier circuits 12 . an output terminal 13 provides the desired output voltage v out across a load 14 to ground . a series inductance ( l s ) 15 may be utilized to reduce the current surge under sparking conditions ( i . e ., where a short circuit to ground temporarily occurs across the load ) and , in conjunction with the capacitance of the load or cable to reduce the ripple . the multiplier chain is supplied with an input ac voltage which as shown here is obtained from an r - f sine wave input source 16 via transformer 17 , the secondary grounded center tap of which is connected to the middle - string of the chain and the outer ends of the secondary of transformer 17 are connected to the side - string capacitances 10 . a modified dual - chain multiplier circuit 20 in accordance with the invention is shown in fig2 wherein each basic stage thereof comprises side - string - capacitance c 1 and a middle - string capacitance c 2 connected to a bridge rectifier circuit 15 as shown . inductances l 1 are connected in series with side - string capacitances c 1 , while inductance l 2 is connected in series with middle - string capacitance c 2 . an ac input voltage is supplied from an r - f square - wave input source 16 via transformer 17 , while a dc output voltage is produced at output terminal 18 across a load 19 to ground . ideally , the input voltage should be a square wave having a value ± v o and a frequency which is selected so that the first harmonic f = ω / 2π is in resonance with the series circuit l 1 , c 1 , i . e ., if it is assumed , for the moment , that l 1 is very large and c 1 is correspondingly small , such that condition ( 1 ) is fulfilled , only a sinusoidal current can pass through the two l 1 - c 1 side - string circuits of the connected stages . if it is further assumed that these series resonance circuits have no losses , then the impedance of the side - string for the first harmonic is zero . the first harmonic of the voltage across the terminals a , b of bridge rectifier 15 must , therefore , be the same as the first harmonic across the input terminals 22 , 23 ( i . e ., across the secondary of transformer 17 ). furthermore , only a first - harmonic current can flow in the side - string ( l 1 large ). since the current flowing is sinusoidal the diodes d - 1 through d - 4 , considered as ideal switches , must open and close pair - wise every half cycle in phase with the driving voltage across the terminals 22 , 23 . assume further , for the moment , that the capacitor c 2 is very large . the voltage across it is then virtually constant . the switches connect this constant voltage source to the terminals a and b , reversing polarity every half - cycle . the voltage across terminals a and b is therefore virtually a square wave . the voltages across terminals 22 and 23 and across terminals a and b are both square waves , and since , as stated above , they have , ideally , the same first harmonic , they must , again , ideally , be identical . such operation means that the voltage produced across the buffer capacitor c 2 is approximately equal to v 0 and that the input voltage to stage 2 of the generator is a square wave of approximately the same amplitude as for stage 1 , the input to stage 3 is of approximately the same amplitude as for stage 2 , and so on . again , for an ideal circuit , a removal of the condition that l 1 be large and c 1 be small has very little effect on the behavior of the circuit as long as condition ( 1 ) is fulfilled . there is virtually no ac voltage difference between points a and 22 , for instance , and therefore no potential difference to drive anything but a sinusoidal resonance current through the elements l 1 , c 1 . such situation is graphically illustrated in fig3 . the square wave 21 is the input voltage across terminals 22 and 23 and , therefore , is also approximately the voltage across terminals a and b . the current 24 is sinusoidal and so are the voltages v l . sbsb . 1 and v c . sbsb . 1 ( voltages 25 and 26 ) across the inductor l and capacitor c 1 , respectively , but ninety degrees out of phase with the current 24 . it should be noted that the ac voltage 26 across the capacitor in this steady - state condition is a maximum at the start of the cycle . it is the ac component of this voltage , rather than a voltage difference between terminals 22 and a that starts the current buildup through the inductor l 1 . the dc voltage across capacitors c 1 is v c . sbsb . 1 ≈ v o , as indicated in fig2 except in unit 1 where it is v c . sbsb . 1 ≈ v o / 2 , when the lower dc terminal is connected to the center - tap of the transformer as shown . the center - tap on the transformer in fig1 and fig2 is not necessary to achieve proper operation of either of these two types of power supplies . the center - tap does , however , provide a convenient point for defining the dc potential of the transformer secondary . if it is omitted there are certain implications for the non - destructive discharge of the supply during breakdown , discussed in detail below . the square wave primary source 16 can be fabricated as a square - wave circuit using transistors or silicon - controlled rectifiers as switches , as would be known to those in the art , with minimum power loss . the efficiency of the overall power supply of the invention is high . the use of sinusoidal currents in each of the stages is much better than the use of sharp current peaks , as in greinacher circuits . it is evident from the preceding discussion that , in the ideal situation , there is no drop in voltage from stage to stage . with n stages connected as shown , the total dc voltage developed between input terminal 24 and output terminal 18 of fig2 is then and is independent of the current . in other words , the internal impedance of the supply is ideally zero . in practice , of course , there are power losses in all components and accompanying voltage drops from stage to stage . there is also a contribution to the effective internal impedance , not accompanied by power losses , from a non - ideal primary square wave form . in practice , the latter contribution is likely to be the most significant one . the simplest case for analysis is one where the primary wave form is as shown in fig4 . as shown therein , the voltage curve 30 is constant from ωt = 0 to ωt = α , where α is an angle which is less than π radians by an amount equal to δ radians , i . e . such voltage function may be regarded as a limiting case resulting in a higher impedance than for a case which is more likely to occur in practice and is illustrated by the curve 31 . the current 32 is sinusoidal from ωt = 0 to ωt = α , but then falls to zero through a much steeper curve 32a ( also sinusoidal ). the analysis of this situation is straight forward and leads to the following approximate result for the first stage , assuming δ & lt ;& lt ; 1 radian . thus , the voltage across buffer capacitor c 2 is where i 1 is the amplitude of the current i in the lc circuit of the first unit . if there are n stages , this amplitude is related to the dc current delivered by the supply approximately by the expression : in successive stages , in the above expression , n is replaced with n - 1 , n - 2 , . . . etc . inserting equation ( 5 ) into equation ( 4 ) leads to for the first stage ( where r = δ 2 / 8fc 1 ). the sum of all voltages v c . sbsb . 2 from stage to stage is the total dc output voltage . the input voltage of a given stage is the voltage v c . sbsb . 2 from the preceding stage . the total voltage can therefore be calculated as follows : the current flowing in the lc circuit is reduced from stage to stage as the factor ( n - 1 ). the total voltage is found by summing over all n units . the result is ## equ1 ## as an example , consider a high voltage power supply with n = 8 , v o = 16 kv , f = 50 khz , δ = 0 . 3 , and c 1 = 0 . 01 μf . the internal impedance , as given by equation ( 7 ), is r i = 4590ω . the no - load voltage is 128 kv , and for a current i dc = 150 ma the voltage drop is δv = 689 volts or 0 . 54 percent . the peak current in the inductors and capacitors of the first stage is 1 . 88 amps and the peak voltage across each component is 600 volts the inductor l 1 is 1 . 01 mh and in bulk considerably smaller than the capacitor c 1 . the peak - to - peak ripple across c 2 , assuming c 2 = c 1 = 0 . 01 μf , is calculated to be 31 . 5 volts , pg , 13 which is only 0 . 2 percent of the dc voltage . hence , the assumption made earlier that c 2 is &# 34 ; large &# 34 ; is reasonable in this case . the ripple frequency is , of course , the second harmonic 2f with some relatively weak higher harmonics . the circuit shown in fig2 produces a positive high voltage at terminal 18 if terminal 24 is grounded . obviously , the diodes can be reversed to produce a negative high voltage . alternatively , each stage can be reversed , a configuration which is equivalent to driving the supply from the top rather than from the bottom , as shown . the inductors l 2 in fig2 are not necessary for the operation of the device as described above . they may be included in some applications , however , since they will serve to reduce the ripple voltage . as described below , they also have an important function in reducing the short - circuit current in the case of a breakdown in the load . the filtering action of l 2 depends upon the capacitance to ground of the terminal or cable and load . as discussed further below , it may be advantageous to make l 2 c 2 = l 1 c 1 which means that l 2 is quite small . if the terminal or cable capacitance ( assume a capacitance c 3 ) is low , it is important to assure that the circuit consisting of n l 2 &# 39 ; s and c 2 &# 39 ; s combined with c 3 does not produce a series resonance condition for the second harmonic 2f . such series resonance condition can be prevented by using an extra filtering inductor ( not shown ) in the high - voltage lead and this will also serve to reduce the short - circuit current . for most applications the components of the power supply are chosen such that the ac voltage across capacitors c 1 is small compared to v o . it then becomes possible to reduce the number of inductors l 1 , for instance , by eliminating the inductances in alternating stages , for example , and increasing the inductance values in the remaining stages accordingly such that the resonance condition ( equation ( 1 ) above ) is substantially fullfilled for the total impedance of the full length of each side - string . for very many applications the high voltage is occasionally short - circuited , for instance , by a breakdown of a high - voltage accelerating gap or accelerating tube . in particular , if the breakdown occurs in vacuum , it is exceedingly fast ( a &# 34 ; picoseconds &# 34 ; wavefront ). it is always important to limit the stored energy extractable from the power supply in such a breakdown . the inductors l 2 tend to serve this purpose by limiting the current that can be instantaneously extracted from the buffer capacitors c 2 . when in a break - down , the high - voltage lead 18 in fig2 is short - circuited to the ground lead 24 , each of the capacitors c 1 and c 2 are presumably charged to a voltage v o . therefore , each of the inductors l 1 and l 2 will experience a voltage drop v o . the short circuit current will build up sinusoidally for the side - strings , through the two diodes d - 1 and d - 2 in the last stage . after one half cycle the capacitors are discharged , but the current continues to flow . for the middle line , the capacitors are bypassed by the diodes which will prevent a negative voltage buildup across the capacitors c 2 . the current will then decay exponentially . in the two side - strings there are no diodes in parallel with the capacitors c 1 . to facilitate a smooth decay , an alternative configuration can be used wherein diodes 35 are connected across the capacitors c 1 , as shown in fig5 . these diodes have to carry a maximum surge current of each of the two diodes d - 1 and d - 2 in the last stage have to carry the surge current in a side - string as well as half the current in the middle - string , i . e ., 50 percent more than diodes 35 , assuming c 1 = c 2 and l 1 = l 2 . for the example given above this total surge current is i surge = 75 . 6 amp . if the diodes d - 1 and d - 2 cannot carry this current , a surge resistor r s ( or a suitable inductor ), capable of carrying the full high voltage for a short time , must be inserted in the high - voltage lead , as shown in fig2 . as shown in fig2 the input voltage is supplied via a high - frequency transformer with center - tap secondary . alternatively , such voltage can be supplied via two or more transformers 36 with parallel primaries , as depicted in fig6 for the case of two transformers . if the transformers 36 are identical and the surge currents i surge in the left and right side - strings are equal , as shown , there will be no induced over - voltage across the terminals connected to the rf input source . the leakage inductance of the input transformers must be small so as to limit the voltage across the secondary during a surge . to ensure uniform discharge of the three input lines , it is beneficial in some applications to insert an additional inductor l 4 as shown in fig6 . inductor l 4 should be made substantially equal to the leakage inductance in the transformers . as mentioned above the center - tap of the secondary or secondaries is not necessary for the correct operation of the device . it merely provides a convenient point for defining the dc potential of the secondary . this can also be done by other means easily devised by those skilled in the art . if point 24 of fig1 is not connected to a center - tap on the secondary or secondaries , for example , the surge current in the side - strings will pass through diodes d - 3 and d - 4 and inductor l 2 of the first stage . these components must be dimensioned accordingly . for some applications , such as injectors for pulsed accelerators , and the like , a very heavy current is drawn from the capacitors during the pulse . the capacitors c 2 in fig2 can in principle be made arbitrarily large , and the inductors l 2 can be eliminated for such applications . thus , as can be seen in the above discussion , the modified greinacher configuration of the invention provides the advantages of rectifier - multiplier chain operation without the disadvantages of the conventional greinacher circuits of the prior art . moreover , the circuit of the invention is relatively simple in configuration and is relatively inexpensive , and does not require low component tolerances , in comparison with the alternative configurations discussed above with respect to the traveling wave configuration , the standing wave configuration , and the cascade transformer configuration of the prior art . the overall circuitry shown in fig2 can be fabricated in a relatively small package for many applications depending on the frequency and the output voltage required , and depending on the number of stages which are needed to produce such output voltage . while the configuration discussed with reference to fig2 - 6 depict preferred embodiments of the invention , modifications thereto within the spirit and scope of the invention may occur to those in the art and the invention is not to be deemed as limited to the particular embodiments described above , except as defined by the appended claims .	7
a radio frequency integrated circuit and a method for manufacturing the same in accordance with a preferred embodiment of the present invention will now be described in detail with reference to the accompanying drawings . in the case that it is described that one film is disposed ‘ on ’ another film or a semiconductor substrate , one film can directly contact another film or the semiconductor substrate , or the third film can be positioned between them . in the drawings , a thickness or size of each layer is exaggerated to provide clear and accurate explanations . wherever possible , the same reference numerals will be used throughout the drawings and the description to refer to the same or like parts . fig1 a to 1 g are cross - sectional views illustrating a method for forming an inductor having a via contact plug on a first wafer to form a radio frequency semiconductor device such as an rf - cmos , bipolar / sige and bicmos in accordance with the preferred embodiment of the present invention . referring to fig1 a , a large vertical via hole 12 is formed by etching a portion of a first semiconductor substrate 11 . the large vertical via hole 12 is an essential element for forming an inductor structure having a high performance by using a cip in accordance with the present invention . a depth of the large vertical via hole 12 is determined by considering a distance capable of preventing generation of a parasite capacitance between a substrate , in which typical elements are formed , and the inductor . that is to say , the depth of the large vertical via hole 12 plays a role of determining the distance between the inductor and the substrate to be formed on the wafer . therefore , the large vertical via hole 12 is formed to have a size of about 0 . 5 μm to about 50 μm and a depth of about 1 μm to about 300 μm . referring to fig1 b , an insulating layer 13 is formed on a surface of the first semiconductor substrate 11 having the large vertical via hole 12 . the insulating layer 13 is formed is formed with a low temperature oxide ( lto ) or a hot temperature oxide ( hto ). the insulating layer is formed to prevent that metal ions are penetrated to the substrate 11 when a diffusion barrier layer or a seed layer is formed at a post process . referring to fig1 c , a photoresist layer 14 is coated to form an inductor structure on the first semiconductor substrate 11 in which the insulating layer 13 is formed . a thickness of the photoresist 14 determines a thickness of a metal wire forming the inductor . referring to fig1 d , a damascene pattern 15 defined by the photoresist pattern 14 p by patterning a portion of the photoresist layer 14 including a portion which the large vertical via hole 12 is located is formed . the damascene pattern 15 is structurally connected to the large vertical via hole 12 . referring to fig1 e , a diffusion barrier layer 16 and a seed layer 17 are sequentially formed on the first substrate 11 including the large vertical via hole 12 and the damascene pattern 15 . the diffusion barrier layer 16 is formed with a material selected from a group consisting of ionized pvd tin , cvd tin , mocvd tin , ionized pvd ta , ionized pvd tan , cvd ta , cvd tan , cvd wn , pvd tialn , pvd tisin , pvd tasin , cvd tialn , cvd tisin , cvd tasin and stacked material thereof at a thickness of about 100 å to about 400 å . the seed layer 16 is formed with a metal selected from a group of cu , ag , au , ti and al by using a pvd method , a cvd method , an ald method , an electro plating method or an electroless plating method at a thickness of about 50 å and 3000 å . referring to fig1 f , after filling the large vertical via hole 12 and the damascene with a conductive material , a chemical mechanical polishing ( cmp ) process is carried out until the upper surface of the photoresist pattern 14 p is exposed , so that an inductor 18 is formed in the damascene pattern 15 and a via contact hole 19 is formed in the large vertical via hole 12 . the conductive material forming the inductor 18 and the via contact plug 19 may be cu , al or w which is typically used as an inductor material in a semiconductor device . a filling process of the conductive material can be achieved by using a general plating process , a selective plating process , a general deposition process , a selective deposition process or the like . referring to fig1 g , after the inductor 18 and the via contact plug 19 are formed , a backside of the substrate 11 is grinded through a backside grinding process until the backside of the via contact plug 19 is exposed . therefore , a first wafer 100 , in which the inductor 18 and the via contact plug 19 are formed , is fabricated . fig2 is a cross - sectional view illustrating a method for forming a logic device having a multi - layer wiring structure on a second wafer in order to the radio frequency semiconductor device such as the rf - cmos , bipolar / sige and bicmos in accordance with the preferred embodiment of the present invention . referring to fig2 , a device isolation layer 22 is formed on a second semiconductor substrate 21 on which a well formation process has been performed , and then a pmos transistor 23 and an nmos transistor 24 are formed through a gate formation process , a source / drain formation process , a contact process and the like . thereafter , first to fifth metal wires 25 to 29 are formed by performing a multi metal wire formation process . herein , a metal wire structure having five metal wire layers is exemplarily described in accordance with the preferred embodiment of the present invention . however , another metal wire structure having more or less metal wire layer can be applied to the present invention . an inductor connection wire 30 is finally formed in order that the inductor is formed on a top metal layer . therefore , a logic device for forming the radio frequency semiconductor device is formed as a second wafer 200 in which the inductor is not formed . also , the large vertical via hole may be applied to the second wafer 200 such as the first wafer 100 . the large vertical via hole can be simultaneously formed with the inductor connection wire 30 by applying a process forming the inductor having the via contact plug of the first wafer 100 . fig3 is a cross - sectional view illustrating the radio frequency semiconductor device bonding the first wafer 100 of fig1 g on the second wafer 200 of fig2 . in the radio frequency semiconductor device , the via contact plug 19 of the first wafer 100 is electrically connected to the inductor connection wire 30 of the second wafer 200 . the first wafer 100 and the second wafer 200 are bonded by a thermal treatment process at an atmosphere of a forming gas such an ar gas , a n 2 gas , a h 2 + ar gas or the like and a temperature of about 200 ° c . to about 50 ° c . for 1 minute to two hours . a pressure of about 100 mbar to about 10000 mbar are applied to wafer to wafer during the thermal treatment process . as discussed earlier , in accordance with the present invention , the radio frequency semiconductor device such as the rf - cmos , bipolar / sige and bicmos is manufactured by forming the wafer including the inductor and the wafer including the logic devices , and applying the 3d integration technology connecting wafer to wafer by forming a large vertical via hole formed with the cip . as a result , since the inductor is formed far from the substrate in which the logic device is formed , the parasitic capacitance can be minimized and the high performance radio frequency semiconductor device is expected . although the present invention has been described in connection with the embodiment of the present invention illustrated in the accompanying drawings , it is not limited thereto . it will be apparent to those skilled in the art that various substitutions , modifications and changes may be made thereto without departing from the scope and spirit of the invention .	7
fig1 is a schematic perspective diagram which depicts a representative and illustrative heat sink assembly 10 . the component clip 24 holds the electronic component 12 against heat sink body 16 . in a typical application the electronic component 12 will include a large area mounting tab which is used to transfer heat to a heat sink body . heat is dissipated to the ambient air by fins typified by fin 36 ( fig2 ). the profile of the extrusion used to from the heat sink body may take a variety of shapes and the fin pattern shown in the figures is exemplary and not intended to limit the scope of the invention . to achieve electrical isolation between the heat sink body 16 and the electronic component 12 , a layer of high thermal conductivity material such as insulator 13 may be placed between the electronic component 12 and the heat sink body 16 . in general , only one component clip 24 is required to mount the electronic component 12 but an additional component clip 24 could be used if required . in practice , the component clip of the present invention generates more than 10 lbs of clamping force which exceeds the force generated by prior spring retention assemblies . in general , the heat sink body 16 will include at least one component clip mounting channel 48 , which includes a ledge or ridge 50 . the component clip mounting channel 48 and ridge 50 cooperate with the anchor bend 32 of the component clip 24 ( see fig2 ) to retain the component clip 20 on the heat sink body 16 . fig2 shows a cross - section of the heat sink assembly 10 in use . the electronic component 12 is seated on the circuit board 14 and the component leads 11 are soldered to the board . the screw clearance hole 41 is aligned with the threaded screw hole 43 ( see fig3 ) in the mounting rail 20 . in use , a screw is threaded through the mounting rail 20 and draws the mounting rail surface 40 into contact with the heat sink body surface 42 . these surfaces form a dove tail to prevent the heat sink body 16 from flaring out under screw pressure . fig3 shows these structures in perspective view . the dove tail surfaces also prevent the mounting rail 20 from contacting the surface of the circuit board 14 . the mounting rail 20 defines a rail axis 21 and the heat sink body 16 may be moved anywhere along the mounting rail 20 along this axis 21 . although screws are preferred for mounting the rail rivets are also useful for many applications . fig4 shows the component clip 24 in isolation . the component clip 24 includes an anchor arm 28 which is connected to a spring arm 30 through a bend 46 . in the figure the length of the anchor arm is exaggerated and it is preferred to &# 34 ; shorten &# 34 ; the length of the anchor arm to limit the overall volume of the heat sink assembly 10 . the spring arm 30 has a thrust surface 34 while the anchor arm 28 terminates in an anchor bend 32 . preferably the thrust surface includes crease 35 or the like . when the electronic component 12 is placed under the crease 35 or the like , the crease 35 abuts the electronic component 12 but is free to slide on the surface of the electronic component 12 . therefore the clamping force is essentially independent of where the crease 35 touches the electronic component 12 . fig5 depicts component clip 24 loosely fitted in the mounting groove 48 . in this drawing the component clip 24 is in the &# 34 ; relaxed &# 34 ; state and the cantilever spring arm angle 54 is acute . in this view it can be seen that the anchor bend 32 substantially spans the clip mounting channel 48 . fig6 depicts the installation procedure for the component clip 24 . in general the electronic component 12 will be positioned relative to the heat sink body 16 . the anchor bend 32 of the component clip 24 is inserted into the clip mounting channel 48 while the component locating end 38 abuts the electronic component 12 . the tool land 44 area on the component clip 24 is provided to seat a tool to permit the clip to be pushed onto the heat sink body 16 as depicted by force vector 52 . fig7 shows the component clip 24 fully seated in the heat sink body 16 with the component clip 24 in the &# 34 ; stressed &# 34 ; state . in this position the arm angle 54 of the bend 46 is approximately ninety degrees . the bend 46 abuts the clip mounting channel 48 and acts as a fulcrum to distribute the elastic stresses throughout the component clip 24 . the ridge 50 cooperates with the component clip 24 to generate an audible and tactile &# 34 ; click &# 34 ; as the component clip 24 bottoms out in the clip mounting channel 48 . in fig6 the crease 35 abuts the an edge of the electronic component 12 package and helps to align it which is useful in some automated assembly processes . as may be seen in the drawing the component clip 24 has a substantially uniform thickness throughout . the distribution of stress in the component clip 24 is distributed between the anchor arm 28 and the spring arm 30 by displacement about the bend 46 . the stresses within the component clip 24 are related to the angles and in general arm angle 54 increases as the component clip 24 is seated in the clip mounting channel 48 . removal of the electronic component is accomplished by moving the electronic component 12 from under the component locating end 38 . once the component 12 is removed , the anchor bend 32 of the component clip 24 may be easily removed from the clip mounting channel 48 . although an exemplary embodiment of the heat sink assembly 10 is disclosed herein many possible variations are contemplated within the scope of the invention which is to be interpreted by the following claims .	7
although the invention is applicable to tools for cutting various workpieces of irregular shape , it is shown in the drawings for purposes of illustration as embodied in a shaper cutter 10 for cutting teeth on a workpiece such as a gear blank ( not shown ). the tool 10 includes a conical steel body 13 with a plurality of teeth 14 spaced angularly around the periphery of the body . the body is adapted to be mounted on a spindle adapter 15 and is adapted to be turned about the axis a of the spindle and the body while the work is turned in synchronism . during such turning , the tool is reciprocated longitudinally relative to the work and , during its downstroke , is brought into cutting engagement with the work to cut teeth in the work . the tool body 13 has a central bore 16 which is received on the spindle adapter 15 in the manner disclosed in haug u . s . pat . no . 4 , 576 , 527 . at its outer end , the tool body is counterbored as indicated at 17 to accommodate a locking nut 18 which is adapted to be threaded onto the lower end of the spindle adapter . the edges of the teeth 14 of the body 13 are formed by the intersection of one face 24 of the body with the ends 25 and sides 26 of the teeth and with the roots 27 . the face 24 is on the larger end of the conical body 13 . the ends 25 and the roots 27 of the teeth 14 are inclined inwardly away from the face to provide a back or relief angle c ( fig3 ) which usually is between 4 and 8 degrees with 8 degrees generally being a suitable angle . the sides 26 of each tooth 14 converge toward each other as they progress upwardly so as to not rub the work during cutting . as shown most clearly in fig3 the face 24 of the tool body 13 is frustoconical . while the face 24 could be convex , it preferably is concave and has a face angle d of between 5 and 10 degrees , 5 degrees being customary in most applications . to avoid the need of resharpening the cutting edges of the tool 10 when the cutting edges become dull , the cutting edges are formed on a thin metal wafer 30 which is fixed removably to and conforms to the shape of the face 24 of the body 13 , the latter basically being the same body as that of a solid tool . the wafer is provided with a plurality of teeth 31 backed rigidly by the teeth 14 on the body 13 and is held removably against the face 24 . when the cutting edges become dull , the wafer 30 is removed and replaced with another one . the sides 32 ( fig8 ) and the ends 33 of the teeth 31 of the wafer and the roots 34 in between are disposed relative to the plane of the wafer so that these edges generally match respectively the sides 26 and the ends 25 of the body teeth 14 and the roots 27 . preferably , the teeth on the wafer are larger than the teeth on the body so that a narrow margin ( e . g ., 0 . 010 &# 34 ;) of the ends , sides and roots of the wafer teeth extend slightly beyond the corresponding portions of the teeth on the body . the wafer preferably is made from a thin ( e . g ., about 0 . 050 &# 34 ;) sheet of tool steel which is subsequently hardened and coated with a thin film of titanium nitride . the aforementioned patent discloses a method by which the wafer may be formed . the wafer 30 is secured to the tool body 13 by a clamping ring 35 ( fig3 ) formed by an annular bushing 36 and an integral radial flange 37 . the bushing fits in the counterbore 17 of the spindle adapter 15 while the flange engages the wafer 30 just short of the roots 34 of the teeth 31 thereof . clamping of the wafer is effected by tightening the nut 18 to draw the flange 37 of the clamping ring 35 into engagement with the wafer . as the nut is tightened , the flange 37 flexes the wafer from an initially flat condition ( fig3 ) and deflects the wafer until the wafer conforms to and lies in face - to - face engagement with the frustoconical face 24 of the body 13 as shown in fig4 . the upper surface of the flange extends parallel to the face 24 and thus the wafer is clamped tightly in its deflected condition between the flange and the body . the ends 33 of the teeth 31 on the wafer 30 are formed at an angle e ( fig3 ) relative to the working face of the wafer so that these ends provide a back or relief angle when the wafer is secured to the face 24 of the body 13 . in the specific cutter 10 which has been illustrated , the angle which the ends 33 make after the wafer is flexed against and is secured to the conical face 24 is the same as the angle c made by the teeth 14 on the body 13 . thus , the angle e is equal to the sum of the face angle d and the outside relief angle c so that , when the wafer is flexed , only the portion corresponding to the angle c remains relative to a line parallel to the axis a of the body 13 . for example , if a face angle d of 5 degrees and an outside relief angle c of 8 degrees are used , the angle e formed on the ends 33 of the teeth 31 of the wafer 30 is 13 degrees . by forming the teeth 31 with the angle e , the sides 32 of the wafer teeth and the roots 34 are also angled back so that they do not rub the workpiece during cutting . flexing of the wafer 30 from the flat condition of fig3 to the deflected position shown in fig4 produces advantages as outlined in detail in my aforementioned patent but creates difficulty from the standpoint of effectively anchoring the wafer in a precisely fixed angular or circumferential position . in the cutter disclosed in my aforementioned patent , angular retention of the wafer is effected by a relatively simple and inexpensive cylindrical pin which fits through a notch in the wafer . in that arrangement , however , there is only line contact between the pin and the edge of the notch around a short circumferential length of the pin and , as a result , tangential cutting forces imposed on the wafer deform the angular interlock region and permit angular shifting of the wafer . while non - pin angular interlocks are available , such interlocks are expensive and also have other drawbacks . the present invention contemplates a unique angular interlock which utilizes a relatively simple and inexpensive cylindrical pin 40 but which , at the same time , establishes substantial surface contact of the wafer with the pin and enables quick and easy installation of the wafer . because of the substantial surface contact made possible by the interlock of the present invention , the deflected wafer is locked rigidly in a fixed angular position and does not shift angularly when subjected to heavy tangential cutting forces . the pin 40 of the invention is simply a short piece of cylindrical steel which , after being ground and hardened , is tightly pressed or otherwise secured in a hole 41 ( fig3 ) formed in the body 13 and opening out of the lower face 24 thereof . the preferred pin has a diameter of 3 / 16 &# 34 ; and a length of 3 / 8 &# 34 ; and is effective for use with wafers having outside diameters ranging from 4 &# 34 ; to 7 &# 34 ;. the axis f of the pin extends parallel to the axis a of the body 13 and , for a purpose to be described subsequently , the lower end 41 ( fig6 ) of the pin is beveled at an angle which preferably corresponds to the face angle d of the body . to best explain the principles of the angular interlock of the invention , reference is made to fig5 which shows a wafer 30 &# 39 ; having a cylindrical hole 50 &# 39 ; of the same diameter as the pin 40 . the dotted line illustration of fig5 shows the wafer in its natural flat condition while the solid line illustration shows the wafer as deflected when fully installed . referring to fig5 it will be seen that the centerline cl - 1 of the hole 50 &# 39 ; of the flat wafer 30 &# 39 ; intersects the centerline cl - 2 of the same hole in the deflected wafer within the hole area of the deflected wafer . in other words , during deflection of the wafer , one specific point a on the centerline cl - 1 moves parallel to the axis a of the tool 10 to a point a &# 39 ; on the centerline cl - 1 . points b , c , d and e at the ends of the hole move laterally as well as axially to points b &# 39 ;, c &# 39 ;, d &# 39 ; and e &# 39 ;, respectively , as the wafer is deflected . due to the lateral movement of the ends of the hole , a cylindrical hole cannot accommodate an axially extending cylindrical pin of the same diameter as the wafer is deflected but instead will interfere with the pin . pursuant to the invention , the wafer 30 is formed with a hole 50 whose upper and lower ends are uniquely configured so as to avoid interference with the axially extending cylindrical pin 40 as the wafer is installed and deflected but , at the same time , to establish substantial areas of surface contact between the fully deflected wafer and the pin in order to anchor the wafer in a rigid angular position . the foregoing is achieved by forming the final configuration of the hole 50 as the wafer 30 is flexed from its initially flat condition to its fully deflected condition . more specifically , a cylindrical but rough - formed hole of appropriate diameter ( e . g ., 0 . 165 &# 34 ; for a pin 40 with a diameter of 3 / 16 &# 34 ;) is initially formed through the wafer 30 parallel to the axis of the flat wafer and by conventional techniques such as drilling or laser cutting . thereafter , the wafer is hardened and ground and is placed on a fixture 60 ( fig9 ) having a central mandrel 61 for locating the wafer radially and having a locator 62 for engaging one of the wafer teeth 31 and holding the wafer angularly . surrounding the mandrel is an anvil 63 having a frustoconical upper face 64 which corresponds in shape to the face 24 of the body 13 . while the wafer 30 is resting in a flat condition on the anvil 63 , a hone 65 ( fig9 ) made of cubic boron nitrite is rotated by a spindle 66 and is advanced through the rough - formed hole 50 . the hone is cylindrical except for a slight lead - in taper at its lower end and , in this instance , has a diameter within the range of 0 . 1890 &# 34 ; and 0 . 1895 &# 34 ;. the axis of the hone parallels the axis of the flat wafer 30 . the hone 65 is plunged through the hole 50 to enlarge the hole to a diameter corresponding to that of the hone . while the hone is in the hole , a pressure plate 67 ( fig9 ) is advanced to deflect the wafer 30 into engagement with the frustoconical face 64 of the anvil 63 . as the wafer is deflected , the hone 65 is slowly reciprocated upwardly and downwardly in the hole 50 . by virtue of deflecting the wafer 30 while the hone 65 is being rotated in the hole 50 , the hole is formed with an irregular and non - cylindrical configuration . specifically , and referring to fig6 the upper end portion of the hole 50 is formed with a cylindrical section 70 around approximately one - half of its circumference and with a downwardly beveled section 71 around the remainder of its circumference . in contrast , the lower portion of the hole is formed with an upwardly beveled section 73 which underlies the cylindrical section 70 and with a cylindrical section 74 which underlies the downwardly beveled section 71 . in essence , the sections 71 and 73 are surfaces of a cylinder which is disposed at an angle equal to the angle d relative to the cylindrical sections 70 and 74 , the latter two surfaces being on a common cylinder . with the hole 50 shaped as described above , it will accept the pin 40 when the wafer 30 is flat ( see fig6 ) and provides clearance to accommodate the pin as the wafer is deflected . as the wafer is deflected , the cylindrical sections 70 and 74 of the hole 50 move laterally away from the pin to allow the hole to accept the pin and , at the same time , the beveled sections 71 and 73 move toward and ultimately engage the pin ( see fig7 ). in the fully deflected position of the wafer , the upper beveled section 71 of the hole snugly engages the pin around approximately one - half its circumference while the lower beveled section 73 of the hole snugly engages the pin around the remainder of its circumference . when the wafer is fully deflected , the upper cylindrical section 70 is spaced from the pin around one side of the pin while the lower cylindrical section 74 is spaced from the pin around the other side thereof . because of the snug surface - to - surface contact between the pin 40 and the beveled sections 71 and 73 of the hole 50 of the deflected wafer 30 , there is comparatively low deformation around the hole region of the wafer when tangential cutting forces are imposed on the wafer . during a dynamic cutting operation , the tangential cutting forces tend to shift the wafer rearwardly relative to the pin and , as a result , the actual tangential cutting forces are resisted by the leading side of the pin while the trailing side of the pin and the adjacent side of the hole are free of pressure . fig7 a is a diagrammatic cross - sectional view of the hole 50 and shows the contact areas between the hole 50 and the leading side of the pin 40 during an actual cutting operation . the beveled section 71 of the hole 50 engages an upper portion of the pin around approximately 90 degrees of the circumference of the leading side of the pin and over a surface contact area which has been shaded and designated as sca - 1 in fig7 a . the beveled section 73 of the hole engages the lower end portion of the pin around the remaining 90 degrees of the leading side . the latter area of engagement is the shaded area designated as sca - 2 in fig7 a . accordingly , during a dynamic cutting operation , there is surface contact between the hole and the pin around approximately 180 degrees of the leading side of the pin in order to reduce deformation at the interlock area and to keep the wafer rigidly locked in an angular position during the usable service life of the wafer . as mentioned earlier , the lower end 41 of the pin 40 is beveled generally in accordance with the deflection angle d of the wafer 30 . as a result , the pin may project into the hole 50 as far as possible without the lower end 41 of the pin engaging and interfering with the clamping ring 35 . to simplify installation of the wafer 30 , it is important that the pin 40 project into the hole 50 while the wafer is resting flat on the clamping ring 35 and before the ring is tightened to deflect the wafer . as a result of the pin projecting into the hole 50 while the wafer is flat , the pin itself holds the wafer in a fixed angular position during tightening of the clamp and avoids the need of using a special fixture for angularly orienting the wafer during installation . testing has shown that the extreme lower point 80 ( fig7 ) of the pin should project into the hole 50 a minimum distance of 0 . 010 &# 34 ; when the wafer is flat in order to insure that the pin will keep the wafer oriented angularly as the clamping ring 35 is tightened . it has been found that , with most cutters 10 up to five diametrical pitch , a minimum penetration of 0 . 010 &# 34 ; of the pin 40 into the hole 50 when the wafer 30 is flat can be established if the axis of the hole is located a distance x ( fig8 ) of 3 / 16 &# 34 ; from the root 34 of the wafer tooth 31 when the wafer is flat . such location of the hole also places the hole close to the teeth to reduce the force exerted on the pin by the tangential cutting forces without placing the hole so close to the tooth as to lead to fracture of the wafer adjacent the hole . in extreme cases where the ratio of the outside diameter of the wafer to the inside diameter thereof leaves a distance of less than 3 / 8 &# 34 ; from the inside diameter to the root 34 of the tooth , the hole 50 usually may be located midway between the inside diameter and the tooth root and a pin of smaller diameter may have to be used . for strength purposes , it is desirable to locate the axis of the hole along the centerline of a tooth 31 . while the irregularly shaped hole 50 has been specifically disclosed as being formed by the hone 65 , other techniques such as electrical discharge machining may be used . also , the pin 40 need not necessarily be cylindrical but could be elliptical or of other appropriate shape .	1
reference will now be made in detail to the embodiments of the present general inventive concept , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to the like elements throughout . the embodiments are described below in order to explain the present general inventive concept be referring to the figures . fig1 illustrates a cam magnet 1 having a body 2 and an arm 3 coupled together at a point of rotation 7 . the body 2 has two plates 15 and 16 on either side of a magnet 20 and the arm 3 . the two plates 15 and 16 are separated from the magnet 20 via connector layers 10 and 11 located on either side of the magnet 20 . the two plates 15 and 16 engage a side of the connector layers 10 and 11 opposite to another side of the connector layers 10 and 11 that engages the magnet 20 to sandwich all three elements 10 , 11 , and 20 together . the arm 3 is rotatable around the axis of rotation 7 located within the body 2 , and is adjustable to various angles along the axis of rotation 7 . the arm 3 connects to a rotating disk or cam 30 situated in an opening 5 in the magnet 20 that divides magnet 20 into two portions . a handle portion 4 is attached to an end of the arm 3 to facilitate movement from a first position to a second position . the arm 3 abuts either portion of the magnet 20 in either first and second positions . because the arm is metallic , the abutting engagement of the arm 3 with the magnet 20 allows the magnet 20 to magnetically secure the arm 3 in either position to avoid inadvertent movement of the arm 3 during use . the cam 30 is mounted at a location off - center from a center of the cam 30 to convert circular movement of the arm 3 to linear motion . specifically , as the arm 3 swings from the first position , illustrated in fig1 , to the second position , illustrated in fig2 , the cam 30 rotates and breaks a planar surface 31 of the magnet 20 to expose a cam extension portion 32 . the purpose of the cam extension portion 32 will be discussed hereafter . in the exemplary embodiment , the cam magnet 1 has at least one notch 35 in one or both ends of the body to secure fixtures in a desired location . in another embodiment , the cam magnet 1 has at least two sides that float or move and can be adjusted and then fixed into place to increase adaptability of the cam magnet 1 . the notch 35 or floating sides allow use with concave or convex surfaces . an example of such use includes is for utility plant products , such as manholes and catch basins . length , width , height , shape , and magnetic strength of the cam magnet 1 may vary depending on a user &# 39 ; s application needs . during use , the cam magnet 1 may be attached to construction material ( not illustrated ) with the arm 3 in the first position . the cam magnet 1 facilitates maneuvering of the material to provide easier processing . when the user desires to remove the cam magnet 1 from the material , the arm 3 can be moved to the second position to rotate the cam 30 and extend the extension portion 32 away from the cam magnet 1 and toward the material . the extension portion 32 moves the magnet 1 away from the material , thereby creating a gap , which weakens the magnetic connection between the cam magnet 1 , thus facilitating removal of the cam magnet 1 from the material . another use of the cam magnet 1 is in combination with a utility hole former . the cam magnet 1 can be formed with the notch 35 that is sized and shaped to engage with a side or other parts of the hole former , such as a donut ring on an inside of the hole former . the cam magnet 1 and hole former are then placed in position on a steel core of a manhole or shell . in one preferred embodiment , the cam magnet 1 has at least tapped hole ( not illustrated ) for coupling with an attachment plate . the attachment plate sits on top of the cam magnet 1 and is coupled to the cam magnet 1 using screws or other means . the cam magnet 1 and attachment plate are attached to steel side rails or parts , which need to be secured in a position . having now described the features , discoveries and principles of the general inventive concept , the manner in which the general inventive concept is constructed and used , the characteristics of the construction , and advantageous , new and useful results obtained ; the new and useful structures , devices , elements , arrangements , parts and combinations , are set forth in the appended claims . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the general inventive concept herein described , and all statements of the scope of the general inventive concept which , as a matter of language , might be said to fall therebetween .	1
as shown in fig1 a , the beam stacking device 10 of this invention includes a prism assembly of two elements : a prism 12 in the form of a rectangular parallelepiped with one lateral edge cut away , thus forming a prism having pentagonal bases and five lateral faces or surfaces ; and a right angle prism 14 . the lateral edges of prism 12 are identified by the letters a , b , c , d and e ; and the lateral edges of prism 14 are identified by the letters d , e and f . for convenience herein , whenever referring to a particular lateral surface , such will be identified simply by specifying the two lateral edges which are the boundaries thereof . for example , the lateral surface bounded by lateral edges a and b is termed “ surface ab ”. thus , relying on this convention and continuing with the description , the surface df of prism 14 serves as an entrance aperture , and the surface ae of prism 12 serves as an exit aperture . the dihedral angles ∠ abc , ∠ bcd and ∠ cde are 90 degrees . the dihedral angles ∠ dea and ∠ eab are 135 degrees . the dihedral angles ∠ edf and ∠ fed are 45 degrees . the length ab is equal to the length bc . the length cd is equal to ab +( 1 /{ square root over ( 2 )}) ae , and the length de is equal to ab −( 1 /{ square root over ( 2 )}) ae . the prisms 12 and 14 are made of , for example , the well known optical glass designated in the schott optical glass catalog as bk 7 . in use , a beam 16 enters the entrance aperture at surface df and proceeds to surface ab . the angle of incidence of the beam 16 at the surface ab is 45 degrees , which is larger than that of the total internal reflection at the interested wavelength . total internal reflection of the beam 16 first occurs at the surface ab . total internal reflection also occurs at the surfaces bc , cd and de . when the beam 16 undergoes total internal reflection at the surface cd for the first time , a first chopped part 16 a emerges from the exit aperture ae while the remaining portion directs to the surface de and thence to the surface ab a second time . the width of the chopped part is equal to the width of the exit aperture ae . after the second round trip , the second chopped part 16 b emerges from the exit aperture ae , but displaced beneath the first chopped part 16 a . for the purpose of illustration , the number of chopped parts is chosen to be five chopped parts 16 a , 16 b , 16 c , 16 d and 16 e . as shown in the orthogonal view in fig1 b , chopped part 16 a is sequentially reflected at surfaces ab , bc and cd and then emerges from exit aperture ae , but displaced beneath beam 16 due to the angle of incidence 18 . chopped part 16 b is sequentially reflected at surfaces ab , bc , cd and de for two round trips and then emerges from exit aperture ae , but displaced beneath chopped part l 6 a due to the angle of incidence . chopped parts 16 c , 16 d and 16 e undergo similar multiple round trip reflections at surfaces ab , bc , cd and de until they finally emerge from exit aperture ae beneath chopped parts 16 b , 16 c and 16 d . thus , the action of the beam stacking device 10 is effectively to chop the incident beam 16 into a specific number of chopped parts and then to redirect and reposition those chopped parts so that they emerge from the beam stacking device stacked one on top of another with a reduced orthogonal dimension corresponding to the direction of stacking and with an increased orthogonal dimension corresponding to the width of the exit aperture , thereby resulting in an output beam which is substantially symmetrical . for many applications , it is desirable to minimize the gap between adjacent chopped parts by choosing the angle of incidence 18 in accordance with the equation , where θ is the angle of incidence 18 , n is the index of bk 7 at the interested wavelength , and dy is the incident beam size in one direction . two alternate embodiments are illustrated in fig2 a , 2 b and 3 a , 3 b . fig2 a shows a beam stacking device 20 of the invention which includes a prism assembly of two elements : a small prism 22 and a larger prism 24 . the lateral edges of prism 22 are identified by the letters g , h and i ; and the lateral edges of the prism 24 are identified by the letters i , j and k . the surfaces gi and gk serve as entrance and exit apertures , respectively . a portion of the prism 24 is cut away to provide the path for the incident beam 26 . the dihedral angles ∠ ghi , ∠ hij and ∠ ijk are 90 degrees . the dihedral angles ∠ igh , ∠ hig , ∠ ikj and ∠ kij are 45 degrees . the dihedral angle ∠ hgk is 135 degrees . the length gh is equal to the length hi . the length ij is the same as the length jk , both being equal to gh +( 1 /{ square root over ( 2 )}) gk . the prisms 22 and 24 are made of , for example , bk 7 . the angle of incidence of the beam 26 at the surface gh is 45 degrees , which is larger than that of the total internal reflection at the interested wavelength . total internal reflection of the beam 26 first occurs at the surface gh . total internal reflection of the beam 26 also occurs at the surfaces hi , ij and jk . when the beam 26 undergoes total internal reflection at the surface jk for the first time , a first chopped part 26 a emerges from the exit aperture gk while the remaining portion directs to the surface gh a second time . the width of the chopped part is equal to the width of the exit aperture gk . after the second round trip , the second chopped part 26 b emerges from the exit aperture gk , but displaced beneath the first chopped part 26 a . this process continues until the entire incident beam is reconfigured . for the purpose of illustration , the number of chopped parts is chosen to be five chopped parts 26 a , 26 b , 26 c , 26 d and 26 e . as shown in the orthogonal view in fig2 b , chopped part 26 a is sequentially reflected at surfaces gh , hi , ij and jk and then emerges from exit aperture gk , but displaced beneath beam 26 due to the angle of incidence 28 . chopped part 26 b is sequentially reflected at surfaces gh , hi , ij and jk for two round trips and then emerges from exit aperture gk , but displaced beneath chopped part 26 a due to the angle of incidence . chopped parts 26 c , 26 d and 26 e undergo similar multiple round trip reflections at surfaces gh , hi , ij and jk until they finally emerge from exit aperture gk beneath parts 26 b , 26 c and 26 d . thus , as with the beam stacking device 10 , the action of the beam stacking device 20 is effectively to chop the incident beam 26 into a specific number of chopped parts and then to redirect and reposition those chopped parts so that they emerge from the beam stacking device stacked one on top of another , thereby attaining a beam with improved orthogonal dimensions which enable its use in applications incapable of the original unmodified beam . fig3 a and 3 b show another alternate embodiment of a beam stacking device in accordance with the invention . illustrated in these figures is a beam stacking device 30 which includes a prism assembly of two elements : a small prism 32 and a larger prism 34 . the lateral edges of prism 32 are identified by the letters g , h and i ; and the lateral edges of the prism 34 are identified by the letters i , l , m and g . the surfaces gi and gm serve as entrance and exit apertures , respectively . a portion of the prism 34 is cut away to provide the path for the incident beam 36 . the dihedral angles ∠ ghi , ∠ hil and ∠ ilm are 90 degrees . the dihedral angles ∠ igh , ∠ hig and ∠ gil are 45 degrees . the dihedral angles ∠ lmg and ∠ mgh are 135 degrees . the length gh is equal to the length hi . the length il is equal to gh +( 1 /{ square root over ( 2 )}) gm , and the length lm is equal to gh −( 1 /{ square root over ( 2 )}) gm . the prisms 32 and 34 are made of , for example , bk 7 . the angle of incidence of the beam 36 at the surface gh is 45 degrees , which is larger than that of the total internal reflection at the interested wavelength . total internal reflection of the beam 36 first occurs at the surface gh . total internal reflection of the beam 36 also occurs at the surfaces hi , il and lm . when the beam 36 undergoes total internal reflection at the surface il for the first time , a first chopped part 36 a having a width equal to the width of the exit aperture gm emerges from the exit aperture gm while the remaining portion of the beam 36 directs to the surface lm and then undergoes a second round trip of sequential reflections at surfaces gh , hi and il . upon undergoing total internal reflection a second time at surface il , a second chopped part 36 b emerges from the exit aperture gm , but displaced beneath the first chopped part 36 a . as this process continues , the beam 36 is chopped into further parts which emerge from the exit aperture gm stacked on top of one another . for the purpose of illustration , the number of chopped parts is chosen to be five chopped parts 36 a , 36 b , 36 c , 36 d and 36 e . in all three embodiments of the invention , the incident beam to be reconfigured passes through an entrance aperture of a prism assembly , undergoes total internal reflection at four total internal reflection surfaces of the prism assembly step by step , and is chopped into a number of parts which emerge from an exit aperture of the prism assembly . the emerged chopped parts are stacked on top of one another due to the angle of incidence of the beam and the size difference of the four total internal reflection surfaces . the result is a reconfigured beam which has a more favorable profile in two orthogonal directions , thus rendering it suitable for use as an attractive and viable optical source in a variety of applications . various modifications can be made to the present invention without departing from the apparent scope hereof .	6
in fig1 , 1 is a controller for controlling an entire apparatus , 2 is an operation entry unit such as a keyboard and a mouse , 3 is an external recording interface ( referred to as i / f hereafter ) with which a unit such as an external recording medium is connected , 4 is a memory , 5 is a hash converter , 6 is a display , 7 is an imager , 8 is an image reproducing unit , 9 is an electronic watermark embedding unit , 10 is an electronic watermark decoder , 11 is a loss - less conversion compressor , 12 is a loss - less conversion de - compressor , 13 is a tampering display for displaying a detected tampered part , and 14 is a bus for connecting the individual parts with each other . i / f &# 39 ; s required between the individual parts and the bus 14 are not shown in fig1 . the controller 1 is a microcomputer ( comprises a cpu , a rom , and a ram , and is simply referred to as cpu ) which controls an entire operation and functions of a decoder and an encoder for electronic watermark , and software processing on this cpu in the controller 1 realizes the individual functions of the imager 7 , the electronic watermark embedding unit 9 , and the loss - less conversion compressor 11 for conducting processing for picturing an image , and the image reproduction unit 8 , the loss - less conversion de - compressor 12 , the electronic watermark decoder 10 , and the tampering display 13 for displaying a detected tampered part ( presenting an indication such as inversion ) for conducting processing for reproducing the image . the operation entry unit 2 servers for entering various types of operation instructions , function selection commands , edit data , and the like , and corresponds to a keyboard , a mouse , a touch panel , and the like . especially , the operation entry unit 2 is used for entering a secret key for encrypting in order to embed electric watermark information , and for decrypting the encrypted electronic watermark . the operation entry unit 2 also servers as display selection means , and an operator operates the operation entry unit 2 to change the display 6 to a desired display state . for example , an entry through a key operation can superimpose the result of decoding the electronic watermark on image information of the input image , or can select either one of them for display . the external recording i / f 3 is an i / f for extracting the image information on an image obtained by the imager 7 , image information including an electronic watermark compressed by the loss - less conversion compressor 11 , data of a tampered part detected by the electronic watermark decoder 10 and the like to the outside of the decoder , and records them on a recording medium ( such as a floppy disk ( fd ) and an optical magnetic disk ( omd )) for storage . the external recording i / f 3 may be connected with a recording medium for recording the software program whose processing is executed on the controller 1 . the memory 4 is recording means for storing image information on the image obtained by the imager 7 , image information which includes the embedded electronic watermark , and is reproduced by the image reproduction unit 8 , image information which is loss - less - converted and compressed , and the like , and corresponds to a ram or a hard disk with a large capacity . the hash converter 5 is used to encrypt image information when the electronic watermark embedding unit 9 embeds electronic watermark information , and is also used to decrypt the image information when the electronic watermark decoder 10 decodes the electronic watermark information . the imager 7 is image information entry means for reading in image information through scanning a set photography or form . the imager 7 corresponds to an image scanner , a scan optical system for a digital camera , a ccd , and the like which are publicly known , and comprise a sensor and its drive circuit . the image reproduction unit 8 controls to reproduce the image information stored in a recording medium accessed through the external recording i / f 3 , and the like . the electronic watermark embedding unit 9 uses the hash converter 5 to encrypt the image information read by the imager 7 , and stored in the memory 4 so as to apply the processing for embedding an electronic watermark into the image information . the electronic watermark decoder 10 extracts the electronic watermark from image information including an embedded electronic watermark , and determines an existence of tampering of the image based on whether the extracted electronic watermark can be decoded or not . the loss - less conversion compressor 11 is used only when it is necessary to compress ( loss - less convert ) image information including an embedded electronic watermark without degrading the information . the loss - less conversion de - compressor 12 decompresses and decodes the image information which is compressed with loss - less conversion after the electronic watermark is embedded . since the compression / decompression processing is known art , the detailed description is not provided . the tampering display 13 includes a function for displaying a corresponding part as an inversion or a black fill when it is determined that image information is tampered based on the result of the decoding in the electronic watermark decoder 10 . fig2 a and 2b are flowcharts showing an encoding method for an electronic watermark of the first embodiment , and showing processing which divides an image into blocks , and embeds an electronic watermark when the electronic watermark is embedded into image information as a digital content . the following section describes a case where processing for embedding an electronic watermark into an image taken by a digital camera is applied to a multi - valued image to which loss - less compressing / decompressing can be applied . the controller 1 stores an encryption key , which is entered from the operation entry unit 2 , and is used for embedding an electronic watermark , into the memory 4 ( s 1 ). also , the controller 1 stores image information taken by the imager 7 into the memory 4 ( s 2 ). the controller 1 divides the image information into blocks with the same size comprising n × m pixels ( s 3 ). at this time , the controller 1 divides such that the block partially overlaps the upper , lower , left , and right blocks . the controller 1 checks whether the entire image information is divided into blocks ( s 4 ), and if the processing for the entire blocks has not completed yet ( no in s 4 ), the controller initializes “ hash no ” in which a hash value obtained using a hash function ( s 5 ). the controller 1 checks a luminance value or a color difference value ( a pixel value ) pixel by pixel from the upper left to the lower right in the same block , and compares it with a predetermined threshold of a predetermined luminance value or color difference value so as to obtain the length ( the position of change ) of a run ( a row ) of successive luminance values or color difference values of the pixels . also , the controller 1 checks whether the length ( the position of change ) of the run ( the row ) of the successive luminance values or color difference values are obtained for the entire pixels ( s 6 ), and if the processing has not completed yet ( no in s 6 ), a hash value is obtained while the last hashno , the luminance value or color difference value of the pixel , the secret key , the date of the processing , and the production number of the apparatus are used as seeds for the hash function , and is stored in “ hash no ” ( s 7 ). it is possible to set which item is selected from these seed data for the hash function ( a combination of multiple items is possible ), and to set the size of the blocks to be divided , and the quantity of the overlap between the neighboring blocks thorough operating the operation entry unit 2 . since the size of the block where an electronic watermark is embedded is inversely proportional to the level of the degradation of an original image , arbitrarily changing the size of the divided blocks can selects a range of the image degradation . also it is possible to restrain the image degradation due to embedding an electronic watermark by comparing the predetermined value as the threshold with a difference in pixel value between the pixel to be checked in step s 6 and its neighboring pixel , and then , embedding the electronic watermark at a part ( boundary ) where a difference in neighboring pixel values is large . the controller 1 determines whether the position of change in the run length in step s 6 is in a changeable region in the block ( s 8 ), and if the position is not in a changeable region ( no in s 8 ), the controller 1 moves to processing for the next pixel ( s 9 ), and then returns to step s 6 . if the position is in a changeable region ( yes in s 8 ), the controller 1 checks whether the position of the pixel corresponds to a position subject to skipping ( s 10 ), and moves to step s 9 if so ( yes in s 10 ). this prevents image degradation while skipping positions where an electronic watermark is embedded since the image degradation increases if an electronic watermark is embedded to entire corresponding pixels . the positions for skipping are set to ( multiples of a certain integer ) th pixel positions or positions where the luminance value or the color difference value changes largely , for example . it is possible to arbitrarily change the degree of skipping the position for embedding an electronic watermark . when the degree of skipping is large , the degradation of an image decreases . thus , since it is necessary to increase the area required for decoding an electronic watermark so as to increase reliability of an electronic watermark for detecting tampering , the area of a gray zone ( indicating tampering ) for identifying a tampered position increases ( precision for identifying a tampered position decreases ). if the position does not correspond to a position subject to skipping in step s 10 ( no in s 10 ), the controller 1 matches the odd / even of the luminance value or the color difference value of the pixel at the position of change to the odd / even of “ hash no ” obtained in step s 7 ( s 11 ). this process ( step s 11 ) conducts the processing for embedding an electronic watermark . then the controller 1 moves to the processing of step s 9 . if the processing has completed for the entire pixels in the block in step s 6 ( yes in s 6 ), the controller 1 moves the processing to the next block ( s 12 ), and then , moves the processing to step s 4 . at this time , the selection of the block in the subject image information moves from the upper left to the lower right as of the run of the pixels . if it is confirmed that the processing for the entire blocks has completed in step s 4 , the controller 1 records the image information including the embedded electronic watermark in the memory 4 or the recording medium ( s 13 ), and then , completes the processing . if information indicating that processing for preventing tampering with an electronic watermark has been applied to image information is added to a file header when the digital content including the embedded electronic watermark is recorded on the recording medium ( since it is difficult to visually confirm whether an electronic watermark has been embedded or not when the image information is displayed ), managing and handling the content becomes easy . it is possible to further apply electronic watermark data to the processing described above . fig3 is a view exemplifying the overlaps of the blocks divided by the processing which divides an image into blocks with the same size ( n × m pixels ) shown in step s 3 in fig2 a . as shown in fig3 , a changeable region in a first block ( block size : n 1 × m 1 ) in step s 8 is ( n 1 × m 1 ), a changeable region in a second block ( n 2 × m 2 ) is a region excluding an overlap with the first block ( x 1 × m 1 ), and a changeable region in a ( k + 1 ) th block ( n 2 × m 2 ) is a region excluding an overlap with the second block ( n 2 × y 1 ) and an overlap with the kth block ( x 1 × m 2 ). namely , a changeable region in a block selected later excludes regions which are changed in blocks selected before . with this selection , since the blocks are associated with one another by generating electronic watermark information including the overlapping regions among the individual blocks , it is possible to detect a replacement between blocks . the following section describes an example of embedding an electronic watermark shown in step s 11 in fig2 b . fig4 shows a part of pixel values ( luminance value : y ) of pixels in an original multi - valued image and those after an electronic watermark is embedded . in this example , since the position of a pixel yk of interest which is checked for whether an electronic watermark can be embedded or not is in a changeable region , and simultaneously is not a position subject to skip ( corresponding to a position with a large change in luminance value ( a position of change )), the luminance value “ 12 ” of the pixel yk is changed to an odd number of “ 11 ” based on a hash value ( such as an odd number ) stored in “ hash no ” in step s 7 shown in fig2 a . if the position of the pixel of interest is not in a changeable region , or is at a position subject to skip , the processing for embedding an electronic watermark is not conducted . fig5 a and 5b are flowcharts showing processing for reading an electronic watermark , decoding it , and detecting tampering during reproducing an image in the first embodiment . first , the controller 1 stores an encryption key , which is used for encryption for embedding an electronic watermark , and is entered from the operation entry unit 2 shown in fig1 , into the memory ( s 21 ), and reads out image information including an embedded electronic watermark from the memory 4 ( s 22 ). at this time , when the image information is stored while it is compressed , the controller 1 uses the loss - less conversion de - compressor 12 to decompress the image information . further , the controller 1 divides the image information into blocks with the same size of n × m ( s 23 ). at this time , the controller 1 conducts the division such that the divided blocks partially overlap neighboring upper , lower , left , and right blocks . the controller 1 checks whether the entire image information is divided into blocks ( s 24 ), and if the processing for the entire blocks has not completed yet ( no in s 24 ), the controller 1 initializes “ hash no ” for storing the hash value ( s 25 ). the controller 1 checks a luminance value or a color difference value pixel by pixel from the upper left to the lower right in the same block , and compares it with a predetermined threshold so as to obtain the length ( the position of change ) of a run ( a row ) of successive luminance values or color difference values of the pixels . also , the controller 1 checks whether the check of the pixel value has completed for the entire pixels ( s 26 ), and if the processing has not completed yet ( no in s 26 ), a hash value is obtained while the last hash no , the luminance value or color difference value of the pixel , the secret key , the date of the processing , and the production number of the apparatus are used as seeds for a hash function , and is stored in “ hash no ” ( s 27 ). the controller 1 determines whether the position of change in the run length in step s 26 is in a changeable region in the block ( s 28 ), and if the position is not in a changeable region ( no in s 28 ), the controller 1 moves to processing for the next pixel ( s 29 ), and then returns to step s 26 . if the position is in a changeable region ( yes in s 28 ), the controller 1 checks whether the position of the pixel corresponds to a position subject to skipping ( s 30 ), and moves to step s 29 if so ( yes in s 30 ). if the position does not correspond to a position subject to skipping in step s 30 ( no in s 30 ), the controller 1 confirms whether the odd / even of the luminance value or the color difference value of a pixel at the position of change matches the odd / even of “ hash no ” obtained in step s 27 ( s 31 ). with this confirmation , the reproducibility of the embedded electronic watermark is checked . if the odd / even matches in step s 31 ( yes in s 31 ), the controller 1 determines that tampering does not exist , and moves to step s 29 . if the odd / even does not match ( no in s 31 ), the controller 1 determines that there exist tampering , records the position of the corresponding block ( s 32 ), and moves to step s 29 . if the processing has completed for the entire pixels in the block in step s 26 ( yes in s 26 ), the controller 1 moves the processing to the next block ( s 33 ), and then , returns to step s 24 . at this time , the selection of the block in the subject image information moves from the upper left to the lower right as of the run of the pixels . if the controller confirms that the processing has completed for the entire blocks in step s 24 ( yes in s 24 ), the controller 1 shows a result of analysis of the image information including the embedded electronic watermark ( s 34 ), and finishes the processing . the controller 1 shows the block recorded in step s 32 as a color inversion pattern , a black fill pattern , a white fill pattern , a color fill pattern other than the black and white fills , or the like on the display 13 based on this analysis result so as to inform the tampering . if tampering was not detected , the controller 1 may show a state such as the date of applying the electronic watermark based on the information such as the date used as the seed data for the hash function when the electronic watermark information is encrypted . as described above , an existence of tampering a digital content is detected , and the tampering is shown by storing multi - valued image information including an electronic watermark after it is loss - less compressed or non - compressed , reading out the loss - less compressed or non - compressed image information , decoding , and checking the electronic watermark in the image information . fig6 is a block diagram showing a schematic constitution of an encoder and a decoder for electronic watermark according to a second embodiment of the present invention . this constitution corresponds to the constitution elements in the encoder and the decoder for electronic watermark described while referring to fig1 in the first embodiment described above , and the same numerals are assigned to constitution elements virtually having a similar function . in fig6 , 1 is a controller , 2 is an operation entry unit , 3 is an external recording i / f , 4 is a memory , 5 is a hash converter , 6 is a display , 7 is an imager , 8 is an image reproduction unit , 9 is an electronic watermark embedding unit , 10 is an electronic watermark decoder , 13 is a tampering display , 14 is a bus , 15 is an mmr compressor , 16 is an mmr de - compressor , and 17 is a multi - value / binary converter . the mmr compressor 15 in fig6 uses mmr compression to compress an image including an electronic watermark embedded by the electronic watermark embedding unit 9 . the mmr de - compressor 16 decompresses to decode the mmr - compressed image including the electronic watermark embedded by the mmr compressor 15 . the multi - value / binary converter 17 binarizes read image information from a multi - valued image to a binary image at a predetermined resolution , thereby obtaining image information comprising white dots and black dots , and a publicly - known technology can be applied to the conversion . fig7 a and 7b show an image formed by binarizing an image read by the imager 7 , and a drawing which is an enlarged part of it , respectively . fig8 a and 8b are flowcharts showing processing which is an encoding method for an electronic watermark according to the second embodiment , and divides an image into blocks when an electronic watermark is embedded into the image which is a digital content . the following section describes processing for embedding an electronic watermark into a binary image as an example . in fig8 a and 8b , the same numerals are also assigned to constitution elements virtually having a similar function to the constitution elements described while referring to fig2 a and 2b in the first embodiment . the controller 1 stores an encryption key , which is entered from the operation entry unit 2 shown in fig6 , and is used for encryption for embedding an electronic watermark , into the memory 4 ( s 1 ). also , the controller 1 stores image information taken by the imager 7 into the memory 4 ( s 2 ). if the image information is a multi - valued image , the controller 1 obtains a binarization threshold using discriminant analysis in the multi - value / binary converter 17 ( s 2 ′). if the image information is a binary image , the controller 1 skips this processing . the controller 1 divides the image information into blocks with the same size comprising n × m pixels ( s 3 ). at this time , the controller 1 divides such that the block partially overlaps the upper , lower , left , and right blocks . then , the controller 1 checks whether the entire image information is divided into the blocks ( s 4 ), and if the processing for the entire blocks has not completed yet ( no in s 4 ), the controller initializes “ hashno ” in which a hash value obtained using a hash function ( s 5 ). the controller 1 checks successive white runs and black runs pixel by pixel from the upper left to the lower right in the same block , obtains the lengths ( the positions of change ) of the successive runs ( rows ), also checks whether the check has completed for the entire pixels ( s 6 ′), and if the processing has not completed ( no in s 6 ′), a new hash value is obtained while the last hashno , the lengths of the white run and the black run of the pixels , the secret key , the date of the processing , and the production number of the apparatus are used as seeds for a hash function , and is stored in “ hash no ” ( s 7 ′). it is possible to select which item is selected from these seed data for the hash function ( a combination of multiple items is possible ). the controller 1 determines whether the position of change in the run length in step s 6 ′ is in a changeable region in the block ( s 8 ), and if the position is not in a changeable region ( no in s 8 ), the controller 1 moves to processing for the next pixel ( a white run or a black run ) ( s 9 ), and then returns to step s 6 ′. if the position is in a changeable region ( yes in s 8 ), the controller 1 checks whether the position of the pixel corresponds to a position subject to skipping ( s 10 ), and moves the processing to step s 9 if so ( yes in s 10 ). this processing prevents an image degradation caused by embedding an electronic watermark . as the position for the skip , a position where a ( multiple of a certain integer ) th white or black run changes is set , for example . if the position does not correspond to a position subject to skipping ( no in s 10 ) in step s 10 , the controller 1 matches the odd / even of the length of the white run or the black run to the odd / even of “ hash no ” obtained in step s 7 ′ ( s 11 ′). this step conducts the processing for embedding an electronic watermark , and then , the controller 1 moves to the processing of step s 9 . if the processing has completed for the entire pixels in the block in step s 6 ′ ( yes in s 6 ′), the controller 1 moves the processing to the next block ( s 12 ), and then , returns the processing to step s 4 . at this time , the selection of the block in the subject image information moves from the upper left to the lower right as of the run of the pixels . if the controller 1 confirms that the processing for the entire blocks has completed in step s 4 , the controller 1 records the image information including the embedded electronic watermark in the memory 4 or the recording medium ( s 13 ), and then , completes the processing . the following section describes an example of embedding an electronic watermark shown in step s 11 ′ in fig8 b . fig9 a and 9b show processing for embedding an electronic watermark into the length of a white run ( lw ), and the length of a black run ( lb ) in an original binary image , respectively . in this example , the controller 1 uses the length of a previous white run ( lw ) or the like to change the length of a black run ( lb ) in which an electronic watermark is embedded such that the odd / even of the length of the black run ( lb ) matches the odd / even of the hash value obtained in step s 7 ′. specifically , the controller 1 conducts processing for extending or contracting the pixel number of the black run ( lb ) by ± 1 so as to conduct the processing for embedding an electronic watermark . if the position of change for embedding the electronic watermark is not in the changeable region , or at a position subject to skipping , the controller 1 does not conduct the processing for embedding an electronic watermark . fig1 a and 10b are flowcharts showing processing relating to the second embodiment , and shows processing for reading an electronic watermark , decoding it , and detecting tampering during reproducing an image . the flowcharts shown in fig1 a and 10b conduct almost the same processing as is conducted by the flowcharts shown in fig5 a and 5b , and differ in processing binary image instead of a multi - valued image . in the flowchart in fig1 a , the controller 1 stores an entered encryption key ( s 21 ), and reads out image information including an embedded electronic watermark from the memory 4 ( s 22 ). at this time , when the image information is stored while it is compressed with mmr compression , the controller 1 uses mmr decompression to decode the image information . further , the controller 1 divides the image information into blocks with the same size of n × m pixels ( s 23 ). the controller 1 checks whether the entire image information is divided into blocks ( s 24 ), and if the entire image information has not been divided ( no in s 24 ), the controller 1 initializes “ hash no ” for storing the hash value ( s 25 ). the controller 1 checks successive white runs and black runs pixel by pixel from the upper left to the lower right in the same block , and obtains the lengths ( the positions of change ) of the successive runs ( rows ). the controller 1 also checks whether the check has completed for the entire pixels ( s 26 ′), and if the processing has not completed ( no in s 26 ′), a new hash value is obtained while the last hash no , the lengths of the white run and the black run of the pixels , the secret key , the date of the processing , and the production number of the apparatus are used as seeds for a hash function , and is stored in “ hash no ” ( s 27 ′). the controller 1 determines whether the position of change in the length in step s 26 ′ is in a changeable region in the block ( s 28 ), and if the position is not in a changeable region ( no in s 28 ), the controller 1 moves to processing for the next pixel ( s 29 ), and returns to step s 26 ′. if the position is in a changeable region ( yes in s 28 ), the controller 1 checks whether the position of change in the length of the white run or the black run corresponds to a position subject to skipping ( s 30 ), and moves to step s 29 if so ( yes in s 30 ). if the position does not correspond to a position subject to skipping ( no in s 30 ) in step s 30 , the controller 1 confirms that the odd / even of the length of the white run or the black run matches the odd / even of “ hash no ” obtained in step s 27 ′ ( s 31 ′). with this processing , the controller 1 conducts the processing for confirming reproducibility of the embedded electronic watermark . if the odd / even matches in step s 31 ′ ( yes in s 31 ′), the controller 1 determines that tampering does not exist , and moves the processing to step s 29 . if the odd / even does not match ( no in s 31 ′), the controller 1 determines that there exists tampering , records the position of the corresponding block ( s 32 ), and moves to step s 29 . if the processing has completed for the entire pixels in the block in step s 26 ′ ( yes in s 26 ′), the controller 1 moves the processing to the next block ( s 33 ), and then , returns to step s 24 . at this time , the selection of the block in the subject image information moves from the upper left to the lower right as of the run of the pixels . if the controller confirms that the processing has completed for the entire blocks in step s 24 ( yes in s 24 ), the controller 1 shows a result of analysis of the image information including the embedded electronic watermark ( s 34 ), and finishes the processing . the controller 1 shows the block recorded in step s 32 as a color inversion , a black fill pattern , a white fill pattern , a color fill pattern other than the black and white fills , or the like on the display 13 based on this analysis result so as to inform the tampering . fig1 a and 11b show an example of an image where processing for detecting tampering is conducted , and a corresponding block is inverted , respectively . as described above , an existence of tampering a digital content is detected , and a tampered position is displayed while binary image information including an embedded electronic watermark is compressed with mmr and stored , the controller 1 reads and decodes the image information compressed with mmr , and checks the electronic watermark in the image information . fig1 is a block diagram showing a schematic constitution of an encoder and a decoder for an electronic watermark according to a third embodiment of the present invention . when compared with the constitution in the block diagram shown in fig1 of the first embodiment , the block diagram shown in fig1 is different in a jpeg compressor 18 for compressing an image and storing it as an approximated image , and a jpeg decompressor 19 for decompressing an compressed image in place of the loss - less conversion compressor 11 and the loss - less conversion de - compressor 12 in the block diagram shown in fig1 . the jpeg compressor 18 compresses with jpeg compression an image including an electronic watermark embedded by an electronic watermark embedding unit 9 , and the jpeg de - compressor 19 decompresses to decode the jpeg - compressed image including the electronic watermark embedded by the jpeg compressor 18 . these steps are conducted with prior art , and detail for them is not provided . fig1 is a flowchart showing processing which is an encoding method for an electronic watermark according to the third embodiment , and divides an image into blocks when an electronic watermark is embedded into the image which is a digital content . a controller 1 stores an entered encryption key ( a secret key ) for embedding an electronic watermark ( s 41 ). the controller 1 reads in a multi - valued image , which is image information for embedding an electronic watermark , and stores it into a memory 4 ( s 42 ). the controller 1 divides the image information into blocks with the same size comprising n × m pixels ( s 43 ). at this time , the controller 1 divides such that the block partially overlaps the upper , lower , left , and right blocks . the controller 1 sets a threshold for a pixel value ( such as a luminance value and a color difference value ) of a pixel in the block , and compares the pixel value of the individual pixels with the threshold to obtain a boundary between two types of image regions based on the length ( the position of change ) of a successive run of the pixel values ( such as a luminance value and a color difference value ) of the pixel ( s 44 ). the controller 1 uses the average of pixel values in a block processed immediately before as this threshold , and selects and switches it according to the application . the controller 1 changes the pixel value so as to increase the difference from the threshold at the obtained boundary ( s 45 ). since an electronic watermark is embedded at the boundary where the density changes largely , a pixel value which is larger or smaller than the threshold by several pixel values in density is enhanced . for example , a pixel value larger than the threshold is set to the white side , and a pixel value smaller than the threshold is set to the black side . the controller 1 checks whether the processing for the entire divided blocks has completed ( s 46 ), if the processing for the entire divided blocks has not completed ( no in s 46 ), the controller 1 embeds an electronic watermark in the block ( s 47 ), when step s 47 ends , the controller 1 moves the processing to the next block ( s 48 ), and the controller 1 returns to step s 46 . when the processing for the entire blocks has completed ( yes in s 46 ), the jpeg compressor conducts compressing ( s 49 ) so as to store the image information including the embedded electronic watermark . fig1 is a flowchart showing embedding an electronic watermark in a block according to the third embodiment . embedding an electronic watermark is repeated using independent multiple processing methods in step s 47 in fig1 such that the image information including the embedded electronic watermark withstands degradation of the image quality when the jpeg compression and the like are conducted . the controller 1 initializes “ loop no ” which records the number of repeating processing for the multiple methods for embedding an electronic watermark ( s 51 ), and checks whether the embedding an electronic watermark has repeated for predetermined times set as embedding an electronic watermark ( s 52 ). when the processing has not repeated for the specified times ( no in s 52 ), the controller 1 initializes “ hash no ” for storing a hash value ( s 53 ). the controller 1 checks the pixel values from the upper left to the lower right pixel by pixel in the same block , obtains the length ( the position of change ) of the run of the pixel values ( the white side or the black side ) of the pixel . the controller 1 also checks whether the check has completed for the entire pixels ( s 54 ), and if the processing has not completed ( no in s 54 ), a new hash value is obtained while the last hash no , the lengths of the run of the pixel values ( the white side or the black side ) of the pixel , the secret key , the date of the processing , and the production number of the apparatus are used as seeds for a hash function , and is stored in “ hash no ” ( s 55 ). it is possible to select arbitrary data ( such as a combination of multiple data ) from these seed data for the hash function . the controller 1 determines whether the position of change in the run length on the white side or the black side in step s 55 is in a changeable region in the block ( s 56 ), and if the position is not in a changeable region ( no in s 56 ), the controller 1 moves to processing for the next pixel ( s 57 ), and then returns to step s 54 . if the position is in a changeable region ( yes in s 56 ), the controller 1 checks whether the position of the pixel corresponds to a position subject to skipping ( s 58 ), and moves to step s 57 if so ( yes in s 58 ). if the position does not correspond to a position subject to skipping ( no in s 58 ) in step s 58 , the controller 1 matches the odd / even of the length of the run at the position of change to the odd / even of “ hash no ” obtained in step s 55 ( s 59 ). the value on the side toward which the change should be conducted is copied to the pixel for matching in odd / even so as to embed an electronic watermark . then , the controller 1 moves the processing to the processing of step s 57 . if the processing has completed for the entire pixels in the block in step s 54 ( yes in s 54 ), the controller 1 adds one to “ loop no ”, moves to the next method for embedding an electronic watermark ( s 60 ), and returns to step s 52 . the controller 1 conducts a similar processing for a new pixel value of the pixel , and if the controller 1 has completed the processing methods for different individual pixel values ( such as a density value and a color difference value ), moves to step s 48 in the flowchart in fig1 , repeats the processing for the next block , and conducts the processing for the entire divided blocks . fig1 is a flowchart showing processing for reading in an electronic watermark , decoding it , and detecting tampering during reproducing an image in the third embodiment . first , the controller 1 stores an entered encryption key ( a secret key ) for embedding an electronic watermark ( s 61 ). the controller 1 also reads out the image information including an embedded electronic watermark ( s 62 ), and decompress the compressed image information ( s 63 ). further , the controller 1 divides the image information into blocks with the same size comprising n × m pixels ( s 64 ). at this time , the controller 1 divides such that the block partially overlaps the upper , lower , left , and right_blocks . the controller 1 sets a threshold for a pixel value ( such as a luminance value and a color difference value ) of the pixel in the block , and compares with the threshold to obtain a boundary between two types of image regions based on the length ( the position of change ) of a successive run of the pixel values ( such as a luminance value and a color difference value ) of the pixel ( s 65 ). the controller 1 checks whether the processing for the entire divided blocks has completed ( s 66 ), when the processing for the entire blocks has not completed ( no in s 66 ), the controller 1 reads out an electronic watermark in the block , decodes it , and determines an existence of tampering ( s 67 ), and the controller 1 moves the processing to the next block when step s 67 is completed ( s 68 ), and returns to step s 66 . if the processing has completed for the entire blocks ( yes in s 66 ), the controller 1 shows a result of analyzing the image information including the embedded electronic watermark ( s 69 ). then , fig1 a and 16b are flowcharts showing processing for reading out the electronic watermark in the block , decoding it , and determining an existence of tampering according to the third embodiment . in step s 67 in fig1 , the electronic watermark is read out and decoded with the independent multiple processing methods . since reading out and decoding the electronic watermark is repeated for the multiple methods , the controller 1 initializes “ loop no ” for recording the number of the processing methods and “ ng # count ” for recording a count of detected abnormalities ( s 70 ). then , the controller 1 checks whether the multiple types of processing conducted as embedding an electronic watermark have conducted ( s 71 ), and if the count of the conducted types of the processing is not the total of the multiple types of the processing ( no in s 71 ), the controller 1 initializes “ hash no ” for storing a hash value obtained by the hash function ( s 72 ). the controller 1 checks the pixel values from the upper left to the lower right pixel by pixel in the same block , obtains the length ( the position of change ) of the white side run or the black side run of the successive pixel values of the pixel , and also checks whether the check has completed for the entire pixels ( s 73 ). if the processing has not completed for the entire pixels ( no in s 73 ), the controller 1 obtains a new hash value while the last hash no , the lengths of the run of the pixel values ( the white side or the black side ) of the pixel , the secret key , the date of the processing , and the production number of the apparatus are used as seed data for a hash function , and stores it in “ hash no ” ( s 74 ). the controller 1 determines whether the position of change in the run length in step s 73 is in a changeable region in the block ( s 75 ), and if the position is not in a changeable region ( no in s 75 ), the controller 1 moves to processing in the corresponding method for the next pixel ( s 76 ), and then returns to step s 73 . if the position is in a changeable region ( yes in s 75 ), the controller 1 checks whether the position of the pixel corresponds to a position subject to skipping ( s 77 ), and moves to step s 76 if so ( yes in s 77 ). if the position does not correspond to a position subject to skipping ( no in s 77 ) in step s 77 , the controller 1 checks the odd / even of the length of the run of the pixel at the position of change based on the odd / even of “ hash no ” obtained in step s 74 ( s 78 ). if the match of the odd / even is confirmed ( yes in s 78 ), the controller 1 determines that the image was not tampered , and moves to step s 76 . if a mismatch of the odd / even is detected ( no in s 78 ), the controller 1 determines that the image was tampered , adds 1 to “ ng # count ”, and moves to step s 76 . if the processing has completed for the entire pixels in the block in step s 73 ( yes in s 73 ), the controller 1 adds 1 to “ loop no ”, switches to a new method for reading out an electronic watermark ( s 80 ), and returns to step s 71 . similar processing is applied to a pixel value of the pixels in the new method , if the entire processing methods for the specified different pixel values ( such as a density value and a color difference value ) have completed ( yes in s 71 ), the controller 1 checks whether “ ng # count ” recording the number of abnormalities is larger than a reference ( s 81 ), and if it is larger ( yes in s 81 ), the controller 1 determines that the corresponding block was tampered , records the position of the block ( s 82 ), and moves to step s 68 in fig1 . if “ ng # count ” is smaller in s 81 ( no in s 81 ), the controller 1 determines that the corresponding block was not tampered , records the position of the block ( s 83 ), and returns to step s 68 in fig1 in the same way . consequently , when image information including an embedded electronic watermark is compressed with lossy compression , is stored , and is reproduced , an existence of tampering of an digital content compressed with the lossy compression is detected based on decision by majority in terms of results of reading out and decoding the electronic watermark in the decoded image information in multiple methods . as described above , when the present invention is integrated into a digital camera and the like , since an electronic watermark is directly embedded into multi - valued or binary image information pictured and recorded , the image information is non - compressed , loss - less - compressed , or lossy - compressed , and is stored , the embedded electronic watermark during the imaging is reproduced in a similar state , and tampering is detected and a block at a corresponding position is limited by checking this electronic watermark , the present invention provides such an effect that an image pictured by the digital camera can be used as an photographic evidence .	6
fig3 is a sectional view of a dry etching apparatus according to an embodiment of the present invention . referring to fig3 a susceptor 13 for supporting a substrate 12 is arranged in a vacuum container ( reaction container ) 11 constituting an etching chamber . a heater ( not shown ) is fitted on the susceptor 13 for heating the substrate 12 . the susceptor 13 can move along orthogonal x - and y - axes on a horizontal plane . a photoreactive gas such as cl 2 is supplied from a flow rate controller 15 to the container 11 through a gas inlet 14 . a deposition gas such as si ( ch 3 ) 4 is supplied from a flow rate controller 16 to the container 11 through the gas inlet 14 . the container 11 has a gas outlet 17 for evacuating the gas therethrough . a first light source 21 for dissociating the photoreactive gas is arranged above the vacuum container 11 . the light source 21 comprises a cd - he laser for emitting light ( laser beam ) 22 , having its emission center at a wavelength of 325 nm . the first light 22 from the light source 21 is introduced to the container 11 through an ultraviolet ray - permeable window 23 in an upper wall of the container 11 . it then vertically irradiates the upper surface of the substrate 12 on the susceptor 13 . a second light source 24 for dissociating the deposition gas is arranged to the left of the container 11 . the light source 24 emits far ultraviolet rays . second light 25 from the second light source 24 is introduced to the container 11 through a light - permeable window 26 in a side wall of the container 11 , and passes parallel to the upper surface of the substrate 12 . the light 25 is guided outside the container 11 through a light - permeable window 27 formed in the side wall of the container 11 opposite to the light - permeable window 26 . a layer consisting of a material for absorbing the first light 22 , e . g ., a carbon layer 30 , covers the inner surface of the container 11 of the etching apparatus having the above - mentioned structure . the reflected or scattered light of the first light 22 irradiating the substrate 12 is absorbed in the carbon layer 30 and does not reach the substrate 12 again . the etching process , in a case using the above - mentioned etching apparatus , will be described . in this example , an n + - polysilicon substrate is used as a sample to be etched . first , as shown in fig4 a , an sio 2 film 32 is deposited on a silicon substrate 31 . an n + - polysilicon layer 33 , as the sample to be etched , is deposited on the film 32 , and an etching mask 34 comprising a photoresist is formed on the layer 33 . a semiconductor body , shown in fig4 a , is disposed on the susceptor 13 of the etching apparatus of fig3 . etching is performed in the following manner . cl 2 , as a photoreactive gas , and si ( ch 3 ) 4 , as a deposition gas , are introduced into the container 11 through the gas inlet 14 . ultraviolet rays having a wavelength of 300 to 400 nm , are radiated as the first light 22 from the first light source 21 onto the semiconductor body . far ultraviolet rays are radiated , as the second light from the second light source 24 , to pass above the semiconductor body . then , cl 2 , as the photoreactive gas , is dissociated by the first light 22 to form cl radicals . the cl radicals etch the n + - polysilicon film 33 . meanwhile , the si ( ch 3 ) 4 gas , as the deposition gas , is dissociated by the second light source 25 and reacts with the cl radicals to form a non - volatile deposited film on the surfaces of the n + - polysilicon film 33 and the mask 34 . the film deposited on the n + - polysilicon film 33 protects the film 33 from penetration by the cl radicals . as a result , a portion of the film 33 covered with the deposited film is not etched . in contrast to this , a light - irradiated surface of the polysilicon film which is not covered with the deposited film , is etched at a higher rate than the deposition rate , due to a photo - assist effect ( mainly attributable to thermal reaction or photochemical reaction ). as a result , vertical etching is performed so that anisotropic etching , which does not cause undercutting , can be achieved . for the sake of explanation , fig4 b shows a state wherein the film 33 is etched to a certain degree , thereafter , radiation of the first light 22 is stopped such that only the etching reaction is stopped . in such a case , the deposition reaction continues , and a non - volatile deposited film 35 is uniformly formed on the surfaces of a polysilicon film 33a and the mask 34 . when the first light 22 is radiated in this state , a portion of the deposited film 35 irradiated with the first light 22 , is quickly etched , and , thereafter , vertical etching of the film 33a progresses . meanwhile , on a side surface of the film 33a not irradiated with light , the deposition reaction progresses faster than the etching reaction . as a result , a thin deposited film 35 is formed to protect the side surface of the film 33a so that anisotropic etching is attained , thereby obtaining a polysilicon pattern 33b without undercutting , as shown in fig4 c . it must be noted that since the film 35 on the side surface of the film 33b is extremely thin , it does not degrade the patterning accuracy . in order to obtain the pattern 33b having no undercutting , as described above , the first light 22 must radiate the surface to be etched , vertically . however , the first light 22 can be reflected or scattered by the surface to be etched , and then reflected by the inner surface of the container 11 to become incident again on the surface to be treated . if the light is reflected by the container 11 , as shown in fig5 the film 35 on the side surface of the film 33a is etched , thereby generating an undercutting 36 . however , according to the present invention , the inner surface of the container 11 is coated with a light - absorbing material film 30 comprising carbon or the like . as a result , the first light 22 reflected or scattered from the surface to be etched does not become incident again on the surface to be etched . as has been mentioned previously , according to the present invention , the layer 33 , as a sample to be etched , can be selectively etched by light radiation without using charged particles such as electrons and ions . in addition , since concurrent etching and film formation are utilized , anisotropic etching is enabled . furthermore , since the carbon layer 30 ( light - absorbing material layer ) is deposited on the inner surface of the container 11 , nonuniform etching ( e . g ., occurrence of undercutting ), caused by reflection or scattering of the light 22 , can be prevented to contribute to proper micropatterning and integration of semiconductor devices . the present invention is not limited to the above - described embodiment . although the present invention has been described with respect to a case of etching , it can also be applied to film formation . for example , referring to the apparatus shown in fig3 si ( ch 3 ) 4 + o 2 and ccl 4 can be used as a deposition gas and a reactive gas , respectively , so that a thin film can be formed on a substrate to be treated . in this case , light irradiation heats and electronically excites the substrate so that deposition on the light - irradiated portion is performed . thus , a film can be deposited only on the light - irradiated portion . in this case , the light - absorbing material layer is provided inside the container 11 in order to prevent light from radiating a portion on which a film is not to be deposited . the present invention can also be applied to surface treatment of a semiconductor substrate or the like .	1
fig1 a is a block diagram showing the cache line allocation system of the present invention . although the embodiment gives three - dimensional graphic shader as an example , the present invention may be applied to other applications . in this embodiment , processer 10 is a graphics processing unit ( gpu ), which assists cpu ( not shown ) to accelerate the graphic processing . processer 10 performs information accessing on cache 14 and system memory 16 via a cache controller 12 . cache 14 may be a static random access memory ( sram ), the accessing speed of which is faster than the system memory 16 such as dynamic random access memory ( dram ). the cache controller 12 and cache 14 may be integrated on the same chip with processor 10 , but it should be understood that the disclosure is not limited thereto . in this embodiment , cache 14 is used as an instruction cache , to store the instructions used by the graphic processing unit to process a three - dimensional graph , but it should be understood that the disclosure is not limited thereto . the three - dimensional graphic shader in this embodiment adopts multithreading operations which means that processer 10 performs more than one processing on the according pixel data simultaneity since every pixel may be performed the same instructions . further , cache 14 in this embodiment may also be a “ multiway ” cache , which divides the whole memory space into a plurality of blocks to reduce the complexity of the judging logical circuit . fig1 b is a block diagram showing the cache line allocation system according to another embodiment of the present invention . in this embodiment , the cache which is similar to the cache 14 in fig1 a may have two levels , which are a first level cache ( named the l1 cache in general ) 14 a and a second level cache ( named the l2 cache in general ) 14 b . the l1 cache and the l2 cache are controlled by a first level cache controller 12 a and a second level cache 12 b respectively . in this embodiment the cache controller as the cache controller 12 in fig1 a also has two levels : the first level cache controller 12 a and the first level cache 14 a . the first level cache controller 12 a and the first level cache 14 a may be integrated in the same chip with processor 10 , but it should be understood that the disclosure is not limited thereto . the cache allocation method of the present invention may be implemented in the first level cache controller 12 a and the first level cache 14 a , but it should be understood that the disclosure is not limited thereto . fig2 is a block diagram showing the detail of the cache controller 12 which includes a control logic unit 120 and a table 122 . control logic unit 120 provides the communication interface to the controller 10 , the cache 14 , and the system memory 16 . table 122 is coupled to the control logic unit 120 , and is used for keeping a record for all the information , such as instructions or pixel data , stored in the cache controller 12 . in this embodiment , the contents of table 122 are not only the addresses of all the information in system memory 16 , but also a lock flag and a replacement value of every line in cache 14 , wherein , the lock flag is the flag identifying whether the corresponding line in cache 14 is locked . when a line is locked , the corresponding lock flag turned to “ locked ” to prevent the information stored in the line from being overwritten , but the information could still be accessed by the system memory . the replacement value is the judgment basis of whether the information in an unlocked line in cache 14 should be overwritten . this embodiment uses “ least recently used , lru ” algorithm , to trace the access frequency of each of the plurality of information , to get a lru displacement value . the lock flag and the replacement value will be discussed in more detail combined with the embodiments in the following description . fig3 is a flow chart showing the cache allocation method of cache 14 according to one embodiment of the present invention . the flow is divided into two stages , the setting stage 310 and the operating stage 320 . at first , in setting stage 310 , at step 31 , the properties of a plurality of information , such as length , the category and the distribution of the instructions , are analyzed by the cpu ( not shown ). in this embodiment , the information is a plurality of instructions used by the graphic processing unit to process a three - dimensional graph , but it should be understood that the disclosure is not limited thereto . then , at step 32 , if the length of the batch of information is larger than the length of cache 14 is determined by the cpu . if the length of the batch of information is less than or equal to the length of cache 14 , cache 14 may store all the information at one time . in this case , as shown in step 33 , all the lines in cache 14 are locked , and the lock flags of all cache lines are modified to “ locked .” therefore , in the following information accessing operations , the corresponding information may be accessed directly in cache 14 without accessing the system memory 16 . since there is not any rewriting operations in the cache lines , a hit determination mechanism of cache 14 can be turned off . the hit determination mechanism is a common method in the art , which means the cpu accessed through the whole cache until it finds the aimed information . in the embodiment , the plurality of instructions would be accessed every time processing a pixel . therefore , in the following operations , processor 10 may access cache 14 directly and there is no need to determine every time whether these instructions can be accessed in cache 14 . the power consumption and the time spent on reading could be both decreased at the same time . if the length of the plurality of information is larger than the length of cache 14 , the process goes to step 34 . at step 34 , whether the difference between the length of the plurality of information and the length of cache 14 is greater than a presupposed critical value is determined , wherein the presupposed critical value is positive and variable . if the result of step 34 is no , the length of the plurality of information is a little bit longer than the length of cache 14 . then , at step 35 , more than a half of all the cache lines or most of the cache lines are locked , e . g . at least one cache line in cache 14 is reserved to unlocked , and the other cache lines are locked . therefore , the information in the locked lines could be read from cache 14 directly in the following applications without accessing the system memory , so the information transmissions of system memory could be decreased and the meaningless updating and rewriting of cache 14 could be effectively reduced . comparing to the conventional approach in which every line is unlocked , the time spent on reading is greatly reduced and the hit rate is increased . on the other hand , the unlocked cache lines are reserved for alternatively writing the following information read from system memory 16 . if the result of step 34 is yes , the length of the plurality of information is much larger than the length of cache 14 . then , at step 36 , less than the half of all the cache lines or a few lines in cache 14 may be locked . in some conditions , all of the lines in cache 14 may be unlocked . more cache lines , or up to all the lines in cache 14 are reserved to be unlocked to participate in alternative writing . for example , the length of the cache is 256 , and the presupposed critical value is 20 . if the length of the plurality of information is 270 , because 270 − 256 & lt ; 20 , which means the length of the plurality of information is a little bit longer than the length of cache 14 , in this condition , most of the lines , for example , 240 lines may be locked , and only 30 instructions may occupy 16 unlocked lines alternatively . on the other hand , the length of the cache is still 256 , the presupposed critical value is still 20 , but the length of the plurality of information is 1000 . 1000 − 256 & gt ; 20 , which means the length of the plurality of information is much longer than the length of cache 14 . in this case , if most lines , for example 240 lines , are locked , there would be 760 instructions occupying the 16 unlocked lines alternatively , then , on the contrary , the system performance may be degraded . so when the length of the plurality of information is much longer than the length of cache 14 , a few lines should be locked , for example 128 or even less . then , the setting stage 310 ends , and the process may enter into the operating stage 320 . in the operating stage 320 , first of all , at step 37 , the instructions in the locked lines may not be overwritten , and the overwriting may only be performed on the instructions in the unlocked lines . generally , the information which has a higher using frequency would be locked . for example , if an instruction may be used by every pixel , then its using frequency may be 100 %. the instructions have a higher using frequency like that should get the corresponding line locked . if an instruction is in an “ if . . . else ” judge branch , assume its using frequency to be 50 % for simplicity , then its using frequency is lower , so its corresponding line may not be locked . the replacement value of the unlocked line may be set significant , and every time the information in the line is read , the replacement value may increase by one . then the information that in the line with a larger replacement value may be read more frequently , and the information that in the line with a smaller replacement value may be read less frequently . the instructions in unlocked cache lines which should be replaced by the new accessing instructions from the system memory 16 may be determined upon the replacement value . the replacement value is lru replacement value in this embodiment . therefore , in the following writing operations , the new information may be used to overwrite the lines with the smaller replacement value in cache 14 . in this way , the information that has a high reading frequency may be replaced less often , therefore in the unlocked lines , the meaningless information updating and rewriting of the cache could also be effectively reduced , and the hit rate could also be increased . because the whole system memory accessing frequency is reduced , the bandwidth usage effectiveness of the system memory is improved . at step 38 , whether all the pixels have been processed is determined . if the result is “ no ,” the process enters to step 37 . if the result is “ yes ,” the cache access operation for processing one graph is ended . the progress may go back to setting stage 310 , for accessing the cache 14 to processing a new graph . fig4 is a flow chart showing the cache allocation method according to another embodiment of the present invention . first of all , at step 41 , processor 10 may send the instruction reading request to cache controller 12 , to ask for at least one instruction . then , at step 42 , the control logic unit 120 of cache controller 12 may determine whether the requested instruction is stored in cache 14 based on table 122 . if the result of step 42 is “ yes ” which means the instruction is in the cache 14 , then cache controller 12 may get the requested instruction from cache 14 to provide it to processor 10 , and in step 43 , all the instructions in cache 14 may be locked . on the other hand , if the result of step 42 is “ no ” which means the instruction is not in the cache 14 , then , in step 44 , cache controller 12 may access system memory 16 for the requested instruction , then provide it to processer 10 , store the instruction in cache 14 and update the table 122 . next , at step 45 , whether the length of the plurality of instructions is larger than the length of cache 14 is determined . if the result is “ no ,” then all the instructions wrote in step 44 may be locked . that is in step 46 , the lock flags of corresponding lines in table 122 are set to be “ locked .” if the result of step 45 is “ yes ,” then enters to step 47 , whether the difference between the length of the plurality of instructions and the length of cache 14 is greater than a presupposed critical value is determined . if the result of step 47 is “ no ,” the length of instructions is a little bit larger than the length of cache 14 . then , at step 48 , a few lines , or at least one line in cache 14 are reserved unlocked , and the other instruction is locked . the unlocked cache lines , on the other hand , are used for following instructions replacement with system memory 16 . if the result of step 47 is “ yes ,” the length of instructions is much longer than the length of cache 14 , then , a few lines in cache 14 may be locked , and most of the lines are unlocked lines . the unlocked cache lines are used for following replacement operations . when a line is determined to be an unlocked line and may perform the following replacement operations , the replacement value corresponding to that line may be set as significant . in step 49 , the instructions in unlocked cache lines that should be replaced by the new accessing instructions from the system memory 16 may be determined upon the replacement value , as discussed above reference to fig3 . using the above process flows of the embodiments of the present invention , the accessing frequency of system memory 16 is effectively reduced , and a hit rate of cache 14 is greatly increased . the hit rate is a value which expresses the rate of obtaining the aimed information from the cache in one accessing operation . especially for the processing of different pixels or different graphs , as the same instructions may be used , the advantages of the present invention are more obvious . the following is an example showing the efficiency improvement of the present invention compared to the conventional approach . assuming the length of the cache is 256 , and the length of shader instructions is 257 . based on the allocation method of cache in conventional approach , when processing the first pixel , the first 256 instructions may be written into the cache in turn from system memory , to be processed by graphics processing unit . when it comes to the 257 th instruction , that instruction may be written into the first cache line and the first instruction may be overwritten . when processing the second pixel , because the first instruction could not be found in the cache , the first to the 256 th instruction must be read from the system memory a second time . for the graphic that has an analyzing degree of 1280 × 1024 , there would be a total 1280 × 1240 × 257 times of system memory accessing , which is 336 , 855 , 040 times of accessing . for the same example , if using the embodiment of the present invention , the first 256 instructions may be written into cache 14 from system memory 16 in turn , the first 255 instructions may be locked in the first 255 cache lines , and the 256 th instruction line may reserved to be unlocked . when it comes to the 257 th instruction , that instruction may be written into the unlocked line in cache 14 from system memory 16 . next , when processing the second pixel , because the first to the 255 th instruction have already been locked in cache 14 , there only need to read the 256 th and the 257 th instruction in turn from system memory 16 . the third and the following pixels would have the same operations . therefore , there are 257 +( 1280 × 1024 − 1 )* 2 times of accessing to the system memory 16 , which is 2 , 621 , 695 times of accessing . comparing to the conventional approach , the effectiveness of the present invention has improved by 128 times . the previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein .	6
example embodiments will now be described more fully with reference to the accompanying drawings . fig1 shows the typical rectification efficiency ( η rect ) for a rectifying device as a function of input power . the rectification efficiency is highly power - dependent . as input power level increases , the rectification efficiency increases until the saturation point where the breakdown effects become dominant . fig2 shows the conduction angle of rectifying devices . the rectifying device conducts current when the voltage across it exceeds its threshold voltage . the conduction angle increases as input power increases . fig3 shows an example of the input conductance as a function of input power level for a rectifying device . rectifiers typically exhibit an increasing input conductance with input power , due to increase in conduction angle . because of the power - dependent input impedance of diode or transistors rectifiers , it is usually difficult to minimize the reflection coefficient γ in a wide range of power levels . as described in equation ( 1 ) above , the overall efficiency ( η overall ) is a function of both η rect and γ , and is highly power - dependent . in conventional rectifier designs , η overall is often optimized at a specific power level , providing a very narrow dynamic range . an adaptive power distribution system is presented in this disclosure . the system exploits the rectifiers &# 39 ; power dependent nonlinear impedance to achieve adaptive power distribution , and therefore significantly enhances the rectifier &# 39 ; s dynamic range . fig4 is basic block diagram of an example adaptive power distribution system 40 . in this example , the system 40 is comprised of two rectifier cells 41 . each rectifier cell 41 includes a rectifying device and an impedance transformation network as will be further described below . in operation , the total dc output power is the combined output from each of the rectifier devices . while reference is made to a system comprised of two rectifier cells , it is readily understood that the techniques set forth herein may be extended to a system having three or more rectifier cells as well . more specifically , the adaptive power distribution system 40 includes an input port 42 configured to receive an input signal ( e . g ., an ac or rf signal ), a first circuit branch 43 and a second circuit branch 44 , where the second circuit branch 44 is arrange in parallel with the first circuit branch 43 . the first circuit branch 43 has an input node electrically coupled to the input port 42 . likewise , the second circuit branch 44 has an input node electrically coupled to the input port 43 . in the example system , the input conductance of rectifier cell 1 and rectifier cell 2 ( looking into the circuit including both the rectifying device and the impedance transformation network ) are denoted as g 1 and g 2 , respectively . individual impedance transformation networks are designed for each of the rectifying cells , such that g 1 ( p in ) is a decreasing function of power , while g 2 ( p in ) is an increasing function of power . ideally , g 1 ( p in ) and g 2 ( p in ) should follow equation ( 2 ): where p in is the source power level ; p 1 sat and p 2 sat are the saturation points for the rectifiers in rectifier cell 1 and rectifier cell 2 , respectively ; g total is the total conductance looking into the entire rectifier array port , and is equal to g 1 + g 2 . fig5 shows the ideal behavior of g 1 ( p in ) and g 2 ( p in ) as a function of available power from the source . by satisfying equation 2 , the variation of g 1 ( p in ) and g 2 ( p in ) with power cancel each other , therefore the total input conductance g total is maintained constant regardless of source power level . g total is matched to the source impedance with conventional impedance transformation circuits ( labeled 46 is fig4 ). since g total is stable over power , the reflection coefficient γ can be minimized within a wide range of power levels . the described approach allows for adaptive power distribution between rectifier 1 and rectifier 2 . as is illustrated in fig5 , a rectifier cell has three operation regions , namely : p in ≦ p 1 sat ; p 1 sat & lt ; p in ≦( p 1 sat + p 2 sat ); and p in & gt ;( p 1 sat + p 2 sat ). for convenience , the three regions are referred to as single device operation region , transition region and saturation region , as is depicted in fig5 . the real power delivered to the individual rectifiers is denoted as p 1 and p 2 . the power distribution ratio between the rectifiers , p 1 / p 2 , is equal to the conductance ratio between the rectifiers , shown in equation ( 3 ): fig6 shows the ideal input power to each of the rectifier cells , as functions of the available power from the source . in the single device operation region , the conductance ratio g 1 / g 2 ( and therefore p 1 / p 2 ) is much higher than 1 . therefore , almost all the input power is delivered to rectifier cell 1 . since the rectification efficiency increases with input power level ( as can be seen in fig2 ), such an approach will maximize the efficiency under the low - power condition . as the input power increases beyond p 1 sat the circuit operates in the transition region . both rectifiers receive input power and contribute to the dc output power . the power distribution ratio gradually decreases with power , from p 1 = p 1 sat and p 2 = 0 at p in = p 1 sat , to p 1 = p 1 sat and p 2 = p 2 sat at p in =( p 1 sat + p 2 sat ). during this transition , p 1 remains the same , i . e . p 1 = p 1 sat and p 2 will be p 2 = p in − p 1 sat . in this way , the rectifier in rectifier cell 1 always operates at its maximum efficiency , while the efficiency of the rectifier in rectifier cell 2 gradually increases with increasing power level , until it reaches its peak efficiency at p in =( p 1 sat + p 2 sat ). in the saturation region , the power level delivered to each device receive is beyond its saturation point . in this region , the power distribution ratio p 1 / p 2 = p 1 sat / p 2 sat is maintained such that the rectification efficiency for the two devices decay at the same rate . a comparison between the rectification efficiency of a single rectifier , and the adaptive power distribution system described in this disclosure are shown in fig7 . in single device operation region , since all the power is delivered to the rectifier in rectifier cell 1 , the efficiency of the rectifier network is equal to the efficiency of a single rectifier circuit . in saturation region , since both devices reach their breakdown region and decay at the same rate , the efficiency of the rectifier network is equal to the shunt of two rectifiers . in the transition region , rectifier cell 1 maintains maximum efficiency . the efficiency of rectifier cell 2 gradually increases with power and reaches maximum efficiency at p in = p 1 sat + p 2 sat ; however , when p in & lt ; p 1 sat + p 2 sat although the efficiency of rectifier cell 2 is not maximized , since the rf power delivered to rectifier cell 2 is small , the degradation of the overall efficiency is small . therefore , the efficiency of the wide dynamic range rectifier network can approach the outline . in summary , the aforementioned method significantly improves both η rect and γ as power level changes , thereby achieving high overall efficiency rectification with a wide dynamic range . fig8 further depicts an example embodiment for the adaptive power distribution system 80 . the adaptive power distribution system 80 includes an input port 81 , a first circuit branch 82 and a second circuit branch 84 , where the second circuit branch 84 is arrange in parallel with the first circuit branch 82 . an impedance matching circuit 88 may be interposed between the input port 81 and the remainder of the circuit , such that input impedance of network is matched to the source impedance z 0 . in the example embodiment , the rectifying devices are implemented by diodes 86 although other types of rectifying devices ( e . g ., transistors , etc .) are contemplated as well . the two rectifying devices are selected such that their saturation points p 1 sat to p 1 sat + p 2 sat covers the desirable power range . each circuit branch includes an impedance transformation network . the first impedance transformation network 83 is electrically connected between the input port 81 and the first diode 86 . the first distribution circuit 83 is represented by reactance jb 2 , jb 4 and jx . on the other hand , the second impedance transformation network 85 is electrically connected between the input port 81 and the second diode 87 . the second distribution circuit 85 is represented by reactance jb 1 , and jb 3 . it is readily understood that the reactance can be implemented using one or more lumped components , transmission lines , or a combinations thereof . in one embodiment , the reactance is implemented using inductors and / or capacitors . other implementations also fall within the scope of this disclosure . the circuit can be rearranged into the form as illustrated in fig9 to simplify its operation description . during operation , the first circuit branch exhibits a decreasing input conductance with power ; while the second circuit branch exhibits an increasing input conductance g 2 with power . that is , the first impedance transformation network 82 and the second impedance transformation network 84 are configured so that ratio of conductance at input of the first rectifier 86 to conductance at input of the second rectifier 87 decreases with increases in magnitude of the rf power . additionally , the sum of the conductance at the input of the first rectifier with the conductance at the input of the second rectifier remains substantially constant over variations in magnitude of the rf power . thus , the power dividing ratio p 1 / p 2 = g 1 / g 2 is much greater than one in the single device operation region , decreases with input power in the transition , and maintains relatively stable in the saturation region , approaching the proposed adaptive power distribution scheme shown in fig6 . to demonstrate this concept , a 900 mhz two - device rectifier array was constructed . a hsms2852 high sensitivity rectifier diode is used for low - power rectification , while a hsms2820 diode which has a higher power capability is used for high - power operation . the circuit is designed with microstrip line impedance matching networks on rogers ro4003c laminates , using a 1 . 2 v rechargeable battery as the load . for comparison , a single diode rectifier is designed with the same device and optimized to achieve maximum efficiency at the same frequency . fig1 shows the simulation result of the power delivered to each rectifier device , as a function of input power level . it can be seen that the power delivered to rectifier 1 is much higher than rectifier 2 below p av of 5 dbm ( the single device operation region ). within the p av ranging from 5 dbm to 15 dbm , the power delivered to rectifier 2 increases as input power increases . this is the transition region of the rectifier circuit . afterwards , the power distribution ratio remains stable between both rectifiers ( the saturation region ). fig1 shows the measured overall efficiency as a function of power . the rectifier array circuit demonstrates & gt ; 50 % overall efficiency over 18 . 5 db variation of input power levels ( from − 0 . 5 dbm to 18 dbm ), which is 11 . 5 db wider than the single - diode rectifier . the approach described is very flexible and it allows one to design rectifier circuits for any desired dynamic range . for example the circuit topology can be extended to an n - device network to include a larger number of rectifiers ( n ≧ 3 ). an example of an adaptive power distribution system having n rectifiers is shown in fig1 . the circuit configuration will appear to be multiple rectifier cells connected in shunt with the correct phase correlations and conductance variation trends . in an n rectifying device array , each device saturation power point is denoted p sat1 , p sat2 , . . . p satn . each rectifying device is connected to an impedance transformation network , for example here , formed by jb i1 , jb i2 and jx i in fig1 ( i = 1 , 2 , . . . n ). the conductance looking into the network formed by jb i1 , jb i2 and device i is denoted as g i . from the ( i − 1 ) th cell , the conductance looking into the rest of the network is denoted as g i ( i = 2 , 3 , . . . , n ). the design conditions are provided below . when input power p in is within the range when p in & lt ; p sat1 , then g 1 = g input and g 2 = g 3 = . . . = g n = 0 and when p in & gt ; σ k = 1 n p sat k , then the following condition is satisfied : therefore , when the input power p in is small ( smaller than p sat1 ), only the rectifier device 1 operates ; as p in increases beyond p sat1 , rectifying device 2 starts to operate . as p in continues to increase , more devices start to conduct , until p in ≧ σ k = 1 n p sat k when all devices saturate . the range at which rectifier array maintains its high efficiencies then ranges from p sat1 to σ k = 1 n p sat k . as an example , fig1 and 14 show the simulated overall efficiency as a function of power . the circuit used for simulation includes three different diodes : hsms2852 for low - power operation , hsms2820 for medium - power operation , and hsms2700 for high - power operation . the rectifier array circuit demonstrates & gt ; 50 % overall efficiency over 32 db variation of input power levels ( from − 3 dbm to 29 dbm ). this disclosure is applicable for powering various devices , or for charging rechargeable batteries ( in wpt and wph systems ). it is also applicable for voltage regulator circuits such as switch mode dc - dc converters . the terminology used herein is for the purpose of describing particular example embodiments only and is not intended to be limiting . as used herein , the singular forms “ a ,” “ an ,” and “ the ” may be intended to include the plural forms as well , unless the context clearly indicates otherwise . the terms “ comprises ,” “ comprising ,” “ including ,” and “ having ,” are inclusive and therefore specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . the method steps , processes , and operations described herein are not to be construed as necessarily requiring their performance in the particular order discussed or illustrated , unless specifically identified as an order of performance . it is also to be understood that additional or alternative steps may be employed . the foregoing description of the embodiments has been provided for purposes of illustration and description . it is not intended to be exhaustive or to limit the disclosure . individual elements or features of a particular embodiment are generally not limited to that particular embodiment , but , where applicable , are interchangeable and can be used in a selected embodiment , even if not specifically shown or described . the same may also be varied in many ways . such variations are not to be regarded as a departure from the disclosure , and all such modifications are intended to be included within the scope of the disclosure .	7
in the following description and claims , the terms “ coupled ” and “ connected ,” along with their derivatives , may be used . it should be understood that these terms are not intended as synonyms for each other . rather , in particular aspects , “ connected ” may be used to indicate that two or more elements are in direct physical or electrical contact with each other . “ coupled ” may mean that two or more elements are in direct physical or electrical contact . however , “ coupled ” may also mean that two or more elements are not in direct contact with each other , but yet still co - operate or interact with each other . an aspect is an implementation or example . reference in the specification to “ an aspect ,” “ one aspect ,” “ some aspects ,” “ various aspects ,” or “ other aspects ” means that a particular feature , structure , or characteristic described in connection with the aspects is included in at least some aspects , but not necessarily all aspects , of the present techniques . the various appearances of “ an aspect ,” “ one aspect ,” or “ some aspects ” are not necessarily all referring to the same aspects . elements or aspects from an aspect can be combined with elements or aspects of another aspect . not all components , features , structures , characteristics , etc . described and illustrated herein need be included in a particular aspect or aspects . if the specification states a component , feature , structure , or characteristic “ may ”, “ might ”, “ can ” or “ could ” be included , for example , that particular component , feature , structure , or characteristic is not required to be included . if the specification or claim refers to “ a ” or “ an ” element , that does not mean there is only one of the element . if the specification or claims refer to “ an additional ” element , that does not preclude there being more than one of the additional element . it is to be noted that , although some aspects have been described in reference to particular implementations , other implementations are possible according to some aspects . additionally , the arrangement and / or order of circuit elements or other features illustrated in the drawings and / or described herein need not be arranged in the particular way illustrated and described . many other arrangements are possible according to some aspects . in each figure , the elements in some cases may each have a same reference number or a different reference number to suggest that the elements represented could be different and / or similar . however , an element may be flexible enough to have different implementations and work with some or all of the systems shown or described herein . the various elements shown in the figures may be the same or different . which one is referred to as a first element and which is called a second element is arbitrary . low noise , low power , rf amplifiers in most communication applications have a single - ended input in order to achieve low noise figure as well as achieve good matching at the antenna interface . in order to achieve im 3 cancellation in a wideband , single - ended amplifier circuit , im 3 correction circuitry should also be wideband , low power as well as single - ended . in order for the correction to be wideband and operate at high rf frequencies n - channel devices may be utilized due to their relatively high mobility compared to p - channel devices . however , p - channel devices may also be used for certain applications assuming the circuit delay through the cancellation circuitry is minimized . the rf amplifiers described herein include a main amplifier and a correction circuit ( e . g ., correction section ). the correction circuit may also be referred to as an “ auxiliary amplifier .” the active devices of the auxiliary amplifiers described herein are preferably composed of a single device ( e . g ., single nmos , pmos , or npn device ) that is coupled to a single - ended main amplifier . one critical function of the auxiliary amplifier is to correct the im 3 products produced in the main amplifier . in one aspect , the auxiliary amplifier may be constructed from a single n - channel device ( e . g ., nmos or npn ) thereby exhibiting minimal delay so that it provides very high bandwidth capability especially over p - channel based cancellation circuits of the prior art . this is due to the mobility of n - channel devices having a mobility that is 2 - 3 times faster than the mobility of p - channel devices . in other aspects , the auxiliary amplifier may be constructed from a single p - channel device ( e . g ., pmos or pnp ) to also minimize delay . such a configuration may be used if the main amplifier to which it is coupled is composed of p - channel devices . the auxiliary amplifier provides a scaled down magnitude of the main amplifier &# 39 ; s fundamental signal as well as an in - phase im 3 term , and both of these terms are summed at a common point in the main amplifier . at this critical point , the undesired third order terms will cancel , resulting in a reduction of overall im 3 . this results in substantial improvement in ip 3 over a wide range of frequencies because of the reduced delay inside the auxiliary amplifier . this improvement allows the dc power dissipation of the overall amplifier to be significantly reduced , as the main amplifier distortion is reduced by an order of magnitude as a result of im 3 cancellation . various aspects of rf amplifier featuring im 3 distortion nulling fig2 illustrates a high - level schematic of a wideband rf amplifier 200 featuring im 3 distortion nulling according to one aspect . the rf amplifier 200 includes a main amplifier circuit 210 and a correction circuit 250 ( e . g ., “ auxiliary amplifier ”). the main amplifier 210 generates a main signal current i main that includes signal component i sig , a dc component i dc1 , and a third order nonlinear current i nl3a . the ratio of the third order nonlinear current component i nl3a to the signal current component i sig represents the im 3 performance for the main amplifier 210 alone . the correction circuit 250 generates an auxiliary signal current i aux that includes a dc component i dc2 and a scaled down version of the main amplifier &# 39 ; s signal current component n * i sig . the auxiliary signal also includes a third order nonlinear current i nl3b , which is on the order of the third order nonlinear current i nl3a in the main amplifier 210 . essentially , the correction circuit 250 is a low power version of the main amplifier 210 but the signal gain is deliberately lowered in order to generate a replica of the main amplifier &# 39 ; s 210 im 3 with the same magnitude and opposite phase . according to one aspect , the correction circuit 250 has an input signal gain that is at least 5 db less than the input signal gain ( i . e ., signal gain between v in and v out ) of the main amplifier circuit . according to one aspect , the correction circuit 250 has an input signal gain that is at least 10 db less than the input signal gain of the main amplifier circuit . according to one aspect , the correction circuit 250 has an input signal gain that is at least 15 db less than the input signal gain of the main amplifier circuit . according to one aspect , the correction circuit 250 has an input signal gain that is at least 15 db to 40 db less than the input signal gain of the main amplifier circuit . the resultant output signal current of the rf amplifier 200 is given by : i out = i main + i aux . if the correction circuit 250 is based on n - channel active devices then the correction circuit 250 inverts the phase of the current terms i dc2 , n * i sig , and i nl3b and the output signal current of the rf amplifier 200 is given by i out = i main + i aux =( i dc1 + i dc2 )+( i sig − n * i sig )+( i nl3a − i nl3b ) where n is a scaling factor much less than one ( 1 ). moreover , the im 3 terms also substantially cancel each other out since they are largely the same magnitude and opposite phase . this results in an rf amplifier 200 output i out having reduced im 3 distortion and consequently an improvement in ip 3 performance . fig3 and 4 illustrate a first exemplary novel wideband rf amplifier 200 according to one aspect of the disclosure . the rf amplifier 200 shown in fig3 and 4 is a cmos , wideband amplifier having a common gate architecture ( e . g ., two - stage common gate ). the rf amplifier 200 includes the main amplifier 210 and the correction circuit 250 . the main amplifier includes a first nmos transistor m 1 ( e . g ., “ input transistor ”) having a transconductance ( gm ) that establishes a real 50 ohms impedance at the input node v in given by the equation rin = 1 / gm , where rin is the input real impedance . passive devices c 1 and l 1 resonate out the effects of the amplifier &# 39 ; s 200 package bondwire inductance as well as parasitic capacitance lumped at the input node v in active devices m 1 and m 2 form a first and second common gate stage in the main amplifier 210 and provide isolation between the input node v in and the output node v out . passive devices r 1 and c 4 form an rc low - pass filter , which rejects undesired common mode , low frequency noise on the power supply v dd . the main dc bias voltage v bias is generated by devices c 2 , r 2 , and m 3 . i ref is a dc bias current which will create a gate - source voltage ( vgs ) across the gate of nmos transistor m 3 . this voltage is mirrored across the gate - source voltage vgs of the first transistor m 1 thereby putting the nmos transistor m 1 in a saturation mode of operation and allowing the wideband main amplifier circuit 210 to amplify a given signal at the input v in . fig4 illustrates a first exemplary schematic of the correction circuit 250 according to one aspect of the disclosure . as previously mentioned , the correction circuit 250 is coupled to the main amplifier 210 and provides an intermodulation product cancellation signal to the main amplifier &# 39 ; s signal path to cancel out im 3 distortion products produced by the main amplifier 210 . in the example illustrated in fig4 , the correction circuit &# 39 ; s 250 active components includes a single nmos transistor m 4 ( e . g ., auxiliary transistor ) that has a gate terminal 402 coupled to the input signal v in and a drain terminal 404 coupled to the common point cp (“ common node ”) of the main amplifier &# 39 ; s active devices m 1 and m 2 . the correction circuit 250 will produce a scaled down version of the main amplifier circuit &# 39 ; s 210 signal current . specifically , the correction circuit &# 39 ; s 250 signal current n * i sig is equal to gm m4 * vgs m4 , where the transconductance gm m4 = gm m1 * n . the fraction n is equal to sqrt [( w m4 / l m4 )/( w m1 / l m1 )], where w and l refer to the device width and length , respectively . passive devices c 3 and r 3 provide the correction circuit &# 39 ; s 250 dc biasing and provide alternating current ( ac ) coupling between the main amplifier ( node a ) and m 4 &# 39 ; s input terminal 402 . the vgs of m 4 ( i . e ., vgs m4 ) is biased such that it is a scaled version of the main amplifier &# 39 ; s first transistor m 1 vgs ( i . e ., vgs m1 ). for example , the width w 4 of m 4 is chosen in order to supply m 4 with the appropriate vgs according to the equation vgs m4 = sqrt [ 2i /( μc ox ( w m4 / l m4 ))] v t , where i ( e . g ., i aux ) is the output current of m 4 , μ is the carrier mobility , and c ox is the gate - to - channel capacitance per unit area . the dc and signal currents of the main amplifier 210 and the correction circuit 250 are summed at the common point cp . that is , the signal i aux provided by the correction circuit 250 is summed at the common point cp so that i aux is subtracted from the main amplifier &# 39 ; s signal path . it is at the common point cp where the im 3 terms ( e . g ., i nl3a and i nl3b ) will cancel . fig5 illustrates a second exemplary novel wideband rf amplifier 500 according to one aspect of the disclosure . the rf amplifier 500 shown in fig5 is a bipolar transistor - based , wideband amplifier having a common base architecture ( e . g ., two - stage common base ). the rf amplifier 500 includes the main amplifier 510 and the correction circuit 550 . like its cmos counterpart shown in fig3 and 4 , the bipolar transistor - based design also includes a single transistor for the correction circuit 550 , which greatly reduces delay and increases ip 3 performance . the transconductance gm of the npn transistor q 1 provides the 50 ohm real input impedance needed to interface with outside devices based on the equation rin = 1 / gm . passive devices c 1 and l 1 resonate out any parasitic inductance seen at the package level and internal gate source parasitic capacitance ( cgs ) of device q 1 . active devices q 1 and q 2 provide isolation between v in and v out and form a first and second common gate stage of the main amplifier 510 . passive devices r 1 and c 4 low - pass filter out any low frequency noise on the supply v cc . the main dc bias voltage v bias is generated by devices r 2 and q 3 . feedback resistor r 2 will compensate for the input transistor &# 39 ; s q 1 kickback base current given by i base = i collector / β , where β is the current gain parameter . capacitor c 2 low - pass filters any common mode noise that can come from reference current i ref . the cancellation circuit 550 is coupled to the main amplifier 510 and provides an intermodulation product cancellation signal to the main amplifier &# 39 ; s signal path to cancel out the im 3 distortion products produced by the main amplifier 510 . the cancellation circuit shown in fig5 consists of a single active device , which is an npn transistor q 4 ( e . g ., “ auxiliary transistor ”), that produces a scaled down version of the main amplifier &# 39 ; s signal current in addition to the im 3 third order nonlinear current . the dc biasing of the cancellation circuit &# 39 ; s transistor q 4 is achieved with passive devices r 3 and c 3 . in some aspects , the resistor r 3 may be excluded . the base - emitter voltage v be of q 4 is equal to η * kt / q * ln ( ic / is ), where η is the area of the transistor q 4 , kt / q is a constant 25 mv built - in voltage and ic and is are the collector and saturation currents , respectively . the transistor q 4 is scaled down by making its area smaller than the area of the main amplifier &# 39 ; s input transistor q 1 . the dc and signal currents of the main amplifier 510 and the correction circuit 550 are summed at the common point cp . that is , the signal i aux provided by the correction circuit 550 is summed at the common point cp so that i aux is subtracted from the main amplifier &# 39 ; s signal path . it is at the common point cp where the im 3 terms ( e . g ., i nl3a and i nl3b ) will cancel . the single transistor m 4 / q 4 design of the correction circuit 250 shown in fig4 and 5 allows the correction circuit 250 to provide a signal to the main amplifier signal path that cancels the im 3 distortion products with very little delay . less delay means less phase and less non - linearity , and consequently greater im 3 product cancelation . the n - channel design also allows the rf amplifier 200 to operate at relatively high frequencies and thus the cancellation circuit 250 allows the rf amplifier 200 to operate effectively across a wide band of frequencies . fig6 illustrates a third exemplary novel rf amplifier 600 according to one aspect of the disclosure . the rf amplifier 600 shown in fig6 is a cmos , wideband amplifier having a common gate architecture ( e . g ., two - stage common gate ). the rf amplifier 600 includes the main amplifier 610 and the correction circuit 650 . the main amplifier includes a first pmos transistor m 1 ( e . g ., “ input transistor ”) having a transconductance ( gm ) that establishes a real 50 ohms impedance at the input node v in given by the equation rin = 1 / gm , where rin is the input real impedance . passive devices c 1 and l 1 resonate out the effects of the amplifier &# 39 ; s 600 package bondwire inductance as well as parasitic capacitance lumped at the input node v in active devices m 1 and m 2 form a first and second common gate stage in the main amplifier 610 and provide isolation between the input node v in and the output node v out . passive devices r 1 and c 4 form an rc low - pass filter , which rejects undesired common mode , low frequency noise on the ground line . the main dc bias voltage v bias is generated by devices c 2 , r 2 , and m 3 . i ref is a dc bias current which will create a gate - source voltage ( vgs ) across the gate of pmos transistor m 3 . this voltage is mirrored across the gate - source voltage vgs of the first transistor m 1 thereby putting the pmos transistor m 1 in a saturation mode of operation and allowing the wideband main amplifier circuit 610 to amplify a given signal at the input v in . the correction circuit 650 is coupled to the main amplifier 610 and provides an intermodulation product cancellation signal to the main amplifier &# 39 ; s signal path to cancel out im 3 distortion products produced by the main amplifier 610 . in the example illustrated in fig6 , the correction circuit &# 39 ; s 650 active components includes a single pmos transistor m 4 ( e . g ., auxiliary transistor ) that has a gate terminal 602 coupled to the input signal v in and a drain terminal 604 coupled to the common point cp (“ common node ”) of the main amplifier &# 39 ; s active devices m 1 and m 2 . the correction circuit 650 will produce a scaled down version of the main amplifier circuit &# 39 ; s 610 signal current . specifically , the correction circuit &# 39 ; s 650 signal current n * i sig is equal to gm m4 * vgs m4 , where the transconductance gm m4 = gm m1 * n . the fraction n is equal to sqrt [ w m1 / l m1 )/( w m4 / l m4 )], where w and l refer to the device width and length , respectively . passive devices c 3 and r 3 provide the correction circuit &# 39 ; s 650 dc biasing . the vgs of m 4 ( i . e ., vgs m4 ) is biased such that it is a scaled version of the main amplifier &# 39 ; s first transistor m 1 vgs ( i . e ., vgs m1 ). the dc and signal currents of the main amplifier 610 and the correction circuit 650 are summed at the common point cp . that is , the signal i aux provided by the correction circuit 650 is summed at the common point cp so that i aux is subtracted from the main amplifier &# 39 ; s signal path . it is at the common point cp where the im 3 terms ( e . g ., i nl3a and i nl3b ) will cancel . the rf amplifiers 200 , 500 , 600 described above with respect to fig3 - 6 include a two - stage common gate main amplifier 210 , 510 , 610 section . however , this is merely exemplary . the cancellation circuits 250 , 550 , 650 , described above may be coupled to main amplifiers having different architecture in order to provide im 3 distortion nulling for such amplifiers . some non - limiting , non - exclusive examples of other rf amplifier architectures that the cancellation circuits 250 , 550 , 650 may be applied to include one or more stage common source / emitter amplifier architectures , one or more stage common drain / collector amplifier architectures , tuned cmos or bipolar amplifier architectures , etc . moreover , in the exemplary cancellation circuits 210 , 510 , 610 described above with respect to fig3 - 6 , the cancellation circuits 210 , 510 , 610 include a solitary active device m 4 / q 4 , meaning that it is the only active device of the cancellation circuit 210 , 510 , 610 . however , in other aspects , the cancellation circuits 210 , 510 , 610 may include additional active components that are not positioned along the intermodulation product cancellation signal path of the cancellation circuit 210 , 510 , 610 . fig7 illustrates a graph of a transient simulation for a two - tone input signal applied to a two - stage common gate rf amplifier 110 ( see fig1 ) without correction circuitry 150 found in the prior art . the main signal tones are spaced 10 mhz apart and have center frequencies of 1 . 500 ghz and 1 . 510 ghz . each tone has a power of − 20 dbm referenced to 50 ohms . the graph shows that such an rf amplifier circuit without correction has a simulated input ip 3 ( iip3 ) of + 2 . 2 dbm and 44 . 4 dbc . fig8 illustrates a graph of a transient simulation for a two - tone input signal applied to a two - stage common gate rf amplifier 110 ( see fig1 ) with correction circuitry 150 found in the prior art . the main signal tones are spaced 10 mhz apart and have center frequencies of 1 . 500 ghz and 1 . 510 ghz . each tone has a power of − 20 dbm referenced to 50 ohms . the graph shows that such an rf amplifier circuit with pmos mirror correction has a simulated iip3 of + 3 . 05 dbm and 46 . 0 dbc . fig9 illustrates a graph of a transient simulation for a two - tone input signal applied to the two - stage common gate rf amplifier 200 shown in fig3 and 4 . the main signal tones are spaced 10 mhz apart and have center frequencies of 1 . 500 ghz and 1 . 510 ghz . each tone has a power of − 20 dbm referenced to 50 ohms . the graph shows that the novel rf amplifier circuit 200 has a simulated iip3 of + 6 . 5 dbm and 52 . 6 dbc , which is much improved over the prior art correction circuitry 150 ( see fig1 ). thus , the short delay nmos correction circuitry 250 ( see fig4 ) improves iip3 considerably by about 3 . 5 to 4 . 3 dbm over two - stage common gate amplifiers having no correction circuitry or those have pmos mirror based correction circuitry 150 . similarly , dbc performance is also improved by at least 6 . 6 dbc . fig1 illustrates a table that summarizes and compares the iip3 performance and dc power consumption of the rf amplifier simulations shown and described with respect to fig7 - 9 . as indicated in the table , the best performance of the three is obtained by the rf amplifier featuring short delay nmos correction circuitry ( i . e ., rf amplifier 200 of fig3 and 4 ) whose iip3 value is greater than both the rf amplifier having no correction circuitry ( i . e ., rf amplifier 110 in fig1 ) and the rf amplifier having the pmos mirror based correction circuitry ( i . e ., rf amplifier 100 in fig1 ). its dc power consumption is also lower than the rf amplifier having the pmos mirror based correction circuitry . fig1 illustrates a noise figure simulation comparing the noise figure of a prior art two - stage common gate amplifier 110 ( see fig1 ) with no correction circuitry to the rf amplifier 200 having nmos based correction circuitry shown in fig3 and 4 . the simulation shows that the correction circuitry contributes a relatively minor noise amount of 0 . 408 db . the noise contribution of is mainly due to auxiliary transistor m 4 shown in fig4 . this significant improvement in iip3 performance and minimal dc power consumption more than justifies the slight increase in noise contributed by the correction circuitry . thus , an improved rf amplifier with im 3 distortion nulling has been disclosed herein that incorporates a single transistor design to minimize delay through the correction circuit . moreover , when the single transistor is an n - channel transistor , bandwidth of the amplifier is significantly improved due to the fast mobility ( μn ) of re - channel devices in order to achieve wideband cancellation of im 3 products created in the main wideband amplifier . it is to be understood that the described aspect is merely illustrative of some of the many specific aspects that represent applications of the principals of the present application . although the concept has been demonstrated in cmos and bipolar technologies , it would be obvious to one skilled in the art to apply the concepts described here to any process technology . the implementation of the concept is not integrated circuit process dependent , and resultantly , the concept is applied equally well to any process technology . moreover , it to be understood that specifics in the aforementioned examples may be used anywhere in one or more aspects . the present techniques are not restricted to the particular details listed herein . indeed , those skilled in the art having the benefit of this disclosure will appreciate that many other variations from the foregoing description and drawings may be made within the scope of the present techniques . accordingly , it is the following claims including any amendments thereto that define the scope of the techniques .	7
this disclosure will now more fully describe embodiments with reference to the accompanying drawings , in which specific embodiments are shown . other aspects may , however , be embodied in many different objects and the inclusion of specific embodiments in the disclosure should not be construed as limiting such aspects to the embodiments set forth herein . rather , the embodiments depicted in the drawings are included to provide a disclosure that is thorough and complete and which fully conveys the intended scope to those skilled in the art . when referring to the figures , like structures and elements shown throughout are indicated with like reference numerals . embodiments described herein relate to systems and methods of updating a graphical database object in a database . fig1 is a block diagram illustrating a database system 100 for updating a database object in response to detecting a database schema change in the database . fig1 illustrates a database system for updating a database object , and it should be appreciated that a database object may include a vast number of suitable graphical database objects including database visualizations such as forms , reports , data views , views , queries , etc . the term database “ object ” will be used herein to mean any such suitable graphical database object . the database system 100 includes a schema update module 120 . the schema update module 120 is programmed to update a database schema . in one possible embodiment , a database schema includes tables in which data is stored in an associated database . for example , in a relational database , a database schema may define tables , fields in each table , and relationships between fields and tables . a database schema may be updated when a new field is added to a table . the database system 100 also includes an object update module 140 . the object update module 140 may be programmed to update a database object in response to detecting a database schema change . in one possible embodiment , the database object may be a database object on which a user places controls for taking actions or for entering , displaying , and editing data in fields . when a database schema may be updated by adding a new field to a database table and the new field is expected to show up in the database object , the object update module 140 updates the database object to add and display the new field in the database object . in other words , the new field may be added to and displayed in the database object when the new field is added to the table . a user thus may view the new field in the database object after the new field is added to the table . in one possible embodiment , the database object may also be updated in response to detecting a database schema change such as a table , query or a structured query language ( sql ) statement change . fig2 is a block diagram illustrating an object update module 140 of fig1 . the object update module 140 includes a find module 144 , a positioning module 150 , and a display module 148 . records from an underlying source of data such as a table , query , or a sql statement are made available for the database object . a recordset schema is used to describe those records . thus , when a database schema is updated such as a table , query or a sql statement change , the recordset schema may be updated as well . the find module 144 may be programmed to find a new field in the updated recordset schema to be added to the database object after the database schema is updated . in one possible embodiment , the find module 144 may be programmed to compare the updated recordset schema to a previous recordset schema to determine whether the updated recordset schema includes any new field not in the previous recordset schema . the previous recordset schema is the recordset schema before the database schema is updated . in one possible embodiment , the previous recordset schema has been saved and cached for the comparison . the find module 144 also may be programmed to compare each field in the updated recordset schema definition to each field in the previous recordset schema definition to determine whether each field in the updated recordset schema has a matched field in the previous recordset schema . if a field in the updated recordset schema can not be found to have previous match , the field is indicated as a new field . a new field is thus found and may be added to the database object . the positioning module 150 may be programmed to position where a new field will be placed in the object . in other words , once a new field is found and determined to be added to the object through the find module 144 , the positioning module 150 may determine where the new field is placed in the object through various mechanisms and implementations ( illustrated in fig3 a - 3c ). the display module 148 may be programmed to display a new field in the object . in other words , once a new field is found and is positioned to where the new field is to be placed , the display module 148 may illustrate the visualization of the new field in the object . the object update module 140 may also include an auto - update module 147 and a user option module 146 . the auto - update module 147 may be programmed to automatically add and display the new field to the object once the new field is found as a new field . in other words , the new field may be dynamically added to and displayed in the object once a database schema has been modified to add the new field . alternatively , the user option module 146 may be programmed to determine whether the user wants a new field to be displayed in the object . in other words , the user may determine whether a new field will be displayed in the object . for example , even if a new field has been found to be added to the object due to a database schema change , a user may determine whether to have the new field inserted and displayed in the object . the user option feature gives a user more flexibility to control what fields are to be added and displayed in a given object . fig3 a - 3c are block diagrams illustrating various implementations for the positioning module 150 of fig2 . in particular , fig3 a illustrates that the positioning module 150 may be implemented through a placeholder control 152 . in one possible embodiment , the placeholder control is a label and text box pair with a keyword such as “ placeholder ” in the tag of the control . in other words , a special tag may be added to the label and text box that is literally the string placeholder . because the string exists , a user may then take that label and text box and interact with it accordingly . in one possible embodiment , the positioning module 150 may be programmed to look for the tag called the keyword such as “ placeholder ”. whenever a new field is found to be added in the object , the positioning module 150 may place the new field to a certain place or position at all times per the placeholder control 152 , for example , to the left of the placeholder control 152 at all times or above the placeholder control at all times for each new field to be added . therefore , a certain programmatic assumption may be applied for this implementation . fig3 b illustrates that the positioning module 150 may be implemented through a new control 154 . the new control 154 has special properties that a user may use to specify where a new field is placed . in one possible embodiment , the new control 154 is effectively a label and a text box , but with the special properties a user may layout in a given user interface . in other words , the implementation allows a user to fully control where the new field is inserted through the new control . for example , it is possible that a user could use different keywords instead of using the example word “ placeholder ”. a user may use placeholder left , placeholder right , placeholder up , and placeholder down to achieve a same effect as the implementation shown in fig3 a . fig3 c illustrates that the positioning module 150 may be implemented through a layout control 156 . the layout control 156 manages the way controls are laid out upon an object . for example , a layout may be used to align all the labels and all the text boxes to a grid pattern . the layout control 156 may have a property that allows a user to specify as a function of the layout control , where to add new fields . therefore , once a new field is found and is added to the object , the new field may be positioned to a place where the layout control 156 specifies in its property . fig4 is a computing system 400 for implementing aspects of the present disclosure . in its most basic configuration , computing system 400 typically includes at least one processing unit 402 and memory 404 . for example , the database system 100 in fig1 may be stored in memory 404 . depending on the exact configuration and type of computing system , memory 404 may be volatile ( such as ram ), non - volatile ( such as rom , flash memory , etc .) or some combination of the two . this most basic configuration is illustrated in fig4 by dashed line 406 . additionally , computing system 400 may also have additional features / functionality . for example , computing system 400 may also include additional storage ( removable and / or non - removable ) including , but not limited to , magnetic or optical disks or tape . such additional storage is illustrated in fig4 by removable storage 408 and non - removable storage 410 . computer storage media includes volatile and nonvolatile , removable and non - removable media implemented in any method or technology for storage of information such as computer readable instructions , data structures , program modules or other data . memory 404 , removable storage 408 and non - removable storage 410 are all examples of computer storage media . computer storage media includes , but is not limited to , ram , rom , eeprom , flash memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium that may be used to store the desired information and which can be accessed by computing system 400 . any such computer storage media may be part of computing system 400 . computing system 400 may also contain communications connection ( s ) 412 that allow the computing system to communicate with other devices . communications connection ( s ) 412 is an example of communication media . communication media typically embodies computer readable instructions , data structures , program modules or other data in a modulated data signal such as a carrier wave or other transport mechanism and includes any information delivery media . the term “ modulated data signal ” means a signal that has one or more of its characteristics set or changed in such a manner as to encode information in the signal . by way of example , and not limitation , communication media includes wired media such as a wired network or direct - wired connection , and wireless media such as acoustic , rf , infrared and other wireless media . the term computer readable media as used herein includes both storage media and communication media . computing system 400 may also have input device ( s ) 414 such as keyboard , mouse , pen , voice input device , touch input device , etc . output device ( s ) 416 such as a display , speakers , printer , etc . may also be included . all these devices are well known in the art and need not be discussed at length here . in some embodiments , memory 404 includes one or more of operating system 420 , application programs 422 , other program modules 424 , and program data 426 . in some embodiments , global data , client - specific data , and transformation rules may each be stored in memory 404 , removable storage 408 , non - removable storage 410 , or any other computer storage media described herein . fig5 illustrates a method 500 of updating a database object in a database system . at operation 502 , the database system validates the database object . in one possible embodiment , the recordset schema may be validated by loading and opening the object . in another possible embodiment , the recordset schema may be validated by activating the object . operational flow proceeds to operation 504 . at operation 504 , the database system updates a database schema . in one possible embodiment , the database schema includes the tables in which data is stored in the database . for example in a relational database , a database schema defines tables , fields in each table , and relationships between fields and tables . in one possible embodiment , the database system updates the database schema by adding a new field to a table in the database . operational flow proceeds to operation 506 . at operation 506 , the database system determines whether any new field is found to be added for the object due to a database schema change . one possible implementation of operation 506 is illustrated in more detail in fig6 , described below . operational flow proceeds to operation 508 . at operation 508 , the database system provides a user an option to determine whether to add a new field to the object . in particular , even if a new field has been found for the object due to a database schema change , the user may determine whether the user wants to have the new field inserted and displayed in the object . this user option feature gives a user more flexibility to control what fields are to be added and displayed in the object . if operation 508 determines the user wants to insert a new field to the object , then operational flow branches “ yes ” and operational flow proceeds to operation 510 . if operation 508 determines the user does not want to insert the new field to the object , then operational flow branches “ no ” and operational flow skips operations 510 and 512 so that the new field will not be inserted and displayed in the object . according to an alternative embodiment , the database system does not provide the user the option of determining whether to add and display the found new field to the object . in other words , according to this alternative embodiment , the found new field will be automatically added to and displayed in the object once the database schema has been modified to add the new field for the object . for this alternative embodiment , operational flow skips operation 508 and directly goes to operation 510 from operation 506 if any new field is found to be added to the object in operation 506 . at operation 51 o , the new field is positioned in the specified or determined place and is inserted in the object . in one possible embodiment , the new field is positioned through a placeholder control . the placeholder control may be a label and text box pair with a keyword such as “ placeholder ” in the tag of the control . in other words , a special tag is added to the label and text box that is literally the string placeholder . because the string exists , a user may then take that label and text box and interact with it accordingly . in another possible embodiment , the new field is positioned through a new control . the new control has special properties with which a user may specify where new fields are placed . for example , the new control may be effectively a label and a text box , but with the special properties a user may layout in a given user interface . in other words , the implementation allows a user to fully control where the new field is inserted through the new control . for example , it is possible that a user may use different keywords instead of using the example word “ placeholder ”. a user may use placeholder left , placeholder right , placeholder up , and placeholder down to achieve a same effect . in yet another possible embodiment , the new field is positioned through a layout control . the layout control manages the way controls are laid out upon an object . the layout control has a property that allows a user to specify as a function of the layout control , where to add new fields . operational flow proceeds to operation 512 . at operation 512 , the new field is displayed in the object . in other words , once a new field is found and positioned to where the new field is to be placed , the new field is displayed and visualized at operation 512 . in one possible embodiment , at operation 512 , the object is loaded and actually re - painted with the new field in the object so that the user is able to view the new field in the object . fig6 illustrates a method 600 of finding a new field for an object of fig5 . the method 600 includes one possible embodiment for operation 506 of fig5 . in the method 600 shown in fig6 , operational flow starts with operation 602 that determines whether the recordset for the object has changed . if operation 602 determines that the recordset schema has not changed , then operational flow branches “ no ” and operational flow proceeds to operation 620 . the operation 620 loads the object without a new field to be added to the object . if operation 602 determines that the recordset schema has changed , then operational flow branches “ yes ” and operational flow proceeds to a loop operation 604 . in the loop operation 604 , each field in the updated recordset schema is compared with fields in the previous recordset schema . in particular , inside the loop operation 604 , there is another loop operation 606 . the loop operation 606 determines whether any bound control matches the field in the updated recordset schema . namely , at operation 608 , each bound control is checked with the field to see whether there is a bound control for the field . after operation 608 , operational flow proceeds to operation 610 that indicates to process a next bound control . after the loop operation 606 is completed , operational flow proceeds to operation 612 . the operation 612 determines whether a field in the updated recordset schema matches any bound control . if operation 612 determines that the field has a matched bound control , then operational flow branches “ yes ” and operational flow proceeds to operation 616 that indicates to process a next field in the recordset schema . if operation 612 determines that the field does not have any matched bound control , then operational flow branches “ no ” and operational flow proceeds to operation 614 that indicates the field is a new field and is to be added to the object . after operation 614 , operational flow proceeds back to operation 616 that indicates to process a next field in the recordset schema . after the loop operation 604 is completed , operational flow proceeds to operation 620 that loads the object with any new field found in the loop operation 604 . although the subject matter has been described in language specific to structural features and / or methodological acts , it is to be understood that the subject matter defined in the appended claims is not necessarily limited to the specific features or acts described above . rather , the specific features and acts described above are disclosed as example forms of implementing the claims .	6
in order to provide a more full understanding of the present invention , a discussion of embodiments of the present invention is provided as follows , in which like reference numbers within the figures indicate like elements . in fig1 , there is shown a cable 100 that has been coiled 102 , and in which an integrated cable stay 104 has been utilized to retain the cable 100 in the coiled condition . as noted above , the term cable is used herein to refer to any long , flexible article which a user may desire to coil or bundle , and may include , but is not limited to ropes , strings , twine , electrical cords , cables , wires , and flexible tubes and hoses . the coiled cable may include several bights 100 a , 100 b , . . . which have been coiled , such as by having been wound between a user &# 39 ; s hand and elbow . a first end 106 of the cable may then be wound around the coiled cable 108 to prevent the coiled cable 108 from becoming uncoiled . in order to prevent the windings 110 from unwinding from around the coiled cable 108 , the first end 106 may include a cable stay 104 , such as a malleable element extending along a length of the cable 100 adjacent the first end 106 of the cable 100 , such that when the first end 106 is wound around the cable 100 , the malleable material is formed to remain in the wound condition , while also allowing the first cable end 106 to be straightened when the first cable end 106 is not wound around a bundled or coiled cable . in fig2 , an alternate embodiment of an integrated stay is shown , using a resilient helical stay 202 to maintain the first cable end around a bundled section of cable 204 . the term resilient is used herein to identify that the helical stay should not preferably be rigid , but rather allow some flexing to ease the winding of the helical stay portion around one or more bights of a bundled or coiled cable . the resilient helical stay 202 forms a spiral 206 around the bundled cable 204 , such that the cable 100 does not readily become unbundled . the helical stay 202 may be applied around the bundled cable 204 by wrapping the helical stay portion around the bundled portion of cable 100 . although the illustrations show a coiled cable being held by a malleable stay and a bundled cable held by a helical stay , either stay form may be used with either gathered , coiled or bundled cable , and no limitations are intended by the use of the particular types of stay in conjunction with coiled or bundled cables . in fig3 , a cable having an internally integrated malleable stay 302 is shown in cross section . the use of the malleable stay 302 allows the cable 100 to be in a straight position when unwrapped . as shown in fig3 , an internally integrated malleable stay 302 may be formed by placing a malleable strip 304 or wire , such as formed by a soft piece of metal ( hereinafter referred to collectively as a “ strip ” 308 ), within the outer sheath 306 of the cable 100 . the strip 308 may be coated , such as with an insulative material , to limit the potential for the strip 308 becoming a conductor within the cable 100 . the outer sheath 306 may be used to contain one or more conductive elements 310 or load bearing elements . the strip 308 may have a length selected to allow a desired amount of self - retaining wraps around a coiled or bundled cable to be achieved . the cable may utilize a malleable strip 308 at one end only , or may utilize malleable strips at both ends . one potential issue regarding the use of a stay in a wrapped section of coil relates to the deformation of the cable when bent . when a cable is bent into a circular path , such as when wound around a coiled or bundled portion of the cable , the outer boundary of the wound portion of cable may typically be at a larger radius than an inner boundary . the difference between the inner radius and the outer radius creates a difference in the lengths of the outer boundary and the inner boundary along the circular path . this difference in the lengths may create relative motion between components which comprise the cable , such as may occur if an outer edge of an outer sheath is stretched relative to a core of the cable . if the components of the cable are joined , i . e ., not allowed to move relative to each other , high stresses may develop in one or more of the components , such that stress or plastic deformation related failures may become a concern . in order to accommodate such relative motion , the components of the cable 100 may be integrated such that the individual components can slide relative to each other . in the case of an integrated malleable stay 302 , the strip 308 may be enclosed within a tube structure ( not shown ) to protect wires or other conductive elements within the outer sheath 306 from abrasion damage from relative motion . the strip 308 itself may be slidable relative to the flexible tube structure and provided with radiused edges to limit the potential for the strip binding in the tube as a result of differential motion between the strip and the tube . as shown in fig4 , the stay of the present invention may alternately be formed by integrating a resilient helical form along an end of a cable . the helical form may hold the cable end in a helical shape , such that the end of the cable may be wrapped around a coiled or bundled cable , with the helical shape inducing the end of the cable to be retained around the coil or bundle . as shown in fig4 a , the resilient helical form 402 may be built into one end of a cable 100 , such that conductive elements 404 and an outer sheath 406 may be formed around the resilient helical form 402 . the helical form 402 may use a non - circular cross section to bias the flexibility of the stay in a preferred direction , as well as to provide pockets 408 within the outer sheath for conductive elements , thus allowing the outer sheath 406 to retain a generally circular cross section . although the implementations shown in fig3 and 4 show the stay being internal to the cable , external stays may be utilized to allow stays to be added to cables that a user already has . as shown in fig5 , an external malleable stay 502 in a wrap form may be formed from a web 504 having one or more malleable strips 506 bonded to a flexible sheet 508 , embedded within a flexible sheet 508 , or placed between flexible sheets . as shown in fig5 , a plurality of strips 506 may be placed between an inner 510 and an outer 512 flexible sheet . the flexible sheets may be formed from a plastic material having sufficient flexibility to allow deformation of the plastic sheets as the stay is wrapped around an end of a portion of a cable , or as the end of a cable to which the stay has been attached is wound around a coiled or bundled portion of the cable . a pressure sensitive adhesive strip 514 may be applied to one end of the wrap style stay to allow the wrap style stay to be joined or bonded to itself around a cable , around a portion of the cable , or a combination of both dependant upon the width of the wrap style stay relative to the circumference of the cable around which the wrap style stay is being wrapped . alternately , the adhesive 514 may be provided with a release strip ( not shown ) which exposes the adhesive only after the release strip has been removed from the wrap style stay . defining the length 516 of the stay to be along the axis 518 along which the malleable strips 506 extend , and the normal to this to be the width 520 , it can be seen that wrap - style stays of a considerably greater width than needed to provide a stay for a single cord may be formed . such a stay having a width greater than needed may be provided with features allowing a portion of the wrap style stay to be readily separated from the remaining portion of the wrap style stay to allow a user to form a wrap style stay having an appropriate width . this may be accomplished by proving the wrap style stay with periodic lines of perforation 522 parallel to the malleable strips , such that a user can easily tear along the line of perforations to form the wrap style stay of an appropriate width . alternately , a wrap style stay of greater width than needed may be packaged such that the packaging provides a convenient means for cutting the wrap style stay to an appropriate width , such as by packaging the wrap style stay in roll form within a box , wherein the box has an opening through which the wrap style stay may be withdrawn , the opening further having an edge provided with a cutter which allows the wrap style stay to be pulled against the cutter to form a wrap style stay of an appropriate width . as shown in fig6 , a section of the flexible wrap style stay 602 having an appropriate length 604 and width 606 may be wrapped around a section of cable 100 to form a stay 608 at the portion of cable 100 around which the wrap style stay 602 has been wrapped . the use of a single strip of adhesive 610 allows the remaining length of the wrap style stay 602 to slide relative to the underlying cable 100 , such that winding the portion of the cable 100 to which the wrap style stay has been applied around a coil or bundle will not create adverse stresses between the wrap style stay 602 and the cable 100 . although the wrap style stay 602 is shown using a pre - applied line of adhesive , other methods of joining or bonding the wrap style stay to the cable 100 may be incorporated . for example , the wrap style stay 602 may use an external clamp to retain the wrap style stay 602 around the cable , such as a piece of tape , wire wrap , or other fastener . alternately , the stay may be retained by an adhesive strip along one edge of the sheet stay which is parallel to the cable length . as shown in fig7 , a stay 702 using malleable strips 704 may alternately be formed as a cable cover 706 . as shown , a cable cover body 708 may be formed from a flexible material . the cable cover body 708 may be provided with one or more malleable elements 710 to allow the stay 702 to be retained in position once an end of a cable has been wound around a coil or bundle . the stay body 708 may additionally be provided with a longitudinal slit 712 allowing a cable 100 to be passed into a cavity running the length of the cable cover 706 . the effectiveness of a cable cover 706 stay may be dependant upon the outer diameter of the cable 100 being slightly larger that the inner diameter of the stay body when no clamp is provided to limit motion of the cable cover relative to the cables . if the cable has a slightly larger outer diameter 714 then the inner diameter 716 of the stay body 708 , the inner diameter 716 may be allowed to expand as required by forming a gap 720 along the slit 712 , thus retaining the stay body 708 around the cable 100 , without requiring tight tolerances with respect to the outer diameter 714 of the cable versus the inner diameter 716 of the stay body 708 . as shown in fig8 , a simple form of a stay 800 according to the present invention may be created by wrapping a malleable element 802 around an end of a cable 100 , such that the stay provides the necessary stiffness to allow a cable end wrapped around a coil or bundle to be held in the wrapped position . the stay 800 may use a middle portion 804 from which the spinal windings are formed , as well as first 806 and second 808 ends which may be wound close together to fix the position of the stay 800 relative to the cable 100 . a plurality of windings of the stay 800 may be used adjacent to the ends of the stay , to assist in retention of the stay ends adjacent to the positions on the cable 100 at which the ends are desired to remain fixed . the use of spiral windings 810 along the length of the portion of the cable 100 to which the stay has been applied allows the windings to adjust as necessary as the cable bends to form any wrappings . the spiral malleable stay may additionally be overwrapped with a flexible material ( not shown ), such as electrical tape , to retain the spiral malleable stay in its position . as shown in fig9 , a stay 902 may be formed as a cover 904 without a slit into an inner cavity , using multiple malleable wires 906 to provide the position retention capability . a clamp 908 formed from a piece of tape , cable tie , or other structure may be included to prevent the cover 904 from sliding relative to the cable 100 around which the cover has been placed . as shown in fig1 , a stay 1002 may alternately be formed using a hook and pile type fastening system commonly called by its trademark “ velcro ”, such that successive windings of the cable may be joined to each other to prevent the windings from unwinding when wound around a cable bundle or coil . the stay 1002 may have a first end 1004 and a second end 1006 and a midpoint 1008 between the first 1004 and second 1006 ends . a surface 1010 may be formed between the first endpoint and the midpoint having one half of a hook and pile fastener , with a second surface 1012 formed between the midpoint 1008 and a second end 1006 having the mating half of the fastener . the stay 1002 may be formed by placing alternating sections of hook and pile material onto two backings , and then joining the backings on opposite sides of the cable 100 , such as by sewing the backings together , or adhering the backings together . preferable , the backing pieces may be joined together tightly enough that the assembled stay 1002 does not readily slip relative to the cable 100 . alternately , a clamp such as a piece of tape wrapped around the cover or a wire tie may be used to create a sufficient interference between the cover and the cable to prevent the cover from readily sliding relative to the cable . the formation of the hook and pile fasteners into a cover running parallel to the long axis of the cable provides the benefit that the cover is less likely to become entangled when attached to the cable than a retainer , such as an attached strap extending outwardly from the cable would do . the present invention may be embodied in other specific forms than the embodiments described above without departing from the spirit or essential attributes of the invention . accordingly , reference should be made to the appended claims , rather than the foregoing specification , as indicating the scope of the invention .	8
hereinafter , embodiments of the present invention will be described in detail with reference to the drawings . first , invention i will be described . a d / e class switching circuit is structured , for example , as shown in fig2 a and 2b . parts identical with those in fig5 a and 5b are designated by like references . fig2 a is the switching circuit and fig2 b is an equivalent circuit thereof . this circuit is directed to a transformer coupling push / pull amplifier using an fet as the d / e class switching element , which shows a saturated operation power amplifier . in this example , there is used the fet as the switching element , but the same structure is applied even in the case where another switching element is employed . input pulse waves which are represented by φ1 and φ2 are inputted to the gates of fets q 1 and q 2 . the input pulse waves φ1 and φ2 have the same frequency f as that of a target radio frequency and 50 % in the maximum duty ratio , and φ1 and φ2 are also given a phase difference of 180 degrees . the fets q 1 and q 2 alternately conduct the on / off operation in accordance with an input pulse , and their functions can be represented by switches sw 1 and sw 2 shown in fig2 b . the loads of the fets q 1 and q 2 are connected to the primary winding of the transformer t , and a voltage v is applied at a neutral point of the primary winding . when the fets q 1 and q 2 alternately conduct the on / off operation in accordance with the input pulse signal , the primary winding of the transformer t is driven , and a power is transmitted to the secondary winding of the transformer t in accordance with the on operation of the respective fets . when the pulse waves φ1 and φ2 are in the maximum duty operation ( duty ratio = 50 %), the circuit is in the d - class operation and becomes in the maximum output operation state where any one of q 1 and q 2 is always on . if the duty ratio of the pulse wave is 50 % or less , there is a period of time where both of q 1 and q 2 are off , during which no power is transmitted to the secondary winding of t . this state is the e - class operation , and the output radio frequency power can be variably controlled in accordance with the duty ratio . the power application efficiency of the d / e class amplifier is 100 % in theory , which is extremely high efficiency . the load 7 is driven by the radio frequency power . as a result , the radio frequency power that is supplied to the load 7 can be variably controlled in accordance with the duty ratio of the pulse wave . that is , the radio frequency for the inductively coupled plasma generation in an inductively coupled plasma mass spectrometer and an inductively coupled plasma light emission spectroscopic analysis device can be generated with efficiency , and the power supply device and the cooling device for the radio frequency amplifier can be downsized . subsequently , invention ii to vi will be described . a push / pull radio frequency amplifier to be used is shown in fig3 . parts identical with those in fig2 a and 2b are represented by like references . fig3 a is the push / pull radio frequency amplifier , and fig3 b is an equivalent circuit thereof . the equivalent circuit is made up of a series circuit of a switch sw 1 and a conductive resistor r 1 and a series circuit of a switch sw 2 and a conductive resistor r 2 . this circuit conducts the d / e class operation when a high output power is required , thereby being capable of obtaining the high output with the high power application efficiency as described above . in the case of the d / e class operation , assuming that the on / off transitional period of time of the switching element is 0 , the generated loss is caused by only very small conductive resistors r 1 and r 2 , and a period of time during which those conductive resistors generate the loss is in proportion to a period of time during which sw 1 and sw 2 are on . therefore , when the pulse width is narrowed in order to lower the output power , the period of time during which sw 1 and sw 2 are on is shortened , and the generated loss is particularly lowered . also , the pulse width is very narrowed , and it is difficult to realize the control and the circuit operation . in addition , a generated higher harmonic wave component increases , and a spurious radiation also increases . under the circumstances , in the case where the circuit is used at the low output , the pulse wave height is lowered , and the fets q 1 and q 2 are allowed to conduct the unsaturated operation , to thereby conduct control so that the conductive resistors r 1 and r 2 increase equivalently . an embodiment of a specific control of the push / pull radio frequency amplifier shown in fig3 is also shown in a block diagram of fig1 . fig1 shows an example of the radio frequency amplifier that aims at the generation of a continuous output that requires , for example , about 2 kw as an maximum output and is stabilized from an extremely low output such as several w , and a constant loss over a lower output such as several hundreds of w to the vicinity of the maximum output . however , it is needless to say that the present invention is not limited to this example . in the figure , reference numeral 10 denotes a controller that conducts the entire control operation . the controller 10 is formed of , for example , a cpu . likewise , it is needless to say that the present invention is not limited to the cpu as the controller , and it is also possible to constitute a controller 10 without using cpu . the controller 10 is connected to a main cpu ( not shown ) and transmits and receives signals therebetween . reference numeral 11 denotes a variable wave height and variable wave width pulse wave generating circuit that conducts the drive pulse width / pulse height control upon receiving the pulse width control signal and the pulse height control signal from the controller 10 . reference numeral 12 denotes a power amplifier that conducts power amplification upon receiving an output of the variable wave height and variable wave width pulse wave generating circuit 11 , and 13 is a power supply voltage / current monitoring circuit . reference numeral 14 denotes an output power monitoring circuit that monitors an output of the power amplifier 12 , and its monitor output is given to the controller 10 . the controller 10 is inputted with a voltage and a current from the power supply voltage / current monitoring circuit 13 , and also inputted with a travelling wave and a reflected wave from the output power monitoring circuit 14 , and additionally inputted with temperatures of the respective portions , a fan state and so on . the controller 10 always monitors those signals , and controls the variable wave height and variable wave width pulse wave generating circuit 11 in accordance with those monitor signals . the operation of the device thus structured will be described below . for example , when an output of the amplifier is set from the main cpu , the controller 10 then gives the pulse width control signal and the pulse height control signal corresponding to the set output and the required power loss to the variable wave height and variable wave width pulse wave generating circuit 11 . the power amplifier 12 is controlled in accordance with an output of the variable wave height and variable wave width pulse wave generating circuit 11 , and the radio frequency power is supplied to the load ( not shown ). the output power monitoring circuit 14 always monitors the output of the power amplifier 12 , and its output is fed back to the controller 10 . the controller 10 controls the output of the power amplifier 12 while monitoring the output of the output power monitoring circuit 14 so that the output becomes the output set in the main cpu so as to generate the loss set in accordance with the output power . this example shows the control using a closed loop , but it is possible to operate by an open loop . as described above , according to this embodiment , with an increase in the conductive resistor of the switching element at the time of an extremely low output , the loss at the conductive resistor portions increases with the result that when it is necessary to lower the output power , the output can be controlled without extremely narrowing the drive pulse width . also , as the side reaction , the problem such as the over - cooling can be solved while the high efficiency advantage is maintained over the wide output power range of from the lower output to about the maximum output . as was described above in detail , the present invention obtains the following technical advantages : ( 1 ) according to invention ii , because the drive pulse width and the drive pulse height can be varied over all area of the required output power range , the output power controllability that is high in efficiency and excellent can be obtained . ( 2 ) according to invention iii , because a loss which is caused by the switching element can increase at the time of a low output , the efficiency is lowered , and a loss necessary to prevent a dewing due to over - cooling , that is , the heating can be obtained . ( 3 ) according to invention iv , in the case where the output power is required to be lowered , since a power consumption ( power supply application efficiency ) is set as a parameter , an output power control that uses not only the pulse width control but also the pulse height control is combined , thereby being capable of obtaining a stable output control and reducing the spurious radiation ( higher harmonic wave ). ( 4 ) according to invention v , because the loss of the radio frequency amplifier is constant , only a constant and minimum load can be applied to the cooling system side of the amplifier . therefore , the operation can be stabilized with the cooling system having the minimum cooling capability , and it is also easy to set the circuit so that the dewing caused by over - cooling is prevented . ( 5 ) according to invention i , although the conventional device requires a large cooling system and must enlarge the power supply capacity because of an inductively coupled plasma mass spectrometer and an inductively coupled plasma light emission spectroscopic analysis device which are low in the power application efficiency , a small cooling system can be used because of the high efficiency of the radio frequency power supply that consumes the maximum power , and the entire power supply capacity is also lessened . in addition , the turning on of the plasma becomes facilitated as compared with the conventional one . ( 6 ) according to invention vi , there can be realized the radio frequency amplifier that is high in efficiency when the high output is required and maintains the necessary loss when the low output is necessary , and can conduct stable control .	7
photoisomerizable compounds suitable for use in the process of the present invention are those which can quench the triplet energy state of photosensitizers to effect a reversible intramolecular isomerization to a high energy conformation . the compounds are carbon containing and preferably include in their molecular structure at least two reactive carbon to carbon double bonds . using the preferred compounds , the photocatalyst quenching reaction is accompanied by an intramolecular cyclization of the isomerizable compound to form a strained ring structure in which the potential energy is stored . suitable isomerizable compounds are described in u . s . pat . nos . 4 , 004 , 571 ; 4 , 004 , 572 and 4 , 004 , 573 . preferred isomerizable compounds include bicyclo ( 2 . 2 . 1 ) hepta - 2 , 5 - diene ( norbornadiene ) and substituted norbornadienes . the substituted norbornadienes preferably are functionalized in the 2 , 3 , 5 or 6 positions . substituents may include any functionalities which do not interfere with the isomerization reaction . preferred substituents include carboxylic acid groups and ester groups having up to about 3 carbon atoms each . preferred isomerizable compounds have a high energy density or heat storage capacity , measured as the amount of energy capable of being stored per gram of compound . norbornadiene , when photoisomerized to yield quadricyclane , exhibits an energy density of approximatey 287 calories per gram , or about 1200 joules per gram . the heat storage capacity of water , to contrast a passive solar energy storage system , is only about 200 joules per gram . even though quadricyclane contains strained carbon ring structures , it is stable up to about 150 ° c . and will not appreciably isomerize to norbornadiene below that temperature , unless in the presence of a reverse isomerization catalyst . photocatalysts according to the present invention include metal compound photosensitizers , preferably complexed with organic ligands . suitable metal components include compounds containing rhenium , iridium , rhodium , ruthenium , osmium , platinum and palladium . preferred are rhenium , iridium and rhodium . most preferred is rhenium . the metal may be present as a salt such as halides or acetates or present in other compounds such as carbonyls or alkyls such as methyl . the complexing ligand may be an organic molecule which is capable of accepting a redistribution of electron density from the metal upon the absorbance of light photons by the photocatalyst . such redistribution enhances the ability of the photocatalyst to transfer charge or energy to the isomerizable compound . suitable ligands include olefinic compounds , aromatic compounds , and aromatic heterocyclic compounds containing oxygen or nitrogen atoms in the hetero ring . the above ligand compounds may be substituted or unsubstituted . preferred are aromatic heterocyclic compounds containing a nitrogen atom in the ring structure . these include but are not limited to pyridine , bipyridine , ethylpyridine , benzoylpyridine , phenylpyridine and quinoline . the mole ratio of ligand to metal depends upon the metal and ligand selected , but generally is about 0 . 5 : 1 to 10 : 1 , and preferably about 2 - 3 : 1 . the photocatalyst may be contacted with the isomerizable compound in the presence of solvents , such as benzene , ethanol and the like . polar solvents are preferred . the photocatalysts of the present invention are both thermally and oxidatively stable . whereas copper containing photocatalysts described above are deactivated through oxidation when air or oxygen is admitted to the catalyst / isomerizable compound system , the photocatalysts of the present invention are not readily air - oxidizable , and can tolerate air in the system . to the extent that oxygen acts as a quencher of photocatalysts in general , that is , a portion of the absorbed light energy may be transferred to oxygen , and this reaction competes with the isomerization reaction , it is preferred that the amount of oxygen in the system be minimized . it should be noted , however , that the presence of oxygen in the process of the present invention does not destroy the catalyst or the reaction . the photocatalysts of the present invention absorb light of the solar spectrum up to wavelengths of about 400 nm , and absorb the light of the solar spectrum from 292 nm to 320 nm more strongly than the prior art photocatalysts discussed above . in addition , the intensity or amount of solar radiation having wavelengths greater than 320 nm is greater than the intensity of solar radiation having wavelengths less than 320 nm . for example , the solar intensity at 400 nm is about twice as great as at 320 nm . the photocatalysts of the present invention are able to absorb a far greater amount of the solar spectrum and total solar radiation , compared to the above described catalysts . according to the process of the present invention , the photocatalyst is contacted with the photoisomerizable compound and exposed to light . light photons are absorbed or captured by the photocatalyst and cause electron excitation in the catalyst . the light energy absorbed is available in the amount of the photocatalysts &# 39 ; triplet energy , for transfer to the photoisomerizable compound . the photoisomerizable compound quenches the photocatalyst , and the triplet energy when transferred , provides the energy of activation for the isomerization reaction to occur . the photoisomerized compound stores at least a portion of the solar energy initially absorbed by the photocatalyst , in the strained conformation . the energy thus stored may be released in the form of heat by inducing the photoisomerized compound to return to the lower energy conformation . the reverse isomerization may be induced by heat or by catalysis . suitable catalysts include those having acidic properties , such as the reverse isomerization catalysts listed in u . s . pat . no . 4 , 004 , 572 . it has previously been demonstrated that the triplet energy of chloro rhenium tricarbonyl bis - 4 - phenylpyridine may be quenched by trans - stilbene and cis - stilbene . photo - isomerization occurs to yield a mixture of both the trans and cis isomers of stilbene . this is thought to be due to the activation energies ( excited state ) of trans stilbene ( about 50 kcal / mole ) and cis - stilbene ( about 57 kcal / mole ) both being less than the triplet energy of the rhenium ( i ) photocatalyst , ( about 62 kcal / mole ). naphthalene ( activation energy about 61 kcal / mole ) has been shown to quench the triplet energy of clre ( co ) 3 ( 4 - phenylpyridine ) 2 , but the rate constant of the quenching is significantly reduced , due to the minor difference between the triplet energy of the photocatalyst and the excited state or activation energy of naphthalene . we have found , however , that the triplet energy of the re ( i ) photocatalyst is unexpectedly quenched by 2 , 5 - norbornadiene , which has an activation energy of about 70 kcal / mole . the quenching of the photocatalyst triplet energy is accompanied by the isomerization of norbornadiene to quadricyclane , depicted below . ## str1 ## according to excited state electronic energy transfer theory , the re ( i ) photocatalyst should not be able to drive the isomerization of norbornadiene to quadricyclane , because the triplet energy of 62 kcal / mole is less than the activation energy of 2 , 5 - norbornadiene , 70 kcal / mole . the mechanism by which the re ( i ) photocatalyst drives the isomerization is not known . included below are additional photoisomerizable compounds whose isomerizations may be driven by the re ( i ) photocatalyst and other photocatalysts according to the process of the invention . ______________________________________ energy storage capacityisomerizable compound ( joules / gram ) ______________________________________ ## str2 ## 500 ## str3 ## 1360 ## str4 ## 1570 ## str5 ## 272______________________________________ although solar radiation ( comprising ultraviolet , visible and infrared radiation ) is the preferred light source for the photoisomerization reaction , any light source which emits wavelengths of light absorbed by the photocatalysts may be used to supply the light energy . for the experiments described below , the light source used was a 200 - watt , short - arc , super - pressure , mercury lamp having a quartz envelope , ( bausch & amp ; lomb ) and was used in conjunction with a quartz collective lens . the lamp produces light of continuous , fairly uniform intensity covering the spectrum of uv , visible , and infrared . there are several very high intensity discrete spectral bands , due to the nature of the mercury arc spectrum . those of major importance occur at 254 , 313 , 366 , 405 , 436 , 550 , and 580 nm . on the other hand , this type of light source is deficient in light energy in the high wavelength side from about 254 - 275 nm . the arc has an average luminance of 25 , 000 candles per square centimeter and a luminous efficiency of 47 . 5 lumens per watt at a real power of 200 watts . the reaction vessel used was a quartz tube 200 × 32 mm with a volumn of about 130 ml . an auxiliary light source , a broad band ultraviolet light , was also used . products were analyzed using a carle iii analytical gas chromatograph using thermistors as detectors . the photocatalyst chloro rhenium tricarbonyl bis - 4 phenylpyridine was prepared by the following procedure . to 800 ml of rapidly mixing hot iso - octane was added 1 . 5 g ( 4 . 1 × 10 - 3 moles ) rhenium pentacarbonyl chloride . to this was added 50 ml of an iso - octane solution containing 1 . 5 g ( 9 . 7 × 10 - 3 moles ) 4 - phenylpyridine ( an 18 % molar excess ). a white precipitate formed and was filtered using a fritted glass funnel . this precipitate was dried using suction for about 1 hour . the infrared spectrum of the re ( i ) compound shows three peaks due to carbonyl stretching at 2020 cm - 1 , 1920 cm - 1 , and 1890 cm - 1 . the ultraviolet - visible spectrum of the re ( i ) compound gives the following extinction coefficients : σ300 ( shoulder )= 32 , 000 and σ270 = 44 , 000 . a solution was prepared containing 50 g ( 0 . 54 moles ) 2 , 5 norbornadiene in 70 ml benzene and this solution was deaerated with n 2 for several minutes . to this solution was added 0 . 3 g ( 4 . 9 × 10 - 4 moles ) of chloro rhenium tricarbonyl - bis - 4 phenylpyridine and 0 . 6 g ( 3 . 9 × 10 - 3 moles ) of excess 4 - phenylipyridine . deaerating was continuous and the solution was irradiated in a quartz tube with the 200 watt , super high pressure mercury arc lamp . the rapid formation of quadricyclane was reported by gas chromatographic analysis almost immediately . after 24 hours of irradiating , analysis indicated the formation of a large amount of quadricyclane about 25 gms ( 0 . 27 moles ). a solution was prepared containing 9 . 2 g norbornadiene in 100 ml absolute ethanol and was deaerated with n 2 for several minutes . to the solution was added 0 . 62 g chloro rhenium tricarbonyl - bis - 4 phenylpyridine ( 10 - 3 moles ). deaerating was continuous and the solution was irradiated as in example 1 for 6 hours , resulting in the formation of quadricyclane . the photocatalyst cuprous chloride was prepared according to the following procedure . to a stirring solution of 10 g ( 0 . 06 moles ) cucl 2 -- 2h 2 o ( cupric chloride dihydrate ) in 10 ml water was slowly added a solution of 7 . 6 g anhydrous sodium sulfite in a minimum of water . initially , the solution turned a dark brown , and , subsequently , the white copper ( i ) chloride began to precipitate . the precipitate and supernatant liquid were poured into a graduated cylinder which contained 1 liter of water to which has been added 1 g of sodium sulfite and about 2 ml of concentrated hydrochloric acid . the fine white precipitate settled to the bottom and the supernatant liquid was carefully decanted . the solid was filtered on a fritted glass suction funnel in such a way that the supernatant liquid always remained above the surface of the solid . the precipitate was washed with several portions of glacial acetic acid , followed by several washings with absolute ethanol , followed by several washings with petroleum ether . the white solid was dried for about one minute with vacuum and then transferred to a dark bottle . the overall redox reaction utilized by this synthesis is as follows : a 1 molar ethanolic solution of 2 , 5 - norbornadiene was prepared in 100 ml ethanol using 9 . 2 g ( 0 . 1 mole ) of 2 , 5 - norbornadiene . the solution was continuously degassed with nitrogen and to it was added 0 . 2 g ( 2 × 10 - 3 moles ) of cu ( i ) cl . the solution was irradiated for 6 hours using the unfiltered light from the super - high pressure mercury arc lamp with continuous bubbling of nitrogen through the solution . even with this precaution , the catalyst became deactivated due to the oxidation of copper ( i ) to copper ( ii ). this oxidation was characterized by a color change in solution from near colorless to a greenish yellow . copper ( ii ) chloride was inactive as a catalyst for 2 , 5 - norbornadiene / quadricyclane photoconversion . the photocatalysts of the present invention , particularly the rhenium ( i ) photocatalysts , unexpectedly catalyze the isomerization of photoisomerizable compounds having activation energies greater than the triplet energy of the photocatalyst . the catalysts are thermally and oxidatively stable . the process of the present invention permits the capture and storage of light energy in the high energy conformation of the isomerizable compounds , for later release as heat upon reverse isomerization induced either thermally or catalytically . thus it should be apparent to those skilled in the art that the subject invention accomplishes the objects set forth above . it is to be understood that the subject invention is not to be limited by the examples set forth herein . these have been provided merely to demonstrate operability , and the selection of photocatalysts , isomerizable compounds , solvents , if any , and reaction conditions can be determined from the total specification disclosure provided , without departing from the spirit of the invention herein disclosed and described , the scope of the invention including modifications and variations that fall within the scope of the attached claims .	8
referring now to the drawing , a display unit is provided as follows . in fig1 a pair of indicia are shown . each of these indicia represent the letter “ s ”. the figure on the left - hand side is shown at ten lenticules per inch and the figure on the right - hand side at thirty lenticules per inch . as can be seen the fineness , or number of lenticules per inch , has a substantial effect on the clarity of the image . the higher the number of lenticules then the clearer the image . however the provision of a high number of lenticules per inch demands substantially enhanced registration between the display member or picture and the lenticular lens . in particular there must be a high degree of contact between the back of the lens and the display member to prevent the picture being out of focus and the picture and lens must be substantially parallel or the image will be substantially destroyed . in order to achieve such a construction in one embodiment the construction of fig2 is provided . in this construction a housing 1 is provided by a perimeter frame 2 . the housing 2 provides a cavity into which the following elements are provided . a lenticular lens 3 is provided along with a display member which may be in the form of a picture 4 , which will be described further hereinafter . the picture 4 is placed closely adjacent the inwardly facing face of the lenticular lens 3 . in the embodiment of fig2 a plate 5 is provided which is preferably a sliding plate . between the sliding plate 5 and the picture 4 may be provided a layer of compressible material such as , for example , a sponge foam layer . pressure members are provided to urge the picture 4 against the lens 3 . in this embodiment the pressure members comprise rollers 8 which are mounted in a suitable carrier 9 , any suitable number of rollers may be provided , there being , for example , four or six such rollers . the rollers are urged against the plate 5 , for example , by a compression spring 10 contained within a cylinder 11 mounted to a backing plate 12 engaged with the perimeter frame 2 . also contained within the housing is a suitable light source 22 . the lenticular lens 3 is held within the perimeter frame 2 , for example , by suitable clamps 23 . in order to reduce and , if possible , prevent distortion of the lens and picture due to the pressure of the springs 10 and rollers 9 , a substantially transparent front plate in the form of a clear panel 24 is provided . this may be formed , for example , from acrylic sheet . the acrylic sheet is made to any desired thickness , for example , in excess of 5 mm . the sponge layer assists the close contact of the picture 4 to the lens 3 and this may be , for example , 2 mm to 6 mm thick at a density of 6 kg to 25 kg per cubic metre . the sponge layer also has the effect of reducing the force between the picture and the lens to the minimum required to achieve the desired result . in terms of the number of lenticules provided in the lens 3 it is envisaged that for example , where a relatively small display is required , for example , in the range six inches by seven inches to eight inches by twelve inches , substantially thirty lenticules per inch may be provided . for larger models such as twelve inches by seventeen inches to twenty four inches by thirty six inches , twenty lenticules per inch is expected to be sufficient . larger displays could use less lenticules such as , for example , ten to fifteen lenticules per inch . when in use , as can be seen , each spring 10 is independent and therefore the force exerted is dependent to some extent on the needs at that particular point . the force of the springs compresses the sponge between the plate 5 and the picture 4 to ensure the best possible contact between the picture 4 and the back of the lens 3 . the provision of the thick panel 24 reduces any tendency for the construction to become convex with respect to the cavity in use . referring now to fig3 and fig4 the lens 3 is mounted on a hinge pin 28 . the hinge pin 28 being carried by a support member 29 which is mounted on the frame 2 . the lens 3 is therefore able to rotate about the hinge pin 28 . in order to obtain adjustment a bracket 30 is provided which is mounted on the lens 3 . a rotatable knob 31 is provided which is threaded and passes through an aperture in the bracket 30 . the knob 31 is held against rotation by engagement with a suitable position such as the surrounding frame 2 . the adjustment which is preferably able to be manipulated from the exterior of the cavity may be contained within a removable cover plate 32 which engages the main part of the frame 2 being sealed , for example , by sealing members 35 and 36 which may be formed , for example , of silicone rubber . the adjustment enables rotational registration of the picture 4 and the lens 3 , that is to say substantial parallelism between the picture 4 and lens 3 is able to be obtained . the effect of this is shown in fig5 where the left - hand picture shows an image where rotational registration is inaccurate and the right - hand picture shows the same image when the rotational registration is corrected . [ 0052 ] fig6 shows a device that covers a group of black lines . this cover plate 40 is able to be moved in slots provided in the frame 2 to adjust the registration between the picture 4 and the lens 3 translationally . the cover 40 is moved to slide along the slots provided and is able to be held in position by rotation in the slot . after the adjustment is made it is moved to cover the black lines and a small dimple ( not shown ) is made on the cover plate 40 and this dimple is within the slot in the frame so that the cover plate will hold its position in use . [ 0053 ] fig7 illustrates a driving mechanism . the driving mechanism 50 provides a motor 51 which in use is intended to continuously rotate when a suitable driving signal is received . two sets of stepping gears are provided to reduce the rotational speed of the driving shaft 52 which shaft drives a cam 53 . a shifting gear 54 is provided which is able to be adjusted by means of a member 55 which is able to be manually engaged . this is more completely described in fig8 which shows two gear groups 60 and 61 . the gear groups 60 may , for example , step down the driving shaft speed to , for example , between four and eight seconds to complete a revolution and the gear chain 61 may achieve a reduction , for example , of about sixteen to thirty - two seconds a turn . the speed is controlled of course by the speed of the motor in association with a suitable electronic control device 65 . the electronic control unit 65 has three main parts . the first part is a pulse generator . the pulse generator has a fixed capacitor and a variable resistor ( vr ). by tuning the vr , the pulse frequency is changed . the higher the resistance , the lower the frequency . the pulses enter into the second part which has a timer ic to control the duration of the pulses . the regulated pulses enter the power switch of the unit . when the pulse is given , the power source is on and the motor runs while the power source is on . when the pulse passes the power is off , and the motor slows down but is not stopped due to its own inertia . before it stops , a further pulse is given and the motor starts to accelerate again . the higher the frequency of the impulse , the longer the acceleration , eventually the motor runs faster , and vice versa . further the speed achieved by the gear chain 60 and the speed of the gear chain 61 is changed by an intermediate cog or roller in the gear chain 62 which is able to be positioned between a low gear position 63 and a high gear position 64 by means of operating the shifting device 55 . the cam 53 is designed to give a linear displacement of , for example , four to six lenticules of the lens to the picture upon one full turn of the cam . since the cam is connected to the driving shaft 52 that is turning at a speed of four to thirty - two seconds per turn , the picture 4 is able to move at a speed from two - thirds to eight seconds per lenticule . a cam follower 70 is provided which surrounds the cam 53 as shown in fig9 . the cam follower is attached to the plate 5 . the cam follower provides two tips 71 and 72 which contact the cam 53 in opposite positions . as shown in fig9 the diagonal distance through the moving centre point # 0 is constant around the perimeter of the cam . when the cam turns from position “ a ” to position “ b ” tip 71 of the cam follower is moved forward the distance determined by the parameters of the construction . however when the cam moves from position “ c ” to position “ d ” the tip 72 is moved so as to return the cam follower to its initial position . as the cam 53 pushes the cam follow 70 , and the cam follower 70 is firmly attached to the sliding plate 5 , the picture is able to be driven up and down or left and right at a constant speed . referring now to fig1 to 13 , a horizontally moving lenticular lens 3 is provided , the lenticules running vertically . an image to be represented is indicated at 80 , images of the picture being taken at positions “ a ”, “ b ” and “ c ” in fig1 . thus an image between the positions “ a1 ” and “ a2 ” is taken from position “ a ” between “ b1 ” and “ b2 ” from position “ b ” and “ c1 ” and “ c2 ” from position “ c ”. when these are correctly positioned on the display member 4 the effect is shown in fig1 . in the left - hand position the lenticule 3 ′ is shown at the position of the image containing , for example , the picture taken from the position “ b ” in fig1 . thus “ b1 ” to “ b2 ” of the image is seen . when the picture has moved so that the lenticule 3 ′ is , for example , at position “ a ” as shown in fig1 , then the image is represented as seen from position “ a ” in fig1 . by suitably shaping the lenticule a substantial number of successive images can be obtained . it is possible to achieve at least twelve consecutive images . the images appear to be in three dimensions because of the different angles on the lenses . referring to fig1 , in order to make the construction substantially weatherproof the silicone seals , previously described , are used . however it is desirable to move air through the construction and this can be achieved by forming venting holes 90 on the inner part of the frame and venting holes 91 on the outer part of the frame , these holes not being in register and preferably the outer holes 91 being lower positioned so that air can move but rain is substantially prevented at least from getting through the inner venting holes 90 . a fan 92 may be provided to move air which , in particular , aids cooling and therefore is arranged to turn on once the light in 22 is turned on . referring now to fig1 a simplified structure is shown . in this simplified structure , which is intended to be a small unit for indoor use , it is possible to delete the cooling fan 92 , the lighting 22 , transformer 93 and also the sliding plate 5 . also the various seals are able to be removed . it is intended that the device is battery operated . as the picture 4 is lighter it is however stiff enough and can be driven by the mechanism directly . in this construction the rollers 8 are able to bear directly on the picture for itself . the lenticular lens 3 is visible through aperture 100 in the frame which comprises a front frame unit 101 and a rear frame unit 102 , able to be engaged one with the other . the cam follower part 70 is mounted directly onto the picture so that cam 53 which operates in substantially the same manner as before between the tips provided in the cam follower drives the picture 4 directly . fig1 shows the picture moving mechanism of this display unit . the cam 53 drives the cam follower 70 which essentially replaces the cam follower and sliding bed of the earlier described construction . the picture is constrained by a pair of guiding racks so as to give the required register as the picture moves . a guiding sleeve 107 is provided . the sleeve 107 is guided by a pin 108 which runs in a slot 109 in the plate 107 . the gap between the picture carrying plate 107 and the guiding racks is less than 0 . 005 of an inch as well as the gap between the guiding sleeve and the guiding pin . this enables satisfactory control to cause parallel movement of the picture responding to the pushing of the cam . a cover plate 110 is provided to cover aperture 111 in the frame part 101 so as to provide access to the cam 53 . by removing the cover plate 101 the cam follower 70 can be released from the cam as indicated in fig1 by arrow 120 so that the picture can be removed upwardly through a slot at 121 in the direction 122 to allow the picture to be replaced . in use a picture is formed substantially as shown in fig1 to 13 and mounted as the display member in either of the embodiments described . operation of the cam and cam follower causes the picture to move relative to the lens thereby causing the illusion at least of movement of the image , as described in fig1 to 13 . the display unit described provides for high quality consecutive image display and is able to provide a relatively low cost display unit for advertising and promotion showing a short smooth moving picture . a substantially continuous running motor is provided to drive the picture , rather than a step motor as in the currently available constructions . the invention allows a display unit to show consecutive images in a widely varying speed to give a measure of natural appearance to be achieved . the display unit also enables illustrations to be substantially in a 3d manner because of the multiple views that are able to be provided . this provides a simple and economic device to demonstrate an object in a perspective with multiple views for advertising , promotion and educational use . the display unit can also be used outdoors , displaying the multiple images and short videos because of the weatherproofing features included in the preferred embodiment .	6
hereinafter , a light emitting device according to embodiments will be described with reference to the accompanying drawings . fig1 is a side - sectional view of a light emitting device according to a first embodiment , fig2 is a plan view illustrating a trench of a package body of fig1 , and fig3 is a side - sectional view of fig2 . referring to fig1 to 3 , a light emitting device 100 comprises a package body 110 having a cavity 101 and a trench 130 , electrodes 112 and 114 , a light emitting diode 120 , a resin material 140 , and a lens 150 . the light emitting device 100 may be defined as a light emitting diode package . this term may be variously defined within the technical scope of embodiments . for example , the package body 110 may be formed of a material having a high insulating property or a high thermal conductivity such as silicon , silicon carbide ( sic ), and aluminum nitride ( aln ). hereinafter , for convenience of description , the package body 110 will refer to as a silicon - based wafer level package ( wlp ). the package body 110 may comprise a frame having a polyhedral shape . the package body 110 may have the same length as each other or lengths different from each other in horizontal and vertical length , but it is not limited thereto . the cavity 101 is defined in an inner upper portion of the package body 110 . a predetermined etching process , e . g ., a wet etching process and / or a dry etching process may be performed on the package body 110 to form the cavity 101 having a vessel ( or a bathtub ) shape or a depressed structure . a lateral surface 117 of the cavity 101 may be perpendicular to a bottom surface of the cavity 101 or inclined outwardly with respect to a vertical shaft . the cavity 101 of the package body 110 may have a single layer or a multi - layer structure . in case of the cavity 101 having the multi - layer structure , at least one cavity may be further defined in a portion of the bottom surface of the cavity 101 . referring to fig2 and 3 , the trench 130 is defined around a top surface of the package body 110 . the trench 130 is disposed along an outer circumference of the cavity 101 by a predetermined depth . the trench 130 may have a shape different from an outer shape of the cavity 101 , e . g ., a circular or an oval shape . referring to fig3 , the trench 130 may have a depth less than about 30 um from a top surface 103 of the package body 110 . the depth of the trench 130 may be defined by considering prevention of resin overflow and electrode formation . the dry etching process and / or the wet etching process may be performed to form the trench 130 . in detail , in the dry etching process , a mask layer may be formed on a surface of the package body 11 , and then , the mask layer may be patterned to form a mask pattern having a desired shape using exposing , developing , and etching processes of photolithography processes . an open region having a trench shape is formed using the mask pattern , and then , the dry etching process is performed . reactive ion etching ( rie ), magnetically enhanced reactive ion etching ( merie ), inductively coupled plasma ( icp ) processes using plasma may be selectively performed in the dry etching process . the dry etching process may be performed on the package body 110 to form the trench 130 having the predetermined depth ( e . g ., less than about 30 um ). in the wet etching process , when the mask pattern having the circular or oval shape is formed on the surface of the package body 110 , the trench 130 having the predetermined depth may be formed using a wet etching solution . the wet etching process may be performed after the dry etching process . at this time , the wet etching process is an isotropic wet etching process . at least one of an acetic acid , a hydrofluoric acid , and a nitric acid may be used as the wet etching solution , or a solution in which the etching solutions are mixed at a predetermined ratio may be used as the wet etching solution . the trench 130 may be formed in the package body 110 before or after the cavity 101 is formed . the trench 130 may have a close - loop shape in which a cut portion does not exist or an open - loop shape in which the cut portion exists . the plurality of electrodes 112 and 114 are disposed on the surface of the package body 110 . the electrodes 112 and 114 are divided by an opened portion 115 through which the top surface of the package body 110 is partitioned into both sides . each of the electrodes 112 and 114 may extend from the bottom surface of the cavity 101 up to the top surface , a lateral surface , and a bottom surface of the package body 110 . both ends of the electrodes 112 and 114 may be disposed on the bottom surface of the package body 110 and used as external electrodes p 1 and p 2 . the electrodes 112 and 114 may be disposed on the trench 130 and in a region except the opened portion 115 . e - beam , sputtering , and electro plating deposition processes may be performed to form the electrodes 112 and 114 . the plurality of electrodes 112 and 114 may have different electrode patterns according to a structure of the cavity 101 and a mounting position of the light emitting diode 120 , respectively , but it is not limited thereto . any one of the plurality of electrodes 112 and 114 may have a via structure . at least one light emitting diode 120 is disposed on the cavity 101 of the package body 110 . an led chip may be used as the light emitting diode 120 . the light emitting diode 120 may selectively comprise a red led chip , a blue led chip , a green led chip , an ultraviolet ( uv ) led chip , and a yellow led chip , but it is not limited thereto . an electrostatic protection device may be mounted on the package body 110 , or an ion implantation or diffusion process may be performed on the package body 110 to realize the electrostatic protection device . the electrostatic protection device may be realized as a zener diode for protecting the light emitting diode 120 . the light emitting diode 120 may be connected to the plurality of electrodes 112 and 114 using wires 120 . wire bonding , die bonding , and flip bonding processes may be selectively performed according to the chip types of the light emitting diode 120 to connect the light emitting diode 120 to the electrodes 112 and 114 . the connection structure of the light emitting diode 120 may be variously modified according to a type of led chip , the number of led chip , and patterns of the electrodes 112 and 114 , but it is not limited thereto . the resin material 140 is filled into the cavity 101 . the resin material 140 may comprise a transparent insulating material , e . g ., a resin material such as an epoxy resin or silicon or a polymer material , but it is not limited thereto . a liquid resin material is dispensed to form the resin material 140 . at least one phosphor of phosphors ( not shown ) such as red , green , and blue phosphors may be added to the resin material 140 , and this may be changed within the technical scope of embodiments . the resin material 140 seals portions of the light emitting diode 120 and the electrodes 112 and 114 to protect them . the lens 150 is disposed on the resin material 140 . a transparent resin material may be dispensed to form the lens 150 before or after the resin material 140 is hardened . the lens 150 may be changed in shape according to a shape of the trench 130 and an amount of the dispensed resin material . the trench 140 may prevent the resin material dispensed for forming the lens 150 from overflowing . thus , an outer shape of the lens 150 may be uniform . the outer shape and size of the lens 150 may be changed according to the shape and size of the trench 140 . for example , when the trench has the circular shape , the outer shape of the lens 150 may have a circular shape . also , when the trench has the oval shape , the outer shape the lens 150 may have an oval shape . an orientation angle may be adjusted according to the shape of the lens 150 using the trench 130 . a process for manufacturing the light emitting device according to the first embodiment will now be roughly described . the cavity 101 is formed in the inner upper portion of the package body 110 , and the trench 130 is formed around the outside of the cavity 101 . the plurality of electrodes 112 and 114 are formed on the package body 110 and the surface of the cavity 101 . the light emitting diode 120 is mounted on the electrodes 112 and 114 . the resin material is formed in the cavity 101 , and the lens 150 is formed inside the trench 130 on the resin material 140 . fig4 is a plan view of a light emitting device according to a second embodiment . in the following description of the second embodiment , duplicate descriptions for elements which are the same as those of the first embodiment will be omitted . referring to fig4 , in a light emitting device 100 a , a trench 130 is disposed around a cavity 101 of a package body 110 . the trench 130 may have a circular shape and be divided into a plurality of trenches 130 a and 130 b that does not communicate with each other . both ends of the plurality of trenches 130 a and 130 b are spaced a predetermined gap 113 from an opened portion 115 . thus , the opened portion 115 may divide the plurality of trenches 130 a and 130 b and a plurality of electrodes 112 and 114 into both sides thereof . when the trenches 130 a and 130 b are not formed in the opened portion 115 , it may prevent the plurality of electrodes 112 and 114 from being electrically shorted within the opened portion 115 . two or more trenches 130 may be formed , and each of the trenches may have the circular shape . the number of trenches may be changed within the technical scope of embodiments . fig5 is a plan view of a light emitting device according to a third embodiment . in the following description of the third embodiment , duplicate descriptions for elements which are the same as those of the first embodiment will be omitted . referring to fig5 , a light emitting device 100 b comprises a package body 110 a having a rectangular shape and a cavity 101 a having a rectangular shape . the package body 110 a has a horizontal length x and a vertical length y which are different from each other . the cavity 101 a having the rectangular shape may be disposed inside the package body 110 a . the cavity 101 a may have a shape different from that of the package body 110 a , e . g ., a square or circular shape , but it is not limited thereto . a trench 130 is disposed around the outside of the cavity 101 a . the trench 130 may have an oval shape . a lens 150 having an oval shape may be manufactured by the trench 130 . light may be oriented in a specific direction or in a specific region due to the lens 150 . the light emitting device 100 b may have a large orientation angle in an x - axis direction and a small orientation angle in a y - axis direction due to the cavity 101 a having the rectangular shape and the lens 150 having the oval shape . fig6 is a perspective view of a light emitting device according to a fourth embodiment . in the following description of the fourth embodiment , duplicate descriptions for elements which are the same as those of the first embodiment will be omitted . referring to fig6 , a light emitting device 100 c comprises a package body 110 in which a cavity 101 b having a circular shape is provided . an outer shape of the cavity 101 b has the circular shape . a resin material is filled in the cavity 101 b , and a lens 150 is disposed on the resin material . an outer surface of the lens 150 is disposed along the trench 130 . the trench 130 is spaced the same distance from a circumference of the cavity 101 b . also , the outer surface of the lens 150 may be spaced the same distance from the circumference of the cavity 101 b . thus , light emitted from the lens 150 may be irradiated with a smooth distribution . dry and wet etching processes may be selectively performed to form the cavity 101 b having the circular shape . when the wet etching process is performed after the dry etching process is performed , an isotropic wet etching process is performed . thus , the cavity 101 b may have a lateral surface 117 curved with a predetermined curvature . the trench 130 of the package body 110 may be formed after the cavity 101 b is formed first , and the process procedure may be changed . fig7 is a side - sectional view of a light emitting device according to a fifth embodiment . in the following description of the fifth embodiment , duplicate descriptions for elements which are the same as those of the first embodiment will be omitted . referring to fig7 , a light emitting device 100 d has a flat top surface without forming a cavity on a package body 110 . a trench 130 having a circular or oval shape is disposed around an outer top surface of the package body 110 . a plurality of electrodes 112 and 114 may be disposed around the outer top surface of the package body 110 . a light emitting diode 120 is attached in the inside or a central region of the trench 130 . the light emitting diode 120 is electrically connected to the plurality of electrodes 112 and 114 . according to the fifth embodiment , the number of processes for forming the cavity in the silicon - based package body 110 may be reduced . technical characteristics of the first to fifth embodiments are not limited to a characteristic of each of the embodiments , and any embodiment may be selectively applied to another embodiment within the technical scope of the embodiments . in the description of embodiments , it will be understood that when a layer ( or film ), region , pattern or structure is referred to as being ‘ on ’ another layer ( or film ), region , pad or pattern , the terminology of ‘ on ’ and ‘ under ’ comprises both the meanings of ‘ directly ’ and ‘ indirectly ’. further , the reference about ‘ on ’ and ‘ under ’ each layer will be made on the basis of drawings . any reference in this specification to “ one embodiment ,” “ an embodiment ,” “ example embodiment ,” etc ., means that a particular feature , structure , or characteristic described in connection with the embodiment is comprised in at least one embodiment of the invention . the shapes of such phrases in various places in the specification are not necessarily all referring to the same embodiment . further , when a particular feature , structure , or characteristic is described in connection with any embodiment , it is submitted that it is within the purview of one skilled in the art to effect such feature , structure , or characteristic in connection with other ones of the embodiments . although embodiments have been described with reference to a number of illustrative embodiments thereof , it should be understood that numerous other modifications and embodiments can be devised by those skilled in the art that will fall within the spirit and scope of the principles of this disclosure . more particularly , various variations and modifications are possible in the component parts and / or arrangements of the subject combination arrangement within the scope of the disclosure , the drawings and the appended claims . in addition to variations and modifications in the component parts and / or arrangements , alternative uses will also be apparent to those skilled in the art .	7
digital video is typically encoded from raw video , where the encoding process typically produces a compressed digital video file that is much smaller in physical size than the original raw video . a number of video codecs for encoding and decoding video exist , such as for example alpary , animation ( qtrle ), arithyuv , avizlib , camstudio gzip / lzo , dirac lossless , fastcodec , ffv1 , h . 264 lossless , huffyuv ( or huffyuv ), jpeg 2000 lossless , lagarith , loco , lzo , msu lossless video codec , png , screenpressor , sheervideo , snow lossless , techsmith screen capture codec ( tscc ), ut video , vmnc , yuls , zmbv ( zip motion block video ) codec , zrle used by vnc , blackmagic codec , apple intermediate codec , audio video standard ( avs ), bink video , blackbird forscene video codec , cinepak , dirac , firebird , h . 261 mpeg - 1 part 2 ( mpeg - 1 video ), h . 262 / mpeg - 2 part 2 ( mpeg - 2 video ), h . 263 , mpeg - 4 part 2 ( mpeg - 4 advanced simple profile ), h . 264 / mpeg - 4 avc or mpeg - 4 part 10 ( mpeg - 4 advanced video coding ), hevc , indeo 3 / 4 / 5 , oms video , on2 technologies ( truemotion vp3 / vp4 , vp5 , vp6 , vp7 , vp8 ; or truemotion s , truemotion 2 ), pixlet , realvideo , snow wavelet codec , sorenson video , sorenson spark , tarkin , theora , vc - 1 ( smpte standard , subset of windows media video ), vp9 by google , windows media video ( wmv ), mjpeg , jpeg 2000 intra frame video codec , apple prores 422 / 4444 , avc - intra , dv , vc - 2 smpte standard ( a . k . a . dirac pro ), vc - 3 smpte standard , gopro cineform , redcode raw , and grass valley codec . because digital video is typically compressed , a large amount of digital video data can be stored and / or transported over a network . digital video storage media include , for example , compact disks formatted for blue - ray ( tm ), dvd , or cd data , video cassette tapes , and digital files stored in computer - readable memory present in a general purpose computer , a gaming console , a handheld device such as a video player , pda , or smartphone , or a remote server . to be viewed , the encoded digital video is decoded by a digital video player . fig1 illustrates one embodiment of a digital video player 100 . digital video players 100 include , for example , digital video recorders ( dvr ), blue - ray ™ players , dvd players , cd players , video cassette players , handheld devices such as specialized video players , pdas , and smartphones , gaming consoles , general purpose computers , and other hardware and / or software devices capable of decoding and displaying video , and any such hardware and / or software built into another device such as a television . the digital video player 100 may receive 106 encoded digital video directly from storage media 104 as described above , or may receive the digital video over a wired or wireless network connection 102 ( often referred to as streaming video ). a decoder 108 decodes the encoded digital video before it is displayed by a display 110 . in transmitting digital video over a network 102 and / or in decoding the digital video , the decoded video can acquire defects . these defects may not be correctable , either because data has been lost or the decoder has lost synchronization with the video stream , the decoder 108 must discard data in order to recover from the defect , or any combination of these reasons . a single defect or an accumulation of defects may be visible to a human viewer . the defects may affect all or part of the viewable image on the display 110 , and can manifest , for example , as pixilation , blockiness , blurriness , noise , and / or other visual distortions , or jerkiness , jumping , freezing , and / or other motion distortions . a person viewing the video on the display 110 may wish to notify the content provider when the digital video she is viewing shows visible defects . alternatively or additionally , the video content provider may want to be informed when the video shows defects , so that the content provider can understand and possibly prevent the defects . a digital video player 100 may be operable to detect that a visible defect has occurred . upon detecting a defect , the digital video player 100 may be operable to save the segment of the video that contained the defect . the digital video player 100 may be operable to detect the defect automatically . alternatively or additionally , the viewer may inform the digital video player 100 that she has seen a defect , such as for instance by pushing a button on a remote control in communication with the digital video player 100 , or typing commands into a computer or smartphone . the defective video segment may , for example , include several seconds and / or segments - worth of frames before the defective frames and / or several segments - worth of frames after the defective frames . the video segment may be taken from the encoded video stream and / or the decoded video stream . the defective video segment may be saved in a specially designated area in the memory or hard drive of the digital video recorder . the specially designated area may be accessible to the viewer and / or to the content provider by way of a remote connect to the digital video player 100 . the specially designated area may additionally or alternatively be secure , such that the area can only be accessed by designated entities or persons , and / or is protected by a password and / or standard encryption method . the digital video player 100 may automatically inform the content provider that a defective video segment has been stored in a computer - readable medium , such as a memory 112 or other digital storage device , for example . alternatively , or additionally , the digital video player 100 may comprise a transmitter 114 configured to transmit or automatically transmit the defective video segment to the content provider . a number of methods exist for a digital video recorder to automatically detect that a video has displayed defects . for example , some digital video recorders are able to detect that video data has been lost . as another example , udp packets contain two cyclic redundancy check ( crc ) bytes allowing detection of errors within the packet . when the crc fails the packet will usually be discarded . as another example , udp datagrams may be provided with a 16 - bit checksum . as another example , some decoders 108 are able to do basic symbol checking and determine that the decoding process has or will lose synchronization with the incoming data stream . other methods exist , and the embodiments herein are not limited in this context . certain embodiments will now be described to provide an overall understanding of the principles of the structure , function , manufacture , and use of the devices and methods disclosed herein . one or more examples of these embodiments are illustrated in the accompanying drawings . those of ordinary skill in the art will understand that the devices and methods specifically described herein and illustrated in the accompanying drawings are non - limiting exemplary embodiments . the features illustrated or described in connection with one exemplary embodiment may be combined with the features of other embodiments . such modifications and variations are intended to be included within the scope of the present disclosure . reference throughout the specification to “ various embodiments ,” “ some embodiments ,” “ one embodiment ,” or “ an embodiment ”, or the like , means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment . thus , appearances of the phrases “ in various embodiments ,” “ in some embodiments ,” “ in one embodiment ”, or “ in an embodiment ”, or the like , in places throughout the specification are not necessarily all referring to the same embodiment . furthermore , the particular features , structures , or characteristics may be combined in any suitable manner in one or more embodiments . thus , the particular features , structures , or characteristics illustrated or described in connection with one embodiment may be combined , in whole or in part , with the features structures , or characteristics of one or more other embodiments without limitation . such modifications and variations are intended to be included within the scope of the present disclosure . fig2 illustrates one embodiment of a process 200 for detecting 204 and storing 206 a defective segment of a digital video . with reference now to fig1 and 2 , in this process 200 , a digital video player 100 plays 202 a video . in some embodiments , the digital video player 100 may automatically detect 204 that a defect has occurred in the display of the video , upon detecting 204 the defect , the digital video player 100 may save 206 the video segment that contained the defect . the digital video player 100 may then determine 210 whether the end of the video has been reached , or the viewer has stopped the display of the video . when neither is the case , the digital video player 100 will continue to play the video 202 . when one or the other is the case , the digital video player will stop 212 . fig3 illustrates one embodiment of a process 300 for detecting 304 and storing 306 a defective segment of a digital video , and automatically notifying 308 the content provider that this has occurred . with reference now to fig1 and 3 , in this process 300 , a digital video player 100 plays 302 a video . in some embodiments , the digital video player 100 may automatically detect 304 that a defect has occurred in the display of the video . upon detecting 304 the defect , the digital video player 100 may save 306 the video segment that contained the defect . the digital video player 100 also may notify 308 the content provider that it has saved 306 a segment of defective video . the digital video player 100 may then determine 310 whether the end of the video has been reached , or the viewer has stopped the display of the video . when neither is the case , the digital video player 100 will continue to play 302 the video . when one or the other is the case , the digital video player 100 will stop 312 . fig4 illustrates one embodiment of a process 400 for detecting 404 and storing 406 a defective segment of a digital video , and automatically transmitting 408 the defective segment to the content provider . with reference now to fig1 and 4 , in this process 400 , a digital video player 100 plays 402 a video . in some embodiments , the digital video player 100 may automatically detect 404 that a defect has occurred in the display of the video . upon detecting 404 the defect , the digital video player 100 may save the video segment 406 that contained the defect . the transmitter 114 portion of the digital video player 100 also may transmit 408 the saved 406 defective video segment to the content provider . the digital video player 100 may then determine 410 whether the end of the video has been reached , or the viewer has stopped the display of the video . when neither is the case , the digital video player 100 will continue to play 402 the video . when one or the other is the case , the digital video 100 player will stop 412 . fig5 illustrates one embodiment of a process 500 in which the viewer detects a defect and initiates a save 504 of a segment of the digital video . with reference now to fig1 and 5 , in this process 500 , a digital video player 100 plays 502 a video . in some embodiments , the viewer may decide that the displayed video has a defect , and initiate 504 a save of a segment of the digital video . upon the viewer initiating 504 a save the defect , the digital video player 100 may save 506 the video segment that contained the defect . the digital video player 100 may then determine 510 whether the end of the video has been reached , or the viewer has stopped the display of the video . when neither is the case , the digital video player 100 will continue to play 502 the video . when one or the other is the case , the digital video player 100 will stop 512 . fig6 illustrates one embodiment of a process 600 in which the viewer detects a defect and initiates a save 604 of a segment of the digital video , and a digital video recorder 100 ( fig1 ) automatically notifies 608 the content provider that this has occurred . with reference now to fig1 and 6 , in this process 600 , a digital video player 100 plays 602 a video . in some embodiments , the viewer may decide that the displayed video has a defect , arid initiate a save 604 of a segment of the digital video . upon the viewer initiating a save 604 the defect , the digital video player 100 may save the video segment 606 that contained the defect . the digital video player 100 may also notify the content provider 608 that it has saved 606 a segment of defective video . the digital video player 100 may then determine 610 whether the end of the video has been reached , or the viewer has stopped the display of the video . when neither is the case , the digital video player 100 will continue to play 602 the video . when one or the other is the case , the digital video player 100 will stop 612 . fig7 illustrates one embodiment of a process 700 in which the viewer detects a defect and initiates a save 704 of a segment of the digital video , and the digital video recorder 100 fig1 ) automatically transmits 708 the defective segment to the content provider . in this process 700 , a digital video player plays 702 a video . with reference now to fig1 and 7 , in some embodiments , the viewer may decide that the displayed video has a defect , and initiate 704 a save of a segment of the digital video . upon the viewer initiating a save 704 the defect , the digital video player 100 may save the video segment 706 that contained the defect . the transmitter 114 portion of the digital video player 100 also may transmit 708 the saved 706 defective video segment the content provider . the digital video player 100 may then determine 710 whether the end of the video has been reached , or the viewer has stopped the display of the video . when neither is the case , the digital video player 100 will continue to play 702 the video . when one or the other is the case , the digital video player 100 will stop 712 . fig8 illustrates one embodiment of a process 800 by which a content provider may acquire a segment of digital video containing a defect . with reference now to fig1 and 8 , in this process 800 , the viewer contacts 802 the content provider . in some embodiments , the viewer may then initiate 804 the transmission of a saved video segment . the transmitter 114 portion of the digital video player 100 may then transmit a defective segment 810 . the content provider may then be able to analyze 812 the defect . fig9 illustrates one embodiment of a process 900 by which a content provider may acquire a segment of digital video containing a defect . with reference now to fig1 and 9 , in this process 900 , the viewer contacts 902 the content provider . in some embodiments , the content provider may then be able to access 904 the saved segment on the digital video player 100 . the transmitter portion 114 of the digital video player 100 may then transmit 910 a defective segment . the content provider may then be able to analyze 912 the defect . it is understood that the above described embodiments are given as examples and not limitations . one skilled in the art will recognized that any and all of the above described embodiments may be combined in a number of different ways . while various details have been set forth in the foregoing description , it will be appreciated that the various aspects of the systems and methods for automated capture of impaired video may be practiced without these specific details . for example , for conciseness and clarity selected aspects have been shown in block diagram form rather than in detail . some portions of the detailed descriptions provided herein may be presented in terms of instructions that operate on data that is stored in a computer memory . such descriptions and representations are used by those skilled in the art to describe and convey the substance of their work to others skilled in the art . in general , an algorithm refers to a self - consistent sequence of steps leading to a desired result , where a “ step ” refers to a manipulation of physical quantities which may , though need not necessarily , take the form of electrical or magnetic signals capable of being stored , transferred , combined , compared , and otherwise manipulated . it is common usage to refer to these signals as bits , values , elements , symbols , characters , terms , numbers , or the like . these and similar terms may be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise as apparent from the foregoing discussion , it is appreciated that , throughout the foregoing description , discussions using terms such as “ processing ” or “ computing ” or “ calculating ” or “ determining ” or “ displaying ” or the like , refer to the action and processes of a computer system , or similar electronic computing device , that manipulates and transforms data represented as physical ( electronic ) quantities within the computer system &# 39 ; s registers and memories into other data similarly represented as physical quantities within the computer system memories or registers or other such information storage , transmission or display devices . it is worthy to note that any reference to “ one aspect ,” “ an aspect ,” “ one embodiment ,” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the aspect is included in at least one aspect . thus , appearances of the phrases “ in one aspect ,” “ in an aspect ,” “ in one embodiment ,” or “ in an embodiment ” in various places throughout the specification are not necessarily all referring to the same aspect . furthermore , the particular features , structures or characteristics may be combined in any suitable manner in one or more aspects . although various embodiments have been described herein , many modifications , variations , substitutions , changes , and equivalents to those embodiments may be implemented and will occur to those skilled in the art . also , where materials are disclosed for certain components , other materials may be used . it is therefore to be understood that the foregoing description and the appended claims are intended to cover all such modifications and variations as falling within the scope of the disclosed embodiments . the following claims are intended to cover all such modification and variations . some or all of the embodiments described herein may generally comprise technologies for various aspects of the systems and methods for automated capture of impaired video , or otherwise according to technologies described herein , in a general sense , those skilled in the art will recognize that the various aspects described herein which can be implemented , individually , and / or collectively , by a wide range of hardware , software , firmware , or any combination thereof can be viewed as being composed of various types of “ electrical circuitry ,” consequently , as used herein “ electrical circuitry ” includes , but is not limited to , electrical circuitry having at least one discrete electrical circuit , electrical circuitry having at least one integrated circuit , electrical circuitry having at least one application specific integrated circuit , electrical circuitry forming a general purpose computing device configured by a computer program ( e . g ., a general purpose computer configured by a computer program which at least partially carries out processes and / or devices described herein , or a microprocessor configured by a computer program which at least partially carries out processes and / or devices described herein ), electrical circuitry forming a memory device ( e . g ., forms of random access memory ), and / or electrical circuitry forming a communications device ( e . g ., a modern , communications switch , or optical - electrical equipment ). those having skill in the art will recognize that the subject matter described herein may be implemented in an analog or digital fashion or some combination thereof . the foregoing detailed description has set forth various embodiments of the devices and / or processes via the use of block diagrams , flowcharts , and / or examples . insofar as such block diagrams , flowcharts , and / or examples contain one or more functions and / or operations , it will be understood by those within the art that each function and / or operation within such block diagrams , flowcharts , or examples can be implemented , individually and / or collectively , by a wide range of hardware , software , firmware , or virtually any combination thereof . in one embodiment , several portions of the subject matter described herein may be implemented via application specific integrated circuits ( asics ), field programmable gate arrays ( fpgas ), digital signal processors ( dsps ), or other integrated formats . those skilled in the art will recognize , however , that some aspects of the embodiments disclosed herein , in whole or in part , can be equivalently implemented in integrated circuits , as one or more computer programs running on one or more computers ( e . g ., as one or more programs running on one or more computer systems ), as one or more programs running on one or more processors ( e . g ., as one or more programs running on one or more microprocessors ), as firmware , or as virtually any combination thereof , and that designing the circuitry and / or writing the code for the software and or firmware would be well within the skill of one of skill in the art in light of this disclosure . in addition , those skilled in the art will appreciate that the mechanisms of the subject matter described herein are capable of being distributed as a program product in a variety of forms , and that an illustrative embodiment of the subject matter described herein applies regardless of the particular type of signal bearing medium used to actually carry out the distribution . examples of a signal bearing medium include , but are not limited to , the following : a recordable type medium such as a floppy disk , a hard disk drive , a compact disc ( cd ), a digital video disk ( dvd ), a digital tape , a computer memory , etc . ; and a transmission type medium such as a digital and / or an analog communication medium ( e . g ., a fiber optic cable , a waveguide , a wired communications link , a wireless communication link ( e . g ., transmitter , receiver , transmission logic , reception logic , etc . ), etc .). although various embodiments have been described herein , many modifications , variations , substitutions , changes , and equivalents to those embodiments may be implemented and will occur to those skilled in the art . also , where materials are disclosed for certain components , other materials may be used . it is therefore to be understood that the foregoing description and the appended claims are intended to cover all such modifications and variations as falling within the scope of the disclosed embodiments . the following claims are intended to cover all such modification and variations .	7
the present invention is a system and method for first resetting ( changing ) the encryption key on a self - encrypting disk drive followed by a complete disk wipe . the encryption key used in a self - encrypting hard disk drive is usually a long key used with a high - security encryption method like aes . this key is typically called the media encryption key ( mek ). this is a strong key generated automatically as a random or pseudo - random number by the disk hardware / firmware that is typically 128 or 256 bits . some disk drives may use more than one mek for different tracks or sectors . unlocking the drive for use may require another key typically called a key encryption key ( kek ) supplied by the user , bios , an operating system or a network . the mek is encrypted by the kek , and only the encrypted version of the mek is stored when the drive is powered off . also , in most systems , the kek is never stored in plain text inside the drive . some drives allow a mode where there is no kek , or the kek is not set . in this mode , the drive is always unlocked and appears not to be encrypting even though it is ( using the mek ). if a kek is set , the drive powers up locked ( with the mek only in encrypted form ) until the correct kek is given to the drive by the user . when a locked self - encrypting drive is powered up , the bios typically first sees a shadow disk that is much smaller than the real disk . the shadow disk is usually around 100 megabytes and contains executable software . the software in the shadow disk is read - only and typically requests the kek from the user to unlock the real disk for use and to decrypt the mek so the real disk can be read and written to . usually , the shadow disk software stores a hash of the kek so it can recognize if the user provides the correct kek . when the user enters the correct pass code ( either the kek itself , or a password or other authentication ) the shadow disk hashes that pass code or kek and compares the hash with the stored hash of the kek . if the two match , the mek is decrypted using the kek in what can be a symmetric or asymmetric encryption method , and puts the decrypted mek into the symmetric encryption - decryption circuit inside the drive ( without ever writing it to the magnetic or semiconductor medium ). usually , the bios is called from the disk to start again , but it now has the much larger real disk with a capacity in gigabytes rather than megabytes , and the operating system boots normally . every hard disk drive ( magnetic or semiconductor ) has an electrical interface to the computer or controller it is connected to . most computers connect hard drives through various i / o channels . every hard disk drive also has a set of commands that are generally executed by loading registers in the disk drive controller . in order to access the disk drive in order to sanitize it , the wipe hardware interface must electrically connect to the drive and be able to issue commands to the drive . fig1 shows details of a prior art self - encrypting disk drive . the electrical interface 1 connects to an external computer or to a special wipe system . the data path 2 passes through a symmetric encrypt / decrypt chip ( or circuit ) 3 . this chip performs the aes or other symmetric encryption algorithm . the plain text mek is usually stored in a hardware register 4 during disk use . an authentication interface 5 typically executes firmware ( or is hardware ) that creates and maintains the shadow disk , keeps a hash of the kek on the shadow disk , and requests and receives the kek or other correct authentication upon power - up . this interface 5 also keeps an encrypted version of the mek available for decrypting and use . the interface 5 also controls authentication for issuing special commands such as a reset - key ( cryptographic erase ) command . since , execution of this command generally renders all the data on the disk permanently unreadable , most systems require special , higher authentication in order to execute this command and other similar commands as opposed to simple read or write commands . in some systems , this command cannot be issued over the regular electrical interface . however , in most systems , commands of this sort can be issued by a higher authority than the user ( in some systems called a crypto officer or the like ). this is usually simply a user with a different password or a different kek that must be entered . authenticating under a lower authority user password only allows disk reads and writes and operational commands , while authenticating under the higher level password allows any operation including a key reset command . with almost all systems , there is no level of authority that can read out the plain text mek or even the encrypted mek . upon receipt of a reset - key command with the proper authentication , the interface 5 executes a special algorithm that generates a new , strong mek of the required 128 or 256 bits . this is typically done with a pseudo - random number generator or the like . this new key is first encrypted with the kek using the secondary encryption technique ( which may be identical to the first ), and the encrypted version of the mek is stored on the shadow disk . the generated plain text mek is than placed in the mek hardware register 4 . at this point , both the old mek and its encrypted copy are permanently gone on most systems . the disk is still functional for reading or writing ; however , any old data will not be readable . any new written data is encrypted with the new mek and can be read back with it . the process is almost transparent with the exception that all the old data is now just random bits . a wipe operation can now begin . however , with self - encrypting disks , there is no way to force the medium write to a particular wipe pattern since all writes are encrypted by the mek , and all meks are internally generated , strong keys . thus , the actual patterns being written into the medium will be different from any pre - specified patterns . also , each successive write of the same pattern ( say 0x55 at a byte level ) will become a different value as the encryption algorithm proceeds . thus , each sector written with the same pattern will be totally different from every other sector written with that pattern . fig2 shows a block diagram of an embodiment of the present invention . a user interface 6 allows the user to choose a particular operation such as reset key , wipe , reset key followed by wipe , wipe followed by reset key , or reset key followed by wipe followed by a second reset key . the user interface 6 may be remote from the actual disk drive being wiped 7 and may communicate over a network 8 such as the internet . it may be a smartphone or other wireless handheld device executing stored instructions from a wirelessly downloaded application . alternatively , it may be a remote terminal or personal computer ( pc ). thus , any remote computer with proper access can control the process . the wipe controller 9 , which can be a pc , server , other computer , microcontroller , or special hardware is attached directly to the disk drive electrical interface 10 . the wipe controller 9 sends the actual commands and write data to the disk or storage device interface 1 , and reads data back from the disk or storage device . upon connecting to the drive , the first task this controller 9 must accomplish is to authenticate itself to the drive controller interface 5 . the authentication must be at a level where a reset key command ( cryptographic erase or cryptographic reset ) can be issued . once authenticated , the wipe controller 9 sends either the reset key command to the drive , or begins to wipe it as the user wishes . if the particular wipe standard requires read back to verify that the original data has been wiped , that can also be performed . in this mode , a sector or other address is typically written followed by a read back . some standards do not require read back in order to run faster . also , some standards require that the entire wipe process be performed more than once ( in some cases , up to three times ). this can also be done . the wipe controller 9 can also verify that a key reset has indeed taken place before beginning the wipe operation . this can be easily done by writing a known pattern to a predetermined sector ( using the old mek ); issuing a key reset ; and then reading back that sector ( at that point under the new mek ). the result should be a collection of almost random bits and not the data that was written . this test also verifies that the encryption hardware is functioning , and that data is indeed being encrypted before being written . the remote terminal or user interface 6 ( which may be a cellular telephone ) typically runs a graphical user interface ( gui ) with menus and command selections known in the art . the remote terminal generally includes key data entry , a display screen which may be a touch screen and possible audio such as voice recognition and a speaker or earphones . fig3 shows a flow chart of an embodiment of the invention . first 11 , the user selects a mode of operation . the system next either resets the key 12 or begins a wipe operation 13 . if no key reset is desired by the user , the wipe operation begins immediately . if a key reset takes place , the wipe can begin next ( if so - selected by the user ). the wipe can repeat n times where n is an integer . after that , an optional verification phase 15 can be executed that ascertains to some required probability that the disk is clean , safe and ready to use . finally , a second key reset 14 can take place if desired . as a final step , optional formatting 16 can be put onto the disk . the user , rather than specifying each step , can alternatively select a particular standard or a particular canned or predetermined routine . the present invention provides a way to conveniently secure and wipe multiple disks using a local or remote interface . in particular , the system can be controlled from a remote location over a network . the symmetric key ( mek ) on a self - encrypting disk , magnetic or semiconductor storage device can be optionally reset before performing wipe operations . it can optionally be reset a second time after wipe operations for additional security . this renders even the wipe data inaccessible . the final result is one or more disks that can be optionally formatted and are ready and safe for use . several descriptions and illustrations have been provided to aid in understanding the present invention . one with skill in the art will realize that numerous changes and variations can be made without departing from the spirit of the invention . each of these changes and variations is within the scope of the present invention .	7
referring in more detail to the drawings , fig1 illustrates a fuel pump 10 having a bag shaped filter 12 connected to the fuel pump inlet 14 and defining an enclosure 16 into which fuel is drawn before being drawn into the fuel pump 10 to be delivered under pressure to an operating engine . a vapor inlet passage 18 is provided adjacent an upper wall 20 of the filter 12 and is preferably formed within a tubular inlet sleeve 22 telescopically received adjacent the fuel pump inlet 14 . the inlet sleeve 22 is preferably generally circumferentially continuous and extends axially downwardly from the upper wall 20 of the filter 12 such that fuel vapor and any large fuel vapor bubbles 24 adjacent the upper wall 20 of the filter 12 pass through the vapor inlet passage 18 before being drawn into the fuel pump 10 . the vapor inlet passage 18 is sized to break up large vapor bubbles 24 into a plurality of smaller vapor bubbles 26 which are more easily processed by the fuel pump 10 without operational problems such as vapor lock or significantly diminished fuel pump efficiency associated with the ingestion of large amounts of vapor at one time . the fuel pump 10 is preferably carried by a fuel pump module 30 disposed within a vehicle fuel tank 32 preferably with the fuel pump inlet 14 generally adjacent the lowest portion of the fuel tank 32 . preferably , a base portion 34 of the fuel pump module 30 rests on the lower fuel tank wall and has a plurality of openings 37 and 38 through which fuel is drawn by the fuel pump 10 into the module 30 from the fuel tank 32 . the fuel pump 10 may be either a positive displacement type pump such as the gear rotor pump disclosed in u . s . pat . no . 5 , 122 , 039 or a turbine vane fuel pump such as the pump disclosed in u . s . pat . no . 5 , 586 , 858 the disclosures of which are incorporated herein by reference and hence , the fuel pump will not be described in greater detail . preferably the fuel pump is capable of supplying the total fuel demand of the vehicle engine . the fuel pump module 30 may define a reserve fuel reservoir 40 having an outlet 42 selectively communicated with the fuel pump inlet 14 by a valve 44 yieldably biased by a spring 46 to bear on a valve seat 48 and prevent the flow of fuel from the reservoir 40 to the fuel pump inlet 14 . the valve 44 is displaceable from the valve seat 48 to allow fuel within the reservoir 40 to flow to the fuel pump inlet 14 when fuel is absent from the fuel pump inlet 14 such that the negative pressure created by the fuel pump 10 displaces the valve 44 and opens the outlet 42 . preferably , as shown in fig1 the valve 44 comprises a valve head 50 which projects through the outlet 42 to close it and a valve body 52 carried by the filter upper wall 20 and preferably embedment molded with or heat sealed to the filter 12 . the valve 44 is preferably carried in a flexible bellows - like portion 54 of the filter upper wall 20 which is displaceable to enable displacement of the valve 44 . excess fuel returned from the engine fuel rail is discharged into the reservoir 40 through the return pipe 56 . when the levels of fuel in the main tank 32 rises above the open upper end of the reservoir , such as during refueling of the tank , fuel from the tank also flows into and fills the reservoir 40 . preferably , a stand pipe 57 is disposed in the reservoir 40 communicating with the fuel pump inlet 14 through an opening 59 in the reservoir 40 and the filter 12 . when the level of fuel in the reservoir 40 reaches the open upper end of the stand pipe 57 , the return fuel in the reservoir 40 flows through the stand pipe 59 to be drawn into the fuel pump 10 . this prevents the return fuel , which has been heated upon passing through the fuel rail , from overflowing the reservoir 40 and being discharged into the colder fuel in the tank 32 which would generate a significant amount of fuel vapor . also , it is desirable to draw the return fuel into the pump 10 because the return fuel has already been filtered at least once upon originally passing through the filter 12 and into the pump 10 . the fuel filter 12 preferably comprises the upper wall 20 and a lower wall 60 each comprising an annular sheet of porous material joined together about their peripheries such as by a heat seal to define the enclosure 16 . as shown in fig2 and 3 , the inlet sleeve 22 is received through an opening 62 in the filter upper wall 20 and is integrally joined with the filter upper wall 20 preferably by a heat seal about the exterior of the inlet sleeve 22 . the vapor inlet passage 18 is preferably an axially extending slot formed through the side wall 64 of the inlet sleeve 22 within the enclosure 16 of the fuel filter 12 . the vapor inlet passage 18 provides a reduced area flow path from adjacent the filter upper wall 20 , through the inlet sleeve 22 and into the fuel pump 10 . the inlet sleeve 22 may have a plurality of depending feet 70 constructed to engage either the filter lower wall 60 or a spacer disk 72 adjacent the filter lower wall 60 . this maintains the filter upper wall 20 separate from the filter lower wall 60 at least adjacent the fuel pump inlet 14 even when fuel is absent adjacent the fuel pump inlet 14 and the capillary action of the liquid in the wet fuel filter 12 prevents the passage of air therethrough and the pressure drop created by the operating pump 10 tends to draw the filter lower wall 60 toward the filter upper wall 20 and the fuel pump inlet 14 . this permits the negative pressure created by the fuel pump 10 to be communicated with the valve 44 normally closing the outlet 42 of the reserve fuel reservoir 40 to displace and open the valve 44 and permit fuel in the reservoir 40 to flow to the fuel pump 10 . to achieve this liquid capillary seal , the filter walls have an average or nominal pore size of about between 20 microns to 40 microns . further , the gaps 74 between the feet 70 and the lower edge of the side wall 64 of the inlet sleeve 22 provide a flow path through which liquid fuel may freely enter the fuel pump inlet 14 after being drawn into the fuel filter enclosure 16 . optionally , as best seen in fig1 the filter lower wall 60 may have an annular perforate disk 80 integral therewith and engageable by either the spring 46 biasing the valve 44 or the feet 70 of the inlet sleeve 22 or both , to maintain the filter lower wall 60 separate from the filter upper wall 20 and thereby permit displacement and opening of the valve 44 adjacent the outlet 42 of the reserve fuel reservoir 40 . more than one vapor inlet passage 18 may be provided in the side wall 64 of the inlet sleeve 22 , with each passage or slot 18 circumferentially spaced about the side wall 64 . in another form , the vapor inlet passage 18 can comprise one or more small through holes in the side wall 64 of the inlet sleeve 22 and adjacent the filter upper wall 20 . in still another form , as shown in fig4 the vapor inlet passage 18 is formed directly in a portion of fuel pump inlet 14 &# 39 ; which extends into the fuel filter enclosure 16 with the filter upper wall 20 sealed about the exterior of the fuel pump inlet 14 &# 39 ; such as by a heat seal . in another embodiment , as shown in fig5 a fuel supply module 100 , such as may be used in a diesel fuel system has a supply tube 102 telescopically received in the inlet sleeve 22 having the vapor inlet passage 18 . a remote fuel pump draws fuel through the filter 12 , the inlet sleeve 22 and through the supply tube 102 to supply the diesel fuel to the vehicle engine . this embodiment is constructed and operates in substantially the same manner as the previous embodiment , with the exception that a fuel pump is not received in the module 100 , and hence , its operation and structure will not be further described . in use , fuel from the surrounding fuel tank 32 is drawn into the fuel pump module 30 and into the fuel filter enclosure 16 by the negative pressure created by the operating fuel pump 10 . as the fuel passes through the fuel filter 12 or is otherwise agitated , heated or subjected to changing temperatures or pressures , a portion of the fuel may vaporize . during use , some of the fuel vapor within the enclosure 16 forms bubbles in or separates from the liquid fuel and collects adjacent the filter upper wall 20 , ( the capillary action of the liquid in the wet filter prevents the fuel vapor from passing therethrough ) forming large vapor bubbles or a vapor dome . the inlet sleeve 22 or pump inlet 14 &# 39 ; which extends into the fuel filter enclosure 16 prevents these large vapor bubbles from being drawn directly into the fuel pump 10 and forces the large vapor bubbles to be drawn through the vapor inlet passage 18 . when drawn through the reduced flow area of the vapor inlet passage 18 the large fuel vapor bubbles are broken or divided into a plurality of smaller bubbles dispersed or entrained within the liquid fuel drawn into the fuel pump 10 to prevent an excessive amount of fuel vapor from being drawn into the fuel pump 10 at one time which would adversely affect the performance of the fuel pump 10 . in use pressurized fuel is supplied from the outlet of the pump 10 to the fuel rail and fuel injectors of a vehicle internal combustion engine and excess fuel is returned to the reservoir 40 through the return pipe 56 . under prolonged periods of engine idling or other low fuel demand conditions , sufficient excess fuel may be returned to the reservoir 40 to substantially completely fill it until the fuel level in the reservoir reaches the open upper end of the stand pipe 57 whereupon the return fuel flows through the stand pipe 57 and the filter 12 so that it may be drawn into the fuel pump 10 .	5
the present invention relates to pseudoscents of explosive materials , which are essentially scent simulants of an explosive that does not contain any explosive materials themselves . these pseudoscents will be particularly useful in the evaluation and training and of explosives detecting canines . the threat of terrorist activities towards us concerns at home and abroad , has made explosives detection a priority in effecting the protection of our infrastructure and citizenry . even with all the technology available for explosives detection , canines offer the advantage of being the least costly and most reliable explosives search - and - detect tool . when fully trained , a typical canine can search a car per minute and over 400 packages in half an hour . furthermore , unlike the point - detection ability of explosives detection instruments , canines can pick up a scent and track it to its source . known for their acute sense of smell , canines have been used to perform various forms of scent - based detection work , including search and rescue of missing or injured persons , narcotic and drug detection by the police and federal authorities , accelerant detection in possible arson incidences , and incendiary device detection for bomb threats . in a bomb threat situation , a trained explosives detecting dog ( edd ) will “ key ” ( i . e ., identify and / or detect ) onto explosive - specific scents , which , to a human , are seemingly indistinguishable from other scents present in the environment . however , even with such superb discriminatory capacity , explosives - detecting dogs ( edds ) miss a small - but - significant percentage of explosives during their search process . these failures are caused by a number of factors , the most pertinent being improper foundation training , the use of wrong aids in detector - dog training programs , and the lack of proper training aids . in order to decrease these failure rates , new and technically superior explosive scent simulants are needed . in these modern times , real explosives are still used in the production of explosive scent simulants . in a typical scent - simulant fabrication process , the energetic component of the explosive to be simulated is homogeneously dispersed within an inert matrix , in amounts that are “ too small to detonate ”. this method of explosive - scent simulant fabrication is based on the philosophy that the scent of an explosive must emanate from the energetic materials that constitute the bulk of the explosive , and nothing else — therefore , a petn - based explosive must smell like petn itself and tnt - based explosive must essentially smell of tnt . from this simple premise , which translates to “ what we see is what we smell ,” further deductions were advanced that canines must be keying onto the scent ( s ) of the energetic component ( s ) within an explosive during a search - and - detect exercise ; and that a detection creature must therefore be trained on the pure scent of the material that it is required to detect , for it to successfully search - and detect that material . the present invention underpins the fact that in humans , their genre , and in a host of other creatures , what is seen is not necessarily what is smelt . in the first instance , just as different creatures see the same object with different degrees of resolution — since their vision is limited to species - dependent wavelengths — so is the sense of smell . therefore creatures also smell the same object with different resolutions . however , and more importantly , whatever it is that any creature smells must have the prime requirement of being volatile enough to be able to exude from what the creature sees , and its concentration within the scent signature of what they see must be equal or greater than the creature &# 39 ; s olfactory threshold for that particular scent . the olfactory threshold can be defined as the lowest olfactory stimulus intensity a creature can detect . due to differences in conformations olfactory organs and density of olfactory cells , it is also expected that the olfactory threshold for a particular scent will differ from creature to creature . in most instances , non - energetic components of an explosive are more volatile than the energetic components that make up the bulk of the explosive . the higher volatility of the non - energetic components means that they will be of a higher concentration within the headspace scent signature of the explosive . in fact , the differences in volatility is such that the concentration of non - energetic components within the headspace scent signature of an explosive can be over two hundred times greater than the concentration of energetic components , even though the non - energetic components normally constitute no greater than five percent of the bulk of the explosive . the highly volatile nature of non - energetic components means that they will be ever - present within the scent signature of explosives and this makes them better odoriferous markers for an explosives detection program based on olfaction , as they will be easier to detect by olfactory receptors involved in the sense of smell , which involves vapor sampling . furthermore , engaging these non - energetic scents as training aids within the training regimen of , for example , explosives detecting canines will greatly improve their success rate in detecting explosives . as a further example , energetic materials such as pentaerythritol tetranitrate ( petn ), cyclotrimethylenetrinitramine / 1 , 3 , 5 - hexahydro - 1 , 3 , 5 - trinitrotriazine ( rdx ), octahydro - 1 , 3 , 5 , 7 - tetranitro - 1 , 3 , 5 , 7 - tetrazocine ( hmx ), nitrocellulose ( nc ), tetryl , trinitrotoluene ( tnt ), and inorganic energetic materials such as ammonium nitrate ( an ) have very low vapor pressures . due to their low vapor pressures , the scents of these and most other commonly used energetic materials , cannot significantly contribute to the headspace scent signatures of the explosive material they constitute ; consequently , explosives - detecting canines ( and analytical instruments ) that are trained to detect just the energetic component ( s ) of an explosive will be consistently pushed to the limits of their sensitivity and their performance will be difficult to enhance or optimize . moreover , when combined with other materials such as polymeric binders , plasticizers and waxes , the actual concentration ( and final ratios ) of these energetic materials within the headspace scent signature of an explosive material diminishes , and may change from one explosive type to another — even if the energetic component within the explosive is the same type and quantity . as for the scent of an explosive when it is dispersed , a dispersant containing a 20 % weight amount of tnt will exhibit a scent signature that differs from a block of pure tnt explosive as it will lack those odoriferous components of the scent signature necessary to formulate an effective scent simulant or training aid for , for example , an explosive detecting dog ( edd ) program . one of the reasons for this that the amounts of highly volatile , non - energetic components , which normally constitute less than 5 % of the bulk of an explosive , will be less than 1 % within a dispersant that contains 20 % of the explosive . since these non - energetic components also have high evaporation rates , they will evaporate off the dispersant sooner than the less - volatile components , thereby leaving the wrong components for dogs to identify with as key odoriferous markers during explosive - detection training programs . moreover , a 20 % weight amount of highly dispersed tnt will degrade much faster than a block of pure tnt , due to accelerated degradation caused by high surface area provided by the dispersant . this high surface area will also accelerate degradation pathways atypical of pure tnt and lead to the production of decomposition products typically absent ( or present in low concentrations ) within the scent signature of a block of pure tnt explosive . also , using solvents to effectively disperse explosives within dispersing matrices during the formulation of an explosive - dispersed simulant could result in a significant amount of such solvent ( s ) trapped within the interstices of the dispersant . these matrix - trapped solvent molecules , in concert with the high surface area provided by the dispersant , can promote reactions , which are typically thermodynamically - unfavorable , with the explosive within the matrices , further leading to the formation of atypical volatile degradation products that might further taint the scent signature . all - in - all , the combination of odors from solvent , reaction processes and decomposition products result in a headspace scent signature that substantially differs from that of a pure block of tnt explosive . this will diminish the precision through which a trainer can condition a dog , or any other creature , to identify with and thereafter detect , the real odoriferous markers of an archetypical tnt - based explosive . predictably scent simulants made by the simple dispersion of small amounts of explosive materials within inert dispersive matrices have produced a low level of detection by edd &# 39 ; s when used within training and evaluation programs . it is evident that that the negligible contribution of energetic materials towards the headspace scent signature of the explosive they constitute justifies a need for modification of the philosophy ( ies ) involved in selecting components for the fabrication of explosive scent simulants and on how canines and analytical instrumentation should be “ trained ” to detect explosives . scent simulants and pseudoscents that are fabricated for research and developmental work in explosives detection will be more effective if their formulations embrace both the de - facto constituents of the headspace scent of the explosive material and , in the case of edd training , addresses the olfactory competence of the explosives detecting canine , and not of the energetic components within an explosive . such considerations will result in the formulation of simulants that can actually be used to develop , sharpen , and / or evaluate the abilities of edds and increase the detection rate of analytical instruments . the present invention therefore relates to a method suitable for fabricating pseudoscents of explosive materials which , albeit precluding any explosive material , contain the necessary odoriferous markers that characterizes a particular explosive . this method involves the process of reconstituting the experimentally determined headspace scent signature of an explosive into a formulation that retains all non - energetic components within such a signature and substitutes the energetic components within the scent signature with “ de - energized but odoriferously equivalent ” components . unlike the principles currently used in the manufacture of non - detonable explosive scent simulants , the foundation of this invention hinges on the supposition that the physico - chemical composition of an explosive material is of minor significance in the fabrication of an explosive simulant for the training and evaluation of explosive - detecting creature ; what is more important is its scent — which can be determined by the analytical identification of the headspace scent signature of these explosive materials — as this is essentially what the diversity of explosive detecting creatures such as dogs , rodents and bees detect . the present invention also relates to compositions of energetically - inert pseudoscents of explosives that contain no energetic components whatsoever but are identical to the scents of materials that are designated as explosives by the us bureau of alcohol tobacco and firearms . such materials include tnt , petn , rdx , nitroglycerin , black powder , triperoxide -, azide -, inorganic nitrates , and nitrocellulose - based explosives . these pseudoscents have no direct physical or chemical equivalence to the explosives that they simulate ; they are solely of odoriferous equivalence . also , since they are non - energetic , none of the pseudoscent formulations produced by the present method can be classified as an explosive material and the pseudoscents can be stored and transported using methods and forms , which , as explosives , would be hazardous or impossible . the pseudoscents produced by this method are also suitable for the training of edds and , when applicable , the calibration of analytical instrumentation that relies on the principle of vapor sampling to detect detonable materials . using these compositions with an appropriate training regime will allow explosive detecting dogs to achieve efficiencies that are far superior to analytical instruments . by adjusting the types and ratios of components within the pseudoscent , it is also possible to further tune the pseudoscent to duplicate the scent of varying amounts of the explosive it simulates . the compositions may also be used to train other creatures , for example , bees , rodents and wasps . the invention can be used to make formulates of energetically - inert pseudoscents of explosives , using the method schematically illustrated in fig1 . the method process starts with the identification of the components within the headspace scent signature . table 1 shows some high explosives types and primary energetic components within the explosive . as shown in table 1 , most explosives are formed by combining two or more energetic components . however , it is possible to utilize the non - energetic and / or de - energized scent of one of such energetic components in the fabrication of a pseudoscent for an explosive . for example , rdx is an energetic compound that is common within many kinds of explosives . since it is scientifically possible to indirectly train an explosive detecting creature to detect a multitude of explosives by simply training the creature to detect a single component ( energetic or non - energetic ) that is common to all the explosives to be detected , an animal trained on detecting an rdx pseudoscent will be capable of detecting all explosive types that contain rdx as an energetic component . table 2 shows the interrelationships between a simulated explosive , its energetically - inert pseudoscent formulation and the scope of detection of the pseudoscent , if used as an explosives - detection training aid . as shown in table 2 , such an explosive detection capacity will be far ranging as an animal trained on an rdx pseudoscent will be able to detect a multitude of explosives such as composition c - 2 , composition c - 4 , composition a - 3 , cyclotol , detonation cord , composition b , and semtex . using the fig1 to further explain the art , explosive 50 is subjected to a gas separation and identification technique such as gas chromatography ( gc ), to identify all components in its headspace scent . non - energetic and energetic components are essentially organic compounds , which are substances with defined chemical compositions . the unique properties that each composition has , for example , their volatility polarity , or the presence of certain functional groups , sets the basis for their separation and identification using any of the methods available for the separation and characterization of gases . after the separation and characterization of the gaseous components derived from headspace scent analysis , identified components will then be categorized into two groups : those that are non - energetic components 51 and those that are energetic components 52 . due to their non - energetic nature , the components constituting 51 are not classified as explosives ; therefore , they can be directly used , singly or in combinations , in the formulation of energetically - inert single - or multicomponent pseudoscents 53 . their use within a formulation is achieved by simply dispersing weight amounts of one , some , or all of the component ( s ) into an inert support matrix , and in concentrations that are low but still above the olfactory thresholds accorded to the creature for which the pseudoscent is intended . since this method of formulation is straightforward and direct , it is referred to as a distinct formulation . it is not necessary that all the scientifically determined non - energetic components of the headspace scent signature be used within a formulation . in fact , different formulations can be made by using different ratios any , some , or all , of 51 . due to their energetic nature and tendency to be officially classified as explosives , the energetic components 52 have to be converted to their de - energized , smell - alike derivatives 54 before being converted into a pseudoscent formulation . these energetic components are , in fact , organic compounds with enough energy harnessed within their molecular structure to cause an explosion . in most cases , the energy is present within functional groups grafted within or along a molecular framework that can be referred to as the parent structure or structural backbone . a unit of such an energetic organic compound is a molecule whose fundamental atoms are held together through covalent bonds . covalent bonding is a type of bonding prevalent within fundamental atoms such as carbon , hydrogen , oxygen , nitrogen and phosphorous , in which electrons need to be shared in order to form a bond between two or more of such atoms . depending of the nature of electron sharing , such a bond can be considered saturated or unsaturated . organic compounds can be further divided into aromatic , aliphatic and closed ring ( cyclic ) compounds . an aromatic organic compound is any mono - or polycyclic compound that is planar in geometry , and which also has 4n + 2 pi electrons within its cyclic system , where n = any integer beginning with the integer zero . non - limiting examples of energetic materials with monocyclic aromatic structural backbones are tnt , picric acid and diazodinitrophenol . examples of those with polyaromatic structural backbones are nitronaphthalene and trinitrofluorenone . an aliphatic organic compound is a compound of a straight - chained or branched geometry whose fundamental atoms are connected through saturated or unsaturated covalent bonds . non - limiting examples of energetic materials with aliphatic structural backbones are nitromethane , nitroglycerin , dinitropropylacrylate , and ethylene glycol dinitrate . a closed ring organic compound is an organic compound that has a closed - ring structure but is not aromatic in character , which means that it does not have the requirement of 4 ( n )+ 2 pi electrons , or the requirement of a planar geometry . the compound may consist of one or many rings that may be fused or connected through bonds . the bonds within a cyclic organic compound may also be saturated or unsaturated . non - limiting examples of energetic materials with closed ring structural backbones are nitrocyclopropane , triacetone triperoxide and cyclotetramethylene tetranitramine ( hmx ). in some instances , metal atoms are incorporated into the structure of organic compounds , to form what are known as organomettalic materials . non - limiting examples of energetic organometallic materials include copper acetylide , lead styphnate and sodium azide . the process of de - energizing an energetic component of the headspace scent signature while retaining odor characteristics of the component can be achieved , at a molecular level , through three main mechanisms . the first is simply by successively removing the energetic functional groups within the structure of the molecule until the molecule becomes non - explosive in character . this type of removal entails the replacement of such an energetic group with a hydrogen atom . a second method is through the systematic replacement of some to all of the energetic functional groups within the molecular structure of the energetic material with non - energetic functional groups that share similar electron withdrawing or donating properties with that particular energetic group , until the molecule becomes non - explosive in character . the nitro group , is the most common energy imparting functional group within the molecular structure of energetic materials . the inherent energy contained within the nitro group is reflected in the fact that when there are three or more of these groups on a benzene ring , as in the case of tnt , the molecule becomes explosive in character . it is advanced that any of the nitro groups within the molecular structure of any energetic compound that constitutes the headspace signature can be replaced with non - energetic groups with similar electron withdrawing properties , to form a compound that has lost the intrinsic explosive power of the parent compound but retains the odor characteristics . groups with electron withdrawing properties that can be used as replacement groups for the nitro group are the cyano , acetyl , halogen , or aldehyde functional groups , and their combinations . the relationship between these groups and the nitro group is that they all have electron withdrawing , aromatic - ring deactivating electronic properties . however , they do not have the energetic characteristic of the nitro group . thus , using tnt as a more specific example , an energetic compound that has three energetic nitro groups within its molecular structure , the complete removal of one nitro group and the replacement of a second one with a chlorine atom ( chlorine belongs to the halogen family of functional groups and is electronegative in character ) results in a de - energized derivative , 2 - chloro , 4 - nitro toluene , that is non - explosive in character but still retains the odor characteristics of tnt . even the complete removal of two nitro groups from the molecular structure of tnt , and the substitution of the third nitro group with the electronically similar ( i . e ., electron withdrawing ) aldehyde group results in a de - energized derivative ( benzaldehyde ) that still has the odor characteristics of tnt . this method becomes more significant when one encounters a headspace scent signature comprised solely of energetic components , because a de - energized derivative will then be necessary for any formulation to be made . dynamite presents such a headspace scent signature . headspace analysis of dynamite shows that the headspace scent signature of dynamite consists solely of ethylene glycol dinitrate and nitroglycerin , both of which are very energetic materials . using the present method , a variety of de - energized derivatives can be made from these energetic components by simply replacing the energetic functional groups within their molecular structure with non - energetic functional groups that have similar electron donating or withdrawing affinities . examples of de - energized pseudoscents that can be derived from ethylene glycol dinitrate are ethylene glycol carboxaldehyde ( replacement of the all the nitro groups within the molecular structure with aldehyde groups ), ethylene glycol diacetate ( replacement of all the nitro groups within the molecular structure with the acetate groups ), while those for nitroglycerin are glycerin acetate ( replacement of all the nitro groups within the molecular structure with the acetate groups ) and glycerin carboxaldehyde ( replacement of the all the nitro groups within the molecular structure with aldehyde groups ). these four de - energized derivatives can be used singly or in all combinations and ratios , within a pseudoscent formulation for the dynamite explosive . a third method of de - energizing an energetic component of the headspace scent signature while retaining odor characteristics of such a component is through the substitution of the structural framework of such energetic component with a higher homologue , or homologues , which harness electronic properties similar to the parent molecule . through such substitution of a smaller structural framework with a larger or a differently - configured one , the explosive potential of the energetic components can be diluted to the extent that it looses its explosive character , since the ratio of the energetic functional groups to the whole molecule , or its ability to coordinate into an explosive entity , decreases . this method may be utilized with or without additional removals of the energetic functional group . thus for the low flash point , energetic material nitromethane ( boiling point 101 ° c . ), which has an one - carbon aliphatic structural framework , a higher homologue nitroparaffin such as nitrohexane ( boiling point 180 ° c . ), which has a six - carbon aliphatic structural framework , can be used as a pseudoscent , with no change in odor . similarly , the explosive power of energetic nitroarenes can be diluted though the substitution of the parent aromatic ring that constitutes the framework , with other single or fused ring systems , or by a conjugated aliphatic system , or their combinations , while removing as many energetic functional groups as necessary to make the compound non - energetic in character . for example , tnt can be de - energized by replacing the cyclic - and - aromatic benzene structural backbone with the linear - and - conjugated hexatriene moiety , with no change in the scent of the parent tnt explosive . as in the formulation consisting of non - energetic components , all or any of the de - energized equivalents of energetic materials within the scent signature depicted by 54 can be dispersed in low concentrations within a matrix , to form de - energized pseudoscent 55 . since the formulation produced by this method contains derivatives of the energetic components of the headspace scent signature and not the actual energetic components themselves , it is considered indirect , and therefore referred to as a distinct type of formulation . optionally , a composite pseudoscent formulation comprising of both non - energetic and de - energized components of the headspace vapor , and as embodied in 60 , can be formed through the combination of the non - dispersed components 51 and 54 or the combination of the matrix - dispersed components 53 and 55 . composite formulations such as 60 are also distinct formulations and can be useful in introducing components that will impart additional characteristics to a pseudoscent , such as to ascribe a specific weight range or a specific brand to the explosive to be detected . thus , in one embodiment , the energetically - inert pseudoscent can include non - energetic components identified within the headspace scent signature of the explosive , as a distinct formulation . suitable examples of non - energetic components of the analyzed headspace scent signature of rdx - based explosives , that are suitable for formulation into a pseudoscent , include cyclohexanone , ethyl acetate , 2 , 3 - dimethyl - 2 , 3 - dinitrobutane ( dmdnb ), 2 - ethyl - hexan - 1 - ol , carene , 1 - methylbutanoate , and mixtures thereof . for petn based explosives , the non - energetic components of the headspace scent suitable for formulation into a pseudoscent can include xylene , styrene , 2 - ethyl - 1 - hexanol , and decane , 2 , 3 - dimethyldinitrobutane and mixtures thereof . for nitrocellulose - based explosives , the non - energetic components of the headspace scent suitable for formulation into a pseudoscent can include limonene , toluene , acetone , ethyl acetate , and mixtures thereof . in another embodiment , the energetically - inert pseudoscent can include de - energized odoriferously identical equivalents 54 of the explosive , as a distinct formulation . these equivalents 54 are essentially analogues of explosive 50 that have undergone structural modification at a molecular level through either ( a ) a successive removal of their energetic functional groups until the molecule is rendered non - explosive in character ( b ) supplanting the structural backbone of the energetic molecule with a homologue that has a higher molecular weight , in an attempt to dilute or nullify the explosive effects of the energetic functional groups , and / or by ( c ) replacing the energetic functional group ( s ) within the molecular structure of an energetic molecule with a non - energetic functional group ( s ) that has similar electron donating or withdrawing properties . it is disclosed that these techniques will essentially render the molecule non - explosive while retaining the odor characteristics of the parent molecule . in another embodiment the energetically - inert pseudoscent can include combinations of both energized and de - energized components of the headspace scent signature of an explosive , as a distinct composite formulation . the formation of the pseudoscent is itself achieved by simply dispersing , at low concentration , amounts of the non - energetic and / or de - energized component ( s ) of the scent signature of an explosive material , as deduced from headspace analysis of the explosive material , within an inert matrix . as illustrated in table 2 , it is not necessary that all the scientifically determined non - energetic or de - energized components of the headspace scent signature be used within a first , second or composite formulation . preferably any of the components within a headspace scent signature that has a concentration that falls within the minimum and maximum olfactory thresholds of the explosive detecting creature can be used within the formulation . those components with lower vapor pressures can be particularly useful in the formulation of pseudoscents that will aid in the detection of equivalents of large amounts of explosives . this is because , in large amounts of explosives , the emanation of components of higher vapor pressures is so rapid that they can completely saturate a room , thereby eliminating the availability of an odor concentration gradient and resulting in the inability of the canine to trace the odor to its source . being exposed to an area saturated with the odor for prolonged periods may also result in ( a reversible ) desensitization towards such odor components during a search process . so , the low vapor pressure components within the explosive scent signature will be more appropriate to be used as a training aid in this instance . conversely , components within the headspace signature with higher vapor pressure can be particularly used in the formulation of pseudoscents that will aid in the detection of small amounts of explosives . this is due to the fact that , when small amounts of explosives are used , the headspace scent signature is dominated by the components with high vapor pressure , and these will be suitable as target scents within a training program . the matrix used for the pseudoscent formulation may be solid , liquid or gaseous \. an example of a gaseous matrix is an aerosol . another example is a non - reactive porous support that allows for a controlled or slow release of the components within the pseudoscents . depending on the characteristics of the explosive scent simulant , crosslinked synthetic polymer ( e . g . silica , cellulose ), gels , emulsions , hydrogels , fillers ( diatomaceous earth , clay , grain husks , saw - dust , porous beads , grain husks , natural fibers ), bio - organic polymers , for example , may be used a dispersant matrices . the microstructure of the matrices may be such that it is amorphous or defined . examples of matrix morphologies include spray dried power , a sphere ( e . g . balls , pebbles , microspheres or a pellet ). the matrix can also include other polymers , buffers , salts , or fillers . the pseudoscent formulants may also be adsorbed onto an inert matrix that has intestacies or pores with diameters that are greater than the longitudinal cross - section of the smallest odoriferous substance within the formulation . such a matrix enables adsorption of the explosive scent simulant within the pores rather than the surface , and their slow release from the confines of the interstices , rather than their evaporation off the absorbent , thus decreasing accelerated decomposition due to surface - area catalysis . the pseudoscent formulation can include a binder . such a binder can include a polymer or a compound that has a molecular weight of ≧ 320 atomic mass units . the preferable solvent to aid in the binding can be selected through using the following hierarchy : the lowest boiling liquid within the formulation as derived from the constituents of the headspace , water , or an organic solvent with a boiling point ≦ 75 ° c . at normal atmospheric pressure . the pseudoscent components , solvent , and the polymer are blended together and the solvent is thereafter evaporated under vacuum . such methods can be applied towards the formulation of pseudoscents for a variety of energetic materials such as nitromethane ; 5 - nitro triazol - 3 - one ( nto ); trinitrotoluene ( tnt ); trinitro triamino benzene ( tatb ); 3 , 5 - dinitro - 2 , 6 - bis - picrylamino pyridine ( pyx ); methyl nitrate ; nitroglycerine ( ng ); ethylene glycol dinitrate ( egdn ); diethylene glycol dinitrate ( degdn ); 2 , 2 - bis [( nitroxy ) methyl ]- 1 , 3 - propanediol dinitrate ( or pentaeritol tetranitrate ) ( petn ); nitrocellulose ; trimethylol ethyl trinitrate ( tmetn ); tetryl ; hexahydro - 1 , 3 , 5 - trinitro - 1 , 3 , 5 - triazine ( rdx ); methylamine nitrate ; octahydro - 1 , 3 , 5 , 7 - tetranitro - 1 , 3 , 5 , 7 - tetrazocine ( hmx ); nitroguanidine ; ammonium nitrate ; ammonium perchlorate ; urea nitrate ; ammonium picrate ; lead azide ; lead styphnate ; mercury fulminate and other fulminates . suitable explosives can be time blasting fuse , detonating cord , trinitrotoluene ( tnt ), dynamite , composition b , tagged and untagged composition c4 , ammonium nitrate , water gel explosive , emulsion blasting agent , smokeless powder and semtex . pseudoscent compositions can include a plurality of non - energetic components of the headspace scent signature of explosives , and / or “ de - energized but odoriferously identical ” equivalents of the energetic components of the headspace scent signature of explosives . the composition is free of explosives . a method of evaluating the efficacy of formulated pseudoscents , also referred to as a scent validation process , is advanced which comprises exposing a candidate pseudoscent to a creature , that has already been trained in explosive detection using real explosives as a training aid , such as an explosives - detecting dog . the response of the creature will determine if it can discriminate the scent of the pseudo from the scent of a real explosive , and this in turn will determine if the candidate pseudoscent is suitable as an explosive training aid for such a creature . an ability to discriminate between both scents will mean that the pseudoscent has a scent that is different from the explosive , which will deem it unsuitable for use as an explosive training an / or evaluation aid . if the response given is not different from that which the creature gives in response to the presence of a real explosive material , then the pseudoscent can be deemed suitable for use as a training aid . this method of evaluation is used in all examples 3 to 10 , where dogs were used to evaluate the suitability of non - energetic components and de - energized derivatives of the headspace scent signature of explosives as simulating the scent of actual explosives . method for producing a training aid for training and evaluation of creatures in explosives detection a method for producing a training aid for training is broadly contemplated including , de - energizing the energetic components of the headspace scent signature of an explosive ; combining the de - energized components into a first formulation ; combining non - energetic components of a headspace scent signature as a second formulation ; and optionally admixing the first and second formulation into a composite formulation , wherein the training aid is substantially free of explosive . a method for producing an energetically - inert pseudoscent for explosives is broadly contemplated including a ) identifying components comprising a headspace scent signature of an explosive ; b ) separating such components into energetic and non - energetic components ; c ) admixing non - energetic components of the headspace scent signature ; d ) de - energizing the energetic components of the headspace scent signature , and ; e ) combining the de - energized odoriferous equivalents of the energetic components of the headspace scent signature , or ( f ) optionally admixing them with the non - explosive components into a formulation , wherein the explosive scent simulant is free of explosives . the invention disclosed herein is exemplified by the following preparations and examples , which should not be construed to limit the scope of the disclosure . alternative preparations and analogous structures may be apparent to those skilled in the art . method of identifying the potential components of a pseudoscent , and subsequent pseudoscent formulation the first stage of identifying the potential candidates for an explosive pseudoscent is to subject the explosive to an analytical method that identifies the components of the headspace scent signature of the explosive . a typical procedure of achieving this through the use of gas chromatography ( gc ), where the explosive of interest is placed in a flask fitted with a serum cap and allow time for its scent to equilibrate with the air inside the flask . a sample of the scent is then removed from the flask by drawing the air within the flask , into a column that contains an absorbent , using a syringe . after concentrating the scent onto the column , this scent is then desorbed from the adsorbent by heating the column . the desorbed scent travels into the gc column where its components are separated and each of the separated components of the scent are identified . this identification process is based on the different retention times of the scent components due to their polarity or mass , and is typically an automated search against a compiled database of compounds with analyzed retention times . once the components are known , they are categorized into energetic and non - energetic . the non - energetic components can be directly used to formulate a pseudoscent , after the scent validation process . the energetic components of the headspace vapor will need to be de - energized and then the de - energized derivatives are subjected to a scent validation process before being used within a pseudoscent formulation . in some instances , the headspace scent signature , when determined by gc , shows the presence of only energetic components within the headspace , as in the case of the dynamite explosive . in this case , de - energizing the energetic components has to take place in order to derive any pseudoscent components for scent validation and pseudoscent formation . it is not necessary that all the scientifically determined non - energetic and de - energized components be used within a formulation . typically , those component scents with vapor pressures that are sufficiently high enough to allow their presence at headspace concentrations that are above the olfactory threshold limits of a dog , or any other creature used for detection , can be used . pseudoscents can be formulated to produce a scent profile of components in the same ratio as they are within the headspace of the explosive . such ratios can be determined using gc methods . pseudoscent formulation is achieved by simply dispersing the chosen non - energetic and de - energized components within an inert matrix , separately , or as a composite formulation , and in concentrations that will not allow the odor of the pseudoscent to be non effective or overwhelming during its use . for testing the suitability of non - energetic or de - energized components as a potentially useful pseudoscent , a canine search - and - detect methodology has been developed that embraces the best practices in scent detection . the setup comprised of a 7 × 9 ( 63 - position ), or 6 × 6 ( 36 - position ) grid of cardboard boxes , of 1 ft 3 in volume and spaced at least 4 ft apart , each of which has a 5 in diameter opening cut out of the topside to allow easy sniffing of the box by canines . non - energetic components , as determined from headspace analysis of the explosive , were dispersed within inert matrices , put in jars and then randomly placed into each box , through the opening . so were the de - energized equivalents of some energetic components identified within the headspace . also randomly placed within the test grid were real explosives such as ammonium nitrate , smokeless powder and c4 explosives . these are to be used to benchmark the ability of the dogs in detecting real explosives under the same conditions as the candidate scents . distracters such as food and toys were also planted in some boxes within the grid to help ascertain the propensity of the dogs in disregarding these objects . each test session was configured in a way that within each test session , there were more non - targets ( empty boxes ) than targets ( occupied boxes ), at least an empty box between two targets , and no more than eight candidate pseudoscents were placed within a test grid per trial session . after the samples are placed and their placement noted , a period of at least 10 minutes was allowed for the vapors of the sample to diffuse in to the box . the maximum and minimum concentration of headspace vapor that can be achieved within a box are controlled through the formulation process witch takes into consideration the vapor pressure and mass ratio of the formulation component ( s ), prevailing temperatures and the scent generation rate . the longevity of scent can also be determined if the evaporation rate ( s ) of the formulation component ( s ) is known . after the standing period dog / handler teams were successively allowed into the grid to commence a search for explosives hidden within the grid . at least four dog / handler teams were used during each test . all dogs used in the test process were certified , experienced explosive detecting dogs and none of the dog / handler teams knew in which boxes the candidate scents , real explosives or distracters were placed . as a team enters the grid , the handler systematically guides the canines around the grid while the canine sniffs around the perimeter and through the opening on the top side of each box , seeking for explosives that it has been trained to find . this process validates a candidate scent as being an explosive scent simulant . a candidate scent is positively validated as a potential explosive - scent simulant when the same edd assuredly and consistently sits next to the box within which it is contained , as this means that the dog supposes that the scent emanating from the box is that of an explosive . such assuredness , if consistently displayed by experienced edds mean that the material within the box being validated has a scent that is so similar to that of an explosive that it cannot be differentiated from a real explosive by an edd . when a candidate non - energetic , de - energized or composite pseudoscent is positively validated , it can then be used within an explosives detection program as a general training aid to train the edd instead of the explosive the pseudoscent represents . it can also be used as a specialty training aid to hone edds onto more precise components of an odor during explosives detection . to date , it is not known what components of an explosive scent edds use in its detection process . after the end of a test run in which all dog / handler teams had each undergone a complete run of the grid , the dog / handler pairing is shuffled , and the whole process was repeated a second time . this , if achievable , helps to check for consistency of data and false dog alerts and highlight those inferences that might be due to dog / handler familiarity - or - unfamiliarity and further help in the development of novel edd training programs . after each test session using different dogs and dog / handler combinations , both the simulants and the sniffing boxes confining them were removed from the test site perimeter . the vacated spots are then replaced by new boxes , which are to be left unused for at least a 24 - hour period . this ensures that the used grid - positions are aired for periods long enough to allow for scent - dissipation if grid contamination had occurred and also that the position of scents were changed after each trial period . referring to fig1 , using gc for headspace characterization , the headspace scent signature of dynamite explosive was found to contain ethylene glycol dinitrate and trinitroglycerine as the primary components . since both components were energetic materials as defined by 52 , they needed to be de - energized before being used within a pseudoscent formulation . thus , with the intention of forming a single - component pseudoscent for dynamite , the nitro groups within the molecular structure of trinitroglycerine were replaced with the acetate functional group , forming glycerol triacetate . the acetate group has similar electron withdrawing properties as the nitro group , and is therefore deemed odoriferously equivalent . a pseudoscent of dynamite of the type represented by 55 was then formed by dispersing 5 . 40 g ( 100 %, active ingredient ), glycerol triacetate in 10 g of diatomaceous earth to produce a training aid with a headspace scent signature of 3 . 3 ppm glycerol triacetate within the 1 ft 3 box . this pseudoscent was then subjected to validation using scent validity tests previously described , in order to ascertain its usability as an explosive training aid . using a search and detect technique , five out of five canines used in this study successfully detected this scent by showing behavioral cues normally associated with finding an explosive material . after the scent validation process , the simulant was subjected to canine explosive detection tests , using united states navy canine / handler teams trained at lackland air force base in san antonio , tex . six out of six canines used in this study successfully detected this scent by showing behavioral cues normally associated with finding an explosive material , which was sitting down next to the box in a fashion edds are taught to indicate when they liken a scent to that of an explosive scent that they had been trained to detect . note that none of the components used in this formulation is classified by dot as an explosive . using gc analytical techniques , the headspace scent signature of dynamite explosive was determined to contain ethylene glycol dinitrate and nitroglycerine as its primary components . since both components of the headspace signature were explosive materials , they cannot be used within the formation of an explosive scent simulant . so , nitroglycerin and ethylene glycol dinitrate were individually de - energized through the complete removal of their energetic nitro pendant groups and their substitution with “ non - energetic but “ odoriferously identical ” acetate groups to form de - energized equivalents 54 . a binary pseudoscent of type 55 was formulated by combining 5 . 02 g ethylene glycol diacetate ( 57 . 6 % wrt glycerol monoacetate ) and 2 . 41 g glycerol monoacetate ( 32 . 4 % wrt ethylene glycol diacetate ) in 10 g of rice husks to produce a 17 . 43 g training aid with a headspace scent signature of 67 ppm ethylene glycol diacetate and 2 ppm glycerol monoacetate within the box in which it was placed . the explosive scent simulant was subjected to scent validation tests , using the scent validation grid previously described . during the test , five out of five canines used in this study successfully detected this scent with behavioral cues normally associated with finding an explosive material . after the scent validation process , the simulant was subjected to canine explosive detection tests , using united states navy canine / handler teams trained at lackland air force base in san antonio , tex . six out of six canines used in this study successfully detected this scent by showing behavioral cues normally associated with finding an explosive material , which was sitting down next to the box in a fashion edds are taught to indicate when they liken a scent to that of an explosive scent that they had been trained to detect . note that none of the components used in this formulation is classified by dot as an explosive . referring to the energetic components available within the headspace scent signature of dynamite and the variety of de - energized equivalents that can be derived from them ( 54 ), a pseudoscent was formulated by combining 0 . 23 g ethylene glycol diacetate ( 4 % wrt glycerol triacetate ) and 5 . 56 g glycerol triacetate ( 96 % wrt ethylene glycol diacetate ) in 10 g of rice husks to produce a 15 . 8 g training aid that produces a headspace scent signature of approximately 6 ppm ethylene glycol diacetate and 3 ppm glycerol triacetate within the 1 ft 3 box within it was placed . the explosive scent simulant was subjected to scent validation tests , using the scent validation grid previously described , during the test , five out of five canines used in this study successfully detected this scent with behavioral cues normally associated with finding an explosive material . after the scent validation process , the simulant was subjected to canine explosive detection tests , using united states navy canine / handler teams trained at lackland air force base in san antonio , tex . six out of six canines used in this study successfully detected this scent by showing behavioral cues normally associated with finding an explosive material , which was sitting down next to the box in a fashion edds are taught to indicate when they liken a scent to that of an explosive scent that they had been trained to detect . note that none of the components used in this formulation is classified by dot as an explosive . referring to fig1 , using gc analytical methods , the headspace scent signature of military - grade c4 explosive was determined to contain , amongst other components , cyclohexanone , ethyl acetate , 2 , 3 - dimethyl - 2 , 3 - dinitrobutane ( dmdnb ), 2 - ethyl - hexan - 1 - ol , carene and 1 methylbutanoate . since none of these components are energetic materials , they can all be used , either individually or in combinations , within a pseudoscent formulation . accordingly , from the variety of non - energetic component combinations available , a binary - component pseudoscent containing 0 . 41 g of cyclohexanone ( 8 % weight wrt 2 - ethyl - 1 - hexanol ) and 4 . 6 g of 2 - ethyl - 1 - hexanol ( 92 % weight wrt cyclohexanone ) in 10 g of diatomaceous earth was formulated to yield a 15 g weight rdx training aid with an approximate headspace scent signature of 522 ppm cyclohexanone and 424 ppm of 2 - ethyl - 1 - hexanol within the box in which it was placed . the explosive scent simulant was subjected to scent validation tests , using the scent validation grid previously described , during the test , five out of five canines used in this study successfully detected this scent with behavioral cues normally associated with finding an explosive material . after the scent validation process the simulant was subjected to canine explosive detection tests , using united states navy canine / handler teams trained at lackland air force base in san antonio , tex . six out of six canines used in this study successfully detected this scent by showing behavioral cues normally associated with finding an explosive material , which was sitting down next to the box in a fashion edds are taught to indicate when they liken a scent to that of an explosive scent that they had been trained to detect . note that none of the components used in this formulation is classified by dot as an explosive . from the components within the headspace scent signature of rdx , as identified in example 6 , and variety of non - energetic component combinations available for the preparation of a scent simulant for this explosive , a single - component pseudoscent containing 1 . 1 g 2 , 3 - dimethyldinitrobutane ( 100 %, active ingredients ) in 10 g of rice husks was formulated to yield a 11 . 1 g rdx training aid that produced a headspace scent signature of approximately 132 ppm within the box . the simulant was subjected to canine explosive detection tests , using the search and detect method and the scent validation grid previously described . during the test , four out of five canines used in this study successfully detected this scent with behavioral cues normally associated with finding an explosive material . after the scent validation process the simulant was subjected to canine explosive detection tests , using united states navy canine / handler teams trained at lackland air force base in san antonio , tex . six out of six canines used in this study successfully detected this scent by showing behavioral cues normally associated with finding an explosive material , which was sitting down next to the box in a fashion edds are taught to indicate when they liken a scent to that of an explosive scent that they had been trained to detect . note that none of the components used in this formulation is classified by dot as an explosive . from the components within the headspace scent signature of rdx , as identified in example 6 , and variety of non - energetic component combinations available for the preparation of a scent simulant , a ternary - component training aid containing 0 . 7 g of cyclohexanone ( 8 . 3 % weight wrt active ingredients ), 0 . 7 g 2 - ethyl - 1 - hexanol ( 8 . 3 % weight wrt active ingredients ) and 7 . 0 g 2 , 3 - dimethyldinitrobutane ( 83 . 3 % weight wrt active ingredients ) in 10 g of rice husks was formulated to yield a 18 . 4 g rdx training aid . this headspace scent signature can be further adjusted by varying the ratio of these three components . the explosive scent simulant was subjected to scent validation tests , using the scent validation grid as described above . during the test , five out of five canines used in this study successfully detected this scent with behavioral cues normally associated with finding an explosive material . after the scent validation process the simulant was subjected to canine explosive detection tests , using united states navy canine / handler teams trained at lackland air force base in san antonio , tex . six out of six canines used in this study successfully detected this scent by showing behavioral cues normally associated with finding an explosive material , which was sitting down next to the box in a fashion edds are taught to indicate when they liken a scent to that of an explosive scent that they had been trained to detect . note that none of the components used in this formulation is classified by dot as an explosive . referring to fig1 , using gc for headspace characterization , the headspace scent signature of military - grade tnt explosive was found to contain : ( a ) 2 , 4 - dnt , ( b ) 2 , 3 - dnt and ( c ) tnt , as the primary headspace components . since tnt is classified as an explosive , our intent does not allow its use in the formation of an inert scent simulant . therefore in order to fabricate odoriferous electronic equivalents ( 54 ) of tnt , the energetic functional groups within the molecular structure of tnt can be substituted with non - energetic ones that are similar in electronic properties . from the variety of possible substitutions possible with the use of electron withdrawing groups , tnt was “ de - energized ” by the complete removal of one nitro group ( i . e ., replacement of the nitro group with a hydrogen atom ) and the replacement of a second nitro group with a chlorine atom . the resulting structure equates to the compound , 2 - chloro - 4 - nitrotoluene . a single - component training aid was formulated by combining 2 . 29 g 2 - chloro - 4 - nitrotoluene ( 100 %, active material ) and 10 g of diatomaceous earth to produce a 12 . 29 g training aid with a headspace scent signature of 1 ppm 2 - chloro - 4 - nitrotoluene within the box . using a search and detect technique , the simulant was placed within the scent validation grid where four out of four canines used in this study successfully detected this scent by showing behavioral cues normally associated with finding an explosive material . after the scent validation process the simulant was subjected to canine explosive detection tests , using united states navy canine / handler teams trained at lackland air force base in san antonio , tex . six out of six canines used in this study successfully detected this scent by showing behavioral cues normally associated with finding an explosive material , which was sitting down next to the box in a fashion edds are taught to indicate when they liken a scent to that of an explosive scent that they had been trained to detect . note that none of the components used in this formulation is classified by dot as an explosive . from the components within the headspace scent signature of tnt , as identified in example 9 , tnt was “ de - energized ” through the following successive steps : ( i ) the removal of all the energetic nitro groups within the molecular structure of tnt , to form toluene , ( ii ) the conversion of the benzene residue in toluene &# 39 ; s molecular structure to the straight - chained structure of 2 - hexene , and ( iii ) the addition of one non - energetic functional group that has comparable electron - withdrawing properties to the nitro groups , to compensate for the three nitro groups previously removed . in this case , the introduced group was the aldehyde group , making the nomenclature of resulting de - energized equivalent of tnt trans - 2 - hexenal . for the fabrication of a second de - energized component to put within the pseudoscent formulation , tnt was again de - energized by removing two nitro groups and a methyl group from the molecular structure of tnt , to form nitrobenzene . for pseudoscent formation , 0 . 04 g “ aquasorb ,” a crosslinked superabsorbent polyacrylamide was added to a stirring mixture of 0 . 087 g trans - 2 - hexenal ( 2 . 33 % wrt nitrobenzene ), 3 . 64 g of nitrobenzene ( 97 . 67 % wrt trans - 2 - hexenal ) and 2 g of pure water . stirring was continued until gelling commenced after which the whole was left standing to form a de - energized pseudoscent with a headspace scent signature of 382 ppm of trans - 2 - hexenal and 192 ppm of nitrobenzene . the pseudoscent was subjected to scent validation tests using the search and detect method and the scent validation grid as described above . four out of five canines used in this study successfully detected this scent by showing behavioral cues normally associated with finding an explosive material . after the scent validation process the simulant was subjected to canine explosive detection tests , using united states navy canine / handler teams trained at lackland air force base in san antonio , tex . six out of six canines used in this study successfully detected this scent by showing behavioral cues normally associated with finding an explosive material , which was sitting down next to the box in a fashion edds are taught to indicate when they liken a scent to that of an explosive scent that they had been trained to detect . note that none of the components used in this formulation is classified by dot as an explosive . the examples and embodiments described herein are for illustrative purposes only and various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims . all publications , patents , and patent applications cited herein are hereby incorporated by reference for all purposes in their entirety .	8
referring now to the drawing , the rate aiding circuitry 10 is shown in dashed lines and is coupled with a standard target tracker 26 and to rate stabilized platform and associated circuitry . a typical rate stabilized platform will involve two degrees of freedom , i . e ., it will respond to changes with reference to two coordinate axes normally referred to as x for yaw and y for pitch . it does not respond to changes in the third axis normally referred to as z for roll . the single figure shows a stable platform 4 and related circuitry for providing x and y coordinate axis processing . the y axis processing 6 is shown generally and is identical to the x axis processing discussed in detail . in a tracking system as shown generally in the single figure , missile motion results in forces being applied to components and systems within the missile housing . stable platforms such as platform 4 are sensitive to these motions . thus , when missile motion forces are applied during the transition of a missile from a stationary position within a launcher to unemcumbered flight position free of the launcher , transient forces affect the missile and stable platform therein . these transient forces are manifest in the inertia of the platform , in the gimbal springs , and through friction , to cause a physical or mechanical misalignment of a target sensor 24 from the electro - optically established target los and of the rate sensor 34 . a torque motor 36 is coupled to the stable platform to respond to forces on the platform to induce a stabilizing influence on the platform . the torque motor can also provide an offsetting or neutralizing response to undersirable motion . in the drawing , these correctional forces are depicted as a mechanical force in dashed lines 33 applied from the torque motor into the target sensor 24 and to rate sensor 34 . in the system target sensor 24 , normally composed of an optical telescope system and a detector , converts an impending target scene into an electrical signal 25 . the x and y coordinate position of the target within this electrical signal is determined by the angular displacement θ of the optical axis of the sensor 24 with respect to the inertial line - of - sight ( los ) between the target position and the tracking system reference position or optical axis . the sensor output electrical signal 25 is operated upon by the tracker 26 to extract the target &# 39 ; s x coordinate 28 . the tracker output 28 is multiplied by a velocity constant in multiplier 30 to produce an output rate command 32 that is coupled back to the stable platform . stable platform 4 includes the rate sensor 34 , target sensor 24 , and torque motor 36 . other circuitry may be on or attached to the platform but are not pertinent to the operation . missile body motion produces disturbance torque 63 on the stable platform resulting from normal mechanical gimbal spring and friction coupling . spring and friction coupling is made as small as possible but in a practical system it can never be completely eliminated . summing circuit 44 receives the output rate command 32 and also receives a feedback signal 35 , providing an output which is coupled to the gain and compensation circuitry 40 . the gain and compensation circuitry 40 contains standard state of the art components for providing stable closed loop operation of the rate platform control loop . the electrical output of circuit 40 is converted to a mechanical torque 37 by torque motor 36 . the platform 4 responds to the total torque applied to it by moving at a rate determined by the magnitude of the applied torque and the inertia of the platform . however , rate sensor 34 is fixed to the stabilized platform and thus responds to the motion of the platform by generating an electrical output proportional to the platform rate , which provides the feedback input 35 to summing circuit 44 . as the stable platform moves at a rate in response to the applied undesirable torque an inertial platform angle is developed and , since the target sensor 24 is fixed to the stable platform , the difference between this platform angle and the target line of sight angle is measured by the target sensor 24 . the rate aiding circuitry 10 is shown in dashed lines and comprises a coordinate transformation circuit 11 , and integrator 12 , and a disable circuit 13 coupled in series with a summing circuit 14 . coordinate transformation circuit 11 also receives the platform rate gyro output 35 . in the general case this transformation is the well known euler equation and has input angles and rates from all three coordinate axis . in the case shown for only one axis of processing this transformation reduces to unity . the transformation circuit is followed by integrator 12 which integrates the transformer signal to provide output 54 which is an estimate of the platform 4 motion . the integrator 12 is in series with disable circuit 13 . during the period of launch disable circuit 13 has a gain of 1 . summing circuit 14 receives the output of the disable circuit 13 and further receives the output 28 from tracker 26 . these two signals , combined , are coupled 58 into a summing circuit 60 and combined with the target sensor 24 output for coupling to tracker 26 . this combined signal 58 allows the position of the tracker gate with respect to the target sensor field - of - view ( fov ) to be shifted in direct proportion to an external electronic command . the electronic command is the output of integrator 12 . in this manner the track gate is moved in the same direction as the target motion in the sensor fov due to sensor rotation . this controlled or directed tracker movement is independent of the ability of the tracker to follow target motion and is used to compensate for missile motion forces during the transient phase of missile launch . however , once the launch is accomplished the gain of disable circuit 13 is reduced to zero in a smooth manner , using a time of approximately 0 . 5 seconds to go from a gain of 1 . 0 to zero , eliminating any output as the gain goes to zero . this allows normal control to be reestablished via 34 , 35 , 32 , and 44 . the exact method of moving track gates in response to an external command varies with the particular type of tracker being used . the particular method used to move a track gate is important only for the requirement that the gate motion must be accomplished without interrupting the basic tracking function . for clarity , only a planer ( single - axis ) rate aided modification is shown . the coordinate data for the other axis must also be provided to the tracker , as shown generally in the drawing . alternatively , the simple , single axis , rate integration 10 can be replaced by a two or three axis signal integration using the appropriate and well known euler equations . in addition , the missile roll rate sensor and the platform pitch and yaw rate sensors ( not shown ) can be used so that roll transients can be accommodated . it should be noted that the success of this additional approach requires an accurate measure by these rate sensors during the period of the launch transient , i . e ., the period from ignition or firing of the rocket motor until the missile is free and clear of the launcher . during missile launch severe missile motion and acceleration create the disturbance torques upon platform 4 which act to perturb the normal platform rate and platform position information . in normal operation as a closed loop tracker / rate platform form , the rate platform loop consisting of the rate gyro or rate sensor 34 , torque motor 36 and platform gain and compensation 40 offset these perturbations , operating to provide a stable inertial reference on which sensor 24 is mounted . during platform perturbation , the platform rate gyro ( sensor 34 ) produces output 35 while the rate platform loop ( 44 , 40 , 36 ) responds to any disturbance torques from missile forces ( 63 ). the output response 35 is integrated by the electronic integrator 12 to produce the estimate of platform position . the rate is integrated by integrator 12 to provide a platform 4 position which is subtracted geometrically from the detected target los angle θ and results in sensor 24 measuring a target position ( output 25 ) equal to this difference . alternatively , for a three dimensional case a set of euler equations based on missile roll rate as well as platform pitch and yaw rates may be integrated to form the estimated platform position . this estimate can then be input to a summing circuit , which functions as the electronic gate position shifter . the shifting of the track gate position ( input 27 ) is equivalent to a subtraction at summing circuit 60 of the estimated platform position from the sensor measured target position 25 . thus , tracker 26 needs respond only to the target los angle θ plus the difference between the estimated motion of platform 4 ( due to launch transient ) and the actual motion . the operation of the remainder of the loop is straight forward . the tracker output 28 is multiplied by the seeker velocity constant 30 to produce the platform rate command 32 . command 32 is then input to the rate platform summing junction 44 to close the track loop . after the period of the launch transient , integrator 12 cannot be allowed to remain in the loop and must be discharged to zero at a rate trackable by the tracker 26 as hereinabove noted . although the present invention has been described with reference to a preferred embodiment , workers skilled in the art will recognize that changes may be made in the form and detail without departing from the scope and spirit of the foregoing disclosure . accordingly , the scope of the invention should be limited only by the claims appended hereto .	5
this article initially examines the mechanism of losses in a model of an existing particle generator as shown in fig1 . this generator to produce particles or aerosols of liquids includes a cylindrical vessel or container 2 and a centrally fitted primary particle emitter or atomiser 4 which includes a number of pneumatic atomiser jets . the aerosol with the particles produced by the atomiser 4 is fed through an outlet tube 6 with a cross - section area f near the top of the container . the liquid to be atomised in the generator is fed through a tube 3 into a liquid storage space 5 up to the level shown by a broken line . the space 5 is provided with a drain connection 7 . compressed air is fed into the atomiser through a tube 8 . the atomiser can be provided with an electric heater 9 . when determining the generation rate of a particle generator the adhesion of a part of the particles to the inside wall of the container and the coagulation of particles are considered as losses . for quantitative detection of the generation mechanism initially the particles generated by the atomiser are compared to those particles lost . the total number n g ( t ) of the particles in the container at the time t with an outflow rate of n w , a loss n b , the coagulation n a and the primary generation rate n e is : the outflow rate through the tube cross - section f at the velocity w t and the particle density n &# 39 ; in the generator is : the wall losses n b result from the size of the particle contact surface f b in the aerosol container , the velocity w b of the particles towards the wall and the adhesion factor γ : the loss rate n a due to coagulation can be calculated by differentiation of the coagulation formula ( 3 ) with the coagulation constant k and the particle density n &# 39 ; o in the generator at the time t = 0 as : ## equ1 ## and taking the particle numerical density n &# 39 ; into consideration is : by combining the formulae ( 1 ) to ( 5 ) and multiplication with the factor 1 / v k one obtains the particle numerical density : ## equ3 ## and by differentiation of formula ( 6 ) according to time one obtains the differentiation formula of the particle numerical density : ## equ4 ## or with the abbreviations : ## equ5 ## the differentiation formula in the clearer form : ## equ6 ## as the solution of these formulae one finds : ## equ7 ## and with the abbreviation : the constant c 2 can be determined with the starting condition t = 0 , n &# 39 ;= n &# 39 ; o : ## equ9 ## the formulae ( 13 ) and ( 14 ) give the time characteristics for balancing the numerical particle density : taking the formulae ( 8a , 8b , 8c and 12 ) into consideration the numerical particle density is : ## equ11 ## and the generation rate at equilibrium is : ## equ12 ## the numerical value of the coagulation constant k included in formula ( 18 ) is known if brownian motion is the surge mechanism . the particle sizes in the generator are distributed over a gauss curve spectrum . a two - particle size classification model is used to simplify calculations . in the aerosol container v k the turbulence of the flow is considerable and must be taken into account . practical values are available for the super - imposition of turbulence upon brownian motion in the flow through smooth tubes . the very complex flow and turbulence conditions in the aerosol vessel v k can hardly be computed . estimates of the value of the coagulation constant are then very difficult . however , one can say that an excessive increase in the particle surge index and therefore also coagulation is involved with turbulence . as an initial aid towards analysis of this process the coagulation constant k was multiplied with the factor s t : with formula ( 19 ) and the abbreviations : ## equ13 ## one obtains the clearer expression : ## equ14 ## the aerosol generator 12 according to the invention is shown in a simplified manner in fig2 . the atomiser 16 is fitted on the base of the container 14 and the atomising gas is fed in from below through a tube 18 at a pressure p n . the atomiser 16 is partly submerged in the aerosol liquid 17 . in the atomiser area 20 the aerosol particles are present at the primary particle generation rate n e and the numerical particle density n &# 39 ;, as indicated by the white arrows . the outlet 22 of the container 14 is connected to a tube 24 which in turn is connected to the infeed 26 of an ejector apparatus 28 . the ejector nozzle 30 connected with a tube 32 feeding a gaseous drive agent with a pressure p l to the ejector nozzle 30 . this produces a generation rate n g with an aerosol transportation velocity w t and an outlet velocity w a at the ejector outlet 36 . to increase the generation rate the pressure p n is to be optimized and the pressure p l is to be increased . by adjusting the pressure p l the particle outlet velocity from the ejector can be determined . in this way it is possible for example to provide an isokinetic particle infeed into a flowing gaseous medium , thus reducing the slip . the various operating parameters are shown in fig3 to 6 described above and therefore require here no further explanation . as indicated , the generation rate can be varied throughout relatively wide ranges . devices as shown in fig2 and described above are used to produce very fine aerosols with a high generation rate so that in the wind tunnels stated above the requirements about the aerosol quantity can largely be met . these devices can also be used in medical applications . devices of this type can further be used for fuel preparation . such applications are illustrated in fig7 and 8 . fig7 shows a schematic of a gas turbine 40 with the turbine 42 , the compressor 44 and the combustion chamber 46 . the fuel is here prepared by means of an aerosol generator 48 in the principle of a generator as shown in fig2 and described above . the drive agent for the atomiser 50 and the ejector 52 is compressed air taken from the compressor outlet 45 which is fed to the atomiser at the pressure p n and the ejector 52 at the pressure p l . in addition a throttle 56 is provided in the connection pipe 54 . in the process heat generator according to fig8 the aerosol generator 60 is designed as per that in fig7 . in this embodiment the atomiser 64 and the ejector 66 are pressurized with the same gas , which again is the combustion air as in fig7 . in this case the entire additional air is fed to the ejector . if necessary the combustion chamber 62 with the heat exchanger 68 could be provided with an infeed for secondary air in order to ensure full combustion of the fuel . for process heat generation or operation of a gas turbine respectively are required high throughput rates for the aerosol generator , i . e . there is necessary a very high particle generation rate . such a high particle generation rate can be achieved by means of an aerosol generator as shown in fig9 to 11 . the aerosol generator 70 comprises a housing 72 with a base 74 and a cover 76 . at a distance above the base 74 a supporting plate 80 for the atomiser 82 is positioned on an annular supporting wall 78 . in a detachable central bottom plate 84 is mounted a feed tube 86 for the liquid to be atomised . the liquid flow is shown by an arrow with black arrowhead . the tube 86 leads into the space 88 surrounded by the supporting wall 78 . said space is connected to the outer annular space 92 via connecting openings 90 . the spaces 88 and 92 form a storing chamber for the liquid . there is supplied such a quantity of liquid that substantially a liquid level 94 is maintained , which is shown by a dash - dotted line . there may be provided an overflow return connection not shown in the drawing . there is furthermore provided a pressure gas pipe 96 which is sealed by and lead through the bottom plate 84 , the internal liquid chamber 88 and the supporting plate 80 until it reaches the area above the supporting plate 80 . through the pipe 96 pressure gas , preferably compressed air , is fed into the internal chamber 98 of the atomiser . the gas flow is shown by arrows with white arrowheads . the atomiser 98 has slot - shaped atomiser nozzles . as to be particularly noted from fig1 and 11 , it is constructed by inner rings 100 and outer rings 102 , which by spacers 104 , 106 are kept at such an axial distance to each other that slot - like discharge openings 108 are formed for the compressed air between the inner rings 100 and slot - like discharge openings 110 for the atomised particles between the outer rings 102 , the atomised particles or the aerosol respectively being shown by arrows with arrowheads dotted inside . in the centre of the supporting plate 80 is provided a feedpipe 112 for the liquid to be atomised . as particularly to be noted from fig1 and 11 , said pipe 112 is provided with an axial bore 114 and with radial bores 116 . the radial bores being connected to the bore 114 are arranged at axial distances corresponding to the thickness of the inner rings 100 plus the thickness of the spacers 104 . in case of the embodiment are being distributed over the circumference three radial bores each time , as to be noted from fig1 . to said radial bores are connected tubes 120 via connecting elements 118 including sealing means , the other end of which is sealingly connected to radial bores 124 in the inner rings 100 via corresponding connecting elements 122 . in front of the outlet of said radial bores 124 an annular channel 126 each is provided on the inner circumference of the outer ring 102 , which axially is connected to an annular slot 128 ending in front of the air discharge opening 108 formed between the inner rings 100 . the stack of rings 100 , 102 is mounted on the supporting plate 80 by means of inner and outer spacing rings 130 , 132 while the space 98 surrounded by the rings is closed by a cover 134 on top , which is again resting on the stack of rings with inner and outer spacing rings 136 , 138 in between . the ends of the spacing rings 130 , 132 and 136 , 138 directed towards each other are formed corresponding to the inner and outer rings 100 and 102 , so that they form slot - like discharge openings 108 and 110 together with the adjacent rings , the lower outer spacing ring 132 also being provided with the annular channel 126 and the annular slots 128 , and the inner spacing ring 130 being provided with openings for the connecting elements for the tubes 120 and the bores 124 . the stack of rings is mounted and compressed by bolts , which may be put through the bores 144 in the spacers 104 , 106 . an ejector means is formed by the discharge opening 108 together with the discharge opening 110 and the annular slot 128 . by the emerging air beam liquid from the liquid supply with the level 94 is sucked in via the slots 128 and the tubes 120 through the bore 114 and then most finely atomised . the atomisation capacity is determined by the radius r d , on which the liquid is sucked in into the air flow through said ejector means as well as the number of rings placed one above the other . so it is easily possible to determine the desired throughput by increasing the number of rings placed one above the other at a given radius r d . the very fine particles or the produced aerosol respectively emerging over the circumference of the atomiser 82 are sucked in by means of an ejector 142 from the housing 72 through an opening 140 and supplied to the consumer , in this case the process heat generator or the burners of a gas turbine respectively , as again shown by the arrow with arrowhead dotted inside . the ejector 142 is here moulded to the cover 76 . just like the ejector according to the embodiment of fig2 the ejector 142 is designed for a capacity corresponding to the generation rate of the atomiser .	5
fig1 shows a perspective exploded view of a display arrangement 1 . 1 with a profile 2 and a bracket element 3 , as well as a rack element 4 and a connecting profile 5 . 1 . the profile made of aluminum has a central web 6 , and arranged thereon two inner flanges 7 , two outer flanges 8 , and two auxiliary flanges 9 . a fastening web 10 is arranged in each case on the inner flanges 7 . the outer flanges 8 are each provided with an exposed web 11 and an inner web 12 . bracket element 3 is made in two parts of a top part 13 and a bottom part 14 , which in the present case are made the same . top part 13 and bottom part 14 each have a tensioning surface 15 . rack element 4 can be tensioned between tensioning surfaces 15 . elastic layers 16 , for example , made of silicon rubber , are provided for distribution of pressure in each case between a surface of rack element 4 and a tensioning surface 15 . rack element 4 can be fabricated of safety glass . to tension rack element 4 , top part 13 and bottom part 14 are drawn against each other by means of two tensioning screws 17 . top part 13 and bottom part 14 are each provided with clamping rails 18 , which by plugging onto inner flanges 7 can be connected with these form - fittingly and releasably . clamping rails 18 are arranged pairwise at a distance to one another , which corresponds approximately to or is slightly smaller than the distance of the outer surfaces of inner flanges 7 , so that a force closure results due to the elastic deformation of clamping rails 18 and / or inner flanges 7 . tabs 19 ( here visible only at top part 13 ) attached to upper part 13 and lower part 14 provide for additional form closure . a securing hole 20 , placed here in the area of tab 19 , is used for receiving a securing screw ( not shown ), with which top part 13 and bottom part 14 can be fixed in addition to profile 2 . this can be screwed , for example , into a securing nut , which is held behind fastening webs 10 . clamping rails 18 are made here as clamping rail segments , because this facilitates the fabrication of the bracket elements . they can also be made continuous , however . connecting profile 5 . 1 has a width that corresponds approximately to the distance of exposed web 11 and inner web 12 from one another , so that it can be pushed between these . another profile 2 can be pushed onto the part of the connecting profile 5 . 1 , said part which then still projects from profile 2 ( not shown ), so that alignment of profiles 2 relative to one another can be omitted . fig2 shows profile 2 , bracket element 3 , and rack element 4 , in a reduced view compared with fig1 . in this view , it becomes clear with use of notches 22 how rack element 4 is held by bracket element 3 . notches 22 are provided at the places through which the tensioning screws are guided or at which profile 2 proceeds . fig3 shows another embodiment of a display arrangement 1 . 2 made from two frames 23 . 1 , 23 . 2 , which are connected to one another by a connecting profile and are each made of four wrap - around profiles 2 . profiles 2 are provided at their ends each with a 45 ° bevel cut and connected to one another by corner connectors 24 , as shown in fig4 . the left frame of the two frames 23 . 1 is provided with a paneling element 25 . paneling element 25 rests on one of the outer sides of each of outer flanges 8 of profiles 2 of frame 23 . 1 and is surrounded laterally by its exposed webs 11 ( not visible here ). paneling element 25 can have the form of an opaque glass pane provided with decoration or textures . the two frames 23 . 1 , 23 . 2 are connectable to one another with connecting profile 5 . 1 by pushing the profile between outer flanges 8 of facing profiles 2 of frames 23 . 1 , 23 . 2 and hanging it , as shown in detail in fig6 a to 6 d . the shown connecting profile 5 . 1 is made in the shape of a box . another variant of a connecting profile 5 . 2 is shown on the side of frame 23 . 1 . this connecting profile 5 . 2 is made cross - shaped , so that four profiles can be connected to one another at right angles . other variants for connecting profiles 5 are , for example , l - shaped for a 90 ° connection of two profiles 2 or t - shaped to connect three profiles 2 . display arrangement 1 . 2 shown here , of course , can also be provided with rack elements 4 and bracket elements 3 , as shown in fig1 and 2 . in this case , separate paneling elements 25 , which adjoin rack elements 4 directly , would be used above , below , and between a plurality of rack elements 4 , so that bracket elements 3 are concealed and the overall aesthetic impression is determined only by the design of paneling elements 25 and rack elements 4 . fig4 shows a perspective diagram of a section of a display arrangement 1 . 1 , 1 . 2 with a profile 2 and corner connector 24 . it has two legs 26 , which stand at right angles on one another and are dimensioned so that they can be inserted with no or with little play in a section of a space , defined by the central web 6 , the two inner flanges 7 , and the two fastening webs 10 , from the end of the profile 2 . profiles 2 , only one of which is shown for better clarity , are provided with a 45 ° bevel cut at their ends . in the interest of good union of corner connectors 24 with profiles 2 , a light press fit is advantageous . the union can be secured against slipping in addition by means of threads cut in corner connectors 24 and headless screw screwed into the thread through a first bored hole in central web 6 of profile 2 ( not shown ). fig5 shows a perspective diagram of a section of a display arrangement 1 . 1 , 1 . 2 with a profile 2 , a paneling element 25 , and a fastening element 27 . in the shown example , fastening element 27 is formed as a retaining bracket , which is glued to the back of paneling element 25 . it has an elastic locking element 28 , which engages between the two inner flanges 7 such that paneling element 25 is secured against falling out in the direction of its front . typically , a number of such or other fastening elements 27 are arranged on each paneling element 25 . fig6 a to 6 d show different views of two profiles 2 connected by means of a connecting profile 5 . 1 . fig6 d shows a cross section , fig6 a and 6 c a longitudinal section along the plane designated by y and z , and fig6 b a longitudinal section along the plane designated by a and b . connecting profile 5 . 1 is formed as a box profile , whose outer dimensions are selected so that with no or with little play it finds room , on the one hand , between exposed webs 11 and inner webs 12 and , on the other , between central webs 6 of profiles 2 . long holes 29 . 1 , 29 . 2 , which expand in each case at an end to a fifth bored hole 30 , are provided at the sides of connecting profile 5 . 1 each facing a central web 6 . for each long hole 29 . 1 , 29 . 2 , correspondingly on central web 6 , a dog point 31 is provided , which is dimensioned so that it fits through fifth bored hole 30 and is then slidable in long hole 29 . 1 , 29 . 2 , so that a releasable connection results . in the case of long hole 29 . 1 , the fifth bored hole points upward , and in the case of long hole 29 . 2 downward . if , for example , frame 23 . 1 is built first , connecting profile 5 . 1 with long hole 29 . 2 can be hung in profile 2 belonging to frame 23 . 1 . next , from the other side of connecting profile 5 . 1 , profile 2 belonging to frame 23 . 2 is hung in long hole 29 . 1 and frame 23 . 2 is constructed . the assembly sequence can be labeled on profiles 2 and / or connecting profile 5 . 1 , 5 . 2 . as becomes clear from fig6 d , both frames 23 . 1 , 23 . 2 are provided with paneling elements 25 . the shown frame 2 of frame 23 . 2 is provided with auxiliary flanges 9 . to facilitate the assembly of paneling elements 25 on frame 2 , an auxiliary assembly fastening can be provided between auxiliary flange 9 and paneling element 25 , for example , as a hook and loop fastener made of two adhering strips , whereby the first strip is arranged on auxiliary flange 9 and the second strip on the back of paneling element 25 . a perspective diagram of a section of another embodiment of a display arrangement 1 . 1 , 1 . 2 with a profile 2 , a paneling element 25 , and a fastening element 27 is shown in fig7 . fastening element 27 comprises a retainer 32 arranged on the back of paneling element 25 with a bar 33 which is magnetically actuatable from the front of paneling element 25 and is arranged pivotably on retainer 32 . bar 33 is in an unlocked position . bar 33 can be pivoted into a locking position , shown in fig8 , from the front of paneling element 25 by , for example , a magnet . in fig8 , bar 33 is in the locking position , in which it engages behind auxiliary flange 9 , so that paneling element 25 is secured from falling out in the direction of its front . bar 33 can be made of a ferromagnetic material . retainer 32 can have the form of a metal sheet , which is screwed or glued onto the back of paneling element 25 . bar 33 can be made alternatively so that in the locking position , it engages behind one of inner flanges 7 . the shown clamping rails 18 can be made as clamping rail segments in the form of discontinuous clamping rails . in particular , the clamping rail segments at one of inner flanges 7 are offset to the clamping rail segments at the other flange of inner flanges 7 in the longitudinal direction of profile 2 . profiles 2 are preferably fabricated as extruded profiles made of aluminum . display arrangement 1 . 2 can be combined with bracket elements 3 different from those shown , particularly also with one - part bracket elements , which , however , have at least clamping rails 18 or clamping rail segments . display arrangement 1 . 1 can be combined with profiles 2 different from those shown , which , however , have at least inner flanges 7 . the number of tensioning screws 17 on each bracket element 3 and accordingly the number and design of notches 22 in rack element 4 can be selected as different from what is shown in the exemplary embodiments . top part 13 and / or bottom part 14 may have a stop relative to one another , which has a minimum distance to limit the press force acting on rack element 4 . at least one of profiles 2 may be fixable to a wall by means of a wall mounting element , whereby the wall mounting element has , for example , a plate with at least one second bored hole or at least one long hole for fastening to the wall and a clamp , and the plate abuts an outer side of one of outer flanges 8 and whereby the clamp connected fixedly or especially adjustably to the plate engages between one of inner flanges 7 and one of auxiliary flanges 9 or between auxiliary flanges 9 , so that profile 2 is secured against slipping in the direction of its inner side and in the normal direction of the plane enclosed by frames 23 . 1 , 23 . 2 . at least one securing plate , which is arranged on , particularly glued to , the back of paneling element 25 , can be provided alternatively or in addition as fastening element 27 . it has a securing clip , in which the headless screw of one of the corner connectors 24 or another screw can be rotated so that paneling element 25 is secured against falling out in the direction of its front . to enable the usability of a standard box profile with 35 mm × 20 mm as connecting profile 5 . 1 , the distance between the edges of inner webs 12 and exposed webs 11 is preferably 20 mm to 21 mm and the distance from the outer side of central web 6 to the outer side of exposed web 11 preferably 17 . 5 mm to 20 mm . alternatively , the distance of the outer flanges 8 can also be selected so that a connecting profile 5 . 1 to 5 . n can be introduced in - between . in this case , inner webs 12 and the parts of exposed webs 11 that point to the respectively other outer flange 8 are omitted . preferably , at least one adjusting element is arranged on a lower horizontal profile 2 for height adjustment . in particular , however , two adjusting elements are provided one each at an end of the lower profile 2 , to facilitate the vertical adjustment of display arrangement 1 . 1 , 1 . 2 . for this purpose , a box profile , particularly a standard box profile with 35 mm × 20 mm , is arranged between the outer flanges of the lower profile , into which various commercially available adjusting elements can be incorporated . another possible display arrangement 1 comprises two profiles 2 which are connected at their outer flanges 8 by means of a connecting profile 5 . 1 and each has a bracket element 3 at the same height , on which a circular rack element 4 is held . in so doing , the fastening devices of the rack element 4 can be concealed with a sufficiently large , tubular paneling element in a simple and decorative way . bracket element 2 can also be made so that clamping rails 18 by insertion between inner flanges 7 or fastening webs 10 can be connected to these . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are to be included within the scope of the following claims .	0
referring now to fig1 it will be seen that there is illustrated an identification system , which is generally identified by the numeral 10 , and which includes an identifying member , generally identified by the numeral 12 , and an authenticating device , generally identified by the numeral 14 . the illustrated identifying member 12 is in the form of a label which may be applied to a piece of equipment . however , it is to be understood that the identifying member 12 may , in a like manner , be in the form of a credit card , a lottery ticket or similar type of matter wherein information is conveyed from a card or label . in accordance with this invention , the identifying member 12 not only will be provided with the customary identifying indicia , but also authenticating indicia a mark identified by the reference number 16 . the authenticating indicia 16 is in the form of a plurality of characters printed in different colors and in overlapping relation as will be described in more detail hereinafter . the authenticating device 14 is illustrated as a simple mask which may be placed in overlying relation with respect to the label 12 in a preselected relationship and includes filter segments 18 , 20 which open through the authenticating device 14 and are placed on the authenticating device 14 in alignment with the authenticating indicia 16 . reference is now made to fig2 wherein the authenticating indicia 16 is illustrated on a much larger scale . preferably the authenticating indicia 16 is printed in two colors at a minimum and may consist of three or more colors . further , normally each character of the authenticating indicia 16 will be of an overlay type involving two characters . with respect to this overlay type , reference is made to fig3 wherein it will be seen that the letters k and s are printed in overlying relation . the letter k is printed in blue while the letter s is printed in red in the illustrated example . referring now to fig4 it will be seen that when the authenticating indicia 16 is viewed through a red filter 22 , all of the printed characters when are red are blocked out and only those characters which are printed in blue will be seen . thus the authenticating indicia 16 of fig2 will appear in fig4 as &# 34 ; made ok .&# 34 ; on the other hand , with reference to fig5 it will be seen that when the authenticating indicia 16 is viewed through a blue filter 24 , all of the characters which are printed in blue will not be seen and thus the authenticating indicia 16 will appear as &# 34 ; not us 87 &# 34 ;. while each of the readings of the authenticating indicia 16 in fig4 and 5 make sense , this is not the authenticating code that is to be detected utilizing the authenticating device 14 . on the other hand , when the authenticating device 14 is aligned in the preselected relationship with the label 12 , the left - hand segment 18 , i . e . the red filter segment , overlies the left portion of the authenticating indicia 16 so that the word &# 34 ; made &# 34 ; will appear . at the same time , the right - hand segment 20 , i . e . the blue filter segment , overlies the right part of the authenticating indicia 16 so that there appears &# 34 ; us 87 &# 34 ;. thus what is seen through the authenticating device 10 is the authenticating indicia &# 34 ; made us 87 &# 34 ;. the foregoing is a typical simple example of the utilization of the invention . referring once again to fig3 it is to be noted that three colors may be utilized in the printing of the authenticating characters . there will be blue areas identified by the numeral 26 , red printing identified by the numeral 28 and a mixture of red and blue printing 30 . further , the general block in which the authenticating characters &# 34 ; s &# 34 ; and &# 34 ; k &# 34 ; appear may otherwise include a third printed color arrangement identified by the numeral 32 . this color arrangement may , for example , be yellow . at this time it is also pointed out that when a two color system is utilized , it is not necessary that the colors be red and blue as discussed in the example . one could have , for example , a combination of blue and yellow or a combination or red and yellow . in addition , it is feasible to utilize even more colors depending upon the nature of the authenticating characters . reference is now made to fig7 wherein the manner of forming the various colored areas shown in fig3 is illustrated . the printing may be in the form of small dots and with respect to the example in fig3 there would be a multiple color printing with selected dots being of selected colors . for example , dots 34 will be blue in color while dots 36 are red in color . further , dots 38 may , for example , be yellow in color . it is to be understood that the overall printing will be a series of dots and in areas where there is overprinting , the color of the dots will be alternating whereas in other areas , the dot colors will be all the same . if desired , as illustrated in fig7 all of the possible dots will have a color . on the other hand , it is feasible that instead of all of the dots 34 in the blue area being blue , only every other dot would be blue while the area of the other dots would be left uncolored . a determination as to whether there would be uncolored areas would depend on whether or not , for example , a deep blue or a light blue is desired . although in the example shown in fig1 - 7 the authenticating characters are in a single line , it is to be understood that this is merely an example of the simplest possible arrangement . if desired , the authenticating characters may be printed in several lines or be arranged in a more complex pattern . in such event , the filter segments 18 , 20 may either be much deeper to take care of several lines of authenticating characters , or there may be a more complex filter segment arrangement such as that shown in fig8 . in the illustrated embodiment of a modified form of filter which would provide for authenticating three lines of characters with the possibility that there may be a varied color arrangement in each line , there is provided a filter arrangement generally identified by the numeral 40 . the filter arrangement 40 includes a red filter segment 42 down in the bottom right - hand corner . next there would be a generally rectangular blue filter segment 44 having a lower right - hand corner notch in which there is inserted the blue segment filter 42 . finally , there would be the filter segment 46 which is red and which is generally angular in outline and extends across the top and the left side of the filter segment 44 . while the filter arrangement 40 is of a two color effect , it is to be understood that three colored filters may be involved . finally , it is pointed out here that although the only illustrated authenticating device is in the form of a mask - like device 14 , the filter system could be contained in a machine which is typically in the possession of an authorized person such as a police officer or a merchant . the filter system preferably would have a fixed position with respect to a guide for the card which is being authenticated . the specific nature of the authenticating indicia may be varied depending upon the usage . for example , when the system is utilized for a credit card , the multiple colored printing may be utilized for identification of the card number . in addition , personal information as to the bearer of the card could also be printed with the system . thus when the card is read by the merchant , it could give the merchant not only the identification number , but personal data relating to the bearer . thus , if the credit card was stolen or counterfeited , the merchant could immediately tell from the personal data that the card does not match the bearer . although only a preferred form of the identification system has been specifically illustrated and described herein , it is to be understood that minor variations may be made in the identification system without departing from the spirit and scope of the invention as defined by the appended claims .	1
fig2 shows an exploded , perspective view of an electrolyte / electrode assembly for a fuel cell with a substrate structure according to one embodiment of the present invention . in this embodiment a flat anode substrate 7 is formed by machining internal ribs on one side of a 4 mm thick , porous nio - ysz cermet matrix , which is made by cold pressing followed by sintering as later described . the porous matrix consists of zirconia either partly or completely stabilized by yttria or magnesia and electrical conductors consisting of nickel - zirconia cermet supported in the porous matrix . the electrically conductive material provides an electrical conductivity to the porous matrix in the direction of the thickness of the anode substrate . a flat anode 6 is formed on the flat side of anode substrate 7 . anode 6 is comprised of nickel oxide , nio and 8 mol % yttria - stabilized zirconia , ysz , in a weight ratio of 2 : 1 , and polyvinyl butyral , pvb , as binder . the pvb is dissolved in ethanol and the ingredients are wet - mixed . the slurry thus obtained is applied to anode substrate 7 and sintered at 1400 ° c . to form the flat anode 6 on anode substrate 7 . ysz is continuously plasma sprayed at a reduced pressure on to anode 6 to form a solid electrolyte element 8 . a flat cathode 9 is formed by application of a lanthanum manganite , lamno 3 , coating thereon followed by sintering at 1200 ° c . a cathode substrate 10 is prepared by pressing and sintering the same lamno 3 that is used in the cathode . its porosity is about 30 %, and the average pore size is about 3 μm . the electrolyte / electrode assembly thus obtained is assembled with a ribbed interconnection shown in fig2 in order to constitute a unit cell . cathode substrate 10 is covered with a separator 11 comprising lanthanum calcium chromite , la 0 . 7 ca 0 . 3 cro 3 , which is plasma sprayed at a reduced pressure over the porous matrix of cathode substrate 10 . a fuel cell stack is fabricated by alternating electrolyte / electrode assemblies and interconnections in sequence and by attaching fuel and air manifolds to the side of the stack as is known in the art . manufacturing methods for the electrode substrate according to the invention are explained in more detail by way of the following examples . first , the following coarse zirconia powder is obtained as the matrix substrate : 8 mole % yttria stabilized zirconia ysz , is granulated with a spray dryer and is provisionally sintered for two hours in air at about 1500 ° c . it is then pulverized and passed through a sieve with openings of about 300 μm to obtain a coarse zirconia powder . the average grain size of the coarse powder obtained is within a range of about 50 to 100 μm . next , a coarse electrically conductive material is granulated as follows : nio and 8 mole % yttria stabilized zirconia ysz are weighed in 2 : 1 proportion by weight , and are wet - mixed into a solution of polyvinyl butyral , pvb , and polyetheylene glycol , peg , in ethanol as binders . the coarse ysz powder mentioned above is added to the mixture , further wet - mixed , left standing , and then heated and dried . the powder thus obtained is put into a die , which is pressed for one to three minutes at room temperature at a pressure of about 1 ton / cm 2 to make a disc . the disc is pulverized coarsely using a stamp mill or cutter mill , passed through a sieve with openings of about 300 μm , and granulated . the grains thus obtained are provisionally sintered for two hours in air at about 1300 ° c ., and the sintered grains are further passed through a sieve with openings of about 300 μm . the coarse powder thus obtained is added to an aqueous solution of polyvinyl alcohol , pva , and polyethylene glycol , peg , as binders , stirred , and then heated and dried . the powder added with the binders is further passed through a sieve with openings of about 300 μm . the sieved powder is put into a die are uniaxially pressed for from one to three minutes at room temperature at a pressure of from about 300 to about 500 kg / cm 2 to change the powder into a substrate , which is then sintered for two hours in air at a temperature of about 1500 ° c . in this way , an anode substrate is obtained with a diameter of about 130 mm and a thickness of about 4 mm , in which nio - ysz cermet as electrically conductive material is supported in the porous matrix consisting of y 2 o 3 stabilized zro 2 ( ysz ). fig3 illustrates the crystal structure of an anode substrate made according to the above , as observed under a scanning electron microscope . the fine powder of the electrical conductors consisting of nickel - zirconia cermet is dispersed and supported in clearances in the matrix of the zirconia coarse powder . the nickel paths that ensure electrical conductivity in the anode substrate are cut off resulting in increased specific resistance if the average grain size of fine nio - ysz powder exceeds about 10 μm . on the other hand , a porous matrix cannot be obtained when the fine grain is sintered if the average grain size of fine nio - ysz powder is less than about 0 . 1 μm . therefore , the grain size range of nio - ysz must be maintained from about 0 . 1 μm to about 10 μm . although , in the above - mentioned example , anode 6 is formed over anode substrate 7 as another layer , anode 6 may be omitted to simplify the manufacturing process since anode substrate 7 already includes the functions of an anode . that is , anode 6 is already formed within anode substrate 7 . the manufacturing process is continued with an 8 mole % y 2 o 3 stabilized zro 3 ( ysz ) electrolyte being plasma sprayed directly on the nio - ysz anode substrate obtained as above described in a thickness ranging from about 100 to about 200 μm , and then a lamno 3 cathode layer is applied to the electrolyte . an electrolyte / electrode assembly , in which the anode substrate includes the functions of an anode , is thus obtained . magnesia - stabilized zirconia , msz , consisting of a coarse zirconia powder , partly stabilized by magnesia , mgo , of 9 mole % is provisionally sintered for about two hours at about 1600 ° c ., passed through a sieve with openings of about 300 μm , and granulated to an average grain size range between about 50 and about 100 μm . using the same processes as mentioned in example 1 , an anode substrate 7 is obtained with a diameter of about 130 mm and a thickness of about 3 mm , in which nio - ysz cermet as electrically conductive material is supported in the porous matrix consisting of mgo stabilized zro 3 . the average linear thermal expansion coefficient of nickel oxide , nio , is about 15 × 10 - 6 /° c . in air , from room temperature to about 1000 ° c ., while the thermal expansion coefficient of msz is about 9 × 10 - 6 /° c . in the same temperature range . therefore , it is possible to have the thermal expansion coefficient of the anode substrate matched by the thermal expansion coefficient of 10 . 5 × 10 - 6 /° c . of the yttria - stabilized zirconia , ysz , which is the solid electrolyte element , by adding the proper amount of msz into the nio . fig4 is a graph showing the relationship of specific resistance to the amount of coarse ysz or msz powder added to the anode substrate . while in nio - ysz without the addition of coarse powder , the thermal expansion coefficient is about 13 × 10 - 6 /° c ., the coefficient can be reduced to about 11 . 4 × 10 - 6 /° c . by adding 50 mole % of coarse ysz powder . on the other hand , the thermal expansion coefficient of the coarse msz powder can be matched with that of ysz by adding about 10 to about 20 % of coarse ysz powder . fig5 shows the relationship between the added amount of coarse ysz and msz powder to the anode substrate and the specific resistance of the anode substrate . an increase in the specific resistance due to the addition of msz tends to be slightly greater than that due to the addition of ysz , but both ysz and msz result in a specific resistance of about 50 mω . cm or lower when the added amount of ysz or msz is within about 40 mole %. the voltage drop due to such resistance is negligible during operation of the fuel cell . therefore , as long as the added amount of coarse zirconia powder is within a range of about 5 to about 40 %, a thermal consistency with ysz can be achieved with the specific resistance remaining at a low value . nickel oxide , nio , and yttria - stabilized zirconia , ysz , are weighed in a weight ratio of 2 : 1 , and added to a solution of pvb , peg , and dioctyl phthalate as binders in a mixed solvent of 60 % toluene and 40 % isopropyl alcohol by weight . the ingredients are wet - mixed in a ball mill to prepare an electrically conductive material . a porous matrix comprised of zirconia felt is immersed in an aqueous solution of the nio - ysz , and then deaerated for from about ten to about thirty minutes under a pressure of approximately 160 mm hg in a vacuum glove box . the matrix is then removed from the box , placed on a polyester film , and is continually dried in the glove box . the matrix is then sintered for about two hours in air at a temperature of about 1500 ° c . to obtain an anode substrate 7 with a diameter of about 130 mm and a thickness of about 3 mm . in this way , an anode substrate is obtained in which nio - ysz cermet as an electrically conductive material is supported in the porous matrix consisting of y 2 o 3 stabilized zro 2 . other materials can be used for the zirconia matrix in lieu of felt , such as sponges , honeycombs , clothes and screens . the same specific resistance and thermal matching with ysz as in example 2 are also possible in this example 3 by introduction of a zirconia matrix . although the electrolyte is applied to the anode substrate in the above mentioned examples , an alternate design using the flat side of the cathode substrate is feasible according to the present invention as will be apparent from the following example 4 . a cathode substrate 10 is prepared as follows : lanthanum oxide , la 2 o 3 , and manganese carbonate , mnco 3 , are weighed in amounts sufficient to constitute lamno 3 . in order to increase the electrical conductivity of lamno 3 , strontium carbonate , srco 3 , is added to obtain lanthanum manganite doped with strontium . the resultant mixture is provisionally sintered for about three hours in air at a temperature of about 1400 ° c . the product is pulverized for about 24 hours in a ball mill . after verifying with the x - ray diffraction process that the resultant powder has a perovskite structure , coarse ysz powder is added as in example 1 , and polyvinyl alcohol , pva , dissolved in water is also added as a binder , and then stirred and dried . the powder , including the binder , is screened through a sieve with openings of about 300 μm to obtain a raw material powder . the raw material powder is put into a die and is uniaxially pressed for from about one to about three minutes at a normal temperature under a pressure ranging from about 500 to about 1000 kg / cm 2 . the formed product is sintered for about five hours in air at a temperature of about 1350 ° c . thus , the cathode substrate 10 is obtained with a diameter of about 130 mm and a thickness of about 4 mm , in which an electrically conductive material comprised of lanthanum manganite is supported in the porous matrix consisting of zirconia either partly or completely stabilized . the average linear thermal expansion coefficient of la 0 . 85 sr 0 . 15 mno 3 , without the addition of coarse zirconia powder was about 11 . 1 × 10 - 6 /° c . in air at temperatures ranging from room temperature to about 1000 ° c . on the other hand , by adding 10 % of coarse ysz powder , a cathode substrate 10 is obtained with a thermal expansion coefficient of 10 . 7 × 10 - 6 /° c . after that , plasma spraying of ysz at a reduced pressure as a solid electrolyte element was done , with no resulting warpage or cracks in the substrate . therefore , by introducing a zirconia matrix in the cathode side , an electrolyte / electrode assembly having thermal consistency with ysz can be obtained . according to the present invention , the electrically conductive material is supported in a porous matrix that consists of the same main constituents as the solid electrolyte element . even if the electrically conductive material changes physically because of oxidation or reduction , the electrode substrate as a whole remains mechanically stable because the supporting element , i . e ., the porous matrix , is stable . in addition , the electrical conductivity of the electrode substrate is raised by optimizing the composition of the electrode substrate consisting of a porous matrix and electrically conductive material , with the electrode substrate being matched thermally with the solid electrolyte element in a unit cell . the present invention has been described in detail with respect to preferred embodiments , and it will now be apparent from the foregoing to those skilled in the art that changes and modifications may be made without departing from the invention in its broader aspects , and it is the intention , therefore , in the appended claims to cover all such changes and modifications as fall within the true spirit of the invention .	7
referring now to fig1 , which is an illustration of an aircraft 10 in accordance with the present invention . the aircraft 10 is comprised of a plurality of joint assemblies wherein traditional fastening and assembly techniques may unfeasible or cost prohibitive . one such joint assembly is referred to as the wing side - of - body joint assembly 12 , see fig2 . the wing side - of - body joint assembly 12 is located where the wing 14 joints the aircraft body side 16 . this joint assembly 12 is very important as it is used to join a variety of structures together to form a reliable joint that is preferably highly resistant to joint fatigue . as illustrated in fig2 , the joint assembly 12 is used to join a variety of different structures . aluminum or titanium chords 18 , also referred to as a first joint element , are utilized to join primary structures such as aluminum or carbon fiber - reinforced composite skin elements 20 , also referred to as a second joint element , stringers 22 , stringer fittings 24 , and body frames 26 . in addition , the chords 18 are utilized to affix additional stiffeners such as body web stiffeners 28 and spice plates 30 . thus the joint assembly 12 joins a wide plurality of structures and must do so reliably and efficiently . one embodiment of a wing side - of - body joint is described in further detail below . a body frame section 26 is a part of the aircraft body side 16 and is found at the point on the aircraft body to which the wing 14 connects . it is fastened to the upper supporting chord element 200 , described below . the main components of one embodiment of a wing side of body joint include an upper supporting chord element 200 and a lower supporting chord element 228 , an upper wing section 212 and a lower wing section 238 , and an upper interior section 220 and a lower interior section 246 . the upper and lower supporting chord elements 200 and 228 have a cross - section resembling a crossed capital t , and comprise a middle chord layer 204 and 230 and a top or bottom chord layer 202 and 232 which are substantially parallel to each other , and are connected by a central wall chord layer 206 and 234 , which runs perpendicular to both top or bottom 202 and 232 and middle chord layer 204 and 230 . a portion of the wall chord layer 206 and 234 , the extension 210 and 236 , extends from the middle chord layer 204 and 230 and is used to connect the upper and lower supporting chord elements 200 and 228 . the upper wing section 212 comprises an upper skin layer 214 and a lower skin layer 216 , and a stringer element 218 therebetween . the upper skin layer 214 and lower skin layer 216 are fastened to the top chord layer 202 and middle chord layer 204 of the upper supporting chord element 200 , respectively , each being fastened with fasteners 34 . the lower skin layer 216 of the upper wing section 212 is overlaid upon the middle chord layer 204 and the stringer 218 , and is fastened to both of those parts . overlaid upon and connecting to the lower skin layer 216 may be a stringer fitting 24 . the upper interior section 220 comprises an upper skin layer 222 and lower skin layer 224 , and a stringer 226 therebetween . the upper and lower skin layers 222 and 224 are fastened to the top and middle chord layers 202 and 204 of the upper supporting chord element , respectively , each being fastened with fasteners 34 . the lower skin layer 224 of the upper interior section 220 is overlaid upon the middle chord layer 204 and the stringer 226 , and is fastened to both of those parts . overlaid upon and connecting to the lower skin layer 224 may be a stringer fitting 24 . the lower wing section 238 comprises an upper skin layer 240 , a lower skin layer 242 , and a stringer element 244 therebetween . the upper skin layer 240 is fastened to the middle chord layer 230 of the lower supporting chord element 228 with fasteners 34 and the lower skin layer 242 is connected to the lower chord layer 232 of the lower supporting chord element 228 with fasteners 34 . a portion of the stringer 244 is also overlaid upon and connected to the middle chord layer 230 of the lower supporting chord element 228 . the lower inner section 246 comprises an upper skin layer 248 , a lower skin layer 250 , and a stringer 252 therebetween . the upper skin layer 248 is fastened to the middle chord layer 230 of the lower supporting chord element 228 with fasteners 34 and the lower skin layer 250 is connected to the lower chord layer 232 of the lower supporting chord element 228 with fasteners 34 . a portion of the stringer 252 is also adjacent to and connected to the middle chord layer 230 of the lower supporting chord element 228 . a spice plate 30 is adjacent to and fastened with fasteners 34 to the lower skin layers 242 and 250 of the lower wing section 238 and lower inner section 246 . the spice plate 30 serves to fasten the skin elements 242 and 250 together . the extensions 210 and 236 of the upper and lower supporting chord elements 200 and 228 are each connected to a body web stiffener 28 , thereby connecting the upper and lower portions together . an issue often arises with wing side - of - body joint assemblies 12 when joint elements such as the chord elements 18 are configured to produce internal reduced clearance regions 32 . as can be visually seen in fig2 , when such chord elements 18 have such reduced clearance regions 32 in addition to being fastened on multiple sides , the ability to position traditional headed bolts into the reduced clearance region 32 may be difficult or impossible . in addition , the ability to nut - side tighten to prevent bolt rotation may be increasingly difficult with existing designs . the present invention , however , utilizes a special cylindrical bolt assembly 34 to allow simplified joint assembly and reliable nut side torque application . a simplified detail of the joint assembly 12 is illustrated in fig3 and 4 a - c . the present cylindrical bolt assemblies 34 are comprised of a cylindrical stud 36 having a threaded head section 38 and a threaded tail section ( nut ) 40 . the threaded head section 38 allows the cylindrical stud 36 to be pushed from outside the reduced clearance region 32 through both the chord 18 and skin 20 . this way , only a threaded head fastener 42 , and possibly head washers 44 , need be navigated into the reduced clearance region 32 rather than an entire bolt assembly . this drastically reduces assembly difficulties . in addition , the present invention contemplates the use of a cap nut 46 as the threaded head fastener 42 . the cap nut 46 may be tightened down against the cylindrical stud 36 until the end of the stud 36 on the threaded head section 38 contacts the bottom of the cap nut 46 , thus limiting further rotation of the nut 46 and forming a rigid fastener head 48 . a crimp or non - metallic insert in the cap nut 46 ensures that the nut 46 remains firmly locked in place after the fastener installation is complete . in this fashion , all the benefits of a traditional solid head bolt are achieved without the assembly difficulties . a nut element 50 , in combination with tail washers 52 , may be torqued onto the cylindrical stud 36 without rotation of the stud by restraining rotation of the cap nut 46 with a conventional wrench . although the formation of a rigid fastener head 48 , as described above , will preclude stud rotation during installation of the nut element 50 , the present invention further contemplates the use of a wrenching features 54 formed on the threaded tail section 40 . the wrenching feature 54 is intended to encompass a wide variety of features capable of restraining rotation of the cylindrical stud 36 without requiring access to the threaded head fastener 42 . these include , but are not limited to , prismatic extensions 56 as shown in fig6 , hexagonal recesses 58 as shown in fig7 , and spline recesses 59 as shown in fig8 . the wrenching features are restrained with a corresponding wrench or key to secure the cylindrical stud 36 while torque is applied purely to the nut element 50 . in addition , the wrenching feature 54 allows for the use of an open head nut 60 as the threaded head fastener 42 , as shown in fig5 a - 5c . the open head nut 60 is threaded onto the threaded head section 38 until the desired threat protrusion level is achieved . thread protrusion is the length of thread from the threaded head section 38 projecting past the nut 60 as it is installed , and is commonly used as a means to ensure proper engagement of typical bolt and nut elements . during this operation , rotation of the stud 36 is prevented by reacting the nut 60 locking torque at the wrenching feature 54 . installation of the nut element 50 is then accomplished by applying a torque to the nut element 50 and using the wrenching feature 54 to keep the stud 36 from rotating . this allows for a standard nut to be utilized as the threaded head fastener 42 which may reduce cost and simplify disassembly should it be desirable . a threaded head fastener with stop features ( indentation ) 110 may also be used to provide automatic orientation of the head fastener 110 with respect to the stud 36 and 120 . finally , as an added feature to reduce weight or further conserve space , the wrenching feature 54 may be frangible as shown in fig4 c . this means that after its use to restrain the cylindrical stud 36 while torque is applied to the nut element 50 , the wrenching feature 54 may be broken off to reduce weight or improve accessibility to other joint regions . a mechanism to automatically orient the threaded head fastener with respect to the stud is provided in fig9 - 12 . referring now to fig9 , a cylindrical bolt assembly with a threaded head fastener with stop indentations 110 and stud 120 exhibiting the stop projections 112 are shown . the nut has two stop indentations 112 into which two stop projections 122 fit , to lock the threaded head fastener in the proper orientation with respect to the bolt . the threaded head fastener also comprises a base 114 , into which the second end 124 of the stud 120 fits . referring now to fig1 , an assembled stud and threaded head fastener 110 is shown . to assemble the threaded head fastener and stud into this configuration , the second end 124 of the stud 120 is inserted into the base 114 of the threaded head fastener 110 . the stop projections 122 may be either in a depressed or raised position . in the depressed position , the stop projections 122 are substantially within the stud 120 , thereby allowing for the head fastener to rotate and fasten onto the stud . the stop projections 122 are also sloped such that upon insertion of the stud 120 into the head fastener 110 , the stop projections 122 are pushed into the depressed position , allowing the head fastener 110 to pass over the stop projections 122 so that the head fastener 110 may be fastened onto the stud 120 . rotational fastening continues until the stop projections 122 re - emerge into the stop indentations 112 on the head fastener 110 . the stop projections 122 may be spring loaded so that they are biased towards the raised position . this allows the stop projections 122 to spring out of the stud once they are aligned with the stop indentations 112 of the head fastener 110 , thereby locking the stud 110 into a fixed position relative to the head fastener 120 . in fig1 , a ball - bearing shaped projection 123 is shown and serves the same function as stop projection 122 . the ball - bearing shaped projection 123 may be depressed into the stud 120 and may retain the head fastener 110 in a fastened position . referring now to fig1 a - 11c , a wing - side of body joint utilizing the fastener with self - indexing nut system is shown , as well as a method of assembling a fastener with self - indexing nut system . the fastener with self - indexing nut system comprises a stud 120 with a threaded head fastener 110 and a threaded tail fastener 50 or nut . the stud 120 comprises a first end 126 and a second end 124 , and a stud 120 extending therebetween . spaced apart from the first end is a first threaded section 128 which runs to an unthreaded middle section 130 . spaced apart from the second end 124 is a second threaded section 132 which runs to the unthreaded middle section 130 . a wing - side of body joint comprises a chord element 18 and skin element 20 which define a reduced clearance region 32 . a stud 120 with stop projections 122 fits through the chord 18 and skin 20 into the reduced clearance region 32 . the second threaded section 132 is fastened to a threaded head fastener 110 . a threaded tail fastener or nut 50 is attached to the first threaded section . a wrenching feature 54 is found adjacent to the first end 126 of the stud 120 . for assembly , the threaded head fastener 110 is placed within the low - clearance region 32 , over the hole through which the stud 120 is to be inserted . the stud 120 is then inserted and the head fastener 110 is rotated until the stop projections 122 emerge through the stop indentations 112 . at this point , a threaded tail fastener is fastened to the non - blind end and the wrenching feature may be broken off . during installation of the threaded tail fastener , the wrenching feature is held to prevent turning of the stud within the hole , thereby preventing scoring of the stud hole . referring now to fig1 , alternate stop indentations and stop projections are shown . note that the stop projections may be found towards the end of the head fastener or spaced apart from the head fastener and that stop indentations and stop projections may be of any shape , including but not limited to circular , rectangular , square , triangular , hexagonal , star shaped , or any other appropriate shape . while the invention has been described in connection with one or more embodiments , it is to be understood that the specific mechanisms and techniques which have been described are merely illustrative of the principles of the invention , numerous modifications may be made to the methods and apparatus described without departing from the spirit and scope of the invention as defined by the appended claims .	1
fig1 shows an example of a typical exhaust system employing a valve 10 embodying principles of the invention , a main catalyst 12 , and a close - coupled catalyst 14 . fig1 shows valve 10 in its normally open condition that allows engine exhaust gases to pass directly to main catalyst 12 , rather than passing through close - coupled catalyst 14 . when valve 10 is operated closed , it blocks the direct communication of the entrance of main catalyst 12 with the engine exhaust manifold so that as a result the exhaust is forced to flow through close - coupled catalyst 14 before entering main catalyst 12 . the opening and closing of valve 10 is remotely controlled by a control system having inputs sensing certain conditions relating to engine operation and an output that operates the valve via an actuator mounted adjacent the valve . fig2 illustrates such an actuator 16 , and fig2 - 8 disclose details of valve 10 . valve 10 comprises a body 18 having a cylindrical wall 20 bounding an exhaust flow path 22 through body 18 between a valve inlet and a valve outlet . transversely diametrically spanning flow path 22 is a cylindrical shaft 24 , that is shown by itself in fig7 prior to its assembly to other parts of the valve . shaft 24 has three different diameter portions , 24a , 24b , 24c , that become successively smaller from right to left in fig7 so as to define two shoulders 24d , and 24e , as shown . shaft portion 24a is circular in cross section , and its far right end serves to journal that end of the shaft on wall 20 via a journal bearing 26 . shaft portion 24b is circular in cross section and has an intermediate section journaled on wall 20 via a journal bearing 28 diametrically opposite bearing 26 about flow path 22 . the journaling of shaft 24 on body 18 via these two bearings provides for the shaft to execute rotary motion about an axis 30 that is coincident with the shaft &# 39 ; s own axis . a blade 32 , that is shown by itself in fig3 and 4 , is disposed on shaft portion 24a within flow path 22 . a central region of blade 32 is shaped into three distinct portions 32a , 32b , and 32c which define a circular aperture 34 into which shaft portion 24a is pressed . portions 32a , 32c define a certain arcuate extent of the aperture about axis 30 , while portion 32b defines an opposite arcuate extent . thus blade 32 has two opposite halves 32d , 32e that are non - co - planar . they are also asymmetrical . each blade half 32d , 32e has a corresponding arcuate edge 32d &# 39 ;, 32e &# 39 ; that is slightly less than a semi - circle . these edges 32d &# 39 ;, 32e &# 39 ; are joined by respective edges 32f , 32g that span portions 32a , 32c respectively and occupy mutually parallel planes which are perpendicular to axis 30 . proximate edge 32f , edge 32d &# 39 ; is provided with a stop tang 32h . blade 32 is united for rotation with shaft 24 by any suitable means of joining , such as by welding the blade to the shaft . disposed on shaft 24 between blade 32 and bearing 28 are two washers 36 , 38 . a third washer 40 is disposed on shaft 24 on the opposite axial face of bearing 28 from washers 36 , 38 . an actuating lever , or crank , 42 , that is shown by itself in fig5 and 6 , is disposed on shaft portion 24c and secured to that end of the shaft . a bellows 44 is disposed over shaft portion 24b and extends between lever 42 and washer 40 . body 18 is metal , such as a nodular iron , which possess a certain degree of ductility . this allows bearings 26 , 28 to be crimped in place on body 18 by respective crimps 46 , 48 after they have been disposed in respective mounting holes 50 , 52 that extend through bosses in diametrically opposites sides of wall 20 between the interior and exterior of body 18 . prior to mounting of bearing 26 in its hole 50 , crimp 46 has not yet been formed . this allows bearing 26 to be pressed into hole 50 from the outside of body 18 until a shoulder 54 that extends around the outside of the bearing abuts a shoulder 56 of hole 50 . then the exterior of the boss is deformed against the bearing to create the crimp . this mounting of bearing 26 in wall 20 creates a surface to surface sealing of the bearing to the wall , and since the bearing contains a blind journal hole for receiving the end of shaft 24 , exhaust gases cannot leak from the valve &# 39 ; s interior via this bearing . the other journal also sealed against escape of exhaust gases even though lever 42 is disposed on the exterior of the valve for connection to actuator 16 . bearing 28 is installed in hole 52 in like manner to the installation of bearing 26 just described , bearing 28 and hole 52 having respective abutting shoulders 58 of bore 28 , 60 of body 18 ; however , as will become more apparent from ensuing description , bearing 28 is pre - assembled onto shaft 24 along with parts 36 , 38 , 40 , 42 , and 44 before it is inserted into hole 52 and crimped in place . accordingly in the completed valve , there is surface to surface sealing of bearing 28 to wall 20 against escape of exhaust gases past the bearing &# 39 ; s o . d . unlike bearing 26 however , bearing 28 does not have a blind hole , but rather a through - hole through which shaft portion 24b extends . thus , it is necessary to prevent escape of exhaust gases via the running clearance between the shaft o . d . and the bearing i . d . this is accomplished as follows . washer 36 is a metal washer that is assembled onto shaft portion 24b to abut shoulder 24d . washer 38 is a ceramic thrust washer , aluminum oxide for example , that is assembled onto shaft portion 24b so as to space washer 36 from bearing 28 . washer 40 is a ceramic thrust washer , aluminum oxide for example , that is assembled onto shaft portion 24b for disposition against the outer face of bearing 28 . bellows 44 is assembled onto shaft portion 24b and finally lever 42 is assembled onto shaft portion 24c and abutted with a proximate radial end wall 44a of bellows 44 to sandwich that end wall between itself and shoulder 24e . end wall 44a has a hole through which shaft 24 passes thus centering this axial end of the bellows with respect to axis 30 . the free end of shaft portion 24c is then deformed to create a head 62 that keeps the lever sandwiching bellows end wall 44a between itself and shoulder 24e . the opposite axial end of bellows 44 has an open circular axial wall 44b that is adjoined interiorly by a circular radial wall 44c . wall 44b closely overlaps the o . d . of washer 40 to thereby center this end of the bellows on the washer and hence with axis 30 . in the finished valve , bellows 44 is resiliently compressed between lever 42 and washer 40 . this is because the difference between the sum of the axial dimensions of parts 36 , 38 , 28 , and 40 along shaft 24 and the distance between shoulders 24d , 24e is less than the free uncompressed length of bellows 44 . since lever 42 and washer 36 are disposed at defined locations along shaft 24 by virtue of their respective abutments with shoulders 24e , 24d , the resilient axial compression of bellows 44 creates a bias force that continually urges wall 44c into surface to surface sealing contact with the radially outer margin of the outer face of washer 40 , and in turn the interior face of washer 40 into surface to surface sealing with the outer face of bearing 28 , while simultaneously urging shoulder 24d against the inner face of washer 36 , and in turn the outer face of washer 36 into surface to surface sealing with the inner face of washer 38 , and in turn the outer face of washer 38 into surface to surface sealing with the inner face of bearing 28 . fig5 shows that lever 42 has a non - circular hole 42a via which it is fitted onto shaft portion 24c . accordingly , it should be understood that shaft portion 24c has a similar initial shape that allows the lever to be assembled onto it prior to creation of head 62 . lever 42 also has a pierced circular hole 42b in spaced relation to hole 42a . hole 42b provides for the operative connection of the movement of actuator 16 to the lever . the body of actuator 16 is mounted to the exterior of valve body 18 by a bracket 64 , as shown in fig2 . the actuator &# 39 ; s movement comprises a rod 66 that is mainly straight , but whose distal end 68 is bent at a right angle to pass through hole 42b of lever 42 . a keeper 70 such as a retaining ring is assembled onto end 68 as shown to keep it from coming out of hole 42b . actuator 16 is a conventional vacuum - actuated device . it has a housing 72 that is divided into two chambers , a vacuum chamber 74 and an atmospheric chamber 76 , by a diaphragm 78 . a spring 80 biases diaphragm 78 toward atmospheric chamber 76 . when no vacuum is communicated to vacuum chamber 74 so that the vacuum chamber is at atmosphere , the actuator assumes the position of fig2 corresponding to valve 10 being open as portrayed by fig2 . when vacuum is introduced into the vacuum chamber , the greater pressure in the atmospheric chamber pushes diaphragm 78 toward vacuum chamber 74 against the force of spring 80 . actuator rod 66 retracts into actuator housing 72 rotating lever 42 , and hence shaft 24 , in the process . consequently , valve 10 is operated closed . the interior of wall 20 has arcuate ledges 82 , 84 against which the arcuate edges of the blade close . when the vacuum in the vacuum chamber disappears , actuator rod 66 extends , rotating lever 42 and shaft 24 in the direction of opening the valve . the full open position is defined by the abutment of stop tang 32h with ledge 84 . fig9 shows a modification wherein a circular annular groove 86 is provided in the outer axial face of bearing 28 and axial wall 44b full overlaps washer 40 and extends into groove 86 . the walls of groove 86 should provide a running clearance for wall 44b , but is preferably dimensioned to provide a labyrinth type seal between the two . due to the harsh environment , the selection of materials is important . bellows 44 , washer 38 , shaft 24 , blade 32 are preferably stainless steel . journal bearings 26 , 28 also are preferably stainless steel . a representative force that is exerted by the compressed bellows is in the 3 - 4 pound range . the process for assembling the valve comprises creating a shaft sub - assembly , as described earlier , and while blade 32 is disposed in flow path 22 with its aperture 34 aligned with the blind hole in bearing 26 , inserting the shaft sub - assembly through hole 52 until bearing 28 is seated in that hole . during insertion , shaft portion 24a passes through aperture 34 . after the insertion , crimp 48 is formed , and blade 32 welded to shaft 24 . the actuator rod end 68 is then connected to lever 42 . while a certain amount of precision in the shaft and its associated parts is necessary in order to achieve the best possible sealing , sealing of the blade to the flow path wall when the valve is closed may not require the same level of precision ; in other words , some leakage through the valve may be acceptable in certain uses of the valve . moreover , the valve may be used in exhaust system configurations other than the one specifically illustrated herein . while a presently preferred embodiment of the invention has been illustrated and described , it should be appreciated that principles are applicable to other embodiments that fall within the scope of the following claims . fig1 , 11 , and 12 disclose an embodiment that contains all the features of fig2 similarly numbered , but differing in that shaft 24 is non - perpendicular to the axis of the circular wall 20 even though the shaft axis 30 still intersects the wall &# 39 ; s axis . the mounting of actuator 16 on valve body 18 is modified so that rod 66 continues to act on lever 42 generally in a plane that is perpendicular to axis 30 . blade 32 is now fully circular and generally planar and comprises a ring seal 90 around its full circumference that is effective to seal the full circumference of the blade to wall 20 when the valve is closed . an integral sleeve 92 passes through the generally planar blade from one face to the other . shaft 24 passes through the sleeve , coupling the blade and shaft for rotary motion in unison while also closing the sleeve so that exhaust cannot pass through the sleeve from one face of the blade to the other . this embodiment will provide improved sealing of the blade to the body when the valve is closed , and consequently less leakage through the closed valve .	5
the method of secure communication between endpoints according to an embodiment of the present invention is mainly designed to implement secure communication between endpoints in different gk management domains in h . 323 - based multimedia communication system in direct routing mode . compared to the prior art , the method of secure communication between endpoints according to an embodiment of the present invention is able to reduce the number of encryption / decryption operations between the home gate keeper of the calling endpoint and the home gate keeper of the called endpoint and support the home gate keeper management domain of the calling endpoints and the home gate keeper management domain of the called endpoint to employ different encryption / decryption algorithms , and the calling endpoint and the called endpoint to employ different encryption / decryption algorithms ; the shared key between the calling endpoint and the called endpoint is generated by the home gate keeper of the called endpoint ; whether to receive the call messages or not is fully controlled by the home gate keeper of the called endpoint and itself , so that it is free from the control of the home gate keeper of the calling endpoint and the called party can lay more trust on the shared key between the endpoints ; such trust mechanism is crucial to operators . in the method of secure communication between endpoints according to an embodiment of the present invention , for communication between endpoints ( eps ) in different gate keeper ( gk ) management domains , when the calling endpoint calls the called endpoint , the home gk of the called endpoint generates a shared key between the calling endpoint and the called endpoint ; the secure communication processing is carried out between the calling endpoint and the called endpoint with the shared key generated by the home gk of the called endpoint . wherein , the process that secure communication between the calling endpoint and the called endpoint is carried out with the shared key generated by the home gk of the called endpoint mainly includes : the calling endpoint or called endpoint utilizes the shared key generated by the home gk of the called endpoint to encrypt the messages to be sent to the counterpart endpoint ; at the same time , the calling endpoint or called endpoint utilizes the shared key generated by the home gk of the called endpoint authenticates the messages sent from the counterpart endpoint and check the message &# 39 ; s integrity . to achieve secure communication between above calling endpoint and called endpoint with the shared key generated by home gk of the called endpoint , the following two tasks need to be accomplished : the home gk of the called endpoint shall encrypt the shared key between the calling endpoint and the called endpoint and then transmit the encrypted shared key to the calling endpoint ; the calling endpoint in turn decrypts the encrypted shared key and utilizes it to encrypt the setup message and subsequent service messages to be sent to the called endpoint ; as shown in fig2 , showing , in the method of secure communication between endpoints according to an embodiment of the present invention , the procedures in which the home gate keeper of the called endpoint encrypts the shared key between the calling endpoint and the called endpoint and then transmits the encrypted shared key to the calling endpoint , and the calling endpoint in turn decrypts the encrypted data to obtain the corresponding shared key , the processing procedures are as follows : step s 1 : when the calling endpoint is to call an endpoint in a different gk management domain from itself , it generates an admissions request ( arq ) message containing called endpoint identification information and then sends the arq message to its own home gk ; step s 2 : with the called endpoint identification information contained in the arq message , the home gk of the calling endpoint locates the gk management domain in which the called endpoint is , and generates a location request ( lrq ) message containing called endpoint identification information and sends it to the home gk of the called endpoint ; step s 3 : after the home gk of the called endpoint receives the lrq message , it generates a shared key between the calling endpoint and the called endpoint ; step s 4 : the home gk of the called endpoint encrypts the shared key between the calling endpoint and the called endpoint in the first encryption mode , and sends the encrypted data to the home gate keeper of the calling endpoint ; in detail , the process that it encrypts the shared key between the calling endpoint and the called endpoint with the first encryption mode , and sends the encrypted data to the home gate keeper of the calling endpoint includes : the administrator presets the shared key between the home gate keeper of the calling endpoint and the home gate keeper of the called endpoint and presets the first key derivation algorithm and the first encryption algorithm within the home gate keeper of the called endpoint ; the two algorithm rules may be standard ones in the prior art ; then the shared key between the calling endpoint and the called endpoint will be processed in the home gate keeper of the called endpoint as follows : the home gate keeper of the called endpoint controls the random sequence generator to generate the first random sequence ; and creates the first clear token clear token1 ; first , it encrypts the shared key between the home gate keeper of the calling endpoint and the home gate keeper of the called endpoint with the first random sequence on the basis of the first key derivation algorithm , to obtain the first derived key ; second , it encrypts the shared key between the calling endpoint and the called endpoint with the obtained first derived key on the basis of the first encryption algorithm , to obtain the first encryption result ; next , it sets the first encryption result , the first random sequence , the first key derivation algorithm and the first encryption algorithm into the respective fields of the first clear token ; finally , it encapsulates the first clear token into the location confirm ( lcf ) message , and feeds back the lcf message to the home gate keeper of the calling endpoint . in this way , it is achieved that the home gate keeper of the called endpoint encrypted the shared key between the calling endpoint and the called endpoint in the first encryption mode and sent the encrypted data to the home gate keeper of the calling endpoint . step s 5 : the home gk of the calling endpoint decrypts the received encrypted data in the first decryption mode to obtain the shared key between the calling endpoint and the called endpoint ; the first decryption process based on the first encryption mode described above is as follows : the home gk of the calling endpoint reads the first encryption result , the first random sequence , the first key derivation algorithm and the first encryption algorithm in the respective fields of the first clear token in the received lcf message ; the home gk of the calling endpoint performs encryption on the shared key between the home gk of the calling endpoint and the home gk of the called endpoint with the first random sequence on the basis of the first key derivation algorithm , to obtain the first derived key ; then , the home gk of the calling endpoint performs decryption on the first encryption result with the obtained first derived key on the basis of the first encryption algorithm , to obtain the shared key between the calling endpoint and the called endpoint . step s 6 : the home gk of the calling endpoint encrypts the shared key between the calling endpoint and the called endpoint in the second encryption mode and sends the encrypted data to the calling endpoint ; wherein in detail , the process of encrypting the shared key between the calling endpoint and the called endpoint with the second encryption mode , and sending the encrypted data to the calling endpoint includes : the administrator presets the shared key between the calling endpoint and the home gk of the calling endpoint and presets the second key derivation algorithm and the second encryption algorithm within the home gk of the calling endpoint ; the home gk of the calling endpoint controls the random sequence generator to generate the second random sequence and creates the second clear token clear token2 ; first , the home gk of the calling endpoint performs encryption on the shared key between the calling endpoint and the home gk of the calling endpoint with the second random sequence on the basis of the second key derivation algorithm , to obtain the second derived key ; and the calling endpoint performs encryption again on the shared key between the calling endpoint and the called endpoint with the obtained second derived key on the basis of the second encryption algorithm , to obtain the second encryption result ; next , the home gk of the calling endpoint sets the second encryption result , the second random sequence , the second key derivation algorithm and the second encryption algorithm described above into the respective fields of the second clear token , respectively ; and the calling endpoint encapsulates the second clear token into the admissions confirm ( acf ) message , and feeds back the acf message to the calling endpoint . step s 7 : the calling endpoint decrypts the received data in the second decryption mode to obtain the shared key between the calling endpoint and the called endpoint ; the second decryption process based on the second encryption mode described above is as follows : the calling endpoint reads the second encryption result , the second random sequence , the second key derivation algorithm and the second encryption algorithm recorded in the respective fields of the second clear token in the received acf message ; the calling endpoint encrypts the shared key between the calling endpoint and the home gate keeper of the calling endpoint with the second random sequence on the basis of the second key derivation algorithm , to obtain the second derived key ; and the calling endpoint decrypts the second encryption result with the obtained second derived key on the basis of the second encryption algorithm , to obtain the shared key between the calling endpoint and the called endpoint . step s 8 : then the calling endpoint can encrypt the setup message and the subsequent service messages to be sent to the called endpoint with the shared key between the calling endpoint and the called endpoint obtained in step s 7 and ensure that the messages can be sent out only after they are encrypted with the shared key , in order to enhance communication security . and , it is needed that the home gk of the called endpoint encrypt the shared key between the calling endpoint and the called endpoint and transmit the encrypted shared key to the called endpoint ; the called endpoint in turn utilizes the decrypted shared key to authenticate the setup message and the subsequent service messages sent from the calling endpoint and check the message &# 39 ; s integrity . fig3 shows the procedures in which the home gate keeper of the called endpoint encrypts the shared key between the calling endpoint and the called endpoint and then transmits it to the called endpoint , and the called endpoint in turn decrypts the encrypted data to obtain the corresponding shared key , with the method of secure communication between endpoints according to an embodiment of the present invention ; the procedures are as follows : step s 10 : when the calling endpoint is to call an endpoint in a different gk management domain from itself , it generates an admissions request ( arq ) message containing called endpoint identification information and then sends the arq message to its own home gk ; step s 20 : with the called endpoint identification information contained in the arq message , the home gk of the calling endpoint locates the gk management domain in which the called endpoint is , and generates a location request ( lrq ) message containing the called endpoint identification information and sends to the home gk of the called endpoint ; step s 30 : after the home gk of the called endpoint receives the lrq message , it generates the shared key between the calling endpoint and the called endpoint ; step s 40 : the home gk of the called endpoint encrypts the shared key between the calling endpoint and the called endpoint in the third encryption mode , and sends the encrypted data to the home gate keeper of the calling endpoint ; in detail , the process that the home gk of the called endpoint encrypts the shared key between the calling endpoint and the called endpoint with the third encryption mode , and sends the encrypted data to the home gate keeper of the calling endpoint includes : the administrator presets a shared key between the called endpoint and the home gk of the called endpoint and presets the third key derivation algorithm and the third encryption algorithm within the home gk of the called endpoint ; the two algorithm rules may also be standard ones in the prior art ; then the shared key between the calling endpoint and the called endpoint will be processed in the home gk of the called endpoint as follows : the home gk of the called endpoint controls the random sequence generator to generate the third random sequence and creates the third clear token clear token3 ; the home gk of the called endpoint performs encryption on the shared key between the called endpoint and the home gk of the called endpoint with the third random sequence on the basis of the third key derivation algorithm , to obtain the third derived key ; the called endpoint performs encryption again on the shared key between the calling endpoint and the called endpoint with the above obtained third derived key on the basis of the third encryption algorithm , to obtain the third encryption result ; next , the home gk of the called endpoint sets the third encryption result , the third random sequence , the third key derivation algorithm and the third encryption algorithm described above into the respective fields of the third clear token , respectively ; finally , the third clear token is encapsulated into the lcf message , and feeds back the lcf message to the home gate keeper of the calling endpoint . step s 50 : the home gk of the calling endpoint takes out the third clear token contained in the received lcf message and encapsulates it into the acf message and feeds back to the calling endpoint ; step s 60 : the calling endpoint takes out the third clear token contained in the acf message , and encapsulates it into the setup message and sends to the called endpoint . step s 70 : the called endpoint decrypts the received data in the third decryption mode , to obtain the shared key between the calling endpoint and the called endpoint ; the third decryption process based on the third encryption described above is as follows : the called endpoint reads the third encryption result , the third random sequence , the third key derivation algorithm and the third encryption algorithm recorded in the respective fields of the third clear token in the received setup message ; the called endpoint encrypts the shared key between the called endpoint and the home gk of the called endpoint with the third random sequence on the basis of the third key derivation algorithm , to obtain the third derived key ; and the called endpoint decrypts the third encryption result with the third derived key on the basis of the third encryption algorithm , to obtain the shared key between the calling endpoint and the called endpoint ; after the called endpoint obtains the shared key between the calling endpoint and the called endpoint , it can utilize the shared key to authenticate the setup message and the subsequent service messages sent from the calling endpoint and check the message &# 39 ; s integrity . wherein , in the encryption / decryption of the shared key between the calling endpoint and the called endpoint with the first encryption / decryption mode , the second encryption / decryption mode and the third encryption / decryption mode , the random sequence used in solving the derived key with the key derivation algorithm is the same as that used in the encryption of the shared key between the calling endpoint and the called endpoint with the encryption algorithm ; of course , the two operation processes may also use different random sequences ; however , the operation principle is similar and will not be described further here . of course , after the calling endpoint and the called endpoint obtain the shared key between themselves , each end can utilize the shared key to encrypt the messages to be sent to the counterpart endpoint and authenticate the messages sent from the counterpart endpoint or check the message &# 39 ; s integrity . hereinafter , the implementation of the method of secure communication between endpoints according to an embodiment of the present invention is detailed , with h . 235 protocol as an example . fig4 shows the processing procedures in an embodiment of the method of secure communication between endpoints of the present invention ; in the embodiment , the gk discovery procedure ( grq / gcf procedure ), endpoint registration procedure ( rrq / rcf procedure ), and negotiation of security features between endpoint and its home gk , are ignored here ; all of them are standard procedures in h . 235 protocol without any change , and thus are not described in detail . for detailed information , please see h . 235 v3 . in addition , the preconditions of the embodiment include : gk has authenticated the endpoints managed by itself , and the endpoints have authenticated their home gk , so that the endpoints and their home gk trust each other . the home gate keeper gkg of the calling endpoint epa and the home gate keeper gkh of the called endpoint epb have authenticated each other , to avoid malicious attacks . under the above preconditions , security of the ras messages can be assured substantially between the calling endpoint epa and the called endpoint epb . meanwhile , the embodiment also requires another precondition : a shared key kag has been set between the calling endpoint epa and its home gate keeper gkg ; a shared key kgh has been set between the home gkg of epa and the home gkh of epb ; and a shared key kbh has been also set between the called endpoint epb and its home gate keeper gkh . in direct routing mode , if q931 messages are not authenticated between epa and epb , it is unable to assure security of the entire calling process , even though the ras messages between epa and epb are secure . therefore , the core of an embodiment of the present invention is to negotiate a security solution ( i . e ., the shared key between epa and epb ) during the secure ras message interaction process , so that subsequent q931 messages can be communicated securely between epa and epb with the security solution obtained through negotiation ( wherein , the procedures in dotted lines in fig4 indicate the ras message interaction process between endpoints ; while the procedures in solid lines indicate the q931 message interaction process between endpoints ). the detailed flow is as follows : epa sends an arq message carrying a clear token cleartoken to its home gkg ; the tokenoid field in the cleartoken is set to “ i0 ”, indicating that epa supports the appendix i of h . 235 v3 ; other fields in the cleartoken are void . in addition , the arq message also carries epb identification information . after gkg receives the arq message sent from epa , it will know that epb is not in its management domain according to the epb identification information contained in the arq message ( the destinationinfo field or destcallsignaladdress field in arq message indicates the epb identification information ), and initiates an lrq message to gkh to inquire the address of epb . when gkg converts the arq message to lrq message , it finds that the value of tokenoid field of cleartoken contained in the arq message is “ i0 ” and thus knows epa supports the features defined in appendix i of h . 235 v3 , and then gkg also generates a cleartoken in the lrq message , with the tokenoid field also set to “ i0 ”; other fields in cleartoken are void ; the endpointidentifier field of the lrq message is set to endpoint id of calling endpoint epa , and the destinationinfo field or destcallsignaladdress field of the lrq message is set to endpoint id of called endpoint epb . if gkg doesn &# 39 ; t support the features defined in is appendix i , it is unnecessary to create a cleartoken whose tokenoid field is “ i0 ” in the lrq message sent out , and the subsequent process will interact by massage in the common communication mode not supporting appendix i . after gkh receives the lrq message , it checks whether the value of tokenoid field of independent cleartoken in the lrq message is “ i0 ”; if the value of tokenoid field is “ i0 ”, it is indicated that the counterpart endpoint supports the features defined in appendix i . if gkh itself also supports the features defined in appendix i , it inquires whether the called epb supports the features defined in appendix i according to the endpoint id information of called endpoint epb provided by the lrq message . if both the called endpoint epb and gkh support the features defined in appendix i , gkh generates a shared key kab between epa and epb ; next , gkh generates a random sequence challenge1 , calculates on the shared key kgh between gkh and gkg and challenge1 with the predefined key derivation algorithm to obtain the derived key ekgh of kgh , and then encrypts kab with the obtained derived key ekgh and the predefined encryption algorithm to obtain ekab1 ; gkh sets ekab1 and encryption parameters ( encryption algorithm , initial vector used in encryption , and random sequence , etc .) into the respective subfields of cleartoken . h235key . securesharedsecret field of an independent clear token cleartoken , respectively ; if the lrq message received by gkh contains the endpointidentifier field , gkh will set the data of this endpointidentifier field into the cleartoken . h235key . securesharedsecret . generalid field of cleartoken ; gkh sets the key derivation algorithm used in solving the derived key ekgh into cleartoken . h235key . securesharedsecret . keyderivationoid field of the cleartoken and sets challenge1 used in solving the derived key ekgh into cleartoken . challenge field of the cleartoken ; the cleartoken . generalid field of the cleartoken is set to endpoint id information of gkg , the cleartoken . senderid is set to the endpoint id of gkh , and finally , gkh sets tokenoid field of this cleartoken as “ i3 ”; hereinafter the cleartoken is abbreviated as ct3 . similarly , gkh operates on the shared key kbh between gkh and epb and another challenge with another key derivation algorithm to obtain the derived key ekbh , encrypts kab with the obtained ekbh on the basis of another encryption algorithm to obtain ekab2 ; gkh sets the encryption result ekab2 and the encryption parameters ( encryption algorithm , initialization vector used in encryption , and random sequence , etc .) into the respective subfields of cleartoken . h235key . securesharedsecret field of another clear token cleartoken , respectively ; if the lrq message received by gkh contains the endpointidentifier field , gkh will also set the data of that field into h235key . securesharedsecret . generalid field of the cleartoken ; the challenge used in solving the derived key ekbh is set to cleartoken . challenge field , the cleartoken . generalid field is set to endpoint id of epb , the cleartoken . senderid field is set to endpoint id of gkh , and finally , the tokenoid of this cleartoken is set to “ i2 ”; this cleartoken is referred to as ctb in h . 235 v3 , and thereby ctb is used to represent this cleartoken in the following . gkh sets the above obtained ct3 and ctb into the lcf message , and feeds back the lcf message to gkg . when gkg receives the lcf message fed back from gkh , it extracts the cleartoken ; if more than two cleartokens are obtained and the tokenoid of one cleartoken is “ i3 ” ( i . e ., ct3 ) and the tokenoid of the other cleartoken is “ i2 ” ( i . e ., ctb ), it indicates gkh ( including epb ) agrees to use the security solution defined in appendix i . gkg constructs an acf message , and creates a new cleartoken whose tokenoid is set to “ i1 ” ( this cleartoken is referred to as cta in h . 235 v3 , and thereby , hereinafter , it is referred to as cta ); and gkg generates a random challenge and sets it into cta . challenge ; it decrypts the data of ct3 . h235key . securesharedsecret . encryptedsessionkey field with the parameters ( challenge , key derivation algorithm , encryption algorithm , initialization vector used in encryption , etc .) provided from ct3 and the shared key kgh ( in practice , the derived key ekgh shall be obtained by operating on kgh through the key derivation algorithm ), to obtain the key kab ; gkg solves the derived key ekag with the shared key kag between the calling endpoint and the home gate keeper of the calling endpoint as well as the preset key derivation algorithm for operation of the challenge in cta . challenge , encrypts kab with ekag , and sets the encryption result and the encryption parameters into the corresponding subfields in cta . h235key . securesharedsecret , and finally , copies the ctb . generalid information to cta . h235key . securesharedsecret . generalid field ; it copies the entire ctb completely into acf message ; if gkh is unable to set ctb . h235key . securesharedsecret . generalid field because the endpointidentifier field is not set in lrq message received by gkg , gkg need to set endpoint id of epa to ctb . h235key . securesharedsecret . generalid field ; finally , gkg feeds back the acf message processed as above to epa . after epa receives the acf message , it extracts cta and ctb from the acf message , and similarly , decrypts the data in cta . h235key . securesharedsecret . encryptedsessionkey field with the information in cta and the shared key kag between epa and gkg ( in practice , what is used actually is the derived key ekag ), to obtain the key kab . epa creates a setup message , copies the entire cth in the acf message into the setup message , and then utilizes the shared key kab to set the authentication information described in appendix d of h . 235 v3 ; epa sends out the setup message directly to epb . after receiving the setup message , epb processes as follows : extracts ctb contained in the setup message , solves the derived key ekbh of kbh with the information in ctb . generalid , ctb . sendersid , and ctb . challenge fields , etc . as above , and decrypts the data in ctb . h235key . securesharedsecret . encryptedsessionkey field with the derived key ekbh to obtain the key kab ; and authenticates the setup message with the obtained kab . the subsequent processing procedures are identical to those used in a common calling process in an h . 323 - based system . after epb successfully authenticates the setup message sent from epa with the solved kab , it initiates an arq request to its home gkh . after gkh receives the arq message , if it determines epb is an endpoint managed by itself , it feeds back an acf message to epb . after epb receives the acf message fed back from gkh , it sends an alerting message to epa . after epb receives the acf message fed back from gkh , it also sends a connect message to epa . after the communication is accomplished between the endpoints , epa sends epb ( or epb sends epa ) a release complete message . when the step 5 above is over , the shared key kab has been established between epa and epb , and then the setup / alerting / connect / release complete messages ( step 8 - 10 ) in a q931 call process can be performed encryption authentication ( or message integrity check ) with the shared key kab by using h . 235 standard method , so as to ensure security of q931 messages in direct routing mode . though the present invention is described utilizing a preferred embodiment as above , it should be noted that those skilled in the art can easily make changes and modifications without deviating from the principle of the present invention , and such changes and modifications shall fall into the protection scope of the present invention .	7
hereafter , a detailed description will be given of most preferred embodiments of the invention , referring to the drawings thereof . fig1 is a plan view of a liquid crystal display device illustrating an embodiment 1 of a display device of the invention . fig2 is a sectional view taken along line x - x ′ of fig1 . the liquid crystal display device of the embodiment 1 shown in fig1 is configured by sealing in a liquid crystal lc between a principal surface of a tft side flexible substrate f - sub 1 , which is a first plastic substrate , and a principal surface of a cf side flexible substrate f - sub 2 , which is a second plastic substrate , and bonding them together with a frame shaped seal agent sl encircling a display area . a feature of the embodiment lies in adopting a structure in which a wiring substrate fpc is sandwiched between the tft side flexible substrate f - sub 1 and the cf side flexible substrate f - sub 2 . as shown in fig2 , on the principal surface of the tft side flexible substrate f - sub 1 is formed a silicon nitride layer ( a second etch stopper layer hfs 2 to be described hereafter ) which , being a transparent inorganic insulating layer , is attached thereto with an adhesive sl - 1 . also , a pixel circuit , configured of thin film transistors tft , and a wiring connection portion tma are formed on the silicon nitride layer . a plurality of terminals led outside the display area from the pixel circuit , configured of the thin film transistors tft , across the seal agent sl are formed in the wiring connection portion tma . furthermore , a wiring substrate ( a flexible printed substrate ) fpc , which inputs signals and voltages from unshown external circuits ( a display control circuit substrate and a icon substrate ), is connected to the plurality of terminals . also , the principal surface of the cf side flexible substrate f - sub 2 has a transparent silicon nitride layer ( a second etch stopper layer hfs 2 to be described hereafter ) attached thereto with a second adhesive sl - 2 , and a color filter layer cf is provided on the silicon nitride layer . the second adhesive sl - 2 fills a space outside the seal agent sl between the tft side flexible substrate f - sub 1 and the cf side flexible substrate f - sub 2 , covering the wiring connection portion tma and the wiring substrate ( the flexible printed substrate ) fpc . the seal agent sl , and the first adhesive sl - 1 and second adhesive sl - 2 , are made of different materials . it is desirable that the seal agent sl is made of a material which does not contaminate the liquid crystal . then , it is desirable that the first adhesive sl - 1 and the second adhesive sl - 2 are made of a transparent material having a bendable property . this is because the liquid crystal display of the invention is supposed to be a flexible display of which a display surface is bendable . furthermore , it is desirable that the first adhesive sl - 1 and the second adhesive sl - 2 are made of a material having a characteristic of preventing moisture from entering a liquid crystal layer . fig3 a to 3h are views illustrating a method of manufacturing the liquid crystal display device described in the embodiment 1 of the invention . fig3 a , being a sectional view of a condition in which a thin film transistor substrate sub 1 and an opposite substrate sub 2 are caused to face each other , shows a condition before the liquid crystal is sealed in . the first etch stopper layer hfs 1 and the second etch stopper layer hfs 2 are laminated , in this order , onto a principal surface of the thin film transistor substrate sub 1 . the pixel circuit configured of the thin film transistors tft is formed on the second etch stopper layer hfs 2 . the first etch stopper layer hfs 1 and the second etch stopper layer hfs 2 are also laminated , in this order , onto a principal surface of the opposite substrate sub 2 . a color filter is formed on the second etch stopper layer hfs 2 . an illustration of a black matrix or the like provided on the opposite substrate sub 2 is omitted . also , an oriented film is formed as a topmost layer on each substrate , but an illustration is omitted here . the seal agent sl is formed encircling the display area of the thin film transistor substrate sub 1 . the wiring substrate fpc is attached to the wiring connection portion tma at one edge of the thin film transistor substrate sub 1 . mo — w is suitable for the first etch stopper layer hfs 1 , while silicon nitride is suitable for the second etch stopper layer hfs 2 . the first etch stopper layer hfs 1 is insoluble in an etchant for a glass substrate . also , the second etch stopper layer hfs 2 is insoluble in an etchant for the first etch stopper layer hfs 1 . as shown in fig3 b , the principal surface of the opposite substrate sub 2 and the principal surface of the thin film transistor substrate sub 1 are bonded together , and the liquid crystal lc is sealed in within a bonding space . a perimeter of the space between the two substrates is sealed with the seal agent sl . in this condition , the opposite substrate sub 2 is dissolved and removed , by a full etching , with a glass dissolving etchant . at this time , an etching of the cf side second etch stopper layer hfs 2 is stopped by the cf side first etch stopper layer hfs 1 ( fig3 c ). next , the cf side first etch stopper layer hfs 1 is dissolved and removed by a full etching ( fig3 d ). an etchant etching the cf side first etch stopper layer hfs 1 does not etch the cf side second etch stopper layer hfs 2 . that is , the color filter cf is protected by the cf side second etch stopper layer hfs 2 . the cf side second adhesive sl - 2 is applied covering the cf side second etch stopper layer hfs 2 , the wiring connection portion tma , and one portion of the wiring substrate fpc . the cf side flexible substrate f - sub 2 , which is the plastic substrate , is attached with the second adhesive sl - 2 ( fig3 e ). by the second adhesive sl - 2 covering a terminal portion of the wiring substrate fpc , a stress concentration on the terminal portion of the wiring substrate fpc is avoided . next , the thin film transistor substrate sub 1 is dissolved and removed , by a full etching , with a glass dissolving etchant . at this time , an etching of the tft side second etch stopper layer hfs 2 is stopped by the tft side first etch stopper layer hfs 1 ( fig3 f ). next , the tft side first etch stopper layer hfs 1 is dissolved and removed by a full etching ( fig3 g ). an etchant etching the tft side first etch stopper layer hfs 1 does not etch the tft side second etch stopper layer hfs 2 . that is , the thin film transistors tft are protected by the tft side second etch stopper layer hfs 2 . the first adhesive sl - 1 is applied covering the tft side second etch stopper layer hfs 2 . the tft side flexible substrate f - sub 1 , which is the plastic substrate , is attached with the first adhesive sl - 1 ( fig3 h ). it is possible , through the heretofore described steps , to obtain the liquid crystal display device described in the embodiment 1 of the invention . next , a description will be given of an embodiment 2 of the invention . fig4 is a sectional view of a liquid crystal display device illustrating the embodiment 2 of the display device of the invention . fig4 corresponds to the section taken along line x - x ′ of fig1 . the liquid crystal display device of the embodiment 2 shown in fig4 is configured by sealing in a liquid crystal lc between a principal surface of a thin film transistor substrate sub 1 , which is a glass substrate , and a principal surface of a cf side flexible substrate f - sub 2 , which is a plastic substrate , and bonding them together with a frame shaped seal agent sl encircling a display area . a feature of the embodiment lies in adopting a structure in which a wiring substrate fpc is sandwiched between the thin film transistor substrate sub 1 , which is the glass substrate , and the cf side flexible substrate f - sub 2 . as shown in fig4 , the principal surface of the cf side flexible substrate f - sub 2 has a silicon nitride layer ( a second etch stopper layer hfs 2 ), which is a transparent inorganic insulating layer , attached thereto with a second adhesive sl - 2 , and a color filter layer cf is provided on the silicon nitride layer . the second adhesive sl - 2 fills a space outside the seal agent sl between the thin film transistor substrate sub 1 and the cf side flexible substrate f - sub 2 , covering the heretofore described wiring connection portion tma and the heretofore described wiring substrate ( the flexible printed substrate ) fpc connected thereto . the seal agent sl and the second adhesive sl - 2 are made of different materials . the materials of the seal agent sl and second adhesive sl - 2 are the same as those of the embodiment 1 . fig5 a to 5e are views illustrating a method of manufacturing the liquid crystal display device described in the embodiment 2 of the invention . fig5 a , being a sectional view of a condition in which the thin film transistor substrate sub 1 and an opposite substrate sub 2 are caused to face each other , shows a condition before the liquid crystal is sealed in . a pixel circuit configured of thin film transistors tft is formed on the principal surface of the thin film transistor substrate sub 1 . a first etch stopper layer hfs 1 and the second etch stopper layer hfs 2 are laminated , in this order , onto a principal surface of the opposite substrate sub 2 . a color filter is formed on the second etch stopper layer hfs 2 . an illustration of a black matrix or the like provided on the opposite substrate sub 2 is omitted . also , an oriented film is formed as a topmost layer on each substrate , but an illustration is omitted here . the seal agent sl is formed encircling the display area of the thin film transistor substrate sub 1 . the wiring substrate fpc is attached to the wiring connection portion tma at one edge of the thin film transistor substrate sub 1 . mo — w is suitable for the first etch stopper layer hfs 1 , while silicon nitride is suitable for the second etch stopper layer hfs 2 . the first etch stopper layer hfs 1 is insoluble in an etchant for the opposite substrate sub 2 . also , the second etch stopper layer hfs 2 is insoluble in an etchant for the first etch stopper layer hfs 1 . as shown in fig5 b , the principal surface of the opposite substrate sub 2 and the principal surface of the thin film transistor substrate sub 1 are bonded together , and the liquid crystal lc is sealed in within a bonding space . a perimeter of the space between the two substrates is sealed with the seal agent sl . in this condition , the opposite substrate sub 2 is dissolved and removed , by a full etching , with a glass dissolving etchant . at this time , an etching of the cf side second etch stopper layer hfs 2 is stopped by the cf side first etch stopper layer hfs 1 ( fig5 c ). next , the cf side first etch stopper layer hfs 1 is dissolved and removed by a full etching ( fig5 d ). an etchant etching the cf side first etch stopper layer hfs 1 does not etch the cf side second etch stopper layer hfs 2 . that is , the color filter cf is protected by the cf side second etch stopper layer hfs 2 . the second adhesive sl - 2 is applied covering the cf side second etch stopper layer hfs 2 , the wiring connection portion tma , and one portion of the wiring substrate fpc . the cf side flexible substrate f - sub 2 , which is the plastic substrate , is attached with the second adhesive sl - 2 ( fig5 e ). by the second adhesive sl - 2 covering a terminal portion of the wiring substrate fpc , a stress concentration on the terminal portion of the wiring substrate fpc is avoided . the thin film transistor substrate sub 1 is reduced in thickness by means of a polishing or the like when necessary . it is possible , through the heretofore described steps , to obtain the liquid crystal display device described in the embodiment 2 of the invention .	6
it has been discovered that many commercial braces do not fit certain sizes and shapes in the most appropriate manner . this is particularly true of legs with large thighs and smaller calf regions . these leg shapes are referred to herein as “ cone - shaped ” legs and illustrated in certain ones of the following drawings . further , the present invention may be adapted to fit the leg shapes of both children and adults . referring now to fig1 there is shown an adjustable hinged knee support 10 constructed in accordance with the principles of the present invention . the knee support 10 facilitates a better fit for users having large thighs or “ cone - shaped ” legs 12 . an adjustable upper fastener assembly 14 accommodates the various thigh sizes . as shown in fig1 a large patella opening 16 ( or alternatively , a large popliteal opening ) is also provided for added comfort . on opposite sides of opening 16 are removable , adjustable half - horseshoe buttress &# 39 ; 21 for comfort and support ( see also fig2 ). as described below , the upper fastener assembly 14 and the lower fastener assembly 18 may be constructed with hook and pile portions to facilitate adjustability and ease of use by the user . still referring to fig1 a hinge 20 is distinctly placed along the medial portion of the knee support 10 . hinge 20 may be either a polycentric ( double axis ) hinge , single axis hinge , complex hinge , or a spiral stay . other types of hinges may also be used as will be shown in more detail below , a second hinge 20 is disposed opposite hinge 20 , and is positioned on the outside portion ofthe knee to balance the support about the knee . it has been observed in prior art that knee braces do not accommodate variations in size of the user &# 39 ; s thigh , the position ofthe respective hinges may vary in accordance with the principles of the present invention . referring now to fig2 there is shown an enlarged fragmentary , side elevation view of an upper portion 22 of hinge 20 of the knee support 10 of fig1 . the position of the upper portion 22 of hinge 20 is shown to be positionable about a hook and pile surface 24 of the knee support 10 . a retaining strap 26 is shown in a position for securement of hinge 20 . in this manner , the position of the hinge 20 relative to the leg of the user , as shown in fig1 may be selectively adjusted to accommodate variations in the size of the thigh of the user . in other words , the medial and lateral hinges ( described below ) are adjusted to allow the knee support 10 to be anatomically correct relative to the knee . referring now to fig3 there is shown the knee support 10 positioned about the leg 12 of a user . in this particular embodiment it may be seen that the thigh 30 is much larger than the calf 32 of the user . for this reason , the knee support 10 is constructed with opposing flaps 34 and 36 which as shown in fig1 when closed comprise an upper portion 52 of the knee support 10 . in this particular illustration , it may be seen that the flaps 34 and 36 are in an open position , which permit the fitting of the knee support 10 about the leg 12 of the user . the flaps 34 and 36 are constructed with hook and pile surfaces 38 ( one which is shown on flap 34 ) to facilitate securement about the leg 12 of the user . a portion of the hook and pile surface 38 comprises a portion of the adjustable upper fastener assembly 14 , illustrated in fig1 . the adjustable upper fastener assembly 14 further includes a strap 40 extending outwardly from flap 36 . still referring to fig3 the lower region 50 of the knee support 10 , in this particular embodiment , is of fixed size and thus is not adjustable . the lower region 50 does , however , include a support strap 52 that affords securement of the knee support 10 about the leg 12 of the user . referring now to fig4 there is shown the knee support 10 of fig3 positioned about the leg 12 of the user with the flap 38 closed and positioned over the flap 36 as described above . a region 38 a of hook and pile material , which is not visible in fig3 is illustrated as it appears on the outer portion of the flap 36 . it should be noted that the term “ hook and pile fasteners ” is a recognized structure to one skilled in the art and is often sold under the trademark velcro ®. it is also well known that the hook and pile enter and engage one another . therefore , if surface 38 , as shown in fig3 is a hook surface then the region 38 a of fig4 would be a pile surface . it is to be understood that further reference herein to a “ hook and pile surface ” refers to either a hook or a pile surface . still referring to fig4 it may be seen that the lower region 50 of the knee support 10 conforms about the calf 32 , with the patella opening 16 more clearly illustrated by the closure of flap 38 over flap 36 . various stitching 54 is shown upon flap 38 as well as stitching 56 shown around the patella opening 16 . this stitching is shown for purposes of illustration only , and other stitching embodiments maybe incorporated herein . all illustrations thereof should not be deemed limited in any respect relative to the principles of the present invention . referring now to fig5 there is shown the knee support 10 with the lower strap 52 securing the lower region 50 ofthe knee support 10 while the upper fastener assembly 14 secures the upper region of the knee support knee 10 about the leg 12 of the user . it may be seen that the hinge 20 is positioned on the hook and pile surface 24 in a position most appropriate to support of knee of the user as will be described in more detail below . referring now to fig6 there is shown the knee support 10 in a front elevation view . this particular view it may be seen that the hinge 20 comprises medial and lateral hinges 20 . because the knee brace may be used on either left or right knees , it is not necessary to differentiate which hinge 20 is medial or lateral . this definition is relative to the leg of the user . the present description is intended to provide an understanding that the position of the medial and lateral hinges 20 may be adjusted so that they are anatomically correct . as described above , the ability to adjust the position of the hinges 20 , and the ability to position the upper portion 22 of the hinge 20 about the hook and pile surface 24 against which it may be secured , facilitates anatomically correct adjustment . in one embodiment of the present invention , a sheet of material 60 covers the hinge 20 . the underside of the sheet 60 has a mating hook and pile surface to engage the hook and pile surface 24 , which provides securement of the upper portion 22 of hinge 20 ( fig2 ) thereto . in operation , the present invention accommodates various leg sizes . this is clearly shown in fig3 where the above described upper fastener assembly 14 and strap 40 therein described allow the user to position the knee support 10 around the leg 12 of the user in a manner facilitating a wide variety of thigh sizes . because thigh sizes will vary ( especially between children and adults ), the knee support 10 ofthe present invention may be provided in a variety of basic sizes , such as small , medium , large , and extra large , to further provide accommodation of varying leg sizes . still referring to fig1 - 6 in combination , fig4 illustrates the anterior hook and pile closure “ wrap around ” configuration that affords ease in the use of the present invention . however , other fasteners can be used . likewise fig5 illustrates the securement of the bottom strap 52 of the present invention around the calf 32 of the user prior to the securement of the upper fastener assembly 14 . this is the preferred method of securing the knee support 10 around the leg 12 of the user . finally , fig6 clearly illustrates the ability to adjust the medial and lateral hinges 20 in an anatomically correct configuration relative to the legs of the user . it is necessary to provide the hinges 20 on opposite sides of the user &# 39 ; s knee , no matter the shape of the user &# 39 ; s thigh so as to provide appropriate support about the knee . thus , the present invention , which utilizes hook and pile adjustable “ wrap around ” fasteners , provides a better fit for “ cone - shaped ” legs than those found in the prior art . the large patella opening 16 provides additional comfort , while a posterior elastic segment on the hook and pile straps 40 and 52 ( fig3 ) prevent any tourniquet effect . as described above , the adjustable , hinged knee support 10 with adjustable hinges is interchangeable for use on either the right or left leg . referring now to fig7 the method of using the present invention allows users having different leg sizes and shapes , including a generally cone - shaped upper leg portion to be fitted with an effective knee support . the user positions the open knee support on the user &# 39 ; s leg and adjusts the hinges as described above so as to position each hinge relative to the user &# 39 ; s knees on opposite size thereof the hook and pile fasteners permit the user to secure the hinge in the position that is most appropriate for the user &# 39 ; s particular leg shape , and further secure the hinge with the straps pulled there around . it is possible to use multiple hinges , and in one aspect of the present invention four different hinges and / or stays may be used . it has been shown to the applicant that not everyone requires a heavy hinge and hinges that simply lockout at either 90 degrees or vertical are in some instances appropriate to prevent hyper extension ofthe user &# 39 ; s knee . in accordance with the principles of the present invention , the use of a polycentric hinge ( a double axis type of hinge ) has also been found to be useful . it should be understood , however , that any type of hinge may be used . one advantage of the present invention is the adjustable hinges . this is because adjustable hinges 20 , as is illustrated in fig2 allow the user to position the hinges 20 about the hook and pile material so as to position them above the knee wherein the hinges are neither to far interior nor to far posterior prior to final securement . another advantage is in the use of a flexible spiral stay , which allows use ofthe knee support 10 for various injuries where it is beneficial for the knee support apparatus to return to a neutral position for proper healing . spiral stays are made from hardened , galvanized spring steel round wire which is coiled and flattened , and is generally referred to in the trade as “ spiral boning ”. such material provides support rigidity for partially immobilizing the knee , yet can be flexed , when placed under pressure , to conform to the body contours of the wearer , as illustrated in fig5 . yet another advantage is in the ample strap length provided , which allows a wide range of adjustability relative to the sizes of the user &# 39 ; s leg . since adjustability is a key aspect of the present invention , straps with hook and pile material are an advantage . finally , the present invention may be adapted to fit both children and adults . the present invention will be supplied in wide variety of sizes to accommodate the needs of various users . although an embodiment of the method and apparatus of the present invention has been illustrated in the accompanying drawings and described in the foregoing detailed description , it will be understood that the invention is not limited to the embodiment disclosed , but is capable of numerous rearrangements , modifications and substitutions without departing from the spirit of the invention as set forth and defined herein .	0
we investigated dedifferentiation of adult atrial and ventricular myocytes . the salient results are that in vitro cell culture conditions can promote dedifferentiation that is associated with down - regulation of cell cycle inhibitors 14 - 3 - 3η and p21 , and that the dedifferentiated cells can divide and generate cardiac precursor cells that are positive for c - kit , nkx2 . 5 and gata4 . the dedifferentiated adult mammalian cardiomycytes are an abundant source of cells for use in cardiac cell regenerative therapies . surprisingly , applicants have found that adult myocytes , derived from the atrium or ventricles , can dedifferentiate and become stem - cell like ( mdcs ). the stem - cell likeness is reflected in the expression of c - kit ( detectable by rt - pcr ), which adult myocytes do not express . when these mdcs differentiate , they lose expression of c - kit . we have not detected expression of sca - 1 under current conditions in the mdcs , although conditions may be found in which it would be expressed . one distinguishing feature of the mdcs is their cell size . the mdcs ( 10 - 30 um ) are bigger than regular cardiac stem cells ( approx 6 - 10 um diameter ) or bone marrow stem cells ( 6 - 8 um ). myocytes can be isolated from either atrial or ventricles of the heart . these can be obtained from any source , for example from biopsies ( endomyocardial or surgical specimens ), cadavers , animal donors , etc . as is known in the art , the tissue can be mechanically macerated to produce and liberate myocytes . enzymes , such as proteases , can also be used to liberate myoctyes from the tissue . purification of adult myocytes can be by any means known in the art . these include differential centrifugation , culturing under selective conditions , differential harvesting of cultured cells , and gradient centrifugation . the purification , however , is optional . in order to dedifferentiate isolated adult cardiac myoctyes , one can culture them in the presence of mitogens . proliferating cells results which have altered properties . any mitogen can be used . mitogens present in serum can be used , including bovine , fetal bovine , human , porcine , and ovine sera . any amount between 0 . 1 to 20 % serum can be used , for example , from 0 . 1 to 1 %, from 1 % to 5 %, from 5 % to 10 %, from 10 % to 15 %, and from 15 % to 20 %. the amount can be increased , in steps increases or in a gradient , as growth progresses . purified growth factors can be used as mitogens , including but not limited to vegf , hgv , igf , fgf , egf , gcsf , gmcsf , mcsf , csf - 1 , and pdgf . changes in proliferation markers , proliferative index , and marker expression can be seen in as little as 3 , 5 , 7 , 9 , 11 days . culturing can be carried out from 1 to 60 days . cultures can be reseeded to maintain a high proliferative index . cell cycle inhibitor expression decreases and proliferative index increases from the initial . the electrophysiology of the cells also changes as they are cultured . inward rectifier potassium current and membrane resting potential decreased as cells dedifferentiated . in addition , electrical capacitance of the cells decreased . cardiomyocytes can be isolated from any mammals . these include rodents and primates . exemplary animal sources include rat , mouse , guinea pig , goat , rabbit , pig , and human . cardiomyocytes can be obtained from laboratory animals , cadavers , or patients . if human cardiomyocytes are used , they can be delivered back to the same patient or to different patients . they can be stored at any stage in the process , before dedifferentiation , after dedifferentiation , and after redifferentiation . the mdcs demonstrate the ability to differentiate . for example , they form spheres . the spheres express less cd34 and c - kit than the mdcs . because the mdcs have the ability to redifferentiate , they are useful for treating patients and animals with heart disease or heart disease models . such diseases include chronic heart failure , post - myocardial infarction , right ventricular failure , pulmonary hypertension , ventricular dysfunction induced by a cytotoxic agent , and ventricular dysfunction induced by an anti - neoplastic agent . the mdcs can be introduced by any means known in the art , including but not limited to intracoronary infusion via a catheter , intramyocardial injection via a catheter , and intramyocardial injection during surgery . the above disclosure generally describes the present invention . all references disclosed herein are expressly incorporated by reference . a more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only , and are not intended to limit the scope of the invention . we purified enzymatically - separated cardiomyocytes from hearts of adult rats , guinea pigs or mice using multiple differential centrifugation and percoll gradient separation steps . tests of morphology ( fig1 ), immunoreactivity ( fig . s 1 a ), and rt - pcr ( fig3 , fig . s 5 ) confirmed the purity of the isolated cardiomyocytes . visually , the primary cells look homogeneously large and striated despite that atrial myocytes have variable shapes when plated to culture ; more importantly , there is no detectable expression of proteins or transcripts characteristic of fibroblasts , endothelial cells or stem cells . to track individual cells in culture , atrial and ventricular myocytes were cultured at low density in grid - culture dishes or on coverslips . shortly after plating , myocytes dedifferentiated , losing striations , rounding up and , often , beating spontaneously . immunocytochemical studies demonstrated that after 3 days of culture , myocytes dedifferentiated , with significantly reduced expression of α - mhc or ctnt ( fig s1b ). inward rectifier potassium current ( i k1 ) and membrane resting potential , characters of cardiomyocytes , were dramatically reduced in dedifferentiated myocytes . electrical capacitance as a means of assessing cell size ( zhang et al ., 2003 ) was also significant smaller with culture prolonged and dedifferentiation and proliferation progressed ( fig s2 ). in addition to these long - recognized morphological and physiological changes , we found that plated myocytes begin to divide and give rise to daughter cells within 3 - 7 days in culture . expression of aurora b in the cleavage gap between cells indicates that new divided , brdu - positive cells with barely detected ctnt are from cardiomyocytes which typically express ctnt ( fig1 ). in addition , atrial myocytes showed greater plasticity and produced daughter cells earlier than ventricular myocytes , but the phenomena are generally similar in myocytes from either chamber . a subgroup of dedifferentiated round myocytes that budded off new daughter cells continued to demonstrate spontaneous contractions . in other cases , cells rounded up before flattening and spreading , did not show spontaneous beating , but gave rise to phase - bright daughter cells . although the dedifferentiation mechanism has been studied intensively and better elucidated in myocytes from amphibians and zebrafishes ( straube and tanaka , 2006b ; lien et al ., 2006 ; ahuja et al ., 2007 ), it is poorly understood in mammalian cardiomyocytes ( engel et al ., 2005 ; driesen et al ., 2006 ; montessuit et al ., 2004 ). we analyzed cell cycle progression in this cell culture model by studying the active cell cycle markers ki67 , histone h3 and brdu incorporation by immunocytochemistry . ki - 67 is a vital molecule for cell proliferation that is expressed in proliferating cells at all phases of the active cell cycle , but is absent in resting ( g0 phase ) cells . after 2d in culture , 11 ± 8 % and 6 ± 2 % of atrial and ventricular myocytes , respectively , re - entered active cell cycle and expressed ki - 67 , with gradually increased levels , reaching to 80 ± 11 . 9 % and 46 ± 11 % at 11 d for atrial and ventricular myocytes , respectively ( p & lt ; 0 . 001 ) ( fig2 a ). we assessed the proportion of dedifferentiated myocytes entering the s phase by incubating the cells with brdu for various periods . cells in m phase were detected using an antibody against phospho histone h3 at s10 ( h3p ). we found a progressive increase in the numbers of brdu - and h3p - positive cells , reaching a maximum at about 1 week . interestingly , the proportion of brdu - and h3p - positive cells was always higher in cultures of atrial myocytes than in that of ventricular myocytes ( fig2 a , 2 b ). besides the cytokinesis , we also found cells in anaphase and telophase ( fig s3 ), demonstrating the progression of proliferation of the dedifferentiated myocytes . to further decipher the mechanisms underlying the cell cycle progression and their differences between atrial and ventricular myocytes , we investigated the expressions of interrelated factors like 14 - 3 - 3 ( ywhah ), p21 and p53 that are critical checkpoint regulators in cell cycle progression ( ahuja et al ., 2007 ) by immunocytochemical detection of cells cultured for 5 days . expression of the negative cell cycle regulator 14 - 3 - 3 has been shown to prevent the cell cycle progression and serum - induced proliferation ( du et al ., 2005 ; yang et al ., 2006 ). as predicted , the expression of 14 - 3 - 3η , an abundant isoforms in the heart ( he et al ., 2006 ), was significantly lower in freshly isolated atrial myocytes than in fresh ventricular myocytes . furthermore , on day 5 , when was the faster response period of cell cycle progression for both types of cells , expression of 14 - 3 - 3η was dramatically reduced ( fig2 c ). p21 ( waf1 / cip1 ), a downstream target of 14 - 3 - 3 and key inhibitory factor involving in all phases of cell cycle ( li and brooks , 1999 ), was also reduced significantly in cultured dedifferentiating / proliferating myocytes . its endogenous level was 61 % higher in freshly isolated ventricular myocytes than in atrial myocytes . furthermore , p53 expressed much less in fresh atrial myocytes than in ventricular myocytes , and decreased significantly in atrial myocytes but not much in ventricular myocytes . taken together , the data suggest the weaker inhibitory signals in atrial myocytes facilitate their faster and easier cell cycle progression and the diminution of the inhibitory factors render the cell into cell cycle progression and proliferation . myocytes cultured in normal density become confluent after 1 - 2 weeks ( fig s4a ) and thereafter clusters of loosely - adherent phase - bright round cells emerged above the monolayer of dedifferentiated / proliferating cells ( fig3 ). these cells , seemed to be heterogenous in size ( fig s4b ), can be harvested by gently pipetting without trypsinization and are referred to as myocyte - derived cells ( mdc ). dedifferentiation , e . g ., in pigment cells , has been demonstrated to contribute to stem cells and tissue regeneration ( real et al ., 2006 ). we asked if mdc that is distinct from cardiomyocytes in morphology and electrophysiology , have any characteristics of cardiac stem cells ( smith et al ., 2007 ; boyle et al ., 2006 ). by direct and indirect fluorescent immunostaining , we found that rat mdc do indeed express stem cell markers c - kit and cd34 , but little or weak , if any , sca - 1 or cd90 ( data not shown ); 61 ± 19 . 7 % freshly harvested mdc were positive to c - kit . furthermore , in the area of mdc clusters , there were cells in the layer strongly positive for c - kit immunostaining ( fig3 b ), implicating the source of mdc . to further confirm the expression of stem cell markers in mdc , we performed rt - pcr to test the expression of different transcripts . c - kit was expressed in heart tissue , bone marrow cells , and mdcs . in addition , the other cardiac stem cell transcript sca - 1 was undetectable in mdc ; endothelial precursor marker gene cd34 was present in mdc . cardiac transcripts α - mhc , nkx2 . 5 , and gata4 were all detected in mdc , heart tissue and purified myocytes as well ( fig3 c ; fig s5 ). mdc self - organized into spheres 3 - 5 days after the cluster cells became more confluent . there were 0 ˜ 4 spheres in each well of a 6 - well culture plate , depending on the condition of cells . mdc spheres either loosely adhered to the culture layer or became suspended in medium , and show slow spontaneous activity within 2 - 5 days of sphere stage ( fig s4c . the semi - adherent spheres could be harvested by gentle pipetting . semi - adherent or suspending spheres flattened onto the bottom when seeded into fibronectin - coated plates , and gave rise to cells off the spheres , which eventually stopped beating while turning into monolayer cells ( fig4 a ). moreover , myocyte cultures could provide 3 ˜ 4 harvests of mdc or spheres . new daughter cells emerged again always around the area where previous mdc were produced . in the spheres , most cells were positive for α - mhc , connexin 43 ( cx43 ), and cd31 immunostaining , and some positive for c - kit . some cells off the sphere also express ctnt and others express c - kit ( fig4 b ). when transduced with replication - defective lentivirus encoding enhanced green fluorescent protein ( egfp ) driven by the cardiac α - mhc promoter , mdc spheres exhibited focal green florescence within 3 - 5 days along with spontaneous contraction ( fig4 d ). rt - pcr revealed that in the spheres , there was weaker stem cell transcript signal of c - kit , but stronger signal of cardiac transcripts α - mhc , nkx2 . 5 , and gata4 , suggesting the cardiogenesis and re - differentiation of mdc when entering in sphere phase . in addition , endothelial precursor marker gene cd34 , present in mdc , tended to decrease in the spheres ; endothelial marker cd31 ( pecam - 1 ) expresses in both mdcs and the spheres ( figure s5 ). cardiomyocytes were isolated from adult male wistar - kyoto rats ( 4 - 8 weeks , 70 - 120 g ), hartley guinea pigs ( 3 - 5 weeks , 300 - 380 g ) or c57bl / 6 mice ( 4 - 6 weeks , 17 - 21 g ) by enzymatic digestion of the whole heart on a langendorff apparatus with similar protocol as previously described . ( zhang et al ., 2006 ; kizana et al ., 2007 ) heparinized animals were anaesthetized by sodium pentobarbital ( ovation pharmaceuticals inc , deerfield , ill .). hearts were rapidly excised and cleaned to remove blood in ice - cold tyrode &# 39 ; s solution before mounted to a langendorff apparatus conjugating to a pressure monitoring device , and perfused retrogradely with the following four oxygenated solutions in sequential order : modified tyrode &# 39 ; s solution containing 1 . 0 mm ca 2 + ( 2 min ), ca 2 + - free tyrode &# 39 ; s solution ( 2 - 3 min ), ca 2 + - free tyrode &# 39 ; s solution containing 0 . 2 wunsch unit / ml of collagenase made from liberase blendzyme 4 ( roche molecular biochemicals , indianapolis , ind .) for 10 - 20 min depending on species and digest conditions . digested atrium and ventricles were cut off and minced in kruftbrühe ( kb ) solution , then filtered through a 200 um nylon mesh to remove big piece of undigested tissues . isolated cells were rinsed in kb solution and let settled by gravity for 3 times to remove debris and non - cardiomyocytes . resuspended cells in kb solution were loaded above the top layer of percoll gradient which was formed by 20 %, 40 %, and 70 % of percoll to separate myocytes from debris and other types of cells . after three washes in kb solution , myocytes were resuspended in kb solution or in culture media for further experiments . modified tyrode &# 39 ; s solution contained ( mm ): nacl 105 , kcl 5 . 4 , kh2po4 0 . 6 , nah2po4 0 . 6 , nahco3 6 , khco3 5 , cacl2 1 , mgcl2 1 , hepes 10 , glucose 5 , taurine 20 ( ph 7 . 35 with naoh ), and kb solution had ( mm ): kcl20 , kh2po4 10 , k - glutamate 70 , mgcl2 1 , glucose 25 , β - hydroxybutyric acid 10 , taurine 20 , egta 0 . 5 , hepes 10 , and 0 . 1 % albumin ( ph 7 . 25 with koh ). purified myocytes were resuspended in medium 199 ( invitrogen , carlsbad , calif .) supplemented with 110 mg / l sodium pyruvate , 0 . 1 mm β - mercaptoethanol , 100 u / ml penicillin , 100 μg / ml streptomycin , and 5 % fbs ( invitrogen ) and cultured in laminin - coated 6 - well culture plates or 100 mm dishes in normal density of 6000 and 9000 cells / cm 2 for ventricular and atrial myocytes respectively , at 37 ° c . for 1 hr before wash to remove dead and non - adherent cells , and repeated once after 1 hr of culture . serum concentration in medium was gradually increased to 10 % and 20 %. on the second and third day of plating , medium was replaced to remove dead cells , and then maintained for prolonged culture while partially changed about every 5 days . in order to verify the proliferation of dedifferentiated myocytes , cells were plated in lower density as compared to normal dense culture for mdc production . numeric grid - marked coverslips ( bellco biotechnology , vineland , n . j .) coated with laminin were used to identify the cellular changes during the culture , under time - lapse microscope ( nikon te - 2000e inverted microscope ) for continuous analysis , or under regular inverted microscope ( nikon te - 2000u ), with phase contrast objectives and images were captured with a monochrome ccd camera ( q - imaging , surrey , bc , canada ) with a program suite image pro plus ( media cybernetics , bethesda , md .). at the end of the tracking , cells were subjected to analysis of markers related to cell cycle progression and stem cell when needed . a 3ccd color video camera ( sony ) connected to a personal computer was used to capture real - time images and videos of beating cells and spheres . at about 10 days to 2 weeks after the culture , the loosely adherent myocytes - derived cells ( mdc ) were harvested by gentle pipetting for 3 times with a disposable transfer pipette . cells were cultivated in same medium as of the serum - rich myocyte culture medium , for the experiments detecting the markers in fresh isolated cells . alternatively , mdc culture medium which was dmem / f 12 supplemented with 0 . 1 mm β - mercaptoethanol , bfgf 0 . 1 ng / ml , tgf - β 1 ng / ml , 100 u / ml penicillin , 100 μg / ml streptomycin , and 10 % fbs , was used to maintain the cells in 95 % humidity , 5 % co2 , at 37 ° c . cells were loaded with 3 - bromo - 2 - deoxyuridine ( brdu ; 5 μm ) for various periods before immunocytochemical assay ( engel et al ., 2005 ). cellular phenotypes in the cultures were analyzed similarly as previously described ( smith et al ., 2007 ; zhang et al ., 2006 ) using immunofluorescence . to test the expression of stem cell markers , rabbit polyclonal antibody ( pab ) against c - kit ( cd117 ) ( santa cruz biotechnology , santa cruz , calif .) or oct - 4 ( abcam , cambridge , mass . ), mouse monoclonal antibody ( mab ) against sca - 1 ( invitrogen ), goat pab against thy - 1 ( cd90 ) were used as primary antibodies . expression of cardiac markers were tested using antibodies included mouse mab of cardiac specific α - mhc from abcam , α - actin from sigma , and rabbit pab cx43 and gata4 from invitrogen , goat pab nkx2 . 5 from santa cruz biotechnologie , inc . primary antibodies against cell cycle - specific molecules included : ki67 , histone h3 ( phosphor s10 ) and anti - bromodeoxyuridine ( brdu ) were from abcam . the specificity of antibodies was confirmed by blocking peptides or control cells . donkey anti - mouse , anti - rabbit , or anti - goat antibodies with fluorescent conjugation were used as secondary antibodies . direct immunostaining were also performed to test the expression of stem cell markers in freshly harvested mdc using pe - conjugated mouse mabs against c - kit ( bd biosciences ), sca - 1 ( invitrogen ), or fitc - conjugated cd90 ( abeam ). in mdc spheres , stem cell and cardiac markers were detected using whole - mount immunofluorescent techniques and examined with standard and z - stack confocal laser scan microscope ( lsm 510 ; zeiss ). the acquisition settings were optimized to avoid false positive or false negative staining images were processed by lsm 510 software suite . reverse - transcription polymerase chain reaction ( rt - pcr ) was performed to test the mrna expression of both stem cell and cardiac markers . extraction of total rna from rat heart tissue , bone marrow cells flushed from femurs , purified myocytes , mdc , and mdc spheres , and one - step rt - pcr were carried out with commercially available kits ( qiagen , valencia , calif .). primer pairs for c - kit , sca - 1 , oct 4 , α - mhc , gata4 , and nkx2 . 5 , β - actin are listed in table s1 . data were expressed as mean ± sem , and paired or un - paired student t - test were used to exam the significance of difference between groups , with a p & lt ; 0 . 01 considered as significant different . ahuja , p ., sdek , p ., and maclellan , w . r . ( 2007 ). cardiac myocyte cell cycle control in development , disease , and regeneration . physiol rev . 87 , 521 - 544 . ausma , j ., litjens , n ., lenders , m . h ., duimel , h ., mast , f ., wouters , l ., ramaekers , f ., allessie , m ., and borgers , m . ( 2001 ). time course of atrial fibrillation - induced cellular structural remodeling in atria of the goat . j . mol . cell cardiol . 33 , 2083 - 2094 . barile , l ., chimenti , i ., gaetani , r ., forte , e ., miraldi , f ., frati , g ., messina , e ., and giacomello , a . ( 2007 ). cardiac stem cells : isolation , expansion and experimental use for myocardial regeneration . nat . clin . pract . cardiovasc . med . 4 suppl 1 , s9 - s14 . beltrami , a . p ., urbanek , k ., kaj stura , j ., yan , s . m ., finato , n ., bussani , r ., nadal - ginard , b ., silvestri , f ., leri , a ., beltrami , c . a ., and anversa , p . ( 2001 ). evidence that human cardiac myocytes divide after myocardial infarction . n . engl . j . med . 344 , 1750 - 1757 . benardeau , a ., hatem , s . n ., rucker - martin , c ., tessier , s ., dinanian , s ., samuel , j . l ., coraboeuf , e ., and mercadier , j . j . ( 1997a ). primary culture of human atrial myocytes is associated with the appearance of structural and functional characteristics of immature myocardium . j . mol . cell cardiol . 29 , 1307 - 1320 . benardeau , a ., hatem , s . n ., rucker - martin , c ., tessier , s ., dinanian , s ., samuel , j . l ., coraboeuf , e ., and mercadier , j . j . ( 1997b ). primary culture of human atrial myocytes is associated with the appearance of structural and functional characteristics of immature myocardium . j . mol . cell cardiol . 29 , 1307 - 1320 . bird , s . d ., doevendans , p . a ., van rooijen , m . a ., brutel , d . l . r ., hassink , r . j ., passier , r ., and mummery , c . l . ( 2003 ). the human adult cardiomyocyte phenotype . cardiovasc . res . 58 , 423 - 434 . boyle , a . j ., schulman , s . p ., hare , j . m ., and oettgen , p . ( 2006 ). is stem cell therapy ready for patients ? stem cell therapy for cardiac repair . ready for the next step . circulation 114 , 339 - 352 . burton , p . b ., yacoub , m . h ., and barton , p . j . ( 1999 ). cyclin - dependent kinase inhibitor expression in human heart failure . a comparison with fetal development . eur . heart j . 20 , 604 - 611 . chabner b a ( 1982 ). cytosine arabinoside . in pharmacologic principles of cancer treatment , chabner b a , ed . ( philadelphia , wb : saunders co . ), pp . 387 - 401 . darling , d . l ., yingling , j ., and wynshaw - boris , a . ( 2005 ). role of 14 - 3 - 3 proteins in eukaryotic signaling and development . curr . top . dev . biol . 68 , 281 - 315 . de la fuente , r ., abad , j . l ., garcia - castro , j ., fernandez - miguel , g ., petriz , j ., rubio , d ., vicario - abejon , c ., guillen , p ., gonzalez , m . a ., and bernad , a . ( 2004 ). dedifferentiated adult articular chondrocytes : a population of human multipotent primitive cells . exp . cell res . 297 , 313 - 328 . dispersyn , g . d ., geuens , e ., ver , d . l ., ramaekers , f . c ., and borgers , m . ( 2001 ). adult rabbit cardiomyocytes undergo hibernation - like dedifferentiation when co - cultured with cardiac fibroblasts . cardiovasc . res . 51 , 230 - 240 . dispersyn , g . d ., mesotten , l ., meuris , b ., maes , a ., mortelmans , l ., flameng , w ., ramaekers , f ., and borgers , m . ( 2002 ). dissociation of cardiomyocyte apoptosis and dedifferentiation in infarct border zones . eur . heart j . 23 , 849 - 857 . driesen , r . b ., dispersyn , g . d ., verheyen , f . k ., van den eijnde , s . m ., hofstra , l ., thone , f ., dijkstra , p ., debie , w ., borgers , m ., and ramaekers , f . c . ( 2005 ). partial cell fusion : a newly recognized type of communication between dedifferentiating cardiomyocytes and fibroblasts . cardiovasc . res . 68 , 37 - 46 . driesen , r . b ., verheyen , f . k ., dijkstra , p ., thone , f ., cleutjens , j . p ., lenders , m . h ., ramaekers , f . c ., and borgers , m . ( 2007 ). structural remodelling of cardiomyocytes in the border zone of infarcted rabbit heart . mol . cell biochem . driesen , r . b ., verheyen , f . k ., dispersyn , g . d ., thone , f ., lenders , m . h ., ramaekers , f . c ., and borgers , m . ( 2006 ). structural adaptation in adult rabbit ventricular myocytes : influence of dynamic physical interaction with fibroblasts . cell biochem . biophys . 44 , 119 - 128 . du , j ., liao , w ., wang , y ., han , c ., and zhang , y . ( 2005 ) inhibitory effect of 14 - 3 - 3 proteins on serum - induced proliferation of cardiac fibroblasts . eur . j . cell biol . 84 , 843 - 852 . engel , f . b ., schebesta , m ., duong , m . t ., lu , g ., ren , s ., madwed , j . b ., jiang , h ., wang , y ., and keating , m . t . ( 2005 ). p38 map kinase inhibition enables proliferation of adult mammalian cardiomyocytes . genes dev . 19 , 1175 - 1187 . engel , f . b ., schebesta , m ., and keating , m . t . ( 2006 ). anillin localization defect in cardiomyocyte binucleation . j . mol . cell cardiol . 41 , 601 - 612 . fredj , s ., bescond , j ., louault , c ., and potreau , d . ( 2005 ). interactions between cardiac cells enhance cardiomyocyte hypertrophy and increase fibroblast proliferation . j . cell physiol 202 , 891 - 899 . gartel , a . l ., serfas , m . s ., and tyner , a . l . ( 1996 ). p21 -- negative regulator of the cell cycle . proc . soc . exp . biol . med . 213 , 138 - 149 . gruh , i ., beilner , j ., blomer , u ., schmiedl , a ., schmidt - richter , i ., kruse , m . l ., haverich , a ., and martin , u . ( 2006 ). no evidence of transdifferentiation of human endothelial progenitor cells into cardiomyocytes after coculture with neonatal rat cardiomyocytes . circulation 113 , 1326 - 1334 . he , m ., zhang , j ., shao , l ., huang , q ., chen , j ., chen , h ., chen , x ., liu , d ., and luo , z . ( 2006 ). upregulation of 14 - 3 - 3 isoforms in acute rat myocardial injuries induced by burn and lipopolysaccharide . clin . exp . pharmacol . physiol 33 , 374 - 380 . hermeking , h . and benzinger , a . ( 2006 ). 14 - 3 - 3 proteins in cell cycle regulation . semin . cancer biol . 16 , 183 - 192 . horackova , m . and byczko , z . ( 1997 ). differences in the structural characteristics of adult guinea pig and rat cardiomyocytes during their adaptation and maintenance in long - term cultures : confocal microscopy study . exp . cell res . 237 , 158 - 175 . kajstura , j ., leri , a ., finato , n ., di loreto , c ., beltrami , c . a ., and anversa , p . ( 1998 ). myocyte proliferation in end - stage cardiac failure in humans . proc . natl . acad . sci . u . s . a 95 , 8801 - 8805 . kang , s . k ., park , j . b ., and cha , s . h . ( 2006 ). multipotent , dedifferentiated cancer stem - like cells from brain gliomas . stem cells dev . 15 , 423 - 435 . kizana , e ., chang , c . y ., cingolani , e ., ramirez - correa , g . a ., sekar , r . b ., abraham , m . r ., ginn , s . l ., tung , l ., alexander , i . e ., and marban , e . ( 2007 ). gene transfer of connexin43 mutants attenuates coupling in cardiomyocytes . novel basis for modulation of cardiac conduction by gene therapy . circ . res . laframboise , w . a ., scalise , d ., stoodley , p ., graner , s . r ., guthrie , r . d ., magovern , j . a ., and becich , m . j . ( 2007 ). cardiac fibroblasts influence cardiomyocyte phenotype in vitro . am . j . physiol cell physiol 292 , c1799 - c1808 . laronga , c ., yang , h . y ., neal , c ., and lee , m . h . ( 2000 ). association of the cyclin - dependent kinases and 14 - 3 - 3 sigma negatively regulates cell cycle progression . j . biol . chem . 275 , 23106 - 23112 . lepilina , a ., coon , a . n ., kikuchi , k ., holdway , j . e ., roberts , r . w ., burns , c . g ., and poss , k . d . ( 2006 ). a dynamic epicardial injury response supports progenitor cell activity during zebrafish heart regeneration . cell 127 , 607 - 619 . li , j . m . and brooks , g . ( 1999 ). cell cycle regulatory molecules ( cyclins , cyclin - dependent kinases and cyclin - dependent kinase inhibitors ) and the cardiovascular system ; potential targets for therapy ? eur . heart j . 20 , 406 - 420 . lien , c . l ., schebesta , m ., makino , s ., weber , g . j ., and keating , m . t . ( 2006 ). gene expression analysis of zebrafish heart regeneration . plos . biol . 4 , e260 . lyngbaek , s ., schneider , m ., hansen , j . l ., and sheikh , s . p . ( 2007 ). cardiac regeneration by resident stem and progenitor cells in the adult heart . basic res . cardiol . 102 , 101 - 114 . macleod , k . f ., sherry , n ., hannon , g ., beach , d ., tokino , t ., kinzler , k ., vogelstein , b ., and jacks , t . ( 1995 ). p53 - dependent and independent expression of p21 during cell growth , differentiation , and dna damage . genes dev . 9 , 935 - 944 . michalopoulos , g . k . and defrances , m . c . ( 1997 ). liver regeneration . science 276 , 60 - 66 . montessuit , c ., rosenblatt - velin , n ., papageorgiou , i ., campos , l ., pellieux , c ., palma , t ., and lerch , r . ( 2004 ). regulation of glucose transporter expression in cardiac myocytes : p38 mapk is a strong inducer of glut4 . cardiovasc . res . 64 , 94 - 104 . oh , h ., chi , x ., bradfute , s . b ., mishina , y ., pocius , j ., michael , l . h ., behringer , r . r ., schwartz , r . j ., entman , m . l ., and schneider , m . d . ( 2004 ). cardiac muscle plasticity in adult and embryo by heart - derived progenitor cells . ann . n . y . acad . sci . 1015 , 182 - 189 . poss , k . d . ( 2007 ). getting to the heart of regeneration in zebrafish . semin . cell dev . biol . 18 , 36 - 45 . real , c ., glavieux - pardanaud , c ., le douarin , n . m ., and dupin , e . ( 2006 ). clonally cultured differentiated pigment cells can dedifferentiate and generate multipotent progenitors with self - renewing potential . dev . biol . roninson , i . b . ( 2002 ). oncogenic functions of tumour suppressor p21 ( waf1 / cip1 / sdi1 ): association with cell senescence and tumour - promoting activities of stromal fibroblasts . cancer lett . 179 , 1 - 14 . rucker - martin , c ., pecker , f ., godreau , d ., and hatem , s . n . ( 2002 ). dedifferentiation of atrial myocytes during atrial fibrillation : role of fibroblast proliferation in vitro . cardiovasc . res . 55 , 38 - 52 . shyu , w . c ., lee , y . j ., liu , d . d ., lin , s . z ., and li , h . ( 2006 ). homing genes , cell therapy and stroke . front biosci . 11 , 899 - 907 . smith , r . r ., barile , l ., cho , h . c ., leppo , m . k ., hare , j . m ., messina , e ., giacomello , a ., abraham , m . r ., and marban , e . ( 2007 ). regenerative potential of cardiosphere - derived cells expanded from percutaneous endomyocardial biopsy specimens . circulation 115 , 896 - 908 . straube , w . l . and tanaka , e . m . ( 2006a ). reversibility of the differentiated state : regeneration in amphibians . artif . organs 30 , 743 - 755 . straube , w . l . and tanaka , e . m . ( 2006b ). reversibility of the differentiated state : regeneration in amphibians . artif . organs 30 , 743 - 755 . thijssen , v . l ., ausma , j ., and borgers , m . ( 2001 ). structural remodelling during chronic atrial fibrillation : act of programmed cell survival . cardiovasc . res . 52 , 14 - 24 . torella , d ., ellison , g . m ., mendez - ferrer , s ., ibanez , b ., and nadal - ginard , b . ( 2006 ). resident human cardiac stem cells : role in cardiac cellular homeostasis and potential for myocardial regeneration . nat . clin . pract . cardiovasc . med . 3 suppl 1 , s8 - 13 . tseng , a . s ., engel , f . b ., and keating , m . t . ( 2006 ). the gsk - 3 inhibitor bio promotes proliferation in mammalian cardiomyocytes . chem . biol . 13 , 957 - 963 . walder , s ., zhang , f ., and ferretti , p . ( 2003 ). up - regulation of neural stem cell markers suggests the occurrence of dedifferentiation in regenerating spinal cord . dev . genes evol . 213 , 625 - 630 . welikson , r . e ., kaestner , s ., reinecke , h ., and hauschka , s . d . ( 2006 ). human umbilical vein endothelial cells fuse with cardiomyocytes but do not activate cardiac gene expression . j . mol . cell cardiol . 40 , 520 - 528 . yang , h ., zhang , y ., zhao , r ., wen , y . y ., fournier , k ., wu , h . b ., yang , h . y ., diaz , j ., laronga , c ., and lee , m . h . ( 2006 ). negative cell cycle regulator 14 - 3 - 3sigma stabilizes p27 kip1 by inhibiting the activity of pkb / akt . oncogene 25 , 4585 - 4594 . yeh , e . t ., zhang , s ., wu , h . d ., korbling , m ., willerson , j . t ., and estrov , z . ( 2003 ). transdifferentiation of human peripheral blood cd34 +- enriched cell population into cardiomyocytes , endothelial cells , and smooth muscle cells in vivo . circulation 108 , 2070 - 2073 . yoshizumi , m ., lee , w . s ., hsieh , c . m ., tsai , j . c ., li , j ., perrella , m . a ., patterson , c ., endege , w . o ., schlegel , r ., and lee , m . e . ( 1995 ). disappearance of cyclin a correlates with permanent withdrawal of cardiomyocytes from the cell cycle in human and rat hearts . j . clin . invest 95 , 2275 - 2280 . zhang , y ., han , h ., wang , j ., wang , h ., yang , b ., and wang , z . ( 2003 ). impairment of herg ( human ether - a - go - go related gene ) k + channel function by hypoglycemia and hyperglycemia : similar phenotypes but different mechanisms . j . biol . chem . 278 , 10417 - 10426 . zhang , y ., xiao , j ., wang , h ., luo , x ., wang , j ., villeneuve , l . r ., zhang , h ., bai , y ., yang , b ., and wang , z . ( 2006 ). restoring depressed herg k + channel function as a mechanism for insulin treatment of abnormal qt prolongation and associated arrhythmias in diabetic rabbits . am . j . physiol heart circ . physiol 291 , h1446 - h1455 . zhao , j ., morozova , n ., williams , l ., libs , l ., avivi , y ., and grafi , g . ( 2001 ). two phases of chromatin decondensation during dedifferentiation of plant cells : distinction between competence for cell fate switch and a commitment for s phase . j . biol . chem . 276 , 22772 - 22778 .	2
the present fouling index method is useful for determining the fouling ( or the rate of carbonaceous deposit formation ) in a variety of hydrocarbons derived from petroleum , for example : crude oil , crude oil distillate fraction , crude oil residues , heat transfer oils and lubricating base oils . the concentrations of components of petroleum which are commonly associated with fouling may be determined by any method which is reliable and reproducible . generally speaking , high performance liquid chromatography ( hplc ) was used in regard to the present invention to separate and measure various fractions of deasphaltenated crude oils or resids . hplc is fully described in a book by l . r . snyder , et al . entitled &# 34 ; introduction to modern liquid chromatography &# 34 ;. hplc separates successfully deasphaltenated crude oils into the three fractions that are the key in determining the crude composition . these fractions are : a saturate fraction , a neutral aromatic fraction , and a polar aromatic fraction . the repeatability of the hplc composition analysis is very good . duplicate tests made on two crudes showed very good agreement . hplc systems are available in hundreds of different configurations from the basic , low cost single pump system to fully automated multi - solvent gradient systems . the separations by hplc are accomplished by pumping solvent / sample through a column which is packed with materials optimized for efficient separations . separation results from differences in the extent to which the various components in the mixture interact with the column packing material . if there is little or no interaction , the component ( s ) will be passed quickly through the column packing resulting in decreasing elution time . each component elutes from the column at a slightly different time , where it is detected and collected . a basic hplc unit is composed of a mobile phase reservoir , a pump for solvent delivery , and a sample injector . a chromatography efficiency hplc separation is achieved by using a combination of correct column , good lc apparatus , good operation and specialized know - how . petroleum oils , such as crude oils and heavy hydrocarbons , are composed of two major parts ; high molecular weight asphaltene ( fraction insoluble in paraffinic solvents ) and a lower molecular weight asphaltene - free oil . the asphaltene and the oil fraction vary significantly in their chemical structure , coking characteristics , thermal characteristics , average molecular weight and distribution . the following table 1 illustrates the varying differences in the characteristics of a typical heavy oil , its asphaltene and deasphaltenated oil fractions : table 1______________________________________ deasphaltenated crude oil oil asphaltene______________________________________average mol . wt . 190 -- 1150coke yield (%) 5 - 12 -- 20 - 30 @ 450 ° c . carbon / hydrogen 0 . 52 0 . 47 0 . 59ratiomelting point (° c .) liquid liquid 190oxygen content 0 . 38 0 . 34 1 . 86 ( wt %) ______________________________________ asphaltenes present in heavy oils have high molecular weight and very broad molecular weight distribution , sometimes with molecular weights up to 10 , 000 . a typical molecular weight distribution of a crude is illustrated in fig1 . it has been found that fouling is primarily a compatibility problem of asphaltenes ( defined herein as n - heptane insolubles or c 7 - asphaltenes ) with the other components of the oil . hence , since asphaltenes are soluble in aromatics but generally insoluble in the saturated hydrocarbons , it is a discovery of this invention that the amount of aromatics relative to asphaltenes determines the compatibility . thus the type of oil is not of overall significance , e . g ., crude , residual or otherwise . hence , the aromatics : asphaltenes as described above and the comparable fouling associated with the ratio in question may be determined on an actual crude or resid or on synthetic compositions . subsequently petroleum oils of any nature may have their aromatic / asphaltene ratio determined directly from the prior data . for example , fig2 and 3 were prepared from numerous different oils of different grade classifications and the two curves are essentially the same . thus it is not so much the relative amounts of saturates and aromatics but only the relative amount of aromatics and asphaltenes which controls and determines compatibility and hence fouling . typical neutral aromatics include for example , indanes , naphthenonaphthalenes and naphthenophenanthenes . typical polar aromatics include for example , benzothiophenes , indenothiophenes , acenaphthylenothiophenes , benzofurans , indenobenzofurans and acenaphthylenofurans . the asphaltenes may be determined by insolubilization with antisolvents such as paraffinic solvents such as n - pentane , n - hexane , cyclohexane , isopentane , petroleum ether , n - heptane and the like . paraffinic and polar asphaltene antisolvents can be used and these are effective over a broad range of oil / solvent ratios . these antisolvents should be of low molecular weight , low viscosity and have low boiling characteristics to allow easy separation and recovery of the insolubles ( asphaltenes ). the paraffin antisolvents include c 3 - c 20 paraffins . the paraffin antisolvents are preferably up to c 10 straight or branched alkanes , usually c 5 to c 10 , e . g ., suitable antisolvents include pentane , isopentane , hexane , 2 - methyl hexane , n - heptane , octane , nonane , decane , isooctane and the like . the polar antisolvents cover a broader spectrum of materials . the present polar solvents are organic compounds which are liquids under the conditions of use . the term &# 34 ; polar &# 34 ; refers to atoms such as oxygen , sulfur , oxygen halogens and nitrogen . a partial listing of suitable polar antisolvents includes alcohols such as , isobutanol , 2 - pentanol , isoamyl alcohol ; ketones such as acetone ; methyl ethyl ketone ; ethers such as diethyl ether , methyl propyl ether ; esters such as methyl formate , butyl formate , methyl acetate , methyl propionate ; glycol ethers , such as ethylene glycol monomethyl ether , ethylene glycol diethyl ether ; heteroatom compounds such as furan , tetrahydrofuran , furfural , methyl pyridine , and the like . mixtures of hydrocarbon and polar materials are desired antisolvents for petroleum streams containing functional groups . sufficient antisolvent is used to insolubilize the asphaltenes , generally about 1 : 10 to 1 : 100 ( volume ) sample to antisolvent . in the present examples n - heptane was the solvent used to deasphaltenize the petroleum fraction . the asphaltene was determined by dissolving the total oil sample in n - heptane at a ratio of 1 : 40 at room temperature and filtering through 0 . 35 micron fluorcarbon membrane . if desired asphaltenes extraction with the antisolvents can be made at higher temperature , e . g ., 30 °- 100 ° c . analytical methods other than liquid extraction with antisolvent can also be used for determining asphaltenes for example ; clay - silica gel chromatography and light scattering . all of the examples cited herein demonstrating the fouling characteristics of crude and residual oils utilized a laboratory test apparatus known as the thermal fouling tester . the tester is a modification of the alcor jet fuel oxidation tester described in astm vol . 50 d - 3241 . it is configured to allow measurement of the fluid temperature at the exit of the heat exchanger while the metal temperature of the heated tube is controlled . the test thus measures the change in temperature of a fluid which has been pumped across a heated surface . the outlet temperature is directly related to the heat transferred to the fluid . if fouling occurs , a deposit adheres to the heated surface and insulates the surface from the test fluid . the insulating deposit reduces the rate of heat transfer to the fluid and its temperature decreases . the rate of change in the fluid temperature is a measure of the rate of fouling . the time over which temperature measurements are recorded was set at 3 hours . the following examples are reported for illustrative purposes only and are not to be construed as limiting the invention herein described . unless specified otherwise , as used herein , all parts and percentages are by weight and based on the total weight of the oil . the fouling characteristics ( δt ) of the specified oils used in this investigation were measured by the thermal fouling tester using the following operation conditions : ______________________________________type of heater tube two piece c / s tubemetal temperature (° f .) 700oil circulation rate ( cc / min ) 3 . 0preheating (° f .) 70pressure ( psig ) 500time ( hours ) 3 . 0______________________________________ in the analytical separation , a 3 . 9 mm by 30 cm long energy analysis column commercially available from waters associates , 34 maple street , milford , mass . 01757 , usa , was used with n - heptane as the solvent and mobile phase . the samples were &# 34 ; dissolved &# 34 ; in the n - heptane at a volume ratio of 1 : 40 of sample : solvent . the solution was filtered through a 0 . 45 micron fluorocarbon membrane filter to remove any insoluble material ( asphaltenes ). the deasphaltenated &# 34 ; oil &# 34 ; was then injected into the energy analysis column . the first peak was the saturates : normal , iso and cyclosaturates . any aliphatic unsaturates are eluted at this time . the neutral aromatics , up through six condensed rings , eluted as the next fraction . at this point , the mobile phase was reversed through the column . this was done by the use of a high pressure valve activated by timed events . with the flow in the reverse direction the polar aromatics eluted . this fraction contained sulfur , nitrogen and oxygen - containing aromatics . the total instrument time was 23 minutes . the neutral aromatics , and polar aromatics were determined from the chromatographic area , times the response factor calculated from the api gravity . the removal of &# 34 ; asphaltenes &# 34 ; was done quantitatively by filtration , and the saturates were determined by difference . the analytical separation was done on a dual detector instrument ( uv at 254 nm and differential refractometer in series ). the column was a 3 . 9 mm by 30 cm long energy analysis column . the solvent and mobile phase was n - heptane . the flow rate was maintained at 2 . 0 ml / min at room temperature . the instrument also contained a high pressure valve used in column backflush . the valve was activated from timed events on an m - 730 data module . the sample was dissolved in n - heptane at a ratio of 1 : 40 ( 0 . 5 grams of sample dissolved in 20 ml of n - heptane ) and mixed using ultrasonic bath for 30 minutes at room temperature . this solution was filtered through a tared 0 . 35 micron fluorcarbon membrane filter . after the filter was dried , it was re - weighed for the amount of saturates and asphaltenes . in these examples the &# 34 ; fouling index &# 34 ; is the ratio of total aromatics : n - heptane insolubles . sixteen different crude oils were evaluated for fouling characteristics ( tft , δt ° f .) and analyzed ( hplc and insolubles ). the ratio of total aromatics : c 7 - asphaltenes ( n - heptane ) and related fouling is reported in table ii . the ratio is reported under the heading fouling index ( fi ). the higher the fi the less incompatibility and hence less fouling . table ii______________________________________relation of incompatibility to tft - foulingcrude fouling tft - foulingno . index ( δ t , ° f . ) ______________________________________1 6 . 1 60 , 612 2 . 5 563 10 . 2 39 , 40 , 414 5 . 1 495 73 . 1 00 . 06 11 . 0 507 4 . 1 418 3 . 9 459 3 . 5 82 , 7710 31 . 2 011 13 . 8 2512 19 . 2 513 5 . 2 8014 3 . 5 8115 3 . 7 7716 29 0 , 4______________________________________ ten different petroleum resides were evaluated for fouling characteristics ( tft δf ° f . ) and analyzed ( hplc and insolubles ). the ratio of total aromatics : c7 - asphaltenes ( n - heptane ) and the related fouling for each resid is reported in table ii . the higher fi the lower the fouling . the results in table iii are reported in fig3 . table iii______________________________________relation of incompatibility to tft - foulingresid fouling tft - foulingno . index ( δ t , ° f . )* ______________________________________1 10 . 4 60 ( 900 ° f .) 2 8 . 0 -- 3 44 0 ( 950 ° f .) 4 4 . 0 55 ( 900 ° f .) 5 25 . 8 8 ( 900 ° f .) 6 5 . 8 42 ( 900 ° f .) 7 4 . 3 53 ( 900 ° f . )/ 94 ( 990 ° f .) 8 0 . 9 79 ( 950 ° f .) 9 1 . 0 -- 10 14 . 1 95 ( 950 ° f .) ______________________________________ *() numbers are for the metal heater temperature in the thermal fouling tester .	6
as shown in fig1 a computer 110 includes software applications used to create and store data assets . these data assets can include word processing files , database files , picture files , database records , or any other type of electronically stored data . once a data asset has been created , it can be stored in an asset storage system 112 ( which may be a disk - based file system ). assets stored in the system 112 may thereafter be retrieved by the computer 110 as well as by other computers having access to the data asset on the storage system 112 . the storage system 112 can include multiple physical devices and can include local and remote storage devices . for example , the storage system 112 can include a local hard disk drive of computer 110 as well as remote server - based storage , storage across multiple servers on a network , and storage in a database . assets in the storage system 112 can be organized in a hierarchical manner , such as files stored in a unix ™ file system , or may be loosely organized , such as files stored across multiple computers connected by the internet network , or may be rigidly organized , such as records stored in a relational database . the logical arrangement , cataloging , storage , and retrieval of data assets in the storage system 112 is facilitated by metadata tags (“ tags ”) associated with the stored data assets . tags are used to represent concrete or abstract objects and ideas , and are used to organize data assets in the storage system 112 by relationships established between the tags and data assets . in the system 100 , tags are stored in a tag database 113 and , through software operations of the computer system 110 and of a tag database server 111 , relationships are established between the tags and data assets . the relationships between tags in the database 113 and data assets in the storage system 112 can be independent of data asset storage types , the applications that create the data assets , and the arrangement of the assets in the storage system 112 . tags can be stored in a tag database 113 by the tag database server 111 . software programs executing on the computer 110 send requests 103 to the server and receive responses 104 from the server to access and alter tag data . tag data manipulation and access requests 103 and tag server responses 104 can be exchanged when a data asset is initially created and stored in the storage system 112 , when an existing data asset is altered , or at other times as may be determined by a user of the computer system 110 . for example , a data asset 107 can be an adobe framemaker ® version 5 . 5 file . the asset 107 can be stored in the system 112 by selecting the ‘ save ’ operation from the framemaker ‘ file ’ menu and designating the storage system 112 as the storage destination for the asset 107 . contemporaneous with the saving of file 107 , actions to create and / or alter tag data can be performed at the computer 110 and server 111 . for example , on a microsoft windows 95 ® system , tag data can be created at the computer 110 using modified operating system ‘ save ’ procedures . the modified ‘ save ’ procedures , as will be explained later , can provide an interface to a user at the computer 110 to receive tag data information or to derive tag information from file 107 contents . the tag data received from the user or derived from the file 107 can then be sent to the server 111 for storage in the tag database 113 . as explained below , the tag data sent to the database 113 can be interrelated with tag elements existing in the database 113 to logically catalog and logically organize the asset 107 . the logical organization and cataloging of tag data in the database 113 is provided through the use of a tag model . the tag model includes several tag categories and defines relationships allowed between tags of a given category and between tags in different categories . these tag relationships can be logically represented in the form of a semantic network ( known herein as a “ tag network ”). as shown in fig2 a tag network 200 is a lattice or graph structure formed from interconnected nodes 201 , 210 - 224 , and 240 - 245 . the tag network 200 provides a metadata description of an asset represented by node 201 . as described by the tag network 200 , and as will be more fully explained below , the asset represented by node 201 is a document about monochrome printers entitled “ hp 1703 specification ,” is related to a project named jasper , has an author named “ simons ” and a primary author named “ jones .” a tag semantic network can represent assets in the storage system 112 ( fig1 ) using asset reference tags (“ asset references ”). for example , the network 200 includes the asset reference 201 . an asset reference is directly related to an asset stored in the storage system 112 . asset references include pointer data identifying a method to retrieve a stored asset . the stored pointer data can include a hierarchical file system directory and file name , a uri ( uniform resource identifier ), a structured query language ( sql ) program , or other asset retrieval information . asset references can also include additional data , such as the asset type and information about the asset &# 39 ; s representation in the storage system 112 . each asset reference in the network 200 can be formed by operating system procedures that provide appropriate pointer data and instructions to a tag server 111 when data assets are stored in the storage system 112 ( fig1 ). a tag network includes various metadata elements that can be interrelated and used to describe stored assets . one tag model metadata type , referred to as a “ named concept ,” is used to describes concrete or abstract idea that a user may wish to interrelate with asset references . for example , the idea of a computer printer is represented by concept 214 uniquely named “ printer .” named concepts can be associated with asset references , and with other tags in a tag network . named concepts can be created using an interface provided at computer 100 or server 111 whereby a user can enter unique text strings describing a concept . after entry of the unique text string , data storage instructions are provided to the server 111 to store each string as a concept in the tag database 113 . additionally , associations between named concepts and asset references can be created by a user using an interface provided at computer 100 or server 111 . named concepts can be hierarchically organized through the use of user - specified refinements . in the tag network 200 , refinements are shown as solid lines interconnecting named concepts 210 - 218 , and 220 - 222 . as shown in fig2 and 3a , refinements interconnecting named concepts 210 - 218 and 220 - 222 establish three concept hierarchies . the first hierarchy 300 includes concepts 210 - 214 related to product types , the second hierarchy 310 includes concepts 214 - 218 related to printer color capabilities , and the third hierarchy 320 includes concepts 220 - 222 related to people . concept hierarchies allow a parent concept to be partitioned into multiple child concept subdivisions . additionally , concept hierarchies can be used to establish peer relationships among concepts . for example , in the semantic network 200 , the parent concept “ product ” 210 is subdivided into two child concepts “ computer s / w ” 211 and “ computer h / w ” 212 . the child concepts 211 and 212 are peers since they are each direct refinements of a common parent concept 210 . a concept may also have multiple parent concepts if it is a logical subdivision of each . thus , concepts may be flexibly arranged in a variety of lattice or directed graph structures . for example , a user may organize a “ car ” concept as a subdivision of a “ product ” concept but also consider the “ car ” concept as a subdivision of a “ entertainment ” concept ( not shown ) if he or she is a car enthusiast . refinements may be specified by a user using a graphical user interface ( gui ) at the computer 110 or server 111 to specify parent - child relationships . for example , a user can specify a parent - child relationship by dragging a graphical icon representative of a child concept onto a graphical icon representative of a parent concept . the hierarchical organization of concepts facilitates navigation of a tag network and facilitates searching for data in the tag network . for example , a user may wish to search the tag network 200 to retrieve all assets associated with the product concept 210 . to do so , a user may select the product concept 210 using a search query interface provided at computer 110 . as can be seen in fig2 no asset references are directly associated with the product concept 210 . however , the network 200 includes asset reference 201 that is associated with the printer concept 214 through a concept instance 240 . as will be explained below , each concept instance functions as a logical surrogate for the concept that it is an instance of . using information concerning the hierarchical relationship 300 ( fig3 a ) among concepts 210 - 214 , a tag network search routine can determine that the printer concept 214 is a subdivision of the computer hardware concept 212 which , in turn , is a subdivision of the product concept 210 . a tag network search routine can therefore conclude that the printer concept 214 is a subdivision of the product concept and therefore the printer concept 214 logically satisfies a search for the product concept 210 . the search routine can therefore determine that asset reference 201 satisfies a query for assets associated with the product concept 210 . in the above example , it was appropriate for the search routines to consider subdivision of a concept when trying to find a match for the concept in the network . in other instances it is appropriate to search only for the specific concept or even to consider the ancestors rather than descendents . this may be specified as search routine query parameters . a tag network can also include anonymous concepts . like named concepts , anonymous concepts can be joined by refinements to other anonymous concepts and to named concepts . unlike named concepts , however , anonymous concepts do not require a unique distinguishing name . instead , anonymous concepts are uniquely distinguished by the refinement relations between the anonymous concept and other anonymous or named concepts . anonymous concepts can be used to group descendent concepts and alter peer relationships among concepts in a concept hierarchy . implementations of the tag model can also include interconnection points 240 - 245 , referred to as “ concept instances .” concept instances function as logical surrogates for the concepts that they are instances of . concept instances can be used to organize and structure logical interconnection between concepts and other types of metadata in a tag network . for example , in the network 200 , concept instance 240 is used as a connection point between asset reference 201 and the “ printer ” concept 214 . a single concept can have multiple instances that descend from the concept . each concept instance is uniquely defined by the concept from which it descends and by its detail associations ( explained later ) to other tag network elements . thus , through the use of concept instances , particular interconnections to a concept can remain logically distinct and separate from other interconnections to that concept . in some implementations , concept instances may be created automatically by the server 111 whenever an association to a concept element or between concept elements is created . in addition to concepts , instances , and asset references , a tag network can include primitive data elements . primitive data elements are general - purpose storage types used to represent , for example , integers , floating - point numbers , character strings , and dates that are entered by a user or created in the system 100 . for example , in the tag network 200 , a string primitive is used to store the string value “ hp 1703 specification ” 260 and a date primitive is used to store the date 261 that the asset was first encountered . the string primitive 260 may be entered by a user while the data primitive 261 may be set by the computer 110 . the value of a primitive data element can be dynamically altered . by interrelating concepts , instances , asset references , primitive elements , and other tag model elements , a meaningful description of a stored asset can be structured . such interrelations can be provided through association relationships (“ associations ”). associations can be specified by a user when a non - hierarchical relationship exists between a source and a target concept , concept instance , asset reference , or primitive data element . in the tag network 200 , associations are shown as dashed lines 250 - 256 . for example , in the network 200 , asset reference 201 pertains to a document about monochrome printers . asset reference 201 is therefore logically related to the printer concept 214 but is not a sub - division of the printer concept 214 . since asset reference 201 is not a sub - division of the printer concept 214 , it is semantically incorrect to use a refinement relationship to interconnect the asset reference 201 and the printer concept 214 . instead , the relationship between the asset reference 201 and printer concept 214 is specified through the use of an association 251 . associations include “ about ” associations 250 - 251 and “ named ” associations 252 - 256 . an about association provides information “ about ” a source that is expressed by a target . for example , an about association 250 exists between asset reference 201 and the instance 245 of the “ jasper ” concept 224 . the association 250 thereby describes the asset referred to by the reference 201 as being “ about ” the jasper project 224 . associations between a source and target can also be described using named associations . named associations include additional information describing the nature of the association between the source and target of the association . the additional detail provided by a named association is referred to as the “ relation ” between the source and target . in the tag semantic network 200 , named associations 252 - 256 have , respectively , relations 272 - 276 entitled “ author ”, “ primary author ”, “ encounter via ”, “ encounter on ”, and “ title .” a named association &# 39 ; s relation provides further information regarding the association between a source and a target . for example , the named association 253 has the “ primary author ” relation 273 . this relation 273 indicates that “ jones ” 222 is the primary author of the document referred to by asset reference 201 . in various implementations , an “ about ” association may be implemented as a named association with a blank or null - value as its name or a particular predetermined relation value may be used to indicate “ about ” associations . like concepts , relations can be user defined and hierarchically - organized . as shown in fig4 three hierarchies 450 , 460 , 470 are formed from relations 272 - 277 , 401 , and 402 . relations 272 - 277 are referenced by named associations 252 - 257 ( fig2 ) while relations 401 and 402 exist in the hierarchies 460 and 470 but are not referenced by a named association . the hierarchical organization of relations , like that of concepts , facilitates navigation of a tag network and facilitates searching for data in the tag network . for example , a user may wish to search for a document with an author of “ jones .” to do so , search routines are used to search the tag network 200 to find an association with the relation “ author ” interconnecting an asset reference and an instance of the “ jones ” concept . in the network 200 , no such association exists . however , using the relation hierarchy 460 ( fig4 ), a search routine could determine that the “ primary author ” relation 273 is a subdivision of the “ author ” relation 272 and therefore satisfies queries requiring the “ author ” relation 272 . thus a search routine could determine that the asset reference 201 having a “ primary author ” of “ jones ” satisfies a query for assets with an “ author ” of “ jones .” as with searching over concepts , searching over relations may also consider only the specified relation or ancestors of that relation . at times , a user may wish to refine one or more concepts without creating further subdivisions of the particular concepts . this may be desirable where , for example , a second and distinct concept hierarchy includes the desired subdivision information . in such a case , the user may want to subdivide a concept using information from the second hierarchy but without duplicating the second hierarchy as a descendent of the concept to be subdivided . for example , as shown in fig3 b , a tag network 350 includes concept hierarchies 360 and 370 . concept hierarchy 360 including concepts 361 - 365 related to products and , in particular , includes concept 363 representing the adobe illustrator ® software product . concept hierarchy 370 includes concepts 371 - 375 related to computer operating systems . a user may wish to subdivide the illustrator concept 363 based on operating systems that the software runs on . although a user can use refinements to subdivide the illustrator concept 363 into additional operating - system dependent subdivision concepts , it may be preferable to refer instead to the concept hierarchy 370 . to do so , the user can make use of a particular type of association referred to as a ‘ detail ’ association . a detail association permits a user to subdivide a concept or instance using a reference to another concept or concept hierarchy in a tag network . in the network 350 , detail associations are shown as dotted lines 351 - 353 interconnecting instances 381 - 383 with , respectively , concept 372 and with instances 384 and 385 . a detail association , like a named association , includes a relation . detail associations 351 and 352 each include the “ runs on ” relation 355 while detail association 353 includes the “ works with ” relation 356 . the detail &# 39 ; s relation describes the nature of the details being added to the concept or instance . for example , instance 381 of the illustrator concept 363 has detail association 351 . the detail association 351 has the “ runs on ” relation 355 and couples the instance 381 to an instance 385 of the unix ® operating system concept 375 . the detail association 351 thereby indicates that the instance 381 of the illustrator concept 363 refers to a version of the adobe illustrator ® software that runs on a unix operating system . consequently , if an asset reference were to have an about association to the instance 381 it would indicate that the referenced asset was ‘ about ’ illustrator software running on a unix operating system . each instance or concept can include multiple detail associations . for example , instance 381 could include a second detail association ( not shown ) having the relation “ version ” to a numeric primitive element having a value of 5 . 5 ( not shown ). the combination of the detail 351 with this second detail would indicate that instance 381 refers to version 5 . 5 of illustrator that runs on unix . each concept instance , e . g ., 381 - 385 of fig3 in a tag semantic network is uniquely defined by its parent concept and its collection of detail associations . in various implementations , relation hierarchies may or may not be considered during a search for a particular detail . thus , in some implementations , a search for a instance having a particular detail association will be satisfied only by the detail having the particular specified relation . implementations of the tag model may also include rules placing particular requirements or restrictions on the organization of tag data . these rules , known as prescriptions , can help ensure a consistent and meaningful organization of tag data . for example , a consistent organization of tag data may be enforced by prescriptions requiring particular detail associations for instances of a specified concept . the tag model may also include prescriptions limiting refinements , associations , and the accepted data range for the values of particular primitive elements . prescriptions affecting a concept or relation may be inherited by descendent concepts , instances and relations . for example , as shown in fig3 b , the computer software concept 362 may have a prescription requiring all instances of the concept 362 to include a “ runs on ” detail association . this prescription may be inherited by descendent concepts such as the illustrator concept 363 thereby requiring instances 381 and 382 of the illustrator concept 363 to have a detail including the “ runs on ” relation 355 . inherited prescriptions may affect both population of data structures and navigation of the tag network . for example , during searching and data entry , if a user fails to specify a particular required detail association , that detail may , by default , have a distinguished target value of “ all .” the “ all ” value will match any particular value specified in a search . in a multi - user implementations , tag model data may be simultaneously accessed , deleted , and updated by multiple users or software processes . alterations made by a first user or application may , in some circumstances , be problematic . in particular , alterations made by a first user or application may change the aggregate information in the tag model database so as to alter a second user &# 39 ; s or program &# 39 ; s understanding of the information . the second user or application may thereafter behave in an erroneous manner due to its incorrect understanding of the state of the tag model data . therefore , the tag model may implement a data integrity mechanism called a ‘ contract ’ that avoids such errant behavior . a contract is a request between a user or application and the tag model database indicating that the requesting user or application needs to maintain a particular view of certain specified tag model elements . when a contract has been established , the tag model database server limits alterations that can be subsequently made . if a second user or application requests a change to the tag model database , and that change would cause a contract to be broken , the tag model database server may prevent the operation or may require the second user to explicitly break the contract such as by entering a command to override the contract . tag data may be presented and manipulated independent of specific software applications . this can be done , for example , using modified operating system functions or through the use of a tag data helper application . as shown in fig1 and 10 , a computer 110 has a software environment 1000 including one or more application software programs 1010 and operating system software 1020 . the application software 1010 is , for example , the adobe illustrator program and the operating software 1020 is , for example , a graphical user interface ( gui ) operating system such as microsoft windows 95 . by modifying operating system software 1020 , operations on data in the tag database 113 can be initiated by a software application 1010 without requiring the explicit alteration of the application . modifications to the operating system 1020 to provide tag data features can include modifications to operating system procedures that provide ‘ save ’ 1021 and ‘ open ’ 1022 functionality . such procedures may be used to create a file system handle that is subsequently used by the operating system 1020 or application procedure 1010 to store , retrieve , or manipulate a data asset . as shown in fig1 , 11a and 11 b , a gui operating system 1020 typically includes graphical interface functions to facilitate file ‘ save ’ and ‘ open ’ operations . these save and open may be initiated by a selection provided in a graphical menu and , when initiated , may provide functions as shown in fig1 a . in particular , ‘ save ’ and ‘ open ’ operations may present a gui interface to receive input from a user 1061 . in response , asset storage data is received from the user 1064 . the received data identifies a location in the storage system 112 ( fig1 ) where a data asset can be stored or where a previously stored data asset can be found . additionally , a file system handle is determined 1067 and provided to the application that initiated the ‘ save ’ or ‘ open ’ operation 1068 . the application may subsequently use the file handle to store or manipulate a data asset in the storage system 112 ( fig1 ). ‘ save ’ and ‘ open ’ procedures provided by an operating system 1020 can be modified and the modified procedures linked to a program application to access and manipulate tag data . for example , “ save ” and “ open ” procedures provided in a dynamically linked library ( such as in a microsoft windows 95 “. dll ” dynamically linked library ) can be modified . when an application using the particular dynamically linked library is linked to the modified library , such as by operating system run - time linking procedures , the new tag database capabilities present in the modified library will be available to the application . as shown in fig1 a and 10 c , data asset software access procedures executing on a computer 110 can include functions to store and manipulate tag data in a tag database 113 ( fig1 ) when these operating system ‘ save ’ and ‘ open ’ functions are initiated by an application 1010 . referring to fig1 and 11 b , to manipulate tag data in the database 113 ‘ save ’ and ‘ open ’ procedures can , for example , present a gui interface to receive asset location information from a user 1071 . additionally , an initial query is sent from the operating system 1020 to the tag server 111 to determine the state of tag networks in the tag database 113 . the initial query can be sent using operating system remote procedure calls to send a request to the tag server 111 . in response , the tag server may return a listing of all concepts , named associations , and relations that can be associated with a data asset being saved or that can be searched for during an ‘ open ’ operation . tag information returned by the tag server 111 to the save 1021 or open 1022 procedure can then be displayed to a user using a tag data interface ( step 1173 ). the tag data interface ( step 1173 ) can be a graphical user interface that allows a user to select particular tag elements , enter new tag elements , or compose arrangements of elements such as concepts , associations , relations , and details . during a file open operation , the tag data received at the interface ( step 1173 ) can be used to form a second tag query ( step 1174 ). in response to the query ( step 1174 ), the tag server 111 can invoke search routines to identify a list of data assets and their storage locations . this data asset list can be returned to the ‘ open ’ procedure and presented to the user of the computer 110 ( step 1175 ). the user can then select one of the listed assets as the target of the “ open ” procedure ( step 1176 ). subsequently , a file handle is determined ( step 1177 ) and returned to an application 1110 for subsequent use by application 1010 and operating system 1020 software procedures ( step 1178 ). an application program may subsequently manipulate the identified asset . many modifications may be made to the exemplary procedures of fig1 a and 11b . additionally , modified operating system procedures are not limited to procedures like ‘ open ’ and ‘ save ,’ but may be extended to many types of operating system procedures . for example , if a data asset is to be printed , the print procedures can query the tag server 111 ( fig1 ) to determine printer - related characteristics of the data asset . for example , data in the tag database 113 ( fig1 ) may indicate that the data asset is a color picture and therefore should be printed using a color output device . modified operating system procedures are only one way to access , create , and manipulate tag data . a tag data viewer application can be used to access , create , and manipulate data in the tag database . a tag data viewer is a software application that exchanges data with the tag server 111 ( fig1 ) to manipulate data in the tag database 113 . the tag viewer provides software functions to identify particular assets in the storage system 112 . these functions can include internet browser - like functions to select data stored on hypertext markup language ( html ) servers . additionally , functions to examine data assets in a database , on a hard disk , or on a collection of network servers may be included . for example , a tag viewer can be used to browse directories graphically in a hierarchical file system . once a user has identified a data asset using the tag viewer , the asset can be associated with tag data . the tag viewer may query the tag server 111 to identify tags that can be associated with the identified asset , present the identified tags to a user , allow a user to select tags , and facilitate the creation of new tags and tag interrelations . a tag semantic network can be implemented using various data structuring techniques . in the embodiment described below , the tag semantic network is implemented using multiple tables stored in a relational database . as shown in fig5 - 9 , in an exemplary relational database implementation , the tag model uses the following database tables : “ asset_refs ” 500 , “ concepts ” 600 , “ concept_instances ” 625 , “ concept_refinements ” 650 , “ relations ” 700 , “ relation_refinements ” 725 , “ associations ” 800 , “ strings ” 900 , “ numbers ” 925 , “ dates ” 950 . the tables in fig5 - 9 correspond to the examples in fig2 a , and 4 . as shown in fig5 asset references can be stored in the “ asset_refs ” database table 500 . each row of the table 500 encodes a separate asset reference . an encoded asset reference includes , for example , a uri ( uniform resource identifier ) or other data identifying how the asset is accessed . each asset reference may also include format information to indicates the type of stored asset . for example , the format identification information can be used to indicate that the stored asset is a text file or an adobe photoshop ® file . each asset reference may also include an identification number that uniquely identifies the asset reference . the identification number may be used in other tag model database tables to identify the asset reference . as shown in fig6 concept definitions can be stored in the “ concepts ” table 600 . for each concept in the tag model , the table 600 includes a row having a unique numerical identification , the concept &# 39 ; s unique name , and an indication of whether the concept is anonymous . for example , the product concept 210 ( fig2 ) is stored as the unique name string “ product ” and the unique identification number 210 . the identification number is a mechanism used to refer indirectly to the concept definition in other tag model database tables . in alternative implementations , the unique concept name , a memory pointer , or other identifier may also be used to refer to a concept . concept instances can be stored in the “ concept_instances ” table 625 . each row of the concept_instances table 625 includes a unique instance identification number and the identification number of the concept to which the instance refers . concept refinements can be stored in the “ concept refinements ” table 650 . the “ concept_refinements ” table 650 defines the hierarchical relationships among concepts in the “ concepts ” table 600 . in the table 650 , concepts are identified by the concept identification numbers defined in table 600 . each row of the “ concept_refinements ” table 650 defines a relationship between an ancestor concept and a descendent concept ( ancestor - descendent relationships include parent - child relationships , in which there is a direct relationship between the ancestor and the descendent , and also include relationships in which the ancestor and descendent are separated by multiple hierarchical levels ). multiple child concepts can be directly connected to a common parent concept thereby forming subdivisions of the parent concept . for example , rows 651 - 654 form the hierarchical concept relationship 300 ( fig3 a ). multiple parent concepts can be directly connected to a common descendent concept ( not shown ). the “ concept_refinements ” table may also indicate indirect relationships in the concept hierarchy . for example , row 660 of table 650 indicates that the illustrator concept is a descendent of the product concept . however , since the illustrator concept is at a minimum distance of ‘ 2 ’ from the product concept , the product concept is not a parent ancestor of the illustrator concept . indirect relationships can be used to optimize search functions by allowing ancestor - descendent relationships to be determined without traversing a concept hierarchy at search time . the distance between concepts need not be included in the “ concept_refinements ” table 650 if only parent - child relations ( i . e ., direct relations between ancestor and descendent concepts ) are represented . as shown in fig7 relations can be stored in the “ relations ” table 700 . for each relation in the tag model , the table 700 includes a row having a unique numerical identification and the relation &# 39 ; s unique name . for example , the “ title ” relation 434 ( fig4 ) is stored in row 703 , which includes the relation name “ title ” and the identification number ‘ 276 ’. relation identification numbers are used to refer indirectly to the relation in other tag model database tables . in alternative implementations , the unique relation name , a memory pointer , or other identifier may also be used to refer to the relation . relation refinements can be stored in the “ relation_refinements ” table 725 . the “ relation_refinements ” table 725 defines the hierarchical relationship among relations in the “ relations ” table 700 . each row of the table 725 defines a relationship between an ancestor relation and a descendent relation . multiple descendent relations can have a common ancestor relation thereby forming subdivisions of the ancestor relation . for example , rows 726 - 728 form the relation hierarchy 460 ( fig4 ). like the “ concept_refinements ” table 650 , the “ relation_refinements ” table 725 may , in various implementations , indicate indirect relationships by including , for example , indirect relations and minimum distance data . as shown in fig8 primitives can be stored in tables 800 , 825 , 850 . the tables 800 , 825 , 850 store , respectively , string primitives , numeric primitives , and date primitives . each row of primitive tables 800 , 825 , 850 includes an identification number and the value of the primitive . the identification number may be used as the target of an association . an implementation may also include additional tables or language type identification information stored along with data representing other primitive elements . as shown in fig9 the “ associations ” table 900 can store associations between source and target concepts , instances , asset references and primitive values . each row of the table 900 defines an association between a source and a target . additionally , each row of the table 900 includes a source type identifier and a target type identifier . for example , the type identifiers ‘ a ’, ‘ c ’, ‘ i ’, ‘ s ’, ‘ n ’, ‘ d ’, are used to designate asset references , concepts , concept instances , string primitive elements , numeric primitive elements , and date primitive elements , respectively . the use of source and target type identifiers in the table 900 facilitates determination of the source &# 39 ; s or target &# 39 ; s definition table 500 , 600 , 625 , 700 , 800 , 825 , 850 . additionally , for each named association , the table 900 includes the numeric identifier corresponding to a relation defined in table 700 ( fig7 ). in the case of about associations , a relation is not designated . the table 900 further includes a column “ is_a_detail ” indicating whether a particular named association is a detail association . in various implementations , various association type , ‘ a ’, ‘ c ’, ‘ i ’, ‘ s ’, ‘ n ’, ‘ d ’ may be stored in a separate table as may detail associations . the encoding of the tag model allows complex queries to be generated . for example , the target of a search can include enumerations of concepts , relations , or primitive values , string regular expressions , and ranges of values . additionally , searching and manipulation of tag model data can be performed using conventional database query languages . for example , in a relational database implementation supporting the structured query language ( sql ) and having database tables such as those illustrated in fig5 through fig9 a user query for documents about computer hardware authored by “ simons ” may be translated into the structured query language ( sql ) query of table 1 to retrieve relevant asset references . the interface to the tag model database can be a graphical user interface ( gui ). in a gui implementation , such as that provided by the apple macos ® operating system or the microsoft windows 95 operating system , search queries can be entered using graphical interface elements such choice lists , push buttons , check boxes , and text entry dialog boxes . such graphical interface elements may provide an interface to a search query generation routine . for example , a gui may present a list of concept elements which can be selected to define a search query . the selected concept elements can then be used by a query generation routine to generate sql or other query code and thereby to interact with the tag model database . additionally , the gui interface can contain interface functionality to input concept element names , input relation element names , manipulate hierarchies of concepts and relations , define asset references , and define interconnections between such elements . in non - gui implementations , these functions may be performed by inputting text and commands using a keyboard in response to computer system prompts . in a program - to - program implementation , the interface to the tag model database may be an application programming interface accessible to other software programs . for example , a program may use the tag model database to logically structure and organize data associated with the internal operation of the first program . such data may be hidden from a human user of the first program . in some implementations , the all or part of the storage system 112 and tag database 113 can be on the same storage media , while in other implementations , the tag database is stored separate from the asset database and may be distributed across a network of storage servers . additionally , the tag database server 111 can be a software process executing on a dedicated server computer or , in some implementations , all or part of the server 111 can be a software process executed at the computer 110 along with various user applications . furthermore , the tag database 113 may include predefined tag elements . for example , a tag database 113 having predefined concepts , relations , and details describing various work and leisure activities may be provided . the invention may be implemented in digital electronic circuitry , or in computer hardware , firmware , software , or in combinations of them . apparatus of the invention may be implemented in a computer program product tangibly embodied in a machine - readable storage device for execution by a programmable processor ; and method steps of the invention may be performed by a programmable processor executing a program of instructions to perform functions of the invention by operating on input data and generating output . the invention may advantageously be implemented in one or more computer programs that are executable on a programmable system including at least one programmable processor coupled to receive data and instructions from , and to transmit data and instructions to , a data storage system , at least one input device , and at least one output device . each computer program may be implemented in a high - level procedural or object - oriented programming language , or in assembly or machine language if desired ; and in any case , the language may be a compiled or interpreted language . suitable processors include , by way of example , both general and special purpose microprocessors . generally , a processor will receive instructions and data from a read - only memory and / or a random access memory . storage devices suitable for tangibly embodying computer program instructions and data include all forms of non - volatile memory , including by way of example semiconductor memory devices , such as eprom , eeprom , and flash memory devices ; magnetic disks such as internal hard disks and removable disks ; magneto - optical disks ; and cd - rom disks . any of the foregoing may be supplemented by , or incorporated in , specially - designed asics ( application - specific integrated circuits ).	8
referring initially to fig1 a system is shown and generally designated 10 for managing pressure in a storage tank 12 that contains hydrocarbons , specifically petroleum - based fuel , and for returning to the tank 12 vapor from fuel - dispensing nozzles 14 that are in communication with the tank 12 . as shown , the system 10 includes a vapor recovery system 16 that is in communication with the nozzles 14 . in one preferred embodiment , the vapor recovery system 16 includes a vapor recovery pump 20 , also referred to as a “ blower ”, that is actuated by an electric , preferably single phase motor 22 , to which the pump 20 is coupled via a coupling represented by the line 24 . the vapor recovery pump can be a type gvr 313 pump made by rotron . also , the vapor recovery pump 20 is in fluid communication with the nozzles 14 via a fluid line 26 . most vapor collected from the vehicle fuel tanks is returned to the tank 12 via a tank suction line 60 , described in further detail below . excess vapor , on the other hand , is sent from the vapor recovery system 16 via a fluid line 28 to a pressure management system 30 , also described in further detail . as described below , the pressure management system 30 includes a membrane , not shown in fig1 for clarity of disclosure but shown in fig2 . the pressure management system 30 preferably includes a pressure pump 32 , also referred to as a “ compressor ”, and a vacuum pump 34 . in the preferred embodiment , both the pressure pump 32 and vacuum pump 34 are identical type e10rotary vane pumps made by blackmer , and both pumps 32 , 34 are actuated by one single phase ac two horsepower motor 36 . in fig1 the couplings between the motor 36 and pumps 32 , 34 are represented by the lines 38 , 40 , respectively . the couplings can be belt drive mechanisms known in the art . as described further below , the pressure and vacuum pumps 32 , 34 respectively push and pull vapor through a membrane that separates clean air from hydrocarbon vapor . the clean air is exhausted to atmosphere through a clean air outlet 42 , whereas the hydrocarbon vapor is returned to the tank 12 through a hydrocarbon return line 44 . with the above introductory disclosure in mind , the skilled artisan will appreciate that excess vapor from the vapor recovery system 16 passes through the membrane in the pressure management system 30 before returning to the tank 12 . as also discussed further below , the pressure management system 30 can include one or more solenoid valves and one or more sensors , and the pump motors 22 , 36 and solenoid valves are electrically connected to a controller 46 . in accordance with the detailed discussion below , the controller 46 is responsive to the system sensors for selectively energizing the motor 22 and for selectively actuating the solenoid valves . in one preferred embodiment , the controller 46 is implemented by discrete logic on a circuit board for undertaking the sequence of operations described below . it is to be understood , however , that the controller 46 can be a pc or other computer that is programmed with a software application to undertake the present logic . now referring to fig2 in which fluid flow direction is indicated by various arrows , the vapor recovery pump 20 has a suction port 48 that communicates with the nozzles 14 to evacuate hydrocarbon vapor away from the nozzles 14 . a vapor recovery pressure switch or sensor 50 communicates with the suction port 48 of the vapor recovery pump 20 for generating an electrical signal that is sent to the controller 46 . the electrical signal is representative of the pressure at the suction port 48 of the vapor recovery pump 20 . when the signal indicates that the vapor recovery pump 20 is not functioning ( e . g ., when no vacuum exists at the suction 48 ), the controller 46 stops the motors 22 , 36 and , if desired , activates an audible or visual alarm . hydrocarbon vapor is discharged through a discharge port 52 of the vapor recovery pump 20 . as shown in fig2 the discharge port 52 of the vapor recovery pump 20 communicates with a suction port 54 of the pressure pump 32 . additionally , a bypass line 56 establishes a separate path for fluid communication from near the suction port 48 of the vapor recovery pump 20 to near the discharge port 52 of the pump 20 , and a bypass element 58 partially occludes the bypass line 56 . in one preferred embodiment , the bypass element 58 is established by a vacuum regulator that includes a vertical pipe having a weight movably disposed therein , with the weight being movable to a closed position in which fluid communication through the bypass line 56 is blocked . when the vacuum at the suction port 48 of the vapor recovery pump 20 becomes sufficiently large , the weight lifts and allows vapor from the discharge port 52 to bypass the pump 20 and recirculate back to the suction port 48 . alternatively , the element 58 can be established by an orifice plate having two quarter - inch diameter holes formed therein . in any case , the bypass element 58 is configured as appropriate to establish a desired constant air to liquid flow rate ratio ( a / l ) to promote efficient and effective operation of the membrane of the present invention . continuing with the description of the preferred piping system shown in fig2 a tank suction line 60 establishes a path for fluid communication from the tank 12 to the suction 54 of the pressure pump 32 as shown . if desired , a tank suction line particulate filter 62 can be disposed in the suction line of the pressure pump 32 to filter particles out of the vapor from the tank 12 that is evacuated by the pressure pump 32 . in one preferred embodiment , the tank suction line particulate filter 62 is a particulate filter made by cim - tek filtration . also , for purposes to be shortly disclosed , a tank suction line three - way solenoid valve 64 is disposed in the tank suction line 60 , it being understood that the valve 64 is electrically connected to the controller 46 . during normal operation , the tank suction valve 64 is configured to establish communication between the suction line 60 and the pressure pump 32 , whereas during the below - described backflush procedure the suction valve 64 is configured to establish communication between the pressure pump 32 and a backflush return line 65 . the pressure pump 32 discharges fluid through a discharge port 66 to a condenser 68 . the condenser 68 condenses vapor in the discharge of the pressure pump 32 to liquid . as envisioned herein , the condenser 68 can be implemented by a conventional heat exchanger such as an air cooler / radiator . alternatively , we have found that the condenser 68 can be established by an uninsulated segment of the piping line , or indeed by a length of rubber tubing that can be disposed in the piping line . high and low safety shut off pressure switches 70 , 72 communicate with the discharge 66 of the pressure pump 32 for detecting the discharge pressure thereof . in one presently preferred embodiment , when the discharge pressure drops below 15 psig , the low pressure switch 72 generates a low pressure signal , and the signal is sent to the controller 46 to activate an alarm and / or to deenergize the pumps of the present invention . in contrast , when the discharge pressure exceeds 25 psig , the high pressure switch 70 generates a high pressure signal , and the signal is sent to the controller 46 to activate an alarm and / or to deenergize the pumps of the present invention . fluid from the condenser 68 flows through a liquid drop out device 74 , as shown in fig2 . as intended by the present invention , the liquid drop out device 74 separates liquid in the fluid from vapor , with the liquid passing through a liquid return line 76 to the tank 12 . in one preferred embodiment , the liquid drop out device 74 is a type sep 10 or 25 cyclone separator . other equivalent devices , however , can be used in lieu of a cyclone separator , including a drop out pot , a dryer , a small diameter pipe to large diameter pipe transition that turns vertical , stainless steel wool or batting , or a combination of one or more of such devices . a vapor blocker , such as pressure activated valve or float switch 78 , can be disposed in the liquid return line 76 to impede vapor from passing through the liquid return line 76 . other equivalent vapor - blocking devices can be used in lieu of the pressure activated valve or float switch 78 , such as , e . g ., a float drain check valve , an orifice , or a poppet - implemented drain trap . in contrast to the path that liquid takes from the liquid drop out device 74 , vapor passes through a particulate filter 80 to a membrane assembly 82 . a membrane , represented by the line 84 in fig2 separates hydrocarbon vapor from clean air . it may now be appreciated that the liquid drop out device 74 not only advantageously returns , as liquid , some of vapor from the nozzles 14 , but also reduces or eliminates liquid contact with the membrane 84 , which would otherwise be deleterious to the performance of the membrane 84 . in the preferred embodiment , the membrane 84 is made by membrane technology and research ( mtr ) of menlo park , calif ., model # 340 - 4120 lpi . other membranes can be used , including those in u . s . pat . nos . 5 , 199 , 962 and 5 , 089 , 033 , incorporated herein by reference . as can be readily appreciated in reference to fig2 after passing through the membrane 84 the hydrocarbon vapor is evacuated through a hydrocarbon outlet line 86 from the membrane assembly 82 by the vacuum pump 34 , which pumps the vapor back to the tank 12 via the hydrocarbon return line 44 . if desired , the hydrocarbon return line 44 can join the return line 76 as shown , to minimize openings into the tank 12 . also , if desired a second condenser 88 or a second liquid drop out device can be disposed in the hydrocarbon return line 44 to further separate liquid from vapor and thereby increase the amount of hydrocarbons in the liquid phase that are returned to the tank 12 . in any case , a suction port 90 of the vacuum pump 34 is in communication with the hydrocarbon outlet of the membrane assembly 82 , while a discharge port 92 of the vacuum pump 34 communicates with the tank 12 . having described the vapor and liquid hydrocarbon return paths to the tank 12 , attention is now directed to the clean air exhaust path . as shown in fig2 clean air from the membrane assembly 82 is exhausted through a clean air check valve 94 and the clean air exhaust 10 line 42 to atmosphere . to ensure that the clean air being exhausted to the environment does not contain an amount of hydrocarbon vapor that exceeds regulatory limits , a hydrocarbon sensor 96 communicates with the clean air exhaust 42 , and the hydrocarbon sensor 96 generates a signal that is sent via an electrical line or wireless network to the controller 46 ( fig1 ), which deenergizes the motors 22 , 36 when a hydrocarbon limit is reached . to further cleanse hydrocarbons from the air that is exhausted to the environment , a charcoal canister 98 can be disposed between the membrane assembly 82 and clean air exhaust 42 as shown . as the air passes through the canister 98 , hydrocarbons are removed from the air . when the charcoal canister is provided , the present invention recognizes that it might be desirable to backflush the canister from time to time , to refresh the activated material in the canister . to facilitate this , a three - way solenoid backflush valve 100 that is controlled by the controller 46 is disposed in the clean air outlet line upstream of the charcoal canister 98 . during normal operation , the backflush valve 100 is configured to establish communication between the membrane assembly 82 and the charcoal canister 98 . during backflush , however , the backflush valve 100 is configured to establish communication between the membrane assembly 82 and a 25 backflush line 102 . a canister discharge check valve 104 is disposed downstream of the charcoal canister 98 in the clean air exhaust line 42 , and a check valve bypass line 106 interconnects the upstream and downstream sides of the check valve 104 as shown . an orifice 108 is disposed in the bypass line 106 to establish a backflush flow rate . in normal operation of the system 10 , forward air flow is established through the canister 98 , wherein air from the membrane assembly 82 flows through the canister 98 to the clean air outlet 42 . when the controller 46 determines that the canister 98 should be backflushed based on , e . g ., the elapse of a predetermined time period between backflushes , or a high hydrocarbon signal from the hydrocarbon sensor 96 , or based on other criteria including a manually input “ backflush ” command signal , the controller 46 establishes a backflush configuration of the system 10 . to do this , the controller 46 signals the tank suction valve 64 to establish communication between the suction 54 of the pressure pump 32 and the backflush return line 65 . also , the controller 46 signals the backflush valve 100 to establish communication between the charcoal canister 98 and the backflush line 102 . in the backflush configuration , the pressure pump 32 takes a suction through the backflush return line 65 on the inlet side 110 of the canister 98 . the discharge of the pressure pump 32 flows through the membrane 84 as described before , but instead of passing in the normal direction through the canister 98 , the air is directed by the backflush valve 100 into the backflush line 102 . from the backflush line 102 , air passes through the bypass line 106 and then passes through the canister 98 in the reverse direction , thereby flushing the canister 98 . as mentioned above , the contaminated backflush air is then drawn through the backflush return line 65 into the pressure pump 32 , and discharged into the membrane assembly 82 to clean the air . when backflushing is complete , the controller 46 reconfigures the three way valves 64 , 100 for normal operation . to avoid overpressurizing the storage tank 12 , backflushing can be undertaken incrementally by cycling the system 10 between the backflush configuration ( to cleanse the canister 98 ) and normal configurations ( to reduce pressure in the tank 12 ) several times , e . g ., twenty times , until the canister 98 has been completely backflushed . completing the description of fig2 on and off pressure switches 112 , 114 communicate with the tank 12 for generating respective pressure signals . in the preferred embodiment , the on pressure switch 112 generates a signal when the tank 12 internal pressure is between 0 . 1 ″ w . c . and 1 . 0 ″ w . c . ( i . e ., when the tank 12 has a slight internal overpressure ). in contrast , the off pressure switch 114 generates a signal when the tank 12 internal pressure is between − 0 . 5 ″ w . c . and − 1 . 0 ″ w . c . ( i . e ., when the tank 12 has a slight internal vacuum ). these signals are sent to the controller 46 , which energizes the motor 36 upon receipt of an “ on ” signal from the on pressure switch 112 and which deenergizes the motor 36 upon receipt of an “ off ” signal from the off pressure switch 114 . the above - described logic ( omitting charcoal canister backflush operations for clarity ) can be further appreciated in reference to fig3 which shows the logic in flow format for disclosure purposes . it is to be understood that the logic can also be thought of in terms of state logic . commencing at decision diamond 116 , the controller 46 determines whether the hydrocarbon level in the clean air exhaust is high , as indicated by the signal from the hydrocarbon sensor 90 . if it is , the controller 46 deactivates one or more of the pumps of the present invention at block 118 . in the preferred embodiment , the pumps must be manually reset to resume normal operation . otherwise , i . e ., if the test at decision diamond 116 is negative , the logic moves to decision diamond 120 , wherein the controller 46 determines whether the vacuum in the tank 12 is high . if it is , the logic moves to block 118 , but otherwise proceeds to decision diamond 122 to determine whether the pressure in the tank 12 is high . a negative test result causes the logic to loop back to decision diamond 116 . in contrast , a positive test result at decision diamond 122 causes the controller 46 to activate the pumps at block 124 . as indicated above , however , the present logic need not flow from decision diamond to decision diamond , but instead can assume “ on ” and “ off ” states and await the various signals described herein to change state appropriately . in any case , the controller selectively energizes the pump motor 36 to establish a predetermined pressure range in the tank 12 . while the particular pressure management and vapor recovery system for filling stations as herein shown and described in detail is fully capable of attaining the above - described objects of the invention , it is to be understood that it is the presently preferred embodiment of the present invention and is thus representative of the subject matter which is broadly contemplated by the present invention , that the scope of the present invention fully encompasses other embodiments which may become obvious to those skilled in the art , and that the scope of the present invention is accordingly to be limited by nothing other than the appended claims , in which reference to an element in the singular is not intended to mean “ one and only one ” unless explicitly so stated , but rather “ one or more ”. all structural and functional equivalents to the elements of the above - described preferred embodiment that are known or later come to be known to those of ordinary skill in the art are expressly incorporated herein by reference and are intended to be encompassed by the present claims . for example , multiple two - way solenoid valves can be used in lieu of each three - way solenoid valve where appropriate , or a single pressure sensor can be used in lieu of two pressure switches where appropriate . moreover , it is not necessary for a device or method to address each and every problem sought to be solved by the present invention , for it to be encompassed by the present claims . furthermore , no element , component , or method step in the present disclosure is intended to be dedicated to the public regardless of whether the element , component , or method step is explicitly recited in the claims . no claim element herein is to be construed under the provisions of 35 u . s . c . § 112 , sixth paragraph , unless the element is expressly recited using the phrase “ means for ”.	1
in the practice of the present invention , a lead anode sheet 9 is joined to a copper busbar 10 in a manner which permits good conductivity between the busbar and the lead sheet . the busbar is coated with lead by means of electrodeposition , thus forming an anode which is substantially corrosion resistant . in accordance with the invention , lead alloy anode material used in electrowinning is formed as a sheet . the lead sheet material employed in the anodes of the invention may be any lead alloy suitable for use in electrowinning . such alloys include lead - silver , lead - calcium - silver , lead - antimony , lead - antimony - arsenic , lead calcium , lead - strontium - tin , lead - strontium - tin - aluminum , lead - calcium - strontium - tin and lead - calcium - tin alloys . the sheet may be formed by casting , extruding or rolling the alloy material . references to lead anode material herein are intended to include all lead alloys , however formed , which are suitable as anode material in electrowinning from sulfuric acid electrolytes . an example of a lead sheet material of choice for use in the present invention is wrought lead - calcium - tin alloy . this alloy should contain between 0 . 03 % and 0 . 08 % calcium and sufficient tin to produce at least a 0 . 11 / 1 calcium / tin weight percent ratio for optimum performance . the tin should additionally be limited to a maximum of about 2 weight percent for maximum mechanical properties . maximizing the tin and / or calcium contents within the above limits increases the mechanical properties of the anode . an additional alloy of choice is wrought lead - calcium - silver alloys . this alloy should contain between 0 . 03 and 0 . 10 % calcium and 0 . 3 % or more silver . such lead - calcium - tin or lead - calcium - silver alloys are preferably formed into sheets by hot working . such hot working may be effected by deforming a cast billet hot , preferably at temperatures above 150 ° c ., to reduce or prevent the amount of precipitation of calcium during the working . by keeping the calcium in solution , the material can be worked extensively from large billets while the material is soft and plastic . the deformation to final gauge may be done hot or cold , depending on the desired properties and grain structure . the hotter the deformation , the lower are the final mechanical properties and the higher the elongation . hot deformation , however , produces fewer stresses which might cause warping than cold working . the copper busbar may be dipped wholly or partially into an alloy of tin to produce a substrate for electrodeposition . for example , a lead alloy containing a sufficient amount of additional tin component which bonds to the copper bar will be an effective coating material . a preferred coating material is a lead - tin - antimony alloy containing at least 50 % lead . the anode sheet 9 may be joined to a busbar 10 as taught in u . s . pat . no . 4 , 373 , 654 , the disclosures of which are incorporated herein by reference . however , any joinder means which does not require widening the anode to any significant extent beyond the width of the busbar and which permits good conductivity between the lead sheet and the busbar may be used . in preferred practice , the busbar has a longitudinal slot 11 into which the lead sheet fits snugly . the bar and the lead sheet are joined together preferably by means of a solder material 12 . the solder is preferably a material containing tin and another material and having sufficient fluidity to allow penetration into the slot and bonding between the copper bar and the lead alloy sheet . such penetration and bonding maximizes the contact between the bar and anode sheet , thus optimizing conductivity . optimally , the lead anode sheet is then burned to the copper bar at all joints to produce a uniform , smooth transition between the bar and sheet . the final burning operation is performed by puddling a filler alloy 13 into all crevices . the filler alloy should bond to the solder , to the copper bar or bar coating alloy and to the anode sheet . it should be of high lead content to give maximum corrosion protection to the joint areas and be fluid enough to fill all crevices and create a smooth transition joint between bar and sheet . preferred filler alloys are : the bar coating alloy , a lead - antimony alloy , as for example lead - 6 % antimony alloy , a lead - low tin solder and lead - copper alloy . in the practice of the present invention , a coating of lead 15 is electrodeposited onto the outside surface of the coated busbar and over the joint . the coating need only be thick enough to ensure complete coverage of the bar and the joint with a corrosion resistant layer . electrodeposition may be effected by simply inverting the joined anode sheet and busbar and immersing the anode into an electroplating solution until the busbar and the joint are completely covered by the solution . the anode is then electrically connected in a manner such that the anode functions as a cathode . the anode used in the electroplating process is any suitable lead material from which lead can be dissolved and deposited on the copper busbar &# 34 ; cathode .&# 34 ; pure lead anodes are preferred , but various lead alloys may also be used . a suitable current is then applied for a period of time sufficient to produce the desired coating . the bath may consist of a solution of lead fluoborate , lead sulfamate , lead fluorosilicate , or other plating bath from which lead can be electrodeposited on the surface of the busbar . in this process , metal is dissolved from a pure lead or lead alloy anode and electrodeposited onto the coated copper busbar producing a complete metallurgical seal around the busbar by the electrodeposited coating . the thickness of the electrodeposited layer may vary from 0 . 001 &# 34 ; ( 0 . 025 mm ) to 0 . 160 &# 34 ; ( 4 mm ). the normal range is 0 . 020 &# 34 ; ( 0 . 5 mm ) to 0 . 080 &# 34 ; ( 2 mm ). anodes were produced by slotting the copper busbar , coating by dipping with a thin ( 0 . 002 - 0 . 005 &# 34 ;) layer of pb - 15 % tin - 1 % antimony alloy . a rolled lead - calcium - tin alloy sheet was joined to the coated bar by filling the slot with a lead - 60 % tin alloy and placing the rolled sheet into the slot in the bar . the joint was sealed with lead - 6 % sb filler metal . finished anodes were inverted and immersed in a bath containing 300 g / l lead fluoborate , 35 g / l fluoboric acid , 10 g / l boric acid , and 0 . 018 g / l animal bone glue such that the complete copper busbar and some of the rolled lead calcium - tin - alloy sheet was immersed in the electrolyte . the electrical connection was made in such a manner as to make the anode a cathode . pure lead was used as the anode material . a current of approximately 200 a / m 2 was applied for 16 hours resulting in the deposition of about 0 . 028 &# 34 ; ( 0 . 77 mm ) of lead coating to the bar which tapered to about 0 . 003 &# 34 ; at the very end of the copper busbar . the performance of anodes having the electroplated lead coating on the copper busbar was compared with normal anodes having only the coating produced by dipping the busbar into the lead -- 15 % tin 1 % antimony alloy . the tests were conducted in a copper electrowinning cell at a current density of 280 - 300 a / m 2 with the busbar located about 2 &# 34 ; above the surface of the electrolyte . the high current density produces a very high concentration of acid mist which contacts the busbar of the anode . the conventional dipped coating of the bar was removed in approximately one month under the severe acid attack and some corrosion of the copper bar occurred . the same anodes containing the electrodeposited lead of this invention suffered no loss of the electrodeposited lead layer and no attack of the copper busbar after 7 months of operation .	8
a print system including an information processing apparatus suitable for applying the invention will now be described hereinbelow . fig3 is a block diagram for explaining a construction of the print system showing an embodiment of the invention . the invention can be obviously applied to any of a system comprising one apparatus , a system comprising a plurality of apparatuses , and a system which is connected through a network such as lan , wan , or the like and in which processes are executed so long as functions of the invention are executed , unless otherwise specified . in fig3 , reference numeral 1500 denotes a host computer having a cpu 301 for executing processes of a document in which a figure , an image , characters , a table ( including a spreadsheet , etc . ), and the like mixedly exist on the basis of a document processing program or the like stored in a program rom in an rom 303 or an external memory 311 . the cpu 301 integratedly controls various devices connected to a system bus 304 . an operating system program ( hereinafter , simply referred to as an os ) as a control program of the cpu 301 and the like are stored in the program rom in the rom 303 or the external memory 311 . font data and the like which are used at the time of the document processes are stored in a font rom in the rom 303 or the external memory 311 . various data which is used when the document processes or the like are executed is stored in a data rom in the rom 303 or the external memory 311 . reference numeral 302 denotes an ram functioning as a main memory , a work area , or the like of the cpu 301 ; 305 a keyboard controller ( kbc ) for controlling a key input from a keyboard 309 or a pointing device ( not shown ); 306 a crt controller ( crtc ) for controlling a display of a crt display ( crt ) 310 ; and 307 a disk controller ( dkc ) for controlling an access to the external memory 311 such as hard disk ( hd ), floppy disk ( fd ), or the like for storing a boot program , various applications , font data , a user file , an edit file , a printer control command forming program ( hereinafter , referred to as a printer driver ), and the like . reference numeral 308 denotes a printer controller ( prtc ) which is connected to a printer 2500 through a predetermined bidirectional interface ( hereinafter , referred to as an interface ) 322 and executes a communication control process with the printer 2500 . the cpu 301 executes , for example , a developing ( rasterizing ) process of an outline font into a display information ram set on the ram 302 , thereby enabling wysiwyg to be realized on the crt 310 . the cpu 301 opens various registered windows and executes various data processes on the basis of commands instructed by a mouse cursor or the like ( not shown ) on the crt 310 . when the user executes a print , he opens a window regarding the setup of the printing and can set a desired printer and set a print processing method for the printer driver including the selection of a print mode . it is assumed that the printer driver program of the invention has been stored in the external memory 311 . in the printer 2500 , reference numeral 312 denotes a printer cpu which outputs an image signal as output information to a printer engine 317 connected to a system bus 315 on the basis of a control program or the like stored in a program rom in an rom 314 or a control program or the like stored in an external memory 321 . a control program of the cpu 312 and the like are stored in the program rom in the rom 314 . font data and the like which are used when output information is formed are stored in a font rom in the rom 314 . in case of a printer without the external memory 321 such as a hard disk or the like , information which is used on the host computer and the like are stored in a data rom in the rom 314 . the cpu 312 can perform a communicating process with the host computer through an input unit 318 and can notify the host computer 1500 of the information in the printer or the like . reference numeral 313 denotes an ram functioning as a main memory , a work area , or the like of the cpu 312 . a memory capacity of the ram 313 can be expanded by an option ram connected to an expansion port ( not shown ). the ram 313 is used as an output information developing area , an environment data storing area , an nvram , or the like . an access to the external memory 321 such as hard disk ( hd ), ic card , or the like is controlled by a disk controller ( dkc ) 319 . the external memory 321 is connected as an option and stores font data , an emulation program , form data , and the like . reference numeral 320 denotes an operation unit on which switches for operation , an led display , and the like are arranged . the number of external memory is not limited to one . the external memory can be constructed in a manner such that at least one or more memories are provided and a plurality of option font cards in addition to built - in fonts and a plurality of external memories in which a program to interpret printer control languages of different language systems has been stored can be connected . further , it is also possible to have an nvram ( not shown ) and store printer mode set information from the operation unit 320 . fig4 is a constructional diagram of a typical printing process in the host computer to which a printing apparatus such as a printer or the like is directly connected or connected via the network . an application 401 , a graphic engine 402 , a printer driver 403 , and a system spooler 404 are program modules which exist as files held in the external memory 311 and each of which is loaded into the ram 302 by the os or a module using such a module and executed when it is executed . the application 401 and printer driver 403 can be added to the fd or a cd - rom ( not shown ) of the external memory 311 or an hd of the external memory 311 via the network ( not shown ). although the application 401 held in the external memory 311 is loaded into the ram 302 and executed , when a printing is performed from the application 401 to the printer 2500 , and an output ( drawing ) is performed by using the graphic engine 402 which is similarly loaded into the ram 302 and is in the operative mode . although data that is outputted to the graphic engine by the application differs depending on the kind of os , for example , in case of using windows ( registered trademark of microsoft corporation ), a gdi function is outputted as a draw command to the gdi as a graphic engine . the graphic engine 402 similarly loads the printer driver 403 prepared for every printing apparatus into the ram 302 from the external memory 311 , converts the gdi ( graphic device interface ) function as an output of the application 401 to a ddi ( device driver interface ) function , and outputs it to the printer driver 403 . on the basis of the ddi function received from the gdi , the printer driver 403 converts it to a printer control command comprising a pdl ( page description language ) which can be interpreted in the printer 2500 or image data at a low level . the converted printer control command is outputted to the printer 2500 via the interface 322 through the system spooler 404 loaded in the ram 302 by the os . fig5 to 11 are diagrams showing an example of a setup change in a print set picture plane in the embodiment . the embodiment will now be described in detail hereinbelow with reference to fig5 to 11 . first , an example of the print set picture plane used in the embodiment is as shown in fig5 , it has a plurality of set picture planes , and they can be switched by a set picture plane switching button 501 provided in the upper portion . besides , print set items 502 to actually perform a print setup is arranged in the set picture plane together with a preview picture plane switching button 504 and a preview picture plane 503 which are characteristic component elements in the embodiment . in the diagram , the set picture plane switching button 501 , print set items 502 , and preview picture plane 503 are the same as those of the conventional apparatus , their descriptions are omitted here . the user can switch the preview picture plane 503 by the operation of the preview picture plane switching button 504 . in the embodiment , as shown in fig5 , three kinds of preview picture planes can be selected and their corresponding buttons are associated with a “ page setup ( page setting )” set picture plane , a “ finishing ” set picture plane , and a “ paper source ( paper feed )” set picture plane from the left , respectively . since a “ quality ( print quality )” set picture and a “ configuration ( setup of a device )” set picture plane do not have a preview picture plane , there is not the preview picture plane switching button 504 regarding the set picture planes other than those three set picture planes . in the embodiment , a procedure for performing the following setup changes among a number of print set items shown on a plurality of set picture planes will now be described as an example . 1 . the setup of “ paper selection ( paper feeding method )” is changed from “ auto ( automatic )” to “ drawer1 ( cassette 1 )”. 2 . the setup of “ page layout ” is changed from “ 1 page per sheet ” to “ 4 pages per sheet ”. 3 . the setup of “ paper selection ( paper feeding method )” is again confirmed . in case of performing the changing operation by using the print set picture plane shown in fig5 as a start point , since the set item of “ paper selection ( paper feeding method )” is arranged on the set picture plane of “ paper source ( paper feed )”, it can be changed here . with respect to the change , the user moves a cursor onto the preview picture plane as shown at 601 in fig6 by using the pointing device such as a mouse or the like and can select a paper feed port by clicking the left button of the mouse on the preview picture plane . besides this operation , the user can also perform the changing operation by selecting a set item as shown at 602 as in a conventional manner . subsequently , the setup of “ page layout ” is changed . in case of subsequently performing the change of 2 , a cursor 701 is moved to the switching button 504 of the preview picture plane by using the pointing device such as a mouse or the like . the preview picture plane 503 is switched from the picture plane associated with “ paper selection ( paper feed )” to the picture plane associated with “ page setup ( page setting )” by the operation of the first left button showing “ page setup ( page setting )”. fig8 shows an example of the print set picture plane after the switching . in fig8 , the set picture plane is in a display state of “ paper source ( paper feed )” and only the preview picture plane is switched as shown at 802 . as mentioned above , by providing the preview picture plane switching button 504 , only the preview picture plane can be switched in the set picture plane , and the use efficiency is improved for the user . subsequently , as described in fig5 and 6 , even in the set picture plane of “ paper source ”, the user can change the setup of “ page layout ” on the preview picture plane by the pointing device such as a mouse or the like . fig9 shows an example of the “ paper source ( paper feed )” set picture plane after completion of the above operation . it shows that “ page layout ” is set to “ 4 pages per sheet ” on a preview picture plane 901 . a situation of “ paper selection ( paper feeding method )” is also displayed in a preview picture plane 902 . when the user operates the mouse , selects “ page setup ( page setting )” by the set picture plane switching button 501 , and switches the set picture plane to the “ page setup ( page setting )” set picture plane , the picture plane of fig6 is displayed in a manner similar to the conventional system and he can confirm that “ page layout ” has been changed to “ 4 pages per sheet ”. by the above processes , the user changes the set values variably existing on a plurality of set picture planes by the simple operation and can easily confirm the change results . in the first embodiment , the display of only the preview picture plane of another set picture plane can be switched from an arbitrary set picture plane and , further , the set items of another set picture plane can be switched from the arbitrary set picture plane by the operation of the preview picture plane . however , there are a variety of set items on each set picture plane ( set sheet ) and all of the set items cannot be operated only by the clicking operation on the preview picture plane . it is an object of the second embodiment , therefore , to enable the switching of the set items by the operation of the preview picture plane to be performed with respect to all of the set items on the set sheet corresponding to the preview picture plane . explanation in such a case will now be described with reference to fig1 and 11 . in fig1 , the item setup in the preview picture plane on the “ paper source ( paper feed )” set picture plane will be described . in fig1 , when the user moves the cursor of the mouse onto the preview picture plane and clicks the right button of the mouse , a window 1001 is displayed . since the paper feeding method has been set to “ different for first , second , others , and last ”, a paper feed source of each page of one job has to be selected . although it can be set by the set item 602 shown in fig6 , in case of setting the paper feed source by the switching of the preview picture plane from the different set sheet , it is selected from the window 1001 . in “ designate first page source ”, the paper feed source of the first page is selected . by checking here , the paper feed source ( manual or cassette ) can be selected in the main diagram in the preview picture plane by clicking the left button of the mouse . one of “ designate second page source ”, “ designate other page source ”, and “ designate last page source ” can be selected in this instance . “ finishing ( setup of a paper delivery method )” can be also selected . that is , in case of printing a plurality of copies , in a set item of “ group ”, the print papers are outputted on a page unit basis every number of output copies . in a set item of “ collate ”, the print papers are outputted on a job unit basis every number of output copies . when the user checks “ rotate - group ” or “ rotate - collate ”, a “ rotate command ” is added to the print data which is generated by the printer driver . the printer which received the rotate command discriminates whether the papers of the designated size and different paper directions have been set or not . if yes , the following processes are executed . that is , in case of the a4 landscape and the “ group ” output , the page is printed and outputted by the number of output copies and , thereafter , the direction of the image data to be formed from the print data is rotated by 90 ° and the printing process is performed to the papers of a4 portrait . in case of a4 landscape and the “ collate ( sort )” output , the page of the first copy of the job is printed and outputted and , thereafter , the direction of the image data to be formed from the print data is rotated by 90 ° and the printing process of the page of the next second copy is performed to the papers of a4 portrait . the above operations are repeated until the last one of the output copies . by the above function , the user can process the above operations by the printer without needing to purposely copy references for a plurality of persons by the copying machine . even in case of the printer without a sorter , since the directions of the copies are different , there is an effect that the user can easily sort them . as described above , by the operation on the preview picture plane , a plurality of print setups on the set sheet can be performed . in fig1 , explanation will be made with respect to the case of switching the preview picture plane on the “ paper source ( paper feed )” set picture plane to that corresponding to a “ finishing ” set picture plane by using the preview picture plane switching button 504 . as described in the first embodiment , after the preview picture plane was switched to the preview picture plane associated with “ finishing ” by the preview picture plane switching button 504 , when the user clicks the right button of the mouse on the preview picture plane , a window 1101 is displayed . when the user checks “ designate binding location ( designation of the binding direction )” in the window 1101 , he can perform the operations of “ major side binding ” and “ minor side binding ” on the preview picture plane . that is , when the user moves the mouse cursor to the paper in the preview picture plane and clicks the left button of the mouse at a position of the major side portion , the “ major side binding ” is set . when the user clicks the left button of the mouse at a position of the minor side portion , the “ minor side binding ” is set . when the user checks “ designate staple position ( designation of the stapling position )”, he can perform the operation regarding the “ staple position ” on the preview picture plane . that is , when the user moves the mouse cursor to the paper in the preview picture plane and clicks the left button of the mouse at the corner of the side whose binding has been designated , “ staple ” is designated . a staple preview as shown at 103 in fig1 is displayed in the preview picture plane . when the user checks “ print style ( printing method )”, the printing method can be designated . it is designated in the window . when the user moves the mouse cursor to “ print style ”, a new window 1102 is displayed . when “ 1 - sided printing ” is designated in the window 1102 , the one - sided printing is performed in the printer 2500 . when “ 2 - sided printing ” is designated in the window 1102 , the two - sided printing is performed in the printer 2500 . a message indicating that a part of the paper in the preview picture plane is displayed in a turn - back state and the print data is also printed on the back side is displayed by switching the paper in the preview picture plane so as to enable the user to discriminate such a point . when “ 2 - sided printing ” is designated , a booklet printing is performed in the printer 2500 . the paper in the preview picture plane is displayed in a double - page spread state . a message indicating that a booklet operation is performed is displayed by switching the paper in the preview picture plane so as to enable the user to discriminate such a point . as described above , a plurality of print setups in another set sheet can be performed by the operation on the preview picture plane . a troublesomeness such that the user has to switch the setup sheet to another setup sheet to be set every time is reduced . the set items which have conventionally been set on a plurality of set sheets can be set on an arbitrary set sheet . in the first and second embodiments , although the icon is used as a preview picture plane switching button 504 , another means can be also used for a character indication or a switching . the invention can be also applied to a device driver portion of a system comprising a plurality of apparatuses ( for example , a host computer , an interface device , a reader , a printer , etc .). the objects of the invention are also accomplished by a method whereby a memory medium on which program codes of software such as a printer driver or the like to realize the functions of the embodiments mentioned above have been stored is supplied to a system or an apparatus , and a computer ( or a cpu or an mpu ) of the system or apparatus reads out and executes the program codes stored in the memory medium . in this case , the program codes themselves read out from the memory medium realize the functions of the embodiments mentioned above and the memory medium in which the program codes have been stored constructs the invention . as a memory medium to supply the program codes , for example , it is possible to use a floppy disk , a hard disk , an optical disk , a magnetooptic disk , a cd - rom , a cd - r , a cd - rw , a magnetic tape , a non - volatile memory card , an mo , a dvd , an rom , or the like . the invention incorporates not only a case where the functions of the embodiments mentioned above are realized by executing the read - out program codes by the computer but also a case where the os ( operating system ) or the like which operates on the computer executes a part or all of the actual processes on the basis of instructions of the program codes and the functions of the embodiments mentioned above are realized by those processes . further , the invention also incorporates a case where the program codes read out from the memory medium are written into a memory equipped for a function expanding board inserted to a computer or a function expanding unit connected to the computer and , thereafter , a cpu or the like equipped for the function expanding board or function expanding unit executes a part or all of the actual processes on the basis of instructions of the program codes , and the functions of the embodiments mentioned above are realized by those processes . program codes themselves which are installed in a computer in order to realize the functions and processes of the invention by the computer also realize the invention . that is , claims of the present invention also incorporate the computer program itself for realizing the functions and processes of the invention . as a method of supplying the computer program , the invention is not limited to the case where the computer program is stored in the fd or cd - rom and read out by the computer and installed in the computer as mentioned above . the computer program can be also supplied by a method whereby the client is connected to a homepage on the internet by using a browser of the client computer and the computer program itself of the invention is downloaded from the homepage or a method whereby a compressed file including an automatic installing function is downloaded . the invention can be also realized by a method whereby the program codes constructing the program of the invention are divided into a plurality of files and each file is downloaded from a different homepage . that is , claims of the invention also incorporate a www server for downloading a program file to realize the functions and processes of the invention by a computer to a plurality of users . the invention can be also realized by a method whereby the program of the invention is enciphered and stored in a memory medium such as an fd or the like and distributed to the user , key information to decipher the encryption is downloaded from a homepage through the internet to the user who cleared predetermined conditions , and the enciphered program is executed by using the key information and installed into a computer . as many apparently widely different embodiments of the present invention can be made without departing from the spirit and scope thereof , it is to be understood that the invention is not limited to the specific embodiments thereof except as defined in the appended claims . as described above , according to the embodiments , by switching only the preview picture plane without switching the print set picture plane , the set contents on the set picture plane other than the print set picture plane displayed at present are displayed and the set contents can be changed . as described above , according to the embodiments , to provide a print set picture plane which can be easily used and understood by the user , it is possible to provide a technique such that the picture plane is switched so that on a preview picture plane of an arbitrary set picture plane , a preview picture plane of another set picture plane can be displayed , thereby enabling the print setup in another set picture plane can be easily recognized . it is also possible to provide a technique such that on a preview picture plane of an arbitrary set picture plane , a preview picture plane of another set picture plane is switched and displayed by the operation on the switched preview picture plane , thereby changing the print setup associated with the switched preview picture plane and enabling the print setup in another set picture plane to be easily changed .	6
embodiment of the present invention will now be described with reference to the drawings . referring to fig2 showing the cross section taken along the line ii — ii of fig1 a dimension of over pin diameter ( opd ) is critical in terms of distortion . the outer ring of constant velocity universal joint as shown is subjected to induction hardening to cure its surface for the purposes of improving its wear resistance and fatigue characteristics . this quenching is performed at a temperature exceeding 800 ° c . at which carbon steel constituting the outer ring of the constant velocity universal joint is austenitized . thus , by the quenching , the carbon steel is transformed to a hardened structure with the above - described characteristics being improved . here , cooling power of cooling medium for use in the quenching is important . a method of measuring the cooling power of the cooling medium will now be described . referring to fig3 the cooling medium 15 is extracted from the cooling water actually used in a cooling medium bath in a quenching line in a factory . to accurately comprehend the change in the cooling water over time , it is necessary to extract the cooling water day by day in the course of measurement . sample member 11 is preferably fabricated using incoloy , which is ni - based alloy that maintains an austenite phase and does not transform from room temperature to high temperature . incoloy also exhibits good heat resistance and forms almost no oxide film . therefore , it will not cause considerable variation even if it is repeatedly used for the quenching . sample member 11 is formed in a cylindrical shape having a diameter of 10 mm and a thermocouple 12 is embedded in its center . for measurement of the cooling power , sample member 11 is heated by a high frequency coil 13 to 550 ° c . as measured by thermocouple 12 , and held at the temperature for a prescribed time period . thereafter , sample member 11 is immersed into cooling water 15 including coolant as a target of measurement , which is held at 100 ° c . in a temperature - controlled bath 14 , to a prescribed depth 16 for cooling . according to the present embodiment , positioning accuracy for positioning sample member 11 at a prescribed position is within ± 0 . 015 mm . the electrical signal sent from thermocouple 12 undergoes data processing , and is displayed as a cooling curve on a chart having a time axis as its horizontal axis , as shown in fig4 . from this cooling curve , the time required for cooling the member from 500 ° c . to 150 ° c . is derived , which is used as a measure of the cooling power . conventionally , the accuracy for positioning the sample member at its stop position was low , i . e ., on the order of ± 0 . 5 mm . with such poor accuracy , the variation in the cooling time was as much as 3 . 2 seconds , as shown in fig5 . in the present invention , however , the accuracy for positioning sample member 11 at its stop position as described above was improved . specifically , by achieving the positioning accuracy within ± 0 . 015 mm , the variation in the cooling time was limited within 0 . 8 seconds , as shown in fig6 . throughout the measurement of the cooling power as described above , cooling medium containing only new coolant was always used . it is noted that , even if the positioning accuracy as described above is set within ± 0 . 03 mm , cooling power utilizable for the control of the distortion could be obtained . fig7 shows cooling curves each obtained when cooling is conducted utilizing cooling medium including the stated percentage of new coolant , with positioning accuracy of the sample member within ± 0 . 015 mm . from fig7 it is noticed that , as the content of the new coolant increases , the cooling becomes slower and the cooling power decreases . the straight line shown in fig8 represents a relation between the cooling time and the coolant concentration when a sample member is immersed and cooled in cooling medium including only new coolant ( equivalent new coolant concentration ). from this straight line , it becomes possible to obtain an equivalent new coolant concentration from the cooling time actually obtained from the cooling medium used in a quenching line of a factory . for example , referring to fig8 when the cooling time obtained from the cooling medium as a target of measurement is 30 . 7 seconds , the equivalent new coolant concentration of this cooling medium can be determined as 9 . 2 %. before improvement of the positioning accuracy , with that of at least ± 0 . 5 mm , the cooling time would vary on the order of ± 2 seconds , leading to variation in equivalent new coolant concentration on the order of ± 2 %. with such a large variation , the change of cooling power over time could not be detected , and therefore , it would be unimaginable to control the distortion by the cooling power . the above - described method of expressing the cooling power as the equivalent new coolant concentration derived from the cooling time is referred to as a cooling faculty ( cf ) method . conventionally , as simple means for measuring the concentration of coolant within the cooing medium , a saccharimeter has been used . hereinafter , for the purposes of comparison , the concentration measured by the saccharimeter according to the prior art will also be described . transition in cooling power of cooling medium over time is shown in fig9 wherein a horizontal axis represents operating days that have passed from the day on which the entire cooling medium was renewed and the use of new liquid of coolant started . obtained by the cf method is the cooling power , measured using the method as shown in fig3 with improved positioning accuracy , and expressed as the equivalent new coolant concentration as described above . according to fig9 the equivalent new coolant concentration starts to decrease from the first day of the use of new liquid of coolant . such decrease ceases after 25 days have passed from the start day , and thereafter , the concentration is held approximately at a fixed level . in fig9 the concentration measured by the saccharimeter is also shown . this shows a change similar to that of the equivalent new coolant concentration , although any specific pattern cannot be observed from the change . fig1 shows a change over time of the difference between the equivalent new coolant concentration and the concentration measured by the saccharimeter . it decreases in an unvaried manner for almost 30 days , and thereafter , there comes a time period in which almost no change is observed . utilizing the graph of fig1 , it becomes possible , by simply measuring the concentration using the saccharimeter , to obtain the equivalent new coolant concentration from the concentration measured and the number of days passed from the start day . as seen from fig1 , it is clear that there is a strong correlation between the distortion and the equivalent new coolant concentration . on the contrary , it cannot be said that there is a certain correlation between the distortion and the concentration measured by the saccharimeter , as shown in fig1 . as explained above , the present invention was inspired by the distinct correlation between cooling power and distortion that is observable only when cooling power is measured by positioning a member to be cooled in cooling medium with high positioning accuracy within a range of ± 0 . 03 mm , or even within ± 0 . 015 mm . according to the present invention , it is possible to keep track of cooling power precisely even when the cooling medium changes over time . thus , distortion due to heat treatment can be controlled to a minimum . although the present invention has been described and illustrated in detail , it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation , the spirit and scope of the present invention being limited only by the terms of the appended claims .	2
thus , the object of this invention is an isolated heteromer that binds arachidonic acid . more specifically , it also binds oleic acid . because of this property , we can see the advantage of this heteromer in particular in the understanding of the capture , release or transportation mechanism of the arachidonic acid or its derivatives and / or in the identification of substances that are susceptible of modifying this transportation mechanism and therefore the biological activity resulting from the arachidonic acid . by derivatives of the arachidonic acid , we mean all biological derivatives of the arachidonic acid such as in particular , the hydroxyacids , the thromboxanes , the leukotrienes and the prostaglandins . therefore , another object of this invention is the use of this heteromer as a diagnostic tool , more specifically for inflammatory diseases or skin disorders with an inflammatory component linked to the release of the arachidonic acid or its derivatives ( see above ) in the same way , the heteromer allows for the evaluation of the biological activity of substances that are likely to be active in the treatment of inflammatory diseases or skin disorders with an inflammatory component linked to the release of the arachidonic acid or its derivatives ( see above ). indeed , thanks to the purification procedure of the heteromer that will be described later , we are aware that a skin with psoriasis contains approximately ten times more of this heteromer than a normal skin ( whose purified quantity reaches approximately 4 pmol / mg of protein ), the quantity of the heteromer found , in particular by the process of purification described later , is therefore one way of diagnosing a skin disorder , such as psoriasis . from this discovery , we can also consider measuring the evolution of the quantity of isolated heteromer using the keratinocytes of a human being who is being treated with a substance that is likely to treat his inflammatory illness or skin disorder . preferably , this isolated heteromer shows a dissociation constant kd that is less than or equal to 300 nm in relation to the arachidonic acid , and preferably less than or equal to 200 nm . these dissociation constants are obtained by carrying out measurements using the carbon - dextran technique . this technique is as follows : aliquot portions of 0 . 5 μg of heteromer in solution in 100 μl of tris buffer ( 50 mm tris / hcl , 25 mm nacl , 2 . 5 mm edta , 1 mm dtt at ph 7 . 5 ) containing 0 . 5 % of gelatin and 1 % of dmso are incubated for 1 hour at 37 ° c . in the presence of increasing quantities of radiolabelled ligand , i . e , 0 - 10 μm for the oleic acid and the arachidonic acid . then , each aliquot portion is treated with 50 μl a mixture of carbon - dextran t40 ® ( 5 % and 0 . 05 % respectively ) at 0 ° c . for 10 minutes , then centrifuged at 10000 g and the radioactivity of the supernatant is measured . a saturation curve is established , and the kd is calculated using the scatchard plot . in other respects , this heteromer shows a dissociation constant in relation to the oleic acid that is less than that of the e - fabp in relation to the same ligand , the e - fabp being the protein described in the siegenthaler , g . et al . ( 1994 ) biochem . j . 302 , 363 - 371 publication . more specifically , the heteromer consistent with the invention is a protein , and this protein has a molecular weight of approximately 34 kda ± 10 % ( analysis in non denaturing conditions ( filtration over gel )). in general , the molecular weights have been determined by column filtration chromatography [( superose 12 ) coupled with an hplc ]. the column , balanced with a 50 mm tris / hcl buffer containing 0 . 2m of nacl is graduated with protein standards of molecular weight ranging from 6 . 5 kda to 150 kda , then , an aliquot portion of heteromer is passed through the column to determine its molecular weight . the elution profile of the proteins is analyzed by the measurement of optical density ( od ) at 280 nm . this heteromer may also bind in quantity up to 1 . 5 times more arachidonic acid than oleic acid . indeed , when a determined quantity of heteromer in solution is incubated in the presence of 600 nm of radiolabelled arachidonic acid , then analyzed through a filtration column over gel [( superose 12 ) balanced with a tris / hcl buffer containing 0 . 2m nacl and connected to a hplc ], the radioactive peak that co - elutes elutes at 34 kda and corresponds to the radiolabelled arachidonic acid - heteromer complex is 1 . 5 times greater than if the experiment were performed in the same conditions , but with 600 nm of radiolabelled oleic acid . quite surprisingly , in conditions that are denaturing for the proteins ( sds - page method ), the analysis discloses that this isolated heteromer corresponds to a non - covalent complex of various sub - units , consisting of one protein called mrp8 which corresponds to the nucleotide and amino acid sequences of seq id nos : 1 - 2 and another protein called mrp14 which corresponds to the nucleotide and amino acid sequences of seq id nos : 3 - 4 . more particularly , this heteromer consists of two mrp8 sub - units and one mrp14 sub - unit . these two proteins , mrp8 and mrp14 , are in particular described in the odink et al ., ( 1987 ) nature 330 , 80 - 82 publication . the purification process of the heteromer matches conventional steps of protein extraction from biological tissues , more specifically from skin tissues , such as in particular the keratinocytes of the skin . the purification process of the heteromer that is implemented consists specifically of the following steps : approximately 5 g of psoriasis scales are homogenized in 15 ml of tris / hcl buffer using a homogenizer ( polytron ) then , the mixture is centrifuged at 100000 g for 1 hour at 4 ° c . the pellet is collected and suspended in 5 ml of the same buffer and centrifuged at 10000 g . the supernatant is eliminated . this washing operation is carried out two more times . then , the pellet is treated in 15 ml of kcl buffer ( 10 mm tris / chl , 0 . 8m kcl , 10 mm monothioglycerol , 10 % glycerol , 1 mm pmsf , 10 u / ml aprotinin , 10 mg / ml leupeptin ) at a ph of 7 . 4 for 90 minutes at 4 ° c . this treatment is repeated once more . the supernatants are brought together and dialyzed overnight through a 20 mm imidazole buffer with a ph of 6 , concentrated using a filtration cell with a dialysis membrane whose pore size is 3500 da , the solution is then charged through a cation ion exchange column ( resource s ). the elution is performed by a gradient consisting of the dialysis buffer but containing 0 . 5m of nacl . the column is first standardized with an incubated sample with tritiated oleic acid . the fractions that co - elute with the radioactive peak are gathered , dialyzed through a 20 mm tris / hcl buffer , ph of 8 . 0 and the solution is concentrated . this solution is passed through a cation ion exchange column ( resource q ) balanced with the last buffer . the elution in the form of a gradient is performed with this tris buffer containing 0 . 5m of nacl . in the same way as above , the column has been standardized and only the proteins that co - elute with the radioactive peak are gathered , dialyzed through a 100 mm sodium phosphate buffer with a ph of 7 . 0 and concentrated the last purification step is carried out on a filtration column ( superose 12 ) balanced with the phosphate buffer . the protein peak that elutes at 34 kda corresponds to the purified heteromer . preferably , the keratinocytes are human differentiated keratinocytes and more advantageously the keratinocytes come from psoriasis scales or from the infundibulum ( epidermic invagination ) of the fair follicle . this heteromer can also be isolated from human leukocytes . thus , this heteromer is also present in the macrophages of the dermis of the skin located around the epidermic peaks , these peaks are characteristic of inflammatory diseases of the skin , such as psoriasis . therefore , this invention relates in particular to a cosmetic or pharmaceutical composition , characterized by the fact that it contains , in an acceptable cosmetic or dermatologic environment , the heteromer described above . in particular , the object of the cosmetic composition is to improve the cosmetic aspect of the skin , in particular , by improving the barrier function of the epidermis . it also relates to the use of this heteromer as medication , in particular for the preventive or curative treatment of hair loss or further for the acceleration of the healing process . indeed , without involving any kind of theory , during the healing process , we notice a cell proliferation and differentiation that are greater than normal ( uninjured skin ), and this process accompanies an increase of the quantity of the heteromer consistent with the invention , it therefore seems that this heteromer is involved in the healing process . thus , the invention relates to the use of the heteromer as described above in a cosmetic composition or as medication , said heteromer or medication being conceived for the treatment of hair loss or for the acceleration of the healing process . the quantity of the heteromer present in this composition may vary to a large extent , in particular in relation to the effect that is sought . in order to give an idea of values , the heteromer can be present at concentrations between 10 − 8 and 20 % by weight in relation to the total weight of the composition . the composition consistent with the invention can be administered by enteral , parenteral or topical pathways . preferably , the topical pathway is used . by topical pathway , we prefer the direct application on the skin , the scalp , the nails or the mucous membranes . the composition consistent with the invention can be in all galenic forms . these compositions are prepared according to the usual methods . a cosmetically or dermatologically acceptable environment generally corresponds to an environment that is compatible with the skin , the scalp , the nails or the mucous membranes . the composition that contains the heteromer can therefore be applied to the face , the neck , the hair or the nails , or any other cutaneous area of the body ( axillary , sub - mammary areas , the folds of the elbow , etc .) by topical pathway , the compositions consistent with the invention come , in particular , in the form of hydroalcoholic , water or oil substances , of dispersions that are of the lotion or serum type , of anhydrous or lipophilic gels , of emulsions of liquid or semi - liquid consistency of the milk type obtained by the dispersion of a fatty phase in an aqueous phase ( h / e ) or inversely ( e / h ), or in the form of mixtures or emulsions of soft , semi - solid or solid consistency of the cream or gel type , or further of microemulsions , microcapsules , microparticles or vesicular dispersions of the ionic and / or non ionic type . these compositions are prepared according to the usual methods by enteral pathway , the compositions consistent with the invention can be in the form of tablets , capsules , sugar - coated pills , syrups , suspensions , solutions , powders , pellets , emulsions , microspheres or nanospheres , or lipidic or polymeric vesicles allowing for a controlled release . by parenteral pathway , the compositions can be in the form of solutions or suspensions for perfusion or for injection . they can also be used for the scalp in the form of aqueous , alcoholic or hydroalcoholic solutions , or in the form of creams , gels , emulsions , foams , or further in the form of compositions for aerosol use also containing a propellant under pressure . the quantities of the various components of the compositions consistent with the invention are those used conventionally in the fields in question . these compositions consist in particular of shaving foams , cleansing , protective , treatment or care creams for the face , the hands , the feet and for the large anatomic wrinkles or for the body ( for example day creams , night creams , cleansing creams , foundation creams , sunscreen creams ), fluid foundations , cleansing milks , body barrier or treatment milks , sun - screen milks or better yet , after - sun milks , lotions , gels or foams for skin care , such as lotions for cleansing or disinfecting , sunscreen lotions , self - tanning lotions , compositions for the bath , deodorizing compositions containing a bactericidal agent , after - shave gels or lotions , depilatory creams , compositions against insect bites , compositions against pain or compositions for the treatment of certain skin disorders such as those mentioned previously , the compositions according to the invention can also consist of solid preparations that make soaps or cleansing cakes . the compositions can also be conditioned in the form of compositions for aerosol use also containing a propellant under pressure , the heteromer can also be incorporated in various compositions for hair care or treatment , and in particular in shampoos , possibly antiparasitic , in lotions for permanents , treatment lotions , hair gels or creams , hair coloring compositions ( in particular oxidation coloring ) possibly in the form of coloring shampoos , hair conditioning lotions , permanent compositions ( in particular compositions for the first step of a permanent ), hair loss gels or lotions , etc . the compositions of the invention can also have a bucco - dental use , for example a toothpaste or mouth wash . in this case , the compositions can contain the usual adjuvants or ancillaries for compositions that have a buccal use and in particular surfactants , thickening agents , humectants , polishing agents such as silica , various active ingredients such as fluorides , in particular sodium fluoride , and possibly sweetening agents such as sodium saccharinate . when the invention &# 39 ; s composition is an emulsion , the proportion of the fatty phase can reach from 5 % to 80 % by weight , and preferably from 5 % to 50 % by weight in relation to the total weight of the composition , the oils , emulsifiers and co - emulsifiers used in the composition in the form of emulsion are chosen among those conventionally used in the cosmetic and pharmaceutical fields . the emulsifier and the co - emulsifier are present in the composition in a proportion ranging from 0 . 3 % to 30 % by weight , and preferably from 0 . 5 % to 30 % or even better from 0 . 5 % to 20 % by weight in relation to the total weight of the composition , in addition , the emulsion can contain lipidic vesicles . when the composition of the invention is a solution or an oil gel , the fatty phase can represent more than 90 % of the total weight of the composition . as it is known , the composition of the invention can also contain the usual adjuvants used in the cosmetic or pharmaceutical fields , such as hydrophilic or lipophilic gelatinizers , hydrophilic or lipophilic actives , preservatives , antioxidants , solvents , perfumes , fillers , filters , bactericides , odor absorbers and dyes . the quantities of these different adjuvants are those used conventionally in the cosmetic and pharmaceutical fields , and range for example from 0 . 01 % to 10 % of the total weight of the composition . these adjuvants , depending on their nature , can be introduced in the fatty phase , in the aqueous phase and / or in the lipidic spherical particles . as far as oils that can be used in the invention are concerned , we can name the mineral oils ( liquid paraffin ), vegetable oils ( liquid fraction of karite butter , sunflower oil ), animal oils ( perhydrosqualene ), synthesis oils ( purcellin oil ), siliconized oils ( cyclomethicone ) and fluorinated oils ( perfluoropolyethers ). one can also use cetyl alcohol , fatty acids ( stearic acid ), waxes ( paraffin , caranda , bees wax ) as fats . as far as emulsifiers that can be used in the invention are concerned , we can name for example glycerol stearate , polysorbate 60 and the peg - 6 / peg - 32 / glycol stearate mixture sold under the name tefose r 63 by the gattefosse company . as far as solvents that can be used in the invention are concerned , we can name the low alcohols , in particular ethanol and isopropanol , propylene glycol . as far as hydrophilic gelatinizers are concerned , we can name the carboxyvinyl polymers ( carbomer ), the acrylic copolymers such as the acrylate / alkylacrylate copolymers , the polyacrylamides , the polysaccharides such as the hydroxypropylcellulose , natural gum and clay , and , as lipophilic gelatinizers , we can name the modified clays such as bentone , the fatty acid metal salts such as aluminum stearates and hydrophobic silica or yet the ethyl cellulose , polyethylene . as hydrophilic actives , we can use protein or protein hydrolyzates , amino acids , polyols , urea , allantoin , sugars and sugar derivatives , water soluble vitamins , starch and vegetable extracts , in particular those from aloe vera . as lipophilic actives , we can use retinol ( vitamin a ) and its derivatives , tocopherol ( vitamin e ) and its derivatives , ceramides , essential oils . in the following or preceding text , the percentages given are expressed in weight , except where otherwise indicated , edta means ethylenediaminetetraacetic acid , dtt means dithiothreitol , dmso means dimethylsulfoxide and pmsf means methanesulfonyl phenyl fluoride . this method allows for the measuring of the quantity of the heteromer according to the invention in biological samples , excluding any form of contamination by the monomers of which it consists , mrp8 and mrp14 , or by their non functional complexes ( that do not migrate ). the technique consists in separating the proteins that are extracted from a biological environment , such as in particular the tissue extracts , cytosolic , membrane extracts , synovial and cephalorhachidian liquids on a polyacrylamide gel ( page ) in acid condition such as at a ph of 4 . 3 . during the electrophoresis , the polarity of the electrodes is reversed so that the positively charged proteins at this ph migrate in this gel . thus , the conventional polyacrylamide gels ( ph 8 . 8 , migration towards the anode ) can be analyzed by this method . between the two glass plates of the apparatus ( biorad mini - gels ), we pour 3 . 5 ml per gel of the mixture consisting of : 1 ml of solution a + 4 . 5 ml of solution c + 1 . 5 ml of h20 + 1 ml of ammonium peroxydisulfate ( aps ) ( 56 mg / 5 ml ). it is left to cure . when the migration gel is cured , we pour the following mixture over it : 1 ml of solution b + 4 ml of solution d + 2 . 25 ml of h20 + 0 . 75 ml of aps . we add the comb and let it cure for a long time . the protein samples are prepared in the e sample buffer ( containing 5 μg per sample of cytochrome c in order to improve the quality of the migration ) and are then deposited in the wells , the protein samples can also be incubated with a radiolabelled ligand of the heteromer consistent with the invention such as tritiated oleic acid . the f buffer of the tanks is diluted 4 times with distilled water and the apparatus is switched on at 200v for 45 minutes . this method of acid gel is inspired from reisfald r a , lewis u j , willian d e , nature 195 : 281 - 283 , 1962 . ( a ) the isolation of the heteromer can be performed directly on the gel by coloring it with a coomassie blue . the blue band that appears above that of the cytochrome c corresponds to that of the heteromer consistent with the invention . ( b ) by immunodetection on gel , it is possible to obtain great sensitivity the gel proteins are then electro - transferred on a cellulose nitrate or polyvinylpyrrolidone sheeting in a 30 mm sodium phosphate buffer with a ph of 6 . 4 under a constant 20v for 1 hour . the membrane is then incubated in an isotonic phosphate ( pbs ) buffer containing 0 . 5 % of powered skim milk , 0 . 2 % of tween 20 ( polysorbate ). the monoclonal antibodies directed against mrp8 and mrp14 ( biomedicals , switzerland ) are used in a { fraction ( 1 / 50 )} dilution . the polyclonal antibodies directed against the heteromer of this invention originating from the rabbit are used in a { fraction ( 1 / 500 )} dilution . thus , all these antibodies , used separately or together , bind to the heteromer according to the invention . the immunoreactive band of the heteromer in accordance with the invention is visualized by using antibodies directed against the antibodies listed above originating from goats that are complexed to the peroxidase and put in the presence of the substrates , 3 . 3 ′- diaminobenzidine and h2o2 . the comparative analysis of the different wells is performed using densitometry . it can also be performed by direct autoradiography when the sample has been incubated with a radiolabelled ligand . these three methods have been performed ( coomassie blue , antibodies and tritiated oleic acid ) using : psoriasis scales , a cytosolic fraction of psoriasis scales , a membrane extract of psoriasis scales , a cytosolic fraction of normal human neutrophils and a membrane fraction of normal human neutrophils . we notice that the band with the strongest electrophoretic mobility corresponds to the heteromer in accordance with the invention . this analysis also reveals that the quantity of the heteromer according to the invention is stronger in the membrane extract of psoriasis scales than in that of the cytosolic fraction of psoriasis scales , the opposite is observed for the normal human neutrophils . ttg acc gag ctg gag aaa gcc ttg aac tct atc atc gac gtc tac cac 107 leu thr glu leu glu lys ala leu asn ser ile ile asp val tyr his aag tac tcc ctg ata aag ggg aat ttc cat gcc gtc tac agg gat gac 155 lys tyr ser leu ile lys gly asn phe his ala val tyr arg asp asp ctg aag aaa ttg cta gag acc gag tgt cct cag tat atc agg aaa aag 203 ggt gca gac gtc tgg ttc aaa gag ttg gat atc aac act gat ggt gca 251 gly ala asp val trp phe lys glu leu asp ile asn thr asp gly ala gtt aac ttc cag gag ttc ctc att ctg gtg ata aag atg ggc gtg gca 299 val asn phe gln glu phe leu ile leu val ile lys met gly val ala gcc cac aaa aaa agc cat gaa gaa agc cac aaa gag tag ctgagttact 348 met leu thr glu leu glu lys ala leu asn ser ile ile asp val tyr his lys tyr ser leu ile lys gly asn phe his ala val tyr arg asp asp leu lys lys leu leu glu thr glu cys pro gln tyr ile arg lys lys gly ala asp val trp phe lys glu leu asp ile asn thr asp gly ala val asn phe gln glu phe leu ile leu val ile lys met gly val aaaacactct gtgtggctcc tcggctttga cagagtgcaa gacg atg act tgc aaa 56 atg tcg cag ctg gaa cgc aac ata gag acc atc atc aac acc ttc cac 104 met ser gln leu glu arg asn ile glu thr ile ile asn thr phe his caa tac tct gtg aag ctg ggg cac cca gac acc ctg aac cag ggg gaa 152 gln tyr ser val lys leu gly his pro asp thr leu asn gln gly glu ttc aaa gag ctg gtg cga aaa gat ctg caa aat ttt ctc aag aag gag 200 aat aag aat gaa aag gtc ata gaa cac atc atg gag gac ctg gac aca 248 aat gca gac aag cag ctg agc ttc gag gag ttc atc atg ctg atg gcg 296 asn ala asp lys gln leu ser phe glu glu phe ile met leu met ala agg cta acc tgg gcc tcc cac gag aag atg cac gag ggt gac gag ggc 344 arg leu thr trp ala ser his glu lys met his glu gly asp glu gly cct ggc cac cac cat aag cca ggc ctc ggg gag ggc acc ccc taa 389 met thr cys lys met ser gln leu glu arg asn ile glu thr ile ile asn thr phe his gln tyr ser val lys leu gly his pro asp thr leu asp leu asp thr asn ala asp lys gln leu ser phe glu glu phe ile	0
referring now to the drawings , wherein like numbers refer to like parts in several views , particularly to fig1 there is shown an electronic device packaging apparatus 100 according to the present invention . the packaging apparatus 100 generally includes a base support 11 , a lower die 12 , a cavity block 21 , an upper die 20 , an elevating plate 18 , supporting shafts 13 , an upper plate 14 , a base plate 15 , a servomotor 16 , and a reduction gear 17 . the lower die 12 is mounted on an upper surface of the base support 11 . the supporting shafts 13 are secured on four corners of the base support 11 around the lower die 12 for supporting the upper plate 14 . the supporting shafts 13 extend through the elevating plate 18 . the elevating plate 18 has disposed on its bottom surface the upper die 20 . on the upper plate 14 , the base plate 15 is disposed . on the base plate 15 , the servomotor 16 and the reduction gear 17 are installed . the reduction gear 17 includes a cover 17a , a worm 16a connected to an output shaft of the servomotor 16 , a worm wheel 16b meshing with the worm 16a , a nut 16c firmly fixed on a lower surface of the worm wheel 16b , and a feed screw 19 ( i . e ., an output shaft of the reduction gear ) extending through the nut 16c and the worm wheel 16b . the nut 16c is rotatably supported by a bearing 15a . the bearing 15a is mounted by a bearing support member 15b which is firmly inserted into a bore formed in the base plate 15 . the feed screw 19 connects with the elevating plate 18 through a bore 14a formed in the upper plate 14 . in operation , when the servomotor 16 is turned on to rotate in a normal direction , it will cause the feed screw 19 to move vertically to displace the elevating plate 18 downward along the supporting shafts 13 until the upper die 20 engages the lower die 12 . when the servomotor 16 is reversed , it will cause the elevating plate 18 to be moved upward along the supporting shafts 13 so that the upper die 20 is lifted out of engagement with the lower die 12 to expose the upper surface of the lower die 12 . the lower die 12 , as shown in fig3 has a stepped surface 12a which is lowered from an upper surface 12b by a height d . on the stepped surface 12a , the cavity block 21 having a thickness d is mounted so that it lies flush with the upper surface 12b . the cavity block 21 has formed in its upper surface three cavities 22 . four positioning pins 23 for positioning a circuit substrate 2 shown in fig1 , are so provided on the stepped surface 12a of the lower die 12 as to project partially from the cavity block 21 through holes 21a , as shown in fig1 , formed in the cavity block . the positioning of the circuit substrate 2 is accomplished by aligning positioning holes 2a formed in corners of the circuit substrate 2 with the positioning pins 23 with a chip - mounting surface of the circuit substrate 2 being oriented downward . the three cavities 22 are formed in the cavity block 21 at locations coincident with chips 3 mounted on the circuit substrate 2 , as shown in fig1 . the upper die 20 , as shown in fig7 has disposed therein a pressure block 24 which is urged downward by a coil spring 25 . holes 26 are drilled in the pressure block 24 in alignment with the positioning pins 23 of the lower die 12 . when the servomotor 16 is rotated in the normal direction , the upper die 20 is , as discussed above , moved downward on the upper surface of the lower die 12 . the pressure block 24 then urges the circuit substrate 2 against the upper surface of the cavity block 21 by virtue of a spring force of the spring 25 . the circuit substrate 2 is , thus , firmly retained between the pressure block 24 and the cavity block 21 . fig5 ( a ) shows one of the cavities 22 formed in the cavity block 21 . fig5 ( b ) shows the bottom of the cavity block 21 . fig6 ( a ) is a cross sectional view taken along the line a -- a in fig4 . fig6 ( b ) is a cross sectional view taken along the line b -- b in fig4 . each of the cavities 22 is , as shown in fig5 ( a ), defined by side walls 22a and a bottom wall 22b , and is of a substantially square shape ( see fig4 ). in the bottom 21c of the cavity block 21 , grooves 29 are , as shown in fig5 ( b ), formed which communicate with the cavities 22 through gate holes 30 , respectively . the grooves 29 also communicate through the other ends with runners 31 , as seen in fig3 and 4 , formed in the upper surface 12b of the lower die 12 . each of the grooves 29 is so defined by tapered side walls widening toward the bottom 21c of the cavity block 21 as to permit a resin material setting therein to be removed easily . additionally , in the cavity block 21 , pin holes 38 are formed into which first ejector pins 34 , as will be described later in detail , are inserted , respectively . with the thus constructed cavity block 21 , the depth of each of the cavities 22 may be set to agree with the thickness of the package 28c of the electronic device 1 , as discussed in the introductory part of this application with reference to fig1 , without changing the thickness d of the cavity block 21 . therefore , when packaging thin electronic devices , it is possible to make the cavities 22 shallow without having to decrease the thickness of the cavity block 21 itself . the cavity block 21 , as shown in fig4 and 5 ( a ), further has formed in the upper surface of the cavity block 21 vent channel outlets 21d each having a depth of less than 30 μm and a width of 300 μm . the vent channel outlets 21d extend in a radial direction from corners of each of the cavities 22 for discharging air existing in the cavity into which a melted resin material is being injected . note that the melted resin material contains particles having a size of about 50 μm ( usually called a filler ), and thus does not leak outside through the vent channel outlets 21d . if the melted resin material slightly leaks into the vent channel outlets 21d and is left on the circuit substrate 2 , it does not affect the quality of the electronic device 1 . the lower die 12 , as shown in fig3 has three pots 27 formed in the upper surface 12b . in each of the pots 27 , a cylindrical raw resin material , usually called a tablet , is disposed . as can be seen in fig3 , and 7 , the runners 31 are formed in the lower die 12 to establish fluid communications between the pots 27 and the grooves 29 of the cavity block 21 , respectively . each of the pots 27 , as shown in fig7 has disposed therein a plunger 32 which is mounted on an end of a rod 33 . a heater ( not shown ) is provided in the lower die 12 for each of the pots 27 which heats the raw resin material 28 to melt it . the melted resin material is then injected by the plunger 32 being elevated by the rod 33 into each of the cavities 22 from the gate hole 30 passing through the runner 31 and the groove 29 . as shown in fig7 first ejector pins 34 and second ejector pins 36 are inserted into the lower die 12 . each of the first ejector pins 34 extends through the cavity block 21 to push the circuit substrate 2 upward . each of the second ejector pins 36 pushes the resin material hardened inside the runner 31 . a rod 35 is slidably inserted into the lower die 12 which connects at its end with the cavity block 21 . the first ejector pins 34 , the second ejector pins 36 , and the rod 35 are elevated by a driver unit ( not shown ). additionally , the upper die 20 has disposed therein pressure pins 37 each pushing the resin material hardened in the pot 27 in a downward direction . in operation , when the servomotor 16 is turned on to rotate in the normal direction after the circuit substrate 2 is secured on the cavity block 21 , it will cause the upper die 20 to move downward so that the circuit substrate 2 is , as shown in fig7 retained between the cavity block 21 and the pressure block 24 . subsequently , after the resin materials 28 disposed in the pots 27 are heated and melted completely , the plungers 32 are elevated . the elevation of the plungers causes , as shown in fig8 the melted resin materials 28a to flow out of the spots 27 to the runners 31 and the grooves 29 which are , in turn , injected into the cavities 22 through the gate holes 30 . upon the injection of the melted resin materials 28a , air in the cavities 22 is discharged outside through the vent channel outlets 21d formed in the upper surface 21b of the cavity block 21 . since the specific gravity of the air is usually smaller than that of the melted resin materials 28a , the air existing in lower portions of the cavities 22 escapes upward into the vent channel outlets 21d . this eliminates the possibility of defects , called voids , being generated in the resin materials within the cavities 22 . the chips 33 disposed in the cavities 22 are then sealed with the melted resin materials 28a . after the melted resin materials 28a are injected into the cavities 22 in the above manner , they are held under pressure for about 30 to 50 sec until the melted resin materials 20a are hardened completely . after the melted resin materials 20a are hardened completely to form resin blocks , the servomotor 16 is reversed to elevate the upper die 20 , exposing the upper surface of the cavity block 21 . the pressure pins 37 , as shown in fig9 are then displaced downward to press the upper surfaces of the resin blocks hardened in the pots 27 , the runners 31 , and the grooves 29 . the rod 35 is then moved upward to lift the cavity block 21 , so that the resin blocks are , as shown in fig1 , separated at the gate holes 30 into resin blocks 28b and resin packages 28c . in this manner , the chips 3 mounted on the circuit substrate 2 are encased within the resin packages 28c , respectively . afterward , the upper die 20 is , as shown in fig1 , further moved upward and , at the same time , the rod 35 is further elevated to lift up the cavity block 21 . the plungers 32 and the second ejector pins 36 are also moved upward to lift up the resin blocks 28b so that it is removed out of the lower die 12 . the circuit substrate 2 with the chips 3 being packaged is then taken out of the cavity block 21 and the resin blocks 28b are removed therefrom . in a subsequent process , the circuit substrate 2 is cut into three pieces to finish an electronic device to an exterior appearance schematically illustrated in fig1 . fig1 shows one of the resin blocks 28b after having been removed from the cavity block 21 as a waste product . the lower case letter a denotes a broken surface of the resin block 28b separated at the gate hole 30 . while the present invention has been disclosed in terms of the preferred embodiment in order to facilitate better understanding thereof , it should be appreciated that the invention can be embodied in various ways without departing from the principle of the invention . therefore , the invention should be understood to include all possible embodiments and modifications to the shown embodiments which can be embodied without departing from the principle of the invention as set forth in the appended claims .	7
according to fig1 , the clip housing 1 of the arrangement according to the invention comprises plastics material . it has a base plate 2 having two securing holes 3 . furthermore , it is provided with a housing 4 which is parallelepipedal . the parallelepipedal housing 4 has no base and instead the base plate 2 is recessed in this region . one of the parallelepiped sides has an opening 5 . the upper side 6 of the parallelepiped facing away from the base plate 2 is provided with an elongate slot 7 which has a free end 7 a . the free elongate slot end 7 a is located at the parallelepiped side provided with the opening 5 . the end 7 b of the elongate slot 7 opposite the free end 7 a forms a securing region 8 for a securing clip 9 , as can be seen in fig2 . according to fig1 , a web 10 is provided spaced below the upper side 6 of the parallelepiped . a free space 11 is formed between the web 10 and the upper side 6 . the free space 11 serves to receive a head 9 a of the securing clip 9 . in the elongate slot 7 , there is provided a centering member , which may preferably that the form of resilient elements which extend into the securing region 8 . the resilient elements are constructed as bending beams or springs 12 , 13 and 14 . one end of each spring is constructed integrally with the clip housing 1 . this is because the bending springs are formed on the inner wall of the elongate slot 7 . at each elongate slot side , there extends a bending spring 12 or 13 in the region of the open end 7 a of the elongate slot 7 , respectively . the bending springs 12 and 13 each protrude with the free end thereof as far as a location in the securing region 8 . the third bending spring 14 is constructed to be shorter than the other bending springs . it extends from the securing region 8 on the inner wall of the elongate slot 7 . the free end thereof protrudes into the securing region 8 . if a securing clip 9 is inserted into the securing region 8 , the bending springs are pretensioned since a shaft 9 b of the securing clip 9 comes into contact with the bending springs 12 , 13 and 14 . the degree of pretensioning is dependent on the diameter which the shaft 9 b has . the pretensioning may be so great and the resilient path of the bending springs 12 , 13 and 14 so great that the free ends thereof touch the inner side of the elongate slot 7 . the inner side then acts as a counter - bearing for the bending springs . when the bending springs become deformed , the free ends thereof may slide along the inner side of the elongate slot 7 . in fig2 , the clip housing 1 of fig1 is illustrated in cross - section , with the securing clip 9 inserted . the securing clip 9 has a flat head 9 a , a cylindrical shaft 9 b and a conical tip 9 c . furthermore , another cylindrical region 9 d with a collar 9 e arranged thereon is provided below the tip . the flat head 9 a of the securing clip 9 fits into the free space 11 which is formed between the web 10 of the clip housing and the upper side 6 thereof . since its head 9 a is enclosed , the securing clip 9 is fixed in the axial direction thereof . the cylindrical region 9 d , which is formed below the conical tip 9 c , has a diameter which is greater than the width of the elongate slot 7 of the clip housing . the securing clip 9 is retained centrally in the securing region 8 of the elongate slot 7 by means of the bending springs . fig3 shows an inner lining portion 15 for a vehicle door . the inner lining portion 15 is produced from plastics material and provided with a plurality of integrated clip housings . an enlarged cutout of an integrated clip housing is illustrated in fig4 . the integrated clip housing substantially corresponds to that according to fig1 , the base plate 2 illustrated in fig1 being replaced by the inner lining portion 15 which carries the integrated clip housing in an integral manner . an alternative clip housing of plastics material is shown in fig5 . this is provided with a separate replacement element 16 having an elongate slot 7 and centering means . the replacement element 16 is also produced from plastics material . in fig5 , the replacement element 16 is connected to the clip housing 1 . the centering means provided in this replacement element 16 correspond to those of the embodiment according to fig1 . fig6 shows the clip housing from fig5 with the replacement element removed . the separate replacement element 16 is illustrated in fig7 . the upper side 6 of the clip housing has a recess 17 into which the replacement element fits . in order to connect the two components , the inner edge of the recess 17 is provided with a spring 18 and , on the outer edge of the replacement element 16 , there is provided a groove 19 which corresponds to the spring 18 of the recess 17 . fig8 shows an alternative replacement element 20 , which can also be inserted into the recess 17 of the clip housing according to fig6 . it also has an elongate slot 7 and centering means and the outer edge thereof is also provided with a groove 19 . in this embodiment , a symmetrical bending spring element 21 is provided as a centering means . it has a contour which extends parallel and with spacing relative to the elongate slot 7 . in the region of the open end 7 a of the elongate slot 7 , the bending spring element 21 is secured at both sides , that is to say , is in each case integrally formed on one and the other elongate slot inner side . in the securing region 8 in this embodiment , there is no free end of a spring provided , but instead the two symmetric halves of the bending spring element 21 meet each other in the securing region 8 and are joined together at an apex . another alternative for a replacement element is illustrated in fig9 . this replacement element 22 is based on the bending spring element according to fig8 . however , it has been modified and has two symmetrical bending springs 23 and 24 . in contrast to fig8 , an interruption of the bending spring element ( gap ) is provided in the region of the apex . the free ends of the bending springs 23 and 24 are thereby produced and protrude into the securing region 8 and thus form two independent bending springs . the outer edge of the replacement element 22 is also provided with a groove 19 which corresponds to the spring 18 at the inner edge of the recess 17 of the housing of fig6 . another embodiment is illustrated in fig1 and 11 . fig1 shows another clip housing which substantially corresponds to the clip housing according to fig1 . however , the centering element has been modified . the modified centering element is a metal spring 25 arranged symmetrically in the elongate slot 7 of the clip housing . it has a contour which extends parallel and with spacing relative to the elongate slot 7 , in a similar manner to the bending spring in fig8 . in the region of the open end 7 a of the elongate slot 7 , the two ends of the metal spring 25 are secured to the clip housing . to this end , according to fig1 , a retention portion 25 a or 25 b is provided at each end of the metal spring , respectively . in a state corresponding to the retention portions 25 a and 25 b of the metal spring 25 , the upper side 6 of the clip housing is provided with laterally open retention pockets 26 a and 26 b . these are constructed so as to be open at the side so that the retention portions 25 a and 25 b of the metal spring 25 can be inserted laterally into the retention pockets 26 a and 26 b , that is to say , in a direction parallel with the longitudinal axis of the elongate slot 7 . the direction of the joining movement for the metal spring 25 is advantageously the same as the joining direction for pushing the securing clip 9 into the elongate slot 7 . this correspondence of the joining direction promotes automation of the assembly . fig1 and 13 show an embodiment which is modified with respect to the embodiment mentioned above . fig1 differs from the clip housing of fig1 because of a different shape of the retention pockets 27 a and 27 b and because of a metal spring 28 which corresponds thereto . the retention pockets 27 a and 27 b of the clip housing are constructed so as to be open towards the top . consequently , the corresponding retention pockets 28 a and 28 b of the metal spring 28 can be inserted from above into the retention pockets , that is to say , in a direction perpendicular relative to the upper side 6 of the clip housing . furthermore , the metal spring 28 also has a contour which extends parallel and with spacing relative to the elongate slot 7 and which resembles the contour of the bending spring according to fig8 .	8
following preferred embodiments and figures will be described in detail so as to achieve aforesaid objects . referring to fig1 , a conventional lc type fiber connector 100 has a generally rectangular shape with a square cross section . the outer surface of the connector 100 includes a spring latch 120 . the spring latch 120 is molded into the outer housing of the connector and includes a living hinge 125 which allows tab 126 to be moved up and down in a direction perpendicular to the central axis 150 - 150 of the connector 100 . in addition , a ferrule 140 protrudes from the opening ill of a two - piece assembly comprising housing 110 and cover 130 which have been ultrasonically bonded together . a spring ( not shown in the figure ) is located inside the two - piece assembly to allow the ferrule 140 to move back and forth through the opening 111 . the spring latch 120 includes a pair of shoulders 121 that are positioned on opposite sides of the tab 126 . referring to fig2 to 4 , the duplex fiber adapter 200 of the present invention includes a unitary molded main body 205 and a cover 300 . in the preferred embodiment , the main body 205 has an axial cavity defined by top side - wall 210 , bottom side - wall 211 , right side - wall 212 and left side - wall 213 . the axial cavity is divided into two halves by a compartment wall 214 that is parallel to the right side - wall 212 and left side - wall 213 and connects with the top side - wall 210 and bottom side - wall 211 . the half of the axial cavity defined by the top side - wall 210 , bottom side - wall 211 , compartment wall 214 and right side - wall 212 is named as the right axial cavity and the other half of the axial cavity defined by the top side - wall 210 , bottom side - wall 211 , compartment wall 214 and left side - wall 213 is named as the left axial cavity . the right axial cavity has opposing first right opening 207 a and second right opening 208 a and the left axial cavity has opposing first left opening 207 b and second left opening 208 b . located on the exterior of the main body 205 is a pair of tabs 201 and 202 . one tab 202 is located on the right side - wall 212 and the other tab 201 is located on the left side wall 213 . the tabs 201 and 202 are operative in supporting the adapter 100 on a surface . the inner cavity of the main body 205 contains a pair of parallel ridges 235 and 236 located on the inner surface of the bottom side - wall 211 . the ridges 235 and 236 are perpendicular to the axial cavity of the main body 205 and divide the compartment wall 214 into two halves . the ridges 235 and 236 define a groove 238 which is perpendicular to the axial cavity of the main body 205 . the groove 238 is half way between the first openings 207 a , 207 b and second openings 208 a , 208 b of the main body 205 . the width of the groove 238 is equal to the thickness of combined flanges 450 of the inner housing halves 410 and 420 . the right side - wall 212 and left side - wall 213 each has a groove 239 that is collinear with the groove 238 . located near the right opening 207 a on the joint of the right side - wall 212 with the bottom side - wall 211 and on the joint of the compartment wall 214 with the bottom side - wall 211 are protrusions 262 . the protrusions 262 are also located near the left opening 207 b on the joint of the left side - wall 213 with the bottom side - wall 211 and on the joint of the compartment wall 214 with the bottom side - wall 211 . similarly , these protrusions 262 are also located near the openings 208 a , 208 b on the joints of the bottom side - wall 211 with the right side - wall 212 , compartment wall 214 and left side - wall 213 , respectively . an access opening 250 is located on the top side - wall 210 . the access opening 250 allows inner housing halves 410 and 420 to be inserted into the axial cavity of the main body 205 and also allows the main body 205 to be constructed by injection molding . the inner housing halves 410 and 420 are identical . each of the inner housing halves 410 and 420 is constructed of plastic by an injection molding process . each half includes two hollow cylinders 440 and a rectan2ular flange 450 located at one end of the cylinder 440 . two halves 410 and 420 are connected at their respective flanges 450 respectively so as to define two common cylinders . two flanges 450 define a thickness which is equal to the widths of the groove 238 and 239 . the inner housing halves 410 , 420 are placed in the main body 205 by aligning the flange 450 of the inner housing half 410 with collinear grooves 238 and 239 and sliding it into place within the main body 205 . the other inner housing half 420 is inserted into the main body 205 in the same fashion . the cylinders 440 of the inner housing halves 410 and 420 are coaxial in the main body 205 and define two common cylinders . located in each of the common cylinders is a hollow sleeve 500 with a generally cylindrical shape . the cover 300 covers the access opening 250 and can be ultrasonically welded to the main body 205 . with reference to fig5 , which is a flow chart of a method for manufacturing the one - piece lc type optical fiber adapter of the present invention . the method includes the steps of : ( 5001 ) providing a main body 205 having an axial cavity , which is defined by a top side - wall 210 , a bottom side - wall 211 , a right side - wall 212 , and a left side - wall 213 , wherein the main body 205 is constructed of plastic by an injection molding process ; ( 5002 ) dividing the axial cavity into two halves through a compartment wall 214 , which is parallel to the right side - wall 212 and left side - wall 213 and connected with the top side - wall 210 and bottom side - wall 211 and has a surface 2141 ; ( 5003 ) forming the half of the axial cavity , a right axial cavity , through the top side - wall 210 , bottom side - wall 211 , compartment wall 214 , and right side - wall 212 , wherein a first right opening 207 a and a second right opening 208 a are formed at the two ends of the right axial cavity respectively ; ( 5004 ) forming the other half of the axial cavity , a left axial cavity , through the top side - wall 210 , bottom side - wall 211 , compartment wall 214 , and left side - wall 213 , wherein a first left opening 207 b and a second left opening 208 b are formed at the two ends of the left axial cavity respectively ; ( 5005 ) forming a pair of tabs 201 and 202 on the exterior of the main body 205 , wherein the one tab 202 is on the right side - wall 212 and the other tab 201 is on the left side - wall 213 ; ( 5006 ) forming two indentations 2391 on the two tabs 201 and 202 on the joint of the tab 201 with the top side - wall 210 and the joint of the tab 202 with the top side - wall 210 respectively , wherein the two indentations 2391 are collinear with the two grooves 239 ; ( 5007 ) forming a pair of parallel ridges 235 and 236 on the inner surface of the bottom side - wall 211 of the axial cavity of the main body 205 so as to define a groove 238 , wherein the ridges 235 and 236 and the groove 238 are perpendicular to the bottom side - wall 211 and divide the compartment wall 214 into two halves , the groove 238 being located at the middle between the first openings 207 a and 207 b and the other middle between second openings 208 a and 208 b of the main body 205 ; ( 5008 ) forming two grooves 239 on the right side - wall 212 and left side - wall 213 respectively , wherein the two grooves 239 are collinear with the groove 238 ; ( 5009 ) forming four pairs of protrusions 262 , wherein the first pair of protrusions 262 are at the locations near the right opening 207 a on the joint of the right side - wall 212 with the bottom side - wall 211 and on the joint of the compartment wall 214 with the bottom side - wall 211 , the second pair of protrusions 262 being at the locations near the left opening 207 b on the joint of the left side - wall 213 with the bottom side - wall 211 and on the joint of the compartment wall 214 with the bottom side - wall 211 , the third pair of protrusions 262 being at the locations near the right opening 208 a on the joint of the right side - wall 212 with the bottom side - wall 211 and on the joint of the compartment wall 214 with the bottom side - wall 211 , and the fourth pair of protrusions 262 being at the locations near the left opening 208 b on the joint of the left side - wall 213 with the bottom side - wall 211 and on the joint of the compartment wall 214 with the bottom side - wall 211 ; ( 5010 ) forming an access opening 250 on the top side - wall 210 , wherein the location of the access opening 250 is corresponding to the two tabs 201 and 202 and constructed by an injection molding process ; ( 5011 ) providing two inner housing halves 410 and 420 that can be inserted into the axial cavity of the main body 205 through the access opening 250 , wherein the two inner housing halves 410 and 420 are identical and constructed of plastic by an injection molding process , each half 410 / 420 including at least two hollow cylinders 440 , a flange 450 being located at the two ends of the same side of the cylinders 440 and shaped as a rectangular member , the thickness of the two flanges 450 of combining the two inner housing halves 410 and 420 being equal to the widths of the grooves 238 and 239 ; ( 5012 ) providing two sleeves 500 , wherein the two cylinders 440 of each of the inner housing halves 410 and 420 are coaxial in the main body 205 and define two cylinders , and the two hollow sleeves 500 being accommodated in the cylinders 440 respectively ; ( 5013 ) combining the inner housing halves 410 and 420 ; ( 5014 ) disposing the combined inner housing halves 410 and 420 in the main body 205 through aligning the flange 450 of the inner housing half 410 with collinear grooves 238 and 239 ; and ( 5015 ) integrating a cover 300 to the access opening 250 of the main body 205 by way of ultrasonic welding , wherein the cover 300 includes two ribs 3001 and a bottom surface 3002 , the two ribs 3001 being tightly embedded into the two indentations 2391 and the surface 2141 of the compartment wall 214 being firmly attached to the bottom surface 3002 , as shown in fig4 . in operation the connector 100 is inserted into the main body 205 from , for example , the first right opening 207 a . the shoulders 121 positioned on the opposite sides of the tab 126 of the spring latch 120 are pushed by the protrusions 262 to cause the spring latch 120 to be deflected downward during the insertion into the main body 205 . the ferrule 140 of the connector 100 is inserted into one end of the hollow sleeve 500 in the right axial cavity . when the shoulders 121 pass over the protrusions 262 j the spring latch 120 is then returned to its original position by its own restorative force to have the shoulders 121 moved upward to position behind the protrusions 262 . the protrusions 262 can stop the backward movement of the shoulders 121 to prevent the connector 100 from being pulled out from the adapter 200 . another connector 100 can be inserted into the main body 205 from the second right opening 208 a in the same manner to have its ferrule 140 to be inserted into the other end of the sleeve 500 in the right axial cavity . the end face of the ferrule 140 will be brought into contact with that of the previous ferrule 140 . similarly , two connectors 100 can be inserted into the main body 205 from the first left opening 207 b and the second left opening 208 b respectively to optically couple with each other . in addition to duplex fiber adapter , the fiber adapter of the present invention can also be designed to couple four pairs of connectors ( not shown in the figure ). more specifically , the axial cavity in the main body of the adapter is divided into four parts by three parallel compartment walls . four connectors can be inserted into the front ends of the four parts of the axial cavity respectively in the above - described manner . similarly , another four connectors can be inserted into the rear ends of the four parts of the axial cavity to couple with the opposite connectors , respectively . since the structure of this adapter is substantially identical to that of the adapter 200 , any further illustrations of such adapter are omitted herein . since the main body of the fiber adapter according to the present invention is unitary , the prior art problem that the stresses cause the two halves of the adapter to separate from each other after time can be avoided . although the invention has been disclosed and illustrated with reference to particular embodiments , the principles involved are susceptible for use in numerous other embodiments that will be apparent to persons skilled in the art . this invention is , therefore , to be limited only as indicated by the scope of the appended claims .	6
the detected actuating positions of accelerator pedal wped and brake pedal bped do not necessarily have to correspond to the actual actuations . it is , for example , possible that a safety function provides in the case of simultaneous actuation of the accelerator pedal and the brake pedal that the position of the accelerator pedal “ overrules ” the position of the brake pedal or also that the position of the brake pedal “ overrules ” the position of the accelerator pedal . the actually ascertained position of accelerator pedal wped would be zero , for example , in the latter case , if the accelerator pedal and the brake pedal were actuated strongly at the same time . fig1 shows on the ordinate braking powers going up and propulsion powers going down , and on the abscissa the position of accelerator pedal wped going left and the position of brake pedal bped going right . as long as a simultaneous actuation of the accelerator pedal and the brake pedal does not occur , it is thus possible to clearly assign a position on the abscissa to the position of accelerator pedal wped and brake pedal bped . in the case of a safety function as mentioned above , this safety function may provide that an unambiguous position on the abscissa is assigned to any position of accelerator pedal wped and brake pedal bped . in the following , it is always assumed that accelerator pedal position wped and the position of brake pedal bped represent ascertained values , after such a safety function has corrected the detected values . fig1 shows motor - based propulsion power pmot , generator - based braking power pgen , and friction braking power phdr . as position wped of the accelerator pedal drops , motor - based propulsion power pmot drops down to a motor - based zero path wpedzero . this decrease is plotted linearly in fig1 but it may assume any other monotonically decreasing curve . motor - based zero path wpedzero is thus position wped of the accelerator pedal in which motor - based propulsion power pmot has dropped to zero . if positions wped of the accelerator pedal are greater than motor - based zero path wpedzero , generator - based braking power pgen is selected to be equal to zero . in the case of positions wped of the accelerator pedal which are smaller than motor - based zero path wpedzero , generator - based braking power pgen increases linearly , as position wped of the accelerator pedal drops , until it assumes a neutral generator - based braking power pgenzero in the case of a neutral position of the accelerator pedal , i . e ., in the case of accelerator pedal position wped being equal to zero . it is possible to predefine the value of neutral generator - based braking power pgenzero ; it is , however , also possible to predefine the quotient , e . g . as 30 %, on neutral generator - based braking power pgenzero and maximum generator - based braking power pgenmax . the latter case thus means that , after motor - based propulsion power pmot has dropped to zero , 30 % of the maximum generator - based braking power could be regulated and / or controlled with the aid of position wped of the accelerator pedal . the linear relationship between position wped of the accelerator pedal and generator - based braking power pgen is not necessarily required . an arbitrary strictly monotonically decreasing relationship is possible . likewise or alternatively , it is also possible to not change the gradient of the relationship between position wped of the accelerator pedal and the generator - based braking power when neutral generator - based braking power pgenzero changes ( e . g ., because it is selected to be proportional to maximum generator - based braking power pgenmax ). it is possible in this case to variably establish generator - based zero path wpedzerogen and , if necessary , also motor - based [ zero path ] wpedzero as a function of neutral generator - based braking power pgenzero and / or as a function of maximum generator - based braking power pgenmax . it is particularly advantageous to select generator - based zero path wpedzerogen and / or motor - based zero path wpedzero to be monotonically increasing , e . g . linearly increasing , having a neutral generator - based braking power pgenzero and / or maximum generator - based braking power pgenmax . if the accelerator pedal is not actuated , but the brake pedal is actuated instead , generator - based braking power pgen increases from neutral generator - based braking power pgenzero , in the case of neutral position bped being equal to zero of the brake pedal , to a predefinable value which is a so - called free travel generator - based braking power mgenfree in the case of free travel bfree of brake pedal position bped . in the case of brake pedal positions bped which are smaller than free travel bfree , a friction braking power is not requested , i . e ., the hydraulic braking system does not brake yet , for example . starting from brake pedal positions bped which are greater or equal to free travel bfree , a friction braking power is requested , i . e ., the hydraulic braking system brakes , for example . in the case of a hydraulic braking system , this point is provided by the start of a hydraulic pressure build - up in the brake master cylinder . it is possible to predefine free travel generator - based braking power pgenfree ; it is also possible to predefine the difference from free travel generator - based braking power pgenfree and neutral generator - based braking power pgenzero ; and it is particularly preferred to predefine the quotient from the difference between free travel generator - based braking power pgenfree , neutral generator - based braking power pgenzero , and maximum generator - based braking power pgenmax , i . e ., quotient ( pgenfree − pgenzero )/ pgenmax is predefined , e . g ., as 35 %. in the exemplary embodiment illustrated in fig1 , the generator - based braking power pgen linearly increases in this range as a function of brake pedal position bped . however , any other strictly monotonically increasing relationships are also possible . if brake pedal position bped exceeds free travel bfree , friction braking power phdr increases in a manner which is characteristic of the braking system . now , it is preferably provided that the further increase of generator - based braking power pgen is selected to be proportional to friction braking power phdr , in particular until generator - based braking power pgen reaches maximum generator - based braking power pgenmax in a maximum path bmax of brake pedal position bped . in the case of brake pedal positions which are greater than maximum path bmax , generator - based braking power pgen is advantageously selected to be constantly identical to maximum generator - based braking power pgenmax . fig2 shows an alternative specific embodiment which is largely identical to the specific embodiment illustrated in fig1 . only the differences are described in the following . in the specific embodiment illustrated in fig2 , a plateau range is provided between motor - based zero path wpedzero and generator - based zero path wpedgen of accelerator pedal position wped . if accelerator pedal position wped is in the range between generator - based zero path wpedzerogen and motor - based zero path wpedzero , neither a motor - based propulsion power pmot nor a generator - based braking power pgen is thus requested , thereby improving the metering ability in this range . the implementation of generator - based braking power pgen thus determined by the control and / or regulating unit is usually carried out by a control and / or regulating unit of the electric machine , e . g ., by accordingly controlling a field current or by a suitably clocked control of rectifying components .	8
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . while the use of drone aircraft has been increasing in recent years , these drones are primarily concerned with providing of photo , video and geolocation data , depending on the purpose of the flight . such systems , however , do not provide an ability to track and focus on a specific person , except possibly through the use of image recognition techniques , which are not always reliable and not always practical . the present invention provides for an ability to identify individuals that are within camera view ( and within a directional sensitivity of an antenna ) based on unique identifiers of mobile phones used by the people in question . although the use of airborne wi - fi access points is known , such an approach is only marginally successful for identifying individuals , because : not all mobile phones have their wi - fi chip turned on not all phones permit identification using the mac address , and some phones randomize the mac address when searching for a network . when using gsm / 3g / 4g type networks , a number of things have to be done to successfully identify users of the phones . for example , the frequency needs to be dynamically changed , to avoid mutual jamming of the frequency by a bts that is nearby . a ) when a subscriber enters the area covered by a directive gain antenna , they are re - connected to a connection device located on the aircraft ; b ) a camera located on the aircraft takes picture or video footage of the subscriber ( or a group of people containing the subscriber ); c ) a mobile device sends its identifying data ( imsi and imei ) to the connection device ; d ) these identifying data is used to find the subscriber in the mobile communications provider &# 39 ; s database ; e ) full data are then sent to the provider and stored in local memory . a system of intelligent connection jamming is used to cut off the subscriber from the provider &# 39 ; s network . in order to explain how it works , the structure of a physical ( e . g . gsm ) channel should be described . each base station has at least 2 physical channels : an uplink channel to receive signals from mobile stations and a downlink channel to send signals to mobile stations . the bandwidth of each channel is 0 . 2 mhz . each pair of channels is linked to a certain channel number , or arfcn . in order to jam connections in a specified area , the whole frequency range corresponding to the gsm - standard is usually jammed . if such an approach is used , it is difficult to re - connect a mobile phone to a connection spot , because in that case the spot should have high capacity . the access point needs to transmit at a relatively high power , at a minimum , higher than the noise level . the present invention uses intelligent jamming , which jams only a busy arfcn , thus enabling to create a connection spot from any free arfcn without any significant capacity requirements . thus , only those channels arfcn channels are jammed that are used by the mobile network operator , while the subscribers using those channels experience a dropped connection . another method for making the mobile devices switch to the airborne mobile bts is by emulation of the base station of an operator with better priority parameters ( e . g ., c1 and c2 in the gsm standard , similar parameters in other standards ). the use of a movable ( airborne ) base station gives that advantage that it is possible to assess the radio environment prior to launch and operation of the airborne bts . with accumulation of a large amount of data regarding which channels are in use , it is possible to select the best channel and transmit the best parameters , compared to a stationary bts . thus , subscribers will be more likely to switch to airborne bts . the system also employs directed gain antennas , which focus the entire power of the transmitter in a narrow angular range , in order for intelligent jamming to work even in the vicinity of real base stations . also , such an antenna provides for rather precise location of subscribers and taking pictures or video footage of them . after the connection spot occupies a free physical arfcn - channel , it starts to imitate a logical bcch ( broadcast ) channel , which is used to transmit identifying data of a base station . operator identification data ( mcc , mnc , lac , cellid ) is translated , and priority coefficients of the base station that are responsible for the phone selecting the base station ( c1 and c2 ) are increased , even if another , more powerful base station is available . in general , it is only required that a base station with the given identifying data ( country and provider number codes ) is not prohibited . in some cases , it could be necessary that the connection device in the aircraft imitate a base station of a local provider . the present invention provides two solutions for that problem : a ) there are identifying data of non - existent network and country , which are transmitted via the logical bcch - channel , so that the mobile station , being unable to perceive any real base stations , considers itself to be in roaming and tries to connect to the connection spot ; b ) the identifying data correspond to a real local provider , but are changed , thus forcing the mobile station to re - connect . providing that geographical conditions are good , the system returns an imsi — a unique sim - card id ( which can also yield additional data about its owner , as it is necessary to present personal data when buying a sim - card in some countries ), an imei — a unique mobile device id ( which can help to track the history of owners and sim - cards ), and a picture of a subscriber . this data can be sufficient to fully identify a subscriber . also , video footage ( e . g ., from a camera mounted on the aircraft ) could be downloaded to the base station or to a server and used to register illegal activities . when it is necessary to find a subscriber and / or his mobile device , the following is performed : 1 . an approximate location is determined using the video camera and the directional antenna . this permits only a rough estimate of the location , however , an important aspect is that it can be done fairly rapidly . with the airborne bts having an antenna whose gain profile matches the field of view of the camera , when new data is received by the antenna regarding identification of the mobile device , an image or video is taken by the video camera , and the image / video is tied to the identification data received by the antenna . using a high gain antenna ( e . g ., with a high gain in a 10 degree field of view ) permits increasing the accuracy of the determination , as long as the subscriber is not too far , e . g ., within a mile or two . 2 . an rrlp request is sent . radio resource location services protocol ( rrlp ) applies to gsm and umts cellular networks . it is used to exchange messages between a handset and an smlc in order to provide geolocation information ; e . g ., in the case of emergency calls . the protocol was developed in order to fulfil the wireless enhanced 911 requirements in the united states . however , since the protocol does not use require any authentication , and it can be used outside a voice call or sms transfer , its use is not restricted to emergency calls and can be used by law enforcement to pinpoint the exact geolocation of the target &# 39 ; s mobile phone . the use of this protocol permits receiving gps / glonass coordinates of the mobile device remotely , although only if the gps signal is available to be received . 3 . using a voice call , with a subsequent search using an audio signal , people trapped under fallen buildings and landslides can be found , particularly when the subscriber is unable to manually respond . 4 . triangulation can also be used , when the airborne bts establishes a hidden connection , i . e ., the mobile device does not show the call , but the gsm chip in the phone still is used to identify the coordinates and transmit them to the bts . the aircraft , using the antenna and measurements of the signal taken from different locations can triangulate on the location of the subscriber . then , depending on weather conditions and other factors , a photo or video of the location can be taken , to match the coordinates determined by triangulation . multiple aircraft btss can be used , to accelerate the process . the server aggregates and processes the information , including the video / image data , the antenna direction data , the identification data , the aircraft location data , the received signal power data , and so on . as shown in fig1 , the following steps are performed : 1 . scanning of all arfcns in the given gsm standard is performed in step 102 . 2 . ranking of arfcns according to the capacity of their downlink channel is performed in step 104 . 3 . is the signal power higher than n dbm ? ( step 106 .) 4 . the arfcn channel is listed as busy ( step 108 .) 5 . was the bcch channel successfully found ? ( step 110 .) 6 . recording the identifying data ( mcc and mnc ), which have been extracted from the channel ( step 112 .) 7 . looking for a free arfcn channel ( step 114 .) 8 . switching on intelligent jamming of all channels listed as busy ( step 116 .) 9 . is the roaming imitation mode on ? ( step 118 .) 10 . ( yes ) choosing non - existent mnc and mcc ( step 120 .) 11 . ( no ) varying mncs ( mobile network code ) and mccs ( mobile country code ) listed as busy ( step 124 .) 12 . collecting identifying data of a mobile device ( step 122 .) fig4 illustrates an exemplary system utilizing the ideas described herein . the subscriber terminals 59 can connect to the mobile network ( stationary or mobile bts ). the bts has to support the relevant standards expected by the mobile devices 59 . a duplexer 402 is used to mix the receiving and transmitting channel . the use of the duplexer improves the quality of the received signal and permits using the same antenna for both sending and receiving . software defined radio ( sdr ) 403 is a technology that permits using software to dynamically change the frequencies , modulation , power and other parameters of the radio signal . the processing of the signal is done on the computer 404 . the use of the sdr platform also permits easy determination of the signal powers at various frequencies . the computer 404 processes the signals and emulates the behavior of a bts . the computer 404 also stores a database of subscribers . the software on the computer 404 defines the standards used by the bts to communicate with the subscribers . the computer 440 also runs algorithms for determining the location of the subscriber using triangulation , and receives the images / video from the camera 406 . the external server 405 receives the data , such as coordinates of the aircraft , its orientation in 3 - d space , identification data of the subscribers , activity on the radio channels , photo and / or video files from the aircraft and any other cameras . by comparing the data ( optionally , from multiple aircraft ), the server can determine the location of the subscribers based on their signal strength and other data . all the aircraft have their clocks synchronized . the server can produce reports , generate statistics and analyze the images to match them to mobile device identifiers . the server can also connect remotely to the airborne btss to configure them . the camera 406 with zoom is used to capture images that match an antenna &# 39 ; s gain profile . fig5 illustrates another aspect of the exemplary system utilizing the ideas described herein . in fig5 is the aircraft , such as a helicopter , a blimp , a drone , a quadracopter , etc . the aircraft needs sufficient lifting power to carry an airborne bts , the antenna ( s ) and the camera 506 . the aircraft is controlled remotely , either using the same channels as those utilized by the bts , or a separate dedicated channel . in some cases , using a spooled wire to control the aircraft may be possible , to increase on - station time . 502 is the bts , further described above . 503 is the antenna , with various gain profiles , which permits efficiently locating the subscribers . both highly directive and diffuse gain profiles can be used ( highly directive for location , diffuse for mobile connections ). the aircraft may have one or more of the subsystems discussed below , which permit improving some of the parameters of the aircraft . 1 . a protective airbag in case of a crash of the unmanned aerial vehicle . the airbag may be inflated either using pyrobolts or using the on - board engine or turbine of the uav itself . this is more effective than a parachute , since the size and weight of such an airbag are much less , and is generally safer for the public . the airbag ( s ) is mounted on the surface of the uav , generally on the bottom - facing surface . anywhere from 1 to 2 - 8 such airbags may be used . the airbag activation system can have a power supply that is separate from the rest of the uav , and can deploy either automatically or manually . for example , it can deploy during severe vibration or acceleration overloads , critical control system errors , when a fall is detected , or upon manual instruction from the pilot . 2 . a heating system for electronics can be installed on the uav , depending on weather conditions and geographic region where the uav is used . sensors for the temperature conditions are also mounted inside the uav , in proximity to the on - board electronics , in order to know when to activate the heating system . the on - board electronics is generally housed in a thermally protected compartment of the uav , and circuit boards can be covered with a water - resistant coating , such as silica gel . the battery compartment is also protected from water and moisture damage , and can have its own heating elements . the power wiring uses low - resistance high - cross - section conductors . when the uav is started , the first thing to activate is usually the heating system ( at a minimum , to check if heating is needed ). then , once proper temperature is reached , the on - board electronics can start , and the engine can being operation . the heating system is responsible for maintaining proper temperature of the batteries and the electronics throughout the flight . 3 . the bts uses an antenna with a highly directional profile of its directional diagram , generally with the peak of the gain being in the downward direction . as a further option , the antenna can be mounted on a suspension with one or two degrees of rotational freedom , and rotated using a motor , in order to better determine the direction towards the transmitter ( subscriber &# 39 ; s mobile device ), and / or to optimize the orientation of the antenna so as to avoid interfering with the radio commands to the uav . the motor is controlled using the on - board electronics + 4 . the antenna ( s ) are mounted so as to improve electromagnetic compatibility characteristics . in the case of separate antennas that receive and transmit , these antennas should be as far as possible from each other . satellite receiving antennas , if any , should preferably be located on separate mounting brackets . ground shielding can be used between the antenna ( s ) and the rest of the electronics . 5 . as another option , the antennas may be placed in plasma volumes , where the plasma is excited so as to permit transmission of the relevant frequencies and filtering of other frequencies , including filtering of electromagnetic effects of the various components of the uav on each other . 6 . the on - board electronics provides for both remotely piloted mode and for autonomous mode using pre - programmed flight patterns , based on gps signals or inertial navigation systems or both . the on - board processor can generate its own flight pattern based on specific task parameters and the uav / bts / antenna characteristics and the expected area that needs to be covered . fig2 is a block diagram of an exemplary mobile device 59 on which the invention can be implemented . the mobile device 59 can be , for example , a personal digital assistant , a cellular telephone , a network appliance , a camera , a smart phone , an enhanced general packet radio service ( egprs ) mobile phone , a network base station , a media player , a navigation device , an email device , a game console , or a combination of any two or more of these data processing devices or other data processing devices . in some implementations , the mobile device 59 includes a touch - sensitive display 73 . the touch - sensitive display 73 can implement liquid crystal display ( lcd ) technology , light emitting polymer display ( lpd ) technology , or some other display technology . the touch - sensitive display 73 can be sensitive to haptic and / or tactile contact with a user . in some implementations , the touch - sensitive display 73 can comprise a multi - touch - sensitive display 73 . a multi - touch - sensitive display 73 can , for example , process multiple simultaneous touch points , including processing data related to the pressure , degree and / or position of each touch point . such processing facilitates gestures and interactions with multiple fingers , chording , and other interactions . other touch - sensitive display technologies can also be used , e . g ., a display in which contact is made using a stylus or other pointing device . in some implementations , the mobile device 59 can display one or more graphical user interfaces on the touch - sensitive display 73 for providing the user access to various system objects and for conveying information to the user . in some implementations , the graphical user interface can include one or more display objects 74 , 76 . in the example shown , the display objects 74 , 76 , are graphic representations of system objects . some examples of system objects include device functions , applications , windows , files , alerts , events , or other identifiable system objects . in some implementations , the mobile device 59 can implement multiple device functionalities , such as a telephony device , as indicated by a phone object 91 ; an e - mail device , as indicated by the e - mail object 92 ; a network data communication device , as indicated by the web object 93 ; a wi - fi base station device ( not shown ); and a media processing device , as indicated by the media player object 94 . in some implementations , particular display objects 74 , e . g ., the phone object 91 , the e - mail object 92 , the web object 93 , and the media player object 94 , can be displayed in a menu bar 95 . in some implementations , device functionalities can be accessed from a top - level graphical user interface , such as the graphical user interface illustrated in the figure . touching one of the objects 91 , 92 , 93 or 94 can , for example , invoke corresponding functionality . in some implementations , the mobile device 59 can implement network distribution functionality . for example , the functionality can enable the user to take the mobile device 59 and its associated network while traveling . in particular , the mobile device 59 can extend internet access ( e . g ., wi - fi ) to other wireless devices in the vicinity . for example , mobile device 59 can be configured as a base station for one or more devices . as such , mobile device 59 can grant or deny network access to other wireless devices . in some implementations , upon invocation of device functionality , the graphical user interface of the mobile device 59 changes , or is augmented or replaced with another user interface or user interface elements , to facilitate user access to particular functions associated with the corresponding device functionality . for example , in response to a user touching the phone object 91 , the graphical user interface of the touch - sensitive display 73 may present display objects related to various phone functions ; likewise , touching of the email object 92 may cause the graphical user interface to present display objects related to various e - mail functions ; touching the web object 93 may cause the graphical user interface to present display objects related to various web - surfing functions ; and touching the media player object 94 may cause the graphical user interface to present display objects related to various media processing functions . in some implementations , the top - level graphical user interface environment or state can be restored by pressing a button 96 located near the bottom of the mobile device 59 . in some implementations , each corresponding device functionality may have corresponding “ home ” display objects displayed on the touch - sensitive display 73 , and the graphical user interface environment can be restored by pressing the “ home ” display object . in some implementations , the top - level graphical user interface can include additional display objects 76 , such as a short messaging service ( sms ) object , a calendar object , a photos object , a camera object , a calculator object , a stocks object , a weather object , a maps object , a notes object , a clock object , an address book object , a settings object , and an app store object 97 . touching the sms display object can , for example , invoke an sms messaging environment and supporting functionality ; likewise , each selection of a display object can invoke a corresponding object environment and functionality . additional and / or different display objects can also be displayed in the graphical user interface . for example , if the device 59 is functioning as a base station for other devices , one or more “ connection ” objects may appear in the graphical user interface to indicate the connection . in some implementations , the display objects 76 can be configured by a user , e . g ., a user may specify which display objects 76 are displayed , and / or may download additional applications or other software that provides other functionalities and corresponding display objects . in some implementations , the mobile device 59 can include one or more input / output ( i / o ) devices and / or sensor devices . for example , a speaker 60 and a microphone 62 can be included to facilitate voice - enabled functionalities , such as phone and voice mail functions . in some implementations , an up / down button 84 for volume control of the speaker 60 and the microphone 62 can be included . the mobile device 59 can also include an on / off button 82 for a ring indicator of incoming phone calls . in some implementations , a loud speaker 64 can be included to facilitate hands - free voice functionalities , such as speaker phone functions . an audio jack 66 can also be included for use of headphones and / or a microphone . in some implementations , a proximity sensor 68 can be included to facilitate the detection of the user positioning the mobile device 59 proximate to the user &# 39 ; s ear and , in response , to disengage the touch - sensitive display 73 to prevent accidental function invocations . in some implementations , the touch - sensitive display 73 can be turned off to conserve additional power when the mobile device 59 is proximate to the user &# 39 ; s ear . other sensors can also be used . for example , in some implementations , an ambient light sensor 70 can be utilized to facilitate adjusting the brightness of the touch - sensitive display 73 . in some implementations , an accelerometer 72 can be utilized to detect movement of the mobile device 59 , as indicated by the directional arrows . accordingly , display objects and / or media can be presented according to a detected orientation , e . g ., portrait or landscape . in some implementations , the mobile device 59 may include circuitry and sensors for supporting a location determining capability , such as that provided by the global positioning system ( gps ) or other positioning systems ( e . g ., systems using wi - fi access points , television signals , cellular grids , uniform resource locators ( urls )). in some implementations , a positioning system ( e . g ., a gps receiver ) can be integrated into the mobile device 59 or provided as a separate device that can be coupled to the mobile device 59 through an interface ( e . g ., port device 90 ) to provide access to location - based services . the mobile device 59 can also include a camera lens and sensor 80 . in some implementations , the camera lens and sensor 80 can be located on the back surface of the mobile device 59 . the camera can capture still images and / or video . the mobile device 59 can also include one or more wireless communication subsystems , such as an 802 . 11b / g communication device 86 , and / or a bluetooth communication device 88 . other communication protocols can also be supported , including other 802 . x communication protocols ( e . g ., wimax , wi - fi , 3g , lte ), code division multiple access ( cdma ), global system for mobile communications ( gsm ), enhanced data gsm environment ( edge ), etc . in some implementations , the port device 90 , e . g ., a universal serial bus ( usb ) port , or a docking port , or some other wired port connection , is included . the port device 90 can , for example , be utilized to establish a wired connection to other computing devices , such as other communication devices 59 , network access devices , a personal computer , a printer , or other processing devices capable of receiving and / or transmitting data . in some implementations , the port device 90 allows the mobile device 59 to synchronize with a host device using one or more protocols , such as , for example , the tcp / ip , http , udp and any other known protocol . in some implementations , a tcp / ip over usb protocol can be used . fig3 is a block diagram 2200 of an example implementation of the mobile device 59 . the mobile device 59 can include a memory interface 2202 , one or more data processors , image processors and / or central processing units 2204 , and a peripherals interface 2206 . the memory interface 2202 , the one or more processors 2204 and / or the peripherals interface 2206 can be separate components or can be integrated in one or more integrated circuits . the various components in the mobile device 59 can be coupled by one or more communication buses or signal lines . sensors , devices and subsystems can be coupled to the peripherals interface 2206 to facilitate multiple functionalities . for example , a motion sensor 2210 , a light sensor 2212 , and a proximity sensor 2214 can be coupled to the peripherals interface 2206 to facilitate the orientation , lighting and proximity functions described above . other sensors 2216 can also be connected to the peripherals interface 2206 , such as a positioning system ( e . g ., gps receiver ), a temperature sensor , a biometric sensor , or other sensing device , to facilitate related functionalities . a camera subsystem 2220 and an optical sensor 2222 , e . g ., a charged coupled device ( ccd ) or a complementary metal - oxide semiconductor ( cmos ) optical sensor , can be utilized to facilitate camera functions , such as recording photographs and video clips . communication functions can be facilitated through one or more wireless communication subsystems 2224 , which can include radio frequency receivers and transmitters and / or optical ( e . g ., infrared ) receivers and transmitters . the specific design and implementation of the communication subsystem 2224 can depend on the communication network ( s ) over which the mobile device 59 is intended to operate . for example , a mobile device 59 may include communication subsystems 2224 designed to operate over a gsm network , a gprs network , an edge network , a wi - fi or wimax network , and a bluetooth network . in particular , the wireless communication subsystems 2224 may include hosting protocols such that the device 59 may be configured as a base station for other wireless devices . an audio subsystem 2226 can be coupled to a speaker 2228 and a microphone 2230 to facilitate voice - enabled functions , such as voice recognition , voice replication , digital recording , and telephony functions . the i / o subsystem 2240 can include a touch screen controller 2242 and / or other input controller ( s ) 2244 . the touch - screen controller 2242 can be coupled to a touch screen 2246 . the touch screen 2246 and touch screen controller 2242 can , for example , detect contact and movement or break thereof using any of multiple touch sensitivity technologies , including but not limited to capacitive , resistive , infrared , and surface acoustic wave technologies , as well as other proximity sensor arrays or other elements for determining one or more points of contact with the touch screen 2246 . the other input controller ( s ) 2244 can be coupled to other input / control devices 2248 , such as one or more buttons , rocker switches , thumb - wheel , infrared port , usb port , and / or a pointer device such as a stylus . the one or more buttons ( not shown ) can include an up / down button for volume control of the speaker 2228 and / or the microphone 2230 . in one implementation , a pressing of the button for a first duration may disengage a lock of the touch screen 2246 ; and a pressing of the button for a second duration that is longer than the first duration may turn power to the mobile device 59 on or off . the user may be able to customize a functionality of one or more of the buttons . the touch screen 2246 can , for example , also be used to implement virtual or soft buttons and / or a keyboard . in some implementations , the mobile device 59 can present recorded audio and / or video files , such as mp3 , aac , and mpeg files . in some implementations , the mobile device 59 can include the functionality of an mp3 player . the mobile device 59 may , therefore , include a 32 - pin connector that is compatible with the mp3 player . other input / output and control devices can also be used . the memory interface 2202 can be coupled to memory 2250 . the memory 2250 can include high - speed random access memory and / or non - volatile memory , such as one or more magnetic disk storage devices , one or more optical storage devices , and / or flash memory ( e . g ., nand , nor ). the memory 2250 can store an operating system 2252 , such as darwin , rtxc , linux , unix , os x , android , ios , windows , or an embedded operating system such as vxworks . the operating system 2252 may include instructions for handling basic system services and for performing hardware dependent tasks . in some implementations , the operating system 2252 can be a kernel ( e . g ., unix kernel ). the memory 2250 may also store communication instructions 2254 to facilitate communicating with one or more additional devices , one or more computers and / or one or more servers . the memory 2250 may include graphical user interface instructions 2256 to facilitate graphic user interface processing including presentation , navigation , and selection within an application store ; sensor processing instructions 2258 to facilitate sensor - related processing and functions ; phone instructions 2260 to facilitate phone - related processes and functions ; electronic messaging instructions 2262 to facilitate electronic - messaging related processes and functions ; web browsing instructions 2264 to facilitate web browsing - related processes and functions ; media processing instructions 2266 to facilitate media processing - related processes and functions ; gps / navigation instructions 2268 to facilitate gps and navigation - related processes and instructions ; camera instructions 2270 to facilitate camera - related processes and functions ; and / or other software instructions 2272 to facilitate other processes and functions . each of the above identified instructions and applications can correspond to a set of instructions for performing one or more functions described above . these instructions need not be implemented as separate software programs , procedures or modules . the memory 2250 can include additional instructions or fewer instructions . furthermore , various functions of the mobile device 59 may be implemented in hardware and / or in software , including in one or more signal processing and / or application specific integrated circuits . with reference to fig6 , an exemplary system for implementing the invention includes a general purpose computing device in the form of a personal computer or server 404 or the like , including a processing unit 21 , a system memory 22 , and a system bus 23 that couples various system components including the system memory to the processing unit 21 . the system bus 23 may be any of several types of bus structures including a memory bus or memory controller , a peripheral bus , and a local bus using any variety of bus architectures . the system memory includes read - only memory ( rom ) 24 and random access memory ( ram ) 25 . a basic input / output system 26 ( bios ), containing the basic routines that help to transfer information between elements within the personal computer 404 , such as during start - up , is stored in rom 24 . the personal computer 404 may further include a hard disk drive 27 for reading from and writing to a hard disk , not shown in the figure , a magnetic disk drive 28 for reading from or writing to a removable magnetic disk 29 , and an optical disk drive 30 for reading from or writing to a removable optical disk 31 such as a cd - rom , dvd - rom or other optical media . the hard disk drive 27 , magnetic disk drive 28 , and optical disk drive 30 are connected to the system bus 23 by a hard disk drive interface 32 , a magnetic disk drive interface 33 , and an optical drive interface 34 , respectively . the drives and their associated computer - readable media provide a non - volatile storage of computer readable instructions , data structures , program modules / subroutines , such that may be used to implement the steps of the method described herein , and other data for the personal computer 404 . although the exemplary environment described herein employs a hard disk , a removable magnetic disk 29 and a removable optical disk 31 , it should be appreciated by those skilled in the art that other types of computer readable media that can store data accessible by a computer , such as magnetic cassettes , flash memory cards , digital video disks , bernoulli cartridges , random access memories ( rams ), read - only memories ( roms ) and the like may also be used in the exemplary operating environment . a number of program modules may be stored on the hard disk , magnetic disk 29 , optical disk 31 , rom 24 or ram 25 , including an operating system 35 ( e . g ., windows ™ 2000 ). the computer 404 includes a file system 36 associated with or included within the operating system 35 , such as the windows nt ™ file system ( ntfs ), one or more application programs 37 , other program modules 38 and program data 39 . a user may enter commands and information into the personal computer 404 through input devices such as a keyboard 40 and pointing device 42 . other input devices ( not shown ) may include a microphone , joystick , game pad , satellite dish , scanner or the like . these and other input devices are often connected to the processing unit 21 through a serial port interface 46 that is coupled to the system bus , but may be connected by other interfaces , such as a parallel port , game port or universal serial bus ( usb ). a monitor 47 or other type of display device is also connected to the system bus 23 via an interface , such as a video adapter 48 . in addition to the monitor 47 , personal computers typically include other peripheral output devices , such as speakers and printers . the personal computer 404 may operate in a networked environment using logical connections to one or more remote computers 49 . the remote computer ( or computers ) 49 may be represented by a personal computer , a server , a router , a network pc , a peer device or other common network node , and it normally includes many or all of the elements described above relative to the personal computer 404 , although only a memory storage device 50 is illustrated . the logical connections include a local area network ( lan ) 51 and a wide area network ( wan ) 52 . such networking environments are commonplace in offices , enterprise - wide computer networks , intranets and the internet . when used in a lan networking environment , the personal computer 404 is connected to the local network 51 through a network interface or adapter 53 . when used in a wan networking environment , the personal computer 404 typically includes a modem 54 or other means for establishing communications over the wide area network 52 , such as the internet . the modem 54 , which may be internal or external , is connected to the system bus 23 via the serial port interface 46 . in a networked environment , program modules depicted relative to the personal computer 404 , or portions thereof , may be stored in the remote memory storage device . it will be appreciated that the network connections shown are exemplary and other means of establishing a communications link between the computers may be used . such computers as described above can be used in conventional networks , e . g . the internet , local area networks , regional networks , wide area networks , and so forth . these networks can link various resources , such as user computers , servers , internet service providers , telephones connected to the network and so on . having thus described a preferred embodiment , it should be apparent to those skilled in the art that certain advantages of the described method and apparatus have been achieved . it should also be appreciated that various modifications , adaptations and alternative embodiments thereof may be made within the scope and spirit of the present invention . the invention is further defined by the following claims .	7
the present invention will now be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . however , this invention may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . like numbers refer to like elements throughout . the method of the invention includes steps for performing an analysis of defect patterns in semiconductor wafers , and may be used at various stages of manufacture where tests are conducted . it is particularly useful the correlating the results of tests conducted at “ wafer sort ”, i . e ., prior to die singulation and packaging , inasmuch as these tests are critical . at this stage , defects found by various test procedures may be related to particular faults in the manufacturing process . as illustrated in fig1 a semiconductor wafer 10 typically has an active surface 12 on which a matrix 13 of integrated circuits or die 14 are formed . the integrated circuits 14 may include elements such as transistors , resistors , capacitors , conductors , etc . individual circuits 14 are shown as die bounded by scribe lines 16 which run parallel to x - axis 20 and the perpendicular y - axis 22 . ordinarily , before a wafer 10 is singulated into separate die 14 , various tests are conducted , including probe tests by a probe instrument 18 . these tests ( including so - called “ parametric ” circuit tests ) result in a characterization of each die 14 of the wafer 10 , and thus a characterization of the entire wafer . each die 14 of a wafer will be associated with a wafer test bin including data identified by an alphanumeric code which represents the characteristics of functional and non - functional die . the wafer test bins are grouped to generate a bin summary or wafer map indicating the locations of die 14 which fail the test . in addition to identifying usable die 14 , the tests are conducted to pinpoint the causes of particular problems , the goal being correction of the manufacturing process to eliminate the defect and improve the yield in other wafers 10 of the lot . there are typically about 25 - 50 wafers per lot . in addition to certain defects whose cause may be known , other defects ( certain circuit defects ) may be considered to be random in nature , even though a cause does of course exist , and there may be discernable . an example of a random defect may be one caused by an air - borne contaminant particle . even with a random defect , it may be possible to determine the particular step in which the contaminant was introduced , so that improvements may be initiated to reduce contamination in that step , for example . a primary test procedure includes parametric electrical circuit tests to determine functionality of each die 14 . the electrical probe instrument 18 positions needle - like probes on the surface 12 of a die 14 and applies varied voltage , current and polarity to the die . furthermore , a multiprobe card may simultaneously test a plurality of die 14 on a wafer 10 . non - contact methods are also available for performing circuit tests and other tests . measured circuit variables may be used to determine current / voltage relationships , resistance , resistivity , diode forward voltage , leakage current , breakdown voltage , beta value , capacitance , and the like . defects may be classified as being large area defects or point defects . examples of large area defects include surface scratches , incomplete etches , areas of non - uniform deposition thickness , and wafer non - planarity . point defects are generally defined as those which appear to be much smaller in area . examples include voids ( pinholes ) in layers , protrusions ( bridges ), and random spot defects . point defects may , however , result from processing steps affecting large areas . they may include , for example , stacking faults , slip , and dislocations which result from poorly designed thermal processes , incomplete annealing , and / or unsatisfactory epitaxial growth steps . the die 14 which fail a particular test may be clustered in a specific spatial location or locations on a wafer surface 12 . for example , as shown in the wafer map of fig2 a particular manufacturing error may result in a group of defective die 14 a which are in a right side 32 , near the center 28 of an exemplary wafer 10 a . these twelve defective die 14 a together form a cluster pattern 30 a . likewise , another wafer 10 b is illustrated in fig3 on which a group of defective die 14 b form a ring or round cluster pattern 30 b near the periphery 26 . the cluster pattern 30 b is shown as circumferential about wafer center 28 . in a typical analysis method of the prior art , a cluster pattern 30 is considered to be a pattern of spatially adjacent die 14 having the same type of defect , where the cluster pattern is recurrent in other wafers 10 in the wafer lot . since the method matches probed wafer maps with other probed wafer maps , at least two probed wafer maps are required . a defect cluster pattern 30 found on one wafer 10 is thus considered significant when at least one other wafer of the wafer lot has the same pattern . turning now to fig4 an example of the method of the invention is now described . when a wafer 10 reaches a stage in manufacture that it is ready to be tested , the method of the invention is started , as shown in block 42 . each die 14 on a wafer 10 is probed for disabling defects ( block 44 ). each defective die is associated with a particular spatial location , for example , defined by x and y coordinates 20 and 22 , respectively , on the wafer 10 . as depicted in block 46 , the defective die 14 a may be notated on a wafer map 50 . a computer ( not shown ) processes the data in digital form . as indicated in block 48 , some or all of the defective die 14 a in a wafer 10 may be in spatial clusters having a similar defect type . one or more reference or pseudo - wafer maps 40 are prepared ( block 54 ) as models to which wafer maps 50 will be compared . each has a pre - determined defect cluster pattern 36 ( see fig5 and 6 ) which is of interest , e . g ., which is known to result from a specific process fault . exemplary pseudo - wafer maps 40 with defined cluster patterns 36 of pseudo - die 38 are shown in fig5 and 6 . [ 0037 ] fig5 illustrates a cluster pattern 36 including a central portion about wafer center 28 of pseudo - map 40 . all defective die 14 in a wafer test which substantially correspond to this area will be considered as this type of defect . fig6 illustrates a cluster pattern 36 including an outer round or ring pattern in the outermost pseudo - die 38 , near the periphery 26 of the pseudo - wafer map 40 . such cluster patterns 36 are commonly associated with specific process operations in ic manufacture . the particular mathematical representation of this type of cluster pattern 36 may also include rings ( not shown ) of a smaller diameter ( i . e ., not in the outermost die 38 ). pseudo - wafer maps 40 are stored ( block 56 ) in a library for use as wafer characterization tools in the present invention . as seen in block 52 of fig4 selected pseudo - wafer maps 40 are combined with the wafer map or maps 50 , as a reference or pseudo - lot . the pseudo - lot of maps 40 and 50 is then subjected in block 58 to a comparison step whereby the pattern ( s ) 30 on wafer map ( s ) 50 and the pattern ( s ) 36 on the pseudo - wafer map ( s ) 50 are cross - compared and sorted according to corresponding or similar cluster patterns which characterize the sorted group . in this sorting step 58 , groups of wafers 10 having corresponding or similar cluster patterns will include single wafers having the sole occurrence of a particular defect . the characterization data for each wafer 10 and die 14 on the wafer is stored ( e . g ., in computer memory ) as shown in block 60 . a wafer report may be generated ( block 62 ). such a report is useful for specifying alterations in the manufacturing process . in addition , if a particular defect cluster 30 appears which has a different shape , etc . the method includes generation of a new pseudo - wafer map 40 in block 64 , for use with future wafer testing . this map 40 may be stored in a pseudo - wafer map library together with other maps 40 in block 56 . it is noted that the steps of fig4 are conducted using software routines , wherein the method is conducted automatically to provide wafer characterization information very quickly . there are various commercial software programs which have comparison - sorting routines which may be used in this invention . for example , certain routines of a mathematical / statistical software program known as s - plus , available from mathsoft inc ., may be combined with s - wafers , a graphical user interface ( gui ) developed by bell laboratories . a series of pseudo - wafer maps 40 may be used which will encompass substantially all defect patterns 30 detected by probing a wafer 10 . for example , such a series may include the following defect patterns : ( 1 ) a rounded failure shape affecting a central portion of the wafer ; ( 2 ) a rounded failure shape affecting the whole periphery of the wafer ; ( 8 ) one vertical failure shape from the upper part of the wafer to the wafer center ; ( 9 ) one vertical failure shape from the lower part of the wafer to the wafer center ; ( 20 ) round shape failure in the left side portion of the wafer ; ( 21 ) round shape failure in the right side portion of the wafer ; and ( 22 ) ad hoc shape to cover a particular failure such as a scratch . each of the above pattern definitions is known to be related to specific types of processing faults . in general , the preferred pattern definition in each pseudo - wafer map 40 is two - fold . that is , it indicates a general shape or type of defect pattern 30 as well as the wafer location in which the pattern appears . a simple example will illustrate the effectiveness of the present invention as compared to prior art methods . assume that a wafer lot includes 25 individual wafers . parametric tests indicate defects which are classified by location ( center , top , bottom , left , or right , for example ): ( a ) 10 wafers have a clear pattern of failing devices in the upper portion of the wafer ; ( c ) 9 wafers do not show any pattern of defects ; and in the method of the present invention , test data including wafer maps from the 25 wafers are grouped with one or more pseudo - maps defining types of defect locations , whether a single die or clustered die . this grouping , i . e . pseudo - lot is processed by software to provide a correlation of all defects of each wafer with at least one pseudo - map . according to a prior art method of analysis , a statistical algorithm is used to detect defect clusters , i . e . defective die which abut each other . the tested wafers are grouped together as a lot and evaluated to find common patterns . where a defective die pattern appears in at least two wafers , the pattern is treated and smoothed to eliminate defects not abutting the other pattern defects . thus , in this example , the patterns ( or lack of patterns ) will be detected , i . e . in the wafers of ( a ), ( b ) and ( c ), above . the single wafer of ( d ) which has a pattern of defects in its left side will not be detected by the algorithm because the pattern occurs only once ( i . e . in only one wafer ). thus , this defect will be deleted from the clustering calculations by a smoothing step . in the present invention , the single wafer having a pattern of left - side defects will be detected by a pseudo - wafer map . as seen in this simple example , the present invention detects and accounts for all defects , both clustered and separate , even if they occur only once in the wafer lot . many modifications and other embodiments of the invention will come to the mind of one skilled in the art having the benefit of the teachings presented in the foregoing descriptions and the associated drawings . therefore , it is to be understood that the invention is not to be limited to the specific embodiments disclosed , and that the modifications and embodiments are intended to be included within the scope of the dependent claims .	7
embodiments of the present invention are directed to a system and method for resampling graphics data of a source image and for providing graphics data generated therefrom for rendering a scaled destination image . certain details are set forth below to provide a sufficient understanding of the invention . however , it will be clear to one skilled in the art that the invention may be practiced without these particular details . in other instances , well - known circuits , control signals , timing protocols , and software operations have not been shown in detail in order to avoid unnecessarily obscuring the invention . fig1 illustrates a computer system 100 in which embodiments of the present invention are implemented . the computer system 100 includes a processor 104 coupled to a host memory 108 through a memory / bus interface 112 . the memory / bus interface 112 is coupled to an expansion bus 116 , such as an industry standard architecture ( isa ) bus or a peripheral component interconnect ( pci ) bus . the computer system 100 also includes one or more input devices 120 , such as a keypad or a mouse , coupled to the processor 104 through the expansion bus 116 and the memory / bus interface 112 . the input devices 120 allow an operator or an electronic device to input data to the computer system 100 . one or more output devices 120 are coupled to the processor 104 to provide output data generated by the processor 104 . the output devices 124 are coupled to the processor 104 through the expansion bus 116 and memory / bus interface 112 . examples of output devices 124 include printers and a sound card driving audio speakers . one or more data storage devices 128 are coupled to the processor 104 through the memory / bus interface 112 and the expansion bus 116 to store data in , or retrieve data from , storage media ( not shown ). examples of storage devices 128 and storage media include fixed disk drives , floppy disk drives , tape cassettes and compact - disc read - only memory drives . the computer system 100 further includes a graphics processing system 132 coupled to the processor 104 through the expansion bus 116 and memory / bus interface 112 . optionally , the graphics processing system 132 may be coupled to the processor 104 and the host memory 108 through other types of architectures . for example , the graphics processing system 132 may be coupled through the memory / bus interface 112 and a high speed bus 136 , such as an accelerated graphics port ( agp ), to provide the graphics processing system 132 with direct memory access ( dma ) to the host memory 108 . that is , the high speed bus 136 and memory bus interface 112 allow the graphics processing system 132 to read and write host memory 108 without the intervention of the processor 104 . thus , data may be transferred to , and from , the host memory 108 at transfer rates much greater than over the expansion bus 116 . a display 140 is coupled to the graphics processing system 132 to display graphics images . the display 140 may be any type of display , such as those commonly used for desktop computers , portable computers , and workstation or server applications , for example , a cathode ray tube ( crt ), a field emission display ( fed ), a liquid crystal display ( lcd ), or the like . fig2 illustrates circuitry included within the graphics processing system 132 for performing various three - dimensional ( 3d ) graphics functions . as shown in fig2 , a bus interface 200 couples the graphics processing system 132 to the expansion bus 116 . in the case where the graphics processing system 132 is coupled to the processor 104 and the host memory 108 through the high speed data bus 136 and the memory / bus interface 112 , the bus interface 200 will include a dma controller ( not shown ) to coordinate transfer of data to and from the host memory 108 and the processor 104 . a graphics processor 204 is coupled to the bus interface 200 and is designed to perform various graphics and video processing functions , such as , but not limited to , generating vertex data and performing vertex transformations for polygon graphics primitives that are used to model 3d objects . the graphics processor 204 is coupled to a triangle engine 208 that includes circuitry for performing various graphics functions , such as clipping , attribute transformations , rendering of graphics primitives , and generating texture coordinates for a texture map . a pixel engine 212 is coupled to receive the graphics data generated by the triangle engine 208 . the pixel engine 212 contains circuitry for performing various graphics functions , such as , but not limited to , texture application or mapping , bilinear filtering , fog , blending , and color space conversion . a memory controller 216 coupled to the pixel engine 212 and the graphics processor 204 handles memory requests to and from an local memory 220 . the local memory 220 stores graphics data , such as source pixel color values and destination pixel color values . a display controller 224 is coupled to the memory controller 216 to receive processed destination color values for pixels that are to be rendered . coupled to the display controller 224 is a resampling circuit 228 that facilitates resizing or resampling graphics images . as will be explained below , embodiments of the resampling circuit 228 perform approximations that simplify the calculation of a model between two sample points for use during resampling . the output color values from the resampling circuit 228 are subsequently provided to a display driver 232 that includes circuitry to provide digital color signals , or convert digital color signals to red , green , and blue analog color signals , to drive the display 140 ( fig1 ). although the resampling circuit 228 is illustrated as being a separate circuit , it will be appreciated that the resampling circuit 228 may also be included in one of the aforementioned circuit blocks of the graphics processing system 132 . for example , the resampling circuit 228 may be included in the graphics processor 204 or the display controller 224 . in other embodiments , the resampling circuit 228 may be included in the display 140 ( fig1 ). therefore , the particular location of the resampling circuit 228 is a detail that may be modified without deviating from the subject matter of the invention , and should not be used in limiting the scope of the present invention . fig3 illustrates a resampling circuit 300 that may be substituted for the resampling circuit 228 shown in fig2 . the resampling circuit 300 includes an x - axis resampling circuit 302 and a y - axis resampling circuit 304 coupled in series to perform axis separable resampling . connected to the input of the x - axis resampling circuit is a source data memory in which image data to be resampled is stored . coupled to the output of the y - axis resampling circuit 304 is a destination data memory 306 into which the resampled data is temporarily stored prior to writing the resulting data to a display memory ( not shown ) or the like . the input and output memory may be the same . as will be discussed in more detail below , the resampling circuit 300 resamples graphics data or sample values of the pixels of a source image and generates graphics data for rendering a destination image . the resampling circuit 300 samples the graphics data by scanning in “ columns ” of graphics data . that is , graphics data for pixels of the source image are sampled in a first direction , typically along a row , for a span of pixels . when the end of the span is reached , the graphics data for the next row is then sampled from the beginning of the length of the span . as a result , the source image is separated into columns of sampled graphics data having widths equal to the span of pixels . scanning in this columnar fashion continues until the graphics data of the source image are completely read . as will be discussed in more detail below , the length of a span is related to the length of buffers in the y - axis resampling circuit 304 . while the graphics data are read , the resampling circuit 300 calculates graphics data for a destination image in accordance with a resampling or scaling ratio . the resampled graphics data for the destination image are typically calculated from an interpolation model that is generated from the pixel sample values of the source image . consequently , graphics data for multiple pixels are used simultaneously for the model generation and sample value interpolation . the amount of graphics data generated by the resampling process depends on the scaling or resizing ratio . for example , if the source image is to be scaled to twice its size , while maintaining its aspect ratio ( i . e ., 2 × along each axis ), the resampling circuit 300 will then generate approximately four - times as much graphics data as that used to represent the source image . as previously discussed , because of the quantity of graphics data that must be generated for rescaling a source image , conventional resampling circuits may have limited scaling capabilities . however , as will be discussed in greater detail below , the resampling circuit 300 is capable of resampling at a variety of scaling or resizing ratios . the resampling circuit 300 can also perform resampling operations for large scaling ratios by performing consecutive resampling operations until the graphics data for the scaling ratio is achieved . for example , if a source image is to be scaled by 5 : 1 ratio , the resampling operation can be performed by first performing a 1 . 25 : 1 resampling operation , followed by a 4 : 1 resampling operation on the graphics data from the initial resampling operation . this flexibility is possible if the source and destination memories are the same physical memory . the memory should be able to service the input / output data bandwidth required for all passes . the resulting graphics data is used for the 5 : 1 destination image . in performing consecutive resampling operations , the resampling operation for the lower scaling ratio should be performed initially because the amount of graphics data resampled in a subsequent resampling operation is reduced , and consequently , will yield a more efficient overall resampling process . it will be appreciated that multiple consecutive resampling operations can be performed to yield very large scaling ratios . for example , scaling a source image by a 100 : 1 ratio can be performed by first by a 100 : 64 resampling operation , followed by three consecutive 4 : 1 resampling operations . it will be appreciated that the sample values for the samples may consist of several different components . for example , the sample value may represent pixel colors which are the combination of red , green , and blue color components . another example includes sample values representing pixel colors which are the combination of luma and chroma components . consequently , because it is well understood in the art , although circuitry to perform graphics operation for each of the components is not expressly shown or described herein , embodiments of the present invention include circuitry , control signals , and the like necessary to perform resampling operations on each component for multi - component sample values . moreover , it will be appreciated that embodiments of the present invention further include the circuitry , control signals , and the like necessary to perform axis separable resampling operations for graphics data represented in multiple axes . implementation of axis separable resampling is well understood in the art , and a more detailed description of such has been omitted from herein to avoid unnecessarily obscuring the present invention . fig4 illustrates an x - axis resampling circuit 400 according to an embodiment of the present invention . graphics data of the pixels of the source image are provided to the x - axis resampling circuit 400 and through a series of x - sample buffers 402 - 408 coupled in series . each of the x - sample buffers 402 - 408 is of sufficient width to accommodate the graphics data for one pixel . the x - sample buffers 402 - 408 may be implemented using conventional data buffer circuits and techniques , such as using static random access memory ( sram ) devices , conventional shift registers , or the like . an x - interpolation circuit 416 is coupled to the input of the first x - sample buffer 402 and the output of the x - sample buffers 402 - 408 . graphics data is sampled by the x - interpolation circuit 416 and used to generate a model from which resampled graphics data along the x - axis for the destination image are calculated . since the x - sample buffers 402 - 408 are all of the same length , the graphics data for five pixels ( i . e ., x − 2 , x − 1 , x 0 , x 1 , and x 2 ) along a row of the source image are synchronized for sampling by the x - interpolation circuit 416 . thus , as the graphics data is shifted through the pipeline of x - sample buffers 402 - 408 , a resampling algorithm can be performed to calculate resampled graphics data along the x - axis for a destination image from the multiple sample values provided at the input of the first x - sample buffer 402 and the output of each of the x - sample buffers 402 - 408 . in operation , the x - interpolation circuit 416 samples the graphics data along a row of pixels for a span of pixels and then returns to the beginning of the span on the next row to begin sampling again . thus , only a portion of each row of pixels is sampled before sampling from the adjacent row . as will be explained in more detail below , the length of the span , or how many pixels are sampled before sampling begins at the next row , is a function of the scaling ratio and buffer length of the y - axis resampling circuit 304 ( fig3 ). as mentioned previously , the result is that the pixels of the source image are divided into columns of pixels , each column having a width equal to the span of pixels . it will be appreciated that various well known algorithms can be used by the x - interpolation circuit 416 to generate graphics data for a destination image . for example , a cubic model can be used to generate a model between two sample points from which resampled graphics data may be interpolated . one such method is described in greater detail in co - pending u . s . patent application ser . no . 09 / 760 , 173 , entitled pixel resampling system and method to slavin , filed jan . 12 , 2001 , which is incorporated herein by reference . in summary , the aforementioned patent application describes using a cubic model from which resampled graphics data can be calculated . the coefficients for the solution of the cubic model between two adjacent sample pixels are calculated by using the color values of the adjacent sample pixels and an estimated gradient value co - sited with the two sample pixels . although the aforementioned algorithm may be used in embodiments of the present invention , it will be appreciated that other algorithms , now known or later developed , may also be used , and consequently , the scope of the present invention should not be limited by the particular interpolation algorithm applied by the x - interpolation circuit 416 , except to the extent recited in the claims attached hereto . it will be further appreciated that the number of samples used for the calculation of the destination graphics data will depend on several factors , one of which is the particular algorithm used for the interpolation model . although fig4 illustrates using five samples from the source image , greater or fewer samples may be used as well . additionally , the interpolation circuits may use different algorithms for different types of graphics data , for example , a first algorithm for graphics data representing text and a second algorithm for graphics data representing video . consequently , the particular number of samples provided to an interpolation circuit , or the number actually used can be modified without deviating from the scope of the present invention . following the resampling operation , the sample values of the source image , as well as the sample values calculated therefrom are provided by the x - interpolation circuit 416 to the y - axis resampling circuit 304 ( fig3 ). as previously discussed , the quantity of graphics data generated by the x - resampling circuit 400 will be dependent on the resampling or scaling ratio . in an axis separable resampling circuit , such as that described herein , the quantity of data is increased or decreased for each axis according to the resampling ratio along the particular axis . thus , as previously mentioned , if a source image is to be doubled ( i . e ., the scaling ratio is 2 ×) along both axes , the x - resampling circuit 400 will provide approximately twice as much graphics data along the x - axis as in the source image . the quantity of graphics data along the y - axis ( i . e ., the number of lines ) is not affected by the x - axis resampling . fig5 illustrates a y - axis resampling circuit 500 according to an embodiment of the present invention . graphics data for pixels of the source image , as well as graphics data calculated for the destination image are provided from a x - axis resampling circuit 302 to the y - resampling circuit 500 . the data is shifted through a pipeline of y - sample buffers 502 - 508 coupled in series . a y - interpolation circuit 520 is coupled to the output of the of x - axis resampling circuit 302 and to the output of each of the y - sample buffers 502 - 508 to sample the graphics data . graphics data is sampled by the y - interpolation circuit 520 and used to calculate graphics data for the destination image . since the y - sample buffers 502 - 508 are all of the same length , the graphics data sampled by the y - interpolation circuit 520 at a given moment are vertically aligned such that interpolation along the y - axis of the source image can be performed in a synchronized manner . moreover , the vertical alignment of the graphics data is maintained as new graphics data provided by the x - axis resampling circuit 302 is shifted into the first y - sample buffer 502 . following calculation of the graphics data for the destination image , y - interpolation circuit 520 provides the data to a destination buffer 530 which temporarily stores the graphics data prior to being written to a display memory ( not shown ). as shown in fig5 , the length of the y - sample buffers 502 - 508 are 128 - bytes wide , however , this value has been selected by way of providing an example , and should not be interpreted as limiting the scope of the present invention . the length of the y - sample buffers generally have a length that is less than the width ( x_max ) of the source image . however , although data buffers of different lengths may be selected for the y - sample buffers 502 - 508 , choosing a length that will take advantage of the access speed of the display memory to which destination data is written is desired . as mentioned previously , the effect is that the graphics data of the source image is resampled in “ columns ” of data . the widths of the columns , or the span , of data will be a function of the desired scaling ratio and the width of the y - sample buffers 502 - 508 . a larger scaling ratio along the x - axis will result in relatively narrower columns because the sum of the graphics data that generated from the x - axis resampling operation and the graphics data of the source image for one row of the source image must fit within the length of a y - sample buffer . in this manner , synchronized sampling by the y - interpolation circuit 520 can be maintained . thus , the span of the columns selected by the x - axis resampling circuit 302 ( fig3 ) is such that the sum of the sample values of the span and the resampled graphics data generated for the length of the span will occupy the length of one of the y - sample buffers of the y - axis resampling circuit 500 . the use of smaller y - sample buffers , and consequently shorter span lengths , also allows large source images to be resampled by breaking the original source image into smaller manageable columns of graphics data . limitations on scaling ratios or source image size are overcome by this approach since the resampling operation is performed for both the x - and y - directions on subsets of the graphics data of a source image rather than performing a resampling operation on the entire source image along one axis before resampling along the other axis , or performing resampling for the entire length of multiple rows of the source image before resampling along the other axis . in operation , the y - interpolation circuit 520 samples the graphics data for five pixels of the source image . the five samples are taken from the source graphics data and calculated graphics data that are provided to a y - resampling circuit 500 from the x - axis resampling circuit 302 . the graphics data is received into the pipeline of y - sample buffers 502 - 508 of the y - resampling circuit 500 , and shifted through the y - sample buffers 502 - 508 such that the y - interpolation circuit 520 uses the sample values to calculate the graphics data for the destination image . the resulting destination graphics data is then provided to a destination buffer 530 and stored temporarily before being written to a memory ( not shown ). the graphics data is provided to the destination buffer 530 in a “ vertical ” orientation and then subsequently rewritten to the memory in a “ horizontal ” orientation for display . it will be appreciated that in resampling the entire source image , the graphics data for the pixels along the edges of the columns will “ overlap ” in order for the resampling circuit 300 to have a sufficient number of samples when calculating resampled graphics data at the interface between adjacent columns of graphics data . the amount of overlap will depend on the interpolation model used by the y - interpolation circuit and the number of samples required to create the model . if the number of samples from a source column are too small , the extra work and memory access to load and process data twice ( from input data overlaps near the column boundaries ) may dominate , so the y - pipeline buffers should not be too short , nor should the x - upsampling ratio be too large . from the foregoing it will be appreciated that , although specific embodiments of the invention have been described herein for purposes of illustration , various modifications may be made without deviating from the spirit and scope of the invention . accordingly , the invention is not limited except as by the appended claims .	6
referring now to the drawings , illustrated generally at 10 in fig1 is one embodiment of the resistance measuring apparatus . included therein is a light source 12 which emits a beam of light 14 . the beam passes through an electrooptic material 16 and is ultimately received by a photodetector 18 . a terminal 19 in the photodetector provides a point for measuring the photocurrent output of the photodetector , such being proportional to the amount of light shining on photodetector 18 . a first pair of plates 20 , 22 are electrically connected ( via wires 24 , 26 , respectively ) to a second pair of plates 28 , 30 . a sample 32 , the resistance of which is to be determined , is contained between the second pair of plates . material 16 is what is known as an electrooptic material , in the instant embodment of the invention being a linbo 3 crystal . such materials have very high electrical resistivities at room temperature and in addition , a property of light transmitted therethrough varies as a function of the electric field in which the material lies . with respect to the linbo 3 crystal , the property so varied is the polarization state of the light . light source 12 in the embodiment of fig1 is a he - ne laser having power rating of approximately 1 - milliwatt . it is to be appreciated that monochromatic light is not required for successful operation of the invention . filtered incoherent light also could be used as source 12 . light beam 14 passes through a conventional linear polarizer 34 . the linearly polarized light emitted from polarizer 34 then passes through a conventional quarter - wave plate 36 . light emerging from plate 36 has been converted to circular polarization . the light then passes through material 16 . light emerging from the crystal passes through a conventional linear polarization analyzer 38 and is received by conventional photodetector 18 . the photodetector and filters 38 are referred to herein collectively as a light detector . a voltage source ( not shown in fig1 ) is illustrated schematically in fig3 at 38 . included within source 38 is a 250 - volt d . c . power supply 40 attached to a charging rod 42 . when a measurement is to be made , rod 42 is brushed against either plate 20 or plate 28 to create potential difference between plates 20 , 28 and plates 22 , 30 . when the rod is removed , the charge so created discharges through material 16 and through sample 32 . for a proper selection of the voltage value of power supply 40 and of the size of material 16 , there is a linear relationship between the intensity of the light emerging from analyzer 38 ( and detected by photodetector 18 ) and the value of voltage appearing across plates 20 , 22 . it is to be appreciated that one skilled in the art could make such a selection of crystal size and voltage values . in operating the embodiment of fig1 light source 12 is first activated . of course , in the absence of an electric field , a constant quantum of light emerges , at a uniform rate , from analyzer 38 and is detected by detector 18 . accordingly , a constant photocurrent appears at terminal 19 of the photodetector . the measurement is begun by briefly contacting charging rod 42 with either plate 20 or plate 28 in order to apply a 250 - volt charge between plates 20 , 28 and plates 22 , 30 . in the presence of the 250 - volt field , the crystal alters the polarization state of light passing therethrough . in the instant embodiment of the invention , the signal at terminal 19 sharply rises at the moment that the rod is applied to charge the plates . for so long as the rod is held against the plates , this high photocurrent output is maintained at terminal 19 . when the rod is removed , discharge occurs through material 16 and sample 32 thus causing the photocurrent at terminal 19 to gradually decrease as the material alters the polarization state of the light responsive to the decaying electric field . turning to fig5 the graph represents a plot of the photocurrent appearing at terminal 19 of the photodetector as it varies with respect to time during an exemplary resistance measurement of sample 32 . the vertical scale of the plot has been divided into arbitrary units which represent variation in photocurrent appearing at terminal 19 of the photodetector . the horizontal scale is divided into seconds . indicated generally at 44 is the steady state photocurrent level prior to application of an electric field with rod 42 as described above . a vertical portion 46 of the graph indicates the point at which the rod is first applied . at that point , the photocurrent output rises due to the increase in light intensity and maintains a constant high level , indicated generally at 48 , until the point 50 at which the rod is removed . when the rod is removed , the photocurrent decays as shown due to the discharge of the field through material 16 and sample 32 . when the capacitance c of the crystal - sample combination is known , the resistance r of the combination may be determined by the well - known equation as follows : r = dt / c 1n ( v 1 / v 2 ) where dt is the time in which the voltage across the crystal decays from a value of v 1 to a value of v 2 and c is the capacitance of the crystal - sample combination . using the chart of fig5 where v 1 is represented by the value of the photocurrent at 50 and v 2 is represented by its value at 52 , dt is thus a value of 30 - seconds . where the system capacitance is approximately 20 pf , the value of r is computed as 1 . 5 × 10 12 ohms . the value c is determined by conventional high frequency impedance or resonance methods . in the system of fig1 and 3 , the resistance of material 16 must be known in order to compute the resistance of sample 32 . additionally , when sample 32 approaches extremely high resistances ( higher than that of material 16 ) the measurements are somewhat less accurate . turning to fig2 a second embodiment of the invention being illustrated , an amplifier 52 is included therein . the amplifier has an input terminal 54 , an output terminal 56 , and a reference terminal 58 . other parts of the embodiment of fig2 which correspond to similar parts in the embodiments of fig1 and 3 have been numbered the same as those previously - described parts . it is to be appreciated that in the schematics of fig2 to 4 , the light source , photodetector and associated polarizers and analyzer are not illustrated ( to increase clarity ); however , they are arranged for each of the embodiments as illustrated in fig1 . as shown in fig2 the output terminal of the amplifier is connected to plate 22 , the input terminal of the amplifier is connected to terminal 19 on the photodetector ( not illustrated in fig2 ) while the reference terminal of the amplifier is in common with plate 30 and with one side of power supply 40 . in operation of the embodiment of fig2 when rod 42 is applied to plates 20 , 28 , the potential difference between plates 20 , 22 is returned to zero by feedback of the photocurrent signal on terminal 19 via amplifier 54 to plate 22 . when rod 42 is removed from plate 20 , the decay in the photocurrent drives the amplifier so that during discharge , there is substantially zero potential difference between plates 20 , 22 . thus , all the discharge occurs through sample 32 . in the embodiment of fig2 output terminal 56 of the amplifier serves as the measurement point . a voltage curve , like that illustrated in fig5 is generated at terminal 56 . since substantially all of the discharge occurs through the sample , the resistance of material 16 need not be known to calculate the resistance of the sample . additionally , the embodiment of fig2 is more sensitive with respect to samples having higher resistances than material 16 since substantially all of the discharge occurs through the sample regardless of the resistance of material 16 . in the embodiment of fig4 an a . c . voltage generator 60 is used in voltage source 38 . a capacitive link 62 is used to couple one side of the alternating voltage generator to an upper plate 63 beneath which is material 16 and sample 32 . a lower plate 64 completes the circuit to the other side of generator 60 . thus , in operation , the alternating charge is coupled across both the material and the sample thus creating an alternating photocurrent output on terminal 19 of the photodetector . when the capacitance of coupling 62 and the combined crystal - sample capacitance are each known , the crystal - sample combined resistance can be determined by conventional calculations based upon comparison of the phase shift between source 60 and the photocurrent appearing on terminal 19 of the photodetector . as has been previously mentioned , the capacitances of coupling 62 and of combined crystal - sample capacitance may be determined by conventional high frequency impedance or resonance methods . in yet another embodiment of the invention ( not illustrated ) plate 64 is separated into a pair of conducting plates , one for material 16 and one for sample 32 . an amplifier , like amplifier 52 in the embodiment of fig2 is then used to maintain zero potential across material 16 so that all of the current flows through sample 32 . this embodiment provides the same advantages as that of fig2 with an a . c . voltage source . the sample , the resistance of which is being measured , could consist of air . such an application of the invention could be used for monitoring humidity or ionization of air . while a preferred embodiment of the invention has been described , it is appreciated that variations and modifications may be made without departing from the spirit of the invention .	6
with continued reference to the drawing figures and particularly fig1 - 3 , the stabilization pontoon assembly 20 of the present invention is shown as being mounted between the sidewalls 21 and 22 of a canoe 24 having a bow 25 and a stern portion 26 . for purposes of further example , the canoe may include one or more seats 27 utilized specifically for fishing and may also incorporate one or more trolling motors such as shown at 28 and 29 which are mounted to one of the sidewalls and the stern wall of the canoe . the stabilization assembly is particular beneficial for stabilizing the canoe in the event a person seated on the seat 27 is fishing and must shift his or her weight . the assembly will ensure that the canoe remains stable regardless of movement of the individual and will also provide stability in the event they are waves developed by naturally occurring winds or by passing motor craft . although the present invention is shown as being used with a canoe , the stabilization assembly may be used with other types of small watercraft . the stabilization pontoon assembly 20 includes a housing 30 which is shown in fig1 as having a rear wall 31 , front wall 32 , and opposite generally arcuate sidewalls 33 and 34 . the upper portion of the housing is closed by a lid 36 which functions as an additional seat or for a work surface when the assembly is installed within the canoe . the lid 36 is connected by a hinge assembly 37 to the rear wall 31 of the housing . it should be noted that , in some embodiments , the housing may exclude the sidewalls 33 and 34 under which circumstances the sidewalls of the canoe will function as the end closures for defining the internal compartments of the housing , as will be described in greater detail hereinafter . although not shown in the drawing figures , a gasket or seal may be provided along the interior surface of the lid 36 so as to ensure that the interior of the housing is substantially water tight when the lid is closed . the housing may also include a bottom wall 38 as shown in drawing fig5 and 6 . in the preferred embodiment of fig1 the housing is easily secured by fasteners , not shown , to the gunwale on opposite sides of the canoe . with particular reference to fig4 the interior of the housing 30 , in the preferred embodiment , is divided into two compartments 40 and 42 by an interior wall 43 . in some embodiments , the compartments 40 and 42 may be combined . the compartment 40 is designed to be adapted to allow one or more batteries 44 and 45 to be mounted therein and electrically connected through appropriate cables to a control panel assembly 46 associated with the stabilizer assembly , as shown in fig1 . the compartment 40 is designed to protect the batteries from becoming wet when in use . it is preferred that at least two batteries be provided so that one of the batteries may be utilized as an auxiliary source of power in the case of an emergency . the mechanics for controlling the stabilizer assembly of the present invention are generally housed within the compartment 42 . the stabilizer assembly includes a pair of outrigger arms 48 and 50 which are connected at their inner end portions , as shown at 51 and 52 , respectively , to a pair of pivot shafts 53 and 54 which are supported within opposing bearing assemblies 55 and 56 and 57 and 58 , respectively . the outer ends of each of the pivot shafts 53 and 54 extend through the rear wall 31 of the housing to the points of connection 51 and 52 with the outrigger arms 48 and 50 . in some embodiments , it is envisioned that the pivot shafts 53 and 54 may be integrally formed with the outrigger arms 48 and 50 . support brackets or rods 60 and 61 are attached to or formed with the outrigger arms 48 and 50 are designed to extend generally laterally away and downwardly at an angle from the outer portions of the outrigger arms 48 and 50 , as shown in drawing fig4 . the brackets 60 and 61 are secured to the upper surface of a pair of floats or pontoons 62 and 63 . the pontoons may take various configurations and be formed of a variety of materials . by way of example , each pontoon may be formed of a closed aluminum cylinder or of an aluminum body having a rounded base portion and a generally flat upper portion . the interior of the pontoon may be hollow . as opposed to using aluminum bodies , it is possible that a closed cell foam material may be utilized for the pontoons . in the preferred embodiment , at least the forward or nose portion of each pontoon includes an upwardly tapered portion . with specific reference to fig1 and 5 , the configuration of the outrigger arms 48 and 50 is such that they are somewhat arcuate in configuration . other configurations may be utilized so long as the shape permits the outriggers to extend upwardly from the housing 30 and over the sidewalls 21 and 22 of the canoe and then downwardly to the pontoons 62 and 63 . with specific reference to fig7 in the embodiment shown in fig1 - 5 , the pontoons 62 and 63 are fixedly mounted to the brackets 60 and 61 extending from the outrigger arms 48 and 50 . when in a fixed configuration , it is preferred that each pontoon are pitched vertically upward relative to a horizontal axis at approximately 5 ° as is shown in drawing fig7 . this will assist in the maneuverability of the canoe in the event power is applied through one of the motors 28 and 29 when the pontoons are in a fully deployed position as shown in drawing fig7 . one of the further advantages of the present invention are embodiments shown in fig8 - 11 . in these embodiments , each pontoon is designed to be mounted so as to have an adjustable pitch angle with respect to the outrigger arms 48 and 50 . in this embodiment , the pontoon connecting rods or brackets , such as shown in fig8 at 61 &# 39 ;, include a bracket assembly 65 having a plurality of openings 66 formed therein in arcuate relationship with respect to one another . the pontoon exemplified in fig8 at 63 is connected to the outrigger arm 50 by a pivot connection 68 which includes a u - shaped yoke member 69 welded or otherwise secured to the end portion of the outrigger arm 50 . the yoke member 69 includes a pair of aligned openings therein through which a locking pin 70 may be selectively extended after passing through one of the openings 66 in the bracket 65 , as shown in fig9 . in this manner , the pitch angle &# 34 ; x &# 34 ; may be varied depending upon the desired planing action to be developed by the pontoons 62 and 63 when in use . to automatically adjust the pitch angle &# 34 ; x &# 34 ; of the pontoons relative to the surface of the water , without requiring manual adjustment , a separate small electric motor , such as shown in fig1 at 72 , may be mounted to each of the u - shaped brackets 69 and electrically connected to a source of power , such as one of the batteries 44 and 45 . each electric motor 72 includes an output shaft 73 having a cogwheel 74 mounted thereto which is enagageable with spaced teeth 75 provided along the outer surface of a reconfigured bracket 76 connected to the pontoon support member or bracket 61 &# 34 ;. the u - shaped bracket 69 is pivotally connected at 77 to the base portion of the bracket 76 . by operation of the motor 72 , the cogwheel 74 will automatically rotate the pontoon bracket 61 &# 34 ; by engagement with the teeth 75 of the bracket 76 to a desired pitch angle . in this manner , the operator may control the pitch angle without having to shift his or her weight in the boat by simply using the appropriate control switches for adjusting the pitch angle , as will be described in greater detail hereinafter . with particular reference to fig4 - 6 , the drive assembly for operatively elevating or deploying the pontoons 62 and 63 will be described in greater detail . each pivot shaft 53 and 54 includes a crank arm 80 and 81 , respectively , which is fixedly secured thereto and extends outwardly therefrom . a central pivot shaft 82 is mounted intermediate and parallel to the pivot shafts 53 and 54 and is supported by bearing assemblies 83 and 84 mounted to the intermediate wall 43 and rear wall 31 of the housing , respectively . a double crank arm 85 is fixedly secured to the pivot shaft 82 and includes opposite end portions which are pivotally connected at 86 and 87 to generally u - shaped yoke members 88 and 89 , respectively , at one end of a pair of link members 90 and 91 . the opposite end of each of the link members 90 and 91 includes another u - shaped yoke member 92 and 93 , respectively , which are pivotally connected at 94 and 95 to the outer ends of each of the crank arms 80 and 81 , respectively . in order to raise the outrigger arms 48 and 50 from the full line position shown in fig6 to the dotted line position shown therein to move the pontoons from a deployed to a raised position , an activation cylinder 100 is provided having an extendable rod 102 associated therewith . in the present embodiment , the cylinder 100 includes an electrically operated extension rod which is driven by a motor 104 having a drive cogwheel 105 associated therewith . the cogwheel drives cooperating teeth ( not shown ) associated with the extension rod 102 . the cylinder 100 and motor 104 are mounted to bracket members within the component chamber 42 . upon activation of the motor 104 , the extension rod 102 may be extended from the position shown in fig6 thus withdrawing the piston rod toward the cylinder 100 . this action causes the double crank arm 85 to pivot with the pivot shaft 82 counterclockwise , as shown by the arrow in the drawing figure . this action pushes the link members outwardly thus pivoting the outrigger arms 48 and 50 upwardly as shown in dotted line in the drawing figure . by reversing the direction of the drive motor 104 , the outrigger arms 48 and 50 may be lowered thus redeploying the pontoons 62 and 63 relative to the sidewalls of the canoe . the motor may be stopped at substantially any position thus regulating the effective vertical displacement of the pontoons and relative to the sidewalls of the canoe . appropriate limit switches are associated with the control circuitry to prevent outrigger arms 48 and 50 from engaging and otherwise damaging the upper edge portion of the sidewalls of the canoe when the stabilizer assembly of the present invention is in use and for further limiting the upward angle of the pontoons when the pontoons are elevated with respect to the sidewalls of the canoe , as shown in dotted line in fig5 . with specific reference to fig1 and 13 , the control circuitry of the present invention will be described in greater detail . the control panel shown in fig1 discloses an &# 34 ; on / off &# 34 ; switch 110 for providing power to an electrical circuit which may be utilized to supply electrical energy from the batteries 44 and 45 to the trolling motors shown at 28 and 29 and to the motor 104 associated with the outrigger control cylinder 100 . the amount of voltage of the batteries may be displayed on an appropriate gauge 112 . a choice of battery for purposes of supplying power is possible through a selector switch 114 . appropriate control buttons 116 and 117 are provided for activating the motor 104 for purposes of raising and lowering the outrigger arms . a separate selector switch 118 is provided to control the motors 72 associated with the pitch adjustment assemblies connecting the outrigger arms to each of the pontoons , as shown in fig1 and 11 . by setting the appropriate degree angle on the control panel , such as between 0 °- 10 °, the pontoon pitch will be changed accordingly . auxiliary switches 120 and 121 are provided for allowing the batte ries 44 and 45 to be connected to a bilge pump or to an auxiliary electrical device , such as a depth gauge or a light assembly utilized with the watercraft . also supplied on the control panel are a pair of electrical outlets 123 and 124 which may be utilized to connect the supply power to an exterior motor , such as trolling motors 28 or 29 . in the preferred embodiment , a further electrical receptacle 125 is provided through the rear wall of the housing for facilitating the connection of a trolling motor attached to the canoe in close proximity to the rear wall of the housing . fig1 is a simplified electrical schematic diagram showing the relative connections between the batteries 44 and 45 and the forward and rear trolling motors 28 and 29 , the cylinder adjustment motor 104 for controlling the vertical positioning of the pontoons 62 and 63 and the switch 118 for controlling the pitch angle motor 72 associated with each outrigger arm 48 and 50 . in use , the stabilizer assembly 20 of the present invention may easily be mounted between the sidewalls of a canoe and may be adapted for other small watercraft . once installed , batteries such as 44 and 45 may be easily connected to the switches associated therewith . with the batteries installed , and by activating the &# 34 ; on / off &# 34 ; switch 110 and the outrigger control arm switches 116 and 117 , it is possible to raise and lower the outrigger arms and adjust the pontoons 62 and 63 , respectively as required . normally , when it is desired to provide maximum stabilization , the pontoons are lowered into engagement with the water as is shown in fig3 and in full line in fig5 . to allow maneuverability and increased speed , the pontoons may be easily raised by activating the switch 116 to raise the outrigger arms and thus the pontoons to the dotted line position shown in fig5 . to further adjust the planing angle of the bow of the boat through the water , the pitch angle of each of the pontoons may likewise be varied . by activation of the control switch 118 , the motors 72 may be utilized to adjust the pitch angle of the pontoons between 0 °- 10 ° or more from the horizontal . in the mechanical embodiment , the pontoons may be preadjusted before the canoe is placed into use utilizing the embodiment shown in fig8 and 9 . as shown in fig1 , appropriate hand or foot switches 130 and 132 may also be connected to control operation of the motors 28 and 29 . the foregoing description of the preferred embodiment of the invention has been presented to illustrate the principles of the invention and not to limit the invention to the particular embodiment illustrated . it is intended that the scope of the invention be defined by all of the embodiments encompassed within the following claims and their equivalents .	1
preferred embodiments of the invention will now be described with reference to the accompanying drawings . [ 0022 ] fig1 is a schematic block diagram of a computer practiced as a first embodiment of the invention . fig2 is a schematic view of a switch included in bus switching controller of the first embodiment . in the first embodiment , the computer 1 may illustratively be a workstation having a network function . the computer 1 includes four processors cpu 2 through cpu 2 c . the cpus are connected to an smp bus b 1 dedicated to processor use . the computer 1 further includes a memory controller 3 for controlling a main memory of the computer . the memory controller 3 is also connected to the smp bus b 1 . in addition , the computer 1 has two pci buses ( i / o buses ) b 2 and b 3 as well as smp - pci bridges 4 and 5 . bridges 4 and 5 carry out signal conversion between the smp bus b 1 and the pci buses b 2 and b 3 respectively to ensure logical consistency therebetween . the pci bus b 2 is connected to the smp bus b 1 via the smp - pci bridge 4 . the pci bus b 3 is connected to the smp bus b 1 through the smp - pci bridge 5 . the computer 1 has pci slots sl 1 through sl 3 and sl 5 through sl 7 to accommodate i / o devices including peripherals . the pci slots sl 1 through sl 3 are connected to the pci bus b 2 , and the pci slots sl 5 through sl 7 are connected to the pci bus b 3 . furthermore , the computer 1 has switches sw 1 and sw 2 ( making up a switching unit ). the pci slot ( i / o slot ) sl 4 is connected to either the pci bus b 2 or b 3 via the switch sw 1 or sw 2 . as shown in fig2 the switches sw 1 and sw 2 are each a complementary metal oxide semiconductor ( cmos ) analog switch that consists only of a transistor t 1 ( p - channel mos transistor ), a transistor t 2 ( n - channel mos transistor ) and an inverter iva , i . e ., an electronic circuit to invert the signal input to the transistor t 1 . the switching unit of this construction reduces significantly leak currents and on - state resistance . the computer 1 also includes an eisa bus b 4 and a pci - eisa bridge 6 that performs signal conversion between the eisa bus b 4 and the pci bus b 2 to ensure logical consistency therebetween . the eisa bus b 4 is connected to the computer 1 through the pci - eisa bridge 6 . the computer 1 has eisa slots esl 1 through esl 3 to accommodate i / o devices such as peripherals . the eisa slots esl 1 through esl 3 are connected to the eisa bus b 4 . the computer 1 further includes a signal generator ( switching controller ) 7 that generates signals to turn on and off the conductive state of each of the switches sw 1 and sw 2 in accordance with a predetermined signal input to the input terminal of each of the switches . the signal generator 7 is illustratively made up of a switch s 1 ( mechanical switching apparatus ), a resistor r for limiting currents , and an inverter iv . one connecting terminal of the resistor r is connected to a power supply . one connecting terminal of the switch s 1 is connected to ground potential . the other connecting terminal of the switch s 1 is connected to the other connecting terminal of the resistor r , to the input terminal of the inverter iv , and to the input terminal of the switch sw 1 . the output terminal of the inverter iv is connected to the input terminal of the switch sw 2 . the switch s 1 , resistor r and inverter iv constitute the signal generator 7 . the signal generator 7 serves as bus switching controller 8 . the switches sw 1 and sw 2 as well as the bus switching controlling means 8 make up a bus switching apparatus . when the settings of the computer 1 are finished , an operator of the computer carries out benchmark tests to examine the computer performance in two cases : first when the pci slot sl 4 is connected to the pci bus b 2 , and second when the pci slot sl 4 is connected to the pci bus b 3 . described below is how to effect the different connections of the pci slot sl 4 : ( 1 ) when the pci slot sl 4 is to be connected to the pci bus b 2 , the operator opens the switch s 1 . this causes a high - level signal to be input to the switch sw 1 through the resistor r and a low - level signal inverted by the inverter iv to enter the switch sw 2 . the switch sw 1 is turned on when supplied with the high - level signal , and the switch sw 2 is turned off when supplied with the low - level signal . the switch settings connect the pci slot sl 4 to the pci bus b 2 . ( 2 ) when the pci slot sl 4 is connected to the pci bus b 3 , the operator closes the switch s 1 . this connects one connecting terminal of the resistor r to ground potential , thereby inputting the low - level signal to the switch sw 1 . the high - level signal is input to the switch sw 2 through the inverter iv . the switch sw 1 is turned off based on the low - level signal and the switch sw 2 is turned on based on the high - level signal . the switch settings connect the pci slot sl 4 to the pci bus b 3 . after benchmark tests to determine the balancing of the loads on the buses have been carried out in each of the above two cases , the operator compares the results and opts for the setup whose test results are the better of the two cases . for example , if the benchmark tests have yielded the better results when the pci slot sl 4 is connected to the pci bus b 2 , then the switch s 1 is placed in the nonconductive state . if the benchmark test results have been the better when the pci slot sl 4 is connected to the pci bus b 3 , the switch s 1 is put in the conductive state . in the manner described , the switch s 1 need only be put in the conductive or nonconductive state in order to switch connection of the pci slot sl 4 to one of the pci buses b 2 and b 3 easily and in a short time . this allows the computer 1 to be used in an optimum working state . because it is not necessary to perform such work as disassembling of the computer enclosure and cable connection rearrangements , there is no possibility of the computer 1 being disabled or its parts being destroyed by operator blunders or foul - ups . an operator with no specialized knowledge of hardware may set up the connection of the pci slot sl 4 in an optimum state easily and in a short time . with the first embodiment , the signal generator 7 ( fig1 ) is composed of the switch s 1 , resistor r and inverter iv . the switches sw 1 and sw 2 are turned on and off by operating the switch s 1 . alternatively , the operation of the switches sw 1 and sw 2 may be effected not by hardware manipulation but by providing a flip - flop output signal to turn on and off the two switches as desired . in the alternative case above , the flip - flop output signal to alternate the switches sw 1 and sw 2 is provided by supplying software to establish a suitable flip - flop input signal . [ 0038 ] fig3 is a block diagram of a computer practiced as a second embodiment of the invention wherein pci slots are switched . in the second embodiment , the computer 1 has a two - bit flip - flop ( acting as a switching controller ) ff . the flip - flop ff is connected to the smp bus b 1 and controlled by a cpu . the computer 1 includes a power source d , a decoder dc , and switches sw 3 , sw 4 , sw 5 and sw 6 ( e . g ., cmos analog switches ). the power source d serves as a power supply to retain data set in the flip - flop ff . the decoder dc outputs a predetermined signal based on the data output by the flip - flop ff . the switches sw 3 and sw 4 constitute one switching unit , and the switches sw 5 and sw 6 make up another switching unit . the flip - flop ff , decoder dc , and switches sw 3 and sw 4 form bus switching controller 8 a . the bus switching controller 8 a and the switches sw 3 through sw 6 constitute a bus switching apparatus . the computer 1 also includes pci slots sl 8 , sl 9 , sl 13 , sl 14 , and pci i / o slots sl 10 through sl 12 . the pci slots sl 8 and sl 9 are connected to the pci bus b 2 . the pci slots sl 13 and sl 14 are connected to the pci bus b 3 . the switch sw 3 is connected interposingly between the pci slot sl 9 and the pci slot sl 10 . the switch sw 5 is connected interposingly between the pci slot sl 10 and the pci slot sl 11 . the switch sw 6 is connected interposingly between the pci slot sl 11 and the pci slot sl 12 . the switch sw 4 is connected interposingly between the pci slot sl 12 and the pci slot sl 13 . the switches sw 3 through sw 6 are turned on and off on the basis of signals output by the decoder dc . when the setting of the computer 1 is finished , the operator initializes the computer by storing information necessary for the start - up of the computer into its memory . with the computer started and placed under actual conditions of use , the operator carries out benchmark tests in four different cases : ( 1 ) when the switchable pci slots sl 10 through sl 12 are all connected to the pci bus b 2 , ( 2 ) when the pci slot sl 10 is connected to the pci bus b 2 and the pci slots sl 11 and sl 12 are connected to the pci bus b 3 , ( 3 ) when the pci slots sl 10 and sl 11 are connected to the pci bus b 2 and the pci slot sl 12 is connected to the pci bus b 3 , and ( 4 ) when the switchable pci slots sl 10 through sl 12 are all connected to the pci bus b 3 . a check is made to see which of the four connective states is conducive to the most efficient computer performance . given the results of the benchmark tests , the operator chooses the connection setup that has proved to be most efficient . for example , if the flip - flop ff outputs a value of “ 00 ,” “ 01 ,” “ 10 ” or “ 11 ,” the decoder dc outputs a low - level signal corresponding to each value in question . given any other value from the flip - flop ff , the decoder dc outputs a high - level signal . thus if the switch sw 5 alone is turned off and the other switches sw 3 , sw 4 and sw 6 are turned on , then the pci slot sl 10 is connected to the pci bus b 2 and the pci slots sl 11 and sl 12 are connected to the pci bus b 3 . the connective states of the pci slots slb through sl 14 established ultimately following the benchmark tests , i . e ., the data of the flip - flop ff , are held therein due to power being supplied to the flip - flop ff ( backed up ) by the power source d when the computer 1 is switched off . with the second embodiment , the settings of the flip - flop ff may be changed by software upon start - up . this allows the connection settings of the pci slots sl 10 through sl 12 to be altered easily and in a short time so that load fluctuations will be countered in a flexible manner . alternatively , as illustrated in fig4 the switchable pci slots sl 10 through sl 12 may be connected by switches sw 7 through sw 10 to the decoder dc . this setup allows the decoder dc to control the connective states of the slots in the same manner as with the second embodiment . in the alternative case above , the switches sw 7 through sw 10 may each take one of two switching connections j 1 and j 2 shown in fig5 under control of the decoder dc . suitable combinations of the switches sw 7 through sw 10 with their appropriate connective states allow each of the pci slots sl 10 through sl 12 to be connected to the desired pci bus b 2 or b 3 as illustrated in the table of fig6 . although the description above contains many specificities , these should not be construed as limiting the scope of the invention but as merely providing illustrations of the presently preferred embodiments of this invention . it is to be understood that changes and variations may be made without departing from the spirit or scope of the invention . for example , although the first and second embodiments above have been shown using semiconductor switches such as cmos analog switches to change pci slot connections , mechanical switches such as toggle switches and seesaw switches may be employed alternatively . ( 1 ) the connection of switchable i / o slots may be switched to an optimum i / o bus by a bus switching controller easily and in a short time ; ( 2 ) a switching controller including a flip - flop permits making connection changes by use of software , thereby allowing anyone without specialized knowledge of computer hardware is thus able to set up easily and quickly i / o slot connections in an optimum state ; and ( 3 ) the advantages described in ( 1 ) and ( 2 ) above eliminate the need for carrying out the disassembly of the computer enclosure or the rearranging of cable connections , thereby removing the possibility of the computer being disabled or its parts being destroyed by errors committed during such work , and addressing load fluctuations on the computer in a flexible manner to significantly enhance computer throughput . while the present invention has been described in detail and pictorially in the accompanying drawings , it is not limited to such details since many changes and modification recognizable to these of ordinary skill in the art may be made to the invention without departing from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	6
the following description is provided to enable any person skilled in the art to make and use the invention and sets forth the best modes contemplated by the inventor of carrying out his invention . various modifications , however , will remain readily apparent to those skilled in the art , since the generic principles of the present invention have been defined herein specifically to provide a carpet seam press . the present invention can best be understood by initial consideration of fig2 . fig2 is a perspective view of a preferred embodiment of the carpet seaming process of the present invention . one change from the prior process to that process depicted here is the addition of the carpet seam press 26 . the seam press 26 is designed to be pressed onto the heated seam 14 between the two carpet sections 10 and 12 ; the press 26 will briefly press the edges 16 and 18 down onto the seam tape 20 , while simultaneously cooling the seam 14 . as the seam press 26 is moved along behind the iron 22 , it will create a tight , well - bonded seam . as is also depicted in fig2 ( and discussed further below in connection with fig3 and 4 ), is another unique aspect of the press 26 ; its integrated convenience outlet ( not shown ). the convenience outlet is an outlet configured to accept a conventional 120vac plug ; it is powered by the same power source that provides power for the press 26 . the convenience outlet provides the user with the ability to plug the iron 22 directly into it , rather than to a wall socket and / or extension cord . as a result , the user need only provide power in one place ( to the press 26 ), rather than two ; this will serve to minimize the number of cords passing across the carpet work area , thereby minimizing their interference with work progress . if we now turn to fig3 we can examine the seaming press 26 in more detail . a preferred embodiment of the seaming press 26 of the present invention is displayed in the perspective view shown in fig3 . the press 26 comprises a housing 30 , defined by a control end 32 and a lamp end 34 . in this example , the control end 32 includes a control panel 36 for operating the electrical components of the press 26 , and from which extends the electrical power cord 28 . disbursed across the face of the control panel 36 are also found a convenience electrical outlet 38 , such as for plugging the iron ( see fig2 ) into . as discussed above in connection with fig2 this convenience outlet 38 enables the installation person to only locate a single remote power source ; by plugging the iron ( see fig2 ) into the outlet 38 , the iron &# 39 ; s cord is kept close at hand , rather than being extended across the room and / or work surface . also found on the control panel 36 are a light switch 40 for operating the internal work light that will be discussed further below in connection with subsequent figures . further found on the control panel 36 is a fan switch 42 for operating the two cooling fans 44 and 46 that are disposed on the top surface of the housing 30 . the cooling fans 44 and 46 will preferably provide downward airflow into the housing 30 , such that a positive pressure is created therein . the air will flow through the internal volume of the housing and out through a plurality of apertures formed in the bottom plate 50 of the press 26 ; further detail of this feature is provided below in connection with subsequent drawing figures . the fan switch permits the user to turn the fans 44 and 46 on and off while leaving the press 26 ( and the iron plugged into the outlet 38 ) plugged in to the electrical power source . as was discussed above in connection with fig2 the press 26 is slid by the user along the recently - formed carpet seam behind the seaming iron ; this is facilitated by the handle 48 extending upwardly from the housing 30 . if we now turn to fig4 we can examine further detail regarding the press 26 of the present invention . [ 0020 ] fig4 is a perspective view of the seam press 26 of fig2 and 3 . in this view , the detail of the lamp end 34 of the press 26 is shown . disbursed on the lamp end 34 is one or more work lamps 52 , or other lighting devices . the lamp 52 is provided to give the user additional lighting upon the seam area , such as when the user is creating a seam in a confined and / or poorly lighted area . in order to operate the light , the user need simply to switch on or off the light switch ( see fig3 ) when additional light is or is not needed . now turning to fig5 we can discuss additional structure features of this particular press 26 design . [ 0021 ] fig5 is an exploded perspective view of the seam press of fig2 - 4 . it should be understood that the shape and composition of the elements shown here are only those necessary for assembling the embodiment shown in the previous fig2 - 4 . as shown , the housing 30 comprises a top plate 58 and a bottom plate 50 . the bottom plate 50 , very importantly , is preferably defined by several apertures or perforations across its face . these perforations 62 are provided to permit air flow entering through the cooling fans 44 and 46 to pass through the substantially hollow housing 30 and out through the bottom plate 50 . this constant flow of air out the perforations 62 will provide a substantial cooling effect in any area upon which the press 26 is placed ( i . e . on a newly ironed seam ), causing the seam to set ( become hardened ) more quickly than by simply allowing it to air cool . it might further be desired that the bottom plate 50 have its bottom surface coated with a non - stick material , in order that it resist sticking to the melted seam tape . in other embodiments , the bottom plate 50 might be constructed without perforations 62 , but might be made from some heat - sinking material and / or heat - sinking cross - section such that the air flow from the cooling fans 44 and 46 simply cool the bottom plate 50 ; the elimination of the perforations 62 would make the surface even more impervious to becoming soiled with glue or other materials . on each side of the housing 30 may be found side plates 56 , such as those shown for displaying trademark indicia and / or instructions thereon . further shown is the lamp assembly 52 that is attached to the lamp end of the housing 30 . in this embodiment , the lamp assembly 52 is a single light that is configured to shine through an aperture formed in the end of the housing 30 ; other designs are conceived , including multiple lamps and / or surface - mounted designs . the cooling fans 44 and 46 are attached to the bottom side of the top plate 58 ( which in turn attaches to the top of the housing 30 ). the fans 44 and 46 are positioned cooperatively to align with two like - sized holes formed in the top plate 58 , and over which are attached grill assemblies 60 . the grill assemblies 60 may further include filters for filtering out airborne contaminants ; in this case , the grill assemblies 60 would be easily removable from the press 26 , such that filter maintenance might be performed . as also shown , the control panel 36 attaches to the control end of the housing 30 . the convenience outlet 38 , switches , and power cable 28 further extend therefrom . as a further added safety measure , a strain relief grommet 54 might be added to the power cable 28 in order to inhibit the possibility that the cable 28 might be inadvertently yanked out from the press 26 ( such as if someone trips over it ). finally , the handle 48 will be configured to attach to either the top plate 58 or the housing 30 , depending upon the particular design and its aesthetic or utility particulars . those skilled in the art will appreciate that various adaptations and modifications of the just - described preferred embodiment can be configured without departing from the scope and spirit of the invention . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described herein .	1
referring now to the figures , in which like reference numerals refer to like components thereof , fig1 a shows an isometric view of a cam , rocker arm , valve or injector , and a pivot shaft for the rocker arm being carried by a separate pivoting mechanism . though only one rocker arm , valve or injector , roller , control arm , and arm actuator are shown in fig1 a , one skilled in the art will recognize that two , three , four , or more sets of the same may be employed in any given engine . in a conventional , center - pivot rocker arm for an overhead cam layout , pivot shaft 1 is in a fixed location , and rocker arm 2 pivots about this fixed location . cam 3 attached to camshaft 37 acts on roller 4 ( the roller 4 can be replaced by a curved sliding surface ) to displace rocker arm 2 . curved arrow 9 indicates the direction of rotation of cam 3 . the elephant &# 39 ; s foot 5 attached to the tip of rocker arm 2 pushes down on valve or injector 6 . the tip of rocker arm 2 usually has a mechanical or hydraulic lash adjuster which is not required to explain the function of the current invention , and is not shown . valve or injector 6 is usually spring loaded ( spring not shown ) to return same to its original position as cam 3 returns to its base circle . phase change is achieved in this invention by moving pivot shaft 1 through a circular arc centered about pivot axis 8 of shaft 38 fixed to control arm 7 . in this embodiment this is shown by positioning control arm 7 at desired points on either side of a centered position , rotating control arm 7 about its own pivot axis 8 of shaft 38 via an arm actuator 10 . thus , in this embodiment , pivot shaft 1 is no longer fixed . arm actuator 10 controls the location of control arm 7 by being able to vary its length from its actuator axis 11 , and thus the timing of the valve or injector 6 relative to the rotation of cam 3 is changed . arm actuator 10 may be a hydraulic actuator , a ball lead screw powered by an electric motor , which could be a stepper motor , or another type of rotary or linear actuator . in another embodiment shown in fig1 b , a rotating actuator 39 is attached to shaft 38 and rotates shaft 38 clockwise and counterclockwise in order to vary the phase . fig2 a shows a side - on view of the mechanism in fig1 a with control arm 7 located in an advanced position from a centered position ( arm actuator 10 and actuator axis 11 are not shown in this view ). if pivot shaft 1 were held fixed ( with a suitable locating mechanism in place of control arm 7 ) in a centered position this would correspond to a conventional design without variable timing . dashed line 12 indicates the location of the centered timing position with roller 4 contacting cam 3 when on the base circle of the cam , which represents a zero phase change . dashed line 13 indicates advanced timing ( advanced phase change ) and dashed line 14 indicates retarded timing ( retarded phase change ). corresponding to these different timing indicators , dashed line 15 indicates control arm 7 in the centered position ( zero phase position ), dashed line 16 indicates the control arm 7 in the advanced phase position , and dashed line 17 indicates the control arm 7 in the retarded phase position . fig2 b and fig2 c show the location of components in the centered and retarded positions respectively ( arm actuator 10 and actuator axis 11 are not shown in these views ). the angular movement required for the cam 3 to roller 4 phasing will be different for the angular movement required for different positions of control arm 7 . please note the change in position of elephant &# 39 ; s foot 5 with respect to the valve or injector 6 in each of the three views . fig3 shows a plot of the minimal change in height of the rocker arm tip throughout a selected range of phasing of the mechanism . since there is only a very small height change of the rocker arm tip as the rocker arm moves through its phasing path , the valve and injector height remain essentially constant during the phasing movement when cam 3 is on the base circle of the cam . movement from the retarded position to the advanced position is approximately between about − 10 ° to + 10 ° or any range there between . the minimal change in height of the rocker arm tip is approximately between − 0 . 001 ″ to + 0 . 001 ″. changes of movement more than − 10 ° to + 10 ° or changes of rocker arm tip height of more than − 0 . 001 ″ to + 0 . 001 ″ are within the scope of this invention , and the ranges listed are just those that have produced good results , but other ranges may also be acceptable . fig4 shows in an alternate embodiment a side - on view of the mechanism in a centered position , but with the elephant &# 39 ; s foot 5 ′ now attached to the valve or injector 6 instead of rocker arm 2 ′ as shown in fig2 a , 2 b , and 2 c . flat surface 18 on the underside of rocker arm 2 ′ is shown as being flat . flat surface 18 of rocker arm 2 ′ may also correspond to the bottom of a lash adjuster fitted to rocker arm 2 ′. fig5 a shows an isometric view of the mechanism in fig1 a , but with rocker arm 2 actuating two valves or injectors 6 ′ via bridge 19 . valves or injectors 6 ′ via bridge 19 are biased by spring 24 . shown in greater detail in fig5 b is a suitable slot 20 shown in bridge 19 to constrain movement of elephant &# 39 ; s foot 5 during motion of rocker arm 2 . bridge 19 has tangs 21 that capture the end of rocker arm 2 to ensure that bridge 19 is properly constrained . fig6 a shows in an alternate embodiment an isometric view of the mechanism in fig4 , but with the rocker arm 2 ′ actuating two valves or injectors 6 ′ via bridge 19 ′. flat surface 18 ′ on the underside of rocker arm 2 ′ is flat . flat surface 18 ′ may also correspond to the bottom of a lash adjuster fitted to rocker arm 2 ′. fig6 b shows in greater detail the elephant &# 39 ; s foot 5 ″ now attached to bridge 19 ′. bridge 19 ′ has tangs 21 ′. flat surface 18 ′ on the underside of rocker arm 2 ′ is flat . flat surface 18 ′ may also correspond to the bottom of a lash adjuster fitted to rocker arm 2 ′. fig6 c shows a detailed view of the underside of the bridge 19 ′ with a recessed retaining cap 22 to capture the top of valve tip 23 . fig7 a shows an isometric view of similar to fig1 a but where the circular movement path of pivot shaft 1 ′ is determined by the shaped underside of curved caps 25 . in this case the pivot shaft 1 ′ is longer than pivot shaft 1 in fig1 a ( and elsewhere ) to allow for contact with constraining curved caps 25 . in fig1 a and 2a ( and elsewhere with the same features ) control arm 7 for pivot shaft 1 is shown hinged at its pivot axis 8 . the undersides of curved caps 25 have a radius whose imaginary center corresponds to pivot axis 8 as shown in fig1 a and others . control arm 26 has lip 36 whose geometry captures curved caps 25 on the top surface , and pivot shaft 1 ′ captures curved caps 25 on its lower surface . thus , when arm actuator 10 ′ changes length , control arm 26 and pivot shaft 1 ′ are translated . connector 27 joins arm actuator 10 ′ to control arm 26 . fig7 b shows a similar isometric view of the geometry described in fig7 a but with a load - bearing member 32 interposed between pivot shaft 1 ′ and a single piece curved cap 28 . load - bearing member 32 allows curved cap 28 ( corresponding to curved caps 25 in fig7 a ) to be a single piece sitting above rocker arm 2 . slot 29 in curved cap 28 allows control arm 30 , which is connected rigidly to load - bearing member 32 ( not shown ) to extend above curved cap 28 where connector 31 joins control arm 30 to arm actuator 10 ″. the underside of curved cap 28 has a radius whose imaginary center corresponds to pivot axis 8 as shown in fig1 a ( and elsewhere ). load - bearing member 32 sits on pivot shaft 1 ′ and may fit snugly over pivot shaft 1 ′ so that they are clipped together . pivot shaft 1 ′ and load - bearing member 32 are biased upwards by suitable means well know in the art ( not shown ) to maintain contact with curved cap 28 . fig8 a shows a side view of fig7 a with pivot shaft 1 ′ in contact with curved caps 25 . the circular arc movement of pivot shaft 1 ′, represented by arrow 34 , is achieved by movement of pivot shaft 1 ′ along curved surface 33 whose imaginary center of curvature corresponds to pivot axis 8 ( as shown in fig1 a and elsewhere .) fig8 b shows a side view of fig7 b . the purpose of load - bearing member 32 is to distribute the forces more controllably between pivot shaft 1 ′ and curved cap 28 , and may be useful for elevating curved cap 28 to allow for clearance between it and rocker arm 2 . load - bearing member 32 may fit snugly over pivot shaft 1 ′ so that they are clipped together . suitable means well known in the art are used to bias curved cap 28 to maintain contact with curved surface 35 of curved cap 28 ( not shown ).	5
fig2 is a block diagram of a computer system architecture according to the present invention . display memory is incorporated into system memory . system data and display data can both be stored in a single memory device , i . e . the main memory 31 . a memory controller 32 , connected to the main memory 31 and the buses 42 and 44 , controls access to system data . the display controller 34 , connected to the main memory 31 and the buses 42 and 44 , controls access to display data . the memory controller 32 can also function as a bridge between the buses 42 and 44 . in a typical computer system , the bus connected to the central processing unit 30 is a local bus , i . e . the bus 42 , and the bus connected to the local bus may be a peripheral component interface ( pci ) bus , or a bus of another standard , i . e . the bus 44 of the present invention . further , the memory controller 32 and the buffer circuit 33 serve as a host bridge between the buses . main memory 31 includes a main memory portion and a display memory portion ( corresponding to the display memory of a conventional computer system ). access paths for the data in the main memory portion include : ( i ) a path from the central processing unit 30 to the main memory 31 through the bus 42 , via the memory controller 32 or the buffer circuit 33 ; and ( ii ) a path from the master card 45 to the main memory 31 through the bus 44 , via the memory controller 32 or the buffer circuit 33 . access paths for data being written to and read from the display memory portion include : ( i ) an access path for display data from the central processing unit 30 to the main memory 31 through the bus 42 , the memory controller 32 , the buffer circuit 33 , the bus 44 and the display controller 34 ; ( ii ) an access path for display data from the master card 45 , i . e . the peripheral components , to the main memory 31 through the bus 44 and the display controller 34 ; and ( iii ) a path of retrieving display data from the main memory 31 directly by the display controller 34 , transforming to the screen 43 and then outputting . control signals for the main memory 31 generated by the memory controller 32 include access requests for system data of the central processing unit 30 or any of the devices on the bus 44 , and refresh for the main memory 31 , etc . the control signals for the main memory 31 generated by the display controller 34 include prefetch of display data , access and refresh for the central processing unit and so on . accordingly , the present invention provides built - in signals to the display controller 34 and the memory controller 32 to arbitrate potentially conflicting controls generated by the two controllers 32 and 34 , so that the operation of the main memory 31 is orderly and efficient . display controller 34 provides a signal vgareq # to memory controller 32 via a first signal line to indicate that the display controller wants to use main memory 31 . memory controller 32 provides a signal vgagnt #, via a second signal line , to display controller 34 to grant display controller 34 use of the main memory 31 . the processing of the request and grant signals , or other related arbitrating operations can be enhanced by adding an arbiter 35 . arbiter 35 is shown as part of memory controller 32 in this embodiment . however , it could be a separate device . when the display controller 34 needs to access data in the main memory 31 , it sends a request signal vgareq # to the arbiter 35 . then the arbiter 35 transfers control to the display controller 34 and sends a grant signal vgagnt # to the display controller 34 at the same time . since the memory area accessed by the display controller 34 is set to be non - cacheable and is independent from the memory area of system data access , no compatibility problems arise . the priority can be properly adjusted in response to requirements by using an arbiter to arbitrate the control of the main memory 31 . in most computer systems , the main memory 31 is constituted by dynamic random access memory devices ( drams ) which store data in capacitive elements that require periodic data refresh to prevent data loss of data due to charge leakage . in the present invention , the refresh of the main memory 31 is initiated by a request signal vgareq # from the display controller 34 . the request signal vgareq # of the display controller 34 is sent out every 16 . 2 μs which is close to the period , about 15 μs , of a refresh signal generated by a counter ( not shown ) used in computer systems having conventional architecture . accordingly , the access for the display controller can be consecutive and will not be interfered with by the refresh operation if the built - in signal vgareq # is used to initiate the refresh operation . thus , the frequency of arbitrating operation decreased and the control latency of the arbiter to the main memory 31 can be reduced to improve the efficiency . the timing relation between the refresh operation and the request signal vgareq # is illustrated in fig3 and 4 . as shown in fig3 the main memory 31 is being refreshed at b while the display controller 34 sends out a request signal vgareq # at a and the memory controller 32 has finished its operation cycle . the display controller 34 may prefetch display data at c after the main memory 31 finishes the refresh operation . that is , refresh occurs after the display controller 34 requests access of data and before a grant signal is responded thereto . another situation is shown in fig4 . the arbiter stops the grant signal vgagnt # at e after the display controller 34 stops the request signal vgareq #, i . e ., after the cycle of display data prefetch is ended at d . thereafter , the refresh operation may proceed until it concludes at f . that is , refresh occurs after the display controller 34 ceases to request data access . therefore , initiating the refresh of the main memory 31 by utilizing the request signal vgareq # of the display controller 34 as a time base reduces the arbitrating latency . moreover , for the prior - art architecture having a display memory , it is not necessary to provide an additional refresh signal or timing cycle of the display memory beyond the one - time refresh of the main memory 31 . the display controller may thus access data consecutively so as to reduce the timing cycle needed to prefetch display data . in the computer system architecture according to the present invention , as shown in fig2 the control circuits of the display controller 34 and the memory controller 32 connected to the main memory 31 are interconnected . the two controllers utilize the same control circuitry to control the main memory 31 to prevent signal contention . fig5 is another timing diagram explaining the operation of the computer system architecture of the present invention . more specifically , this figure explains the timing related to switching of the controllers for use control of the main memory 31 . the control signals sent to the main memory 31 include ras #, cas #, we # and max . max is a memory input address the magnitude of which depends on the size of the memory . therefore , while the display controller 34 accesses display data from the main memory 31 , it pulls down the request signal vgareq # at g . the request signal vgareq # is sent to the arbiter which will terminate the control cycle of the memory controller 32 over the main memory 31 after its operation cycle is finished . then the control signals are put in a tri - state status at h . meanwhile , a grant signal vgagnt # is sent to the display controller 34 at i to allow the control signals of the display controller 34 change to normal status from tri - state status at j , that is , to hold the main memory in a display controller cycle . after accessing display data , the display controller 34 will raise the level of its request signal vgareq # to indicate a terminate request at k . the control signals ras #, cas # and we # of the memory controller are then driven to a high level at n to hold the main memory 31 in memory controller cycle . thereafter , the display controller cycle ends and all of the control signals of the display controller 34 are changed to tri - state status at l . the grant signal vgagnt # is then raised to high level at m . thereafter , the main memory 31 can be operated in memory controller cycle . by using the computer system architecture of the present invention , hardware requirements are reduced by eliminating display memory . while the present invention has been particularly shown and described with reference to a preferred embodiment , it will be readily appreciated by those of ordinary skill in the art that various changes and modifications may be made without departing from the spirit and scope of the invention . it is intended that the claims be interpreted to cover the disclosed embodiment , those alternatives which have been discussed above and all equivalents thereto .	6
the following description is of the best presently contemplated mode of carrying out the present invention . this description is made for the purposes of illustrating the general principles of the invention and is not to be taken in a limiting sense . the scope of the invention is best determined by reference to the appended claims . the present invention is designed to simulate , on a small scale , the installation of carpet at an actual installation site . a measurement tape , which is used as a scale model of a standard size roll of carpet , is carefully cut or torn into pieces and is placed over a scale floor plan of the installation site in a manner in which the installation site is to covered by actual pieces of carpet . by calculating the length of the measurement tape which is required to cover the scale floor plan of the installation site , the quantity of standard width carpet which should be delivered to the actual installation site may be precisely determined using the known scale ratio between the carpet measurement tape and the actual installation site . in this manner , the retailer can avoid inaccurate calculations , financial losses and inconveniences due to the delivery of insufficient or excess quantities of carpet to installation sites . fig1 illustrates a portion of a roll of measurement tape 20 of the present invention . the measurement tape 20 is formed of a sheet material , such as paper , having one adhesive side . the tape is preferably , but not necessarily , transparent and may have a removable backing ( not shown ) covering its adhesive surface to prevent unintended adhesion moreover , the adhesive property of the tape is preferably such that the tape can be removed from a surface , repositioned and readhered . the width of the measurement tape is scaled to the width of a standard roll of carpet . for example , since a standard roll of carpet has a width of 12 feet in the united states , if a scale of 1 / 4 inch to 1 foot is used , the measurement tape should have a width of 3 inches . it is preferable for the same scale to be utilized for the length direction of the measurement tape as is utilized for the width direction . to continue the example , the scale in the width direction should also be 1 / 4 inch to 1 foot . the measurement tape ( and backing , if provided ) is perforated at regular intervals along its width and its length . the distances between the intervals should preferably correspond to scaled distances at which carpet is normally measured and cut for delivery to the installation site . for example , it is common in the united states to measure carpet for delivery in intervals of feet . accordingly , continuing with the example , the perforations 22 should be positioned in the length and width directions of the tape at intervals of every 1 / 4 inch . the perforations 22 should therefore divide the measurement tape into squares of 1 / 4 inch by 1 / 4 inch which are representative of a square foot of carpet . the measurement tape contains indicators 24 of the direction of the grain of the roll of carpet represented by the tape . for example , the indicators 24 may be in the form of arrows , with each arrow of the tape pointing in the same grain direction , as illustrated in fig1 . as an alternative example , the indications 24 may be in the form of plural parallel hatch marks and / or perpendicular lines . preferably , a grain direction indicator 24 should be provided at each perforated block of the measurement tape . for example , in fig1 each 1 / 4 inch by 1 / 4 inch block contains an arrow in its center , with the direction of each arrow being identical for the same roll of tape . the grain direction indicators 24 are designed to assist in maintaining continuity in the grain of each piece of carpet in relation to all of the other pieces of carpet during installation . thus , when different pieces of the tape are placed adjacent to one another in a manner simulating the placement of adjacent carpet pieces of the same roll , it will be readily apparent from the direction of the arrows of the various pieces of measurement tape whether their grain direction is identical . the measurement tape of the present invention also contains indicators 26 of the distance intervals at which the pattern of the carpet represented by the tape repeats along the length direction . in the united states , carpet patterns typically repeat every 3 feet along the length of the carpet . the measurement tape illustrated in fig1 therefore contains a bold line or other pattern interval indicator at every 3 / 4 inch interval along the length of the tape . in this manner , when two pieces of tape are placed adjacent to one another to represent adjacent pieces of carpet , it may be easily determined whether the actual represented carpet pattern will be continuous between the two pieces by observing whether the indicators 26 match one another . if the pattern is not continuous , this will also be readily apparent , as will the distance one piece must be adjusted with respect to the other to make the pattern continuous . the present invention may also provide indicators 28 of the intervals at which the carpet pattern repeats along the width of the carpet . carpet patterns in the united states typically repeat every 11 / 2 or 3 feet in the direction of the width of the carpet . bold lines or other indicators similar to those shown at the intervals along the length of the carpet may also be provided at the appropriate scaled intervals along the width of the tape . the measurement tape 20 may also have width indicators 30 placed at different points along the width of the tape . the width indicators 30 assist the user in counting the number of feet between different points along the width of the measurement tape 20 . for example , if an eight scale - foot wide piece of tape is desired , the user simply has to locate the width indicator &# 34 ; 8 &# 34 ; rather than counting over eight intervals from the left - hand edge of the tape before deciding along which perforation the roll should be torn . as illustrated , the measurement tape of fig1 contains width indicator numerals placed alongside every longitudinal column of perforations . these numerals represent the 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 and 12 scale - foot widths of the measurement tape . of course , less than every longitudinal column of perforations may be provided with such indicators . the manner in which the measurement tape of the present invention should be utilized is described below with respect to a sample dimensioned floor plan . fig2 illustrates a sample scale floor plan 40 of an installation site to be carpeted once the dimensions of the floor plan are known , a floor plan 50 such as illustrated in fig3 should be constructed as a scale model representation , with a scale equal to the same scale as that of the measurement tape ( 1 / 4 inch to 1 foot , to continue the example ). as shown in fig3 the scaled floor plan 50 is then covered with a transparent sheet of tissue paper 52 or other similar protective layer . pieces of the measurement tape 20 may then be adhered to the transparent sheet 52 in a manner to simulate the placement of carpet over the actual floor of the installation site 40 . for the purposes of illustration , one method of covering the scaled floor plan 50 will be described below . as illustrated in fig4 a , a block a of the measurement tape 20 having dimensions of 3 &# 34 ; ( 12 scale - feet ) in length and 3 &# 34 ; ( 12 scale - feet ) in width should first be removed from the roll of carpet measurement tape . in order to more closely simulate the shape of the scale model representation , a block b having dimensions of 11 / 2 &# 34 ; ( 6 scale - feet ) in length and 3 / 4 &# 34 ; ( 3 scale - feet ) in width is removed from the block a . this block b may then be placed to the side as scrap which may be used later should the need arise for a piece having such a size , shape , grain and pattern . the backing of block a should then be removed , and the block a placed over the scaled floor plan , as illustrated in fig4 a , so that the block a adheres to the transparent sheet 52 covering the floor plan 50 . as illustrated , a portion 60 of the floor plan still remains uncovered . at this point , it must be determined whether another piece of tape 20 should be removed from the carpet measuring roll , thus representing additional carpet which must be delivered to the installation site , or whether the area 60 may be covered with existing scrap pieces . in this instance , the scrap block b is available for use . however , before block b may be used , a careful determination must be made as to whether ( 1 ) the size of block b is sufficient to cover the uncovered portion 60 , ( 2 ) whether the block b will cover portion 60 when it is oriented to have the same grain direction as the remainder of the carpet , and ( 3 ) whether the pattern of block b will remain continuous at its seam with the remainder of the carpet a . if the answer to all of these questions is yes , the block b may be used . due to its grain direction , then block b cannot simply be rotated 90 ° to cover the uncovered portion 60 . if this were done , the arrows of block a and block b would point in different directions . rather , block b should be torn in half along the perforation 62 and reoriented into identical blocks c and d , as illustrated in fig5 . next , the carpet pattern indicators of blocks c and d must be arranged to match those of block a such that a determination can be made as to which four foot width of the total 6 foot width of adjacent blocks c and d must be used . since the pattern indicators 28a running along the length of block a match the pattern indicators 28b and 28c running along the shared seam if blocks c and d are positioned together , as illustrated in fig6 only the center four foot width of blocks c and d are needed . thus , the one scale foot ( 1 / 4 inch ) width strips 64 should be removed from the outside edges of block c and block d . the removed strips 64 may then be set aside for later use , if the need arises the backing layer may then be removed from both reshaped blocks c and d of the measuring tape , and blocks c and d adhered to the transparent sheet 52 to cover the portion 60 . as is apparent from the above example , the total quantity of carpet which should be supplied to the installation site ( in the example , 12 linear feet of the standard 12 foot wide carpet roll ) may be easily calculated by determining the length of the roll of tape which must be used to cover the entire scaled floor plan . at this point , it should be noted that if the carpet measuring tape totally covers the scale floor plan , then the retailer is guaranteed that the amount of carpet actually being sent to the installation site is sufficient to cover the entire floor . of course , if the area to be covered with carpet has dimensions which are not exactly equal to an integral number of feet , then the user of my invention should still cover the entire scaled floor plan with tape torn at the perforations . the small excess amount of carpet can simply be trimmed off at the installation site . in many cases , it may be desirable to test whether one method of cutting and positioning the carpet is more economical than another . in such a case , a separate transparent sheet may be positioned over the floor plan and the carpet measuring tape laid out in a different manner using the above described procedure . the carpet layout which results in the least amount of tape usage , without producing an excessive number of seams , is the more economical . as an alternate embodiment of the present invention , the transparent sheet may be eliminated and the pieces of measurement tape may be directly adhered to the scale floor plan of the installation site . if multiple methods of cutting and placement of the measurement tape are desired to be tested , then multiple photocopies of the scale floor plan of the installation site may be used for each attempt at laying out the carpet . once a preferred method of placement of the measurement tape pieces on the scale floor plan has been determined , the scale floor plan with adhered tape pieces may be given to the installer so that the installer can then see exactly how each piece of carpet should be cut from the length of standard width carpet and positioned at the installation site . it should now be apparent that , using my inventive method and tape , the possibility of delivering an insufficient amount of carpet ( i . e ., a short measure ) to an installation site can be virtually eliminated . according to my invention , the scale floor plan of the area to be carpeted should be completely covered with tape . the retailer may then send a length of standard width carpet to the installation site corresponding to the number of linear scale feet of tape used to cover the entire scale floor plan . the retailer &# 39 ; s completely tape - covered floor plan may then be given to the installer . when the installer cuts and lays - out the carpet in the same way that the tape pieces are cut and layed out on the scale floor plan , the retailer is assured that the carpet which is delivered to the cite will be sufficient to carpet the entire installation site . short measures can thereby be completely eliminated . moreover , the retailer can experiment with various ways of cutting and laying out the carpet using the tape and can pick the manner which results in the most efficient use of carpet and the carpet installers time . it is frequently the case that the carpet layout which results in the least waste of carpet will also have the most seams . however , it takes time , and thus money , to align and join seams . experimenting with my inventive tape is far faster and less expensive than experimenting at the installation site with carpet . by first laying out tape over the scaled floor plan , the retailer can pick the carpet layout which results in the most clearly economical balance of seams and wasted carpet scraps . in summary , the present invention provides a highly useful , virtually fool - proof visual aid which allows the user to accurately and inexpensively determine the total quantity of carpet which should be delivered to an installation site to cover a floor plan . the invention takes into consideration the size and shape of the carpet pieces to be used , as well as the grain direction and pattern of the carpet pieces . determinations may therefore be made as to the most economical manner of cutting and installation . in addition , the invention allows the user to visually determine if and when scrap pieces generated during the installation procedure may be utilized as substitutes for newly cut to size pieces of carpet from the standard - width roll , thereby reducing the amount of wasted scrap carpet material generated . moreover , the present invention also provides a visual aid to the carpet installer as to the manner in which the carpet pieces should be cut from the standard width carpet and installed at the installation site . one preferred embodiment of the present invention has been illustrated and described in detail with respect to use in measuring carpet . however , the invention is not so limited numerous variations within the spirit and scope of the invention are possible . for example , the invention is not limited only to use with carpet , but works equally well with linoleum and many other sheet - like materials which may be used to cover various defined areas . this invention also may be used as a teaching tool for new personnel , such as estimators , carpet layers , and sales people since carpet customers usually do not know how to compute the yardage they need for their homes or offices , they are usually at the mercy of the retailer and can be overcharged for more yardage than they actually need or use . this invention will serve as a safeguard to the customer since it will educate the customer as to the exact amount of yards required and being delivered to the job site . the customer will thus not have to pay for more carpet than is required .	0
the present invention is directed to a textual and graphical method and system for providing instructions on installation of stereo or electrical components or products in a home , automobile or mobile units . in the method and system of the present invention , instructions are provided in a schematic format , use fewer pages and use graphical depictions of parts and tools required for installation . in addition , the installation steps are laid out clearly in sequence . the steps may be numbered steps and graphics depicting the assembly of parts and the making of connections may be present . fig1 and 2 depict exemplary methods and systems for instructing on installation with textual and graphical components . alternatively , the steps may not be numbered and instead , either arrows or like signals may be used or the installation steps are located in a logical order so that a user will readily understand the sequence of steps . use of the method and system permits users to look at a graphical image and locate the actual component depicted in the image . the user will be able to hold the component and then attach it to the necessary object by referring to the graphic and the accompanying text . this method and system results in installation being easier and faster than when using typical installation guides because users do not have to solely rely on text to determine which component the text refers . consequently , the present invention improves the installation process for professionals and nonprofessionals and results in fewer returns of stereo or electrical components ( based on inability to install ). in one embodiment , the method and system comprise numbered steps , headings for each step , markings of each tool and part used , and graphical depictions or pictures of tools and parts used , and how the tools and parts are manipulated . in one embodiment , shown in fig1 , the method and system utilize instructions for installing a car amplifier laid out graphically and textually in ten steps . these steps include : ( 1 ) unpacking the product &# 39 ; s contents and laying out necessary tools 100 ; ( 2 ) mounting the amplifier with screws and washers 110 ; ( 3 ) connecting wires to a power source 120 ; ( 4 ) connecting the ground wires 130 ; ( 5 ) connecting the remote wire 140 ; ( 6 ) connecting the audio jacks 150 ; ( 7 ) connecting the amplifier to the car &# 39 ; s speakers and / or subwoofer 160 , 170 ; ( 8 ) connecting the speakers 180 ; ( 9 ) adjusting the amplifier settings 190 ; and ( 10 ) troubleshooting the amplifier 200 . as shown , these steps are laid out on two pages in column format with pictures of tasks and parts used and installation techniques , thus simplifying the installation process and ensuring proper installation while simultaneously minimizing the likelihood of the corresponding product being damaged during installation and / or returned to the merchant . fig2 shows another example of the present invention . the method and system are used for installing a subwoofer in a vehicle and the instructions are laid out graphically and textually in four steps . these steps include : ( 1 ) unpacking the product &# 39 ; s contents and laying out if necessary 210 ; ( 2 ) mounting the subwoofer in a vehicle 220 ; ( 3 ) installing the subwoofer by connecting the necessary audio cable ( s ); and ( 4 ) troubleshooting the subwoofer 240 . although these embodiments all contain numbered steps , the steps need not be numbered . for example , if columns are used , users know to read from left to right and top to bottom . this means that if columns are used , the steps may begin on the left or upper left side of a page in one column , proceed downward in the column and then proceed to the beginning of the next column to the right of the completed column . alternatively , if columns are not used , arrows may be used to direct the user &# 39 ; s attention to the step ( s ) that need to be completed next . alternatively , columns may not be used . instead , the instructions appear on multiple pages or sheets with each page or sheet providing at least one installation instruction . the steps shown herein are by way of example and manufacturers may vary the steps or their number for the different products installed . additionally , the troubleshooting step is optional and need not appear with the textual and graphical instructions . the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof and , accordingly , reference should be made to the appended claims , rather than to the foregoing specification , as indicating the scope of the invention .	6
turning now to fig1 the mold for the manufacture of injection moldings from plastic material there shown is for the making of large plates for filter presses . such plates have , forexample , a square shape with a dimension of 1200 mm on each side and a thickness of 250 mm . the lower and upper base plates 1 of the mold ( the positive and negative matrices ) are each provided with cooling grids of welded steel tubes 2 . the cooling grids are cast into the base plates 1 , for which advantageously aluminum alloys are used , in the course of their casting . the borders of the cavity of the mold are defined by strips 5 , between which strips 5 suitably shaped forming strips 4 and forming plates 3 are fixed ; the thickness of strips 4 and plates 3 does not exceed 12 mm . an insert for the inlet of plastic material is provided in the center of the mold in the upper negative matrix plate 1 . as shown in fig2 the lower positive matrix comprises a base plate 1 , to which circumferential strips 5 are screwed and secured by bolts . strip 5 has a recess 5a which affixes to the base plate 1 a circumferential shape forming strip 4 together with the forming plate 3 , which is provided on one side with a recess 11 . the forming plate 3 is fixed to the base plate 1 by a screw 6 which has formed on its head the same pattern as is formed on the active surface of the forming plate 3 . the pattern comprises a system of shapes which form during the injection molding a draining system limited by prismatic extensions of a dimension 8 × 8 mm and a height of 4 mm , the extensions being slightly conical , so that the thus formed grooves have the shape of an open trapezohedron with a longer base of 4 mm . the face wall of the extensions is provided with additional grooves of a width of 1 . 5 mm and a depth of 1 mm . the active surfaces 7 of the forming plates 3 , screws 6 , and forming strips 4 are provided with a coating of polytetrafluorethylene 0 . 03 mm thick and their surfaces facing the base plate 1 are provided with grooves 8 for receiving heating elements or a tempering medium and with grooves 9 for an auxiliary cooling system . the external space around the grooves 8 and 9 is separated by a packing 10 , advantageously made of rubber with a circular cross section . when applying the technology of electrochemical working , a particularly optimum design of grooves 8 and 9 of a tempering and cooling system having a maximum efficiency can be achieved . a fixing bolt 13 , serving for fastening the body 12 of the core is anchored in the lower base plate 1 . fig3 to 13 , incl ., illustrate a number of alternative arrangements of cores and of the manner of securing the mobile cores in the mold . in fig3 there is shown a core for the creation of an opening in the wall of the injection molding . the core comprises a mobile core body 12 , in the internal formed hollow space of which there is a fixing bolt 13 , bolt 13 being a screw bolt . the head of the screw bolt 13 is seated on an internal formed wall of the core body 12 by way of a washer 14 . the diameter of the forming bolt 13 is smaller than the hollow of the core body 12 so as to provide a space , for the shifting of the mobile core body 12 , between the eccentrically situated fixing bolt 13 and the internal wall of the core body 12 . the core body 12 is only slightly tightened to the base plate 1 by the fixing bolt 13 , permitting its movement due to the shrinking of the solidifying plastic material , whereby the core body 12 is shifted along the surface of the mold and along the washer 14 of the fixing bolt 13 . in fig4 there is shown a core for a mold having a small shrinkage of the injected plastic material . such mold has a mobile core body 12 , in the central hollow space of which there is disposed a fixing or centering bolt 17 firmly connected to the base plate 1 . the space between the centering bolt 17 and the internal wall of the core body 12 is filled with a resilient insert 15 of foamed rubber . the thickness of the wall of the resilient insert 15 is chosen according to the required shrinking . in the embodiment of fig5 and 8 the core of the mold with a mobile core body 12 has in the central hollow space of the core body 12 a fixing bolt 17 fixed to the base plate 1 . the centering bolt 17 is provided on its top with a recess , into which a guiding 16 is engaging , enabling to retain the direction of movement of the core when the melt of plastic material enters the mold . the core of the mold can be partly shifted in directions perpendicular to its axis and in directions of forces acting due to shrinkage of the solidifying melt 21 of plastic material , ( limited , of course , by the circumferential strip 5 ) as shown in fig8 . the core of the mold according to the embodiment of fig6 and 7 is designed for larger shrinkages of the plastic material and for rectification of the direction of shifting of the core body 12 along the base plate 1 . in the central hollow space of the core body 12 there is provided a fixing bolt in the form of a centering bolt 17 affixed to the wall of the mold . the centering bolt 17 is situated eccentrically in the hollow of the core body 12 and is provided with a spring loaded distance bolt 18 , the end of which rests against the internal wall of the core body 12 . the distance bolt 18 is adjusted in a direction opposite to that of the action of the shrinking plastic material . a flat spring 19 , which engages a groove in the distance bolt 18 , is anchored in a cover 20 for the centering bolt 18 . the flat spring 19 permits a sufficient shifting of the mobile core body 12 due to its adjustment against the direction of shrinkage whereby the core can be better fixed in the mold . the core can be shifted along the base plate 1 , limited by the circumferential strip 5 . fig9 shows a core as a removable part of the mold , the core forming the required recess in the injected casting . the mobile core body 12 is provided with a slot 22 , permitting a shifting of the core body 12 in the direction of the plastic material of shrinking , with a fixing element in the shape of a screw 23 engaging into said slot 22 , whereby when removing the injected casting from the mold the core body 12 remains in the mold and is manually returned toward the circumferential strips 5 of the mold ; alternatively , a spring ( not shown ) can be provided caring for this return movement . according to fig1 a core of the mold forms a dovetail recess on the side of the injected molding . the core comprises a mobile core body 12 provided with two fixing extensions 25 situated in a recess 27 of the circumferential strip 5 . the fixing extension 25 , for instance bolts , are mutually connected by a leaf spring 24 . an abutting bolt 26 is provided in the center of the spring 24 . due to this design , the core is shifted in the direction of shrinking of the solidifying plastic material . another arrangement for forming a dovetail recess in a side wall is shown in fig1 . such arrangement is disposed in the base plate 1 and in the circumferential strip 5 of the mold . the fixing extension 25 of the core body 12 is shiftably in a recess 27 of the circumferential strip 5 of the mold and its end is provided with a coil compression spring 29 situated in a sleeve 28 closed by a nut 30 . the spring 29 maintains the core pressed against the circumferential strip 5 of the mold and permits movement of the core due to shrinking of the plastic material after the core has been surrounded by the melt . in fig1 the core of the mold forms an opening in the wall of the injected casting . the core has a ferromagnetic fixing extension 25 of the core body 12 engaging in a recess 27 of the circumferential strip 5 of the mold . the shaped fixing extension 25 is fixed in the circumferential strip 5 of the mold by means of a permanent magnet 31 also disposed in the recess 27 . in the embodiment of fig1 the fixing extension 25 is fixed in a recess 27 in the circumferential strip 5 of the mold by means of a holder 32 on which a steel spring 24 bears . the extremity of the holder 32 in the recess of the circumferential strip 5 is provided with a coil compression spring 29 . although the invention is illustrated and described with reference to a plurality of preferred embodiments thereof , it is to be expressly understood that it is in no way limited to the disclosure of such a plurality of preferred embodiments , but is capable of numerous modifications within the scope of the appended claims .	1
referring to fig1 , an example motor vehicle 10 is shown having a vehicle body 12 that includes a rear compartment or bed 14 enclosed by side panels 16 and 18 as well as a tailgate 20 . a counterbalance hinge assembly 22 pivotally supports the tailgate 20 between the side panels 16 and 18 in a manner to be described in greater detail below . the tailgate 20 is pivotally supported between pillars formed by the side panels 16 and 18 . in the example shown , side panels 16 and 18 and the tailgate 20 are formed by respective inner and outer panels 24 and 26 of sheet metal joined at the ends by overlapping flanges or the like . in other examples , other materials may be used in constructing the side panels 16 and 18 and the tailgate 20 . the example counterbalance hinge assembly 22 includes a torque rod 30 , which is linear and aligned along a pivotal axis between the side panels 16 and 18 . the torque rod 30 carries first and second end assemblies 32 and 34 . the first and second end assemblies 32 and 34 enable the torque rod 30 to be secured with respect to the tailgate 20 at one end , and with respect to the side panels 16 and 18 at a second end . in the example shown in fig2 , the first end assembly 32 pivotably supports the tailgate 20 at the left body pillar including inner panel 24 . the first end assembly 32 forms a left side vehicle hinge pin that includes a pivot member 40 having a cylindrical boss 42 and a mounting stem 44 . the mounting stem 44 secures the pivot member 40 to the vehicle pillar at the inner panel 24 . in one example , the stem 44 may be a square housing received in a square opening in the inner panel 24 of the left side panel 16 , and secured in position by welds , adhesive or other fasteners . in other examples , the stem 44 may include a threaded member that is received in a weld nut 45 mounted on a surface of the inner panel 24 . the first end assembly 32 receives an end of the torque rod to be secured to the tailgate 20 . this connection includes a bushing 46 , which is pivotally or rotatably received about the cylindrical boss 42 . in one example , the bushing 46 includes a cylindrical receptacle 48 and a stem 50 . the stem 50 includes an exterior configuration that is faceted to be retained in an opening 52 in a tailgate wall 23 of the tailgate 20 . as used herein , a facet refers to any cross - section having at least one surface discontinuity that prevents rotation within a correspondingly shaped , compatible piece . in other examples , the bushing 46 is welded or otherwise attached to the tailgate wall 23 . one example stem 50 is modified or faceted to mount to the tailgate 20 . in another example , the surface of the receptacle 48 may fit in an enlarged opening in the tailgate wall 23 aligned with the pivotal axis and extending through a portion of the tailgate wall 23 . the receptacle 48 , or the stem 50 may be configured exteriorly or otherwise fastened to avoid relative rotation between the bushing 46 and tailgate wall 23 so that the bushing 46 that receives the torque rod pivots with the tailgate 20 . fig3 illustrates an exploded view of the example counterbalance hinge assembly 22 of fig2 . the stem 50 includes a chamber 66 that receives an end portion of the torque rod 30 . the end portion is faceted and corresponds to the chamber 66 as shown to lock the bushing 46 to the torque rod 30 . in one example , the torque rod 30 comprises a hexagonal shaft end and the opening 66 is compatibly configured to avoid relative rotation between the bushing 46 and the torque rod end 67 . the second end assembly 34 includes a vehicle hinge pin for pivotally carrying the tailgate 20 adjacent to the right side panel 18 and includes a spriget 70 . the spriget 70 combines a key 78 with a mounting stem 72 for securing the key 78 to the right hand side panel 18 . the mounting stem 72 is received in an opening 76 . a fastener such as nut 77 ( fig2 ) or the like may be used to fasten the stem 72 to the side panel 18 . the key 78 has an elongated shape , the elongated shape being aligned in a direction intermediate the vertical , closed and the horizontal , open positions of the tailgate 20 to define a removal direction along the elongated axis of the key body 78 . the key 78 is received in the slot 83 of a bushing 90 and in the slot 84 of the pivot body 80 . the second end assembly 34 also includes a pivot body 80 having a cylindrical body 82 with a radial slot 84 aligned for reception of the key 78 . the pivot body 80 includes a stem 86 having a chamber 88 adapted to receive and secure the right end 87 of the torque rod 30 . the assembly 34 also includes a bushing 90 which can be mounted within an opening 85 of the tailgate wall 23 . the bushing 90 includes a chamber 92 adapted to pivotally receive body 82 of the pivot body 80 . in one example , the bushing 90 includes a stem 94 received in the correspondingly configured opening 85 . the configuration of the opening 85 may non - rotatably retain the bushing 90 in the inner wall of the tailgate 20 . the bushing 90 may be retained in the opening 85 by a retainer , for example , a snap ring 91 engaged in a groove on the stem 94 . in one example , the stem 86 includes a groove 89 that receives a snap ring 91 at a position adjacent the end of stem 94 . when assembled , the right hand end 87 of the torque rod 30 is retained in a stationary position by the pivot body 80 passing through the bushing 90 mounted in the tailgate 20 . the rigid connection to the body side panel 18 is made by the bracket 74 and spriget 70 as assembled as discussed above . the left hand end 67 of the torque rod 30 is retained by the tailgate wall 23 to move with the tailgate 20 . thus , as the tailgate 20 is moved between the upright , closed position and the horizontal , open position , the torque rod 30 twists . in one example , the unbiased position of the torque rod 30 occurs when the tailgate 20 is aligned with the elongated axis of the key 78 , whereby spring tension is introduced to pivot the tailgate 20 away from the closed position when it is unlatched , and to raise it to the closed position when it has been unlatched from its open position . fig4 is an exploded view of another example counterbalance hinge assembly 22 with demonstrates a modification that eases assembly and repair . the stem 50 of the bushing 46 is correspondingly sized to fit in the opening 85 of a tailgate panel attachment bracket 54 . the attachment bracket 54 may provide the benefit of reinforcing the end panel of the tailgate and simplifying the formation of opening 52 that receives the bushing 46 . rather than trying to form a properly sized and configured opening 56 in the tailgate wall 23 , the bracket 54 with opening 85 is placed next to an enlarged opening 56 in the tailgate wall 23 . the openings 85 and 56 are aligned with the pivotal axis extending through the tailgate 20 . in one example , an upper flange 58 is bolted to the tailgate wall 23 of the tailgate 20 with a bolt and nut 60 and 62 . in other examples , welds or other fasteners secure the flange 58 . the opening 85 is configured to avoid relative rotation between the stem 50 and the opening 56 such that when assembled , both the installation bracket 54 and the bushing 46 pivot with the tailgate 20 . the bracket 54 includes a releasable engagement clamp 104 on a flange 64 that is angled relative to the flange 58 . the clamp 104 includes a clamp seat 106 raised up through the tailgate wall 23 to align the clamp 104 on the pivotal axis . in the example shown , the bracket 54 includes an offset arm , bent as shown , to provide a raised position for the clamp 104 above the plane of the flange 64 . the seat 106 includes a cavity 108 which is aligned with the pivotal axis extending through the opening 56 and the bushing 46 . a clamping flange 110 includes a recess 112 configured in compliance with the faceted segment of the torque rod 30 such that clamping of the flange 110 against the clamping seat 106 rotationally fixes the torque rod 30 with respect to the bracket 54 , and thus the tailgate 20 . the raising of the clamp 104 to align the axis of the torque rod 30 with the pivotal axis by the raised seat 106 provides room for fasteners , such as the head of a rivet extending through aligned apertures in the seat 106 and the flange 110 . in one example , a single rivet 114 is used to retain one side of the flange 110 with the seat 106 . on the opposite side , the flange 110 includes a weld nut 116 that threadably receives a fastener 118 extending from beneath the seat 106 . the opening 119 in a bracket 96 is aligned with opening 98 , and mounted to the outside of the tailgate wall 23 . the bushing 90 carried by the bracket includes a chamber 92 adapted to pivotally receive body 82 of the pivot body 80 . in one example , the bushing 90 includes a stem 94 received in the correspondingly configured opening 119 . the configuration of the opening 119 rotationally fixes the bushing 90 to the tailgate wall 23 . as a result , the counterbalance hinge assembly 22 may provide the benefit of loose assembly , and thus can be positioned before spring tension is applied to the counterbalance hinge assembly 22 . in one example assembly method , brackets 54 and 96 are attached to the tailgate 20 , by welding such that configured openings 85 and 119 align with the openings 52 and 98 in the tailgate wall 23 . this may beneficially enable configured openings 85 and 119 to be preferably sized , shaped and positioned after the tailgate has been manufactured , and overcomes the difficulty of shaping , sizing and aligning the apertures of the original tailgate panel stampings . the fastener 118 is initially installed in a pre - production or fabrication assembly procedure , for example , and left loose for tightening at the assembly plant . at the assembly plant , the entire bracket 54 is secured by welding or other fastening means to the tailgate 20 . an aperture at the bottom of the tailgate receives the clamp 104 of the bracket 54 . the torque rod 30 , carrying pivot body 80 at end 87 , is positioned such that end 67 is inserted through opening 98 to extend across the vehicle body 12 through the tailgate 20 and into the faceted , complementary hole formed by the recesses 112 and 108 . the torque rod 30 is inserted through the bushing 90 , which is already attached to bracket 96 in a prior operation . the fastener 118 is then tightened to provide proper biasing between the vertical , closed and horizontal , open positions . the assembly discussed above provides an assembly for simply removably mounting a closure member between spaced apart body side panels of a vehicle body by using a linear torque rod extending across the tailgate . the assemblies provide means for connecting the torque rod in driving engagement with the vehicle body hinge pin within the bushing and independently of the rotatable support of the bushing on the hinge pin . the illustrative examples permit the bushing 90 to be received laterally downwardly over at least a portion of the vehicle body hinge pin when the tailgate 20 is in the removal position . accordingly , the torque rod 30 is twisted in tension when the closure member is pivoted to either the closed or open positions from the removal position . this tension provides a counterbalancing effort to assist with pivotal movement of the tailgate 20 . the counterbalance hinge assembly 22 may permit facile removal of the closure member from the vehicle body when the closure member is in the removal position . although a preferred embodiment of this invention has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of this invention . for that reason , the following claims should be studied to determine the true scope and content of this invention .	4

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.