Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
the present invention relates to a new method of coat - finishing polyester fabrics , specifically , to a new method of coat - finishing polyester fabrics to produce anti - migration properties . ( 1 ) a uniform resin composition is formed by adding a cyclic compound of a non - reductive , maltooligosaccharine , a cyclodextrin in which 6 - 8 units of glucose exists in α - 1 , 4 glucoside - bonded form , to the coating resin composition . ( 2 ) this uniform resin composition is coated on the fabric surface by known methods . in the present invention , polyester fabric means fabrics in which polyester is one component , such as polyester - nylon , polyester - cotton , polyester - rayon and polyester - acrylic blends , as well as 100 % polyester fabrics . the coating effect is especially high in the case of 100 % polyester fabrics dyed with disperse dyes . among the cyclic compounds of non - reductive maltooligosaccharide , cyclodextrin , in which the glucose unit is composed of 6 - 8 , α - 1 , 4 glucoside bonds , has good solubility in polar and nonpolary solvents and is not changed chemically on heat - setting due to its high stability above 180 ° c . moreover , since the above cyclodextrin has good compatibility with the coating resin , it does not limit the choice of the resin and it is possible to obtain a coating material having various properties . and it is possible to obtain a sufficient anti - migration property with even a small amount , since the cyclodextrin is uniformly dispersed into the coating layer , due to the uniform resin composition . since the cyclodextrin in the coating layer has good affinity towards disperse dyes , which migrate in the course of coating processes or sewing , handling and using , the cyclodextrin fixes the disperse dyes , which prevents migration ; thus staining of white or light color fibers which come into contact with the coating layer does not occur . the amount of cyclodextrin to be used depends , in particular , on the content of the disperse dye existing in the polyester fabrics ; generally a suitable amount is 1 . 0 - 15 weight % based on the weight of the fabrics , preferably 2 . 0 - 10 weight %. when the amount of cyclodextrin is less than 1 . 0 weight %, the effect is not sufficient and if the amount of cyclodextrin is more than 15 weight %, it is not economical , since no further improvement in the anti - migration property is obtained . furthermore , cyclodextrin having repeating units of glucose of less than 5 or more than 9 is very expensive , and not economical in comparison to the preferred cyclodextrin . resins for coat - finishing are not particularly limited , but one or more resins selected from acrylic , urethane , silicone , fluorinated vinyl chloride , amide , cellulose , peptide and rubber resin can be used for clothes , generally urethane and acrylic resins are used . as a process of coat - finishing , dry processes , wet processes , melt cooling processes and laminating processes can be used without limitation . a suitable process should be selected , depending on the resin used and the appearance characteristics of the coating layer . the polyester coated fabrics according to the present invention have excellent mechanical properties , chemical resistance , feel , aesthetic properties and economical efficiency as compared to nylon and cotton fabrics . the coating compositions can be applied as coatings for clothes , such as moisture - permeable water proof and water - repellent and water proof materials and can be widely applied to industrial use . the following examples will be given by way of illustration of the present invention but are not construed as limiting thereof . the polyester fabrics which are used in examples and comparative examples are plain fabrics constituted of polyester 100d / 192f as warp and polyester 75d / 72f as weft , and having a warp of 216 ply / inch and a weft of 94 ply / inch . polyester fabrics were dyed with a disperse dye at 130 ° c . for 45 min ., and washed by known methods , heat - set at 170 ° c . and coated . blue fabric was dyed with dispersol blue b - r ( ici , c . i . disperse blue 56 ) 5 % o . w . f ., red fabric was dyed with dispersol red b - 2b ( ici , c . i . disperse red 60 ) 5 % o . w . f ., yellow fabric was dyed with miketon polyester yellow f3g ( mitsui doatsu dyestuff co ., c . i . disperse yellow 54 ) % 5 o . w . f ., and black fabric was dyed with miketon polyester black pbsf ( mitsui doatsu dyestuff co .) 10 % o . w . f ., respectively . migration of the coated fabrics was measured by japanese industrial standard , jis l 0854 , wherein a white polyester fabric , coated with a conventional , non - cyclodextrin containing resin , was contacted with the dyed fabrics of the examples . the fabrics were inserted between two pieces of glass and pressed together with a 4 . 5 kg weight . the samples were kept in a constant temperature and moisture apparatus of 120 ° c .± 2 ° c . for 80 min ., and cooled to room temperature . the migration state from sample to the appended white fabrics was graded with a grey scale for staining . the coating resin which was used in examples and comparative examples is as follows . ______________________________________1 . polyester system polyurethane resin crisvon 8006hv : dainippon ink and chemical manufacture pararesin u - 11 : ohara paragium co . manufacture2 . acrylic resin criscoat p - 1018a : dainippon ink and chemical manufacture3 . amino acid resin luckskin ua - 3295a , b : seiko chemical co . manufacture______________________________________ and the result of examples and comparative examples were shown in table 1 . a uniform coating resin composition composed of crisvon 8006hv urethane resin , 90 parts , dmf ( demethylformamide ), 50 parts , cyclodextrin having 7 repeating units of glucose , 10 parts and a crosslinking agent , 5 parts , was coated on test fabrics by gravure coating machine . the coated fabrics were coagulated in water , dried and heat - set , so that the adhesion amount of cyclodextrin in the fabrics was 5 % o . w . f . a uniform coating resin composed of crisvon 8006hv urethane resin , 90 parts , dmf 50 parts , cyclodextrin having 5 repeating units of glucose , 15 parts and a crosslinking agent , 5 parts , was coated on test fabrics as in example 1 , so that the amount of cyclodextrin was 2 . 5 % o . w . f . a uniform coating resin composed of crisvon 8006hv urethane resin 90 parts , dmf 50 parts , cyclodextrin having 8 repeating units of glucose , 15 parts and a crosslinking agent 5 parts was coated on test fabrics as in example 1 , so that the amount of cyclodextrin was 7 . 5 % o . w . f . a resin prepared by dissolving crisvon 8006hv urethane resin , 100 parts , in dmf 30 parts was coated on test fabrics as in example 1 . a uniform coating resin composed of crisvon 8006 hv urethane resin , 90 parts , dmf 50 parts , cyclodextrin mixture having 6 - 8 repeating units of glucose , 20 parts and a crosslinking agent , 5 parts , was coated as in example 1 , so that the amount of cyclodextrin mixture was 7 % o . w . f . when crisvon 8006 hv urethane resin was used in the above examples , crisvon nx ( dainippon ink and chemical co .) was used as crosslinking agent . a uniform resin composition composed of cyclodextrin having 7 repeating units of glucose , 10 parts , dmf 30 parts , parkresin u - 11 , 100 parts , cat . u , which is the mixture of crosslinking agent and catalyst , 10 parts and ammonia water , as viscosity increasing agent , was knife coated on test fabrics . coated fabrics were dried and heat - set , so that the amount of cyclodextrin was 3 % o . w . f . a uniform resin composition composed of pararesin u - 11 , 100 parts , cat . u , 10 parts and ammonia water was coated on test fabrics as in example 5 . a resin composition composed of criscoat p - 1018 a acrylic resin , 100 parts , crisvon cl - 3 ( dainippon ink and chemical co .) as isocyanate system crosslinking agent , 3 parts , toluene , 2 parts and cyclodextrin having 7 repeating units of glucose , 10 parts , was knife coated on test fabrics . the coated fabrics were dried and heat - set , so that the amount of cyclodextrin was 8 % o . w . f . a resin composition composed of criscoat p - 1018 a acrylic resin , 100 parts , isocyanate system crosslinking agent , 3 parts , and toluene , 2 parts , was coated as in example 6 . a uniform resin composition composed of luckskin 3295 a amino acid resin , 50 parts , luckskin 3295 b amino acid resin , 50 parts , luckskin cl - 100 as crosslinking agent ( seiko chemical co . ), 2 parts , dmf , 20 parts , cyclodextrin having 7 repeating units of glucose , 10 parts , was coated on test fabrics by gravure coating machine . the coated fabric was coagulated , washed , dried and heat - set , so that the amount of cyclodextrin was 4 % o . w . f . a resin composition composed of luckskin 3295 a amino acid resin , 50 parts , luckskin 3295 b amino acid resin , 50 parts , luckskin cl - 100 , 2 parts , dmf , 20 parts , was coated as in example 7 . table 1______________________________________ fastness to sublimation ( staining , grey scale ) section blue red yellow black______________________________________example 1 4 - 5 4 - 5 5 4example 2 4 4 4 - 5 3 - 4example 3 4 - 5 4 - 5 4 - 5 4example 4 5 5 5 4 - 5example 5 5 4 - 5 5 4example 6 5 5 5 4 - 5example 7 4 4 4 4comparative 2 1 - 2 2 1example 1comparative 2 2 2 1 - 2example 2comparative 2 2 2 1 - 2example 3comparative 2 2 2 1 - 2example 4______________________________________	3
in order to implement legacy ieee 802 . 11 coding and interleaving schemes and systems , coding schemes are implemented to move bit padding in the physical or phy layer from before coding ( encoder ) to after coding ( encoder ). exemplary implementations include an encoder module in devices to provide for such schemes and processes . fig1 is an illustrative system 100 that implements coded bit padding . the system 100 can include multiple devices 102 in communication with one another . in this example , the system includes a device 102 ( 1 ) with an encoding module 104 ( 1 ). device 102 ( 1 ) is coupled via a wired connection 106 to a device 102 ( 2 ). device 102 ( 2 ) includes an encoding module 104 ( 2 ). system 100 further includes a device 102 ( 2 ) in wireless communication 108 with device 102 ( n ). device 102 ( 3 ) includes an encoder module 104 ( 3 ), and device 102 ( n ) includes an encoder module 104 ( n ). encoder modules 104 are implemented to provide coded bit padding for ofdm symbols transmitted by devices 102 . in certain implementations , the devices 102 may include ofdm modules ( not shown ) to generate an ofdm signal . each device 102 can include a transmitter , receiver , or transceiver to convey output ( i . e ., ofdm symbols ). these transmitters , receivers , or transceivers may be configured to convey the output via an electrical conductor , electromagnetic radiation , or both . each device 102 includes one or more processors ( described below ) and a memory ( described below ) coupled to the processor ( s ). devices 102 can include wireless access points , radio frequency transceivers , software defined radios , modems , interface cards , cellular telephones , portable media players , desktop computers , laptops , tablet computers , net books , personal digital assistants , servers , standalone transceiver interfaces , and so forth . in exemplary operations , communication in system 100 can implement an 80 mhz channel , or higher such as 120 mhz or 160 mhz and 256 qam ( quadrature amplitude modulation ). in legacy ieee 802 . 11 , such features can be problematic for data tone selection . the encoding schemes and processes ( i . e ., encoding module 104 ) described herein , are directed to such issues . the number of data tones implemented by system 100 may be even tone counts of 216 , 220 , 222 , 224 , 228 , 230 , 232 and 234 for a 80 mhz system . these numbers are based on the reuse of the ieee 802 . 11n interleaver structure , and data bit flow . this is in addition to having a minimum tone count of at least two times the 40 mhz ( i . e . 80 mhz ) ieee 802 . 11n system . the described encoding schemes consider the addition of 256 qam , with code rates such as 2 / 3 and 5 / 6 , where the number of data tone count options drops by a half . this is due the numerology and flow used in the ieee 802 . 11a / n standard . a code rate of 2 / 3 is attractive when coupled with 256 qam . the 2 / 3 code rate is more effective from a transmitter power amplifier perspective , than rates such as 3 / 4 or 7 / 8 , and can allow a decrease in power consumption or a less expensive device 102 to be utilized when implementing the same transmit range as legacy ieee 802 . 11 systems . furthermore , if legacy 20 mhz ieee 802 . 11 systems use 256 qam , coding rates of 2 / 3 or 5 / 6 may not be used . this can be the case , because providing new tone allocation ( configurations ) may not fit exactly in an integer number of ofdm symbols , unlike legacy ieee 802 . 11 systems that have data tone counts and modulation and coding that create payloads that fit exactly in an integer number of ofdm symbols . for legacy ieee 802 . 11 encoding schemes , consideration can be made for two constraints , which depend on the ofdm symbol size and the encoder ( encoding module 104 ). the first constraint is that the number of coded bits per ofdm symbol or ncbps should be an integer . the second constraint is that the number of data bits per ofdm symbol or ndbps should also be an integer . an integer for ndbps can assure that all data lengths work with no additional padding using the current ieee 801 . 11 a / n equations . if ndbps is not an integer , then many payload sizes can result in a non - integer number of padding bits , or the number of encoded bits exceeding the number of ofdm symbols . in either case , this leads to a minimum of one additional ofdm symbol that is not needed , which includes only padding bits . current ieee 802 . 11a / n equations require that ncbps and ndbps be integers . in certain cases , the ieee 802 . 11a / n equations the padding bits to be added can be a non integer , which results in the inability to fill out the packet . the schemes processes described herein are not limited to by the having ncbps and ndbps to be integers . the schemes and processes that are described provide that for data tone counts to be used with various modulation or coding scenarios , to move the bit padding operation from the input of the encoder ( coding ), to the output of the encoder ( coding ), after the bits have been encoded . the following equation ( 1 ) can be used to compute the number of padding bits to fill out the least number of ofdm symbols to transmit the media access control or mac payload . where n pad is the number of padded symbols to be added ; n sym is the number of ofdm symbols based on the equation in ieee 802 . 11a / n standard ; n sym is the number of data tones ; n macbytes is the number of mac layer bytes that are being passed to the phy layer ; 16 is the length of the service field ; and 6 is the length of the tail bits . this bit padding approach can remove an ieee 802 . 11 requirement on the ndbps and ncbps for data tone allocation , with a number of modulation and coding combinations . the bit padding approach is also intended to be backwards compatibility with ieee 802 . 11 systems / standards incorporated into current and legacy ieee 802 . 11 processing chains . furthermore , such a bit padding approach can allow for various combinations of data tones , modulation , and coding without restricting one of the aforementioned variables . in particular , restricting the number of data tones can lower system data rate , as would disallowing 256 qam . restricting the coding can , as discussed above , potentially increase cost or power consumption . in prior or legacy ieee 802 . 11 systems , the numerology can only allow for integer data bits per ofdm symbol and integer number of coded bits per ofdm symbol . a new signal field can be required for next generation ieee 802 . 11 systems , where knowledge of the padding method and number may have to be known . the bit padding approach can provide modulation and coding rates used in bandwidths of 60 to 160 mhz , and in particular 80 mhz . fig2 illustrates an exemplary device 104 that implements coded bit padding . the device 104 includes devices 104 ( 1 ), 104 ( 2 ), 104 ( 3 ) and 104 ( n ). device 104 describes certain components and it is to be understood that described components can be replaced with other components , and combined with one another . additional components and devices may also be included in device 104 . a host microprocessor or processor 200 , which can include multiple processors , is provided . the processor 200 can be connected or coupled to a memory 202 . memory 202 can include multiple memory components and devices . the memory component 202 can be coupled to the processor 200 to support and / or implement the execution of programs , such as key generation and delivery protocol . the memory component 202 includes removable / non - removable and volatile / non - volatile device storage media with computer - readable instructions , which are not limited to magnetic tape cassettes , flash memory cards , digital versatile disks , and the like . the memory 202 can store processes that perform the methods that are described herein . in an implementation , the ieee 802 . 11 standard is extended and implemented by device 104 . therefore , in such an implementation , device 104 includes particular hardware / firmware / software configurations to support the ieee 802 . 11 standard . device 104 implements a common medium access control or mac layer , which provides a variety of functions that support the operation of ieee 802 . 11 based wireless communications . as known by those skilled in the art , the mac layer manages and maintains communications between ieee 802 . 11 wireless communication devices by coordinating access to a shared radio channel and utilizing protocols that enhance communications over a wireless medium . the mac layer uses an 802 . 11 physical or phy layer , to perform the tasks of carrier sensing , transmission , and receiving of ofdm symbols . the device 104 further includes encoder module 104 . the encoder module 104 , which is further described below , is used to perform receiving data bits , encoding ( coding ), modulating , and outputting ofdm symbols . furthermore , one or more antennae 206 ( 1 ) to 206 ( n ) can be included with or connected to the device 104 . antennae 206 can include multiple antennae for multiple input , multiple output ( mimo ) operation . antenna 210 can be configured to receive and send transmission . fig3 illustrates an exemplary encoder module 104 for bit padding . the particular operating parameters described are illustrative and are not intended to be limiting . it is to be understood that other operating parameters may be implemented . in this example , encoder module 104 can operate using an 80 mhz transmission bandwidth with 224 data tones , implementing 256 qam with a code rate of 2 / 3 . the data bits 300 , include 200 bytes ( 200 * 8 ) or 1600 data bits , which are passed from the mac layer . the data bits 300 are passed onto a payload represented by a service field 302 having 16 bits , the data bits 304 ( 1600 data bits ), and tail bits 306 . the tail bits 306 are used to flush the encoder module 104 . the payload is sent to a scrambling process 308 and encoded 310 at a 2 / 3 rate . the scramble 308 and encode 310 can be presented as a coding or encoding module 312 . addition of padding bits represented by module 314 , is performed . in this example , 1151 symbols or bits are added . interleaving and modulation mapping can be performed as shown in module 316 . an output buffer 318 receives the interleaved and modulated symbols which included 3584 coded symbols or 450 modulation signals . a minimal number of ofdm symbols represented by ofdm symbol 1 320 and ofdm symbol 2 322 is shown . the ofdm symbol 1 320 and ofdm symbol 2 are output of the output buffer 318 . in contrast to schemes that implement the use of padding bits prior to coding or encoding ( i . e ., encoding 312 ), no extra padding bits are needed , and no extra ofdm symbol is generated . fig4 is a flow chart for an example process 400 for coded bit padding . as an example , the code bit padding may be performed using the encoder module 104 of the device 102 . the order in which the method is described is not intended to be construed as a limitation , and any number of the described method blocks can be combined to implement the method , or alternate method . additionally , individual blocks can be deleted from the method without departing from the spirit and scope of the subject matter described herein . furthermore , the method can be implemented in any suitable hardware , software , firmware , or a combination thereof , without departing from the scope of the invention . at block 402 , receiving a data payload for ofdm transmission is performed . as discussed above , the data payload can be passed from the mac layer to the phy layer . the received payload can include data bits along with service data bits and tail bits . the data payload may be determined by a number of data tones , which as discussed above , can be an even number tone count . at block 404 , coding or encoding is performed on the data payload . as discussed above , 256 qam may be implemented , and code rates such 2 / 3 or 5 / 6 . furthermore , bandwidth operation can include 60 to 160 mhz , and particularly 80 mhz . at block 406 , adding padding bits is performed . the number of padding bits may be derived by the following equation as discussed above , to fill out the least number of ofdm symbols to transmit the media access control or mac payload . where n pad is the number of padded symbols to be added ; n sym is the number of ofdm symbols based on the equation in ieee 802 . 11a / n standard ; n sym is the number of data tones ; n macbytes is the number of mac layer bytes that are being passed to the phy layer ; 16 is the length of the service field ; and 6 is the length of the tail bits . in addition , interleaving and modulation may occur after padding bits are added . at block 408 , outputting a minimal number of ofdm symbols is performed . the number of coded bits per ofdm signal or ncbps can be an integer . also , the number of data bits per ofdm signal or ndbps can also be an integer . although specific details of illustrative methods are described with regard to the figures and other flow diagrams presented herein , it should be understood that certain acts shown in the figures need not be performed in the order described , and may be modified , and / or may be omitted entirely , depending on the circumstances . as described in this application , modules and engines may be implemented using software , hardware , firmware , or a combination of these . moreover , the acts and methods described may be implemented by a computer , processor or other computing device based on instructions stored on memory , the memory comprising one or more computer - readable storage media ( crsm ). the crsm may be any available physical media accessible by a computing device to implement the instructions stored thereon . crsm may include , but is not limited to , random access memory ( ram ), read - only memory ( rom ), electrically erasable programmable read - only memory ( eeprom ), flash memory or other solid - state memory technology , compact disk read - only memory ( cd - rom ), digital versatile disks ( dvd ) or other optical disk storage , magnetic disk storage or other magnetic storage devices , or any other medium which can be used to store the desired information and which can be accessed by a computing device .	7
reference will now be made in detail to the preferred embodiments , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to like elements throughout . there have been discussions in connection with 3gpp frequency division duplex ( fdd ) enhanced dedicated channel , or enhanced uplink ( e - dch ) relating to how radio resource management ( rrm ) for uplink ( ul ) resources and the corresponding scheduling of e - dch resources in the network can be improved . the proposals consider measurements by a radio network controller ( rnc ). e - dch is a packet oriented uplink channel especially suited for high data rates and bursty transmission . the received power used by user equipments ( ues ) in the uplink is managed by a base station ( bs ) in order to improve utilization of uplink noise rise . however since the network is responsible for overall rrm , including legacy channels , noise rise in the bs receiver needs to be carefully controlled by the network . radio resource management is a method whereby the network controls how many ues come into a node b . noise contributed by each ue is measured , so that the network can determine if the number of ues in a cell is at its maximum , or whether it can be increased , or whether the data rate of existing ues in the cell can be increased . fig1 shows a typical arrangement of cells 1 , 2 , 3 in a network 4 controlled by an rnc 5 . the rnc sends instructions via radio network links 6 to each node b nb 1 , nb 2 , nb 3 setting limits of maximum noise rise . each node b then subdivides the available noise rise in a known manner and signals to each ue 7 , 8 , 9 ( and 10 , 11 , 12 ) the maximum which is available to it . fig2 illustrates how one ue 12 can have an impact on the noise at more than one node b nb 2 , nb 3 . e - dch transmissions 13 from the ue are received at both nb 2 , its serving node b and a non - serving node nb 3 . the serving node b can send absolute grants 14 and relative grants and the non - serving node b sends relative grants 15 . the rnc communicates the maximum noise rise to each node b . although , ue 12 is not served by nb 3 , its position is such that it can interfere with ues served by nb 2 , so the rnc needs to be able to control this effect . fig3 illustrates how different types of noise make up the noise rise at a node b . for all node bs there is a certain amount of noise whose source is unknown and which cannot be compensated for . this unknown noise 16 is the minimum . added to this is an amount of noise caused by the receiver itself , e . g . due to the components 17 . noise produced due to communication can be broken down into noise from other cells 18 , noise 19 from other channels communicating via the node b which are not operating enhanced uplink ; and noise 20 at the node b caused by its served ues operating e - dch . as described in more detail below , the method allows a received total wideband power value to be determined for each of the operating noise types , 18 , 19 , 20 . an additional variable is that at different ambient temperatures the component noise 17 will vary . it will be least at the daily minimum and usually greatest at the daily maximum . the increase in this noise 17 is indicated by the dotted line 21 . the maximum permitted noise rise in the cell is indicted by the level 22 . to optimize efficiency , it is desirable to get as close to this level without exceeding it . in order to effectively manage overall rrm , it is necessary for the rnc to be able to set targets for the bs for the uplink resources that it manages and monitor the usage of these resources ( noise rise ) by the bs . currently the only suitable measurement in this area is received total wideband power ( rtwp ) at the bs receiver . rtwp measures uplink interference and so can be used to determine the overall noise rise if the noise level at the bs is known . rtwp measured at an antenna is analog and takes into account the receiver behavior . rtwp is measured in a quiet period with no 3g transmissions , so only hardware or random other noise outside the control of the node b is measured . the measured quiet rtwp is either stored at the node b or returned to the rnc to give a basic level of noise from which to calculate the e - dch generated noise . examples of determination of the optimum quiet period t 0 based on statistical cell traffic analysis are described below . the phase of low traffic activity within one day can be determined by analyzing the cell traffic of an example cell , cell x and other cells close to cell x for a number of days . this can be analyzed in the rnc . this analysis provides a time dependent probability for low traffic activity on a cell basis in terms of a time window where the probability for low traffic activity is the lowest for cell x and the surrounding cells . the optimal time t 0 within this time window is either when there is no traffic in cell x , by setting a threshold , or at a time when the traffic is predicted to be lowest based on the statistics . the time t 0 can be signalled from the rnc to the node b , alternatively the rnc signals only the time window and the node b decides t 0 within this time window autonomously . to determine the noise rise share of e - dch users , a sum of received signal code power ( rscp ) of all ues using e - dch is determined . rscp in the node b is not defined as a measurement in the standard , but such a determination of the code power can be easily done in the digital domain node b , since the signal to interference ratio ( sir ) measurement also requires this functionality . knowledge of corresponding scrambling and spreading codes that are used is required . rscp is a digital measurement , from which after decoding channels , the node b knows all transmission power levels and where they are from . the ue from which these come may or may not be served by that node b . in order to compensate errors when referencing such an rscp value to the antenna connector , e . g . due to rf gain variations , this is a relative measurement . e ⁢ - ⁢ d ⁢ ⁢ c ⁢ ⁢ h ⁢ ⁢ noise total ⁢ ⁢ uplink ⁢ ⁢ noise = sum ⁢ ⁢ of ⁢ ⁢ all ⁢ ⁢ e ⁢ - ⁢ d ⁢ ⁢ c ⁢ ⁢ h ⁢ ⁢ r ⁢ ⁢ s ⁢ ⁢ c ⁢ ⁢ p ⁢ ⁢ in ⁢ ⁢ cell ⁢ ⁢ x r ⁢ ⁢ t ⁢ ⁢ w ⁢ ⁢ p ⁢ ⁢ in ⁢ ⁢ cell ⁢ ⁢ x ( note : this is a linear description , in db it would be a difference ) such a measurement reported from a node b to an rnc allows determination of the share of the sum of all enhanced ul ( e - dch ) channels from other cells ( for which cell x is called non - serving cell ); and other intra cell interference in cell x ( e . g . rach or hs - dpcch in cell x ) to the total ul noise . as the sum of all enhanced ul ( e - dch ) channels for which cell x is the serving cell and the sum of all enhanced ul ( e - dch ) channels from other cells ( for which cell x is called non - serving cell ) are controlled by cell x in a different way , the former , serving cell is controlled by absolute grant ( ag ) or relative grant ( rg ) up / hold / down commands , and the latter , non - serving cell is controlled only by rg down / hold command , then these noise types can also be further distinguished into : this allows an even more detailed control of the ul interference caused by e - dch and such information can be used in the node b scheduler as well as in the admission control by the rnc . it is also possible to calculate and report to the rnc for a finer admission control the ratio of : measurement of rscp applies more overall accuracy to control the noise rise by taking into account the type of use of each ue . in an active cell , an increase in noise occurs when physical receiver characteristics change due to variation in ambient temperature , e . g . at a different time of day . in some places temperatures may vary significantly between night and day , such as from 2 ° c . to 40 ° c . a further feature provides a method of dealing with these temperature induced changes , by measuring the temperature at the node b when the later measurement is made and using a lut to determine how characteristics change due to temperature , a correction is applied to improve the accuracy of the total noise measurement . this method can be used in conjunction with the rscp measurements , or separately . it is necessary to know how much e - dch alone contributes to the measured differential , rather than from other cells in the vicinity . conventionally , it has not been possible to determine an indication of the share of interference or noise rise resulting from e - dch transmissions compared to that used for other transmissions such as legacy dedicated channel ( dch ), forward access channel ( fach ) etc ., although , this can be done using rscp as described above . a scheduler in the node b determines the available noise rise for all ues and allocates a local maximum for each . transmission at a higher data rate means more noise , so fewer ues can transmit . the node b allocates to the ue a maximum data rate that it can used and from this it is possible to determine the noise that this data rate will create at the node b ), so the node b must measure the actual noise correctly to keep within the allocated maximum . in a known system , the rnc can command that a certain portion of the noise rise ( target noise rise ) be used by the scheduler for e - dch noise rise at the bs , or node b receiver , but the node b has no way of informing the rnc about the actual status , i . e . the noise rise in the bs receiver caused by e - dch users which it serves , or e - dch users in other cells . in this case , the expression “ users in other cells ” includes users sending their data to a different node b , but receiving relative grants from the same node b . therefore the rrm control mechanism available to the rnc is at best open loop , which is unlikely to be sufficient in a real network . the node b needs to measure all noise contributions and the rnc signals an upper limit which is the maximum uplink noise permitted . if the node b exceeds this maximum , the performance and throughput will deteriorate and at worst the whole cell will cease to operate . the rnc must tell each node b the maximum noise rise it can use and send a limit and then the node b must measure the actual noise rise against this limit and tell the rnc . in all cells there is background noise and the node b needs to know what the background noise is , so it can determine the amount by which it changes in busy times . an absolute value for this purpose ( e . g . absolute interference at the bs receiver ) is not suitable , as e - dch caused rtwp does not exist as such and such an absolute value would be of no use . an absolute value would not indicate noise rise to the rnc and the value would be determined in the base band and needs to be referenced to the antenna connector , thus containing inaccuracy due to the receiver gain in the receive chain . current total rtwp power measurement has an error of +/− 4 db absolute accuracy which cannot be significantly improved . an error of 0 . 5 db in the ul noise rise estimation will cause an e - dch throughput loss of about 10 % and a 3 db error leads to a loss in the order of 50 %. similar figures could be expected for any rrm based on absolute interference measurements , so a better solution is required . there is also a relative accuracy defined for rtwp : +/− 0 . 5 db . “ relative accuracy ” refers to the allowed difference between two measurements of rtwp made at different points in time arising from measurement inaccuracy ; however the time between these two rtwp measurements is not explicitly specified in 3gpp release 6 . one way to obtain a noise rise measurement , including a component which takes into account the interference from other cells , with a relative accuracy of 0 . 5 db , rather than the absolute accuracy of 4 db would be to measure the node b noise power by taking an rtwp measurement at a point in time when the entire network is quiet , i . e . when there are no uplink transmissions in any cell , and then during active e - dch operation to report measured rtwp relative to the quiet period value . however , taking an rtwp in ‘ low cell traffic density hours ’, to get an estimation of the receiver noise and the other parts of interference which can not directly be influenced , as a reference could be a problem in that temperature drift can produce fluctuations in receiver noise of 0 . 5 db , for the example of a temperature difference between day and night of 20 - 30 ° c . with remote radio heads . another problem is to determine the time of lowest cell traffic activity as this depends of the deployment , time and other influences . the node b can only measure the total noise , which includes unknown background noise , temperature induced noise and noise from legacy channels which are not operating e - dch . in a known system , the rnc controlled how much power each ue could use , which is quite slow and inefficient because of the need to transmit information over a long run . enhanced uplink passes some of the management function to the node b , thereby reducing signalling delays . however , the node b is not able to control ues in adjacent cells which might cause interference although it can adjust the maximum power that they use by the relative grant , so the rnc still has a role and a need to determine the noise actually generated at each node b to ensure that one cell does not interfere with another . if the node b scheduler is not doing too well , the rnc will tell the node b to reduce its noise . the node b does not know what other node bs are doing so rnc controls to make sure other node bs are not interfered with . the method enables a practical bs measurement that is useful for rrm , has reasonable accuracy and reflects the proportion of uplink resources used for e - dch rtwp received from cell x can be considered as a sum of : ( a ) receiver noise caused by a receiver in node b for cell x ; ( b ) inter - cell interference from other cells close to cell x ( as long as not covered below ); ( c ) the sum of all ul dedicated channels ( ul dpch ) of cell x ; ( d ) the sum of all enhanced ul ( e - dch ) channels for which cell x is the serving cell ; ( e ) the sum of all enhanced ul ( e - dch ) channels from other cells ( for which cell x is called non - serving cell ); and ( f ) other intra cell interference in cell x ( e . g . rach or hs - dpcch in cell x ) a measurement rtwp_ 1 at time instant t 1 relative to rtwp_ 0 at t 0 where t 1 is the time instant at which the ul noise should be controlled in an active network and t 0 is a phase of low traffic activity in the network , means that it is possible to get an impression of how the parts c , d , e and f contribute to the ul noise rise ( rtwp_ 1 / rtwp_ 0 ). in such a case rtwp_ 0 could either be stored in the node b or provided by the rnc via lub signalling , indicating that this is to be used as a basis for the control of the total noise rise . the relative rtwp measurement has the advantage of higher accuracy as systematic errors ( e . g . for rf gain variations when referring to the antenna connector ) for both rtwp parts cancel each other for the quotient . drawbacks of the “ quiet period ” measurement must be overcome . considering a reference rtwp_ 0 which is taken in the low activity hours , during which only ( a ) and ( b ) are relevant , the temperature drift of the receiver noise ( a ) can be improved by having a stored reference for receiver noise , i . e . a table dependent on temperature which may be provided for example in the node b , in the rnc , or provided by omc . such a look up table can be e . g . noise figure as a function of temperature at the receiver and this can be either stored in the node b or stored in the rnc or provided to node b or rnc via operation & amp ; maintenance ( o & amp ; m ). assuming rtwp_ 0 ( t 0 , t 0 ) is measured where t 0 is the temperature at the receiver at the time instant t 0 and at a later time t 1 where the temperature at the receiver is t 1 but it is not possible to measure rtwp_ 0 at t 1 as there is already a higher activity in the cell : in this case the receiver noise for t 0 could be subtracted from the rtwp_ 0 value at t 0 ( based on the table ) and a corresponding correction for t 1 could be added ( also dependent on the table ) as soon as t 0 and t 1 are known . although this does not deal with the problem that the inter cell interference ( b ) at t 0 and t 1 might not be identical , it improves the temperature drift of the receiver noise ( a ). the look up table can be made dependent on further parameters which influence the receiver noise . the more parameters that are included , the more desirable it is to keep the table in the node b , as otherwise these parameters need to be signalled to the rnc too , removing some of the benefits of operating e - dch . the optimal time t 0 can be determined by statistical analysis of the cell traffic in cell x and the other cells close to cell x , as described above . taken alone , such an improved measurement gives a more accurate idea of the noise rise level and in combination with measuring the share of the noise rise occupied by e - dch users , significantly improves efficiency . the control of ul noise rise is based on the assumption that the rnc provides a target value and the node b measures corresponding quantities and the node b reports them back to the rnc ( in a filtered way ) and / or uses them for its own scheduler . with the measurement improvements described above , a finer control of the ul noise rise is possible which improves the cell capacity , the interference control and the performance at the cell edge . the overall noise rise report using rtwp is improved by a temperature dependent lookup table and an indication of noise rise share is provided using relative rscp measurements . the system also includes permanent or removable storage , such as magnetic and optical discs , ram , rom , etc . on which the process and data structures of the method can be stored and distributed . the processes can also be distributed via , for example , downloading over a network such as the internet . the system can output the results to a display device , printer , readily accessible memory or another computer on a network . a description has been provided with particular reference to preferred embodiments thereof and examples , but it will be understood that variations and modifications can be effected within the spirit and scope of the claims which may include the phrase “ at least one of a , b and c ” as an alternative expression that means one or more of a , b and c may be used , contrary to the holding in superguide v . directv , 358 f3d 870 , 69 uspq2d 1865 ( fed . cir . 2004 ).	7
[ 0034 ] fig1 is a partial isometric view of a boat fitted with the apparatus . in this figure the apparatus shown is integrated with a steering rudder . this assembly includes the vessel hull ( 11 ), the structural connection between the vessel hull and the rudder ( 15 ), the rudder of the vessel ( 13 ), and the transverse hydrofoil . [ 0035 ] fig2 is a profile view of a complete sailboat fitted with the invention . in addition to the items noted in fig1 this figure illustrates a representative static waterplane ( 14 ). it is anticipated that the preferred configuration will be to structurally support the hydrofoil by attaching it to the steering rudder of the vessel which in turn will be located aft of the stern of the vessel . however , in some vessels this will be impractical for structural and / or aesthetic reasons . in these cases the hydrofoil may be held in the preferred position using a streamlined strut or struts that are not designed as the primary mechanism to steer the vessel . also , in ballasted sailing vessels that often sail with significant heel , it is anticipated that more than one of these foil assemblies may be fitted such that the span of the hydrofoil is approximately parallel with the waterplane of the vessel in its heeled position . [ 0036 ] fig3 shows the preferred embodiment of the invention with adjustable hydrofoil angle of attack . in this case the foil is mounted in a steering rudder . the hydrofoil ( 12 ) is mounted on a pivot axle ( 22 ) and is actuated by a pushrod ( 20 ). this pushrod is recessed in the middle of the rudder section and is actuated by a device comprised of a sheave ( 19 ) attached to the pushrod . this sheave is actuated by a rope ( 21 ) that is led into the boat from where it can be adjusted by the crew . a cleat is provided to allow this rope to be fixed so that a hydrofoil angle of attack may be maintained . in the preferred embodiment , the pushrod is spring loaded so that it maintains pressure on the rope . there are many other possible methods of hydrofoil actuation — the assembly shown represents one possible method . a representative range of hydrofoil angles of attack is shown by note ( 18 ). note ( 16 ) shows a representative stem wave contour without the invention fitted . note ( 17 ) shows a representative stem wave contour with the invention fitted and adjusted to a positive angle of attack . [ 0037 ] fig4 shows a detail of the assembly shown in fig3 . in this figure the hydrofoil section ( 33 ) is shown as symmetrical about the plane which contains the edges of the hydrofoil . it is important to note that for many applications , the preferred hydrofoil section will not be symmetrical about this plane . in addition to the features noted in fig3 fig4 shows the transverse pin ( 32 ) attached to the end of the pushrod . it is anticipated that the hydrofoil will be built in two halves , one on each side of the rudder ( or support strut ). these halves will slide onto the hydrofoil axle ( 22 ) and the transverse pin ( 32 ) and will be held in place with set screws . [ 0038 ] fig5 shows an alternate embodiment of the invention with adjustable hydrofoil angle of attack . the hydrofoil is again shown connected to a steering rudder . in this embodiment of the invention , the hydrofoil is rigidly attached to the rudder which in turn is inserted into a steering case ( 34 ). fig6 shows a representative section through the case and rudder near the top of the steering case . the complete rudder / hydrofoil assembly can be rotated relative to the steering case with the intent of adjusting the hydrofoil angle of attack . note ( 23 ) points to the rudder in the positive angle of attack ( lifting ) position . note ( 24 ) points to the rudder in the negative or neutral angle of attack position . in this embodiment of the invention the forward upper section of the rudder is cut back ( 29 ) to allow clearance for the rudder to rotate between positions ( 23 ) and ( 24 ). a sheave ( 35 ) is attached to the top of the rudder . a rope ( 30 ) running through this sheave transmits force to the top of the rudder to accomplish rotation . this rope leads into the vessel to allow it to be adjusted by the crew . some fixing method shall be fitted to allow a hydrofoil angle of attack to be maintained . a spring device ( 25 ) is fitted to maintain pressure against the adjustment rope . in order to transmit vertical forces from the rudder / hydrofoil assembly into the case , the top of the rudder is fitted with a transverse rod ( 27 ). a rope ( 26 ) loops over this pin and restrains it from large vertical movements without restraining it forward and aft within the desired range of motion . [ 0039 ] fig6 shows a section through the steering case . the pivot point ( 36 ) for rotating the steering case and rudder / hydrofoil assembly with the intention of steering the vessel is shown . a cross section of the top of the rudder ( 37 ) is also shown .	1
the invention relates to an interfacing system and method for a diesel particulate filter regeneration system in a truck or other vehicle . fig1 is a schematic diagram of how the invention may be integrated in an exemplary simplified diesel engine - equipped vehicle . a diesel engine 10 has an exhaust conduit 14 connected to receive exhaust gas from the engine cylinders 12 . the engine 10 in fig1 illustrates six cylinders , however , the details of engine and the number of cylinders is not part of the invention and it is to be understood that the invention may be adapted for an engine of any design . the exhaust conduit 14 conveys exhaust gas to one or more aftertreatment devices as may be installed on the vehicle . in fig1 , a diesel particulate filter ( dpf ) 16 is illustrated . as is known , a dpf removes particulate matter from the exhaust stream before the exhaust is released to the environment through the stack outlet 18 . pressure sensors are disposed at the inlet 20 and outlet 22 of the dpf to measure the exhaust gas pressure going into and exiting the dpf . the pressure values may be used as an indication of the amount of particulate matter collected in the filter . a processing unit 24 is connected to receive pressure data from the inlet 20 and outlet 22 pressure sensors , and apply an algorithm to determine a particulate load in the dpf . the processing unit 24 communicates the particulate load calculation , or alternatively , the raw pressure data , to a control unit 26 , which may be the vehicle &# 39 ; s engine control unit ( ecu ). the control unit 26 will include a control sequence to determine , based on the particulate load calculation , when a regeneration of the dpf is needed to remove collected particulate matter . when initiated by an operator , the control unit 26 will receive and monitor vehicle data 28 to determine whether conditions are appropriate for running a regeneration of the dpf . the other vehicle data may be related to requisites for the system to allow a regeneration to be done . for example , and for the example described here , the system may be configured for a vocational truck and programmed so that a regeneration may occur only when the truck is parked with various vehicle systems in a neutral or non - active state . these may include one or more of : the parking brake engaged , the service brake not engaged , the clutch pedal not depressed , the transmission in neutral , the accelerator at idle speed , the vehicle speed at zero or below a selected threshold value , no power take - off devices active , the engine oil and / or coolant temperature at a sufficient value , and the exhaust temperature at a sufficient value . the skilled person implementing the system and method in accordance with the invention may of course choose alternative or additional requisites . the control unit 26 receives the particulate load data from the processing unit 24 and receives information on other vehicle systems from other sensors and devices ( not illustrated ). responsive to at least one piece of received information , the control unit 26 causes a message to display on the display unit 30 . as described in greater detail below , the message may inform the operator of the particulate load status of the dpf unit , request an action by the operator , or display additional selected information responsive to operator input . an input device 32 is operatively connected to the display to allow the operator to request information and select a particular action to be carried out the control unit 26 . the control unit 26 responds to the operator input to cause the selected action to be performed . if a regeneration of the dpf is the selected action , the control unit 26 will cause the vehicle &# 39 ; s regeneration sequence to function . in the illustrated embodiment , a regeneration is performed by an injector 34 injecting hydrocarbon into the exhaust upstream of the dpf . if , for example , the dpf includes a catalyzed filter , the hydrocarbon will oxidize when it comes into contact with the catalyst , raising the exhaust gas temperature and burning the collected particulate matter . other methods of handling an injected hydrocarbon , and other methods of performing a regeneration , as are known or become known could be used in connection with the invention . the invention may be configured to advantageously operate through existing vehicle devices , that is , the existing instrument panel screen display and existing levers and buttons . fig2 illustrates an input device 32 as may be used with the invention . the input device 32 is integrated in a lever 36 mounted on a vehicle steering column , as , for example , a windshield wiper control lever or turn signal . the input device 32 is positioned for and includes devices conveniently controlled by the fingers , including a rocker switch 40 mounted on the axial end 38 of the lever 36 , a first pushbutton switch 42 , and a second pushbutton switch 44 . these switches are used to scroll through and select various information displays and actions that are displayed on the display unit 30 . the rocker switch 40 may be configured so that a movement depressing one side 40 a causes a cursor ( or highlighting or the like ) to move in one direction , for example , advancing through a list or series , and depressing the other side 40 b causes the cursor to move in the opposite direction . the first pushbutton switch 42 may be configured to input an “ enter ” command to cause the selected choice ( highlighted or cursor indicated ) to be performed . the second pushbutton switch 44 may be configured as an “ escape ” selection to cause the display to return to the previous display or screen . turning to fig3 , a default or general information screen display is shown . the general display includes a first portion 50 including a series 52 of selections an operator may make to obtain information from the control unit 26 on the status of vehicle components . the illustrated series 50 includes “ gauges ”, which will display certain vehicle gauges such as speed , engine revolutions , coolant temperature , etc ., “ fuel data ” which will show fuel volume and the like , “ time / distance ” which shows trip time and distance traveled , and “ aftertreatment ”, which shows information and presents action selections related to the aftertreatment system . the first part also includes a day and month display 54 . the default display may include displays of other information , for example , a second portion 60 showing oil temperature , a third portion 62 showing a clock , and a fourth portion 64 including an odometer display 66 and a status indicator 68 for the aftertreatment system . the status indicator 68 is shown as “ ats ” crossed out . according to the invention , and as illustrated in fig4 , the control unit 26 will cause a pop - up message box 56 to be displayed to alert the operator of a status change of the dpf system requiring attention , usually that the control unit 26 has determined that regeneration of the dpf is needed . an icon may be included in the message display . the pop - up message may be tailored to the urgency of the need for regeneration . for example , when the control unit 26 first determines that a regeneration is needed , the message “ parked regen needed ”, may be displayed in the pop - up box 56 . as explained below , the operator may then navigate through screen displays to choose more information on vehicle systems or initiate the regeneration as requested . the operator may , however , be forced to ignore the message because it is inconvenient or inappropriate to initiate a regeneration at the time the message is displayed . for example , the vehicle may be at a fuel pump or unloading or picking up a load . the control unit 26 continues to monitor the dpf particulate load , and if a regeneration is not performed when initially indicated , the particulate load will increase , prompting a second , higher urgency , message to be displayed , for example , “ parked regen required .” this message may be displayed as blinking to underscore the urgency . if the operator does not initiate a regeneration as requested by the message the control unit 26 will continue to monitor the particulate load on the dpf , and when the particulate load reaches a level that could cause engine or exhaust system damage will display a message “ ats service required engine derate active ”, which may also be displayed as blinking or flashing . this indicates to the operator that the aftertreatment service by a technician is required and an operator - initiated regeneration is no longer allowed . in addition , the operator is notified that the engine power is being derated , and the operator should prepare for an engine shutdown , for example , by pulling off the road . the control unit 26 may determine or estimate the particulate load in the dpf by calculation using the pressure sensor data , by engine running time and load , or any convenient method . after receiving the message in the pop up box 56 shown in fig4 that a regeneration is needed or required , the operator can remove the pop - up message and return to the default screen by pressing the escape button 44 on the input device 32 shown in fig2 . using the rocker switch 40 the operator may highlight “ aftertreatment ” ( as shown in fig3 ), and press the “ enter ” button 42 to have displayed information and action selections related to the aftertreatment system , which is shown in fig5 . the display will indicate that the “ aftertreatment ” menu is open , and operator will be presented with a selection box 58 displaying choices of requesting a parked regeneration , checking the ats ( aftertreatment system ) status , and canceling or inhibiting regeneration , as will be explained . as an optional feature of the invention , the operator may select “ ats status ” to inquire on the particulate load specifics , for example , if near the end of a trip to avoid an additional stop . the selection “ ats status ” will display a series shown in fig6 , including “ dpf load ”. the operator may then highlight this selection using the rocker switch 40 and select it using the enter button 42 . the system will then display a pop up message box , overlaying the selection box 58 , communicating particulate load data , for example , “ soot level moderately high ”, indicating the operator may be able to operate the vehicle for an additional period of time , or , “ soot level critically high ”, indicating that the operator must request a regeneration without undue delay to avoid an engine derate condition . returning to fig5 , the operator may elect to request a regeneration by highlighting and selecting the option “ request parked regen ” from the selection box 58 . a display screen as shown in fig7 will be shown on the screen showing that “ request parked regen ” has been selected and displaying a message box 56 . the operator will typically be trained to first park the truck and establish the conditions for a regeneration . the truck may optionally include the instructions in a readily accessible location , for example , on a sun visor card . in response , the system will check whether the requisite conditions are established , and while doing so , display a message indicating “ data transfer in progress , please wait .” an exemplary list of requisite conditions was described in connection with fig1 , above . if the system determines that the vehicle requisite conditions are not appropriate for initiating a regeneration , a message is displayed in the message box 56 indicating “ regen failed ” and instructing the operator to “ check status menu ”, to investigate which of the requisite conditions is not met . pressing the enter button 42 will bring the operator directly to the screen display shown in fig6 , or alternatively , to the screen display shown in fig5 from which the operator can navigate to the display of fig6 by selecting “ ats status ”. the screen display of fig6 will include a message box 56 including a listing of vehicle systems : dpf load , clutch , service brake , and pto status are shown as examples . using the rocker switch 42 , the operator may scroll through the list to discover which system is not in compliance for regeneration . if the condition is one the operator can correct , such as the parking brake not being engaged or a pto device being engaged , the operator can make the correction , press escape to return to the screen display of fig5 , and re - enter the request for regeneration . the message that initiation of a regeneration failed may be due to the engine temperature being too low to support the regeneration , which the operator will discover by scrolling through the selections of the screen display shown in fig6 . this may happen when the system determines immediately after engine start that a regeneration is needed . in this case , the operator will simply wait for the engine to warm to the appropriate temperature and re - enter the request for regeneration . another condition that prevents a regeneration from initiating is that the operator had previously selected to inhibit regeneration under the “ cancel regen ” selection shown in fig5 . by selecting “ cancel regen ”, the display shows the screen display shown in fig8 . the operator may highlight either “ disable regen ” or “ enable regen ” as needed and press the enter button to make that selection . of course , to allow regeneration to be initiated , the “ enable regen ” selection must be selected . as described above , the operator can then return to the display of fig5 using the escape button 44 and re - enter the request for a regeneration . the “ disable regen ” selection may be appropriate to prevent inadvertently initiating a regeneration . the “ disable regen ” selection will also work to cancel an ongoing regeneration , which may be necessary if conditions merit . returning to fig7 , if a regeneration has been requested , and the requisite vehicle conditions are met , the system will initiate a regeneration of the dpf , which will be indicated by a message “ regen requested ” as the system prepares for the regeneration . this message will be followed by a pop - up message when the regeneration is actually being performed , “ regen in progress .” the “ regen in progress ” message will continue to be displayed while the regeneration is being done , which may take on the order of twenty minutes to thirty minutes . as mentioned , an activated regeneration can be canceled by the operator navigating to the “ cancel regen ” selection in the aftertreatment screen of fig5 to the screen display of fig8 , and selecting “ disable regen ”. in addition , the system can be configured to cancel an activated regeneration if one or more of the requisite vehicle conditions is changed during the regeneration . for example , if the operator puts the vehicle in gear , releases the parking brake , and presses the accelerator to begin moving the vehicle , three requisite conditions will be changed , and in response to any of them the system may stop the regeneration if configured to do so and display the “ regen failed ” message in the pop up box 58 . the invention has been described in terms of exemplary embodiments , structure , and components and those skilled in the art will understand that the scope of the invention is defined by the appended claims and equivalents and substitutions may be made without departing from the scope of the claims .	5
fig1 through 3 , discussed below , and the various embodiments used to describe the principles of the present invention in this patent document are by way of illustration only and should not be construed in any way to limit the scope of the invention . those skilled in the art will understand that the principles of the present invention may be implemented in any suitably arranged microprocessor , microcontroller , or similar data processor . fig1 illustrates exemplary microcontroller 100 , which contains an encryption - decryption circuit according to a first embodiment of the present invention . microcontroller 100 comprises processor core logic and flash memory circuit 110 and encryption and decryption circuit 120 . processor core logic and flash memory circuit 110 executes the primary functions of microcontroller 100 . encryption and decryption circuit 120 is used to encrypt and decrypt data . according to an advantageous embodiment of the present invention , microcontroller 100 is able to receive encrypted data , such as object code , from an external source , such as the internet or an external processing system to which microcontroller 100 is connected . advantageously , microcontroller 100 may also send encrypted data to the external source . processor core logic and flash memory circuit 110 controls encryption and decryption circuit 120 using the control lines load , shift , encrypt / decrypt ( e / d ), and the data buses data in and data out . when the encrypt / decrypt is set to encrypt mode , processor core logic and flash memory circuit 110 is operable to transfer unencrypted data to encryption and decryption circuit 120 on the k - bit data in bus and to receive encrypted data from encryption and decryption circuit 120 on the k - bit data out bus . when the encrypt / decrypt is set to decrypt mode , processor core logic and flash memory circuit 110 is operable to transfer encrypted data to encryption and decryption circuit 120 on the k - bit data in bus and to receive unencrypted data from encryption and decryption circuit 120 on the k - bit data out bus . encryption and decryption circuit 120 comprises n - bit shift register 122 , n - bit keyword buffer 124 , exclusive - or ( xor ) gate array 126 , and exclusive - or ( xor ) +/− y gate array 127 . n - bit keyword buffer 124 contains an n - bit binary data key that is unique to microcontroller 100 . the key may be broken into two n / 2 - bit keys , one of which is held within microcontroller 100 , such as a serial number . this is used to limit the distribution of the software to only one target machine ( such as a license upgrade ). processor core logic and flash memory circuit 110 loads the key into n - bit shift register 122 by enabling the load signal . xor gate array 126 receives m arbitrary bits from n - bit shift register 122 and determines a single bit exclusive - or result of all m bits . thus , the single bit xor result , f ( b ), is given by : where ba , bb , bc , . . . , and bg are the m arbitrarily selected ones of bits b 1 , b 2 , b 3 , . . . , bn from n - bit shift register 122 . the xor result , f ( b ), is then input to n - bit shift register 122 . processor core logic and flash memory circuit 110 shifts the n binary bits in n - bit shift register 122 using the shift control signal . for each shift of n - bit shift register 122 , k arbitrary bits from n - bit shift register 122 are also applied to xor +/− y gate array 127 . xor +/− y gate array 127 comprises k exclusive - or gates , each of which has two inputs and one output . each of the k arbitrary bits from n - bit shift register 122 is xored with one of the k bits on the data in bits to produce one of the k bits on the data out bus . since exclusive or is a reversible operation if the output ( i . e ., result ) and one input are known , the present invention has the advantage of being symmetrical between encryption and decryption . thus , unencrypted data may be encrypted by exclusive - oring with the k bits from n - bit shift register 122 . the encrypted data may then be decrypted by exclusive - oring with the k bits from n - bit shift register 122 . the data pattern in n - bit shift register is completely deterministic given a known key and the number of shifts . according to an advantageous embodiment , the k bit binary value y may be added after the xor operation during encryption mode and k bit binary value y may be subtracted prior to the xor operation during decryption mode . in an exemplary embodiment of the present invention , y = 0 , so that only the xor function is implemented by xor +/− y gate array 127 . according to an advantageous embodiment of the present invention , the value of k is the same as the data width of processor core logic and flash memory circuit 110 . thus , if microcontroller 100 is an 8 - bit processing device , k = 8 , if microcontroller 110 is a 16 - bit processing device , k = 16 , and so forth . by way of example , in a representative microcontroller , n - bit shift register 122 may be a 128 shift register , m may be 25 , and k may be 16 . thus , the 128 bits from 128 bit keyword buffer 124 may be loaded into shift register 122 and shifted s times to an arbitrary starting point . on each shift , 25 arbitrary bits from shift register 122 are exclusive - ored ( xored ) together to produce a one bit result that is shifted into shift register 122 . once the starting point is reached , 16 arbirtrary bits from shift register 122 are xored with the 16 bits from the data in bus to produce 16 encrypted bits on the data out bus . each subsequent shift of shift register 122 produces a new 16 bit pattern that is xored with the next 16 bit data word on the data in bus , until all data words are encrypted . a similar operation occurs during decryption . the 128 bits from 128 bit keyword buffer 124 are loaded into shift register 122 and shifted s times to the arbitrary starting point , just as during encryption . on each shift , 25 arbitrary bits from shift register 122 are exclusive - ored ( xored ) together to produce a one bit result that is shifted into shift register 122 . once the starting point is reached , 16 arbitrary bits from shift register 122 are xored with the 16 encrypted data bits from the data in bus to produce 16 unencrypted bits on the data out bus . each subsequent shift of shift register 122 produces a new 16 bit pattern that is xored with the next 16 bit encrypted data word on the data in bus , until all encrypted data words are unencrypted ( decrypted ). fig2 illustrates exemplary microcontroller 200 containing an encryption - decryption circuit according to a second embodiment of the present invention . microcontroller 200 is similar to microcontroller 100 in fig1 in most respects . microcontroller 200 comprises processor core logic and flash memory circuit 210 and encryption - decryption circuit 220 . processor core logic and flash memory circuit 210 executes the primary functions of microcontroller 200 . encryption and decryption circuit 220 is used to encrypt and decrypt data . processor core logic and flash memory circuit 210 controls encryption and decryption circuit 220 using the control lines load , shift , and encrypt / decrypt ( e / d ), the switch select control lines , switch select , and the data buses data in and data out . when the encrypt / decrypt is set to encrypt mode , processor core logic and flash memory circuit 210 is operable to transfer unencrypted data to encryption - decryption circuit 220 on the k - bit data in bus and to receive encrypted data from encryption and decryption circuit 220 on the k - bit data out bus . when the encrypt / decrypt is set to decrypt mode , processor core logic and flash memory circuit 210 is operable to transfer encrypted data to encryption and decryption circuit 220 on the k - bit data in bus and to receive unencrypted data from encryption and decryption circuit 220 on the k - bit data out bus . encryption and decryption circuit 220 comprises n - bit shift register 222 , n - bit keyword buffer 224 , n × m switch 225 , exclusive - or ( xor ) gate array 226 , n × k switch 227 , and exclusive - or ( xor ) +/− y gate array 228 . n - bit keyword buffer 224 contains an n - bit binary data key that is unique to microcontroller 200 . the primary difference between microcontroller 200 and microcontroller 100 in fig1 is that the m bits applied to xor gate array 226 are not fixed , but rather are selectable by the switch select control signals using n × m switch 225 . similarly , the k bits applied to xor gate array 228 are not fixed , but rather are selectable by the switch select control signals using n × k switch 225 . switch 225 and switch 227 are optional and may be implemented to provide additional levels of security . fig3 depicts flow diagram 300 , which illustrates the operation of the exemplary encryption - decryption circuit according to the principles of the present invention . initially , microcontroller 200 loads the n bit keyword into shift register 222 ( process step 305 ). optionally , microcontroller 200 sets switch select signals for one or both of n × m switch 225 and n × k switch 227 if the switches are implemented ( process step 310 ). next , microcontroller 200 shifts the bits in shift register 222 s times to establish a starting point ( process step 310 ). then , microcontroller 200 applies the first k bit data word to xor +/− y gate array 228 via the data in bus and reads the result from the data out bus ( process step 320 ). finally , microcontroller 200 shifts the data in shift register 222 and applies the next k bit data word to xor +/− y gate array 228 via the data in bus and reads the result from the data out bus ( process step 325 ). microcontroller 200 repeats step 325 until all data is encrypted or decrypted ( process step 330 ). although the present invention has been described in detail , those skilled in the art should understand that they can make various changes , substitutions and alterations herein without departing from the spirit and scope of the invention in its broadest form .	7
referring now more particularly to the drawings , fig1 shows a cast bar 10 advancing from a casting machine ( not shown ) toward a rolling mill 14 . a cast bar 10 advances toward mill 14 it passes through sooter 16 which burns acetylene to form a uniform layer of soot which deposits on the surface of cast bar 10 . after soot is uniformly applied to its surface , cast bar 10 continues to advance toward mill 14 and passes infrared radiation sensor 18 where infrared radiation which is emitted from bar 10 is detected . the detected infrared radiation is converted into an electrical signal in sensor 18 , simplified by amplifier 20 and transmitted to recorder 21 , digital display 23 or other remote instruments not shown where it is displayed in a useful fashion or used as control input data . cast bar 10 continues to advance and passes atomizer 22 where the soot coating is removed by means of a fine water spray or water oil emulsion spray directed against bar 10 by atomizer 22 which causes the carbon to fall from the cast bar 10 . automatic sooter 16 is illustrated in more detail in fig2 . the acetylene supply means 19 which supplies acetylene to sooting tips 17 is adapted to provide a constant flow of acetylene regardless of the pressure of the acetylene source . this is accomplished by first flowing the acetylene through acetylene filter 24 where gas borne solid impurities are removed . after exiting the filter 24 the acetylene passes through a solenoid valve 25 which is adapted to receive remote signals capable of interrupting or starting the flow of acetylene through the system . from solenoid valve 25 the acetylene passes to flow control valve 26 where the flow rate of the acetylene is adjusted to a constant rate which is thereafter independant of the upstream pressure of the general source of acetylene supply . the acetylene then flows from the flow control valve 26 to flow meter 27 and thence to mixer 28 where it is mixed with air before being conveyed to manifold 20 to which sooting tips 17 are attached . the air which is mixed with the acetylene in mixer 28 follows a similar and parallel path from the general air supply to mixer 28 . air flows through air supply means 19 to filter 24a which removes any air borne particulate contaminants . after passing through air filter 24a the air then passes through solenoid valve 25a which is adapted to receive remote source signals capable of interrupting or starting the flow of air through the system . from solenoid valve 25a the air then passes to flow control valve 26a where the flow rate is adjusted to a constant rate which is independant of the pressure of the general source of air supply . air then flows from flow control valve 26a through flow meter 27a to mixer 28 where it is mixed with the acetylene and the air acetylene mixture is then transported to manifold 29 for subsequent soot production at sooting tips 17 . ignition of the air acetylene mixture flowing from sooting tips 17 is accomplished by positioning an electric igniter 30 in the stream of air fuel mixture flowing from tips 17 . the electric igniter ignites the acetylene - air mixture and the mixture of acetylene and air is regulated to burn in such a way to promote soot formation so that a layer of soot will be deposited by convection and system pressure on cast bar 10 as it advances past and through the burning air - acetylene mixture . an electric igniter of the glow - plug type has been used with best results but both a spark plug type igniter or pilot flame could also be used successfully . carbon could also be applied as a spray or by electrostatic deposition methods but such methods are temperature dependent and must be closely controlled . soot applied using the automatic sooter 16 can be applied in varied thicknesses and with proper acetylene and air flow rates ( for example 12 cubic feet per minute acetylene and 20 cubic feet per minute air ) essentially no free atmospheric soot is experienced when tips 17 are of the horns h - 1 type and are positioned approximately three to four inches from the cast bar . at such use levels , approximately 7 to 8 pounds of soot would be deposited on the substrate in a five day , 24 hour per day work week if the equipment were operating at eighty percent efficiency . in the operation of the automatic sooter 16 an air supply of from 20 to 200 psi ( 2 to 5 scfh ) is required and an acetylene supply of a maximum 15 psi at 5 to 20 scfh per hour is required . cast bar 10 which has been blackened with soot produced by automatic sooter 16 advances past infrared sensor 18 . because the cast bar 10 has been blackened , the emissivity of the bar passing sensor 18 becomes the emissivity of the carbon coating ( from about 0 . 78 to about 0 . 80 in the temperature range of from room temperature to 1000 ° f .) instead of the highly variable emissivity of an uncoated aluminum cast bar . therefore , accurate bar temperature measurements can be made with very little variation ( k 3 ° f . within the separational temperature range ). when the cast bar 10 is coated with soot the radiative surface properties of the bar are made substantially constant and because the black surface will absorb and not reflect radiative energy from other sources , the radiation detected relates to the absolute temperature of the emitting object ( cast bar 10 ) and therefore such detected radiation can be used to monitor the temperature of the emitting object . because the ambient temperature in the vicinity of a continuous casting and rolling line can reach temperatures in excess of 100 ° f . cooler 32 is used to cool sensor 18 . this cooling is accomplished by using a water system the used water from which is routed to atomizer 22 via water delivery means 33 for spraying thereof onto the cast bar 10 . cooling water is supplied to cooler 32 via water supply means 33a with the motive force necessary to move the water being supplied by the flow of air through atomizer 22 which is of the venturi type . lens 34 of sensor 18 is kept free of dust and other particulate matter which might interfere with reception of infrared radiation from cast bar 10 by continuously purging the lens 34 and lens area with either air , nitrogen , helium or mixtures thereof which is delivered to the lens through purging gas purge line 35 . purging gas entering purge line 25 from the source of purging gas ( not shown ) passes through filter 36 which houses a filter element fine enough to remove any harmful particulate contaminants which might be in the unfiltered purging gas . after passing through filter 36 the purging gas passes through flow control unit 37 so that a constant flow of purging gas to lens 34 is assured without regard to intermittent increases or decreases in the pressure of the purging gas . a flow meter 38 is also provided downstream of flow control unit 37 so that the operator may select the desired flow rate of the purging gas being supplied to lens 34 through purging line 35 . this introduction of a purging gas into lens 34 creates a positive pressure within the lens body thereby preventing carbon particles or other particulate contaminants from entering the lens and interfering with the accurate sensing of radiant energy from cast bar 20 . while it is necessary to apply the soot to the surface of cast bar 10 to accurately measure the radiant energy being emitted by the bar , it is equally as necessary to completely remove all of the soot from bar 10 before the bar enters rolling mill 14 . if the soot is not removed , the carbon particles will be removed from the surface of rod by the rolling lubricant and will soon so alter the lubricating properties of the rolling lubricant that production will have to be curtailed or stopped altogether while contaminated rolling lubricant is replaced with fresh lubricant . in order to avoid such an occurance , the apparatus of the present invention has had included in it a device designed to completely remove the soot from the surface of bar 10 before the bar enters rolling mill 14 . referring to fig4 for a more detailed view of this device , it can be seen that cooler 32 which maintains the temperature of sensor 18 within the optional operating range for infrared radiation sensors is adapted to allow the cooling water which enters from coolant supply line 32a to drain from the sensor area through drain line 32b . cooling water thus removed from sensor 18 is accumulated in reservoir 40 and as needed withdrawn from reservoir 40 through atomizer supply line 41 by the flow of air through venturi type atomizer 43 . water being withdrawn from reservoir 40 is filtered through submerged filter 42 as it enters supply line 41 . this filtered water is then conveyed to atomizer 43 where it is applied to the soot bearing surface of cast bar 10 in quantities sufficient to remove all residual soot from the surface of bar 10 . usually no more than about one - half to one liter of water per hour is required to completely remove all residual soot from the bar surface depending on production rate and size of bar . a soluble oil and water emulsion may be used to remove the soot from bar 10 with equal success . atomizer 43 requires air to draw water from reservoir 40 and propel the water droplets onto the cast bar 10 , this air is supplied to atomizer 43 through air line 44 . air entering atomizer 43 through line 44 is filtered through filter 45 before entering the atomizer 43 to prevent blockages caused by particulate contaminants borne by the unfiltered air . soot may also be removed from bar 10 by using a torch ( not shown ) and a very lean oxidizing flame which completes combustion of the soot . in any event , it is necessary to carefully remove the soot from bar 10 to prevent the harmful effects described above and to avoid significantly altering the temperature of bar 10 before it enters the rolling mill 14 because , an increase or decrease from optimum rolling temperature can significantly harm the physical and electrical properties of the rod being rolled from cast bar 10 . to demonstrate the effect of reflected radiant energy upon the temperature of a cast aluminum alloy bar , soot was applied to a cast bar which had implanted in it a type &# 34 ; k &# 34 ; thermocouple . the temperature of the soot covered area of the cast bar was determined to be approximately 800 ° f . when the temperature of the bar was measured by the infrared radiation technique of the present invention and the temperature of the cast bar as measured by the type &# 34 ; k &# 34 ; thermocouple was also measured as approximately 800 ° f . while the temperature measured by an infrared sensor focused on an area of the bar having no soot covering was lower than 500 ° f . additionally experiments also demonstrated that within reasonable limits , the thickness of the soot layer covering the bar has no appreciable effect on the accuracy of the measurements made by the method and apparatus of the present invention so long as the bar surface is completely covered . this invention has hereinbefore been described in terms of one preferred embodiment but it is understood that variations and modifications can be effected within the spirit and scope of the invention as described and as defined in the appended claims .	8
as illustrated in fig1 a tube extractor / slitter constructed in accordance with the present invention is illustrated in a disposition abutting a tubesheet 12 for extracting tubes 14 which have been partially pulled through the face of the tubesheet , the extractor / slitter acting not only to grasp and extract the tube but also to slit it into a pair of tube halves 16 , 18 . the extractor / slitter is structurally similar to the extractor disclosed in the aforesaid harris u . s . pat . nos . 4 , 044 , 444 and 4 , 815 , 201 except for various changes for the slitting function as hereinafter described . the tube 14 is illustrated after it has been loosened from the tight fit with the tubesheet 12 and other tubesheets ( not illustrated ) and has been pulled by a tube puller a distance of approximately 21 / 2 inches . although the apparatus may comprise a single housing , it preferably in the preferred embodiment includes a pair of housings 20 , 22 positioned for movement relative to each other by a plurality of parallel rods 24 , best illustrated in fig2 extending through both housings and having stop nuts 26 threaded on the ends thereof for limiting the separation between the housings . mounted within each housing 20 , 22 is a respective driving and deforming roll 28 , 30 mounted on respective shafts 32 , 34 journally supported by bearings 36 , 38 mounted in the respective housing 20 , 22 . the periphery of each of the driving and deforming rolls 28 , 30 project out of a face of the respective housing 20 , 22 toward the opposite housing and define a passageway 40 therebetween through which a tube 14 may be driven or pulled , the width of the passageway being determined by the positions of the stop nuts 26 . if implementation of the invention was by a single housing , the passageway would be formed therethrough and the rolls could be mounted within a cartridge or the like positioned within the passageway . at least one of the rollers 28 , 30 , and preferably both , are driven by motor means . to achieve this , the upper end of the shaft 32 is coupled to a hydraulic motor 42 while the upper end of the shaft 34 may be coupled to a similar hydraulic motor 44 , the motor 42 being bolted to the housing 20 and the motor 44 being bolted to the housing 22 . ideally , the motors 42 , 44 are series connected , positive displacement hydraulic motors wherein the motor 44 receives hydraulic fluid under pressure through a line 46 and exhausts the fluid through a line 48 from the outlet of the motor 44 to the inlet of the motor 42 . the hydraulic fluid is exhausted from the motor 42 through a line 50 and recirculated to the source of pressurized fluid . as pointed out in the aforesaid harris u . s . pat . no . 4 , 815 , 201 with this arrangement the flow rate and the pressure drop for each motor is substantially the same and the motors are continuously driven at the same speed and power in a synchronous manner . although such synchronous drive of the rollers 20 , 22 is desirable and provides significant advantages , other connections between the hydraulic motors may also effect a positive traveling of the tubes from the tubesheet . although , in these latter situations some slippage may occur , slippage may not be a major disadvantage in this case since the tubes are slit . if one of the motors fails to keep up with the other motor it may be dragged along by the tube itself . should one drive begin to slip , the other will tend to take over and if the tube becomes stuck , both may slip to prevent damage to the equipment . additionally , although somewhat inefficient , a single motor may be utilized to drive one of the shafts 34 , 36 with the other shaft driven by gearing means or the like . whatever drive means is utilized , however , it must be understood that the shafts 34 , 36 rotate in opposite directions relative to the other so as to pull a tube 14 into the passageway 40 defined by the nip between the rolls . a handle 52 secured to a bracket 54 rigidly secured to the housing of one of the motors , e . g . motor 42 , permits the apparatus to be positioned relative to the tubesheet 12 . as illustrated in the drawings , and in particular fig5 each roll 28 , 30 is a serrated roll so as to grasp and pull a tube entering the passageway 40 therebetween . as illustrated in fig2 through 4 and 6 of the drawings , as best shown in fig6 each roll has its greatest diameter in the central portion 56 , and has axially remote cylindrical portions 58 , 60 of a smaller diameter connected to the central portion 56 by respective substantially truncated conical surfaces 62 , 64 tapering from the diameter of the central section 56 to the respective smaller sections 58 , 60 . thus , as illustrated in fig6 a tube being drawn into the passageway 40 is deformed by the rolls 28 , 30 from its normal cylindrical cross section to one which has a flattened central portion 66 with a pair of bulbous shaped edges 68 , 70 . thus , the tube is effectively changed in cross sectional configuration to one which has a figure - eight shape with a flattened midsection . such configuration is substantially different from the deformation created by the prior art on tubes being withdrawn from the tubesheet . this configuration permits the deformed tube to be slit axially along the respective edges 68 , 70 by a rotary blade without an anvil or supplemental backing . the material itself acts as an anvil since the flattened figure - eight configuration has been found to permit one - sided slitting . journalled for rotation on a respective pin 72 , 74 carried in the housings 20 , 22 on mounting plates or the like 76 , 78 are a pair of slitter blades 80 , 82 . the pins 72 , 74 extend intermediate the housings 20 , 22 and , as best illustrated in fig4 and 6 , the axes of the pins are disposed downstream of the axes of the shafts 32 , 34 and thus the axes of the rollers 28 , 30 . thus , the axis of each slitter blade 80 , 82 lies in a plane that is normal or perpendicular to the axes of both rollers 28 , 30 and closer to the exit of the passageway 40 . each slitter blade 80 , 82 is a circular wheel having a sharp hardened steel wedge shaped cutting edge 84 , 86 and the disposition of the slitter blade intermediate the housings 20 , 22 is such that the blades are centrally located relative to the bulbous edges 68 , 70 of the deformed tubes . additionally , as illustrated in fig3 the diameters of the blades 80 , 82 and the disposition of the pins 72 and 74 is such that the blades 80 and 82 are disposed intermediate the smaller diameter portions 58 and 60 respectively of both rollers 28 , 30 and the cutting edges 84 and 86 are disposed intermediate a portion of the conical surfaces 62 and 64 respectively of the rollers . additionally , by positioning the axes of the slitter blades 80 , 82 downstream of the axes of the rollers 28 , 30 , such that cutting takes place at the intersection of the peripheries of the blades and the plane of the axes of both rollers , i . e ., at points 88 , 90 , the tubes are deformed into the flattened midsection figure - eight configuration as aforesaid as they are being contacted by the slitter blades . thus , the bulbous edges 68 , 70 of the tubes may be slit by the slitter blades engaging the leading edges of the tubes and entering from outside the deformed tubes to cleanly sever the walls of the tubes along the bulbous edge , the blades being rotated by the movement of the tubes being fed by the rollers 28 , 30 . during the cutting action of the slitter blades the driving deforming rollers 28 , 30 at the conical surfaces thereof support the sloped portion of the surfaces of the bulbous edges so that the slitter blades may sever the edges of the tubing rather than merely displacing the material inwardly . the configuration of the flattened mid - section figure - eight deformed tubes is such that the full beam strength of both walls of the tube offer sufficient resistance to the inward deformation that would otherwise result due to the pressure of the edge of the rotary slitting blades . the tube walls are therefore severed rather than merely displaced inwardly . no internal supporting device is thus necessary to prevent the displacement since the material of the tube itself acts as an anvil . by using a rotary blade to slit the tube , minimal force is required and thus not only is a sharp edge maintained over a long period of time , but also the cutting does not rob excessive force from the application to the rollers 28 , 30 necessary for extracting and traveling the tubes out of the tubesheet . the traveling and forming action of the combination rollers 28 , 30 impart internal stresses on the tube so that when the walls are slit , the two flattened half sections curl outwardly in the respective directions of the rotating rolls . this results in two substantially neat coils formed from the severed tube halves and the entire operation may take place within five feet of the tubesheet . numerous alterations of the structure herein disclosed will suggest themselves to those skilled in the art . however , it is to be understood that the present disclosure relates to the preferred embodiment of the invention which is for purposes of illustration only and not to be construed as a limitation of the invention . all such modifications which do not depart from the spirit of the invention are intended to be included within the scope of the appended claims .	1
referring now to fig1 the circuit illustrated includes a simplified generic representation of a conventional ground fault interrupter housed in enclosure 1 wherein electrical power from a . c . source 100 is supplied to the gfci circuitry through male plug contacts as follows : hot side contact 10 to lead 7 and grounded neutral contact 9 to lead 6 . grounding contact 11 is connected to a feed through lead 8 which by - passes the gfci circuitry , and is connected directly to third wire contact 51 of receptacle 30 . leads 6 and 7 are passed through the core of the toroidal differential current transformer 3 which is also called a core balance and zero sequence current transformer . such a transformer is designed to sense differences in current carried by the said conductors 6 and 7 . a difference which can be attributed to a fault current path carrying a portion of the current to ground which should be carried to the source by the return wire or grounded neutral 6 . the leads 4 and 5 from the coil of transformer 3 are connected to the ground fault circuit interrupter module 2 for amplification of generated current and subsequent control of current to relay coil 25 . leads 6 and 7 after passage through the core of toroidal transformer 3 feed through the module as respective leads 12 and 13 , and emerge , respectively , as leads 19 and 20 which connect , respectively , with relay armature contacts 21 and 22 . feed - through lead 13 also carries current from the hot side of the line from source 100 through lead 16 to reset switch terminal 17 . feed - through lead 12 is connected to the module at 14 to furnish a grounded neutral return path for its circuitry . current from the hot side is supplied from 17 through contact 18 to the module when the contacts are connected by a reset switch and the module then acts to supply energizing current to coil 25 through its leads 26 and 27 , except when a differentially generated signal from transformer 3 indicates a fault , at which time the current to coil 25 is interrupted and it is de - energized . when coil 25 is energized , hot side contact pair 22 and 24 and grounded neutral side and contact pair 21 and 23 close to supply electrical power from source 100 to respective receptacle contacts 50 and 49 through respective leads 29 and 28 . when plugged into the receptacle , ground fault protected power from source 100 is supplied to a load circuit which includes leads 35 and 34 carried in plug housing 37 and cable sheath 38 which are connected to hot and neutral contacts 32 and 31 of plug 37 which engage hot and neutral receptacle contacts 50 and 49 , respectively . the third wire grounding contact 51 of receptacle 30 engages the grounding prong 33 of plug 37 which is connected to lead 36 carried by cable sheath 38 to supply a grounding means in the load circuit . the test switch terminals 46 and 47 are connected momentarily for testing purposes by normally open switch 48 . in many instances of gfci design the test switch connects a resistance between an ungrounded conductor on the load side such as 29 with a grounded neutral conductor such as 6 before its passage through transformer 3 , or with a grounding conductor such as 8 . no specifics are depicted in the generalized representation . it should be noted here that the above described portion of fig1 comprising the elements listed as 100 and as 1 through 14 , 16 through 44 , and 46 through 51 , are substantially the same in fig1 through 5 . in the block diagram of fig1 instead of a normally closed reset switch 15 , such as that shown only in fig5 a controlled reset switch 41 is shown connected to reset switch terminals 17 and 18 by leads 53 and 52 , respectively . the controlled reset switch 41 is shown linked for control to a current limited ground fault sensor 43 by a control coupling 42 . the ground fault sensor 43 is shown connected to hot lead 29 by a coupling lead 44 which passes a brief probe or test current into the load circuit when otherwise disconnected from the power source 100 by the de - energizing of relay coil 25 and opening of contacts 22 and 24 , and contacts 21 and 23 . if a path to ground in the load circuit exists for the test current from the sensor 43 , and is above a conduction level predetermined to constitute a hazard , the sensor 43 through control coupling 42 causes the controlled reset switch 41 to open , or to remain open after initial opening caused by momentary ground fault simulator 45 . in accomplishing a reset of the gfci , the current path across reset switch terminals 17 and 18 must first be broken , and then restored . if a fault causing the gfci to trip is very brief , the path across the terminals 17 and 18 may be substantially uninterrupted , or interrupted insufficiently for reset purposes , and the continuing current path would cause the gfci to remain in the off or tripped state in the absence of hazard . to assure the initial open state after tripping , prerequisite to resetting of the gfci , the momentary ground fault simulator device 45 is provided . a momentary path to ground of sufficient extent supplied by the ground fault simulator 45 , also serves to test the function of current limited ground fault sensor 43 , control coupling 42 , and controlled reset switch 41 , and is preferred to a more direct means of causing an initial open state in the reset switch current path . in the event that any of the elements fail to the extent that there is no response to the simulated ground fault , and the said current path remains conductive , the ground fault circuit interrupter will not be reset . if the defect causes the said current path to remain open , the gfci will also not be reset . in either instance , a unit with defective automatic reset circuitry would be kept out of service . if the automatic reset circuit is connected in series with a manually operated reset switch rather than in its place , and the failure is such that the controlled reset switch remains conductive , the manual reset switch may be used to override the automatic device . in the more specific embodiment of fig2 the controlled reset switch is shown to comprise an scr 57 connected between reset switch terminals 17 and 18 , by respective leads 53 and 52 . variable resistance 58 and fixed resistance 59 are connected in series between the gate and anode of scr 57 with photo conductive cell 60 connected between the gate and cathode . a probe or test current supplied from source 100 through terminal 17 and lead 53 is limited by resistance 62 , and is passed through neon discharge lamp 61 and rectifier diode 63 before passing into the coupling lead 44 which connects the sensor 43 to lead 29 and thus passes it on to load circuit . the resistance 62 may be 22k to 220k ohms with readily available ne2h or ne2 lamps , respectively , and while the sensitivity of the automatic reset is shown as being made adjustable only by the variable gate to anode resistance 58 of scr 57 in the controlled reset switch element 41 , it should be understood that resistance 62 may also be made variable to further affect sensitivity to fault by adjustment in the sensor element 43 . if a fault path to ground exists in the load circuit after disconnection by the tripped gfci , current will flow through the lamp 61 of sensor element 43 , and the emission path will serve as control coupling 42 wherein the light emitted by fault current flow in the neon of 61 will reach the photo conductor 60 of controlled reset switching element 41 and when sufficient to sufficiently lower the resistance of 60 , will cause scr 57 to interrupt the current path between reset terminals 17 and 18 , or to reduce said current flow below a critical level required for gfci operation . the sensitivity of the reset circuit , determined by selection of components as well as adjustment of variable resistances , should be such as to provide a greater sensitivity to a given fault resistance in sensor 43 after tripping of the gfci than that exhibited by the gfci in its tripping , in order to avoid rapid resetting and retripping in the presence of a fault of marginal hazard level . the sensitivity of sensor 43 should not be made overly great , however , or the continuing presence of minor faults below established hazard levels may prevent reset after the fault that caused the tripping has been cleared . the specifics of this adjustment are a matter related to the nature of the appliance and scenario of the application , however , and special circumstances such as those to be found in medical situations may benefit from special levels of &# 34 ; holding &# 34 ; sensitivity after tripping , not only in adjustment of the sensor to delay reset until faults of any appreciable level are cleared , but in increasing the trip sensitivity of the gfci itself for the greater protection of shock susceptible patients since unwarranted and unnecessary downtime would not be increased due to the automatic reset feature , and power would not be appreciably interrupted , except in the presence of true fault conditions . the more specific embodiment of fig2 also shows the momentary ground fault simulator 45 to comprise a capacitor 54 charged in one direction through rectifier diode 55 during the time relay coil 25 is energized and contacts 22 and 24 are closed , and contacts 21 and 39 are open . when the gfci is tripped , and coil 25 is de - energized , contacts 22 and 24 are open , and contacts 21 and 39 close to short out rectifier diode 55 through lead 56 , so that the capacitor 54 is free to charge in the opposite direction through rectifier diode 63 included in the ground fault sensor 43 and to thus supply to the sensor circuitry a brief pathway to ground as a ground fault simulation . fig2 a depicts an alternate means of connecting capacitor 54 and rectifier diode 55 of the momentary ground fault simulator in fig2 so as to utilize the hot side contacts 22 and 40 to short out or shunt rectifier diode 55 rather than the grounded neutral contacts 21 and 39 . the combined resistance of 58 and 59 would be typically adjusted between 400k and 1 megohm and the scr should be a sensitive gate type rated as having a 200 microampere igt , 1 to 4 ampere it ( rms ), and 200 volt or greater vdrm . the value of the capacitor 54 should be 0 . 033 mfd to 0 . 2 mfd , and should be rated in excess of 250 wvdc . the photo conductor 60 is typically a 170 volt 0 . 2 watt cadmium sulphide type , and the minimum resistance is preferably low , in the 100 ohm range , with dark resistance in the 500k ohm range , resistances 58 , 59 , and 62 , should be 1 / 4 to 1 / 2 watt and rectifier diodes 55 and 63 are general purpose silicon types rated at 1000 volt prv and 1 to 2 . 5 amperes ( rms ). turning now to fig3 it should be noted that components referenced as 100 , 1 through 14 , and 16 through 57 have substantially the same location connection , and function as in fig2 . an additional component , rectifier 64 is included in controlled reset switch 41 to protect the gate of scr 57 , to block reverse gate voltage on the negative half cycle of anode supply voltage . the current limited ground fault sensor in this instance comprises the gate connected control circuit of scr 57 and includes a rectifier 65 having its anode connected to the anode of gate protective rectifier 64 , and its cathode connected to the anode of scr 57 or directly to reset terminal 17 , or other similar supplier of current from source 100 . the fault sensor 43 also includes a capacitor 68 connected in parallel with a series connected variable resistance 66 and fixed resistance 67 and the combination also connecting the anode of rectifier 64 with a supplier of current from source 100 which is in this instance contact 40 connected to lead 20 by gfci relay armature contact 22 . this connection through the relay contacts , rather than an optional direct connection to a source of anode voltage , disconnects the path of triggering current to the gate until tripping of the gfci and assists in the necessary interruption of the current path across reset terminals 17 and 18 . this arrangement also causes a reduction in the difference between the lessor initial sensitivity to fault and the greater sensitivity to fault that results once the scr has reacted to substantially reduce current flow across reset terminals 17 and 18 . if the difference were extreme , the far greater &# 34 ; holding &# 34 ; sensitivity could have the undesirable effect of maintaining the tripped state in the presence of much less than hazardous fault conditions as previously discussed in regard to fig2 . the first element or current limited ground fault sensor 43 also includes a capacitor 69 and rectifier 70 . the capacitor 69 is connected on one side to the anode of rectifier 64 and on the other to the cathode of rectifier 70 , and to the cathode of scr 57 in the second element 41 through rectifier 89 , which is shown as a part of the second element 41 , but which could just as well be included as a part of the first element 43 , as could rectifier 64 . in this instance , the coupling of the first element 43 with the second element 41 made through the control coupling element 42 is of an electrically conductive nature . the coupling of the first element 43 with the load circuit is accomplished by connection of the anode of rectifier 70 to lead 29 by means of coupling lead 44 , and may be made through an optional current limiting resistance 71 . such a current limiting resistance 71 , is of value only in the event of a bi - directionally conducting failure of scr 57 , a conductive failure of capacitor 69 , a failure of both of the rectifiers 70 and 89 , or any other conductive failure that would deliver a hazardous level of current from the source to the load circuit after it is disconnected from the source by the gfci . it should be noted that the current limited sensor circuit can be employed without connecting the capacitor 69 to the cathode of scr 57 through rectifier 89 or by any other means , but if this is done , rectifier 70 must also be eliminated , and capacitor 69 connected directly to optional current limiting resistance 71 or to lead 44 . in fig3 the scr is as for fig2 resistances are 1 / 4 to 1 / 2 watt with 67 having a value of 470k ohm , 66 having a value of approximately 500k ohms , and the optional resistance 71 , having a value of approximately 33k ohms . the capacitor 69 should be approximately 0 . 033 to 0 . 047 mfd . the capacitor 68 should be approximately 0 . 02 mfd , and tends to be a more critical value . both capacitors should have a minimum rating of 250 wvdc . in operation , the scr is triggered into conduction by voltage supplied through resistances 67 and 68 , and capacitor 68 when connected to the source 100 through lead 72 contacts 22 and 40 , leads 20 , 13 , etc ., and triggering level will be normally reached at the gate when capacitor 69 is sufficiently charged in the forward direction of scr 57 . a subsequent discharge of capacitor 69 or charge in the opposite direction is accomplished through rectifier 65 which is continuously connected to source 100 through reset terminal 17 . after tripping of the gfci , opening of the load circuit , including leads 34 and 35 , and closure of contacts 21 and 39 , and 22 and 40 , a brief pathway to ground exists through capacitor 54 in the momentary ground fault simulator element 45 to discharge capacitor 69 and provide for an initial non - conductive state in scr 57 . if another pathway to ground of sufficiently low impedance exists in the load circuit , capacitor 69 will continue to be discharged or to be charged in the opposite direction at a rate greater than it can be charged in the forward direction , and scr 57 will remain non - conductive , and the gfci will not be reset . when no such pathway to ground exists , capacitor 69 can be charged in the forward direction , scr 57 can be triggered into conduction , and the gfci reset . in fig4 components referenced as 100 , 1 through 14 , 16 through 44 , and 46 through 53 , have substantially the same location and function as in fig3 . in this instance , lead 72 from gfci relay contact 40 is connected to one side of the coil 74 of a small d . p . s . t ., normally closed relay with contact pairs 75 and 77 , and 76 and 78 , and the other side of the coil is connected through small relay contacts 75 and 77 , and lead 73 to gfci relay contact 39 . the series connected resistances 66 and 67 which were connected in parallel with capacitor 68 contacts 75 and 77 , and lead 73 to gfci relay contact 39 . the series connected resistances 66 and 67 which were connected in parallel with capacitor 68 to source 100 through lead 72 and contact 40 in fig3 are now connected to said source 100 through lead 78 , small relay contacts 78 and 76 , lead 79 and 53 , etc . when the gfci relay coil 25 is de - energized and the load disconnected from source 100 by the opening relay contacts , the closing contact pairs 21 and 39 and 22 and 40 supply power from source 100 to small relay coil 74 through its own normally closed contacts 75 and 77 which causes the relay to open and close rapidly in buzzer fashion and open and close its contacts 76 and 78 carried on the same armature . this effect provides an audible indication of tripping , greatly facilitates the initial current path interruption across reset terminals 17 and 18 , and causes a more controllable difference between the lesser initial sensitivity to fault and the greater sensitivity to fault that exists after scr 57 has been rendered substantially non - conductive ( holding sensitivity ). in this instance , the momentary ground fault simulator is not employed , but resistance 81 connecting lead 44 with a source of ground potential through contacts 39 and 21 assists in achieving an initial break in the current path between reset terminals 17 and 18 when tripping is not due to a true fault or the tripping fault is very brief . since the rate of contact opening and closure is dependent upon the physical characteristics of the small relay , care should be taken in the selection to maximize the effect and some means of providing adjustability such as a variability in spring tension could be of value . turning finally to fig5 it will be noted that components 1 through 14 , and 16 through 40 , and 46 through 51 are shown in fig1 through 4 , having substantially the same location , and with the addition of normally closed pushbutton switch 15 across the reset terminals 17 and 18 , represent an unmodified conventional ground fault circuit interrupter connected to a load circuit plug and cable and to an a . c . power source . in this instance the automatic reset circuit resides in its own enclosure 150 , but still functions to interrupt and restore the current pathway to the ground fault circuit interrupter module through reset terminals 17 and 18 , and switch 15 , by interrupting current to the entire gfci unit after tripping of the gfci has disconnected the load from source 100 . gfci plug terminals 9 , 10 , and 11 , engage automatic reset receptacle terminals 90 , 91 , and 92 , respectively , with grounded and grounding terminals 90 and 92 feeding directly through leads 93 and 95 to grounded and grounding terminals 97 and 99 , respectively . the hot side current pathway to plug contact 10 of the gfci comprising the reset circuit plug contact 98 , leads 121 and 94 , and receptacle contact 91 is interrupted by normally open contacts 102 and 103 . lead 121 supplies current from the hot side of source 100 to the anode of scr 107 and through 107 , when made conductive , to relay coil 118 equipped with &# 34 ; free wheeling &# 34 ; diode 119 . in accord with this invention , and in order to provide an assurance of correct or non - hazardous wiring in a receptacle into which plug contacts 97 , 98 , and 99 will be inserted , return current through coil 118 to the ground side of source 100 is given two pathways . initially , when coil 118 is not energized , contacts 104 and 106 provide the pathway to lead 95 , and thus to grounding plug contact 99 . if no third wire grounding is available , the coil cannot be energized . if grounding pathway is intact , the coil can be energized and immediately upon energizing will close contacts 105 and 106 , and transfer the ground side pathway to lead 93 , and thus to grounded neutral plug contact 97 . if hot and neutral are reversed in the receptacle , no energizing will take place . if hot and grounding are reversed , the coil will be energized only when contacts 104 and 106 are closed . no continuous current pathway will be provided , and the resulting buzzer action of the relay will give audible indication of the receptacle error . if grounded and grounding connections are reversed , energizing will occur , but while this latter receptacle wiring error is of some importance , it does not constitute an immediate hazard with reference to operation of the invention . in this arrangement , the relay comprising coil 118 and contacts 101 through 106 should be selected to offer a rapid transfer from grounding to grounded neutral connection to avoid de - energizing during transfer . it will be noted that resistances 111 and 112 , rectifier diodes 108 , 109 , 113 , and 120 , and capacitor 110 perform substantially the same function as resistances 66 and 67 , rectifier diodes 64 , 65 , 70 , and 89 , and capacitor 69 in fig3 and 4 , in comprising an scr gate control circuit capable of reacting to a fault in the load circuit which includes leads 34 , 35 , and 36 in plug 37 and cable sheath 38 . in this instance , the controlled scr 107 with its gate protective rectifier diode 108 does not directly perform the reset switching function as in fig3 and 4 , but becomes part of the first element or current limited ground fault sensor . the relay coil 118 with its free wheeling diode 119 also becomes part of the first element with the relay contacts 102 and 103 comprising the controlled reset switching function of the second element in interrupting and restoring power to the gfci module . a magnetic field of influence indicated by dotted line 42 &# 39 ; generated by the coil 118 with its core becomes the control coupling or third element of the automatic reset circuit . while current limiting resistance 114 , approximately 22k ohms resembles that of 71 in fig3 and 4 , it is not optional . resistance 117 , approximately 100k ohms , connects the sensor element to the grounded neutral load lead 34 through contact 31 of plug 37 , contact 83 of receptacle - plug combination 82 , and lead 115 , and serves to assist in assuring initial reset interruption in the event of very brief tripping and in place of the fault simulator . resistance 114 is connected by lead 116 to contact 84 in receptacle - plug combination 82 and thus to contact 32 and load lead 35 in load plug 37 and cable sheath 38 . load plug contacts 31 , 32 , and 33 feed through contacts 83 - 86 , 84 - 87 , and 85 - 88 of receptacle - plug . combination 82 to the gfci receptacle contacts 49 , 50 , and 51 , respectively . relay contacts 101 , 104 , 105 , and 106 , carry only the current demanded by the automatic reset circuit , and may be small . while the 102 and 103 contacts enjoy dry switching conditions and are designed to close before the relay of the gfci closes to connect the load and to open after the relay of the gfci opens to disconnect the load , to avoid arcing problems , they must be large enough to carry the current for which the gfci is rated . while the sensor element in this instance includes the gate control circuit comprising capacitor 110 , resistances 111 and 112 , and rectifier 109 , it should be understood that scr 107 could be controlled by other means such as a photoconductive cell as outlined in fig2 wherein a light source is employed in the sensor circuit . while this invention has been described with respect to certain specific embodiments , it will be appreciated that many modifications and changes may be made by those skilled in the art without departing from the inventive concepts or spirit of this invention . it is intended , therefore , by the appended claims to cover all such modifications and changes as fall within the true spirit and scope of the invention .	7
the following description of the preferred embodiment ( s ) is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . for purposes of clarity , the same reference numbers will be used in the drawings to identify similar elements . as used herein , the term module refers to an application specific integrated circuit ( asic ), an electronic circuit , a processor ( shared , dedicated , or group ) and memory that executes one or more software or firmware programs , a combinational logic circuit , and / or other suitable components that provide the described functionality . referring now to fig1 , a vehicle is shown generally at 10 . the vehicle includes an engine 12 that drives a transmission 14 through a torque converter 16 . air is drawn into the engine 12 through a throttle 18 . the air is mixed with fuel and combusted within cylinders ( not shown ) of the engine 12 to produce drive torque . the torque converter 16 supplies the engine torque to the transmission via an input shaft 20 . the transmission 14 in the exemplary embodiment is a multi - speed , automatic , clutch - to - clutch transmission that drives an output shaft 22 based on engine torque . the output shaft 22 drives a driveline 24 of the vehicle 10 . a range selection device 26 enables an operator to set the transmission 14 at a desired operating range including , but not limited to , park , reverse , neutral , and one or more forward drive positions . the speed and torque relationships between the engine 12 and the driveline 24 are controlled by hydraulically operated clutches c 1 , c 2 , c 3 , c 4 , and c 5 of the transmission 14 . pressurized fluid is provided to the clutches from a regulated hydraulic pressure source 28 . the clutches c 1 , c 2 , c 3 , c 4 , and c 5 are coupled to the hydraulic pressure source via control valves 30 , which regulate clutch pressure by supplying or discharging fluid to / from the clutches c 1 , c 2 , c 3 , c 4 , and c 5 . referring now to fig2 , in the exemplary transmission , the five clutches c 1 , c 2 , c 3 , c 4 and c 5 are selectively engaged to provide neutral , six forward drive ratios , and one reverse drive ratio . although the exemplary automatic transmission 14 includes six forward drive ratios and one reverse drive ratio , it is appreciated that the air purge method and system for a rotating clutch according to the present invention can be implemented in automatic transmissions having more or fewer drive ratios . the table of fig2 illustrates an exemplary combination of engaged clutches to establish the various drive ratios . each drive ratio relates to an automatic gear of the transmission where the gears for a six speed automatic transmission are first , second , third , fourth , fifth and sixth . the first forward drive ratio is established by engaging the first clutch c 1 and the fifth clutch c 5 . the second forward drive ratio is established by disengaging the fifth clutch c 5 and substantially simultaneously engaging the fourth clutch c 4 . to establish the third forward drive ratio , the fourth clutch c 4 is disengaged as the third clutch c 3 is engaged . the fourth forward drive ratio is established by disengaging the third clutch c 3 while engaging the second clutch c 2 . to establish the fifth forward drive ratio , the first clutch c 1 is disengaged as the third clutch c 3 is substantially simultaneously engaged . the sixth forward drive ratio is established by disengaging the third clutch c 3 and simultaneously engaging the fourth clutch c 4 . the reverse drive ratio is established by engaging the third clutch c 3 and the fifth clutch c 5 . the transmission 14 is in neutral when only the fifth clutch c 5 is engaged . referring back to fig1 , a speed sensor 32 senses a rotational speed of the engine 12 and generates an engine speed signal . a temperature sensor 36 senses a temperature of the transmission fluid and generates a transmission temperature signal . the range selection device 26 generates a range signal . a control module 40 receives the above mentioned signals . the control module 40 controls the operation of the control valves 30 in order to pulse on and off clutches of the transmission 14 . the control module 40 pulses a clutch based on the received signals and the air purge method of the present invention . in an exemplary embodiment , the control module 40 pulses c 3 a determined number of times while the transmission 14 is operating in first and second gear , before the transmission 14 reaches third gear . referring to fig3 , fig3 is a data flow diagram illustrating sub - modules and data - flows of the control module 40 of the present invention . the control module 40 includes an enable module 42 , a gear enable module 44 , a pulse determination module 46 , a clutch pressure module 48 , and a shift delay module 50 . the enable module 42 receives the range signal 52 from the range selection device 26 ( fig1 ). the enable module 42 determines whether the air purge method has already run this key cycle . if the air purge method has not run , the enable module enables the air purge method by setting an enable flag 54 to true . if the air purge method has already run once this key cycle but the transmission range 52 indicates park or neutral for a selectable period of time during the key cycle , the enable module 42 re - enables the air purge method by setting the enable flag 54 to true . gear enable module 44 receives a transmission gear 56 determined from the ratio of the transmission 14 ( fig1 ) and the enable flag 54 from enable module 42 . gear enable module 44 evaluates the transmission gear 56 . if the enable flag 54 is true and the transmission 14 ( fig1 ) is operating in a proper gear to enable pulsing of a clutch , gear enable module 44 enables the pulse determination module 46 by setting a pulse enable flag 58 to true . pulse determination module 46 receives the transmission temperature 60 , a current calculated line pressure 62 , and the enable flag 58 . pulse determination module 46 calculates a pulse on time 66 from a learned volume of the clutch and a state of convergence to the volume . the learned volume of the clutch and the state of convergence of the volume are calculated based on the transmission temperature 60 and the current line pressure 62 . pulse determination module 46 also calculates a pulse off time 68 and an adequate pulse number 70 based on the transmission temperature 60 . clutch pressure module 48 receives the pulse on time 66 , the pulse off time 68 , and the pulse number 70 . clutch pressure module 48 commands line pressure 72 at a maximum value according to the pulse on and off times 66 , 68 and the number of pulses 70 . clutch pressure module keeps a pulse count 74 of the number of pulses completed . shift delay module 50 receives engine speed sensed from the engine 12 ( fig1 ), the transmission gear 56 , and the pulse count 74 . if the pulse count 74 is not equal to a desired number of pulses for the current gear 56 , shift delay module 50 delays the transmission 14 ( fig1 ) from shifting to the next higher gear ( upshifting ) by sending a commanded gear signal 78 to maintain the current gear . shift delay module 50 delays the shift as long as the engine speed 76 does not indicate an overspeed condition . shift delay module 50 further delays subsequent upshifts after the pulse count 74 indicates the pulses have completed to ensure adequate shift spacing . referring now to fig4 , a flowchart illustrating steps of the air purge method according to the present invention is shown . the air purge method is continually performed throughout a key cycle . in step 100 , control determines whether enable conditions are met . if a new key cycle has occurred or the range indicates park or neutral for a selected period of time , enable conditions are met and control continues with step 110 . otherwise control loops back and continues to monitor the enable conditions . in step 110 , control determines whether the transmission is operating in the proper gear to pulse the clutch on and off . in the example of pulsing c 3 on and off , the proper gears would be first gear and second gear . if the transmission is in the proper gear , control continues with step 120 . in step 120 , control calculates a pulse on and off time and pulse number based on a learned clutch volume , an adaptive convergence state , and the transmission temperature . in step 130 , control commands maximum pressure . if the pulse on time has expired in step 140 , control continues with step 150 . if the pulse on time has not expired in step 140 , control continues commanding maximum pressure in step 130 . once the pulse on time has expired , control commands pressure off in step 150 . in step 160 , control determines whether a desired number of pulses has completed for that gear . if the desired number of pulses has not completed , control delays an upshift from occurring in step 170 by commanding the current gear to be maintained . control then evaluates the pulse off time in step 180 . if the pulse off time has not expired control continues to command pressure off in step 150 . if the pulse off time has expired , control increments a pulse counter in step 186 and loops back to step 120 where a new pulse on and off time and pulse number is calculated . control then continues to pulse the clutch on and off until a desired number of pulses has completed . in step 160 , if the pulse counter equals the desired number of pulses , the upshift is allowed in step 190 and the pulse values are reset to zero in step 200 . control then loops back to step 110 where the transmission gear is evaluated . if the transmission is still operating in the proper gear for pulsing , control continues to pulse the clutch as stated in the steps above . otherwise , the transmission 14 ( fig1 ) has shifted to a gear in which pulsing of the clutch is not desired . in the exemplary embodiment , this is third gear because c 3 is required to be fully applied for the operation of third gear . once the transmission 14 ( fig1 ) is not operating in the desired gear , control delays any subsequent upshifts based on the time delay created by the pulsing in step 210 . this delay time can be selectable . the delay prevents undesireable shifts occurring one right after another . control then loops back to step 100 where the enable conditions are evaluated . those skilled in the art can now appreciate from the foregoing description that the broad teachings of the present invention can be implemented in a variety of forms . therefore , while this invention has been described in connection with particular examples thereof , the true scope of the invention should not be so limited since other modifications will become apparent to the skilled practitioner upon a study of the drawings , specification , and the following claims .	5
in addition to the description provided below , all of the materials contained in co - pending patent application , ser . no . 08 / 136 , 161 filed on oct . 15 , 1993 , are incorporated herein by this reference . with reference to fig1 there is shown a portion of a memory wherein the present invention is implemented , the memory 10 preferably comprising a plurality of multi - bit memory cells uc00 - uc22 arranged in rows and columns . each of the memory cells is preferably capable of storing a plurality of bits of data . for each column of cells , there is a pair of corresponding complementary bit lines ( bl0 and bl0 , bl1 and bl1 , bl2 and bl2 ) coupled to each of the cells in that column . in addition to being coupled to each of the cells in a particular column , each pair of complementary bit lines is also coupled to a corresponding bit driver line ( bl0 , bl1 , bl2 ). as will be explained , the bit driver lines and the complementary bit lines are used to store a voltage found on the input voltage line vr into the memory cells uc00 - uc22 . preferably , the complementary bit lines ( bl0 and bl0 , bl1 and bl1 , bl2 and bl2 ) are further coupled to corresponding sense amps ( sa0 , sa1 , sa2 ). as will be explained , the sense amps and the bit lines are used to read data out of the memory cells . coupled to each row of the memory cells are complementary word lines ( wl0 and wl0 , wl1 and wl1 , wl2 and wl2 ). these word lines are used to control the activation ( i . e . the conduction ) of the memory cells . together , the word lines and the bit lines control which memory cell is accessed , both for reading and writing purposes . with reference to fig2 the structure of each of the memory cells will now be described in detail . for the sake of convenience , only memory cell uc00 is shown in fig2 but it should be understood that each of the memory cells uc00 - uc22 preferably has the same construction . as shown , memory cell uc00 preferably comprises a switching element 20 , a storage capacitor 22 , and an isolating element 24 . the switching element 20 preferably has a first terminal coupled to bit line bl0 , a second terminal coupled to the storage capacitor 22 , and a plurality of control terminals coupled to complementary word lines wl0 and wl0 . the switching element 20 preferably comprises at least two complementary switching components , with one switching component 26 having a threshold voltage which is positive , and one switching component having a threshold voltage which is negative . by positive threshold voltage , it is meant that switching component 26 will conduct ( i . e . turn on ) when a positive voltage having a sufficient magnitude exists between the control terminal of the switching component 26 and the capacitor 22 . likewise , by negative threshold voltage , it is meant that switching component 28 will conduct when a negative voltage having a sufficient magnitude exists between the control terminal of the switching component 28 and the capacitor 22 . the positive threshold switching component 26 preferably has a first terminal coupled to the bit line bl0 , a second terminal coupled to the capacitor 22 , and a control terminal coupled to word line wl0 . likewise , the negative threshold switching component 28 preferably has a first terminal coupled to the bit line bl0 , a second terminal coupled to the capacitor 22 , and a control terminal coupled to word line wl0 . the general function of switching element 20 is to selectively couple the capacitor 22 to the bit line bl0 in response to control signals received on the word lines wl0 , wl0 . this allows data to be selectively read from and written to cell uc00 . the construction of switching element 20 is advantageous in at least two respects . first , the positive and negative threshold components 26 , 28 are complementary devices . this means that when they both conduct , they generate complementary noise signals which cancel each other out . this serves to significantly reduce the amount of switching noise that is passed on to the capacitor 22 , which in turn , reduces the impact of noise on the data stored in the capacitor 22 . second , because one of the switching components 26 has a positive threshold , and the other 28 has a negative threshold , switching element 20 does not suffer from the cut - off effect described above . as long as a sufficient voltage is applied to the word lines wl0 , wl0 , at least one of the components 26 , 28 will be able to conduct to couple the capacitor 22 to the bit line bl0 , regardless of the voltage stored in the capacitor . this means that memory cell uc00 can store voltages within the entire dynamic operating voltage range , free of any cut - off effects . since memory cell uc00 is able to store voltages in a wider voltage range than the prior art cells , memory cell uc00 is capable of storing more data than the prior art memory cells . the isolating element 24 preferably has substantially the same construction as switching element 20 . element 24 preferably comprises a positive threshold switching component 30 and a negative threshold switching component 32 . component 30 preferably has a first terminal coupled to the capacitor 22 , a second terminal coupled to the bit line bl0 , and a control terminal coupled to word line wl0 , while component 32 preferably has a first terminal coupled to the capacitor 22 , a second terminal coupled to the bit line bl0 , and a control terminal coupled to word line wl0 . the general function of element 24 is to electrically isolate memory cell uc00 from other neighboring circuit components . when it is non - conducting ( i . e . off ), element 24 prevents signals on bit line bl0 from affecting the data stored in capacitor 22 . when conducting , element 24 couples the capacitor 22 to the bit line bl0 . in implementing the memory cell of the present invention , a number of different switching devices can be used as the positive and negative threshold switching components 26 , 28 , 30 , 32 . examples of positive threshold switching devices include n - channel enhancement metal oxide semiconductor field effect transistors ( mosfet ), npn bipolar junction transistors ( bjt ), n - type junction field effect transistors ( jfet ). n - channel enhancement metal electrode semiconductor field effect transistors ( mesfet ), and n - channel metal insulator semiconductor field effect transistor ( misfet ). examples of negative threshold switching devices include p - channel enhancement mosfet &# 39 ; s , pnp bjt &# 39 ; s , p - type jfet &# 39 ; s , p - channel enhancement mesfet &# 39 ; s , and p - channel misfet &# 39 ; s . which devices are used is a matter of design choice . with reference to fig3 there is shown a preferred embodiment of the present invention wherein the memory cell uc00 is implemented using mosfet &# 39 ; s . as shown in fig3 the memory cell 40 preferably comprises a storage capacitor 42 , two n - channel enhancement mosfet &# 39 ; s n1 , n2 , and two p - channel enhancement mosfet &# 39 ; s p1 , p2 . together , transistors n1 and p1 form the switching element 20 of fig1 and together , transistors n2 and p2 form the isolating element 24 of fig1 . transistor n1 preferably has a drain terminal coupled to bit line bl0 , a source terminal coupled to a first terminal of the capacitor 42 , and a gate terminal coupled to write line wl0 . transistor p1 preferably has a drain terminal coupled to bit line bl0 , a source terminal coupled to the first terminal of the capacitor 42 , and a gate terminal coupled to write line wl0 . transistor n2 preferably has a drain terminal coupled to a second terminal of the capacitor 42 , a source terminal coupled to bit line bl0 , and a gate terminal coupled to write line wl0 . transistor p2 preferably has a drain terminal coupled to the second terminal of the capacitor 42 , a source terminal coupled to bit line bl0 , and a gate terminal coupled to write line wl0 . other types of field effect transistors ( fet &# 39 ; s ), such as the ones noted above , may be substituted for mosfet &# 39 ; s n1 , n2 , p1 , and p2 . the configuration just described may be used for all implementations where fet &# 39 ; s are used . in the case where bipolar junction transistors are employed , n1 and n2 are preferably implemented using npn bjt &# 39 ; s , and p1 and p2 are preferably implemented using pnp bjt &# 39 ; s . in such an implementation , transistor n1 preferably has a collector terminal coupled to bit line bl0 , an emitter terminal coupled to a first terminal of the capacitor 42 , and a base terminal coupled to write line wl0 . transistor p1 preferably has a collector terminal coupled to bit line bl0 , an emitter terminal coupled to the first terminal of the capacitor 42 , and a base terminal coupled to write line wl0 . transistor n2 preferably has a collector terminal coupled to a second terminal of the capacitor 42 , an emitter terminal coupled to bit line bl0 , and a base terminal coupled to write line wl0 . further , transistor p2 preferably has a collector terminal coupled to the second terminal of the capacitor 42 , an emitter terminal coupled to bit line bl0 , and a base terminal coupled to write line wl0 . connected in this manner , the bjt implementation would function in substantially the same manner as the mosfet implementation shown in fig3 . thus far , only the basic memory cell 40 has been described . optionally , other elements may be added to the cell 40 to further enhance performance . fig4 shows a memory cell of the present invention wherein a discharge element 50 is added to the cell . discharge element 50 preferably has a first terminal coupled to the first terminal of the capacitor 42 , a second terminal coupled to the second terminal of the capacitor 42 , and two control terminals coupled to the complementary discharge control lines ( discharge and discharge ). the primary function of discharge element 50 is to remove charge from the capacitor 42 before new data is stored in the capacitor 42 . this prevents any leftover charge from affecting or altering the new data being stored in the capacitor 42 . the discharge element 50 preferably has substantially the same construction as the switching 20 and isolating elements 24 . more specifically , element 50 preferably comprises a pair of complementary switching components , with one component having a positive threshold voltage and the other having a negative threshold voltage . in the preferred embodiment shown in fig4 element 50 comprises an n - channel enhancement mosfet n3 ( acting as the positive threshold component ) and a p - channel enhancement mosfet p3 ( acting as the negative threshold component ). transistor n3 preferably has a drain terminal coupled to the first terminal of the capacitor 42 , a source terminal coupled to the second terminal of the capacitor 42 , and a gate terminal coupled to the discharge line ( discharge ). likewise , transistor p3 preferably has a drain terminal coupled to the first terminal of the capacitor 42 , a source terminal coupled to the second terminal of the capacitor 42 , and a gate terminal coupled to the discharge line ( discharge ). of course , other similar devices , such as bjt &# 39 ; s and other types of fet &# 39 ; s may be used instead of the mosfet &# 39 ; s shown in fig4 . as a further enhancement to the memory circuit , yet another discharge element 60 may be included . note that this discharge element 60 is preferably not a part of the memory cell 40 . discharge element 60 preferably has a first terminal coupled to bit line bl0 , a second terminal coupled to bit line bl0 , and two control terminals coupled to the complementary reset control lines ( reset and reset ). the primary function of element 60 is to remove leftover charge from the complementary bit lines before reading and writing operations so that the leftover charge does not affect the data being read or written . the discharge element 60 preferably has substantially the same construction as the discharge element 50 . more specifically , discharge element 60 preferably comprises a pair of complementary switching components , with one component having a positive threshold voltage and the other having a negative threshold voltage . in the preferred embodiment shown in fig4 element 60 comprises an n - channel enhancement mosfet n4 ( acting as the positive threshold component ) and a p - channel enhancement mosfet p4 ( acting as the negative threshold component ). transistor n4 preferably has a drain terminal coupled to the bit line bl0 , a source terminal coupled to the bit line bl0 , and a gate terminal coupled to the reset line ( reset ). likewise , transistor p4 preferably has a drain terminal coupled to the bit line bl0 , a source terminal coupled to the bit line bl0 , and a gate terminal coupled to the reset line ( reset ). if so desired , other devices such as bjt &# 39 ; s and other types of fet &# 39 ; s may be used in place of the mosfet &# 39 ; s shown in fig4 . with reference to fig1 and 4 , the operation of memory 10 will now be described . the writing cycle will be described first . for the sake of illustration , it will be assumed that memory cell uc00 is the cell to which data will be written . the write cycle begins with reset signals being sent on the reset lines ( reset and reset ). these signals cause transistors n4 and p4 to become conductive , which in turn , causes bit lines bl0 and bl0 to be discharged . this process serves to cleanse the bit lines to get them ready for the write operation . also , discharge signals are sent onto the discharge lines ( discharge and discharge ) to activate transistors n3 and p3 . this causes capacitor 42 to be discharged , thereby making it ready to receive the new data . once that is done , bit driver line bd0 is activated , to allow the voltage appearing on the input voltage line vr to reach bit line bl0 . the voltage on line vr will increment with each clock cycle , as is known in the art . when the voltage on line vr reaches the desired voltage ( representing the desired data bits ), then activation signals are sent onto word lines wl0 and wl0 to turn on transistors n1 , n2 , p1 , and p2 . this in effect allows the voltage appearing on bit line bl0 to be loaded into the storage capacitor 42 . thereafter , the activation signals are removed from the word lines wl0 , wl0 to once again render the transistors n1 , n2 , p1 , p2 non - conductive , thereby storing the desired voltage within the capacitor 42 . the write cycle is thus complete . for the read cycle , a similar process is carried out . to read data from memory cell uc00 , reset signals are first sent onto the reset lines ( reset and reset ) to cause transistors n4 and p4 to remove any leftover charge from the bit lines bl0 , bl0 . then , activation signals are sent onto word lines wl0 and wl0 to activate transistors n1 , n2 , p1 , and p2 . this allows the voltage stored in the capacitor 42 to be transferred onto bit line bl0 . thereafter , the sense amp sa0 receives the voltage from memory cell uc00 and compares it with a reference voltage appearing on line vref . like the voltages appearing on input line vr , the voltages on line vref are preferably incremented each clock cycle . eventually , the voltage from cell uc00 will match one of the voltages appearing on line vref . the voltage , and hence the data , stored in the memory cell uc00 is thus ascertained . in the reading method just described , the output voltage from the memory cell uc00 is compared directly with the voltage on line vref . it should be noted that cell uc00 may also be read using a comparison method involving a dummy cell . this method will be described with reference to the memory portion 70 shown in fig5 . as shown , memory portion 70 preferably comprises a plurality of bit lines bl0 , bl1 with each bit line bl0 , bl1 having a plurality of memory cells uc00 , uc10 , uc20 , uc01 , uc11 , uc21 coupled thereto . in addition to the memory cells , a pair of dummy cells 72 , 74 are also coupled to the bit lines bl0 , bl1 . preferably , all of the cells in fig5 including both the memory cells uc00 , uc10 , uc20 , uc01 , uc11 , uc21 and the dummy cells 72 , take the form of the memory cell of the present invention . the bit lines bl0 , bl1 are attached at one end to the inputs of a comparator 76 , and at the other end to switches 78 and 80 . switches 78 , 80 selectively couple the bit lines bl0 , bl1 to the reference voltage line vref , the input voltage line vr , or to neither . also preferably included in memory portion 70 is a discharge element 82 coupled to both of the bit lines bl0 , bl1 . discharge element 82 serves substantially the same function as discharge element 60 of fig4 and preferably has the same construction . to read data from one of the memory cells , memory cell uc00 for example , the bit lines bl0 , bl1 are first discharged by activating discharge element 82 . once the bit lines are cleansed , switch 80 is activated ( i . e . turned on ) to couple line vref to bit line bl1 , thereby passing a reference voltage appearing on line vref onto bit line bl1 . thereafter , the dummy cell 74 is rendered conductive to receive the voltage appearing on bit line bl1 . once that is done , dummy cell 74 is rendered non - conductive to store the received voltage , and switch 80 is deactivated to decouple bit line bl1 from line vref . thereafter , both the memory cell uc00 and the dummy cell 74 are rendered conductive to transfer the voltages stored within the cells onto bit lines bl0 and bl1 to allow the comparator 76 to compare the voltages from the two cells uc00 , 74 . the above process is preferably repeated for each increment of the voltage on line vref . eventually , the voltage in cell uc00 will match a voltage in the dummy cell 74 . the voltage , and hence , the data in cell uc00 is thus ascertained . a similar process may be used to read data from the other memory cells . a point to note is that to read data from one of the memory cells attached to bit line bl0 , dummy cell 74 is used as a reference cell , and to read data from one of the memory cells attached to bit line bl1 , dummy cell 72 is used as a reference cell . an advantage of this reading method is that it allows for stray capacitance canceling . more specifically , since the memory cell uc00 and the dummy cell 74 have substantially the same construction , and since bit lines bl0 and bl1 are substantially symmetrical , the effects of stray capacitance will be substantially the same for both cells . these effects will cancel each other out when the comparator 76 compares the voltages on the two bit lines bl0 , bl1 . thus , a true comparison of the memory cell voltage and the reference voltage is obtained . this contributes to a more accurate determination of the data stored within the memory cell .	6
preferred embodiments of the present invention are illustrated in the figures , like numerals being used to refer to like and corresponding parts of the various drawings . the various embodiments of the method and system for enhancing the useful lifetime of an ophthalmic illumination system of this invention provide for an enhanced fiber optic illuminator that has an optimized throughput after a preset number of operating hours ( e . g ., 200 hrs ) that meets the throughput requirements desired for the illumination system . in some embodiments , the throughput during the initial operating period ( e . g ., up to 200 hrs ) can be at least as high as the throughput at a desired end of the initial operating period ( e . g ., at 200 hrs ). embodiments of the present invention can further provide a fiber throughput that is relatively constant during the initial operating period . by initially misaligning the xenon lamp arc in a direction towards the lamp anode , an optimum throughput during the initial operating period can be achieved , as well as equal or better throughput during the illuminator lifetime after the initial operating period . embodiments of the present invention can include a fiber optic illumination system comprising a xenon light source in which the xenon arc lamp bulb has been offset ( e . g ., positioned in a vertically offset position ) from an axis corresponding to the optical path axis of an optical fiber ( e . g ., from the initial position of prior art systems as known to those having skill in the art ) to move the arc off - axis at the beginning of life of the xenon light source . the xenon light source can be any xenon lamp having the characteristics required to provide high intensity light for an illuminator , such as an ophthalmic illuminator , as will be known to those having skill in the art . for example , the xenon light source can be an osram 75 w xenon bulb . by initially positioning the xenon lamp arc off - axis at the zero operating hour time ( the initial position ), as the xenon lamp arc location moves away from the anode due to cathode degradation as the lamp ages , the arc will move increasingly on - axis and the coupling efficiency into the optical fiber will increase . this effect will tend to cancel out the effect of decreasing arc peak luminance as operation time increases so that the overall light throughput through the optical fiber ( e . g ., a handheld illuminator probe fiber ) will tend to remain about constant as the lamp ages . the initial position of the xenon lamp is determined by first positioning the xenon lamp bulb to achieve a maximum light flux through an output optical fiber . the bulb ( or bulb \ mirror assembly ) is then vertically misaligned by a prescribed amount and set in place . the desired initial position of the bulb is determined as described below . fig1 is a diagrammatic representation of one embodiment of an enhanced high brightness ophthalmic illuminator system of the present invention . illuminator system 10 comprises power supply 12 and illumination source 14 , cold mirror 16 , a hot mirror 18 , a beam splitter 20 , mirror 21 , optical fiber ports 24 and attenuators 22 . illuminator system 10 also can comprise one or more optical fiber probes 26 for receiving and transmitting light from illumination source 14 to a surgical site . optical fiber probes 26 comprise the handheld portion of the illuminator system 10 , including optical fiber 34 , which is optically coupled to the illumination source 14 within enclosure 11 . high brightness illuminator system 10 is exemplary only and is not intended to limit the scope of the present invention in any way . the embodiments of the present invention can be used to enhance any such ophthalmic illuminator , medical laser , or any other system or machine in which it is desirable to extend the useful lifetime of an illumination source . optical source 14 of illuminator system 10 in this example comprises a xenon lamp , but it can comprise any suitable light source as known to those having skill in the art in which the cathode degrades with age affecting the arc position and intensity . xenon lamp 14 emits light beam 28 , which is directed along the optical path comprising cold mirror 16 , hot mirror 18 , beam splitter 20 , mirror 21 , attenuators 22 , and optical fiber ports 24 . in this example , beam splitter 20 splits light beam 28 into two optical paths to provide for two optical probes 26 if desired . cold mirror 16 and hot mirror 18 combine to remove the infrared and uv components of light beam 28 ( heat ) and provide a cool visible light beam 28 to the downstream optical components , as will be familiar to those skilled in the art . attenuators 22 attenuate optical beam 28 . attenuators 22 can each be custom designed for its respective optical path and need not be identical , though they can be . further , each attenuator 22 can be independently controlled via , for example , pcb 30 . although high brightness illuminator system 10 is shown comprising two optical fiber ports 24 ( with aspheric lenses or other focusing elements ), it will be known to those having skill in the art that a single optical port 24 or multiple optical ports 24 can be implemented within illuminator system 10 . illuminator system 10 further comprises a printed circuit board (“ pcb ”) 30 , or its electronic equivalent , to provide signal processing and control functions . pcb 30 can be implemented in any manner and configuration capable of performing the desired processing and control functions described herein , as will be apparent to those having skill in the art . optical ports 24 comprise a receptacle to receive the proximal end of an optical fiber 34 corresponding to a fiber probe 26 , which is inserted into the high brightness illuminator enclosure 11 and optically coupled to illumination source 14 to direct light onto a desired site . fig2 is a more detailed diagrammatic representation of a portion of illuminator system 10 of fig1 . light emitted from the illumination source 14 arc region ( e . g ., a xenon arc lamp ) is collimated by the collimating lens 13 , and filtered by the cold mirror 16 , hot mirror 18 and attenuator 22 . the light is then focused by the condensing lens 23 ( which can be part of an optical fiber port 24 ) into optical fiber 34 . coupling the light from illumination source 14 into optical fiber 34 is efficient if the arc region is very small , the magnification provided by the illuminator system optics is small enough that the area of the arc image on the optical fiber 34 fits the core area of the optical fiber 34 and the illumination source 14 bulb is aligned so that the arc image size is kept small and the arc image fits within the core area of the optical fiber . fig3 illustrates one example of the optical coupling to a fiber of the light from an illumination source 14 comprising an osram 75 w xenon bulb . as shown in fig3 , the light source 14 arc is tear - drop shaped in this example with the long axis vertical and having an approximate width of about 0 . 18 mm . the optical fiber 34 , in this example , has a 1 . 14 mm diameter proximal end and the optical components of illuminator system 10 provide a magnification of about 1 . 41 . in this example , the arc image 52 fits within the optical fiber 34 core area , and due to the tear - drop shape of the arc , an optimum fiber throughput occurs when the hot - spot 50 is vertically decentered relative to the optical fiber 34 longitudinal axis . fig4 is a close - up view of the arc region of an illumination source 14 comprising a xenon lamp . arc 55 is created between anode 60 and cathode 65 . as can be seen from fig4 , arc 55 is closer to the cathode 65 . arc 55 emits the light provided by illuminator system 10 . as the illumination source 14 bulb ages , the tip of the cathode 65 erodes away , causing the tip of cathode 65 to move in a downward direction ( for a typical installation ) away from the anode 60 and to become blunter . as the cathode 65 erodes , the arc 55 grows in size , decreases in peak luminance , and also moves in the same direction as the cathode 65 away from anode 60 , causing a monotonic and rapid decrease in the illuminator system light throughput . the resultant change in measured arc luminance versus operating time for the example of an osram 75 w bulb is show in the graph of fig5 . it is worth noting that although the examples provided herein involve an osram 75 w xenon bulb , the analysis and results are expected to be comparable for other such illumination sources . the arc 55 position can shift by about 250 microns during the first 200 hours of bulb operation due to such cathode degradation . therefore , if the illumination source 14 is aligned for maximum fiber throughput at zero hours of system operation , the arc 55 movement combined with the decrease in arc 55 peak luminance can cause significant degradation in fiber throughput . the embodiments of the present invention comprise an illumination source 14 bulb offset ( e . g ., vertically misaligned ) relative to the longitudinal axis of an optical fiber 34 , so that the illumination source 14 performance at the end of a desired initial high - performance period of operation ( e . g ., about 200 hours ) is at a desired optimal level . at zero hours , the arc 55 can be positioned to have a desired optimum peak luminance , but will be vertically misaligned . at the end of the initial period of operation , the arc 55 will have a degraded peak luminance ( see fig5 ), but will achieve a position of approximate vertical alignment . these two effects can tend to cancel each other out so that the fiber throughput at zero hours , at the end of the initial period of operation ( e . g ., 200 hours ) and at times in between will be about the same ( approximately constant ). the effects described herein have been demonstrated theoretically by analyzing an illuminator system 10 having an osram 75 w xenon illumination source 14 using zemax optical ray tracing software . the results of one such analysis are illustrated in fig6 . as shown in fig6 , if the vertical portion of the illumination source 14 bulb is positioned to achieve a desired optimum throughput at 5 . 5 hours of operation , the bulb throughput will decrease by about 35 % after about 219 hours . however , if the vertical position of the bulb is adjusted to achieve a desired optimum throughput at 219 hours , the 5 . 5 hour to 219 hour throughput decrease is less than about 7 %. the throughput in such a case degrades much more slowly and monotonically between about 5 . 5 and about 219 hours . in some embodiments , an illuminator system 10 can comprise a retro - reflecting mirror ( or other reflector ) 70 behind the illumination source 14 arc , as shown in fig7 . the retro - reflecting mirror 70 can be positioned such that it is slightly misaligned ( offset ) vertically relative to the illumination source 14 bulb in order to keep the majority of reflected arc 55 image power off the cathode 65 , and thus decrease the rate of cathode 65 erosion . fig8 a and 8b illustrate the results of a comparison between a theoretical zemax software simulation and experimental data ( on a different osram 75 w xenon bulb than the theoretical simulation ). the results for about zero hours and about 200 hours operation time ( with the peak throughput value at about zero hours operation time normalized to 1 ) show excellent agreement between theory and experiment . various embodiments of the present invention thus provide for improved optical coupling to and light transmission through a small gauge optical fiber . further , the embodiments of this invention provide the ability to significantly reduce the decay in coupling efficiency with time as a xenon light source ages . the embodiments of the present invention can be incorporated into any xenon lamp based optical device , such as an ophthalmic illuminator , where optical coupling of a light beam into a small gauge optical fiber is desired . the present invention has been described by reference to certain preferred embodiments ; however , it should be understood that it may be embodied in other specific forms or variations thereof without departing from its spirit or essential characteristics . the embodiments described above are therefore considered to be illustrative in all respects and not restrictive , the scope of the invention being indicated by the appended claims .	0
the brushless homopolar axial - field motor represented in fig1 to 3 is triphasic , has eight poles , and exhibits six about 8 mm wide airgaps . it comprises a rotor 1 and a stator 2 , the stator 2 being connected to a source of electrical energy by suitable lead wires l , l &# 39 ;, and l &# 34 ; as shown in fig1 . the rotor 1 replaces the brake drum or brake disk , and the stator 2 replaces the brake shoe assembly or brake pads together with the brake back plate or brake splash shield , without changes in the wheel - axle 3 . the rotor 1 contains an axially magnetized , or non - magnetic , support tube 5 . in the case of motor - driven wheels , the rotor 1 is solid with the ( rotating ) axle of the wheel , and the bearings 4 are missing . a tubular permanent magnet 6 of highest energy density and with predominantly axial magnetization is set on the support tube 5 . the permanent magnet 6 may be composed of annular disks or annular sectors . it is suitably composed of a samarium - cobalt ( or similar ) material with energy density of 2 . 10 5 j / m 3 or higher . forged iron annular - stellar disks 7 , for example , 1 . 9 cm thick , adjoin the permanent magnet 6 frontally . the forged iron disk facing the external side of the wheel carries the screws 8 holding the wheel , as indicated on fig1 and 2 . the predominantly axially magnetized permanent magnet 6 can exhibit , towards its ends adjoining the forged iron disks , a gradually increased radial component of the magnetization , pointing outward . five pole rings 9 shaped in the form of stars of support arms with axially magnetized pole - pieces 11 of high energy density attached to the free ends of the support arms 10 , are set on the permanent magnet 6 . the pole pieces 11 can also be made of samarium - cobalt material , or , e . g ., of an iron - aluminum - nickel - cobalt alloy ( 5 . 10 4 j / m 3 ). between the pole - rings 9 , light metal plastic or poured resin rings can be applied as additional fasteners . the support arms 10 themselves are made of non - magnetic material and are slightly slanted to provide ventilation . the stator 2 of the axial - field motor is composed of a pot - shaped casing 13 fastened on the wheel - axle and steering knuckle . some openings are present on the bottom of the pot - shaped casing for ventilation and cooling . in the case of motor wheels the casing rests on the bearings which support the ( rotating ) axle . six ring - shaped support elements 14 , each of them carrying a flat ring - shaped coil 15 protruding into the airgap between the pole - pieces 11 , are fixed in the case , extending inwards . on the inner side of the ring - shaped coils there are support rings 16 . the support elements 14 and the support rings 16 are fastened to the corresponding flat ring - shaped coil 15 e . g ., by pouring a hardening agent . the ring - shaped bobbin - wound armature coil 15 can be made suitably of lamellar windings 17 as shown in fig4 with the use of ribbon conductor . each of the six ring - shaped coils 15 contains three phases spatially displaced by 15 ° from each other and connected for all six ring - shaped coils in series such that only three power leads are leaving the motor . the winding is connected preferably in star . the axial - field motor is homopolar , since the lines of force are passing through the pole - pieces 11 everywhere in the same direction . the magnetic flux density in the airgap is about 0 . 8 tests . for a current of 250a the motor develops a torque of about 330 nm . a power of about 20 kw is thereby obtained at a frequency of 600 rotations / m which corresponds to an applied voltage of 100 v . usually there would be two axial - field motors installed in any car at the otherwise not propelled wheels , yielding 40 kw together . for a small car weighing 1000 kg ( including the batteries ), with a diameter of the wheels of 0 . 5 m the speed developed is then about 100 km / h or 62 . 5 m . p . h . due to the limited available torque , the highest slope accessible to the car without use of the internal combustion engine is about 15 %. the acceleration time from rest to 50 km / h ( 31 m . p . h .) is about 8 s . a control system and a battery are needed for the operation of the axial - field motor . the control system is constructed with solid - state components and performs two main functions . ( a ) switching the current for the three phases in the right sequence , such that all radially oriented conductors in the three - phase winding contribute positively to the torque while they are in the airgap . this switching process is triggered by three hall - effect switches h1 , h2 , h3 ( fig2 ) placed on the stator 2 in spatial intervals of α = 15 ° in order to sense the position of the rotor . the switching cycle of the hall switches is represented in fig5 . ( b ) control of the current absorbed by the motor and of the torque generated in the motor . the torque is proportional to the current . the battery contains , e . g ., 18 lead or iron - nickel batteries of 6 v , or the same number of 12 v - batteries , the first choice being particularly favorable for the case of 120 v power outlets being used with a transformerless charger for overnight recharging , or used without charger , by simply switching from the motor m in fig6 to the power outlet ( not shown ). during driving or regenerative braking the batteries can be switched automatically , depending on the frequency of the signals given by the hall switches h 1 - h 3 to the prom , i . e ., depending both on motor speed and on whether the gas pedal or the brake pedal is depressed , in six parallel groups of three batteries in series ( 18 / 36 v ), in three parallel groups of six batteries in series ( 36 / 72 v ), in two parallel groups of nine batteries in series , or all in series ( 108 / 215 v ). the batteries , located for instance in the trunk of the car , are weighing at this time about 300 kg and provide the car with an action radius of about 80 km without the use of the internal combustion engine . the engine is to be used for longer trips . with the battery taken out , only the resistive braking mode of operation can be used . removal of the battery is recommended for extended , or trans - continental trips . fig6 shows a circuit in the power control , which allows for driving , regenerative braking , and resistive braking operation of the axial - field motor . the circuit is connected through an ammeter i and a main switch h to the battery . the capacitor c is parallel to the entrance and reduces the ripple . then a second switch a follows . parallel to the capacitor c is the series connection of a transistor - diode chopper combination tm , dm , a braking resistor and a transistor - diode chopper combination tb , db . the transistor - diode chopper combination tm , dm is for current limitation and control in the driving mode , and the chopper tb , db is for current limitation and control in the resistive braking mode . parallel to the chopper tm , dm there is an inductor l and a safety - diode d which eliminates possible high voltage transients . after the circuit mentioned above , in fig6 there follows a bridge of six transistor - diode combinations t1d1 , t2d2 , t3d3 , t4d4 , t5d5 and t6d6 which are connected with the motor m . these six transistor - diode combinations are switched by the hall - effect switches ( through the prom ) and generate triphasic current . during regenerative braking the six diodes d1 , d2 , d3 , d4 , d5 and d6 work as a rectifier bridge and charge the battery b . the transistors tm , tb , and t1 - t6 are preferably silicon controlled rectifiers ( scr ). if n motors are present , this ( bridge ) part of the controller will be duplicated n times in parallel . a suitable choice of the currents j r j s and j t sent to the motor in the three phases in fig5 is shown in fig7 . the steering of the control shown in fig6 by the hall switches h1 , h2 and h3 , by the gas and brake pedals of the car , and by the respective level of the motor current is performed advantageously through a prom . the connections of such a prom are presented in fig8 . the prom receives signals from the hall - switches h1 , h2 and h3 , a signal v / r corresponding to the choice of forward or reverse driving , a signal ap / bp from a gas pedal ( accelerator ) potentiometer or a brake pedal potentiometer , a signal tj indicating possible thermal overloads of the motor m and the transistor tm , as well as a current level signal jv . from the output of the prom leave the control signals for the transistors t1 to t6 . two other signals from the prom control two oscillant circuits which determine the width and frequency of the rectangular opening - pulses for the transistor - diode chopper combinations tm and tb , respectively . in addition , the prom emits several battery - switching signals . due to the most likely presence of two motors ( with independent phases ) the upper part of the prom in fig8 and the connections h1 - h3 , t1 - t6 , and tj will be duplicated in practice . this duplication is trivial and has been omitted in this text for the sake of simplicity . in the electric operation mode the driver controls the vehicle with the help of the gas pedal , of the brake pedal , and of the three - position switch for forward driving , exclusively ( resistive , i . e ., dynamical ) braking , and reverse driving . from the three - position switch the signal v / r originates , depending on which position the switch is in . braking is possible in all three positions , resistive ( i . e ., dynamical ) braking even when the main switch h is open . the other parts of the control system are set in operation by closing the main switch h . this is suitably done in the &# 34 ; garage &# 34 ; position of the ignition lock ( which does not lock the steering wheel , but has the ignition off ). in addition to their normal function , the gas and brake pedals are each connected mechanically with a potentiometer which also has a contact at the beginning of its way in the case of the gas pedal and a contact at the middle of its way in the case of the brake pedal . with the main switch h closed , if the gas pedal is depressed the switch a ( fig6 ) and the gas pedal contact arm ( which switches the ap / bp signal ) will close themselves after a short way of the pedal . in this position the gas potentiometer has the largest value of its resistance , and consequently the prom opens the transistor tm only about 5 % of the time ( creep speed , to be adjusted at the oscillant circuit next to the prom ). if the gas pedal is further depressed , the width and repetition frequency of the rectangular &# 34 ; on &# 34 ;- signals finally increase , e . g . up to 3 . 10 - 3 s and 300 hz , respectively and the transistor tm will be open for about 90 % of the time . at this point the transistor tm may be short - circuited by a direct switch ( not shown on fig6 ). the control can also be performed by making the gas potentiometer ( or variable inductance ), part of an oscillant circuit whose frequency it determines , and which in turn determines the repetition frequency and width of the &# 34 ; on &# 34 ;- signals for the transistor tm . the &# 34 ; on &# 34 ;- signals are further limited in width and frequency by thermal overload signals t1 which act on the oscillant circuit and are coming from the stator - windings of the axial - field motors and from the support of the transistor tm . if the gas pedal is left free , the car moves freely by virtue of its inertia . if the brake pedal is depressed , after a very short way a contact is closed switching the battery ( through the prom ) to the series - parallel combination corresponding to the respective motor speed , similar to what happens if the gas pedal is depressed , but with a slightly different adjustment . simultaneously , the switch a closes itself . thereby the battery will be charged through the six diodes d1 to d6 in regenerative braking . at very low speeds , at which the battery can no longer be switched down , the regenerative braking action vanishes gradually . if the brake pedal is further depressed , both the hydraulic brakes ( at the non - electric wheels ) and resistive ( dynamical ) braking are initiated beyond a certain position s of the pedal . resistive braking occurs , similar to the electric action of the gas pedal , by the closing of the brake potentiometer contact in the position s . at this initial position , somewhat before the middle of the pedal way , the brake potentiometer ( or variable inductance ) has its largest value , and therefore the prom opens the transistor tb only for about 5 % of the time . resistive braking occurs with heat being generated mainly in the resistor r b , but also in the motors m , the transistor tb and in the wiring in parallel , i . e ., additionally to the hydraulic brakes . the energy appearing in the case of stronger braking action is therefore distributed among battery , brake pads , and the resistor r b connected in series with the chopper combination tb , db in fig6 . the control of the resistive braking is again accomplished , e . g ., by making the brake potentiometer ( or variable inductance ) part of an oscillant circuit connected to the prom , thereby controlling the frequency of the circuit , and indirectly the frequency and width of the &# 34 ; on &# 34 ; signals for tb . however , these signals are not limited additionally by thermal overload signals from the motors m and the support of the transistor tb , but these thermal overload signals activate only a red brake overload warning light in view of the driver on the dashboard . the ammeter i , with red maximal current marks on both sides , indicates the battery discharge current by deflection to the right and the charging current by deflection to the left in regenerative braking . the series - parallel battery - switching is controlled by the prom both in driving and regenerative braking on the basis of the motor speed information derived from the hall switches h1 , h2 and h3 , also taking into account the signal ap / bp . a different shaping of the axial - field motor , e . g . as disk motor , is considered as a poorer execution of the invention . all other modifications of mechanical or electrical nature within the framework of the claims are included in the protected domain of the invention . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is , therefore , to be understood that within the scope of the appended claims , the invention may be practiced otherwise than specifically described herein .	8
the present methods described herein are primarily referenced to forming a single electrode device , and in particular a neural electrode device . however , it should be understood that the present methods can be configured to form a plurality of electrode devices that are suitable for medical sensing or stimulation applications . in a preferred embodiment , the present methods can be adapted to manufacture an electrode that is suitable for any electrical stimulation technology and any recording or sensing technology having conductive electrodes , such as electrodes that are useful in physiological solutions . in that light , the methods described herein are readily adaptable to scaling to batch processes for forming a plurality of electrode devices with reduced impedance at relatively low cost and high uniformity from one electrode to the next . turning now to the drawings , fig1 illustrates a neural interface system 10 according to the present invention . the neural interface system 10 comprises an electrode array 12 having a plurality of electrode sites 14 a and 14 b . the electrodes may be adapted to optimally sample ( record ) 14 a or selectively activate ( stimulate ) 14 b neural populations and may be individually or simultaneously activatable to create an activation pattern . the neural interface system 10 may further include a pre - molded component 15 onto which the neural interface array is attached or assembled that supports the electrode array 12 . the electrode array 12 is coupled to the pre - molded component 15 such that the electrodes 14 a , 14 b are arranged both circumferentially around and axially there along . alternatively the electrode array 12 may be kept in its original planar form and attached to another planar component for mechanical support . the neural interface system 10 of the present invention is preferably designed for deep brain stimulation and , more specifically , for deep brain stimulation with fine electrode site positioning , selectivity , tunability , and precise activation patterning . the neural interface system 10 , however , may be alternatively used in any suitable environment ( such as the spinal cord , peripheral nerve , muscle , or any other suitable anatomical location ) and for any suitable reason . methods for building the electrode array 12 comprising the electrodes 14 a , 14 b formed from shaped metallizations with reduced impedance will now be described . fig2 shows the dielectric substrate 16 contacting a release layer 18 that is directly supported on a carrier 20 . the dielectric layer 16 can be of a flexible thin material , preferably parylene , polyimide , silicone , or even a thin - film of silicon , or some combination of organic and inorganic dielectrics , but may alternatively be of any suitable material . the carrier 20 is preferably made of glass or silicon , but may alternatively be made from any other suitable material . the carrier 20 is may be flexible , rigid , or semi rigid depending on the microfabrication tooling ( organic electronics equipment can increasingly use flexible substrates without a carrier layer such as in roll - to - roll manufacturing , whereas ic and mems microfabrication equipment use a rigid silicon carrier ). a rigid carrier layer 20 has a thickness ranging from about 200 microns to about 925 microns , preferably greater than 500 microns . a metallization layer 22 in fig2 is deposited on the upper or outer surface 16 a of the dielectric substrate 16 . the metallization 22 is shown as a continuous layer and can be patterned using any suitable wet etch or dry etch wherein the mask is a photodefined resist or any other masking material patterned directly or indirectly using standard photolithography techniques having a perimeter extending from a lower metallization surface supported on the upper substrate surface 16 a to an upper metallization surface spaced from the lower metallization surface by a thickness of the perimeter . the metallizations 22 can be deposited using any suitable thin film , semiconductor , microelectromechanical systems ( mems ) manufacturing technique or other microfabrication process , such as physical vapor deposition . exemplary techniques and processes include evaporation and sputtering deposition . the metallizations layer 22 preferably includes a conductive material such as of gold ( au ), platinum ( pt ) or platinum - iridium , iridium oxide , titanium nitride , or any other metal , metal oxide , or conductive polymer having suitable electrically conductive properties . fig3 shows where the continuous metallization 22 has been patterned into a plurality of discrete metallization structures 22 a , 22 b , 22 c , 22 d , 22 e , etc . the metallization layer 22 can be patterned through etching , liftoff deposition ( not shown ), or any other suitable thin film , semiconductor manufacturing , mems manufacturing , or other microfabrication process . depending on the particular application for the finished neural interface system 10 , the dielectric substrate 16 , the release layer 18 and the carrier 20 can be flexible , semi - flexible , or rigid . the present method can further include patterning the metallization structures 22 a , 22 b , 22 c , 22 d , 22 e , etc . to include conductive traces , bond pads , and other suitable conductive elements . in fig4 , a layer of nanospheres 26 has been deposited onto the dielectric substrate 16 to cover both the shaped metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . and the substrate surface 16 a between adjacent metallizations . the nanospheres 26 form a high - density , high - resolution spatial pattern serving as a substantially uniform mask or template over the surface of the individual metallizations . that is because the nanospheres 26 are substantially identical in size and shape . when they are deposited in a monolayer onto the metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc ., the nanospheres 26 self - assemble into a tightly packed , uniform pattern . for example , the present method can include depositing a monolayer of nanospheres 26 onto the metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . by drop wetting ( direct application of the nanospheres in solution ) and then allowing them to self - assemble into hexagonally packed patterns ( fig8 ) upon de - wetting . this embodiment includes depositing a nanosphere solution including nanospheres and a solvent onto the metallization structures 22 a , 22 b , 22 c , 22 d , 22 e , etc . the solvent is then evaporated . the solvent is preferably selected based on its viscosity , evaporation rate , and wettability on the metallizations patterned on the dielectric substrate 16 . in one illustrative example , the solution includes polystyrene spheres mixed in a solvent of ethanol and de - ionized water . the ratio of ethanol to de - ionized water is approximately 4 : 1 . however , the solution can include nanospheres 26 other than those of polystyrene , such as glass , and a suitable solvent other than a mixture of ethanol and de - ionized water . the solution is preferably dropped onto the dielectric substrate 16 such that a monolayer of nanospheres 26 is distributed substantially uniformly on the metallization structures 22 a , 22 b , 22 c , 22 d , 22 e , etc . depositing the nanosphere solution may be performed by using the langmuir - blodgett technique to transfer a pre - fabricated monolayer of nanospheres 26 onto the metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . patterned on the dielectric substrate 16 . in an example , nanospheres 26 having a surface tension of γ - ns are in a solvent having a surface tension of γ - solvent . it is given that γ - ns is less than γ - solvent . then , a monolayer of nanospheres 26 forms at the exposed surface of metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . patterned on the dielectric substrate 16 . the substrate 16 supported on the carrier 20 can be moved through the solution to transfer the monolayer of the nanospheres 26 thereto . illustratively , one can use the drop wetting method by mixing a nanosphere solution ( e . g ., 5 % w / v solution ) into a 4 : 1 volume mixture of ethanol to de - ionized water . when applied to a patterned dielectric substrate 16 at room temperature on a horizontal surface , the nanospheres 26 will self - assemble along a contact line during the evaporation or de - wetting process . evaporation of the solvent can occur unassisted or be accelerated with environmental changes , such as in temperature and pressure from that of an ambient atmosphere . a second preferred embodiment is where the nanospheres 26 are deposited onto the metallization structures 22 a , 22 b , 22 c , 22 d , 22 e , etc . via spin - coating the above described nanosphere solution . if desired , the nanosphere solution can have a different viscosity , wettability , or other mixture ratio than that used with the drop - wetting or langmuir - elodgett technique . furthermore , depending on the nature of the nanosphere solution , spin - coating can include a particular rate of spinning and / or acceleration . according to the present invention , a series of recessed undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc . or upstanding undulations 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc . are formed on the surface of the metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . the recessed or upstanding undulations can be approximately pyramidal wave undulations , square wave undulations , approximately triangular wave undulations , or an undulation of any other suitable shape . fig5 , 5 a and 5 a ′ show recessed undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc . that have been formed by etching 28 recesses 30 into the thickness of the respective metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . etching 28 the recesses 30 into the metallizations takes place beneath the interstitial spaces of the layer of assembled nanospheres 26 . the result is undulations 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc . comprising recesses extending into the original thickness or height ( h ) of the metallization layers supported on the substrate 16 . for etching , it is preferred that the nanospheres 26 a diameter ranging from about 20 nanometer ( nm ) to about 1 , 000 nm . etching can be performed with any suitable etching process . one advantage of etching is that it does not require any adhesion between the existing metallization layer and newly deposited conductive material . platinum , for example , is a commonly used biocompatible metal that can be dry etched using techniques described in u . s . pat . no . 6 , 323 , 132 with a reactive ion etcher . the contents of this patent are incorporated herein by reference . in that manner , etching forms the recesses 30 having a depth extending part - way through the thickness of the metallization 22 b from that portion of its upper surface of the metallization not contacted or otherwise covered by a nanosphere 26 . the recesses 30 can extend from about 1 % to about 99 % into the thickness of the metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . more preferably , the recesses are from about 50 % to about 90 % into the original metallization thickness . the metallizations shown in fig5 a have a thickness measured from the upper surface 16 a of the dielectric 18 to the upper surface of the as - deposited metallization of from about 0 . 25 micron to about 20 microns , more preferably from about 10 microns to about 20 microns . fig6 , 6 a and 6 a ′ relate to an alternative method where the upstanding undulations 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc . are formed by depositing 30 additional metallization material ( e . g ., in a lift - off deposition ) onto the metallizations 22 a , 225 , 22 c , 22 d , 22 e , etc . through the interstitial spaces between the nanospheres 26 . deposition 30 continues until the desired height of the added metallization material 32 measured from its base 32 a supported on the upper surface of the original metallization 22 b is achieved . for this technique , it is preferred that that the nanospheres have a diameter ranging from about 500 nm to about 5 , 000 nm . one advantage of this variation is that depositing material preferably results in metal - metal bonds and predictable surface properties . fig7 a illustrates a representative one of the undulations where the additional metallization material 32 forms a base on the upper surface of the metallization 22 b and build - up in a pyramidal manner . that is without contacting the adjacent nanospheres 26 , but while following their generally circular contour . in that respect , the height of the upstanding undulations is preferably about 90 % of the radius of the nanosphere . it has been discovered that this ratio provides maximum . added surface area for the added metallization . that means the upstanding additional or secondary metallization material has a height ranging from about 225 nm to about 2 , 250 nm above the upper surface of the primary metallization 22 . moreover , the added metallization does not grow so high as to prevent the subsequent removal of the nanospheres . in order for nanosphere removal , it is important that the added metallization not extend past the imaginary equator and over the upper half of the hemisphere . with this rule , it has been determined that approximately a . four - fold increase in the geometric surface area ( gsa ) is achievable . fig7 b is a photograph showing how the deposited metallization material builds up from the upper surface of a metallization without contacting the nanospheres 26 . the nanospheres 26 have been removed in the photograph , but the generally circular shape of one of them is delineated by the circle bordered by the deposited metallization material , which is seen as the off - white pyramidal bodies having somewhat triangular bases . in both embodiments , the recessed undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc and extending 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc on the respective metallizations are preferably bounded by the interstitial spaces of the nanospheres 26 . since the nanospheres 26 are substantially uniform in shape and arranged in a substantially uniform distribution in the layers of fig5 and 6 supported on the upper surface of the metallization 22 a , 22 b , 22 c , 22 d , 22 e , etc ., there is a substantially uniform distribution of interstitial spaces between the nanospheres 26 . consequently , the undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc . and 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ”, etc . are substantially uniformly distributed throughout the surface area of the shaped metallization . if desired , the nanospheres 26 are removed from the dielectric substrate 18 after forming recessed or extending the undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc . and 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc . on the respective metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . or , the nanospheres 26 can be left on the metallizations . the undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc and 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc significantly increase the electrochemical surface area ( esa ) of the electrode , particularly relative to the geometric surface area ( gsa ) of an electrode formed from one of the metallization according to the present invention . the interstitial spaces of the nanospheres ( or “ pores ” of the layers of the nanospheres ) are preferably arranged in a . substantially uniform distribution , thereby enabling substantially uniform arrangement of the undulations . the particular form of the undulation , whether they be of the recessed or the extending form ( etching or deposition ) of the metallizations depends on the functional application of the electrode that will be manufactured from the metallization device , desired dimensions of the electrode , extensions , and / or recesses , materials within the metallization , and / or any suitable factor . in any event , the undulating surface provides an increased esa predicated on the diameter and packing arrangement of the nanospheres 26 , and the depth of recess 30 for the recessed undulation 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc . or the increased thickness of the deposited metallization material 32 for the extending undulations 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″ etc . as shown in fig8 , the amount that the esa increases as is inversely proportional to the diameter of the sphere : where a inc = additional area additional area created inside the fundamental unit of the equilateral triangle formed by 3 adjacent spheres when hexagonally packed , d s = diameter of a sphere , d m = height of deposition or the depth of etch , and a e = geometric area of electrode ( derived from the metallizations 22 ). estimated area change in various illustrative examples of etched metallization electrode sites ( fig5 , 5 a and 5 a ′) are shown in table 1 of fig9 . in some preferred embodiments , the present invention methods additionally or alternatively include one or more of several variations described below . as shown in fig1 a and 10b , a further surface area increase can be achieved according to the present invention by undercutting one or more alternating layers of patterned metal . in one version of this embodiment , the method includes : depositing a planar metallization layer stack ( e . g ., au / pt , au / ir , or other au stack ) onto the dielectric substrate 16 , and then selectively wet etching the au metal . an example of this is to deposit a layer of platinum 40 onto the dielectric layer ( not shown in fig1 b ) using one of the methods previously described with respect to fig3 and 4 . without removing the nanospheres 26 , a layer of gold 42 is deposited on top of the platinum 40 followed by a second layer of platinum . the nanospheres 26 and the underlying photoresist pattern 24 are then removed and the gold 42 is wet etched . etching serves to expose additional surface area of the platinum 40 that was previously positioned both above and below the gold . this is shown by the exposed surface 42 a of the platinum layers 42 in fig1 b . it is important to not etch too much of the gold 42 so that it can no longer act as a structural support for the platinum . 40 . in fig1 b , the depth of etch is depicted as d au , which is less than the original thickness of the gold layer measured parallel to the plane of the dielectric substrate 16 . in addition to platinum , iridium , iridium oxide , and titanium nitride are suitable metallization materials for use with this gold etching process . in that manner , gold etching serves to expose more of the non - au metal surface area . fig1 a and 11b relate to another embodiment of the method according to the present invention . this embodiment additionally or alternatively includes depositing an alternating combination of layers on the dielectric substrate ( not shown in fig1 b ). in one specific embodiment alternating layer of platinum 40 and gold 42 are deposited one on top of the other until a stack of a desired height is achieved . in a similar manner as described above with respect to fig1 a and 10b , the gold layers are wet etched to undercut and expose addition platinum surface area . as described above , it is important not to etch too much of the gold 42 . in fig1 b , the depth of etch is depicted as d au , which is less than the original thickness of the gold layer measured parallel to the plane of the dielectric substrate 16 . enough gold must be left to serve as a structural pillar supporting the above platinum and gold layers . an example of this embodiment is alternating layers of au / pt / au / pt / au / pt stacked one on top of the other . gold . etching preferably forms more esa . although omitted for clarity , the preferred embodiments of the present methods include every combination and permutation of the various processes described above . furthermore , the preferred embodiments of the present method can be executed by a computer program or other system including computer program code for controlling hardware ( e . g ., machines for deposition , sputtering ) in an automated fashion . as previously discussed with respect to fig1 , a neural interface device 10 with reduced impedance according to the present invention includes the dielectric substrate 16 supporting the electrode array 12 comprising the plurality of electrodes 14 a , 14 b . after the metallization material 22 has been provided with an undulating surface characteristic , whether the undulations are recessed or upstanding the neural array is further completed with the addition of top dielectric , bond pads if necessary , vias , and other desired features ( none of these are shown here ). finally the neural array including the dielectric substrate 16 is removed from the carrier 20 . the release layer 18 facilitates this separation in some cases but not always required especially if the dielectric substrate 16 only has weak bonding to the carrier 18 . the dielectric substrates ( top and bottom ) and the electrode array 12 are then formed into a desired shape of the neural interface system 10 , which can be either planar or three - dimensional such as the cylindrical shape shown . the neural interface device 10 can be a planar probe with the electrode array 12 , a cylindrical probe with the electrode array , a substantially planar or curved substrate with the electrode array , or any suitable electrode device . at least a portion of each electrode 14 a , 14 b has a substantially uniform undulating surface described above . at least a portion . of the substantially uniform undulating surfaces of the electrodes 14 a , 14 b includes peaks and / or crevices ( e . g ., recesses ) that are preferably distributed in a regular arrangement and , more preferably , in an approximately hexagonal arrangement as shown in fig5 a , 5 a ′, 6 a and 6 a ′. the undulating surfaces increases the electrochemical surface area of the electrodes 14 a , 14 b , thereby reducing their impedance and improving their functionality for stimulation and sensing purposes . while this invention has been described in conjunction with preferred embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art . accordingly , the present invention is intended to embrace all such alternatives , modifications and variations that fall within the broad scope of the appended claims .	0
in one embodiment , the present invention is a digitally controlled threshold adjustment circuit which does not impose any significant bandwidth reduction due to loading of the signal path . since the circuit is digitally controlled , it can easily be incorporated into an adaptive algorithm that can automatically find the optimal point for sampling , without user intervention . fig4 is an exemplary circuit diagram of a threshold adjuster , according to one embodiment of the present invention . as depicted in fig4 , a threshold adjustment circuit 42 is connected to current summing nodes 43 and 44 , which generate outp and outn , respectively . as an example , threshold adjustment circuit 42 can be connected to outp and outn at the output of a gain stage which includes a trans - conductance ( gm ) 41 sinking current from load impedances ( r load ) 47 a and 47 b . threshold adjustment circuit 42 includes a current dac 45 , which generates a threshold current 46 ( i threshold ). in one embodiment , a thermometer coded current steering dac is utilized to implement the dac 45 , as depicted in fig5 . fig5 is an exemplary circuit diagram of a current steering dac , according to one embodiment of the present invention . as shown , transistor m b biased by a current i unit supplies a bias voltage v bias . each of the transistors m 0 to m k is turned on by respective switches s 0 to s k that are driven by cont & lt ; 0 & gt ; to cont & lt ; k & gt ;, respectively . depending on the digital code cont & lt ; k : 0 & gt ;, current i out ( i threshold ) varies from 0 to its maximum required value in linear and monotonic steps . the maximum i threshold value can be calculated as ( k + 1 ) i unit . in addition , the linear step size is i unit . the dac is called a thermometer dac in this case , because the current sources switch one - at - a - time only . referring back to fig4 , nmos transistors mp and mn are used in their saturation regions to sink all of i threshold to either outp or outn . in other words , nmos transistors mp and mn are used for polarity selection of threshold adjustment . if mp is turned on ( saturation region ), then mn is turned off sending i threshold to outn . likewise , if mn is turned on ( saturation region ), then mp is turned off sending i threshold to outp . if i threshold is sunk into outn , the dc voltage component of outn decreases by the amount that corresponds to the voltage drop generated by i threshold on r load 47 a . that is , the selected current from the dac induces a voltage drop across the loads , which in turn reduces the dc voltage component of outn . in the above embodiment , nmos transistors mp and mn , as well as transistors in the dac are all low voltage transistors . furthermore , the power supply vdd is used above the reliability voltage limit of the low voltage transistors . using low voltage transistors is preferred to obtain the maximum trans - conductance with minimum area and loading . using a vdd above the reliability voltage limit is also preferred to achieve higher speed for circuit components such as drivers , flip - flops , etc . if the low voltage transistors are used with a vdd above their reliability voltage limit , a careful biasing and proper operation of the low voltage transistors should be taken into account in the design of the circuit . in other words , the design should ensure that the voltage drops across the terminals of every low voltage transistor be within their reliability voltage limit . in operation , when mp is turned on , input voltage vbp ( on ) is pulled to a predetermined voltage level above the threshold voltage v th of mp , but lower than power supply vdd , to keep mp in saturation region , even if i threshold goes to its maximum level . a saturation region of a nmos transition occurs when vd & gt ; vg − v th of the transistor . when operating in the saturation region , a transistor has a high impedance between its source and drain . this high impedance decouples the output capacitance of the dac from the r load . if vbp ( on ) was selected as high as vdd , then mp would go into triode region where not only its drain capacitance increases , but also , the dac output capacitance would be added to the outn node . increased drain capacitance due to mp entering into triode region would decrease the bandwidth at node outn . in one embodiment , the input voltages vbp and vbn are digitally controlled . likewise , when mn is turned on , input voltage vbn ( on ) is pulled to a predetermined voltage level , lower than power supply vdd to keep mn in saturation region , even if i threshold goes to its maximum level . similar to vbp ( on ), if vbn ( on ) was selected as high as vdd , then mn would go into triode region where its drain capacitance increases significantly . again , increased drain capacitance due to mn entering into triode region would decrease the bandwidth at node outp . in one embodiment , the predetermined voltage level of the input voltage vbp ( on )/ vbn ( on ) is generated using a resistor voltage divider ( not shown ) to limit the vbp ( on )/ vbn ( on ) voltage to a voltage lower than vdd , so that mp / mn operate in their saturation regions and stay within their reliability limits . similarly , the predetermined voltage level of the input voltages vbp ( off )/ vbn ( off ) is generated using a resistor divider ( not shown ) to limit the vbp ( off )/ vbn ( off ) to a voltage higher than gnd , so that mp / mn operate in their off regions and stay within their reliability limits . further , bulk nodes of mp and mn are tied to a common source node v source to prevent drain - to - bulk voltage ( vdb ) from going above the reliability voltage limit . likewise , when the bulk node is tied to source node the bulk - to - source voltage ( vbs ) becomes zero . thus , the body effect on threshold voltage v th of the transistor , which is a function of vbs , is also eliminated . this decreases the gate - to - source voltage ( vgs ) of the respective transistor for a given current density . since vgs is reduced , this results in relaxing the headroom requirement of dac transistors . when mp is turned off , vbp ( off ) is pulled to a predetermined voltage level below the threshold voltage v th of mp , but higher than ground voltage ( gnd ) to keep drain - to - gate voltage ( vdg ) of mp below the reliability voltage limit . similarly , when mn is turned off , vbn ( off ) is pulled to a predetermined voltage level below the threshold voltage v th of mn , but higher than gnd to keep vdg voltage of mn below the reliability voltage limit . however , if vbn ( off ) is selected too low , such as gnd , vdg of mp and mn would increase above its limit , which could cause reliability issues for mp and mn . when the threshold adjustment circuit is disabled , the dc component voltage levels of outp and outn do not need to be adjusted . in one embodiment , both mp and mn are turned on resulting in sinking a small amount of current such as , but not limited to , i unit into mp and mn . however , keeping mp and mn both on will have some disadvantages . due to mismatch between mp and mn , i threshold will not be evenly sunk into outp and outn , which can cause a leaky and undesired threshold adjustment . depending on the amount of current left sinking , dc component voltage levels of both outp and outn will go down and thus decrease the headroom for gm ( dac ) stage . moreover , if both mp and mn are left on ( in their saturation regions ), then rds ( mp )+ rds ( mn ) decrease the output impedance r load resulting in a decrease in the gain . in one embodiment , when the threshold adjustment circuit is disabled , both mp and mn are turned off and another current passage path is created by switching on the transistor m shut . the reason for creating another current passage path is to keep the common source node voltage v source of mp and mn above a certain level so that the drain - to - source voltage ( vds ) of mp and mn can be kept within the reliability voltage limit . thus , a small amount of current such as , i unit is left sinking into m shut to keep v source above a certain level . since m shut is not in the critical signal path , a high voltage transistor for m shut is used such that it does not require any special biasing for m shut , since vdd is within the reliability voltage limit of the high voltage transistor m shut . if high voltage transistors are not available in the process and / or m shut should also be protected against over the limit terminal voltages , an alternative implementation of disabling scheme is illustrated in fig6 . resistor r is used to limit the vds voltage of m shut . in addition , the gate voltages of m shut , disable and enable voltages , have predetermined values to avoid any over the limit terminal voltages for m shut and m ena whether they are turned on or off . one or more nmos or pmos transistors can be utilized to implement resistor r . transistor mi that is biased by v bias operates as a current source . although the threshold adjustment circuit is described using nmos transistors only , those skilled in the art understand that the threshold adjustment circuit can be implemented using only pmos transistors or using both nmos and pmos transistors . the threshold adjustment circuit of fig4 is utilized to decrease the dc voltage components of outn or outp . fig7 is an exemplary circuit diagram of a threshold adjustment circuit that decreases the dc voltage components of outn and outp and increases the dc voltage components of outn and outp , resulting in a more uniform signal , as shown in fig1 b . as illustrated in fig7 , a first threshold adjustment circuit 73 operates similar to the threshold adjustment circuit described in fig4 to decrease and / or increase the dc voltage components of gm 72 outputs , outn and outp . a second threshold adjustment circuit 74 operates in a complementary way to the threshold adjustment circuit 73 to increase and / or decrease the dc voltage components of outn and outp also . a signal nv shut which may be the inverted signal v shut is used to shut the second threshold adjustment circuit 74 . each of the threshold adjustment circuits 73 and 74 include a dac that is controlled by control signals cont & lt ; k : 0 & gt ;. the control signals cont & lt ; k : 0 & gt ; to each of the threshold adjustment circuits 73 and 74 may be the same or different , depending on the amount of current requirements to reduce the asymmetric eye opening , shown in fig1 a . in one embodiment there is only one dac that is supplying / sinking current to each of the threshold adjustment circuits 73 and 74 . load resistors 75 a and 75 b are similar to those load resistors of fig4 . an exemplary embodiment of the threshold adjustment circuit 74 is shown in fig8 . fig8 is an exemplary circuit diagram of a threshold adjustment circuit for increasing dc voltage components , according to one embodiment of the present invention . the circuit is similar to the threshold adjustment circuit of fig4 in operation , however , it uses pmos transistors , instead of nmos transistors and supplies a current i threshold , rather than sinking the current , to the loads . the threshold adjustment circuit is coupled to outp and outn at the output of a gm 82 sourcing current from load impedances ( r load ) 85 a and 85 b . dac 84 generates a threshold current 86 ( i threshold ). again , depending on the digital code cont & lt ; k : 0 & gt ;, current i threshold varies from 0 to its maximum required value in linear and monotonic steps . pmos transistors mpp and mpn driven by inputs vbn and vbp are used in their saturation regions to send all of i threshold to either outp or outn . if mpp is turned on ( saturation region ), then mpn is turned off sending i threshold to outp . likewise , if mpn is turned on ( saturation region ), then mpp is turned off sending i threshold to outn . if i threshold is supplied into outn , dc voltage components of outn increases by the amount that corresponds to the voltage drop generated by i threshold on r load 85 b . in the above embodiment , pmos transistors mpp and mpn , as well as transistors in the dac are all low voltage transistors . however , m pshut transistor may be a thick oxide transistor . if high voltage transistors are not available in the process and / or m pshut should also be protected against over the limit terminal voltages , the alternative implementation of disabling scheme of fig6 , that is , using a resistor r to limit the vds voltage of mpshut may be used . control signal nv shut is used to disable the threshold adjustment circuit by turning the pmos transistor m pshut on while both mpn and mpp are off . also , the bulks of mpp and mpn are connected to the common source node v psource and vbp and vbn voltages are set properly for turning mpp and mpn on / off to avoid any voltage drop across the terminals of mpp and mpn rising below the reliability limit . it will be recognized by those skilled in the art that various modifications may be made to the illustrated and other embodiments of the invention described above , without departing from the broad inventive scope thereof . it will be understood therefore that the invention is not limited to the particular embodiments or arrangements disclosed .	7
as shown in fig1 a of the drawings , there is represented a substrate 10 having a semiconductor chip 12 of an electronic package located thereon . the semiconductor chip 12 in this structure , as presently employed in the technology , utilizes essentially round ball - shaped solder balls 14 ( of which one is illustrated ) on an enlarged scale in fig1 c , from the encircled part a in fig1 b , which produces a c4 connection . all of the electronic package components , including the printed circuit board 18 , are known in the state - of - the - art , as mentioned hereinabove . referring in further detail to the drawings , as illustrated herein , fig2 a shows a deformed state of the c4 connection 14 due to the relative motion of the upper and lower c4 pads 20 , 22 . the arrow shown on top of the substrate 10 represents the vector of relative motion . fig2 b shows a generalized displacement pattern of the c4 connection in a three - dimensional representation . hereby , ab and cd represent the displacement vectors of the top and bottom pads 20 , 22 . the in - plane relative motion of the circular pads 20 , 22 is given by the vector be . thus , the vector be is the in - plane projection of the relative pad motion ( referred to as relative motion vector ). in this representation , the pads 20 , 22 are assumed to be arranged in parallel relative to each other . fig3 a and 3 b show an array of c4s 14 on a substrate 10 as currently employed in prior art , together with the typical direction of motion thereof during a thermal cycle . in this diagrammatic representation , the relative motion or displacement vector is assumed to be directed along the radial direction in an in - plane projection . a detailed analysis of a specified electronic package may indicate that the direction of motion can be closely projected before an electronic package is actually prototyped or manufactured . referring to fig4 a of the drawings , this elucidates the concept of the present invention . the previously disclosed circular pads 20 , 22 are now modified into elliptical pads 26 and the minor axis 28 of each pad 26 is set parallel to the relative motion or displacement vector , as shown in fig4 b . an identical grid structure is deployed , as in fig3 a and 3 b , indicative that the pitch of the elliptic - c4 is the same as that of the circular - c4 . the mode of implementation as shown in fig4 a consists of depositing only a limited number of elliptical - shape c4s 30 near the corner of a substrate 10 , while maintaining the spherical shape of c4s 14 for all the remaining ones . the c4s 30 carry signals and voltages to transistors ( not shown ) embedded in the semiconductor chip 12 , whereby it can be shown that an elliptical c4 30 may enhance resistance to electromigration . therefore , currently carrying c4s that are prone to electromigration can be made of elliptical c4 30 , while others can be left as circular c4s 14 in the event that fatigue is not a concern , this can then be a second mode of implementation of the invention . a combination of first and second mode in these configurations of the c4 connects is optimal for a semiconductor chip that is prone to fatigue as well as to electromigration problems . fig5 shows an example of an elliptical c4 30 , which is subjected to shear strain along the minor axis thereof . the aspect ratio of the c4 elliptical cross - section ( major axis / minor axis ) is 2 . 25 , obtained from a circular shape by stretching the radius by 50 % along one direction and reducing the radius in the perpendicular direction by 33 %— so that the overall surface area is maintained . the computed von mises stresses are maximum near the edge of the pads . fig6 shows the effect of the relative increase of the major axis on strain energy and von mises stress . both quantities have been obtained by averaging the fe results on a slice of the c4 close to a pad ( thickness of the slice = 7 μm ). it is noted that an elliptical c4 with a 125 μm major axis , when loaded along its minor axis , reduces the strain energy by 10 % with respect to its spherical c4 counterpart of equal cross sectional area . it is emphasized that these estimates are based on linear elastic analyses , whereas the c4s are well - known to undergo plastic deformations upon thermal cycling conditions ( both in the field and under dtc ). however , reductions in the elastic stresses ( and strain energy ) prior to yielding translate to benefits in the plastic strains and energies , and consequently impart enhancements in the fatigue life of the electronic components . unlike their spherical counterparts , c4s based on elliptical cross - sections are not isotropic , meaning that any miscalculation or uncertainty in the gradient vector will inevitably raise stresses and energies above the predicted level . in order for the proposed approach to be convenient , it needs to be robust , signifying that realistically possible miscalculations must not transform the benefit into a disadvantage . fig7 illustrates the effect of misorientation of an elliptic - c4 from its ideal position . the location and magnitude of the peak value changes , whereas fig8 depicts the effect of misorientation on stresses and energy . hereby , it is notable that for the same aspect ratio as in fig6 , a miscalculation of 20 % ( quite severe ) in the gradient vector only causes stresses and energy increases of less than 4 %. in other words , the benefit gained in choosing c4s 30 of elliptical cross section is reduced , but is not eliminated , or even worse turned into a potential disadvantage . surviving industry standard dtc cycle is many times more challenging than surviving a customer “ use condition .” the dtc cycle subjects a whole electronic package to same temperature condition in which the differential displacement vector ( ddv ) has a cohesive directions response . fig9 represents a depiction of a current density distribution through a c4 connection in three elevational locations , whereby there can be observed that the electrical current density peaks along the pad edges . fig1 a and 10 b show a schematic representation of the dimensions used for , respectively , a circular and an elliptical c4 . fig1 a and 11 b show the current density distribution when a 200 ma current is driven through the circular and elliptical c4s wherein the elliptical c4s provide a longer edge for the electrical current to be distributed , and to thereby reduce the peak magnitude commensurately . finally , fig1 discloses a normalized comparative plot of current density . there is obtained a 10 % decrease in peak electrical current density for an aspect ratio of 1 . 65 , as used in this example . the foregoing clearly indicates the advantages obtained over standard spherical c4s through the use of c4s with elliptical pads . in conclusion , c4s with elliptical pads , when oriented along an optimal path , possess the following advantages over the industry standard spherical c4s : ( i ) an increased fatigue life , which is achieved due to a reduced stressed level under the same thermal cycle conditions ; and ( ii ) a reduced sensitivity to electromigration damage , due to an obtained reduction in the peak current density . an implementation of the invention consists of using elliptical c4s in the semiconductor chip areas subjected to a maximum strain ( i . e ., normally near the corner region of the chip ), with the minor axis of the c4 pad aligned with the relative displacement vector ( i . e ., roughly along the radial direction from the center of the chip ); similarly , the c4s that receive the highest currents should be elliptical , with the minor axis aligned with the horizontal lines feeding power to a c4 . it is important to emphasize that the above - mentioned approach does not require any new manufacturing process ; only needed is the depositing of elliptical pads on both the semiconductor chip and the substrate , and the c4s will assume the desired shape during the reflow process to which they are subjected . the advantage of the elliptical geometry can be applied to all electrical or non - electrical components that require attachment , using fatigue prone material . while the present invention has been particularly shown and described with respect to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in forms and details may be made without departing from the spirit and scope of the present invention . it is therefore intended that the present invention not be limited to the exact forms and details described and illustrated , but to fall within the spirit and scope of the appended claims .	8
as fig1 and 2 show , the frame of the bogie comprises two lateral sole - bars 1 whose general longitudinal direction m is , at rest , parallel to the rails 2 and to a median vertical plane pp of the bogie . in the following , everything which is parallel to the plane defined by the two rails 2 , which are assumed to be horizontal and parallel , will be described as horizontal and everything which is perpendicular to this plane as vertical . the two sole - bars 1 are supported by two axles 3 whose axis 4 is perpendicular to the plane pp . the axles 3 are symmetrically disposed on either side of a median vertical transverse plane tt of the bogie . between the sole - bars 1 , each axle 3 carries two wheels 6 . beyond each wheel 6 , the axles 3 have an axial extension 7 supported by a bearing 8 mounted in an axle - box 9 which is located beneath the sole - bar . the base of each axle - box 9 is extended forwards and backwards by a lug 11 extending in an approximately horizontal plane . an elastic system 12 , comprising , in the example , two helical springs with a common vertical axis , bears in compression on the upper face of each lug 11 . at each axle end , one of the elastic systems 12 bears directly beneath the sole - bar 1 . the other elastic system 12 bears in a cap 13 which is pulled downwards by the sole - bar 1 by means of an oblique swing - link 14 . because of the obliqueness of the swing - link 14 , the cap 13 undergoes a force directed obliquely downwards , the vertical component of which compresses the elastic system 12 and the horizontal component of which is transmitted to the axle - box 9 by means of a pushing device 16 which is slidably mounted in the sole - bar . the pushing device 16 bears on a lateral face of the axle - box 9 and pushes the axle - box 9 so as to bear by its opposite lateral face against a corresponding wall 17 of the sole - bar . thus , in a known manner , during the oscillations of the suspension , the axle - box 9 rubs against the pushing device 16 and against the face 17 through a bearing force which is proportional to the state of compression of the elastic systems 12 , and therefore proportional to the load supported by the axle . this produces a damping effect of the oscillations which is proportional to the load supported by the axle . the sole - bars 1 are joined together , in the plane tt , by a bolster 18 . the central region of the upper face of the bolster is constructed in the form of a cylindrical pivot - bearing 19 for the articulation of the bolster 18 with the body ( not shown ) of the wagon . as fig4 shows , the pivot - bearing 19 is intended to receive a complementary cylindrical pivot 21 fixed to the lower face of the body of the wagon and connected axially to the bolster , with the possibility for rotation about the central vertical axis of the bogie , by means of a retention bolt 22 . the pivot 21 bears on the bottom of the pivot - bearing 19 by means of a side friction block 23 . the use of a cylindrical pivot is rendered possible as , with the bogie according to the invention , it is sufficient that the bolster 18 can pivot about a single axis in relation to the body of the wagon . it is therefore pointless having recourse to a more complicated and bulkier articulation of the spherical type . as fig3 shows , the bolster 18 also carries on its upper face , in the vicinity of the inner face of each sole - bar , two lateral bearing members 37 for the body of the wagon . these lateral bearing members are elastically compressible and comprise , on their upper faces , a friction lining 38 intended to bear frictionally against the lower face of the body of the wagon in order to hold up the body of the wagon at some distance away from the pivot - bearing 19 and , consequently , to eliminate the major portion of the swinging loads to which the pivot - bearing could be subjected and , at the same time , to dampen , by friction , the possible sideways movements of the bogie in relation to the body of the wagon . each end of the bolster 18 is engaged in a window 24 of one of the sole - bars 1 . an elastic articulation is produced between the bolster 18 and the sole - bar 1 in this opening . this linkage prepositions each sole - bar in relation to the bolster 18 . in order to achieve this , each sole - bar 1 carries on its inner face , that is to say facing the other sole - bar 1 , two friction linings 26 located on each side of the window 24 , which define two lateral reference faces of the sole - bar which are coplanar and parallel to the plane pp . in addition , the bolster 18 carries in the vicinity of each of its ends and on each of its lateral faces a bracket 27 to which is fixed , facing respectively one of the linings 26 , a friction lining 28 . the friction linings 28 define on the bolster 18 two reference faces which are conjugate with those defined by the linings 26 on the sole - bar 1 and which are coplanar and perpendicular to the longitudinal direction l of the bolster 18 . thus , when the linings 26 and 28 bear on each other , the corresponding sole - bar 1 is in an orthogonal configuration in relation to the bolster 18 . in addition , if the two sole - bars 1 are in this configuration in relation to the bolster 18 , neither of the sole - bars 1 is ahead of the other in relation to the direction of advance of the bogie along the rails , provided that the distribution of the clearances x and x &# 39 ; ( fig1 and 2 ), which are allowed on each side of the bolster in the window 24 along the longitudinal direction m , is the same at the two ends of the bolster . it will be noticed that each sole - bar 1 can pivot in an equalising movement about an axis parallel to the longitudinal direction l of the bolster 18 without this leading to lift - off between the friction linings 26 and 28 . such a movement requires simply sliding with friction between these linings , which plays a beneficial damping role . such an equalising movement is permitted by the clearances x and x &# 39 ; initially provided between the bolster and the front and rear walls of the window 24 . this clearance then assumes a wedge shape on each side of the bolster , as fig5 shows . furthermore , each end of the bolster 18 bears by its base against the base of the window 24 , by means of two elastic blocks 32 each comprising a mass 33 of rubber or another elastomer interposed between two end plates 34 and 36 . more particularly , the base of the window comprises two faces 31 in the form of a concave dihedron , which is symmetrical in relation to the transverse plane tt , and the base of the bolster end has a complementary convex dihedral shape whose two faces 29 are , when the bogie is at rest , substantially parallel to the faces 31 of the bolster . the two elastic blocks 32 are each mounted between one of the faces 31 of the window 24 and the parallel face 29 of the bolster . each elastic block 32 is relatively incompressible , but very flexible in terms of shear deformation such that the block 32 barely transmits forces parallel to its bearing faces . thus the compressive forces exerted by the block 32 on each of these faces are substantially perpendicular to the latter . each face 31 and each face 29 is inclined at an angle a ( fig3 ) in relation to the longitudinal direction l of the bolster 18 . the angle a , approximately 30 °, is oriented such that the compressive force f of the elastic block 32 ( fig3 ) on the corresponding face 31 of the window 24 has a horizontal component f ht parallel to the direction l which pushes the sole - bar 1 towards the median longitudinal plane pp and , consequently , tends to press the sole - bar by its two friction linings 26 against the two friction linings 28 which are firmly attached to the bolster 18 . the face 31 is therefore directed obliquely upwards and towards the plane pp . it will be noted that the elastic block 32 exerts on the face 29 of the bolster 18 a force having a component directed horizontally towards the outside of the bogie , but this force is balanced by an equal and opposite force exerted by the elastic blocks on which the other end of the bolster 18 bears . thus , the transverse horizontal component f ht produced by each elastic block 32 on the associated sole - bar 1 tends permanently to produce , between the linings 26 and 28 the bearing together by virtue of which the sole - bar 1 preserves its preferred configuration in relation to the bolster 18 . furthermore , as fig1 shows , the two faces 31 and the two faces 29 form an angle b of approximately 30 ° with the longitudinal direction m of the sole - bar 1 . taking into account the symmetry in relation to the plane tt , this inclination results in the compressive force f exerted by each elastic block 32 on the corresponding face 31 of the window 24 having a horizontal component f hl parallel to the longitudinal direction m of the sole - bar 1 . when the clearances x and x &# 39 ; are equal , the two components f hl are equal and opposite : this is the position of stability . if the clearances x and x &# 39 ; are not equal , one of the elastic blocks 32 is more compressed than the other and this results in the two components f hl being unequal and their resultant is non zero and tends to move the sole - bar in relation to the bolster in the direction for re - establishing the equality between the clearances x and x &# 39 ;. as the faces 29 and 31 , between which the elastic blocks 32 are interposed , are substantially parallel to each other , the elastic blocks 32 have , a priori , no strong tendency to slide parallel to these faces under the effect of the load : such a sliding would produce no work of spring - back of the blocks 32 . however , in order to preposition the blocks and to prevent parasitic movements , a stop shoulder 39 in the vicinity of the upper end of the face 29 and a stop shoulder 41 in the vicinity of the lower end of each face 31 are provided for each block 32 ( fig3 ). in the example shown , the angle a ( fig3 ) is chosen to be 25 ° and the angle b ( fig1 ) is chosen to be 30 °. the rubber of the blocks 32 can have a shore hardness equal to 50 . the dimensions ( length and width ) of the rubber blocks 32 are chosen to be sufficient for the blocks not to undergo an excessive compression from the bolster and the sole - bars . in service , through the action of the load from the wagon , which load is transmitted to the pivot - bearing 19 of the central bolster 18 via the pivot 21 , the bolster bears on the sole - bars 1 by means of the elastic blocks 32 . the latter , under compression and shear stresses , allow a relative sliding between the bolster and each sole - bar and produce on the sole - bars , in relation to the bolster , a force whose component f ht ( fig4 ) applies the reference faces of both sole - bars , which faces are defined by the linings 26 , against the corresponding references faces , which faces are defined by the linings 28 , of the bolster 18 . under the lateral thrusts transmitted to the sole - bar by the axles , the sole - bar tends , when travelling , to have parasitic movements which would correspond to a lift - off of one of the lining pairs 26 , 28 , the other lining pair 26 , 28 , located on the other side of the bolster playing the role of a hinge . but this tendency for parasitic movement is combatted by the elastic blocks loaded by the bolster 18 and , more particularly by the component f ht of their compressive force f . this force is proportional to the load supported by the bolster 5 , such that the stability increases with the load supported by the bogie , since this is desirable , given that the parasitic forces are themselves proportional to the load . on the other hand , as fig5 shows , the elastic blocks 32 oppose only a small return moment countering the pivoting movements of each sole - bar 1 about an axis parallel to the longitudinal direction of the bolster . during such a movement , it is generally observed that one of the elastic blocks 32 undergoes an overload , but that the other , on the contrary , helps the movement as this movement corresponds for it to a spring back . under these conditions , the bogie according to the invention enables the two sole - bars to assume different orientations about an axis parallel to the longitudinal direction of the bolster , which enables the load to be distributed over the four wheels 6 of the bogie even when the railway track is highly deformed . all this is possible without the bolster 18 having to be inclined in relation to the body of the wagon . this is why the invention permits the use of a flat cylindrical pivot - bearing , as explained hereinabove . during violent buffing between wagons , one of the clearances x or x &# 39 ; may momentarily be cancelled out and a lateral face of the bolster may come into contact with the lateral face of the window 24 located opposite . this is not a drawback , these two faces being sized in a sufficiently extensive manner in order to undergo such a shock without damage . the invention is not limited to the example described and shown . the bolster could have in place of the surfaces 29 a single surface in the form of a cylinder sector whose generatrices would be parallel to the edge separating the surfaces 29 . this cylindrical surface would bear directly , by two of its generatrices , on the surfaces 31 of the sole - bar . it is also possible to produce the linkage between the bolster and each sole - bar by a traction connection rod or a pair of traction connection rods extending upwards and towards the outside of the bogie from the bolster to the sole - bar . this connection rod or these connection rods would transmit an oblique force whose horizontal component would push the sole - bar against the bearing linings 28 of the bolster .	1
with reference to fig1 the preferred embodiment of a folding ladder assembly 20 according to the presenting invention is depicted connected to a vehicle , preferably beneath the platform 22 , or bed , of a flatbed truck . the ladder assembly 20 includes a support frame 26 ( see also fig3 ) which is secured to the underside of the platform 22 , and a ladder portion 28 which is pivotably attached to the support frame 26 by a pair of pivots 30 , 32 . the ladder portion is pivotable about an axis extending through the pivots 30 , 32 between an upright , operable position ( fig1 ) and a horizontal , collapsed position ( see fig2 ). with reference to fig1 the support frame 26 includes a pair of side members 34 , 36 which are arranged parallel to one another and extend in a manner transverse to a longitudinal axis of the truck . an outer end of each of the side members 34 , 36 is situated beneath and immediately adjacent an edge 18 of the platform 22 of the truck . the side members 34 , 36 extend beneath the platform of the truck and are joined together at the inner ends of the members 34 , 36 by an end member 38 . projecting downwardly at the outer end of each of the side members 34 , 36 is a flange member 40 , 42 which pivotably carries the ladder portion 28 by the pivots 30 , 32 . a pair of guide members 44 , 46 , are located on the support frame between the end member 38 and the flange members 40 , 42 . the guide members project downwardly from the side members 34 , 36 ( see fig5 ) and are each formed of a pair of flat members 52 , 54 , 56 , 58 secured on either edge of one of the side members 34 , 36 . extending between the lower ends of the flat members of each guide member is a pin 48 , 50 which functions to guide and orient the ladder portion 28 as will be more fully explained below . preferably , all of the members of the support frame are formed of flat steel and may be welded together at suitable joints . the side members 34 , 36 and the end member 38 form a rigid frame unit which may be readily secured to the underside of a platform of a truck as by welding or bolting , for example by bolts 24 . the ladder portion 28 includes a generally u - shaped peripheral frame having side members 62 , 64 and parallel crosspieces 66 , 68 , 70 . the crosspieces interconnect the side members to provide a rigid frame suitable for use as a ladder when the ladder portion is in the operative position . in this way , crosspiece 66 provides a bottom step , crosspiece 68 provides an intermediate step and crosspiece 70 provides a top step . the side members and crosspieces may be formed out of flat steel suitably welded together , with the top crosspiece 70 formed of right angle steel in order to impart substantial strength to the frame . a pair of spacing members 72 , 74 are each attached at one end to one of the side members 62 , 64 at the top of the u - shaped frame . the spacing members each extend at right angles to the frame formed by the side members 62 , 64 and crosspieces 66 , 68 , 70 and are pivotably attached to the flange members 40 , 42 at the pivots 30 , 32 . the pivots 30 , 32 are aligned with one another along an axis which is parallel to a fore - to - aft longitudinal axis of the truck . the ladder portion further includes a pair of stabilizer arms 80 , 82 which are pivotably connected at their outer ends to the side members 62 , 64 by a pair of aligned pivots 88 , 90 . the stabilizer arms are located on the insides of the side members 62 , 64 . the pair of pivots 88 , 90 are aligned on an axis which is parallel to the axis of pivots 30 , 32 and parallel to the fore - to - aft longitudinal axis of the truck . the stabilizer arms 80 , 82 each have a generally elongate , curved shape with an outer end thereof being pivotably attached to the side members 62 , 64 , see fig1 and 3 . the stabilizer arms are situated generally beneath and coplanar relative to the side members 34 , 36 of the support frame . the stabilizer arms are received by the guide members 44 , 46 of the support frame with a bottom edge of each of the stabilizer arms 80 , 82 traveling on the pins 48 , 50 when the ladder portion is moving between the operable and collapsed positions . a stop member 92 , 94 including a length of steel that is longer than the spacing between the pairs of flat members 52 , 54 and 56 , 58 is provided at the inner end of each of the stabilizer arms 80 , 82 to engage the flat members and thereby retain the arm within its respective guide member , see fig5 . each stabilizer arm 80 , 82 is provided with an inner notch 100 , 102 and an outer notch 104 , 106 on lower edges of the stabilizer arms . the inner notches 100 , 102 are located in proximity to the inner ends of the stabilizer arms and receive the pins 48 , 50 when the ladder portion is in the operable position . the outer notches 104 , 106 are located in proximity to the outer ends of the stabilizer arms and receive the pins 48 , 50 when the ladder portion is in the collapsed position , see fig2 . the inner notches 100 , 102 have a generally u - shaped configuration , with the closed ends thereof being inclined outwardly , i . e ., toward the edge of the platform edge 38 so that the force resulting from the weight of the ladder , or a person climbing the ladder , urges the pins 48 , 50 toward the closed ends of the notches 100 , 102 . the outer notches 104 , 106 have a generally u - shaped configuration and are oriented so as to be essentially upright when the ladder assembly is collapsed . thus , the force resulting from the weight of the ladder portion in the collapsed position tends to urge the pins 48 , 50 toward the closed ends of the notches 104 , 106 . it will be appreciated that the inner and outer notches cooperate with the pins 48 , 50 to provide releasable connections between the guide members 44 , 46 of the support frame and the stabilizer arms 80 , 82 when the ladder portion is in the operable and collapsed positions . the stabilizer arms travel in the guide members while the ladder portion is moving between the operable and collapsed positions and are maintained within the guide members by the stop members 92 , 94 . the spacing between the pins 48 , 50 and the cross members 34 , 36 of the support frame is sufficient to enable the stabilizer arms to freely travel within the guide members without obstruction and to move up and down in a vertical manner to a limited extent . a pair of release levers 84 , 86 are provided for facilitating release of the stabilizer arms from the guide members when unfolding the ladder to an upright position . the release levers are pivotably connected intermediate their ends to the pivots 88 , 90 so as to be situated to the outside of the side members 62 , 64 , see fig1 and 3 . the unlatching levers 84 , 86 each include a generally u - shaped bar portion 110 , 112 secured at a midsection thereof to a respective flange portion 114 , 116 . the flange portions are pivotably connected to the side members 62 , 64 of the ladder portion at the pivots 88 , 90 . the u - shaped bar portions 110 , 112 each have an upper leg end 118 which is located above the stabilizer arms 80 , 82 and a lower leg 120 which is located beneath the stabilizer arms , see fig1 and 4 . when the ladder portion is in the collapsed position ( fig2 ), the stabilizer arms may be unlatched from the guide members by exerting an upward , lifting force on the frame of the ladder portion about the pivots 30 , 32 and pivoting the upper legs 118 of the unlatching levers toward the side members 62 , 64 . in this fashion , the lower legs 120 of the unlatching levers are swung into contact with the stabilizer arms 80 , 82 and raise these arms about the pivots 88 , 90 to disengage the outer notches 104 , 106 from the pins 48 , 50 , see also fig3 . thereafter , the ladder portion is allowed to swing downwardly about pivots 30 , 32 under its own weight , enabling the stabilizer arms to slide upon the pins 48 , 50 , until the pins 48 , 50 enter the inner notches 100 , 102 , see fig4 . in this regard , it should be noted that the ladder portion may be permitted to swing downwardly so that the inner notches 100 , 102 ride past the pins 48 , 50 and the stop members 92 , 94 contact the guide members 44 , 46 . in such a position the ladder portion will have traveled outwardly of its equilibrium position ( i . e ., the rest position in which it would have from the pivots 30 , 32 in the absence of the stabilizer arms ) and can then be allowed to swing slowly inwardly under its own weight until the inner notches 100 , 102 receive the pins 48 , 50 ( fig4 ). even when the pins are received in the inner notches 100 , 102 , the ladder is disposed forwardly of its equilibrium position . thus , the weight of the ladder portion will tend to maintain the pins against the closed ends of the inner notches . the ladder portion is maintained in the collapsed and operable positions by the forces resulting from the weight of the ladder portion acting about the pivots 30 , 32 . the forces act in directions which tend to urge the pins 48 , 50 into the notches of the stabilizer arms . the move the ladder portion into the collapsed position , the stabilizer arms are moved in an upward direction about the pivots 88 , 90 by lifting the stabilizer arms . the lifting disconnects the stabilizer arms from the guide members by disengaging the notches 100 , 102 from the pins 48 , 50 . while the stabilizer arms are lifted above the pins , the ladder portion is swung towards the guide members . as soon as the pins 48 , 50 become relocated between the notches 100 , 102 and the pivots 88 , 90 , the stabilizer arms may be permitted to travel on the pins 48 , 50 . as soon as the ladder has been moved sufficiently beyond the collapsed position , the ladder portion may be permitted to move downwardly , in the opposite direction to automatically engage the notches 104 , 106 in the pins 48 , 50 . the ladder portion will now be maintained in the collapsed position by reason of the force resulting from the weight of the ladder portion about the pivots 30 , 32 . it should be apparent that there has been provided in accordance with the present invention a folding ladder for attachment to the underside of a flatbed truck which is readily movable between a first useful position and a second storage position . moreover , it will be apparent to those skilled in the art that numerous modifications , variations , substitutions and equivalents may be made for the features of the invention without departing from the spirit and scope of the invention . accordingly , it is expressly intended that all such modifications , variations , substitutions and equivalents which fall within the spirit and scope of the invention are defined in the appended claims being embraced thereby .	1
the present invention shall be further explained by the following , on the basis of the examples , which make reference to the accompanying figures , the invention not being limited by the examples or the figures . in the figures : fig1 shows the relationship between the plasma concentrations of sflt - 1 and plgf . fig2 shows sflt - 1 - concentrations relating to the plgf initial status , and plgf concentrations relating to the initial concentration of sflt - 1 . fig3 shows event - rates , calculated according to kaplan - meier , wherein the cumulative incidence of death , non - fatal myocardial infarction , stroke , and resuscitation is related to the initial concentration of plgf in plasma ( n = 230 ). the patients were divided into groups according to the median plgf concentrations of plgf ( 17 . 7 ng / l ). fig4 shows event - rates , calculated according to kaplan - meier , wherein the cumulative incidence of death , non - fatal myocardial infarction , stroke , and resuscitation is related to the initial concentrations of sflt - 1 in plasma ( n = 230 ). the patients were divided into groups according to the median sflt - 1 concentrations ( 56 . 5 ng / l ). fig5 shows the prognostic relevance of plgf for the incidence of death , non - fatal myocardial infarction , stroke , and resuscitation related to the sflt - 1 - concentrations . the patients were divided into tertiles according to the plgf - concentrations (& lt ; 15 . 6 ; 15 . 6 - 23 . 3 ; & gt ; 23 . 3 ng / l ) and to the sflt - 1 concentrations (& lt ; 37 . 4 ; 37 . 4 - 91 . 4 ; & gt ; 91 . 4 ng / l ) ( n = 230 ), respectively . fig6 shows event - rates , calculated according to kaplan - meier , wherein the cumulative incidence of death , non - fatal myocardial infarction , stroke , and resuscitation is related to the initial concentrations of flt - 1 and plgf ( n = 230 ), respectively . the patients were divided into groups according to the median concentrations of sflt - 1 and plgf . fig7 shows changes in the concentrations of plgf and sflt - 1 , respectively , related to a randomised treatment during the further observation . the samples were collected at the beginning ( initial value ), after 30 days , and after 12 months ( n ≧ 80 ). the patients who were examined were those who were already involved in the optimaal study ( optimal trial in myocardial infarction with angiotensin ii antagonist losartan ) and who had experienced a myocardial infarction . the design and the most important results of the optimaal study were already described earlier ( 11 ). the study comprised a group of 230 patients diagnosed with myocardial infarction and a dysfunction of the left ventricle and / or a heart failure during the acute phase of the myocardial infarction . the patients were randomly divided into groups and adjusted to a dosage of losartan ( 1 × 50 mg / day ) or captopril ( 3 × 50 mg / day ), in accordance with compatibility . there were no substantial differences between both groups as treated regarding the initial characteristics . blood was drawn from the patients in the morning in a fasted state , wherein the blood samples were collected in pyrogen - free vacuum tubes with edta . the tubes were immediately immersed in ice - water , centrifuged within 15 minutes ( 1 , 000 g , 4 ° c ., 15 minutes ), and the plasma was stored as a multitude of aliquots at − 80 ° c . until analysis . the determination of the markers were performed blinded , i . e ., without knowledge of the patients &# 39 ; histories and treatment as assigned , in the central laboratory of the university of frankfurt . plgf , vegf , sflt - 1 , and scd40 ligand ( scd40l ) were measured using the elisa technique ( all reagents from r & amp ; d systems , wiesbaden ) ( 7 , 12 , 13 ). highly sensitive c - reactive protein ( hscrp ) was measured using the behring bn ii nephelometer ( dade - behring , deerfield , ill .) ( 14 ). in connection with the study , an end point was determined which was composed of several parameters . the end point included overall mortality independent from the cause of death , resuscitation after cardiac arrest , re - occurring of non - fatal myocardial infarction , and stroke . a detailed description of the design and organization of the optimaal study has already been published earlier ( 11 , 15 ). a logistic regression model was used in order to determine the relative risk for vascular events ( 16 ). the separation into groups took place on the basis of the median concentration of each biomarker . a logistic regression model was used in order to determine the relative risk of death , non - fatal myocardial infarction , stroke and the need for resuscitation ( 16 ). the effects of the initial characteristics and biochemical markers on each of the relationships between plgf concentrations and sflt - 1 concentrations , respectively , and vascular events , as examined , were analyzed through the stepwise functioning logistic regression model . all results that were obtained for continuous variables are given as mean value ± standard deviation . comparisons between the groups were analyzed by the t - test ( two - sided ). a comparison of the categorical variables was made by the pearson χ 2 - test . values of p & lt ; 0 . 05 were regarded as statistically significant . all analyses were performed using the software spss 11 . 5 ( spss inc ., chicago , ill .). statistical parameters are : n = 230 , lacking 10 ; median ( plgf ) = 17 . 7250 , median ( sflt - 1 ) = 56 . 5000 ; percentile = 33 . 33333333 , 15 . 5700 , 37 . 4300 , 66 . 66666667 , 23 . 2700 , 91 . 4100 . the analysis according to kaplan - meyer represents a statistic standard method for the calculation of differences in the rate of death or the rate of an event - free survival . the initial concentrations of sflt - 1 in plasma showed a mean value of 183 . 2 ± 465 . 6 ng / l ( range of 5 . 0 to 2503 . 4 ), and the initial concentrations of plgf in plasma were 24 . 0 ± 20 . 0 ng / l ( range of 5 . 0 to 144 . 9 ). when the sflt - 1 - plasma concentrations were correlated to traditional biomarkers , no correlation with hscrp concentrations ( rank correlation coefficient according to spearman r = 0 . 12 ; p = 0 . 08 ) was found , whereas the bi - variable correlation analysis showed a significant inverse correlation between sflt - 1 and scd40l , although the correlation coefficients of r = 0 . 17 ( p = 0 . 018 ) were low . in addition , no significant correlation between vegf ( r = 0 . 03 ; p = 0 . 66 ) or plgf ( r = 0 . 05 ; p = 0 . 44 ) and sflt - 1 plasma concentrations ( fig1 ), respectively , was found , although the sflt - 1 - concentrations were significantly higher in patients with elevated plgf - concentrations ( fig2 ). relationship between vascular events and the plasma concentrations of plgf and sflt - 1 the patients were divided according to their median concentrations of biomarkers . the initial characteristics differed in patients with high plgf concentrations and patients with low plgf concentrations only with respect to the sflt - 1 - concentrations ( table 1 ). in patients with elevated plgf concentrations , the event - rates for the combined end points of mortality , non - fatal . myocardial infarction , stroke , and reuscitation resuscitation were significantly higher ( 38 . 8 % vs . 18 . 3 %; p = 0 . 001 ) ( fig3 ) compared to those with low plgf concentrations . with reference to the most important vascular events ( death and non - fatal myocardial infarction ), the differences persisted with an event rate of 30 . 4 % in patients with elevated plgf concentrations , compared to 15 . 7 % in patients with low plgf - concentrations ( odds ratio 2 . 36 [ 95 % ci 1 . 24 - 4 . 48 ]; p = 0 . 012 ). the initial characteristics differed in patients with high sflt - 1 concentrations and patients with low sflt - 1 - concentrations in view of the concentrations of bnp , scd40l , and plgf , and the incidence of new q - waves in the ecg and the duration of hospitalization ( table 1 ). in patients with elevated sflt - 1 concentrations the event - rates for the combined end points of mortality , non - fatal myocardial infarction , stroke , and resuscitation tended to be lower than in patients with low sflt - 1 concentrations ( 22 . 6 % vs . 33 . 9 %; p = 0 . 08 ) ( fig4 ). a non - significant difference was observed for the most important vascular events ( death and non - fatal myocardial infarction ) in 19 . 1 % of the patients with elevated sflt - 1 - concentrations compared to 27 . 0 % in patients with low sflt - 1 - concentrations ( odds ratio 0 . 64 [ 95 % ci 0 . 34 - 1 . 19 ]; p = 0 . 21 ). patients with elevated plgf concentrations also showed elevated concentrations of sflt - 1 ( fig2 ). nevertheless , the sflt - 1 concentrations of both groups overlapped in a substantial range indicating that , surprisingly , the compensatory increase of the sflt - 1 concentrations in patients with elevated plgf concentrations is inconsistent and can not be observed in all patients . patients with plgf concentrations in the two upper tertiles who , nevertheless , did not show an increase in the sflt - 1 concentrations ( lower tertile ), showed adverse after - effects compared to patients who exhibited sflt concentrations in the uppermost tertile , but similarly elevated plgf concentrations ( fig5 ). when the plgf concentrations were only slightly elevated ( second tertile ), even a moderate increase in the sflt - 1 concentrations appeared to protect the patients from adverse after - effects . in contrast , in patients with strongly elevated concentrations of plgf ( third tertile ), only those patients with sflt - 1 concentrations in the uppermost tertile showed a significantly lower event - rate . when the patients were divided into two groups on the basis of their plgf and sflt - 1 concentrations , respectively , the prognosis of the patients with high sflt - 1 concentrations did not differ significantly from those patients with either high or low plgf concentrations ( fig6 ). accordingly , the ratio of plgf and sflt - 1 is a powerful independent parameter for a prediction of vascular events ( odds ratio 4 . 00 [ 95 % ci 2 . 14 - 7 . 23 ]; p & lt ; 0 . 001 ), which is significantly superior to the exclusive determination of one of the parameters . the event - rates in patients with low plgf - concentrations were 14 . 0 % and were independent from the sflt - 1 - concentrations ( p = 0 . 95 ). in contrast , the event - rates in patients with high plgf - concentrations were 55 . 8 %, if the sflt - 1 - concentrations were low , but 24 . 3 %, if the sflt - 1 - concentrations were elevated ( p = 0 . 002 ). ( a ) a ratio of [ plgf = high : sflt - 1 = low ] indicates a high risk for the patient for an adverse event such as death , non - fatal myocardial infarction , and stroke . ( b ) in contrast , if the plgf value is low , the risk for an adverse event is markedly lowered , regardless of whether or not the sflt - 1 - value is high or low . ( c ) at a ratio of [ plgf = low : sflt - 1 = low ], the risk for an adverse event is particularly low . ( d ) if the sflt - 1 - value is high , the risk for an adverse event is markedly lowered , regardless of whether or not the plgf - value is high or low . in order to further examine the potential prognostic independence of individual biomarkers , a stepwise multivariable logistic regression analysis was performed , comprising plgf and sflt - 1 , as well as further biochemical markers , such as bnp , a marker of neurohumoral activation , hscrp , a classical acute phase protein , and scd40l , a marker of thromboinflammatory activation . in addition , basic characteristics were taken into account that showed a significant prognostic meaning in an univariable model . for the combined end points after a four - year observation period , only two established risk factors , namely advanced age and diabetes , were found as independent prognostic parameters , after the biochemical markers were included in the model ( table 2 ). the markers bnp ( p = 0 . 043 ), scd40l ( p = 0 . 007 ), plgf ( p = 0 . 001 ), and sflt - 1 ( p = 0 . 006 ) remained important and independent prognostic parameters for the further disease progression , whereas hscrp lost somewhat of importance after plgf was introduced into the model ( p = 0 . 77 after introduction of plgf ). in agreement with the results of the study , which were derived from the overall group of the patients , no difference in clinical progression was found between the captopril and the losartan treatment groups . in addition , neither in patients with high nor in patients with low plgf concentrations was a reduction of the events observed ( plgf low : 19 % event - rate in the captopril group vs . 17 . 5 % in the losartan group ; p = 1 . 00 ; plgf high : 41 . 1 % vs . 35 . 6 %; p = 0 . 57 ). similar results were obtained for the sflt - 1 - concentrations : sflt - 1 high : 22 . 2 % in the captopril group vs . 23 . 9 % in the losartan group ( p = 1 . 00 ); sflt - 1 low : 36 . 7 % in the captopril - group vs . 30 . 9 % in the group vs . 30 . 9 % in the losartan - group ( p = 0 . 56 ). it was furthermore found that in patients of whom serial samples were available ( day 0 , 30 days , and 1 year ; n ≧ 80 for each group and each time point ) both the plgf and the sflt - 1 concentrations continuously decreased during the observation period , no differences occurring between the treatment groups ( fig7 ). the results of the study show that elevated blood levels of plgf are connected to vascular events in patients after a myocardial infarction . in agreement with a new study on patients with acute coronary heart diseases ( 7 ), the prognostic importance of the concentrations of plgf in plasma was independent from other biomarkers representing distinct pathophysiological processes . elevated plgf concentrations provided a prognostic value which had more significance than information derived from hscrp plasma concentrations . through multivariate regression analysis , several other biochemical markers , including b - type natriuretic peptide , a marker of neurohumoral activation , scd40l , a marker of thrombo - inflammatory activation , and plgf , a marker of vascular inflammation , were identified as independent prognostic parameters for the further progression of the disease during the following four years . nevertheless , the new and most important finding of the study is that the prognostic importance of plgf is modulated by sflt - 1 . these findings show that the balance between plgf and its soluble receptor sflt - 1 as the only known endogenous regulator is an essential determinant in view of the further disease progression in patients with acute myocardial infarction . both the reason of the elevated concentrations of sflt - 1 as well as the signals which up - regulate the flt - 1 expression in patients which have experienced an acute myocardial infarction currently are not known . hypoxia is a potent stimulus for the up - regulation of the flt - 1 - expression ( 6 , 19 ). it is possible that a large portion of sflt - 1 is released from the inflammatory cells by so - called shedding ( 3 , 9 , 20 ). independent of the mechanisms that are involved in the increase of the concentrations of sflt - 1 in plasma , the results of the present study emphasize the key role of the balance between pro - and anti - inflammatory mediators for the risk stratification in the context of an acute coronary heart disease ( 21 ). in particular , these studies give rise to the hope that new anti - inflammatory strategies can be developed in order to counteract the progression of a manifested atherosclerosis . the infusion of sflt - 1 with the purpose to reduce the concentrations of circulating active plgf in patients with unstable or rapidly progressing coronary heart disease could be particularly effective in those patients who have elevated plgf concentrations and low concentrations of its inhibitor sflt - 1 . the results of the present study show that elevated plasma concentrations of plgf , a marker of vascular inflammation , in patients after a myocardial infarction is correlated with an elevated risk for subsequent vascular events . nevertheless , the informational value with regard to prognosis depends on the concentration of sflt - 1 , which supports the hypothesis that sflt - 1 regulates the activity of plgf through binding and inactivation . these findings could provide the basis of a new anti - inflammatory therapeutic approach using sflt - 1 in order to reduce circulating plgf in patients who have an elevated risk for an adverse vascular event . braunwald e . unstable angina : an etiologic approach to management . circulation . 1998 ; 98 : 2219 - 22 . libby p , ridker p m , maseri a . inflammation and atherosclerosis . circulation . 2002 ; 105 : 1135 - 43 . luttun a , tjwa m , moons l , wu y , angelillo - scherrer a , liao f , nagy j a , hooper a , priller j , de klerck b , compernolle v , daci e , bohlen p , dewerchin m , herbert j m , fava r , matthys p , carmeliet g , collen d , dvorak h f , hicklin d j , carmeliet p . revascularization of ischemic tissues by plgf treatment , and inhibition of tumor angiogenesis , arthritis and atherosclerosis by anti - flt1 . nat med . 2002 ; 8 : 831 - 40 . maglione d , guerriero v , viglietto g , delli - bovi p , persico m g . isolation of a human placenta cdna coding for a protein related to the vascular permeability factor . proc natl acad sci usa . 1991 ; 88 : 9267 - 71 . autiero m , luttun a , tjwa m , carmeliet p . placental growth factor and its receptor , vascular endothelial growth factor receptor - 1 : novel targets for stimulation of ischemic tissue revascularization and inhibition of angiogenic and inflammatory disorders . j thromb haemost . 2003 ; 1 : 1356 - 70 . luttun a , tjwa m , carmeliet p . placental growth factor ( plgf ) and its receptor flt - 1 ( vegfr - 1 ): novel therapeutic targets for angiogenic disorders . ann n y acad sci . 2002 ; 979 : 80 - 93 . heeschen c , dimmeler s , fichtlscherer s , hamm c w , berger j , simoons m l , zeiher a m . prognostic value of placental growth factor in patients with acute chest pain . jama . 2004 ; 291 : 435 - 41 . khaliq a , dunk c , jiang j , shams m , li x f , acevedo c , weich h , whittle m , ahmed a . hypoxia down - regulates placenta growth factor , whereas fetal growth restriction up - regulates placenta growth factor expression : molecular evidence for “ placental hyperoxia ” in intrauterine growth restriction . lab invest . 1999 ; 79 : 151 - 70 . rafii s , avecilla s , shmelkov s , shido k , tejada r , moore m a , heissig b , hattori k . angiogenic factors reconstitute hematopoiesis by recruiting stem cells from bone marrow microenvironment . ann n y acad sci . 2003 ; 996 : 49 - 60 . chung n a , makin a j , lip g y . measurement of the soluble angiopoietin receptor tie - 2 in patients with coronary artery disease : development and application of an immunoassay . eur j clin invest . 2003 ; 33 : 529 - 35 . dickstein k , kjekshus j . effects of losartan and captopril on mortality and morbidity in high - risk patients after acute myocardial infarction : the optimaal randomised randomized trial . optimal trial in myocardial infarction with angiotensin ii antagonist losartan . lancet . 2002 ; 360 : 752 - 760 . heeschen c , dimmeler s , hamm c w , van den brand m j , boersma e , zeiher a m , simoons m l . soluble cd40 ligand in acute coronary syndromes . n engl j med . 2003 ; 348 : 1104 - 11 . heeschen c , dimmeler s , hamm c w , boersma e , zeiher a m , simoons m l . prognostic significance of angiogenic growth factor serum levels in patients with acute coronary syndromes . circulation . 2003 ; 107 : 524 - 530 . heeschen c , hamm c w , bruemmer j , simoons m l . predictive value of c - reactive protein and troponin t in patients with unstable angina : a comparative analysis . capture investigators . chimeric c7e3 antiplatelet therapy in unstable angina refractory to standard treatment trial . j am coll cardiol . 2000 ; 35 : 1535 - 42 . dickstein k , kjekshus j . comparison of the effects of losartan and captopril on mortality in patients after acute myocardial infarction : the optimaal trial design . optimal therapy in myocardial infarction with the angiotensin ii antagonist losartan . am j cardiol . 1999 ; 83 : 477 - 81 . cox d r . regression models and life - tables . j r stat soc [ b ]. 1972 ; 34 : 187 - 220 . maynard s e , jiang - yong min j - y , merchan j , lim k h , li j , mondal s , libermann t a , morgan j p , sellke f w , stillman i e , epstein f h , sukhatme v p , karumanchi s a . excess placental soluble fms - like tyrosine kinase 1 ( sflt1 ) may contribute to endothelial dysfunction , hypertension , and proteinuria in preeclampsia . j . clin . invest . 2003 ; 1 11 : 649 - 658 . levine r j , maynard s e , qian c , lim k h , england l j , lu k f , schisterman e f , thadhani r , sachs b p , epstein f h , sibai b m , sukhatme v p , karumanchi s a . circulating angiogenic factors and the risk of peeelampsioa preeclampsioa . n engl j med . 2004 ; 350 : 672 - 683 . takeda n , maemura k , imai y , harada t , kawanami d , nojiri t , manabe i , nagai r . endothelial pas domain protein 1 gene promotes angiogenesis through the transactivation of both vascular endothelial growth factor and its receptor , flt - 1 . circ res . 2004 ; 95 : 146 - 53 . selvaraj s k , giri r k , perelman n , johnson c , malik p , kalra v k . mechanism of monocyte activation and expression of proinflammatory cytochemokines by placenta growth factor . blood . 2003 ; 102 : 1515 - 24 . heeschen c , dimmeler s , hamm c w , fichtlscherer s , boersma e , simoons m l , zeiher a m . serum level of the antiinflammatory cytokine interleukin - 10 is an important prognostic determinant in patients with acute coronary syndromes . circulation . 2003 ; 107 : 2109 - 14 . ridker p m . clinical application of c - reactive protein for cardiovascular disease detection and prevention . circulation 2003 ; 107 : 363 - 369 . koenig w , lowel h , baumert j , meisinger c . c - reactive protein modulates risk prediction based on the framingham score : implications for future risk assessment : results from a large cohort study in southern germany . circulation 2004 ; 109 : 1349 - 53 . danesh j , wheeler j g , hirschfield g m , et al . c - reactive protein and other circulating markers of inflammation in the prediction of coronary heart disease . n engl j med 2004 ; 350 : 1387 - 97 . morrow d a , rifai n , antman e m , et al . c - reactive protein is a potent predictor of mortality independently of and in combination with troponin t in acute coronary syndromes : a timi 11a substudy . thrombolysis in myocardial infarction . j am coll cardiol 1998 ; 31 : 1460 - 5 . lindahl b , toss h , siegbahn a , venge p , wallentin l . markers of myocardial damage and inflammation in relation to long - term mortality in unstable coronary artery disease . frisc study group . fragmin during instability in coronary artery disease . n engl j med 2000 ; 343 : 1139 - 47 . james s k , lindahl b , siegbahn a , et al . n - terminal pro - brain natriuretic peptide and other risk markers for the separate prediction of mortality and subsequent myocardial infarction in patients with unstable coronary artery disease : a global utilization of strategies to open occluded arteries ( gusto )- iv substudy . circulation 2003 ; 108 : 275 - 81 .	6
the novel compounds of this invention are the levorotatory and dextrorotatory enantiomers of the compound having the following structural formula : ## str1 ## or pharmaceutically acceptable salts thereof , wherein x . sub . α represents bromo or chloro ; r represents hydrogen , lower alkyl , especially c 1 - 3 alkyl , or fluoro ; r 1 represents methyl or cyclopropylmethyl , when x . sub . α is bromo ; and r 1 represents cyclopropylmethyl when x . sub . α is chloro . a preferred embodiment of the novel compounds is that wherein r is hydrogen . an even more preferred embodiment of the novel compounds is that wherein r is hydrogen , and x . sub . α is bromo . the pharmaceutically acceptable salts of the novel compounds of this invention are acid addition salts formed from a novel compound and an organic or inorganic acid recognized by the art as providing a pharmaceutically acceptable acid addition salt , such as hydrochloride , hydrobromide , dihydrogen phosphate , sulfate , pamoate , citrate , napsylate , pyruvate , isethionate , maleate , fumarate , or the like . the salts are prepared by dissolving approximately equimolecular amounts of the free base compound and the desired acid in a solvent followed by crystallization of the salt product . the novel process for the preparation of the compounds of this invention comprises dehydration of an r - substituted 1 - r 1 - 4 -( 3 - x . sub . α - 5 - hydroxy - 5h - dibenzo [ a , d ] cyclohepten - 5 - yl ) piperidine with a dehydrating agent such as trifluoroacetic acid / trifluoroacetic anhydride at reflux temperature , as described in j . med . chem ., 8 , 829 ( 1965 ), to form a racemic mixture of the novel compounds of this invention . the racemic mixture is then resolved by formation of diastereomeric salts with it and an optically active acid such as di - p - toluoyl - d - tartaric acid in a solvent such as ethanol followed by separation of the diastereomeric pair of salts such as by fractional crystallization followed by separate treatment of each salt with an alkali such as an alkali metal hydroxide , bicarbonate or carbonate , especially sodium bicarbonate or carbonate to liberate the free (+)- and (-)- enantiomers . the levorotatory isomer is further resolved via recrystallization from a solvent such as acetonitrile . the optically enriched dextrorotatory compound obtained as described above can be racemized by heating a solution of it in an inert solvent until a sample fails to show optical activity . it is convenient to reflux a toluene solution for about 10 - 50 hours . in this manner , additional quantities of the racemic compound can be obtained from which additional levorotatory material can be isolated by the above described resolution . the compounds useful in the novel method of treatment and novel pharmaceutical formulations of this invention have structural formula : ## str2 ## or a pharmaceutically acceptable salt thereof , wherein r is as previously defined ; r 1 is methyl or cyclopropylmethyl ; and x is halo , such as chloro , bromo , or iodo . it is preferred that r be hydrogen and x be bromo or iodo . the pharmaceutically acceptable salts contemplated for this purpose are the same salts discussed herein in connection with the group of novel compounds . as pointed out by ebnother et al ., helv . chim . acta , 48 , 1237 - 1249 ( 1965 ) these compounds exist as levorotatory and dextrorotatory optical enantiomers . all of the antipsychotic activity resides in the levorotatory enantiomers , but the racemic mixtures of the levo - and dextrorotatory enantiomers , the mixture from which the levorotatory enantiomers are obtained are still potent antipsychotic agents and are useful in the novel method of treatment and novel pharmaceutical formulations of this invention . thus there is contemplated for use in the novel method of treatment and pharmaceutical formulations : ( 1 ) racemic mixtures of levo - and dextrorotatory enantiomers , herein after referred to as &# 34 ; racemic compounds &# 34 ;; and ( 2 ) any mixtures optically enriched in the levoratory sense or pure levoratotary enantiomers , hereinafter referred to as &# 34 ; levorotatory compounds &# 34 ;. the novel method of treatment of this invention comprises the administration of an antipsychotically effective amount of one of the racemic or levorotatory compounds or a pharmaceutically acceptable salt thereof to a psychotic patient . the route of administration can be oral , rectal , intravenous , intramuscular , or subcutaneous . doses of 0 . 1 to 20 mg ./ kg ./ day and preferably of 0 . 5 to 10 mg ./ kg ./ day of active ingredient are adequate , and if preferred , it can be administered in divided doses given two to four times daily . it is to be noted that the precise unit dosage form and dosage level depend upon the case history of the individual being treated and , consequently , are left to the discretion of the therapist . pharmaceutical compositions comprising a compound useful in the novel method of treatment as active ingredient may be in any art recognized form suitable for oral use , such as tablets , troches , lozenges , aqueous or oil suspensions , dispersible powders , or granules , emulsions , hard or soft capsules , syrups , or elixirs . for intravenous and intramuscular and subcutaneous use the pharmaceutical compositions may be in any art recognized form of a sterile injectable preparation such as a sterile aqueous or oleaginous solution or suspension . the amount of active ingredient incorporated in a unit dosage of the above described pharmaceutical compositions may be from 1 to 400 mg ., and preferably from 5 to 250 mg . to an ice cooled solution of 2 . 10 g . ( 0 . 0074 mol ) of 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - one in 35 ml . of dry tetrahydrofuran is added dropwise 36 ml . of 0 . 41 m 1 - methyl - 4 - piperidylmagnesium chloride . the solution is stirred for one hour and then the tetrahydrofuran is removed by evaporation on a rotary evaporator . the red , oily residue that remains is dissolved in benzene and water is added dropwise until a clear benzene supernatant and a gelatinous aqueous phase is obtained . the benzene phase is decanted and the gelatinous aqueous phase is extracted with four 50 ml . portions of hot benzene . the combined benzene phases are washed with water , dried over magnesium sulfate , filtered , and benzene is removed on a rotary evaporator . the residue is triturated with cold acetonitrile and collected by filtration to give 0 . 86 g . ( 40 %) of 1 - methyl - 4 -( 3 - bromo - 5 - hydroxy - 5h - dibenzo [ a , d ] cyclohepten - 5 - yl ) piperidine . a solution of 0 . 86 g . ( 0 . 003 mol ) of 1 - methyl - 4 -( 3 - bromo - 5 - hydroxy - 5h - dibenzo [ a , d ] cyclohepten - 5 - yl ) piperidine in 30 ml . of trifluoroacetic acid and 15 ml . of trifluoroacetic anhydride is stirred and refluxed for 16 hours . the solvents are removed by evaporation on a rotary evaporator . the residue is dissolved in chloroform , and this chloroform solution is washed with sodium hydroxide solution , water , dried over magnesium sulfate , and filtered . evaporation of the chloroform from the filtrate gives 0 . 88 g . of a yellow oil . this oil is dissolved in a minimum amount of absolute ethanol , treated with ethanolic hcl , and is cooled . the white crystalline material that precipitates is collected by filtration and is recrystallized from acetonitrile to give 0 . 67 g . of (±)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine hydrochloride . to a solution of 12 . 42 g . ( 0 . 0339 mol ) of (±)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene piperidine in 250 ml of hot ethanol is added 13 . 11 g . ( 0 . 0339 mol ) of di - p - toluoyl - d - tartaric acid dissolved in 50 ml of warm ethanol . the solution is stirred and allowed to cool to room temperature . the salt that crystallizes is removed by filtration and is recrystallized from ethanol six times to afford 2 . 62 g . of material having a constant rotation : [ α ] 589 25 - 111 °, [ α ] 578 25 - 116 °, [ α ] 546 25 - 137 °, [ α ] 436 25 - 306 ° ( c , 0 . 531 , pyridine ). this salt is converted to the free base with saturated sodium bicarbonate solution and extracting it into ether . the ether phase is washed with water , dried over magnesium sulfate , filtered , and the ether is removed . recrystallization from acetonitrile gives (-)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine as tlc homogeneous ( fl . alumina / chcl 3 ), sparkling white prisms , m . p . 189 °- 190 °; [ α ] 589 25 - 100 °, [ α ] 578 25 - 106 °, [ α ] 546 25 - 127 °, [ α ] 436 25 - 304 ° ( c , 0 . 731 , chcl 3 ). anal . calcd . for c 21 h 20 brn : c , 68 . 86 ; h , 5 . 50 ; br , 21 , 82 ; n , 3 . 82 . found : c , 68 . 97 ; h , 5 . 58 ; br , 21 . 62 ; n , 3 . 39 . starting with 5 . 76 g ( 0 . 0157 mol ) of (±)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine toluoyl - 1 - tartaric acid monohydrate in 25 ml . of ethanol and using the procedure as described above , 1 . 60 g of crystalline salt is obtained [ α ] 589 25 + 110 °; [ α ] 578 25 + 116 °; [ α ] 546 25 + 137 °; [ α ] 436 25 + 302 ° ( c , 0 . 403 , pyridine ). conversion to the free base and crystallization from acetonitrile gives (+)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine , m . p . 189 °- 191 ° c . ; [ α ] 589 25 + 100 °, [ α ] 578 25 + 107 , [ α ] 546 25 + 127 , [ α ] 436 25 + 307 ° ( c , 0 . 651 , chcl 3 ). employing the procedures substantially as described in examples 1 and 2 but substituting for the 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - one and / or the 1 - methyl - 4 - piperidylmagnesium chloride used in example 1 , step a similar relative amounts of the 3 - x . sub . α - 7 - r - 5h - dibenzo [ a , d ]- cyclohepten - 5 - ones , and 1 - r 1 - 4 - piperidylmagnesium chloride , described in table i , there are produced the (-)- and (+)- enantiomers of 1 - r 1 - 4 -( 3 - x . sub . α - 7 - r - 5h - dibenzo [ a , d ]- cyclohepten - 5 - ylidene ) piperidine , also described in table i in accordance with the following reaction scheme : table i__________________________________________________________________________ ## str3 ## r r . sup . 1 x . sub . α__________________________________________________________________________ f ch . sub . 3 br ch . sub . 3 ch . sub . 3 br h ## str4 ## br f ## str5 ## br ch . sub . 3 ## str6 ## br h ## str7 ## cl f ch . sub . 3 cl ch . sub . 3 ch . sub . 3 cl f ## str8 ## cl ch . sub . 3 ## str9 ## cl__________________________________________________________________________ a typical tablet containing 100 mg . of (-)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine per tablet is prepared by mixing together with the active ingredient calcium phosphate , lactose and starch in the amounts shown in the table below . after these ingredients are thoroughly mixed , the appropriate amount of magnesium stearate is added and the dry mixture is then compressed into tablets . ______________________________________tablet formulaingredient mg . per tablet______________________________________ (-)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ]- cyclohepten - 5 - ylidene ) piperidine 100 mg . calcium phosphate 52 mg . lactose 60 mg . starch 10 mg . magnesium stearate 1 mg . ______________________________________ similarly tablets containing the other racemic or levorotatory compounds active in the novel method of treatment of this invention are prepared by substituting for the 100 mg ( 2 . 7 × 10 - 4 mole ) of (-)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine a comparable molecular amount of any of the racemic or levorotatory compounds with structural formula : ## str10 ## or a pharmaceutically acceptable salt thereof wherein x , r and r 1 are as previously defined . mice ( cf 1 females weighing about 20 g .) were injected i . p . with the test compounds two hours and five minutes prior to a subcutaneous administration of (+)- amphetamine , 10 mg ./ kg . forty - five minutes after giving (+)- amphetamine , the mice were observed for the presence or absence of excitement and locomotor stimulation elicited by (+)- amphetamine . at a dose of 30 mg ./ kg . of (-)- 1 - methyl - 4 -( 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - yldiene )- piperidine ( l - 634 , 340 ) or (-)- 1 - methyl - 4 -( 3 - bromo - 5 - h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine ( l - 636 , 524 ), 80 % of the mice failed to exhibit the typical signs normally elicited by (+)- amphetamine . a reference neuroleptic , chlorpromazine , also antagonized the action of (+)- amphetamine ( table 1 ). squirrel monkeys ( saimiri sciureus ) of both sexes were trained to press a lever in order to avoid an electric shock . the animals were trained and tested while restrained in a chair in an isolation chamber . the electric shock ( 600 v a . c ., 2 ma , 1 second ) was given via leads placed on the seat of the chair and a ring around the animal &# 39 ; s neck . background noise was supplied with a grason stadler noise generator . a modified sidman avoidance schedule ( rs - 36 , ss - 36 ) was used , programming 36 seconds of shock - free time after each lever press ( avoidance response ). a lever press made during a shock ( escape response ) immediately terminated the shock , resetting the shock - shock interval timer to 36 seconds . the avoidance schedule also contained an &# 34 ; alarm &# 34 ; system to shut off the schedule for 30 minutes , if an animal received 10 consecutive shocks without a lever press . this prevented the animals from receiving an excessive number of shocks . following the 30 - minute alarm period , the schedule resumed again . an animal was assigned the maximum number of shocks ( 50 / 30 minutes ), if the alarm system was activated during a trial . the test compounds were administered by gavage at cumulative doses of 0 . 33 , 1 and 3 mg ./ kg . given at 0 , 90 and 180 minutes of the test session . (-)- 1 - methyl - 4 -( 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine ( l - 634 , 340 ) caused the monkeys to take a large number of shocks , i . e . avoidance responding was markedly depressed ( table 2 ). chlorpromazine , a reference standard , also exhibits a similar action in this test procedure . table 1______________________________________antagonism of (+)- amphetamine - inducedexcitement and hyperactivity . treatment . sup . a # protected . sup . b ( mg ./ kg . i . p .) # tested______________________________________l - 634 , 340 - oop - 02 ( 6 ) 2 / 5 &# 34 ; ( 30 ) 4 / 5 &# 34 ; ( 150 ) 5 / 5l - 636 , 524 - ooy - 01 ( 6 ) 0 / 5 &# 34 ; ( 30 ) 4 / 5 &# 34 ; ( 150 ) 5 / 5chlorpromazine ( 6 ) 5 / 5 &# 34 ; ( 30 ) 5 / 5 &# 34 ; ( 150 ) ______________________________________ . sup . a two hours and five minutes before (+) amphetamine ( 10 mg ./ kg . s . c .) . sup . b mice were observed 45 minutes after (+) amphetamine . table 2__________________________________________________________________________antiavoidance activity in squirrel monkey . shocks received / 30 minutes time ( minutes ) treatment 0 - 30 30 - 60 60 - 90 90 - 120 120 - 150 150 - 180 180 - 210 210 - 240 240 - 270__________________________________________________________________________mg ./ kg . p . o . : 0 . 33 1 . 0 3 . 0control . sup . a 0 0 0 1 0 0 0 0 0l - 634 , 340 . sup . b 0 1 10 20 38 50 50 50 50control . sup . a 0 1 3 3 3 1 1 2 3chlorpromazine . sup . b 0 0 0 0 2 2 5 50 50__________________________________________________________________________ . sup . a average of two control sessions ( one before and one after drug testing ) for three monkeys . . sup . b average for the same three monkeys for one session .	2
turning to the drawings , wherein like reference numerals refer to like elements , the invention is illustrated as being implemented in a suitable environment . the following description is based on embodiments of the invention and should not be taken as limiting the invention with regard to alternative embodiments that are not explicitly described herein . embodiments of the invention provide techniques for identifying and enhancing ( e . g ., visually enhancing ) one or more multimedia feeds ( e . g ., video feeds ) from a plurality of such feeds that are simultaneously being presented ( e . g ., displayed ) to the user . this identification and enhancement may be based on media analysis performed on the plurality of feeds , e . g ., in a runtime or in a pre - processed fashion . this media analysis may be customized for or by the user . apparatus for implementing any of the below described arrangements , and for performing any of the below described method steps , may be provided by configuring or adapting any suitable apparatus , for example one or more computers or other processing apparatus or processors or by providing additional modules . the apparatus may comprise a computer , a network of computers , or one or more processors for implementing instructions and using data , including instructions and data in the form of a computer program or a plurality of computer programs stored in or on a machine - readable storage medium such as computer memory , a computer disk , rom , prom , etc ., or any combination of these or other storage media . it should be noted that certain of the process steps depicted in the below described process flowcharts may be omitted or such process steps may be performed in an order differing from that presented below and shown in those process flowcharts . furthermore , although all the process steps have , for convenience and ease of understanding , been depicted as discrete temporally - sequential steps , nevertheless some of the process steps may in fact be performed simultaneously or at least overlapping to some extent temporally . referring now to the figures , fig1 is a schematic illustration ( not to scale ) showing an example system 1 in which embodiments of a method of video - feed enhancement can be implemented . an embodiment of the method of video - feed enhancement is described in more detail below with reference to fig3 . in other embodiments , the method of video - feed enhancement may be implemented in a different way that may , for example , comprise one or more different entities instead of or in addition to those shown in fig1 . the system 1 comprises a service provider 2 , a network 4 , a television ( tv ) 6 , and a user 8 . in other embodiments , a different type of audiovisual - reception client ( e . g ., a tablet computer , a smartphone , etc .) may be used instead of or in addition to the tv 6 . the service provider 2 may be a provider of cable - television or satellite - television services . the service provider 2 is a provider of a plurality of tv feeds . each of the tv feeds may be for a different tv program . for example , each tv feed may be a tv feed for a different sporting event . also , one or more of the tv feeds may relate to the same event ( e . g ., a sporting event , a political rally , etc .) but may be from different camera angles , broadcasters , etc . the service provider 2 is connected ( e . g ., via the network 4 ) to the tv 6 . this connection is such that the tv feeds provided by the service provider 2 may be sent from the service provider 2 to the tv 6 via the network 4 . in other embodiments , the service provider 2 may be an internet site or service that provides multimedia feeds or clips ( e . g ., hulu ™, youtube ™, etc .). in other embodiments , there may be a plurality of service providers 2 each of which may provide multimedia content . the network 4 may be any appropriate network , for example , a cable - television network , a satellite - television network , the internet , or a combination of those networks . in embodiments in which a plurality of service providers 2 ( e . g ., different types of service provider 2 ) provide multimedia content to a client device 6 , the multimedia content may be provided over a plurality of networks 4 ( e . g ., different types of network 4 ). for example , each service provider 2 may provide multimedia content to a client device 6 via a different network 4 . the client device 6 ( e . g ., a tv ) may be capable of receiving multimedia content over each of the networks 4 used . furthermore , the client device 6 may be capable of receiving multimedia content simultaneously over the plurality of networks 4 . the tv 6 is described in more detail below with reference to fig2 . the tv 6 is configured to receive the tv feeds sent to it from the service provider 2 . the tv 6 is configured to process the received tv feeds as described in more detail below with reference to fig3 . the tv 6 is configured to display one or more of the tv feeds to the user 8 as described in more detail below with reference to fig3 . the user 8 is a user of the tv 6 . fig2 is a schematic illustration ( not to scale ) of the tv 6 . the tv 6 may comprise a media - analysis module 10 , a selection module 12 , an enhancement module 14 , a display 16 , and a user input 18 . in other embodiments , one or more of the modules 10 through 18 may be located remotely from the tv 6 . in other words , the functionality of the tv 6 in this embodiment may be provided , in other embodiments , by one or more differently arranged modules . for example , in other embodiments one or more of the modules 10 through 14 may be located remotely from the tv 6 ( which may comprise the display 16 and the user input 18 ) and may be connected to the tv 6 via the network 4 . for example , the modules 10 through 14 may be located in the “ cloud ” rather than in the tv 6 . also for example , in other embodiments one or more of the modules 10 through 14 may be located in one or more separate computing devices ( devices that are different from to the tv 6 ) that may communicate with the tv 6 ( e . g ., via a wired or wireless communications link ) such that information may be transferred among the tv 6 and one or more of the separate computing devices . in this embodiment , the media - analysis module 10 may be connected to the service provider 2 via the network 4 such that the media - analysis module 10 may receive the plurality of tv feeds sent to the tv 6 from the service provider 2 . the media - analysis module 10 may be configured to process the received tv feeds as described in more detail below with reference to fig3 . this processing may be performed to determine , for each of the received tv feeds , values of one or more metrics . the media - analysis module 10 may be connected to the selection module 12 and to the enhancement module 14 such that information ( e . g ., the metric values determined by the media - analysis module 10 ) may be sent from the media - analysis module 10 to each of the selection module 12 and the enhancement module 14 . the media - analysis module 10 may also be connected to the user input 18 such that information input ( e . g ., by the user 8 ) at the user input 18 may be sent from the user input 18 to the media - analysis module 10 . the information input at the user input 18 may be used by the media - analysis module 10 during the processing of the tv feeds . the selection module 12 may be connected to the service provider 2 via the network 4 such that the selection module 12 may receive the plurality of tv feeds sent to the tv 6 from the service provider 2 . the selection module 12 may be configured to process the received tv feeds as described in more detail below with reference to fig3 . this processing may comprise using the information sent to the selection module 12 from the media - analysis module 10 ( e . g ., the determined metric values ). also , this processing may be performed to select one or more of the tv feeds . the selection module 12 may be connected to the enhancement module 14 such that information ( e . g ., information specifying which tv feeds have been selected by the selection module 12 ) may be sent from the selection module 12 to the enhancement module 14 . the selection module 12 may also be connected to the user input 18 such that information input ( e . g ., by the user 8 ) at the user input 18 may be sent from the user input 18 to the selection module 12 . the information input at the user input 18 may be used by the selection module 12 during the processing of the tv feeds . the enhancement module 14 may be connected to the service provider 2 via the network 4 such that the enhancement module 14 may receive the plurality of tv feeds sent to the tv 6 from the service provider 2 . the enhancement module 14 may be configured to process the received tv feeds as described in more detail below with reference to fig3 . this processing may comprise using the information sent to the enhancement module 14 from the media - analysis module 10 ( e . g ., the determined metric values ). also , this processing may comprise using the information sent to the enhancement module 14 from the selection module 12 ( e . g ., information specifying which tv feeds have been selected by the selection module 12 ). also , this processing may be performed to enhance one or more of the tv feeds . the terminology “ enhancing a tv feed ” is used herein to refer to processing performed on a tv feed such that , when displayed , that tv feed is displayed differently from how an unenhanced tv feed would be displayed . for example , an enhanced tv feed may be displayed in a display window on a display screen larger than that in which an unenhanced tv feed would be displayed , an enhanced tv feed may be displayed at a resolution higher than that with which an unenhanced tv feed would be displayed , an enhanced tv feed may be displayed with an aspect ratio different from that with which an unenhanced tv feed would be displayed , an enhanced tv feed may have its audio played , whilst unenhanced tv feeds may not have their audio played , etc . the enhancement module 14 may be connected to the display 16 such that information ( e . g ., enhanced or unenhanced tv feeds ) may be sent from the enhancement module 14 to the display 16 . the enhancement module 14 may also be connected to the user input 18 such that information input ( e . g ., by the user 8 ) at the user input 18 may be sent from the user input 18 to the enhancement module 14 . the information input at the user input 18 may be used by the enhancement module 14 during the processing of the tv feeds . the display 16 may be configured to display the tv feeds sent to it from the enhancement module 14 as described in more detail below with reference to fig3 . the user input 18 may be any appropriate device , means , or interface using which the user 8 may input information into the tv 6 ( e . g ., for use by the media - analysis module 10 , by the selection module 12 , or by the enhancement module 14 ). fig3 is a process flow - chart showing certain steps of an embodiment of the method of video - feed enhancement as may be performed by elements of the system 1 . at step s 2 , the service provider 2 sends , via the network 4 , the plurality of tv feeds to the tv 6 . in particular , the plurality of tv feeds may be sent to the media - analysis module 10 , to the selection module 12 , and to the enhancement module 14 . at step s 4 , the media - analysis module 10 processes the received plurality of tv feeds . the media - analysis module 10 may , for each of the plurality of tv feeds , determine a value of one or more metrics . a metric determined at step s 4 may be any appropriate metric . for example , one or more of the metrics may be measures of how exciting a tv feed is . in other words , a metric value determined for a tv feed may be indicative of how exciting events occurring in that tv feed are deemed to be . such metrics may be thought of as “ excitement metrics .” an example excitement metric is that determined by thuuz ™. a metric determined at step s 4 may be a function or combination of any number of other metric values . for example , a metric value determined at step s 4 may be a weighted combination of a plurality of other metric values . a metric determined at step s 4 may be dependent upon any parameters that are related to the tv feeds . such parameters related to a tv feed may include , but are not limited to : a number of current “ likes ” for that tv feed from members of a social network of the user 8 , a source - generated rating for that tv feed , a detected presence of a specific actor or object ( e . g ., as specified by the user 8 ) in that tv feed , and a detected discussion of or reference to a specific topic ( e . g ., a subject , event , person , or story , as specified by the user 8 ) in that tv feed . the media - analysis module 10 may comprise one or more detectors for determining the metric values . for example , the media - analysis module 10 may comprise an “ excitement detector ” ( for detecting a level of excitement in a tv feed ), a “ social activity detector ” ( for detecting activity in one or more of the user &# 39 ; s social networks related to a tv feed ), an “ object detector ” ( for detecting the presence of a specific object in a tv feed ), etc . one or more of the detectors may monitor or analyze only some of the content of a tv feed , such as the audio track , the video track , individual frames from the video track , or the closed - captioning text associated with the tv feed . for example , an object detector that is monitoring for the presence of a car may analyze frames from the video track for the presence of car - shaped objects , or analyze the audio track for car - engine sounds , or analyze the closed - caption text for words associated with cars or driving . a detector may combine two or more types of analysis . this tends to improve robustness . in this embodiment , the metric values may be determined automatically by one or more processors ( i . e ., by the media - analysis module 10 ). however , in other embodiments , one or more of the metric values may be determined in a different way , e . g ., by a human . the user 8 may select which metrics are determined at step s 4 or how those metrics are determined . the user 8 may specify which parameters or data sources are used to determine the metric values . the user 8 may specify such information , for example , by inputting his preferences in to the media - analysis module 10 using the user input 18 . alternatively , the user 8 may specify a “ user profile ” which may specify such information and may be accessed by the media - analysis module 10 . the user profile could be entered , stored , and accessed in any appropriate way . for example , the user 8 may input profile information into a web - site designed to capture and store such information . also for example , one or more processors may analyze the user behaviour ( e . g ., the user &# 39 ; s viewing habits or social networking behaviour ) to learn the user preferences or to derive profile information . at step s 6 , the one or more metric values that have been determined for each of the tv feeds are sent from the media - analysis module 10 to the selection module 12 and to the enhancement module 14 . at step s 8 , using the received metric values , the selection module 12 may select one or more of the plurality of tv feeds received by the tv 6 . the selection module 12 may select one or more of the plurality of tv feeds for display to the user 8 as described in more detail below at step s 16 . the selection of a tv feed by the selection module 12 may depend on the metric values corresponding to that tv feed relative to the metric values corresponding to other tv feeds . the selection of one or more tv feeds from the plurality of tv feeds may be in accordance with any appropriate criteria . for example , if the metric values determined for each the tv feeds are indicative of the level of excitement of that tv feed , then the selection module 12 may select the subset of the plurality of tv feeds that correspond to the highest metric values ( i . e ., the highest excitement levels ). in other words , the selection module 12 may select the most exciting tv feeds from the plurality of received tv feeds . for example , if twenty tv feeds are sent from the service provider 2 to the tv 6 , then the selection module 12 may select from those twenty tv feeds the six tv feeds that correspond to the highest excitement levels ( i . e ., the tv feeds that correspond to the six highest metric values ). the one or more tv feeds selected by the selection module 12 are hereinafter referred to as the “ selected tv feeds .” the user 8 may specify one or more of the criteria that are used , by the selection module 12 , to select one or more tv feeds from the plurality of tv feeds . the user 8 may specify these criteria , for example , by inputting the criteria in to the selection module 12 using the user input 18 . alternatively , the user 8 may specify a “ user profile ” which may specify such criteria and may be accessed by the selection module 12 . at step s 10 , information specifying the selected tv feeds is sent from the selection module 12 to the enhancement module 14 . at step s 12 , using the information received from the media - analysis module 10 ( i . e ., the metric values determined for each of the tv feeds ) and the information received from the selection module 12 ( i . e ., the information specifying the selected tv feeds ), the enhancement module 14 may identify one or more of the of the selected tv feeds for enhancement . any appropriate criteria may be used to identify which of the selected tv feeds are to be enhanced . for example , the tv feed corresponding to the highest excitement metric value ( i . e ., the most exciting tv feed ) may be identified as the only tv feed to be enhanced . the user 8 may specify one or more of the criteria that are used , by the enhancement module 14 , to identify one or more tv feeds from the selected tv feeds . the user 8 may specify these criteria , for example , by inputting the criteria in to the enhancement module 14 using the user input 18 . alternatively , the user 8 may specify a “ user profile ” which may specify such criteria and may be accessed by the enhancement module 14 . at step s 14 , the one or more tv feeds identified at step s 12 may be processed by the enhancement module 14 so that , when displayed ( at step s 16 ) those tv feeds are enhanced . in other words , the one or more tv feeds identified at step s 12 may be processed by the enhancement module 14 so that , when displayed , they are displayed differently from the other tv feeds ( i . e ., from the unenhanced tv feeds ). for example , the one or more tv feeds identified at step s 12 may be processed by the enhancement module 14 so that , when displayed , they are displayed in a larger display window on the display 16 than are the tv feeds that were not identified at step s 12 . the enhancements applied to one or more of the selected tv feeds may be any appropriate enhancements . for example , enhancements may be such that an enhanced tv feed is displayed in a different size display window , in a different shape display window , at a different resolution , with a different aspect ratio , at a different location on a display , etc ., when compared with an unenhanced tv feed . also , the type or level of enhancement applied to a tv feed may be dependent upon the metric values corresponding to that tv feed . for example , the selected tv feeds may be processed so that , when those tv feeds are displayed , the relative sizes of display windows that those tv feeds are displayed in reflect the relative magnitudes of the metric values corresponding to those tv feeds ( e . g ., a tv feed corresponding to a relatively large metric value would be displayed in a relatively large display window , whilst a tv feed corresponding to a relatively small metric value would be displayed in a relatively small display window ). the user 8 may specify one or more of the enhancements that may be applied to one or more of the selected tv feeds by the enhancement module 14 . the user 8 may specify these enhancements , for example , by inputting enhancement selections in to the enhancement module 14 using the user input 18 . alternatively , the user 8 may specify a “ user profile ” which may specify desired enhancements and may be accessed by the enhancement module 14 . at step s 16 , the enhancement module 14 may display , on the display 16 , the selected tv feeds . one or more of these selected tv feeds may have been enhanced at step s 14 such that those enhanced tv feeds are displayed differently from the unenhanced tv feeds . for example , enhanced tv feeds may be displayed , on the display 16 , in a different size display window , in a different shape display window , at a different resolution , with a different aspect ratio , at a different location on a display , etc ., when compared with unenhanced tv feeds . the selected tv feeds may be displayed in any appropriate way , configuration , or format . for example , the tv feeds may be displayed in a circular configuration . alternatively , the tv feeds may be displayed such that the one or more enhanced tv feeds are displayed in one portion of the display 16 , whilst the other , unenhanced , tv feeds are displayed in a different portion of the display 16 . the user 8 may specify a way , configuration , or format in which the selected tv feeds may be displayed on the display 16 . the user 8 may specify these , for example , by inputting display specifications in to the enhancement module 14 using the user input 18 . alternatively , the user 8 may specify a “ user profile ” which may specify display specifications and may be accessed by the enhancement module 14 . fig4 is a schematic illustration ( not to scale ) showing an example of how the selected tv feeds may be displayed on the display 16 at step s 16 . in this example , a single tv feed has been enhanced so that it is displayed in a larger display window than the ones used for the other unenhanced tv feeds . in fig4 the enhanced tv feed and the display window in which it is displayed are indicated by the reference numeral 20 , whereas unenhanced tv feeds and the display windows in which they are displayed are indicated by the reference numeral 22 . in this example , there are a total of six tv feeds ( i . e ., six tv feeds have been selected at step s 8 for display ). in particular , there is a single enhanced tv feed 20 and five unenhanced tv feeds 22 . also , in this example , the selected tv feeds 20 , 22 are displayed on the display 16 in a circular formation . the audio track of the enhanced tv feed 20 may be played , whilst the audio tracks of the unenhanced tv feeds 22 may be muted . an advantage provided by the above described system and method is that a number of tv feeds may be monitored , and only those that are determined to be the most exciting or interesting , etc ., ( as measured using some metric ) are displayed to the user 8 . if exciting or interesting , etc ., events occur in a tv feed that is not currently being displayed to a user 8 ( such that that hidden tv feed becomes more exciting or interesting than one or more of the tv feeds currently being displayed ), then that hidden feed may replace a less exciting or interesting tv feed that is currently being displayed . this replacement may be based on any appropriate replacement policy . this replacement of one tv feed with another may be performed automatically ( e . g ., without requiring the user &# 39 ; s permission to perform ), or the user 8 may be asked for permission to perform the replacement . a further advantage provided by the above described system and method is that , of the tv feeds that are displayed to the user 8 , one or more of the most exciting or interesting , etc ., ( as measured using some metric ) tv feeds may be highlighted to the user 8 , i . e ., one or more of the most exciting or interesting , etc ., tv feeds may be enhanced . this tends to draw the user &# 39 ; s attention to events that the user 8 may regard as the most exciting or interesting , etc . if exciting or interesting , etc ., events occur in an unenhanced tv feed ( such that the unenhanced tv feed becomes more exciting or interesting than an enhanced tv feed ), then that unenhanced tv feed may be enhanced . also , the currently enhanced tv feed may be unenhanced . this enhancement change may be performed automatically ( e . g ., without requiring the user &# 39 ; s permission to perform ), or the user 8 may be asked for permission to perform the replacement . a display size of a de - emphasized tv feed may , for example , correspond to its relative excitement level with respect to other tv feeds . any interactive prompts that ask for user permission to change which feeds are being displayed to the user 8 or how those feeds are displayed may be disabled , e . g ., by the user 8 . thus , a user 8 can choose to not be disturbed by interactive prompts if he so wishes . for example , if the user 8 wishes to watch a currently enhanced tv feed and has no interest in watching another feed , then the user 8 may disable the updating of the tv feeds or may select that currently enhanced tv feed as the only feed for display . the above described system and method advantageously tend to improve the ability of a user 8 to find content that is of interest to that user 8 . the above described method may be implemented as a web - based service that is capable of enhancing a content search experience of a user 8 . alternatively , the above described method may be implemented as an application ( or suite of applications ) running on a user device 6 . the above described method may be implemented in a “ smart remote ” ( i . e ., in a tv remote control ) that assists the selection of content from a secondary device based on the configured metric for display on a primary device . the above described system and method advantageously tend to help the user 8 in navigating through large amounts of multimedia content . an example of an optional additional feature is a feature that tends to prevent the user 8 from missing an interesting or exciting event . such features may include , for example , a feature that “ rewinds ” ( by an appropriate amount of time ) a tv feed before it is displayed to the user 8 or before it is enhanced . for example , at least a portion of a multimedia feed may be stored . using the metric value corresponding to that multimedia feed , a start time ( within that multimedia feed ) of an exciting or interesting event may be determined . when that feed is displayed to the user 8 , that feed may be replayed from a point in that feed prior to the determined start time of the event ( by replaying some or all of the stored portion of the feed ). in some embodiments , a rewind feature may track the start times of events that the user 8 may regard as the most exciting or interesting and time - shift playback of tv feeds containing those events such that those feeds are displayed to the user 8 from a point prior to the exciting or interesting events occurring . time shifting may involve recording ( e . g ., temporarily ) some or all of a tv feed and then playing back some or all of the stored portion . for example , the tv feeds received by the tv and displayed to the user 8 may be stored beginning at tv - program boundaries . alternatively the tv feeds may be stored beginning at the start of exciting or interesting events . the display 16 showing the user 8 the tv feed may continue showing the time - shifted tv feed until a catch - up event occurs . examples of catch - up events include the end of a tv program , the end of an exciting or interesting event , or a request by the user 8 to begin watching the tv feed live . a further example of an optional additional feature is a feature that enables a user , whilst watching a plurality of tv feeds , to choose a subset of those feeds ( e . g ., a single tv feed ) to view on its own rather than continuing to watch the plurality of tv feeds . upon changing from viewing a plurality of tv feeds to viewing a subset ( e . g ., one ) of those feeds , the above described “ rewind feature ” may be implemented . this would tend to ensure that the user does not miss any important or interesting events that occur in the tv feeds that he has elected to view . in other embodiments , the feeds could be provided with a delay to permit the analysis ( by the media - analysis module 10 ) to be ahead of the presented video . thus , the display or enhancement of a feed may be at a point in the feed prior to the exciting or notable event . alternatively , scene - detection processes may be implemented to allow a tv feed to be displayed or enhanced from the start of a scene . in the above embodiments , metric values ( e . g ., excitement metric values ) for the tv feeds are determined by the tv 6 . however , in other embodiments excitement information for a feed may be determined or received in a different way . for example , metric values may be provided by the content source ( e . g ., the service provider 2 or the provider of the multimedia content ). the metric values for a feed may then be embedded in the transport stream of that feed . also for example , metric values may be provided by a head end , e . g ., as a web service front end to a service analyzing incoming feeds . also for example , metric values may be determined by an application running on the tv 6 . also for example , if a feed is being received from an “ over - the - top source ,” e . g ., the internet , metric values may be provided by the content source and may be embedded in the metadata of the source ( e . g ., in the html header ). also for example , metric values may be provided by a third party ( e . g ., a separate on - line provider of metric values ), for example as a web service front end to the service analyzing web feeds . in the above embodiments , the process of fig3 may be performed by the apparatus described above with reference to fig1 and 2 . however , in other embodiments the method of fig3 may be implemented by a different appropriate apparatus configured or arranged in a different way . for example , in other embodiments , some or all of the modules that perform some or all of the process steps of fig3 may be in a network - centric arrangement . also , in other embodiments , some or all of the modules that perform some or all of the process steps of fig3 may be located “ in the cloud .” in the above embodiment , the invention is implemented using tv feeds . however , in other embodiments , one or more of these feeds may be a different type of multimedia feed , e . g ., movies , youtube ™ videos , videos from web sites , “ apps ,” etc . in view of the many possible embodiments to which the principles of the present invention may be applied , it should be recognized that the embodiments described herein with respect to the drawing figures are meant to be illustrative only and should not be taken as limiting the scope of the invention . therefore , the invention as described herein contemplates all such embodiments as may come within the scope of the following claims and equivalents thereof .	7
any of the embodiments may be driven by a high inertia fluid stream . the fluid stream may be a liquid stream moving at a moderate velocity or a gas or vapor stream moving at higher velocity . in one application , the gas stream may be the exhaust of a gas turbine , such as of the type used to drive large electrical generators . one of the advantages of this invention is that energy is taken from the inertia of the fluid stream , such as by reducing the velocity of a gas stream , without substantially changing the temperature of the gas stream significantly . in this manner , this invention may be used in conjunction with a thermal energy recovery system , as by using the hot exhaust gases exiting from this device in a steam cycle . referring to fig1 - 3 , there is illustrated a simplified wobble plate motor 10 illustrating its principles of operation . the motor 10 comprises a plate or disc 12 journalled or rotatably mounted by a bearing assembly 14 on a bent end 16 of a shaft 18 rotatably mounted by a bearing assembly 20 in a planar base 22 perpendicular to the shaft 18 . if necessary or desirable , the bearing assemblies 14 , 20 may include thrust elements to counteract any tendency of the shaft 18 to move axially . the concept is that a force applied to only one segment of the disc 12 , as in the direction of the arrow 24 , causes the disc 12 to roll on the planar base 22 and thereby rotate the shaft 18 in the direction shown by the arrow 26 thereby driving an input to a work consumer such as an electrical generator , pump , compressor or the like . thus , the plate 12 rotates about an axis 28 of the shaft 18 in a manner analogous to a spinning coin as it begins to decay , i . e . as the spin rate slows to a value where the coin is inclined to its axis of rotation . in other words , the plate 12 nutates as it rolls on a track provided by the base 22 . the force applied to the plate 12 is generated by a differential pressure applied directly to the plate 12 as contrasted to a pressure generated force applied through a cylinder , piston or other mechanical device . although the differential pressure may be the difference between atmospheric pressure and a partial vacuum , it may be preferred to provide a positive pressure to only one segment of the disc 12 because much greater positive pressures are more readily available and produce much greater torque on the output shaft 18 . although the power fluid may be a liquid , it may be preferred to use a gas , such as steam which is readily available in some industrial environments of which one example is the exhaust from steam turbines . as shown in fig1 , an imaginary plane 30 is defined by the shaft 18 and its bent end 16 to divide a front 32 of the disc 12 into two segments 34 , 36 to divide the back of the disc 12 into two segments 38 , 40 . it will be seen that a force applied in the direction of the arrow 24 to the segment 34 causes the disc 12 to rotate in the direction shown by the arrow 26 , as does a force applied to segment 40 in the direction shown by the arrow 42 . in other words , forces represented by the arrows 24 , 42 cause rotation of the disc 12 in the same direction , i . e . as shown by the arrow 26 . similarly , forces applied to the segments 36 , 38 cause rotation of the disc 12 in the direction opposite to the arrow 26 . thus , the segments 34 , 40 may be considered complementary or additive and the segments 36 , 38 may be considered opposite or subtractive relative to the segments 34 , 40 . the various segments 34 , 36 , 38 , 40 suggest a myriad of ways in which pressures , or partial vacuums , may be applied to the disc 12 to induce rotation of the shaft 18 in a desired direction . as used herein , saying that pressure is applied to only one segment of the disc 12 may mean that the disc is subject to greater pressures inducing rotation in one direction rather than in the other direction , such as will occur when high pressure is applied to one segment of the disc 12 and atmospheric pressure is applied to an opposite or subtractive segment . there are a variety of ways to apply pressure to only one segment of the plate 12 and not to its opposite . as shown in fig1 - 3 , one or more horizontal arrays of nozzles 44 may be supported in any suitable manner , such as on a ring header 46 , about the disc 12 so that one or more nozzles 44 is always aimed at or near a given point on the disc 12 such as the imaginary marking 270 °. the nozzles 44 are actuated sequentially so that one or more of them discharge power fluid onto the plate 12 toward one or more of the selected plate segments inducing rotation in the desired direction . this may be accomplished in any suitable manner , a simple version of which may be that each nozzle includes a valve 46 having a sensor , such as a feeler , positioned to be tripped by an edge or a detectable marker on the plate 12 as it approaches the nozzle 44 to deliver high pressure fluid from a source 49 . each of the nozzles 44 is connected by a valve 48 to a pressure source 49 so by judiciously operating selected ones of the valves 48 , a high pressure fluid is delivered through the nozzle 44 aimed at the 270 ° mark , the disc 12 will rotate or nutate about the axis 18 in the direction of the arrow 26 . the nozzles 44 may extend completely around the disc 12 as shown in fig3 so one or more of the nozzles 44 aimed at the back 38 of the disc 12 may simultaneously be actuated to deliver power fluid to the back of the imaginary marking 90 °, i . e . at the complementary segment 40 . this effectively doubles the force applied to the disc 12 and thus doubles the usable output of the shaft 18 . operation of the motor 10 will now be described . when motive fluid is delivered by the nozzles 44 to the segment 34 and / or to the segment 40 , the disc 12 rolls on the base 22 because the pressure and thus the force applied to the complementary disc segments 34 , 40 is greater than atmospheric pressure acting on the subtractive segments 36 , 38 . this rotates the shaft 18 and provides torque and horsepower to operate a work consuming device . referring to fig4 - 5 , there is illustrated another embodiment comprising a motor 50 having a member 52 such as a plate , disc , tube or the like journalled or rotatably mounted by a bearing assembly 54 on a bent end 56 of a shaft 58 rotatably mounted about an axis 60 by a bearing assembly 62 in a planar base 64 . if necessary or desirable , the bearing assemblies 54 , 62 may include thrust elements to counteract any tendency of the shaft 58 to move axially . from one point of view , the concept is that a force applied to the disc 52 , as in the direction of the arrow 66 , causes the plate 52 to roll on the planar base 64 and thereby rotate the shaft 58 in the direction shown by the arrow 68 thereby driving an input to a work consumer such as an electrical generator , pump , compressor or the like drivably connected to the shaft end 70 . from another point of view , the concept is that a force applied to the disc 52 , as in the direction of the arrow 66 , causes the shaft 58 to rotate in the direction of the arrow 68 while the plate 52 cooperates with the base 64 to constrain movement of the shaft end 70 into simple rotary movement about the axis 60 . the member 52 may preferably include a ring or rim 72 and a plurality of radiating struts 74 providing a receptacle for the bearing 54 . this allows the motive fluid to flow through the member 52 for purposes more fully apparent hereinafter . the base 64 may be of similar construction providing a ring 76 and a series of radiating struts 78 . to make the plate 52 roll on the base 64 without slipping , a gear or gear teeth 80 on the plate 52 may mesh with a gear or gear teeth 82 on the base 64 . it will be seen that the gear teeth 80 , 82 provide complementary bevel gears . it will also be seen that the rings 72 , 76 may be of equal diameter or may be of different diameter , meaning that the gears 80 , 82 may be of different or the same diameter . the motor 50 may be positioned in a housing 84 of any suitable type and is illustrated as a simple tubular housing having a passage 86 , an inlet end 88 and an outlet end 90 . the struts 78 may extend to connect to the housing 84 thereby positioning the motor 50 at a desired location . the plate 52 and base 64 may accordingly comprise latticework arrangements in the sense that a fluid flowing through the housing passage 86 is only minimally obstructed . driving the shaft 58 or the plate 52 , depending on ones view , is a blade assembly 92 mounted on the bent end 56 of the shaft 58 . the blade assembly 92 may include the bevel gear provided by the teeth 80 . the blade assembly 92 may include a hub 94 and a series of blades 96 radiating away from the hub 94 . the blade assembly 92 is fixed to the gear 80 and the blades 96 are inclined so that , on one side of the blade assembly 92 , the blades 96 present a more - or - less solid appearance ( such as on the left in fig4 ) and a more - or - less open appearance ( such as on the right of fig4 ). as the plate 52 nutates on its circular edge around and in cooperation with the ring 76 , the plate 52 and shaft rotates relative to each other as allowed by the bearing 54 . manifestly , the inclination of the blades 96 can be reversed to cause rotation of the blade assembly 92 in the opposite direction . as an alternative , the blades 96 may be of airfoil shape and suitably positioned to produce torque to drive the plate 52 and the shaft 58 . high inertia fluid flowing through the passage 86 in the direction shown by the arrow 100 impacts the blades 96 on the left in fig4 and tends to flow freely through the blades 96 on the right in fig4 . this pushes the blade assembly 92 to the left in fig4 causing nutation of the blade assembly 92 as it tracks along the stationary bevel gear 82 . the axial shaft 70 is accordingly rotated and may be connected to a work producing device such as an electrical generator , pump or the like thereby producing work . it will accordingly be seen that the blade assembly 92 nutates during operation of the motor 50 thereby rotating the output shaft 70 . there is a tendency of air flowing through the passage 86 to bypass the blade assembly 92 reducing the efficiency of the motor 50 . it may be preferred to provide a shroud 110 to divert air through the blade assembly 92 as shown in the embodiments of fig6 and 7 . the shroud 110 may act as a flow director , directing flow only toward the blades 96 which are transverse to , or side - on to , the direction of flow through the housing 84 . the shroud 110 may also act as a flow accelerator as will be more fully apparent hereinafter . the shroud 110 may take a number of suitable forms and may include a plate 112 having an opening 114 aligned with those fan blades 96 that are side - on to the direction of flow as suggested in fig6 . an important advantage of the embodiment of fig6 - 7 is that rotation of the plate 112 and the opening 114 remains synchronized with nutation of the fan assembly 92 so the opening 114 always aligns with the side - on blades . to this end , the plate 112 may rotate at the same rate , or synchronously , with nutation of the fan assembly 92 . this is much easier to accomplish when the gears provided by the teeth 80 , 82 are the same size because this means that the member 52 nutates and the plate 112 rotates at the same rate . the plate 112 may be fixed on a shaft end 115 by a coupling 117 coaxial with the axis 60 . the shaft end 115 is part of a bent shaft 116 having an inclined end 118 rotatably mounted on the inclined shaft end 56 by a coupling 120 . it will be seen that rotation of the fan assembly 92 causes the inclined shaft end 56 to rotate in a circle 122 . this causes the inclined end 118 of the shaft 116 to rotate thereby rotating the plate 112 and maintaining the opening 114 aligned with that segment of the blades 96 that act to rotate the fan assembly . the shroud 110 accordingly increases the efficiency of the motor 50 by reducing fluid bypass around the blade assembly 92 . it will also be apparent that the opening 114 restricts the area of flow immediately upstream of the blade assembly 92 thereby increasing the velocity of the fluid stream impacting the side - on blades . the motors 10 , 50 are effective in producing work from moving fluid streams of different density , such as air and water , and from fluid streams moving at much different velocities . the exhaust stream from gas turbine engines is quite high , perhaps too high for efficient use in some of the embodiments disclosed herein . in this event , the exhaust stream may be split and run through motors which are essentially parallel , the size of the passage through which it flows may be increased to decrease the velocity or in some other arrangement . in addition , the exhaust stream may be of sufficient velocity that substantial energy remains after passing through one of the motors disclosed herein . in this event , motors may be placed in series , depending on the tradeoff between efficient use of available energy , capital costs , operating costs and the like . it will be apparent that suitable seals may be provided at desired locations to minimize leaking of the driving fluid , suitable bearings may be provided to increase reliability and performance and other engineering solutions may be provided to overcome problems which may become apparent . it will be seen that the discs 12 , 52 may be circular or of other smooth arcuate periphery so long as the base 22 , 64 is either planar in the case of a circular disc or of complementary shape in the case of a smoothly arcuate periphery , such as an ellipse . it will also be seen that the discs 12 , 52 are at an acute angle relative to the bases 22 , 64 . although this invention has been disclosed and described in its preferred forms with a certain degree of particularity , it is understood that the present disclosure of the preferred forms is only by way of example and that numerous changes in the details of operation and in the combination and arrangement of parts may be resorted to without departing from the spirit and scope of the invention as hereinafter claimed .	5
as shown in fig1 , the fuel - saving accelerator 1 for internal combustion engine of the present invention comprises a water tank 2 , a water processing unit 4 and a water amount control unit 6 . the water tank 2 stores water which is used as auxiliary fuel for the internal combustion engine . when the amount of the water stored the water tank reduces to a preset lower threshold , fresh water will be supplied to the water tank , to maintain the amount of water to a level sufficient for the normal operation of the internal combustion engine . the water tank 2 supplies water to the water processing unit 4 through the inlet 3 of the latter , and then the water will be processed by the water processing unit . the processed water is output from the outlet 3 ′ of the water processing unit 4 , and then is supplied to the water amount control unit 6 through the inlet 7 of the water amount control unit via a tube 5 . the water amount control unit 6 will control the amount of water output therefrom , and supplies a controlled amount of water to the combustion chamber 10 of the internal combustion engine 11 via the outlet 7 ′ thereof , a connection tube 8 and an intake port 9 of the internal combustion engine . in the combustion chamber , the water will be mixed with the fuel oil , and then the mixture of water and fuel oil will be burnt together , thus , the combustion rate of the fuel oil could be improved . in an example shown in fig2 , the water processing unit 4 includes an inner cavity to contain the materials for processing the water , an inlet 3 and an outlet 3 ′ provided at opposite ends of the water processing unit 4 , in which the water to be processed is supplied to the inner cavity through the inlet 3 and then the processed water is output through the outlet 3 ′. the inner cavity of the water processing unit 4 may be divided into three sections which are provided with organic absorption cotton 12 , absorbent charcoal 13 , and ion - exchange resin 14 respectively , in which the organic absorption cotton 12 is used to absorb particles and impurities in the water , the absorbent charcoal 13 is used to absorb the harmful metals and other heavy metals in the water , and the ion - exchange resin 14 is used to lower the concentration of calcium and magnesium ion in the water . the water processing unit 4 could remove the impurities in the water and adjust the ph value of the water . preferably , the water processing unit 4 may adjust the ph value of the water to ph 6 ˜ 8 . the water processing unit 4 may be of column shape , as shown in fig2 , or be in any other suitable forms . alternatively , the inner cavity of the water processing unit 4 could be filled with other suitable materials for processing the water . fig3 shows an example of the water amount control unit 6 of the fuel - saving accelerator 1 according to the present invention . the water amount control unit 6 is provided with a through hole 15 , and an inlet 7 and an outlet 7 ′ of the water amount control unit 6 are formed on the opposite ends of the through hole 15 . the water amount control unit 6 may be made of stainless steel , copper or other suitable materials . the diameter d of the through hole 15 is determined according to the following equation . where apui is a constant value of 8000 whose unit of ( cc * km / l )* mm , fc is the fuel consumption of the internal combustion engine whose unit is l / km , while cc is the cylinder capacity of the internal combustion engine whose unit is cc ( cubic centimeter ). the water processed by the water processing unit 4 is supplied to the water amount control unit 6 through the transmission tube 5 and the inlet 7 , and the water amount control unit 6 controls the amount of water output therefrom by virtue of the through hole 15 , and then the controlled amount of water is supplied to the combustion chamber of the internal combustion engine through the outlet 7 ′ and the connection tube 8 . through determining the diameter of the through hole 15 within the water amount control unit 6 according to the above - mentioned equation , the amount of water suctioned into the combustion chamber via intake port 9 during the induction stroke of the internal combustion engine could be controlled . thus , the water and the fuel oil could be mixed in an appropriate rate with the combustion chamber , therefore , the combustion efficiency of the fuel oil could be improved , and the fuel consumption and environmental pollution could be reduced . as shown in fig1 , the water processing unit 4 and the water amount control unit 6 may be mounted within the water tank 2 , to minimize the size of the fuel - saving accelerator 1 and integrate the components thereof . alternatively , the water processing unit 4 and the water amount control unit 6 may also be mounted outside of the water tank 2 , to increase the capacity of the water tank 2 . the operation of the fuel - saving accelerator of the present invention is as follows . firstly , the water tank 2 supplies water to the water processing unit 4 , and then the water processing unit 4 supplies the water processed therein to the water amount control unit 6 . next , during the induction stroke of the internal combustion engine 11 , the controlled amount of water is suctioned into the combustion chamber 10 through the intake port 9 from the water amount control unit 6 . the suctioned water will mix with the fuel oil in the combustion chamber . during the compression stroke of the internal combustion engine , the suctioned water would release hydrogen under the condition of high temperature and high pressure within the combustion chamber . the hydrogen may assist in improving the combustion efficiency of the fuel oil , thus , the dynamic performance of the internal combustion engine could be enhanced , and the fuel consumption and environmental pollution could be reduced . to verify the fuel - saving performance of the fuel - saving accelerator of the present invention , the present applicant entrusted the china national quality control & amp ; inspection center for automobiles ( xiang fan ) to have comparison tests on the performance of the samples with or without the fuel - saving accelerator of the present invention . the samples are based on the vehicles honda odyssey ( manufactured by guangzhou honda automobile co ., ltd . in china ) and landwind ( manufactured by jiangling motors corporation , ltd . in china ). the standards adopted in the comparison tests are “ passenger car — fuel consumption test method ” ( gb / t 12545 . 1 - 2001 ), “ motor vehicles — acceleration performance — test method ” ( gb / t 12543 - 1990 ), “ motor vehicles — maximum speed — test method ” ( gb / t 12544 - 1990 ), “ motor vehicles — minimum stable speed — test method ” ( gb / t 12547 - 1990 ), and “ motor vehicles — steep hill climbing — test method ” ( gb / t 12539 - 1990 ). honda odyssey is used as the basis of the samples 1 and 2 of the test 1 , in which the sample 1 is a sample without a fuel - saving accelerator of the present invention , while the sample 2 is a sample provided with the present fuel - saving accelerator . the cylinder capacity of honda odyssey is 2400 cc and the fuel consumption is 7 . 46 l / 100 km = 0 . 0746 l / km , thus , the diameter d of the through hole 15 of the water amount control unit 6 is d =( 0 . 0746 / 2400 )* 8000 = 0 . 24867 mm . the test results of the test 1 are listed in the following table 1 . as shown in table 1 , after provided with the present fuel - saving accelerator , the dynamic performance of the prototype honda odyssey is improved obviously , and the fuel consumption of its internal combustion engine is decreased at the same time . fig4 shows the v - t curve graph of the samples 1 and 2 during the acceleration from standing start , and fig5 shows the v - s curve graph of the samples 1 and 2 during the acceleration from standing start . also shown in the fig4 and 5 , after provided with the present fuel - saving accelerator , the dynamic performance , especially the acceleration capability of the prototype is enhanced significantly . landwind is used as basis of the sample 3 and 4 of the test 2 , in which the sample 3 is a sample without a fuel - saving accelerator of the present invention , while the sample 4 is a sample provided with the present fuel - saving accelerator . the cylinder capacity of landwind is 2000 cc and the fuel consumption is 12 . 17 l / 100 km = 0 . 01217l / km , thus , the diameter d of the through hole 15 of the water amount control unit 6 is d =( 0 . 01217 / 2000 )* 8000 = 0 . 4868 mm . the test results of the test 2 are listed in the following table 2 . as shown in table 2 , after provided with the present fuel - saving accelerator , the dynamic performance of the prototype landwind is improved obviously , and the fuel consumption of its internal combustion engine is decreased at the same time . fig6 shows the v - s curve graph of the samples 3 and 4 during the acceleration from standing start , fig7 shows the v - t curve graph of the samples 3 and 4 during the acceleration from standing start , fig8 shows the v - s curve graph of the samples 3 and 4 during the acceleration from 30 km / h to 110 km / h with direct drive transmission , fig9 shows the v - t curve graph of the samples 3 and 4 during the acceleration from 30 km / h to 110 km / h with direct drive transmission , fig1 shows the v - s curve graph of the samples 3 and 4 during the acceleration from 30 km / h to 110 km / h with maximum drive transmission , and fig1 shows the v - t curve graph of the samples 3 and 4 during the acceleration from 30 km / h to 110 km / h with maximum drive transmission . also shown in the fig6 - 11 , after provided with the present fuel - saving accelerator , the dynamic performance , especially the acceleration capability of the prototype is enhanced significantly . although the description of the present invention is made with reference to the preferred embodiments , the present invention is not limited to these embodiments . various modifications and changes can be made to the invention by those skilled in the art without departing from the spirit and scopes of the present invention .	8
[ 0027 ] fig1 is an exemplary block diagram of an audio transmission system 100 of the invention . an encoding terminal 110 that downsamples and encodes audio signals is connected to a multimedia communications network 140 through modem 120 and local exchange carrier 130 . a decoding terminal 170 that receives , decodes and upsamples the audio signals is also connected to the multimedia communications network 140 through modem 160 and local exchange carrier 150 . the encoding terminal 110 and decoding terminal 170 include memory units 180 and 190 , respectively , for intermediate storage of the compressed audio signal either prior to transmission or after reception of the audio signals , for example . the multimedia communications network 140 represents any combination of existing communications networks , such as a telephone network , internet , intranet , etc . the modem devices 120 , 160 may be ethernet interfaces , cable modems , isdn modems , adsl modems , or any other interface circuit intended to connect two networks or a network and a digital computing apparatus . the modem devices 120 , 160 may contain a conventional rj - 11 outlet for connection to computer modem , facsimiles , printers or other equipment . the modem devices 120 and 160 may also be equipped with universal serial bus ( usb ), integrated system digital network ( isdn ) or other standard data interfaces , as will be appreciated by the person skilled in the art . however , other similar devices may be used to permit sharing of large bandwidths over media already installed . encoding terminal 110 and decoding terminal 170 may be any pair of devices that receive and send audio signals according to the invention through the multimedia communications network 140 via modems 120 and 160 . the encoding terminal 110 and decoding terminal 170 may represent such devices as a personal computer ( pc ), telephone , television , facsimile , or any other device capable of sending and receiving audio signals . it may be appreciated that the encoding terminal 110 and decoding terminal 170 may include software and / or hardware for performing the encoding and decoding functions , and further that the encoding and decoding terminals may be different types of devices . it may further be appreciated that while the encoding terminal 110 and the decoding terminal 170 include memory units 180 and 190 , respectively , for intermediate storage of the compressed audio signal , the compressed audio signal may be intermediately stored in one or more other intermediate storage devices located throughout the audio transmission system 100 , such as between the modem 120 , 160 and the local exchange carrier 130 , 150 , or in the multi - media communications network 140 . in providing a more detailed discussion of the encoding and decoding of audio signals , a discussion of conventional systems is set forth in fig2 - 6 to better to explain the features and advantages of the present invention . [ 0033 ] fig2 shows a generic audio encoding / decoding system 200 operating at a bit rate which is sufficient to encode all of the frequencies in the input signal . an encoder 210 located within a computing unit , for example a pc , receives an audio input signal with frequency range fin ( typically spanning the range of 20 hz - 20 khz ) and encodes the signal for transmission across a communications channel . the input signal may either be analog or digital . if the input signal is analog , the encoder 210 will include an analog - to - digital conversion apparatus . however , the input signal may already be digitized , such as stored signals retrieved from an audio compact disc , for example . a decoder 220 , located within another pc for example , receives and decodes the transmitted audio signal to produce an audio output f out which is less than fin and less than f s / 2 . the encoder / decoder system 200 in this example has no other specified bandwidth limit and the distortion level is unspecified . if the bit rate b ch and the sample rate f s are high enough ( for the encoding algorithm ) then the reproduced audio will be indistinguishable from the original . if either is too low , then the audio will be perceived as degraded . [ 0036 ] fig3 shows a generic frame - based audio encoding / decoding system 300 operating at a high sampling rate , such as 44100 sps . the audio encoder / decoder system of fig3 is similar to that of fig2 but the sampling rate of 44100 sps used for encoding is too high to permit transparent audio reproduction of the full human - audible frequency range ( 20 hz - 20 khz ) at the specified bit rate of 96 kbps , so a degradation in audio signal quality is perceived . in this example , as well as in the examples in fig4 - 6 , the encoder is operating at 96 kbps and 44100 sps , although the same principles apply at other sampling rates and other bit rates . one way to improve reproduced audio signal quality when the bit rate is too low to support the full frequency range of the input is to encode less than the full frequency range . by way of reference , for a production quality aac codec , best reproduced signal quality at 96 kbps and 44100 sps occurs for a signal bandwidth of about 13 khz . fig4 - 6 show various ways to decrease the audio frequency range . [ 0038 ] fig4 shows a generic frame - based audio encoding / decoding system 400 operating at a high sampling rate that uses a low pass filter 410 to limit the frequency range that is encoded . in many cases , a lower sampling rate would allow a wider frequency range or alternatively a higher quality audio signal ( because of frame overhead and music statistics ). consequently , the system in fig4 is sub - optimal . [ 0039 ] fig5 shows a generic frame - based audio encoding / decoding system 500 that operates at a high sampling rate ( 44100 sps ) that discards spectral coefficients in the input signal to limit the frequency range that is encoded and transmitted . this operation is similar but not identical to that of the low pass filter 410 discussed above . the audio input signal is input to the modified discrete cosine transform ( mdct ) 510 ( or other time - to - frequency domain transform ) and the spectral coefficients are discarded by the spectral coefficient discard unit 520 . the signal is then input to a noise allocation unit 530 ( which computes the masking thresholds for the audio frame and quantizes the spectral coefficients according to the thresholds ) which emits the compressed signal . the compressed signal is then transmitted to the decoder 220 of another computing unit ( for example , another pc , or a portable audio device similar to the diamond rio mp3 player ) for decoding and output . [ 0041 ] fig6 shows a generic frame - based audio encoding / decoding system 600 that downsamples the audio input signal to limit the frequency range that is encoded and transmitted . ( resamplers typically incorporate frequency - limiting filters .) the audio input signal is downsampled by the downsampler 610 at a 2 : 1 ratio and is then input into encoder 210 for encoding . the signal is then transmitted across a communication channel to the decoder 220 at the receiving pc that plays out the audio signal at the downsampled rate . this will generally be suboptimal because the decoder 220 must operate at a submultiple of 44100 sps . in this example , the suboptimal would be 2 : 1 to 22050 , which is not the rate that provides optimal frequency response . [ 0042 ] fig7 shows the encoding / decoding system 700 of the invention . the audio encoding / decoding system 700 includes an optimal triplet of sample rate f s0 ( in this case 32 ksps ), bit rate 96 kbps , and the maximum supportable frequency range f 0 which at 96 kbps / 32 ksps is about 13 khz . the optimal triplet could be determined in a number of ways , e . g . algorithmically or by searching a table . the analog signal ( or a digitized version of the analog signal ) is input to the encoding unit 710 of a pc , for example , where the signal is downsampled by downsampler 730 from 44100 to 32000 and encoded by the audio encoder 740 . the encoded audio signal is then transmitted across a communications channel , through a modem , for example , at a given bit rate of 96 kbps to another pc for output . at the receiving pc , the received signal is input to a decoding unit 720 , where a bit stream decoder 750 decodes the downsampled signal . the decoded signal is then input to the upsampler 760 which upsamples the signal to the original or other suitable sample rate . an audio output is then produced with a frequency range f out of about 13 khz . note that in the example of fig7 sps and 32000 sps are standard aac rates . as discussed above in reference to fig1 the encoding unit 710 and the decoding unit 720 may include memory units for intermediate storage of the compressed audio signal either prior to transmission or after reception of the audio signals , for example . it may be the case that the codec ( for example , aac ) is specified at a set of standard rates ; and that f s0 does not match one of these standard rates . however many codecs ( such as aac ) can be modified to run at an arbitrary sample rate , and although the resulting encoding unit 710 will generate aac bit streams that will not reproduce audio accurately unless the decoding unit 720 incorporates this invention , the perceived quality of the reproduced audio signal will be better for the bit stream that uses the non - standard rate than for a bit stream that uses any standard rate . for example , as shown in fig8 the downsampling process used in fig7 may be more computationally efficient when the downsampling factor is the ratio of two small numbers . consider the case where it is desired to downsample from the standard rate of 44100 sps to the standard rate of 32000 sps . neither 441 nor 320 ( the smallest integers which preserve the 44100 : 32000 ratio ) qualify as a small integer in this context . if a ratio of 11 : 8 is used , which is equivalent to the ratio of 44000 : 32000 , we can downsample to a comparable intermediate sample rate ( 32073 sps ) in a computationally efficient way , without degrading significantly either frequency response or distortion levels from the optimal sample rate of 32000 sps . accordingly , as shown in fig8 the process is the same as that in fig7 but 32073 sps is used as the intermediate sampling frequency . 32073 sps is sufficiently close to an aac standard rate that audio signals can be encoded using the parameters for a standard aac rate . when the intermediate sampling rate is close to a codec standard rate , the bit stream header , which generally carries information about the sampling rate at which the audio was encoded , can indicate the nearby standard rate . this is generally advantageous because it allows a conventional decoder ( i . e . one which does not incorporate the current invention ) to decode the bit stream and reproduce the audio , even though the audio reproduction strictly speaking is not accurate . in this case ( 32073 sps sampling rate rather than the 32000 sps indicated in the bit stream header ), there will be a pitch shift in the audio reproduced by the conventional decoder . this may be acceptable for some applications but not for others . however , the invention is still useful when the resulting sampling rate is not close to a standard rate , as long as it is possible to modify the audio encoding unit 710 so that it supports the non - standard rate . for example , with a downsample ratio of 9 : 8 one obtains a sampling rate of 39200 sps , which with a production aac codec would support a frequency range as high as 15 - 17 khz at a bit rate of 112 kbps at an acceptable level of distortion . since the downsample factor is again the ratio of two small numbers , the resampling process would again be computationally efficient . it may be advantageous to indicate to the decoding unit 720 what resampling ratio has been used to encode the audio , since otherwise the codec system ( fig7 & amp ; 8 ) must operate at a fixed resampling ratio . as a particular embodiment of the method and apparatus of this invention , the resampling ratio is incorporated into the bit stream within a reserved bit field of the standard header . as an alternative embodiment , the resampling ratio can be incorporated as side channel information . in a specific example , aac permits “ data packets ” to be incorporated in the bit stream . these data packets are ignored by a standard aac codec . the resampling ratio can be specified in a data packet , possibly along with other information . while the invention above has been discussed from the point of view of supporting the maximum frequency range for a given bit rate and level of distortion , there are two alternative ways of looking at this problem . rather than support maximum frequency at a given bit rate , a frequency range and a given distortion level at a minimum bit rate may be supported . alternatively , a given frequency range at a given bit rate may be supported to achieve the lowest distortion levels . that is , there are three interrelated variables : bit rate , distortion level , and frequency support . one can fix any two variables and use the above embodiment to achieve the best possible results for the remaining variable . [ 0052 ] fig9 is a flowchart of the encoding process according to the invention . process begins at step 1000 and proceeds to step 1010 where the sample rate f s0 and maximum frequency range f 0 are determined as an optimal pair either algorithmically or by searching a table , for example . in step 1020 , an input signal is received by the encoding unit 710 and is downsampled by downsampler 730 to f s0 . the process proceeds to step 1030 where the signal is encoded by the audio encoder 740 . the process then proceeds to step 1040 where the signal ( along with a header , data packet , etc . that includes the downsampling information ), is transmitted at a given bit rate from a modem across a communication channel . the encoding process then goes to step 1050 and ends . [ 0053 ] fig1 is a flowchart of the decoding process . process begins at step 1100 and proceeds to step 1110 where the downsampled signal ( along with a header , data packet , etc . that includes the downsampling information ) is received by another pc &# 39 ; s ( for example ) decoding unit 720 . the process proceeds to step 1120 where the downsampled signal is decoded by the bit stream decoder 750 and then upsampled at step 1130 by the upsampler 760 at a ratio corresponding to the downsampling ratio included with the received downsampled signal , for example . the upsampled signal is then output in step 1140 . the process then goes to step 1150 and ends . while this invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art . accordingly , preferred embodiments of the invention is set forth herein are intended to be illustrative , not limiting . various changes may be made without departing from the spirit and scope of the invention .	6
in a cdma - system mobile terminals receive and combine branches from many base stations at the same time . this is possible since different base stations use the same frequency for their branches to one and the same mobile terminal . in the following description each base station corresponds to one cell . [ 0032 ] fig1 shows schematically a mobile terminal 1 , which has established radio links to a first , a second and a third base station 3 , 5 and 7 , respectively . there is also shown a fourth , a fifth and a sixth base station 9 , 11 and 13 , respectively . they have not established radio links to the mobile terminal 1 . the mobile terminal 1 has an active set 15 of base stations 3 , 5 , 7 from which the mobile terminal 1 receives radio signals and a monitored set 17 of base stations 9 , 11 , 13 from which the mobile terminal 1 should be ready to receive radio signals . the mobile terminal 1 receives a pilot signal from all base stations in a region around the mobile terminal , this region comprising both the active set 15 and the monitored set 17 . pilot signals are used in the cdma system to estimate the quality of the downlinks from the base stations . a pilot signal is a data - unmodulated spreading - coded signal , which is continuously transmitted by each base station to its coverage area . a rake receiver ( not shown ) in a mobile terminal indicates when it has received power on a specific code corresponding to a pilot signal from a specific base station . the mobile terminal receives these pilot signals from the base stations and reports measurement values to a node , rnc , in the network connected to the base stations . the node uses the pilot signal measurements to instruct the mobile terminal to receive or not receive downlinks from the different base stations . the pilot signals giving the strongest measurement values form the active set 15 of the base stations 3 , 5 , 7 in the mobile terminal . from the base stations 9 , 11 , 13 comprised in the monitored set 17 the mobile terminal 1 receives nothing but these pilot signals . the rake receiver in each mobile terminal continuously measures pilot signals . each rake receiver maintains a measurement list of the base stations and the corresponding spreading codes of the pilot signals that are situated near the mobile terminal and that are possible candidates for handover or connection establishment . the base stations on the measurement list form a group of candidates , which may become members of the active set . when a mobile terminal moves , the measurement list is updated . the rake receiver receives radio signals from a new base station when the rnc instructs the mobile terminal to do so . the instructions from the rnc are based on the strengths of the , in the mobile terminal , received pilot signals . the mobile terminal repeatedly sends information to the base stations about for example , how strong the different received pilot signals are . this information could be sent periodically or only when a change in the signal has been recorded . the information is forwarded from the base stations to the rnc ( radio network controller ). the rnc knows also the sending effect of the pilot signals and thus it knows the attenuation between the base station and the mobile terminal for each downlink ( radio links from the base stations to the mobile terminals ). it can thus from this information derive which downlinks that are most important in the different connections . accordingly , in fig1 the base stations 3 , 5 , 7 in the active set 15 are located “ close ” to the mobile terminal 1 and the base stations 9 , 11 , 13 in the monitored set 17 are located “ next ” to the active set base stations . this “ close ” and “ next ” corresponds rather to the needed power for a good connection than to a geographical distance . when the mobile terminal moves some of the monitored set base stations 9 , 11 , 13 are moved from the monitored set 17 to the active set 15 and vice versa . both sets 15 , 17 are thus currently updated as the mobile 1 moves between the cells of the base stations . [ 0039 ] fig2 shows schematically the mobile terminal 1 in fig1 . the mobile terminal 1 comprises a rake receiver 20 . a similar device is placed in all mobile terminals and also in each base station . the rake receiver 20 receives radio signals 22 , 24 and 26 , respectively , from the base stations 3 , 5 and 7 , respectively , ( see fig1 ) that are comprised in the above - mentioned active set 15 . these signals 22 , 24 , 26 have each different codes . the rake receiver 20 decodes the signals 22 , 24 , 26 and combines them into one signal 28 . the fact that the end signal 28 is combined from many signals 22 , 24 , 26 gives an increased signal quality thanks to diversity . the signal from one base station is also divided into many radio paths during the transmission between the base station and the rake receiver due to reflections . the different radio paths will propagate along different paths and thus they will arrive at the rake receiver 20 in different times . the rake receiver 20 combines also these radio paths and quality in the connection is once again gained because of diversity . [ 0040 ] fig3 shows a node , rnc ( radio network controller ) 30 , in the telephone network and how it is connected to the first , second , third , fourth , fifth and sixth base stations 3 , 5 , 7 , 9 , 11 , 13 in fig1 . the mobile terminal 1 shown in fig3 emits a signal , which is received in the three “ closest ” base stations 3 , 5 , 7 . the signal has travelled along different radio paths to the different base stations 3 , 5 , 7 and thus the signal quality could differ . the rnc 30 combines then the different uplinks of the signal received in the first , second and third base stations 3 , 5 , 7 . quality of the resulting signal is gained thanks to diversity . a lack of resources can arise in a base station . it could be a lack of power or a lack of codes . a lack of codes means that there are so many connections that the number of orthogonal codes is not sufficient . however , if there are many connections using a high data rate a lack of codes can occur even if there are not so many branches since high data rate codes are few . in the case of a lack of resources in a base station one or more downlinks from this base station to different mobile terminals has to be given less power or be removed . if there is a lack of codes the code for the removed downlink should be reallocated for a new connection . this decision about how to free resources has to be quick and according to the invention the decision should be taken locally in the base station and it should rely on information sent to the base station from the rnc . there are different possibilities for the transmission of data , such as voice , text and information from the rnc 30 to the base stations 3 , 5 , 7 , 9 , 11 , 13 and vice versa . one example is that a packet with data is sent whenever there is data to be sent . another example is that packets with data are sent continuously between the base stations and the rnc , for example every 20 ms , no matter if there is data to be sent . according to the invention the rnc informs the base stations about the importance of different branches . one way of informing is to send some information in a header together with the data in the packet from the rnc to the base stations . this information could for example be information about how important this particular base station , to which the packet is going , is for the receiving of the signal from the mobile terminal concerned . the information sent from the rnc to the base stations could , beside the mentioned information about how important each branch in the uplink ( from the mobile terminals to the base stations ) is for a resulting signal combined in the rnc , contain information about how important each branch in the downlink ( from the base stations to the mobile terminals ) is for the resulting signal in the mobile terminal . this is possible since the mobile terminals send information about for example measurements of the pilot signals to the rnc through the base stations in measurement report messages . information about the uplinks known in the base stations , for example interference of the uplinks , can be sent to the rnc from the base stations , in either a packet header or as a separate message . the rnc has also knowledge about codes used for the connections . this code information and uplink and downlink information is , according to one embodiment of the invention , forwarded in any suitable combination from the rnc to the base stations in a header of a packet . either the rnc forwards just the plain information or a mean value of the importance according to this information over a certain time period . if packets are sent continuously it is possible that the rnc sends information of the importance back to a base station for every received data packet from the base station . this implies that the base station has to combine and evaluate all pieces of information to get a correct judgement of what to do to save resources . the information is then used in the base stations to decide locally for example which downlinks that should be given less power or how the signal processing resources for the receiving of different uplinks should be distributed in case of a shortage of resources . another method for informing the base stations of the importance of different branches is to provide each data packet that is sent to the base stations with a value telling how important it is that this data is forwarded to the mobile terminal . the value is thus based on the information of the uplinks , downlinks and codes that is available in the rnc . the base station may then calculate from these values the importance of each branch . still another method is to not send data at all from the rnc to branches that are unnecessary for the total signal . the rnc still uses the information about uplinks , downlinks and codes or one or two of them to decide which branches that are not so important . the base station may then from the amount of received data estimate the importance of each branch and in the case of a shortage of power use this estimation when choosing which branch that should be given less power . however , if a base station receives nothing from the rnc it is important that the base station does not transmit anything to the mobile terminal since this “ nonsense signal ” if sent would disturb the real signal . this is described in a copending u . s . patent application ser . no . 09 / 042359 filed mar . 13 , 1998 . still another method is to let the base station count the number of faulty signal blocks it has received from a mobile terminal and to let the rnc inform the base station if there are more than one base station connected to the mobile terminal and perhaps about downlink conditions . if there are more than one base station connected and the base station receives many faulty blocks the base station can decide by itself to decrease the power to a downlink . with this information about both uplink and downlink conditions and also about codes , that in some way is sent to the base stations from the rnc in different combinations , the base stations can make a correct decision about how to save resources . for example a branch with little importance to the signal quality could be given less power or maybe be removed . and if there is a lack of codes the code used for the branch that has been removed should be reallocated to a new connection . if the condition of a branch is changed and no data is going to be sent from the rnc to the base station concerned , i . e . no packet is going to be sent , there is a possibility to send packets without data , just containing the needed information in a header . there are as already mentioned different possibilities for the rnc to inform the base stations of the conditions of the different branches . one is that the rnc sends information to the base stations every time a packet is sent . in this case the base station needs to combine and evaluate these pieces of information by itself . another possibility is that the rnc collects information about the different branches from the base stations and the mobile terminals for a certain time period and combines it to a judgement of the importance of the different branches to be sent to the base stations . in a first embodiment of the invention , shown in fig3 the rnc 30 comprises receiving means 40 adapted to receive uplinks from the base stations and measurement reports on the pilot signal measurements from the mobile terminals . the receiving means 40 is connected to a deriving means 41 adapted to derive a resulting signal from the incoming uplinks from the base stations . in this embodiment the deriving means 41 combines the uplinks to acquire a signal of good quality . the rnc comprises also determination means 42 connected to the deriving means 41 . the determination means 42 is adapted to determine the importance of each received uplink to the resulting signals . the rnc also comprises informing means 44 connected to the determination means 42 adapted to inform each base station concerned about for example this determination . the information comprises in this embodiment information about the quality of the uplink in relation to the other received uplinks from the same signal and also information about the quality of the different downlinks from the base stations . the downlink information is obtained from the measurement reports received from the mobile terminals . in this embodiment this information is sent to the base stations whenever there is a change in the importance of the branches . this could be done in a packet switched interface where information could be sent in a header of a packet even if there is no payload to be sent . in this first embodiment each base station comprises , as shown in fig3 in the first base station 3 , a resource device 31 adapted to either decrease the transmission power for a specific branch or remove this specific branch and if necessary reallocate the code of the branch to a new connection when the base station experiences a decrease or a lack of resources . the resource device 31 comprises a receiving means 32 , a deciding means 34 connected to the receiving means 32 and a power controlling means 36 connected to the deciding means 34 . the receiving means 32 receives the information sent by the informing means 44 in the rnc 30 . the deciding means 34 decides according to the information received in the receiving means 32 which downlinks that should be removed or be given less power if there is or is about to be a shortage of resources in the base station . the power controlling means 36 turns off or decreases the power according to the decision in case of a shortage of resources . the power controlling means 36 could also reallocate the code for the branch that has been removed to a new connection if there is or is about to be a lack of codes . in fig4 a base station 50 connected to a node 52 in the network according to a second embodiment of the invention is shown . the node 52 is of the same kind as illustrated in fig3 . it comprises a receiving means 40 ′, a deriving means 41 ′ connected to the receiving means , a determination means 42 ′ connected to the deriving means 41 ′ and an informing means 44 ′ connected to the determination means 42 ′. the functions of the means 40 ′, 41 ′, 42 ′, 44 ′ are the same as the functions of the means 40 , 41 , 42 , 44 in the first embodiment besides that in this embodiment the information about the quality of the uplinks and downlinks and information about the codes is sent from the node 52 to the base station as an answer every time data , such as voice or text , has been delivered from the base station 50 to the node 52 . this implies that the base station 50 has to combine and evaluate the pieces of information by itself . for this purpose a resource device 54 is provided in the base station 50 . it comprises a receiving means 56 , a decision means 58 and a power controlling means 59 of the same kind as in the embodiment of fig3 . the power controlling means 59 is in this embodiment connected to a receiving resources controlling means 60 adapted for controlling the receiving resources in the base station . the resource device 54 comprises also a combining means 61 connected to the receiving means 56 and an evaluating means 62 connected to the combining means 61 and to the decision means 58 . in the combining means 61 the information from the node 52 is combined and in the evaluating means 62 the information is evaluated before the decision means 58 decides what to do to save resources . in this second embodiment the power controlling means 59 controls the power and the allocated codes as described in the first embodiment but it can also decrease the data rate for certain connections to save power . these two embodiments are just two examples of embodiments . by combining the different possibilities described above in different ways a number of new embodiments is achieved .	7
[ 0044 ] fig1 illustrates one version of the hydrolysis process and the arrangement of its component parts by which a urea - free ammonia gas stream is produced from solid urea . in this version , the gaseous ammonia - containing product formed is separated from the liquid phase aqueous reaction media remaining within the hydrolysis reactor , the contents of which are mainly comprised of unreacted urea , ammonium carbamate , water , and a lesser amount of biuret . as shown , the urea feed , line 3 , is supplied as a dry solid from bin 1 . the urea from this is fed into a dissolver 2 to which makeup water is supplied from line 4 in an amount to solubilize the urea . the urea solution formed is further adjusted to the desired concentration for feeding to the hydrolysis reaction by the addition of additional water introduced through line 5 . the solution is then pressurized by pump 6 for injection through line 7 into the hydrolysis reactor 10 , in which the urea is converted to ammonium carbamate , ammonia and carbon dioxide upon heating under pressure . the heating may be provided by various means known to those familiar with the art , such as by internal or external heat exchange , as shown by heater 14 . a particularly useful way is with an internal pipe coil using steam or a hot heat transfer fluid . the heat input is adjusted to maintain the desired operating temperature and pressure to supply ammonia at the rate required . the contents are held at a constant volume by a liquid level controller which controls the urea feed pump and maintains a space above the aqueous liquid reaction media for the gaseous ammonia and carbon dioxide products to separate from the liquid . an expanded section 11 of the hydrolysis reactor 10 can be used to aid in the separation of the product gases from the liquid solution and prevent carryover of unreacted urea by entrainment and / or foaming . unreacted urea and / or biuret and intermediate ammonium carbamate remain in the reactor in the liquid reaction media for eventual conversion . a back pressure valve 12 is used to maintain pressure in the reactor and control the flow of the gaseous products being removed . the gaseous ammonia and carbon dioxide are discharged at a controlled rate to match the needs of the nitrogen oxides removal , flue gas “ conditioning ”, or other applications . the ammonia - carbon dioxide stream is customarily diluted with a carrier gas , such as compressed air , steam or flue gas , or mixtures thereof introduced through line 13 , before discharge into the flue gas flowing in duct 20 , in order to aid in obtaining a better distribution of the ammonia into the flue gas stream , such as for reaction with nitrogen oxides . the gas leaving the reactor is not allowed to cool below 60 ° c . in order to prevent solids deposition from ammonium carbonate / bicarbonate formation , or until it is diluted enough to prevent such happening . [ 0046 ] fig2 illustrates another version of the process equipment arrangement designed to provide good separation of the gaseous ammonia and carbon dioxide hydrolysis products formed from the liquid reaction media in the hydrolysis reactor by use of an overflow takeoff line to maintain a constant level of the reaction media , through which a portion of the liquid reaction media is removed and recycled back through line 16 to the urea feed dissolver 2 , or into the feed to pump 6 through line 16 - b . control valve 15 prevents the discharge of product gas through the liquid recycle line and controls the rate of flow through line 16 . the process is operated in a manner similar to that described for fig1 . the recycled reaction media leaving through line 16 is comprised mainly of the unreacted urea , ammonium carbamate , dissolved ammonia and water . [ 0047 ] fig3 shows an equipment arrangement which reduces the amount of water carried away in the product gas stream . in this arrangement , a condenser 17 is located in the vapor line leaving the hydrolysis reactor 10 which condenses and removes a substantial portion of the water that is carried along with the product gaseous ammonia and carbon dioxide stream in line 21 leaving the hydrolysis reactor 10 . the condensed water is separated and removed in line 16 . this not only removes a substantial portion of the water from the gaseous ammonia and carbon dioxide product stream , but reduces the water requirements of the system . the condensate in line 16 may be returned to the system at various optional points . it may be recycled to the bottom of the hydrolysis reactor 10 through line 16 - a , to replace dilution water normally introduced through line 5 at line 16 - b , or to the urea dissolver 2 to replace a portion of the solution water normally introduced in line 4 . control valve 15 prevents the discharge of gas and allows only liquid to pass . the condenser 17 , control valve 12 and off - gas product line 21 are not allowed to cool below 60 ° c . in order to avoid deposition of ammonium carbonate solids . the heat requirements for the hydrolysis reaction system may also be reduced by using the urea feed stream from pump 6 , prior to its entrance into the reactor 10 , as the coolant to the condenser 17 , following which the heated feed stream in line 7 is delivered to the reactor 10 . [ 0048 ] fig4 shows another arrangement and method of operation in which the hydrolyzed reaction products are discharged from heated reactor 30 as a mixed liquid - gas stream and there is no separation of the gaseous reaction products within the reactor body . the liquid reaction media and gaseous product stream pass from reactor 30 and are discharged into a separator 31 also under pressure . the gaseous product stream is removed at a controlled rate through control valve 32 in line 33 , and the separated liquid phase reaction media recycled through line 34 . control valve 35 allows only liquid phase to pass . the discharged liquid media can optionally be recycled back to reactor 30 through line 34 - a by gravity , or fed to the suction side of reactor feed pump 6 through line 34 - b . in another option , the liquid media in line 35 can be recycled back to urea dissolver 2 . via line 34 . the gaseous ammonia , carbon dioxide and water vapor leave via line 33 and are fed at a controlled rate through control valve 32 into the process gas stream gas in duct 20 . the control valve and off - gas piping are heated to a temperature above 60 ° c . [ 0050 ] fig5 shows an equipment arrangement by which the product ammonia and carbon dioxide stream is diluted , that is particularly useful for the removal of nitrogen oxides by the scr and sncr methods , or the “ conditioning ” of flue gas to give improved particulates removal . in this , the product gas stream from the hydrolysis reactor , controlled by valve 12 or 32 discharges into mixer 22 into which a stream of compressed air , steam or combustion gas , or mixtures thereof , is introduced simultaneously . the increased gas volume and lower concentration of the diluted ammonia treating gas makes for a better distribution and commingling of the ammonia and the intimate mixing and contact needed for contacting and reaction with all of the nitrogen oxides molecules or fine particulates in the combustion gas stream . typically , the ammonia gas feed stream is distributed into the combustion gas stream by means of an injection grid with multiple feed points extending over the cross - sectional flow area of the duct or by multiple high pressure injection nozzles . with this arrangement , the dilution gas is air which is introduced through line 23 , is compressed by compressor 24 and then heated in heat exchanger 25 located in hot gas duct 20 prior to its introduction into contactor 22 . [ 0051 ] fig6 shows an arrangement by which the hot combustion gas stream may be utilized to supply the heat requirements of the endothermic hydrolysis reaction and thereby eliminate the requirement for an outside or separate source of heat , such as steam or hot oil . a sidestream of the hot flue gas in duct 20 is delivered through line 40 to blower 41 from which it passes through heat exchanger 42 in which it heats a circulating heat transfer fluid and exits back into the flue gas stream in line 43 . the heated heat transfer fluid leaves through line 44 and re - enters exchanger 42 in line 48 . the hot heat transfer fluid in line 44 is circulated by pump 45 through buffer tank 46 from which a portion is delivered to reactor 10 through control valve 49 at a rate as required by the hydrolysis reaction taking place in reactor 10 , in which heat is transferred through internal heat transfer coil 50 to the urea hydrolysis reaction media . the cooled heat transfer fluid leaves heat transfer coil 50 in reactor 10 through line 51 . the cooled fluid then joins the overflow from surge tank 46 exiting through pressure control valve 47 and returns to heat exchanger 42 for reheating . the heating of reactor 10 may also be provided by an exchanger located externally to the hydrolysis reactor . such a means may be used for heating the hydrolysis reactor as shown in the systems of fig1 , 3 and 4 , and / or dilution gas of fig5 and 6 . various of the individual equipment features , configurations and modes of operation described in the foregoing may be utilized in other arrangements . a test reactor for determining the rate of the hydrolysis reaction versus temperature for the thermal hydrolysis method for converting urea to ammonia was constructed of ¾ - inch diameter by 12 - inch long pipe with an expanded upper section similar to that shown in fig1 . the lower section is heated externally and a pressure gauge is located at the top of the expanded upper disengaging section . tests were conducted at a number of different concentrations of urea in water to determine the effect of urea concentration on the rate of the hydrolysis reaction . solutions were introduced into the lower section of the hydrolysis reactor and heated progressively to higher temperature levels in a batch mode of operation . the ammonia and carbon dioxide generated build up the gas pressure as the temperature is increased above 125 ° c . below 125 ° c . the rate of reaction is very slow . table 1 shows the effect of temperature on the rate at which the hydrolysis reaction proceeds for several urea concentrations ( as ammonia generated ) and the effect of an additive reaction rate enhancing material — vanadium pentaoxice ( v 2 o 5 )— on the reaction rate , when operated in a batch mode . a graphical comparison of the data presented in example 1 shows the rates of hydrolysis for urea with water alone , with vanadium oxide ( v 2 o 5 ) and molybdic oxide ( moo 3 ), is shown in fig7 . the addition of vanadium oxide to the reaction media enhances the rate of the hydrolysis reaction , as shown by the data of example 1 . vanadium pentaoxide , or its salts , shows the greatest effect in increasing the rate of reaction , both as to the kindling temperature for the reaction and over the entire temperature range . the enhancement , however , can be equaled by a modest increase in temperature for the water system alone . the rate of the urea hydrolysis reaction is also enhanced to varying degrees by the addition of other elements selected from groups ii i - b , iv , v and vi - a of the periodic chart of the elements to the reaction media . in their elemental metallic form , there is no significant increase over that of water alone . materials showing enhancing activity include the oxides and ammonium and alkali metal salts of molybdenum , chromium , tin , bismuth , boron , and certain active surface solid materials , such as activated carbon , activated silica and activated alumina , and ion - exchange resins in their acid and basic forms . the solids not dissolved among these may be used in either suspended or fixed positions . reaction rates are further increased by operation at elevated ph levels ( above ph = 10 ), as obtained by the addition of alkali metal hydroxides , carbonates , or bicarbonate salts to the reaction media with both water based reaction systems alone , or when added to an enhancer - containing system . at a ratio of 0 . 5 k 2 co 3 : 1 . 0 urea in a 40 % urea solution , rates similar to that of vanadium oxide are obtained . the hydrolysis reaction was operated in a continuous mode in which a solution of 40 percent urea in water was pumped at a controlled rate into the hydrolysis reactor described in example 1 , in which it was heated to temperatures up to 155 ° c . with the heat “ input ” controlled to maintain a pressure of 75 psig . the ammonia - containing product gas stream formed discharged through a needle valve at a controlled flow rate equivalent to 0 . 2 g / min . the ammonia - containing product gas generated was absorbed in a measured amount of water and analyzed at regular intervals for buildup of ammonia . a constant level of the urea solution was maintained in the reactor by injection of urea feed solution into the bottom of the hydrolysis reactor at a rate of 0 . 9 ml / min ., which essentially matches the ammonia generation rate of 0 . 2 g / min . and the amount of urea injected . the urea hydrolysis reactor and system described in example 3 was operated in a continuous manner in conjunction with a pilot plant combustion gas generator to demonstrate the effectiveness of ammonia derived from the hydrolysis of urea for the actual removal of nitrogen oxides from a typical combustion gas stream when using a regular commercial scr catalyst . the temperature of the nitrogen oxides containing combustion gas was adjusted to approximately 750 ° f . at the catalyst inlet . at a concentration of 200 ppm nox in the inlet feed gas to the catalyst section the concentration of nitrogen oxides in the leaving combustion gas was reduced to the 18 ppm level , to give a removal efficiency of better than 90 %. the urea hydrolysis section generated ammonia smoothly at a constant rate as evidenced by the constancy of the nitrogen oxides concentration over an extended period of operation . when the system was operated with an aqueous ammonia solution as the source of ammonia and the same flue gas stream and catalyst , the removal of nitrogen oxides was the same . plant operating data developed for an industrial scale 110 mw gas fired turbine combined cycle power plant are shown in table 2 . the plant currently uses hazardous anhydrous ammonia that is stored in a 25 ton storage vessel , which provides a 30 day supply . employment of the subject invention eliminates the need for storage of anhydrous ammonia . urea is available commercially in solid form or as a 50 % solution that can be delivered to the plant site by tank car or truck . for the 50 percent urea solution , a 11 , 000 gallon storage tank provides 30 days capacity . the 50 % urea solution from the storage tank is then diluted to 40 % by feeding in deionized water at a matching rate as the urea is fed to the hydrolysis reactor . the hydrolysis reactor is heated with steam ( 200 psig ) and is operated at an approximate temperature of 150 ° c . and an operating pressure of 75 psig . the reactor pressure is controlled by the heat input to the reactor and the gas takeoff rate is controlled by an adjustable control valve , which adjusts to match the required amount for control of the nitrogen oxides in the combustion gas stream . the control valve and discharge piping are heated to above 80 ° c . the product gas stream is diluted with hot compressed air prior to introduction into a distribution grid in the flue gas duct . it is to be understood that the examples shown are given by way of illustration and are not to be construed as limiting the invention . a similar process may be used for other processes requiring ammonia . the above descriptions are for teaching the person of ordinary skill in the art how to practice the present invention and it is not intended to detail all of those modifications and variations of it which will become apparent to the skilled worker upon reading the description . it is intended , however that all such obvious modifications and variations be included within the scope of the present invention which is defined by the following claims .	2
turning more specifically to the drawings , in fig1 the transmission housing 10 supports within its interior the engine pulley 12 and the drive shaft pulley 14 . each of the pulleys has one sidewall fixed in the horizontal direction and the other movable in the horizontal direction , so that the spacing of the groove between the two sidewalls of each pulley is variable . the mechanism for controlling the spacing will be discussed in more detail below in conjunction with fig2 but basically this mechanism is included in a hydraulic actuator unit 16 . this actuator unit located between the two pulleys controls the position of the horizontally movable sidewall of each pulley . since the movable sidewall is opposite for the two pulleys , one , for example being the right wall 12a in pulley 12 and the left wall 14a in pulley 14 , movement of the horizontally movable wall 12a of pulley 12 to the left ( as viewed in fig1 ) decreases its spacing from the horizontally fixed wall 12b , whereas movement of the horizontally movable wall 14a of pulley 14 to the left increases its spacing from the horizontally fixed wall 14b . the opposite results are achieved when both walls 12a and 14a are moved to the right . the engine pulley 12 is coupled to the shaft 18 which is linked to the engine ( not shown ) and the driven shaft pulley 14 is coupled to the driven shaft 20 . the coupling will be described in more detail below . bearings 22 are included to support rotation of the pulleys and shafts with respect to the housing in the usual fashion . as is seen , the sidewalls of each of the pulleys 12 and 14 are slanted in the working parts of their widths so that the grooves 24 and 26 , respectively , between the sidewalls are tapered , and their widths increase with distance from the pulley axes , which lie along the associated shafts 18 and 20 , respectively . the drive belt 28 rides between the two sidewalls of each of the two pulleys . as is described more fully hereinafter in connection with fig4 and 5 , the belt 28 is provided with transverse metal bands or pins 30 whose end portions 32 are bent and ground at their tips to match the taper of the sidewalls so that a tight slipless contact is made between the tips and the sidewalls of the pulley . the bent ends provide a predesigned spring tension adequate to keep the tips pressed against the sidewalls . when the sidewalls of pulley 12 are far apart as shown in fig1 the belt 28 will be located close to the shaft 18 , so that pulley 12 has a small effective radius and will make several rotations for each rotation of pulley 14 in which the belt 28 rides higher in the groove so that it has a larger effective radius . when the sidewalls of pulley 12 are moved closer together , thereby also moving the sidewalls of pulley 14 farther apart , the belt 28 will rise in pulley 12 and drop in pulley 14 and the ratio of the radii of the two pulleys will thereby change . as will be understood , fig1 depicts the pulleys 12 and 14 in a very low ratio configuration , and any change would normally be in the direction of a higher ratio , i . e ., so that the belt would rise in pulley 12 and drop in pulley 14 . returning to the hydraulic actuator unit 16 , shown in more detail in fig2 and used to control the horizontal movement of the horizontally movable sidewalls 12a and 14a , it comprises a cylinder 36 defining a chamber 38 within which is a compression spring 40 which bears against and biases an axial plunger member 42 to the right . the plunger member 42 includes an axial shaft 44 extending axially through the chamber 38 and carrying at its opposite ends brackets 46 and 48 for engagement with the horizontal movable walls 12a and 14a , respectively , of the two pulleys 12 and 14 ( see fig1 ). an annular stop member 50 surrounds the shaft 44 and is axially captured within the chamber 38 by split rings 52 . o - rings 54 and 56 carried by the plunger 42 and the stop member 50 seal the chamber 38 relative to the shaft 44 and the cylinder 36 . a further o - ring 58 establishes a seal between the shaft 44 and the end wall 60 of the cylinder 36 . to effect a ratio change , fluid is introduced into and withdrawn from the chamber 38 by way of a fluid coupling 62 to urge the plunger 42 to the left against the bias of the spring 40 . as illustrated in fig2 the spring 40 normally biases the plunger to the low ratio configuration of fig1 and 2 . the pressure provided by the fluid in cavity 38 is controlled by the factors which are normally used to determine the optimum effective gear ratio of an automatic transmission system and will not be discussed in detail herein . other arrangements are known for controlling the movement and may be substituted . for example , a second fluid coupling 64 may be provided in place of or as a supplement to the spring 40 depending on the control system used . with reference to fig1 and 3 , the manner in which shafts 18 and 20 are coupled to the sidewall members of the pulleys 12 and 14 , respectively , will now be described . for illustrative purposes , the description will be made with reference to the connection for pulley sidewall 14a , but it will be understood to apply to the other pulley sidewalls as well . as shown in fig1 the sidewall member 14a contains an annular hub portion 66 that is rotatably mounted on the surface of shaft 20 . there is no direct driving connection between the sidewall member 14a and the shaft 20 . rather , the driving connection is made through an intermediate resilient ring member 68 and an annular collar member 70 . the collar member includes a first cylindrical portion 72 that is splined or otherwise rigidly connected to shaft 20 for rotation therewith . at its axially inner end the collar 70 includes an enlarged diameter portion 74 which forms a seat for the bearing 22 ( see fig1 ). inwardly of the bearing seal portion 74 , the collar is formed with an upstanding flange 76 which engages , in a manner more fully described hereinafter , the intermediate flex ring member 68 . the outer bearing seat for the bearing 22 is carried by a non - rotating cap member 78 ( fig1 ) that fits over the collar member 70 . to stabilize the unit a sealed bearing unit 80 is provided between the cap member 78 and the collar 70 . as shown in fig1 the bracket 48 of the actuator unit 16 engages the axially outer end of the cap member 78 for purposes of control of the width of groove 26 in pulley 14 . the other end bracket 46 of the actuator unit 16 engages the axially inner end of a like cap member 81 associated with the movable sidewall member 12a of the pulley 12 . an access cover 82 fits over the axially outer ends of the drive shaft 20 and the actuator 16 . as illustrated in fig3 the facing surfaces 76a and 68a of the flange 76 and the ring member 68 , respectively , are formed with matching wedge serrations to provide a secure driving engagement therebetween . the other surface 68b of ring member 68 and the facing surface 66a of the hub portion 66 of the sidewall member 14a ( shown in phantom ) are also formed with matching serrations for the like purpose . as mentioned , the ring member 68 is made of a resilient material , such as a suitable elastomer and is so proportioned as to wedge members 66 and 70 apart when one element is rotatably displaced with respect to the other . because brackets 46 and 48 are rigid , the displacement can only be an inward clamping force on the belt . firstly , and most importantly , since the driving member 76 is clamped by way of the serrations to the resilient member 68 , the force clamping the two together will be dependent on the torque being applied to the clamping member 68 and this clamping force will be further transmitted as an inward clamping force between the pulley sidewall to which member 76 is bound and the belt . this force is proportional to the torque being applied . additionally , this resilient member helps provide isolation against shocks which might affect the system deleteriously , although most of the vibration isolation is provided by the rotational flex or displacement between members 66 and 70 . advantageously , a driving connection utilizing a resilient element 68 , as described , is used between both the horizontally fixed and horizontally moveable sidewalls of each pulley with its associated shaft . in some instances , it may be sufficient if the resilient coupling is provided between only one of the sidewalls and its shaft . in other instances , it may prove sufficient to provide such resilient coupling between only one shaft and one or both of the pulley sidewalls associated with it . it is to be recognized , that this aspect of the invention can be independent of the belt aspect of the invention and can find utility with other forms of belts . alternatively , the novel form of belt can be used independently of this novel driving arrangement . in particular in some instances , it may prove advantageous to use instead , the known &# 34 ; roller wedge &# 34 ; mechanism for coupling the shaft to the pulley wall . this mechanism can also be used to provide a strong clamping force between the belt and the pulley walls which is proportional to the torque applied . in this technique , a roller is enclosed between inwardly tapered portions of the shaft and that pulley wall , such that rotation , for example , of the shaft , coupled with resistance of the wall will cause the roller to try to climb the incline in its enclosure . however , because the shaft cannot move axially because of bearings in the housing , the shaft causes the wall to rotate as well as exert an inward or clamping force on the belt . fig4 and 6 illustrate the structure of one embodiment of a drive belt in accordance with this feature of the invention . the belt comprises a matrix or base 84 , typically of a rubber compound of the type useful in pulley belts . a plurality of transversely extending pins or bands 30 of generally rectangular cross section are imbedded in the base over most of their lengths , only the end portions 32 being free . the end portions 32 are bent and their tips 88 ground so that the belt will sit tightly between the sidewalls . typically the edges will be ground to an angle of about 25 degrees from the vertical , and the sidewalls forming the grooves in the pulleys are tapered similarly . other bevels may of course be used . also imbedded in the base 84 is a plurality of cables or cords 90 , suitably fiberglass or the like , which extend longitudinally along the length of the belt to increase its resistance to stretching during operation . importantly the pins are spaced apart from one another in the longitudinal direction of the belt as seen best in fig6 . fig5 and 7 show an alternative form of the belt which differs in several respects . in this form , the pins or bands 130 are circular in cross section . additionally , the base 184 is divided transversely into two sections and each pin includes a central section 130a which is an inverted u to increase the flexibility of the belt particularly in the transverse direction . as previously mentioned , an important characteristic of this belt is that it is designed to make essentially a metal - to - metal contact with the sidewalls of the groove during operation . a metal - to - metal contact is therefore established and maintained so long as the drive is active . such a contact because of its high frictional characteristics , has many times the holding ability of to the contact in a drive in which torque is transmitted through an oil film . moreover , though ordinarily it is preferred to run the belt completely dry , in some instances it may be useful to have an oil film initially present at the beginning of energizing the drive . in such a case the tips of the pin should be so shaped that any such film is rapidly squeezed out between the two working surfaces so that a metal - to - metal contact is quickly established and thereafter maintained as long as the drive is active . it is important to avoid overheating of the belt which might destabilize the rubber base . spacing the pins apart longitudinally and the use of exposed end portions for the metal pins acts to keep the belt from overheating by circulation . moreover , having the pins only partially imbedded in the matrix also helps avoid overheating . a spacing apart longitudinally comparable to the width of the pin has been found particularly advantageous . in the two embodiments shown , each of the pins comprises a slightly curved intermediate portion between a pair of end portions which are bent to provide spring action on the tapered tips to keep the tips pressed to the sidewalls . in some instances , it may prove advantageous to provide a more curved intermediate portion , the radius of curvature being chosen to provide an increase in the flexibility of the pins to improve the gripping action between the pin tips and the pulley sidewalls . especially in such instances , it may be advantageous to imbed the central portions of the pins more deeply in the rubber base . the cables provide longitudinal strength and stability of the belt while permitting considerable flexibility in the transverse direction . it should be apparent that there should be considerable latitude in the choice of materials forming the belt . for example , the rubber - like compound used for the base can take a variety of forms consistent with its desired characteristics of stability despite heating , strong support of the pins and enough flexibility to permit a tight fit even though the pin tips must be permitted to flex in and out as the spacing of the walls is varied . the effective dimension of the pin will change to allow speed change . tangential initial contact later will be either lengthened or shortened . the pin tips must never lose contact with the pulleys so the pins must have the capacity to make this adjustment . as previously mentioned , the pins are advantageously essentially of hardened steel but protective coatings may be useful . although the invention has been described with reference to specific embodiments thereof , it will be understood that such embodiments are illustrative only and that the invention is susceptible of variation and modification without departing from the inventive concepts disclosed . all such variations and modifications , therefore , are intended to be encompassed within the spirit and scope of the appended claims .	5
when referred to hereafter , the terminology “ wireless transmit / receive unit ( wtru )” includes but is not limited to a user equipment ( ue ), a mobile station , a fixed or mobile subscriber unit , a pager , a cellular telephone , a personal digital assistant ( pda ), a computer , or any other type of user device capable of operating in a wireless environment . when referred to hereafter , the terminology “ base station ” includes but is not limited to a node - b , a site controller , an access point ( ap ), or any other type of interfacing device capable of operating in a wireless environment . although the present disclosure is described in the context of hspa , it should not be construed as being limited to this context , which is used as an example . a plurality of power grant tables are stored in the wtru . in a first embodiment an index offset value and extended power grant table are disclosed . the plurality of power grant tables is derived from the extended table . as an example , one table of the plurality may contain power values which can be used for bpsk modulation while another contains power values which can be used for 16qam modulation . the offset value is used as a pointer for the starting index and is established as part of initial call setup between two transceivers . an example of two such transceivers is a wtru and a node b initiating a call setup by layer 3 signaling . once the offset value is known to the wtru , the portion of the extended grant table that will be used is known to the wtru . this method provides flexibility since the extended table could be any size and only the applicable portion of the table is used . referring to fig1 , by way of example , an absolute grant value table , formerly with 32 indices , is extended to 64 indices by the addition of 32 new entries . an existing table is shown as feature 15 in fig1 , containing indices 0 through 31 and corresponding power ratio values in the column headed “ absolute grant value .” the power ratio values are shown as squares of ratios of e - dpdch amplitude to dpcch amplitude . ( e - dpdch is enhanced dedicated physical data channel and dpcch is dedicated physical control channel .) the notation x4 , x6 etc . in entries for index 24 - 31 indicates the number of e - dpdch channels for each of these entries . index 24 is associated with four e - dpdch channels , index 25 with two , etc . the table designated as feature 15 is defined in the third generation partnership project ( 3gpp ) specification 25 . 212 , version 7 . 5 . 0 , section 4 . 10 . 1a . 1 . the 32 newly defined entries , defining a second table , are indicated as feature 10 , with indices 32 through 63 . the two tables of fig1 can accommodate both 16qam modulation power ratios and bpsk modulation power ratios . for bpsk modulation , the index offset value is zero . this indicates that the table containing index values from 0 - 31 shall be used for bpsk . for 16qam modulation , the index offset value is 32 . this indicates that the table for 16qam contains the entries having index values from 32 - 63 . if the modulation scheme is on the borderline between bpsk and 16qam , an index offset value of 16 may be used . this would indicate the use of the upper range of bpsk ( index 16 - 31 ) and the lower range of 16qam ( index 32 - 47 ), resulting in a range of values from index number 16 to 47 . to reduce the number of bits used to indicate the index offset value , a large table , for example a table with the number of indices much greater than 64 , may be split into segments corresponding to the offset value . if , for example , only bpsk and 16qam are used , then only 1 - bit is required to indicate the offset value to determine whether the upper half 10 or lower half 15 of table 1 is used . the index offset value may be used to specify a custom power grant table depending on the number of bits that are available for use in the initial setup . this method provides flexibility with minimal changes in initial setup . the offset value in the table may be transmitted to the wtru in multiple ways . a first alternative is direct transmission of value during setup . direct transmission of the offset value may be set up to accommodate any desired offset value . a second alternative is to make the offset dependent on the slot offset of the agch relative to a top sub - frame boundary . for a currently configured agch , this allows for three possible values , namely 0 , 1 or 2 . a third alternative is to make the offset a function of the hybrid radio network temporary identifier ( h - rnti ). the h - rnti offset value could be pre - assigned for different offset values . a fourth alternative is to make the offset dependent on the agch code or channel number that is being used for the agch . the agch coding or channel number could be set up for different offset values . only one code currently exits for the agch . other convolutional codes with same rate and puncturing could be used to signify different offsets . this may require that the wtru perform several decoding cycles of agch data until the right code is selected . as a fifth alternative , the offset could be signaled by the radio access network ( ran ) through radio resource control ( rrc ) signaling . the value of the offset , and thereby the grant table being used , can either be static ( i . e . same offset throughout the duration of the connection ), semi - static ( i . e . reconfigurable through l3 or l2 signaling ) or dynamic ( i . e . dynamically signaled to the node b for every new transport block ). a second embodiment uses a separate power grant table for different modulation types , such as bpsk and 16qam modulation . in this case , no setup is required since the modulation type determines the tables to use . the applicable table is designated based on the modulation type . by way of example , for bpsk modulation , a current absolute grant value mapping may be used , while for 16qam modulation , a new grant table could be devised and either preconfigured in the wtru or signaled to the wtru . a current table which could be used for bpsk is defined in the third generation partnership project ( 3gpp ) specification 25 . 212 , version 7 . 5 . 0 , section 4 . 10 . 1a . 1 . this method has no impact on current systems other than adding a new table for 16qam modulation . a third embodiment uses an existing power grant table , but with one or more larger intervals for the power ratio values so that the power values cover both bpsk and 16qam modulation or other modulation types . this may be done by updating existing grant tables with new values . in particular , two power grant tables used in the wtru may be tables 16b and 16b . 12 in third generation partnership project ( 3gpp ) specification 25 . 212 , version 7 . 5 . 0 , section 4 . 10 . 1a . 1 . the 3gpp specification 25 . 331 , version 7 . 5 . 0 , section 10 . 3 . 6 . 86a may also be used to define the tables . grant tables , intervals , or both may be pre - configured in a wtru . alternatively , tables , intervals or both may be signaled to the wtru through rrc signaling upon establishment of the radio communication . in the latter case , either a table or an interval between power values can also be dynamically reconfigurable throughout the life of a connection through rrc signaling . the updated grant table may be signaled by the ran to the wtru in one of the following ways : signaling the entire table ; signaling the first and last power grant values ; or signaling an interval between power values . fig2 shows a wireless transmit receive unit ( wtru ) 100 configured to operate according to the method disclosed above . wtru 100 contains a transceiver 105 operating as a transmitter and a receiver , a memory 110 , and a processor 115 . memory 110 stores a plurality of power grant tables . transceiver 105 is configured for receiving a signal designating which table is to be used to grant power levels during a communication . the signal may contain an offset or an interval for defining and designating grant tables , as described above . transceiver 105 may receive grant tables which may be stored in memory 110 . processor 115 processes the information in the signal , designates the grant table to be used , and controls transmitted power based on the designated table . although the features and elements of the present disclosure are described in particular combinations , each feature or element can be used alone without the other features and elements or in various combinations with or without other features and elements . the methods or flow charts provided in the present disclosure may be implemented in a computer program , software , or firmware tangibly embodied in a computer - readable storage medium for execution by a general purpose computer or a processor . examples of computer - readable storage mediums include a read only memory ( rom ), a random access memory ( ram ), a register , cache memory , semiconductor memory devices , magnetic media such as internal hard disks and removable disks , magneto - optical media , and optical media such as cd - rom disks , and digital versatile disks ( dvds ). suitable processors include , by way of example , a general purpose processor , a special purpose processor , a conventional processor , a digital signal processor ( dsp ), a plurality of microprocessors , one or more microprocessors in association with a dsp core , a controller , a microcontroller , application specific integrated circuits ( asics ), field programmable gate arrays ( fpgas ) circuits , any other type of integrated circuit ( ic ), and / or a state machine . a processor in association with software may be used to implement a radio frequency transceiver for use in a wireless transmit receive unit ( wtru ), user equipment ( ue ), terminal , base station , radio network controller ( rnc ), or any host computer . the wtru may be used in conjunction with modules , implemented in hardware and / or software , such as a camera , a video camera module , a videophone , a speakerphone , a vibration device , a speaker , a microphone , a television transceiver , a hands free headset , a keyboard , a bluetooth ® module , a frequency modulated ( fm ) radio unit , a liquid crystal display ( lcd ) display unit , an organic light - emitting diode ( oled ) display unit , a digital music player , a media player , a video game player module , an internet browser , and / or any wireless local area network ( wlan ) module .	7
referring to fig1 a first presently preferred embodiment of a security cover 10 for a display case 12 is shown . the display case 12 , commonly used in retail establishments for merchandising jewelry or other valuable items , includes a typically wooden base 14 supporting a glass enclosed display area containing the jewelry or similar items . the display area is enclosed by transparent glass for viewing of the items and includes a glass front face 16 , a glass rear face 18 , a glass top face 20 and glass end faces 22 . commonly , the rear face 18 of the display case 12 may be glass or another material and include sliding and lockable doors ( not shown ) for convenient access to the contents of the display case 12 by a salesperson . it should be readily understood by those skilled in the art that the display case shown and described herein is for exemplary purposes only and should not be considered a limitation upon the scope of this invention as defined by the appended claims . for example , the present invention is readily useful for a variety of display case sizes , configurations , geometries and designs . the security cover 10 , according to a first presently preferred embodiment of this invention , as shown in fig1 and 6 , includes a pair of generally l - shaped mating panels 24 which are secured together by an elongate lock bar 26 and a lock 28 . the panels 24 are releasably mounted to the base 14 of the display case 12 by an anchor in the form of a front rail 30 and a rear rail 32 . the front and rear rails 30 , 32 are positioned immediately below the front and rear glass faces 16 , 18 , respectively , of the display case 12 and are mounted to the base 14 as will be described later herein . each panel 24 of the security cover 10 is generally l - shaped and , when installed on the display case 12 , includes a generally vertical pane 34 juxtaposed to and covering the glass front face 16 or glass rear face 18 and a generally horizontal pane 36 juxtaposed to and covering at least a portion of the glass top face 20 of the display case 12 in the presently preferred embodiment . panes of the panels 24 may be included for covering the end faces 22 of the display case 12 as required within the scope of this invention . each panel 24 is preferably molded or otherwise formed of an opaque plexiglass , lexan ®, abs plastic or similar material . preferably , the panels 24 are a frangible - resistant rigid material which is resistant to breaking , mutilation , fracture or the like . additionally , the panels 24 are preferably opaque to inhibit visual access to the contents of the display case 12 when installed thereon . the horizontal and vertical panes 36 , 34 are rigidly connected to conform to the geometry of the display case 12 to which they are installed . depending upon the forming technique used in manufacturing the panels 24 , a generally vertical lip 38 may be included at the juncture between the vertical and horizontal panes 34 , 36 or , as shown in a second presently preferred embodiment of the panels in fig6 a smoothly continuous corner 40 may be formed at the juncture between the panes 34 , 36 . the vertical lip 38 also serves as a structural member to provide added strength to the display cover 10 in this area to distribute the stresses from hammer or other blows and prevents such forces from being transmitted to the attachment points of the rails 30 , 32 . a hook 42 extends the length of each panel 24 along a lower proximal edge of the vertical pane 34 for releasably coupling the panel 24 to the anchor rail 30 , 32 . depending upon the mounting mechanism for the anchor rail 30 , 32 , a notch 44 may be provided in the hook 42 to accommodate the mounting mechanism . preferably , a sloped sill 46 is also included along the lower portion of the vertical pane 34 of each panel 24 . the sloped sill 46 protrudes from the vertical pane 34 and overhangs the anchor rail 30 , 32 as shown in fig6 so that a downwardly directed blow by a hammer or other blunt instrument is deflected from impacting and damaging the anchor rail 30 , 32 . an upstanding flange 48 extends the length of each panel 24 along a distal edge thereof on the horizontal pane 36 of the panel . the flange 48 of each panel 24 is juxtaposed to the flange 24 of the complimentary panel 24 generally along the longitudinal center line of the top glass face 20 of the display case 12 in the embodiments shown in fig1 and 6 . the flanges 48 each include a plurality of spaced inverted t - slots 50 which correspond in size , location and configuration with the t - slots 50 in the flange 48 of the mating panel 24 . the t - slot 50 includes a generally vertical opening or mouth 52 connected to oppositely directed stems 54 . additionally , at least one and preferably two lock apertures 56 a , 56 b are provided in the flanges 48 . the lock bar 26 , as shown in fig1 - 3 , has a generally inverted u - shaped configuration with a pair of spaced sidewalls 58 . the lock bar 26 is also preferably made out of 0 . 060 inch thick stainless steel . a plurality of pins 60 extend between the sidewalls 58 of the lock bar 26 at spaced locations corresponding to the locations of the t - slots 50 in the flanges 48 . similarly , at least one lock bar aperture 62 is provided through each of the sidewalls 58 of the lock bar 26 . for installation of the lock bar 26 , the pins 60 are aligned with the mouth 52 of the t - slots 50 and the lock bar 26 is pushed downwardly with the flanges 48 positioned between the spaced sidewalls 58 thereof until the pins 60 bottom out in the t - slots 50 . the lock bar 26 is then slid or translated longitudinally relative to the panels 24 in either direction so that each pin 60 is seated within one of the stems 54 of the respective t - slot 50 . once the pins 60 are inserted into the stems 54 of the t - slot 50 , the lock bar apertures 62 register with one of the lock apertures 56 a , 56 b in the flanges 48 so that the pad lock or other locking mechanism 28 can be inserted through the lock apertures 56 a , 56 b and the lock bar apertures 62 to securely enclose the faces of the display case 12 . in addition to joining the panels 24 together , the lock bar 26 provides a structural member at the center of the display case 12 to withstand the stresses of an attack . referring to fig4 and 5 , a mounting mechanism for each anchor rail 30 , 32 is shown . the anchor rail 30 , 32 is preferably a circular metal rail with a tubular opening 64 on each end thereof . a post 66 projecting from an end cap 68 is received into the tubular opening 64 . the end cap 68 also includes a bore hole 70 through a body portion 72 thereof . the end cap 68 is mounted to the base 14 of the display case 12 by a preferably three inch long screw 74 inserted through the bore hole 70 and screwed into a wooden , particleboard , plywood or other similar material portion of the base 14 . preferably , a metal , generally square plate 76 having a central hole 78 therethrough is positioned between the end cap 68 and the base 14 of the display case 12 for more secure mounting of the rail 30 , 32 . the opposite end of the rail 30 , 32 is likewise mounted to the base 14 with an end cap 68 , screw 74 and plate 76 . spaced along the length of the rail 30 , 32 between the end caps 68 are a plurality of spacers 80 positioned between the rail 30 , 32 and the base 14 of the display case 12 . the spacers 80 include a central bore hole 82 through which a screw 84 is inserted through a hole 86 in the bottom 88 of a notch 90 on the rail 30 , 32 to firmly anchor the rail 30 , 32 approximately three - eighths of an inch from the base 14 . preferably , the screws 74 , 84 are inserted into a typically three - quarter inch thick particleboard , plywood or other wooden portion of the base 14 underlying the display area of the display case 12 , as shown in fig5 . as such , the rail 30 , 32 is securely mounted to the display case 12 for anchoring the panels 24 of the security cover 10 to resist removal , mutilation , dislodgment or the like . it should be readily understood that the installation of the anchor rails 30 , 32 and other components of the security cover 10 according to a presently preferred embodiment of this invention are shown and described for exemplary purposes only . after the front and rear anchor rails 30 , 32 are mounted to the base 14 of the display case 12 , the respective panels 24 are installed by initially hooking the proximal hook - shaped edge 42 of each panel 24 onto the anchor rail 30 , 32 with the vertical pane 34 spaced from the front or rear face 16 , 18 of the display case 12 as shown in fig6 . with the hook 42 engaged on the rail 30 , 32 , the panel 24 is pivoted upwardly toward the display case 12 until the vertical pane 34 is juxtaposed to the front or rear face 16 , 18 of the display case 12 and the horizontal pane 36 is juxtaposed to the top face 20 of the display case 12 . after the complementary panel 24 is likewise installed , the lock bar 26 is installed onto the juxtaposed flanges 48 with the pins 60 inserted into the mouth 52 of the respective t - slots 50 . the lock bar 26 is then slid longitudinally to seat the pins 60 within one of the stems 54 of the t - slots 50 and thereby register the lock bar apertures 62 with the lock apertures 56 a or 56 b on the flanges 48 . the padlock or other locking device 28 is then inserted through the registered lock apertures 56 a or 56 b and lock bar apertures 62 and the installation of the security cover 10 according to a presently preferred embodiment of this invention is complete . removal of the security cover 10 is likewise easily accomplished by a salesperson by removal of the lock 28 , translation of the lock bar 26 to align the pins 60 with the mouth 52 of the respective t - slots 50 , removal of the lock bar 26 and pivotal removal of each of the panels 24 for storage and subsequent reuse . as such , the security cover 10 according to the presently preferred embodiment of this invention provides a frangible - resistant protective cover for the glass faces of the display case 12 . moreover , the security cover 10 is completely removable from the display case 12 when not in use and securely anchored thereto when in use . furthermore , the use of the security cover 10 does not detrimentally impact the viewing of the contents of the display case 12 during normal business hours nor hinder the access to those contents by salespersons . it should be readily understood that the presently preferred embodiments of the security cover 10 include two complimentary or mating generally l - shaped panels 24 with flanges 48 that are juxtaposed directly together on the top face 20 of the display case 12 . however , other arrangements are readily within the scope of this invention . for example , panels which are not l - shaped , complementary panels one of which is l - shaped having a horizontal pane that covers the entirety of the top face and security covers which include intermediate panel sections which cover a portion or all of one of the faces of the display case are within the scope of this invention . moreover , any arrangement of panels which , in combination , are juxtaposed to and / or cover the various faces of the display case are also within the scope of this invention . from the above disclosure of the general principles of the present invention and the preceding detailed description of at least one preferred embodiment , those skilled in the art will readily comprehend the various modifications to which this invention is susceptible . therefore , we desire to be limited only by the scope of the following claims and equivalents thereof .	0
the entire disclosures of u . s . application ser . no . 12 / 518 , 460 filed jun . 10 , 2009 , entitled distributed emitter voice lift system , and u . s . provisional patent application no . 60 / 874 , 818 filed dec . 14 , 2006 , entitled distributed emitter voice lift system with optional sound masking , are incorporated herein by reference . an improved system and method is disclosed for providing sound reinforcement in a classroom , an office , a conference room , an auditorium , or any other suitable venue . the presently disclosed system and method can provide voice reinforcement (“ voice lift ”) functionality via a plurality of spatially distributed emitters (“ loudspeakers ”), providing a more uniform sound field coverage and allowing a talker &# 39 ; s voice to sound equally natural and equally intelligible at all listener locations . the disclosed system and method can also provide sound masking functionality via the same plurality of spatially distributed loudspeakers used for the voice lift function , generating more uniform levels of acoustic sound masking signals throughout the venue in which the system is deployed . fig1 depicts an illustrative embodiment of a sound reinforcement system 100 , in accordance with the present invention . in the illustrated embodiment , the sound reinforcement system 100 includes a plurality of microphones 102 a , 102 b , at least one receiver 104 , at least one sound masking signal generator 106 , at least one system controller 108 , and a plurality of emitters (“ loudspeakers ”) 112 a , 112 b , 112 c , 112 d , 112 e , 112 f spatially distributed within a venue 110 . each of the microphones 102 a , 102 b is operative to detect the speech of a human operator ( the “ talker ”), to generate at least one voice signal corresponding to the detected speech , and to provide the voice signals to the receiver 104 . as shown in fig1 , the voice signals generated by the microphones 102 a , 102 b correspond to wireless ( e . g ., infrared ( ir ) or radio frequency ( rf )) voice signals 103 , and therefore the receiver 104 is configured as a wireless ( e . g ., ir or rf ) receiver . it should be appreciated , however , that the voice signals generated by the microphones 102 a , 102 b may alternatively be provided to the receiver 104 via wired connections . for example , the voice signals 103 may be provided to the receiver 104 using institute of electrical and electronics engineers ( ieee ) 802 . 11 , bluetooth , or any other suitable wireless or wired communications protocol . in one embodiment , the receiver 104 is configured to be ceiling mountable to assure that the ir or rf signals 103 generated by the microphones 102 a , 102 b are received with minimal obstruction and / or interference . the receiver 104 provides electrical voice signals 105 corresponding to the wireless voice signals 103 generated by the microphones 102 a , 102 b to the system controller 108 . as shown in fig1 , the sound masking signal generator 106 is configured to generate at least one electrical sound masking signal 107 having a specified sound masking spectrum , and to provide the sound masking signal 107 to the system controller 108 , which receives the voice signals 105 and the sound masking signal 107 from the receiver 104 and the sound masking signal generator 106 , respectively . in one embodiment , the system controller 108 provides the voice signals 105 and the sound masking signal 107 to the six spatially distributed loudspeakers 112 a - 112 f over multiple channels 109 . for example , the system controller 108 may provide the voice signals on at least one first channel and the sound masking signal on at least one second channel , and then provide the voice and sound masking signals to the loudspeakers 112 a - 112 f over the respective channels 109 . like the receiver 104 , each of the spatially distributed loudspeakers 112 a - 112 f is configured to be ceiling mountable . in one embodiment , each of the loudspeakers 112 a - 112 f has a low directivity index , and is arranged to face downwardly from the ceiling , thereby allowing the respective loudspeaker to emit acoustic voice and sound masking signals simultaneously in one or more direct paths to the ears of individuals ( the “ listeners ”) located in the venue 110 in which the system 100 is deployed . as a result , a more uniform sound field coverage for the acoustic voice signals , and more uniform levels of the acoustic sound masking signals , can be obtained throughout the venue 110 . in an alternative embodiment , the plurality of loudspeakers can include two or more sets of loudspeakers , in which at least one set of loudspeakers is used to emit the acoustic voice signals and at least one other set of loudspeakers is used to emit the acoustic sound masking signals . in one embodiment , the sound masking signal generator 106 is configured to store at least one set of information specifying at least one sound masking spectrum , and to generate at least one electrical sound masking signal having the sound masking spectrum specified by the stored set of information . the sound masking signal generator 106 is therefore like the sound masking signal generator described in u . s . pat . no . 7 , 194 , 094 ( the &# 39 ; 094 patent ) issued mar . 20 , 2007 entitled sound masking system and assigned to the same assignee of the present invention , the entire disclosure of which is incorporated herein by reference . specifically , the sound masking signal generator 106 operates to provide two or more channels of mutually incoherent electrical sound masking signals having temporally random signals with frequency characteristics within the specified sound masking spectrum . in one embodiment , the predetermined sound masking spectrum is designed with less “ roll off ” in sound intensity in high frequency components , e . g ., frequency components above approximately 1250 hz , to provide superior sound masking in an open plan venue such as an open plan classroom or office . as described above , each of the spatially distributed loudspeakers 112 a - 112 f is configured to be ceiling mountable , to have a low directivity index , and to be arranged to face downwardly from the ceiling to allow the respective loudspeaker to emit the acoustic voice and sound masking signals simultaneously in one or more direct paths to the ears of the listeners located in the venue 110 . in the illustrated embodiment , each of the loudspeakers 112 a - 112 f is like the loudspeaker assembly described in the above - referenced &# 39 ; 094 patent , having the low directivity index and being disposable within an aperture in the ceiling . as shown in fig1 , the six loudspeakers 112 a - 112 f are disposed in a 3 - by - 2 arrangement spaced apart from one another by distances d 1 , d 2 to provide sufficient overlap in the acoustic voice and sound masking signals emitted by adjacent loudspeakers , thereby producing a uniform sound field coverage and uniform levels of acoustic sound masking signals throughout the venue 110 . it should be appreciated , however , that any other suitable number of loudspeakers in any other suitable arrangement may alternatively be employed . for example , the loudspeakers 112 a - 112 f can be wired directly to the system controller 108 , or daisy chained from one loudspeaker to the next via wired connections . as shown in fig1 , the sound reinforcement system 100 further includes a remote control unit 114 , an external audio source 116 , a network 118 , a server 120 , and a database 122 . in the illustrated embodiment , the remote control unit 114 is configured to use ir , rf , or any other suitable wireless signals 115 to transmit data and / or commands to the system controller 108 for controlling the levels of one or both of the acoustic voice signals and the acoustic sound masking signals emitted by the loudspeakers 112 a - 112 f in the venue 110 . the external audio source 116 is configured to provide additional audio input signals 117 to the system controller 108 for subsequent transmission in the venue 110 by the loudspeakers 112 a - 112 f . for example , the external audio source 116 may be a compact disk ( cd ) player , a digital video disk ( dvd ) player , a personal computer ( pc ), a source of paging signals , or any other suitable audio source . the system controller 108 is configured to be communicably connectable to the network 118 via a network connection 119 . for example , the network 118 may include one or more of a local area network ( lan ), a wide area network ( wan ), the internet , or any other suitable network . the system controller 108 is operative to communicate over the network 118 with the server 120 , which can include or be externally connectable to the database 122 . in one embodiment , the server 120 operates in conjunction with the database 122 as a database server to provide a structured collection of data files in the mp3 format or any other suitable file format for storing digital audio data . in an illustrative mode of operation , the sound reinforcement system 100 is configured to provide a voice reinforcement (“ voice lift ”) function in a classroom environment . to that end , one of the microphones 102 a , 102 b may be designed to be worn by a classroom instructor either on a lanyard , clipped as a lavaliere , or as a headset , and another one of the microphones 102 a , 102 b may be designed as a hand - held type suitable for being passed from one student to another during periods of student participation . the system controller 108 receives the voice signals 105 corresponding to the speech detected by the respective instructor and student microphones , and optionally any additional audio input signals 117 that the instructor may provide via a cd player , a dvd player , a pc , etc . in one embodiment , the voice signals 105 and the additional audio input signals 117 are provided to the system controller 108 simultaneously . the system controller 108 amplifies and processes the voice and other audio input signals 105 , 117 , as appropriate , for subsequent distribution in the venue 110 , i . e ., the classroom , via the loudspeakers 112 a - 112 f . the sound reinforcement system 100 provides features that address the communication needs of individuals who gather to meet in small or large venues such as instructors and students in a classroom environment . according to one such feature , the system controller 108 provides microphone localization processing to locate the microphone of the instructor , and to apply suitable delays to the voice and other audio signals provided to the spatially distributed loudspeakers 112 a - 112 f based on the location of the instructor &# 39 ; s microphone . as a result , the instructor &# 39 ; s voice can be made to have a more natural sound at all student locations no matter where the instructor is currently located in the classroom . such microphone localization processing is particularly useful in a large , open plan classroom environment . fig2 depicts a representative layout of the spatially distributed loudspeakers 112 a - 112 f for use in describing the microphone localization processing of the system controller 108 ( see fig1 ). as shown in fig2 , the representative layout of the loudspeakers 112 a - 112 f is like that depicted in fig1 , i . e ., the six loudspeakers 112 a - 112 f are disposed in a 3 - by - 2 arrangement spaced apart from one another by distances sufficient to provide a degree of overlap in the acoustic signals emitted by adjacent loudspeakers . the microphone localization processing can be employed to mitigate delay - related phenomena caused by the haas effect ( also called the “ precedence effect ”) when the system is deployed in a large venue such as a large , open plan classroom . specifically , the system controller 108 performs microphone localization processing by calculating time delays to be applied to voice signals generated by the talker &# 39 ; s microphone based upon the relative distances between the microphone and the respective loudspeakers spatially distributed throughout the venue . the system controller 108 typically calculates and applies such time delays when the venue is large enough to have listener locations where the observed difference between the arrival time of speech via the amplified signal path through the loudspeakers , and the arrival time of the same speech via the direct propagation signal path from the talker , exceeds approximately 20 msec . by tracking the talker &# 39 ; s microphone location and applying the calculated time delays to the amplified signals , the speech emanating from the loudspeakers can be made to sound more natural at all listener locations . applying the calculated time delays to the amplified signals also allows the listeners to locate the talker more easily . for example , in a classroom environment , students located at the rear of the classroom will be able to locate an instructor lecturing at the front of the classroom more easily because the sound of the instructor &# 39 ; s voice emanating from the loudspeakers will be delayed , thereby causing the amplified sound from the loudspeakers to reach the students at substantially the same time as the sound of the instructor &# 39 ; s unamplified voice . to calculate the appropriate amount of time delay to be applied to the amplified signals , the location of the talker &# 39 ; s microphone , e . g ., the instructor &# 39 ; s microphone 102 a , is estimated relative to the locations of the loudspeakers 112 a - 112 f spatially distributed in the venue 110 , e . g ., the classroom . as shown in fig2 , the exemplary venue 110 is partitioned into a plurality of zones 1 , 2 , 3 such that the loudspeakers 112 e - 112 f are disposed in zone 1 , the loudspeakers 112 a , 112 d are disposed in zone 2 , and the loudspeakers 112 b - 112 c are disposed in zone 3 . further , in this example , the instructor &# 39 ; s microphone 102 a is approximately centrally located in the classroom within zone 2 . next , the time delays to be applied to the amplified sound emanating from the loudspeakers 112 a - 112 f are calculated based on the time required for sound to travel from the location of the instructor &# 39 ; s microphone 102 a to the locations of the loudspeakers 112 a - 112 f in the respective zones 1 , 2 , 3 . in one embodiment , the system controller 108 can apply the calculated time delays to the amplified signals by digitizing the voice signals 105 provided by the receiver 104 , buffering the digitized voice signals , and sampling the buffered signals at the calculated time delays . for example , a first time delay may be applied to the sound emanating from the loudspeakers 112 e - 112 f in zone 1 and a second time delay may be applied to the sound emanating from the loudspeakers 112 b - 112 c in zone 3 , while no time delay is applied to the sound emanating from the loudspeakers 112 a , 112 d in zone 2 where the instructor &# 39 ; s microphone 102 a is located . in one embodiment , the location of the instructor &# 39 ; s microphone 102 a in the venue 110 , e . g ., the classroom , is estimated by using a wavefront curvature technique . to employ the wavefront curvature technique , both the microphone 102 a and the receiver 104 may be implemented as ir devices . for example , the ir receiver 104 may be configured as a two dimensional array of ir point sensors . by measuring the time delay of the ir signals generated by the microphone 102 a between the ir point sensors of the two dimensional array , such as by cross - correlation of the ir sensor outputs , the curvature of the arriving ir wavefront , the direction of the microphone 102 a relative to the receiver 104 , and the distance between the microphone 102 a and the receiver 104 can be estimated . using the estimated direction and distance of the microphone 102 a relative to the receiver 104 and the known locations of the loudspeakers 112 a - 112 f in the venue 110 , the distances between the microphone 102 a and the respective loudspeakers 112 a - 112 f can be determined . the appropriate time delays to be applied to the sound emanating from the loudspeakers 112 a - 112 f can then be calculated based on the distances between the microphone 102 a and the respective loudspeakers 112 a - 112 f . according to another feature , the sound reinforcement system 100 of fig1 can be incorporated for use in a voip emergency or other event notification system , as illustrated in fig3 . as shown in fig3 , a sound reinforcement system 300 deployed in a classroom environment can be communicably connected to a school or campus emergency response center via a network 318 . the sound reinforcement system 300 includes at least one microphone 302 , a system controller 308 , at least one loudspeaker 312 , at least one optional ear - bud device 326 , and an emergency on / off switch 324 for enabling the emergency or other event notification functionality . the microphone 302 is communicably connected to a voip encoder / decoder 308 . 1 and a voice lift processor 308 . 2 contained in the system controller 308 . the emergency on / off switch 324 is also communicably connected to the voip encoder / decoder 308 . 1 , which in turn is communicably connectable to the ear - bud device 326 via a bluetooth transmitter 308 . 3 contained in the system controller 308 . as further shown in fig3 , the school or campus emergency response center includes an emergency processor 328 containing an alert processor 330 , a voip encoder / decoder 332 , and a server 320 , an alert display 334 , at least one microphone 336 , and at least one audio output 338 . the system controller 308 within the sound reinforcement system 300 can communicate with the emergency processor 328 over the network 318 . in addition , the alert processor 330 can provide alert outputs for display on the alert display 334 , and the voip encoder / decoder 332 can receive input signals and provide output signals from / to the microphone 336 and the audio output 338 , respectively . accordingly , if an emergency occurs in the classroom , then the network 318 connecting the sound reinforcement system 300 to the school / campus emergency response center can be used as a communications path to inform school officials and / or emergency responders of both the occurrence and the characteristics of the emergency . in one embodiment , the network 318 corresponds to a school / campus data network generally accessible from every classroom in the school or on the campus . the two - way voip capability provided over the network 318 allows both emergency signaling and voice communications between the sound reinforcement system 300 and the school / campus emergency response center . in one embodiment , such emergency communication is implemented at the classroom in three steps , specifically , ( 1 ) notifying the school / campus emergency response center of the emergency , ( 2 ) describing the emergency in detail to the emergency response center , and ( 3 ) responding to instructions from the emergency response center for mitigation of the emergency . for example , such emergency notification may be accomplished by activating a pushbutton or a series of pushbuttons on the emergency on / off switch 324 , which may be located on the lavaliere microphone , on one of the hand - held microphones , or on the voice lift unit itself , or by providing speech recognition in the system controller 108 . upon activating the emergency notifying signal , the time and location of the emergency is determined and recorded at the server 320 and subsequently routed to the emergency responders . subsequent speech further describing the nature of the emergency , provided via the microphone 302 , can also be recorded at the server 320 and routed to the emergency responders . upon receipt of the time , location , and description of the emergency , the emergency responders can , should the situation require it , provide information to an instructor alone through the ear - bud device 326 . the emergency responders can also activate emergency paging in the classroom and / or on a wider basis ( e . g ., building - wide or campus - wide ), and initiate a two - way dialog with the individuals in the classroom over the network 318 for implementing possible emergency mitigation scenarios . according to still another feature , the sound reinforcement system 100 of fig1 can be incorporated for use in a voip point - to - point communication system , as illustrated in fig4 . as shown in fig4 , a plurality of sound reinforcement systems 400 a , 400 b , 400 c , 400 d can be deployed in multiple classrooms , respectively , either in a school or on a campus . further , each of the sound reinforcement systems 400 a - 400 d is communicably connected to a server 420 via a local network 418 . 1 , which in turn is communicably connected to an external network 418 . 2 such as the internet . each of the systems 400 a - 400 d includes at least one microphone 402 , a system controller 408 , a plurality of loudspeakers 412 a , 412 b , and a network connection on / off switch 324 for enabling the voip point - to - point communication functionality . the microphone 402 is communicably connected to a voip encoder / decoder 408 . 1 and a voice lift processor 408 . 2 contained in the system controller 408 . the pod - cast on / off switch 424 is also communicably connected to the voip encoder / decoder 408 . 1 . moreover , the system controller 408 within each sound reinforcement system 400 a - 400 d can communicate with the server 420 over the local network 418 . 1 , and with a system 400 e deployed in a remote classroom over the internet 418 . 2 . in the illustrated embodiment , the system 400 e is like the sound reinforcement systems 400 a - 400 d , and is deployed in the remote classroom for enabling voip point - to - point communication , e . g ., for remote learning , with the systems 400 a - 400 d over the networks 418 . 1 - 418 . 2 . according to yet another feature , the sound reinforcement system 100 of fig1 can be employed in a voip pod - casting application , as illustrated in fig5 . as shown in fig5 , a sound reinforcement system 500 deployed in a classroom environment can be communicably connected to a local computer 540 and a server 520 via a local network 518 . 1 , and to a remote computer 542 via the local network 518 . 1 and an external network 518 . 2 such as the internet . the sound reinforcement system 500 includes at least one microphone 502 , a system controller 508 , and an on / off switch 524 for enabling the voip pod - casting functionality . the microphone 502 is communicably connected to a voip encoder 508 . 1 contained in the system controller 508 . the pod - cast on / off switch 524 is also communicably connected to the voip encoder 508 . 1 , which in turn is connectable to the network 518 . 1 . in the voip pod - casting application , the capability of the system 500 to convert sounds into data packets allows archiving , storing , recovering , and replaying of those sounds concurrently or at some later time . for example , a lecture presented by an instructor , inclusive or exclusive of commentary from the student audience , may be recorded and archived , allowing others who may have missed the lecture , or may wish to revisit the lecture in the course of studying , to download and replay ( e . g ., pod - cast ) the lecture at anytime in the future . in one embodiment , the system 500 can record digital audio , convert it to any suitable audio format , e . g ., compressed ( mp3 , mp4 , etc .) or uncompressed ( wav , etc . ), and allow the instructor or others to catalog the recording appropriately . such recording capability allows instructors and their supervisors to listen to the instructors ’ lectures at some later time for the purpose of oversight and / or evaluation . in addition , the system 500 can be combined with a video recording / broadcasting system to create integrated audio / video broadcasts for use in remote learning . according to still yet another feature , the sound reinforcement system 100 of fig1 can be employed in a voip paging application , as illustrated in fig6 . as shown in fig6 , a sound reinforcement system 600 deployed in a classroom environment can be communicably connected to an administration center 616 via a local network 617 . the administration center 616 includes at least one microphone 616 . 1 and a voip paging interface 616 . 2 . the sound reinforcement system 600 includes a system controller 608 , a plurality of loudspeakers 612 a , 612 b , and an optional ear - bud device 626 . the system controller 608 includes a voip decoder 608 . 1 , which is connected to the loudspeakers 612 a , 612 b . in this example , the voip decoder 608 . 1 is also communicably connectable to the optional ear - bud device 626 via , e . g ., a bluetooth transmitter 608 . 2 contained in the system controller 608 . in the voip paging application , the system controller 608 converts voice signals generated by the microphone 616 . 1 into data packets , which may be received by any compatible voip device ( e . g ., a telephone , a pc , etc .) or by another installation of the sound reinforcement system ( not shown ). the sound corresponding to the data packets may subsequently be played through the spatially distributed loudspeakers 612 a , 612 b disposed in one or more of the respective systems . having described the above illustrative embodiments , other alternative embodiments or variations may be made . for example , the sound reinforcement system may be configured to distribute a voice lift function and a sound masking function via separate loudspeaker assembly systems ; e . g ., the sound masking signal may be distributed via upwardly facing loudspeakers in the ceiling plenum . the sound reinforcement system may be configured to include one or more personal receiver / amplifier / loudspeaker units for use by audibly challenged individuals in the venue in which the system is deployed . in addition , the sound reinforcement system may be configured to provide for the distribution of two or more channels of sound generated by one or more music sources . for example , the system can be configured to associate adjacent loudspeakers with different channels for appropriately distributing , e . g ., the “ right ” and “ left ” channels of stereophonic sound . because the subjective improvement of musical sound from stereophonic music sources is mostly due to the incoherence among the channels , the spatially distributed loudspeakers need not be arranged in the right - left configuration of traditional stereo sound systems . the system can also be provided with one or more “ woofer ” loudspeakers , cross - over filters , and / or power amplifiers to raise the output level and / or improve the quality of the musical sound . in addition , it was described above that the system controller can receive voice signals and a sound masking signal , and provide the voice signals and the sound masking signal to a plurality of spatially distributed loudspeakers over multiple channels . in alternative embodiments , the system controller can be configured to incorporate any suitable digital signal processing capability to allow a user to select any desired functionality or any desired combination of functionalities , including but not limited to voice lift , sound masking , paging , pod - casting , emergency broadcasting , and / or remote learning . it will be appreciated by those of ordinary skill in the art that modifications to and variations of the above - described distributed emitter voice lift system may be made without departing from the inventive concepts disclosed herein . accordingly , the invention should not be viewed as limited except as by the scope and spirit of the appended claims .	7
the cable lock / bracket combination 10 of the present invention is shown in fig1 as attaching a cable - type bicycle lock 14 to a strut 8 of a bicycle . the cable lock 14 has a lock head 16 and a cable 18 . the cable 18 is permanently attached to the lock head 16 at an anchor end 20 and is releasably attached to the lock head 16 at a free end 22 . the lock head 16 includes a keyway 24 that accepts a key for accessing an internal locking mechanism . when closed , the locking mechanism retains the cable free end 22 through an aperture 26 in the side of the lock head 16 . when opened by the key , the locking mechanism releases the free end 22 , allowing it to be removed from the aperture 26 so the cable 18 may be snaked through the bicycle and a stationary fixture . alternatively , a set of combination dials , rather than a key , operates the locking mechanism . the cable 18 is typically composed of braided steel encased in vinyl , but the present invention contemplates that any form of cable may be used . the bracket 12 attaches to a frame strut 8 and has two sections , an attachment 30 and a seat 32 . the attachment 30 is adapted to mount the bracket 12 to the frame strut 8 . the present invention contemplates using any form of mounting that is adequate for the task , two of which are briefly described below . a unitary embodiment 36 of the attachment 30 is shown in fig3 . the unitary embodiment 36 consists of a flap 38 that extends from one side of the bracket 12 and wraps around the frame strut 8 . the end 40 of the flap 38 has a hole 42 through which a screw 44 extends . the screw 44 is tightened via a nut 46 to secure the bracket 12 to the frame strut 8 . the clamp embodiment 50 of the attachment 30 is shown in fig3 . the face 52 of the bracket 12 includes a semi - cylindrical surface . a hose clamp 54 or other similar device extends around the frame strut 8 and through a slot 56 behind the face 52 . the clamp 54 is tightened to secure the bracket 12 to the frame strut 8 . at the opposite end of the bracket 12 from the attachment 30 is the seat 32 . the seat 32 has a cavity 60 , the inner surface of which is shaped somewhat like a funnel . the lock head 16 fits into the cavity 60 , where the cable 18 extending from the lock head 16 fits through an opening 62 at the bottom of the cavity 60 . typically , gravity holds the lock head 16 in the cavity 60 . the purpose of the funnel shape is to act as a stop limiting the distance that the lock head 16 can go into the cavity 60 , thereby preventing the lock head 16 from falling through the cable opening 62 . the exact shape of the cavity 60 is not particularly important . the only restrictions are that the lock head 16 can fit into the cavity 60 and that the cable opening 62 is too small for the entire lock head 16 to fit through . preferably , the shape of the lock head 16 and cavity 60 are matched so that the lock head 16 fits snuggly within the cavity 60 . a snug fit minimizes movement of the lock head 16 within the cavity 60 . an improvement over the prior art is a gap 64 in the side of the cavity 60 that allows for insertion of the cable 18 into the cavity 60 . without the gap 64 , as in the prior art , the cable 18 would have to be released from the lock head 16 and the free end 22 snaked completely through the cavity 60 . the gap 64 provides a much more convenient way to insert the lock head 16 into the cavity 60 . the gap 64 should only be wide enough to allow the cable 18 to fit through . it should not be so wide as to compromise the integrity of the bracket 12 or to allow the lock head 16 to fit through . in the typical cable lock , the aperture 26 into which the free end 22 of the cable 18 is inserted is located on the side of the lock head 16 . if the cavity 60 is sized so that the aperture 26 would fall within the cavity 60 , a means must be provided to accommodate the cable 18 when the free end 22 is in locked into the aperture 26 . a notch 68 in the upper edge 66 of the cavity 60 provides a location for the cable 18 . the notch 68 can also provide a secondary function , which is to prevent the lock head 16 from rotating within the cavity 60 . normally , however , this function is unnecessary if the cavity 60 and lock head are shaped to prevent rotation . for example , in the embodiment of fig1 the lock head has an approximately oval horizontal cross - section , so that it cannot rotate within the cavity 60 . optionally , the seat 32 has a latch for securing the lock head 16 into the cavity 60 , as shown in fig5 and 6 . the latch precludes the need for gravity to hold the lock head 16 in the cavity 60 , so that various orientations of the bracket 12 are possible . the latch includes an arm 72 in four sections . the lower end of the spring section 74 is anchored to the bracket 12 , as at 76 . extending at about 90 ° from the upper end of the spring section 74 is an offset section 78 , which offsets the knob section 80 from the spring section 74 . extending in the opposite direction from the offset section 78 is a tongue 82 . the arm 72 is positioned so that it can flex between a latched position and an unlatched position . in the latched position , the tongue 82 extends into the cavity 60 . in the unlatched position , the tongue 82 does not extend into the cavity 60 . the spring section 74 biases the arm 72 to the latched position , so that manual force is needed to move the arm 72 to the unlatched position . when the manual force is removed , the arm 72 returns to the latched position . when the lock head 16 is within the cavity 60 , the tongue 82 fits into a groove 88 in the lock head 16 . the upper surface of the tongue 82 is curved downwardly , as at 84 , so that the arm 72 is pushed out of the way when the lock head 16 is being inserted into the cavity 60 . when the lock head 16 is fully inserted into the cavity 60 and the tongue 82 is aligned with the groove 88 , the arm 72 snaps back so that the tongue 82 is in the groove 88 . the lower surface of the tongue 82 and the lower surface of the groove 88 are flat so that the lock head 16 cannot be pulled from the cavity 60 . the lock head 16 is removed from the cavity 60 by manually pulling back on the knob 80 so that the tongue 82 comes out of the groove 88 , and then pulling the lock head 16 from the cavity 60 . the arm 72 can be located anywhere around the circumference of the seat 32 . most preferably , however , it is located in the section of the seat nearest the attachment 30 . this gives the most support and protection to the arm 72 . because the arm 72 has a protruding knob 80 and is somewhat flexible , it would be vulnerable to having an external object catch on it and snap it off if not protected . preferably , the bracket 12 is composed of a rigid plastic , such as abs , nylon 6 / 6 , or glass - filled nylon 6 / 6 . thus it has been shown and described a cable lock and bracket which satisfies the objects set forth above . since certain changes may be made in the present disclosure without departing from the scope of the present invention , it is intended that all matter described in the foregoing specification and shown in the accompanying drawings be interpreted as illustrative and not in a limiting sense .	8
following is a description of one exemplary data center environment in which a heat removal system may be implemented according to some embodiments . fig1 depicts a diagram schematically illustrating a layout of a data center heat removal system according to some embodiments . in the example of fig1 , a data center heat removal system for a data center 100 includes a chilling unit 102 . as will be described in greater detail below , the chilling unit 102 may include a housing , one or more fans or similar devices configured for drawing in air from outside the data center , one or more misters for cooling the air , and one or more chiller units for further reducing the air temperature . the data center 100 may include one or more server pods 106 a and 106 b . the server pods 106 a and 106 b may be embodied as self - contained rooms or enclosures that have walls 107 , doors 116 a , 116 b , 116 c , 116 d , and ceilings ( not shown ). the server pods 106 a and 106 b are configured to house one or more banks of servers 108 a , 108 b and 108 c , and 108 d , respectively . the server banks 108 a , 108 b and 108 c , and 108 d may comprise racks of servers mounted on above each other . it is noted that while two server pods are illustrated , in practice , a data center may employ many more . thus , the figures are by way of example only . the server pods 106 a and 106 b include openings 112 for drawing in cool air from the chilling unit 102 via one or more “ cold aisles ” 115 . additional cold aisles may be formed between other server pods , in the example where the data center includes numerous server pods . the server pods 106 a and 106 b may further be configured such that banks of servers 108 a and 108 b ( and similarly , server banks 108 c and 108 d ) are separated by a “ hot aisle ” 110 a and 110 b , respectively . in operation , cold air is drawn in from the cold aisle ( s ) 115 and flows across the server banks 108 a and 108 b ( and similarly , server banks 108 c and 108 d ), where the air is heated by the servers . the heated air , isolated in the hot aisles 110 a and 110 b , is then drawn up and out through vents 117 a and 117 b in the ceiling of the respective pods 106 a and 106 b . the heated air escaping from the hot aisles 110 a and 110 b will yield lower pressure in the hot aisles 110 a and 110 b , causing cool air to be drawn from the cold aisle ( s ) 115 . the air circulation can be controlled by varying the volume of air allowed through the supply side or through the exhaust side or both ( described in detail below ). accordingly , air heated by the server banks 108 a , 108 b and 108 c , and 108 d will rise to the top of the pods 106 a and 106 b via natural convection and be vented through vents 117 a and 117 b . some embodiments provide a sealed hood for the hot air flows ( see e . g ., the hood 211 shown in fig2 ). in some embodiments , additional fans may be provided in or in conjunction with the vents 117 a and 117 b to assist in drawing out the heated air and / or to maintain a desired pressure differential . as illustrated by the exemplary flow lines in fig1 ( represented by lines 114 a and 114 b ), air flows from the chilling unit 102 into one or more cold aisles 115 , from which they are drawn into the server pods 106 a and 106 b via openings 112 . inside the server pods 106 a and 106 b , internal fans of the servers ( not shown ) may draw the air across the servers and out into the hot aisles 110 a and 110 b . from the hot aisles 110 a and 110 b , the heated air is vented through the vents 117 a and 117 b . in some embodiments , the vents 117 a and 117 b may be provided with or associated with fans that draw air up into them . in some embodiments , the fans are coupled to or controlled by one or more pressure sensors , which can be utilized to ensure that the pressure in the hot aisles 110 a and 110 b is lower than the pressure in the cold aisles 115 . for example , if the pressure in the hot aisle 110 a or 110 b is detected as being the same or higher than the pressure in the cold aisle 115 , the respective fans may be operated at a higher speed to draw more air in the hot aisles 110 a and 110 b up for venting through the vents 117 a and 117 b . this ensures that a desired pressure differential , and / or a desired air flow rate , can be maintained or otherwise controlled . fig2 is a perspective view illustrating an exemplary server pod of a data center that houses a plurality of server banks ( now shown ). for clarity , only one server pod is shown . the data center of fig2 may be an embodiment of the data center 100 shown in fig1 . in this example , a server pod 206 a and an adjacent server pod ( not shown ) are separated by cold aisle 215 . the sides of the server pod 206 a include screened openings 212 for admitting cool air into the server pods 206 a . as illustrated , the server pod 206 a includes an access door 216 a defining an opening to the hot aisle ( not shown ) inside the server pod 206 a . in the example illustrated , the server pod hot aisle ( inside the server pod 206 a ) extends from the ceiling of the server pod 206 a to the ceiling of the data center via an enclosure or hood 211 . the cold aisle 215 is pressurized with cool air which is then drawn through the racks of the server pod 206 a , as illustrated by arrows 214 . the air is then drawn out the top of the server pod 206 a via the enclosed or sealed hood 211 . as described above with respect to fig1 , a data center heat removal system may include one or more chilling units , such as the chilling unit 102 . fig3 is a block diagram of one exemplary arrangement of a chilling unit 300 , which may be used in a data center according to some embodiments . the chilling unit 300 may include a structure or housing for housing the various components of the chilling unit , described below . in one example , a housing may comprise a shipping container housing , being approximately 20 feet long , 7 ′ 10 ″ tall , and 7 ′ 8 ″ wide according to one non - limiting example . other types and sizes are may also be used . in the exemplary chilling unit 300 shown in fig3 , the direction of air flow through the chilling unit 300 is shown by the arrows at each end of the chilling unit 300 . ambient air enters the chilling unit 300 at a first end 301 ( as shown by the arrow 303 ) and exits at a second end 305 into the data center ( as shown by the arrow 307 ). in the example illustrated in fig3 , the chilling unit 300 includes a first fan unit 314 , a first filter 312 , a second fan unit 310 , a mister 308 , a chiller unit 306 , a third fan unit 304 , and a second mister 302 . in some embodiments , each of the components may be configured to extend across a cross section of the container . further , in some embodiments , one or more of the components may not be necessary . for example , in some embodiments , the chiller unit 306 may not be required by a data center heat removal system disclosed herein ( e . g ., the data center 100 shown in fig1 ) where the air outside a data center configured with the data center heat removal system is usually at a sufficiently cool temperature ( e . g ., depending upon the climate , location , and / or altitude at which the data center is located ) that artificial cooling may not be necessary . furthermore , in some embodiments , the humidity of the air may be such that only one mister is needed . in some embodiments , the number and configuration of fan units in the chilling unit 300 may be chosen based on air flow requirements , as desired . in some embodiments , the fan units 314 , 310 , and 304 may each include four 44 ″ drum fans capable of moving approximately 72 , 000 cfm of air . the control of the fan units is described in detail below . the filter units 312 may be implemented as four - stage hepa filters in some embodiments . in some embodiments , the chiller unit 306 may be configured to include chillers on both sides of the chilling unit 300 , with coils that extend to meet each other at 45 degrees from the sides . in some embodiments , the coil units may be hinged such that , when not in use , they can swing to the sides of the chilling unit using motors . in some embodiments of a data center heat removal system , various types of sensors can be placed in a data center to sense various conditions in the data center . in some embodiments , the sensed conditions are stored in a database and are used by a control system to control the operation of the components of the chilling unit and associated fans , vents , etc . ( described below ). the control system may be associated with the chilling unit 300 or the data center itself , or both . the sensors may include temperature sensors , humidity sensors , air flow sensors , pressure sensors , and / or other types of environmental sensors . in some embodiments , each chilling unit 300 may provide up to 60 , 000 cfm of air to the data center at or under 78 degrees . in other embodiments , each chill unit 300 may provide more or less capacity , as desired . while the chilling unit 300 is pressurizing the data center , the variable speed ceiling fans ( e . g ., for the vents 117 a and 117 b of fig1 or the hood 211 of fig2 ) of the data center may be adjusted to keep the pressure in the hot aisles at lower than the cool side of the system . when the temperature is below a threshold value ( e . g ., 65 degrees ), one of the fans may be slowed or shut off to decrease the pressure and the ceiling fan will slow to reduce amount of air that is being released . fig4 - 7 are views of an exemplary chilling unit according to some embodiments . other configurations and layouts are also possible . in fig4 - 7 , the housing walls are hidden to show the chilling unit components inside the housing . fig4 is an isometric view of a chilling unit . fig5 is a top view of the chilling unit shown in fig4 . fig6 is a side view of the chilling unit shown in fig4 . fig7 is an end view of the chilling unit shown in fig4 . as mentioned above , in some embodiments , a chilling unit can be housed using a standard shipping container . a typical shipping container is comprised of a steel box having doors at one end . although a standard shipping container works well as a chilling unit housing , a customized housing can also be used . in one example , a standard 20 foot freezer shipping container is used . in this example , an intake area ( described below ) is formed at one end of the container . as shown in fig4 - 7 , a chilling unit 400 includes a housing 410 having doors 412 at one end . during use of the chilling unit 400 , the doors 412 are opened , or completely removed . in fig4 - 6 , the direction of air flow through the chilling unit 400 is from right to left . at the right end of the chilling unit 400 are a plurality of vents 414 that form openings in the housing 410 to allow air to be drawn into the chilling unit 400 from outside . in the example shown in fig4 , the vents 414 are formed on the end , and on 3 sides of the housing 410 . downstream from the vents 414 are one or more fans 416 . in the example shown in fig4 - 7 , four fans are arranged to substantially cover the cross - sectional area of the housing 410 . more or fewer fans could be used . as described in more detail below , the fans 416 may be single or variable speed , and may be controlled together or independently . the fans 416 draw air into the chilling unit 400 via the vents 414 , and force the air through filter ( s ) 418 . in one example , the fans 416 are 42 inch drum fans , each capable of moving 18 , 200 cubic feet per minute ( cfm ) of air . in the example of fig4 - 7 , four fans are placed in the intake side . in other examples ( e . g ., fig3 ), four more fans are placed on the exhaust end of the housing 410 . in one example , the filters are 3 - stage heap filters angled at 45 degrees from both sides to provide more surface area . downstream from the filters 418 is a mister 420 . in the example shown , the mister 420 comprises a series of mister nozzles near the top of the housing 410 pointing downward . when the mister 420 is activated , a fine mist 422 of water is sprayed downward as the air flows through the chilling unit 400 . depending on the temperature and relative humidity , the mister 420 can lower the temperature of the air by approximately 10 degrees . downstream from the mister 420 are mister cooling elements 424 . for clarity , the mister cooling elements 424 are not shown in fig4 , but are shown in fig5 - 6 . the mister cooling elements 424 are made of a metal material and help to cool the air even further by providing a surface for mist condensation . as the air flows through the mister cooling elements 424 , the air is not only cooled by evaporating mist , but also by passing through the mister cooling elements 424 . the mister cooling elements 424 can be any configuration that allows air to flow through , while providing a metal surface for mist condensation . examples of the mister cooling elements 424 can include coils , a metal grate or mesh , etc ., as one skilled in the art would understand . downstream from the mister 420 and the mister cooling elements 424 are a pair of chillers 426 mounted on opposite walls of the housing 410 . the chillers 426 can be conventional off - the - shelf air - conditioning or freezer units configured to chill the air . if the air needs to be further cooled , one or more of the chillers 426 can be turned on . fig5 - 6 also show freezer elements such as freezer coils 428 disposed within the housing 410 between the chillers 426 . the freezer elements 428 are extensions of piping from the chillers 426 extending into the chiller unit 400 to improve heat transfer with the air . in one example , the freezer elements 428 are configured to extend out at a 45 degree angle from the sides of the housing 410 . in one example , the freezer elements 428 are movable to automatically swing back against the interior wall of the housing 410 when not in use . note that the configuration of a chilling unit can take on many configurations , as desired . for example , the chilling unit 300 shown in fig3 has three sets of fans and two sets of misters . depending on various factors , such as local climate , data center size , cost limitations , etc ., a chilling unit can be configured in such a way as to balance desired performance and cost . as mentioned above , the temperature of a data center can be controlled and maintained by sensing various conditions in the data center and controlling various components of a system accordingly . fig8 is a block diagram illustrating a system 800 that is configured to maintain a desired data center temperature in the most energy efficient manner possible . the system 800 has a controller 810 capable of interfacing and controlling the various components of the system 800 . the controller 810 may be comprised of a single device that interfaces with the components of the system 800 , or may include multiple devices working together . for example , a data center may have separate fan controllers , chiller controllers , etc . in one example , a web - based application runs on a server 812 and controls the operation of the controller 810 . one or more client devices 814 can be used by a technician to configure and monitor the controller via the web - based application . the system 800 uses a plurality of sensors 816 to sense various conditions in the data center . the sensors may include temperature sensors , humidity sensors , air flow sensors , and / or pressure sensors , and any other desired sensors . the temperature sensors may sense the temperature in the hot isles , cold isles , server pods , chilling units , exhaust vents , individual servers , etc . the ambient temperature can also be sensed outdoors or at the intake portion of the chilling unit . similarly , humidity sensors can also sense the humidity anywhere in the data center , as desired . pressure sensors sense air pressure at various places in the data center . by monitoring the air pressure throughout the data center , a desired air flow through the system can be maintained . in one example , the air pressure is sensed in the cold isles , hot isles , and exhaust vents . the system 800 may also use any other type of sensor desired . the system 800 controls the operation of the fans 818 of the system to maintain a desired air flow throughout the system . for example , a data center may have fans in the chilling units ( e . g ., fans 416 in fig4 ) and in the exhaust vents ( e . g ., vents 117 a and 117 b in fig1 ). the controller 810 controls whether the fans are on or off , as well as controlling their speed , when variable speed fans are used . the controller 810 is capable of determining how to most efficiently use the fans to maintain a desired air flow , and thus temperature . for example , if a given amount of air flow is needed to maintain a target temperature , the controller can selectively activate individual fans , and control them at desired speed ( s ) to achieve a desired airflow using the least amount of electricity possible . the system 800 can also control the opening and closing of vents 820 in the system , if the system is equipped with closable vents . for example , the intake vents of the chilling units may include louvers that can be opened and closed by the controller 810 . similarly , the exhaust vents can be opened and closed by the controller 810 . the vents 820 can not only be opened and closed , but can be opened a desired amount , to further control the amount of air flow through the vents 820 . the system 800 also controls the operation of the misters 822 ( e . g ., misters 420 in fig4 ) of the system to lower the air temperature in the system . as described above , activating the misters 822 can , under the right conditions , lower the air temperature by approximately 10 degrees . the misters 822 have the most effect in low - humidity conditions . by knowing the humidity of the air , the controller 810 can determine when activating the misters 822 will have a beneficial effect . the system 800 also controls the operation of the chiller units 824 ( e . g ., chillers 426 in fig4 ) of the system to lower the air temperature . by activating the chiller units 824 , the air temperature can be significantly lowered to help achieve a desired air temperature . the controller 810 may also control various other components , as desired . in addition , the controller 810 and web - based application can monitor , log , and report various aspects of the operation of the system 800 . the system 800 may include monitors , visual indicators , alarms , etc ., either via client devices or standalone indicators and devices , to allow users or technicians to monitor the operation of the system 800 . the system 800 is controlled to achieve a desired target temperature in the server pods in the most efficient manner possible . the dominate factor that determines the cost of cooling a data center of electricity usage . the various components of the system 800 that contribute to lowering air temperatures each use different amounts of electricity . therefore , the controller 810 is configured to achieve and maintain a target temperature by controlling the system components in such a way that electricity usage is minimized . a goal of the controller is to maintain a desired target temperature , using the least possible amount of electricity . when the chiller units may use significantly more power than the fans and misters , the controller will try to maintain the desired target temperature without using the chiller units , or at least minimizing the use of the chiller units . similarly , the controller will selectively activate and control the speed of the fans to achieve a desired airflow using the least amount of power . in one example , the controller 810 uses an algorithm to control the system . the algorithm may , when possible , maintain a desired target temperature without using the chiller units 824 . for example , under the right conditions , the desired target temperature can be maintained by controlling the activation and speed of the fans 818 alone . under the right conditions ( e . g ., a relatively low humidity level ), the misters 822 may be used with the fans . use of the misters 822 may allow fans usage to be reduced , further lowering power usage . the control algorithm , via the sensors , knows the conditions ( e . g ., temperature , humidity , air pressure differentials ) in the system , and can control the system accordingly . for example , assume that an x degree temperature drop is needed . knowing the outside ambient air temperature , the various temperatures in the system , and the relative air pressures in the system , the controller can determine that y cubic feet of air flow is needed to reach the desired target temperature . the controller then selectively activates and controls the speed of the fans in the system to achieve the determined air flow rate . the controller also takes into account how activation of the misters will affect the air temperature , and thus the desired air flow rate . when the sensed conditions indicate that use of the misters would be beneficial , the misters will be activated . as a result , the controller can maintain the desired target temperature using a combination of fans and the misters in the most efficient way possible , preferably without relying on the chiller units . if the outside ambient temperature is high enough ( perhaps 78 degrees , in one example ), the desired target temperature may not be achievable with fans and mister alone . when that is the case , the controller will turn on one or more of the chiller units to bring the air temperature down to the desired target level . fig9 is a logical control diagram illustrating an example of the control of the fans ( e . g ., fans 416 in fig4 ) in a chilling unit based on a sensed condition . in the example illustrated in fig9 , the controller controls the amount of air flow through the system based on the temperature of the air at the intake of the chilling unit . in general , cooler air requires less air flow to cool the data center , while warmer air requires more air flow to cool the data center . as shown in fig9 , the controller obtains a temperature reading from one or more temperature sensors . the temperature sensor ( s ) may be located at the intake of the chilling unit , outside of the chilling unit , or at any other suitable location . in this example , if the sensor reports an air temperature of approximately 50 degrees fahrenheit , the controller sends a digital signal to the chilling unit fans to run at 50 cfm / kw . as indicated by the air flow rate values in fig9 , the desired flow rate also depends on the amount of power being consumed in the data center , in this example , 50 cfm / kw . in other words , when more power is being consumed by the data center , more heat is generated , and therefore , more air flow is needed . the desired flow rate can be achieved by selectively activating fans , as well as setting the speed of the activated fans . in some examples , the air flow rate may be fine - tuned by also controlling exhaust fans . if the sensor reports an air temperature of approximately 70 degrees fahrenheit , the controller sends a digital signal to the chilling unit fans to run at 126 cfm / kw . if the sensor reports an air temperature of approximately 90 degrees fahrenheit , the controller sends a digital signal to the chilling unit fans to run at 225 cfm / kw . other components of the system ( e . g ., misters , coolers , etc .) can be controlled in a similar manner based on any desired sensed conditions , as one skilled in the art would understand . also note that the activation of different components of the system may affect each other . for example , if the misters are activated , a lower air flow rate may be desired , compared to a desired air flow rate without the misters . note that it is important to not only lower the temperature of a data center to a desired level , but to not let the temperature drop too far below the desired level . the reliability of some server equipment relies on a relatively constant temperature . therefore , in some conditions ( e . g ., winter months ), the outside ambient air will be cool enough that the controller will restrict air flow to keep the air temperature up to the desired target value . the systems described above can be built into a new data center or retrofitted into an existing data center . in an example where a system is retrofitted into an existing data center , one or more chilling units can each be installed in an opening formed in a data center wall , as illustrated in fig1 . in each hot isle , an exhaust vent / hood ( e . g ., vents 117 a and 117 b in fig1 ) is created to draw hot air out of the data center . a controller and various sensors ( e . g ., temperature , humidity , and / or pressure , etc .) can also be installed to monitor and control the operation of the system . these , and other , aspects of the disclosure and various features and advantageous details thereof are explained more fully with reference to the exemplary , and therefore non - limiting , embodiments illustrated herein . it should be understood , however , that the detailed description and the specific examples , while indicating the preferred embodiments , are given by way of illustration only and not by way of limitation . descriptions of known programming techniques , computer software , hardware , operating platforms and protocols may be omitted so as not to unnecessarily obscure the disclosure in detail . various substitutions , modifications , additions and / or rearrangements within the spirit and / or scope of the underlying inventive concept will become apparent to those skilled in the art from this disclosure . some embodiments described herein can be implemented in the form of control logic in software or hardware or a combination of both . the control logic may be stored in an information storage medium , such as a computer - readable medium , as a plurality of instructions adapted to direct an information processing device to perform a set of steps disclosed in the various embodiments . based on the disclosure and teachings provided herein , a person of ordinary skill in the art will appreciate other ways and / or methods to implement the invention . it is also within the spirit and scope of the invention to implement in software programming or code the steps , operations , methods , routines or portions thereof described herein , where such software programming or code can be stored in a computer - readable medium and can be operated on by a processor to permit a computer to perform any of the steps , operations , methods , routines or portions thereof described herein . the invention may be implemented by using software programming or code in one or more control systems , by using application specific integrated circuits , programmable logic devices , field programmable gate arrays , optical , chemical , biological , quantum or nanoengineered systems , components and mechanisms , various types of sensors including temperature , humidity , and / or pressure sensors may be used . the functions of the invention can be achieved by various means including distributed , or networked systems , hardware components , and / or circuits . in another example , communication or transfer ( or otherwise moving from one place to another ) of data may be wired , wireless , or by any other means . a “ computer - readable medium ” may be any medium that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , system or device . the computer readable medium can be , by way of example only but not by limitation , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , system , device , propagation medium , or computer memory . such computer - readable medium shall be machine readable and include software programming or code that can be human readable ( e . g ., source code ) or machine readable ( e . g ., object code ). examples of non - transitory computer - readable media can include random access memories , read - only memories , hard drives , data cartridges , magnetic tapes , floppy diskettes , flash memory drives , optical data storage devices , compact - disc read - only memories , and other appropriate computer memories and data storage devices . in an illustrative embodiment , some or all of the software components may reside on a single server computer or on any combination of separate server computers . as one skilled in the art can appreciate , a computer program product implementing an embodiment disclosed herein may comprise one or more non - transitory computer readable media storing computer instructions translatable by one or more processors in a computing environment . a “ processor ” includes any , hardware system , mechanism or component that processes data , signals or other information . a processor can include a system with a central processing unit , multiple processing units , dedicated circuitry for achieving functionality , or other systems . processing need not be limited to a geographic location , or have temporal limitations . for example , a processor can perform its functions in “ real - time ,” “ offline ,” in a “ batch mode ,” etc . portions of processing can be performed at different times and at different locations , by different ( or the same ) processing systems . those skilled in the art will appreciate that a suitable control system can include a central processing unit (“ cpu ”), at least one read - only memory (“ rom ”), at least one random access memory (“ ram ”), at least one hard drive (“ hd ”), and one or more input / output (“ i / o ”) device ( s ). the i / o devices can include a keyboard , monitor , printer , electronic pointing device ( for example , mouse , trackball , stylus , touch pad , etc . ), or the like . in embodiments of the invention , the control system can have access to at least one database over a network connection . rom , ram , and hd are computer memories for storing computer - executable instructions executable by the cpu or capable of being compiled or interpreted to be executable by the cpu . suitable computer - executable instructions may reside on a computer readable medium ( e . g ., rom , ram , and / or hd ), hardware circuitry or the like , or any combination thereof . within this disclosure , the term “ computer readable medium ” is not limited to rom , ram , and hd and can include any type of data storage medium that can be read by a processor . examples of computer - readable storage media can include , but are not limited to , volatile and non - volatile computer memories and storage devices such as random access memories , read - only memories , hard drives , data cartridges , direct access storage device arrays , magnetic tapes , floppy diskettes , flash memory drives , optical data storage devices , compact - disc read - only memories , and other appropriate computer memories and data storage devices . thus , a computer - readable medium may refer to a data cartridge , a data backup magnetic tape , a floppy diskette , a flash memory drive , an optical data storage drive , a cd - rom , rom , ram , hd , or the like . as used herein , the terms “ comprises ,” “ comprising ,” “ includes ,” “ including ,” “ has ,” “ having ,” or any other variation thereof , are intended to cover a non - exclusive inclusion . for example , a process , product , article , or apparatus that comprises a list of elements is not necessarily limited only those elements but may include other elements not expressly listed or inherent to such process , product , article , or apparatus . furthermore , the term “ or ” as used herein is generally intended to mean “ and / or ” unless otherwise indicated . for example , a condition a or b is satisfied by any one of the following : a is true ( or present ) and b is false ( or not present ), a is false ( or not present ) and b is true ( or present ), and both a and b are true ( or present ). as used herein , including the accompanying appendices , a term preceded by “ a ” or “ an ” ( and “ the ” when antecedent basis is “ a ” or “ an ”) includes both singular and plural of such term , unless clearly indicated otherwise ( i . e ., that the reference “ a ” or “ an ” clearly indicates only the singular or only the plural ). also , as used in the description herein and in the accompanying appendices , the meaning of “ in ” includes “ in ” and “ on ” unless the context clearly dictates otherwise . additionally , any examples or illustrations given herein are not to be regarded in any way as restrictions on , limits to , or express definitions of , any term or terms with which they are utilized . instead these examples or illustrations are to be regarded as being described with respect to one particular embodiment and as illustrative only . those of ordinary skill in the art will appreciate that any term or terms with which these examples or illustrations are utilized encompass other embodiments as well as implementations and adaptations thereof which may or may not be given therewith or elsewhere in the specification and all such embodiments are intended to be included within the scope of that term or terms . language designating such non - limiting examples and illustrations includes , but is not limited to : “ for example ,” “ for instance ,” “ e . g .,” “ in one embodiment ,” and the like . those skilled in the art of the invention will recognize that the disclosed embodiments have relevance to a wide variety of areas in addition to the specific examples described above . for example , although the examples above are described in the context of data centers , some embodiments disclosed herein can be adapted or otherwise implemented to work in other types of environments , circumstances , etc . in this context , the specification and figures are to be regarded in an illustrative rather than a restrictive sense , and all such modifications are intended to be included within the scope of this disclosure . accordingly , the scope of the present disclosure should be determined by the following claims and their legal equivalents .	7
fig1 shows schematically an inverter 5 according to an embodiment of the present invention that is configured to provide a boosted output voltage vgb in response to an input signal changing . inverter 5 has a power supply input 6 for receiving vddg which is the voltage level of the high power rail of the circuit , a power supply input 7 which receives the voltage from a boosted voltage source vgb which is a higher voltage level than that of the high voltage rail and a power supply input 8 which receives the low voltage level vss . inverter 5 has an input 10 and an output 12 and in response to the input signal being high the inverter outputs a low output signal . when the input signal falls low then the inverter output level rises . initially it rises to the level of vddg and then it rises higher to the boosted vgb level . as can be seen schematically in this figure the rise from the low level to vddg occurs at one rate while the rise from vddg to vgb occurs more slowly . the rate at which these levels rise depends on the sizing of the devices within inverter 5 . the rise to the level of vddg affects the timing of the circuit and thus , should be fast , while the rise to the additional biased voltage simply reduces leakage currents and thus , this level not being attained very quickly is not so important . thus , it may be advantageous to allow the rise in voltage level from vddg to vgb to occur more slowly and use smaller components thereby saving area . fig2 shows a circuit diagram illustrating the inverter 5 of an embodiment of the present invention . in this embodiment the input signal is shown as changing from a 1 to 0 and the various states of the transistors are shown as changing in response to this . the input signal is designated as a sleep signal as this inverter is to be used to control the power transistors of a circuit such that in this case as they are pmos transistors when the sleep signal goes low and the output rises it turns them off and the circuit enters low power mode . a boost to the output voltage makes sure that these power transistors are in the super cut off state during this low power mode and their leakage current is therefore reduced . in this embodiment we have various transistors 20 , 30 , 40 , 50 , 60 , 70 , 80 and 90 , which act to control the connection of the high voltage line vddg and the boosted high voltage vgb to the output . operation of this circuit occurs as follows . when the input signal is high transistor 20 is on and a low signal is output at the output . this low signal turns transistor 30 on and a high signal is transmitted to node n 2 such that a 1 appears at this node . this turns transistor 60 off and isolates the output from the power supply vddg . the 1 at the input and the 0 at the output mean that transistor 90 is on and the 1 from the input is transmitted to node n 4 and turns transistor 80 off . this isolates the bias gate voltage 1 ′ from the output . the 0 at the output also turns gate 70 on but as gate 90 is off the 1 ′ does not get transmitted any further . when the input signal falls to a 0 then this turns transistor 20 off and isolates the output from vss . initially the 0 that was previously output means that gate 30 is still on and thus , the 0 at the input is transmitted to node n 2 and this falls to 0 . this turns transistor 60 on and current from the power supply vddg is sent through transistor 60 and raises the output level to 1 . transistor 60 is a large transistor with a low impedance and can thus , transmit a high current and the transition at the output from 0 to 1 is fast . as the output reaches 1 , transistor 90 is turned on and the 0 at the input is transmitted through transistor 90 to the gate of transistor 80 and this turns this on . this means that the output voltage rises from 1 to p . this rise in voltage level being supplied by the boosted voltage source vgb . when the output is at 1 before the boost there is a 1 at the input to transistor 70 but a 1 ′ at its source meaning that it is only partially off . the 1 that is transmitted through transistor 90 goes to transistor 50 and turns this off and turns transistor 40 on . this means that the 0 that was at n 2 rises to 1 ′ through transistor 40 and this turns transistor 60 off . the 1 ′ at the output is also transmitted to the gate of transistor 70 and turns this off completely . thus , as can be seen once the output level reaches the level of the power supply source vddg the arrangement of the transistors means that the transistor 80 is turned on and the boosted power supply can be supplied to the output but at the same time the power supply vddg is isolated from this output preventing any route for current from the boosted power supply vbg to the power supply vddg . fig3 shows a timing diagram showing how the voltage at nodes n 2 and n 4 of the circuit of fig2 vary with the input signal . thus , when the input signal is high the voltage at node 2 is also high at one volt , the voltage of the supply line while the voltage at n 4 is at the boosted 1 . 25 volts . this is because transistor 70 is on while transistor 80 is off . when the input voltage falls low then the voltage at node n 2 falls too . this is in response to transistor 40 turning off . the voltage at node n 2 being low causes transistor 60 to turn on . this is a large transistor designed to connect to the high power line vddg and thus , it can carry a lot of current and the voltage level at the output signal therefore rises quickly to a 1 . when it reaches a 1 then this acts to turn the nmos transistor 90 on which transmits the 0 through to the gate of transistor 80 and turns it on , this then supplies the boosted voltage level to the output . this high level at the input to transistor 70 turns it off which in turn turns transistor 40 on making the voltage at n 2 rise to the boosted voltage level of 1 . 25 volts and turns transistor 60 off thereby isolating the supply voltage vddg from the supply voltage vgb via the output line . when the input voltage signal goes high again then the voltage at n 2 drops to 1 volt from the 1 ′ volt while the voltage at n 4 rises to 1 ′ as transistor 70 turns on . thus , the various transistors act to connect firstly the high voltage source vddg to the output and then to connect the boosted high voltage source to the output while isolating the output from the high voltage source vddg . fig4 shows a use of an inverter according to an embodiment of the present invention . in this embodiment , inverter 5 is used to control the header transistors 100 that act to gate processing circuitry 110 . thus , the high voltage rail 120 supplying vddg is connected to the virtual power rail 130 via transistors 100 which are aligned in parallel in response to a signal output by the inverter 5 . thus , when a 0 is output these header transistors 100 are on and the virtual power rail 130 is at approximately vddg . when a sleep signal indicating that the circuitry is to enter low power mode is received at inverter 5 then a high output signal is output which turns header transistors 100 off . inverter 5 is a two - stage inverter as is described with respect to fig1 and 2 . thus , initially the voltage level rises to vddg which is sufficient to turn the header transistors 100 off . it then rises further to the gate bias voltage of 1 . 25 volts which means that transistors 100 enter their super cut off state which reduces any leakage currents across these header transistors 100 . in this embodiment , a number of driver circuits 140 are shown connected to the three stage inverter 5 . these circuits are there to introduce a delay to the switching on of the transistors . this is because many circuits have a large number of header transistors which are arranged in groups . if all the header transistors are turned on at the same time then there will be a large current peak and this will cause the supply voltage to fall and might cause some failure of the circuit if it falls beneath a critical value . thus , the switching on of the circuits is arranged such that they do not all turn on together but are turned on with a slight delay between each . these driver circuits 140 are used to introduce the delay . there is no need to provide a delay when the circuit is switching off . fig5 shows an alternative use of the voltage level shifting device according to an embodiment of the present invention . in this embodiment inverter 5 is used to boost the voltage on the word lines for accessing a memory cell 7 . one problem with memory cells is that if they are to be robust with regard to data retention then they can be quite difficult to overwrite . writing requires the state of the cells to flip . the cells are generally cross - coupled inverters and if they are stable to voltage fluctuations they do become difficult to overwrite . this problem has been addressed by providing a boost to the word line voltage during write which enables the cells to be flipped . inverter 5 according to embodiments of the present invention is a convenient way of providing this boost to the word line in an area efficient manner . fig6 shows a tristate two - stage inverter according to an embodiment of the present invention . inverter 5 of fig1 to 4 has an output state of a 0 or of 1 ′ vbg . it may be convenient for the inverter to also have a tristate high impedance output in which the input signal is isolated from the output signal . this tristate three - stage inverter has additional transistors to the two - stage inverter of fig2 . these additional inverters comprise a transistor 210 for controlling the tristate output and transistors 220 , 230 , 240 and 250 . these transistors help generate the high impedance state when the retention signal indicates that this sleep state is to be entered . thus , this tristate two - stage inverter has three possible outputs , the tristate high impedance output , a 0 output and the , boosted voltage output . this can be used in a circuit shown in fig7 for controlling header transistors 100 . in this case , there is an additional diode connected transistor 140 that is arranged between the header transistors and that is used to generate the retention state . thus , in this case transistors 100 and 140 can be used to generate three possible states , an on state when the circuitry 110 is powered , an off state when transistors 100 are turned off and no power is supplied to circuitry 110 and a retention state when a reduced voltage level is applied to virtual power rail 130 such that there is sufficient voltage to retain the state within circuitry 110 but there is a reduced voltage drop across this circuitry and thus , power leakage levels are lower . when diode connected transistor 140 is on it provides a connection between the output of the header transistors 100 and their gates such that there is a voltage drop across them which is dependent on the threshold voltage of the header transistors 100 . thus , the output voltage on the virtual voltage rail is no longer vddg but is vddg minus the threshold voltage of these header transistors . this is the tristate state where the input signal input to tristate inverter 55 is isolated from its output which stops this output from competing with the voltage level at the source of the diode connected transistor 140 . as in the embodiment of fig4 , the inverter 55 has the ability to output a boosted voltage level vgb and thus , produce the super cut off state for header transistors 100 . there is an additional instate inverter 5 which is used to generate this boosted signal for the input to the diode connected transistor 140 and stop any leakage route through this transistor 140 . fig8 shows some example of current flows of two - stage voltage level shifters according to embodiments of the present invention compared to a single stage voltage level shifter according to the prior art that simply uses the boosted voltage source for the complete transition . row 300 relates to a circuit having a voltage level shifter of the prior art , 310 relates to the two - state inverter with a fast slew rate , 320 a two - stage inverter with a slow slate rate , 330 the tristate two - stage inverter with the slow slew rate and 340 the slow slew rate tristate arrangement shown in fig7 . as was noted previously , the rate of change of voltage level from vddg to the boosted level vgb can be slow as at this point the circuit is already turned off but is not in the super cut off state . delaying entry into the super cut off state merely increases leakage currents without affecting operational performance and thus , in many cases is acceptable . thus , it may be advantageous in some embodiments to select small transistors for the transistors that feed the boosted voltage level , i . e . transistors 70 , 80 and 90 in fig2 . this will result in a slow slew rate rise from vddg to vgb as is shown in the diagram at the bottom of fig8 . in other embodiments , it may be acceptable to have larger transistors at these points and thus , a fast slew rate can be obtained for this later portion of the transition . in the prior art the peak current taken from the boosted voltage source is 2 . 23 milliamps , whilst the highest current taken from the boosted voltage source in any of the embodiments of the present invention is 927 micro amps . this is significantly lower . this is because the current for generating this change in voltage level is generated from the vddg source . as this is required to power the rest of the circuitry it needs to be a large source and the grid connecting it to the circuitry is similarly large . thus , in the prior art a grid and boosted power supply sufficient to supply a peak current of 2 . 23 milliamps is required , while embodiments of the current invention only require a peak current of 927 microamps , or if a slow slew rate is acceptable 174 microamps . the diagram also shows the difference in transition times and peak currents between the fast and the slow slew rates . these are quite significant and thus , in some embodiments where it is very important to have a small source the slow slew rates may prove to be advantageous . fig9 shows a flow diagram illustrating steps in a method according to an embodiment of the present invention . in this method a high input signal is initially received and in response to this the low voltage source is connected to the output and a low output signal is output . it is then determined if the input signal has transitioned to a low value . if it has the power supply vddg is connected to the output and a high output signal is output . it is then determined if the output voltage has obtained this vddg value . when it has the boosted output voltage is connected to the output and the vddg output is isolated from the output and thus , a boosted value is output . it is then determined if the input signal has transitioned to a higher value . if it has then the sequence is started again . it should be noted that although embodiments of the invention have been described with respect to providing a voltage level shift from a low level to a high level and then a boosted high level , it will be clear to a skilled person that the techniques of embodiments of the present invention could equally well be applied to shifting from a high level to a low level and then a boosted extra low level , for example from vdd to vss to vss ′. thus , in an embodiment corresponding to those of fig4 and 7 a voltage booster could be used where the power control transistors are footer nmos transistors and they could be used to produce a voltage level that is boosted with respect to the low voltage level such that perhaps a negative voltage is applied to the gates of these footer transistors . although illustrative embodiments of the invention have been described in detail herein with reference to the accompanying drawings , it is to be understood that the invention is not limited to those precise embodiments , and that various changes and modifications can be effected therein by one skilled in the art without departing from the scope and spirit of the invention as defined by the appended claims . for example , various combinations of the features of the following dependent claims could be made with the features of the independent claims without departing from the scope of the present invention .	7
the invention provides a semiconductor device having low - voltage / high - voltage transistors and a method for forming low - voltage / high - voltage transistors of semiconductor devices for use in large scale integrated circuits ( lsi ), for example . in the method , and preferably on an lsi where at least one low - voltage transistor is intermingled with a high - voltage transistor , a low - density doping ( ldd ) implantation of the high - voltage transistor is conducted . then , a protective oxide film for the ldd implantation of the low - voltage transistor is formed using a suitable oxidation process such as thermal oxidation or thermal chemical vapor deposition ( cvd ). thereafter , ldd implantation of the low - voltage transistor is conducted . with the method of the invention , a deep junction is obtained in the ldd region of the high - voltage transistor because , after ldd implantation , the oxidation process ( thermal oxidation / thermal cvd ) is applied , causing any impurities to diffuse . moreover , any generation of hot carriers near the drain region is suppressed because the ldd junction is smooth and deep . a smooth ldd junction relaxes the electrical field density near the drain . also , a deep ldd junction prevents the concentration of current pass at interface channel and gate oxide . what results is a structure that is substantially impervious to deterioration in transistor characteristics . moreover , since an oxidation or thermal process is not applied in the ldd region of the low - voltage transistor , the low - voltage transistor has a shallow ldd region , making it difficult for any short channel effects to occur . with this method , characteristics for both the low - voltage and high - voltage transistors may be optimized . that is , high - voltage transistors have deep and smooth ldd junctions , resulting in good hot carrier immunity . low - voltage transistors have shallow and high dosed ldd junctions to thereby ensure good short channel immunity with high performance . fig2 is a cross - sectional view illustrating a semiconductor device 10 having at least one high voltage transistor and one low - voltage transistor provided on a single chip . this semiconductor device 10 is an exemplary device formed according to a preferred embodiment of the invention . the semiconductor device 10 comprises n - channel mos ( nmos ) transistors 12 and 14 and p - channel mos ( pmos ) transistors 16 and 18 . the nmos transistor 12 and the pmos transistor 16 are low voltage transistors that are driven at a given low voltage , e . g ., an operation voltage of about 1 . 8 volts . in contrast , the nmos transistor 14 and the pmos transistor 18 are high voltage transistors that are driven at a high voltage , e . g ., an operation voltage of about 3 . 3 volts . the nmos transistor 12 and the pmos transistor 16 driven at the low operating voltage are used for a portion of circuitry that exchanges signals within the semiconductor device 10 , such as a logic circuit . the low voltage mos transistors 12 and 14 have thin - film gate oxide films 20 and 22 respectively . in contrast , high - voltage nmos transistor 14 and pmos transistor 18 are typically used for a portion of the interface between the semiconductor device 10 and an external circuit . the high voltage mos transistors 14 and 18 have thick - film gate oxide films 24 and 26 respectively . a p - type channel region 28 is formed below the nmos transistor 12 , and a p - type channel region 30 is formed below the nmos transistor 14 . n - type lightly doped drain regions ( ldd ) 32 and n - type source / drain ( s / d ) regions 36 are formed on each side of the channel region 28 , and n - type ldd regions 34 and n - type source / drain regions 38 are formed on each side of the channel region 30 . the ldd regions 32 and 34 are formed so as to be lower in impurity concentration than the source / drain regions 36 and 38 . an n - type channel region 40 is formed below the pmos transistor 16 , and an n - type channel region 42 is formed below the pmos transistor 18 . p - type ldd regions 44 and p - type source / drain regions 48 are formed on each side of the channel region 40 , and p - type ldd regions 46 and p - type source / drain regions 50 are formed on each side of the channel region 42 . the ldd regions 44 and 46 are formed so as to be lower in impurity concentration than the source / drain regions 48 and 50 . in fig2 , reference symbol pa represents a junction depth profile of ldd region 32 ; pb represents a junction depth profile of ldd region 34 ; pc represents a junction depth profile of ldd region 44 ; and pd represents a junction depth profile of ldd region 46 . as shown in fig2 , in the semiconductor device 10 in accordance with the invention , the high - voltage transistors 14 and 18 have deeper junction depth profiles in the ldd regions than the low - voltage transistors 12 and 16 ( i . e ., pa & lt ; pb , and pc & lt ; pd ). fig3 is a flow diagram illustrating the method of the invention . referring to fig3 , in step s 30 element separations are formed on a semiconductor substrate using sti ( shallow trench isolation ) or the like . in step s 30 , a well is formed and the threshold voltage value of the transistor ( s ) is adjusted by using a mask made of photo - resist , for example , to implant p - type impurities into the nmos region of nmos transistors 12 and 14 , and n - type impurities into the pmos region of pmos transistors 16 and 18 . these form the p - type channel regions 28 and 30 and the n - type channel regions 40 and 42 of fig2 . since the threshold voltage value of the low - voltage transistors 12 and 16 and the high - voltage transistors 14 and 18 are each respectively adjusted , it is also acceptable to use a mask to further implant separately . next , a gate insulation film is formed in step s 31 , and the gate oxide film of only the high - voltage transistor is applied , so as to be thicker than the gate oxide film of the low - voltage transistor . this application also may be done using a known masking technique or the like . then , in step s 32 poly - si is deposited as a gate electrode for each transistor and the gate electrode for each transistor is processed into the desired shape . thereafter , a dopant of n - type impurities , such as phosphorous at an energy of about 20 kev and a dose of about 6 × 10 13 / cm 2 for example , are implanted in a step s 33 into the ldd region 34 of only the high - voltage nmos transistor 14 , and a dopant of p - type impurities ( e . g ., bf 2 at energy of about 20 kev and dose of about 6 × 10 13 / cm 2 ) are implanted into the ldd region 46 of only the high - voltage pmos transistor 18 . in step s 34 the oxidation process is performed . an oxide film approximately 3 to 7 nm in thickness is formed on the poly - si surface over each of the transistors 12 , 14 , 16 and 18 as well as the silicon substrate surface 11 , using an oxidation process at approximately 800 to 1100 ° c . the oxidation step advantageously dopes the high - voltage transistors , because the thermal diffusing of the dopant by oxidation ( implanted in the previous step ) causes a deeper ldd region junction to be formed , as illustrated in fig2 . moreover , the thermal diffusing of the dopant in the oxidation step ensures that there is a smooth transition between n - type and p - type regions within each transistor , which enhances transistor reliability . the resulting smooth junction relaxes electrical field density near drain , which suppress generation of hot carrier . thereafter , in step s 35 , a dopant of n - type impurities ( e . g ., arsenic at energy of about 5 kev and dose of about 1 × 10 15 / cm 2 ) are implanted into the ldd region 32 and a dopant of p - type impurities ( e . g ., boron at energy of about 15 kev and a dose of about 3 × 10 13 / cm 2 with 20 degrees tilt ) are implanted into the pocket region 33 of only the low - voltage nmos transistor 12 and a dopant of p - type impurities ( e . g ., boron at an energy of about 2 kev and a dose of about 3 × 10 14 / cm 2 ) are implanted into the ldd region 44 , and a dopant of n - type impurities ( e . g ., phosphorus at an energy of about 45 kev and a dose of about 5 × 10 13 / cm 2 with 25 degrees tilt ) are implanted into the pocket region 45 of low - voltage pmos transistor 16 . after forming a gate spacer ( not shown ), source and drain implantations for the source and drain regions 36 , 38 , 48 and 50 of the nmos and pmos transistors are conducted ( step s 36 ), followed by the application of a silicide interlayer film ( step s 37 ). finally , wiring formation processes ( step s 38 ) are conducted to form wire pairs for connection to the surface of the semiconductor device 10 for each transistor . as described above , the method of the present invention provides a semiconductor device having both high - voltage and low - voltage transistors with increased reliability , where both may be manufactured without reducing the reliability of the high - voltage transistor or performance of the low - voltage transistor . moreover , oxidation after ldd doping of the high - voltage transistor enables diffusion to create a deeper ldd region junction , while the protective oxide film allows the low - voltage transistor to maintain a relatively shallow ldd junction depth to optimize performance and reliability . therefore , the present invention inserts a thermal process such as oxidation between the ldd step for the high - voltage transistor and the ldd step for the low - voltage transistor . as a result , the impurities in the ldd region of the high - voltage transistor undergo thermal diffusion , thus causing the junction at the ldd / source region of ldd / channel or ldd / drain region to be smooth and the electric field in the vicinity of the drain region to be eased . as for the low - voltage transistor , since no thermal process is conducted , the ldd region structure is of a shallow depth so that transistor performance can be maintained . the invention being thus described , it will be obvious that the same may be varied in many ways . the above - described method has been described as comprised of several components , flowcharts or blocks , it should be understood that the method or manufacturing the semiconductor device may be implemented by application specific integrated circuits , software - driven processor circuitry , or other arrangements of discrete components . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	7
certain terminology may be employed in the description to follow for convenience rather than for any limiting purpose . for example , the terms “ top ”, “ bottom ”, “ forward ”, “ rearward ”, “ right ”, “ left ”, “ rightmost ”, “ leftmost ”, “ upper ”, and “ lower ” designate directions in the drawings to which reference is made . terminology of similar import other than the words specifically mentioned above is likewise to be considered as being used for purposes of convenience rather than in any limiting sense . in the description and figures to follow , corresponding characters are used to designate corresponding elements throughout the several views , with equivalent elements being referenced with prime or sequential alphanumeric designations where appropriate to assist understanding . modern electronic circuit assemblies are progressively moving towards denser and denser concentrations of heat generating components within given package sizes . increased density brings a need for enhanced means to remove heat , and as well , means to contain electromagnetic radiation generated by the circuitry during its operation . one approach known in the art is to completely enclose the electronic circuit board and attendant circuitry with a thermally conductive and electromagnetic radiation containing enclosure . a common term for such an enclosure which conforms relatively closely to the dimensions of a circuit card is that of a “ clamshell ”. the clamshell enclosure has additional advantages in assisting in preventing penetration of exterior interfering radiation , such as that from adjacent circuit assemblies , from interfering with circuitry within the enclosure . a relative disadvantage of a clamshell enclosure is the difficulty in replacing components . within telecommunications systems , there are electronic assemblies with subassemblies which may have an operational life significantly less than the life of the remainder of the assembly . one example is the laser transceivers used in modern optical networking equipment . with a clamshell enclosure which contains multiple such laser transceiver assemblies , the failure of one assembly would require the removal of the entire clamshell if the failed assembly were to be replaced . clearly , it would be desirable to have a clamshell enclosure which would admit removable subassemblies . however , in the case of laser transceiver assemblies , for example , there is a strong need for effective heatsinking of the transceiver assembly . in an assembly with permanently mounted transceivers , it is common in the art to use the wall of the clamshell enclosure as a heatsink , and appropriate means for securing the transceiver in good thermal contact with the wall are used . in the case of removable assemblies , it is necessary to be able to remove the subassembly , yet when the subassembly is mounted in operational position , to also ensure adequate thermal contact . referring to fig1 a there may be seen an exploded view of a circuit board 180 having mounted thereon a frame 182 , a heatsink 184 , and a clip assembly 186 . the frame 182 serves as a mounting enclosure for a removable component or assembly , while heatsink 184 is mechanically attached to frame 182 via clip assembly 186 . not shown is a connector mounted on circuit board 180 , to which the removable component connects upon insertion into frame 182 . referring to fig1 b , there may seen a perspective view of the heatsink 184 , secured to frame 182 with clip 186 , while removable component 110 is shown prior to mounting within frame 182 . in fig1 c , removable component 110 is shown mounted within frame 182 . in the mounted position , heatsink 184 , in mechanical contact with removable component 110 , acts to reduce thermal resistance from removable component 110 to the ambient environment , thereby dissipating heat generated within removable component 110 . the resulting reduction in temperature rises within removable component 110 act to keep temperatures within operational limits and enhance long term reliability of removable component 110 , as is well known in the art . one possible problem with the approach diagrammed in fig1 is the sliding friction occurring between heatsink 184 and the removable component 110 . close mechanical contact between removable component 110 and heatsink 184 is necessary for good thermal flow , however manufacturing tolerances work against achieving the necessary fit . intermediate resilient thermally conductive materials may be used to mediate the gap resulting from manufacturing tolerances , however the high coefficient of friction that results from use of such materials results in unacceptably high forces being generated upon insertion and removal of removable component 110 . referring to fig2 , there may be seen a perspective view from the bottom , of one side 200 of a clamshell enclosure . on the enclosure side 200 may be seen mounting holes 202 , for securing the enclosure side 200 to the circuit board and opposite side of the enclosure . also visible is aperture 204 , an opening in enclosure side 200 , for the receiving of a floating heatsink which will be described below . mounting tabs 206 , at the front of enclosure side 200 , are for the installation of card ejectors ( not shown ), mechanical latches which assist in insertion and removal of the clamshell assembly upon installation . the clamshell enclosure is conveniently made from a castable , extruded or machined aluminum alloy , providing both thermal conductivity and electromagnetic interference shielding . reference is now made to fig3 a , which shows a floating heatsink 330 having a resilient bias member 332 disposed on the top surface of floating heatsink 330 around its periphery . in this embodiment , the resilient bias member 332 is an electromagnetic gasket formed from an elastomeric compound having electrically conductive media disbursed therethrough . the electromagnetic gasket acts so as to contain electromagnetic energy within the clamshell enclosure . resilient bias member 332 also operates to urge floating heatsink 330 downwards against a removable component . in particular , the floating heatsink 330 is dimensioned larger than the aperture 204 ( fig2 ) within the clamshell enclosure . accordingly , the floating heatsink 330 is dimensioned such that its periphery overlaps with the enclosure side 200 ( fig2 ) of the clamshell enclosure surrounding the aperture 204 . thus , the resilient bias member 332 is disposed between the enclosure side 200 of the clamshell enclosure and the peripheral overlap portion of the floating heatsink 330 . resilient bias member 332 acts against the underside of the clamshell enclosure so as to urge the floating heatsink 330 downwards against a removable component . although in this embodiment , resilient bias member 332 is formed of an elastomeric compound , in general any resilient gasketing material known to those skilled in the art having a compression - set over its operating life sufficient to provide an appropriate biasing force to provide good thermal contact against a removable component while providing adequate electromagnetic interference gasketing could be employed . under certain applications , the amount of bias provided by the resilient gasketing material may be insufficient to provide the amount of bias desired . in these circumstances an additional bias element 340 , for example a separate spring element , may be used to augment the bias provided by the resilient gasketing material that makes up the resilient bias member 332 . such an additional bias element 340 may comprise a spring element running parallel to the resilient gasketing material , or a plurality of spaced smaller springs , for example . the additional bias element 340 may be disposed in a channel 334 formed between the resilient bias member 332 and an upper portion of the floating heatsink 330 . it is also clear that certain applications , for example circuitry having low frequency signals , may not require a continuous gasket around the periphery of the overlap . in this case , the resilient gasketing material may be disposed only over a portion of the overlap , or at a plurality of discontinuous portions , insofar as the emissions or susceptibility requirements regarding electromagnetic leakage through any gaps meet the requirements of the particular apparatus . reference is now made to fig3 b , which shows another embodiment of a floating heatsink 330 with resilient bias member 332 . in this embodiment , resilient bias member 332 includes a multi - fingered metallic gasketing strip surrounding the periphery of floating heatsink 330 . the metallic gasketing strip is formed from a plurality of fingers or ridges 338 ( individually indicated as 338 a , 338 b , . . . , 338 n ). the succession of fingers or ridges 338 within the ridged metallic gasketing strip provides resilience as well as effective electromagnetic shielding . the fingers or ridges 338 bias the floating heatsink 330 in a downward direction relative to the surrounding clamshell enclosure by bearing against the enclosure side 200 surrounding the aperture 204 within the clamshell enclosure . referring to fig4 , there may be seen an exploded perspective view of a clamshell enclosure using a floating heatsink according to an embodiment of the invention . a top side clamshell enclosure portion 420 is securable to a bottom side clamshell enclosure portion 421 . circuit board 400 , located within the clamshell enclosure when top side 420 is secured to bottom side 421 , has component frame 402 mounted thereon . component frame 402 , for receiving a removable component , is mounted adjacent aperture 423 which is located on a front face of bottom side enclosure portion 421 . upon assembly of the clamshell enclosure , floating heatsink 430 mounts within aperture 424 in top side clamshell enclosure portion 420 , immediately adjacent component frame 402 . in operation , resilient bias member 432 urges floating heatsink 430 against a component housed within frame 402 . resilient bias member 432 also provides an electromagnetic interference gasket function within the gap between floating heatsink 430 and top side clamshell enclosure portion 420 . referring to fig5 , there may be seen an assembled clamshell enclosure 525 , having a removable component 510 in position for insertion into aperture 523 . upon insertion into aperture 523 , removable component 510 passes into the component frame ( not seen in this diagram ) and bears against floating heatsink 532 . the resilient bias member mounted between the top surface 520 and floating heatsink 532 urges heatsink 532 against removable component 510 , providing good thermal contact . also , as described previously , the resilient bias member also serves as a gasket , blocking or attenuating electromagnetic radiation that might enter or exit the clamshell enclosure around the periphery of floating heatsink 532 . referring to fig6 a , there may be seen a cross - sectional view of fig5 taken at section 2 and a corresponding cross - sectional view with the removable component 610 inserted at fig6 b . more specifically , clamshell enclosure 625 has top side enclosure member 620 having aperture 624 therein . floating heatsink 630 resides within aperture 624 , having resilient bias member 632 between heatsink 630 and top side enclosure member 620 . removable component 610 , illustrated in the removed position in fig6 a , upon insertion , bears against heatsink 630 . in the inserted position , illustrated in fig6 b , resilient bias member 632 urges the heatsink 630 against removable component 610 , providing good thermal contact . as may be seen , the assemblies described above provide one skilled in the art a method and apparatus for providing thermal contact for removable components and maintenance of the integrity of an electromagnetic screening enclosure so as to prevent either emissions or admission of electromagnetic radiation . as well , the aforedescribed assemblies provide allowance for mechanical tolerances incurred in manufacturing and over the operational life of the assembly , as well as control of contact forces via the resilient bias member for proper thermal and interconnection performance . further , the described design provides for a reduction in size over approaches which do not integrate the bias member functionality with electromagnetic gasketing . this reduction in size allows for greater utilization of the interior space of the clamshell enclosure . while the invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art in light of the foregoing description . for example , the floating heatsink assembly within a clamshell enclosure could be adapted to non - removable components fixed to the circuit board , eliminating the usual need for a compliant thermal compound to fill the space between the fixed component and the heatsink . in this type of application , the elimination of the thermal compound would both simplify initial manufacturing processes and any subsequent repair processes . as well , the clamshell type of enclosure exemplifies but one kind of containment enclosure . it is contemplated that electronic assemblies having portions of the assembly enclosed , albeit not wholly as in the clamshell embodiment , could also make use of the floating heatsink for removable components requiring heatsinking within the enclosed portion . therefore , what has been described are embodiments providing means for mounting a removable component to a circuit pack where the circuit pack is enclosed in a fixed heatsink . by utilizing a floating heatsink mounted within an aperture of the fixed heatsink , in coordination with a resilient bias member that also acts as an electromagnetic containment gasket , component removability is obtained while still effecting electromagnetic shielding and thermal contact between the heatsink and component . numerous modifications , variations and adaptations may be made to the particular embodiments of the invention described above without departing from the scope of the invention , which is defined in the claims . accordingly , it is intended to embrace all such alternatives , modifications , and variations as fall within the spirit and broad scope of the appended claims .	6
the following detailed description is for the best currently contemplated methods for carrying out the invention . the description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating the general principles of the invention . in order to fully appreciate this invention , it is best to describe the details of the component parts in connection with the operational modes of the gas turbine engine &# 39 ; s fuel control system . in this light the descriptions that follow address both engine operation and shutdown modes for two embodiments of the inventive rapid shutdown and ecology system . in fig1 an illustrative gas turbine engine fuel control system 10 of a mostly conventional configuration known to those skilled in the art includes fuel supply 11 originating from fuel tanks ( not shown ) entering a low pressure fuel pump 12 , which increases the pressure in line 13 to level po . fuel then proceeds to high pressure pump 14 , which further increases fuel pressure to level p 1 in line 15 , at which point it enters metering valve 16 for modulating the rate of flow from the fuel supply to the combustor atomizers ( not shown ). fuel pressure in line 15 a downstream of metering valve 16 decreases to level p 2 ( by the setting of bypass valve 18 ) and thereafter further decreases to level p 3 in line 22 after passing through pressurizing valve 21 , which controls and establishes a minimum pressure of fuel delivered to the combustor atomizers downstream of flow arrow 23 . the bypass valve 18 returns , via lines 19 and 20 , pump flow in excess of metered flow and also controls fuel pressure such that p 1 is always higher than p 3 , usually about 25 psi or greater . additionally , at low fuel flow rates , p 1 will be additionally higher than p 3 by the setting of pressure rising valve 21 . orifice 19 a is provided on line 19 to create a damping pressure drop to stabilize bypass valve 18 . all functions of the gas turbine engine fuel control system 10 are commanded by the engine electronic control unit ( ecu ), which is not shown on the drawings , by repositioning the metering valve 16 . the inventive rapid shutdown and ecology system 24 communicates with line 22 by means of line 25 , and is positioned to be downstream of pressure rising valve 21 and upstream of the combustor atomizers . it is comprised of a metallic cylindrically shaped valve body 26 internally bored to define valve chamber 27 having an upper end 28 and an a lower end 29 at the longitudinal extremities . a large piston member “ b ” 30 is movable along the longitudinal axis of the valve chamber 27 between upper end 28 and lower end 29 . the flat surface of large piston member “ b ” 30 at the upper end 28 is bored to form fuel cavity “ b ” 31 . the depth and diameter of said fuel cavity “ b ” 31 are sized to provide a scavenge volume sufficient to accommodate all fuel in the fuel control system 10 downstream of pressure rising valve 21 , when the large piston member “ b ” 30 has moved to the extreme of its stroke in the direction of lower end 29 . a spirally wound spring 32 is positioned along the axial periphery of fuel cavity “ b ” 31 , such that when compressed , one end bears on upper end 28 and the other end bears on the base of fuel cavity “ b ” 31 . spring 32 is designed to remain fully compressed when fuel pressure px in fuel cavity “ a ” 34 is sufficiently greater than p 3 , the pressure immediately downstream of pressure rising valve 21 . in other words , the difference between px and p 3 times the area of piston b must be greater than the load in spring 32 . o - ring seals 44 are provided at three circumferential levels to prevent fuel flow between the inner surface of valve chamber 27 and the exterior surface of large piston member “ b ” 30 when the latter strokes along the longitudinal axis of valve chamber 27 . small piston member “ a ” 33 is placed internal to a close tolerance cylindrically bored cavity 36 located along the longitudinal centerline of large piston member “ b ” 30 at lower end 29 . small piston member “ a ” 33 may be equipped with an o - ring seat 45 to prevent any leakage of metered fuel during normal engine operation . face plate 35 , secured to large piston member “ b ” 30 , interlocks small piston member “ a ” 33 within bored cavity 36 . two fuel passages extending from bored cavity upper end 36 a provide communication with elements of the fuel control system 10 manifold as follows : passageway 37 leads to annular cavity 37 a on valve body 26 , and then to line 38 , thus permitting free flow of fuel from downstream of metering valve 16 to small piston member “ a ” 33 at the bored cavity upper end 36 a . fuel passageway 39 leads to annular cavity 39 a on valve body 26 , and then via line 40 to line 13 downstream of the low pressure fuel pump 12 . electro - magnetic solenoid valve 41 , which is commanded by the ecu , connects line 40 with fuel cavity “ a ” at lower end 29 . on the opposite side of valve body 26 , line 42 connects fuel cavity “ a ” 34 with line 15 , immediately downstream of high pressure pump 14 . a small orifice 43 is provided on line 42 to establish a pressure drop from p 1 to px when solenoid valve 41 is open . for one embodiment , diameter 46 of large piston member “ b ” 30 is about 2 . 5 inches and stroke 47 is about 1 . 5 inches . those dimensions will vary as a function of the specific gas turbine engine &# 39 ; s fuel control system configuration . still referring to fig1 the fuel control system is shown in its first position during engine operation . solenoid valve 41 is closed and pressure in fuel cavity “ a ” 34 , px , is equal to p 1 , which is always higher than p 3 ( by at least about 25 psi ). accordingly , large piston member “ b ” 30 is fully stroked toward upper end 28 , and spring 32 is fully compressed . simultaneously , since px is higher than p 2 , small piston member “ a ” 33 is fully stroked toward bored cavity upper end 36 a , thus preventing fuel flow from line 38 to line 40 . therefore , during engine operation , the inventive rapid shutdown and ecology system remains inoperative . referring now to fig2 there is shown the same gas turbine engine fuel control system schematic as in fig1 with the exception that the embodiment of the inventive rapid shutdown and ecology system 10 is now shown in its second position at engine shut down . it is at this phase that it accomplishes its intended dual function of rapid shutoff ( or turn on ) of fuel flow as well as ecology fuel management . when the gas turbine engine is shut down either by manual command from the control system ( for instance , by the pilot for aircraft applications ) or automatically through an overspeed , overtemperature or other fault detection system , the ecu opens solenoid valve 41 and shortly thereafter , when p 2 falls below a predetermined level , pressure rising valve 21 closes . closure of pressure rising valve 21 terminates fuel delivery to the combustor atomizers and opening of solenoid valve 41 immediately establishes a communication path between the upstream and downstream sides of high pressure pump 14 ( via line 42 , fuel cavity “ a ” 34 , solenoid valve 41 , and line 40 ). due to the pressure drop of orifice 43 , fuel pressure in fuel cavity “ a ” 34 , px , thus drops to po , causing spring 32 to shift large piston member “ b ” 30 to the extreme of its stroke in the direction of lower end 29 . this action increases the volume of fuel cavity “ b ” 31 thereby collecting all the fuel in the fuel control system 10 downstream of pressure rising valve 21 , and preventing it from draining into the engine creating atmospheric pollution and / or puddling , causing hot starts upon subsequent engine operation . simultaneously with the reduction of px to po , small piston member “ a ” 33 moves toward lower end 29 , thus establishing an open communication path between passageways 37 and 39 , annular cavity 39 a , and line 40 . in addition , as the pressure in lines 37 , 38 and 19 fall to the po level the bypass valve 18 moves toward orifice 19 a . these actions cause all of the fuel being delivered to the chamber atomizers to be immediately bypassed back to the high pressure pump 14 inlet , either through the bypass valve itself or through piston “ a ” cavity upper end 36 a . the rapid shutoff of fuel flow to the engine has therefore been achieved . when solenoid valve 41 is again closed by ecu command , the reverse process takes place . fuel cavity “ a ” pressure px increases to p 1 forcing small piston member “ a ” 33 to move toward bored cavity upper end 36 a , closing passageway 39 and terminating the fuel bypass condition . large piston “ b ” 30 also moves toward upper end 28 , compressing spring 32 , and forcing the fuel previously collected in fuel cavity “ b ” 31 to return to the fuel control system manifold downstream of pressure rising valve 21 . rapid turn on of fuel flow to the engine has therefore been achieved and atmospheric pollution has been prevented . on some gas turbine engine fuel control systems , the setting of bypass valve 18 is quite low and pressure rising valve 21 is referenced to po rather than p 2 . under those conditions , the difference between p 1 and p 3 is insufficient to compress spring 32 and hold large piston member “ b ” 30 fully stroked toward upper end 28 , as shown in fig1 . to accommodate those conditions and still provide the intended dual function of rapid shut down ( or turn on ) of fuel flow as well as ecology fuel management , another embodiment of the inventive rapid shut down and ecology system has been devised and is shown on fig3 and 4 . in fig3 another embodiment of the inventive rapid shutdown and ecology system is shown in its first position during engine operation . the gas turbine engine fuel control system 10 is the same as that shown of fig1 and 2 , and is comprised of the same conventional components , including low pressure fuel pump 12 , high pressure pump 14 , metering valve 16 , bypass valve 18 , pressurizing valve 21 , and various inter - communicating fuel lines , and all functions are commanded by the engine electronic control unit ( ecu ). the other embodiment is comprised of two separately functioning subsystems , one for the ecology management function 48 a and another for the rapid shutdown function 48 b . the ecology management subsystem is shown to the right of view line a - a , and may be remotely located from the remaining fuel control system . it is comprised of a cylindrically shaped valve body 49 internally bored to define valve chamber 50 having an upper end 52 and an a lower end 53 at the longitudinal extremities . a large piston member “ b ” 51 is movable along the longitudinal axis of valve chamber 50 between upper end 52 and lower end 53 . the flat surface of large piston member “ b ” 51 at the upper end 52 is bored to form fuel cavity “ b ” 54 . the depth and diameter of said fuel cavity “ b ” 54 are sized to provide a scavenge volume sufficient to accommodate all fuel in the fuel control system 10 downstream of pressure rising valve 21 , when the large piston member “ b ” 51 has moved to the extreme of its stroke in the direction of lower end 53 . a spirally wound spring 55 is positioned along the axial periphery of fuel cavity “ b ” 54 , such that when compressed , one end bears on upper end 52 and the other end bears on the base of fuel cavity “ b ” 54 . spring 55 is designed to remain fully compressed when fuel pressure px , in fuel cavity “ a ” 57 , acting on piston diameter “ a ” 59 produces a force which is greater that the force produced by pressure p 3 acting on the smaller piston diameter “ b ” 58 . when large piston member “ b ” 51 is in contact with upper end 52 during engine operation , fuel leakage from p 3 to px is prevented by circumferential o - ring seal 56 and annular o - ring seal 60 . under this condition , the small amount of fuel displaced into large piston annular cavity 66 is routed via fuel port 61 into a small , spring loaded , accumulator valve 62 where it is temporarily stored until engine shut down , at which time the spring load forces its return to fuel cavity “ b ” 54 . a “ witness ” drain 63 is provided to collect any inadvertent fuel leakage past accumulator valve 62 . an alternate embodiment involves use of a spring loaded check valve 64 in lieu of accumulator valve 62 . in such a case , the displaced fuel is released via line 65 to any fuel line , such as line 40 , having pressure po . for another embodiment of the ecology management subsystem 48 a , piston diameter “ a ” 59 is about 2 . 5 inches and piston diameter “ b ” 58 is about 2 . 0 inches , while stroke 51 a is about 1 . 5 inches . those dimensions will vary as a function of the specific gas turbine engine &# 39 ; s fuel control system configuration . still referring to fig3 the rapid shutdown subsystem 48 b is comprised of a metallic cylindrically shaped valve body 67 internally bored to define valve chamber 68 and having an upper end 69 and a lower end 70 . a closely fitting cylindrically shaped small piston 71 placed internal to valve body 67 and is movable along the longitudinal axis of valve chamber 68 between the upper end 69 and the lower end 70 . an o - ring seal 72 is fitted along the periphery of small piston 70 to prevent fuel passage between upper 69 and lower 70 ends of valve chamber 68 . the rapid shutdown subsystem 48 b communicates with the ecology subsystem 48 a and other elements of the fuel control system 10 by means of the following fuel lines : line 73 is connected to line 15 downstream of high pressure pump 14 and leads to solenoid valve 74 ( which is commanded by the ecu ) and then to fuel cavity “ a ” 57 of the ecology subsystem 48 a . an orifice 75 is provided to create a pressure drop from p 1 to px when the solenoid valve 74 is open . line 76 connects line 73 to valve body 67 , thus exposing the lower end 70 of small piston 71 to pressure p 1 . line 77 connects to line 15 a and exposes the upper end 69 of small piston 71 to pressure p 2 , which is lower than p 1 . finally , line 79 communicates between the upper end 69 of valve body 67 and line 13 , immediately downstream of low pressure pump 12 , which is at pressure po , and line 78 connects line 79 to solenoid valve 74 . the fuel control system as shown in fig3 is in its first position during engine operation . solenoid valve 74 is closed and pressure in fuel cavity “ a ” 57 , px , is equal to p 1 by virtue of fuel flow through line 73 . accordingly , large piston member “ b ” 51 is fully stroked toward upper end 52 , and spring 55 is fully compressed . simultaneously , since px is higher than p 2 , small piston 71 is fully stroked toward the upper end 69 , thus preventing fuel flow from line 77 ( pressure p 2 ) to line 79 ( pressure po ). therefore , during engine operation , the other embodiment of the inventive rapid shutdown and ecology system remains inoperative . referring now to fig4 there is shown the same gas turbine engine fuel control system schematic as in fig3 with the exception that the other embodiment of the inventive rapid shutdown and ecology system 10 is now shown in its second position at engine shut down . it is at this phase that it accomplishes its intended dual function of rapid shutoff ( or turn on ) of fuel flow as well as ecology fuel management . when the gas turbine engine is shut down either by manual command from the control system ( for instance , by the pilot for aircraft applications ) or automatically through an overspeed , overtemperature or other fault detection system , the ecu opens solenoid valve 74 and shortly thereafter , when p 2 falls below a predetermined level , pressure rising valve 21 closes . closure of pressure rising valve 21 terminates fuel delivery to the combustor atomizers and opening of solenoid valve 74 immediately establishes a communication path between the upstream and downstream sides of high pressure pump 14 ( via line 73 , solenoid valve 74 , and lines 78 and 79 ). fuel pressure in fuel cavity “ a ” 57 , px , thus drops to po , causing spring 55 to shift large piston member “ b ” 51 to the extreme of its stroke in the direction of lower end 53 . this action increases the volume of fuel cavity “ b ” 54 thereby collecting all the fuel in the fuel control system 10 downstream of pressure rising valve 21 , and preventing it from draining into the engine creating atmospheric pollution and / or puddling , causing hot starts upon subsequent engine operation . simultaneously , at rapid shutdown subsystem 48 b , with the reduction of px to po , small piston 71 moves toward lower end 70 , thus establishing an open communication path between line 77 and line 79 . in addition , as the pressure in lines 77 and 19 fall to the p 0 level the bypass valve 18 moves toward orifice 19 a . these actions causes all of the fuel being delivered to the chamber atomizers to be immediately bypassed back to the high pressure pump 14 inlet , either through the bypass valve itself or through piston “ a ” cavity upper end 69 . the rapid shutoff of fuel flow to the engine has therefore been achieved . when solenoid valve 74 is again closed by ecu command , the reverse process takes place . fuel cavity “ a ” 57 pressure px increases to p 1 forcing small piston 71 to move toward upper end 69 , stopping flow through line 77 thus terminating the fuel bypass condition . on the ecology management subsystem , 48 a , large piston member “ b ” 51 also moves toward upper end 52 , compressing spring 55 , and forcing the fuel previously collected in fuel cavity “ b ” 54 to return to the fuel control system manifold downstream of pressure rising valve 21 . rapid turn on of fuel flow to the engine has therefore been achieved and atmospheric pollution has been prevented . the other embodiment also has the advantage that the ecology and rapid shutdown features can be separated , along line a - a of fig3 and 4 , in the event the ecology function is not required , such as on military engines . although the present invention has been described in considerable detail with reference to certain preferred versions thereof , other versions are possible . therefore , the spirit and scope of the appended claims should not be limited to the description of the preferred versions contained therein .	5
fig1 shows a flowchart which illustrates an embodiment of the method in accordance with the invention especially suitable for detection of low - frequency faults ; step s 10 of the flowchart determines the rate of change roc 1 of the first signal s 1 and the rate of change roc 2 of the second signal s 2 . this is preferably done by determining the amount of the difference between a first value s 1 w 1 of the first signal s 1 and an earlier second value s 1 w 2 of the first signal s 1 . the rate of change for the second signal s 2 is preferably determined by determining the amount of the difference between a first value s 2 w 1 of the second signal s 2 and an earlier second value s 2 w 2 of the second signal s 2 . in step s 11 the first threshold value sw 1 is adapted . for this purpose there is preferably provision for the adaptation of the first threshold value sw 1 to be undertaken depending on the rate of change roc 1 of the first signal s 1 and depending on the rate of change roc 2 of the second signal s 2 , by determining at the sum of the maximum rates of change max 1 , max 2 , max 3 and max 4 determined at the various points in time and of a constant k . step s 12 determines the amount b 1 of the difference between the value of the first signal s 1 and the value of the second signal s 2 . step s 13 compares the amount b 1 determined in step s 12 with the first threshold value sw 1 adapted in a step s 11 . where the amount b 1 exceeds the current first threshold value sw 1 the conclusion is that a fault has occurred . the flowchart then branches back to step s 10 . fig2 shows a flowchart which illustrates an embodiment of the method in accordance with the invention especially suitable for detection of high - frequency faults ; step s 20 determined the rate of change roc 1 of the first signal s 1 and the rate of change roc 2 of the second signal s 2 in the way already explained on the basis of fig1 . step s 21 determines the first rate of change sum roc 1 s and the second rate of change sum roc 2 s . in this case the first rate of change sum roc 1 s is determined from a rate of change roc 1 w 1 of the first signal s 1 determined at a first point in time and a number of rates of change roc 1 w 2 , roc 1 w 3 , roc 1 w 4 , roc 1 w 5 , roc 1 w 6 , roc 1 w 7 and roc 1 w 8 of the first signal s 1 determined before the first point in time while the second of rate of change sum roc 2 s is determined from a rate of change roc 2 w 1 of the second signal s 2 determined at a second point in time and a number of rates of change r 0 c 2 w 2 , roc 2 w 3 , roc 2 w 4 , r 0 c 2 w 5 , roc 2 w 6 , roc 2 w 7 and roc 2 w 8 of the second signal s 2 determined before the second point in time . the first point in time and the second point in time can coincide in this case . step s 23 executes low pass filtering of the difference between the first rate of change sum roc 1 s and the second rate of change sum roc 2 s in order to remove undesired high frequency components from this difference . in step s 24 the amount of the low pass filtered difference between first rate of change sum roc 1 s and the second rate of change sum roc 2 s is formed in order to determine a filtered value fw . subsequently the filtered value fw is compared in step s 25 with a first prespecified second threshold value sw 2 in which case a high frequency fault is concluded if the filtered value fw exceeds the second threshold value fw 2 . then the flowchart branches back to step s 20 . fig3 shows an embodiment of the first means for determining rates of change preferably provided in the device in accordance of invention . in this diagram subtraction means 34 form the difference between a first value s 1 w 1 of the first signal s 1 and an earlier second value s 1 w 2 of the first signal s 1 provided by delay means 32 . means for forming the amount 36 generate the amount of this difference and make it available as rate of change roc 1 of the first signal s 1 . fig4 shows an embodiment of the second means for determining rates of change preferably provided in the device in accordance of invention . in a similar way to the case shown in fig3 , subtraction means 40 form the difference between a first value s 2 w 1 of the second signal s 2 and an earlier second value sws 2 of the second signal s 2 provided by delay means 38 . means of forming the amount 42 make available the difference as a rate - of - change signal roc 2 of the second signal s 2 . fig5 shows part of an embodiment of the device in accordance with the invention especially for detection of low - frequency faults . in this diagram the means of adapting the threshold values designated 16 overall feature means for determining maxima 44 to which the rate of change roc 1 of the first signal s 1 and the rate of change roc 2 of the second signal s 2 are directed . the means of determining maxima 44 directs the current maximum of the rate of change roc 1 of the first signal s 1 and the rate of change roc 2 of the second signal s 2 to summation means 46 . furthermore the maxima of the rates of change max 1 , max 2 , max 3 and max 4 determined at various points in time and provided by the relevant delay means 48 to 52 are directed to the summation means 46 . from these and from a constant k fed in from memory means 54 the summation means 46 determines the current first threshold value sw 1 which will be directed to first comparison means 14 . the first comparison means 14 compare the first threshold value sw 1 with an amount b 1 which is determined by the means for forming the amount 58 from a difference between a value of the first signal s 1 and value of the second signal s 2 provided by a subtraction means 56 . where the first comparison means 14 determines that the amount b 1 is larger than the first threshold value sw 1 it concludes that there is a fault . fig6 shows a part of an embodiment of the device in accordance with the invention especially suitable for detection of high - frequency faults . in this diagram a first rate of change sum roc 1 s and a second rate of change sum roc 2 s is fed to a means of subtraction 26 to form the difference between these two rates of change . the first rate of change sum roc 1 s and the second rate of change sum roc 2 s are determined in this case using the means described below on the basis of fig7 and 8 . the difference determined by the means of subtraction 26 is fed to a low pass filter 28 which filters out undesired high - frequency signal components . the low pass filtered difference between the first rate of change sum roc 1 s and the second rate of change sum roc 2 s is subsequently fed to amount formation means 30 which delivers a corresponding amount as filtered value fw . the filtered value fw is fed to second comparison means 18 which compares the filtered value fw with a second threshold value sw 2 which is fed from threshold value storage means 20 . where the filtered value fw is larger than the second threshold value sw 2 the conclusion is that there is a high - frequency fault . fig7 shows an embodiment of the first means of summation preferably provided for the device in accordance with the invention . in this diagram a current rate of change roc 1 determined by the means for determining rates of change shown in fig3 is fed to first means of summation 22 . furthermore earlier rates of change roc 1 w 2 , roc 1 w 3 , roc 1 w 4 , roc 1 w 5 , roc 1 w 6 , roc 1 w 7 and r 0 c 1 w 8 provided by the relevant delay means 60 to 72 are fed to the first means of summation 22 . the first means of summation 22 delivers the first rate of change sum roc 1 s , which corresponds to a sliding average . fig8 shows an embodiment of the second means of summation preferably provided for the device in accordance with the invention . in this diagram a current rate of change roc 2 of second signal s 2 determined by the means for determining rates of change shown in fig4 is fed to second means of summation 24 . furthermore earlier rates of change roc 2 w 2 , roc 2 w 3 , roc 2 w 4 , roc 2 w 5 , roc 2 w 6 , roc 2 w 7 and roc 2 w 8 of the second signal s 2 provided by the relevant delay means 74 to 86 are fed to the second means of summation 24 . the second means of summation 24 delivers the second rate of change sum roc 2 s which can also be designated as a sliding average value . fig9 shows a graph which for example illustrates a typical curve of the first signal and of the second signal , in which case the curve s 1 designates the curve of the first signal and the curve s 2 reproduces the curve of the second signal . it can be seen from the illustration in fig9 that the second signal s 2 is delayed by four sampling steps compared to the first signal s 1 . furthermore the second signal s 2 exhibits a sine - wave additive fault with rising frequency . fig1 shows a graph which , for the curve of the first signal and the second signal in accordance with fig9 , illustrates the adaptation of the first threshold value , the amount of the difference between the value of the first signal and the value of the second signal and an error signal which shows when the signal difference lies above the relevant diagnosis threshold , with the curve sw 1 reproducing the curve of the first threshold value while the curve b 1 reproduces the amount of the difference of the first signal s 1 and the second signal s 2 . the curve fe shows when the amount b 1 lies above the diagnosis threshold determined in each case by the first threshold value sw 1 . it can be seen from the illustration in fig1 that the first threshold value sw 1 becomes ever greater as the frequency of the fault increases , which is also caused by the fact that the rate of change of the first signal and of the second signal increases . the curve shown in fig1 for example can be produced by the form of embodiment of the method in accordance with the invention explained on the basis of fig1 . it can be seen that faults are less easily able to be detected as the signal frequency increases . fig1 shows a graph which , for the curves of the first signal and the second signal in accordance with fig9 , illustrates the output signal of the first summation means and the second summation means . in this diagram the curve roc 1 s indicates the first rate of change sum while the curve roc 2 s indicates the second rate of change sum . the illustration in fig1 corresponds to a sliding average formed over 8 sampling steps of the first signal s 1 of the second signal s 2 respectively . the first rate of change sum roc 1 s returns to 0 after 50 sampling steps , while the second rate of change sum roc 2 s becomes ever larger as the signal frequency rises . fig1 shows a graph , which for the curves of the first signal and the second signal in accordance with fig9 , illustrates the amount of the low pass filtered difference between the first rate of change sum and second rate of change sum . it can be seen from the illustration in fig1 that the filtered value fw continues to increase as the frequency of the input signals rises . error detection , particularly of high frequency faults , is possible by a subsequent comparison with the second threshold value . the features of the invention disclosed in this description , in the drawings and in the claims can be of importance both individually and in any combination for implementing the invention .	6
fig1 - 5 show generally a first embodiment of the apparatus of the present designated generally by the numeral 10 . medullary nail inserter and remover 10 includes a frame or body in the form of an elongated handle 11 having a proximal end 12 and a distal end 13 . the proximal end 12 of the handle provides an anvil 14 that can be hammered or otherwise impacted by a user in order to insert or to remove the handle and an attached intramedullary rod 56 . placement of intramedullary rods per se in a patient &# 39 ; s femur is discussed in u . s . pat . no . 5 , 167 , 663 incorporated herein by reference . a trigger 15 and pushrod 16 are preferably integral and moveable relative to the handle body 11 . the trigger 15 moves between &# 34 ; releasing &# 34 ; and &# 34 ; locking &# 34 ; positions . when the surgeon pulls the trigger 15 towards anvil 14 and overcomes the spring 17 pressure , this defines the &# 34 ; releasing &# 34 ; position . when the surgeon releases the trigger , spring 17 urges trigger 15 and its pushrod 16 towards the distal end 13 of the handle body 11 to define the &# 34 ; locking &# 34 ; position . trigger 15 and pushrod 16 can be an integral part . handle body 11 has a longitudinal slot 18 that is occupied by pushrod 16 . trigger 15 tracks slot 18 and a longitudinal groove 20 in handle 11 . post 19 extends from rear of trigger 15 and is surrounded by coil spring 17 . spring 17 is held in position by virtue of its placement on post 19 . the coil spring 17 presses at one end portion against trigger 15 . the opposing end portion coil spring 17 fits against handle 11 at opening 19a . the distal end 13 portion of handle body 11 provides a cylindrical sleeve 21 having an outer surface 22 and an inner surface 23 . sleeve 21 surrounds cylindrically shaped member 24 . cylindrical member 24 provides an open socket that includes a hexagonal ( see fig6 ) or circular ( see fig1 ) portion 25 . socket portion 25 carries a plurality of locking balls 26 . each locking ball 26 is carried in an opening 27 . the openings 27 are sized and shaped to allow each ball 26 to extend well into socket 25 . however , the balls 26 do not fall into the socket 25 . each opening 27 is sized to allow almost one - half of a particular ball 26 to enter socket 26 ( see fig6 - 8 ). a majority of each locking ball 26 is retained within opening 27 at all times . cylindrical member 24 includes an annular end portion 29 that has a beveled annular surface portion 28 . beveled annular surface 28 allows each of the locking balls 26 to retreat fully into opening 27 so that nail puller element 48 can be removed when the trigger 15 is pulled to the &# 34 ; releasing &# 34 ; position ( see fig8 ). cylindrically shaped member 24 attaches to handle body 11 at narrowed portion 30 . a pair of opposed slots 31 , 33 are placed on opposite sides of longitudinally extending slot 18 . the slots 31 , 33 allow post 32 to extend through pushrod 16 and into each slot 31 , 33 . the post 32 forms a connection with link 34 at one end portion of link 34 . the opposing end portion of link 34 attaches to transverse post 35 ( see fig1 ). post 35 is attached to cylindrical sleeve 21 at slot opening 36 . an angle 37 is formed between the central axis of socket 25 and the longitudinal axis of handle body 11 which is generally parallel to pushrod 16 . cylindrical bore 39 is separated from the socket portion 25 by annular shoulder 38 . cylindrical bore 39 communicates with a smaller diameter passageways or channels 40 , 41 each having a common central axis 42 . the channels 40 , 41 allow a wire to be placed through each channel 40 , 41 and into cylindrical bore 39 and then into socket 25 . the wire can also be inserted into the intramedullary rod via the central bore 55 of nail puller 48 . axis 42 in fig4 shows the central axis of channels 40 , 41 . angle 37 defines the angle between axis 42 and the central longitudinal axis of handle body 11 designated as 43 in fig4 . a pair of opposed longitudinally extending slots 44 , 45 are positioned on opposite sides of cylindrical member 24 . pins 46 , 47 are provided on cylindrical sleeve 21 , each of the pins 46 , 47 extending respectively into a slot 44 , 45 . the pins 46 , 47 communicate with the end portions of the respective slots 44 , 45 to define limits of movement of cylindrical sleeve 21 relative to cylindrical member 24 . because of the connection between cylindrical sleeve 21 and pushrod 16 via link 34 , this also defines the limits of travel of pushrod 16 and trigger 15 . nail puller 48 includes an elongated shank 49 that includes a cylindrical head 50 and a hexagonal section 53 . an annular groove 52 is positioned at one end portion of shank 49 adjacent hexagonal section 53 . the opposite end of shank 49 provides a threaded end portion 54 . nail puller element 48 includes a longitudinal cylindrical bore 55 that extends the full length of shank 49 . nail puller element 48 can threadably attach at threads 54 to intramedullary rod 56 . the proximal end 57 of intramedullary rod 56 is provided with internal threads 58 that can engage the distal end 58 of nail puller element 48 at threaded portion 54 . intramedullary rod 56 is a commercially available surgical prosthetic device . such a rod can be seen in the prior brumfield patent 5 , 167 , 633 incorporated herein by reference . intramedullary rods 56 typically include a longitudinal bore 59 , a pair of diagonal openings 60 , 61 , a pair of transverse openings 62 , 63 . a plurality of bone screws ( not shown ) can be affixed through one of the openings 60 - 63 for affixing the intramedullary rod 56 to a patient &# 39 ; s bone tissue . bore 59 can extend the full length of rod 56 . the distal end 58 can be a closed end . in order to remove an intramedullary rod 56 from a patient &# 39 ; s intramedullary canal ( such as a femur ) 68 the surgeon first threads nail puller 48 into the proximal end 57 of intramedullary rod 56 . the surgeon can apply torque to the nail puller element 48 at hexagonal head 53 portion or to hexagonal section 51 using a wrench or like instrument . the surgeon then pulls trigger 15 which retracts pushrod 68 and pulls link 34 and sleeve 21 . this places the plurality of locking balls 26 adjacent beveled annular section 28 of sleeve 21 . in the position , each of the locking balls 26 is free to travel toward the beveled annular surface 28 and away from hexagonal socket 25 . this allows the nail puller element 48 to be withdrawn socket 25 as the locking balls 26 are released from the annular groove 52 of nail puller element 48 . to insert a rod 56 , the surgeon attaches nail puller element 48 to intramedullary rod 56 at proximal end 57 by threading the threaded end portion 54 into corresponding internal threads with bore 59 . the surgeon then attaches handle 11 to the nail puller element 48 at head 51a , 53 . the locking balls 26 register in annular groove 52 . the surgeon releases the trigger to lock the balls 26 in locking position ( fig7 ). the surgeon can them impact the handle 11 to transmit force necessary to implant rod 56 into the patient &# 39 ; s intramedullary canal . in fig1 - 13 , a second embodiment of the apparatus of the present invention is shown illustrating a second construction of the linkage that includes the handle 11 , pushrod 16 , cylindrical member 24 , and cylindrical sleeve 21 . in fig1 - 13 , the pushrod 16 provides a pair of tab 65 that extend transversely with respect to the central longitudinal axis of the pushrod 16 . the tab 65 register with an elongated longitudinal slot 66 . the pushrod moves between locking and releasing positions as with the first embodiment , but in the second embodiment , the locking tabs register with opposite end portions of the slot 66 depending upon whether the pushrod is in locking or releasing position . when a surgeon pulls the trigger 15 the locking tabs 65 register with end portion 67 of slot 66 . when the surgeon releases the trigger 15 , coil spring 17 urges the pushrod toward distal end 13 of handle body 11 and the tab 65 engage end portion 68 of longitudinal recess 66 . a link 70 is pinned at pinned connection 69 to pushrod 16 . link 70 attaches to cylindrical sleeve 21 at pinned connection 71 . transverse pin 71 extends through transverse 72 and sleeve 21 . one end portion of link 70 register in slot 73 of cylindrical sleeve 21 as shown in fig1 . the cylindrical portion 24 is integrally formed with handle body 11 as shown in fig1 . socket 25 is generally cylindrically shaped and carries the plurality of locking balls 26 at openings 27 . a single diagonally extending channel 74 extends between socket 25 and the upper surface 75 of handle 11 at opening 76 . the following table lists the part numbers and part descriptions as used herein and in the drawings attached hereto . ______________________________________parts listpart number description______________________________________10 medullary nail remover11 handle body12 proximal end13 distal end14 anvil15 trigger16 pushrod17 spring18 longitudinal slot19 post20 groove21 cylindrical sleeve22 outer surface23 inner surface24 cylindrical member25 socket26 locking ball27 opening28 beveled annular surface29 annular end portion30 narrowed portion31 slot32 post33 slot34 link35 post36 transverse opening37 angle38 annular shoulder39 cylindrical bore40 channel41 channel42 axis43 angle44 slot45 slot46 pin47 pin48 nail puller element49 shank50 cylindrical section51 hexagonal head section 51a cylindrical section52 annular groove53 hexagonal head section54 threaded portion55 cylindrical bore56 intramedullary rod57 proximal end58 distal end59 longitudinal bore60 diagonal opening61 diagonal opening62 transverse opening63 transverse opening64 distal end65 tab66 slot67 end of slot68 end of slot69 pinned connection70 link71 pin72 transverse opening73 slot74 channel75 upper surface76 opening______________________________________ because many varying and different embodiments may be made with in the scope of the inventive concept herein taught , and because many modifications may be made in the embodiments herein detailed in accordance with the descriptive requirement of the law , it is to be understood that the details herein are to be interpreted as illustrative and not in a limiting sense .	0
the principles of the present invention are particularly useful when utilized in a device generally illustrated at 20 in fig1 . the device 20 includes a pulse laser 6 which is a laser diode and transmits a light pulse 21 through a first focusing means such as a lens 1 to strike a beam divider 2 which is for example a 50 % mirror . the pulse 21 from the laser is divided in two portions 22 , 23 by the beam divider 2 with the unused portion 22 being fed or directed to a light absorbing surface 16 so that no disruptive reflections come about . if desired , the unused portion 22 may be directed to a light sensing means 15 ( fig2 ) to create a reference signal . the other portion 23 is directed towards an end of an optical fiber 11 and is preferably focused at the end by a second focusing means comprising a lens 3 . in order to avoid reflections as the pulse 23 strikes the end of the fiber 11 , a coated quartz plate 8 is disposed adjacent the end of the fiber 11 and the gap between the plate 8 is filled with an immersion fluid 9 . as illustrated , the fiber 11 is releasably held in a prism - shaped guideway 10 so that the fiber being measured may be easily interchanged . the pulse as it travels through the glass fiber 11 will be reflected when it reaches the opposite end or strikes a discontinuity in the fiber . when reflected , it will return and exit through the one end and strike the beam divider 2 which will reflect it preferably through focusing means such as a lens 4 onto a light sensing means receiver 7 which is a light sensitive receiver . since short fibers will require pulses having less magnitude than the longer fibers , it is desirable that the output of the laser 6 can be changed as the length of the fibers being tested is changed . however , it is undesirable to decrease the output of the laser by decreasing the current applied thereto because the necessary decreases in the current may fall in the vicinity of the laser threshold and cause alteration in the shape of the pulse as well as cause a timewise shifting . thus , the apparatus includes one or more interchangeable dampening filters 5 which are disposed in the path of the output pulse 21 of the laser to vary the output power of the pulse . it is especially favorable if all the optical surfaces for a utilized wavelength of the pulse laser 6 are coated to minimize reflection losses . it is also desirable for the laser 6 , the guideway 10 as well as the receiver 7 to be adjustable in three dimensions relative to the coupling device 2 . in fig2 a block circuit diagram of the inventive device is illustrated . the block 6 is the pulse laser which preferably is a laser diode of the type ld22 which is sold by laser diode company and which produces light of a wavelength of 905 m ( 9050 angstroms ). if a wavelength of 850 nm ( 8500 angstroms ) is desired , a laser diode la63 which is sold by the above manufacturer can be utilized . the laser 6 is triggered by a laser drive or control system 12 which can contain either a thyristor , a transistor or an avalanche transistor as an amplification element . the laser drive system 12 is controlled by a control device having a pulse generator 13 which produces pulses of a pulse width of 1 microsecond and at a pulse repetition frequency of 1 khz and at an amplitude of approximately 5 volts . an example of a suitable pulse generator is a pulse generator 101 which is manufactured and sold by the data pulse company . as mentioned above , light pulses which are reflected by a discontinuity or by a fiber end are directed to the light sensing means such as an optical receiver 7 which generates an electrical pulse from the sensed reflected light pulse . an example of suitable optical receivers are of a type such as rca &# 39 ; s type c 30815 or texas instrument type tixl74 . electrical pulses from the receiver 7 are fed to a stop input on a counter 14 which receives a triggering or starting pulse from the pulse generator 13 . an example of a typical counter which may be utilized is for example a tektronix type dc 505 or a hewlett packard type 5245 l . as mentioned above , the drive 12 may contain either a thyristor , transistor or an avalanche transistor as an amplifying element . as illustrated in fig3 the pulse laser 6 is connected to a power supply by an avalanche transistor 24 which receives an input pulse via line 25 from the pulse generator 13 . a strip line 26 is connected across the avalanche transistor 23 and may be for example approximately 1ω ≈ 5ns of electrical length and may comprise a teflon foil of 3 × 15 cm which foil is coated with copper . as mentioned above , the pulse which is coupled into one end of the glass fiber will be reflected by either the opposite end or a discontinuity contained in the fiber . thus , the term &# 34 ; discontinuity &# 34 ; should be interpreted in the present invention as including the discontinuity that occurs at the opposite end of the glass fiber . since the speed of propagation of the light in the glass fiber is easily determined and known , the geometric distance of the discontinuity from the one end of the glass fiber can be easily calculated from the measured time interval between coupling of the pulse into the one end and receiving or sensing the reflected pulse . due to the multiplicity of the losses which occur only a high output pulse laser and sensitive receivers can be utilized in the above apparatus . since the reflected output at the fiber end which is in contact with the area amounts to a so - called fresnel reflection in quartz of 3 . 5 %, the return signal is weaker by 15 db . based on this assumption , the following measurements of reflection were made with the other end of the glass fiber in contact with different materials . ______________________________________fiber end in contact with : reflection factors______________________________________air ( calibration value ) 0 . 035aluminum mirror 0 . 77mercury drops 0 . 35glycerin drops 0 . 0015non - coated photodiode ( bpx 65 ) 0 . 23non - coated photodiode immersed 0 . 11coated diode ( bpx special ) outside the coating 0 . 23inside the coating 0 . 038immersed and inside the coating not measuredplug , not immersed 0 . 052plug , immersed 0 . 0035water ( n . sub . 20 . sup . d = 1 , 333 ) 0 . 0039glycerin + water ( n . sub . 20 . sup . d = 1 . 46 ) 0 . 00035bromonaphthaline ( n . sub . 20 . sup . d = 1 . 66 ) 0 . 0049methylene iodine ( n . sub . 20 . sup . d = 1 . 74 ) 0 . 011______________________________________ if a simple gaas heterostructure laser diode with a pulse width of 100 ns and a 1 watt coupled - in output is used , a 95 db of dampening can still be permitted . a disadvantage of the broad pulses ( 100 ns ) consists in the fact that the resolution between two neighboring reflections comes at approximately 10 meters . thus , the point of reflection can be determined with only an accuracy of ± 3 . 5 meters . however , if one works with a repetition frequency of a few khz for the pulse laser , then one can employ a regulated amplifier and the accuracy improves to 1 meter . this relatively high accuracy comes from the fact that the pulse must pass through the glass fiber twice and the speed of light in glass is substantially less than that of air . thus , a doped quartz glass fiber for a light pulse of a wavelength of 0 . 9 μm has an index of refraction of 1 . 46 and the speed of the light pulse in the glass fiber is 0 . 1027 m / ns . while the apparatus of fig2 suggests starting the counter 14 with a triggering pulse from the pulse generator 13 which pulse is applied to the laser drive 12 , it is possible to use a second light sensing device 15 similar to the receiver 7 . this second light receiver is positioned to receive the portion 22 and will create a starting signal or pulse which is applied to the counter . although various minor modifications may be suggested by those versed in the art , it should be understood that i wish to employ within the scope of the patent granted hereon , all such modifications as reasonably and properly come within the scope of my contribution to the art .	6
fig1 represents a cube - shaped implant 1 of enlarged size reflecting the state of the art . the open configuration , especially of the faces 2 and vertex areas 4 , but also of edges 3 , is to be seen as a weak point of such implants 1 because the aneurysm wall in contact with them is particularly prone to rupture . in addition , the insufficient packing density of the implant 1 in the vicinity of said areas 2 , 3 and 4 only prevents to a minor extent implants subsequently placed for the purpose of filling the inner hollow space 5 from being expelled again . fig2 shows two views 2 a and 2 b of a tetrahedron - shaped implant 1 ′ according to the invention , said implant having assumed its three - dimensional tetrahedral tertiary structure . the faces 2 ′ of tetrahedron 6 are built up by two uniformly sized large loops 7 , two of which in each case being adjacently positioned , with the projections of the large loops 7 extending into the space constituted by the sectional areas of two neighboring large loops 7 each forming the imaginary edges 3 ′ of tetrahedron 6 . in each of faces 2 ′ a loop 8 of smaller size is arranged . by this arrangement the packing density of the tetrahedron 6 in the area of faces 2 ′ is increased , which significantly improves the safety against rupturing dangers to which the adjoining aneurysm wall is exposed when implant segments or further implants are subsequently inserted or placed . the high packing density thus achieved in faces 2 ′ moreover prevents in particular subsequently inserted implant segments or subsequently inserted additional implants meant to fill the inner hollow space 5 ′ from being forced out again through the neck of the aneurysm . for that reason the implant 1 ′ according to the invention is particularly suited as well to the therapeutic occlusion of wide - neck aneurysms the treatment of which , as is known , is especially difficult as a rule . besides , the arrangement of the smaller loops 8 slightly raised above the projection plane of the tetrahedron faces 2 ′ formed by the large loops 7 enables the implant 1 ′ to be particularly well secured in the aneurysm , with special reference in this context being made to fig2 a . filament 9 forming the tetrahedron 6 is a micro - helix having a diameter of 0 . 26 mm and consisting of a platinum - iridium wire which has a diameter of 60 . mu . m . a nitinol wire extends through the inner hollow space of the micro - helix , said wire being non - detachably connected at the proximal and distal end to filament 9 and due to its elastic biasing force imprinting on the helix 9 the tetrahedral tertiary structure after said helix has been released from the catheter . fig3 represents the secondary structure of the tetrahedron shown in fig2 in the form of a development of a ball making use of 4 radial sections 10 to 10 ″′. the loops 7 / 8 themselves are of roughly circular shape and having assumed their predetermined spatial configuration form a regular tetrahedron . along the longitudinal axis of helix 9 the large 7 and the small loops 8 are arranged alternately , with the small loops 8 being placed inside the large loops 7 in the secondary structure . the proximal and the distal ends of filament 9 are identified by reference number 11 and , respectively , 12 . fig4 shows two views 4 a and 4 b of a tetrahedron - shaped implant 1 ′ according to the invention , said implant having assumed its three - dimensional tertiary structure . the faces 2 ′ of tetrahedron 6 are built up by uniformly sized large loops 7 of which two each are positioned adjacent to each other and thus form by way of their projections the imaginary edges 3 ′ of tetrahedron 6 . at the location where the projection of three adjoining large loops 7 each intersects there are the vertices 4 ′ of the tetrahedron , with one smaller sized loop 8 each being arranged at said vertices . since the smaller loops 8 are arranged below the imaginary points of intersection the tetrahedron 6 in this case has a more rounded shape deviating from an ideal geometric tetrahedron shape . by this arrangement the packing density of the tetrahedron 6 in the area of vertices 4 ′ is increased , which significantly improves the safety against rupturing dangers to which the adjacent aneurysm wall is exposed when implant segments or further implants are subsequently inserted or placed . aside from this , the rounded tetrahedral shape thus formed will more favorably adapt to the organic structure of aneurysm lumens to be filled than could be accomplished with an ideal geometric tetrahedron . the high packing density thus achieved at vertices 4 ′ moreover prevents in particular implant segments or additional implants subsequently inserted or placed for the purpose of filling the inner hollow space 5 ′ from being forced out again through the neck of the aneurysm . the helix 9 forming the tetrahedron 6 is a micro - helix having a diameter of 0 . 26 mm and consisting of a platinum - iridium wire which has a diameter of 60 . mu . m . a polymer thread or a thread made of a nickel - titanium alloy extends through the inner hollow space of the micro - helix , with said thread being fixed at the proximal and distal end of the helix 9 and prevents the helix 9 from being torn off during the placement or repositioning . on the platinum - iridium wire an elastic biasing force has been imprinted which forces it into its preformed tetrahedral configuration as soon as the mechanical constraint caused by the catheter has been omitted . although the platinum - iridium alloy used has no shape - memory properties it greatly improves the slidability of the helix during placement on account of its excellent supporting characteristics . fig5 by way of 4 radial sections 10 to 10 ′″ represents the secondary structure of the tetrahedron shown in fig4 in the form of the development of a ball . the loops 7 / 8 themselves are of roughly circular shape and having assumed their predetermined spatial configuration form a regular tetrahedron . along the longitudinal axis of helix 9 the large 7 and the small loops 8 are arranged alternately , with the small loops 8 being placed between the large loops 7 . the proximal and the distal ends of helix 9 are identified by reference number 11 and , respectively , 12 . in fig6 an implant 1 ′ according to the invention is illustrated that is placed into an aciniform aneurysm 13 , said implant forming into a tetrahedron 6 as tertiary structure . by arranging the smaller loops 8 in the area of the faces 2 ′ of the tetrahedron 6 built up by the large loops 7 a higher packing density of the tetrahedron faces 2 ′ is achieved . this not only reduces the danger of a wall rupture but also and in particular prevents additionally inserted implants ( not shown here ) from exiting through the neck of the aneurysm 14 . this configuration even enables aneurysms exhibiting medium - sized necks 14 as illustrated here to be occluded without having to employ stents . it is particularly expedient here if the implant 1 ′ as shown is positioned in such a way that one of the tightly packed face areas 2 ′ of the tetrahedron 6 is situated at or above the aneurysm neck 14 . the tetrahedral tertiary structure is excellently suited for the occlusion of large aneurysms , for example of an aneurysm 13 as shown here having a therapeutic dimension of 10 min in diameter . since the tetrahedron 6 has a diameter of 12 mm it secures itself firmly inside the aneurysm 13 during placement when forming into its tertiary structure such that the tension thus built up prevents it from slipping out of the aneurysm 13 . such an “ oversizing ” offers advantages particularly for the treatment of wide - neck aneurysms because customary implants are not sufficiently secured inside of them to make sure they cannot exit or be expelled . with the help of a micro - catheter the implant 1 ′ with the distal portion 12 of the helix 9 in front was moved through the blood vessel 15 into the aneurysm 13 where , when discharged from the catheter , it assumed the illustrated three - dimensional tertiary structure on account of a mixed stress - and temperature - induced martensitic transformation of the nitinol wire accommodated in the micro - helix 9 consisting of a platinum - iridium alloy . after checking the correct positioning under radiographic control by employing customary state - of - the - art methods the implant was detached electrolytically from the insertion aid designed in the form of a guide wire . for this purpose and with the aid of a source of electrical power a voltage was applied for a period of 0 . 1 to 20 minutes to the cathode positioned on the body surface and to the implant 1 ′ acting as anode and being placed in the aneurysm 13 to be occluded . applying this voltage resulted in the implant 1 ′ becoming electrolytically detached due to electrolytic corrosion taking place at the electrolytically corrodible location in the severance module arranged between the guide wire and the filament 9 . said severance module is of particularly robust design and has a relatively large diameter of 100 . mu . m to yield a high margin of safety preventing kinking or buckling when the implant 1 is positioned . finally , the guide wire was retracted into the catheter and then removed from the system together with the catheter . fig7 is a schematic view of the development of a pentagonal dodecahedron and the extension of a micro - helix 9 designed to form into a pentagonal dodecahedron . the individual faces f1 to f12 of the polyhedron are defined by the loops of the micro - helix . in this case the distal end of the micro - helix 9 is located on a face f12 whereas the proximal end enters the body at a vertex or corner point between f1 / f2 / f3 . fig8 eventually shows as schematic representation the tapered portion of the distal end 17 of a filamentous shaping element 16 reducing to approx . 50 % of the diameter .	0
referring now to the drawings , wherein like components are designated by like reference numerals , fig1 schematically illustrates one preferred embodiment 10 of laser apparatus in accordance with the present invention . apparatus 10 includes a mode - locked resonator 12 having a resonator ( cavity ) length l . it is emphasized that the length l , as defined here , is the round - trip length of the resonator , i . e ., in a linear resonator having first and second end - mirrors , l is twice the distance from the first end - mirror to the second end - mirror . length l is an optical round - trip length of the resonator and includes the effect of refractive index of a gain - medium ( also not shown ) and any other refractive optical elements therein . mode - locked resonator 12 delivers optical pulses having a fundamental wavelength at a pulse - repetition period τ . the pulse - repetition period is dependent on the optical length of the resonator and is equal to the round - trip time τ for fundamental radiation in the resonator , i . e ., the round - trip length l divided by the speed of light . the pulse repetition frequency ( prf ) of pulses delivered is , of course , 1 / τ . the present invention is particularly useful when the prf of the fundamental wavelength pulses is greater than about 10 mhz and the pulse - duration of the fundamental wavelength optical pulses is less than about 100 picoseconds . in one example of the above - discussed paladin ™ laser , the prf of the resonator is about 80 mhz , i . e ., τ is about 12 . 5 nanoseconds ( ns ). the pulse - duration ( fwhm ) is about 15 picoseconds , i . e ., τ is about 830 times the pulse - duration . as noted above , this laser generates pulses of third - harmonic ( 3h ) radiation having a wavelength of about 355 nm from fundamental - wavelength pulses having a wavelength of about 1064 nm . for convenience of description , reference is made to this laser further in this description , but this should not be construed as limiting the invention to the particular structure or parameters of this mode - locked laser . in apparatus 10 , pulses of fundamental - wavelength radiation from resonator 12 are delivered to a harmonic generator 14 along path a . the harmonic generator converts the fundamental - wavelength pulses delivered by the laser - resonator to harmonic - wavelength pulses . harmonic generator 14 may include only one optically nonlinear crystal arranged to generate pulses of second - harmonic radiation , or two or more optically nonlinear crystals arranged to generate pulses of third or higher harmonic - wavelength radiation as is known in the art . harmonic - radiation pulses from harmonic generator 10 are delivered along path b to a pulse stretching delay loop ( pulse - stretcher ) 16 in accordance with the present invention . an inventive aspect of this pulse - stretcher is that the delay loop thereof has as round - trip of l ± δl , where δl is a relatively small fraction , for example , less than about one - hundredth of round - trip length l . in other words , the delay loop of stretcher 16 preferably has a round - trip delay time of τ ± δτ , where δτ is on the order of a few pulse - durations , i . e ., the round - trip delay time is fractionally greater than or less than a pulse - repetition period . a pulse - repetition period of 12 . 5 ns corresponds to a delay loop round - trip length of about 3 . 75 meters and a resonator length of about 1 . 875 meters . prior - art pulse - stretchers of the type described in above referenced u . s . pat . no . 7 , 035 , 012 have a delay time per round - trip that is only between one - half and a few pulse - durations . fig2 schematically illustrates one example of an optical delay loop 16 a suitable for use in the apparatus of fig1 . delay loop 16 a includes a beamsplitter 18 that is partially reflective and partially transmissive for the wavelength of harmonic - wavelength pulses generated by the harmonic generator of apparatus 10 . each of the harmonic - wavelength pulses is incident on beamsplitter 18 , which reflects a portion ( the first or prompt replica ) of the pulse along path c and transmits the remainder of the pulse into the delay loop . in the delay loop , the remainder of the pulse is incident sequentially on concave mirrors 20 , 22 , and 24 , which are preferably configured to image the remainder of the pulse 1 : 1 , and preferably in the same orientation , back onto the beamsplitter at the original point of incidence . a portion of the remainder of the pulse is transmitted through the beamsplitter along path c as a second replica of the pulse and the remainder of that remainder goes around the delay loop again to provide third fourth , fifth etc . replicas until the pulse - replicas become vanishingly small and there is essentially nothing remaining of the pulse in the delay loop . relay imaging in delay loop 16 a is at unit magnification ( 1 : 1 ) when mirrors 20 and 24 have the same focal length . mirrors 20 , 22 , 24 , and beamsplitter 18 are preferably separated by a distance approximately equal to f 1 + 2f 2 . where f 1 is the focal length of mirrors 20 and 24 , and f 2 is the focal length of mirror 22 . this ensures that a source in the plane of beamsplitter 18 is relay imaged onto the same plane after a complete roundtrip in delay loop 16 a . preferably f 1 is about equal to 2f 2 . this provides that the size of a circulating pulse ( pulse - beam ) is the same on all three mirrors and beamsplitter 18 , and that focal points ( waists ) of the beam are located about mid - way between mirrors 20 and 22 , and between mirrors 24 and 22 . the first replica of the pulse will have a relative ( to the original pulse ) peak - intensity ( relative peak - power ) r , where r is the reflectivity of the beamsplitter at the harmonic wavelength . the remaining ( transmitted ) replicas will have a relative power p ( n ) that can be approximated by an equation : p ( n )=( 1 − a ) n − 1 ( 1 − r ) 2 r n − 2 ( 1 ) where a is the round - trip loss from scatter , absorption and the like , and n is the replica - number 2 , 3 , 4 , and so forth . it can be determined from equation ( 1 ) that , in this loop configuration , the lowest peak relative power in a set ( burst ) of replicas of any one pulse will be obtained when the first and second replicas thereof have equal peak - power . the value of r required to establish this condition can be approximated by an equation : r = 2 ⁢ a - 3 + 5 - 4 ⁢ ⁢ a 2 ⁢ ( a - 1 ) ( 2 ) by way of example , for a round - trip loss a of 0 . 02 r will be about 37 . 85 %. it can also be determined that whatever the peak - power of the first and second replicas , the third replica will have a peak - power less than either the first and second replicas . it can further be determined that the fourth and higher replicas will have a lower peak - power than the forgoing replica ; and more than 99 % of the maximum pulse energy obtainable , i . e ., after round - trip losses , is contained in the first six replicas of any pulse . all pulse - replicas of any one pulse that are delivered by a delay loop are temporally spaced apart by τ ± δτ . fig3 schematically illustrates another preferred embodiment 11 of laser apparatus in accordance with the present invention similar to apparatus 10 of fig1 but wherein the delay loop 16 of apparatus 10 is replaced by a delay loop 17 that delivers a predetermined number ( here four ) of replicas of each pulse , with each replica delivered along a different path . the four paths are designated p 1 , p 2 , p 3 , and p 4 . beam - combining optics 26 combine the replicas along a common path c as illustrated . alternatively , beam - combining optics can be provided that focus the different replica paths at a common point on a target to which the replicas are being delivered . various forms of beam - combining optics are known in the art to which the present invention pertains . as a detailed description of any such beam - combining optics is not necessary for understanding principles of the present invention , no such detailed description is presented herein . fig4 depicts one example 17 a of delay - loop 17 . delay loop 17 a is similar to delay loop 16 a of fig2 with an exception that the beamsplitter and mirrors of the loop are misaligned from the alignment of fig2 such that , after a first round trip in the loop , the remainder of the pulse is incident on the beamsplitter at a point thereon spaced apart from the point of entry . after a second and third round trips in the loop the remainder of the remainder of the pulse , and the remainder of the remainder of the remainder of the pulse , are incident on the beamsplitter at other spaced - apart points . another exception is that beamsplitter 18 of loop 16 a is replaced in loop 17 a by a beamsplitter 18 s , the reflectivity ( and transmission ) of which is graded or stepped over the beamsplitter such that reflectivity thereof is dependent on the location thereon of incident radiation . fig4 a schematically illustrates one example of reflective zones r 1 , r 2 , r 3 , and r 4 on a beamsplitter 18 s corresponding to the location thereon of paths p 1 , p 2 , p 3 , and p 4 , respectively . the paths are spaced apart and about parallel to each other . the reflectivity r 4 at the point of incidence on beamsplitter 18 s after the third round trip is made as close to zero as possible . alternatively , the beamsplitter can be configured such that after the third round trip the remaining pulse energy bypasses the beamsplitter altogether . an advantage of this type of loop is that the reflectivity - grading or reflectivity - stepping of the beamsplitter can be selected such that each replica of any one pulse has about the same peak - power . a disadvantage is that beam quality on target will usually be less than optimum due to the separation of the replica paths . delay loop 17 a is only one example of a loop that can provide a predetermined number of replicas along a corresponding number of separate paths . others are described in above - referenced u . s . pat . no . 7 , 035 , 012 , the complete disclosure of which is hereby incorporated by reference . any of these loops can be operated in an aligned form as an “ infinite ” loop , such as loop 16 a , with all replicas leaving the loop on a common path . fig5 is a timing diagram schematically illustrating division of harmonic - wavelength pulses into replicas thereof and recombination of replicas of different pulses into bursts thereof in a delay loop such as the delay loop of fig2 . the vertical axis in each line of the timing diagram is relative peak - power . the timing diagram is meant to represent operation of apparatus 10 immediately after the resonator begins to deliver pulses . the temporal development of replicas of the first through sixth pulses is depicted . replicas d 1 , d 2 , d 3 , d 4 , and d 5 are depicted for each of the six pulses . replicas d 1 and d 2 are assumed to have the same peak - power . in a delay loop 16 a having a loss of 2 % per round trip , this will occur when the reflectivity of beamsplitter 18 is about 37 . 9 % and there is no second - surface reflection . replicas d 3 , d 4 and d 5 have progressively diminishing peak - power , and it is assumed that higher numbered replicas have a sufficiently low peak - power as to be negligible . by way of example for an input pulse of unit peak - power d 1 , d 2 , d 3 , d 4 , and d 5 will have relative peak values of about 0 . 379 , 0 . 379 , 0 . 140 , 0 . 052 , 0 . 019 . the next replica would have a peak - power less than 1 % of the input pulse . it is assumed that the round - trip delay in the resonator is τ ± δτ . successive replicas of any one pulse are temporally spaced apart by this round - trip delay time . the first replica of any one pulse is temporally spaced apart from the first replica of an immediately previous pulse by the pulse - repetition period τ . it can be seen that there is a transient period of about 4 round - trip times until a burst b 1 of 5 replicas is output . the burst comprises , in time sequence , the first replica of the fifth pulse , the second replica of the fourth pulse , the third replica of the third pulse , the fourth replica of the second pulse , and the fifth replica of the first pulse , with the replicas spaced apart by δτ . similar bursts will follow at intervals of τ , i . e ., the pulse - repetition period of pulses from the mode - locked resonator , with each burst comprising , in general , the sum of replicas p n ( d 1 ), p n − 1 ( d 2 ), p n − 2 ( d 3 ), p n − 3 ( d 4 ), p n − 4 ( d 5 ) where pn is the n th pulse , pn − 1 is the ( n − 1 ) th pulse and so forth . it should be noted here that pulses from a mode - locked resonator are typically highly coherent , and replicas thereof will also be highly coherent . accordingly , it is advisable to select a delay loop length such that δτ is at least about one pulse - duration , and preferably at least two or three pulse - durations , to avoid optical interference between the pulse - replicas . with a replica separation of three pulse - durations , the effective burst - duration will be only about twelve pulse - durations , i . e ., about 1 . 5 % of a pulse - repetition period for 15 - picosecond pulses at a prf of 80 mhz . the term “ effective ”, as used here , implies that the sixth and higher replicas of individual pulses have negligible contribution . the bursts of replicas will have an effect on a target of single , stretched pulses delivered at the prf of the laser - resonator . it should also be noted that if the length of the delay loop is selected such that the round - trip time therein is τ - δτ , pulse - replicas in a burst will be in a temporal sequence that is the reverse of the sequence discussed above , i . e ., p n − 4 ( d 5 ), p n − 3 ( d 4 ), p n − 2 ( d 3 ), p n − 1 ( d 2 ), and p n ( d 1 ). this is not possible in a prior - art closed - loop pulse - stretcher wherein the round - trip time is on the order of a pulse - duration . such a sequence can be used to “ tailor ” the energy - deposition temporal profile in pulse - bursts when two stretchers are “ cascaded ”. examples of this are presented further hereinbelow . fig6 is a timing diagram schematically illustrating division of harmonic - wavelength pulses into replicas thereof and recombination of replicas of different pulses into bursts thereof in a delay loop such as the delay loop of fig4 . in this example graded beamsplitter 18 s of delay loop 17 a ( see fig4 ) has been arranged such that only four replicas per pulse are created , all having the same peak - power . in this case , the temporal sequence of replicas in a burst is un - important . whatever the temporal sequence , the energy deposition profile in a burst of replicas can be tailored by appropriate selection of stepped or graded reflectivity in the beamsplitter of the delay loop . it is emphasized here that although the round - trip length of a delay loop in accordance with the present invention is only longer or shorter than that length required to provide a delay time equal to τ by a relatively small fraction , the fraction , in length units , is a few millimeters more or less than the round - trip length . this is very much greater than common manufacturing tolerances anticipated in constructing the loop or in variations in the loop length that might occur through environmental effects such as temperature variations or the like . in other words , the fractional difference is highly unlikely to occur by accident , and , in a properly constructed loop the length of the loop can be stabilized such that the fractional delay time δτ does not vary significantly in normal use . fig7 schematically illustrates yet another preferred embodiment 15 of laser apparatus in accordance with the present invention similar to the apparatus of fig1 , but wherein bursts of pulses from pulse - stretcher 16 are delivered along common path c to a second pulse - stretcher 19 having a round - trip length fractionally different from the round - trip resonator length and different from the round - trip length in pulse - stretcher 16 . pulse - stretcher 19 is arranged to divide bursts of replica pulses from pulse - stretcher into a plurality of temporally spaced - apart replicas of the pulse - bursts following a common path in the delay loop and to recombine different ones of the first pulse - burst - replicas along a common path e . pulse - stretcher 19 outputs burst of replicas with each of the bursts having more replicas per burst than the input bursts and a longer burst - duration than the input bursts . fig8 is a timing diagram schematically illustrating division of bursts of harmonic - wavelength pulses into replicas thereof by an example of pulse - stretcher 19 including a delay loop similar to the delay loop of fig2 . in this example , the beamsplitter reflectivity of both pulse - stretchers is assumed to be that which will provide that the first two replicas of a pulse ( in the case of first pulse - stretcher 16 ) or a burst thereof ( in the case of first pulse - stretcher 19 ) have equal peak - power . accordingly , the first two replica pulses in portions 1 and 2 of a first burst of pulse - replicas have a relative peak - power of about 0 . 143 with the first two replicas in subsequent portions scaling accordingly as depicted in the first line of fig8 . the burst - portions are spaced apart by a time period τ + aδτ , where a is selected ( cooperative with the temporal spacing δτ of replicas in a burst ) according to a desired degree of temporal overlap of burst - portions at the output of pulse - stretcher 19 , while still maintaining a preferred temporal spacing of at least two pulse - durations between any two replicas in the overlapping burst - portions . here , after 4 pulse - bursts have been delivered into pulse - stretcher 19 from pulse - stretcher 16 ( the first 4 lines of the timing diagram of fig8 ) the output of pulse - stretcher 19 ( the bottom line of the timing diagram of fig8 ) will comprise , portion 1 of burst 4 , portion 2 of burst three , portion 3 of burst two , and portion 4 of burst 1 . the burst - portions are combined and temporally overlapped to form , in effect , a single burst of pulse - replicas . similar combined burst - portions will be output from pulse - stretcher 19 at time intervals of τ , i . e ., at the prf of the mode - locked laser . the relative temporal position of replicas in a combined burst can be determined by tabling values of an expression : for integer values 1 through m and 1 through n , where a and b are specified in pulse - durations , a is the separation of replicas in a burst and b is the separation of burst - portions in a combination thereof , n is the number of significant replicas in a burst and m is the number of significant burst - portions in a combination . values of x in the table can be searched to make sure that there are no replicas too closely spaced according to whatever criterion is selected . fig8 a is a graph schematically illustrating computed relative intensity as a function of time in a burst of replicas at the output of pulse - stretcher 19 with the following assumptions . the replicas are assumed to be “ sech squared ” pulses . the first pulse - stretcher is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses plus seven - times the pulse - duration of the harmonic - wavelength pulses , and the second pulse - stretcher is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses plus twelve - times the pulse - duration of the harmonic - wavelength pulses . the beamsplitter reflectivity in each pulse - stretcher is assumed to be 37 . 85 % with round - trip losses of 2 % in each pulse - stretcher . the sixth and higher replicas in a burst are neglected and the fifth and higher burst - portions are neglected . a pulse - duration is about 1 . 7 on the arbitrary time scale . no two pulse - replicas are spaced apart by less than about two pulse - durations . fig8 b is a graph schematically illustrating computed relative intensity as a function of time in a burst of replicas at the output of pulse - stretcher 19 . here assumptions are the same as for the graph of fig8 with an exception that the first pulse - stretcher is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses plus three - times the pulse - duration of the harmonic - wavelength pulses , and the second pulse - stretcher is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses plus sixteen - times the pulse - duration of the harmonic - wavelength pulses . fig9 is a timing diagram schematically illustrating division of bursts of harmonic - wavelength pulses into replicas thereof by an example of pulse - stretcher 19 of fig7 including a delay loop similar to the delay loop of fig2 . replicas of different pulse - replica - bursts are combined into longer bursts as described above with reference to fig8 . in the timing diagram of fig9 , however , the delay loops of pulse - stretchers 16 and 19 are assumed to have round - trip lengths respectively fractionally greater and fractionally less than the round - trip resonator - length l of the mode - locked laser . a result of this is that , in combined burst - portions at the output of pulse - stretcher 19 , pulse - replicas having the highest peak - power are located in the center of the combination of bursts with replicas having lower power ahead of and behind these highest - peak - power replicas , as indicated in the bottom line of the timing diagram of fig9 . in the discussion presented above , the importance of avoiding temporal overlap of pulse - replicas is discussed in the context of avoiding interference . in cases where polarization of radiation delivered to a target is not important , it is possible to cause some replicas in a burst thereof to be plane - polarized in a first orientation , and others to be plane - polarized in a second orientation perpendicular to the first orientation . if a pulse - replica plane - polarized in the first orientation temporally overlaps a pulse - replica plane - polarized in the second orientation the replicas will not interfere . one means of effecting alternate polarization of replicas is depicted in fig7 a . here a second pulse - stretcher 19 a is configured such that the polarization of radiation circulating therein is rotated by 90 degrees on successive round - trips of the delay loop . fig7 b schematically illustrates one example 19 b of a delay loop for effecting this polarization rotation . delay loop 19 a is similar to the delay loop of fig2 with an exception that a half - wave ( at the wavelength of the harmonic - wavelength pulses ) plate 30 is included in the path of radiation in the loop . if radiation circulating in the resonator is vertically polarized on a nth round trip as indicated in fig7 b by arrow pn , the radiation will be horizontally polarized on an ( n + 1 ) th round trip as indicated by arrowhead pn + 1 . in this arrangement , it is recommended that the delay loop be configured such that the angle of incidence on beamsplitter 18 be as near normal as is practical . this will minimize the reflectivity difference on the beamsplitter for the different polarization - orientations . however , at an angle sufficiently different from normal , for example about 45 °, a beamsplitter can be designed that has a predetermined polarization - dependence of reflectivity , with this dependence used as an additional variable for tailoring the relative intensity of replicas output by the delay loop . by way of example , if the beamsplitter in a lossless loop has a reflectivity for the input polarization - orientation of about 29 . 289 % and a reflectivity of about 58 . 578 % for a polarization - orientation perpendicular to the input polarization - orientation , then the first three replicas will have a relative intensity of 0 . 29289 and the fourth replica and fifth replicas will have a relative intensity of only 0 . 0502 . the sixth replicas will have a relative intensity of about 0 . 008 . there will be about 88 % of the input pulse energy in the first three replicas . the peak - intensity in a burst of replicas will be about 25 % less than would be the case for an optimized loop without polarization dependence . for real ( lossy ) conditions the two reflectivity values ( r p and r s ) can be approximated by equations : r p = 1 + 1 t + 2 ⁢ ⁢ t - 1 + 2 ⁢ ⁢ t + 5 ⁢ ⁢ t 2 t 2 ⁢ ( 1 + t ) ( 4 ) r s = 1 + 3 ⁢ ⁢ t - 1 + 2 ⁢ ⁢ t + 5 ⁢ ⁢ t 2 2 ⁢ ⁢ t ( 5 ) where t is 1 . 0 minus the round trip loss , and r p has the lower of the two values . fig9 a is a timing diagram schematically illustrating division of bursts of harmonic - wavelength pulses into replicas thereof by an example of the second pulse - stretcher including a delay loop similar to the delay loop of fig7 b and recombination of horizontally and vertically polarized replicas of different pulse - replica - bursts into longer bursts . in fig9 a , vertically polarized pulse - replicas are designated by bold lines and horizontally - polarized pulse - replicas are designated by fine lines . odd - numbered portions of pulse - bursts created by the second pulse - stretcher from a burst of pulses received from the first stretcher are assumed to be vertically polarized . even - numbered burst - portions are assumed to be horizontally polarized . in a burst of replicas at the output of the second - pulse - stretcher the most closely temporally spaced replicas are plane - polarized perpendicular to each other . those skilled in the art will recognize without further detailed description or illustration that a half - wave plate could be incorporated in the first pulse - stretcher such that odd and even numbered pulse - replicas were plane - polarized perpendicular to each other . fig9 b - d are graphs schematically illustrating computed relative intensity as a function of time in a burst of replicas of hypothetical sech - squared pulses from the second pulse - stretcher of the apparatus of fig7 a wherein the first pulse - stretcher has a delay loop similar to the delay loop of fig2 and the second pulse - stretcher has a delay loop similar to the delay loop of fig7 b . the first pulse - stretcher is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses plus six - times the pulse - duration of the harmonic - wavelength pulses . the second pulse - stretcher ( the polarization alternating stretcher ) is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses minus five - times the pulse - duration of the harmonic - wavelength pulses . odd and even numbered burst - portions generated by delay loop 19 b are assumed to be respectively vertically and horizontally polarized . the beamsplitter in the polarization alternating stretcher is assumed to have the same reflectivity for each polarization state . other assumptions are the same as those of the computation of fig8 a . fig9 b and 9c graphically depict respectively the sum of vertically - polarized pulse - replicas and the sum of horizontally polarized replicas ( curves v and h respectively ) at the output of the second pulse - stretcher . in each case , the temporally closest - spaced pulse - replicas are separated by at least about two pulse - durations and also have very different peak - power , such that the difference between any constructive and destructive interference will be negligible . fig9 d graphically depicts the sum of the horizontally and vertically polarized sums . here , there are three central peak components formed by temporally overlapping vertical and horizontally polarized components . there will , accordingly , not be any interference in these peaks it is evident from the above described examples that arranging two of the inventive pulse - stretchers “ cascaded ” in optical series , and using available variables such as positive and “ negative ” delay , different delay values , and overlapping pulse - replicas perpendicular to each other affords significant flexibility in tailoring the temporal energy deposition profile of a replica pulse - burst delivered by the second pulse - stretcher . additional flexibility is possible by varying the reflectivity of the beamsplitters in the two pulse - stretchers . in above - described embodiments of the invention , each pulse - stretcher has a round - trip delay that is fractionally different from the round - trip time of radiation in the mode - locked resonator , i . e ., fractionally different from a pulse - repetition period τ of the mode - locked resonator . the fractional difference referred to here is less than a few percent of τ . variables discussed above can also be used to advantage in embodiments of the present invention wherein the inventive pulse - stretching delay loops have a round - trip delay - time that is fractionally different from a submultiple of the resonator round - trip time τ ( τ / n ± δτ , where n is an integer equal to or greater than 2 ) of the resonator . this is achieved by making the length of a delay loop about equal to l / n ± δl , where l as noted above , is the round - trip optical length of the resonator . in such embodiments the prf of stretched harmonic - wavelength pulses is n times the prf of the fundamental - wavelength pulses . fig1 schematically illustrates yet another preferred embodiment 21 of laser apparatus in accordance with the present invention that provides stretched harmonic - wavelength pulses at a prf higher than that of the fundamental wavelength pulses . apparatus 21 is similar to apparatus 10 of fig1 with an exception that pulse - stretcher 16 of apparatus 10 is replaced in apparatus 21 by a pulse - stretcher 23 that includes a delay loop having a round - trip delay time of τ / 2 ± δτ , i . e ., fractionally different from one - half of the round - trip time τ of mode - locked resonator 12 . the round - trip time of mode - locked resonator 12 is , of course , equal to the pulse - repetition period of the resonator . fig1 is a timing diagram schematically illustrating generation of pulse - bursts in an example of the apparatus of fig1 . pulse - stretcher 23 divides each input pulse into replicas d 1 , d 2 , d 3 , d 4 , and so forth as discussed above . here fifth and six replicas have too low a peak - power to be depicted and , accordingly , are neglected . the replicas of any pulse each have a different peak - power . in fig1 , the second replica of each pulse has a higher peak - power than the first replica for reasons that are discussed further hereinbelow . the third replica has a lower peak - power than the first replica , and the fourth replica has a lower peak - power than the third replica , as discussed above . the delay loop is assumed to have a round - trip delay time of τ / 2 + δτ , and the replicas of each pulse are temporally spaced by this time - interval . the first replicas of successive pulses are temporally spaced by the pulse - repetition period τ . the steady state output of pulse - stretcher 23 , depicted on the bottom line of the timing diagram of fig1 will comprise bursts of pulse - replicas b 1 , b 2 , b 3 , b 4 , b 5 , and so forth , at a burst - repetition frequency that is twice the prf of mode - locked resonator 12 . the bursts of pulse - replicas can be considered as “ stretched ” pulses repeated at twice the prf of mode - locked resonator 12 . the burst - repetition frequency can be considered as a stretched - pulse - repetition frequency . in fig1 , as the fifth and higher replicas of each pulse are neglected , burst b 1 comprises the first replica of the third pulse and the third replica of the second pulse . burst b 2 comprises the second replica of the third pulse and the fourth replica of the second pulse . burst b 3 comprises the first replica of the fourth pulse and the third replica of the third pulse , and burst b 4 comprises the second replica of the third pulse and the fourth replica of the second pulse . burst b 3 will actually also comprise the fifth replica ( not shown ) of the second pulse . burst b 4 will actually also comprise the sixth replica ( not shown ) of the second pulse . generally , in the steady state , an n th burst of replicas will comprise only even numbered pulse - replicas and an ( n + 1 ) th burst of replicas will comprise only odd numbered replicas , although any replica higher than the sixth will have vanishingly small peak - power , and can be neglected in most cases . now , in certain applications , it may be desirable that each burst of pulse - replicas ( stretched pulse ) have the same energy . this can be achieved by selecting a suitable value for beamsplitter 18 in the delay loop . recognizing that equation ( 1 ) discussed above for computing the intensity of a particular transmitted replica defines a geometric progression having a common ration r ( 1 − a ) and a scale factor ( 1 − a ) ( 1 − r ) 2 , and defining t =( 1 − a ) the total intensity i odd of odd - numbered replicas will be given by an equation : i odd = r + ( 1 - r ) 2 ⁢ rt 2 1 - r 2 ⁢ t 2 ( 6 ) and the total intensity i even of even - numbered replicas will be given by an equation : i even = ( 1 - r ) 2 ⁢ t 1 - r 2 ⁢ t 2 ( 7 ) from which it can be determined that i odd and i even will be equal when : r will be ⅓ ( 33 . 333 . . . %) when the round - trip loss is zero ( t = 1 ). for a round - trip loss of 2 % ( t = 0 . 98 ), r is about 33 . 108 %. by way of example , this provides that the first , second , third , fourth , fifth , and sixth replicas of a pulse have relative peak - power ( or peak - intensity ) of , about , 0 . 331 , 0 . 439 , 0 . 142 , 0 . 046 , 0 . 015 , and 0 . 005 . similarly it can be determined that total loss l total is given by an equation : l total = ( 1 - r ) ⁢ ( 1 - t ) 1 - rt ( 9 ) and that the intensity i in each of the equal - energy bursts is given by an equation : where in each case r has been determined from equation ( 8 ). when t = 1 ( r = 333 . 3333 %) each of the equal energy bursts produced from an input pulse will have 50 % of the energy of the input pulse . in practice it is difficult to obtain , at least from commercial suppliers , beamsplitters having a reflectivity with one or two tenths of a percent of a specified value between about 30 % and 40 %. in cases where equal burst - energy is of critical importance , it may be found useful to configure beamsplitter 18 such that it has a selectively variable reflectivity . this can be done , for example , by providing a coating having a continuously graded reflectivity ( from a value high than a desired value to a value lower than the desired value ) over the surface of the beamsplitter , with either an angular or linear gradient , and correspondingly rotating or translating the beamsplitter in the input beam path until equal burst - energy is obtained . a method of producing graded reflectivity coatings is described in u . s . pat . no . 5 , 993 , 904 , assigned to the assignee of the present invention , and the complete disclosure of which is hereby incorporated by reference . fig1 a is graph schematically illustrating computed relative power as a function of time of a sequence of equal - energy bursts of pulse - replicas from pulse - stretcher 23 in which δτ is adjusted to provide a spacing of four pulse - durations between replicas . the time axis is greatly foreshortened to allow detail of the pulse - replicas to be depicted . of note , here , is that while there are two bursts per repetition - period , the bursts are not temporally , exactly equally spaced . the temporal spacing of the bursts alternates between τ / 2 + δτ and τ / 2 − δτ . as already noted , however , δτ will usually be less than about 1 % of τ . fig1 a schematically illustrates still another preferred embodiment 21 a of laser apparatus in accordance with the present invention similar to the apparatus of fig1 but wherein the output of pulse - stretcher 23 is directed along a path c 1 into a second pulse - stretcher 25 having a round - trip length l / 4 + aδl corresponding to a round - trip delay - time τ / 4 + aδτ . the action of pulse - stretcher 25 is depicted , in timing diagram form , in fig1 b . each burst from pulse - stretcher 23 is divided into portions in pulse - stretcher 25 . in fig1 b , odd - numbered burst - portions are designated o 1 , o 2 , o 3 , and o 4 , with higher numbered portions o 5 , o 6 , and so forth , not visible on the scale of the diagram . even - numbered burst - portions are designated e 1 , e 2 , e 3 , and e 4 , again , with higher numbered portions e 5 , e 6 , and so forth , also not visible on the scale of the diagram . in the output channel c of pulse - stretcher 25 , the bottom line of fig1 b , there is a repeated series of four sequences or bursts of pulse - replicas . each series includes sequences s 1 , s 2 , s 3 , and s 4 . these are delivered in a time period τ , such that the sequence repetition rate is four - times the pulse repetition rate of the mode - locked resonator . in the steady state , in general terms , s 1 comprises the 1 st portion of the ( n + 1 ) th burst from pulse - stretcher 23 , the 3 rd portion of the nth burst , the 5 th portion of the ( n − 1 ) th burst , and so forth . s 2 comprises the 2 nd portion of the ( n + 1 ) th burst , the 4 th portion of the n th burst , the 6 th portion of the ( n − 1 ) th burst , and so forth . s 3 comprises the 1 st portion of the ( n + 2 ) th burst , the 3 rd portion of the ( n + 1 ) th burst , the 5 th portion of the n th burst , and so forth . s 4 comprises the 2 nd portion of the ( n + 2 ) th burst , the 4 th portion of the ( n + 1 ) th burst , the 6 th portion of the n th burst , and so forth . fig1 c is a graph schematically illustrating detail of computed relative power as a function of time for five pulse - sequences in the timing diagram of fig1 b . as in fig1 a , the time - axis is greatly foreshortened to allow detail of the pulse - replicas to be depicted . it is assumed in this computation that pulse - replicas in the input bursts are spaced apart by δτ equal to four pulse - durations and that the value aδτ is sixteen pulse - durations . it is also assumed that the input to pulse - stretcher 25 is replica - bursts of equal energy as discussed above . it is further assumed that the round - trip loss in each of the pulse - stretchers is 0 . 02 , and that the reflectivity of the beamsplitter in each of the pulse - stretchers is about 33 . 1 %, i . e ., that value which provides the equal - energy bursts from pulse - stretcher 23 . those having sufficient patience to compute the energy in each of the four sequences s 1 - s 4 will find that each sequence has about the same energy , even though each comprises a different set of replicas from those comprised by any other . as in the case of pulse - stretcher 23 , the sequences are not temporally , exactly equally spaced , but can be described as being about equally spaced . the present invention is described above in terms of particular embodiments . certain embodiments are arranged to deliver bursts of harmonic - wavelength pulse - replicas with temporal separation of pulses in the burst being only a relatively small fraction of the temporal separation of the pulses bursts . although the invention is described in terms of generating the harmonic - wavelength pulse - replicas by extra - cavity frequency - conversion of fundamental - wavelength optical pulses , principles of the invention are also applicable to generating bursts of pulse - replicas of harmonic - wavelength pulses from an intra - cavity frequency - converted laser - resonator and even to generating bursts of fundamental wavelength pulses or frequency - converted pulses of a non - harmonic wavelength such are generated in the resonator of an optical parametric oscillator . those skilled in the art may devise other embodiments of the present invention combining features from the above - described embodiments with out departing from the spirit and scope of the present invention . accordingly it is emphasized that the present invention is not limited to the embodiments described and depicted herein . rather , the invention is limited only by the claims appended hereto .	7
the present invention may be best understood by reference to fig1 which is a flow chart setting forth the steps of the process of the invention that are described in greater detail hereinbelow . a color photograph or picture having the desired image is chosen . the photograph or picture is then used as the basis for preparing an illustration which will then serve as the basis for the four - color separation . when creating the illustration , the coloring of the illustration is based on the premise that the background color of the substrate upon which the image is printed will be allowed to show through in a large portion of the final decorative object . additionally , the illustration must also be made with sufficient detailing so as to present the design . for example , if the design is of a person , the details of the face and other distinguishing characteristics must be present . however , a large portion of the area of the object , in the range of about 20 - 80 % of the area of the substrate , will be left blank in the illustration so that after printing , the substrate will be seen in the final object . hence , smaller details of the design object are deleted in the illustration . as a first step in the printing process , once the illustration has been prepared , the illustration is scanned by a precision four color processor used in the print art . while the processor may be a standard scanner known in the art , the software controlling the processor must be adjusted in such a way that colors closely related to the color of the substrate that will be used are deleted . this is accomplished by reading the color that is to be deleted with the color densimeter , obtaining a value for that color and picking a suitable range of color values around the value of the deleted color , that will also be deleted . one skilled in the art may accomplish this with minimal experimentation by compressing the tonal range to eliminate the colors close in appearance to the color to be deleted . these deletions will leave blanks in the four stencils produced by the separator , where the color is close to the background color , in addition to those areas left blank by the illustrator . the blanks should result in 20 - 80 % of the surface area of the substrate , that is not printed on . more preferably , the blank area of the substrate ranges from about 40 - 60 % of the surface area . once the color separation has been completed , the image is then screen printed onto a suitable substrate . while any screen printing device may be used in the process , a preferred screen printer is one known as a four - color in - line uv screen press , such as was disclosed in u . s . pat . no . 4 , 903 , 592 . this type of screen press allows for the printing of all four colors on the substrate with a constant vacuum on the substrate . moreover , the use of such a screen printer prevents the substrate from excessive movement or vibration during the printing process , such that greater accuracy and clarity of the image may be accomplished . the substrate used in the process of this invention may be any substrate to which the uv inks used in the process will adhere . it is preferred that the substrate be one that is soft and glossy , so as to impart a good effect , i . e ., that of appearing three dimensional , to the final product . a preferred substrate is polyvinylchloride with plasticizers added up to 45 weight percent . for printing , the stencils are first inserted in the press , after which the substrate is fed into the press . the ink is then laid down on the substrate through the stencils so as to produce the image on the substrate . after application of each of the inks , the ink is allowed to set and dry before the next color ink is laid down . each ink application , followed by drying , is repeated until all four color inks have been applied . after a final drying , the substrate , with the design printed thereon , may then be cut as desired so as to produce the decorative design article of the present invention , e . g ., a human shape for a silhouette or a triangular shape for a pennant , etc . the present invention is further illustrated by the following specific example which is not intended in any way to limit the scope of the invention . dan marino silhouette -- an illustration was prepared from a photograph of a sports figure , dan marino of the miami dolphins football team . the drawing illustration of dan marino was created with the intent to put it on a white background , in order to simulate the white background of a miami dolphins uniform . various details of the design &# 39 ; s subject body were deleted in the illustration so as to maximize the blank area . however , sufficient definition remained , so that the figure in the illustration was recognizable as dan marino . the illustration so prepared was then scanned by a customized 70 line scan to produce the four - color preparation , which produced a high percentage of open print area . when scanning the illustration , the scanner was programmed to ignore colors near white , which was the color of the substrate background upon which the design was to be printed . four ulano 469 direct emulsion screw stencils were produced after the preparation of the four color separation by the scanner . for the screen printing , a precision processor model hpp3545 four - color in - line uv screen press was used . the process was initiated by placing the stencils into the press . the plain weave mesh used in the printing had a 390 line count and was made of low elongation monofilament polyester . the squeegee used in the printing was a special dual durometer 90 print side with 60 support side . the screen frame used was a newman adjustable roller model m6a . the inks used in the printing were ultra violet cured colonial ink corporation d40 process colors . two gallons of ink were used in total for a run of 2 , 500 35 &# 39 ;× 45 &# 39 ; substrate sheets . this was a very light amount , because such a large percentage ( about 50 %) of the substrate was not printed upon . the substrate used for preparing the dan marino silhouette was a 22 gauge polyvinyl chloride ( pvc ) film with plasticizers added at 45 weight percent . this is a relatively thick , soft and glossy plastic . the pvc had been dyed white . the pvc was fed into the press and the image was printed in four stages with four different colors being printed through their respective stencils that had been previously produced by the scanner . after each printing , the ink was allowed to dry before applying another layer of ink . once the printing was accomplished , the pvc was die - cut so as to produce a silhouette in the shape of dan marino , as he had posed for the original photograph .	1
as a preliminary matter , it readily will be understood by those persons skilled in the alt that the present invention is susceptible of broad utility and application . many methods , embodiments and adaptations of the present invention other than those herein described , as well as many variations , modifications , and equivalent arrangements , will be apparent from or reasonably suggested by the present invention and the following description thereof , without departing from the substance or scope of the present invention . accordingly , while the present invention has been described herein in detail in relation to preferred embodiments , it is to be understood that this disclosure is only illustrative and exemplary of the present invention and is made merely for the purposes of providing a full and enabling disclosure of the invention . the foregoing disclosure is not intended nor is to be construed to limit the present invention or otherwise to exclude any such other embodiments , adaptations , variations , modifications and equivalent arrangements , the present invention being limited only by the claims appended hereto and the equivalents thereof . turning now to the figures , fig1 illustrates a communication system 2 for altering communication segments at an intermediate communication device . a client device 4 communicates over a communication network 6 , such as a hybrid fiber coaxial cable (“ hfc ”) network , with a server device 8 . communications between client 4 and server 8 typically are processed by a centrally located intermediate network element , or device , 10 , such as a router , a cmts , a switch , or other device that processes and directs network traffic . for purposes of example , client 4 may refer to a consumer &# 39 ; s home personal computer (“ pc ”) and server 8 may refer to a web site operator &# 39 ; s web server . it will be appreciated that either client 4 or server 8 can be coupled to element 10 via network 6 as shown , or may be coupled to the intermediate network element from another network connection , such as an ethernet connection to the internet or a connection to a public switched telephony network . server 8 and client 4 communication may communication using internet protocol (“ ip ”) and related protocols , such as transmission control protocol (“ tcp ”), which is a core protocol of the internet protocol suite , as known in the alt . communication information and data is typically carried in packets , or segments , from one user device to another user device . a user device requesting information is typically referred to as a client and the device that the information is requested of is typically referred to as a server . as an example , client device 4 initiates a tcp session and sends a synchronization segment 12 a , or syn segment , toward server 8 . syn segment 12 a may include a syn bit 14 , that is set ( set is represented in the figure as a value of ‘ 1 ’) to indicate to another network device that it is indeed a syn segment . syn segment 12 a may also include a receive window scaling option field 16 . the receive window scale option field 16 is typically a three - byte field in segment 12 a and not only provides a window scale value , but also indicates that the tcp sending device , in this case client 4 , is prepared and ready to perform receive window scaling in both the send and receive directions . as syn segment 12 a propagates through network 6 after being sent from client 4 , the syn segment is intercepted by intermediate network device 10 ( a cmts is shown , but item 10 may also refers to other types of centrally located network devices that couple the client and server ). when syn segment 12 a is intercepted , cmts 10 evaluates the segment to determine whether it is a syn segment and if so , whether it indicates that receive window scaling is enabled at client 4 . if the result of both evaluations is true , then the cmts inserts a value retrieved from a memory 18 at the cmts that stores a scaling value . the value retrieved from memory 18 and inserted into the syn segment replaces the receive window size value stored in portion 16 of segment 12 a . the result of the replacement is that the altered syn segment , now shown as segment 12 b , includes the original syn bit set in portion 14 , but field 16 now contains a ‘ 4 ’ rather than ‘ 1 ’ as was in syn segment 12 a sent from client 4 . it will be appreciated that the syn segment structure is depicted in the figure for clarity and simplicity of illustration , and may not be representative of the structure of an actual segment . indeed , a typical tcp segment , including a syn segment , would have syn bit portion 14 , and receive window size value portion 16 at the beginning bytes that precede a segment &# 39 ; s payload . when server 8 receives the depicted syn segment 12 b , the receive window size scale value from portion 14 is stored to memory 20 . the value stored as value 22 is then used to scale all receive window size values in tcp segments received subsequent to receiving syn segment 12 b . another aspect shown in fig1 depicts cmts 18 altering a tcp segment sent from client 4 when the cmts intercepts the segment before forwarding it to the destination server 8 . a typical non - syn tcp packet 22 a contains a receive window value in a predetermined sixteen - bit receive window value portion 24 . this receive window value is typically based on the current capacity of a receive buffer at client 4 when the client sends tcp packet 22 a , or segment . in the example shown in the figure , the current capacity of the buffer at server 4 can support receiving 30k bytes of data . however , since the round trip time of segment 22 a propagating to cmts 10 , which intercepts it and forwards it on to server 8 and any return segments sent from server 8 to client 4 via the cmts takes a finite amount of time , and during that time the receive buffer at the client will have increased capacity as its contents are processed , the receive window size value can be artificially increased at the cmts . this provides the advantage that server 8 will send more segments back to client 4 that the receive window value in portion 24 indicates , thus making efficient use of the buffer &# 39 ; s increased capacity that will be available when the return segments are received at the client . it will be appreciated that typically after network element 10 alters a segment , or packet , it connects checksums associated with the altered segment . accordingly , the figure depicts tcp segment 22 a as sent from client 4 with a receive window size value of 30k , but after being intercepted at cmts 10 , the cmts replaces the value in portion 24 with a value determined according to a predetermined formula if the value in segment 22 a is less than a predetermined amount . in the example , assuming that the predetermined value is 64 kbytes ( the maximum that can be represented by the sixteen - bit portion 24 ), cmts 10 replaces the value in portion 24 of segment 22 a with a binary value representing 64k , and altered segment 22 b is the result , having a value of 64k in its portion 24 . this aspect ensures that server 8 will always send a minimum number of segments at each transmission during the session . it will be appreciated that the predetermined value and predetermined formula may be stored on memory 18 along with the receive window scale factor value discussed above . furthermore , it will be appreciated that the receive window scales factor value aspect and the replacing of the receive window size value aspect may both be used to increase the number and size of tcp segments sent from server 8 to client 4 . for example , if the scale factor is 4 , as discussed above and the receive window value is changed from 30k to 64k bytes , then server 8 would receive segment 22 b and scale it by the scale factor stored at memory 20 . the result of scaling 64k bytes by the scale factor of 4 is 2 4 × 64k = 16 × 64k = 1 , 024 , 000 bytes , or 1 . megabyte . thus , although client 4 sent out a syn segment 12 a with a scale factor of 1 and a subsequent tcp segment 22 a with a receive window size value of 30k , cmts 10 altered the syn segment and subsequent tcp segment so that server 8 will send segments totaling 1 megabyte to client 4 after receiving altered segment 22 b . combining the second aspect of altering the value in the portion 24 of a tcp segment with the scaling aspect prevents a no - send situation which would occur if the value in the receive window size value was zero in the tcp segment ( scaling zero results in zero ). it will , be appreciated that typically after network element 10 alters a segment , or packet , it corrects checksums associated with the altered segment . turning now to fig2 , the figure illustrates a flow diagram of a method 200 for adjusting a scalable receive window size value for regulating transmission of tcp segments . method 210 starts at step 205 . at step 210 , a tcp client begins setting up a tcp session with a tcp server . the tcp client may be , for example , a personal computer coupled to a network device , such as a cable modem , dsl modem , dial up modem , network interfaced card , etc . the tcp server may be , for example , a web server hosting a web site , a video program server , a media gateway , or other communication device . the client generates a syn message that is sent to the server as know in the art related to tcp networking , as detailed in rfc - 1323 , for example , which is incorporated herein by reference in its entirety . the syn message , or segment , as referred to in rfc - 1323 ( segments may also be commonly referred to as packets ) is sent from the tcp client to the tcp server . as discussed above , the tcp client may be coupled to a communication device that interfaces with a communication network , such as , for example , a cable network , a dsl network , a telephony network or a local area network , in the case of the network device being a cable modem , a dsl modem , a dial up modem or a network interface card , respectively . in the communication networks , the network devices typically couple to a central device , such as , for example , a cable modem termination system (“ cmts ”) in a cable network , which is sometimes referred to as a hybrid fiber coaxial (“ hfc ”) network . the cmts , or other similar device in other networks , is referred to as an intermediate network device herein and in the claims section . at step 215 , the cmts receives , or intercepts , the syn segment . a determination is made at step 217 whether the intercepted segment is a syn segment by evaluating whether a syn bit position / syn flag within the syn segment is set . if the determination at step 217 is that the segment is not a syn segment , then method 210 ends at step 240 . if the determination at step 217 is that the intercepted segment is a syn segment , then a determination is made at step 218 whether the tcp client device supports an optional receive window scaling feature . this determination may be made by evaluating the segment for , for example , a 3 - byte window scaling option field . if the scaling option field is not detected , method 200 ends . if a scaling option field is detected at step 218 , a scale factor value is inserted into the scaling option field at the cmts , or other intermediate network device , and the segment is forwarded on to the tcp server at step 220 . at step 225 , the tcp server receives the syn segment , extracts the scale factor value from the syn segment and stores the scale factor value to a memory at the server . the memory could be any memory known to those skilled in the alt , including ram , hard drive , flash memory , etc . as other packets / segments are received at the tcp server in the future , which will probably not be tcp syn segments and will likely be segments carrying data or other content information , a receive window value , as known in the art and as described in rfc 1323 , is evaluated . although described in rfc - 1323 , briefly , a receive window size value is used to inform a server how much memory capacity a client has to receive segments . according to the tcp protocol , the largest value that the sixteen - bit receive window value corresponds to is 64k bytes . to compensate for round trip delay time , as discussed above , the scale factor is applied to the receive window size value at step 230 . essentially , the sixteen - bit receive window value size is scaled by the scale amount ( defined to be 2 **( scaling option field value )) and the server then transmits a number of bytes to the requesting client up to the number of the scaled receive window value size at step 235 . for example , if the scale value is 00000100 2 = 4 10 then the receive window size value would be multiplied by 2 4 = 16 10 . if the receive window size value received in a given tcp packet corresponded to 10k bytes , and the scale factor stored at the server were 00000100 2 , then the server would send up to 160k bytes to the requesting tcp client at step 235 . method 200 ends at step 240 . turning now to fig3 , a flow diagram illustrates a method 300 for adjusting the size of the receive window value at an intermediate network device . method 300 starts at step 305 . following initial start up of a tcp session as discussed above and in rfc 1323 , an intermediate network element / device intercepts a tcp segment at step 310 from a tcp client . the segment is evaluated at step 320 and a determination is made whether the receive window size value — referred to in rfc - 1323 as receive window size ( seg . wnd ) value — in the tcp segment is less than a predetermined number . the predetermined number is preferably 64k bytes , but can be another value as chosen by the operator of the intermediate network device . if the value of the receive window size is not less that the predetermined number , then method 300 forwards the segment to the tcp server at step 340 . if the receive window value is determined by the intermediate network device at step 320 to be less than the predetermined value , for example 64k bytes , the intermediate network device adjusts the receive window size value in the tcp packet according to a predetermined formula . the formula may be , for example , ‘ x = 64k ’, thus always forcing the receive window size value to be 64k , or whatever other constant value that the operator of the intermediate network device chooses . after the receive window size value has been adjusted , or altered , at step 330 , the altered segment for which the receive window value has been altered , is forwarded to the tcp server at step 340 . method 300 ends at step 350 .	7
the description given here is to allow someone of ordinary skill in the art to build and use the present invention in related applications . a variety of modifications on the embodiments described , may be apparent to one skilled in the art and the general principles of the invention described here may be applicable to other embodiments . these other embodiments may be constructed using n - channel transistors instead of p - channel transistors , or vice versa ; bipolar transistors instead of mos ; different amplifier types instead of what is illustrated here ; different digital circuits with similar functionality instead of what is suggested here ; different construction topologies which functions similar to what is described here . therefore , the scope of present invention should not be taken as limited to the particular embodiments illustrated and described herein , but given the widest scope consistent with the principal and novel features disclosed here . in regards to fig1 , a typical switched capacitor step - down voltage regulator that is also known as “ buck ” regulator , operates based on storing and releasing electrical energy on an inductor ( 108 ). the input voltage v in is applied to node ( 106 ). during a period of time when a high side switch ( 103 ) is on but a low side switch ( 104 ) is off , a certain amount of energy is stored on the inductor . this “ stored ” energy and also the energy dissipated by the resistive load ( 110 ), are coming from the source supply . when the high side switch ( 103 ) is off and the low side switch ( 104 ) is on , although no energy is transferred from input source , the inductor continues to keep the amount of the current it was flowing through . by omitting the parasitics of the high side and low side switches ( 103 , 104 ), the inductor ( 108 ) and the capacitor ( 109 ); the voltage across the load ( 110 ) would be equivalent to in order to make the load voltage accurately constant , it is compared with a precise voltage reference connected to node ( 101 ) and duty cycle ( 105 ) is adjusted by a pulse width modulating ( pwm ) system ( 102 ). the details of such operation are is explained in many textbooks , articles , and other education materials . the important fact from this invention &# 39 ; s point of view is that , even if the duty cycle is not controlled by such a feedback loop system but stays constant , the voltage across the inductor ( 108 ) and the switch ( 107 ) must remain approximately constant . in other words , looking at equation ( 1 ), it is apparent that the output voltage can adjusted by varying d . if d is dynamically adjusted , any disturbance in the input voltage can be compensated for . this is a traditional way of how a switching regulator is made . however , if d is kept constant and the input voltage is dynamically adjusted , similar control can be exerted over the output voltage . since controlling the duty cycle without loosing stability of the loop is complicated and involved with special signals , such as a sawtooth waveform , therefore analysis and design and the number of components to be used becomes undesired , and regulation from the input voltage would have advantages . adjusting the input voltage can be done by using a linear regulator illustrated in fig2 . although variants of this type of regulator exist , the basic principle is more or less the same . a high gain operational amplifier ( 204 ) drives a pass transistor ( 203 ). in simple terms , the pass transistor &# 39 ; s resistance is adjusted in such a way that with the voltage division , a desired voltage across the load ( 205 ) can be achieved from input ( 202 ). to do this , the operational amplifier compares the output voltage and a precision reference voltage ( 201 ) and tries to make them the same . for simplification purposes , neither stability compensation nor other circuit techniques that make this circuit work properly are illustrated in this figure . when the ratio of the voltage at the output and input gets smaller , the efficiency of a linear regulator becomes poor . this is simply because the dissipated power on the pass transistor is not useful . other than efficiency , linear regulators are far better than their switching counterparts , in terms of electrical properties and design ease . it would be obvious to the one skilled in art that if the voltage across the pass transistor is kept small , then the downside of this type of regulator may be eliminated . referring to fig4 , an embodiment of such a system is illustrated . by using a high efficiency voltage shifter ( 407 ) the voltage across the pass transistor is minimized . this system is exactly same as the linear regulator drawn in fig2 with the addition of voltage shifter 407 . in this embodiment , the voltage across the voltage shifter is set to an appropriate value . this value can also be dynamically adjusted by looking at efficiency behavior of the entire system . the input to voltage shifter is indicated in fig4 by reference number ( 406 ). in essence , since the voltage across the pass transistor is a good measure of the efficiency , some embodiments can simply check this voltage and set the voltage across the voltage shifter . the linear loop still compares the output voltage with a reference voltage ( 401 ) using operational amplifier ( 405 ) and controls the resistance of pass transistor ( 403 ). this is done in such a way that the difference between input voltage ( 402 ) and output voltage ( 404 ) is essentially minimized . making the assumption that the voltage difference between node ( 404 ) and voltage across load ( 408 ) remains constant , the output voltage can be regulated without sacrificing efficiency . in fig5 is a simplified image of the buck regulator shown in fig1 configured for use as high efficiency voltage shifter for the linear regulator shown in fig2 . the difference here is that the switching regulator is not in a dynamic loop . the duty cycle ( 508 ) is set and not changed unless some efficiency drop or mode of operation ( continuous - discontinuous ) change occurs . fig6 illustrates one of many possible implementations of an efficiency monitor according to embodiments of the present invention . the linear regulator &# 39 ; s pass transistor ( 603 ) and its driving amplifier ( 605 ) are added for clarity . as mentioned earlier , the voltage across transistor ( 603 ) must be kept substantially to a minimum . the amplifier ( 615 ) measures this differential voltage and converts it to a signal referenced to the ground . gain of this amplifier is set to a known and invariant value . the output is fed to two comparators ( 610 ) and ( 611 ), compared with respect to two known values vupper ( 608 ) and vlower ( 609 ). the output of these comparators generates logic signals ( 612 ) and ( 613 ), named inc and dec , attributing either increment and decrement , or increase and decrease , depending on the embodiment that follows . for example , if this efficiency monitor drives the pwm ( 507 ) system shown on fig5 , these signals will increase or decrease the duty cycle . in other words , if the voltage across the pass transistor is larger than the upper reference voltage , the duty cycle will be increased to compensate , or vice versa . this embodiment can be used for current limiting feature of the entire regulator with an additional comparator . in fig7 , an electronic circuit block shown to generate signals ( 704 ) for controlling switches in the high efficiency voltage shifter . since various embodiments can be used for voltage shifter , this block ( 703 ) can convert inc ( 701 ) and dec ( 702 ) signals into either a duty cycle based or frequency based signals . an example duty cycle control logic which may be replaced with the block shown in fig7 , is illustrated in fig8 . when a clock is provided to input ( 803 ) or input ( 806 ), two counters starts counting . if a count value ( 813 ) in the period counter ( 805 ) reaches the value ( 812 ) in the pulse counter ( 804 ), a digital comparator ( 807 ) sends a signal ( 811 ) to a set - reset latch ( 808 ) to toggle . when the entire period is reached , period counter output ( 809 ) toggles the latch back . the period counter can be made programmable to set a desired period , however , maximum count of both counters should be the same to ensure a 100 % duty cycle . since the period counter holds the previous value if there is no change on the inc and dec signals , such a system acts as an integrator and helps the stability and also helps soft start operation naturally . fig9 illustrates the embodiment combining a linear regulator , a switching ( buck type ) step - down regulator , an efficiency monitor , and a duty cycle generator . due to the fact that signals and power are switched , a sample and hold ( sih ) block built out of a switch ( 909 ) and a capacitor ( 910 ) are added to efficiency monitor . the sih ensures that the efficiency is measured only when high side switch ( 921 ) is on . in this embodiment , a feedback filter ( 914 ) is placed to eliminate instability issues . the embodiment shown in fig1 brings further improvement over what is in fig9 . the pass transistor and the high side switch are incorporated in the same transistor ( 1017 ). the gate of transistor ( 1017 ) is driven by transistors ( 1015 ) and ( 1016 ). if transistor ( 1017 ) is off , then transistor ( 1015 ) is on and transistor ( 1016 ) is off . if transistor ( 1017 ) is on , transistor ( 1015 ) is off , then transistor ( 1016 ) is on and passes the analog signal , which the linear regulator amplifier generates , to the gate of transistor ( 1017 ). in this embodiment the feedback stability filter is replaced with a compensation network ( 1014 ) with a sih across the output transistor . in fig1 , the topology is modified slightly to reduce the need of two sih circuit ( 1107 ) to one . one of the advantages of this invention is to be able to switch the switching regulator switches faster . this is because they are not part of the main loop so that there is no unwanted latency . the higher switching frequency leads to smaller inductors . even then , this may not help to build fully integrated regulators unless switching frequency is at gigahz levels . an alternative might be a switched capacitor ( or charge redistribution ) type of step - down converters . a simplified switched capacitor step - down converter is illustrated in fig3 . in such embodiments , switches ( 303 , 304 , 305 , 306 ) are driven by non - overlapping but alternating signals to transfer charge from input voltage supply ( 315 ) to the load ( 313 ). every charge transfer causes a charge distribution between shorted capacitors which may be ( 309 , 310 , 311 , 312 ). this process reduces the voltage 307 to a desired level . as the voltage reduction amount can be adjusted by using predetermined capacitance values , it can also be determined by using variable switching frequency ( please refer to isik and james &# 39 ; u . s . patent application ser . no . 12 / 981 , 377 for a better explanation ). this is true 44 ′ only if there is always a load current . therefore , a feedback from the output is compared with a precision voltage reference ( 301 ) and a frequency modulator circuitry ( 302 ) generates a signal ( 314 ) to control the switches . advantages of such an embodiment over a buck converter is that it is inductor free and frequency can be increased to much higher levels . these two advantages can lead to fully integrated implementation . fig1 illustrates an embodiment which is very similar to the embodiment shown in fig1 . the difference is that the high efficiency voltage shifter is replaced with a switched capacitor regulator . it should also be obvious to one skilled in art that the duty cycle control block is replaced by a frequency control block ( 1206 ). fig1 . is a simplified schematic of an embodiment with enhancements similar to those enhancements shown in fig1 .	8
fig3 shows a first embodiment of the present invention . a ferrule 1 includes guide - pin guide holes 2 formed so as to penetrate a side edge of the ferrule from the front end surface of the side edge , an adhesive filling hole 3 formed in an upper surface of the ferrule 1 , multiple insertion holes 4 being communicated with this adhesive filling hole 3 and allowing insertion of front ends of optical fibers , and an obliquely polished surface 5 as well as a non - obliquely polished surface 6 both of which are formed on the front end surface of the ferrule 1 . specifically , near an entrance of each guide - pin guide hole 2 , a recess 7 communicated with this entrance is formed . the recess 7 is formed into a groove shape along the obliquely polished surface 5 , and this groove - shaped recess 7 is formed to reach an upper surface 8 of the ferrule 1 . to be more specific , the groove - shaped recess 7 is formed so as to extend toward the non - obliquely polished surface 6 and reach the upper surface 8 of the ferrule 1 . comparing with a case where the groove - shaped recess is formed toward an obliquely polished surface side ( a side opposite to the side where non - obliquely polished surface 6 is formed ), this structure prevents a depth of the recess 7 from being shallow because of the inclination . moreover , the groove - shaped recess 7 preferably has a width equal to or greater than a diameter of each of the guide - pin guide holes 2 . operations and effects of this invention will now be described with reference to fig5 . a pair of ferrules 1 and 1 are held by pressurization toward each other by use of pressurizing means ( not shown ) such as a clamp spring or the like . when the ferrules 1 and 1 are held by pressurization , the obliquely polished surfaces 5 slide relatively to each other along the oblique surfaces . as a result , a shear stress occurs in the vicinity of an edge of the guide - pin guide hole 2 , which is in contact with a guide pin p . if this stress occurs repeatedly , a bump q may be formed due to plastic deformation . in this case , the recess 7 formed at the edge of the guide - pin guide hole 2 on the obliquely polished surface 5 on the opponent side will house this bump q . therefore , the bump q will not pressurize the obliquely polished surface 5 on the opponent side and change a position thereof . in other words , since the recess 7 houses the bump q , a minute clearance will not be formed between the ferrules 1 and 1 by pressurizing the obliquely polished surface 5 of the opponent ferrule . therefore , pc contact will not be obstructed . in the first embodiment , an end of each of the recesses 7 itself is simply extended to the upper surface 8 of the ferrule 1 . alternatively , in a second embodiment , a taper portion 9 is first formed around each of the guide - pin guide holes 2 as shown in fig4 , and another groove can be formed continuously to this taper portion 9 . by forming the recess into a taper , it is possible to prevent a cracked resin formed at the time of connecting or disconnecting a joint pin from protruding toward a contact edge surface and thereby adversely affecting optical connection . each of the groove - shaped recesses 7 illustrated in fig3 and fig4 is extended until reaching the upper surface 8 of the ferrule . instead , the recess may be extended halfway before reaching the upper surface 8 of the ferrule . the present invention is applicable to a ferrule for an mt connector and to a ferrule for a mpo connector . moreover , an array of the insertion holes 4 for optical fibers formed on the front end surface is not limited only to a single row . the invention is also applicable to a structure including multiple rows of the insertion holes .	6
reference will now be made in detail to the embodiments of the invention , examples of which are illustrated in the accompanying drawings . the proper identification of a party in a proposed transaction of goods , information or services may be ascertained by the use of a two - dimensional bar code . the need to encode more information in a smaller space has driven the development , standardization , and growing use of two - dimensional bar codes . where traditional one - dimensional bar codes act as a pointer to reference information stored in a database , two - dimensional codes can function as the database itself , and therefore assure complete portability for two - dimensional labeled items . for example , pdf417 , or portable data file 417 , is a two - dimensional stacked bar code symbology capable of encoding over a kilobyte of data per label . the “ portable data file ” approach is well suited to applications where it is impractical to store item information in a database or where the database is not accessible when and where the item &# 39 ; s bar code is read in addition , pdf417 is an error - correcting symbology designed for real - world applications where portions of labels can get destroyed in handling . it performs error correction by making calculations , if necessary , to reconstruct undecoded or corrupted portions of the symbol . a user may define one of 9 error correction levels labelled levels 0 to 8 . all error correction levels , except level 0 , not only detect errors but also can correct erroneously decoded or missing information . pdf 417 also has the feature of macro pdf417 . this mechanism allows files of data to be represented logically and consecutively in a number of ‘ pdf417 ’ symbols . up to 99 , 999 different pdf417 symbols can be so linked or concatenated and be scanned in any sequence to enable the original data file to be correctly reconstructed . in particular , pdf417 has been demonstrated to be effective in communicating large data files and to be easily scannable with existing proven hand - held technologies . successful installations and broad supplier support further supported its selection . detailed decision factors included : demonstrated to be readable with a wide range of scanner technologies including laser , linear ccd and imagers best backward compatibility with the scanning of one - dimensional bar codes in existing applications . based on the versatility of the two - dimensional bar code , it is possible to use the code as a key to access information . for example , a consumer desiring certain information or goods from a provider presents a bar code previously obtained from the provider which encodes information about the consumer that only the consumer himself or herself can verify . if the provider matches the information from the bar code with the information presently provided characteristics of the user , the provider can allow access to the desired information or goods without fear that a fraud or mistake has taken place . for example , as illustrated in fig1 a computer program is used to generate a request to print a check . the user inputs the requisite information including his or her signature using , for example , a pen tablet . the computer program then prints a check similar to the form in fig2 which includes information about the user &# 39 ; s signature and other pertinent data encoded in the pdf 417 bar code on the check . the user then may sign the check in the normal fashion in the lower right hand corner . upon receipt , the bank may verify the authenticity of the signature by scanning both the pdf 417 bar code and the signature and comparing them . if they are substantially identical , the authenticity is verified . this concept can be expanded to include any type of biometric data such as facial appearance , signatures , thumbprints , handprints , voice prints and retinal scans and any type of transaction where a secure and inexpensive method of authentication is desired by each party . in an embodiment of the present invention , a mail item retrieval system ( mirs ) may be utilized . there are 38 , 000 retail postal locations and an unlimited number of non - usps commercial sites where mirs can be located . the mirs provides customers with the freedom to pick up their package 24 hours a day , seven days a week . in a further embodiment , the mirs may be located at a user &# 39 ; s home or place of business . the mirs is based on the concept that each user need only provide select biometric data to the mirs provider once in a secure fashion . at this time , the user also provides his or her location information which may include the user &# 39 ; s address , phone numbers and e - mail contacts . the user may also provide financial information to the mirs , such as a credit card number . this biometric data is then stored into the mirs to be encoded into future two - dimensional bar codes provided to the user in electronic format and thereafter printed by the user on his or her personal printer . the mirs may also provide security guarantees that creates a firewall between the biometric information . once an account is established with the mirs , the user may directs that providers of goods send merchandise purchased over the phone or the internet be sent to his or her mailbox account with the mirs . providers and other providers of goods and services may also interact with the mirs provider . turning now to fig3 shown is a flowchart of using the mirs , which is an embodiment of the present invention . in step 10 , a user receives notification of a package &# 39 ; s arrival at the mirs facility . such a notification could occur via voicemail , electronic mail , a cell phone , a pager or a pda . the notification will include an attachment for printing an appropriate receipt . in step 20 , the user at his or her convenience retrieves the information about the package received and in particular obtain a printed copy of a receipt including such information . the receipt will include a two - dimensional bar code , such as pdf which will incorporate information provided by the user to identify himself or herself previously to the system the bar code on the receipt may contain biometric data that is a unique to the user and that has been previously provided in a secure manner to the entity providing the notification service . such biometric data may include , for example , voice - print fingerprint , hand - print , retinal scan information , signature information , facial features or any other unique identifying features about the user . as shown in fig4 the printed receipt obtained may also include information necessary for the user to obtain the package . such information may include the nature of the package , the dimensions of the package and the location where the package currently resides . the security of the mirs is guaranteed by the fact that the receipt cannot be used to retrieve the package from the mirs unless and until it is countersigned by the correct user . if anyone other than the correct user attempts to sign the receipt and retrieve the package , the mirs will not release the package because the biometric signature information contained in the two - dimensional bar code and the signature will not match . this security technique may also be used for other biometric data . returning to fig3 in step 30 , the user brings the printed receipt to of the location of the package , at this location the user then it provides the required biometric data to the package provider . for example , the user may affix his or her signature on the printed receipt just prior to arriving at the package retrieval facility . as shown in step 40 , at the package retrieval facility which may be at a post office or other central location or even an the user &# 39 ; s home , the user has the mirs scan the two - dimensional bar code and also provides the necessary biometric data to the retrieval system . the act of providing such data may be accomplished by signing the receipt in the space indicated and having the mirs scan the signature or by providing a retinal scan handprint , fingerprint or voice print to the mirs . alternatively , the mirs could use a camera to scan the facial features of the user and compare the biometric data retrieved from that scan with the biometric data retrieved from scanning the two - dimensional bar code . in step 50 , the mirs compares the previously obtained biometric data encoded in and the two - dimensional bar code with the currently obtained data biometric data provided by the user . if the two sets of data match , the retrieval system than provides the package to the user . as shown in step 60 , the retrieval system may present the user with the package in order for the user to confirm that that is the actual package that is desired . in a further embodiment , the mirs can arrange that the provider of the goods only charge the user &# 39 ; s credit card once the user has actually retrieved the package . this can be accomplished without having the mirs reveal the user &# 39 ; s financial information to the provider . in a further embodiment , the mirs may employ the signature - capture system using electro - optical scanning as disclosed in u . s . pat . no . 5 , 138 , 140 , which is hereby incorporated by reference in its entirety . two - dimensional information such as a written signature can be captured and subsequently reconstructed by using an electro - optical scanner . a multi - row preamble code and a multi - row postamble code flank the signature , and each code has a row identifier for identifying which row is being scanned by a scan line emitted by the scanner , as well as start / stop data for identifying when each scan line traverses the boundaries of a space containing the signature . the occupied zones , i . e . those having parts of the signature , present a different light reflectivity to the scanner than the non - occupied zones , i . e . those having no parts of the signature . the occupied zones are akin to bars , while the non - occupied zones are akin to spaces of a upc symbol . the occupied zones represent binary ones , and the non - occupied zones represent binary zeros . when a scan line of the scanner traverses a row of zones in the space , the occupied zones reflect less light than the non - occupied zones , and this light - variable information can be processed into data representative of the signature in a manner completely analogous to that are known in the art for processing a upc symbol . however , unlike a upc symbol , which is one - dimensional and can be scanned and read by a scan line anywhere along its height ( i . e . the transverse “ y ” axis ), a signature is two - dimensional since it contains different information in both the longitudinal (“ x ” axis ) and the transverse (“ y ” axis ) directions . to decode a two - dimensional signature , it is further necessary to know which row of zones is being scanned by a particular scan line and also when each scan line enters and exits the space containing the signature . the signature scanner uses a multi - row preamble code means , and a multi - row postamble code means , respectively located forwardly and rearwardly of the space as considered along the longitudinal direction . each code means is a multi - tiered symbol structure having electro - optically scannable and readable encoded data arranged along the longitudinal and transverse directions . each symbol structure can be a unique two - dimensional marking symbol structure , a tiered bar code , or a new symbol structure compatible with prevailing standard bar code symbology . as shown in fig4 a , each code means arranges its encoded data in a plurality of longitudinally - extending rows 1 , 2 , 3 , 4 . . . n , where n is a substantially large enough number to provide adequate resolution of the signature . in theory , an infinite number of rows would provide the sharpest resolution , but , in practice , 25 rows are sufficient to provide an adequately resolved signature . the rows are tiered , i . e . stacked one above another , in the transverse direction . each row of encoded data also includes synchronizing means , i . e . start / stop data , for identifying when each scan line traverses the anterior and posterior boundary lines of the signature space . in a further embodiment , the scanning described above may be accomplished by the user using a device independent from the mirs , such as , for example , a stand - alone portable scanning device or a scanner integrated into a cell phone , pda , or pager . the returns process is a large and looming problem for retailers , e - tailers , catalog companies and the usps . the mirs may be used in a similar manner for the return of packages to a provider . after notifying the provider of the goods that a return is desired , the provider can take the opportunity to ascertain why the user wishes to return the item . such notification may be done by phone or over the internet . once the provider is notified , the provider can use the mirs to electronically deliver a return receipt to the user . the user may then print the receipt , which will include a two - dimensional bar code including encoded biometric information of the user . the receipt may also include information about addressing the package for a return including the location of the mirs , the address to which the package should be sent and postage return information . such information may also be printed out as a separate mailing label , which may be affixed to the return package . similar to the acquisition process , the user brings the printed receipt to the mirs . at this location the user then it provides the required biometric data to the mirs . for example , the user may affix his or her signature on the printed receipt just prior to arriving at the package retrieval facility . at the package deposit facility which may be at a post office or other central location or even an the user &# 39 ; s home , the user scans the two dimensional bar code and also provides the necessary biometric data to the retrieval system . the act of providing such data may be accomplished by signing the receipt in the space indicated and scanning the signature or by providing a retinal scan or handprint , fingerprint , voice print to the mirs . alternatively , the mirs could use a camera to scan the facial features of the user and compare the biometric data retrieved from that scan with the biometric data retrieved from scanning the two - dimensional bar code . the user may then deposit the package in the mirs in a secure manner . in a further embodiment , the mirs could analyze the returned package physical characteristics such as its size and weight to make a determination whether the goods to be returned are actually in the package . the mirs would compare the measured physical characteristics of the package with those previously provided by the provider . if the analysis reveals that the actual package characteristics differ from the expected characteristics , the user at the mirs could be given the opportunity to verify that the package actually contains the goods that are to be returned . if the analysis reveals that the actual package characteristics match the expected characteristics , the mirs could arrange for the provider to immediately refund the purchase price by crediting the credit card of the user if the user has chosen to provide this information to the mirs . such a credit could be reversed by the mirs if the provider later receives the package to find that the goods returned do not , in fact , match the goods expected . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims .	6
fig1 depicts a surface acoustic wave filter 10 which is in some respects of conventional construction . for example , it is formed upon one surface of a piezoelectric substrate 12 by the deposition of conductive metallic elements designed to form a sending interdigital transducer 14 , a multi - strip coupler 16 , and a receiving interdigital transducer 18 . the sending and receiving transducers are located on different tracks , i . e . opposite halves of the substrate surface , so as to avoid bulk mode reflection coupling between them . the multi - strip coupler serves to translate acoustic signals laterally from the track of the sending transducer to that of the receiving transducer , so as to maintain coupling between the transducers with respect to surface acoustic signals , although they remain decoupled with respect to bulk mode reflections . unfortunately , the multi - strip coupler also transfers unwanted surface mode reflections from track to track , in either direction , just as efficiently as it does the desired surface acoustic signal . it is effective in discriminating against bulk mode reflections , but it cannot tell the difference between a surface mode signal and a surface mode reflection . in the usual manner , each of the interdigital transducers comprises a pair of electrically opposed bus bars 20 and 21 which are connected to respective opposite electrical terminals 24 and 25 . interior fingers 28 and 29 extend in mutually parallel relationship from the opposed bus bars 20 and 21 respectively , and are interdigitated ( i . e . their lengths overlap ) so as to produce the electro - acoustic interaction for which such devices are known . the spacing between the fingers is one quarter wavelength ( at the operating frequency of the filter ). most of the interior fingers 28 and 29 are of the usual split configuration , actually consisting in effect of two adjacent but separate half - fingers a quarter wavelength apart ( at the center frequency of the filter ), extending from a common bus bar 20 or 21 , and also connected together at the ends remote from their common bus bar . another conventional aspect of this filter is the fact that the receiving transducer 18 is apodized , or finger - length - weighted , to tailor its frequency response characteristics to the particular filter application . thus the lengths of the interior fingers 28 and 29 of the latter transducer vary along the length of the longitudinal transducer axis ab so that the active , interdigitated area of the transducer is divided roughly into a central major lobe 18c and a number of minor lobes such as 18a and 18b on either side of the major lobe . in accordance with this invention , however , a novel structural feature is introduced into each of the transducers 14 and 18 : at one end of each of these transducers is an electrically connected , unsplit end finger 32 extending from bus bar 20 in a direction parallel to interior fingers 28 and 29 to a point halfway across the aperture of the transducer ; while at the other end is another electrically connected unsplit end finger 33 extending from bus bar 21 also in a direction parallel to interior fingers 28 and 29 to a point halfway across the aperture of the transducer . no other finger is colinear with any of the end fingers 32 or 33 ; that is , the locations 36 and 37 which are colinear with the end fingers 32 and 33 respectively are empty substrate areas devoid of any metallic fingers . the end fingers 32 and 33 are , like the interior fingers , spaced one quarter wavelength ( at the operating frequency of the filter ) from their respective nearest neighbors . as the term is used herein , an &# 34 ; end finger &# 34 ; is one which which is located at either the entrance or exit end of its transducer , and has no neighboring fingers on one side thereof . the &# 34 ; aperture &# 34 ; of a transducer is defined as the distance , in a direction transverse to the transducer &# 39 ; s longitudinal axis ab , over which the electrically opposed interior fingers 28 and 29 thereof are interdigitated , i . e . the active breadth of the transducer . in the case of an apodized device such as transducer 18 , the &# 34 ; aperture &# 34 ; is considered to be the maximum interdigitated distance , i . e . the peak breadth of the major active lobe 18c . in this invention the end fingers 32 and 33 extend halfway across the apertures of their respective transducers . it should also be noted that the end fingers are electrically tied to the instantaneous voltages of their respective bus bars 20 and 21 . in the above - cited prior art patent a similarly located finger is employed for echo compensation . but in that case a portion of that finger is electrically isolated , rather than having a definite voltage , and another portion thereof which has a definite voltage is colinear with the isolated finger portion , and these two portions toghether extend across nearly the entire transducer aperture . these structural divergences result in important differences in the mechanism of echo suppression and the degree of success achieved . an understanding of the difference in mode of operation requires an explanation of the respective theories of operation of these two devices . as explained in the cited prior art patent , the operation of that device depends upon the assumption that a surface acoustic wave reflection bouncing off an electrically isolated finger portion will be 180 &# 39 ; out of phase with a surface acoustic wave reflection bouncing off another finger portion which is electrically connected to a bus bar , when the two finger portions are colinear so that they are in the same phase relationship to the incident wave . these two out - of - phase reflections tend to cancel each other . notice that colinearity and electrical isolation are fundamentally important aspects of the operation of the prior art device . notice also that the echo cancellation effect depends upon the electrical disparity ( connected vs . isolated ) between the two finger elements , rather than upon a acoustic path length differential ; since they are colinear , the acoustic paths are equal . in contrast , the echo cancellation effect of the present structure depends upon a differential between acoustic path lengths . with reference to fig1 suppose an incident surface acoustic wave , represented by arrows 39 and 40 , impinges upon one end ( the entrance end ) of receiving transducer 18 . arrow 39 represents that portion of the incident wave which impinges upon the end finger 33 at the entrance end of transducer 18 , while arrow 40 represents that portion of the incident wave which impinges upon the first interior finger 28 at that same end of the transducer . since the end finger 33 extends across half of the aperture of the transducer , the incident wave is divided equally between arrows 39 and 40 . arrow 41 represents the reflection which results from finger 33 , while arrow 42 represents the reflection from finger 28 at the entrance end of the receiving transducer . since the signals represented by arrows 39 and 40 are equal in amplitude , and since the structures they encounter have the same topography except for a quarter wavelength difference in location , the reflections represented by arrows 41 and 42 are also equal in amplitude . since the fingers 33 and 28 are separated by a distance of one quarter wavelength along the transducer axis ab , there is a half wavelength difference between the total incident and reflected path length traveled by wave 39 , 41 and the total incident and reflected path length traveled by wave 40 , 42 . therefore the reflections 41 and 42 are equal in amplitude and 180 degrees out of phase with each other , which is the relationship required for cancellation . note that in this device the fingers 28 and 33 at the entrance end of the transducer must not be colinear , as in the prior art , because the principle of operation requires these fingers to be a quarter wavelength apart . note also that , in order for the phase difference between the reflections 41 and 42 to be entirely a function of the acoustic path length differential , and not affected by electrical polarity or isolation , both fingers 28 and 33 at the entrance end of the transducer are electrically tied to their respective bus bars , and neither one of them is electrically floating , as in the prior art . the reason for also providing a similar end finger 32 at the exit end of transducer 18 , and similar end fingers 32 and 33 at the opposite ends of transducer 14 , may be understood by probing deeper into the theory of operation of this device . in actuality , each finger ( and each half of each split finger ) of each transducer produces its own reflection . but since the two halves of each split finger are a quarter wavelength apart , their reflections tend to cancel each other , for path - length - differential reasons . therefore , relatively little reflection occurs as a result of a wave front &# 39 ; s passage through the interior of a transducer . instead , most of the reflection results from uncompensated boundary effects occurring at the entrance and exit ends of the transducers . for the first transit wave , the signal from sending transducer 14 enters receiving transducer 18 at the entrance end ( where end finger 33 is located ) and is partly reflected back from that end . as the unreflected portion of the signal proceeds through the receiving transducer to the exit end ( where end finger 32 is located ), it is partly reflected back from that end also . the first reflections from both ends of transducer 18 travel back to transducer 14 , entering it at the end where end finger 32 is located , and exiting from it at the end where end finger 33 is located . these first reflections are then re - reflected , once from each end of the transducer 14 , forward toward transducer 18 again . accordingly , the present invention employs an end finger for reflection compensation at each end of each transducer . the mechanism by which reflection compensation occurs at each location is the same as that explained above for the entrance end of receiving transducer 18 . the means by which the present invention produces echo compensation has been shown to be fundamentally different from that exploited by the prior art &# 34 ; floating finger &# 34 ; patent . in addition , measurements made on both structures suggest that almost an order of magnitude improvement can be obtained by means of the present invention . the explanation for such a surprising improvement may lie in an analysis of the fundamental mechanisms responsible for surface acoustic reflections which are described above . the first mechanism , mass loading , is not eliminated by the prior art technique of floating half a finger , because substantially all the mass of the floating half finger remains . the second mechanism , local short circuiting , is likewise not affected by floating half a finger , because the finger material is still there to provide a conductive path between different voltage points on the substrate . in other words , the assumption of the prior art patent , that the reflection from a floating finger will be 180 degrees out of phase with the reflection from a connected finger , is not borne out with respect to these two mechanisms . only the circulating current effect is affected by the floating finger technique , because disconnecting the floating finger from a bus bar does interrupt the circulating current path . the approach of the present invention , however , compensates for the reflections produced by all three of these mechanisms , because the assumption that reflections from the two opposite halves of the transducer aperture will have 180 &# 39 ; different path lengths is always true , regardless of the fundamental mechanism by which the reflection is produced . the result , according to empirical observations , is a surprising degree of improvement in echo suppression . because of this invention , therefore , superior filters producing a more ghost - free television image are possible . in the foregoing discussion , the theory of operation was described in connection with transducer 18 , considered as a receiver , while transducer 14 was viewed as the transmitter . but it is demonstrable that the same theoretical mechanisms of echo suppression operate when the improvement of this invention is incorporated into the transmitting transducer 14 . fig2 through 4 illustrate some of the structural variations of the invention , which however operate in the same manner as the embodiment of fig1 explained above . fig2 illustrates a transducer 110 comprising a piezoelectric substrate 112 on a surface of which are formed a sending transducer 114 , a multistrip coupler 116 , and an apodized receiving transducer 118 . in this embodiment , however , the axis of apodization cd is not coincident with the longitudinal transducer axis ab , but is at an angle to it . in order to point out that the placement of the end fingers is not important , the end finger 132 of the sending transducer 114 is not confined to one side of the transducer aperture , i . e . it is not adjacent to bus bar 120 nor to bus bar 121 thereof . although it is necessary for effective echo cancellation that the length w / 2 of the end finger be equal to one half the transducer aperture w , its location need not be confined to one half of the transducer . since the end finger 132 is not within connecting distance of either of the bus bars 120 or 121 , however , it is necessary to find another way to connect it to a definite potential reference . in the embodiment of fig2 this is accomplished by connecting the end finger 132 to the nearest interior finger 128 at both ends as illustrated , or only at one end if preferred . another type of end finger is illustrated by finger 133 at the other end of transducer 114 . this one is divided into two segments 133a and 133b , in order to demonstrate that the end finger need not be continuous , so long as the combined lengths of all the segments equals half the transducer aperture ; i . e . in this case w1 + w2 = w / 2 . still another type of end finger , exemplified by fingers 232 and 233 of transducer 118 , is required to accommodate the asymmetric apodization pattern thereof . these , however , are best seen in the enlarged detailed views of fig3 and 4 respectively . in fig3 it is seen more clearly that , because of the asymmetry of the apodization pattern , the division between the opposite polarity fingers ( short finger 128 and long finger 129 ) is much closer to one side of the transducer than the other , i . e . closer to bus bar 120 than to bus bar 121 . therefore the end finger 232 , since it extends from bus bar 120 halfway across the transducer aperture , overlaps all of the neighboring short finger 128 extending from bus bar 120 plus a portion of the neighboring long finger 129 which extends from the opposite bus bar 121 . in order to avoid disrupting the apodization pattern , this necessitates that the end finger 232 be divided into two segments 232a and 232b which are electrically connected to opposite sides of the transducer . segment 232a is connected to bus bar 120 , while segment 232b is connected to finger 129 which in turn is connected to bus bar 121 . similarly in fig4 the end finger 233 is divided into a longer segment 233a which is electrically connected to finger 128 and through the latter to bus bar 120 , and a shorter segment 233b which is connected directly to bus bar 121 . thus it will be realized that , while it is necessary for the end fingers 232 and 233 of transducer 118 to be connected to some definite potential , it is not necessary that all segments thereof be at the same potential . it should also be observed that the half aperture length requirement for end fingers is met when the total length of segment 232a plus segment 232b is equal to w / 2 , and similarly for the total length of segment 233a plus segment 233b . in any of these embodiments , the invention not only accomplishes echo suppression in a way which is different from the approaches taken by the prior art , but also achieves a significant and surprising degree of improvement thereover . the foregoing detailed description specifies an embodiment which is presently preferred , and which serves to illustrate this invention . but other embodiments may be imagined now or in the future which may incorporate one or more aspects of the invention . therefore the scope of protection accorded should not be limited to the particulars of this description , but instead should be determined by the following claims . these claims , moreover , should be interpreted consistently with the general principles and novel teachings expressed herein .	7
the current subject matter utilizes acoustophoresis , a low - power , no - pressure - drop , no - clog , solid - state approach to particle removal from fluid dispersions : i . e ., it is used to achieve separations that are more typically performed with porous filters and centrifuges , but it has none of the disadvantages of these systems . for example , the diagram 100 of fig1 shows the acoustic radiation forces acting on a suspended particle for an applied acoustic frequency of 1 mhz ( typical for an ultrasonic transducer ) and an acoustic pressure of 0 . 5 mpa maximum at the antinodes ( readily achieved in water ). achievement of higher applied acoustic frequencies and higher acoustic pressures is possible with modern electronic drives , transducers , and intermediate matching layers . examples of acoustic filters utilizing acoustophoresis can be found in commonly owned u . s . patent application ser . nos . 12 / 947 , 757 , 61 / 261 , 686 , 13 / 085 , 299 and 61 / 342 , 307 , the contents of all of these applications are hereby fully incorporated by reference . the acoustic radiation force ( f ac ) acts on the secondary - phase particles ( or fluid droplets ), pushing them to the nodes ( or antinodes ) of the acoustic standing wave . the magnitude of the force depends on the particle density and compressibility relative to the fluid medium , and increases with the particle volume . the diagram 100 of fig1 illustrates the acoustic force that operates on four different secondary phases in water as a function of the particle ( or droplet ) radius . the four secondary phases are hexanes ( a mixture of hydrocarbons , a model for oils ), red blood cells ( a model for biological cells ), bacterial spores ( a model for “ large ” protein clusters and polystyrene beads such as are used for flow cytometry ), and paramagnetic polystyrene beads ( used for various biological capture and separation protocols ). parameters used in the calculation of the acoustic force are given below in table 1 . the current subject matter is advantageous in that it uses acoustophoresis for separations in extremely high volumes and in flowing systems with very high flow rates . separations have been done for micron - size particles , for which the acoustophoretic force is quite small . for example , b . lipkens , j . dionne , a . trask , b . szczur , a . stevens , e . rietman , “ separation of micron - sized particles in macro - scale cavities by ultrasonic standing waves ,” presented at the international congress on ultrasonics , santiago , jan . 11 - 17 , 2009 ; and b . lipkens , j . dionne , m . costolo , a . stevens , and e . rietman , “ separation of bacterial spores from flowing water in macro - scale cavities by ultrasonic standing waves ”, ( arxiv ) june 2010 , the contents of both papers are hereby fully incorporated by reference ) show that bacillus cereus bacterial spores ( a model for anthrax ) have been trapped at 15 % efficiency in an acoustophoretic cavity embedded in a flow system that can process drinking water at rates up to 120 ml / minute ( 1 cm / second linear flow ). the concentration ratio has been as high as 1000 in a single - pass , small - scale prototype acoustocollector . the techniques described in this paper will scale up to higher flow rates or larger flow channel , which has been proven in a 6 ″× 6 ″ system and processing to 12 ″ in dimension . the current subject matter allows for the simultaneous agglomeration of suspended solids such as microorganisms and dirt ( metal oxides ) and oil droplets . the ability to translate and concentrate these secondary phases is known as acoustophoresis . described herein is an improved flow chamber with two different ultrasonic transducer arrangements . diagrams 200 , 300 respectively of fig2 - 3 , show two different transducer arrangements for two variations of an overall - view of the current systems which utilize a series of solid cylindrical and hollow cylindrical transducers with the flowing water for particle agglomeration . a small experimental system put together by the inventors that demonstrate the concept is described below . with reference to fig2 and 3 , a flow chamber 210 is illustrated having a multi - phase water inlet 220 , a low density outlet 230 , a water outlet 240 , and a solids outlet 250 . it will be appreciated that there may be two or more of each inlet and outlet depending on the desired configuration and volumes being processed . multi - phase water ( i . e ., water having suspended particulate , etc .) enters from the multi - phase water inlet 220 and exits as filtered water from water outlet 240 . particles and fluids having a low density , i . e ., lower than the host fluid , such , as oils and other low - density fluids , exit from the low density outlet 230 and solids and other higher density particles exit from the solids outlet 250 . an acoustic standing wave is generated in the middle of the flow chamber 210 , either by a set of tube - shaped transducers 260 arranged in a parallel spacing within a center portion of the flow chamber or by an array of flat transducers 310 , causes the particles ( oil droplets ) to agglomerate at the nodes ( antinodes ) in the acoustic wave . the agglomeration for high density particles will eventually result in their growing so as to overcome the acoustic pinning force and gravity settling causes them to fall into solids outlet 250 . in the case of oil droplets the agglomeration at the antinodes will result in droplet coalescence and they will be able to overcome the acoustic pinning force and buoyancy force causes the larger droplets to drift to the low density outlet 230 . several examples are shown in the photographs in fig4 a - d . the first photo 410 shows the acoustophoretic collection of iron oxide particles , the second photograph 420 shows the collection of algae , the third photograph 430 shows the collection of bacterial spores , and the fourth photograph 440 shows the collection of oil droplets , all in a flowing water stream . a flat , circular transducer can , for example , be used in an acoustocollector to generate the collected matter in fig4 a - d . the radial component of the pressure field of such a transducer is described by a bessel function t whereas the axial component is described by a cosine function such as in the case of a one dimensional standing wave . the radial component acts to hold the captured algae in the column against the fluid flow drag force . the trapped algae are then further concentrated by inter - particles forces . the particles are then further separated from the flow by gravitational settling or by being driven to a collector pocket through a slow frequency sweeping method similar to that given in ( i ) b . lipkens , m . costolo , and e . rietman , “ the effect of frequency sweeping and fluid flow on particle trajectories in ultrasonic standing waves ”, ieee sensors journal , vol . 8 , no . 6 , pp . 667 - 677 , 2008 ; ( ii ) lipkens , j . dionne , m . costolo , and e . rietman , “ frequency sweeping and fluid flow effects on particle trajectories in ultrasonic standing waves ,” acoustics 08 , paris , jun . 29 - jul . 4 , 2008 ; and ( iii ) b . lipkens , j . dionne , a . trask , b . szczur , and e . rietman , “ prediction and measurement of particle velocities in ultrasonic standing waves ,” j . acoust . soc . am . 124 , no . 4 , pp . 2492 ( a ). the contents of each of the aforementioned papers are hereby fully incorporated by reference . physics of acoustophoresis . acoustophoresis is the separation of a second phase ( or phases ) from a host fluid using sound pressure to create the driving force . an ultrasonic transducer operating at a fixed frequency f ( hz ) is used to set up an acoustic standing wave in a fluid - filled cavity . a one dimensional standing wave is characterized by a local pressure p that is a function of position ( x ) and time ( t ), p ( x , t )= p cos ( kx ) cos ( ω t ), ( 1 ) where p is the amplitude of the acoustic pressure ; k is the wavenumber (= 2π / λ , where λ is the wavelength ), and ω = 2πf , where ω is the angular frequency . the pressure of the acoustic wave produces an acoustic radiation force f ac on secondary - phase elements according to where r p is the particle radius , ρ f is the density of the fluid medium , c f is the speed of sound in the fluid , and x is the acoustic contrast factor , defined by where λ is the ratio of the particle density to fluid density and σ is the ratio of the speed of sound in the particle to the sound speed in the fluid . the acoustic radiation force acts in the direction of the acoustic field . the acoustic radiation force is proportional to the product of acoustic pressure and acoustic pressure gradient . an inspection of the acoustic radiation force shows that it is proportional to the particle volume , frequency ( or wavenumber ), the acoustic energy density ( or the square of the acoustic pressure amplitude ), and the acoustic contrast factor . note also that the spatial dependency has twice the periodicity of the acoustic field . the acoustic radiation force is thus a function of two mechanical properties , namely density and compressibility . for three dimensional acoustic fields , a more general approach for calculating the acoustic radiation force is needed . gor &# 39 ; kov &# 39 ; s ( 1962 ) formulation can be used for this ( see l . p . gor &# 39 ; kov , “ on the forces acting on a small particle in an acoustical field in an ideal fluid ,” sov . phys . dokl ., vol . 6 , pp . 773 - 775 , 1962 ). gor &# 39 ; kov developed an expression for the acoustic radiation force f ac applicable to any sound field . the primary acoustic radiation force is defined as the gradient of a field potential u , given by and f 1 and f 2 are the monopole and dipole contributions defined by where p ( x , y , z , t ) is the acoustic pressure , v ( x , y , z , t ) is the fluid particle velocity , and & lt ;& gt ; denote time averages . v o is the volume of the particle . the diagram 100 of fig1 shows the force required to separate small particles of various material properties . each material has its own x parameter given in equation [ 3 ]. in diagram 100 , material properties ( e . g . speed of sound , density ) are used for the indicated material . the graph for bacteria spore is also valid for other materials of similar bulk modulus . meaning smaller bacteria spore , very large protein clusters , and polystyrene microspheres would all be in this category . the blood cell curve is for any cells of similar bulk modulus . finally the hexane curve would be valid for any tiny drops of oil - like material with the radius indicated on the curve . these curves are for , as an example , 1 mhz applied acoustic frequency and an acoustic pressure of 0 . 5 mpa . these are easily achieved control variables . higher frequency and higher pressure will afford better separation of smaller particles — down to 10 s of nm . simulations regarding the current subject matter were run by plotting the following equation : where n is the number density of the suspended particulate , f is the frequency , c is the speed of sound , e ac is the energy density of the acoustic wave , r is the particle radius , x is the contrast factor , t is time , m is the dynamic viscosity of the fluid , and x is position in the standing wave . the equation describes the kinetics of the particles in the standing wave as a result of the action of the drag force and acoustic radiation force . this equation is derived in the paper by feke et al . the diagrams of fig5 - 10 plot the relative concentration , capture efficiency for different size particles of different densities and different frequencies . along the x - axis is direction the particles travel from 0 to λ / 2 . the y - axis is the concentration relative to the initial of 1 . diagram 500 of fig5 shows the separation at 250 khz for oil and an acoustic pressure amplitude of 250 khz . three particles sizes are shown ; in black a 1 mm radius particle , in green a 10 mm radius particle , and in red a 100 mm radius particle . we see that the large droplets are heavily concentrated at the pressure anti - nodal planes of the standing wave , whereas the intermediate and small particle have not undergone any appreciable concentration . this situation can be used to selectively concentrate and separate large particles , and exhibits size - exclusion behavior . diagram 600 of fig6 shows separation at 1 mhz for oil . here one can see a concentration efficiency of much greater than 20 : 1 for the intermediate and large droplets , and only minor changes for the small droplets . finally , diagram 700 of fig7 shows separation at 10 mhz , where the intermediate and small particles are heavily concentrated , but not the large ones . this is caused by the fact that the large particles are of the same order as the wavelength , and the acoustic radiation force is no longer effective . this is significant , because it shows a size - exclusion behavior that can be further exploited for preparation of very fine emulsions of biologically significant agents . fig8 - 10 show analogous conditions for iron oxide ( feo 2 , a metal oxide simulant ). diagram 800 of fig8 shows concentration at 250 khz and 250 kpa for large , intermediate , and small particles of 100 , 10 , and 1 micron . we observe that particles with positive contrast move to the pressure nodes . it also shows that the large particles are concentrated significantly at the pressure nodes , and intermediate and smaller particles are not concentrated . therefore , size - exclusion can work here as well . diagram 900 of fig9 shows the concentration at 1 mhz and 1 mpa , and shows that large and intermediate particles are concentrated but not small ones . finally , diagram 1000 of fig1 shows concentration at 10 mhz , where intermediate and small particles are concentrated . the large particles are of similar magnitude as the wavelength and do not experience significant concentration . analogous behavior is observed for micro - algae , bacteria , and blood cells . like the oil case above , this is also significant because it demonstrates that the current subject matter can be applied for biotechnology applications for separating species of various sizes , essentially a high - flow , large - volume , size - exclusion separation technology . it also shows promise for lipid and platelet separation of blood . as described above , two approaches to concentrating the particles through acoustic standing wave agglomeration ( or coalescence ). ( 1 ) the first approach as illustrated in fig2 involves a series involves a parallel array of tube - shaped transducers . ( 2 ) the second approach as illustrated in fig3 uses a series of flat acoustic transducers operating at 1 mhz and 10 mhz . notwithstanding , it will be appreciated that other arrangements of acoustic transducers can be utilized . the first implementation is shown in fig2 with further details in the diagram 1100 of fig1 . with this arrangement , a multiphase - water mixture is pumped into the flow chamber 210 via the multi - phase water inlet 220 device from the where it encounters a parallel array of tube - shaped transducers 260 each operating at 1 - 10 mhz frequency . when the solution encounters the array of tube transducers 260 the agglomeration occurs and due to gravity the large clumps fall into the solids outlet 250 ( e . g ., a collection port , etc .). any coalesced oil , or oil - like substances , will overcome buoyancy and self - transport to the respective low density outlet 230 on the top of the flow chamber 210 . diagram 1100 of fig1 shows pressure nodes in the tube - shaped transducer array 260 . with the second approach , as shown in fig3 , a multiphase - water mixture is pumped into the flow chamber 210 via the multi - phase water inlet 220 where it encounters a serial array of flat 1 cm transducers 310 operating at a frequency range between 1 and 10 mhz . like the first approach , when the solution encounters the array of tube transducers 310 the agglomeration occurs and due to gravity the large clumps fall into the solids outlet 250 ( e . g ., a collection port , etc .). any coalesced oil , or oil - like substances , will overcome buoyancy and self - transport to the low density outlet 230 on the top of the flow chamber 210 . as used herein , unless otherwise stated , the term outlet can comprise a piped exit from the flow chamber 210 or it can comprise a collection port requiring periodic removal of separated particulate . while this specification contains many specifics , these should not be construed as limitations on the scope of what is claimed or of what may be claimed , but rather as descriptions of features specific to particular variations . certain features that are described in this specification in the context of separate variations can also be implemented in combination in a single variation . conversely , various features that are described in the context of a single variation can also be implemented in multiple variations separately or in any suitable sub - combination . moreover , although features may be described above as acting in certain combinations and even initially claimed as such , one or more features from a claimed combination can in some cases be excised from the combination , and the claimed combination may be directed to a sub - combination or a variation of a sub - combination . similarly , while operations are depicted in the drawings in a particular order , this should not be understood as requiring that such operations be performed in the particular order shown or in sequential order , or that all illustrated operations be performed , to achieve desirable results . only a few examples and implementations are disclosed . variations , modifications and enhancements to the described examples and implementations and other implementations may be made based on what is disclosed .	2
a new formulation on of zta that is lighter in weight than standard zta ( 10 - 25 percent by weight zro 2 ), but that is stronger than non - toughened alumina has been formulated . yittria tetragonal zirconia polycrystals ( ytzp ) has a theoretical density of around 6 . 1 g / cc and is much denser than pure α - al 2 o 3 that has a theoretical density of around 3 . 98 g / cc , so incorporating less ytzp will make the material lighter . standard zta of 25 - percent by weight of ytzp has a theoretical density of 4 . 35 g / cc . the new material with about 1 - to - 2 percent by weight ytzp has an actual density of only 3 . 92 - 3 . 95 g / cc . less than 2 . 5 weight percent ytzp keeps density of the final ceramic under 4 . 0 g / cc , while more than 0 . 5 weight percent ytzp helps add some strength to the ceramic . by itself the small amount of ytzp added to the α - al 2 o 3 , however , does not dramatically increase the strength of the alumina as the grain size of the alumina still grows during processing to grain sizes of 6 - to - 20 microns during high temperature processing of 1637 ° c .- 1660 ° c . the large grain size equates to lower strength . mgo is known to be a grain growth inhibitor , however standard amounts of mgo ( 0 . 06 - percent by weight ) provided alone in vendor materials such as by pechiney ® lsb 172 do not provide enough inhibition to limit grain growth to less than 6 - microns . it was found that by adding small amounts ( range of 0 . 03 to 0 . 05 weight percent ) of mgo as mg ( oh ) 2 particles , and further combining with low percentages of nano - ytzp the average . al 2 o 3 grain size can be kept less than 6 - microns ( specifically a d50 diameter of between 4 . 8 and 6 . 0 - microns for the ceramic produced in examples 1 - 3 ) during high - temperature processing and improve the material &# 39 ; s strength . this new sintered composition of zta comprises 0 . 5 to 2 . 5 weight percent zro 2 in the form of crystalline grains that are stabilized in a substantially tetragonal crystal structure , 0 . 03 to 0 . 10 weight percent mgo in the form of crystalline grains , and the remainder of the ceramic being substantially α - al 2 o 3 . the ceramic has an actual density of less than 4 . 0 g / cc . the ceramic has an average α - al 2 o 3 grain size less than 6 - microns and strength greater than 50 kpsi . α - al 2 o 3 crystalline particles used in the preparation of the examples described below were pechiney ® powders , specifically , pechiney ® p172 sb03 that has no mgo and a d50 particle size of 0 . 5 - microns and pechiney ® p172 lsb that has 0 . 06 weight percent mgo and a d50 particle size of 0 . 50 - microns . ytzp with a particle size of less than 0 . 1 - microns ( nanoparticle size ) were used . these ytzp powders were purchased from absco ® and mel ® of england . the mgo added to control the grain growth was in the fully hydrated form as mg ( oh ) 2 . the fully hydrated mgo was prepared by milling mgo in dionized water at a concentration of 60 - percent solids . the yield from the solids becomes 69 - percent mgo on sintering . the slurry particle size was 0 . 5 - 1 . 0 microns , which upon calcination becomes less than 0 . 1 - microns . having the mgo fully hydrated provides for better composition control with yields of mgo that are more accurate . one or more organic binders in combination with water and a dispersant ( ammonium polyacrylate by rt vanderbuilt ®) were mixed with all particles to form a slurry . the organic binders act as a binding agent that holds the mixture of particles together . during sintering , the organic binders burn off , leaving the shape of the body intact . some examples of organic binders that may be used to form green compact include polyvinyl alcohol ( pva ) and polyethylene glycol ( peg ). other binders include , but are not limited to , acrylic binders , gum and waxes . general preparation of the new lightweight zta formulation is as follows . measured amounts of α - al 2 o 3 powder , ytzp powder , mg ( oh ) 2 as a slurry , organic binders , dispersants and water are mixed together in a premix tank and then passed through a bead mill . after bead milling , the d50 of all particles in the slurry is milled to less than 1 - micron . the resulting slurry is spray dried into granulated powder and then pressed into a green compact of a given shape . the green compact is heated to 350 ° c . to 600 ° c . as part of a binder burn out cycle . the green compact is then further heated to a sintering temperature of 1637 ° c . to 1660 ° c . for 4 - hours . shrinkage of approximately 18 - 22 percent is obtained after sintering . the composition ranges of the final lightweight , high - strength zta materials are listed in table 1 . modulus of rupture was tested using an instron ® three point bend fixture . a mixture of alumina powder with no vendor added mgo , 0 . 05 - weight percent added mgo ( added as 0 . 12 % mg ( oh ) 2 slurry ), and 2 . 0 - weight percent nano - ytzp was prepared according to the formulation in table 2 . p172 sb03 and mg ( oh ) 2 were added first followed by nanoparticle ytzp to the water , binder and a dispersant . the slurry was premixed for 30 - minutes and then passed through the bead mill once . the slurry was spray dried with the binder at 550 - 600 psi . the parts were pressed and sintered at 1637 ° c . to 1660 ° c . with a binder burnout cycle between 350 ° c .- 600 ° c . a 3 - point bend test showed strength of 55 kpsi . actual density of the sintered ceramic was 3 . 94 g / cc . grain size was d50 4 . 8 - microns . sample preparation was the same as example 2 above ; however , 0 . 03 - weight percent mgo was added as mg ( oh ) 2 slurry . a 3 - point bend test showed strength of 53 kpsi . grain size was d50 5 . 4 - microns . sample preparation was the same as example 2 above ; however , 1 . 0 - weight percent nano - ytzp was added . a 3 - point bend test showed strength of 48 kpsi . grain size was d50 5 . 8 - microns . sample preparation was the same as example 2 above ; however , no mgo was added . a 3 - point bend test showed strength of 43 kpsi . grain size was d50 6 . 1 - microns . sample preparation was the same as example 2 above ; however , no nano - ytzp was added . a 3 - point bend test showed strength of 44 kpsi . grain size was d50 12 . 0 - microns . a mixture of alumina powder with only the mgo added by the vendor and 2 . 0 - weight percent nano - ytzp , but with no additional mg ( oh ) 2 , was prepared according to the formulation in table 3 . p172 lsb was added first followed by nano - ytzp to the water , binder and a dispersant . the slurry was premix for 30 - minutes and then passed through the bead mill once . the slurry vas spray dried with the binder at 550 - 600 psi . the pans were pressed and sintered at 1637 ° c . to 1660 ° c . with a binder burnout cycle between 350 ° c .- 600 ° c . a 3 - point bend test showed strength of 44 kpsi . actual density of the sintered ceramic was 3 . 94 g / cc . average grain size was 7 . 7 - microns . sample preparation was the same as example 6 above ; however , no nano - ytzp was added . a 3 - point bend test showed strength of 44 kpsi . actual density of the sintered ceramic was 3 . 90 g / cc . grain size was 15 - microns . while several embodiments of the invention , together with modifications thereof , have been described in detail herein and illustrated by the accompanying examples , it will be evident that various compositions and further modifications are possible without departing from the scope of the invention . nothing in the above specification is intended to limit the invention more narrowly than the appended claims . the examples given are intended only to be illustrative rather than exclusive .	2
clearly , a method and apparatus for electronically determining the true internal temperature of a cell / battery would be of great value . the present invention addresses this need . a very important application of the method taught herein is in the detection of “ thermal runaway ”— a phenomenon in which the internal temperature of a battery undergoing charging rises catastrophically ( see , e . g ., mcshane et al ., u . s . pat . no . 5 , 574 , 355 ). using the technique disclosed below , a runaway condition can be quickly detected by a precipitous internal temperature rise , which , in turn could be used to shut off the charger or reduce its charging voltage . fig1 discloses a block diagram of apparatus for evaluating a battery &# 39 ; s internal temperature according to the present invention . apparatus of this type is fully disclosed in pending u . s . patent application ser . no . 09 / 152 , 219 , filed sep . 11 , 1998 and entitled “ method and apparatus for measuring complex impedance of cells and batteries ” and pending u . s . patent application ser . no . 09 / 151 , 324 , filed sep . 11 , 1998 , entitled “ method and apparatus for determining battery properties from complex impedance admittance ” which are incorporated herein by reference . measuring circuitry 10 electrically couples to cell / battery 20 by means of current - carrying contacts a and b and voltage - sensing contacts c and d . measuring circuitry 10 passes a periodic time - varying current i ( t ) through contacts a and b and senses a periodic time - varying voltage v ( t ) across contacts c and d . by appropriately processing and combining i ( t ) and v ( t ), measuring circuitry 10 determines real and imaginary parts of a complex parameter , either impedance z or admittance y , at a measuring frequency f k ; where f k is a discrete frequency contained in the periodic waveforms of both i ( t ) and v ( t ). control circuitry 30 couples to measuring circuitry 10 via command path 40 and commands measuring circuitry 10 to determine the complex parameter of cell / battery 20 at , each one of n discrete measuring frequencies , where n is an integer number . this action defines 3 n experimental quantities : the values of the n measuring frequencies and the values of the n imaginary parts and n real parts of the complex parameter at the n measuring frequencies . computation circuitry 50 couples to measuring circuitry 10 and to control circuitry 30 via data paths 60 and 70 , respectively , and accepts the 2 n experimental values from measuring circuitry 10 and the values of the n measuring frequencies from control circuitry 30 . upon a “ begin computation ” command from control circuitry 30 via command path 80 , computation circuitry 50 uses algorithms disclosed in u . s . patent application ser . no . 09 / 151 , 324 to combine these 3 n quantities numerically to evaluate 2 n elements of an equivalent circuit representation of the cell / battery . computation circuitry 50 then calculates the internal temperature of the cell / battery from values of particular elements of this circuit representation . finally , computation circuitry 50 outputs the computed result to the user on display 90 and / or uses the result to activate an alarm 100 or to control a process 110 such as a battery charger . in practice , a microprocessor or microcontroller running an appropriate software program can perform the functions of both control circuitry 30 and computation circuitry 50 . fig2 discloses a six - element equivalent circuit representation of a typical automotive storage battery . this circuit representation was evaluated using apparatus of the type disclosed in fig1 with n = 3 by employing algorithms disclosed in u . s . patent application ser . no . 09 / 151 , 324 . the three measurement frequencies were 5 hz , 70 hz , and 1000 hz . one notes that the n = 3 equivalent circuit comprises three subcircuits : one notes further that the three subcircuits are characterized by having very different time constants . the shortest time constant , τ 1 = l 1 · g 1 = 93 . 5 μs , belongs to the series g 1 - l 1 subcircuit . the next longest time constant , τ 2 = c 2 / g 2 = 2 . 22 ms , belongs to the parallel g 2 - c 2 subcircuit ; and the longest time - constant , τ 3 = c 3 / g 3 = 41 . 6 ms , belongs to the parallel g 3 - c 3 subcircuit . accordingly , the three subcircuits represent quite different physical processes and can be differentiated from one another by their time constants . fig3 is a logarithmic plot of the three time constants defined above as functions of charge ( ampere - hours ) removed from the battery . one notes that the three time constants remain widely separated as charge is removed , and that the longest of the three , τ 3 , is nearly independent of state - of - charge . this result is important to the present invention . fig4 discloses the observed variation of time constant τ 3 = c 3 / g 3 with internal battery temperature . one sees that τ 3 varies inversely with temperature . this variation is consistent with a theoretical model that associates the g 3 - c 3 subcircuit with a linearized , small - signal , representation of the nonlinear electrochemical reaction occurring at the negative plates . for such a model , the rc product τ 3 = c 3 / g 3 represents the reaction time for the process and therefore varies inversely with temperature . by empirically establishing this relationship between τ 3 and t , one can actually utilize measurements of τ 3 to determine the battery &# 39 ; s internal temperature , t . fig4 shows experimental points compared with a theoretical τ 3 ( t c ) relationship . note that the steepest slope , and hence the most accurate temperature determination , occurs in the most interesting region between − 20 ° c . and + 20 ° c . the theoretical curve disclosed in fig4 is a plot of the following equation : τ 3  ( t c ) = k 3 + 1 1 k 2 + 1 k 1  exp   { qv 0 / k  ( t c + 273  ° ) } ( 1 ) where τ 3 is the time constant measured in milliseconds and t c is the internal temperature measured in degrees celsius . physical parameters introduced in this equation are : the three constants k 1 , k 2 , and k 3 were empirically determined to be one notes excellent agreement between theory and experiment . measurements show that τ 3 is virtually independent of battery size and state - of - charge ( see fig3 ). thus , this empirical τ 3 ( t c ) relationship plotted in fig4 appears to be quite universal . in order to determine internal temperature from time constant measurements , one must mathematically invert the above τ 3 ( t c ) relationship to obtain a t c ( τ 3 ) relationship . the result is : t c  ( τ 3 ) = ( qv 0 / k ) ln   { ( k 2 / k 1 )  ( τ 3 - k 3 ) ( k 2 + k 3 - τ 3 ) } - 273  ° ( 2 ) where the parameters and constants , q , v 0 , k , k 1 , k 2 , k 3 , are the same as those introduced in the τ 3 ( t c ) relationship . the inverse theoretical t c ( τ 3 ) curve is plotted in fig5 . by employing this relationship , one can readily determine the battery &# 39 ; s true internal temperature from measurements of τ 3 . this important temperature information can then be used to apply accurate temperature corrections to other measured quantities , such as cca , state - of - charge , and amp - hour capacity . it can also be used to detect a thermal runaway condition , and to control an external process such as a battery charger . this completes the disclosure of my invention . fig6 however , will place the true nature of the invention in greater perspective . fig6 illustrates the g 3 - c 3 subcircuit and shows that the complex admittance of this parallel subcircuit , y 3 = g 3 + jωc 3 , explicitly contains the two quantities , g 3 and c 3 , necessary to determine the battery &# 39 ; s internal temperature . thus , my discussion above actually discloses a relationship existing between the real and imaginary parts of y 3 and the internal temperature of the battery . although it is true that complex z and complex y are reciprocals of one another , no simple relationship exists between the real and imaginary parts of impedance z 3 and time constant τ 3 . accordingly , the results of any ac measurement must be expressed in complex admittance form — not complex impedance form — in order to observe the important relationship that i have disclosed herein . how this complex admittance is obtained , however , is relatively unimportant . although my disclosure has relied upon particular apparatus and algorithms previously disclosed in u . s . patent applications ser . no . 09 / 152 , 219 and ser . no . 09 / 151 , 324 , other methods will be apparent to one skilled in the arts . for example , one can employ bridges or other types of apparatus to measure complex admittance ( or its reciprocal , complex impedance ). furthermore , if accuracy is not a strict requirement , one can take advantage of the fact that the various time constants are widely separated from one another and simply assume that the subcircuits are not coupled . within this approximation , c 2 and c 3 are treated as short circuits at frequencies near f 01 = ½ πτ 2 , l 1 and c 3 are treated as short circuits at frequencies near f 02 = ½ πτ 1 , and at frequencies near f 03 = ½ πτ 3 , l 1 is treated as a short circuit while c 2 is treated as an open circuit . thus , with some batteries , it is possible to obtain satisfactory results from a very simple analysis of measurements at two or three frequencies . with certain batteries , it is even possible to obtain useful approximations to y 3 from measurements of complex y or z = 1 / y obtained at a single , appropriately chosen , frequency . workers skilled in the art will recognize that these and other variations may be made in form , and detail without departing from the true spirit and scope of my invention .	6
pastes ready for use based on organopolysiloxanes have already been widely used for sealing joints . such masses and the elastomer bodies obtained from them by cross - linking with atmospheric moisture constitute an ideal sealing substance for many different purposes . the classical examples of such so - called one - component systems are described , for example , in french pat . no . 1 , 188 , 495 , german pat . no . 1 , 247 , 646 , and w . noll , &# 34 ; chemie und technologie der silicone &# 34 ;, 1966 , verlag chemie , weinheim , chapter 8 . 1 , in particular pages 341 and 342 . it has surprisingly been found that such masses have very little power of adherence to ice compared with other materials . due to the excellent hydrophobic action of these substances , formation of compact ice is to a large extent prevented and any coarse crystalline ice adhering to the substances can be removed by a fairly strong wind or rapidly drops off due to its loose structure and weak adherence . in addition , these masses have the advantage that they can be diluted with a wide variety of solvents ( anhydrous ) and can be applied to the surface relatively rapidly and inexpensively , e . g . by spraying . the important advantage of the masses used according to the invention , however , compared with the known materials which are relatively rigid and hard , is that when cured they constitute a highly elastic substance which is capable of absorbing quite large movements ( from about ± 20 % to ± 50 %, depending on their composition ) without any loss in functional efficiency . this elasticity is particularly advantageous in facilitating the removal of parts of ice from the underlying surface . the vulcanizates are insensitive to a wide variety of environmental influences such as uv radiation , moisture , sea water and high and low temperatures . their mechanical characteristics therefore remain unchanged over very long periods of time which is , of course , a great advantage when the substances are used , for example , on an offshore drilling platform . the above mentioned application of the masses according to the invention provides a considerable lowering in cost ( saving of energy ) since the formation of ice in critical areas , e . g . on a drilling platform , had hitherto to be prevented by electric heating . the cold - setting one - component silicone systems used according to the invention normally contain the following components : 1 . an α , ω - dihydroxy - diorganosiloxane in which the organo group would normally be a methyl or phenyl group . a halogen alkyl group such as chloromethyl , an alkenyl group such as vinyl or a cycloalkyl group such as a cyclohexyl group may also be present in minor proportions . the viscosity of these dihydroxy - polydiorganosiloxanes is in the region of about 500 to 2 , 000 , 000 cp ( 20 ° c . ), depending on the requirements of the end product . such homo -, hetero - or copolymers generally constitute about 10 to 90 % by weight of the total quantity of paste . 2 . plasticizers as additives , e . g . α , ω - trialkyl - siloxypolydiorganic siloxane having a viscosity of 10 to 1 , 000 , 000 cp ( 20 ° c .). 3 . the cross - linking substances are polyfunctional organosilicon compounds containing more than two functional groups . when the one - component silicone pastes used according to the invention are prepared by mixing the various substances listed under ( a )-( g ), the substances used as cross - linking agents may be bound to the polymer either during the mixing process or during storage or in a form of premix by splitting off one of the reactive groups . these organosilicon compounds may be of the following kind : in this formula , r may be an alkyl , alkenyl , aryl or halogenated alkyl , alkenyl or aryl group , and x is a reactive group capable of reacting with a silanol group of component ( 1 ). the reactive group may be , for example , an alkoxy , acyloxy , amino , acid amide or oxime group . alkyltriacetoxysilanes are preferred . ( b ) di -, tri - and polysiloxanes formed by partial hydrolysis from the silanes mentioned under ( a ) as indicated by the formula for the disiloxane : 4 . fillers ( charged or uncharged ) of a general kind used singly or in most cases as mixtures , e . g . reinforcing fillers ( highly disperse silica produced by flame hydrolysis , titanium dioxide , carbon black , etc .) or fillers such as powdered quartz , chalk ( natural and precipitated ), synthetic resin powder and pigments of all kinds , e . g . iron oxide pigments . 5 . various kinds of auxiliary substances , e . g . the silanes described under paragraph 2 ., above , containing aminoalkyl , epoxyalkyl or other reactive alkyl groups . ( a ) additives , acting , for example , as drying agents , e . g . complex titanic acid esters ( see e . g . german pat . no . 1 , 258 , 087 ) ( b ) additives acting , for example , as adhesifying agents , e . g . hexamethyldisiloxane ( see u . s . pat . no . 4 , 419 , 484 or european no . 57 , 878 b1 ) or di - tert .- butoxydiacetoxysilane . primers may also be used to improve adherence . ( c ) catalysts to accelerate the reaction , e . g . organic tin compounds or , for example , amino compounds . ( d ) suitable solvent additives are mainly those which do not react with the cross - linking substance , e . g . xylene , petroleum hydrocarbon fractions or , for example , isododecane or different mixtures of the various solvents to enable the substance used according to the invention to be adjusted , for example so that it can be sprayed on a wide variety of different surfaces . the polysiloxane masses may be prepared in known manner in planet mixers , dissolvers or other suitable mixing apparatus . the quantity of solvent used generally amounts to about 5 to 85 % by weight , based on the total quantity of coating compound , preferably 35 to 55 % by weight . under certain accurately specified conditions , however , the process may also be carried out solvent - free . the coating may be applied , for example , by spraying , spread coating , immersion or casting . the coating is preferably applied by a so - called airless spraying process . preparation of the substances to be used according to the invention and their application are described in more detail in the following examples ( percentages are percentages by weight unless otherwise indicated ). a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp . was introduced into the reaction vessel . 5 parts by weight of ethyltriacetoxysilane and 0 . 9 parts by weight of di - tert .- butoxy - diacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 02 parts by weight of a catalyst ( dibutyl tin diacetate ) was then added and the mixture stirred under vacuum until homogeneous . 60 parts by weight of xylene were finally added and the mixture again stirred until homogeneous . a vacuum was briefly applied at the end . the mass was then filled into containers and if kept free from moisture could be stored for half a year without any deterioration in the capacity for vulcanization or in the adherence when the mass was subsequently used as anti - icing mass . this mass can be applied by spraying , for example by the airless spraying technique . the following examples illustrate the same properties as regards storage and application . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., were introduced into the reaction vessel . 5 parts by weight of methyl triacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 01 part by weight of a catalyst ( dibutyl tin diacetate ) was then added and the mixture stirred under vacuum until homogeneous . 60 parts by weight of isooctane were finally added and stirred in until homogeneous . a vacuum was briefly applied at the end . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp . and 2 parts by weight of hexamethyldisiloxane were introduced into the reaction vessel . 15 parts by weight of vinyl triacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 01 part by weight of a catalyst ( dibutyl tin diacetate ) was then added and the mixture stirred under vacuum until homogeneous . 60 parts by weight of isododecane were finally added and the mixture stirred until homogeneous . finally , a vacuum was briefly applied . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., was introduced into the reaction vessel . 5 parts by weight of ethyl triacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 02 parts by weight of a catalyst ( dibutyl tin diacetate ) was then added and stirred in under vacuum until the mixture was homogeneous . 60 parts by weight of xylene were finally added and the mixture was stirred until homogeneous . a vacuum was briefly applied at the end . a mixture of 60 parts by weight α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., and 2 parts by weight of hexamethyldisiloxane was introduced into the reaction vessel . 5 parts by weight of ethyltriacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 1 . 0 part by weight of a complex titanic acid ester ( di - butoxy - di - acetoacetic ester titanate ) was then added and the mixture was briefly stirred . 0 . 03 parts by weight of a catalyst ( dibutyl tin diacetate ) were then added and the mixture was stirred under vacuum until homogeneous . 60 parts by weight of xylene were finally added and the mixture stirred until homogeneous . a vacuum was briefly applied at the end . a mixture of 35 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 8 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., was introduced into the reaction vessel . 4 . 5 parts by weight of a complex titanic acid ester ( dibutoxy - diacetoacetic - ester titanate ) were added at room temperature and the mixture was stirred . 4 . 5 parts by weight of a finely disperse silica and 40 parts by weight of a chalk were incorporated ( finally under vacuum ). 1 . 2 parts by weight of an iron oxide pigment and 1 . 4 parts by weight of a catalyst ( dibutyl tin dilaurate ) were then stirred in . 4 parts by weight of bis -( n - methylbenzamido )- ethoxy - methylsilane were then added . 50 parts by weight of isododecane were finally added and the mixture stirred until homogeneous . a vacuum was briefly applied at the end . a mixture of 34 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 34 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., was introduced into the reaction vessel . 4 parts by weight of complex titanic acid ester ( dibutoxy - diacetoacetic ester titanate ), 2 parts by weight of methyltrimethoxy silane and 0 . 5 parts by weight of γ - glycidyloxy - propyltrimethoxysilane were added and stirred in . 30 parts by weight of a chalk and 1 . 2 parts by weight of an iron oxide pigment were then added and the mixture was stirred . 4 . 5 parts by weight of a finely disperse silica were then stirred in ( a vacuum was finally applied ). 0 . 06 parts by weight of a catalyst ( dibutyl tin diacetate ) were then added and incorporated under vacuum . 50 % by weight of a petroleum hydrocarbon fraction ( isopar h of esso ) were finally added and the mixture stirred until homogeneous . a vacuum was briefly applied at the end . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., and 2 parts by weight of hexamethyldisiloxane was introduced into the reaction vessel . 5 parts by weight of methyl - tris ( 2 - butanoneoxime )- silane were added at room temperature and the mixture was briefly stirred . 8 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 5 parts by weight of γ - aminopropyl - triethoxysilane and 0 . 6 parts by weight of a catalyst ( dibutyl tin dilaurate ) were then added and the mixture was stirred under vacuum until homogeneous . 60 parts by weight of xylene were finally added and stirred in until the mixture was homogeneous , a vacuum being briefly applied at the end . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., and 2 parts by weight of hexamethyldisiloxane were introduced into the reaction vessel . 6 parts by weight of methyltributylaminosilane were added at room temperature and the mixture was briefly stirred . 13 parts by weight of a finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred until homogeneous . 20 parts by weight of xylene and 40 parts by weight of isododecane were finally added and the mixture stirred until homogeneous with brief application of a vacuum towards the end of the mixing process . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., and 2 parts by weight of hexamethyldisiloxane were introduced into the reaction vessel . 5 parts by weight of ethyl triacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 02 parts by weight of a catalyst ( dibutyl tin diacetate ) were then added and the mixture was stirred under vacuum until homogeneous . 65 parts by weight of methylene chloride , based on the starting quantity , were finally added and stirred in until the mixture was homogeneous . a vacuum was briefly applied at the end . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy ) polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., was introduced into the reaction vessel . 5 parts by weight of ethyltriacetoxysilane and 0 . 9 parts by weight of di - tert .- butoxydiacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 02 parts by weight of a catalyst ( dibutyl tin diacetate ) were then added and the mixture was stirred under vacuum until homogeneous . 65 parts by weight of 1 , 1 , 1 - trichloroethane were then added , based on the starting quantity , and stirred in until the mixture was homogeneous . a vacuum was briefly applied at the end . the following anti - icing experiments were carried out with the masses described above : a layer of ice about 25 mm in thickness ( from sea water ) was produced at a temperature of - 21 ° c . on a steel plate measuring 8 × 1000 × 1000 mm coated with the material according to example 4 . the plate was placed vertically . the thickness of the coating was 1 . 5 mm . the temperature was maintained at - 21 ° c . for a further 12 hours after the ice had formed so that all the ice could assume this temperature . the temperature in the chamber was then slowly raised ( 2 ° c ./ h ). at - 10 ° c ., the forces of adherence of the ice to the silicone rubber diminished to such an extent that the ice became detached and fell off , i . e . at - 10 ° c . adherence between ice and the mass according to the invention was already eliminated . the ice adhered very firmly to a vinyl coating used in practice and could only be removed at temperatures above 0 ° c . ( 2 ) test in a climatic chamber with simulation of natural environment ( wind , temperature , water ) several plates ( 1 × 500 × 500 mm ) were again coated with the mass according to example 1 ( thickness of coating 1 . 5 mm ) and tested in the climatic chamber ( see table 1 ) table 1______________________________________test no . 1 2 3 4 5 6______________________________________wind velocity ( m / s ) 1 12 1 12 1 12air temperature (° c .) - 6 - 6 - 14 - 14 - 20 - 20sea water temperature + 4 . 5 + 4 . 5 + 4 . 5 + 4 . 5 + 4 . 5 + 4 . 5 (° c . ) diameter of drops of 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1sea water ( mm ) spray frequency ( s / s ) 2 / 5 2 / 5 2 / 5 2 / 5 2 / 5water content / liquid 1 1 1 1 1 ( g / m . sup . 3 ) ______________________________________ the plates were set up at an angle of 15 ° which is close to the position occurring under practical conditions and promotes the formation of ice . the test plates were inspected every hour so that the formation of ice on the surface could be recorded . table 2__________________________________________________________________________wind air temp . duration ice thicknesstest no . ( m / s ) ° c . of test hrs ( mm ) remarks__________________________________________________________________________1 1 - 6 4 0 no ice , water sprayed from the plate2 12 - 6 9 0 - 4 loose ice sludge in the water layer3 1 - 14 5 1 - 4 hard ice easily removed by hand4 12 - 14 12 10 - 50 hard , needle - shaped ice which was blown away by the wind after some time . the thin layer left behind could easily be removed by hand5 1 - 20 4 1 - 4 hard ice , easily removed by hand6 12 - 20 2 . 5 2 - 4 hard ice , easily removed by hand7 12 - 14 3 5 - 10 hard ice , breaks cohesive in one piece when attempts are made at removal__________________________________________________________________________ simulated climate , a coating according to example 1 was tested in test nos . 1 to 6 and a standard vinyl coating was tested in test no . 7 . this test clearly shows the advantage of a plate treated with the silicone mass compared with a surface treated with the vinyl coating conventionally used . the ice was very readily removed from the plates treated with silicone rubber and was blown away by the wind when it reached a certain size . on the vinyl coating used in practice ( test no . 7 ), by contrast , the forces of adherence were more powerful than the forces of cohesion so that a permanent layer of ice could form . in test no . 6 , the plate was stored for a further 48 hours ( without wind or sea water ) after the test described above . at the end of that time , the ice was in equilibrium with its surroundings . even after this treatment , no special change in the properties was observed and the ice could still be easily removed by hand .	2
plasmid pfs14nsd hpv16 - l1 was constructed by exchanging in the plasmid pfs14 nsd ( 54 ) the hepatitis b nucleocapsid gene ( hbcag , ncoi - hindiii fragment ) for a ncoi - hindiii fragment encoding the hpv16 - l1 open reading frame . the hpv 16 - l1 ncoi - hindiii fragment was generated by polymerase chain reaction ( pcr ) using the baculovirus expression plasmid psynwtvi − hpv16 114 / b - l1 + l2 ( 23 ) as a template with a 28mer containing a ncoi site : 5 ′- gggccatggctctttggctgccttagtga - 3 ′ ( seq id no : 1 and a 27 mer containing a hindiii site 5 ′- gggaagcttcaatacttaagcttacg - 3 ′( seq id no : 2 . the final construct containing the tac promoter places the hpv16 - l1 atg at position + 8 relative to the shine - dalgarno sequence and introduces a change in the second amino acid which becomes an alanine instead of the serine encoded by the original sequence . sequencing of the entire l1 open reading frame was carried out ( mycrosynthag ) and no further nucleotide change was observed . plasmid pfs14nsd hpv16 - l1 was amplified in e . coli jm105 and then electroporated as described previously ( 50 ) into bacterial strain cs022 . this strain is derived from the atcc 14028 strain , into which the pho - 24 mutation was introduced by p22 transduction , resulting in attenuation in both virulence and survival within macrophages in vitro ( phop c , ( 35 )). the resultant recombinant strain is called phop c / hpv hereafter . after overnight growth at 37 ° c . the recombinant bacteria were lysed by boiling in laemmli buffer containing 5 % sds . the lysates were separated on 10 % sds / page gels and expression of l1 was analyzed by western blot using hpv16 - l1 mab camvir - 1 ( 33 ) as primary antibody , an alkaline - phosphatase conjugated goat anti - mouse igg ( sigma ) as secondary antibody and bcip / nbt ( boehringer ) as substrate . to prepare vlps , bacteria were lysed by sonication and the lysate fractionnated on a 10 %- 40 % sucrose gradient in phosphate buffer saline ( pbs ) containing 1m nacl for 1 hour at 40 krpm using a tst41 . 14 rotor . fractions of the gradient were then analysed for the presence of the l1 protein by western blot . the fractions of high sedimentation containing the l1 protein were pooled , dialyzed against pbs / 0 . 5m nacl . vlps were pelleted for 1h at 50 krpm using a tst65 . 1 rotor , adsorbed to carbon - coated grids , negatively stained with phosphotungstic acid and examined with a philips electron microscope . purification of hpv16 vlps expressed in insect cells from a recombinant baculovirus . the transfer vector psynwtvi − hpv16 114 / b - l1 + l2 ( 23 ) was cotransfected with the linearized genome of baculovirus ( baculo - gold , pharmingen ) using the calcium - phosphate method into sf9 cells . the recombinant baculoviruses were plaque - purified and propagated by standard methods ( 39 ). baculo - derived hpv16 vlps were purified as described previously ( 23 ). six - week - old female balb / c mice were immunized at day 0 and at week 14 by the nasal route with 5 × 10 7 cfu of inoculum . blood , saliva and genital samples were taken as described previously ( 18 ). all samples were stored at − 70 ° c . the amount of total iga , anti - lps iga and igg antibodies in samples were determined by enzyme - linked immunosorbent assay ( elisa ) as described previously ( 18 ). for the anti - hpv16 vlp , elisa plates were coated with 10 ng of a preparation of baculo - derived hpv16 vlps in pbs ( total protein content was determined with a biorad protein assay with bsa as standard ). this amount of vlp was saturating in our elisa test . endpoint dilutions of samples were carried out . the specific iga or igg amounts are expressed as reciprocal of the highest dilution that yielded an od 492 four times that of preimmune samples . these reciprocal dilutions were normalized to the amount of total iga or igg in saliva and genital washes . elisa plates were also coated with 10 ng of baculo - derived hpv16 vlps in 0 . 2m carbonate buffer ph9 . 5 to determine the titer of antibodies recognizing unfolded vlps ( 14 ). infectious pseudovirions consisting of hpv capsid made of l1 and l2 surrounding the bovine papillomavirus type 1 ( bpv1 ) genome , designated hpv16 ( bpv1 ) , were generated as recently described ( 43 ). briefly , bphe - 1 hamster cells harbouring autonomously replicating bpv1 genomes were co - infected with defective recombinant semliki forest viruses that expressed l1 and l2 virion capsid genes of hpv16 . infectious pseudotype hpv16 virus in cell extracts was quantitated by the induction of transformed foci in monolayers of mouse c127 cells . neutralizing activity was measured after preincubation of the cell extracts with mouse sera diluted 1 : 50 ( 1 . 0 ml final volume ) in culture medium . mouse monoclonal antibodies h16 . e70 and r1a1 were generated against recombinant baculovirus expressed hpv16 l1 vlps and bpv16 vlps respectively , and used at a 1 : 100 dilution . h16 . e70 and b1 . a1 served as positive and negative controls for hpv16 ( bpv1 ) neutralization , respectively . the open reading frame of the major protein l1 of hpv16 was cloned in the plasmid pfs14 nsd ( 53 ). l1 is constitutively expressed under the control of the tac promoter in s . typhimurium . a unique 57 kda protein detected in the lysate of phop c / hpv overnight cultures ( fig1 a ), was identified as hpv16 l1 by western immunoblot using an anti - hpv16 - l1 monoclonal antibody ( camvir , ( 33 ), fig1 b ). to determine whether the l1 protein expressed by phop c / hpv assembled into vlp , the bacterial lysate was fractionated through a 10 - 400 sucrose gradient and the heavier fractions containing the l1 protein ( fig1 b ) were analyzed by electron microscopy . spherical particles typical of pv capsids were recovered from the bacterial preparation ( fig2 a ) but the bacterial vlps appeared more polymorphic in size with diameters ranging from 40 to 55 nm ( fig2 a ) when compared to ˜ 55 nm vlps expressed in insect cells ( fig2 b ). nasal immunization with the phop c / hpv strain induces systemic and mucosal antibody responses . since nasal immunization using recombinant salmonella was shown to elicit strong vaginal siga responses against an expressed foreign antigen ( 18 ), we immunized mice nasally with the phop c / hpv strain ( 5 × 10 7 cfu ). samples of blood , saliva and vaginal washes were taken 0 , 2 , 4 , and 6 weeks after immunization . the immune responses against both the carrier , i . e . anti - lps and the carried antigen , i . e . anti - hpv16 vlp , were determined . serum hpv16 vlp specific igg ( fig3 ) were detected after 2 weeks in one mouse and after 4 weeks in all mice . the response peaked after 6 weeks at relatively low titers and persisted at least until week 14 . at that time , no hpv16 vlp specific antibodies were detected in vaginal secretions , while one mouse had low titers of iga in the saliva . the systemic and the mucosal immune responses against lps were relatively low ( fig3 ), but similar to those elicited by the phop c / hbc strain ( 18 ) suggesting a normal take of phop c / hpv salmonella by the mice . the low anti - lps response observed after nasal immunization incited us to perform a booster immunization . thus , a second nasal immunization was performed at week 14 and samples were taken 5 and 10 weeks later ( week 19 and 24 respectively ). the second immunization induced , 5 weeks later ( week 19 ), a 15 fold increase of anti - hpv16 vlp igg in serum , as well as anti - hpv16 vlp iga in the vaginal washes ( fig3 ) from the three mice . anti - hpv16 vlp igg were also found in vaginal washes but only in two mice at week 19 and titers were again almost undetectable at week 24 ( fig3 ). anti - hpv16 vlp iga and igg were also found in the saliva of the three mice in amounts comparable or slightly higher to those found in vaginal washes . in order to examine whether the immune responses induced by the phop c / hpv strain generated conformational antibodies directed against native but not unfolded vlps , we measured by elisa ( table 1 ) the binding of antibodies , in the samples from the immunized mice , to baculo - derived vlps in pbs ( native form ) or in carbonate buffer ( ph 9 . 5 , unfolded vlp , ( 14 )). the specific igg or iga elicited by the phop c / hpv strain very poorly recognizes unfolded vlps suggesting that the majority of l1 were folded into highly ordered structures when expressed in phop c / hpv ( table 1 ) in previous studies of baculo - derived vlps , neutralizing activity and protection from experimental infection generally correlated with elisa reactivity to native vlps . we therefore wished to determine if the conformationally dependent anti - vlp antibodies elicited by the live salmonella vaccine were also neutralizing . although no infectivity assay or source of the virus currently exists for authentic hpv16 , it has recently been demonstrated that hpv16 capsid proteins can encapsidate autonomously replicating bpv1 genomes resulting in hpv16 ( bpv1 ) pseudotype virions whose infectivity can be monitored by focal transformation of cultured mouse fibroblasts ( 43 ). we therefore used the hpv16 ( bpv1 ) infectivity assay to examine the neutralizing activity of the mouse sera generated above . each of the three immune sera displayed strong neutralizing activity against hpv16 ( bpv1 ) ( fig5 ), but did not neutralize bpv1 virions ( data not shown ). the preimmune sera had no neutralizing activity . the neutralizing activities of the immmune sera appeared to correlate with the titers in the native vlp elisa , although the sera were only tested at a single dilution . it has been recently shown that the growth syngeneic tumour cells ( c3 ) injected into the flank of c57bl / 6 mice was inhibited by a subcutaneous immunization with purified hpv16 cell ( 84 ). we have tested whether nasal immunization with purified vlps and recombinant salmonella / hpv strains was able to induce the same effect . specifically , we have tested the following strains : phoc / hpv16 l1 ( 86 ) and the x4550 ( 56 ) expressing either high levels ( x4550 / pya34l1 ) or low levels ( x4550 / pya32l1 ) hpv16 l1 . tumour growth in the different groups of mice is shown in fig6 . our preliminary results demonstrate that nasal immunization with purified vlps is effective and that all the salmonella / hpv strain tested induced partial tumour protection . of interest , is the strain x4550 / pya34l1 that prevented complete tumour growth in 4 / 10 mice . the l2 or17 was cloned downstream of the l1 orf by pcr into the plasmid ppsnsdhpv16 l1 ( 86 ). the pcr reaction included a 5 ′ specific oligonucleotide that contained a synthetic shine - dalgarno sequence in order to allow translation of 12 from a polycistronic l1 − l2 rna . the resultant phopc / hpv16 l1 + l2 recombinant strain expressed both l1 and l2 and vlps assembled in amount similar to the parent phopc / hpv16 l1 strain as assessed by a sandwich elisa . this suggests that by fusing the e7 orf to the l2 orf , in the phop c / hpv16 l1 + l2 strain , a chimeric vlps would also assemble and such recombinant salmonella strain used to induce hpv16 e7 - ctls . high level expression of l1 in the inducible e . coli pet expression system . the l1 orf was cloned in the plasmid pet3 ( novagen ). l1 - expression driven by a t7 promoter was assessed in the strain pl21aplyss ( expressing t7 polymerase upon iptg induction ). after iptg induction , a 10 fold higher level of l1 expression / bacteria was achieved in comparison to the salmonella phop c strain ( see fig8 ). the lysate of this recombinant e . coli formed a band at a density of vlps in a cscl density gradient , suggesting that the vlps self - assembled in this bacteria . in this study , we demonstrate that an attenuated salmonella strain expressing the major capsid protein of hpv16 is a promising vaccine candidate against hpv16 infection , as the vlps that are assembled by this recombinant bacteria can induce serum as well as genital vlp - specific conformational antibodies . the results above also show that the antibodies are able to neutralize hpv16 viruses . these results could be readily extrapolated by the skilled person to other types of hpv or other papillomaviruses , or other prokaryotic microorganisms . the life cycle of papillomavirus is intimately associated with the differentiation of the epithelial cells in skin or the oral and genital mucosa ( 5 , 19 , 40 , 62 ). it is believed that viruses gain access to the basal epithelial cells through mucosal abrasions ( 21 ). upon infection of the cervical epithelium for instance , the viral dna released in the cytoplasm of the basal cells migrates into the nucleus where it remains episomic and early genes are transcribed leading to a low rate of cell proliferation and the thickening of the basal layer ( cervical intraepithelial neoplasia type i , cin i ). as the infected epithelial cells migrate through the suprabasal layer and undergo differentiation , the episomal viral genome replicates reaching ˜ 1000 copies per cell ( 29 ). concomitant to viral dna amplification , late genes become expressed and capsids assemble in terminally differentiated keratinocytes ( fig4 ), thus facilitating a new round of infection . in high grade lesions ( cin iii and carcinoma ) the entire epithelium consists of undifferentiated basal cells in which the viral dna has been integrated into cellular dna . in these cells , the e6 / e7 gene products constitute the major hpv proteins expressed and viruses are no longer produced . based on our knowledge of hpv pathogenesis , it appears that two arms of immunity ( humoral and cellular ) have to be effective to prevent viral infection , to decrease the local viral load , or to cure tumors ( fig4 see also ( 59 )) . a local or systemic humoral immune response with neutralizing antibodies is likely to block early infection , while a cellular response may contribute to the elimination of untransformed or transformed infected cells . an ideal vaccine should trigger the two types of response , although the immunological correlate of protection and of cure have not been identified so far . prophylactic vaccines inducing type - specific neutralizing conformational ( anti - vlp ) antibodies have been shown to prevent crpv or copv infections in cottontail rabbit ( 4 ) or dog ( 57 ), respectively . in both cases serum neutralizing antibodies where generated by vaccination with self - assembled pv capsids . by analogy , neutralizing antibodies to hpv16 capsid in cervical secretions are expected to prevent infection . since the precise mucosal site where early hpv infection takes place is not known , it is difficult to predict whether siga antibodies acting from the lumenal site or circulating igg antibodies reaching the basal layers will be most efficient . the elimination of hpv - infected cells or tumor cells requires a cellular immune response with cytotoxic t lymphocytes ( ctl ) recognizing viral antigens presented by mhc class i molecules on the infected cells . therapeutic vaccines aimed at eliminating hpv - induced tumors have been generated using either peptides corresponding to t cell epitopes from the e6 / e7 oncogenes or e6 / e7 expressing vaccinia viruses . both were shown to elicit ctls and in some cases tumor regression was observed ( 3 , 6 , 7 , 12 , 13 , 34 ). one of the major problems , however , is that mhc class i molecules are down - regulated in the differentiated keratinocytes that produce viruses or in tumour cells ( 9 ). since both humoral and cellular immunity are believed to control hpv infection and since local and systemic responses are desirable , an efficient vaccine should reach inductive sites associated with mucosal surface and / or peripheral lymph nodes . live bacterial vaccines are known to cross mucosal surfaces and elicit humoral or cellular responses ( 41 ). recombinant and attenuated enteropathogenic bacteria , such as salmonella , represent ideal antigen delivery systems , because they efficiently cross all mucosal surfaces to gain access to both mucosal organized lymphoid tissue ( malt ) or draining lymph nodes . they exploit the two basic sampling systems mediating uptake of mucosally administered antigens including m cells in simple epithelial and dendritic cells both in simple and stratified epithelial ( 38 ). we have selected a salmonella typhimurium strain attenuated for macrophage survival , because long lasting antibody responses were elicited by a single nasal , oral , rectal or vaginal administration of recombinant bacteria expressing a foreign antigen ( 18 ). in that study , the best genital responses were obtained after nasal immunization . in the airways , antigen uptake occurs through m cells found in nalt , the nasal associated lymphoid tissue ( 25 ) and balt , the bronchial associated lymphoid tissue ( 55 ). the primed iga - expressing lymphocytes then migrate into cervical and uterine tissues where they produce polymeric iga antibodies , which are transported across the epithelium by the polymeric ig receptor ( 26 - 28 ). intraepithelial dendritic cells in the bronchial epithelium also play a major role in antigen presentation by taking up the antigens in the respiratory epithelium and carrying them to distant draining lymph nodes where priming occurs ( 17 ). this probably explains why nasal immunization is so efficient in triggering both local and systemic antibody responses . antigens expressed in salmonella strains can also elicit cellular responses with specific ctls ( 1 , 16 , 58 ). depending on which viral antigen is expressed , specific ctls recognizing infected cells at different stages of differentiation could be generated ( fig4 ). for instance , e7 - specific ctls were generated by immunizing mice with recombinant salmonella expressing hpv16 e7 epitopes ( 31 ). to trigger neutralizing antibodies using recombinant salmonella , it is essential that the antigen retains its native conformation . for hpv , this requires that the l1 proteins form vlps . papilloma vlps have been shown to assemble in eukaryotic cells ( 15 , 22 , 45 , 48 , 61 ), but not in prokaryotes . in bacteria mainly l1 - fusion proteins were expressed ( 2 , 20 , 24 ) and when bona fide l1 proteins were expressed , vlp assembly was not examined ( 11 ). as shown in this paper , hpv16 vlp assemble in salmonella probably because the level of expression achieved in our experiments was high and capsid assembly does not require glycosylation ( 60 ). capsid production in bacteria has also been reported for other viruses such as the nucleocapsid of hepatitis b virus ( 52 ) and the capsid of polyomavirus ( 30 , 46 ). polyomavirus vp1 major capsid protein , analogous to hpv l1 , forms capsomers when expressed in e . coli which subsequently self - assembled into vlps in vitro ( 46 ). the fact that only capsomers but no vlps were recovered is probably due to the reducing agents present during purification , which are known to disrupt capsids ( 47 ). nasal immunization with the phop c / hpv strain induced systemic and mucosal antibodies against native but not denatured hpv16 vlps . in contrast , recombinant vaccinia expressing hpv1 capsid protein triggered serum antibodies recognizing both folded and unfolded vlp , probably reflecting different mode of viral protein expression , and low hpv - specific genital iga antibody titers ( 14 ), as expected with a non - mucosal route of immunization . antibody titers against the foreign antigen induced by phop c / hpv compared to phop / hbc salmonella were about 10 times lower ( 18 ). this could reflect differences in immunogenicity between the two viral antigens ( 51 ) or , more likely , differences in plasmid stability . in contrast to the hbc dna , the plasmid carrying the hpv16 - l1 dna was unstable in salmonella in vivo in the absence of selective pressure , since less than 1 % of the salmonella recovered from different tissues two weeks after immunization still harboured the l1 - containing plasmid ( data not shown ). to increase the stability of the plasmid we are currently recloning the l1 gene in β - aspartate semialdehyde dehydrogenase ( asd )- based vectors which maintain selective pressure in vivo ( 36 , 56 ). ( a ) that purified vlps and salmonella / hpv strains are capable of providing tumour protection in a hpv16 mouse tumour model . ( b ) that chimeras of a hpv protein and a fusion partner assemble in prokaryotes to form vlps . ( c ) that high levels of expression of hpv proteins that assemble to form vlps can be obtained in e . coli , demonstrating that the invention is applicable in prokaryotes other than salmonella . in conclusion , we have constructed a recombinant salmonella strain expressing hpv 16 - l1 capsid proteins and assembling vlps that induce conformational serum igg and vaginal siga antibodies recognizing vlps . neutralizing activities of these antibodies were tested and shown to display strong neutralizing activity in an hpv16 ( bpv1 ) infectivity assay . b titers are expressed as the reciprocal of the highest sample dilution that yielded an od 492 four times that of preimmune sample c anti - hpv16 l1 monoclonal igg ( 35 μg / ml ), 30 ) used as positive control 7 . chen et al , 1991 . proc . nat . acad . sci . usa . 88 ( 1 ) : 110 - 4 . 10 . curtiss , 1990 . attenuated salmonella strains as live vectors for the expression of foreign antigens . marcel dekker , inc ., new york . 16 . hess et al , 1996 . proc . nat . acad . sci . usa . 93 ( 4 ): 1458 - 1463 . 19 . howley , 1990 . papillomaviridae and their replication . fields virology . raven press , new york . 21 . jenson et al , 1987 . obst . gynec . clin . north am . 14 ( 2 ): 397 - 406 . 22 . kirnbauer et al , 1992 . proc . nat . acad . sci . usa . 89 : 12180 - 12184 . 37 . nardelli - haefliger et al , 1996 . oral and rectal immunization of adult female volunteers with a recombinant attenuated salmonella typhi vaccine strain . submitted . 39 . o &# 39 ; reilly et al , 1992 . baculovirus expression vectors . a laboratory manual . freman w . h . and company , new york . 41 . roberts et al , 1994 . salmonella as carriers of heterologous antigens , p . 27 - 58 . crc press inc . 49 . schiffman et al , 1993 . j . nat . cancer inst ,. 85 ( 12 ) : 958 - 64 . 51 . schödel et al , 1990 . collogue inserm ed , vol . 194 . john libbey eurotext , montrouge . 53 . schödel et al , 1993 . hybrid hepatitis b virus core / pre - s particles : position effects on immunogenicity of heterologous epitopes and expression in avirulent salmonellae for oral vaccination . plenum press , new york . 57 . suzich et al , 1995 . proc . nat . acad . sci . usa . 92 ( 25 ): 11553 - 11557 . 59 . tindle et al , 1994 . curr . top . in micr . immunol . 186 ( 217 ): 217 - 53 . 62 . zur hausen and schneider , 1987 . the role of papillomaviruses in human anogenital cancer , in the papovaviridae : the papillomaviruses , vol . 2 . salzman , n . p . and howley , p . m . eds , plenum , new york . 64 . bartholomeusz et al , 1986 . journal of gastroenterology and hepatology . 1 : 61 - 67 . 66 . curtiss et al , 1994 . nonrecombinant and recombinant avirulent salmonella vacines . in g . p . e . a . talwar ( ed . ), recombinant and synthetic vaccines . narosa publishing house , new delhi , india . 68 . curtiss et al , 1994 . recombinant salmonella vectors in vaccine development , p . 23 - 33 . in f . brown ( ed . ), recombinant vectors in vaccine development , vol . 82 . karger , basel . 73 . hone et al , 1992 . journal of clinical investigation . 90 ( 2 ) : 412 - 20 . 75 . roberts et al , 1994 . salmonella as carriers of heterologous antigens , p . 27 - 58 . crc press inc . 77 . schödel et al , 1996 . hybrid hepatitis b virus core antigen as a vaccine carrier moiety : ii expression in avirulent salmonella spp . for mucosal immunization , p . 15 - 21 . in s . cohen and a . shaf ferman ( ed . ), novel strategies in design and production of vaccines . plenum press , ny . 84 . greestone et al , 1997 . hpv16 l1 / l2 - e7 chimeric papillomavirus - like particles induce both neutralizing antibodies and e7 specific anti - tumour immunity . 16th international papillomavirus conferencce , siena , italy , abstract : 177 .	8
an example of known display apparatus is shown in u . s . pat . no . 4 , 019 , 773 -- vehling , f . w .-- issued apr . 26 , 1977 fai 5 and directed to a mobile carpet display center . although the display apparatus is suitable for the use specified , in the patent , it could not readily be maneuvered into a trade show space since there is no provision for close quarter maneuvering . other examples of equally unsuitable display apparatus are shown in u . s . pat . nos . 3 , 692 , 350 -- radtke , c . w .-- issued sep . 19 , 1972 , for a mobile outdoor display unit and 4 , 480 , 866 -- komatsu , s .-- issued nov . 6 , 1984 and 2 , 069 , 852 -- ruthenburg , l .-- issued feb . 9 , 1937 for a vehicle for displaying goods . the apparatus shown in these patents also do not meet the requirement for maneuvering . in addition , none of the known vehicles are specially adapted for maximizing the usage of alloted space . it is a prime object of the present invention to provide mobile article display vehicles which are maneuverable into closely defined spaces while maintaining an excellent economy 4 :) f space use . a further object is to provide a self contained mobile display vehicle which can be substantially completely set up off the show location and readily moved and set up for article display with a minimum of time and labor cost . a still further object of the invention is to provide a vehicle especially adapted to utilize the alloted space at an exhibition site . in accordance with the present invention the mobile display apparatus comprises a trailer type structure with normal undercarriage and trailer hitch facilities . the display part of the apparatus can be in the form of a flat bed trailer for articles which can be transported covered with a tarpaulin or in the form of a box - like main body , preferably utilizing the flat bed as the floor thereof , provided with , at least , one box - like cover on , at least , one side . the cover being hinge connected to one vertical edge of the end of the fixed structure to allow opening outward to approximately 180 degrees . it may be desirable to divide the cover into , for instance , two equal parts , one part hinged at each end of the main structure . furthermore , covers may be provided on both sides of the main body resulting in increased display area with a walk through possibility and maximum usage of space . the fixed structure and the cover can each be provided with counters and shelves , as required to display the articles , with the necessary accessory piping and wiring incorporated . in order to improve the usefulness and facilitate fast and efficient set - up of a display slotted structural elements are secured in the inside corners and on the inside peripheries of the box - like structure and the covers . these slotted elements are available commercially and are eminently suited for this purpose and come in cross - sectional configurations suitable for corner and flat surface mounting with the slotted side facing outward so that hangers , shelf brackets and the like can be inserted in and locked in the slots at the appropriate locations for hangers and shelf supports . the vehicle then requires only one or two connections to be made on the site for power , water etc ., the articles to be displayed being previously placed in position , off site , so that they are immediately on display when the covers are opened . in order to facilitate maneuvering the apparatus in tight spaces casters are provided , preferably , at each of the corners of the trailer part . the casters are vertically adjustable to raise the undercarriage free of a floor or road surface whereafter the casters carry the weight of the complete apparatus and allow movement of the vehicle , in any direction , on the casters . when the vehicle is properly positioned the casters may be adjusted to allow part or all of the weight of the vehicle to rest on the undercarriage . alternately the casters may be fixed in position and the undercarriage raised to leave the fixed casters to support the weight of the vehicle . it is , however , desirable to provide casters which are , individually , vertically adjustable in order that on site levelling may be achieved . fig1 shows a perspective view of the vehicle in partly open condition illustrating the versatility of article display configuration , fig2 shows a plan view of the mobile article display vehicle in the configuration shown in fig1 fig3 shows a side view of the vehicle of fig1 in a closed configuration , fig5 shows a end view of the of fig1 in a parked position , with the vehicle weight resting on the casters . fig6 and 7 illustrate cross - sectional configurations of slotted elements adapted to hold hangers , shelf brackets and the like . referring to the drawings , fig1 and 2 show the article display vehicle , according to the invention , as comprising a flat bed 1 having an undercarriage 2 provided with wheels 3 and a trailer hitch 4 , preferably removable , for attaching the apparatus to a motor vehicle for movement between locations . the vehicle is shown as being provided with casters 11 supported by telescopic pipe or hydraulic cylinder means 10 , 12 which provide , additional to the normal caster support , means to adjust the caster downward to lift the undercarriage wheels 3 clear of a road or floor surface , see fig1 so that the vehicle , as a whole , can be minutely maneuvered , on its caster supports , into a confined space , i . e . an exhibition space . means , not shown , are provided to lock the caster wheels and their supports in fixed positions vertically and against rolling or swiveling . the casters may be retracted slightly to allow part of the weight of the unit to rest on the undercarriage . furthermore , the casters may be used to level the flat bed area of the vehicle if this is desirable and / or necessary . mounted on the flat bed is a box - like main body 8 having side covers 5 which are preferably box - like in structure although it is conceivable and perhaps useful , in some instances , to omit either the top or bottom side , or both , of the cover for easier access to the inner side of the main vertical panel of the cover . the covers are hinged to the vertical end corners of the main body part 8 by hinges 9 as best shown in fig4 and 5 . preferably two equally dimensioned covers 5 are provided on each side of the main body 8 as shown in fig3 . as best shown in fig1 and 5 , the body is provided with a roof or top side 7 . running lengthwise , on each top side of the main body part and under the outer sides of the roof are auxiliary closure flaps 6 each having a turned down outer flange 6a which overlaps the top edge of the cover . these flaps serve two purposes , they act as rain shields for the covers and the structure as a whole and , furthermore , when the structure is closed the flaps prevent inadvertent opening of the covers . referring now to fig1 and 5 , caster supports 12 , preferably in the form of hydraulic cylinders , are shown located at the corners of the vehicle . the supports 12 are provided with telescoped parts 10 , for instance secured to a piston movable in a cylinder 12 , which parts are provided , at their lower extremities with caster wheels 11 which are shown in fig1 and 5 as supporting the weight of the vehicle , the undercarriage wheels 3 being raised clear of the floor or road surface 13 thus allowing for the maneuvering of the vehicle on the caster wheels 11 . individual adjustment of the casters can be used for levelling of the trailer as required for the display . in order to facilitate easy set - up of a display and provide a wide choice of arrangements , the box 8 and the covers 5 are provided with slotted structural elements 14 , shown in heavy line in fig1 on the inside perimeter edges of the box - like structure and the covers as well as in the inside corners of the box - like structure and the covers . the slotted elements have cross - sectional configurations suitable for corner ( quarter round ), fig6 and flat surface ( partial sphere ), fig7 mounting where the slots 15 face inward to provide a longitudinal lock - in slots for hangers and shelf brackets arrangeable in a great variety of configurations . with this facility provided integral with the box - like structure an exhibiter is free to exhibit in an individualistic manner . the box - like structure , complete with structural elements may in itself constitute a separate unit conveniently removable from the trailer part to constitute a portable display container and be transported separately to an exhibition site . the vehicle , according to the invention , is the basic display vehicle . shelving , lighting , power and water supplies etc . can be incorporated in the box - like structure as needed to facilitate the display of particular articles of merchandise and in a manner which requires only one connection for each particular supply . the apparatus can be completely outfitted , for instance , at the products - to - be - displayed source so that it is only necessary to connect supply sources after the apparatus is maneuvered into the allotted space at the exhibition site , thus saving time and labor . in addition , problems that may arise in the setting up of the display can be solved at the source location . since exhibition spaces are standardized the vehicle can be dimensioned to make the most efficient use of the space available . although a simple embodiment of the invention is disclosed it will be obvious that variations of the embodiment described may be made which do not depart from the spirit and scope of the invention as defined in the appended claims . for instance , there may be one or more covers per side of the box - like structure , one side of the box may be closed and fill panels and the like may be used to enhance the display . adjustment of the caster supports may be manually or electrical powered . in addition , there may be three or more casters provided for maneuvering and the hitch and supporting tongue made retractable into the bed of the vehicle .	6
according to the method of at least one of the preferred embodiments of the present invention , a printing plate precursor having a support with a surface including titanium is converted from a hydrophobic state into a hydrophilic state by first anodizing and than annealing the surface under reduced pressure . alternatively , a printing plate precursor having a support with a surface including titanium is converted from a hydrophobic state into a hydrophilic state by first etching the support followed by an anodizing step . by irradiation of the hydrophilized surface with heat and / or infrared light , a switch from a hydrophilic state into a hydrophobic state is obtained . the support of the printing plate precursor having a surface including titanium is preferably a titanium metal sheet . alternatively , the support is a base onto which a thin layer of titanium metal is applied . the titanium metal sheet may be a commercially available titanium metal sheet having preferably about 99 . 5 % wt to about 99 . 9 % wt purity . also suitable is an alloy of titanium containing about 4 % wt to about 5 % wt of for example aluminum , vanadium , manganese , iron , chromium and molybdenum . the thickness of the titanium metal sheet is not critical : it may be between about 0 . 05 mm to about 0 . 6 mm , preferably from about 0 . 05 mm to about 0 . 4 mm , and more preferably from about 0 . 1 mm to about 0 . 3 mm . the base onto which a thin layer of titanium is applied may be a metal sheet including , for example , aluminum , stainless steel , nickel , and copper . also suitable as a base is a flexible plastic support such as polyester or cellulose ester , waterproof paper , polyethylene - laminated paper , or polyethylene - impregnated paper . the support can also be a laminate including an aluminum foil and a plastic layer , e . g ., polyester film . when a metal sheet is used as a base for the titanium layer , the surface of the metal base may have been roughened by any of the known methods . the surface roughening may be mechanical , electrochemical , or chemical etching , or by combinations of these methods . a particularly preferred lithographic support is an electrochemically grained and anodized aluminum support . the grained and anodized aluminum support is preferably grained by electrochemical graining , and anodized via anodizing techniques employing phosphoric acid or a sulphuric acid / phosphoric acid mixture . methods of both graining and anodization of aluminum are very well known in the art . by varying the type and / or concentration of the electrolyte and the applied voltage in the graining step , different types of grains can be obtained . by anodizing the aluminum support , its abrasion resistance and hydrophilic nature are improved . the microstructure as well as the thickness of the al 2 o 3 layer are determined by the anodizing step , the anodic weight ( g / m 2 al 2 o 3 formed on the aluminum surface ) varies between about 1 g / m 2 and about 8 g / m 2 . the thin layer of titanium present on the base may be applied by known methods such as for example vapor deposition , spray pyrolysis , sputtering , or electrodeposition . the thickness of the deposited titanium metal layer is preferably from about 0 . 01 μm to about 10 μm , more preferably from about 0 . 05 μm to about 1 . 0 μm , and most preferably the thickness varies between about 0 . 10 μm and about 0 . 30 μm . the titanium sheet or the base provided with a titanium layer may be subjected to a surface roughening step treatment prior to the anodization step . preceding the surface - roughening step , a degreasing step may be conducted with for example a surfactant , an organic solvent or an aqueous alkali solution . the surface roughening treatment of the titanium sheet or the base provided with a titanium layer can be conducted by various methods ; examples thereof include mechanically roughening ( e . g ., grinding with balls , brushing , blasting , or buffing ), electrochemical dissolution ( e . g ., surface roughening in an electrolytic solution with application of an ac or dc current ) or chemical dissolution ( e . g ., immersing the metal in an aqueous solution of one or more alkaline salts selected from sodium hydroxide , sodium carbonate , sodium silicate or sodium pyrophosphate ). these methods may be used alone or in combination . according to a preferred method of the present invention , the anodization of titanium is performed by treatment of the surface including titanium with an aqueous electrolyte solution at a concentration of about 0 . 001 mol / l to about 5 mol / l , preferably from about 0 . 005 mol / l to about 3 mol / l , a liquid temperature of about 5 ° c . to about 70 ° c ., preferably from about 15 ° c . to about 30 ° c ., a dc voltage of about 1 v to about 100 v , preferably about 5 v to about 50 v , more preferably about 10 v to about 30 v , and an electrolysis period of about 10 seconds to about 10 minutes , preferably about 1 minute to about 8 minutes . more preferably , the surface of the support is anodized in an aqueous electrolyte solution containing at least one of the following chemicals : an inorganic acid selected from sulfuric acid , phosphoric acid , nitric acid or boric acid ; hydrogen peroxide in addition to one or more of the above inorganic acids ; an alkali metal salt and / or an alkaline earth metal salt of the above inorganic acids ; an organic acid selected from oxalic acid , tartaric acid , citric acid , acetic acid , lactic acid , succinic acid , glutamic acid , sulfosalicyclic acid or naphthalenedisulfonic acid ; an alkali metal salt and / or an alkaline earth metal salt of the above organic acids ; hydroxides and / or water - soluble carbonates of sodium , potassium , calcium , lithium , and magnesium and / or aqueous alkali solutions such as ammonium hydroxide solution ; glycerophosphoric acid and the alkali metal salt and / or the alkaline earth metal salt thereof and / or acetic acid and the alkali metal salt and / or the alkaline earth metal salt thereof . these aqueous electrolyte solutions may be used alone or in combination . the concentration of the solutions depends on the kind of the electrolyte used for the anodization process . in an example of a preferred embodiment of the present invention , the electrolyte solution preferably includes oxalic acid at a concentration of about 0 . 6 mol / l , and the anodizing reaction is carried out at room temperature using about 20 v dc for a period of about 5 minutes . doping the anodized surface with a metal such as platinum , palladium , gold , silver , copper , nickel , iron , or cobalt or a mixture thereof may be advantageous . according to the method of the first preferred embodiment of the present invention , the anodized support is annealed at a reduced atmospheric pressure . other gasses such as h 2 or n 2 gas may be used during the annealing step . preferably , the annealing temperature varies between about 350 ° c . and about 550 ° c ., more preferably between about 400 ° c . and about 500 ° c ., and the annealing time varies between about 60 minutes and about 240 minutes , more preferably between about 80 and about 200 minutes . the pressure applied during the annealing step varies between about 0 . 1 kpa ( 1 mbar ) and about 1 kpa ( 10 mbar ), and more preferably between about 0 . 2 kpa ( 2 mbar ) and about 0 . 6 kpa ( 6 mbar ). according to the method of the second preferred embodiment of the present invention , prior to the anodization step , the support is etched . etching of metal surfaces can be done in many ways . for example , aqueous solutions including one or more alkaline salts can be used . in an example of the present preferred embodiment , a mixture including h 2 o 2 and naoh is used wherein the concentration of h 2 o 2 varies between about 0 . 05 mol / l and about 1 mol / l , more preferably between about 0 . 1 mol / l and about 0 . 8 mol / l and the concentration of naoh varies between about 0 . 1 mol / l and about 5 mol / l , more preferably between about 0 . 5 mol / l and about 3 . 5 mol / l . the etching temperature varies preferably between about 50 ° c . and about 100 ° c ., more preferably between about 60 ° c . and about 80 ° c . and the reaction time varies preferably between about 0 . 5 minute and about 10 minutes , more preferably between about 0 . 5 minute and about 5 minutes . alternatively , the etching and anodizing steps may be carried out in one step . the etched and anodized printing plate precursor may optionally undergo further post - treatments such as chemical reducing treatments , e . g ., annealing at reduced pressure as defined in the first method , or photolytic reduction , e . g ., uv - treatment . the lithographic printing plate precursor including an anodized and annealed support or including an etched and anodized support thus obtained , may be rinsed with water , with a liquid containing a surfactant or with a desensitizing liquid ( so called gum solution ) containing gum arabic or a starch derivative , or with combinations thereof . the surface of the printing plate precursor is hydrophilic and upon image - wise exposure to heat and / or light , the exposed areas become ink accepting . this conversion from a hydrophilic to a hydrophobic state can , for example , be characterized by an increase of the contact angle for water measured on the surface : the contact angle for water increases after the treatment of the support indicating a hydrophilic / hydrophobic conversion . the contact angle is defined as the angle between the tangent of the edge of the water droplet at the contact zone between the support and the droplet . a layer which includes a compound capable of absorbing light and converting the absorbed energy into heat may optionally be coated onto the anodized and annealed support or onto the etched and anodized support . the compound capable of absorbing light and converting it into heat is preferably an infrared absorbing agent . preferred ir absorbing compounds are dyes such as cyanine , merocyanine , indoaniline , oxonol , pyrilium and squarilium dyes or pigments such as carbon black . examples of suitable ir absorbers are described in , e . g ., ep 823 327 , ep 978 376 , ep 1 029 667 , ep 1 053 868 , ep 1 093 934 , wo 97 / 39894 and wo 00 / 29214 . a preferred compound is the following cyanine dye ir - a : wherein x − is a suitable counter ion such as tosylate . the coating may in addition to the layer including the infrared absorbing agent also contain one or more additional layer ( s ) such as , i . e ., a protective layer or an adhesion - improving layer between the layer including the infrared absorbing agent and the support . optionally , the layer including a compound capable of absorbing light or an optional other layer may further contain additional ingredients . for example , binders , surfactants such as perfluoro surfactants , silicon or titanium dioxide particles or colorants may be present . according to the present preferred embodiment , the heat - sensitive printing plate precursor thus obtained is then image - wise exposed directly with heat or indirectly with infrared light , preferably near infrared light . the infrared light is preferably converted into heat by an ir light absorbing compound as discussed above . the printing plate precursor is not sensitive to ambient light so that it can be handled without the need for a safe light environment . the printing plate precursor can be exposed to infrared light via , e . g ., leds or an infrared laser . preferably , the light used for the exposure is a laser emitting near infrared light having a wavelength in the range from about 700 nm to about 1500 nm , e . g ., a semiconductor laser diode , a nd : yag or a nd : ylf laser . the exposure step may optionally be followed by a rinsing step and / or a gumming step . the gumming step involves post - treatment of the heat - sensitive printing plate with a gum solution . a gum solution is typically an aqueous liquid which includes one or more surface protective compounds that are capable of protecting the lithographic image of a heat - sensitive material or printing plate against contamination or damaging . suitable examples of such compounds are film - forming hydrophilic polymers or surfactants . according to the present preferred embodiment , the heat - sensitive printing plate is then ready for printing without an additional development step . the exposed plate can be mounted on a conventional , so - called wet offset printing press in which ink and an aqueous dampening liquid are supplied to the material . the non - image areas hold the dampening water and the image areas hold the ink . another suitable printing method uses so - called single - fluid ink without a dampening liquid . suitable single - fluid inks have been described in u . s . pat . no . 4 , 045 , 232 , u . s . pat . no . 4 , 981 , 517 and u . s . pat . no . 6 , 140 , 392 . in an example of the present preferred embodiment , the single - fluid ink includes an ink phase , also called the hydrophobic or oleophilic phase , and a polyol phase as described in wo 00 / 32705 . alternatively , the printing plate is first mounted on the printing cylinder of the printing press and then image - wise exposed directly on the press via an integrated image - recording device . subsequent to exposure , the plate is ready for printing . the printing plate can be regenerated after printing . after printing , the printing plate is subjected to a flood exposure with uv light whereby hydrophobic areas are converted to a hydrophilic state and recover sensitivity to infrared light and / or heat irradiation . optionally , before the flood exposure step , a cleaning step may be performed to remove the adherent ink . suitable solvents that can be used for cleaning include hydrophobic petroleum solvents such as aromatic hydrocarbons commercially available as printing ink solvents : kerosine , benzol , toluol , xylol , acetone , methyl ethyl ketone , and mixtures thereof . the regenerated printing plate precursor thus obtained can be used for a next printing operation involving image - wise exposure and printing . a titanium foil ( goodfellow ti000380 99 . 6 %, 125 μm foil ) was cleaned by ultrasound treatment in isopropanol and was subsequently rinsed with water . samples with a size of 19 cm × 5 . 5 cm were cut out of the cleaned titanium support and anodized using a counter electrode of titanium and a distance between the two electrodes of 2 . 4 cm . table 1 lists the different anodizing conditions . printing plate precursors 1 and 3 were anodized in one single step whereas printing plate precursor 2 was anodized in three subsequent steps . every anodizing step was followed by a rinsing step with water . the thus obtained printing plate precursors 1 , 2 and 3 were subsequently irradiated with a single beam ir - laser diode at 830 nm with a pitch of 7 μm at 280 mw at 4 m / s ( corresponding to an energy density of 1000 mj / cm 2 ) and with a single beam ir - laser diode at 830 nm with a pitch of 7 μm at 280 mw at 8 m / s ( corresponding to an energy density of 500 mj / cm 2 ). after irradiation , the contact angles of the printing plates 1 , 2 and 3 were measured with a water droplet utilizing a fibro dat1100 equipment ( trademark of fibro system ab ). the contact angles were measured 2 ms after the deposition of the water droplet and are summarized in table 2 . the results of table 2 indicate that the annealing step under reduced pressure of the printing plate precursors results in a lowering of the contact angle value . upon laser irradiation of printing plate precursor 3 ( non annealed sample and annealed sample ), printing plate 3 is obtained of which the contact angle remains the same for the non - annealed plate and increases for the annealed plates indicating a hydrophilic / hydrophobic switch ( table 3 ). after the etching step , the different printing plate precursors were anodized at room temperature utilizing a dc voltage of 20 v ( table 4 ). a titanium counter electrode was used and the distance between the two electrodes was 2 . 4 cm . the printing plate precursors 4 - 10 were subsequently exposed with a single beam ir laser diode at 830 nm with a pitch of 7 μm at different powers and drum speeds . the resulting energy densities are given in table 5 . after the laser exposure , the plates were immediately mounted on a abdick 360 wet offset printing press . van son 167 ink ( trademark of van son ) was used together with a fountain solution of 5 % g671 ( trademark of agfa - gevaert ) in water . a non - compressible rubber blanket was used and 250 copies were printed on 80 g offset paper . the ink density on the prints were measured using a gretag macbeth d19c densitometer ( available from gretag macbeth ag ) and are summarized in table 6 ( ink density after 50 prints ) and table 7 ( ink density after 250 prints ). tables 6 and 7 show that an etching step followed by an anodization step results in a support having a surface with hydrophilic properties . upon exposure to infrared light , the ink density values increase . the best results are obtained by the “ strongest ” etching condition , i . e ., longest reaction time and highest concentration of h 2 o 2 and naoh ( see inventive printing plate 8 ). when no etching step is carried out ( only an anodization step ), the support has a surface with hydrophobic properties ( ink density value ≧ 1 ; see comparative printing plates 4 and 5 ). after the printjob , printing plate 8 was cleaned by removing the ink from the plate ; the plate cleaner howson normakleen rc910 ( trademark of howson normakleen ) was used . subsequently , the plate was irradiated for 24 hours with a mercury lamp emitting at 254 nm at 0 . 5 mw / cm 2 . after the uv - treatment , half of the plate was irradiated with the ir - laser according to table 5 . after the laser exposure , the plates were immediately mounted on a abdick 360 wet offset printing press . van son 167 ink was used together with a fountain solution of 5 % g671 ( trademark of agfa - gevaert ) in water . a non - compressible rubber blanket was used and the copies were printed on 80 g offset paper . the portion of the plate which was not irradiated with the ir - laser showed at print 50 ink density values varying between 0 . 05 and 0 . 15 . the portion of the plate which was irradiated with the ir - laser showed ink density values of 1 . 0 . the ink density values were measured using a gretag macbeth d19c densitometer ( available from gretag macbeth ). this example shows that flood exposure of the printing plate with uv - light results in a precursor which can be re - used in a next cycle of imaging and printing . while preferred embodiments of the present invention have been described above , it is to be understood that variations and modifications will be apparent to those skilled in the art without departing the scope and spirit of the present invention . the scope of the present invention , therefore , is to be determined solely by the following claims .	2
referring initially to fig1 a wellbore system 10 is illustrated as generally comprising a borehole 12 extending downward into a subterranean formation 14 , implanted radioactive marker bullets ( rmbs ) 16 , stray side rmbs 18 , stray bottom rmbs 20 , stray floating rmb 21 , and a downhole tool assembly 22 . downhole tool assembly 22 is received in borehole 12 and is supported by a cable 24 which extends into borehole 12 and is coupled to surface equipment 26 . cable 24 and surface equipment 26 cooperate to raise and lower tool assembly 22 in borehole 12 . preferably , cable 24 is a wireline which not only physically supports tool assembly 22 , but also includes electrical conductors for carrying power and / or electrical control signals from surface equipment 26 to tool assembly 22 . downhole tool assembly 22 comprises a radioactive marker bullet gun 28 and a magnetic fishing tool 30 . gun 28 is operable to propel radioactive marker bullets ( rmbs ) outward and into subterranean formation 14 . properly implanted rmbs 16 are snugly received in subterranean formation 14 so that any local shifting of subterranean formation 14 causes corresponding shifting of implanted rmbs 16 in that location . although gun 28 is designed to fire radioactive marker bullets into subterranean formation 14 , several factors , such as improper operation of gun 28 and / or extremely high density of subterranean formation 14 , may cause inadequate lodging of the radioactive marker bullets in subterranean formation 14 . such stray rmbs 18 , 20 , 21 may partially lodge in formation 14 ( e . g ., stray side rmb 18 b ), may fall ( e . g ., stray floating rmb 21 ) in borehole 12 and come to rest on a ledge of the sidewall of borehole 12 ( e . g ., stray side rmb 18 a ), or may simply fall to the bottom of borehole 12 ( e . g ., stray bottom rmbs 20 ). magnetic fishing tool 30 is operable to attract and hold stray rmbs 18 , 20 which are relatively loosely positioned in borehole 12 . magnetic fishing tool 30 comprises a first group of side magnets 32 , a second group of side magnets 34 axially spaced from the first group of side magnets 32 , and a group of end magnets 36 . side magnets 32 , 34 face generally outward toward the side walls of borehole 12 so that stray rmbs 18 , 21 can be pulled into contact with and held against the outwardly facing surface of side magnets 32 , 34 by magnetic force . end magnets 36 face generally downward toward the bottom of borehole 12 so that stray bottom rmbs 20 can be pulled into contact with and held against the downwardly facing surface of end magnets 36 by magnetic force . rmbs 16 , 18 , 20 , 21 can be any conventional bullet capable of being coupled to magnets 32 , 24 , 36 of fishing tool 30 by magnetic force . preferably , rmbs 16 , 18 , 20 , 21 include a quantity of a radioactive substance , for example , a pellet of cesium 137 of about 100 - 150 micro - curies . the radioactive substance is preferably encased in a durable , metallic casing ( shaped as a conventional bullet ) which can be attracted to and held in contact with magnets 32 , 24 , 36 of fishing tool 30 . radioactive marker bullet gun 28 can be any conventional radioactive marker bullet gun capable of propelling radioactive marker bullets into subterranean formation 14 . an example of a suitable radioactive marker bullet gun is the “ e - gun ( bullet ) perforating system ” available from baker atlas , houston , tex . another radioactive marker bullet gun which can be modified for use with fishing tool 30 is described in u . s . pat . no . 4 , 916 , 312 ( assigned to schlumberger technology ), the entire disclosure of which is incorporated herein by reference . other suitable radioactive marker bullet gun configurations are well known in the art . referring now to fig2 - 4 , magnetic fishing tool 30 generally comprises an elongated main body 38 extending along a longitudinal axis 39 and three groups of magnets 32 , 34 , 36 coupled to body 38 at specific axial locations . body 38 includes a proximal end 40 adapted to be coupled to a radioactive marker bullet gun and a distal end 42 which normally faces downward when fishing tool 30 is inserted into a borehole . proximal end 40 preferably includes a male threaded member 44 for coupling fishing tool 30 to a normally lower end of a radioactive marker bullet gun . the outer surface of main body 38 includes first , second , and third axially spaced wide outer surfaces 46 , 48 , 50 , first and second axially spaced narrow outer surfaces 52 , 54 , a plurality of tapered axially spaced transition surfaces 56 , a terminal end surface 58 , and a terminal tapered surface 60 . first wide outer surface 46 is located proximate distal end 42 . third wide outer surface 50 is located proximate proximal end 40 . second wide outer surface 48 is axially spaced from and positioned between first and third wide outer surfaces 46 , 50 . first narrow outer surface 52 is axially positioned between first and second wide outer surfaces 46 , 48 . second narrow outer surface 54 is axially positioned between second and third wide outer surfaces 48 , 50 . each transition surface 56 provides a tapered transition between one of narrow outer surfaces 52 , 54 and an adjacent one of wide outer surfaces 46 , 48 , 50 . terminal tapered surface 60 provides a tapered transition between first wide outer surface 46 and terminal end surface 58 . preferably , wide outer surfaces 46 , 48 , 50 and narrow outer surfaces 52 , 54 are substantially cylindrical in shape , transition surfaces 56 and terminal tapered surface 60 are substantially frustoconical in shape , and terminal end surface 58 is substantially flat . first and second groups of side magnets 32 , 34 are coupled to main body 38 proximate first and second narrow outer surfaces 52 , 54 , respectively . end magnets 36 are coupled to main body 38 proximate terminal end surface 58 . preferably magnets 32 , 34 , 36 are embedded in main body 38 by inserting each individual magnet into a respective bore in main body 38 . preferably , magnets 32 , 34 , 36 are generally cylindrical in shape . magnets 32 , 34 , 36 can be fixed to main body 38 by any means known in the art such as , for example , glueing , soldering , or welding . magnets 32 , 34 , 36 can be any magnet ( permanent or electromagnet ) of suitable strength for attracting and holding radioactive marker bullets thereto . magnets 32 , 34 , 36 are preferably permanent magnets , more preferably rare earth permanent magnets , and most preferably samarium cobalt magnets . first and second groups of side magnets 32 , 34 each comprise a plurality of individual magnets which are circumferentially spaced around a respective narrow outer surface 52 , 54 of main body 38 . preferably , each of first and second groups of side magnets 32 , 34 comprises from 3 to 12 individual magnets , more preferably from 4 to 8 individual magnets . the individual magnets in each of first and second groups of side magnets 32 , 34 are preferably substantially symmetrically spaced around longitudinal axis 39 . each magnet in first and second groups of side magnets 32 , 34 presents a substantially flat outwardly - facing side surface 62 . side surfaces 62 preferably face generally radially away from longitudinal axis 39 of main body 38 . preferably , each side surface 62 of each individual magnet in the groups of side magnets 32 , 34 faces in a direction which is within 30 degrees of perpendicular to the direction of extension of longitudinal axis 39 , more preferably within 15 degrees of perpendicular to the direction of extension of longitudinal axis 39 , and most preferably substantially perpendicular to the direction of extension of longitudinal axis 39 . wide outer surfaces 46 , 48 , 50 are preferably substantially cylindrical and have substantially the same width . wide outer surfaces 46 , 48 , 50 are radially spaced from longitudinal axis 39 by a maximum radial distance which is greater than the maximum distance between longitudinal axis 39 and side surfaces 62 of side magnets 32 , 34 . it is important for wide outer surfaces 46 , 48 , 50 to extend a greater radial distance from longitudinal axis 39 than side surfaces 62 of side magnets 32 , 34 in order to protect a captured side rmb 64 from being disengaged from ( i . e ., “ scraped off ”) side surface 62 by the sidewall of the borehole when fishing tool 30 is shifted up and down in the borehole . preferably , the maximum radial distance between longitudinal axis 39 and wide outer surfaces 46 , 48 , 50 is at least 10 percent greater than the maximum radial distance between longitudinal axis 39 and side surfaces 62 of side magnets 32 , 34 , more preferably at least 20 percent greater , and most preferably at least 40 percent greater . as used herein , the term “ maximum radial distance ” means the maximum distance from a central axis ( e . g ., longitudinal axis 39 ) to any point on a particular surface or group of surfaces , measured perpendicular to the direction of extension of the central axis . the maximum radial distance between longitudinal axis 39 and wide outer surfaces 46 , 48 , 50 is preferably in the range of from about 1 inch to about 6 inches , more preferably in the range of from about 1 . 5 inches to about 4 inches , and most preferably in the range of from 2 inches to 3 inches . narrow outer surfaces 52 , 54 are preferably substantially cylindrical and have substantially the same width . the maximum radial distance between longitudinal axis 39 and narrow outer surfaces 52 , 54 is less than the maximum radial distance between longitudinal axis 39 and wide outer surfaces 46 , 48 , 50 . the maximum radial distance between longitudinal axis 39 and narrow outer surfaces 52 , 54 can be less than the maximum radial distance between longitudinal axis 39 and side surfaces 62 of side magnets 32 , 34 ( i . e ., when side surfaces 62 of side magnets 32 , 34 are slightly raised from narrow outer surfaces 52 , 54 ). alternatively , the maximum radial distance between longitudinal axis 39 and narrow outer surfaces 52 , 54 and the maximum radial distance between longitudinal axis 39 and side surfaces 62 of side magnets 32 , 34 is substantially the same ( i . e ., when side surfaces 62 of side magnets 32 , 34 are substantially flush with narrow outer surfaces 52 , 54 ). group of end magnets 36 comprises a plurality of spaced - apart individual magnets . preferably , group of end magnets 36 comprises from 1 to 8 individual magnets , more preferably from 2 to 6 individual magnets , and most preferably 3 individual magnets . each end magnet 36 presents a substantially flat downwardly - facing bottom surface 66 . bottom surfaces 66 preferably face generally axially away from main body 38 in a direction which is within 30 degrees of parallel to the direction of extension of longitudinal axis 39 , more preferably within 15 degrees of parallel to the direction of extension of longitudinal axis 39 , and most preferably substantially parallel to the direction of extension of longitudinal axis 39 . the direction in which bottom surfaces 66 of end magnets 36 face and the direction in which each side surface 62 of side magnets 32 , 34 face are preferably within 30 degrees of perpendicular to one another , more preferably within 15 degrees to perpendicular to one another , and most preferably substantially perpendicular to one another . side surfaces 62 of side magnets 32 , 34 and bottom surfaces 66 of end magnets 36 are preferably exposed ( i . e ., uncovered ) so that radioactive marker bullets located away from side and bottom surfaces 62 , 66 can be pulled directly into contact with and held against side and bottom surfaces 62 , 66 by magnetic force . referring again to fig1 in operation , downhole tool assembly 22 can be assembled by coupling magnetic fishing tool 30 to a normally lower end of radioactive marker bullet gun 28 . a normally upper end of radioactive marker bullet gun 28 can then be coupled to cable 24 . downhole tool assembly 22 can then be lowered into borehole 12 . once in borehole 12 , radioactive marker bullets ( rmbs ) can be propelled outwardly from gun 28 into subterranean formation 14 . stray rmbs 18 , 20 , 21 fired from gun 28 but not properly lodged in subterranean formation 14 may fall downward from gun 28 and towards magnetic fishing tool 30 . as these stray rmbs ( e . g ., stray floating rmb 21 ) fall past fishing tool 30 , they may become attracted by and coupled to side magnets 32 , 34 of fishing tool 30 . some of the stray rmbs ( e . g ., stray side rmb 18 a ) may fall past magnetic fishing tool 30 and come to rest on ledges of the sidewall of borehole 12 . other of the stray rmbs ( e . g ., stray bottom rmbs 20 ) may fall to the bottom of borehole 12 . stray rmbs 18 , 21 can be pulled into contact with and coupled to side magnets 32 , 34 of fishing tool 30 when fishing tool 30 is passed by and / or contacted with stray side rmbs 18 . stray bottom rmbs 20 can be pulled into contact with and coupled to end magnets 36 when fishing tool 30 is lowered to the bottom of borehole 12 . when downhole tool assembly 22 is removed from borehole 12 , the stray rmbs coupled to magnets 32 , 34 , 36 of magnetic fishing tool 30 are removed therewith . thus , downhole tool 22 allows implanted rmbs 16 to be fired into subterranean formation 14 and stray rmbs 18 , 20 , 21 to be retrieved from borehole 12 during a single run of downhole tool assembly 22 in borehole 12 . the preferred forms of the invention described above are to be used as illustration only , and should not be utilized in a limiting sense to interpret the scope of the present invention . obvious modifications to the exemplary embodiments , set forth above could be readily made by those skilled in the art without departing from the spirit of the present invention . the inventor hereby states his intent to rely on the doctrine of equivalence to determine and assess the reasonably fair scope of the present invention as pertains to any apparatus not materially departing from , but outside the literal scope of the invention as set forth in the following claims .	4
throughout the drawings , the same reference numerals are used to denote the same features . fig1 is an schematic , top plan view of the present invention . in this view , the plane of the door to which the invention is mounted is in the plane of the paper . in this version of the invention , the housing 12 of the device is a slipcover , which is placed over the latch handle of an existing deadbolt door lock . the slipcover is preferably constructed of metal or metalized plastic and is dimensioned and configured to be slightly larger than the existing latch . alternatively , the slip cover may be constructed from a flexible or elastic material so that the slipcover will fit snugly over the handle without any loose edges . the slipcover has an outside surface and an inside surface ; see fig4 . the inside surface of the slipcover is next to the door and has an opening to receive the existing deadbolt latch handle . fig1 and 2 illustrate that the outside surface has a visible signal 14 incorporated into the slip cover . as noted earlier , the signal 14 may be any type of signal , without limitation , that is dimensioned and configured to toggle between an “ on ” position and an “ off ” position . a light - emitting diode ( led ) is preferred , but a small light bulb or lcd may also be used . the signal is preferably positioned distally from the rotational axis of the deadbolt latch handle . this is simply the preferred embodiment . the signal 14 may be disposed at any point on the surface of housing 12 . the signal is attached to circuitry 16 securely contained within the slipcover . the circuitry operationally connects the signal 14 to a switch 18 for turning the signal on and off , at least one battery 20 to power the signal , and an optional timer 22 . in the preferred version of the invention , the circuitry is configured so that the battery supplies power through the optional timer 22 to the signal 14 when the deadbolt is in the locked position . a switch 18 responsive to the rotation of the latch handle controls the power supply from the battery 20 to the timer 22 . when the deadbolt is locked , the switch is closed , and power flows from the battery , through the timer , and into the signal , thus turning it on . when the deadbolt is unlocked , the switch is opened , and the signal is turned off . thus , the switch is activated when the latch handle is thrown to engage the deadbolt , which locks the door . in the preferred embodiment , the switch 18 is a simple , pressure activated switch that responds to the rotational movement of the latch handle . simple rotary switches are well known . any other type of switch that is responsive to the rotation of the deadbolt latch handle may also be used , for example a magnetic switch , a mercury - type gravity switch , a gyroscopically - activated switch , a reed switch , etc . as noted earlier , the invention may be configured in the form of a slip cover that fits over the latch of an existing deadbolt lockset . another version of the invention is a replacement latch handle which attaches to an existing deadbolt lockset . the latch handle contains the signal and circuitry noted earlier . in this version of the invention , the conventional latch handle on an existing deadbolt lockset is removed , and a latch handle according to the present invention is inserted in its place . alternatively , an original equipment manufacturer deadbolt latch set may be manufactured that includes the present invention directly incorporated into the latch . fig4 is a perspective , exploded rendering of a preferred version of the present invention . the back side of the housing is visible , as is frame 40 on which is anchored the batteries 20 , circuitry 16 ( in the form of an integrated chip ) and signal 15 ( depicted as an led ). fig5 a is a top plan view of the invention depicted in fig4 , and fig5 b is a vertical cross - section along line c - c of fig5 a . as can be best in fig5 b , the frame 40 and its associated components , fits snugly within the housing 12 . the led 14 is then visible through an aperture 14 ′ ( see fig6 c ) in the housing 12 . the frame 40 can be adhered within the frame by any mechanism known in the art , including friction , glue , solder , fasteners of any sort , etc . detailed views of the housing in isolation are provided in fig6 a , 6 b , 6 c , 6 d , 6 e . fig6 c is the top plan view of the housing ; fig6 a is a cross - section through line a - a ; fig6 b is a cross - section through line b - b ; fig6 d is a left - side , vertical cross - section of fig6 c ; fig6 e is a rear elevation view of fig6 c . preferred dimensions ( in inches ) are provided . these dimensions are provided solely for purposes of illustration and are not limiting in any fashion . fig7 is a perspective rendering of the circuitry , batteries , and led that are carried on frame 40 , which is ultimately contained within the housing . the frame 40 can be fabricated from any suitably stiff or semi - flexible material , typically plastic . the frame may also be a printed circuit board , in which case the required circuitry would be incorporated directly into frame 40 itself . a micro - chip 16 is provided to activate and deactivate signal 14 in response to the position of the housing . the position of the housing is sensed by reed switch 18 , which activates and deactivate the signal 14 in response to the position of the housing in which the frame is disposed . batteries 20 are depicted within corresponding brackets 41 to hold them in place . fig8 is a circuit diagram illustrating how the led 14 is energized by batteries 20 in response to motion of the handle body . the circuit is opened or closed via switches sw 1 ( right side ) and sw 2 ( left side ) in response to the position of the housing . the two arms of the reed valve 18 serve to open and close the circuit in response to the left or right orientation of the deadbolt lock to which the housing is attached . a microchip 16 ′, such as a pic10f206 , may be used to control the status of the led . the pic10f206 is a low - cost , high - performance , 8 - bit , fully static , flash - based cmos microcontroller . it employs a risc architecture with only 33 single - word / single - cycle instructions . all instructions are single cycle ( 1 μs ) except for program branches , which take two cycles . it is a preferred chip because of its easy - to - use and easy to remember instruction set reduces development time significantly . a host of other functionally equivalent microcontrollers may also be used . they can be obtained from a very large number of international suppliers , such as microchip technology inc ., chandler , ariz . it is understood that the invention is not confined to the particular construction and arrangement of parts herein illustrated and described , but embraces such modified forms thereof as come within the scope of the following claims .	4
the catalystic cracking processes of this invention are those employing zeolitic - containing catalysts wherein the concentration of the zeolite is in the range of 6 to 40 weight percent of the catalyst composite and which have a tendency to be deactivated by the deposition thereon of metal contaminants as previously described , to the extent that optimum gasoline product yields are no longer obtained . the inventive process is effective in processes employing cracking catalyst compositions which contain at least 1 , 500 ppm nickel equivalent metal contaminants and is generally applicable to processes wherein the cracking catalyst can contain up to 5 , 000 ppm nickel equivalent metal contaminants . the cracking catalyst compositions of the process of this invention include those which comprise a crystalline aluminosilicate dispersed in a refractory metal oxide matrix such as disclosed in u . s . pat . nos . 3 , 140 , 249 and 3 , 140 , 253 to c . j . plank and e . j . rosinski . suitable matrix materials comprise inorganic oxides such as amorphous and semi - crystalline silica - aluminas , silica - magnesias , silica - alumina - magnesia , alumina , titania , zirconia , and mixtures thereof . zeolites or molecular sieves having cracking activity and suitable in the preparation of the catalysts of this invention are crystalline , three - dimensional , stable structures containing a large number of uniform openings or cavities interconnected by smaller , relatively uniform holes or channels . the formula for the zeolites can be represented as follows : where m is a metal cation and n its valence ; x varies from 0 to 1 ; and y is a function of the degree of dehydration and varies from 0 to 9 . m is preferably a rare earth metal cation such as lanthanum , cerium , praseodymium , neodymium or mixtures thereof . zeolites which can be employed in the practice of this invention include both natural and synthetic zeolites . these natural occurring zeolites include gmelinite , chabazite , dachiardite , clinoptilolite , faujasite , heulandite , analcite , levynite , erionite , sodalite , cancrinite , nepheline lazurite , scolecite , natrolite , offretite , mesolite , mordenite , brewsterite , ferrierite , and the like . suitable synthetic zeolites which can be employed in the inventive process include zeolites x , y , a , l , zk - 4 b , e , f , h , j , m , q , t , w , z , alpha and beta , zsm - types and omega . the effective pore size of synthetic zeolites are suitable between 6 and 15 a in diameter . the term &# 34 ; zeolites &# 34 ; as used herein contemplates not only aluminosilicates but substances in which the aluminum are replaced by gallium and substances in which the silicon is replaced by germanium . the preferred zeolites are the synthetic faujasites of the types y and x or mixtures thereof . it is also well known in the art that to obtain good cracking activity the zeolites must be in good cracking form . in most cases this involves reducing the alkali metal content of the zeolite to as low a level as possible as a high alkali metal content reduces the thermal structural stability , and the effective lifetime of the catalyst is impaired . procedures for removing alkali metals and putting the zeolite in the proper form are well known in the art and are as described in u . s . pat . no . 3 , 547 , 816 . conventional methods can be employed to form the catalyst composite . for example , finely divided zeolite can be admixed with the finely divided matrix material , and the mixture spray dried to form the catalyst composite . other suitable methods of dispersing the zeolite materials in the matrix materials are described in u . s . pat . nos . 3 , 271 , 418 ; 3 , 717 , 587 ; 3 , 657 , 154 ; and 3 , 676 , 330 whose descriptions are incorporated herein by reference thereto . in addition to the zeolitic - containing cracking catalyst compositions heretofore described , other materials useful in preparing the tin - containing catalysts of this invention also include the laminer 2 : 1 layer - lattice aluminosilicate materials described in u . s . pat . no . 3 , 852 , 405 . the preparation of such materials is described in the said patent and the disclosure therein is incorporated in this application by reference thereto . when employed in the preparation of the catalysts of this invention , such laminar 2 : 1 layer - lattice aluminosilicate materials are combined with a zeolitic composition . the cracking catalyst compositions of this invention also contain a concentration of tin of at least 2 , 000 ppm . the concentration of tin in the catalyst composite will normally range from 0 . 2 to 2 . 5 weight percent of the catalyst composite . the tin can be added to the fresh cracking catalyst by impregnation , employing a tin compound which is either the oxide or which is convertible to the oxide upon subjecting the catalyst composite to a calcination step . for example , a compound selected from the group consisting of tetraphenyl tin , hexabutyl tin , and tetraethyl tin can be added to a hydrocarbon solvent such as benzene and the catalyst composition contacted with the hydrocarbon solvent containing the selected tin compound so as to prepare , after drying and calcination , a final catalyst composition containing a concentration of tin as defined above . when the tin compound employed in preparing the catalyst composite is selected from the group consisting of tin chloride , tin bromide , and tin sulfate , the compound can be dissolved in water and the catalyst composition contacted with the water solution so as to prepare , after drying and calcination , a final catalyst composition containing the desired concentration of tin . another method of adding the tin to the catalyst composite is by the addition of tin to an inorganic oxide gel . the preparation of plural gels is well known in the art and generally involves either separate precipitation or coprecipitation in which a suitable salt of the tin oxide is added to an alkali metal silicate and an acid or base , as required , is added to precipitate the corresponding oxide . the inorganic oxide gel as prepared and containing the tin can then be combined with the aluminosilicate by methods well known in the art . another suitable method of adding the tin to the zeolite - containing catalyst composite is by a conventional ion exchange method . an alternative method of compositing the tin with the zeolite - containing cracking catalyst is to introduce a tin compound , such as previously descried , into the hydrocarbon feed to the catalytic cracking zone until the concentration of the tin on the catalyst is at least 2 , 000 ppm . generally , the rate of introduction of the tin compound in the hydrocarbon feed to the cracking zone will be such that the concentration of the tin compound will range from about 3 ppm to 3 , 000 ppm , preferably from 100 to 500 ppm in the hydrocarbon feed . contacting the catalyst containing contaminating metals with the tin compound can conveniently comprise dispersing the tin compound into the hydrocarbon feed employing a suitable liquid solvent or dispersing agent . following the compositing of the tin with the zeolite - containing catalyst , the catalyst can be further treated according to conventional methods such as heating the catalyst to elevated temperatures , generally in the range of about 800 ° to about 1 , 600 ° f . ( 427 ° to 870 ° c .) for a period of time ranging from 3 to 30 minutes in the presence of a free oxygen - containing gas . this further treatment which is effected in the catalyst regeneration step when the tin compound is introduced into the cracking zone hydrocarbon feed , results in the treating agent , if not presently in the form of the oxide , being converted to the oxide . the catalyst compositions of this invention are employed in the cracking of charge stocks , in the absence of added hydrogen , to produce gasoline and light distillate fractions from heavier hydrocarbon feed stocks . the charge stocks generally are those having an average boiling temperature above 600 ° f . ( 316 ° c .) and include materials such as gas oils , cycle oils , residuums and the like . as previously described , conventional catalytic cracking charge stocks contain less than 1 . 5 ppm nickel equivalents as metal contaminants . the charge stocks employed in the process of this invention can contain significantly higher concentrations of metal contaminants as the tin - containing catalysts are effective in catalytic cracking processes operated at metal contaminant levers exceeding 1 , 500 ppm nickel equivalents . the process employing the tin - containing catalysts is also effective at metal contaminant levels exceeding 2 , 500 ppm nickel equivalents and even exceeding 5 , 000 ppm nickel equivalents . thus , the charge stocks to the catalytic cracking process of this invention can contain metal contaminants in the range up to 3 . 5 ppm and higher nickel equivalents . although not to be limited thereto , a preferred method of employing the catalysts of this invention is by fluid catalytic cracking using riser outlet temperatures between about 900 ° to 1 , 100 ° f . ( 482 ° to 593 ° c ). the invention will hereafter be described as it relates to a fluid catalytic cracking process although those skilled in the art will readily recognize that the invention is equally applicable to those catalytic cracking processes employing a fixed catalyst bed and conventional operating conditions of temperature , pressure , and space velocity . under fluid catalytic cracking conditions the cracking occurs in the presence of a fluidized composited catalyst in an elongated reactor tube commonly referred to as a riser . generally , the riser has a length to diameter ratio of about 20 . the charge stock is passed through a preheater which heats the feed to a temperature of about 600 ° f . ( 316 ° c .) and the heated feed is then charged into the bottom of the riser . in operation , a contact time ( based on feed ) of up to 15 seconds and catalyst to oil weight ratios of about 4 : 1 to about 15 : 1 are employed . steam can be introduced into the oil inlet line to the riser and / or introduced independently to the bottom of the riser so as to assist in carrying regenerated catalyst upwardly through the riser . regenerated catalyst at temperatures generally between about 1 , 100 ° and 1 , 350 ° f . ( 593 ° to 732 ° c .) is introduced into the bottom of the riser . the riser system at a pressure in the range of about 5 to about 50 psig (. 35 to 3 . 50 kg / cm 2 ) is normally operated with catalyst and hydrocarbon feed flowing concurrently into and upwardly into the riser at about the same flow velocity , thereby avoiding any significant slippage of catalyst relative to hydrocarbon in the riser and avoiding formation of a catalyst bed in the reaction flow stream . in this manner the catalyst to oil ratio thus increases significantly from the riser inlet along the reaction flow stream . the riser temperature drops along the riser length due to heating and vaporization of the feed by the slightly endothermic nature of the cracking reaction and heat loss to the atmosphere . as nearly all the cracking occurs within one or two seconds , it is necessary that feed vaporization occurs nearly instantaneously upon contact of feed and regenerated catalyst at the bottom of the riser . therefore , at the riser inlet , the hot , regenerated catalyst and preheated feed , generally together with a mixing agent such as steam , ( as hereto described ) nitrogen , methane , ethane or other light gas , are intimately admixed to achieve an equilibrium temperature nearly instantaneously . the catalyst containing metal contaminants and carbon is separated from the hydrocarbon product effluent withdrawn from the reactor and passed to a regenerator . in the regenerator the catalyst is heated to a temperature in the range of about 800 ° to about 1600 ° f . ( 427 ° to 871 ° c . ), preferably 1160 ° to 1260 ° f . ( 627 ° to 682 ° c . ), for a period of time ranging from three to thirty minutes in the presence of a free - oxygen containing gas . this burning step is conducted so as to reduce the concentration of the carbon on the catalyst to less than 0 . 3 weight percent by conversion of the carbon to carbon monoxide and carbon dioxide . conventional processes can operate with catalysts containing contaminated metals concentrations greater than 1000 ppm nickel equivalents but at a substantial loss of product distribution and conversion . further , under such conditions undesirably high concentrations of coke , hydrogen and light gas are produced . by employing the defined catalyst in the manner of this invention , the contaminant metals level on the catalyst can exceed 2500 ppm nickel equivalents while obtaining a conversion and gasoline yield normally effected by conventional catalysts containing only 500 ppm nickel equivalent metal contaminants . gasoline yield is not significantly reduced as metals contaminant levels increase up to 5 , 000 ppm nickel equivalents . although hydrogen yields increase with increasing metal contamination above 1500 ppm , the rate of increase is substantially less than that normally obtained in conventional hydrocarbon cracking processes . thus , by this invention the cracking process can be operated efficiently with a metal contaminant concentration level on the catalyst up to at least 5000 ppm nickel equivalents . as previously indicated , the process of this invention has a significant advantage over conventional catalytic cracking processes by providing an economically attractive method to include higher metals - containing gas oils as a feed to the catalytic cracking process . because of the loss of selectivity to high value products ( loss of conversion and yield of gasoline , and gain in coke and light gases ) with the increase in metals contamination on conventional cracking catalysts , most refiners attempt to maintain a low metals level on the cracking catalyst -- less than 1000 ppm . an unsatisfactory method of controlling metals contamination in addition to those previously discussed is to increase the catalyst makeup rate to a level higher than that required to maintain activity or to satisfy unit losses . the following examples are presented to illustrate objects and advantages of the invention . however , it is not intended that the invention should be limited to the specific embodiments presented therein . in the catalytic cracking run , conducted in the absence of added hydrogen , of this example , a kuwait gas oil feed stock having a boiling range of 500 ° f . ( 260 ° c .) to 800 ° f . ( 427 ° c .) was employed . the catalyst employed was a crystalline aluminosilicate dispersed in a refractory oxide matrix wherein the concentration of the zeolite was in the range of 30 - 40 weight percent . the physical characteristics and chemical composition of the catalyst containing 0 . 25 weight percent nickel and 0 . 035 weight percent vanadium for a total of 2 , 570 ppm nickel equivalents as metal contaminants was as follows : ______________________________________ after heating in the presence of oxygen forphysical characteristics : 3 hours at 552 ° c . ______________________________________ surface area : m . sup . 2 / g 193 pore volume : cc / g 0 . 222 apparent bulk density : kg / dm . sup . 3 0 . 716 volatile content : 2 hrs . at 1500 ° f . 12 . 3 % particle size distribution 0 - 20 microns 3 . 0 20 - 40 microns 12 . 8 40 - 80 microns 52 . 7 & gt ; 80 microns 31 . 5chemical composition : wt . % iron ( fe . sub . 2 o . sub . 3 ) 0 . 543 nickel ( ni ) 0 . 25 vanadium ( v ) 0 . 035 sodium ( na ) 0 . 62 alumina ( al . sub . 2 o . sub . 3 ) 42 . 15 cerium ( ce ) 0 . 19______________________________________ the catalytic cracking run of this example was conducted employing a fixed catalyst bed , a temperature of 900 ° f . ( 482 ° c . ), a weight hourly space velocity of 15 , and a contact time of 80 . 5 seconds . the results obtained in this run ( run no . 1 ) were a conversion of 56 . 2 volume percent of the feed , a c 5 + gasoline production of 36 . 0 volume percent of the feed , a production of 5 . 47 weight percent carbon on the catalyst and a hydrogen yield of 0 . 44 weight percent of the feed . in this example the effectiveness of employing a cracking catalyst when processing the kuwait gas oil of example i is demonstrated . in run no . 2 the catalyst composition of example i containing 2 , 570 ppm nickel equivalents as metal contaminants was impregnated with hexabutyl tin to obtain a catalyst composite containing 0 . 61 weight percent tin . in run no . 3 the fresh catalyst composition of example i was impregnated with tin chloride to obtain a catalyst composite containing 0 . 61 weight percent tin and the catalyst thereafter contaminated with 2 , 570 ppm nickel equivalents as metal contaminants . the cracking conditions employed in each of runs 2 and 3 were the same as those employed in run no . 1 of example i . the results obtained in each of the runs , together with the results otained in run no . 1 , are shown below in table i . table i______________________________________ c . sub . 5 . sup .+ conversion gasoline carbon hydrogenrun vol % vol % wt % wt % no . of feed of feed of feed of feed______________________________________1 56 . 2 36 . 0 5 . 47 . 442 60 . 3 40 . 1 5 . 06 . 283 63 . 9 42 . 6 4 . 58 . 28______________________________________ a comparison of the results obtained demonstrates the effectiveness of the catalyst composition containing tin to obtain significant improvement in the conversion and in c 5 + gasoline produced when operating with metal contaminants on the catalyst equal to 2 , 570 ppm nickel equivalents . also , the effectiveness of a tin - containing catalyst to significantly reduce the production of carbon and hydrogen is demonstrated . although the invention has been described with references to specific embodiments , references , and details , various modifications and changes will be apparent to one skilled in the art and are contemplated to be embraced in this invention .	2
the present disclosure provides an online shopping system and method which increases the conversion rate of an e - commerce website by reducing the incidence of shopping cart abandonment , which is now described in detail with reference to the figures . it is to be understood and appreciated the herein description is meant to illustrate , and not limit , the scope of the present disclosure . as used throughout this disclosure , the term “ product ” is to be construed to mean a deliverable product ( i . e ., physical product , downloadable media , and the like ) except when used in an arithmetical context whereupon “ product ” is to be construed to have its ordinary meaning ( i . e ., the result of an arithmetic multiplication ). as used throughout this disclosure , the term “ item ” is to be construed to mean a symbolic representation of product ( i . e ., a database entry of corresponding to a product or a representation of the product in a shopping cart ). fig1 illustrates an exemplary e - commerce server 10 embodying aspects of the present disclosure . the e - commerce server 10 includes at least one processor 25 that is operatively coupled , by system bus or other suitable means , to storage device 15 , memory 20 , and communications interface 30 . communications interface 30 is operatively coupled to consumer access devices , which may include without limitation a personal computer 65 and / or wireless device 70 , via a data network 60 , such as the internet , as is well - known in the art . in an embodiment , communications interface 30 may be a wired network interface such as a 100base - t fast ethernet interface , or a wireless network interface such as a wireless network interface compliant with the ieee 802 . 11 (“ wifi ”) standard . e - commerce server 10 may include a merchant item database ( not shown ) for storing data related to the items the merchant may offer for sale , a consumer favorite products list ( not shown ), and / or a record of a consumer &# 39 ; s purchase history . e - commerce server 10 may also provide an online shopping cart for enabling a consumer to select items for purchase , as is well - known . e - commerce server 10 further includes a filler item processing module 50 having at least one of software , firmware and hardware for evaluating the value of items in a shopping cart and suggesting filler items in accordance with the present disclosure . in one embodiment , the filler item processing module 50 includes a shopping cart filler item module 100 , a checkout filler item module 200 , and a filler item identification module 300 . shopping cart filler item module 100 includes a software program having a set of programmable instructions configured for execution by the at least one processor 25 of the e - commerce server 100 for presenting filler items to a consumer when the shopping cart is modified , i . e ., at least one item is added , changed , or deleted from the shopping cart . checkout filler item module 200 includes a software program having a set of programmable instructions configured for execution by the at least one processor 25 of the e - commerce server 100 for presenting filler items and / or alternative offers to a consumer during the checkout process . filler item identification module 300 includes a software program having a set of programmable instructions configured for execution by the at least one processor 25 of the e - commerce server 100 for identifying filler items that may be offered to a consumer . in an envisioned embodiment of present disclosure , the filler item processing module 50 implementing the algorithms disclosed herein is contained within a software extension component , such as a script , macro , dynamic link library ( dll ), plug - in or snap - in , that extends the capabilities of a website e - commerce module 140 , such as without limitation , microsoft commerce server ™, adobe coldfusion ™, or apache or other web server in an e - commerce configuration . in another embodiment contemplated by the present disclosure , filler item processing module 50 implementing the algorithms disclosed herein is incorporated within the website e - commerce module 140 . with reference to fig2 , an embodiment of the shopping cart filler item module 100 is presented in accordance with the present disclosure . it is to be understood that the labels and symbols used throughout this disclosure are illustrative in nature , and are not to be construed as limiting the scope of the present disclosure . in the step 110 the consumer browses , or “ shops ” the merchant site , to select item ( s ) for purchase . upon selection the items may be added to the shopping cart in the step 115 . alternatively , in the step 115 an existing item in the shopping cart may be modified , i . e ., the desired quantity may be changed , or an existing item in the shopping cart may be deleted . the product of the unit price and corresponding quantity of each item is summed in the step 120 to cumulatively compute the order subtotal . in the step 125 the order subtotal is compared to the promotional threshold amount . if the promotional threshold has been reached , i . e ., the order total is equal to or greater than the promotional threshold , the shopping cart filler item module 100 processing is concluded and the consumer is returned to the browsing state 110 . however , if the promotional threshold has not been reached , the step 130 is performed wherein filler items are identified by the filler item identification module 300 , as will be described in detail hereinbelow . if no filler items are identified , the shopping cart filler item module 100 processing is concluded and the consumer is returned to the browsing state 10 . however , if filler items have been found , the step 140 is performed wherein the filler items are presented to the consumer for purchase . in the step 145 it is determined whether the consumer has chosen a filler items . if no item was selected , the consumer is returned to the browsing state 110 . if an item was selected , the item is added to the shopping cart in the step 150 and the consumer is returned to the browsing state 10 . turning now to fig3 , an embodiment of the checkout filler item module 200 is presented in accordance with the present disclosure . in the step 210 the consumer may browse or “ shop ” the merchant and ultimately in the step 215 proceed to checkout . the product of the unit price and corresponding quantity of each item is summed in the step 220 to cumulatively compute the order subtotal . in the step 225 the order subtotal is compared to the promotional threshold amount . if the promotional threshold has been reached , i . e ., the order total is equal to or greater than the promotional threshold , the checkout filler item module 200 processing is concluded and the checkout process continues , i . e ., the consumer may supply to the merchant site shipping , billing and other necessary information to complete the transaction . however , if the promotional threshold has not been reached , the step 228 is performed wherein filler items are identified by the filler item identification module 300 , as will be described in detail hereinbelow . if no filler items are identified , the step 250 is performed wherein an alternative offer is presented to the consumer , for example , reduced cost shipping . in the step 255 it is determined whether the consumer has accepted the order . if the consumer rejected the alternative offer , the checkout filler item module 200 processing is concluded and the checkout process continues . conversely , if the consumer accepted the alternative offer , the alternative offer is applied to the shopping cart in the step 260 , and thereafter checkout filler item module 200 concludes and checkout continues . if , however , filler items are identified , the step 235 is performed wherein the filler items are presented to the consumer for purchase . in the step 240 it is determined whether the consumer has chosen a filler items . if no item was chosen , checkout filler item module 200 processing concludes and checkout continues . if an item was chosen , the item is added to the shopping cart in the step 245 , and checkout filler item module 200 processing concludes and checkout continues . in another envisioned embodiment , only certain items corresponding to a predetermined criteria , i . e ., only items from a particular manufacturer or of a particular type , are considered in an order subtotal calculation . in this manner , a promotion such as “ buy one hundred dollars worth of xerox toner and receive free shipping ” could be achieved . referring now to fig4 , the filler item identification module 300 is described . in the step 305 , a qualification amount needed to qualify the consumer &# 39 ; s order is computed by subtracting the order subtotal ( previously described ) from the promotional threshold amount . in the step 310 , the consumer &# 39 ; s favorite product list may be examined to identify which , if any , of the consumer &# 39 ; s favorite products have a price that equals or exceeds the qualification amount . the list may be examined any suitable means , including without limitation a database query , an indexed lookup , or a sequential search . in the step 315 it is determined whether any filler items were identified in the consumer &# 39 ; s favorite product list and if so , the filler items are processed for presentation to the consumer . in an embodiment , the identified filler items are caused to be conveyed to a calling module ( i . e ., the module which requested identification of filler items ) such as a shopping cart filler item module 100 or checkout filler item module 200 . having successfully identified filler items in the consumer &# 39 ; s favorite product list , the filler item identification module 300 concludes ( step 350 ). if no filler items were identified in the consumer &# 39 ; s favorite product list , the step 320 is performed wherein a consumer &# 39 ; s purchase history may be examined to correlate types of items the consumer has purchased in the past with items in a merchant item database ( i . e . items which are offered for sale by the merchant ). in an embodiment , the consumer &# 39 ; s purchase history may include the items currently in the consumer &# 39 ; s shopping cart . those items in the merchant item database which are similar to items in the customer &# 39 ; s purchase history are identified as potential filler items . as an example only , purchase history items may be correlated to merchant database items on any of merchandise class , department , color , style , size , technology , artist , brand , and / or manufacturer . any potential filler items thus identified are then further examined to determine which , if any , potential filler items having a price that equals or exceeds the qualification amount . those items which have a price equaling or exceeding the qualification amount are identified as filler items . in the step 325 it is determined whether any filler items were identified and if so , the filler items are processed for presentation to the consumer as previously described herein , and the filler item identification module 300 concludes ( step 350 ). if no filler items were identified which correlate to the consumer &# 39 ; s purchasing history , the step 330 is performed wherein a merchant database may be examined to identify which , if any , of the items which are offered for sale by the merchant have a price that equals or exceeds the qualification amount . in an embodiment , the identified merchant database items may be ranked in accordance with a predetermined priority , such as items currently “ on sale ” ( i . e ., currently offered at a reduced price ), overstock items , slow moving inventory , and / or clearance items . higher - ranked items may then be presented to the consumer before lower - ranked items . the ranking order may be determined by the merchant to , for example , help achieve the merchant &# 39 ; s business objectives ( i . e ., reduce inventory on slow moving or overstock items , promotes particular brands , and the like ). in the step 335 it is determined whether any filler items were identified and if so , the filler items are processed for presentation to the consumer as previously described herein , and the filler item identification module 300 concludes ( step 350 ). otherwise , no filler items could be identified by the filler item identification module 300 . in an embodiment , the fact that no filler items were identified is caused to be conveyed to a calling module ( i . e ., the module which requested identification of filler items ) such as a shopping cart filler item module 100 or checkout filler item module 200 . filler item identification module 300 then concludes ( step 350 ). other methods of identifying filler items are contemplated with the scope of the present disclosure , for example , choosing a filler item from a list of at least one predetermined filler item . in fig5 and 6 there is shown exemplary web pages illustrating a shopping cart presentation of filler items to the consumer , and the shopping cart after the consumer has selected a filler item , respectively . in fig4 the consumer has previously added the items 410 to the cart , having a subtotal 420 . filler items 450 a - d are presented to the consumer in accordance with the method disclosed herein . the consumer may select a filler item 450 a - d by causing to be activated a corresponding “ add to cart ” button 455 a - d . alternatively , the consumer may choose to view additional or alternative filler items by causing to be activated a “ suggest more items ” button 440 . alternatively , the consumer may choose to keep shopping the merchant site by causing to be activated a “ keep shopping ” button 430 , or , continue to checkout by causing to be activated a “ continue checkout ” button 435 . in fig6 , the consumer has selected filler item 450 a which has been added to the cart 510 having a subtotal 520 . the consumer may choose to keep shopping the merchant site by causing to be activated a “ keep shopping ” button 530 , or , continue to checkout by causing to be activated a “ continue checkout ” button 535 . it will be appreciated that various of the above - disclosed and other features and functions , or alternatives thereof , may be desirably combined into many other different systems or applications . various presently unforeseen or unanticipated alternatives , modifications , variations or improvements therein may be subsequently made by those skilled in the art which are also intended to be encompassed by the following claims . the claims can encompass embodiments in hardware , software , or a combination thereof .	6
the present disclosure is directed to lens - to - camera mount adapters that permit both tilting and shifting , and more specifically is directed to such adapters suitable for use with short flange distance mirrorless cameras coupled with conventional long - working distance lenses designed for slr type cameras . the lens - to camera mount adapter disclosed herein is referred to as a “ tilt shift adapter ” or just “ adapter ” for short . the combination of a tilt shift adapter and at least one of a lens and a camera is called an “ assembly ” and is identified by reference number 4 . with reference to fig1 , 7 , 10 and 13 , an exemplary adapter 10 is shown as part of an assembly 4 . adapter 10 includes a first body portion 11 with a first side 11 a configured to operably engage a camera 300 and a second body portion 12 with a second side 12 a configured to operably engage a lens 200 . an aperture 16 in body portions 11 and 12 allows the passage of light from lens 200 attached to the second side 12 a to camera 300 attached to the first side 11 a . an example adapter 10 has a rounded top 13 with generally parallel edges 22 when viewed face on . first and second body portions are engaged so that they can move relatively to one another to create a tilt and a shift relative to first side 11 a and second side 12 ( i . e ., between the first and second sides ). as described below , the amount of tilting and the amount of shifting can be precisely controlled by tilt adjustment screws 109 and shift adjustment screws 108 . example first and second sides 11 a and 12 a are respectively configured with standard camera - engaging and lens - engaging devices 124 and 115 respectively , as is used in the art . an exemplary engagement device is a bayonet mount . threads can also be used . the exact size and shape of the aperture 16 depends on the requirements and specifications of the engagement devices 124 and 115 , respectively . the first and second sides 11 a and 12 a include respective first and second flanges 124 and 115 that respectively engage camera and lens flanges of camera 300 and lens 200 being operably coupled to the adapter . the first and second flanges 124 and 115 are also called the camera flange and the lens flange , respectively . the first and second flanges 124 and 115 can be tilted and shifted with respect to one another by tilting and shifting the first and second body portions 11 and 12 , respectively . the tilting and shifting motions are constrained by cylindrical and planar dovetail bearings 117 and 110 . in both cases , play in the dovetail bearings 117 and 110 is eliminated by tilt movement adjustment screws 109 and shift movement adjustment screws 108 , respectively . adjustment screws 108 and 109 are tipped with slide adjustment bearing material 145 to provide a smooth sliding friction . the tilt and shift dovetail bearings 117 and 110 are independent from each other , meaning that the tilting and shifting motions can be carried out either separately or in combination . both the tilt and shift motions are precisely controlled by the aforementioned precision tilting and shifting mechanisms that include in an example corresponding leadscrews 131 and 126 , respectively , tipped with ergonomic knobs 105 and 106 , respectively . the precision tilting and shifting mechanisms can be used to precisely set select amounts of tilt and shift . the adapter 10 includes an extended body portion 14 . the extended body portion 14 includes a side 14 a that accommodates a spring - tensioned lock lever 118 ( fig6 ), whose function is explained below . the extended body portion 14 includes a bottom edge 15 to which is attached a mount 101 , e . g ., a mounting plate , that allows the adapter 10 to be mounted to an adapter body support 400 , i . e ., a support structure , such as a tripod ( see fig1 ). while mount 101 is sometimes referred to below as a “ tripod mount ,” it is not limited to mounting to tripods . mount 101 is shown attached to the bottom edge 15 of the extended body portion 14 using screws 149 , by way of example . in addition to tilt and shift motions , the adapter 10 features a rotation function so that the tilting and shifting can take place in different directions . this is accomplished by a precision rotation bearing 150 that lies between the first body portion 11 and the first flange 124 . as mentioned above , the first flange 124 is configured to couple the adapter 10 to the camera 300 , and so it remains fixed relative to the camera . by rotating the first flange 124 relative to the remainder of the adapter 10 , the adapter is able to rotate relative to the camera 300 . this allows the shifting and tilting motions to take place along either the landscape or portrait direction of the camera 300 , or along at least one and preferably several intermediate angular positions . in an example , the rotation is controlled by the aforementioned spring - tensioned lock lever 118 shown in fig6 . rotation is locked by engaging the hooked end 119 of lock lever 118 with any of several corresponding holes 151 located along the outer edge of the first flange 124 . in an example , the spacing of holes 151 permits angular rotation from zero to 90 degrees in angular increments , such as 30 - degree increments . in an embodiment , the adapter 10 has a maximum shift of +/− 8 mm , a maximum tilt of +/− 8 degrees , and a maximum rotation of 90 degrees to permit both portrait and landscape camera orientations . the adapter 10 includes bayonet rings 115 and 124 for attaching a lens 200 and a camera body 300 , respectively . the tripod mount 101 is interchangeable to permit use with an arbitrary variety of tripod heads . fig2 a through 2c shows three elevation views ( front , side and rear , respectively ) of assembly 4 with camera and lens attached to tilt shift adapter 10 in the portrait orientation . fig3 shows a tilt drive knob 105 and a shift drive knob 106 that control the tilt and shift motions respectively . the aperture setting indicator 107 and shift scale 104 provide a visual indicator for the aperture value and degree of shift , respectively . the lens unlock button 107 is pressed to release the lens 200 to allow its removal . the camera - mounted lens unlock button 301 is normally used to release lenses attached to the camera 300 , but in the present case it is used to release adapter 10 . in fig4 , adjustment screws 108 are used to eliminate play in the shifting mechanism . the aperture set knob 112 is moved in a short arc to manually adjust the aperture of suitable lenses 200 . this is particularly useful for nikkor g type lenses ( manufactured by nikon corporation ), which have a mechanical iris control tab but lack an aperture control ring . in fig5 , the adapter 10 is shown in a maximum tilt configuration . the adjustment screws 109 are used to eliminate play in the tilting mechanism . the center of rotation of the tilt motion approximately coincides with the image plane . this ensures that there is little or no focus shift in the center of the image when the lens is tilted . fig6 illustrates features related to adapter rotation . this rotation is used to rotate the adapter 10 relative to the camera flange 124 of camera 300 so that the camera orientation can be switched from landscape to portrait orientation or vice versa . the spring - tensioned lock lever 118 allows controlled adapter rotation by engaging the camera flange 124 at holes 151 spaced at fixed angular increments my means of a hook 119 . fig6 also illustrates the screws 149 that are used to attach mount 101 to extended body portion 14 . fig7 illustrates additional features related to adapter rotation . in fig7 , the camera &# 39 ; s lens locking pin 302 , which is analgous to the lens locking pin 116 on the adapter , engages with the hole 125 in the camera flange 124 to allow precise adapter rotation while keeping the bayonet ring rigidly fixed to the camera . the oblong slot 122 in the spring - tensioned lock lever 118 allows the lever to rotate about the bearing 121 while the bearing screw 123 prevents the lever from lifting up out of its plane of rotation . the spring - tensioned lock lever 118 is actuated by grasping the lock lever knob 120 and moving it to - and - fro . fig8 is a cross - sectional view of the adapter that illustrates several mechanisms and features of an embodiment of the present invention including the aperture drive ring 111 , the aperture drive knob 112 , the shift drive knob 106 , the shift movment lead screw 126 , the shift movement drive nut 127 , and dovetail tilt 117 and shift 110 guides . fig9 is an elevation view of side 12 a shown when the lens flange 115 is shifted to its maximum vertical position . several mechanisms and features are illustrated , including an aperture indicator 113 , a lens locking pin 116 , a lens locking pin retractor button 107 , the shift drive knob 106 , the tilt drive knob 105 , a portion of the dovetail shift gude 110 , the aperture drive ring 111 , the aperture drive knob 112 , and the lens engagement hook of the aperture drive , 114 . fig1 is a side view showing the shift indicator line 128 , the shift index scale 104 , the first body portion 11 , the first side 11 a , the second body portion 12 , the second side 12 a , the first flange 124 , the second flange 115 , the lens locking pin 116 , the tilt drive knob 105 , the shift drive knob 106 , the extended body portion 14 , the side 14 a that accommodates a spring - tensioned lock lever 118 with lock lever knob 120 , and the bottom edge 15 of the extended body portion to which mount 101 is attached . fig1 is a cross - sectional view of the adapter 10 that illustrates several mechanisms , including the tilt drive lead screw 131 , the self - aligning tilt drive lead screw bearing 132 , the self - aligning tilt drive nut 133 , the rotation bearing for the self aligning tilt drive nut 134 , the lens lock pin sleeve 135 , the bottom of the spring - loaded lens locking pin 136 , the lens locking pin 116 , the lens locking pin lever 130 , the shift drive lead screw 126 , the shift drive nut , 127 , the cylindrical dovetail tilt guide 117 , the linear dovetail shift guide 110 , the first side flange ( i . e ., camera flange ) 124 , and the second side flange ( i . e . lens flange ) 115 . fig1 is a detail view of the second side showing details related to the neutral setting of the tilt mechanism . this mechanism is important because it provides a precise and repeatable means for making the second flange 115 parallel to the first flange 124 . this setting will be used very often in photography when no tilt adjustment is desired . the tilt scale 137 reads an angle ( e . g ., one degree ) for each tic mark . the vernier index line 138 for the tilt scale permits tilt readings to within a finer angle , such as 0 . 5 degrees . a tilt lead screw bearing cover 140 also serves as a zero position stop for a zero tilt lever 139 . an eccentric sleeve bearing 149 is shown for the zero tilt lever 139 . a countersunk sleeve bearing lock 142 is also shown . a zero tilt lever engagement stop 143 is used to position the zero tilt lever 139 in the proper position in order to engage the zero tilt lever stop 140 . fig1 is a view of the second side of the adapter 10 when set in a neutral position for both tilt and shift ( i . e ., zero tilt and zero shift ). fig1 shows the rounded top 13 , parallel edges 22 , extended body portion 14 , bottom edge 15 of the extended body portion , along with mount 101 . fig1 illustrates the aperture open indicator 103 and closed indicator 102 . the small central dot symbol 102 indicates the minimum aperture position , and the large central dot symbol 103 indicates the maximum aperture position . indicator lines 153 show intermediate aperture values . fig1 illustrates a variety of additional mechanisms and features , including the lens locking pin 116 , one of several lens bayonet springs 144 that provide a snug fit of the lens onto the second side flange 115 , the slide adjustment bearing material 145 which provides a smooth sliding friction , one of the tilt movement adjustment screws 109 , the compression spring 146 for adapter rotation , one of several set screws 147 to lock the inner ring of the adapter to the camera flange 124 , the portion of the adapter body 148 that rotates relative to the camera flange when the adapter is rotated from landscape to portrait orientation ( or vice versa ), and the rotation bearing surface 150 . fig1 illustrates an adapter 10 according to the present invention attached to an adapter body support 400 . in this figure the body support 400 is shown as a tripod , but in practice other types of supports may be used , such as a rigid pier , a clamp mounted to a pole , a beanbag support , or any other camera supporting means known in the art . fig1 is a schematic drawing of a camera 300 , including the camera body 305 , lens flange 303 , lens mounting pin 302 , and image plane 304 . thus , embodiments include a lens - to - camera mount adapter , referred to herein as a tilt shift adapter ( or just “ adapter ”), with both tilting and shifting functions . in addition , the adapter has tilt and shift functions that are precisely controlled , e . g ., by means of lead screws or the like . in addition , example adapters include means for direct attachment to a tripod or similar support . example adapters also have means for manually controlling the aperture for certain attached lenses which lack a manual aperture control means , such as an aperture ring . the example embodiments described above is suitable to adapt nikon f - mount lenses onto panasonic or olympus micro four thirds camera bodies . since the flange distance df ( i . e ., the distance from the lens mounting flange 303 on the camera body 305 to the camera image plane 304 ; see fig1 ) of micro four thirds cameras is 19 . 25 mm and the flange distance for nikon f - mount lenses is 46 . 5 mm , the distance between the flange surfaces 115 and 124 of an embodiment is 27 . 25 mm . in addition , the example embodiment can provide manual aperture adjustment for nikon “ g ” type lenses having an f - mount . many other embodiments fall within the scope of this disclosure . for example , in order to be compatible with sony nex series cameras having a flange distance ( see fig1 ) of 18 mm , the distance between the flange surfaces 115 and 124 would have to be increased by 1 . 25 mm relative to an adapter designed for micro four thirds cameras . the adapter 10 may also be made compatible with lenses mounts other than the nikon f - mount standard . such lens mounts include but are not limited to canon eos , sony alpha , pentax k , olympus om , minolta maxxum , m42 , yashica / contax , and leica r . exemplary embodiments incorporating various different tripod adapters to fit different tripod heads are also fall within the scope of this disclosure . such tripod heads include but are not limited to those manufactured by arca - swiss , manfrotto , and gitzo . it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit and scope of the invention . thus it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .	6
typically , a compound of the invention is administered in an amount effective to treat a condition as described herein . the compounds of the invention are administered by any suitable route in the form of a pharmaceutical composition adapted to such a route , and in a dose effective for the treatment intended . therapeutically effective doses of the compounds required to treat the progress of the medical condition are readily ascertained by one of ordinary skill in the art using preclinical and clinical approaches familiar to the medicinal arts . the term “ treating ”, as used herein , unless otherwise indicated , means reversing , alleviating , inhibiting the progress of , or preventing the disorder or condition to which such term applies , or one or more symptoms of such disorder or condition . the term “ treatment ”, as used herein , unless otherwise indicated , refers to the act of treating as “ treating ” is defined immediately above . the term “ treating ” also includes adjuvant and neo - adjuvant treatment of a subject . the compounds of the invention may be administered orally . oral administration may involve swallowing , so that the compound enters the gastrointestinal tract , or buccal or sublingual administration may be employed , by which the compound enters the blood stream directly from the mouth . in another embodiment , the compounds of the invention may also be administered directly into the blood stream , into muscle , or into an internal organ . suitable means for parenteral administration include intravenous , intraarterial , intraperitoneal , intrathecal , intraventricular , intraurethral , intrasternal , intracranial , intramuscular and subcutaneous . suitable devices for parenteral administration include needle ( including microneedle ) injectors , needle - free injectors and infusion techniques . in another embodiment , the compounds of the invention may also be administered topically to the skin or mucosa , that is , dermally or transdermally . in another embodiment , the compounds of the invention can also be administered intranasally or by inhalation . in another embodiment , the compounds of the invention may be administered rectally or vaginally . in another embodiment , the compounds of the invention may also be administered directly to the eye or ear . the dosage regimen for the compounds and / or compositions containing the compounds is based on a variety of factors , including the type , age , weight , sex and medical condition of the patient ; the severity of the condition ; the route of administration ; and the activity of the particular compound employed . thus the dosage regimen may vary widely . dosage levels of the order from about 0 . 01 mg to about 100 mg per kilogram of body weight per day are useful in the treatment of the above - indicated conditions . in one embodiment , the total daily dose of a compound of the invention ( administered in single or divided doses ) is typically from about 0 . 01 to about 100 mg / kg . in another embodiment , the total daily dose of the compound of the invention is from about 0 . 1 to about 50 mg / kg , and in another embodiment , from about 0 . 5 to about 30 mg / kg ( i . e ., mg compound of the invention per kg body weight ). in one embodiment , dosing is from 0 . 01 to 10 mg / kg / day . in another embodiment , dosing is from 0 . 1 to 1 . 0 mg / kg / day . dosage unit compositions may contain such amounts or submultiples thereof to make up the daily dose . in many instances , the administration of the compound will be repeated a plurality of times in a day ( typically no greater than 4 times ). multiple doses per day typically may be used to increase the total daily dose , if desired . for oral administration , the compositions may be provided in the form of tablets containing from about 0 . 01 mg to about 500 mg of the active ingredient , or in another embodiment , from about 1 mg to about 100 mg of active ingredient . intravenously , doses may range from about 0 . 1 to about 10 mg / kg / minute during a constant rate infusion . suitable subjects according to the present invention include mammalian subjects . mammals according to the present invention include , but are not limited to , canine , feline , bovine , caprine , equine , ovine , porcine , rodents , lagomorphs , primates , and the like , and encompass mammals in utero . in one embodiment , humans are suitable subjects . human subjects may be of either gender and at any stage of development . in another embodiment , the invention comprises the use of one or more compounds of the invention for the preparation of a medicament for the treatment of the conditions recited herein . for the treatment of the conditions referred to above , the compound of the invention can be administered as compound per se . alternatively , pharmaceutically acceptable salts are suitable for medical applications because of their greater aqueous solubility relative to the parent compound . in another embodiment , the present invention comprises pharmaceutical compositions . such pharmaceutical compositions comprise a compound of the invention presented with a pharmaceutically acceptable carrier . the carrier can be a solid , a liquid , or both , and may be formulated with the compound as a unit - dose composition , for example , a tablet , which can contain from 0 . 05 % to 95 % by weight of the active compounds . a compound of the invention may be coupled with suitable polymers as targetable drug carriers . other pharmacologically active substances can also be present . the compounds of the present invention may be administered by any suitable route , preferably in the form of a pharmaceutical composition adapted to such a route , and in a dose effective for the treatment intended . the active compounds and compositions , for example , may be administered orally , rectally , parenterally , or topically . oral administration of a solid dose form may be , for example , presented in discrete units , such as hard or soft capsules , pills , cachets , lozenges , or tablets , each containing a predetermined amount of at least one compound of the present invention . in another embodiment , the oral administration may be in a powder or granule form . in another embodiment , the oral dose form is sub - lingual , such as , for example , a lozenge . in such solid dosage forms , the compounds of formula i are ordinarily combined with one or more adjuvants . such capsules or tablets may contain a controlled - release formulation . in the case of capsules , tablets , and pills , the dosage forms also may comprise buffering agents or may be prepared with enteric coatings . in another embodiment , oral administration may be in a liquid dose form . liquid dosage forms for oral administration include , for example , pharmaceutically acceptable emulsions , solutions , suspensions , syrups , and elixirs containing inert diluents commonly used in the art ( e . g ., water ). such compositions also may comprise adjuvants , such as wetting , emulsifying , suspending , flavoring ( e . g ., sweetening ), and / or perfuming agents . in another embodiment , the present invention comprises a parenteral dose form . “ parenteral administration ” includes , for example , subcutaneous injections , intravenous injections , intraperitoneal injections , intramuscular injections , intrasternal injections , and infusion . injectable preparations ( e . g ., sterile injectable aqueous or oleaginous suspensions ) may be formulated according to the known art using suitable dispersing , wetting agents , and / or suspending agents . in another embodiment , the present invention comprises a topical dose form . “ topical administration ” includes , for example , transdermal administration , such as via transdermal patches or iontophoresis devices , intraocular administration , or intranasal or inhalation administration . compositions for topical administration also include , for example , topical gels , sprays , ointments , and creams . a topical formulation may include a compound which enhances absorption or penetration of the active ingredient through the skin or other affected areas . when the compounds of this invention are administered by a transdermal device , administration will be accomplished using a patch either of the reservoir and porous membrane type or of a solid matrix variety . typical formulations for this purpose include gels , hydrogels , lotions , solutions , creams , ointments , dusting powders , dressings , foams , films , skin patches , wafers , implants , sponges , fibers , bandages and microemulsions . liposomes may also be used . typical carriers include alcohol , water , mineral oil , liquid petrolatum , white petrolatum , glycerin , polyethylene glycol and propylene glycol . penetration enhancers may be incorporated ; see , for example , j . pharm . sci ., 88 ( 10 ), 955 - 958 , by finnin and morgan ( october 1999 ). formulations suitable for topical administration to the eye include , for example , eye drops wherein the compound of this invention is dissolved or suspended in a suitable carrier . a typical formulation suitable for ocular or aural administration may be in the form of drops of a micronized suspension or solution in isotonic , ph - adjusted , sterile saline . other formulations suitable for ocular and aural administration include ointments , biodegradable ( e . g ., absorbable gel sponges , collagen ) and non - biodegradable ( e . g ., silicone ) implants , wafers , lenses and particulate or vesicular systems , such as niosomes or liposomes . a polymer such as cross - linked polyacrylic acid , polyvinyl alcohol , hyaluronic acid , a cellulosic polymer , for example , ( hydroxypropyl ) methyl cellulose , hydroxyethyl cellulose , or methyl cellulose , or a heteropolysaccharide polymer , for example , gelan gum , may be incorporated together with a preservative , such as benzalkonium chloride . such formulations may also be delivered by iontophoresis . for intranasal administration or administration by inhalation , the active compounds of the invention are conveniently delivered in the form of a solution or suspension from a pump spray container that is squeezed or pumped by the patient or as an aerosol spray presentation from a pressurized container or a nebulizer , with the use of a suitable propellant . formulations suitable for intranasal administration are typically administered in the form of a dry powder ( either alone , as a mixture , for example , in a dry blend with lactose , or as a mixed component particle , for example , mixed with phospholipids , such as phosphatidylcholine ) from a dry powder inhaler or as an aerosol spray from a pressurized container , pump , spray , atomizer ( preferably an atomizer using electrohydrodynamics to produce a fine mist ), or nebulizer , with or without the use of a suitable propellant , such as 1 , 1 , 1 , 2 - tetrafluoroethane or 1 , 1 , 1 , 2 , 3 , 3 , 3 - heptafluoropropane . for intranasal use , the powder may comprise a bioadhesive agent , for example , chitosan or cyclodextrin . in another embodiment , the present invention comprises a rectal dose form . such rectal dose form may be in the form of , for example , a suppository . cocoa butter is a traditional suppository base , but various alternatives may be used as appropriate . other carrier materials and modes of administration known in the pharmaceutical art may also be used . pharmaceutical compositions of the invention may be prepared by any of the well - known techniques of pharmacy , such as effective formulation and administration procedures . the above considerations in regard to effective formulations and administration procedures are well known in the art and are described in standard textbooks . formulation of drugs is discussed in , for example , hoover , john e ., remington &# 39 ; s pharmaceutical sciences , mack publishing co ., easton , pa ., 1975 ; liberman et al ., eds ., pharmaceutical dosage forms , marcel decker , new york , n . y ., 1980 ; and kibbe et al ., eds ., handbook of pharmaceutical excipients ( 3 rd ed . ), american pharmaceutical association , washington , 1999 . the compounds of the present invention can be used , alone or in combination with other therapeutic agents , in the treatment of various conditions or disease states . the compound ( s ) of the present invention and other therapeutic agent ( s ) may be may be administered simultaneously ( either in the same dosage form or in separate dosage forms ) or sequentially . two or more compounds may be administered simultaneously , concurrently or sequentially . additionally , simultaneous administration may be carried out by mixing the compounds prior to administration or by administering the compounds at the same point in time but at different anatomic sites or using different routes of administration . the phrases “ concurrent administration ,” “ co - administration ,” “ simultaneous administration ,” and “ administered simultaneously ” mean that the compounds are administered in combination . the present invention includes the use of a combination of a lrrk2 inhibitor compound as provided in formula ( i ) and one or more additional pharmaceutically active agent ( s ). if a combination of active agents is administered , then they may be administered sequentially or simultaneously , in separate dosage forms or combined in a single dosage form . accordingly , the present invention also includes pharmaceutical compositions comprising an amount of : ( a ) a first agent comprising a compound of formula ( i ) or a pharmaceutically acceptable salt of the compound ; ( b ) a second pharmaceutically active agent ; and ( c ) a pharmaceutically acceptable carrier , vehicle or diluent . various pharmaceutically active agents may be selected for use in conjunction with the compounds of formula ( i ), depending on the disease , disorder , or condition to be treated . for example , a pharmaceutical composition for use in treating parkinson &# 39 ; s disease may comprise a compound of formula ( i ) or a pharmaceutically acceptable salt thereof together with another agent such as a dopamine ( levodopa , either alone or with a dopa decarboxylase inhibitor ), a monoamine oxidase ( mao ) inhibitor , a catechol o - methyltransferase ( comt ) inhibitor or an anticholinergic agent , or any combination thereof . particularly preferred agents to combine with the compounds of formula ( i ) for use in treating parkinson &# 39 ; s disease include levodopa , carbidopa , tolcapone , entacapone , selegiline , benztropine and trihexyphenidyl , or any combination thereof . pharmaceutically active agents that may be used in combination with the compounds of formula ( i ) and compositions thereof include , without limitation : ( i ) levodopa ( or its methyl or ethyl ester ), alone or in combination with a dopa decarboxylase inhibitor ( e . g ., carbidopa ( sinemet , carbilev , parcopa ), benserazide ( madopar ), α - methyldopa , monofluoromethyldopa , difluoromethyldopa , brocresine , or m - hydroxybenzylhydrazine ); ( ii ) anticholinergics , such as amitriptyline ( elavil , endep ), butriptyline , benztropine mesylate ( cogentin ), trihexyphenidyl ( artane ), diphenhydramine ( benadryl ), orphenadrine ( norflex ), hyoscyamine , atropine ( atropen ), scopolamine ( transderm - scop ), scopolamine methylbromide ( parmine ), dicycloverine ( bentyl , byclomine , dibent , dilomine ), tolterodine ( detrol ), oxybutynin ( ditropan , lyrinel xl , oxytrol ), penthienate bromide , propantheline ( pro - banthine ), cyclizine , imipramine hydrochloride ( tofranil ), imipramine maleate ( surmontil ), lofepramine , desipramine ( norpramin ), doxepin ( sinequan , zonalon ), trimipramine ( surmontil ), and glycopyrrolate ( robinul ); ( iii ) catechol o - methyltransferase ( comt ) inhibitors , such as nitecapone , tolcapone ( tasmar ), entacapone ( comtan ), and tropolone ; ( iv ) monoamine oxidase ( mao ) inhibitors , such as selegiline ( emsam ), selegiline hydrochloride ( 1 - deprenyl , eldepryl , zelapar ), dimethylselegiline , brofaromine , phenelzine ( nardil ), tranylcypromine ( parnate ), moclobemide ( aurorix , manerix ), befloxatone , safinamide , isocarboxazid ( marplan ), nialamide ( niamid ), rasagiline ( azilect ), iproniazide ( marsilid , iprozid , ipronid ), iproclozide , toloxatone ( humoryl , perenum ), bifemelane , desoxypeganine , harmine ( also known as telepathine or banasterine ), harmaline , linezolid ( zyvox , zyvoxid ), and pargyline ( eudatin , supirdyl ); ( v ) acetylcholinesterase inhibitors , such as donepezil hydrochloride ( aricept ®, memac ), physostigmine salicylate ( antilirium ®), physostigmine sulfate ( eserine ), ganstigmine , rivastigmine ( exelon ®), ladostigil , np - 0361 , galantamine hydrobromide ( razadyne ®, reminyl ®, nivalin ®), tacrine ( cognex ®), tolserine , memoquin , huperzine a ( hup - a ; neuro - hitech ), phenserine , bisnorcymserine ( also known as bnc ), and inm - 176 ; ( vi ) amyloid - β ( or fragments thereof ), such as aβ 1 - 15 conjugated to pan hla dr - binding epitope ( padre ®), acc - 001 ( elan / wyeth ), and affitope ; ( vii ) antibodies to amyloid - β ( or fragments thereof ), such as ponezumab , solanezumab , bapineuzumab ( also known as aab - 001 ), aab - 002 ( wyeth / elan ), gantenerumab , intravenous ig ( gammagard ®), ly2062430 ( humanized m266 ; lilly ), and those disclosed in international patent publication nos wo04 / 032868 , wo05 / 025616 , wo006 / 036291 , wo006 / 069081 , wo06 / 118959 , in us patent publication nos us2003 / 0073655 , us2004 / 0192898 , us2005 / 0048049 , us2005 / 0019328 , in european patent publication nos ep0994728 and 1257584 , and in u . s . pat . no . 5 , 750 , 349 ; ( viii ) amyloid - lowering or - inhibiting agents ( including those that reduce amyloid production , accumulation and fibrillization ) such as eprodisate , celecoxib , lovastatin , anapsos , colostrinin , pioglitazone , clioquinol ( also known as pbt1 ), pbt2 ( prana biotechnology ), flurbiprofen ( ansaid ®, froben ®) and its r - enantiomer tarenflurbil ( flurizan ®), nitroflurbiprofen , fenoprofen ( fenopron , nalfon ®), ibuprofen ( advil ®, motrin ®, nurofen ®), ibuprofen lysinate , meclofenamic acid , meclofenamate sodium ( meclomen ®), indomethacin ( indocin ®), diclofenac sodium ( voltaren ®), diclofenac potassium , sulindac ( clinoril ®), sulindac sulfide , diflunisal ( dolobid ®), naproxen ( naprosyn ®), naproxen sodium ( anaprox ®, aleve ®), insulin - degrading enzyme ( also known as insulysin ), the gingko biloba extract egb - 761 ( rokan ®, tebonin ®), tramiprosate ( cerebril ®, alzhemed ®), kiacta ®), neprilysin ( also known as neutral endopeptidase ( nep )), scyllo - inositol ( also known as scyllitol ), atorvastatin ( lipitor ®), simvastatin ( zocor ®), ibutamoren mesylate , bace inhibitors such as ly450139 ( lilly ), bms - 782450 , gsk - 188909 ; gamma secretase modulators and inhibitors such as elnd - 007 , bms - 708163 ( avagacestat ), and dsp8658 ( dainippon ); and rage ( receptor for advanced glycation end - products ) inhibitors , such as ttp488 ( transtech ) and ttp4000 ( transtech ), and those disclosed in u . s . pat . no . 7 , 285 , 293 , including pti - 777 ; ( ix ) alpha - adrenergic receptor agonists , and beta - adrenergic receptor blocking agents ( beta blockers ); anticholinergics ; anticonvulsants ; antipsychotics ; calcium channel blockers ; catechol o - methyltransferase ( comt ) inhibitors ; central nervous system stimulants ; corticosteroids ; dopamine receptor agonists and antagonists ; dopamine reuptake inhibitors ; gamma - aminobutyric acid ( gaba ) receptor agonists ; immunosuppressants ; interferons ; muscarinic receptor agonists ; neuroprotective drugs ; nicotinic receptor agonists ; norepinephrine ( noradrenaline ) reuptake inhibitors ; quinolines ; and trophic factors ; ( x ) histamine 3 ( h3 ) antagonists , such as pf - 3654746 and those disclosed in us patent publication nos us2005 - 0043354 , us2005 - 0267095 , us2005 - 0256135 , us2008 - 0096955 , us2007 - 1079175 , and us2008 - 0176925 ; international patent publication nos wo2006 / 136924 , wo2007 / 063385 , wo2007 / 069053 , wo2007 / 088450 , wo2007 / 099423 , wo2007 / 105053 , wo2007 / 138431 , and wo2007 / 088462 ; and u . s . pat . no . 7 , 115 , 600 ); ( xi ) n - methyl - d - aspartate ( nmda ) receptor antagonists , such as memantine ( namenda , axura , eb ixa ), amantadine ( symmetrel ), acamprosate ( campral ), besonprodil , ketamine ( ketalar ), delucemine , dexanabinol , dexefaroxan , dextromethorphan , dextrorphan , traxoprodil , cp - 283097 , himantane , idantadol , ipenoxazone , l - 701252 ( merck ), lancicemine , levorphanol ( dromoran ), methadone , ( dolophine ), neramexane , perzinfotel , phencyclidine , tianeptine ( stablon ), dizocilpine ( also known as mk - 801 ), ibogaine , voacangine , tiletamine , riluzole ( rilutek ), aptiganel ( cerestat ), gavestinel , and remacimide ; ( xii ) phosphodiesterase ( pde ) inhibitors , including ( a ) pde1 inhibitors ; ( b ) pde2 inhibitors ; ( c ) pde3 inhibitors ; ( d ) pde4 inhibitors ; ( e ) pde5 inhibitors ; ( f ) pde9 inhibitors ( e . g ., pf - 04447943 , bay 73 - 6691 ( bayer ag ) and those disclosed in us patent publication nos us2003 / 0195205 , us2004 / 0220186 , us2006 / 0111372 , us2006 / 0106035 , and u . s . ser . no . 12 / 118 , 062 ( filed may 9 , 2008 )); and ( g ) pde10 inhibitors such as 2 -({ 4 -[ 1 - methyl - 4 -( pyridin - 4 - yl )- 1h - pyrazol - 3 - yl ] phenoxy } methyl ) quinoline ( pf - 2545920 ); ( xiii ) serotonin ( 5 - hydroxytryptamine ) 1a ( 5 - ht 1a ) receptor antagonists , such as spiperone , levo - pindolol , lecozotan ; ( xiv ) serotonin ( 5 - hydroxytryptamine ) 2c ( 5 - ht 2c ) receptor agonists , such as vabicaserin , and zicronapine ; serotonin ( 5 - hydroxytryptamine ) 4 ( 5 - ht 4 ) receptor agonists / antagonists , such as prx - 03140 ( epix ) and pf - 04995274 ; ( xv ) serotonin ( 5 - hydroxytryptamine ) 3c ( 5 - ht 3c ) receptor antagonists , such as ondansetron ( zofran ); ( xvi ) serotonin ( 5 - hydroxytryptamine ) 6 ( 5 - ht 6 ) receptor antagonists , such as mianserin ( tolvon , bolvidon , norval ), methiothepin ( also known as metitepine ), ritanserin , sb - 271046 , sb - 742457 ( glaxosmithkline ), lu ae58054 ( lundbeck a / s ), sam - 760 , and prx - 07034 ( epix ); ( xvii ) serotonin ( 5 - ht ) reuptake inhibitors such as alaproclate , citalopram ( celexa , cipramil ), escitalopram ( lexapro , cipralex ), clomipramine ( anafranil ), duloxetine ( cymbalta ), femoxetine ( malexil ), fenfluramine ( pondimin ), norfenfluramine , fluoxetine ( prozac ), fluvoxamine ( luvox ), indalpine , milnacipran ( ixel ), paroxetine ( paxil , seroxat ), sertraline ( zoloft , lustral ), trazodone ( desyrel , molipaxin ), venlafaxine ( effexor ), zimelidine ( normud , zelmid ), bicifadine , desvenlafaxine ( pristiq ), brasofensine , vilazodone , cariprazine and tesofensine ; ( xviii ) glycine transporter - 1 inhibitors such as paliflutine , org - 25935 , and org - 26041 ; and mglur modulators such as afq - 059 and amantidine ; ( xix ) ampa - type glutamate receptor modulators such as perampanel , mibampator , selurampanel , gsk - 729327 , and n -{( 3s , 4s )- 4 -[ 4 -( 5 - cyanothiophen - 2 - yl ) phenoxy ] tetrahydrofuran - 3 - yl } propane - 2 - sulfonamide ; ( xx ) p450 inhibitors , such as ritonavir ; ( xxi ) tau therapy targets , such as davunetide ; the present invention further comprises kits that are suitable for use in performing the methods of treatment described above . in one embodiment , the kit contains a first dosage form comprising one or more of the compounds of the present invention and a container for the dosage , in quantities sufficient to carry out the methods of the present invention . in another embodiment , the kit of the present invention comprises one or more compounds of the invention . the compounds of formula ( i ) may be prepared by the methods described below , together with synthetic methods known in the art of organic chemistry , or modifications and transformations that are familiar to those of ordinary skill in the art . the starting materials used herein are commercially available or may be prepared by routine methods known in the art [ such as those methods disclosed in standard reference books such as the compendium of organic synthetic methods , vol . i - xii ( published by wiley - interscience )]. preferred methods include , but are not limited to , those described below . during any of the following synthetic sequences it may be necessary and / or desirable to protect sensitive or reactive groups on any of the molecules concerned . this can be achieved by means of conventional protecting groups , such as those described in t . w . greene , protective groups in organic chemistry , john wiley & amp ; sons , 1981 ; t . w . greene and p . g . m . wuts , protective groups in organic chemistry , john wiley & amp ; sons , 1991 ; and t . w . greene and p . g . m . wuts , protective groups in organic chemistry , john wiley & amp ; sons , 1999 , which are hereby incorporated by reference . compounds of formula ( i ), or their pharmaceutically acceptable salts , can be prepared according to the reaction schemes discussed herein below . unless otherwise indicated , the substituents in the schemes are defined as above . isolation and purification of the products is accomplished by standard procedures , which are known to a chemist of ordinary skill . one skilled in the art will recognize that in many cases , the compounds in reaction schemes 1 through 4 may be generated as a mixture of diastereomers and / or enantiomers ; these may be separated at various stages of the synthetic schemes using conventional techniques or a combination of such techniques , such as , but not limited to , crystallization , normal - phase chromatography , reversed phase chromatography and chiral chromatography , to afford the single enantiomers of the invention . it will be understood by one skilled in the art that the various symbols , superscripts and subscripts used in the schemes , methods and examples are used for convenience of representation and / or to reflect the order in which they are introduced in the schemes , and are not intended to necessarily correspond to the symbols , superscripts or subscripts in the appended claims . the schemes are representative of methods useful in synthesizing the compounds of the present invention . they are not to constrain the scope of the invention in any way . the reactions for preparing compounds of the invention can be carried out in suitable solvents , which can be readily selected by one of skill in the art of organic synthesis . suitable solvents can be substantially non - reactive with the starting materials ( reactants ), the intermediates , or products at the temperatures at which the reactions are carried out , e . g ., temperatures which can range from the solvent &# 39 ; s freezing temperature to the solvent &# 39 ; s boiling temperature . a given reaction can be carried out in one solvent or a mixture of more than one solvent . depending on the particular reaction step , suitable solvents for a particular reaction step can be selected by the skilled artisan . reactions can be monitored according to any suitable method known in the art . for example , product formation can be monitored by spectroscopic means , such as nuclear magnetic resonance spectroscopy ( e . g ., 1 h or 13 c ), infrared spectroscopy , spectrophotometry ( e . g ., uv - visible ), mass spectrometry , or by chromatographic methods such as high performance liquid chromatography ( hplc ) or thin layer chromatography ( tlc ). compounds of formula ( i ) and intermediates thereof may be prepared according to the following reaction schemes and accompanying discussion . unless otherwise indicated , r 1 , r 1a , r 1b , r 2 , r 3 , r 4 , r 5 , r 6 , x and z in the reaction schemes and discussions that follow are as defined as the same as hereinabove . in general the compounds of this invention may be made by processes which include processes analogous to those known in the chemical arts , particularly in light of the description contained herein . certain processes for the manufacture of the compounds of this invention and intermediates thereof are provided as further features of the invention and are illustrated by the following reaction schemes . other processes may be described in the experimental section . the schemes and examples provided herein ( including the corresponding description ) are for illustration only , and not intended to limit the scope of the present invention . reaction scheme 1 depicts the preparation of compounds of formula ( i ). referring to scheme 1 , compounds 1 . 1 and 1 . 2 are either commercially available or can be made by methods described herein or other methods well known to those skilled in the art . in the compound of formula 1 . 1 the group designated lg represents an appropriate leaving group such as a halide ( eg chloro or bromo ) or triflate which is suitable to undergoe nucleophilic displacement when reacted with the amine of formula 1 . 2 . in the amine compound of formula 1 . 2 the group designated pg represents an appropriate amine protecting group such as an acid labile protecting group selected from 2 , 4 - dimethoxybenzyl ( dmb ), 4 - methoxybenzyl ( pmb ) and t - butoxycarbonyl ( boc ). the compounds of formulae 1 . 1 and 1 . 2 can be reacted , for example , in the presence of an appropriate base such as n , n - diisopropylethylamine ( hunig &# 39 ; s base ) or triethylamine in a suitable solvent such as acetonitrile or n , n - dimethylformamide ( dmf ) to afford the compound of formula 1 . 3 . the reaction is typically carried out at an elevated temperature , such as 50 to 100 ° c . for a period of 1 to 48 hours . removal of the protecting group , such as an acid labile protecting group ( pg ) from the compound of formula 1 . 3 can typically be accomplished by treatment of 1 . 3 with an appropriate acid such as acetic acid , trifluoroacetic acid or hydrochloric acid to provide the compound of formula 1 . 4 . also , it is to be understood that in certain instances the compound of formula 1 . 1 can be reacted with an unprotected amine of formula r 2 — nh 2 to arrive directly to a compound of formula 1 . 4 . reduction of the nitro group in the compound of formula 1 . 4 using conditions congruent with the functionality present affords the compound of formula 1 . 5 . for example , the nitro group in the compound of formula 1 . 4 can be reduced to the corresponding amine of formula 1 . 5 by treatment of 1 . 4 with zinc dust and ammonium hydroxide in methanol or alternatively by hydrogenation of 1 . 4 using an appropriate catalyst such as platinum ( iv ) oxide in an appropriate solvent such as methanol , acetonitrile or a mixture thereof . coupling the diamine compound 1 . 5 with the carboxylic acid of formula 1 . 6 then provides the desired compound of formula ( i ), also denoted as 1 . 7 . the coupling reaction with the diamine of formula 1 . 5 and the carboxylic acid of formula 1 . 6 can be carried out in an appropriate solvent such as n , n - dimethylformamide in the presence of an appropriate base such as diisopropylethylamine and a coupling reagent such as 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphirane 2 , 4 , 6 - trioxide . reaction scheme 2 depicts to the preparation of compounds of formula 1 . 7 ′ which is a compound of formula ( i ) in which r 2 is the chiral 2 - methyltetrahydropyran - 4 - yl moiety as shown . using a published procedure , prins reaction of the compound 2 . 1 with the compound 2 . 2 generated the pyran 2 . 3 . chiral resolution to produce the separated enantiomers , using an enzyme - based method , afforded the compound of formula 2 . 5 after hydrolysis of the resolved ester 2 . 4 . oxidation of 2 . 5 gave ketone 2 . 6 which was reacted with the compound of formula 2 . 7 using reductive amination chemistry to provide the protected amine of formula 2 . 8 . the protected amine of formula 2 . 8 can be reacted with the compound of formula 1 . 1 in a manner analogous to that previously described in scheme 1 to provide the compound of formula 1 . 3 ′. the compounds of formulae 1 . 4 ′, 1 . 5 ′ and 1 . 7 ′ can then be prepared in a manner analogous to the methods described in scheme 1 for the compounds of formulae 1 . 4 , 1 . 5 and 1 . 7 , respectively . reaction scheme 3 depicts how the functional group at position r 3 of a compound of formula ( i ) ( i . e . when z is cr 3 ) can be modified early in the synthesis . modification , early in the synthesis of a compound such as commercially available 3 . 1 ( wherein lg is bromo ) allows one skilled in the art to introduce groups such as methoxy which are robust enough to be carried throughout the entire synthesis in a manner analogous to that described for scheme 1 . the compound of formula 3 . 1 can be reacted with sodium methoxide in the presence of copper iodide to provide the methoxy compound of formula 3 . 2 . the compound of formula 3 . 2 can then be treated with phosphorous oxychloride in order to convert the hydroxy group present in the compound of formula 3 . 1 into the corresponding chloride of formula 1 . 1 ″. the compound of formula 1 . 1 ″ can then be reacted with the amine of formula 1 . 2 to provide the compound of 1 . 3 ″ in a manner as previously described for scheme 1 . the compound of formula 1 . 3 ″ can then be further elaborated to the compounds of formulae 1 . 4 ″, 1 . 5 ″ and 1 . 7 ″ in a manner analogous to the corresponding steps described previously for scheme 1 . reaction scheme 4 shows a late stage transformation of the compound of formula 4 . 1 to 1 . 7 ′″, a method which can be employed to prepare certain compounds within formula ( i ) where z is cr 3 and in which the r 3 functional group present is not compatible with the entire synthetic route as set forth in scheme 1 . for example , the nitrile group (— cn ) present at the r 3 position in the compound of formula 1 . 7 ′″ would not survive the reduction step necessary for the transformation of 1 . 4 to 1 . 5 as described in scheme 1 ( the reduction of the nitro group to the corresponding amine ). in scheme 4 the compound of formula 4 . 1 is one in which lg represents a suitable leaving group such as a halide ( eg bromo ). the compound of formula 4 . 1 can be reacted with zinc cyanide in the presence of an appropriate catalyst such as tetrakis ( triphenylphosphine ) palladium in an appropriate solvent such as n , n - dimethylformamide . the reaction is typically carried out at a temperature range of approximately ambient temperature to 100 ° c . for a period of 1 to 48 hours to provide the compound of formula 1 . 7 ′″. the methods generically described in schemes 1 - 4 are not to be construed in a limiting manner . it is to be understood by one skilled in the art that variation in the order of certain reaction steps and conditions may be employed to provide compounds of formula ( i ). the selection of which approach is best to utilize can be made by one skilled in the art of organic synthesis . more specific examples of the methods used to prepare compounds of formula ( i ) are provided below in the examples , and likewise these methods are also not to be construed by one skilled in the art in a limiting manner . the following illustrate the synthesis of various compounds of the present invention . additional compounds within the scope of this invention may be prepared using the methods illustrated in these examples , either alone or in combination with techniques generally known in the art . experiments were generally carried out under inert atmosphere ( nitrogen or argon ), particularly in cases where oxygen - or moisture - sensitive reagents or intermediates were employed . commercial solvents and reagents were generally used without further purification . anhydrous solvents were employed where appropriate , generally acroseal ® products from acros organics or drisolv ® products from emd chemicals . in other cases , commercial solvents were passed through columns packed with 4 å molecular sieves , until the following qc standards for water were attained : a ) & lt ; 100 ppm for dichloromethane , toluene , n , n - dimethylformamide and tetrahydrofuran ; b ) & lt ; 180 ppm for methanol , ethanol , 1 , 4 - dioxane and diisopropylamine . for very sensitive reactions , solvents were further treated with metallic sodium , calcium hydride or molecular sieves , and distilled just prior to use . products were generally dried under vacuum before being carried on to further reactions or submitted for biological testing . mass spectrometry data is reported from either liquid chromatography - mass spectrometry ( lcms ), atmospheric pressure chemical ionization ( apci ) or gas chromatography - mass spectrometry ( gcms ) instrumentation . chemical shifts for nuclear magnetic resonance ( nmr ) data are expressed in parts per million ( ppm , 6 ) referenced to residual peaks from the deuterated solvents employed . in some examples , chiral separations were carried out to separate enantiomers of certain compounds of the invention ( in some examples , the separated enantiomers are designated as ent - 1 and ent - 2 , according to their order of elution ). in some examples , the optical rotation of an enantiomer was measured using a polarimeter . according to its observed rotation data ( or its specific rotation data ), an enantiomer with a clockwise rotation was designated as the (+)- enantiomer and an enantiomer with a counter - clockwise rotation was designated as the (−)- enantiomer . racemic compounds are indicated by the presence of (+/−) adjacent to the structure ; in these cases , indicated stereochemistry represents the relative ( rather than absolute ) configuration of the compound &# 39 ; s substituents . reactions proceeding through detectable intermediates were generally followed by lcms , and allowed to proceed to full conversion prior to addition of subsequent reagents . for syntheses referencing procedures in other examples or methods , reaction conditions ( reaction time and temperature ) may vary . in general , reactions were followed by thin - layer chromatography or mass spectrometry , and subjected to work - up when appropriate . purifications may vary between experiments : in general , solvents and the solvent ratios used for eluents / gradients were chosen to provide appropriate r f s or retention times . 1 -( 2 , 4 - dimethoxyphenyl ) methanamine ( 1 . 97 ml , 13 . 1 mmol ) was added to a solution of 2 - methyltetrahydro - 4h - pyran - 4 - one ( 500 mg , 4 . 4 mmol ) in methanol ( 10 ml ). after stirring for 1 hour at room temperature , the reaction mixture was cooled to − 78 ° c . and a solution of lithium borohydride ( 98 %, 85 mg , 3 . 8 mmol ) in tetrahydrofuran ( 1 . 5 ml ) was added drop - wise . the reaction mixture was allowed to slowly warm to room temperature overnight , whereupon it was cooled to − 20 ° c . and quenched via careful addition of saturated aqueous sodium bicarbonate solution . ethyl acetate ( 25 ml ) and sufficient water to solubilize the precipitate were added , and the aqueous layer was extracted with ethyl acetate . the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . chromatography on silica gel [ gradient : 0 % to 15 % ( 10 : 1 methanol / concentrated ammonium hydroxide ) in ethyl acetate ] provided the product as a colorless oil . yield : 936 mg , 3 . 53 mmol , 80 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 13 ( d , j = 8 . 0 hz , 1h ), 6 . 46 ( d , half of ab quartet , j = 2 . 2 hz , 1h ), 6 . 44 ( dd , half of abx pattern , j = 8 . 1 , 2 . 3 hz , 1h ), 4 . 00 ( ddd , j = 11 . 6 , 4 . 6 , 1 . 6 hz , 1h ), 3 . 82 ( s , 3h ), 3 . 81 ( s , 3h ), 3 . 76 ( s , 2h ), 3 . 37 - 3 . 46 ( m , 2h ), 2 . 63 - 2 . 72 ( m , 1h ), 1 . 85 - 1 . 92 ( m , 1h ), 1 . 78 - 1 . 85 ( m , 1h ), 1 . 37 ( dddd , j = 13 , 12 , 11 , 4 . 6 hz , 1h ), 1 . 20 ( d , j = 6 . 2 hz , 3h ), 1 . 10 ( ddd , j = 12 , 11 , 11 hz , 1h ). using a syringe pump , 2 - methyltetrahydro - 4h - pyran - 4 - one ( 7 . 00 g , 61 . 3 mmol ) was added over 3 . 5 hours ( 2 ml / hour ) to a solution of 1 -( 2 , 4 - dimethoxyphenyl ) methanamine ( 9 . 21 ml , 61 . 3 mmol ) in methanol ( 137 ml ). after completion of the addition , the reaction mixture was allowed to stir at room temperature for 1 hour . this solution was then reacted with lithium borohydride ( 0 . 48 m solution in tetrahydrofuran , 153 . 2 ml , 73 . 5 mmol ) using a flow reactor [ 25 ml reactor made up of a 1 ml glass chip with two feeding channels and perfluoroalkoxy tubing ( 24 ml volume ); temperature : − 78 ° c . ; reaction concentration : 0 . 2 m ; residence time : 10 minutes ; flow rate : 1 . 25 ml / minute on both streams ]. the collected reaction mixture was diluted with saturated aqueous sodium bicarbonate solution and extracted with ethyl acetate . the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . 1 h nmr analysis at this point revealed a cis : trans ratio of 10 . 7 : 1 . silica gel chromatography ( gradient : 0 % to 20 % methanol in ethyl acetate ) afforded cis product p1 . yield : 11 . 59 g , 43 . 68 mmol , 71 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 16 ( d , j = 8 . 0 hz , 1h ), 6 . 41 - 6 . 48 ( m , 2h ), 4 . 00 ( ddd , j = 11 . 7 , 4 . 7 , 1 . 8 hz , 1h ), 3 . 82 ( s , 3h ), 3 . 80 ( s , 3h ), 3 . 78 ( s , 2h ), 3 . 36 - 3 . 46 ( m , 2h ), 2 . 70 ( tt , j = 11 . 2 , 4 . 1 hz , 1h ), 1 . 87 - 1 . 94 ( m , 1h ), 1 . 79 - 1 . 87 ( m , 1h ), 1 . 35 - 1 . 47 ( m , 1h ), 1 . 20 ( d , j = 6 . 2 hz , 3h ), 1 . 08 - 1 . 19 ( m , 1h ). also isolated was the trans isomer c38 . yield : 1 . 24 g , 4 . 67 mmol , 7 . 6 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 14 ( d , j = 8 . 2 hz , 1h ), 6 . 42 - 6 . 48 ( m , 2h ), 3 . 84 - 3 . 94 ( m , 2h ), 3 . 82 ( s , 3h ), 3 . 81 ( s , 3h ), 3 . 69 - 3 . 77 ( m , 3h ), 2 . 97 - 3 . 02 ( m , 1h ), 1 . 72 - 1 . 82 ( m , 1h ), 1 . 44 - 1 . 66 ( m , 3h ), 1 . 14 ( d , j = 6 . 2 hz , 3h ). but - 3 - en - 1 - ol ( 39 . 0 ml , 453 mmol ) and acetaldehyde ( 25 . 5 ml , 454 mmol ) were combined in aqueous sulfuric acid ( 20 % w / w , 565 g ) and stirred at 80 ° c . for 5 days . the reaction mixture was cooled to room temperature and extracted with diethyl ether , and then with dichloromethane ; the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 25 % ethyl acetate in heptane ) afforded the product as a colorless oil . yield : 11 . 2 g , 96 . 4 mmol , 21 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 3 . 99 ( ddd , j = 11 . 8 , 4 . 9 , 1 . 7 hz , 1h ), 3 . 71 - 3 . 80 ( m , 1h ), 3 . 35 - 3 . 46 ( m , 2h ), 1 . 82 - 1 . 98 ( m , 3h ), 1 . 48 ( dddd , j = 12 . 5 , 12 . 4 , 11 . 1 , 4 . 9 hz , 1h ), 1 . 21 ( d , j = 6 . 2 hz , 3h ), 1 . 14 - 1 . 24 ( m , 1h ). ethenyl butanoate ( 78 . 6 ml , 620 mmol ) and novozyme 435 ( immobilized candida antarctica lipase b , 25 g ) were added to a solution of c1 ( 150 g , 1 . 29 mol ) in tetrahydrofuran ( 1 . 3 l ). the reaction mixture was stirred at room temperature for 2 hours , whereupon it was filtered through a pad of diatomaceous earth , which was then rinsed twice with dichloromethane . the combined filtrates were concentrated in vacuo and purified via silica gel chromatography ( gradient : 0 % to 10 % ethyl acetate in heptane ), providing the product as an oil . yield : 51 . 5 g , 276 mmol , 45 %. the absolute configurations of c2 and subsequent intermediates were confirmed via an x - ray structural determination carried out on c14 ( see example 2 ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 4 . 82 - 4 . 92 ( m , 1h ), 3 . 99 ( ddd , j = 11 . 9 , 4 . 9 , 1 . 7 hz , 1h ), 3 . 42 - 3 . 52 ( m , 2h ), 2 . 25 ( t , j = 7 . 4 hz , 2h ), 1 . 92 - 2 . 00 ( m , 1h ), 1 . 84 - 1 . 91 ( m , 1h ), 1 . 52 - 1 . 69 ( m , 3h ), 1 . 28 ( ddd , j = 12 , 11 , 11 hz , 1h ), 1 . 20 ( d , j = 6 . 2 hz , 3h ), 0 . 94 ( t , j = 7 . 4 hz , 3h ). a solution of c2 ( 51 . 5 g , 276 mmol ) in methanol and tetrahydrofuran ( 1 : 1 , 700 ml ) was treated with a solution of lithium hydroxide ( 19 . 9 g , 831 mmol ) in water ( 120 ml ), and the reaction mixture was stirred overnight at room temperature . after removal of the organic solvents via concentration under reduced pressure , the aqueous residue was extracted 4 times with dichloromethane ; the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo to afford the product as a colorless oil . yield : 27 . 3 g , 235 mmol , 85 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 3 . 99 ( ddd , j = 11 . 8 , 4 . 8 , 1 . 7 hz , 1h ), 3 . 71 - 3 . 80 ( m , 1h ), 3 . 35 - 3 . 47 ( m , 2h ), 1 . 82 - 1 . 98 ( m , 3h ), 1 . 48 ( dddd , j = 12 . 5 , 12 . 4 , 11 . 1 , 4 . 8 hz , 1h ), 1 . 21 ( d , j = 6 . 2 hz , 3h ), 1 . 14 - 1 . 24 ( m , 1h ). a solution of c3 ( 27 . 3 g , 235 mmol ) in acetone ( 980 ml ) was cooled in an ice bath and treated drop - wise with jones reagent ( 2 . 5 m , 103 ml , 258 mmol ). the reaction mixture was stirred for 10 minutes at 0 ° c ., then warmed to room temperature , stirred for a further 30 minutes , and cooled to 0 ° c . 2 - propanol ( 18 ml , 240 mmol ) was added , and stirring was continued for 30 minutes . after the mixture had been concentrated in vacuo , the residue was partitioned between water and dichloromethane ; the aqueous layer was extracted 3 times with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated under reduced pressure to provide the product as a light yellow oil . yield : 23 g , 200 mmol , 85 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 4 . 25 ( ddd , j = 11 . 5 , 7 . 4 , 1 . 3 hz , 1h ), 3 . 70 ( dqd , j = 12 . 2 , 6 . 1 , 2 . 7 hz , 1h ), 3 . 64 ( ddd , j = 12 . 2 , 11 . 6 , 2 . 8 hz , 1h ), 2 . 55 ( dddd , j = 14 . 6 , 12 . 4 , 7 . 4 , 1 . 0 hz , 1h ), 2 . 37 ( ddd , j = 14 . 4 , 2 . 3 , 2 . 3 hz , 1h ), 2 . 21 - 2 . 31 ( m , 2h ), 1 . 29 ( d , j = 6 . 2 hz , 3h ). 1 -( 2 , 4 - dimethoxyphenyl ) methanamine ( 20 . 3 ml , 135 mmol ) was added to a solution of c4 ( 10 . 3 g , 90 . 2 mmol ) in methanol ( 200 ml ), and the reaction mixture was stirred for 1 hour at room temperature . it was then cooled to − 78 ° c . ; lithium borohydride solution ( 2 m in tetrahydrofuran , 45 . 1 ml , 90 . 2 mmol ) was added drop - wise , and stirring was continued at − 78 ° c . for 2 hours . after slowly warming to room temperature overnight , the reaction mixture was quenched via careful addition of saturated aqueous sodium bicarbonate solution . ethyl acetate ( 250 ml ) and sufficient water to solubilize the precipitate were added , and the aqueous layer was extracted with ethyl acetate ; the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ) provided the product as a colorless oil ( 10 . 4 g ). similar purification of mixed fractions afforded additional product ( 3 . 7 g ). combined yield : 14 . 1 g , 53 . 1 mmol , 59 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 13 ( d , j = 8 . 0 hz , 1h ), 6 . 42 - 6 . 47 ( m , 2h ), 3 . 99 ( ddd , j = 11 . 6 , 4 . 6 , 1 . 5 hz , 1h ), 3 . 82 ( s , 3h ), 3 . 80 ( s , 3h ), 3 . 76 ( s , 2h ), 3 . 36 - 3 . 45 ( m , 2h ), 2 . 63 - 2 . 73 ( m , 1h ), 1 . 85 - 1 . 92 ( m , 1h ), 1 . 78 - 1 . 85 ( m , 1h ), 1 . 38 ( dddd , j = 13 , 12 , 11 , 4 . 7 hz , 1h ), 1 . 20 ( d , j = 6 . 2 hz , 3h ), 1 . 10 ( ddd , j = 11 , 11 , 11 hz , 1h ). a solution of p1 ( 200 mg , 0 . 754 mmol ) in acetonitrile ( 0 . 05 m ) was added to a slurry of (+)-( 2s )- 4 -( 1 , 3 - dioxo - 1 , 3 - dihydro - 2h - isoindol - 2 - yl )- 2 - hydroxybutanoic acid ( 93 . 9 mg , 0 . 377 mmol ) in acetonitrile ( 0 . 15 m ). the reaction mixture was heated to 75 ° c . to effect complete dissolution , and was then allowed to cool to room temperature and stir for an additional 18 hours . the resulting solid ( c39 ) was collected via filtration , washed with acetonitrile , and dissolved in dichloromethane . this solution was washed three times with 1 m aqueous sodium hydroxide solution and once with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo to afford the product as a colorless oil . the indicated absolute configuration was established via chiral hplc comparison with a known sample of p2 . the enantiomeric excess of this batch of p2 was determined to be 77 . 5 % by supercritical fluid chromatography ( column : chiral technologies chiralpak as , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : ethanol containing 0 . 2 % ammonium hydroxide ; gradient : 5 % to 60 % b ). in this system , p2 was the second - eluting enantiomer . yield : 68 mg , 0 . 26 mmol , 69 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 13 ( d , j = 8 . 0 hz , 1h ), 6 . 46 ( d , half of ab quartet , j = 2 . 3 hz , 1h ), 6 . 44 ( dd , half of abx pattern , j = 8 . 1 , 2 . 4 hz , 1h ), 4 . 00 ( ddd , j = 11 . 7 , 4 . 7 , 1 . 8 hz , 1h ), 3 . 82 ( s , 3h ), 3 . 81 ( s , 3h ), 3 . 76 ( s , 2h ), 3 . 37 - 3 . 46 ( m , 2h ), 2 . 63 - 2 . 72 ( m , 1h ), 1 . 85 - 1 . 92 ( m , 1h ), 1 . 78 - 1 . 85 ( m , 1h ), 1 . 38 ( dddd , j = 12 . 7 , 12 . 5 , 11 . 3 , 4 . 7 hz , 1h ), 1 . 20 ( d , j = 6 . 2 hz , 3h ), 1 . 10 ( ddd , j = 12 . 3 , 11 . 3 , 11 . 1 hz , 1h ). trans - 3 - aminocyclopentanol , hydrochloride salt ( 9 . 7 g , 70 mmol ) was mixed with dichloromethane ( 120 ml ), whereupon triethylamine ( 21 . 6 ml , 155 mmol ) was added , followed by di - tert - butyl dicarbonate ( 16 . 9 g , 77 . 4 mmol ). after the reaction mixture had been stirred at room temperature overnight , water was added and the resulting mixture was extracted with dichloromethane . the organic layer was washed with water , dried over sodium sulfate , filtered , and concentrated in vacuo to afford a slightly yellow oil , which solidified upon addition of heptane . this material was collected via filtration , washed with heptane and crystallized from dichloromethane / heptane , providing the product as a white solid . yield : 11 . 86 g , 58 . 93 mmol , 84 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 4 . 36 - 4 . 54 ( m , 2h ), 4 . 10 - 4 . 25 ( br m , 1h ), 2 . 16 - 2 . 28 ( m , 1h ), 1 . 97 - 2 . 09 ( m , 2h ), 1 . 55 - 1 . 71 ( m , 2h ), 1 . 45 ( s , 9h ), 1 . 36 - 1 . 48 ( m , 2h ). 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 7 . 43 ml , 49 . 7 mmol ) was added to a mixture of c40 ( 5 . 00 g , 24 . 8 mmol ), toluene ( 25 ml ), and pyridine - 2 - sulfonyl fluoride ( pyfluor ; 4 . 40 g , 27 . 3 mmol ). after 16 hours at room temperature , the reaction mixture was diluted with saturated aqueous sodium bicarbonate solution ( 50 ml ) and extracted with heptane ( 3 × 100 ml ). the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in heptane ) provided the product as a solid . yield : 3 . 78 g , 18 . 6 mmol , 75 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ [ 5 . 20 - 5 . 26 ( m ) and 5 . 07 - 5 . 13 ( m ), j hf = 54 hz , total 1h ], 4 . 75 - 4 . 89 ( br m , 1h ), 4 . 10 - 4 . 24 ( br m , 1h ), 1 . 99 - 2 . 21 ( m , 3h ), 1 . 66 - 1 . 95 ( m , 3h ), 1 . 45 ( s , 9h ). hydrogen chloride ( 4 m solution in 1 , 4 - dioxane , 46 . 2 ml , 185 mmol ) was added to a 0 ° c . solution of c41 ( 3 . 76 g , 18 . 5 mmol ) in tetrahydrofuran ( 54 ml ), and the reaction mixture was allowed to slowly warm to room temperature overnight . solvents were removed in vacuo , and the residue was recrystallized from 2 - propanol / heptane , affording the product as a white solid . yield : 2 . 45 g , 17 . 6 mmol , 95 %. 1 h nmr ( 400 mhz , d 2 o ) δ [ 5 . 31 - 5 . 35 ( m ) and 5 . 18 - 5 . 22 ( m ), j hf = 53 hz , total 1h ], 3 . 76 - 3 . 84 ( m , 1h ), 2 . 00 - 2 . 40 ( m , 4h ), 1 . 75 - 1 . 98 ( m , 2h ). using the method of s . specklin et al . ( tetrahedron lett . 2014 , 55 , 6987 - 6991 ), pancreatin ( sigma , from porcine pancreas , 4 × usp specifications ; 15 . 2 g ) was added to a stirring solution of cis - cyclopent - 4 - ene - 1 , 3 - diol ( 3 . 04 g , 30 . 4 mmol ), vinyl acetate ( 19 . 6 ml , 213 mmol ), and triethylamine ( 29 . 6 ml , 212 mmol ) in tetrahydrofuran ( 76 ml ). the resulting suspension was stirred for 22 hours at room temperature , whereupon it was filtered through a pad of diatomaceous earth . after the filter pad had been washed with ethyl acetate ( 50 ml ), the combined filtrates were concentrated in vacuo and purified via silica gel chromatography ( gradient : 20 % to 33 % ethyl acetate in cyclohexane ), affording the product as a yellow solid . yield : 2 . 28 g , 16 . 0 mmol , 53 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 6 . 12 ( ddd , j = 5 . 5 , 1 . 9 , 1 . 3 hz , 1h ), 5 . 99 ( ddd , j = 5 . 5 , 2 . 1 , 1 . 2 hz , 1h ), 5 . 48 - 5 . 53 ( m , 1h ), 4 . 70 - 4 . 75 ( m , 1h ), 2 . 76 - 2 . 86 ( m , 1h ), 2 . 06 ( s , 3h ), 1 . 66 ( ddd , j = 14 . 6 , 3 . 9 , 3 . 7 hz , 1h ). diisopropyl azodicarboxylate ( 94 %, 2 . 73 ml , 13 . 0 mmol ) was slowly added to a mixture of c42 ( 1 . 68 g , 11 . 8 mmol ), tetrahydrofuran ( 50 ml ), 1h - isoindole - 1 , 3 ( 2h )- dione ( 1 . 92 g , 13 . 0 mmol ), and triphenylphosphine ( 98 . 5 %, 3 . 47 g , 13 . 0 mmol ). after the reaction mixture had been stirred at room temperature for 18 hours , it was eluted through a short pad of silica gel ( 100 g ), which was then further eluted with ethyl acetate . fractions containing the product were combined , concentrated in vacuo , and subjected to chromatography on silica gel ( gradient : 0 % to 40 % ethyl acetate in heptane ), providing the product as a white solid ( 4 . 96 g ). by 1 h nmr , this material was contaminated with a substantial quantity of material derived from diisopropyl azodicarboxylate ; a portion was taken to the following step without additional purification . gcms m / z 211 . 0 [ m - acoh ] + . 1 h nmr ( 400 mhz , cdcl 3 ), product peaks only : δ 7 . 81 - 7 . 84 ( m , 2h ), 7 . 70 - 7 . 73 ( m , 2h ), 6 . 16 ( ddd , j = 5 . 7 , 2 . 3 , 2 . 2 hz , 1h ), 6 . 01 - 6 . 06 ( m , 1h ), 5 . 98 ( ddd , j = 5 . 7 , 2 . 2 , 1 . 0 hz , 1h ), 5 . 52 - 5 . 58 ( m , 1h ), 2 . 57 ( ddd , j = 14 . 4 , 7 . 2 , 4 . 7 hz , 1h ), 2 . 27 ( ddd , j = 14 . 5 , 8 . 5 , 2 . 9 hz , 1h ), 2 . 07 ( s , 3h ). 2 - aminoethanol ( 2 . 13 ml , 35 . 3 mmol ) was added to a solution of c43 ( from the previous step , 2 . 40 g , 56 . 29 mmol ) in ethyl acetate ( 20 ml ), and the reaction mixture was heated at reflux for 18 hours . more 2 - aminoethanol ( 1 . 0 ml , 17 mmol ) was added , and heating was continued for an additional 4 hours . after removal of solvent under reduced pressure , the residue was purified using silica gel chromatography [ gradient : 0 % to 10 % ( 2 m ammonia in methanol ) in dichloromethane ] to afford the product as a colorless oil ( 1 . 25 g ). this material was taken directly into the following step . to a solution of c44 ( from the previous step , 56 . 29 mmol ) in dichloromethane ( 30 ml ) was added sodium bicarbonate ( 3 . 72 g , 44 . 3 mmol ) and di - tert - butyl dicarbonate ( 3 . 86 g , 17 . 7 mmol ). the reaction mixture was stirred at room temperature overnight , whereupon it was concentrated in vacuo and used directly in the following step . potassium carbonate ( 2 . 44 g , 17 . 7 mmol ) was added to a solution of c45 ( from the previous step , 56 . 29 mmol ) in methanol ( 20 ml ). the reaction mixture was stirred at room temperature for 1 hour , whereupon it was diluted with water ( 50 ml ) and extracted with diethyl ether ( 3 × 30 ml ). the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 60 % ethyl acetate in heptane ) provided the product as a white solid . yield : 783 mg , 3 . 93 mmol , 62 % over 4 steps . gcms m / z 143 . 0 [ m - 2 - methylprop - 1 - ene ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 5 . 96 - 6 . 00 ( m , 1h ), 5 . 92 - 5 . 96 ( m , 1h ), 4 . 85 - 5 . 01 ( m , 2h ), 2 . 19 ( ddd , j = 14 . 4 , 7 . 4 , 3 . 1 hz , 1h ), 1 . 95 ( ddd , j = 14 . 4 , 7 . 0 , 4 . 3 hz , 1h ), 1 . 45 ( s , 9h ). a mixture of c46 ( 315 mg , 1 . 58 mmol ) and 10 % palladium on carbon ( 150 mg ) in methanol ( 20 ml ) was hydrogenated at 60 psi for 4 hours . the catalyst was removed via filtration , and the filtrate was concentrated in vacuo and combined with the crude product from a similar reaction carried out using c46 ( 151 mg , 0 . 758 mmol ). chromatography on silica gel ( gradient : 0 % to 60 % ethyl acetate in heptane ) afforded the product as a white solid . combined yield : 286 mg , 1 . 42 mmol , 61 %. gcms m / z 145 . 0 [ m - 2 - methylprop - 1 - ene ]+. 1 h nmr ( 400 mhz , cdcl 3 ) δ 4 . 49 ( br s , 1h ), 4 . 36 - 4 . 42 ( m , 1h ), 4 . 09 - 4 . 24 ( br m , 1h ), 2 . 15 - 2 . 26 ( m , 1h ), 1 . 95 - 2 . 08 ( m , 2h ), 1 . 8 - 2 . 0 ( v br s , 1h ), 1 . 55 - 1 . 69 ( m , 2h ), 1 . 44 ( s , 9h ), 1 . 33 - 1 . 45 ( m , 1h ). pyridine - 2 - sulfonyl fluoride ( 252 mg , 1 . 56 mmol ) was added to a mixture of c47 ( 286 mg , 1 . 42 mmol ) in toluene ( 1 . 4 ml ). 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 0 . 425 ml , 2 . 84 mmol ) was then added , and the reaction mixture was stirred overnight at room temperature . saturated aqueous sodium bicarbonate solution ( 10 ml ) was added , and the resulting mixture was extracted with diethyl ether ( 3 × 10 ml ). the combined organic layers were dried over sodium sulfate , filtered , concentrated in vacuo , and purified via silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in heptane ), providing the product as a white solid . yield : 181 mg , 0 . 890 mmol , 63 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ [ 5 . 20 - 5 . 25 ( m ) and 5 . 07 - 5 . 12 ( m ), j hf = 54 hz , total 1h ], 4 . 76 - 4 . 88 ( br m , 1h ), 4 . 10 - 4 . 23 ( br m , 1h ), 1 . 99 - 2 . 20 ( m , 3h ), 1 . 66 - 1 . 94 ( m , 3h ), 1 . 45 ( s , 9h ). a solution of hydrogen chloride in 1 , 4 - dioxane ( 4 m , 2 . 2 ml , 8 . 8 mmol ) was added to c48 ( 181 mg , 0 . 890 mmol ), and the reaction mixture was stirred at room temperature for 3 hours . concentration in vacuo afforded the product as a white solid . yield : 121 mg , 0 . 867 mmol , 97 %. 1 h nmr ( 400 mhz , cd 3 od ) δ [ 5 . 25 - 5 . 29 ( m ) and 5 . 11 - 5 . 16 ( m ), j hf = 53 hz , total 1h ], 3 . 67 - 3 . 76 ( m , 1h ), 2 . 35 ( dddd , j = 36 . 0 , 15 . 6 , 8 . 6 , 4 . 7 hz , 1h ), 1 . 79 - 2 . 27 ( m , 5h ). triethylamine ( 2 . 6 mmol ) and benzyl chloroformate ( 0 . 136 ml , 0 . 953 mmol ) were added to a suspension of c49 ( 121 mg , 0 . 867 mmol ) in dichloromethane ( 5 ml ), and the reaction mixture was stirred at room temperature for 2 hours . it was then concentrated in vacuo and purified via chromatography on silica gel ( gradient : 0 % to 40 % ethyl acetate in heptane ), affording the product as a white solid . yield : 159 mg , 0 . 670 mmol , 77 %. specific rotation : [ α ]− 1 . 4 ° ( c 1 . 52 , dichloromethane ). gcms m / z 237 . 0 [ m + ]. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 29 - 7 . 40 ( m , 5h ), 5 . 10 ( s , 2h ), 5 . 00 - 5 . 27 ( m , 2h ), 4 . 20 - 4 . 31 ( br m , 1h ), 2 . 00 - 2 . 20 ( m , 3h ), 1 . 69 - 1 . 98 ( m , 3h ). a mixture of trans - 3 - aminocyclopentanol , hydrochloride salt ( 2 . 30 g , 16 . 7 mmol ) in water ( 15 ml ) was cooled to 0 ° c . aqueous sodium hydroxide solution ( 3 m , 12 . 3 ml , 36 . 9 mmol ) and benzyl chloroformate ( 2 . 62 ml , 18 . 4 mmol ) were added by turns . after completion of the additions , the reaction mixture was stirred at 0 ° c . for 3 hours , whereupon it was diluted with water and extracted with dichloromethane ( 3 × 30 ml ). the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . the residue was recrystallized from dichloromethane / heptane to afford the product as a white solid ( 2 . 88 g ). the mother liquors were concentrated and recrystallized from dichloromethane / heptane to provide additional product ( 286 mg ). combined yield : 3 . 17 g , 13 . 5 mmol , 81 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 29 - 7 . 40 ( m , 5h ), 5 . 10 ( br s , 2h ), 4 . 60 - 4 . 77 ( br s , 1h ), 4 . 38 - 4 . 46 ( m , 1h ), 4 . 19 - 4 . 33 ( m , 1h ), 2 . 18 - 2 . 32 ( m , 1h ), 1 . 98 - 2 . 13 ( m , 2h ), 1 . 57 - 1 . 74 ( m , 2h ), 1 . 38 - 1 . 49 ( m , 1h ), 1 . 38 ( d , j = 3 . 5 hz , 1h ). pyridine - 2 - sulfonyl fluoride ( 2 . 17 g , 13 . 5 mmol ), followed by 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 3 . 67 ml , 24 . 5 mmol ), was added to a solution of c50 ( 2 . 88 g , 12 . 2 mmol ) in toluene ( 20 ml ). the reaction mixture was stirred for 64 hours , whereupon saturated aqueous sodium bicarbonate solution ( 20 ml ) was added . the resulting mixture was extracted with ethyl acetate ( 3 × 20 ml ); the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 40 % ethyl acetate in heptane ) provided the product as a solid . yield : 2 . 23 g , 9 . 40 mmol , 77 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 29 - 7 . 41 ( m , 5h ), 5 . 10 ( br s , 2h ), 5 . 00 - 5 . 27 ( m , 2h ), 4 . 20 - 4 . 31 ( br m , 1h ), 2 . 00 - 2 . 20 ( m , 3h ), 1 . 69 - 1 . 98 ( m , 3h ). step 3 . isolation of benzyl [( 1r , 3s )- 3 - fluorocyclopentyl ] carbamate ( p4 ) and benzyl [( 1 s , 3r )- 3 - fluorocyclopentyl ] carbamate ( c52 ) the component enantiomers of c51 ( 1 . 60 g ) were separated using supercritical fluid chromatography [ column : phenomenex lux amylose - 2 , 5 μm ; mobile phase : 9 : 1 carbon dioxide /( ethanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting enantiomer was p4 , and the second - eluting enantiomer was c52 . the absolute configurations shown were assigned to the enantiomers through comparison of their rotations with the sample of p4 synthesized in preparation p4 . for p4 , yield : 612 mg , 38 % for the separation . specific rotation : [ α ]− 3 . 9 ° ( c 0 . 455 , dichloromethane ). lcms m / z 238 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 30 - 7 . 39 ( m , 5h ), 5 . 10 ( s , 2h ), 5 . 01 - 5 . 27 ( m , 2h ), 4 . 20 - 4 . 31 ( br m , 1h ), 2 . 00 - 2 . 21 ( m , 3h ), 1 . 69 - 1 . 98 ( m , 3h ). for c52 , yield : 647 mg , 40 % for the separation . specific rotation : [ α ]+ 5 . 5 ° ( c 0 . 445 , dichloromethane ). lcms m / z 238 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 29 - 7 . 39 ( m , 5h ), 5 . 10 ( s , 2h ), 5 . 01 - 5 . 27 ( m , 2h ), 4 . 20 - 4 . 31 ( br m , 1h ), 2 . 01 - 2 . 20 ( m , 3h ), 1 . 69 - 1 . 98 ( m , 3h ). a mixture of c5 ( which may be prepared according to j . gainer et al ., j . chem . soc ., perkin trans . 1 ( 1972 - 1999 ) 1976 , 9 , 994 - 997 ; 400 mg , 2 . 36 mmol ) and concentrated hydrochloric acid ( 5 ml ) was heated at 50 ° c . overnight . the reaction mixture was concentrated to provide the product . yield : 300 mg , 2 . 1 mmol , 89 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 6 . 18 ( br s , 1h ), 3 . 62 ( s , 2h ), 2 . 37 ( d , j = 0 . 6 hz , 3h ). a mixture of sodium metal ( 1 . 3 g , 56 mmol ) in methanol ( 50 ml ) was stirred at room temperature for 30 minutes , whereupon n , n - dimethylformamide ( 50 ml ) was introduced . copper ( i ) iodide ( 4 . 25 g , 22 . 3 mmol ) and 6 - bromo - 3 - nitroquinolin - 4 - ol ( 5 . 00 g , 18 . 6 mmol ) were added , and the reaction mixture was heated at 100 ° c . for 3 days . it was then cooled and filtered ; the filtrate was concentrated in vacuo and the residue was diluted with water ( 200 ml ). after adjustment of the ph to 5 - 6 via addition of concentrated hydrochloric acid , the mixture was filtered again , and the filter cake was washed with water ( 40 ml ), affording the product as a brown solid . yield : 2 . 8 g , 13 mmol , 70 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 12 ( br s , 1h ), 7 . 68 ( br d , j = 8 . 5 hz , 1h ), 7 . 65 ( d , j = 2 . 3 hz , 1h ), 7 . 42 ( dd , j = 8 . 8 , 2 . 8 hz , 1h ), 3 . 87 ( s , 3h ). phosphorus oxychloride ( 11 . 7 g , 76 . 3 mmol ) was added drop - wise to a solution of c7 ( 5 . 8 g , 26 mmol ) in n , n - dimethylformamide ( 50 ml ), and the reaction mixture was stirred at room temperature for 2 hours , whereupon it was poured into ice water ( 100 ml ). the resulting mixture was filtered and the filter cake was washed with water ( 300 ml ) to provide the product as a brown solid . yield : 4 . 5 g , 19 mmol , 73 %. this experiment was carried out in three batches . to a mixture of c8 ( 1 . 5 g , 6 . 3 mmol ) and p1 ( 2 . 18 g , 8 . 22 mmol ) in n , n - dimethylformamide ( 15 ml ) was added triethylamine ( 1 . 3 g , 13 mmol ), and the mixture was heated at 80 ° c . overnight . the three reaction mixtures were combined , diluted with water ( 300 ml ), and extracted with dichloromethane ( 3 × 150 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 3 × 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo ; purification via silica gel chromatography ( eluent : 5 : 1 petroleum ether / ethyl acetate ) afforded the product as a yellow oil . yield : 4 . 8 g , 10 mmol , 53 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 94 ( s , 1h ), 7 . 97 ( d , j = 9 . 2 hz , 1h ), 7 . 51 ( d , j = 2 . 9 hz , 1h ), 7 . 42 ( dd , j = 9 . 1 , 2 . 8 hz , 1h ), 6 . 91 ( d , j = 8 . 3 hz , 1h ), 6 . 24 ( dd , half of abx pattern , j = 8 . 3 , 2 . 4 hz , 1h ), 6 . 21 ( d , half of ab quartet , j = 2 . 3 hz , 1h ), 4 . 32 ( ab quartet , j ab = 14 . 8 hz , δν ab = 8 . 0 hz , 2h ), 3 . 98 - 4 . 05 ( m , 1h ), 3 . 88 ( s , 3h ), 3 . 73 - 3 . 84 ( m , 1h ), 3 . 70 ( s , 3h ), 3 . 48 ( s , 3h ), 3 . 38 - 3 . 47 ( m , 2h ), 1 . 82 - 2 . 00 ( m , 3h ), 1 . 51 - 1 . 62 ( m , 1h ), 1 . 18 ( d , j = 6 . 2 hz , 3h ). a solution of c9 ( 4 . 8 g , 10 mmol ) in trifluoroacetic acid ( 30 ml ) was stirred at room temperature for 30 minutes , whereupon it was diluted with dichloromethane ( 200 ml ). saturated aqueous sodium bicarbonate solution ( 200 ml ) was added , and the aqueous layer was extracted with dichloromethane ( 3 × 100 ml ); the combined organic layers were washed with saturated aqueous sodium chloride solution ( 3 × 100 ml ), dried over sodium sulfate , filtered , and concentrated under reduced pressure . the residue was washed with ethyl acetate ( 30 ml ) to afford the product as a yellow solid . yield : 2 . 5 g , 7 . 9 mmol , 79 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 26 ( s , 1h ), 8 . 87 ( br d , j = 8 . 9 hz , 1h ), 7 . 97 ( d , j = 10 . 0 hz , 1h ), 7 . 42 - 7 . 48 ( m , 2h ), 4 . 23 - 4 . 35 ( m , 1h ), 4 . 11 ( br dd , j = 12 , 5 hz , 1h ), 3 . 93 ( s , 3h ), 3 . 45 - 3 . 55 ( m , 2h ), 2 . 09 - 2 . 19 ( m , 2h ), 1 . 7 - 1 . 84 ( m , 1h ), 1 . 48 ( ddd , j = 12 , 12 , 11 hz , 1h ), 1 . 26 ( d , j = 6 . 3 hz , 3h ). to a solution of c10 ( 2 . 5 g , 7 . 9 mmol ) in a mixture of methanol ( 25 ml ) and acetonitrile ( 100 ml ) was added platinum ( iv ) oxide ( 500 mg , 2 . 2 mmol ). the reaction mixture was degassed and purged with hydrogen three times , then stirred at room temperature for 3 hours under a balloon containing hydrogen . the reaction mixture was filtered and the filtrate was concentrated , providing the product as a black solid , which was used without further purification . yield : 2 . 0 g , 7 . 0 mmol , 89 %. lcms m / z 287 . 9 [ m + h ] + . to a solution of c11 ( 350 mg , 1 . 22 mmol ) and c6 ( 200 mg , 1 . 4 mmol ) in n , n - dimethylformamide ( 15 ml ) was added n , n - diisopropylethylamine ( 346 mg , 2 . 68 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 2 . 3 g , 3 . 6 mmol ), and the reaction mixture was heated at 120 ° c . for 5 hours . it was then diluted with water ( 80 ml ) and extracted with ethyl acetate ( 3 × 50 ml ); the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . purification via reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient 18 % to 38 % b ) provided the racemic product as a white solid , which was then separated into its component enantiomers using supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). the first - eluting compound was 1 , isolated as a white solid . yield : 9 . 2 mg , 23 μmol , 2 %. lcms m / z 393 . 0 [ m + h ] + . retention time : 5 . 51 minutes ( analytical column : chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ; flow rate : 1 . 5 ml / minute ). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 01 ( s , 1h ), 8 . 07 ( d , j = 9 . 2 hz , 1h ), 7 . 85 - 7 . 94 ( br m , 1h ), 7 . 35 ( br d , j = 9 hz , 1h ), 6 . 24 ( s , 1h ), 5 . 04 - 5 . 20 ( br m , 1h ), 4 . 60 ( br s , 2h ), 4 . 12 - 4 . 23 ( br m , 1h ), 3 . 97 ( s , 3h ), 3 . 54 - 3 . 72 ( br m , 2h ), 2 . 6 - 2 . 72 ( br m , 1h , assumed ; partially obscured by solvent peak ), 2 . 39 ( s , 3h ), 2 . 24 - 2 . 35 ( br m , 1h ), 1 . 93 - 2 . 05 ( br m , 1h ), 1 . 78 - 1 . 90 ( br m , 1h ), 1 . 21 ( d , j = 5 . 9 hz , 3h ). the second - eluting enantiomer was c12 , also obtained as a white solid . yield : 11 . 3 mg , 28 . 8 μmol , 2 . 4 %. lcms m / z 393 . 0 [ m + h ] + . retention time : 6 . 6 minutes ( analytical conditions identical to those used for 1 ) 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 01 ( s , 1h ), 8 . 07 ( d , j = 9 . 2 hz , 1h ), 7 . 85 - 7 . 94 ( br m , 1h ), 7 . 35 ( dd , j = 9 . 3 , 2 . 5 hz , 1h ), 6 . 24 ( s , 1h ), 5 . 05 - 5 . 19 ( br m , 1h ), 4 . 59 ( br s , 2h ), 4 . 12 - 4 . 23 ( br m , 1h ), 3 . 97 ( s , 3h ), 3 . 55 - 3 . 72 ( br m , 2h ), 2 . 57 - 2 . 72 ( br m , 1h ), 2 . 39 ( s , 3h ), 2 . 22 - 2 . 36 ( br m , 1h ), 1 . 93 - 2 . 06 ( br m , 1h ), 1 . 78 - 1 . 91 ( br m , 1h ), 1 . 21 ( d , j = 6 . 0 hz , 3h ). the absolute configurations of 1 and c12 were assigned based on their relative biological activity ( see table 3 , the x - ray crystal structure determination of c14 below , and the discussion in example 5 , step 3 ). n , n - dimethylformamide ( 3 . 1 ml , 40 mmol ) and thionyl chloride ( 97 %, 6 . 9 ml , 93 mmol ) were added to a suspension of 6 - chloro - 3 - nitroquinolin - 4 - ol ( 15 . 38 g , 68 . 48 mmol ) in dichloromethane ( 140 ml ), and the reaction mixture was heated at reflux . after 5 hours , it was cooled to room temperature , diluted with additional dichloromethane ( 25 ml ), and poured into saturated aqueous sodium bicarbonate solution ( 250 ml ). the aqueous layer was extracted with dichloromethane ( 100 ml ), then passed through a plug of diatomaceous earth , which was rinsed with dichloromethane ( 50 ml ). the combined organic layers and organic filtrate were dried over magnesium sulfate , filtered , and concentrated in vacuo to afford the product as a pale tan solid . yield : 16 . 8 g , quantitative . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 25 ( s , 1h ), 8 . 42 ( d , j = 2 . 2 hz , 1h ), 8 . 17 ( d , j = 8 . 9 hz , 1h ), 7 . 89 ( dd , j = 9 . 0 , 2 . 2 hz , 1h ). compound c13 ( 12 . 2 g , 50 . 2 mmol ) was added to a solution of p2 ( 13 . 3 g , 50 . 1 mmol ) and n , n - diisopropylethylamine ( 13 . 1 ml , 75 . 2 mmol ) in acetonitrile ( 250 ml ), and the reaction mixture was heated to 55 ° c . overnight . after concentration in vacuo , the residue was partitioned between aqueous sodium bicarbonate solution ( 100 ml ) and dichloromethane ( 150 ml ). the aqueous layer was extracted with dichloromethane ( 2 × 50 ml ) and the combined organic layers were treated with trifluoroacetic acid ( 25 ml ). { caution : exotherm !}. after 20 minutes , saturated aqueous sodium carbonate solution ( 150 ml ) was added portion - wise , and the mixture was allowed to stir for 10 minutes . the aqueous layer was extracted twice with dichloromethane , and the combined organic layers were concentrated in vacuo , providing a reddish solid ( 17 . 3 g ); this was triturated with diethyl ether ( 230 ml ) to afford a yellow solid ( 14 . 0 g ). a portion of this solid ( 10 g ) was subjected to purification via supercritical fluid chromatography ( column : lux amylose - 2 , 5 μm ; mobile phase : 65 : 35 carbon dioxide / methanol ), providing the product as a crystalline solid . the indicated absolute configuration was determined via single crystal x - ray structural determination on this material : see below . yield : 7 . 1 g , 22 mmol , 62 % ( yield corrected for material omitted from purification ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 36 ( s , 1h ), 9 . 11 ( br d , j = 9 hz , 1h ), 8 . 12 ( d , j = 2 . 0 hz , 1h ), 7 . 98 ( d , j = 8 . 9 hz , 1h ), 7 . 73 ( dd , j = 8 . 9 , 2 . 2 hz , 1h ), 4 . 21 - 4 . 33 ( m , 1h ), 4 . 08 - 4 . 15 ( m , 1h ), 3 . 50 - 3 . 60 ( m , 2h ), 2 . 11 - 2 . 22 ( m , 2h ), 1 . 77 ( dddd , j = 12 , 12 , 12 , 5 hz , 1h ), 1 . 49 ( ddd , j = 12 , 12 , 11 hz , 1h ), 1 . 28 ( d , j = 6 . 2 hz , 3h ). data collection was performed on a bruker apex diffractometer at room temperature . data collection consisted of omega and phi scans . the structure was solved by direct methods using shelx software suite in the space group p2 1 2 1 2 1 . the structure was subsequently refined by the full - matrix least squares method . all non - hydrogen atoms were found and refined using anisotropic displacement parameters . the hydrogen atom located on nitrogen was found from the fourier difference map and refined with distances restrained . the remaining hydrogen atoms were placed in calculated positions and were allowed to ride on their carrier atoms . the final refinement included isotropic displacement parameters for all hydrogen atoms . analysis of the absolute structure using likelihood methods ( hooft , 2008 ) was performed using platon ( spek , 2003 ). the results indicate that the absolute structure has been correctly assigned . the method calculates that the probability that the structure is correct is 100 . 0 . the hooft parameter is reported as 0 . 017 with an esd of 0 . 09 . the final r - index was 4 . 8 %. a final difference fourier revealed no missing or misplaced electron density . pertinent crystal , data collection and refinement information is summarized in table a . atomic coordinates , bond lengths , bond angles , torsion angles and displacement parameters are listed in tables b - e . platon , a . l . spek , j . appl . cryst . 2003 , 36 , 7 - 13 . mercury , c . f . macrae , p . r . edington , p . mccabe , e . pidcock , g . p . shields , r . taylor , m . towler , and j . van de streek , j . appl . cryst . 2006 , 39 , 453 - 457 . olex2 , o . v . dolomanov , l . j . bourhis , r . j . gildea , j . a . k . howard , and h . puschmann , j . appl . cryst . 2009 , 42 , 339 - 341 . r . w . w . hooft , l . h . straver , and a . l . spek , j . appl . cryst . 2008 , 41 , 96 - 103 . parameters ( å 2 × 10 3 ) for c14 . u ( eq ) is defined as one - third anisotropic displacement parameters ( å 2 × 10 3 ) for c14 . form : − 2π 2 [ h 2 a * 2 u 11 + . . . + 2 h k a * b * u 12 ]. zinc dust ( 97 . 5 %, 12 . 3 g , 183 mmol ) was added in one portion to a suspension of c14 ( 7 . 40 g , 23 . 0 mmol ) in methanol ( 100 ml ) and concentrated ammonium hydroxide ( 100 ml ). after 1 hour , the reaction mixture was filtered through diatomaceous earth ; the filter pad was rinsed with dichloromethane ( 70 ml ). the filtrate was diluted with water , and the aqueous layer was extracted with dichloromethane ( 2 × 60 ml ). the combined organic layers were dried over sodium sulfate , filtered , concentrated in vacuo , and purified via silica gel chromatography ( gradient : 40 % to 100 % ethyl acetate in heptane ) to provide the product . yield : 3 . 68 g , 12 . 6 mmol , 55 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 48 ( s , 1h ), 7 . 91 ( d , j = 8 . 9 hz , 1h ), 7 . 74 ( d , j = 2 . 2 hz , 1h ), 7 . 40 ( dd , j = 8 . 9 , 2 . 2 hz , 1h ), 4 . 02 ( br dd , j = 12 , 5 hz , 1h ), 3 . 88 ( br s , 2h ), 3 . 29 - 3 . 56 ( m , 4h ), 1 . 82 - 1 . 96 ( m , 2h ), 1 . 56 ( dddd , j = 12 , 12 , 12 , 5 hz , 1h ), 1 . 21 - 1 . 31 ( m , 1h ), 1 . 21 ( d , j = 6 . 2 hz , 3h ). to a mixture of c15 ( 400 mg , 1 . 37 mmol ) and ( 5 - methoxypyridin - 2 - yl ) acetic acid ( 229 mg , 1 . 37 mmol ) in n , n - dimethylformamide ( 3 ml ) was added n , n - diisopropylethylamine ( 532 mg , 4 . 12 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 1 . 31 g , 4 . 12 mmol , as a 50 % solution in ethyl acetate ). the reaction mixture was heated at 100 ° c . overnight , whereupon it was cooled to room temperature , combined with two similar , small - scale , reactions carried out on c15 ( total of 40 mg , 0 . 14 mmol ) and diluted with water ( 100 ml ). the resulting mixture was extracted with dichloromethane ( 2 × 200 ml ), and the combined organic layers were concentrated in vacuo . silica gel chromatography ( eluent : 2 % methanol in ethyl acetate ), followed by reversed phase hplc ( column : dikma diamonsil ( 2 ) c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 22 % to 42 % b ), afforded the product as a yellow solid . yield : 147 mg , 0 . 348 mmol , 23 %. lcms m / z 423 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 9 . 16 ( s , 1h ), 8 . 70 - 8 . 82 ( br m , 1h ), 8 . 17 - 8 . 22 ( m , 2h ), 7 . 75 ( dd , j = 8 . 8 , 2 . 1 hz , 1h ), 7 . 35 - 7 . 43 ( m , 2h ), 5 . 23 - 5 . 42 ( br m , 1h ), 4 . 69 ( s , 2h ), 4 . 18 - 4 . 26 ( m , 1h ), 3 . 86 ( s , 3h ), 3 . 61 - 3 . 76 ( br m , 2h ), 2 . 56 - 2 . 69 ( br m , 1h ), 2 . 24 - 2 . 41 ( br m , 1h ), 1 . 75 - 1 . 91 ( br m , 1h ), 1 . 61 - 1 . 75 ( br m , 1h ), 1 . 28 ( d , j = 6 . 2 hz , 3h ). 6 - bromo - 4 - chloro - 3 - nitroquinoline ( 1 . 93 g , 6 . 71 mmol ) was added to a solution of p2 ( 2 . 35 g , 8 . 86 mmol ) and n , n - diisopropylethylamine ( 3 . 4 ml , 20 mmol ) in acetonitrile ( 39 ml ), and the reaction mixture was heated to 45 ° c . for 18 hours . acetic acid ( 1 . 8 ml , 24 mmol ) was then added , and stirring was continued for 5 hours at 100 ° c ., whereupon the reaction mixture was allowed to cool to room temperature and stir for 18 hours . after solvent had been removed in vacuo , the residue was taken up in dichloromethane and washed with saturated aqueous sodium bicarbonate solution . the organic layer was loaded onto a silica gel column and eluted ( gradient : 0 % to 5 % methanol in dichloromethane ), affording the product as a brown oil . yield : 1 . 40 g , 3 . 82 mmol , 57 %. lcms m / z 366 . 0 , 368 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 37 ( s , 1h ), 9 . 13 ( br d , j = 9 hz , 1h ), 8 . 30 ( br d , j = 2 . 0 hz , 1h ), 7 . 91 ( br d , half of ab quartet , j = 8 . 8 hz , 1h ), 7 . 86 ( dd , half of abx pattern , j = 8 . 9 , 2 . 0 hz , 1h ), 4 . 21 - 4 . 32 ( m , 1h ), 4 . 12 ( ddd , j = 12 . 1 , 4 . 7 , 1 . 7 hz , 1h ), 3 . 52 - 3 . 60 ( m , 2h ), 2 . 11 - 2 . 21 ( m , 2h ), 1 . 78 ( dddd , j = 12 , 12 , 11 , 5 hz , 1h ), 1 . 49 ( ddd , j = 13 , 11 , 11 hz , 1h ), 1 . 28 ( d , j = 6 . 2 hz , 3h ). zinc ( 97 . 5 %, 2 . 33 g , 34 . 7 mmol ) was added in one portion to a 0 ° c . suspension of c16 ( 1 . 40 g , 3 . 82 mmol ) in methanol ( 6 ml ) and concentrated ammonium hydroxide ( 6 ml ), and the reaction mixture was stirred at 0 ° c . for 30 minutes . it was then allowed to warm to room temperature and stir for 45 minutes , whereupon it was filtered through diatomaceous earth . the filter cake was rinsed with dichloromethane , and the combined filtrates were diluted with water . the aqueous layer was extracted with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 3 % methanol in dichloromethane ) provided the product as a tan foam . yield : 836 mg , 2 . 49 mmol , 65 %. lcms m / z 336 . 1 , 338 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 49 ( s , 1h ), 7 . 92 ( d , j = 2 . 1 hz , 1h ), 7 . 84 ( d , j = 8 . 8 hz , 1h ), 7 . 53 ( dd , j = 8 . 9 , 2 . 1 hz , 1h ), 4 . 03 ( ddd , j = 11 . 8 , 4 . 7 , 1 . 7 hz , 1h ), 3 . 88 ( br s , 2h ), 3 . 33 - 3 . 56 ( m , 4h ), 1 . 82 - 1 . 96 ( m , 2h ), 1 . 50 - 1 . 62 ( m , 1h ), 1 . 26 ( ddd , j = 12 , 11 , 11 hz , 1h ), 1 . 21 ( d , j = 6 . 2 hz , 3h ). a mixture of c17 ( 836 mg , 2 . 49 mmol ), c6 ( 281 mg , 1 . 99 mmol ), 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 9 ml , 3 . 2 mmol ), and n , n - diisopropylethylamine ( 0 . 87 ml , 5 . 0 mmol ) in ethyl acetate ( 10 ml ) was stirred at 50 ° c . overnight . acetic acid ( 1 equivalent ) was added , and heating was continued at 115 ° c . for 5 hours , whereupon the reaction mixture was allowed to cool to room temperature and stir for 18 hours . after removal of volatiles in vacuo , the residue was taken up in dichloromethane and washed with saturated aqueous sodium bicarbonate solution . the organic layer was loaded onto a silica gel column and eluted ( gradient : 0 % to 5 % methanol in dichloromethane ) to provide the product as a tan solid . yield : 507 mg , 1 . 15 mmol , 58 %. lcms m / z 441 . 2 , 443 . 3 [ m + h ] + . tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 262 mg , 0 . 227 mmol ) was added to a mixture of c18 ( 500 mg , 1 . 13 mmol ) and zinc cyanide ( 99 %, 644 mg , 5 . 43 mmol ) in n , n - dimethylformamide ( 5 ml ), and the reaction flask was subjected to three cycles of evacuation followed by nitrogen fill . the reaction mixture was then heated at 100 ° c . for 20 hours , whereupon it was partitioned between water and ethyl acetate , and filtered through diatomaceous earth . the filter cake was rinsed with ethyl acetate , and the aqueous layer from the combined filtrates was extracted twice with ethyl acetate . the combined organic layers were washed 5 times with water , dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient , 0 % to 3 % methanol in methylene chloride ) provided a mixture of product and c18 ( 324 mg , ˜ 1 : 1 ), so this material was resubjected to the reaction conditions . tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 172 mg , 0 . 149 mmol ) was added to a mixture of zinc cyanide ( 99 %, 422 mg , 3 . 56 mmol ) and the material containing c18 and 3 ( 324 mg ) in n , n - dimethylformamide ( 2 ml ), and the reaction flask was subjected to three cycles of evacuation followed by nitrogen fill . the reaction mixture was then heated at 100 ° c . for 2 hours , partitioned between water and ethyl acetate , and filtered through diatomaceous earth . the filter cake was rinsed with ethyl acetate and with water , and the aqueous layer from the combined filtrates was extracted twice with ethyl acetate . the combined organic layers were washed 5 times with water , dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ) yielded an oil , which was triturated with diethyl ether to afford a tan solid . this was recrystallized from ethyl acetate / heptane to provide the product as an off - white solid . yield : 97 mg , 0 . 25 mmol , 22 %. lcms m / z 388 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 41 ( s , 1h ), 8 . 9 - 9 . 1 ( br m , 1h ), 8 . 38 ( d , j = 8 . 7 hz , 1h ), 7 . 86 ( dd , j = 8 . 6 , 1 . 5 hz , 1h ), 6 . 02 ( br s , 1h ), 5 . 15 - 5 . 28 ( br m , 1h ), 4 . 53 ( s , 2h ), 4 . 32 ( br dd , j = 12 , 5 hz , 1h ), 3 . 66 - 3 . 79 ( br m , 2h ), 2 . 53 - 2 . 69 ( br m , 1h ), 2 . 41 ( s , 3h ), 2 . 23 - 2 . 4 ( br m , 1h ), 1 . 66 - 1 . 96 ( br m , 2h ), 1 . 36 ( d , j = 6 . 2 hz , 3h ). a mixture of c15 ( 400 mg , 1 . 4 mmol ), ( 5 - methyl - 1 , 2 - oxazol - 3 - yl ) acetic acid ( 155 mg , 1 . 10 mmol ), 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 0 ml , 1 . 7 mmol ), and n , n - diisopropylethylamine ( 0 . 48 ml , 2 . 8 mmol ) in ethyl acetate ( 10 ml ) was stirred at 50 ° c . overnight . the reaction mixture was concentrated in vacuo to remove most of the ethyl acetate , then diluted with acetic acid and heated to 115 ° c . when the reaction was judged to be complete by lcms analysis , the reaction mixture was concentrated under reduced pressure , taken up in dichloromethane , and washed with saturated aqueous sodium bicarbonate solution . the aqueous layer was extracted once with dichloromethane , and the combined organic layers were adsorbed onto silica gel and chromatographed ( eluent : ethyl acetate ). the product ( 405 mg ) was mixed with diethyl ether and allowed to stir for 2 days , whereupon the solid was collected by filtration and washed with a mixture of 3 : 1 heptane / diethyl ether , to afford the product ( 239 mg ) as a solid . this material was shown to be crystalline via powder x - ray diffraction . the combined filtrates were concentrated in vacuo , mixed with diethyl ether ( 4 ml ), and stirred for 2 hours , whereupon heptane ( 1 ml ) was added . after 2 hours , heptane ( 2 ml ) was again added , and stirring was continued overnight . additional heptane ( 1 ml ) was added , and after stirring overnight once more , the solid present was isolated via filtration and rinsed with heptane , to provide additional product ( 99 mg ). total yield : 338 mg , 0 . 852 mmol , 77 %. lcms m / z 397 . 3 , 399 . 3 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 9 . 29 ( s , 1h ), 8 . 58 - 8 . 73 ( br m , 1h ), 8 . 23 ( d , j = 9 . 0 hz , 1h ), 7 . 64 ( dd , j = 8 . 8 , 2 . 0 hz , 1h ), 6 . 00 ( br s , 1h ), 5 . 09 - 5 . 25 ( br m , 1h ), 4 . 51 ( s , 2h ), 4 . 30 ( br dd , j = 12 , 5 hz , 1h ), 3 . 65 - 3 . 79 ( br m , 2h ), 2 . 59 - 2 . 77 ( br m , 1h ), 2 . 40 ( s , 3h ), 2 . 32 - 2 . 47 ( m , 1h ), 1 . 73 - 1 . 88 ( br m , 1h ), 1 . 35 ( d , j = 6 . 2 hz , 3h ). this experiment was carried out in two identical batches . to a 0 ° c . mixture of hydroxylamine hydrochloride ( 39 . 3 g , 566 mmol ) in ethanol ( 1 . 2 l ) was added triethylamine ( 86 g , 850 mmol ). after this mixture had stirred for 10 minutes , ethyl cyanoacetate ( 32 g , 280 mmol ) was added drop - wise , and the reaction mixture was allowed to warm to room temperature and stir overnight . additional triethylamine ( 86 g , 850 mmol ) was introduced , followed by acetic anhydride ( 89 . 5 g , 877 mmol ), and stirring was continued for 2 hours at room temperature . the reaction mixture was then stirred overnight at 90 ° c . at this point , the two batches were combined and concentrated in vacuo . the residue was partitioned between ethyl acetate ( 1 l ) and hydrochloric acid ( 1 m , 500 ml ), and the aqueous layer was extracted with ethyl acetate ( 2 × 100 ml ); the combined organic layers were washed with saturated aqueous sodium bicarbonate solution ( 1 l ) until the ph reached 7 , then dried over sodium sulfate , filtered , and concentrated under reduced pressure . silica gel chromatography ( gradient : 0 % to 20 % ethyl acetate in petroleum ether ) afforded the product as a colorless oil . yield : 20 . 0 g , 118 mmol , 21 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 4 . 20 ( q , j = 7 . 1 hz , 2h ), 3 . 76 ( s , 2h ), 2 . 58 ( s , 3h ), 1 . 26 ( t , j = 7 . 2 hz , 3h ). a mixture of c19 ( 4 . 30 g , 25 . 3 mmol ) and hydrochloric acid ( 2 m , 50 ml , 100 mmol ) was stirred for 2 days at room temperature , then warmed to 50 ° c . for 2 days . concentrated hydrochloric acid ( 2 ml ) was added , and heating was continued at 50 ° c . for 66 hours , whereupon the reaction mixture was cooled to room temperature and concentrated in vacuo , to a volume of approximately 10 ml . this was extracted eight times with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated under reduced pressure to afford the product as a white solid . yield : 2 . 85 g , 20 . 1 mmol , 79 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 43 ( br s , 1h ), 3 . 86 ( s , 2h ), 2 . 62 ( s , 3h ). a mixture of c15 ( 770 mg , 2 . 64 mmol ), c20 ( 300 mg , 2 . 11 mmol ), 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 2 . 0 ml , 3 . 4 mmol ), and n , n - diisopropylethylamine ( 0 . 92 ml , 5 . 3 mmol ) in ethyl acetate ( 10 ml ) was heated at 60 ° c . for 2 hours , then at reflux for 2 hours . additional 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 2 . 0 ml , 3 . 4 mmol ) was introduced , and heating at reflux was continued overnight . the reaction mixture was concentrated in vacuo to remove the majority of the ethyl acetate , then diluted with acetic acid and heated to 100 ° c . overnight . after removal of solvents under reduced pressure , the residue was taken up in dichloromethane and washed with saturated aqueous sodium bicarbonate solution ; the aqueous layer was extracted with dichloromethane , and the combined organic layers were adsorbed onto diatomaceous earth and chromatographed using silica gel ( gradient : 0 % to 5 % methanol in dichloromethane ). the product ( 739 mg ) was mixed with diethyl ether ( 7 ml ) and stirred for 2 days . the resulting solid was collected via filtration and rinsed with 3 : 1 heptane / diethyl ether , affording the product as an off - white solid ( 329 mg ). the combined filtrates were concentrated in vacuo , dissolved in diethyl ether ( 3 ml ) and stirred for 2 days . filtration and washing of the filter cake with 3 : 1 heptane / diethyl ether provided additional product as an off - white solid . combined yield : 390 mg , 0 . 98 mmol , 46 %. lcms m / z 398 . 2 , 400 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 29 ( s , 1h ), 8 . 56 - 8 . 78 ( br m , 1h ), 8 . 24 ( d , j = 8 . 8 hz , 1h ), 7 . 65 ( dd , j = 8 . 9 , 1 . 9 hz , 1h ), 4 . 94 - 5 . 17 ( br m , 1h ), 4 . 60 ( s , 2h ), 4 . 28 - 4 . 39 ( m , 1h ), 3 . 63 - 3 . 81 ( br m , 2h ), 2 . 67 - 2 . 88 ( br m , 1h ), 2 . 60 ( s , 3h ), 2 . 38 - 2 . 6 ( br m , 1h ), 1 . 80 - 2 . 08 ( br m , 2h ), 1 . 38 ( d , j = 6 . 2 hz , 3h ). compared to example 5 , the enantiomer of example 5 ( example 51 ) proved to be significantly less potent ( see table 3 for biological activity data ). the absolute configurations of separated enantiomers described herein were assigned on the basis of their relative biological activity in accordance with these two compounds . triethylamine ( 364 mg , 3 . 60 mmol ) was added to a mixture of 6 - bromo - 4 - chloro - 3 - nitroquinoline ( 515 mg , 1 . 79 mmol ) and ( 1 s , 3r )- 3 - fluorocyclopentanamine ( 250 mg , 2 . 4 mmol ) in tetrahydrofuran ( 10 ml ), and the reaction mixture was heated at 45 ° c . for 2 hours . it was then diluted with water ( 50 ml ) and extracted with ethyl acetate ( 3 × 20 ml ); the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo , providing the product as a yellow solid . yield : 439 mg , 1 . 24 mmol , 69 %. lcms m / z 355 . 6 [ m + h ] + . to a mixture of c21 ( 500 mg , 1 . 4 mmol ) in methanol ( 50 ml ) and acetonitrile ( 10 ml ) was added platinum ( iv ) oxide ( 50 mg , 0 . 22 mmol ). the suspension was degassed and purged with hydrogen three times , whereupon the reaction mixture was stirred at room temperature for 1 . 5 hours under a balloon of hydrogen . after filtration of the reaction mixture , the filter cake was washed with acetonitrile ( 3 × 10 ml ), and the combined filtrates were concentrated in vacuo to provide the product as a yellow oil . yield : 400 mg , 1 . 2 mmol , 86 %. lcms m / z 323 . 8 [ m + h ] + . a solution of c22 ( 90 mg , 0 . 28 mmol ) and acetic acid ( catalytic quantity ) in 1 , 1 , 1 - triethoxyethane ( 5 ml ) was stirred at 110 ° c . overnight , whereupon the reaction mixture was concentrated in vacuo . purification via reversed phase hplc ( column : ymc - actus triart c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 25 % to 45 % b ) provided the product as a yellow solid . yield : 30 . 2 mg , 86 . 7 μmol , 31 %. lcms m / z 350 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 22 ( s , 1h ), 8 . 69 - 8 . 73 ( m , 1h ), 8 . 11 ( d , j = 9 . 0 hz , 1h ), 7 . 86 ( dd , j = 8 . 9 , 1 . 9 hz , 1h ), 5 . 40 - 5 . 53 ( m , 1 . 5h ), 5 . 31 - 5 . 38 ( m , 0 . 5h ), 2 . 8 - 2 . 96 ( m , 1h ), 2 . 78 ( s , 3h ), 2 . 01 - 2 . 5 ( m , 5h ). concentrated nitric acid ( 1 . 5 ml ) was added to a solution of 1 , 5 - naphthyridin - 4 - ol ( 600 mg , 4 . 1 mmol ) in concentrated sulfuric acid ( 4 . 5 ml ), and the reaction mixture was stirred at 90 ° c . overnight . it was then poured into water , cooled in an ice bath , and adjusted to a ph of 6 - 7 by addition of aqueous ammonium hydroxide . the resulting mixture was stirred in the ice bath for 10 minutes , then filtered ; the collected solid was washed with water to afford the product as a yellow solid . yield : 0 . 60 g , 3 . 1 mmol , 76 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 96 ( s , 1h ), 8 . 55 - 8 . 60 ( m , 1h ), 7 . 98 ( br d , j = 8 . 2 hz , 1h ), 7 . 54 ( dd , j = 8 . 3 , 4 . 3 hz , 1h ). phosphorus oxychloride ( 624 mg , 4 . 08 mmol ) was added drop - wise to a solution of c23 ( 0 . 60 g , 3 . 1 mmol ) in n , n - dimethylformamide ( 10 ml ). the reaction mixture was stirred at room temperature for 2 hours , whereupon it was poured into ice water ( 80 ml ). the resulting mixture was filtered and the filter cake was washed with water ( 30 ml ), affording the product as a yellow solid . yield : 0 . 36 g , 1 . 7 mmol , 55 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 50 ( s , 1h ), 9 . 28 ( dd , j = 4 . 1 , 1 . 5 hz , 1h ), 8 . 65 ( dd , j = 8 . 5 , 1 . 5 hz , 1h ), 8 . 09 ( dd , j = 8 . 5 , 4 . 1 hz , 1h ). triethylamine ( 580 mg , 5 . 7 mmol ) was added to a mixture of c24 ( 600 mg , 2 . 9 mmol ) and p1 ( 761 mg , 2 . 87 mmol ) in n , n - dimethylformamide ( 10 ml ). the reaction mixture was heated at 50 ° c . for 1 hour , whereupon it was diluted with water ( 50 ml ) and extracted with ethyl acetate ( 3 × 30 ml ). after the combined organic layers had been washed with saturated aqueous sodium chloride solution ( 100 ml ), they were dried over sodium sulfate , filtered , and concentrated in vacuo . chromatography on silica gel ( gradient : 0 % to 40 % ethyl acetate in petroleum ether ) provided the product as a yellow solid . yield : 1 . 0 g , 2 . 3 mmol , 80 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 96 ( s , 1h ), 8 . 90 ( dd , j = 4 . 1 , 1 . 7 hz , 1h ), 8 . 29 ( dd , j = 8 . 5 , 1 . 7 hz , 1h ), 7 . 65 ( dd , j = 8 . 5 , 4 . 1 hz , 1h ), 6 . 89 ( d , j = 9 . 0 hz , 1h ), 6 . 16 - 6 . 20 ( m , 2h ), 4 . 76 - 4 . 86 ( m , 1h ), 4 . 56 ( ab quartet , j ab = 16 . 1 hz , δν ab = 18 . 6 hz , 2h ), 4 . 07 - 4 . 14 ( m , 1h ), 3 . 69 ( s , 3h ), 3 . 47 - 3 . 55 ( m , 2h ), 3 . 46 ( s , 3h ), 2 . 25 - 2 . 34 ( m , 2h ), 2 . 04 - 2 . 16 ( m , 1h ), 1 . 76 - 1 . 88 ( m , 1h ), 1 . 27 ( d , j = 6 . 3 hz , 3h ). a mixture of c25 ( 1 . 0 g , 2 . 3 mmol ) and trifluoroacetic acid ( 20 ml ) was stirred at room temperature for 30 minutes , whereupon it was concentrated in vacuo . after the residue had been adjusted to a ph of 7 - 8 via addition of saturated aqueous sodium bicarbonate solution ( 100 ml ), it was extracted with ethyl acetate ( 3 × 30 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated under reduced pressure to afford the product as a yellow solid . yield : 0 . 60 g , 2 . 1 mmol , 91 %. 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 9 . 41 ( br s , 1h ), 8 . 83 ( dd , j = 4 . 1 , 1 . 6 hz , 1h ), 8 . 29 ( br dd , j = 8 . 4 , 1 . 6 hz , 1h ), 7 . 69 ( dd , j = 8 . 5 , 4 . 1 hz , 1h ), 4 . 11 ( br dd , j = 12 , 4 hz , 1h ), 3 . 59 - 3 . 69 ( m , 2h ), 2 . 15 - 2 . 30 ( m , 2h ), 1 . 61 - 1 . 74 ( m , 1h ), 1 . 35 - 1 . 45 ( m , 1h ), 1 . 28 ( d , j = 6 . 3 hz , 3h ). to a suspension of c26 ( 600 mg , 2 . 1 mmol ) in tetrahydrofuran ( 10 ml ) and water ( 5 ml ) was added zinc dust ( 677 mg , 10 . 4 mmol ) and ammonium chloride ( 551 mg , 10 . 3 mmol ). the reaction mixture was then stirred at 60 ° c . for 40 minutes , whereupon it was diluted with water ( 50 ml ) and extracted with ethyl acetate ( 3 × 50 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo to afford the product as a yellow solid . yield : 0 . 40 g , 1 . 5 mmol , 71 %. lcms m / z 259 . 0 [ m + h ] + . 1 , 1 ′- carbonyldiimidazole ( cdi , 250 mg , 1 . 54 mmol ) was added to a mixture of c27 ( 200 mg , 0 . 77 mmol ) and 1 , 3 - thiazol - 4 - ylacetic acid ( 138 mg , 0 . 964 mmol ) in n , n - dimethylformamide ( 3 ml ). the reaction mixture was heated at 50 ° c . overnight , whereupon it was diluted with water ( 30 ml ) and extracted with ethyl acetate ( 3 × 30 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated under reduced pressure to afford the product , which was carried directly into the following step . lcms m / z 384 . 2 [ m + h ] + . compound c28 ( from the previous step , 295 mg , & lt ; 0 . 77 mmol ) and acetic acid ( 2 ml ) were combined in a sealed tube and heated in a microwave reactor at 155 ° c . for 20 minutes . the reaction mixture was concentrated in vacuo and purified by reversed phase hplc ( column : ymc - actus triart c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 23 % to 43 % b ) to afford a racemic mixture of the products as a yellow solid . yield : 25 mg , 68 μmol , 9 % over 2 steps . the component enantiomers were separated via supercritical fluid chromatography ( column : chiralcel od - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). example 7 , the second - eluting enantiomer , was isolated as a yellow solid . yield : 9 . 0 mg , 25 μmol , 3 % over two steps . retention time : 6 . 37 minutes ( analytical column : chiralcel od - 3 , 4 . 6 × 150 mm , 3 μm ; same gradient as above ; flow rate : 1 . 5 ml / minute ). lcms m / z 366 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 26 ( s , 1h ), 9 . 05 ( d , j = 1 . 9 hz , 1h ), 9 . 02 ( dd , j = 4 . 3 , 1 . 6 hz , 1h ), 8 . 53 ( dd , j = 8 . 5 , 1 . 7 hz , 1h ), 7 . 74 ( dd , j = 8 . 5 , 4 . 3 hz , 1h ), 7 . 65 ( br s , 1h ), 4 . 86 - 5 . 05 ( br m , 1h ), 4 . 76 ( s , 2h ), 3 . 96 - 4 . 05 ( m , 1h ), 3 . 44 - 3 . 60 ( m , 2h ), 3 . 13 - 3 . 3 ( br m , 1h ), 2 . 85 - 3 . 07 ( br m , 1h ), 1 . 31 - 1 . 55 ( br m , 2h ), 1 . 13 ( d , j = 6 . 2 hz , 3h ). enantiomer c29 eluted first , and was also isolated as a yellow solid . yield : 6 . 5 mg , 18 μmol , 2 % over two steps . retention time : 6 . 16 minutes using an identical analytical hplc system . lcms m / z 366 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 26 ( s , 1h ), 9 . 05 ( d , j = 2 . 0 hz , 1h ), 9 . 02 ( dd , j = 4 . 1 , 1 . 6 hz , 1h ), 8 . 53 ( dd , j = 8 . 4 , 1 . 6 hz , 1h ), 7 . 74 ( dd , j = 8 . 4 , 4 . 3 hz , 1h ), 7 . 65 ( br s , 1h ), 4 . 86 - 5 . 05 ( br m , 1h ), 4 . 76 ( s , 2h ), 3 . 97 - 4 . 04 ( m , 1h ), 3 . 44 - 3 . 60 ( m , 2h ), 3 . 14 - 3 . 28 ( br m , 1h ), 2 . 86 - 3 . 08 ( br m , 1h ), 1 . 31 - 1 . 56 ( br m , 2h ), 1 . 13 ( d , j = 6 . 2 hz , 3h ). a solution of 1 , 3 , 4 - thiadiazol - 2 - amine ( 3 . 0 g , 30 mmol ) and ethyl 4 - chloro - 3 - oxobutanoate ( 7 . 4 g , 45 mmol ) in anhydrous ethanol ( 50 ml ) was heated at reflux for 24 hours , whereupon the reaction mixture was concentrated in vacuo . the residue was dissolved in 10 % hydrochloric acid , and washed with chloroform ( 3 × 50 ml ); the aqueous layer was then neutralized with sodium bicarbonate and extracted with chloroform ( 3 × 50 ml ). the combined organic extracts were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo to provide the product as a yellow oil . yield : 1 . 0 g , 4 . 7 mmol , 16 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 51 ( s , 1h ), 7 . 80 ( t , j = 0 . 7 hz , 1h ), 4 . 21 ( q , j = 7 . 2 hz , 2h ), 3 . 77 ( d , j = 0 . 6 hz , 2h ), 1 . 29 ( t , j = 7 . 2 hz , 3h ). a solution of c30 ( 1 . 0 g , 4 . 7 mmol ) in hydrochloric acid ( 5 ml ) was heated at reflux overnight . the reaction mixture was then concentrated in vacuo , and the residue was washed with dichloromethane ( 10 ml ) to afford the product as a brown solid . yield : 1 g , quantitative . lcms m / z 184 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 40 ( s , 1h ), 8 . 28 ( br s , 1h ), 3 . 79 ( br s , 2h ). to a mixture of c15 ( 850 mg , 2 . 91 mmol ) and c31 ( 640 mg , 3 . 5 mmol ) in n , n - dimethylformamide ( 20 ml ) was added n , n - diisopropylethylamine ( 828 mg , 6 . 41 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 5 . 5 g , 8 . 6 mmol ). the reaction mixture was heated at 100 ° c . overnight , whereupon it was diluted with water ( 50 ml ) and extracted with dichloromethane ( 3 × 50 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 150 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( eluent : 10 : 1 dichloromethane / methanol ) provided the product as a yellow solid . yield : 372 mg , 0 . 848 mmol , 29 %. lcms m / z 438 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 29 ( s , 1h ), 8 . 60 - 8 . 75 ( br m , 1h ), 8 . 53 ( s , 1h ), 8 . 22 ( d , j = 8 . 8 hz , 1h ), 7 . 79 ( s , 1h ), 7 . 63 ( dd , j = 8 . 7 , 1 . 9 hz , 1h ), 5 . 29 - 5 . 42 ( m , 1h ), 4 . 58 ( br s , 2h ), 4 . 30 ( br dd , j = 12 , 5 hz , 1h ), 3 . 65 - 3 . 80 ( br m , 2h ), 2 . 61 - 2 . 82 ( br m , 1h ), 2 . 34 - 2 . 54 ( br m , 1h ), 1 . 71 - 1 . 97 ( br m , 2h ), 1 . 35 ( d , j = 6 . 2 hz , 3h ). a mixture of c15 ( 280 mg , 0 . 96 mmol ), cyanoacetic acid ( 65 . 3 mg , 0 . 768 mmol ), 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 635 mg , 2 . 00 mmol , as a 50 % solution in ethyl acetate ), and n , n - diisopropylethylamine ( 0 . 34 ml , 2 . 0 mmol ) in ethyl acetate ( 8 ml ) was stirred for 1 hour , then treated with additional 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 0 ml , 1 . 7 mmol ) and heated at reflux overnight . the reaction mixture was cooled to room temperature , diluted with additional ethyl acetate and washed with saturated aqueous sodium bicarbonate solution . the aqueous layer was extracted with ethyl acetate , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . chromatography on silica gel ( gradient : 50 % to 100 % ethyl acetate in heptane ) afforded the product as a white solid . yield : 159 mg , 0 . 466 mmol , 61 %. lcms m / z 341 . 2 , 343 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 30 ( s , 1h ), 8 . 5 - 8 . 8 ( v br m , 1h ), 8 . 26 ( d , j = 9 . 0 hz , 1h ), 7 . 69 ( dd , j = 8 . 8 , 2 . 0 hz , 1h ), 4 . 8 - 5 . 1 ( v br m , 1h ), 4 . 35 - 4 . 43 ( m , 1h ), 4 . 29 ( s , 2h ), 3 . 73 - 3 . 86 ( m , 2h ), 2 . 35 - 2 . 95 ( v br m , 2h ), 2 . 05 - 2 . 29 ( br m , 2h ), 1 . 41 ( d , j = 6 . 0 hz , 3h ). a mixture of c15 ( 889 mg , 3 . 05 mmol ), 1 , 3 - thiazol - 4 - ylacetic acid ( 438 mg , 2 . 44 mmol ), 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 2 . 3 ml , 3 . 9 mmol ), and n , n - diisopropylethylamine ( 1 . 1 ml , 6 . 3 mmol ) in ethyl acetate ( 14 ml ) was stirred for 1 hour and 45 minutes at room temperature , then heated at 50 ° c . for 1 hour . acetic acid ( 30 ml ) was added , and the reaction mixture was stirred at 115 ° c . for 66 hours . solvents were removed in vacuo ; the residue was diluted with saturated aqueous sodium bicarbonate solution and extracted three times with ethyl acetate . the combined organic layers were dried over magnesium sulfate , filtered , and concentrated under reduced pressure . after silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ), the material obtained from the clean fractions was dissolved in ethyl acetate , treated with activated charcoal , and filtered . the filtrate was concentrated in vacuo and purified via silica gel chromatography ( eluent : diethyl ether ) to afford the product as a white foam . yield : 584 mg , 1 . 46 mmol , 60 %. lcms m / z 399 . 2 , 401 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 9 . 29 ( s , 1h ), 8 . 80 - 8 . 83 ( m , 1h ), 8 . 58 - 8 . 71 ( br m , 1h ), 8 . 22 ( d , j = 8 . 9 hz , 1h ), 7 . 63 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 7 . 24 ( br s , 1h ), 5 . 20 - 5 . 34 ( m , 1h ), 4 . 72 ( s , 2h ), 4 . 29 ( br dd , j = 12 , 5 hz , 1h ), 3 . 60 - 3 . 76 ( br m , 2h ), 2 . 60 - 2 . 80 ( br m , 1h ), 2 . 33 - 2 . 51 ( br m , 1h ), 1 . 7 - 1 . 87 ( br m , 1h ), 1 . 34 ( d , j = 6 . 0 hz , 3h ). 3 - chloroperoxybenzoic acid ( mcpba , 547 mg , 3 . 17 mmol ) was added to a solution of c32 ( 972 mg , 2 . 44 mmol ) in dichloromethane ( 12 ml ). after stirring at room temperature overnight , the reaction mixture was treated with saturated aqueous sodium bicarbonate solution ( 30 ml ) and stirred for an additional 20 minutes . the aqueous layer was extracted three times with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ) provided the product as a yellow solid . yield : 1 . 0 g , 2 . 4 mmol , 98 %. lcms m / z 415 . 3 , 417 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 9 . 05 ( d , j = 9 . 4 hz , 1h ), 9 . 03 ( s , 1h ), 8 . 81 ( d , j = 1 . 8 hz , 1h ), 8 . 63 - 8 . 76 ( br m , 1h ), 7 . 70 ( dd , j = 9 . 4 , 1 . 8 hz , 1h ), 5 . 23 - 5 . 36 ( m , 1h ), 4 . 68 ( s , 2h ), 4 . 30 ( dd , j = 12 . 1 , 5 . 1 hz , 1h ), 3 . 61 - 3 . 80 ( m , 2h ), 2 . 53 - 2 . 71 ( br m , 1h ), 2 . 25 - 2 . 42 ( br m , 1h ), 1 . 78 - 1 . 93 ( br m , 1h ), 1 . 65 - 1 . 78 ( br m , 1h ), 1 . 34 ( d , j = 6 . 2 hz , 3h ). phosphorus oxychloride ( 98 %, 0 . 17 ml , 1 . 8 mmol ) was added to a solution of c33 ( 300 mg , 0 . 72 mmol ) in chloroform ( 4 ml ), and the reaction mixture was heated to 70 ° c . for 1 . 5 hours . after cooling to room temperature , it was poured into a stirring mixture of water and dichloromethane and allowed to stir for 20 minutes . the mixture was basified via addition of saturated aqueous sodium bicarbonate solution ; the aqueous layer was extracted once with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 50 % to 100 % ethyl acetate in heptane ) provided the product as a white foam . yield : 290 mg , 0 . 669 mmol , 93 %. lcms m / z 433 . 2 , 435 . 2 , 437 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 78 ( d , j = 1 . 8 hz , 1h ), 8 . 56 - 8 . 67 ( br m , 1h ), 8 . 07 ( d , j = 8 . 9 hz , 1h ), 7 . 59 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 7 . 23 - 7 . 29 ( br m , 1h ), 5 . 23 - 5 . 35 ( m , 1h ), 4 . 75 ( s , 2h ), 4 . 26 ( dd , j = 11 . 9 , 4 . 9 hz , 1h ), 3 . 57 - 3 . 72 ( m , 2h ), 2 . 53 - 2 . 74 ( br m , 1h ), 2 . 26 - 2 . 46 ( br m , 1h ), 1 . 69 - 1 . 83 ( br m , 1h ), 1 . 55 - 1 . 69 ( br m , 1h ), 1 . 31 ( d , j = 6 . 2 hz , 3h ). compound c34 ( 45 mg , 0 . 10 mmol ) was combined with zinc dust ( 98 %, 55 . 5 mg , 0 . 832 mmol ) in ( 2 h 4 ) acetic acid ( 0 . 5 ml ) and heated at 100 ° c . for 15 minutes . the reaction mixture was cooled to room temperature , treated with 1 m aqueous sodium hydroxide solution , and extracted with dichloromethane . the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . the residue was mixed with acetic acid ( 2 ml ) and heated to 100 ° c . for 10 minutes ; after removal of solvent under reduced pressure , the residue was dissolved in dichloromethane and washed with saturated aqueous sodium bicarbonate solution . the aqueous layer was extracted once with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( eluent : ethyl acetate , followed by a gradient of 0 % to 5 % methanol in dichloromethane ) afforded the product as a white solid . yield : 10 . 1 mg , 25 . 3 μmol , 25 %. this material exhibited − 85 % deuterium incorporation by 1 h nmr analysis . lcms m / z 400 . 3 , 402 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 9 . 29 ( residual protio peak ), 8 . 81 ( d , j = 1 . 8 hz , 1h ), 8 . 59 - 8 . 70 ( br m , 1h ), 8 . 22 ( d , j = 9 . 0 hz , 1h ), 7 . 63 ( dd , j = 9 . 0 , 2 . 1 hz , 1h ), 7 . 22 - 7 . 25 ( m , 1h ), 5 . 20 - 5 . 33 ( m , 1h ), 4 . 73 ( s , 2h ), 4 . 29 ( br dd , j = 12 , 5 hz , 1h ), 3 . 61 - 3 . 75 ( br m , 2h ), 2 . 61 - 2 . 79 ( br m , 1h ), 2 . 33 - 2 . 52 ( br m , 1h ), 1 . 70 - 1 . 85 ( br m , 1h ), 1 . 34 ( d , j = 6 . 2 hz , 3h ). n , n - diisopropylethylamine ( 828 mg , 6 . 41 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 5 . 5 g , 8 . 7 mmol ) were added to a mixture of c15 ( 850 mg , 2 . 91 mmol ) and ( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) acetic acid ( 493 mg , 3 . 49 mmol ) in n , n - dimethylformamide ( 20 ml ). the reaction mixture was heated at 100 ° c . overnight , whereupon it was diluted with water ( 50 ml ) and extracted with dichloromethane ( 3 × 50 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 150 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . purification via reversed phase hplc ( column : ymc - actus triart c18 , 5 μm ; mobile phase a : water containing 0 . 225 % formic acid ; mobile phase b : acetonitrile ; eluent : 42 % b ) afforded the product as a yellow solid . yield : 340 mg , 0 . 86 mmol , 30 %. lcms m / z 396 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 31 ( s , 1h ), 8 . 58 - 8 . 72 ( br m , 1h ), 8 . 23 ( d , j = 8 . 9 hz , 1h ), 7 . 67 ( dd , j = 8 . 9 , 2 . 0 hz , 1h ), 7 . 47 ( br s , 1h ), 5 . 99 ( s , 2h ), 5 . 30 - 5 . 42 ( m , 1h ), 4 . 29 ( br dd , j = 12 , 5 hz , 1h ), 3 . 68 - 3 . 81 ( m , 2h ), 2 . 56 - 2 . 74 ( br m , 1h ), 2 . 32 ( s , 3h ), 2 . 3 - 2 . 46 ( br m , 1h ), 1 . 43 - 1 . 90 ( 2 br m , 2h , assumed ; partially obscured by water peak ), 1 . 34 ( d , j = 6 . 0 hz , 3h ). a mixture of c15 ( 500 mg , 1 . 71 mmol ) and ( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) acetic acid ( 247 mg , 1 . 75 mmol ) was purged three times with nitrogen and then mixed with toluene ( 5 . 7 ml ). n , n - diisopropylethylamine ( 0 . 30 ml , 1 . 72 mmol ) was added , followed by 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 48 ml , 2 . 49 mmol ). the reaction mixture was heated to 70 ° c . for 70 minutes , at which time lcms analysis indicated consumption of starting material and an approximately 2 : 1 ratio of intermediate amide : 11 . the reaction mixture was then heated at 110 ° c . for 3 hours , whereupon it was cooled , diluted with ethyl acetate , and washed with saturated aqueous sodium bicarbonate solution . the organic layer was dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 10 % methanol in dichloromethane ) afforded the product as a solid . yield : 585 mg , 1 . 47 mmol , 86 %. lcms m / z 397 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 30 ( s , 1h ), 8 . 55 - 8 . 73 ( br m , 1h ), 8 . 23 ( d , j = 9 . 0 hz , 1h ), 7 . 66 ( dd , j = 8 . 8 , 2 . 2 hz , 1h ), 7 . 43 - 7 . 50 ( br m , 1h ), 5 . 99 ( s , 2h ), 5 . 29 - 5 . 42 ( m , 1h ), 4 . 29 ( br dd , j = 12 . 1 , 4 . 7 hz , 1h ), 3 . 65 - 3 . 81 ( m , 2h ), 2 . 54 - 2 . 75 ( br m , 1h ), 2 . 31 ( s , 3h ), 2 . 24 - 2 . 47 ( br m , 1h ), 1 . 43 - 1 . 75 ( br m , 2h ), 1 . 34 ( d , j = 6 . 1 hz , 3h ). n , n - diisopropylethylamine ( 8 . 33 ml , 47 . 8 mmol ) was added to a suspension of c13 ( 3 . 32 g , 13 . 7 mmol ) and p3 ( 2 . 00 g , 14 . 3 mmol ) in acetonitrile ( 80 ml ). the reaction mixture was stirred at room temperature for 5 minutes and then heated to 55 ° c . for 6 hours , whereupon it was cooled to room temperature . after addition of aqueous sodium bicarbonate solution , the mixture was extracted with dichloromethane , and the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 40 % ethyl acetate in heptane ) provided the product as a solid . yield : 3 . 78 g , 12 . 2 mmol , 89 %. lcms m / z 310 . 3 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 79 ( br d , 1h ), 9 . 35 ( s , 1h ), 8 . 23 ( d , j = 2 . 3 hz , 1h ), 7 . 95 ( d , j = 9 . 0 hz , 1h ), 7 . 71 ( dd , j = 9 . 0 , 2 . 2 hz , 1h ), [ 5 . 38 - 5 . 43 ( m ) and 5 . 25 - 5 . 30 ( m ), total 1h ], 4 . 71 - 4 . 80 ( m , 1h ), 2 . 43 - 2 . 54 ( m , 1h ), 2 . 27 - 2 . 43 ( m , 3h ), 2 . 15 - 2 . 27 ( m , 1h ), 1 . 87 - 2 . 08 ( m , 1h ). zinc ( 8 . 66 g , 132 mmol ) was added in one portion to a mixture of c53 ( 4 . 00 g , 12 . 9 mmol ) in methanol ( 64 ml ) and concentrated ammonium hydroxide ( 64 ml ). after 2 hours at room temperature , the reaction mixture was filtered through diatomaceous earth , and the filter pad was washed with dichloromethane and methanol . the combined filtrates were concentrated in vacuo ; the residue was diluted with water and extracted with dichloromethane ( 3 × 100 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated under reduced pressure . silica gel chromatography ( gradient : 0 % to 60 % ethyl acetate in heptane , followed by 100 % ethyl acetate ) and subsequent trituration with diethyl ether afforded the product as a solid . yield : 1 . 68 g , 6 . 01 mmol , 47 %. lcms m / z 280 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 47 ( s , 1h ), 7 . 89 ( d , j = 9 . 0 hz , 1h ), 7 . 85 ( d , j = 2 . 2 hz , 1h ), 7 . 39 ( dd , j = 8 . 9 , 2 . 2 hz , 1h ), [ 5 . 36 - 5 . 41 ( m ) and 5 . 23 - 5 . 28 ( m ), j hf = 54 hz , total 1h ], 4 . 16 - 4 . 26 ( m , 1h ), 3 . 81 - 3 . 92 ( m , 3h ), 1 . 78 - 2 . 34 ( m , 6h ). n , n - diisopropylethylamine ( 0 . 280 ml , 1 . 61 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 0 . 958 ml , 1 . 61 mmol ) were added to a mixture of c54 ( 150 mg , 0 . 536 mmol ) and ( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) acetic acid ( 75 . 7 mg , 0 . 536 mmol ) in ethyl acetate ( 3 . 2 ml ). the reaction mixture was heated at 80 ° c . overnight , whereupon it was diluted with ethyl acetate and washed with water . the aqueous layer was extracted once with ethyl acetate , and the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . chromatography on silica gel ( gradient : 0 % to 5 % methanol in dichloromethane ), followed by trituration with heptane containing a small amount of ethyl acetate , provided a mixture of 93 and c55 as an off - white solid . yield of racemic product : 148 mg , 0 . 384 mmol , 72 %. the component enantiomers were separated using supercritical fluid chromatography [ column : phenomenex lux amylose - 1 , 5 μm ; mobile phase : 7 : 3 carbon dioxide /( 1 : 1 acetonitrile / methanol )]. the first - eluting enantiomer was triturated with diethyl ether to afford 93 , obtained as a white solid . yield : 52 mg . 0 . 135 mmol , 35 % for the separation . lcms m / z 385 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 31 ( s , 1h ), 8 . 49 - 8 . 53 ( m , 1h ), 8 . 22 ( d , j = 9 . 0 hz , 1h ), 7 . 67 ( dd , j = 9 . 0 , 2 . 2 hz , 1h ), 7 . 47 ( br s , 1h ), 5 . 99 ( ab quartet , j ab = 15 . 6 hz , δν ab = 11 . 0 hz , 2h ), [ 5 . 43 - 5 . 56 ( m ) and 5 . 32 - 5 . 38 ( m ), total 2h ], 2 . 42 - 2 . 78 ( m , 4h ), 2 . 33 ( d , j = 0 . 6 hz , 3h ), 1 . 98 - 2 . 18 ( m , 1h ), 1 . 88 - 1 . 98 ( m , 1h ). the second - eluting enantiomer was c55 , also isolated as a white solid after trituration with diethyl ether . yield : 58 mg , 0 . 151 mmol , 39 % for the separation . lcms m / z 385 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 31 ( s , 1h ), 8 . 49 - 8 . 53 ( m , 1h ), 8 . 22 ( d , j = 9 . 0 hz , 1h ), 7 . 67 ( dd , j = 9 . 0 , 2 . 2 hz , 1h ), 7 . 47 ( br s , 1h ), 5 . 99 ( ab quartet , j ab = 15 . 6 hz , δν ab = 11 . 0 hz , 2h ), [ 5 . 43 - 5 . 56 ( m ) and 5 . 32 - 5 . 38 ( m ), total 2h ], 2 . 42 - 2 . 77 ( m , 4h ), 2 . 33 ( d , j = 0 . 6 hz , 3h ), 1 . 98 - 2 . 18 ( m , 1h ), 1 . 88 - 1 . 98 ( m , 1h ). a reaction vessel containing a mixture of c53 ( 6 . 00 g , 19 . 4 mmol ), potassium ferrocyanide ( ii ) trihydrate ( 4 . 09 g , 9 . 68 mmol ), [( 2 - di - tert - butylphosphino - 2 ′, 4 ′, 6 ′- triisopropyl - 1 , 1 ′- biphenyl )- 2 -( 2 ′- amino - 1 , 1 ′- biphenyl )] palladium ( ii ) methanesulfonate ( tbuxphos pd g3 precatalyst ; 769 mg , 0 . 968 mmol ), and di - tert - butyl [ 2 ′, 4 ′, 6 ′- tri ( propan - 2 - yl ) biphenyl - 2 - yl ] phosphane ( 411 mg , 0 . 968 mmol ) was evacuated and charged with nitrogen . this evacuation cycle was repeated twice , and then 1 , 4 - dioxane ( previously degassed by bubbling nitrogen through it for 2 hours with vigorous stirring ; 39 ml ) and aqueous potassium acetate solution ( 0 . 0625 m , prepared using degassed deionized water ; 38 . 7 ml , 2 . 42 mmol ) were added . the reaction mixture was placed into a preheated 100 ° c . oil bath and stirred at 100 ° c . for 2 hours , whereupon it was removed from the oil bath , cooled to room temperature , and partitioned between ethyl acetate and saturated aqueous sodium bicarbonate solution . the aqueous layer was extracted with ethyl acetate ( 3 × 100 ml ) and dichloromethane ( 100 ml ), and the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . the residue was triturated with dichloromethane and heptane , and the resulting solid was recrystallized from dichloromethane / heptane to provide the product as a solid . yield : 4 . 70 g , 15 . 6 mmol , 80 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 98 - 10 . 09 ( br m , 1h ), 9 . 46 ( s , 1h ), 8 . 61 ( d , j = 1 . 8 hz , 1h ), 8 . 09 ( d , half of ab quartet , j = 8 . 6 hz , 1h ), 7 . 92 ( dd , half of abx pattern , j = 8 . 8 , 1 . 8 hz , 1h ), [ 5 . 42 - 5 . 46 ( m ) and 5 . 29 - 5 . 33 ( m ), total 1h ], 4 . 71 - 4 . 80 ( m , 1h ), 2 . 48 - 2 . 59 ( m , 1h ), 2 . 29 - 2 . 46 ( m , 3h ), 2 . 19 - 2 . 29 ( m , 1h ), 1 . 92 - 2 . 13 ( m , 1h ). zinc ( 4 . 46 g , 66 . 4 mmol ) was added in one portion to a mixture of c56 ( 2 . 00 g , 6 . 63 mmol ) in methanol ( 33 ml ) and concentrated ammonium hydroxide ( 33 ml ). after 1 hour , the reaction mixture was filtered through a pad of diatomaceous earth ; the filter pad was rinsed with dichloromethane and a small amount of methanol , and the combined filtrates were diluted with a 1 : 1 mixture of water and saturated aqueous sodium chloride solution . the aqueous layer was extracted with dichloromethane , and the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . trituration of the residue with diethyl ether for 30 minutes provided the product as a yellow solid . yield : 1 . 49 g , 5 . 51 mmol , 83 %. lcms m / z 271 . 4 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 58 ( s , 1h ), 8 . 28 ( d , j = 1 . 6 hz , 1h ), 8 . 02 ( d , j = 8 . 6 hz , 1h ), 7 . 60 ( dd , j = 8 . 7 , 1 . 7 hz , 1h ), [ 5 . 39 - 5 . 44 ( m ) and 5 . 26 - 5 . 30 ( m ), j hf = 53 hz , total 1h ], 4 . 23 - 4 . 33 ( m , 1h ), 3 . 98 - 4 . 07 ( m , 1h ), 3 . 91 ( br s , 2h ), 2 . 20 - 2 . 36 ( m , 1h ), 2 . 04 - 2 . 18 ( m , 2h ), 1 . 81 - 2 . 03 ( m , 3h ). n , n - diisopropylethylamine ( 0 . 374 ml , 2 . 15 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 28 ml , 2 . 15 mmol ) were added to a mixture of c57 ( 200 mg , 0 . 740 mmol ) and ( 4 - methyl - 1h - pyrazol - 1 - yl ) acetic acid ( 100 mg , 0 . 714 mmol ) in ethyl acetate ( 4 . 4 ml ), and the reaction mixture was heated at 80 ° c . overnight . it was then partitioned between ethyl acetate and water . the aqueous layer was extracted with ethyl acetate , and the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ), followed by trituration with diethyl ether , provided a mixture of 94 and c58 as an off - white solid . yield of racemic material : 203 mg , 0 . 542 mmol , 76 %. this was separated into its component enantiomers using supercritical fluid chromatography [ column : chiral technologies chiralpak ad - h , 5 μm ; mobile phase : 4 : 1 carbon dioxide /( ethanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting enantiomer was 94 , isolated as a white solid . yield : 78 mg , 0 . 21 mmol , 39 % for the separation . lcms m / z 375 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 43 ( s , 1h ), 8 . 94 - 9 . 00 ( m , 1h ), 8 . 36 ( d , j = 8 . 6 hz , 1h ), 7 . 86 ( dd , j = 8 . 6 , 1 . 6 hz , 1h ), 7 . 37 ( s , 1h ), 7 . 28 ( s , 1h ), 5 . 75 ( s , 2h ), 5 . 53 - 5 . 65 ( m , 1h ), [ 5 . 47 - 5 . 53 ( m ) and 5 . 34 - 5 . 40 ( m ), j hf = 54 hz , total 1h ], 2 . 43 - 2 . 70 ( m , 4h ), 2 . 04 ( s , 3h ), 1 . 92 - 2 . 14 ( m , 1h ), 1 . 82 - 1 . 92 ( m , 1h ). the second - eluting compound , also obtained as a white solid , was c58 . yield : 91 mg , 0 . 24 mmol , 44 % for the separation . lcms m / z 375 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 43 ( s , 1h ), 8 . 95 - 9 . 00 ( m , 1h ), 8 . 36 ( d , j = 8 . 6 hz , 1h ), 7 . 86 ( dd , j = 8 . 7 , 1 . 7 hz , 1h ), 7 . 37 ( s , 1h ), 7 . 28 ( s , 1h ), 5 . 75 ( s , 2h ), 5 . 52 - 5 . 65 ( m , 1h ), [ 5 . 48 - 5 . 53 ( m ) and 5 . 34 - 5 . 40 ( m ), j hf = 54 hz , total 1h ], 2 . 43 - 2 . 70 ( m , 4h ), 2 . 04 ( s , 3h ), 1 . 92 - 2 . 14 ( m , 1h ), 1 . 82 - 1 . 92 ( m , 1h ). this experiment was run in two identical batches . { caution : this reaction should not be carried out on greater than a 1 gram scale , due to highly energetic reactants and intermediates . use of proper safety precautions and a blast shield is essential .} nitromethane ( 4 . 71 g , 77 . 2 mmol ) was added in a drop - wise manner to a solution of sodium hydroxide ( 3 . 95 g , 98 . 8 mmol ) in water ( 25 ml ), and the resulting solution was allowed to heat to 45 ° c . over 5 minutes , whereupon it was cooled in a water bath and treated with concentrated hydrochloric acid ( 12 m , 10 ml ) until the ph of the solution became acidic . this was then added to a suspension of 2 - amino - 5 - cyanobenzoic acid ( 5 . 0 g , 31 mmol ) in water ( 50 ml ), acetone ( 10 ml ) and concentrated hydrochloric acid ( 12 m , 50 ml ) at 25 ° c ., and the reaction mixture was allowed to stir at 25 ° c . for 15 hours . the two batches were combined at this point , and the resulting suspension was filtered ; the collected solid was washed with water to provide the product as a yellow solid . from analysis of the 1 h nmr , the product was presumed to exist as a mixture of rotamers . yield : 13 . 8 g , 59 . 2 mmol , 95 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ [ 13 . 15 ( s ) and 13 . 12 ( s ), total 1h ], 8 . 37 ( d , j = 2 . 0 hz , 1h ), 8 . 07 - 8 . 15 ( m , 2h ), 7 . 92 ( d , half of ab quartet , j = 9 . 0 hz , 1h ), 6 . 86 ( d , j = 6 . 0 hz , 1h ). potassium carbonate ( 39 . 1 g , 283 mmol ) was added to a suspension of c59 ( 22 . 0 g , 94 . 4 mmol ) in acetic anhydride ( 200 ml ). after the reaction mixture had been heated to 90 ° c . for 2 hours , it was filtered , and the collected material was washed with tert - butyl methyl ether ( 100 ml ) and with water ( 400 ml ), affording the product as a brown solid . yield : 17 . 0 g , 79 . 0 mmol , 84 %. lcms m / z 215 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 14 ( s , 1h ), 8 . 55 ( dd , j = 2 . 0 , 0 . 5 hz , 1h ), 7 . 98 ( dd , j = 8 . 5 , 2 . 0 hz , 1h ), 7 . 77 ( dd , j = 8 . 5 , 0 . 5 hz , 1h ). conversion of c60 to the product was carried out using the method described for synthesis of c8 from c7 in example 1 . the product was isolated as a brown solid . yield : 9 . 1 g , 39 mmol , 86 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 26 ( s , 1h ), 8 . 59 ( d , j = 1 . 8 hz , 1h ), 8 . 16 ( dd , j = 8 . 7 , 1 . 9 hz , 1h ), 7 . 93 ( d , j = 8 . 8 hz , 1h ). to a solution of c61 ( 8 . 81 g , 37 . 7 mmol ) in acetonitrile ( 80 ml ) was added p2 ( 11 . 0 g , 41 . 5 mmol ), followed by n , n - diisopropylethylamine ( 5 . 85 g , 45 . 3 mmol ). the reaction mixture was stirred for 2 hours at room temperature , whereupon it was concentrated in vacuo and purified via silica gel chromatography ( eluent : 4 : 1 petroleum ether / ethyl acetate ), affording the product as a viscous orange oil that slowly solidified . yield : 15 . 0 g , 32 . 4 mmol , 86 %. lcms m / z 313 . 0 [ m -( 2 , 4 - dimethoxybenzyl )+ h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 18 ( s , 1h ), 8 . 55 ( br dd , j = 1 . 3 , 1 hz , 1h ), 8 . 15 ( d , j = 1 . 0 hz , 2h ), 6 . 88 ( d , j = 8 . 0 hz , 1h ), 6 . 24 - 6 . 30 ( m , 2h ), 4 . 33 ( br ab quartet , j ab = 14 . 5 hz , δν ab = 12 hz , 2h ), 3 . 76 - 3 . 92 ( m , 2h ), 3 . 62 ( s , 3h ), 3 . 42 ( s , 3h ), 3 . 3 - 3 . 4 ( m , 2h , assumed ; largely obscured by water peak ), 1 . 83 - 2 . 00 ( m , 2h ), 1 . 70 - 1 . 83 ( m , 1h ), 1 . 42 - 1 . 54 ( m , 1h ), 1 . 09 ( d , j = 6 . 0 hz , 3h ). a mixture of c62 ( 15 . 0 g , 32 . 4 mmol ) and trifluoroacetic acid ( 18 . 5 g , 162 mmol ) in dichloromethane ( 150 ml ) was stirred at room temperature for 30 minutes , whereupon it was concentrated to a volume of 20 ml and treated with saturated aqueous sodium bicarbonate solution ( 200 ml ). the aqueous layer was extracted with dichloromethane ( 3 × 150 ml ), and the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo to provide the product as a yellow solid . yield : 5 . 68 g , 18 . 2 mmol , 56 %. lcms m / z 313 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 06 - 9 . 09 ( m , 2h ), 8 . 30 ( br d , j = 9 . 0 hz , 1h ), 8 . 14 ( dd , half of abx pattern , j = 8 . 7 , 1 . 6 hz , 1h ), 8 . 01 ( d , half of ab quartet , j = 8 . 8 hz , 1h ), 3 . 87 - 3 . 93 ( m , 1h ), 3 . 69 - 3 . 82 ( m , 1h ), 3 . 3 - 3 . 5 ( m , 2h , assumed ; largely obscured by water peak ), 1 . 87 - 2 . 03 ( m , 2h ), 1 . 60 - 1 . 72 ( m , 1h ), 1 . 36 - 1 . 47 ( m , 1h ), 1 . 11 ( d , j = 6 . 0 hz , 3h ). ethanol ( 60 ml ) and water ( 15 ml ) were added to a mixture of c63 ( 5 . 68 g , 18 . 2 mmol ), iron ( 10 . 2 g , 183 mmol ), and ammonium chloride ( 9 . 73 g , 182 mmol ). the reaction mixture was heated to 80 ° c . for 1 hour , whereupon it was diluted with ethanol ( 100 ml ) and filtered . the filtrate was concentrated in vacuo , and the resulting solid was partitioned between saturated aqueous sodium bicarbonate solution ( 100 ml ) and dichloromethane ( 300 ml ). the organic layer was dried over sodium sulfate , filtered , and concentrated under reduced pressure to afford the product as a brown solid . yield : 4 . 73 g , 16 . 8 mmol , 92 %. lcms m / z 282 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 8 . 55 ( d , j = 1 . 2 hz , 1h ), 8 . 51 ( s , 1h ), 7 . 90 ( d , j = 8 . 8 hz , 1h ), 7 . 60 ( dd , j = 8 . 5 , 1 . 8 hz , 1h ), 3 . 92 - 4 . 00 ( m , 1h ), 3 . 58 - 3 . 69 ( m , 1h ), 3 . 39 - 3 . 50 ( m , 2h ), 1 . 78 - 1 . 94 ( m , 2h ), 1 . 56 - 1 . 69 ( m , 1h ), 1 . 29 - 1 . 40 ( m , 1h ), 1 . 17 ( d , j = 6 . 0 hz , 3h ). 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 8 g , 2 . 8 mmol ) and n , n - diisopropylethylamine ( 439 mg , 3 . 40 mmol ) were added to a mixture of c64 ( 320 mg , 1 . 13 mmol ) and ( 3 - methyl - 1 , 2 - oxazol - 5 - yl ) acetic acid ( 192 mg , 1 . 36 mmol ) in ethyl acetate ( 5 ml ) at room temperature ( 18 ° c .). after the reaction mixture had been heated at 80 ° c . for 2 . 5 days , it was cooled to room temperature ( 18 ° c . ), and partitioned between saturated aqueous sodium chloride solution ( 40 ml ) and ethyl acetate ( 6 × 40 ml ). the combined organic layers were concentrated in vacuo and purified via silica gel chromatography ( gradient : 0 % to 8 % methanol in dichloromethane ) to give a brown gum , which was triturated with a mixture of petroleum ether and ethyl acetate ( 2 : 1 , 30 ml ). the resulting solid was washed with a mixture of petroleum ether and ethyl acetate ( 1 : 1 , 10 ml ) and then with petroleum ether ( 10 ml ), providing the product as a brownish solid . yield : 160 mg , 0 . 413 mmol , 37 %. lcms m / z 388 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 40 ( s , 1h ), 8 . 80 - 9 . 15 ( br m , 1h ), 8 . 39 ( d , j = 8 . 5 hz , 1h ), 7 . 88 ( br d , j = 8 . 5 hz , 1h ), 6 . 10 ( s , 1h ), 4 . 99 - 5 . 25 ( br m , 1h ), 4 . 63 ( s , 2h ), 4 . 35 ( br dd , j = 12 , 5 hz , 1h ), 3 . 65 - 3 . 83 ( m , 2h ), 2 . 51 - 2 . 78 ( br m , 1h ), 2 . 22 - 2 . 48 ( br m , 1h ), 2 . 29 ( s , 3h ), 1 . 75 - 2 . 19 ( br m , 2h ), 1 . 38 ( d , j = 6 . 0 hz , 3h ). a solution of c64 in n , n - dimethylacetamide ( 0 . 1 m , 1 . 0 ml , 100 μmol ) was added to ( 5 - methoxypyridin - 2 - yl ) acetic acid ( 25 mg , 150 μmol ). n , n - diisopropylethylamine ( 50 μl , 300 μmol ) was added , followed by bis ( 2 - oxo - 1 , 3 - oxazolidin - 3 - yl ) phosphinic chloride ( bop - cl , 38 . 1 mg , 150 μmol ), and the reaction vial was capped and shaken at 30 ° c . for 16 hours . after solvent had been removed using a speedvac ® concentrator , the residue was washed and extracted with ethyl acetate ( 3 × 1 . 5 ml ). the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo , affording the product , which was taken directly to the next step acetic acid ( 1 ml ) was added to c65 ( from the previous step , 5100 μmol ), and the reaction vial was capped and shaken at 80 ° c . for 16 hours . purification via reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 20 % to 50 % b ) provided the product . yield : 4 . 0 mg , 8 . 7 μmol , 9 % over 2 steps . lcms m / z 414 [ m + h ] + . retention time : 2 . 44 minutes via analytical hplc ( column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 0375 % trifluoroacetic acid in water ; mobile phase b : 0 . 01875 % trifluoroacetic acid in acetonitrile ; gradient : 1 % to 5 % b over 0 . 6 minutes ; 5 % to 100 % b over 3 . 4 minutes ; flow rate : 0 . 8 ml / minute ). n , n - diisopropylethylamine ( 0 . 387 ml , 2 . 22 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 32 ml , 2 . 22 mmol ) were added to a mixture of c57 ( 200 mg , 0 . 740 mmol ) and c6 ( 104 mg , 0 . 737 mmol ) in ethyl acetate ( 4 . 4 ml ), and the reaction mixture was heated at 80 ° c . overnight . it was then diluted with additional ethyl acetate and washed with water . the aqueous layer was extracted once with ethyl acetate , and the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( eluent : ethyl acetate ), followed by trituration with diethyl ether , provided a mixture of 97 and c66 as an off - white solid . yield of racemic product : 141 mg , 0 . 376 mmol , 51 %. this material was separated into its component enantiomers via supercritical fluid chromatography ( column : phenomenex lux amylose - 1 , 5 μm ; mobile phase : 4 : 1 carbon dioxide / ethanol ). the first - eluting enantiomer was 97 , obtained as a white solid . yield : 63 . 4 mg , 0 . 169 mmol , 45 % for the separation . lcms m / z 376 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 40 ( s , 1h ), 8 . 92 - 8 . 97 ( m , 1h ), 8 . 35 ( d , j = 8 . 6 hz , 1h ), 7 . 85 ( dd , j = 8 . 6 , 1 . 6 hz , 1h ), 6 . 00 ( s , 1h ), [ 5 . 48 - 5 . 54 ( m ) and 5 . 32 - 5 . 44 ( m ), total 2h ], 4 . 53 ( s , 2h ), 2 . 46 - 2 . 76 ( m , 4h ), 2 . 40 ( s , 3h ), 1 . 92 - 2 . 15 ( m , 2h ). a sample of 97 synthesized and isolated in the same way gave specific rotation [ α ]− 42 . 0 ° ( c 0 . 105 , dichloromethane ). an x - ray structural determination ( see below ) was carried out on a sample of 97 that had been crystallized from heptane / ethyl acetate ; this provided confirmation of the cis - configuration of the nitrogen and fluorine atoms on the cyclopentane ring . the indicated absolute stereochemistry of 97 is strongly inferred from the alternate synthesis of example 97 described below ; the absolute configuration of reagent c49 would be identical to that of its precursor p4 , which is predicted based on its enzymatic synthesis in preparation p4 . the second - eluting enantiomer , also isolated as a white solid , was c66 , 1 -[( 1 s , 3r )- 3 - fluorocyclopentyl ]- 2 -[( 5 - methyl - 1 , 2 - oxazol - 3 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile . yield : 65 . 3 mg , 0 . 174 mmol , 46 % for the separation . lcms m / z 376 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 40 ( s , 1h ), 8 . 92 - 8 . 97 ( m , 1h ), 8 . 35 ( d , j = 8 . 8 hz , 1h ), 7 . 85 ( dd , j = 8 . 6 , 1 . 6 hz , 1h ), 6 . 00 ( s , 1h ), [ 5 . 48 - 5 . 54 ( m ) and 5 . 32 - 5 . 44 ( m ), total 2h ], 4 . 53 ( s , 2h ), 2 . 45 - 2 . 76 ( m , 4h ), 2 . 40 ( s , 3h ), 1 . 92 - 2 . 15 ( m , 2h ). a sample of c66 synthesized and isolated in the same way gave specific rotation [ α ]+ 21 . 4 ° ( c 0 . 180 , dichloromethane ). data collection was performed on a bruker apex diffractometer at − 150 ° c . data collection consisted of omega and phi scans . the structure was solved by direct methods using shelx software suite in the triclinic class space group p1 as two molecules per asymmetric unit . the structure was subsequently refined by the full - matrix least squares method . all non - hydrogen atoms were found and refined using anisotropic displacement parameters . the remaining hydrogen atoms were placed in calculated positions and were allowed to ride on their carrier atoms . the final refinement included isotropic displacement parameters for all hydrogen atoms . analysis of the absolute structure using likelihood methods ( hooft 2008 ) was performed using platon ( spek 2010 ). the analysis could not determine the absolute configuration in this case because of the weak intensity of the friedel pairs . the final r - index was 7 . 5 %. a final difference fourier revealed no missing or misplaced electron density . pertinent crystal , data collection , and refinement information is summarized in table f . atomic coordinates , bond lengths , bond angles , and displacement parameters are listed in tables g , h , and j . platon , a . l . spek , j . appl . cryst . 2003 , 36 , 7 - 13 . mercury , c . f . macrae , p . r . edington , p . mccabe , e . pidcock , g . p . shields , r . taylor , m . towler , and j . van de streek , j . appl . cryst . 2006 , 39 , 453 - 457 . olex2 , o . v . dolomanov , l . j . bourhis , r . j . gildea , j . a . k . howard , and h . puschmann , j . appl . cryst . 2009 , 42 , 339 - 341 . r . w . w . hooft , l . h . straver , and a . l . spek , j . appl . cryst . 2008 , 41 , 96 - 103 . parameters ( å 2 × 10 3 ) for 97 . u ( eq ) is defined as one - third anisotropic displacement parameters ( å 2 × 10 3 ) for 97 . form : − 2π 2 [ h 2 a * 2 u 11 + . . . + 2 h k a * b * u 12 ]. compound p4 ( from alternate preparation of p4 above , 250 mg , 1 . 05 mmol ) was dissolved in a solution of hydrogen chloride in methanol ( 1 . 25 m , 12 . 6 ml , 15 . 8 mmol ). palladium on carbon ( 10 %, 250 mg ) was added , and the reaction vessel was pressurized to 100 psi with nitrogen three times , followed by pressurization to 40 psi with hydrogen three times . the reaction mixture was then hydrogenated at room temperature and 40 psi overnight , whereupon it was purged three times with nitrogen and combined with a similar reaction carried out on p4 ( 270 mg , 1 . 14 mmol ). after the mixture had been filtered through a polyethylene filter , the filtrate was concentrated in vacuo , azeotroped once with toluene , and washed twice with heptane , affording the product as a white solid . yield : 315 mg , assumed quantitative . 1 h nmr ( 400 mhz , cd 3 od ) δ [ 5 . 24 - 5 . 29 ( m ) and 5 . 11 - 5 . 16 ( m ), j hf = 53 hz , total 1h ], 3 . 67 - 3 . 77 ( br m , 1h ), 2 . 35 ( dddd , j = 35 . 9 , 15 . 6 , 8 . 6 , 4 . 7 hz , 1h ), 1 . 79 - 2 . 27 ( m , 5h ). reaction of c13 with c49 was effected using the method described for synthesis of c53 from c13 in example 93 . in this case , the purified material from silica gel chromatography was crystallized from dichloromethane / heptane , affording the product as a solid . yield : 685 mg , 2 . 21 mmol , 89 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 80 ( br d , j = 7 hz , 1h ), 9 . 36 ( s , 1h ), 8 . 24 ( d , j = 2 . 3 hz , 1h ), 7 . 96 ( d , j = 9 . 0 hz , 1h ), 7 . 71 ( dd , j = 8 . 9 , 2 . 2 hz , 1h ), [ 5 . 38 - 5 . 43 ( m ) and 5 . 25 - 5 . 30 ( m ), j hf = 53 hz , total 1h ], 4 . 71 - 4 . 81 ( m , 1h ), 2 . 43 - 2 . 54 ( m , 1h ), 2 . 28 - 2 . 43 ( m , 3h ), 2 . 16 - 2 . 27 ( m , 1h ), 1 . 88 - 2 . 08 ( m , 1h ). conversion of c67 to the product was carried out using the method described for synthesis of c56 from c53 in example 94 . in this case , purification was effected using silica gel chromatography ( gradient : 0 % to 60 % ethyl acetate in heptane , followed by 100 % ethyl acetate ), providing the product as a solid . yield : 332 mg , 1 . 11 mmol , 50 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 10 . 04 ( br d , j = 7 hz , 1h ), 9 . 46 ( s , 1h ), 8 . 61 ( d , j = 1 . 8 hz , 1h ), 8 . 09 ( d , half of ab quartet , j = 8 . 8 hz , 1h ), 7 . 92 ( dd , half of abx pattern , j = 8 . 7 , 1 . 7 hz , 1h ), [ 5 . 42 - 5 . 46 ( m ) and 5 . 29 - 5 . 33 ( m ), total 1h ], 4 . 71 - 4 . 80 ( m , 1h ), 2 . 48 - 2 . 59 ( m , 1h ), 2 . 29 - 2 . 46 ( m , 3h ), 2 . 19 - 2 . 29 ( m , 1h ), 1 . 92 - 2 . 13 ( m , 1h ). zinc ( 97 . 5 %, 0 . 739 g , 11 . 0 mmol ) was added in one portion to a mixture of c68 ( 331 mg , 1 . 10 mmol ) in methanol ( 5 . 5 ml ) and concentrated ammonium hydroxide ( 5 . 5 ml ). after 1 hour at room temperature , the reaction mixture was filtered through diatomaceous earth , and the filter pad was washed with methanol . the combined filtrates were concentrated in vacuo , and the residue was purified via chromatography on silica gel ( gradient : 0 % to 10 % methanol in ethyl acetate ). the resulting material was triturated with diethyl ether and washed with heptane to afford the product . yield : 114 mg , 0 . 422 mmol , 38 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 57 ( s , 1h ), 8 . 28 ( d , j = 1 . 6 hz , 1h ), 8 . 02 ( d , j = 8 . 6 hz , 1h ), 7 . 60 ( dd , j = 8 . 6 , 1 . 8 hz , 1h ), [ 5 . 39 - 5 . 43 ( m ) and 5 . 26 - 5 . 30 ( m ), j hf = 53 . 5 hz , total 1h ], 4 . 23 - 4 . 33 ( m , 1h ), 3 . 99 - 4 . 07 ( m , 1h ), 3 . 91 ( br s , 2h ), 2 . 20 - 2 . 35 ( m , 1h ), 2 . 04 - 2 . 17 ( m , 2h ), 1 . 82 - 2 . 03 ( m , 3h ). n , n - diisopropylethylamine ( 39 . 1 μl , 0 . 224 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 0 . 191 ml , 0 . 321 mmol ) were added to a mixture of c69 ( 60 mg , 0 . 22 mmol ) and c6 ( 31 . 3 mg , 0 . 222 mmol ) in toluene ( 2 . 2 ml ). the reaction mixture was heated at 70 ° c . for 1 hour , and then at 110 ° c . for 3 hours , whereupon it was cooled to room temperature and directly subjected to two chromatographic purifications on silica gel ( gradient : 0 % to 20 % methanol in ethyl acetate ). the resulting material was triturated with ethyl acetate and diethyl ether to provide the product as an off - white to light yellow solid . yield : 41 . 2 mg , 0 . 110 mmol , 50 %. specific rotation : [ α ]− 39 . 4 ° ( c 0 . 120 , dichloromethane ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 41 ( s , 1h ), 8 . 92 - 8 . 97 ( m , 1h ), 8 . 36 ( d , j = 8 . 8 hz , 1h ), 7 . 85 ( dd , j = 8 . 7 , 1 . 7 hz , 1h ), 6 . 00 ( br s , 1h ), 5 . 32 - 5 . 54 ( m , 2h ), 4 . 53 ( s , 2h ), 2 . 46 - 2 . 76 ( m , 4h ), 2 . 41 ( br s , 3h ), 1 . 92 - 2 . 15 ( m , 2h ). compound c64 was reacted with pyrazin - 2 - ylacetic acid using the method described in example 96 for synthesis of c65 from c64 . the product was taken directly to the next step . conversion of c70 to the product was effected using the method described for synthesis of 96 from c65 in example 96 . purification via reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : aqueous ammonia , ph 10 ; mobile phase b : acetonitrile ; gradient : 18 % to 48 % b ) provided the product . yield : 3 . 0 mg , 7 . 0 μmol , 7 %. lcms m / z 385 [ m + h ] + . retention time : 2 . 30 minutes via analytical hplc ( column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 5 % b for 0 . 5 minutes ; 5 % to 100 % b over 2 . 9 minutes ; 100 % b for 0 . 8 minutes ; flow rate : 0 . 8 ml / minute ). a mixture of c15 ( 29 mg , 100 μmol ), [ 4 -( trifluoromethyl )- 1h - 1 , 2 , 3 - triazol - 1 - yl ] acetic acid ( see m . d . andrews et al ., us 20150218172 a1 , aug . 6 , 2015 ) ( 23 mg , 120 μmol ), and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 0 ml , 1 . 7 mmol ) was prepared in a vial , which was then capped and shaken at 120 ° c . for 16 hours . after solvent had been removed using a speedvac ® concentrator , the residue was purified via reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 17 % to 57 % b ) to provide the product . yield : 10 . 2 mg , 20 . 5 μmol , 20 %. lcms m / z 451 [ m + h ] + . retention time : 2 . 90 minutes via analytical hplc ( column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 0375 % trifluoroacetic acid in water ; mobile phase b : 0 . 01875 % trifluoroacetic acid in acetonitrile ; gradient : 1 % to 5 % b over 0 . 6 minutes ; 5 % to 100 % b over 3 . 4 minutes ; flow rate : 0 . 8 ml / minute ). formic acid ( 310 ml ) was added to a mixture of iron powder ( 34 . 7 g , 621 mmol ), ammonium chloride ( 33 . 2 g , 621 mmol ), and c14 ( 20 g , 62 . 2 mmol ) in 2 - propanol ( 310 ml ) at room temperature ( 14 ° c .). the reaction mixture was heated at 80 ° c . for 16 hours , whereupon it was diluted with ethanol ( 300 ml ), and filtered . the collected solids were washed with 2 - propanol ( 200 ml ) and dichloromethane ( 100 ml ), and the combined filtrates were concentrated in vacuo , then co - evaporated with ethanol ( 200 ml ). the residue was diluted with dichloromethane ( 300 ml ), basified via addition of saturated aqueous sodium bicarbonate solution ( 500 ml ), and then filtered through diatomaceous earth ; the filter pad was washed with dichloromethane ( 300 ml ). the aqueous layer of the combined filtrates was extracted with dichloromethane ( 4 × 100 ml ), and the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated under reduced pressure . silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ) afforded a solid , which was washed with a mixture of petroleum ether and ethyl acetate ( 3 : 1 , 100 ml ) and with petroleum ether ( 50 ml ) to provide the product as a beige solid . yield : 10 . 05 g , 33 . 3 mmol , 54 %. lcms m / z 301 . 8 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 35 ( s , 1h ), 8 . 25 ( d , j = 9 . 0 hz , 1h ), 8 . 19 ( s , 1h ), 8 . 09 ( d , j = 2 . 3 hz , 1h ), 7 . 66 ( dd , j = 8 . 8 , 2 . 3 hz , 1h ), 5 . 02 ( tt , j = 12 . 0 , 3 . 8 hz , 1h ), 4 . 30 ( ddd , j = 11 . 9 , 4 . 6 , 1 . 6 hz , 1h ), 3 . 77 - 3 . 89 ( m , 2h ), 2 . 33 - 2 . 46 ( m , 2h ), 2 . 09 - 2 . 22 ( m , 1h ), 1 . 83 - 1 . 95 ( m , 1h ), 1 . 38 ( d , j = 6 . 3 hz , 3h ). a solution of lithium diisopropylamide in heptane / tetrahydrofuran / ethylbenzene ( 2 m , 3 . 0 ml , 6 . 0 mmol ) was added to a − 78 ° c . solution of c71 ( 1 . 64 g , 5 . 43 mmol ) in tetrahydrofuran ( 28 ml ), and the reaction mixture was allowed to stir at − 78 ° c . for 15 minutes . a solution of 5 - methylpyridine - 2 - carbaldehyde ( 29 mg , 0 . 24 mmol ) in tetrahydrofuran ( 0 . 4 ml ) was cooled to − 78 ° c . and treated with a portion of the c71 - containing reaction mixture ( 0 . 9 ml , approximately 0 . 15 mmol ); stirring was continued at − 78 ° c . for 15 minutes , whereupon the cooling bath was removed , and the reaction mixture was allowed to warm to room temperature . it was then partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing . the organic layer was eluted through a solid phase extraction cartridge ( 6 ml ) charged with sodium sulfate (˜ 1 g ); this extraction procedure was repeated twice , and the combined eluents were concentrated in vacuo and used directly in the following step . pyridine ( 45 μl , 0 . 56 mmol ) was added to c72 ( from the previous step , 50 . 15 mmol ), followed by a solution of 4 -( dimethylamino ) pyridine ( 2 . 5 mg , 20 μmol ) in 1 , 2 - dichloroethane ( 0 . 3 ml ). the reaction vessel was evacuated and charged with nitrogen ; this evacuation cycle was repeated twice , and then a solution of o - phenyl carbonochloridothioate ( 52 mg , 0 . 30 mmol ) in 1 , 2 - dichloroethane ( 0 . 3 ml ) was added . after the reaction mixture had been shaken at room temperature for 2 hours , it was partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing . the organic layer was eluted through a solid phase extraction cartridge ( 6 ml ) charged with sodium sulfate (˜ 1 g ); this extraction procedure was repeated twice , and the combined eluents were concentrated in vacuo . the resulting material was treated with a solution of 2 , 2 ′- azobisisobutyronitrile ( 2 mg , 10 μmol ) in toluene ( 0 . 6 ml ) and 1 , 1 , 1 , 3 , 3 , 3 - hexamethyl - 2 -( trimethylsilyl ) trisilane ( 40 ul , 0 . 13 mmol ) and the reaction mixture was shaken at 110 ° c . for 20 hours . it was then partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing , and the organic layer was eluted through a solid phase extraction cartridge ( 6 ml ) charged with sodium sulfate (˜ 1 g ); this extraction procedure was repeated twice , and the combined eluents were concentrated in vacuo and purified using reversed phase hplc ( column : waters xbridge c18 , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : 0 . 05 % ammonium hydroxide in acetonitrile ; gradient : 5 % to 100 % b ). yield : 4 . 7 mg , 12 μmol , 8 % over 2 steps . lcms m / z 407 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . retention time : 1 . 89 minutes via analytical hplc ( column : waters atlantis dc18 , 4 . 6 × 50 mm , 5 μm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); gradient : 20 % to 95 % b , linear over 4 . 0 minutes ; flow rate : 2 ml / minute ). reaction of c57 with ( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) acetic acid was effected using the method described for synthesis of 97 from c57 and c6 in example 97 , providing a racemic mixture of c73 and 101 as an off - white solid . yield of racemic material : 54 . 0 mg , 0 . 144 mmol , 40 %. lcms m / z 376 . 4 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 43 ( s , 1h ), 8 . 93 - 8 . 99 ( m , 1h ), 8 . 37 ( d , j = 8 . 6 hz , 1h ), 7 . 89 ( dd , j = 8 . 6 , 1 . 6 hz , 1h ), 7 . 48 ( br s , 1h ), 6 . 01 ( ab quartet , j ab = 15 . 4 hz , δν ab = 11 . 7 hz , 2h ), [ 5 . 49 - 5 . 63 ( m ) and 5 . 36 - 5 . 42 ( m ), total 2h ], 2 . 46 - 2 . 75 ( m , 4h ), 2 . 33 ( br s , 3h ), 1 . 92 - 2 . 19 ( m , 2h ). the component enantiomers were separated using supercritical fluid chromatography [ column : phenomenex lux cellulose - 2 , 5 μm ; mobile phase : 1 : 1 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting enantiomer , isolated as a white solid , was c73 , 1 -( cis - 3 - fluorocyclopentyl )- 2 -[( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , ent - 1 . yield : 8 . 4 mg , 22 μmol , 16 % for the separation . lcms m / z 376 . 1 [ m + h ] + . retention time : 8 . 32 minutes via analytical hplc [ column : phenomenex lux cellulose - 2 , 4 . 6 × 100 mm , 5 μm ; mobile phase : 1 : 1 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide ); flow rate : 1 . 5 ml / minute ]. the second - eluting enantiomer was 101 , also obtained as a white solid . yield : 6 . 6 mg , 18 μmol , 12 % for the separation . lcms m / z 376 . 0 [ m + h ] + . retention time : 9 . 93 minutes ( analytical hplc conditions identical to those described above for c73 ). n - butyllithium ( 2 . 5 m in hexanes ; 5 . 00 ml , 12 . 5 mmol ) was slowly added drop - wise to a − 78 ° c . solution of 4 , 6 - dimethylpyrimidine ( 1 . 08 g , 9 . 99 mmol ) in tetrahydrofuran ( 20 ml ). after the reaction mixture had been stirred for 20 minutes at − 78 ° c ., solid carbon dioxide ( dry ice , 5 . 0 g ) was added , and the reaction mixture was warmed to room temperature ( 15 ° c .) and stirred for 1 hour . water ( 3 . 0 ml ) was then added , and the resulting mixture was concentrated in vacuo to provide the product as a white solid . yield : 1 . 53 g , 9 . 68 mmol , 97 %. 1 h nmr ( 400 mhz , d 2 o ) δ 8 . 78 ( s , 1h ), 7 . 28 ( s , 1h ), [ 3 . 60 ( s ) and 3 . 59 ( br s ), total 2h ], 2 . 43 ( s , 3h ). 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 795 mg , 1 . 25 mmol ) and n , n - diisopropylethylamine ( 194 mg , 1 . 50 mmol ) were added to a mixture of c15 ( 146 mg , 0 . 500 mmol ) and c74 ( 87 . 5 mg , 0 . 553 mmol ) in ethyl acetate ( 2 ml ) at room temperature ( 15 ° c .). the reaction mixture was heated at 80 ° c . for 16 hours , whereupon it was combined with a reaction mixture from a similar reaction carried out using c15 ( 100 mg , 0 . 343 mmol ). the mixture was partitioned between water ( 40 ml ) and ethyl acetate ( 40 ml ), and the aqueous layer was extracted with ethyl acetate ( 6 × 40 ml ). the combined organic layers were concentrated in vacuo and purified via reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 26 % to 56 % b ) to afford the product as a yellow solid . yield : 195 mg , 0 . 478 mmol , 57 %. chromatography on silica gel ( gradient : 0 % to 10 % methanol in dichloromethane ), followed by trituration with diethyl ether , provided a further purified sample as a light yellow solid . this sample was crystalline via powder x - ray diffraction . lcms m / z 408 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ), characteristic peaks : δ 9 . 19 ( s , 1h ), 8 . 94 ( s , 1h ), 8 . 56 - 8 . 75 ( br m , 1h ), 8 . 20 ( d , j = 9 . 0 hz , 1h ), 7 . 75 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 7 . 46 ( br s , 1h ), 5 . 10 - 5 . 34 ( br m , 1h ), 4 . 72 ( s , 2h ), 4 . 06 - 4 . 22 ( br m , 1h ), 3 . 48 - 3 . 77 ( br m , 2h ), 2 . 46 ( s , 3h ), 2 . 10 - 2 . 28 ( br m , 1h ), 1 . 93 - 2 . 09 ( br m , 1h ), 1 . 76 - 1 . 93 ( br m , 1h ), 1 . 21 ( d , j = 5 . 9 hz , 3h ). n - bromosuccinimide ( 5 . 89 g , 33 . 1 mmol ) was added to a solution of 4 - methyl - 1h - 1 , 2 , 3 - triazole ( 2 . 50 g , 30 . 1 mmol ) in chloroform ( 30 ml ), and the reaction mixture was stirred for 16 hours at room temperature ( 15 ° c .). it was then diluted with dichloromethane ( 100 ml ), washed with water ( 2 × 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo to provide the product as a white solid ( 4 . 9 g ), which was used directly in the next step . tert - butyl bromoacetate ( 8 . 8 g , 45 mmol ) was added in one portion to a mixture of c75 ( from the previous step , 4 . 9 g , ≦ 30 . 1 mmol ) and cesium carbonate ( 17 . 6 g , 54 . 0 mmol ) in n , n - dimethylformamide ( 80 ml ). the reaction mixture was stirred at room temperature ( 20 ° c .) for 16 hours , whereupon it was diluted with water ( 100 ml ) and extracted with ethyl acetate ( 2 × 80 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 2 × 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 15 %, ethyl acetate in petroleum ether ) provided the product as a colorless oil . yield : 4 . 00 g , 14 . 5 mmol , 48 % over 2 steps . step 3 . synthesis of tert - butyl ( 4 - methyl - 2h - 1 , 2 , 3 - triazol - 2 - yl ) acetate ( c77 ), methyl ( 4 - methyl - 2h - 1 , 2 , 3 - triazol - 2 - yl ) acetate ( c78 ), and ( 4 - methyl - 2h - 1 , 2 , 3 - triazol - 2 - yl ) acetic acid ( c79 ) a mixture of c76 ( 3 . 50 g , 12 . 7 mmol ) and palladium on carbon ( 10 %, 500 mg ) in methanol ( 35 ml ) was stirred under hydrogen ( 40 psi ) for 4 hours at room temperature ( 17 ° c .). the reaction mixture was filtered , and the filtrate was concentrated in vacuo , providing a yellow oil ( 3 . 00 g ). on the basis of 1 h nmr , the product was assigned as a mixture of c77 ( tert - butyl ester ), c78 ( methyl ester ), and c79 ( carboxylic acid ); this material was taken directly to the following step for ester hydrolysis . 1 h nmr peaks ( 400 mhz , cd 3 od ) δ [ 7 . 50 ( s ) and 7 . 49 ( s ), total 1h ], [ 5 . 23 ( s ), 5 . 17 ( s ), and 5 . 10 ( s ), total 2h ], 3 . 75 ( s , from methyl ester ), 2 . 30 ( s , 3h ), 1 . 46 ( s , from tert - butyl ester ). a mixture of c77 , c78 , and c79 ( from the previous step , 3 . 00 g , 512 . 7 mmol ) in trifluoroacetic acid ( 3 ml ) was stirred for 2 hours at room temperature ( 17 ° c .). after removal of solvent in vacuo , the residue was dissolved in tetrahydrofuran ( 10 ml ) and treated with aqueous sodium hydroxide solution ( 2 m , 10 ml ). the reaction mixture was stirred for 1 hour at room temperature ( 17 ° c . ), concentrated in vacuo , and partitioned between water ( 50 ml ) and dichloromethane ( 20 ml ). the aqueous layer was extracted with dichloromethane ( 2 × 20 ml ), and then acidified with 1 m aqueous hydrochloric acid to a ph of 1 . this acidic aqueous layer was extracted with ethyl acetate ( 3 × 40 ml ), and the combined ethyl acetate layers were dried over sodium sulfate , filtered , and concentrated under reduced pressure to provide the product as a yellow solid . yield : 1 . 9 g , 13 mmol , 100 % over 2 steps . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 46 ( s , 1h ), 5 . 25 ( s , 2h ), 2 . 34 ( s , 3h ). reaction of c15 with c79 was carried out using the method described for synthesis of 95 from c64 and ( 3 - methyl - 1 , 2 - oxazol - 5 - yl ) acetic acid in example 95 . purification was effected via reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 35 % to 55 % b ), affording the product as a pale yellow gum . yield : 95 mg , 0 . 24 mmol , 48 %. lcms m / z 397 . 0 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 33 ( s , 1h ), 8 . 54 - 8 . 70 ( br m , 1h ), 8 . 23 ( d , j = 9 . 0 hz , 1h ), 7 . 65 ( dd , j = 8 . 9 , 2 . 1 hz , 1h ), 7 . 44 ( br s , 1h ), 6 . 02 ( s , 2h ), 5 . 15 - 5 . 30 ( m , 1h ), 4 . 29 ( dd , j = 12 , 5 hz , 1h ), 3 . 58 - 3 . 78 ( m , 2h ), 2 . 55 - 2 . 81 ( br m , 1h ), 2 . 31 ( s , 3h ), 2 . 3 - 2 . 52 ( br m , 1h ), 1 . 62 - 1 . 78 ( br m , 1h ), 1 . 44 - 1 . 62 ( br m , 1h ), 1 . 34 ( d , j = 6 . 0 hz , 3h ). to a solution of 2 - bromo - 5 - methylpyrazine ( 5 . 0 g , 28 . 9 mmol ) in 1 , 4 - dioxane ( 150 ml ) were added dimethyl propanedioate ( 11 . 5 g , 87 . 0 mmol ), pyridine - 2 - carboxylic acid ( 712 mg , 5 . 78 mmol ), copper ( i ) iodide ( 2 . 20 g , 11 . 6 mmol ), and cesium carbonate ( 28 . 2 g , 86 . 6 mmol ). the reaction mixture was stirred at 95 ° c . for 16 hours , whereupon it was cooled to ambient temperature and combined with a similar reaction carried out using 2 - bromo - 5 - methylpyrazine ( 100 mg , 0 . 578 mmol ). the combined material was diluted with ethyl acetate ( 150 ml ), washed with saturated aqueous sodium chloride solution ( 150 ml ), dried over sodium sulfate , filtered and concentrated in vacuo . silica gel chromatography ( gradient : 1 % to 67 % ethyl acetate in petroleum ether ) provided the product as a yellow solid . yield : 5 . 1 g , 23 mmol , 78 %. lcms m / z 224 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 62 ( d , j = 1 . 5 hz , 1h ), 8 . 42 - 8 . 44 ( m , 1h ), 4 . 94 ( s , 1h ), 3 . 80 ( s , 6h ), 2 . 58 ( s , 3h ). aqueous sodium hydroxide solution ( 2 m , 44 . 6 ml , 89 . 2 mmol ) was added to a 10 ° c . solution of c80 ( 5 . 00 g , 22 . 3 mmol ) in tetrahydrofuran ( 15 ml ). after the reaction mixture had been stirred for 16 hours , it was combined with a similar reaction carried out using c80 ( 100 mg , 0 . 45 mmol ) and washed with 4 - methylpentan - 2 - one . the aqueous layer was then adjusted to ph 3 via addition of 6 m aqueous hydrochloric acid , while the temperature of the mixture was maintained between 20 ° c . and 25 ° c . after the mixture had been concentrated to dryness , the residue was extracted with 4 - methylpentan - 2 - one ( 2 × 150 ml ), and the two combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . recrystallization from dichloromethane / tert - butyl methyl ether ( 1 : 20 , 50 ml ) afforded the product as a yellow solid . yield : 1 . 80 g , 11 . 8 mmol , 52 %. lcms m / z 153 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 33 ( s , 1h ), 8 . 20 ( s , 1h ), 3 . 62 ( s , 2h ), 2 . 45 ( s , 3h ). 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 4 . 30 g , 6 . 76 mmol ) and n , n - diisopropylethylamine ( 1 . 05 g , 8 . 12 mmol ) were added to a mixture of c15 ( 788 mg , 2 . 70 mmol ) and c81 ( 452 mg , 2 . 97 mmol ) in ethyl acetate ( 11 ml ) at room temperature ( 15 ° c .). the reaction mixture was heated at 80 ° c . for 44 hours , whereupon it was cooled to room temperature and combined with a similar reaction carried out using c15 ( 87 . 5 mg , 0 . 300 mmol ). the mixture was partitioned between water ( 40 ml ) and dichloromethane ( 100 ml ), and the aqueous layer was extracted with dichloromethane ( 6 × 100 ml ). the combined organic layers were concentrated in vacuo and purified using silica gel chromatography ( gradient : 0 % to 10 % methanol in dichloromethane ), followed by reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 35 % to 65 % b ). the product was obtained as a pale yellow gum . yield : 490 mg , 1 . 20 mmol , 40 %. lcms m / z 408 . 0 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 26 ( s , 1h ), 8 . 6 - 8 . 70 ( br m , 1h ), 8 . 58 ( s , 1h ), 8 . 38 ( s , 1h ), 8 . 21 ( d , j = 8 . 8 hz , 1h ), 7 . 62 ( dd , j = 8 . 9 , 2 . 1 hz , 1h ), 5 . 18 - 5 . 35 ( br m , 1h ), 4 . 65 ( s , 2h ), 4 . 30 ( br dd , j = 11 . 8 , 5 . 0 hz , 1h ), 3 . 58 - 3 . 80 ( br m , 2h ), 2 . 61 - 2 . 82 ( br m , 1h ), 2 . 55 ( s , 3h ), 2 . 34 - 2 . 54 ( br m , 1h ), 1 . 58 - 1 . 91 ( br m , 2h ), 1 . 34 ( d , j = 6 . 3 hz , 3h ). potential improvement to step 3 ( synthesis of 104 ), demonstrated using the racemate of c15 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 436 mg , 0 . 685 mmol ) was added to a solution of the racemate of c15 ( 100 mg , 0 . 343 mmol ), c81 ( 52 . 1 mg , 0 . 342 mmol ), and n , n - diisopropylethylamine ( 66 μl , 0 . 38 mmol ) in ethyl acetate ( 3 ml ). the reaction mixture was allowed to stir at room temperature for 1 . 5 hours , at which time lcms analysis indicated complete conversion to the uncyclized amide ( lcms m / z 426 . 4 [ m + h ]+). the reaction mixture was concentrated in vacuo to remove ethyl acetate , and the resulting oil was dissolved in toluene ( 5 ml ) and heated to 105 ° c . for 1 hour and 40 minutes . the reaction mixture was partitioned between ethyl acetate and saturated aqueous sodium bicarbonate solution , and the organic layer was washed with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 10 % to 20 % methanol in ethyl acetate ) provided an oil , which was dissolved in minimal ethyl acetate and treated with heptane . concentration in vacuo provided the racemate of 104 as a nearly colorless solid . yield : 78 mg , 0 . 19 mmol , 55 %. lcms m / z 408 . 3 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 600 mhz , dmso - d 6 ), characteristic peaks : δ 9 . 16 ( br s , 1h ), 8 . 59 - 8 . 71 ( m , 2h ), 8 . 46 ( s , 1h ), 8 . 19 ( d , j = 8 . 8 hz , 1h ), 7 . 74 ( br d , j = 8 . 8 hz , 1h ), 5 . 20 - 5 . 35 ( br m , 1h ), 4 . 76 ( s , 2h ), 4 . 10 - 4 . 20 ( br m , 1h ), 3 . 54 - 3 . 76 ( br m , 2h ), 2 . 48 ( s , 3h ), 2 . 12 - 2 . 28 ( br m , 1h ), 1 . 92 - 2 . 07 ( br m , 1h ), 1 . 78 - 1 . 92 ( br m , 1h ), 1 . 22 ( d , j = 5 . 9 hz , 3h ). a mixture of 2 - chloro - 5 -( trifluoromethyl ) pyrazine ( 6 . 10 g , 33 . 4 mmol ), dimethyl propanedioate ( 4 . 64 g , 35 . 1 mmol ), and cesium carbonate ( 12 . 0 g , 36 . 8 mmol ) in n , n - dimethylformamide ( 40 ml ) was stirred at 15 ° c . for 16 hours . the reaction mixture was then partitioned between ethyl acetate ( 200 ml ) and saturated aqueous sodium chloride solution ( 150 ml ), and the organic layer was washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . purification via chromatography on silica gel ( gradient : 0 % to 30 % ethyl acetate in petroleum ether ) afforded the product as a yellow oil ( 6 . 1 g ). by 1 h nmr , it was determined that the product contained dimethyl propanedioate . yield , corrected for dimethyl propanedioate contaminant : 4 . 30 g , 15 . 5 mmol , 46 %. 1 h nmr ( 400 mhz , cdcl 3 ), product peaks only : δ 8 . 91 ( s , 2h ), 5 . 08 ( s , 1h ), 3 . 83 ( s , 6h ). to a solution of c82 ( 2 . 78 g from the previous step ; corrected for dimethyl propanedioate contaminant : 1 . 96 g , 7 . 05 mmol ) in tetrahydrofuran ( 15 ml ) was added aqueous sodium hydroxide solution ( 2 m , 20 ml , 40 mmol ) in one portion , and the reaction mixture was stirred at 45 ° c . for 16 hours . after it had been cooled to 20 ° c ., the reaction mixture was washed with tert - butyl methyl ether ( 2 × 30 ml ). the aqueous layer was then acidified to ph 3 via addition of 6 m aqueous hydrochloric acid , and extracted with ethyl acetate ( 2 × 40 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 2 × 20 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo to provide the product as a yellow oil . yield : 1 . 0 g , 4 . 9 mmol , 70 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 93 ( br s , 1h ), 8 . 75 ( br s , 1h ), 4 . 07 ( s , 2h ). n , n - diisopropylethylamine ( 111 mg , 0 . 859 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 545 mg , 0 . 856 mmol ) were added to a solution of c15 ( 100 mg , 0 . 343 mmol ) and c83 ( 70 . 6 mg , 0 . 343 mmol ) in ethyl acetate ( 2 ml ) at room temperature ( 19 ° c .). the reaction mixture was stirred at 80 ° c . for 40 hours , whereupon it was washed sequentially with water ( 3 × 50 ml ) and with saturated aqueous sodium chloride solution ( 100 ml ). the organic layer was dried over sodium sulfate , filtered , and concentrated in vacuo . reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 44 % to 74 % b ) afforded the product as a brown solid . yield : 125 mg , 0 . 271 mmol , 79 %. lcms m / z 462 . 0 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 9 . 09 ( br s , 1h ), 8 . 98 ( br s , 1h ), 8 . 96 ( br s , 1h ), 8 . 75 - 8 . 90 ( br m , 1h ), 8 . 19 ( d , j = 9 . 0 hz , 1h ), 7 . 74 ( dd , j = 8 . 9 , 2 . 1 hz , 1h ), 5 . 25 - 5 . 45 ( br m , 1h ), 4 . 93 - 4 . 98 ( m , 2h ), 4 . 28 ( br dd , j = 12 . 0 , 5 . 3 hz , 1h ), 3 . 69 - 3 . 86 ( m , 2h ), 2 . 62 - 2 . 83 ( br m , 1h ), 2 . 32 - 2 . 52 ( br m , 1h ), 1 . 93 - 2 . 22 ( br m , 2h ), 1 . 34 ( d , j = 6 . 0 hz , 3h ). n , n - diisopropylethylamine ( 169 mg , 1 . 31 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 2 g , 1 . 9 mmol ) were added to a mixture of c17 ( 200 mg , 0 . 595 mmol ) and ( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) acetic acid ( 101 mg , 0 . 716 mmol ) in n , n - dimethylformamide ( 10 ml ), and the reaction mixture was heated at 100 ° c . overnight . it was then diluted with water ( 30 ml ) and extracted with dichloromethane ( 3 × 20 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 50 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . reversed phase hplc ( column : ymc - actus triart c18 , 5 μm ; mobile phase a : water containing 0 . 225 % formic acid ; mobile phase b : acetonitrile ; gradient : 31 % to 51 % b ) provided the product as a yellow solid . yield : 18 . 9 mg , 42 . 8 μmol , 7 %. lcms m / z 442 . 8 ( bromine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ), characteristic peaks : δ 9 . 24 ( s , 1h ), 8 . 70 - 8 . 89 ( m , 1h ), 8 . 13 ( d , j = 8 . 5 hz , 1h ), 7 . 97 ( s , 1h ), 7 . 88 ( br dd , j = 9 , 2 hz , 1h ), 6 . 22 ( s , 2h ), 5 . 21 - 5 . 40 ( br m , 1h ), 4 . 11 - 4 . 23 ( m , 1h ), 3 . 54 - 3 . 78 ( m , 2h ), 2 . 25 ( s , 3h ), 2 . 05 - 2 . 24 ( br m , 1h ), 1 . 69 - 2 . 04 ( br m , 2h ), 1 . 23 ( d , j = 6 . 0 hz , 3h ). tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 52 . 4 mg , 45 . 3 μmol ) and zinc cyanide ( 426 mg , 3 . 63 mmol ) were added to a solution of c84 ( 200 mg , 0 . 453 mmol ) in n , n - dimethylformamide ( 15 ml ), and the reaction vessel was evacuated and charged with nitrogen . this evacuation cycle was repeated twice , and the reaction mixture was then heated at 140 ° c . overnight . after filtration of the reaction mixture , the filtrate was diluted with water ( 50 ml ) and extracted with ethyl acetate ( 3 × 50 ml ); the combined organic layers were washed with saturated aqueous sodium chloride solution ( 50 ml ), dried over sodium sulfate , and concentrated in vacuo . purification via reversed phase hplc ( column : phenomenex gemini c18 , 8 μm ; mobile phase a : aqueous ammonia , ph 10 ; mobile phase b : acetonitrile ; gradient : 21 % to 41 % b ) afforded the product as a white solid . yield : 43 . 6 mg , 0 . 113 mmol , 25 %. lcms m / z 387 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 43 ( s , 1h ), 8 . 91 - 9 . 10 ( br m , 1h ), 8 . 39 ( d , j = 8 . 8 hz , 1h ), 7 . 90 ( dd , j = 9 , 1 hz , 1h ), 7 . 45 - 7 . 51 ( br s , 1h ), 6 . 01 ( s , 2h ), 5 . 34 - 5 . 48 ( br m , 1h ), 4 . 31 ( br dd , j = 12 , 5 hz , 1h ), 3 . 68 - 3 . 83 ( m , 2h ), 2 . 50 - 2 . 67 ( br m , 1h ), 2 . 33 ( s , 3h ), 2 . 21 - 2 . 38 ( br m , 1h ), 1 . 48 - 1 . 82 ( br m , 2h , assumed ; partially obscured by water peak ), 1 . 35 ( d , j = 6 . 0 hz , 3h ). lithium aluminum hydride ( 685 mg , 18 . 0 mmol ) was added to a 0 ° c . suspension of ethyl 1 - methyl - 1h - 1 , 2 , 3 - triazole - 4 - carboxylate ( 1 . 40 g , 9 . 02 mmol ) in tetrahydrofuran ( 20 ml ) and the reaction mixture was stirred at 0 ° c . for 1 hour . water was then added drop - wise at 0 ° c . until no further gas evolution was observed , whereupon sodium sulfate was added , and the mixture was stirred for 10 minutes . the mixture was then filtered , and the filtrate was concentrated in vacuo , affording the product as a yellow oil . yield : 700 mg , 6 . 19 mmol , 69 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 7 . 90 ( s , 1h ), 5 . 15 ( t , j = 5 . 5 hz , 1h ), 4 . 49 ( d , j = 5 . 5 hz , 2h ), 4 . 01 ( s , 3h ). methanesulfonyl chloride ( 851 mg , 7 . 43 mmol ) was added to a 0 ° c . solution of c85 ( 700 mg , 6 . 19 mmol ) and triethylamine ( 1 . 00 g , 9 . 88 mmol ) in dichloromethane ( 20 ml ). the reaction mixture was stirred at 0 ° c . for 2 hours , whereupon water ( 100 ml ) was added , and the mixture was extracted with dichloromethane ( 2 × 100 ml ). the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo to provide the product as a yellow oil , which was used directly in the next step . yield : 800 mg , 4 . 18 mmol , 68 %. to a solution of c86 ( 800 mg , 4 . 18 mmol ) in acetonitrile ( 20 ml ) was added potassium cyanide ( 1 . 50 g , 23 . 0 mmol ). the reaction mixture was stirred at 60 ° c . overnight , whereupon it was treated with water ( 150 ml ) and extracted with dichloromethane ( 3 × 100 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 80 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo to afford the product as a brown solid . yield : 200 mg , 1 . 64 mmol , 39 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 61 ( s , 1h ), 4 . 13 ( s , 3h ), 3 . 89 ( br s , 2h ). a solution of c87 ( 200 mg , 1 . 64 mmol ) in concentrated hydrochloric acid ( 4 ml ) was stirred at 60 ° c . for 2 hours . after the reaction mixture had cooled to room temperature , it was diluted with water ( 10 ml ) and washed with tert - butyl methyl ether ( 2 × 20 ml ). the aqueous layer was then concentrated to dryness , providing the product as a brown solid . yield : 200 mg , 1 . 42 mmol , 87 %. lcms m / z 142 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 7 . 94 ( s , 1h ), 4 . 01 ( s , 3h ), 3 . 66 ( s , 2h ). n , n - diisopropylethylamine ( 133 mg , 1 . 03 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 327 mg , 1 . 03 mmol ) were added to a mixture of c15 ( 100 g , 0 . 343 mmol ) and c88 ( 100 mg , 0 . 709 mmol ) in n , n - dimethylformamide ( 2 ml ). the reaction mixture was heated at 100 ° c . overnight , whereupon it was cooled to room temperature , diluted with saturated aqueous sodium chloride solution ( 30 ml ), and extracted with dichloromethane ( 2 × 30 ml ). the combined organic layers were concentrated in vacuo and purified using reversed phase hplc ( column : phenomenex gemini c18 , 8 μm ; mobile phase a : aqueous ammonia , ph 10 ; mobile phase b : acetonitrile ; gradient : 25 % to 45 % b ) to afford the product as a white solid . yield : 30 . 6 mg , 77 . 1 μmol , 22 %. lcms m / z 396 . 9 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 18 ( s , 1h ), 8 . 57 - 8 . 71 ( br m , 1h ), 8 . 19 ( d , j = 8 . 8 hz , 1h ), 8 . 03 ( br s , 1h ), 7 . 74 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 5 . 22 - 5 . 39 ( br m , 1h ), 4 . 62 ( s , 2h ), 4 . 11 - 4 . 21 ( br m , 1h ), 4 . 02 ( s , 3h ), 3 . 55 - 3 . 76 ( br m , 2h ), 2 . 36 - 2 . 5 ( br m , 1h , assumed ; partially obscured by solvent peak ), 2 . 09 - 2 . 25 ( br m , 1h ), 1 . 73 - 2 . 04 ( br m , 2h ), 1 . 22 ( d , j = 6 . 0 hz , 3h ). n , n - diisopropylethylamine ( 150 mg , 1 . 16 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 0 . 493 ml , 0 . 828 mmol ) were added to a mixture of c64 ( 148 mg , 0 . 524 mmol ) and c81 ( 80 mg , 0 . 53 mmol ) in n , n - dimethylformamide ( 2 ml ), and the reaction mixture was stirred at 110 ° c . for 15 hours . it was then poured into water ( 10 ml ) and extracted with dichloromethane ( 3 × 20 ml ). the combined organic layers were washed with water ( 2 × 20 ml ), dried over sodium sulfate , filtered , concentrated under reduced pressure , and purified using reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 25 % to 55 % b ) to afford the product as a light yellow solid . yield : 41 . 1 mg , 0 . 103 mmol , 20 %. lcms m / z 399 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 9 . 23 ( s , 1h ), 9 . 07 - 9 . 20 ( br m , 1h ), 8 . 64 ( s , 1h ), 8 . 47 ( s , 1h ), 8 . 32 ( d , j = 9 . 0 hz , 1h ), 7 . 97 ( br d , j = 8 . 5 hz , 1h ), 5 . 35 - 5 . 54 ( br m , 1h ), 4 . 81 ( s , 2h ), 4 . 22 - 4 . 33 ( m , 1h ), 3 . 68 - 3 . 86 ( br m , 2h ), 2 . 57 - 2 . 75 ( br m , 1h ), 2 . 55 ( s , 3h ), 2 . 24 - 2 . 44 ( br m , 1h ), 1 . 84 - 2 . 21 ( br m , 2h ), 1 . 33 ( d , j = 6 . 0 hz , 3h ). n , n - diisopropylethylamine ( 1 . 29 ml , 7 . 41 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 3 . 53 g , 5 . 55 mmol ) were added to a mixture of c57 ( 500 mg , 1 . 85 mmol ) and c81 ( 296 mg , 1 . 94 mmol ) in n , n - dimethylformamide ( 9 . 2 ml ). the reaction mixture was heated to 110 ° c . overnight , whereupon it was cooled to room temperature and partitioned between water and ethyl acetate . the aqueous layer was extracted three times with ethyl acetate , and the combined organic layers were washed with water ( 3 × 20 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 10 % methanol in ethyl acetate ) afforded a mixture of 109 and c89 as a solid . yield of racemic product : 444 mg , 1 . 15 mmol , 62 %. this was combined with the product of a similar reaction ( 14 mg ) and separated into its component enantiomers via supercritical fluid chromatography [ column : chiral technologies chiralpak as - h , 5 μm ; mobile phase : 4 : 1 carbon dioxide /( ethanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting enantiomer was 109 , obtained as a solid . yield : 164 mg , 36 % for the separation . lcms m / z 387 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 39 ( s , 1h ), 8 . 90 - 8 . 95 ( m , 1h ), 8 . 61 ( s , 1h ), 8 . 38 ( s , 1h ), 8 . 35 ( d , j = 8 . 6 hz , 1h ), 7 . 85 ( br d , j = 8 . 6 hz , 1h ), 5 . 35 - 5 . 58 ( m , 2h ), 4 . 69 ( s , 2h ), 2 . 61 - 2 . 81 ( m , 3h ), 2 . 57 ( s , 3h ), 2 . 46 - 2 . 61 ( m , 1h ), 1 . 90 - 2 . 18 ( m , 2h ). the second - eluting enantiomer , also isolated as a solid , was c89 , 1 -( cis - 3 - fluorocyclopentyl )- 2 -[( 5 - methylpyrazin - 2 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , ent - 2 . yield : 179 mg , 39 % for the separation . lcms m / z 387 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 39 ( s , 1h ), 8 . 90 - 8 . 95 ( m , 1h ), 8 . 60 ( br s , 1h ), 8 . 38 ( br s , 1h ), 8 . 35 ( d , j = 9 . 0 hz , 1h ), 7 . 85 ( dd , j = 8 . 6 , 1 . 2 hz , 1h ), 5 . 35 - 5 . 58 ( m , 2h ), 4 . 68 ( s , 2h ), 2 . 61 - 2 . 80 ( m , 3h ), 2 . 57 ( s , 3h ), 2 . 46 - 2 . 61 ( m , 1h ), 1 . 90 - 2 . 17 ( m , 2h ). ethyl bromoacetate ( 2 . 59 g , 15 . 5 mmol ) was added in one portion to a mixture of 4 - methoxy - 1h - pyrazole , hydrochloride salt ( 1 . 90 g , 14 . 1 mmol ) and potassium carbonate ( 4 . 10 g , 29 . 7 mmol ) in n , n - dimethylformamide ( 20 ml ), and the reaction mixture was stirred at room temperature ( 20 ° c .) for 60 hours . it was then diluted with water ( 100 ml ) and extracted with ethyl acetate ( 3 × 80 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 2 × 150 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in petroleum ether ) provided the product as a colorless oil . yield : 1 . 90 g , 10 . 3 mmol , 73 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 30 ( s , 1h ), 7 . 15 ( s , 1h ), 4 . 80 ( s , 2h ), 4 . 24 ( q , j = 7 . 2 hz , 2h ), 3 . 76 ( s , 3h ), 1 . 29 ( t , j = 7 . 2 hz , 3h ). aqueous sodium hydroxide solution ( 2 m , 10 . 3 ml , 20 . 6 mmol ) was added in one portion to a room temperature ( 17 ° c .) solution of c90 ( 1 . 90 g , 10 . 3 mmol ) in tetrahydrofuran ( 10 ml ), and the reaction mixture was stirred at room temperature ( 17 ° c .) for 3 hours . after removal of tetrahydrofuran in vacuo , the residue was dissolved in water ( 20 ml ) and washed with dichloromethane ( 2 × 20 ml ). the aqueous phase was acidified to ph 1 with 1 m hydrochloric acid , and then extracted with ethyl acetate ( 3 × 30 ml ). the combined ethyl acetate layers were dried over sodium sulfate , filtered , and concentrated under reduced pressure to afford the product as a white solid . yield : 1 . 5 g , 9 . 6 mmol , 93 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 35 ( s , 1h ), 7 . 15 ( s , 1h ), 4 . 87 ( s , 2h ), 3 . 77 ( s , 3h ). 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 436 mg , 0 . 685 mmol ) and n , n - diisopropylethylamine ( 106 mg , 0 . 820 mmol ) were added to a mixture of c15 ( 80 mg , 0 . 27 mmol ) and c91 ( 42 . 8 mg , 0 . 274 mmol ) in ethyl acetate ( 2 ml ). the reaction mixture was heated at 85 ° c . for 16 hours , whereupon it was partitioned between ethyl acetate ( 10 ml ) and water ( 30 ml ). the organic layer was washed sequentially with water ( 2 × 30 ml ) and with saturated aqueous sodium chloride solution ( 50 ml ), dried , filtered , and concentrated in vacuo . reversed phase hplc ( column : waters xbridge c18 obd , 5 μm ; mobile phase a : water containing 0 . 05 % ammonium hydroxide ; mobile phase b : acetonitrile ; gradient : 5 % to 95 % b ) provided the product as a white solid . yield : 64 . 6 mg , 0 . 157 mmol , 58 %. lcms m / z 412 . 0 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 32 ( s , 1h ), 8 . 57 - 8 . 70 ( br m , 1h ), 8 . 23 ( d , j = 8 . 5 hz , 1h ), 7 . 66 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 7 . 29 ( s , 1h ), 7 . 14 ( s , 1h ), 5 . 70 ( s , 2h ), 5 . 27 - 5 . 41 ( m , 1h ), 4 . 28 ( br dd , j = 12 . 0 , 5 . 0 hz , 1h ), 3 . 67 ( s , 3h ), 3 . 63 - 3 . 77 ( m , 2h ), 2 . 53 - 2 . 74 ( br m , 1h ), 2 . 26 - 2 . 47 ( br m , 1h ), 1 . 56 - 1 . 7 ( br m , 1h , assumed ; partially obscured by water peak ), 1 . 40 - 1 . 56 ( br m , 1h ), 1 . 33 ( d , j = 6 . 0 hz , 3h ). this reaction was run in two identical batches . 2 , 2 - difluorocyclohexanamine , hydrochloride salt ( 410 mg , 2 . 39 mmol ) and n , n - diisopropylethylamine ( 900 mg , 6 . 96 mmol ) were added to a mixture of c61 ( 620 mg , 2 . 6 mmol ) in acetonitrile ( 10 ml ), and the reaction mixture was stirred at room temperature for 15 hours . the two batches were combined , concentrated in vacuo , and purified using silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in petroleum ether ) to provide the product as a yellow solid . yield : 790 mg , 2 . 38 mmol , 50 %. lcms m / z 332 . 7 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 49 ( s , 1h ), 9 . 05 ( brd , j = 9 . 8 hz , 1h ), 8 . 43 ( brs , 1h ), 8 . 15 ( d , j = 8 . 5 hz , 1h ), 7 . 96 ( dd , j = 8 . 8 , 1 . 8 hz , 1h ), 4 . 10 - 4 . 24 ( m , 1h ), 2 . 22 - 2 . 42 ( m , 2h ), 1 . 43 - 2 . 01 ( m , 6h , assumed ; partially obscured by water peak ). platinum on carbon ( 5 %, 81 mg ) was added in one portion to a mixture of c92 ( 690 mg , 2 . 08 mmol ) in tetrahydrofuran ( 50 ml ). the reaction mixture was purged three times with nitrogen , and then purged three times with hydrogen , whereupon it was hydrogenated for 2 hours at room temperature (− 20 ° c .) under 40 psi of hydrogen . after the reaction mixture had remained at room temperature for 16 hours , it was filtered through diatomaceous earth ; the filter pad was washed sequentially with tetrahydrofuran ( 150 ml ) and ethyl acetate ( 50 ml ), and the combined filtrates were concentrated in vacuo to afford the product as an orange solid . yield : 650 mg , quantitative . lcms m / z 302 . 7 [ m + h ] + . n , n - diisopropylethylamine ( 80 mg , 0 . 62 mmol ) was added to a mixture of c93 ( 100 mg , 0 . 33 mmol ) and c6 ( 68 mg , 0 . 48 mmol ) in toluene ( 1 ml ). 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 411 mg , 0 . 646 mmol ) was then added , and the reaction mixture was heated at 70 ° c . for 45 minutes , and then at 105 ° c . for 2 . 5 days . after cooling to room temperature , it was combined with a similar reaction carried out using c93 ( 20 mg , 66 μmol ), and the resulting mixture was taken up in ethyl acetate ( 40 ml ) and washed with saturated aqueous sodium bicarbonate solution ( 20 ml ). the aqueous layer was extracted with ethyl acetate ( 2 × 30 ml ), and the combined organic layers were washed with saturated aqueous sodium chloride solution ( 30 ml ), dried over sodium sulfate , filtered , and concentrated under reduced pressure . purification using reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 35 % to 65 % b ) afforded a racemic mixture of 111 and c94 as a yellow solid . from analysis of the 1 h nmr spectrum , this material was assumed to exist as a mixture of rotamers . yield of racemic material : 40 mg , 98 μmol , 25 %. lcms m / z 407 . 8 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ [ 9 . 40 ( s ) and 9 . 40 ( s ), total 1h ], [ 8 . 94 ( br s ) and 8 . 51 ( br s ), total 1h ], [ 8 . 39 ( d , j = 8 . 8 hz ) and 8 . 33 ( d , j = 8 . 5 hz ), total 1h ], [ 7 . 87 ( dd , j = 8 . 7 , 1 . 6 hz ) and 7 . 82 ( dd , j = 8 . 7 , 1 . 6 hz ), total 1h ], [ 6 . 11 - 6 . 13 ( m ) and 6 . 04 - 6 . 06 ( m ), total 1h ], 5 . 18 - 5 . 42 ( m , 1h ), [ 4 . 62 ( ab quartet , j ab = 16 . 7 hz , δν ab = 21 . 8 hz ) and 4 . 51 ( ab quartet , j ab = 15 . 8 hz , δν ab = 10 . 7 hz ), total 2h ], 2 . 47 - 2 . 88 ( m , 2h ), [ 2 . 43 ( d , j = 1 . 0 hz ) and 2 . 40 ( d , j = 0 . 8 hz ), total 3h ], 2 . 03 - 2 . 25 ( m , 4h ), 1 . 78 - 1 . 98 ( m , 2h ). the racemic material ( 34 . 3 mg ) was separated into its component enantiomers via supercritical fluid chromatography [ column : chiral technologies chiralpak ad - h , 5 μm ; mobile phase : 95 : 5 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting enantiomer was 111 . yield : 5 . 6 mg , 16 % for the separation . lcms m / z 408 . 4 [ m + h ] + . retention time : 3 . 66 minutes via analytical hplc [ column : chiral technologies ad - h , 4 . 6 × 100 mm , 5 μm ; mobile phase : 90 : 10 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide ); flow rate : 1 . 5 ml / minute ]. the second - eluting enantiomer was c94 . yield : 4 . 3 mg , 12 % for the separation . lcms m / z 408 . 1 [ m + h ] + . retention time 4 . 63 minutes ( analytical hplc conditions identical to those used above for 111 ). n , n - diisopropylethylamine ( 251 mg , 1 . 94 mmol ) was added to a 20 ° c . solution of c61 ( 210 mg , 0 . 899 mmol ) and ( 3r )- 1 - methylpyrrolidin - 3 - amine ( 77 . 9 mg , 0 . 778 mmol ) in acetonitrile ( 3 ml ). the reaction mixture was stirred at 20 ° c . for 2 hours , whereupon it was concentrated in vacuo . purification of the residue via silica gel chromatography ( gradient : 0 % to 1 % methanol in dichloromethane ) afforded the product as a yellow solid . yield : 210 mg , 0 . 706 mmol , 91 %. lcms m / z 297 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 10 . 04 - 10 . 15 ( br m , 1h ), 9 . 45 ( s , 1h ), 8 . 55 ( d , j = 1 . 5 hz , 1h ), 8 . 07 ( d , half of ab quartet , j = 8 . 5 hz , 1h ), 7 . 92 ( dd , half of abx pattern , j = 8 . 5 , 1 . 8 hz , 1h ), 4 . 65 - 4 . 74 ( m , 1h ), 3 . 02 - 3 . 10 ( m , 1h ), 2 . 84 - 2 . 90 ( m , 1h ), 2 . 80 ( dd , half of abx pattern , j = 9 . 9 , 5 . 6 hz , 1h ), 2 . 61 - 2 . 71 ( m , 1h ) 2 . 46 ( s , 3h ), 2 . 41 - 2 . 50 ( m , 1h ), 2 . 06 - 2 . 16 ( m , 1h ). to a solution of c95 ( 100 mg , 0 . 336 mmol ) in a mixture of ethanol ( 1 ml ) and water ( 0 . 25 ml ) were added ammonium chloride ( 36 mg , 0 . 673 mmol ) and iron powder ( 75 . 1 mg , 1 . 34 mmol ), and the reaction mixture was stirred at 80 ° c . for 1 hour . it was then filtered , and the filter cake was washed with methanol ( 30 ml ). the organic layer from the combined filtrates was concentrated in vacuo and purified via silica gel chromatography ( gradient : 0 % to 15 % methanol in dichloromethane ), affording the product as a yellow solid . yield : 112 mg , assumed quantitative . 1 h nmr ( 400 mhz , dmso - d 6 ), characteristic peaks : δ 8 . 65 - 8 . 71 ( br s , 1h ), 8 . 58 ( s , 1h ), 7 . 89 ( d , j = 8 . 5 hz , 1h ), 7 . 62 ( dd , j = 8 . 5 , 2 . 0 hz , 1h ), 5 . 56 - 5 . 70 ( br s , 1h ), 5 . 43 ( d , j = 10 . 5 hz , 1h ), 4 . 32 - 4 . 46 ( br m , 1h ), 2 . 81 ( s , 3h ), 1 . 84 - 1 . 95 ( m , 1h ). n , n - diisopropylethylamine ( 25 . 4 mg , 0 . 196 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 238 mg , 0 . 374 mmol ) were added to a solution of c96 ( 50 mg , 0 . 19 mmol ) and c20 ( 27 . 1 mg , 0 . 191 mmol ) in toluene ( 1 ml ), and the reaction mixture was stirred at 70 ° c . for 1 hour . lcms at this point indicated conversion to the intermediate amide ( lcms m / z 392 . 2 [ m + h ]+), and the reaction mixture was then stirred at 105 ° c . for 16 hours , whereupon it was concentrated in vacuo and purified by reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 27 % to 47 % b ), affording the product as a yellow solid . yield : 13 . 0 mg , 34 . 8 μmol , 18 %. lcms m / z 374 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 10 . 00 - 10 . 26 ( br s , 1h ), 9 . 39 ( s , 1h ), 8 . 32 ( d , j = 8 . 6 hz , 1h ), 7 . 84 ( dd , j = 8 . 7 , 1 . 6 hz , 1h ), 5 . 50 - 5 . 62 ( m , 1h ), 4 . 72 ( br ab quartet , j ab = 16 . 3 hz , δν ab = 20 . 5 hz , 2h ), 3 . 38 - 3 . 48 ( m , 2h ), 2 . 86 ( dd , j = 11 . 0 , 10 . 8 hz , 1h ), 2 . 60 ( s , 3h ), 2 . 57 ( s , 3h ), 2 . 42 - 2 . 63 ( m , 2h ), 2 . 32 - 2 . 42 ( br m , 1h ). n , n - diisopropylethylamine ( 25 . 4 mg , 0 . 196 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 238 mg , 0 . 374 mmol ) were added to a solution of c96 ( 50 mg , 0 . 19 mmol ) and pyrazin - 2 - ylacetic acid ( 26 . 4 mg , 0 . 191 mmol ) in toluene ( 1 ml ). the reaction mixture was stirred at 70 ° c . for 1 hour , and then at 105 ° c . for 16 hours . removal of solvent in vacuo provided a residue , which was purified using reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 25 % to 55 % b ) to afford the product as a yellow solid . yield : 10 . 3 mg , 30 . 6 μmol , 16 %. lcms m / z 370 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 10 . 18 - 10 . 32 ( br s , 1h ), 9 . 38 ( s , 1h ), 8 . 72 ( d , j = 1 . 3 hz , 1h ), 8 . 52 - 8 . 54 ( m , 2h ), 8 . 32 ( d , j = 8 . 5 hz , 1h ), 7 . 83 ( dd , j = 8 . 6 , 1 . 6 hz , 1h ), 5 . 64 - 5 . 74 ( m , 1h ), 4 . 78 ( br s , 2h ), 3 . 40 - 3 . 46 ( m , 1h ), 3 . 38 ( dd , j = 11 . 0 , 4 . 3 hz , 1h ), 2 . 79 ( dd , j = 11 . 0 , 10 . 8 hz , 1h ), 2 . 56 ( s , 3h ), 2 . 53 - 2 . 61 ( m , 1h ), 2 . 41 - 2 . 52 ( m , 1h ), 2 . 15 - 2 . 27 ( br m , 1h ). a solution of 6 -( trifluoromethyl ) quinolin - 4 - ol ( 2 . 00 g , 9 . 38 mmol ) in concentrated nitric acid ( 10 ml ) was stirred for 14 hours at 50 ° c ., whereupon it was poured into water ( 50 ml ). the resulting solid was isolated via filtration , providing the product as a pale yellow solid . yield : 1 . 80 g , 6 . 97 mmol , 74 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 29 ( s , 1h ), 8 . 46 ( s , 1h ), 8 . 11 ( d , j = 9 . 0 hz , 1h ), 7 . 92 ( d , j = 8 . 5 hz , 1h ). phosphorus oxychloride ( 3 . 25 ml , 34 . 9 mmol ) was added to a 15 ° c . solution of compound c97 ( 3 . 00 g , 11 . 6 mmol ) in n , n - dimethylformamide ( 10 ml ), and the reaction mixture was stirred for 2 hours at 15 ° c . it was then poured into water ( 80 ml ). collection of the precipitate via filtration provided the product as a solid ( 2 . 40 g ). this material was impure by 1 h nmr analysis , and was taken directly into the following step . 1 h nmr ( 400 mhz , dmso - d 6 ), product peaks only : δ 9 . 22 ( s , 1h ), 8 . 40 ( br s , 1h ), 8 . 03 ( br d , j = 8 . 5 hz , 1h ), 7 . 92 - 7 . 97 ( m , 1h ). n , n - diisopropylethylamine ( 3 . 36 g , 26 . 0 mmol ) and p2 ( 2 . 43 g , 9 . 16 mmol ) were slowly added to a 15 ° c . solution of c98 ( from the previous step , 2 . 40 g , 58 . 68 mmol ) in acetonitrile ( 30 ml ), and the reaction mixture was stirred for 30 minutes at 80 ° c . water ( 100 ml ) was added , and the resulting mixture was extracted with ethyl acetate ( 3 × 100 ml ). the combined organic layers were concentrated in vacuo , and the residue was purified via silica gel chromatography ( gradient : 9 % to 25 % ethyl acetate in petroleum ether ) to provide the product as a yellow solid . yield : 3 . 40 g , 6 . 73 mmol , 58 % over 2 steps . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 11 ( s , 1h ), 8 . 60 ( br s , 1h ), 8 . 15 ( d , j = 9 . 0 hz , 1h ), 7 . 92 ( dd , j = 8 . 8 , 1 . 8 hz , 1h ), 6 . 84 ( d , j = 8 . 0 hz , 1h ), 6 . 22 ( dd , j = 8 . 3 , 2 . 3 hz , 1h ), 6 . 16 ( d , j = 2 . 0 hz , 1h ), 4 . 33 - 4 . 44 ( m , 2h ), 4 . 02 - 4 . 10 ( m , 1h ), 3 . 77 - 3 . 87 ( m , 1h ), 3 . 68 ( s , 3h ), 3 . 50 ( s , 3h ), 3 . 36 - 3 . 46 ( m , 2h ), 1 . 95 - 2 . 10 ( m , 3h ), 1 . 67 - 1 . 78 ( m , 1h ), 1 . 23 ( d , j = 6 . 0 hz , 3h ). trifluoroacetic acid ( 7 . 67 g , 67 . 3 mmol ) was added to a 15 ° c . solution of compound c99 ( 3 . 40 g , 6 . 73 mmol ) in dichloromethane ( 30 ml ), and the reaction mixture was stirred for 30 minutes at 15 ° c . solvents were removed in vacuo , and the residue was diluted with water ( 100 ml ) and extracted with ethyl acetate ( 3 × 100 ml ). the combined organic layers were concentrated in vacuo to afford the product ( 2 . 50 g ) as a pale yellow solid , a portion of which was used directly in the following step . lcms m / z 355 . 8 [ m + h ] + . iron powder ( 314 mg , 5 . 62 mmol ) and ammonium chloride ( 301 mg , 5 . 63 mmol ) were added to a solution of c100 ( from the previous step , 200 mg , 50 . 54 mmol ) in ethanol ( 5 ml ) and water ( 1 ml ), and the reaction mixture was stirred for 1 hour at 80 ° c . it was then filtered through diatomaceous earth , and the filtrate was concentrated in vacuo . silica gel chromatography ( gradient : 9 % to 33 % ethyl acetate in petroleum ether ) afforded the product as a pale grey solid . yield : 140 mg , 0 . 430 mmol , 80 % over 2 steps . lcms m / z 325 . 9 [ m + h ] + . to a solution of c20 ( 60 . 0 mg , 0 . 422 mmol ) in n , n - dimethylformamide ( 2 ml ) were added c101 ( 137 mg , 0 . 421 mmol ), n , n - diisopropylethylamine ( 161 mg , 1 . 25 mmol ), and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 0 . 39 ml , 0 . 655 mmol ). the reaction mixture was stirred for 2 hours at 110 ° c ., whereupon it was diluted with water ( 80 ml ) and extracted with ethyl acetate ( 3 × 80 ml ). the combined organic layers were concentrated in vacuo and purified by reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 40 % to 70 % b ), providing the product as a pale grey solid . yield : 16 . 8 mg , 38 . 9 μmol , 9 %. lcms m / z 432 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 41 ( s , 1h ), 8 . 94 - 9 . 11 ( br m , 1h ), 8 . 41 ( d , j = 8 . 8 hz , 1h ), 7 . 90 ( dd , j = 8 . 8 , 1 . 8 hz , 1h ), 4 . 99 - 5 . 19 ( br m , 1h ), 4 . 62 ( s , 2h ), 4 . 33 ( br dd , j = 12 , 5 hz , 1h ), 3 . 64 - 3 . 79 ( m , 2h ), 2 . 67 - 2 . 87 ( br m , 1h ), 2 . 61 ( s , 3h ), 2 . 38 - 2 . 63 ( br m , 1h ), 1 . 80 - 2 . 09 ( br m , 2h ), 1 . 35 ( d , j = 6 . 0 hz , 3h ). n , n - diisopropylethylamine ( 71 . 6 μl , 0 . 411 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 0 . 245 ml , 0 . 412 mmol ) were added to a mixture of c15 ( 40 . 0 mg , 0 . 137 mmol ) and ( 3 - methyl - 1 , 2 - oxazol - 5 - yl ) acetic acid ( 19 . 3 mg , 0 . 137 mmol ) in ethyl acetate ( 0 . 8 ml ), and the reaction mixture was heated at 80 ° c . overnight . it was then partitioned between saturated aqueous sodium bicarbonate solution and ethyl acetate , and the aqueous layer was extracted twice with ethyl acetate . the combined organic layers were dried over sodium sulfate , filtered , and concentrated under reduced pressure . chromatography on silica gel ( gradient : 0 % to 10 % methanol in dichloromethane ), followed by trituration with diethyl ether , provided the product as a yellow solid . yield : 33 . 2 mg , 83 . 6 μmol , 61 %. lcms m / z 397 . 3 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 28 ( s , 1h ), 8 . 55 - 8 . 75 ( br m , 1h ), 8 . 24 ( d , j = 8 . 6 hz , 1h ), 7 . 66 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 6 . 07 ( s , 1h ), 4 . 90 - 5 . 13 ( br m , 1h ), 4 . 61 ( s , 2h ), 4 . 34 ( br dd , j = 11 . 7 , 4 . 3 hz , 1h ), 3 . 64 - 3 . 82 ( m , 2h ), 2 . 62 - 2 . 88 ( br m , 1h ), 2 . 36 - 2 . 59 ( br m , 1h ), 2 . 28 ( s , 3h ), 1 . 71 - 2 . 02 ( br m , 2h ), 1 . 37 ( d , j = 5 . 9 hz , 3h ). n , n - diisopropylethylamine ( 52 mg , 0 . 40 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 480 mg , 0 . 75 mmol ) were added to a solution of c15 ( 102 mg , 0 . 350 mmol ) and ( 5 - methyl - 1 , 3 , 4 - thiadiazol - 2 - yl ) acetic acid ( 60 mg , 0 . 38 mmol ) in toluene ( 3 ml ). the reaction mixture was heated to 70 ° c . for 2 hours , and then at 105 ° c . for 18 hours . saturated aqueous sodium bicarbonate solution ( 10 ml ) was added , and the resulting mixture was extracted with ethyl acetate ( 6 × 10 ml ). the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . purification via reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 34 % to 54 % b ) afforded the product as a red solid . yield : 38 mg , 92 μmol , 26 %. lcms m / z 414 . 0 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 28 ( s , 1h ), 8 . 56 - 8 . 76 ( br m , 1h ), 8 . 23 ( d , j = 9 . 0 hz , 1h ), 7 . 65 ( dd , j = 8 . 9 , 2 . 1 hz , 1h ), 5 . 23 - 5 . 37 ( m , 1h ), 4 . 94 ( s , 2h ), 4 . 31 ( br dd , j = 12 , 5 hz , 1h ), 3 . 68 - 3 . 82 ( m , 2h ), 2 . 76 ( s , 3h ), 2 . 57 - 2 . 80 ( br m , 1h ), 2 . 31 - 2 . 52 ( br m , 1h ), 1 . 58 - 1 . 9 ( br m , 2h , assumed ; partially obscured by water peak ), 1 . 36 ( d , j = 6 . 0 hz , 3h ). conversion of vicinal chloro - nitro bicyclic heteroaromatics to 1 , 2 - disubstituted - imidazo [ 4 , 5 - c ]- fused tricyclic compounds m1 the vicinal chloro - nitro bicyclic heteroaromatic starting material c35 ( 1 mmol ) was combined in a vial with amine r 2 — nh 2 ( 1 . 2 mmol ) and n , n - dimethylformamide ( 4 ml ). triethylamine ( 300 μl , 2 mmol ) was added , the vial was sealed , and the reaction mixture was shaken at 30 ° c . for 16 hours . solvent was removed using a speedvac ® concentrator to provide the product . compound c36 from the previous step was mixed with methanol ( 2 ml ) and aqueous ammonium hydroxide solution ( 2 ml ). activated zinc dust ( 650 mg , 10 mmol ) was added to the vial , which was then sealed and shaken at 30 ° c . for 1 hour . the reaction mixture was filtered , and the filtrate was concentrated using a speedvac ® concentrator . water ( 10 ml ) was added to the residue , and the mixture was extracted with ethyl acetate ( 3 × 10 ml ); the combined organic layers were dried over sodium sulfate , filtered , and concentrated to afford the product . a solution of c37 in 1 , 4 - dioxane ( 0 . 125 m , 800 μl , 100 μmol ) was added to the carboxylic acid ( r 1 )( r 10 ) chcooh ( 100 μmol ). triethylamine ( 45 μl , 320 μmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 80 μl , 130 μmol ) were added , the vial was sealed , and the reaction mixture was shaken at 130 ° c . for 16 hours . after concentration using a speedvac ®, the product was purified using one of the following reversed phase hplc systems : 1 ) column : phenomenex gemini c18 , 8 μm ; gradient : acetonitrile in aqueous ammonium hydroxide ( ph 10 ); 2 ) column : dikma diamonsil ( 2 ) c18 , 5 μm ; gradient : acetonitrile in ( water containing 0 . 225 % formic acid ); 3 ) column : ymc - actus triart c18 , 5 μm ; gradient : acetonitrile in aqueous ammonium hydroxide ( ph 10 ). conversion of vicinal chloro - nitro bicyclic heteroaromatics to 1 , 2 - disubstituted - imidazo [ 4 , 5 - c ]- fused tricyclic compounds m1 compound c35 ( 0 . 15 mmol ) was combined with amine r 2 — nh 2 ( 0 . 18 mmol ) and n , n - diisopropylethylamine ( 0 . 10 ml , 0 . 6 mmol ) in acetonitrile ( 0 . 5 ml ), and the reaction vial was shaken at 45 ° c . for 2 hours . the reaction mixture was then partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing . the organic layer was eluted through a solid - phase extraction cartridge ( 6 ml ) loaded with sodium sulfate (˜ 1 g ); this extraction process was repeated twice , and solvent was removed in vacuo to provide the product . compound c36 ( from the previous step , ˜ 0 . 15 mmol ) was treated with methanol ( 0 . 3 ml ) and aqueous ammonium hydroxide solution ( 0 . 3 ml ). zinc dust (˜ 100 mg , 1 . 5 mmol ) was added , and the reaction mixture was shaken at room temperature for 1 hour , then filtered through diatomaceous earth . the filter pad was washed with ethyl acetate ( 2 × 2 . 5 ml ), and the combined filtrates were concentrated in vacuo . the residue was partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing . the organic layer was eluted through a solid - phase extraction cartridge ( 6 ml ) loaded with sodium sulfate (˜ 1 g ); this extraction process was repeated twice , and solvent was removed under reduced pressure to provide the product . compound c37 ( from the previous step , ˜ 0 . 15 mmol ) was dissolved in 1 - methylpyrrolidin - 2 - one ( 0 . 4 ml ) and added to carboxylic acid ( r 1 )( r 10 ) chcooh ( 0 . 19 mmol ). triethylamine ( 23 μl , 0 . 16 mmol ) and a solution of o -( 7 - azabenzotriazol - 1 - yl )- n , n , n ′, n ′- tetramethyluronium hexafluorophosphate ( hatu , 71 mg , 0 . 19 mmol ) in 1 - methylpyrrolidin - 2 - one ( 0 . 3 ml ) were added . ( an extra equivalent of triethylamine was employed if the carboxylic acid was a hydrochloride salt .) the reaction mixture was shaken at 100 ° c . for 20 hours , then partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing . the organic layer was eluted through a solid - phase extraction cartridge ( 6 ml ) loaded with sodium sulfate (˜ 1 g ); this extraction process was repeated twice , and solvent was removed under reduced pressure to provide the product . purification was carried out via gradient elution , using one of the following reversed phase hplc systems : 1 ) column : waters sunfire c18 , 5 μm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); or 2 ) column : waters xbridge c18 , 5 μm ; mobile phase a : 0 . 03 % ammonium hydroxide in water ( v / v ); mobile phase b : 0 . 03 % ammonium hydroxide in acetonitrile ( v / v ). table 1 , below , provides the method of preparation , structure , and physicochemical data for the compounds of examples 12 - 92 and 117 - 145 . 2 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : lux cellulose - 1 , 5 μm ; eluent : 4 : 1 carbon dioxide / methanol ). the second - eluting compound was example 12 . the enantiomer of example 12 , 8 - bromo - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , was the first - eluting enantiomer , and exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 510 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 226 nm . 3 . example 9 was reacted with hydroxylamine and n , n - diisopropylethylamine in ethanol ; the resulting 2 -{ 8 - chloro - 1 -[( 2r , 4r )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 1h - imidazo [ 4 , 5 - c ] quinolin - 2 - yl }- n ′- hydroxyethanimidamide was cyclized using trimethyl orthoformate and p - toluenesulfonic acid to afford example 13 . 4 . the requisite 8 - bromo - 2 - methyl - 1 -( tetrahydro - 2h - pyran - 4 - yl )- 1h - imidazo [ 4 , 5 - c ] quinoline was prepared using the general method of example 6 . 5 . reaction of tert - butyl [( 1r , 3r )- 3 - hydroxycyclopentyl ] carbamate with ( diethylamino ) sulfur trifluoride , followed by treatment with hydrogen chloride in ethyl acetate , afforded ( 1r , 3s )- 3 - fluorocyclopentanamine . 6 . conditions for analytical hplc . column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 0375 % trifluoroacetic acid in water ; mobile phase b : 0 . 01875 % trifluoroacetic acid in acetonitrile ; gradient : 1 % to 5 % b over 0 . 6 minutes ; 5 % to 100 % b over 3 . 4 minutes ; flow rate : 0 . 8 ml / minute . 7 . the requisite 8 - bromo - 2 - methyl - 1 -( 2 - methyltetrahydro - 2h - pyran - 4 - yl )- 1h - imidazo [ 4 , 5 - c ] quinoline was prepared using the general method of example 6 . 8 . 8 - bromo - 1 -( 2 - methyltetrahydro - 2h - pyran - 4 - yl )- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline was synthesized using the method of example 7 . the final product was generated as a mixture of examples 21 and 23 , which was separated via reversed phase hplc ( column : ymc - actus triart c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 29 % to 49 % b ). 9 . the requisite 8 - bromo - 1 -( cis - 2 - methyltetrahydro - 2h - pyran - 4 - yl )- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline was prepared using the general method of example 1 . 10 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - 3 , 4 . 6 × 50 mm , 3 μm ; same gradient system ), example 22 exhibited a retention time of 1 . 18 minutes . the enantiomer of example 22 , 1 -[( 2 s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , had a retention time of 1 . 37 minutes under the same conditions . the enantiomer of example 22 , lcms m / z 374 . 0 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 534 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 258 nm . 11 . example 23 was separated into its component enantiomers via supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - 3 , 4 . 6 × 50 mm , 3 μm ; same gradient system ), example 24 exhibited a retention time of 1 . 37 minutes . the enantiomer of example 24 , 1 -[( 2r , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , had a retention time of 1 . 51 minutes under the same conditions . the enantiomer of example 24 , lcms m / z 374 . 1 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 267 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 134 nm . 12 . conditions for analytical hplc . column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 0375 % trifluoroacetic acid in water ; mobile phase b : 0 . 01875 % trifluoroacetic acid in acetonitrile ; gradient : 10 % to 100 % b over 4 . 0 minutes ; flow rate : 0 . 8 ml / minute . 13 . conditions for analytical hplc . column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 5 % b for 0 . 5 minutes ; 5 % to 100 % b over 2 . 9 minutes ; 100 % b for 0 . 8 minutes ; flow rate : 0 . 8 ml / minute . 14 . this example was prepared as a racemate ; the enantiomers were separated via supercritical fluid chromatography . example 51 was the second - eluting enantiomer ; retention time 6 . 21 minutes ( analytical column : chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : ethanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ; flow rate : 1 . 5 ml / minute ). the enantiomer of example 51 ( example 5 ) exhibited a retention time of 5 . 65 minutes in this analytical system . 15 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; same gradient system ), example 54 exhibited a retention time of 6 . 28 minutes . the enantiomer of example 54 , 8 - fluoro - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 6 . 66 minutes under the same conditions . the enantiomer of example 54 , lcms m / z 366 . 9 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 332 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 236 nm . 16 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralcel od - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc [ column : chiralpak as - h , 4 . 6 × 250 mm , 5 μm ; mobile phase : 10 % ethanol ( containing 0 . 05 % diethylamine ) in carbon dioxide ], example 55 exhibited a retention time of 5 . 85 minutes . the enantiomer of example 55 , 8 - fluoro - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 3 - thiazol - 4 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , lcms m / z 383 . 0 [ m + h ] + , had a retention time of 6 . 02 minutes under the same conditions . the enantiomer of example 55 , lcms m / z 366 . 9 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 725 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 380 nm . 17 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralcel od - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralcel od - 3 , 4 . 6 × 150 mm , 3 μm ; same gradient system ; flow rate : 1 . 5 ml / minute ), example 57 exhibited a retention time of 8 . 22 minutes . the enantiomer of example 57 , 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 3 - thiazol - 4 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , had a retention time of 7 . 29 minutes under the same conditions . the enantiomer of example 57 , lcms m / z 390 . 0 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 382 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 196 nm . 18 . hydrogenation of 2 , 6 - dimethyl - 4h - pyran - 4 - one over palladium on carbon afforded cis - 2 , 6 - dimethyltetrahydro - 4h - pyran - 4 - one , which was converted to the requisite ( 2r , 4r , 6s )- n -( 2 , 4 - dimethoxybenzyl )- 2 , 6 - dimethyltetrahydro - 2h - pyran - 4 - amine using the method described for synthesis of p1 in preparation p1 . 19 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; same gradient system ), example 62 exhibited a retention time of 4 . 19 minutes . the enantiomer of example 62 , 8 - methoxy - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 5 . 07 minutes under the same conditions . the enantiomer of example 62 , lcms m / z 379 . 0 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 1713 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 508 nm . 20 . this example was prepared as a racemate ; the enantiomers were separated via supercritical fluid chromatography . example 64 was the second - eluting enantiomer ; retention time 8 . 87 minutes ( analytical column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). the enantiomer of example 64 ( example 8 ) exhibited a retention time of 6 . 98 minutes in this analytical system . 21 . this example was prepared as a racemate ; the enantiomers were separated via supercritical fluid chromatography . example 65 was the second - eluting enantiomer ; retention time 8 . 73 minutes ( analytical column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). the enantiomer of example 65 , 8 - chloro - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1h - 1 , 2 , 4 - triazol - 1 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 7 . 97 minutes under the same conditions . the enantiomer of example 65 , lcms m / z 382 . 9 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 687 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 241 nm . 22 . the requisite cis - n -( 2 , 4 - dimethoxybenzyl )- 2 - ethyltetrahydro - 2h - pyran - 4 - amine was prepared from propanal and but - 3 - en - 1 - ol in analogy with the syntheses of p1 and p2 , except that pyridinium chlorochromate was used in place of jones reagent . 23 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; same gradient system ), example 67 exhibited a retention time of 1 . 17 minutes . the enantiomer of example 67 , 1 -[( 2s , 4s )- 2 - ethyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , had a retention time of 1 . 38 minutes under the same conditions . the enantiomer of example 67 , lcms m / z 388 . 0 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 699 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 403 nm . 24 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; same gradient system ), example 68 exhibited a retention time of 5 . 76 minutes . the enantiomer of example 68 , 1 -[( 2 s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ][ 1 , 5 ] naphthyridine , had a retention time of 6 . 14 minutes under the same conditions . the enantiomer of example 68 , lcms m / z 349 . 9 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 853 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 632 nm . 25 . conditions for analytical hplc . column : waters atlantis dc18 , 4 . 6 × 50 mm , 5 μm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); gradient : 5 . 0 % to 95 % b , linear over 4 . 0 minutes ; flow rate : 2 ml / minute . 26 . compound c34 was combined with a solution of ammonia in methanol ( 7 m ) and heated in a microwave reactor at 160 ° c . to afford example 85 . 27 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : ethanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; same gradient system ), example 87 exhibited a retention time of 6 . 39 minutes . the enantiomer of example 87 , 8 - methoxy - 2 -[( 5 - methyl - 1 , 2 , 4 - oxadiazol - 3 - yl ) methyl ]- 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 7 . 57 minutes under the same conditions . the enantiomer of example 87 , lcms m / z 394 . 1 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 2853 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 929 nm . 28 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; same gradient system ), example 88 exhibited a retention time of 6 . 96 minutes . the enantiomer of example 88 , 8 - methoxy - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -[( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 7 . 78 minutes under the same conditions . the enantiomer of example 88 , lcms m / z 393 . 1 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 1055 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 372 nm . 29 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; same gradient system ), example 89 exhibited a retention time of 7 . 54 minutes . the enantiomer of example 89 , 8 - methoxy - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 3 - thiazol - 4 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 8 . 17 minutes under the same conditions . the enantiomer of example 89 , lcms m / z 395 . 0 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 1218 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 743 nm . 30 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : ethanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; same gradient system ), example 90 exhibited a retention time of 8 . 60 minutes . the enantiomer of example 90 , 2 -( imidazo [ 2 , 1 - b ][ 1 , 3 , 4 ] thiadiazol - 6 - ylmethyl )- 8 - methoxy - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 9 . 48 minutes under the same conditions . the enantiomer of example 90 , lcms m / z 435 . 1 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 623 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 245 nm . 31 . reagent cis - 2 -[( benzyloxy ) methyl ]- n -( 2 , 4 - dimethoxybenzyl ) tetrahydro - 2h - pyran - 4 - amine was prepared from ( benzyloxy ) acetaldehyde and but - 3 - en - 1 - ol in analogy with footnote 22 . 32 . intermediate 1 -{ cis - 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - yl }- 2 - methyl - 1h - imidazo [ 4 , 5 - c ] quinoline was deprotected with boron trichloride , and the resulting alcohol was converted to the 4 - methylbenzenesulfonate derivative . displacement with tetraethylammonium cyanide afforded example 91 . 33 . the requisite ( 5 - methyl - 1 , 3 - oxazol - 2 - yl ) acetic acid was prepared using the method of a . s . k . hashmi et al ., org . lett . 2004 , 6 , 4391 - 4394 . 34 . in this case , the zinc cyanide reaction employed tris ( dibenzylideneacetone ) dipalladium ( 0 ) and dicyclohexyl ( 2 ′, 6 ′- dimethoxybiphenyl - 2 - yl ) phosphane rather than tetrakis ( triphenylphosphine ) palladium ( 0 ), and was carried out using microwave irradiation . 35 . the racemic product was separated into its enantiomers via supercritical fluid chromatography [ column : phenomenex lux cellulose - 1 , 5 μm ; eluent : 4 : 1 carbon dioxide /( ethanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting compound was example 118 . the enantiomer of example 118 , 1 -( cis - 3 - fluorocyclopentyl ]- 2 -[( 3 - methyl - 1 , 2 - oxazol - 5 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , ent - 2 , was the second - eluting enantiomer , and exhibited the following biological data : lrrk2 , format 2 wt ic 50 , 22 . 4 nm ; lrrk2 , format 2 g2019s mutant ic 50 , 26 . 1 nm . 36 . reaction of ethyl 5 -( trifluoromethyl )- 1 , 2 - oxazole - 3 - carboxylate with sodium borohydride , followed by conversion of the primary alcohol to the corresponding mesylate and displacement with potassium cyanide , provided [ 5 -( trifluoromethyl )- 1 , 2 - oxazol - 3 - yl ] acetonitrile . nitrile hydrolysis using concentrated hydrochloric acid then afforded the requisite [ 5 -( trifluoromethyl )- 1 , 2 - oxazol - 3 - yl ] acetic acid . 37 . the requisite ( 2 - cyclopropyl - 1 , 3 - oxazol - 4 - yl ) acetic acid can be prepared using the method described by m . d . andrews et al ., pct int . appl ., 2012137089 , oct . 11 , 2012 . 38 . reaction of 5 -( chloromethyl )- 1 , 3 - oxazole with sodium cyanide , followed by nitrile hydrolysis using aqueous sodium hydroxide , provided 1 , 3 - oxazol - 5 - ylacetic acid . 39 . the racemic product was separated into its enantiomers via supercritical fluid chromatography [ column : chiral technologies chiralpak ad - h , 5 μm ; mobile phase : 1 : 1 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting compound was example 132 . the enantiomer of example 132 , 1 -( cis - 3 - fluorocyclopentyl )- 2 -{[ 4 -( methoxymethyl )- 1h - 1 , 2 , 3 - triazol - 1 - yl ] methyl }- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , ent - 2 , was the second - eluting enantiomer , and exhibited the following biological data : lrrk2 , format 2 wt ic 50 , 26 . 8 nm ; lrrk2 , format 2 g2019s mutant ic 50 , 34 . 5 nm . 40 . conditions for analytical hplc . column : chiral technologies chiralpak ad - h , 4 . 6 × 100 mm , 5 μm ; mobile phase : 1 : 1 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide ); flow rate : 3 . 0 ml / minute . 41 . reaction of but - 3 - en - 1 - ol and ( benzyloxy ) acetaldehyde in the presence of sulfuric acid provided 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - ol , which was oxidized with pyridinium chlorochromate to afford 2 -[( benzyloxy ) methyl ] tetrahydro - 4h - pyran - 4 - one . subsequent reductive amination with 1 -( 2 , 4 - dimethoxyphenyl ) methanamine and lithium borohydride gave cis - 2 -[( benzyloxy ) methyl ]- n -( 2 , 4 - dimethoxybenzyl ) tetrahydro - 2h - pyran - 4 - amine . this was reacted with c13 and triethylamine , and the product was deprotected using trifluoroacetic acid to yield n -{ cis - 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - yl }- 6 - chloro - 3 - nitroquinolin - 4 - am ine ; hydrogenation of the nitro group over platinum ( iv ) oxide afforded n 4 -{ cis - 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - yl }- 6 - chloroquinoline - 3 , 4 - diamine . 42 . 1 -{( 2r , 4s )- 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - yl }- 8 - chloro - 2 -[( 5 - methyl - 1 , 2 - oxazol - 3 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline ( the product from reaction of c6 and n 4 -{ cis - 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - yl }- 6 - chloroquinoline - 3 , 4 - diamine , described in footnote 41 ) was reacted with boron trichloride . the resulting primary alcohol was converted to the corresponding mesylate derivative and displaced using potassium cyanide with catalytic tetraethylammonium cyanide to afford the racemate of example 134 . 43 . the racemate of example 134 was separated into its component enantiomers via supercritical fluid chromatography ( column : chiral technologies chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). the first - eluting compound was example 134 . the enantiomer of example 134 , [ cis - 4 -{ 8 - chloro - 2 -[( 5 - methyl - 1 , 2 - oxazol - 3 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl } tetrahydro - 2h - pyran - 2 - yl ] acetonitrile , ent - 2 , was the second - eluting enantiomer , and exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 353 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 327 nm . 44 . the racemate of example 135 was separated into its component enantiomers via supercritical fluid chromatography ( column : chiral technologies chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). the first - eluting compound was example 135 . the enantiomer of example 135 , [ cis - 4 -{ 8 - chloro - 2 -[( 5 - methyl - 1 , 2 , 4 - oxadiazol - 3 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl } tetrahydro - 2h - pyran - 2 - yl ] acetonitrile , ent - 2 , was the second - eluting enantiomer , and exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 1450 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 1220 nm . 45 . reaction of tert - butyl cyclopent - 3 - en - 1 - ylcarbamate with 3 - chloroperoxybenzoic acid , followed by epoxide opening with methylmagnesium bromide in the presence of copper ( i ) iodide , provided tert - butyl [ rel -( 3r , 4r )- 3 - hydroxy - 4 - methylcyclopentyl ] carbamate . conversion of the secondary alcohol to the corresponding fluoride was carried out with ( diethylamino ) sulfur trifluoride ; deprotection using hydrogen chloride afforded the requisite rel -( 3s , 4r )- 3 - fluoro - 4 - methylcyclopentanamine . this was reacted with c13 in the presence of triethylamine , and the nitro group of the product was hydrogenated over platinum ( iv ) oxide to provide 6 - chloro - n 4 -[ rel -( 3s , 4r )- 3 - fluoro - 4 - methylcyclopentyl ] quinoline - 3 , 4 - diamine . 46 . the mixture of diastereomeric products was separated into its component racemic isomers via reversed phase hplc ( column : kromasil eternity xt c18 , 10 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 26 % to 46 % b ). the first - eluting compound was example 136 . the diastereomer of example 136 , 8 - chloro - 1 -[ rel -( 3s , 4r )- 3 - fluoro - 4 - methylcyclopentyl ]- 2 -[( 5 - methyl - 1 , 2 , 4 - oxadiazol - 3 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline , diast - 2 , was the second - eluting compound , and exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 156 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 105 nm , lrrk2 , format 2 wt ic 50 , 63 . 2 nm ; lrrk2 , format 2 g2019s mutant ic 50 , 69 . 2 nm 47 . mcyp - rxn buffer ( 545 . 0 mg , codex ®) was treated with deionized water ( 19 . 2 ml ) and charged with a solution of mcyp0016 ( 41 . 38 mg , codex ® microcyp ®) dissolved in potassium phosphate buffer ( 0 . 1 m , 4 . 0 ml ) at ph 8 . 0 . the mixture was treated with a solution of example 4 ( 5 . 72 mg ) dissolved in dimethyl sulfoxide ( 0 . 6 ml ) and potassium phosphate buffer ( 0 . 1 m , 0 . 6 ml ) at ph 8 . 0 . the reaction mixture was shaken at 30 ° c . for 12 hours . isolation via reversed phase hplc ( column : phenomenex gemini nx c18 , 5 μm ; mobile phase a : water containing 0 . 1 % formic acid ; mobile phase b : acetonitrile containing 0 . 1 % formic acid ; gradient : 5 % to 90 % b ) afforded example 137 . 48 . example 4 was subjected to incubation with codex ® microcyp ® mcyp0030 at 30 ° c ., using the general procedure described in footnote 47 . isolation via reversed phase hplc ( column : phenomenex gemini nx c18 , 5 μm ; mobile phase a : water containing 0 . 1 % formic acid ; mobile phase b : acetonitrile containing 0 . 1 % formic acid ; gradient : 5 % to 90 % b ) afforded example 138 . 49 . example 138 was reacted with ( diethylamino ) sulfur trifluoride to provide example 139 . 50 . the requisite 6 - fluoro - n 4 -[( 2r , 4r )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ] quinoline - 3 , 4 - diamine was synthesized from 6 - fluoro - 3 - nitroquinolin - 4 - ol using the general method described in example 1 for synthesis of c11 from c7 , except that p2 was used in place of p1 , and hydrogenation was carried out over platinum on carbon , rather than platinum ( iv ) oxide . 51 . reaction of 1 , 2 , 3 - thiadiazol - 4 - ylmethanol with methanesulfonyl chloride , followed by displacement using potassium cyanide and hydrolysis in concentrated hydrochloric acid , provided the requisite 1 , 2 , 3 - thiadiazol - 4 - ylacetic acid . 52 . in this case , the final coupling and cyclization reaction was carried out in two steps : reaction of 6 - fluoro - n 4 -[( 2r , 4r )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ] quinoline - 3 , 4 - diamine ( footnote 50 ) with 1 , 2 , 3 - thiadiazol - 4 - ylacetic acid ( footnote 51 ) was effected with 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide and triethylamine at 50 ° c ., and intermediate n -( 6 - fluoro - 4 -{[( 2r , 4r )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ] amino } quinolin - 3 - yl )- 2 -( 1 , 2 , 3 - thiadiazol - 4 - yl ) acetamide was isolated . further reaction with 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide and n , n - diisopropylethylamine at 110 ° c . afforded example 140 . 53 . the final coupling and cyclization reaction was carried out in two steps , as described for example 140 in footnote 52 . 55 . 3 - amino - 4 -[( 2 , 2 - difluorocyclopentyl ) amino ] quinoline - 6 - carbonitrile was synthesized from c61 using the method described for preparation of c54 from c13 in example 93 . 56 . the racemic product was separated into its enantiomers via supercritical fluid chromatography [ column : chiral technologies chiralpak as , 5 μm ; eluent : 4 : 1 carbon dioxide / 2 - propanol containing 0 . 1 % ammonium hydroxide )]. the first - eluting compound was example 143 , and example 144 was the second - eluting enantiomer . 57 . conversion of ( 5 - cyclopropyl - 1 , 2 - oxazol - 3 - yl ) methanol to the requisite ( 5 - cyclopropyl - 1 , 2 - oxazol - 3 - yl ) acetic acid was carried out using the method described in footnote 51 . table 2 , below , provides the structure and mass spectral data for the compounds of examples 146 - 250 . 1 . examples 146 and 147 were synthesized as the racemic mixture , and then separated into individual enantiomers using supercritical fluid chromatography ( column : phenomenex lux amylose - 1 , 5 μm ; mobile phase : 85 : 15 carbon dioxide / ethanol ). example 146 was the first - eluting enantiomer , followed by example 147 . 2 . examples 168 and 169 were synthesized as the racemic mixture , and then separated into individual enantiomers using supercritical fluid chromatography [ column : phenomenex chiralcel od - h , 5 μm ; mobile phase : 85 : 15 carbon dioxide /( methanol containing 0 . 05 % ammonium hydroxide )]. example 168 was the first - eluting enantiomer , followed by example 169 . 3 . example 170 was isolated from the corresponding racemic mixture via supercritical fluid chromatography [ column : chiral technologies chiralpak ad - h , 5 μm ; mobile phase : 85 : 15 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. example 170 was the first - eluting enantiomer . 4 . examples 176 and 177 were synthesized as the racemic mixture , and then separated into individual enantiomers using supercritical fluid chromatography [ column : chiral technologies chiralpak as , 5 μm ; mobile phase : 85 : 15 carbon dioxide /( 2 - propanol containing 0 . 1 % ammonium hydroxide )]. example 176 was the first - eluting enantiomer , followed by example 177 . 5 . examples 196 and 197 were synthesized as the racemic mixture . separation and purification required two chromatographic steps : supercritical fluid chromatography [ column : phenomenex lux cellulose - 2 , 10 μm ; mobile phase : 3 : 2 carbon dioxide /( methanol containing 0 . 1 % ammonium hydroxide )] provided example 196 as the first - eluting enantiomer and example 197 as the second - eluting enantiomer . further purification was effected using reversed phase hplc ( column : waters xbridge c18 obd , 5 μm ; mobile phase a : water containing 0 . 05 % ammonium hydroxide ; mobile phase b : acetonitrile ; gradient : 25 % to 55 % b ). 6 . example 207 was isolated from the corresponding racemic mixture via supercritical fluid chromatography [ column : chiral technologies chiralpak ad , 5 μm ; mobile phase : 3 : 1 carbon dioxide /( ethanol containing 0 . 1 % ammonium hydroxide )]. example 207 was the second - eluting enantiomer . 7 . reaction of c61 with 2 , 2 - difluoropropan - 1 - amine and n , n - diisopropylethylamine provided 4 -[( 2 , 2 - difluoropropyl ) amino ]- 3 - nitroquinoline - 6 - carbonitrile , which was reduced with iron in the presence of hydrochloric acid to afford the requisite intermediate 3 - amino - 4 -[( 2 , 2 - difluoropropyl ) amino ] quinoline - 6 - carbonitrile . 8 . example 211 was isolated from the corresponding racemic mixture via supercritical fluid chromatography [ column : phenomenex lux amylose - 1 , 5 μm ; mobile phase : 85 : 15 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. example 211 was the first - eluting enantiomer . 9 . example 215 was isolated from the corresponding racemic mixture via supercritical fluid chromatography . under analytical hplc [ column : phenomenex lux cellulose - 2 , 3 μm ; mobile phase : 3 : 2 carbon dioxide /( 2 - propanol containing 0 . 05 % diethylamine ); flow rate : 2 . 5 ml / minute ], example 215 was the first - eluting enantiomer . 10 . example 221 was synthesized from example 137 via fluorination with ( diethylamino ) sulfur trifluoride . 11 . examples 237 and 238 were synthesized as the diastereomeric mixture , and then separated into individual diastereomers using supercritical fluid chromatography [ column : phenomenex chiralcel oj - h , 5 μm ; mobile phase : 9 : 1 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. example 237 was the first - eluting diastereomer , followed by example 238 . lrrk2 kinase activity was measured using lantha screen technology from invitrogen . gst - tagged truncated lrrk2 from invitrogen ( cat # pv4874 ) was incubated with a fluorescein - labeled peptide substrate based upon ezrin / radixin / moesin ( erm ), also known as lrrktide ( invitrogen cat # pr8976a ), in the presence of a dose response of compound . upon completion , the assay was stopped and detected with a terbium labeled anti - phospho - erm antibody ( invitrogen , cat # pr8975a ). the assay was carried out under the following protocol : 3 μl of a working solution of substrate ( 233 nm lrrktide , 117 μm atp ) prepared in assay buffer ( 50 mm hepes , ph 7 . 5 , 3 mm mgcl 2 , with 2 mm dtt and 0 . 01 % brij35 added fresh ) was added to a low volume greiner 384 - well plate . the compound dose response was prepared by diluting compound to a top concentration of 3 . 16 mm in 100 % dmso and serial diluted by half - log in dmso 11 times . aliquots ( 3 . 5 μl ) of the 100 % dmso dose response were mixed with 46 . 5 μl water then 1 μl of this mixture was added to the 3 μl substrate mix in the 384 - well plate . the kinase reaction was started with 3 μl of a working solution of lrrk2 enzyme at a concentration of 4 μg / ml . the final reaction concentrations were 100 nm lrrktide , 50 μm atp , 1 . 7 μg / ml lrrk2 enzyme and a compound dose response with a top dose of 32 μm . the reaction was allowed to progress at room temperature for two hours and then stopped with the addition of 7 μl of detection buffer ( 20 mm tris ph 7 . 6 , 0 . 01 % np - 40 , 0 . 02 % nan 3 , 6 mm edta with 2 nm terbium labeled anti - phospho - erm ). after an incubation of 1 hour at room temperature , the plate was read on an envision with an excitation wavelength of 340 nm and a reading emission at both 520 nm and 495 nm . the ratio of the 520 nm and 495 nm emission was used to analyze the data . inhibition of mutant g2019s lrrk2 ( invitrogen cat # pv4881 ) was measured in the exact same method . all final concentrations of substrate atp and enzyme were the same . however , since the mutant enzyme is more active the reaction time was reduced to 90 minutes to ensure that inhibition was measured at steady state before any substrate depletion could occur . lrrk2 kinase activity was measured using lantha screen technology from invitrogen . gst - tagged truncated lrrk2 from invitrogen ( cat # pv4874 ) was incubated with a fluorescein - labeled peptide substrate based upon ezrin / radixin / moesin ( erm ), also known as lrrktide ( invitrogen cat # pr8976a ), in the presence of a dose response of compound . upon completion , the assay was stopped and detected with a terbium labeled anti - phospho - erm antibody ( invitrogen , cat # pr8975a ). the assay was carried out under the following protocol : the compound dose response was prepared by diluting compound to a top concentration of 0 . 3 mm in 100 % dmso and serial diluted by half - log in dmso to give an 11 point curve , 100 × final assay concentration . using echo acoustic dispensing , 60 nl of compound was transferred to a low volume corning 384 - well assay plate . 3 μl of a working solution of substrate ( 200 nm lrrktide , 2000 mm atp ) prepared in assay buffer ( 50 mm hepes , ph 7 . 5 , 3 mm mgcl 2 , with 2 mm dtt and 0 . 01 % brij35 added fresh ) was added to the 60 nl compound assay plate . the kinase reaction was started with 3 ml of a working solution of lrrk2 enzyme at a concentration of 4 mg / ml . the final reaction concentrations were 100 nm lrrktide , 1000 mm atp , 2 mg / ml lrrk2 enzyme and a compound dose response with a top dose of 3 mm . the reaction was allowed to progress at room temperature for 30 minutes and then stopped with the addition of 6 ml of detection buffer ( 20 mm tris ph 7 . 6 , 0 . 01 % np - 40 , 6 mm edta with 2 nm terbium labeled anti - phospho - erm ). after an incubation of 1 hour at room temperature , the plate was read on an envision with an excitation wavelength of 340 nm and a reading emission at both 520 nm and 495 nm . the ratio of the 520 nm and 495 nm emission was used to analyze the data . inhibition of mutant g2019s lrrk2 ( invitrogen cat # pv4881 ) was measured in the exact same method . all final concentrations of substrate atp and enzyme were the same . tables 3 and 4 , below , provide the lrrk2 ic 50 data for the compounds of the invention . the examples presented in table 4 may be prepared using the methods illustrated in the syntheses of examples 1 - 92 , either alone or in combination with techniques generally known in the art . table 5 below provides kinase selectivity data for the compounds of examples 3 , 4 , 5 and 22 . the compounds were run using a commercially available kinase selectivity assay which is available from carnabio usa , inc . 209 west central st ., suite 307 , natick , mass . 01760 usa . the compounds of examples 3 , 4 , 5 and 22 were run in the assay at a concentration of 1 μm using an atp concentration of 1 mm . table 5a below provides kinase selectivity from a further assay run for the compounds of examples 4 , 11 , 5 , 104 , 102 and 116 .	0
referring now in detail to the drawings for the purpose of illustrating the present invention , the improved dental drilling assembly as shown in fig1 comprises an adjustable extension member 10 containing a body 11 , a threaded end portion 12 disposed at end thereof , an inner threaded hole 13 disposed at the other end thereof and a slot 14 extending across the end of the extension member . the apparatus further includes a triple arm drilling assembly 15 having large wheels 16 , small wheels 17 and 18 , a hand piece 19 connected to the small wheels 18 , a hanger 20 , a motor 21 having both a large pulley 22 and a small pulley 23 , and a belt 24 providing rotational communication between small wheels 17 and 18 , large wheels 16 and either the large or small pulleys 22 and 23 , respectively . in operation , if it is desired to use the large pulley 22 on the motor 21 , then the distance between the wheels 16 must be increased in order to make the pulleys 22 and 16 compatible and the belt 24 conveyed thereon in substantial parallel relationship . thus , the space between the wheels 16 is enlarged by first removing the bolts 25 and the wheels 16 from the drilling assembly and using the threaded end portion 12 to screw the adjustable extension member into the location from which the bolt 25 was removed . the wheel 16 is then placed over the other end of the adjustable extension member and the bolt 25 is screwed into the threaded end portion 13 of the extension member . by the use of the adjustable extension member , the space between the pulley wheel 16 can be substantially increased . by utilizing the adjustable extension members at both sides of the pulley wheel 16 , the distance between the pulley wheels can be further increased . the slot 14 is provided on the end of the adjustable extension member to provide a location for a screwdriver or other device for facilitating the attachment of the adjustable extension member . if it is desired to use the small pulley 23 on the motor , then the adjustable extension members can be removed and the pulley wheel 16 replaced in the manner discussed hereinabove . thus , the device of the present invention makes it possible to utilize a single drilling assembly with a motor which is provided with multiple sized pulleys in order to achieve different operating conditions . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	0
reference will now be made in detail to embodiments of the present invention , one or more examples of which are illustrated in the accompanying drawings . each example is provided by way of explanation of the invention , not as a limitation of the invention . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention . for instance , features illustrated or described as part of one embodiment can be used in another embodiment to yield a still further embodiment . thus , it is intended that the present invention cover such modifications and variations that come within the scope of the appended claims and their equivalents . by way of explanation and not by way of limitation , the following description focuses on subsea pre - positioned capping device ( pcd ) used with a jack - up drilling unit . however , it is to be clearly understood that the principles of the present invention are not limited to environments as described herein . thus , the use of the pcd on a jack - up drilling unit is described herein as merely an example of the wide variety of uses for the principles of the present invention . the pcd can be used with a subsea bop or any surface bop with location being subsea , on a lower level below the bop , or positioned immediately below the bop . fig1 illustrates a jack - up drilling rig unit 10 depicted with a jack - up rig 100 resting on the sea - bed 20 . the jack - up rig 100 is a type of mobile platform including a buoyant hull 160 fitted with a number of movable legs 140 , capable of raising the hull 160 over the surface of the sea . the buoyant hull 160 enables transportation of the unit 10 and all attached machinery to a desired location . once on location , the hull 160 raises to the required elevation above the sea - bed 20 surface on its legs 140 supported by the sea - bed 20 . the legs 140 of such units may be designed to penetrate the sea - bed 20 , may be fitted with enlarged sections or footings , or may be attached to a bottom mat . footings or spudcans 180 spread the load so the rig 100 does not sink into the sea - bed 20 . the base of each leg 140 is fitted with a spudcan 180 , which may include a plate or dish designed to spread the load and prevent over penetration of the leg 140 into the sea - bed 20 . the spudcans 180 may be circular , square or polygonal . a high pressure riser 220 leads to the wellhead 200 in the sea - bed 20 . the high pressure riser 220 may be a thick walled , high strength riser and can contain full well pressure . a surface blowout preventer ( bop ) stack 240 is located on the jack - up rig 100 . the pcd 300 is pre - installed on the wellhead 200 . the pcd 300 functions as an independent safety and containment device for well leakage and / or blowout . the pcd 300 is installed on the well when the bop stack 240 is installed and is a safety device to be used if the drilling unit &# 39 ; s bop stack 240 fails to control a well blowout . when necessary , the pcd 300 is activated immediately to regain control of the well leak or blowout providing a secondary level of environmental and personnel protection . the pcd 300 can additionally function to secure the well by closure of the pcd 300 if the rig must be moved . fig2 shows the pcd 300 designed for attachment onto substantially any wellbore worldwide and for functioning in subsea and surface operations . the pcd 300 forms a capping stack , which may include a first blind shear ram 301 , a second blind shear ram 302 , a power source 307 for closing the rams 301 , 302 and that is independent from the rig 100 and an independent control system 303 . the power source 307 ( e . g ., pressurized tanks with hydraulic fluid ) of the pcd 300 provides stored power to the control system 303 and as otherwise necessary for actuation of the pcd 300 without relying on power from the rig 100 . since the power source 307 may form an integral component of the pcd 300 and be disposed remote from the rig 100 , collocation of the power source 307 with the blind shear rams 301 , 302 enables operability without relying on hydraulic pressure supplied from the rig 100 . the blind shear rams 301 , 302 ( also known as shear seal rams , or sealing shear rams ) seal the wellbore , even when the bore is occupied by a drill string , by cutting through the drill string as the rams 301 , 302 close off the well . the upper portion of the severed drill string is freed from the ram 301 , 302 , while the lower portion may be crimped and the “ fish tail ” captured to hang the drill string . for some embodiments , the independent control system 303 for the pcd 300 may not actuate the rams 301 , 302 during normal drilling or kick occurrences handled by the bop stack 240 but rather only upon the independent control system 303 being operated for loss of control for which the bop stack 240 does not or cannot regain control . the pcd 300 may further include at least one pressure and / or temperature transducer below each ram 301 , 302 capable of analogue local display . the pcd 300 may have a number of outlets 304 . each outlet may be provided with two hydraulically controlled gate valves . two of the outlets may be equipped with manually controlled chokes to perform soft shut - in of the second blind shear ram 302 . the capping stack may also include an inlet 305 to inject glycol or methanol to mitigate hydrate formation . as described in further detail with respect to fig3 , the independent control system 303 activates the pcd 300 independent from activation of the bop stack 240 and can be operated by the drilling rig unit 10 or from a vessel or other installation remote from the drilling rig unit 10 . for some embodiments , the control system 303 includes a self - contained electrical supply , such as a battery , for any functions of the control system 303 described herein and utilizing current independent of the drilling rig unit 10 . in some embodiments , the independent control system 303 may form part of a digital acoustic control system . the digital acoustic control system may utilize low frequency sound sent to , or received from , the control system 303 on the pcd 300 . fig3 depicts two digital acoustic control systems . the digital acoustic control system on the drilling rig unit 10 includes a rig transducer 315 disposed in the water and coupled to a rig user interface station 320 , which may be operated by the drilling crew or the operator supervisor on the drilling rig unit 10 . the digital acoustic control system on a vessel near the drilling location includes an auxiliary transducer 340 coupled to an auxiliary user interface station 345 , which may be operated by a well control representative . as used herein , an independent management system refers to the auxiliary user interface station 345 with the well control representative not being managed by the drilling crew operating the rig user interface station 320 . for some embodiments , the auxiliary user interface station 345 functions concurrent with the rig user interface station 320 for possible actuation of the pcd 300 if needed . the pcd 300 having this independent management system ensures that decisions are made in a timely manner to prevent a major blowout and harm to personnel . personnel directly involved in the well blowout on the installation , and which perhaps caused it , may not manage the pcd 300 . independent systems from the drilling rig unit 10 mean that in the event of a large fire / explosion on the drilling rig unit 10 the pcd 300 can still be activated to protect personnel and the environment . as previously mentioned , the pcd 300 may be implemented in numerous cases , including : ( 1 ) failure of the well control system on the drilling rig unit 10 ; ( 2 ) management system failure on the drilling rig unit 10 ; or ( 3 ) fire or explosion on the drilling rig unit 10 that prevents operation or continued operation , i . e ., loss of hydraulic pressure on some function , of other well control systems , such as the bop stack 240 . in operation , signals from the rig transducer 315 or the auxiliary transducer 340 to a pcd transducer 310 or a remote transducer 335 provide command signals to the control system 303 for functioning of the pcd 300 . both the pcd transducer 310 and the remote transducer 335 connect to the control system 303 . the remote transducer 335 may connect to the pcd 300 by a cable 325 of sufficient length ( e . g ., 150 meters ) to enable placement of the remote transducer 335 away from the pcd transducer 310 proximate the pcd 300 . the remote transducer 335 thus may facilitate communicating with pcd 300 should access to the drilling rig unit 10 be restricted . acoustic data transmission may also be sent from the pcd 300 to the surface via the transducers 310 , 315 , 335 , 340 to monitor the system status and wellbore conditions ( e . g ., pressure and / or temperature measured by the transducers of the pcd 300 ). while the digital acoustic control system functions as the primary pcd control system , a secondary interface may also be utilized . in an embodiment , a remotely operated vehicle ( rov ) may be utilized as a secondary pcd control system with the rov providing physical input direct to the pcd 300 through an rov control panel 306 . the rov control panel 306 may send a signal to the control system 303 of the pcd 300 that operates valves sending hydraulic pressure from the power source 307 to operate the blind shear rams 301 , 302 . pcd systems on the surface have independent controls also . examples of such independent controls include wireless controls or shielded fiber optics , cable , or piping . regardless of signal interface techniques employed , the independent controls enable operation of the pcd systems independent from bop control systems . in some embodiments , the pcd facilitates capping a well almost immediately . this quick response time reduces the chance of fire or explosion endangering personnel or even sinking the drilling unit or complete loss of a fixed platform . the blowout oil spill volume is greatly reduced as the flow duration is minutes instead of weeks reducing the potential for environmental damage . there are no issues with installing the system since the pcd is preinstalled . a conventional capping stack , which is installed after a blowout , could encounter a situation where debris prevents installation . the pcd also prevents the situation where the drilling unit or platform collapses on a well due to fire and / or explosion . in this case , the blowout could not be capped with a capping stack due to debris or damage to the bop and / or wellhead . the pcd with independent power can be operated even with significant damage to the drilling unit . the drilling unit &# 39 ; s bop might have failed due to loss of power but this would not impact the pcd . the pcd may include redundant blind shear rams in case one ram fails to shear the drill string and seal the well , but one ram may be sufficient if designed to shear and seal on tubulars used in the well . fig4 illustrates use of a capping and diverter assembly with a conduit 400 for flow diversion from the pcd 300 to a location away from the drilling rig unit 10 . ability of the pcd 300 to close the well depends on integrity of the well casing and extent of pressure in the well . if casing integrity is lost , formation hydrocarbons may flow outside the casing bypassing a fluid pathway through the wellhead 200 . the hydrocarbons coming from the seabed 20 create environmental problems and endanger personnel and the drilling rig unit 10 since the hydrocarbons leak under or in direct proximity of the drilling rig unit 10 . for some embodiments , the conduit 400 and some or all associated components shown in fig4 may be pre - positioned and coupled together during drilling such that in the event of an emergency no delay or installation issues are encountered with respect to operations described herein . use of the pcd 300 coupled to the conduit 400 to divert the hydrocarbons eliminates or at least limits flow of the hydrocarbons to the seabed 20 at the wellhead 200 . diverting the hydrocarbons from around the drilling rig unit 10 enables the drilling unit rig 10 to be boarded and problems corrected to secure the well using the drilling rig unit 10 . the capping and diverter assembly includes the conduit 400 coupled to the outlet 304 ( shown in fig2 ) of the pcd 300 and extending in a lateral direction away from the wellhead 200 , and hence the drilling rig unit 10 , a distance of at least 250 meters or at least 500 meters . part of the conduit 400 may form a riser section to take the hydrocarbons to above a sea surface for facilitating disposal / processing . in some embodiments , a portion of the conduit 400 lays on the seabed 20 between the pcd 300 and a weight 402 . the riser section of the conduit 400 extends upward from the weight 402 toward a buoy 404 . mooring lines 406 from the buoy 404 anchor to the seabed 20 and secure the buoy 404 in location above the weight 402 . in some embodiments , an end of the conduit 400 includes a flare 410 for burning the hydrocarbons above the sea surface . a containment boom 408 may secure to the buoy 410 and encircle the sea surface surrounding the flare 410 for limiting the hydrocarbons from floating away from an area of the flare 410 . for some embodiments , an end of the conduit 400 couples to a containment module 414 , such as a floating production storage and offloading ( fpso ) facility , for holding a quantity of the hydrocarbons flowing from the conduit 400 . the containment module 414 may couple to the conduit 400 via a moored and buoyed terminal 412 . the containment module 414 captures the hydrocarbons for limiting environmental impacts if the well cannot be repaired or secured for an extended period of time . in operation , the pcd 300 closes in event of a blowout where the bop stack 240 does not function to close the well . if the hydrocarbons come to the seabed 20 while the pcd 300 is closed , operating the chokes on the outlet 304 open the flow from the wellhead 200 through the conduit 400 . the opening of the chokes continues and may be done in increments until flow ceases coming up through the seabed 20 or at least is reduced and may enable safe work on the drilling rig unit 10 . once the hydrocarbons stop flowing around the drilling rig unit 10 , the rig personnel can board the drilling rig unit 10 for operation to correct problems . operating the chokes to adjust flow rates may utilize the acoustic control system described herein with respect to fig3 for the pcd 300 . in some embodiments , a rov may also manipulate the choke or be utilized as a secondary controller for backup to the acoustic control system . the chokes may utilize power of the pcd 300 and thus also be operable independent of the drilling rig unit 10 . the flare 410 ignites upon the hydrocarbons being diverted through the conduit 400 by the opening of the chokes . activation of the pcd 300 and subsequent burning of the hydrocarbons with the flare 410 may occur immediately following an event without delay of bringing in and connecting equipment after the event . even if not present when the event occurs , the containment module 414 also may require no subsea work , which could be impossible or difficult near the wellhead 200 , to couple with the conduit 400 and accept the hydrocarbons diverted due to the event . in closing , it should be noted that the discussion of any reference is not an admission that it is prior art to the present invention , especially any reference that may have a publication date after the priority date of this application . at the same time , each and every claim below is hereby incorporated into this detailed description or specification as an additional embodiment of the present invention . although the systems and processes described herein have been described in detail , it should be understood that various changes , substitutions , and alterations can be made without departing from the spirit and scope of the invention as defined by the following claims . those skilled in the art may be able to study the preferred embodiments and identify other ways to practice the invention that are not exactly as described herein . it is the intent of the inventors that variations and equivalents of the invention are within the scope of the claims while the description , abstract and drawings are not to be used to limit the scope of the invention . the invention is specifically intended to be as broad as the claims below and their equivalents .	4
turning first to fig1 through 6 of the drawings , there is depicted an apparatus 10 for surgical , or gastrointestinal decompression and irrigation of a patient . the apparatus includes a tube 12 with a distal end 14 which is inserted into the intestine through the nasal or oral orifice . if there is a need for large bowel decompression , it can be inserted through the anal canal or through enterotomy . a proximal end 18 is located outside the patient . having a generally circular cross - section , the tube 12 defines quadruple longitudinally extending lumens 20 , 22 , 24 , 26 ( fig3 ). accommodated within a guide wire lumen 20 is a spring wire 28 which prevents kinking of the tube 12 during insertion into the patient and for stiffening the tube , thereby facilitating emplacement in the gastrointestinal tract . a spring wire 28 may be of any kind which has a stiffening means . exemplary of such means include intermeshing coils which stiffen the spring wire 28 upon squeezing . suction means 30 , such as a vacuum pump ( fig1 ), are connected to the suction lumen 22 via a container 50 for receiving syphoned fluid . irrigation means , such as a fluid delivery device 32 , are connected to an irrigation lumen 24 . if desired , an electrical supply means ( not shown ) is in electrical communication with a lamp 74 ( fig2 ) along the electrical lumen 26 , so that signals are communicated from a pressure sensing device located at the distal end 14 of the tube 12 , and so that the lamp 74 may be illuminated if desired . one or more openings 38 extend through a septum 42 of the tube 12 ( fig4 ) from the suction lumen 22 to the irrigation lumen 24 for ducting irrigation fluid or gastrointestinal content from the irrigation lumen 24 to the suction lumen 22 and for venting the suction lumen in case the pores 44 are plugged by solid matter or by the stomach lining . to communicate negative pressure to gastrointestinal contents or other spaces which require decompression , the suction pores 44 extend laterally from the suction lumen 22 through an outside wall of the tube 10 . referring now to fig1 the apparatus of the invention comprises suction lumen 22 , a manometric device 46 with an inflow channel 48 and a container 50 for fluid collection . the manometric device 46 is located between a centralized suction system 30 and the sealed container 50 . the manometric system has an indicator 52 , which indicates pressure and first and second pre - set stops or electrodes 54 , 56 . if desired , the indicator 52 may have its oscillation damped by a suitable vibration dampening means . the system works in the following manner . when the negative pressure ( suction ) is applied to the suctioning lumen , negative pressure gradually builds in the organ , cavity or space ( closed system ). as negative pressure in the system builds , the indicator 52 moves towards the first electrode 56 . as pressure in the inflow channel 48 falls due to the negative pressure , the indicator 52 contacts the electrode 56 . at that moment , the suction control valve 64 will cut off the suction system 30 . other valves , 58 , 60 , 62 , will control the air vent and fluid flow of the irrigation solution . air and / or saline solution , or both , will gradually enter the system , and the negative pressure will become alleviated . at that time the indicator will move in the opposite direction ( towards second electrode 54 ) and finally will contact the electrode located thereat . then , the pressure in the decompressed organ or cavity will approximate the pre - set maximum level . contact with electrode 54 will close valves 58 , 60 , 62 so that no more air or fluid may enter the organ cavity . at that moment , the suction system becomes on - line via valve 64 , and the pressure begins to fall , moving the indicator again towards 56 . this movement of the indicator back and forth will continue intermittently . in practice , the manometric device 56 is in electrical communication with the valves 58 , 60 , 62 , 64 . further detail of the operating modes 1 - 9 are to be discussed later . the system also permits increasing or decreasing pressure in the system by moving the pre - set pressure levels 54 , 56 towards each other or apart . this is achieved by moving the electrodes clockwise or counterclockwise with a suitable means , such as two rotary rings inset into the manometric device ( fig1 ). referring again to fig1 to assist the surgeon in using the disclosed system , there are provided visual or aural phase indicators 80 , 82 . for example , indicator 80 may usually take the form of a red lamp , while 82 may be a violet - colored lamp , if desired . the chart below summarizes the indications during suction , transition from suction to irrigation , irrigation , and suction phases of the disclosed apparatus : ______________________________________phase indicatorphase violet ( 80 ) red ( 82 ) needle movement______________________________________suction on off clockwisesuction / off on staticirrigationirrigation off on counter - clockwisesuction on off static______________________________________ disclosure will now be made of the surgical procedures by which the apparatus 10 of the present invention may be used . 3 . inflate a balloon 76 via an inflation channel 78 which is located outside and extends along the length of the sheath 66 ; 4 . withdraw the sheath 66 , leaving the tube in place so that the balloon 76 blocks the gastroesophageal junction to prevent regurgitation of the gastrointestinal contents while carrying out the procedure ( fig5 ); 5 . advance the tube toward the pylorus and to the duodenum through the curvatures of the duodenum and the small bowel . during this step , the flexibility of the tube may be changed by altering the stiffness of the guidewire ; 6 . transillumination can be used in order to properly locate the distal end of the tube in the duodenum and to direct the tube to the small bowel . in this step , a source of illumination 74 located at the distal end 14 of the tube 12 is energized ; 7 . grasp or knead through the bowel the tube thereby advancing the tube further into the bowel to the desired extent ; 8 . connect the apparatus 10 to an external system ( fig1 ); 9 . decompress or syphon off the bowel contents and irrigate until the effluent is clear or reduced ; 10 . remove the tube slowly while continually decompressing the small bowel , duodenum , and stomach ; 11 . totally decompress the stomach so that no residual content can be regurgitated ; it should be noted that the above described decompressive and irrigation procedure can be performed with any environment requiring drainage and / or decompression , e . g . the sump drains placed in the cavity of a wound or abscess . for general surgical applications , less than all of the four lumens may be needed . for example , the spring wire lumen 28 may not be needed . nor may the electrical supply lumen 26 be required , so that only two lumens , irrigation and suction may be in operation . medical drainage system can broadly be classified as &# 34 ; closed suction &# 34 ; and sump drains . in closed suction drainage systems , there is one lumen , which drains a closed system . as a result , the system tends to collapse under the influence of the vacuum created thereby and tends to become sealed . in sump drainage systems , however , there are generally two lumens . one provides drainage , while another provides venting . in such systems , no appreciable vacuum is formed . the present system can be utilized with different drainage systems . if closed , a suction draining technique is used , e . g . in pleural space drains , only with one lumen chest tube . to define a suitable suctioning regime , the indicator would be placed in a pre - set negative pressure by regulating the suction vent 30 . if the pressure in the suction tube drops , the arrow will move towards preset minimum pressure considered to be critical . ultimately , the arrow will touch the contact ( 54 ) and the ( red ) lamp 80 will illuminate . simultaneously , a timer will turn on . if the negative pressure in the system does not start building up after the pre - set period of time , an emergency alarm may provide a cue to decrease pressure in the system . the 3 - way stopcock valve 62 allows fluid communication between the irrigation and suction lines . in one valve configuration there is flow between the suction line and ambient air . in another there is fluid communication between the irrigation line and ambient air . thus , by suitable orientation of the valve 62 , the irrigation fluid may flow alone , air may flow alone , or the irrigation fluid and air may flow together toward the closed system 72 . the different modes in which the disclosed apparatus can be used will be described . in this mode , all valves are closed . no drainage occurs , and there is no air or fluid inflow ; in this mode , the irrigation and suction lumens function , but passively under ambient atmospheric pressure . outflow of , for example , stomach contents , occurs solely under the influence of gravity ; in this mode , there is a slow inflow of irrigation solution into the stomach or cavity to be treated . in this mode , the disclosed apparatus is used to administer a medicament to the vessel to be treated ; in this mode , both the inflow of irrigation fluid and the outflow of , for example , stomach contents , occurs solely under the influence of gravity . there is no communication of negative pressure by the suctioning system ; in this mode , a positive pressure means , such as a roller pump , is in fluid communication with a source of irrigation fluid . inflow occurs under the positive pressure which is used in part to displace fluid in the vessel to be treated so that it emerges into a collecting container . again , no negative pressure is communicated to the vessel to be treated by a central suctioning system ; in this mode , there is negative pressure communicated by the central source thereof to the container and to the manometric device . simultaneously , active irrigation of the space which requires decompression and / or lavage of the organ or space is carrout out ; in step 1 of this mode , suction is applied , the irrigating fluid is turned off , and pressure in the system declines , as registered by a clockwise movement of the indicator in the manometric device ; in this configuration , pressure in the vessel to be decompressed diminishes and reaches a minimum level . at this point , the arrow of the manometric device moves and touches the contact 56 . suction is then arrested and the illuminated indicator 80 activates . irrigation then begins and pressure in the system begins accumulating . at that moment , irrigation occurs under the influence of existing negative pressure , gravitational forces , and the elastic forces exerted by a decompressed organ as it tends to revert to its original , compliant shape ; in this configuration , the indicator of the manometric device slowly moves counterclockwise as negative pressure in the system continues to be alleviated . in this configuration , suction predominates , and the vessel to be treated begins to be evacuated ; in this configuration , the device is being used as a sump , wherein an air vent and suction combine to promote free drainage or purging of the vessel to be treated ; in this mode , the supply of irrigation fluid is isolated , and the vessel to be treated becomes contracted ; and in this configuration , if the seal formed by the vessel to be treated breaks , e . g . there is an air leak from a lung , the arrow in the manometric device will inevitably turn counterclockwise and touch the contact 54 . an alarm will sound at this point , indicating a potentially dangerous condition . fig4 is an enlarged sectional view of the distal end 14 of the tube 12 . as will now be apparent , the manometric device 46 enables negative pressure to be applied in a pulsating manner . in one cycle , suction is applied , while in the subsequent cycle , suction is suppressed . under gravity , or under externally applied pressure , the irrigation fluid travels along the irrigation lumen 24 and emerges from the tube 12 at its distal end 14 through pores 38 . the stomach lining 72 envelopes the distal end 14 of the tube 12 , forming a closed system . when suction is applied , the gastrointestinal contents are syphoned through the pores 38 and through the gate 44 , before being transported along the suction lumen 22 . if solid matter or the stomach lining plugs or blocks any pore 38 , fluid communication is still enabled via other pores 38 and the gate 44 . continuing with reference to fig4 in the disclosed configuration , there is a solution to problems which were manifest in prior art approaches . under traditional approaches , plugging of a pore 38 often resulted in an absence of flow . it was not always clear to the surgeon as to why flow had stopped . a question may have lingered as to whether the absence was attributable to the absence of stomach content ( decompression complete ) or to obstruction by food particles , blood clots , or other materials ( decompression incomplete ). in contrast , the tube and associated apparatus of the present invention allow suction and flow to continue intermittently . the tube can be produced from silicon as well as other elastic natural or artificial ( synthetic ) materials . the manometric device 56 of the present invention can usefully be embodied in an intermittent suction unit , such as that sold by the boc health care company ( ohmeda model ), or the boehringer company &# 39 ; s intermitting suction regulator ( model 7702 ). noteworthy is that the present invention discloses a system which is driven in response to the pressure sensed by the manometric device 56 . this is an indicator of pressure existing within the closed system 72 ( fig4 ). so that such pressure is sensed directly , none of the pores 38 may lie outside the closed system 72 . continuing with reference to fig4 the distal end 14 may include a tip structure which includes a pressure transducer connected to an external pressure gauge independent of the manometric device 56 . such a pressure gauge is helpful in corroborating data indicated by the device 56 and may , in an emergency case or if desired , be used to override the pulsating influence of the device 56 . although not depicted , it will be apparent to those of ordinary skill that there is a means for communicating to each of the valves a suitable electrical signal for triggering their opening and closing in response to pressure sensed in the inlet channel 48 . having above indicated a preferred embodiment of the present invention , it will occur to those skilled in the art that modifications and alternatives can be practiced within the spirit of the invention . it is accordingly intended to define the scope of the invention only as indicated in the following claims .	0
hereinafter , the preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings . it is to be understood , however , that the present invention may be embodied in various forms not to be interpreted as limiting . the embodiments of the present invention are provided for those skilled in the art to understand the present invention more completely . in the embodiments of the present invention , a sulfur compound including copper sulfide is used to provide an antibacterial filter that is relatively inexpensive , easy to process , non - toxic , and excellent in antibacterial and deodorizing activities . for this , a description will be given as to an antibacterial filter using a sulfur compound dispersed in or applied to a porous medium and , more specifically , to its antibacterial and deodorizing activities . on the other hand , the antibacterial filter of the present invention may be manufactured by applying a coating of the sulfur compound on the surface of a porous medium through deposition or dyeing or mixing particles of the sulfur compound with the porous medium . the antibacterial filter of the present invention not only does the antibacterial activity to eliminate toxic microorganisms through the holes in the porous medium , but also the deodorizing activity to remove a foul odor . the material for the porous medium may be a polymer , a ceramic , or a metal , preferably a polymer . specific examples of the polymer include polyurethane resin , nylon resin , etc . ; those of the ceramic may include zeolite , silica , alumina , zirconium phosphate , etc . ; and those of the metal include aluminum , etc . the porous medium contains minute pores , through which a fluid passes . the pore size or the porosity of the porous medium may vary depending on the environment in which the antibacterial filter of the present invention is used . in the embodiment of the present invention , a porous medium comprised of a polymer is given as a preferred example . but , the porous medium may be comprised of a ceramic or a metal within the scope of the present invention . a chemical foaming agent , liquid nitrogen , or a supercritical fluid may be incorporated into the porous medium to form pores . more specifically , while extruded at a temperature higher than the melting temperature by 30 to 40 ° c ., a polymer resin used as a matrix for the porous medium is mixed with a chemical foaming agent , liquid nitrogen , or supercritical carbon dioxide that is side - fed . as the polymer resin is extruded , the evaporated foaming agent , nitrogen or carbon dioxide is released into the air to form pores . the copper - based compound applied to the embodiment of the present invention is preferably copper sulfide ( cus ). copper sulfide is prepared by reacting copper sulfate ( cuso 4 ) with a salt selected from sulfides , fluorides , and chlorides in an aqueous phase at mole ratio of 1 : 1 at 10 to 80 ° c . in this regard , the synthesis is performed under the condition that the synthesized particle of copper sulfide has a chemical structure of cu x s y ( where x / y is 0 . 8 to 1 . 5 ). specific examples of the sulfides available in the present invention may include sodium sulfide , iron sulfide , potassium sulfide , zinc sulfide , etc . ; specific examples of the fluorides available in the present invention may include sodium fluoride , iron fluoride , potassium fluoride , zinc fluoride , etc . ; and specific examples of the chlorides available in the present invention may include sodium chloride , iron chloride , potassium chloride , zinc chloride , etc . in this case , the copper sulfide synthesized from sodium sulfide and copper sulfate is most excellent in the antibacterial activity . when the reaction temperature is less than 10 ° c . in the synthesis of copper - based particles , the reactivity of copper sulfate and the salt decreases to deteriorate the deodorizing activity despite the good antibacterial activity . when the reaction temperature exceeds 80 ° c ., the reaction rate is extremely high so as to increase the density of the crystals on the surface of copper sulfide and the concentration of copper , resulting in good deodorizing activity and poor antibacterial activity . further , the ratio x / y of the copper - based particles less than 0 . 8 leads to excessively high concentration of sulfur ( s ), consequently with good antibacterial activity and poor deodorizing activity . the ratio x / y of the copper - based particles greater than 1 . 5 contributes to an increase in the concentration of copper ( cu ), which improves the deodorizing activity and deteriorates the antibacterial activity . hereinafter , a description will be given as to the process for manufacturing an antibacterial filter in two methods : applying a coating of copper sulfide as a sulfur compound to a porous medium ; or dispersing copper sulfide particles in a porous medium . the method for applying a coating of copper sulfide to a porous medium according to an embodiment of the present invention involves stirring a predetermined amount of copper sulfide in a solvent such as isopropyl alcohol ( ipa ) at the room temperature for several hours to prepare a coating solution with good dispersability . then , the coating solution is applied to the porous medium by dip coating . the coated porous medium is dried for several hours to scores of hours and then subjected to an annealing process at t c to t m for scores of minutes . in order to obtain a filter with good antibacterial and deodorizing activities , the procedures are repeatedly performed in the same manner as described above to form a coating of copper sulfide at high concentration on the surface of the porous medium . a porous medium of copper sulfide may have pores made by using a foaming agent or adding liquid nitrogen or a supercritical fluid . more specifically , while extruded at a temperature higher than the melting temperature of the resin by about 30 to 40 ° c ., the polymer resin used as a matrix for the porous medium and copper sulfide are mixed sufficiently with a chemical foaming agent , liquid nitrogen , or supercritical carbon dioxide that is side - fed . as the polymer resin mixed with copper sulfide is extruded , a filter comprising a porous medium of copper sulfide with pores is completed . the porosity of the filter is suitably 10 to 40 %, more preferably 20 to 30 %. when the porosity is less than 10 %, the contact area is too small to display a good deodorizing activity . when the porosity is greater than 40 %, it is hard to get a filter form . the porosity may be controlled by the weight ratio of the resin to the foaming agent , the temperature , the rotating speed of the screw , the retention time , the l / d ratio ( where l is the length of the compounder screw ; and d is the diameter of the screw ), etc . when a chemical foaming agent is used , it has a lower evaporation temperature than the thermoplastic resin used as a matrix and thus kept in the gas state while moved by the screw . during the extrusion , the chemical foaming agent is released into the air to form pores . in the case of using liquid nitrogen or a supercritical fluid , which is supplied under high pressure , it is designed to maintain high pressure in the extrusion step . in other words , the liquid nitrogen or supercritical fluid supplied by side feeding is sufficiently mixed with the resin and then extruded . in the extrusion step , the evaporated nitrogen and carbon dioxide are released into the air to form pores . the chemical foaming agent is in wide use , because it is relatively inexpensive and requires a simple facility . but , the use of the chemical foaming agent possibly causes a pyrolysis of the resin and makes it hard to control the fine pores uniform . the liquid nitrogen or supercritical carbon dioxide costs high but advantageously enables it to make minute pores uniform . an exemplary method for manufacturing the antibacterial filter of the present invention is given as follows . cuso 4 and na 2 s in an amount of one mole each are added to distilled water and stirred to prepare an aqueous solution , which is then put into an isothermal reactor at 50 ° c . to synthesize copper sulfide ( cus ) as shown in fig1 . in this regard , the x / y ratio is 1 . 02 . the copper sulfide thus obtained has the crystalline structure peculiar to copper sulfide as shown in fig2 , and its particle image magnified by a factor of 30 , 000 is presented in fig3 . referring to fig3 , there appears no peak for the sulfur , which does not have a crystalline structure , whereas peaks for the copper appear at 55 , 65 , 99 , 125 , and 137 degrees . the copper sulfide thus prepared is mixed with the nylon resin to form an antibacterial filter as shown in fig4 . the activity evaluation of the antibacterial filter prepared in the embodiment of the present invention is performed in the manner as follows . the average particle diameter of the copper sulfide and metal particles is measured with a particle size analyzer ( els - z2 , otsuka electronics co ., japan ). ( 2 ) antibacterial activity a culture medium with escherichia coli ( atcc 25922 ) is put in contact with a specimen and incubated at 25 ° c . for 24 hours . after incubation , the bacterial growth is determined to evaluate the antibacterial effect of the specimen . 1 g of the copper - based particles is put into a reactor and then 10 , 000 ng / ml of gaseous formaldehyde is injected . after 5 minutes , the concentration of the formaldehyde eliminated is determined to evaluate the deodorizing effect of the copper - based particles . the concentration of the remaining gaseous formaldehyde is determined with a gas chromatograph ( agilent 6890 , aglient technologies inc ., u . s . a ). the copper - to - sulfur molar ratio of the copper sulfide particles is determined with an inductively coupled plasma mass spectrometer ( agilent 7500 , aglient technologies inc ., u . s . a .). the porosity (%) (=[( d i − d p )/ d i ]× 100 , where d i is the density of the filter without pores ; and d p is the density of the filter with pores ) of the porous filter is determined by measuring the density of the specimen . the density measurement is performed with an electronic scale ( xp204v , mettler - toledo co ., swiss ). the copper sulfide used in the antibacterial filter according to the embodiment of the present invention has the antibacterial activity of 1 × 10 4 counts / ml to 1 × 10 6 counts / ml , and the deodorizing activity of 90 to 98 %. further , the copper / sulfur ratio , i . e ., x / y ratio is 0 . 8 to 1 . 5 , and the porosity is suitably 10 to 40 %, more preferably 20 to 30 % accordingly , the antibacterial filter of the present invention makes the use of the properties of copper sulfide to secure the antibacterial and deodorizing effects required to antibacterial filters . furthermore , copper sulfide is relatively inexpensive , easy to process , and non - toxic , so the antibacterial filter using copper sulfide is considered to be more useful than the conventional antibacterial filters using silver . although the preferred embodiments of the present invention have been described in detail , it is understood that the present invention should not be limited to these exemplary embodiments but various alternatives can be made by those skilled in the art within the spirit and scope of the present invention as hereinafter claimed .	1
a connector system with a plug and socket is described . the connector system allows rotation of the plug and socket with respect to each other while the plug and socket are electrically coupled . embodiments of the connector system help to prevent component and connector damage during coupling and uncoupling of mating components . fig1 is a diagram of an embodiment of a connector system 100 . the connector system 100 includes a plug housing 102 and a receptacle housing 112 . portions of the plug housing 102 and the receptacle housing 112 are cut away to show contacts 108 and 110 . reference number 110 indicates a representative receptacle electrical contact . the receptacle electrical contact 110 is fixedly attached to the receptacle housing 112 . the receptacle electrical contact 110 is a single piece of conductive material in a blade shape with a ninety degree angle between its two ends . one end of the receptacle electrical contact 110 is a mating end that is accessible through an opening in the receptacle housing 112 . as shown in fig1 all of the mating ends of the receptacle electrical contacts 110 are accessible through a single opening in the receptacle housing 112 that faces the plug housing 102 . the ends of the receptacle electrical contacts 110 opposite the mating ends may be electrically connected to an electrical component either removably or permanently . the plug housing 102 includes two bosses 104 that allow the plug housing 102 to be connected to a component , for example by screws inserted through the holes in the bosses 104 . the plug housing 102 further includes two tapered ears 115 that fit into the opening in the receptacle housing 112 . between tapered ears 115 , multiple guide openings 113 in the plug housing 102 each accept one mating end of a receptacle electrical contact 110 . each plug electrical contact 108 includes a distal end accessible through the guide opening 113 and a proximal end that projects between the bosses 104 . each plug electrical contact 108 is fixedly attached to the plug housing 102 between its distal end and its proximal end . the proximal ends of the plug electrical contacts 108 may be electrically connected , removably or permanently , to an electrical component . the proximal ends of the plug electrical contacts 108 are blades in one plane . the distal ends of the plug electrical contacts 108 are the distal sections of the same blades bent to be substantially in a plane orthogonal to the plane of the proximal ends . when the plug housing 102 is inserted in the receptacle housing 112 , the mating end of a receptacle electrical contact 110 is placed in physical contact with a distal end of a respective plug electrical contact 108 . the plug housing 102 and the receptacle housing 112 are rotatable with respect to each other while the electrical connection between the plug electrical contacts 108 and the receptacle electrical contacts 110 is maintained . the limits of rotation are defined by the ears 115 making contact with sides of the opening in the receptacle housing 112 in which the ears 115 are inserted . in one embodiment , the plug housing 102 and the receptacle housing 112 may rotate through an angle of up to thirty degrees with respect to each other . in various embodiments , the number of plug electrical contacts 108 and the number of receptacle electrical contacts 110 varies according to need . for example , one embodiment has four plug electrical contacts 108 and the same number of receptacle electrical contacts 110 . another embodiment has twenty plug electrical contacts 108 and the same number of receptacle electrical contacts 110 . in general , according to the components that are to be electrically coupled through the connector system 100 , the number of plug and receptacle contact pairs may vary between one and twenty or more pairs of contacts . in one embodiment , the plug housing 102 and the receptacle housing 112 are made of glass reinforced thermoplastic . in various embodiments , the plug housing 102 and the receptacle housing 112 may be made of any relatively rigid insulating material with the appropriate wear characteristics . in one embodiment , the receptacle electrical contacts 110 and the plug electrical contacts 108 are made of a copper alloy plated with gold . the receptacle electrical contacts 110 and the plug electrical contacts 108 may be made of any conducting material with the appropriate electrical and mechanical characteristics for the required application . the material should be resilient such that the distal ends of the plug electrical contacts retain resilience after being preshaped as shown in fig2 a . fig2 a is a diagram of a plug electrical contact 108 , showing the distal end 111 and the proximal end 109 . in one embodiment , the plug electrical contact 108 is a single piece of a resilient , conductive material . the distal end 111 is preshaped so as to remain biased against the mating end of a respective receptacle electrical contact 110 . fig2 b is a right side view of the plug electrical contact 108 of fig2 a , and fig2 c is a left side view of the plug electrical contact 108 of fig2 a . fig3 is a diagram of a plug electrical contact 108 in a mated position with a receptacle electrical contact 110 . the area 220 is the area of electrical contact and the point about which the plug electrical contact 108 and the receptacle electrical contact 110 rotate with respect to each other . fig4 is a diagram of one embodiment in which the connector system 100 is used to couple a hand - held device 202 and a cradle 204 . the cradle 204 may be a source of power for recharging or may facilitate communication between the hand - held device 202 and , for example , a personal computer . the hand - held device may be any hand - held electrical component , such as a personal data assistant ( pda ), that must occasionally communicate with another electrical component . the hand - held device 202 rests in the cradle in a curved rest area 208 . the hand - held device includes a curved area 206 that fits into the curved rest area 208 and allows easy rotation of the hand - held device 202 with respect to the cradle 204 . when the hand - held device 202 is placed in the cradle 204 or removed from the cradle 204 , the natural path of motion is not straight into and out of the cradle 204 in line with the contacts 108 and 110 of the plug housing 102 and the receptacle housing 112 . rather , the natural path includes placing lateral stress on the connector 100 . for example , a user removing the hand - held device 202 from the cradle 204 naturally pulls the hand - held device out from the cradle 204 either before or at the same time the user pulls the hand - held device 202 up in line with the connector 100 . the connector 100 allows rotation of the plug housing 102 and its contacts 108 with respect to the receptacle housing 112 and its contacts 110 . connector system 100 thus alleviates the problem of inadvertent component and contact damage on insertion and removal of the hand - held device 202 . the plug housing 102 is shown connected to the cradle 204 by screws 210 through the bosses 104 . the proximal ends of the plug electrical contacts 108 are visible inside and outside the plug housing 102 in this case because the plug housing 102 is made of a transparent insulator material . in other embodiments , the plug housing 102 may not be transparent , in which case only the tips of the proximal ends of the plug electrical contacts 108 extending beyond the plug housing 102 would be visible . a connector ( not shown ) may be removably coupled to the proximal ends of the plug electrical contacts 108 to couple the connector 100 directly or indirectly to some device , such as a personal computer . in other embodiments , the plug electrical contacts 108 may be permanently coupled to another connector or to a device or component , for example by soldering the proximal ends . fig5 is a diagram of the hand - held device 202 coupled to the cradle 204 through the connector 100 . in this diagram , the hand - held device 202 is rotated through an angle 302 with respect to the cradle 204 . in one embodiment , the angle 302 represents one half of the total rotation possible . in various embodiments , the total angle of rotation available may be variously distributed between a direction to one side of the connector 100 and a direction to the opposite side of the connector 100 . for example , in some embodiments , the cradle 204 may hold the plug connector 102 in a vertical position and allow rotation out of the vertical in two directions . in one embodiment , the total angle of rotation is less than or equal to thirty degrees . fig6 is a diagram showing the side of the hand - held device 202 that faces the cradle 204 ( and is therefore not visible in fig4 and 5 ). the hand - held device 202 includes a circuit board 402 containing electrical components necessary to make it function . part of the circuit board 402 is visible because a region of the hand - held device 202 casing is cut away , as shown . the receptacle housing 112 is shown . the receptacle housing 112 appears as it would if it were made of a transparent insulating material so that all of the mating ends of the receptacle electrical connections are visible . the ends opposite the mating ends ( not shown ) are inserted into the circuit board 402 and are permanently coupled to electrical contacts on the side of the circuit board 402 that is not shown . for example , each of the receptacle electrical contacts 110 may be soldered , in which case , solder dots such as solder dots 406 would be visible on the circuit board 402 . in one embodiment of the connector system 100 suitable for a common pda device and cradle , the connector system has a current rating of one amp , a dielectric withstanding voltage of 400 volt alternating current , and an insulation resistance of 1000 megaohms . typical mechanical characteristics of such an embodiment include a 5000 cycle life , a contact normal force of 3 . 5 pounds , a withdrawal force of 0 . 7 pounds , minimum , and an operating temperature range of from − 10 ° c . to + 105 ° c . fig7 a is a diagram of one embodiment of a connector system having ten sets of plug electrical contacts 1087 and receptacle electrical contacts 1107 . a plug housing 1027 is shown with its dimensions , and a receptacle housing 1127 is shown with its dimensions . fig7 b is a diagram showing a side view of the plug housing 1027 with its dimensions , and a side view of the receptacle housing 1127 with its dimensions . the invention has been described with reference to specific embodiments . various modifications may be made by one of ordinary skill in the art without departing from the spirit and scope of the invention as defined in the following claims . for example , alternative materials , different dimensions , and different configurations are within the scope of the invention as claimed . in addition , the connector system described may used to electrically couple , directly or indirectly , any components other than the components specifically shown and described .	7
fig1 shows an embodiment of the anti - ram system of this invention installed in a shallow trench alongside a sidewalk . the top surface 10 of the base or pad of the anti - ram system is shown recessed below the desired grade level . as shown in fig2 , a landscaping surface , such as grass 12 is placed over the top surface 10 of the base or pad . as further shown in fig2 , ornamental or functional objects are placed over the bollards 14 shown in fig1 . such objects include lamp posts 16 , waste container 18 , ornaments 20 , and a seat and shelter 22 . the ornamental and functional items disguise the presence of the bollards of the anti - ram system . fig3 shows an embodiment of this invention with four bollards 14 , mounted on the steel framework 23 for the pad of the anti - ram system . the framework 23 includes transversely extending tubular members 24 , longitudinally extending tubular members 26 , and longitudinally extending angle members 28 . in a preferred embodiment of this invention , the tubular members 24 and 26 have a rectangular cross - section , such that they form a generally planar upper and lower surface for the pad . the longitudinally extending tubular members 26 are welded to the sides of the transversely extending tubular members 24 . depending on the strength requirements of a particular anti - ram system , the welds can be fillet welds or full penetration welds on all four sides of the tubular members 26 . similarly , the longitudinally extending angle members 28 are welded to the sides of the tubular members 24 by either full penetration or fillet welds . alternatively , angular notches can be cut in the transversely extending tubular members 24 for the longitudinally extending angle member to pass through , in which case the angle member may be formed as one continuous piece . holes are provided in the transversely extending tubular members 24 to receive the cylindrical bollards 14 . again , the cylindrical bollards are secured to the tubular members 24 by fillet or full penetrations welds at both the upper and lower surfaces of the tubular members 24 . apertures 31 are provided in both tubular members 24 and 26 , such that they may be filled with a material such as concrete , to add strength and weight to the base or pad . fig4 , which is similar to fig3 , shows a rebar cage , or grillage 30 placed around the steel framework 23 . the rebar cage includes an upper portion on top of the tubular members 24 and 26 and a lower portion under the tubular members 24 and 26 . the rebars forming the cage 30 , are welded to the tubular member 24 and 26 . fig5 shows a top plan view of a framework for a typical set of three bollards , and fig6 shows a side elevation of the same framework constructed in accordance with this invention . fig7 shows an elevation view of a rebar cage or grillage secured to the framework shown in fig5 . fig8 is a typical side section view of the rebar cage and framework shown in fig7 , and fig9 is a typical front end section view , while fig1 is a typical rear end section view . fig1 is a cross - sectional detailed view of an end plate secured in the tubular member 24 . a gap is provided in the end plate to provide for the filling of the tubular member with a material such as concrete . fig1 is a detailed cross - section of one of the cover strips 32 provided on the bollards 14 . fig5 - 12 are representative of a base or pad system in accordance with this invention which requires the provision of an excavation approximately 14 inches deep . the steel framework has a height of approximately 10 inches , the rebar cage adding approximately ½ inch to the height , and the encapsulating concrete adding another 1 and ½ inch , for a total of 12 inches . fig1 - 22 are similar to fig5 - 12 in showing details of a second preferred embodiment of this invention . in this embodiment the base or pad is considerable thinner than that shown in fig5 - 12 . in this embodiment the overall height of the pad could be only 6 and ½ inches , the steel frame having a height of 5 inches , with the rebar being located mid - height in the steel frame , rather that on the top and the bottom . the concrete adds 1 and ½ inches to the height of the pad . referring to fig2 - 28 , it can be seen that by forming triangles with the transversely and longitudinally extending tubular members , it is possible to form a curved line of bollards . referring to fig4 , two bollard pads 32 , are shown spaced apart by a gap . before the pads are filed with concrete , a pair of pipes are placed within the pads , such that post tensioning members can be passed through the pipes to secure the two bollard pads 32 to each other . of course , any number of pads could be placed in alignment and secured by the post tensioning members . referring to fig4 , the bollard system of this invention may be formed as a unit to be place on a surface for temporary bollard protection . the bottom surface is formed as a high friction surface , so as to resist sliding when an impact is received by the bollards . referring to fig4 a perspective view of a steel frame formed for the base of a bollard system of this invention is shown , which is intended for placement on a slope . the bollards are secured to the base at an angle , such that when the base is placed on a slope , the bollards will be vertical . fig4 shows an embodiment of this invention wherein an opening is left in the base of the bollard system to provide for an opening , such that when a grate is installed over the opening , an open space below the base is ventilated through the opening . while only one embodiment of the invention has been shown , it should be apparent to those skilled in the art that what has been described is considered at present to be a preferred embodiment of the anti - ram system and method of installation of this invention . in accordance with the patent statute , changes may be made in the anti - ram system and method of installation of this invention without actually departing from the true spirit and scope of this invention . the appended claims are intended to cover all such changes and modifications which fall in the true spirit and scope of this invention .	4
the expression , &# 34 ; insular form ,&# 34 ; means that isolated particles and / or agglomerates of particles of vanadium oxide are spaced from one another on the peripheral surface of the taper - nose portion . the particles of vanadium oxide do not provide a continuous line or coating on the peripheral surface of the taper - nose portion , but are in the form of islands thereon . according to the present invention , the spark plug has improved self - cleaning ability due to the presence of islands of vanadium oxide on a taper - nose portion of the insulator . vanadium oxide is provided in insular form or as islands on the peripheral surface of the taper - nose portion of a spark plug insulator so that required electrical insulation is not lowered . as particles of vanadium oxide ( in insular form ) are separated from the taper - nose portion during spark plug service over a long period of time , it is most fortunate that such separated vanadium oxide particles are readily discharged to the exterior of the engine along with exhaust gases discharged therefrom , thus having no likelihood of damaging the engine . furthermore , in a spark plug according to the present invention , since particles of vanadium oxide are merely islands on the taper - nose portion , the taper - nose portion of the insulator is free of an undesirable temperature rise during the running of the engine ; there is no risk of pre - ignition during high - speed , high - load running . in order to form particles of vanadium oxide in insular form on the peripheral surface of the taper - nose portion , all that is required is to apply a suspension , e . g . aqueous , of vanadium oxide to the taper - nose portion , followed by drying or by drying and baking . thus , the formation of vanadium oxide in insular form is simple and easy . the expression , &# 34 ; self - cleaning ability ,&# 34 ; means that , in the event that unburnt carbon adheres to the surface of the taper - nose portion as a result of running an engine at a low temperature for a short distance , the spark plug is heated by heat in the combustion chamber , the temperature of which is raised during a subsequent engine running cycle , thus resulting in the natural removal of carbon therefrom . the cleaning function is consequently achieved by the spark plug itself . in this connection , effecting self - cleaning at the lowest possible temperature is desired . for example , if a self - cleaning temperature of a spark plug having no specially - provided countermeasure for the self - cleaning is in the order of 550 ° c ., it is desired that the self - cleaning temperature is lowered to lower than 500 ° c ., more preferably lower than 450 ° c ., by suitable countermeasures for the self - cleaning , in view of the improvement of a self - cleaning . it is noteworthy that vanadium oxide , in insular form , sticks to the taper - nose surface of a spark plug insulator . by forming particles of vanadium oxide in insular form on the taper - nose portion , the self - cleaning ability of a spark plug is greatly improved . since particles of vanadium oxide are in insular form and are thus spaced from one another of from aggregates thereof on the taper - nose surface , such particles of vanadium oxide do not impair the electric - insulation properties of the surface of the spark plug insulator . were particles of vanadium oxide to form a continuum over the surface of the insulator , a breakdown in electric - insulating properties of the taper - nose surface of the insulator would be caused during spark plug service , reducing the effectiveness of the spark plug itself . particles of vanadium oxide may be of a primary particle consisting of a single particle of vanadium oxide or of a secondary agglomerated particle consisting of two or more particles agglomerated ( see fig2 b and 2c ). as the degree of adhesion of vanadium oxide to the taper - nose insulator surface increases , the spark plug provides increased durability . even when the sticking force is weak , the self - cleaning action is by no means impaired by the presence of vanadium oxide islands on the taper - nose portion . in the present invention , a material for forming particles in insular form 7 is vanadium oxide . this is a generic term which includes all oxides of vanadium , e . g . vanadium pentoxide ( v 2 o 5 ) and vanadium trioxide ( v 2 o 3 ), individually or in any combination . however , vanadium pentoxide is preferred . the particles ( in insular form ) formed on the taper - nose portion of the insulator are also unlimited in their vanadium oxide constitution , which is , e . g ., v 2 o 5 , v 2 o 3 or a mixture thereof . thus , whenever the formed particles are of an oxide of vanadium , the objects of the present invention are achieved irrespective of the type of vanadium oxide used . in order to form particles of vanadium oxide in insular form on the taper - nose portion , powdered vanadium oxide is suspended in a liquid , such as water or alcohol , e . g . ethyl alcohol . the suspension is then applied to the taper - nose surface 61 of an insulator 6 , followed by drying at a temperature in the range of from 40 ° to 100 ° c . the drying causes vanadium oxide to stick to the taper - nose portion of the insulator with a comparatively weak force . in this connection , baking at a temperature in a range of from 700 ° to 900 ° c . for five to thirty minutes , after drying , is recommended in order to ensure the adhesion of the vanadium oxide sticking to the taper - nose portion and to increase durability of the plug . the suspension is applied to the taper - nose portion , e . g ., by dipping the taper - nose portion in the suspension of vanadium oxide , by coating the suspension on the taper - nose portion with a brush or by spraying the same on the taper - nose portion . the concentration of vanadium oxide in the suspension is from 0 . 01 to 6 percent by weight ( the same throughout the specification ), and a vanadium oxide concentration of from 0 . 5 to 5 percent by weight is preferred to obtain an extended duration of the self - cleaning function . in forming particles of vanadium oxide in insular form on the taper - nose insulator surface , powdered vanadium oxide having a grain diameter of from 0 . 5 to 10μ is used . the particle density of vanadium oxide , in insular form , on the taper - nose portion is preferably in the range of from 3 × 10 - 5 g to 3 × 10 - 3 g per cm 2 of the taper - nose surface area . an average vanadium oxide particle thickness is preferably less than 10μ in view of the electrically insulating property of the insulator . however , the self - cleaning ability is reduced when particles of vanadium oxide are less than 0 . 1μ in thickness . the formation of particles of vanadium oxide in insular form on the taper - nose portion is accomplished , e . g ., by applying a liquid suspension of vanadium oxide to the taper - nose portion , drying and ( optionally ) heating . particles of vanadium oxide , during the several steps , pass through the stages or states depicted by fig2 a , 2b and 2c . as seen in these figures by application of the suspension to the taper - nose portion 61 , a layer of suspension 70 , wherein powdered vanadium oxide 71 in a suspended state , such as , of a primary particle or a secondary agglomerated particle , is formed on the taper - nose insulator surface 61 ( fig2 a ). by the succeeding drying step , the particles of vanadium oxide 72 , in insular form , scatter and stick to the surface of the taper - nose portion 61 of the insulator ( fig2 b ). by the heating ( for baking ), following the drying , particles of vanadium oxide 72 are fused to cling closely and to adhere more securely to the surface of the insulator . the fused particles , after cooling , stiffen and remain in insular form as they stick firmly to the surface of the insulator , whereby vanadium oxide , in insular form 73 , sticks on the surface of the taper - nose portion of the insulator ( fig2 c ). without further elaboration , one skilled in the art can , from the preceding description , appreciate and use the present invention to its fullest extent . the following specific embodiments are , therefore , merely illustrative and do not in any way limit the disclosure . as a material for forming particles , in insular form , a suspension of powdered vanadium pentoxide ( v 2 o 5 ) is applied to the surface of a taper - nose portion 61 of a ceramic insulator 6 of a commercially - available spark plug . the spark plug insulator dried at about 60 ° c . for 30 seconds , and then heated ( baked ) in an electric furnace at 750 ° c . for 20 minutes , followed by cooling to obtain a spark plug having particles of vanadium oxide , in insular form , on the surface of the taper - nose portion 61 . in this first embodiment , suspensions containing powdered vanadium pentoxide of 5 , 1 , 0 . 5 , 0 . 1 , and 0 . 01 % by weight , respectively , are used , as shown in table a , and the taper - nose portion 61 is dipped once in such suspension . the suspension is applied to an area of the taper - nose portion 61 covering from the lower tip to an upper portion thereof which is 10 mm distant from the lower tip thereof . powdered vanadium pentoxide having an average grain diameter of 0 . 5 to 6μ is used , and ethyl alcohol is the suspension medium . the particles and agglomerates of vanadium oxide form islands on the surface of the taper - nose portion 61 of insulator 6 and have average thicknesses , respectively , as shown in table a . the thus - obtained spark plug 1 is conventionally installed in an automobile engine . the engine is then run while the engine wall is being cooled in order to maintain nose portion 61 of the insulator 6 of the spark plug 1 at a temperature lower than 150 ° c . a large amount of unburnt carbon is thus made to adhere to the surface of the taper - nose portion 61 . the spark plug 1 is then removed from the engine and placed in an electric furnace . the temperature of the electric furnace is raised by degrees to measure the temperature ( carbon removal temperature ) at which the unburnt carbon ( adhering to the taper - nose portion ) is removed from the spark plug . the aforesaid engine was run for 8 minutes at 1000 rpm / min . with a mixture charge of an air - fuel ratio of 5 or 6 . table a also shows corresponding results for an untreated , commercially - available spark plug ( no . c 1 ) having no vanadium oxide . table a confirms that , in case of spark plugs ( nos . 1 through 5 ) according to the present invention , a temperature at which the unburnt carbon is removed from the plugs is lower by from 100 ° to 120 ° c . than that required for a commercially - available spark plug ( no . c 1 ) having no vanadium oxide thereon . in order to observe the distribution of vanadium oxide , in insular form , on spark plugs produced according to the present invention , the surface of the taper - nose portion of the insulator was electron - photomicrographed . fig3 a is an electron - photomicrograph ( 3000 magnifications ) of spark plug no . 3 in table a . in this photomicrograph , the minute granular form is a particle of vanadium oxide , in insular form , sticking to the surface of the taper - nose portion . for better presentation , a copy of the electron - photomicrograph was prepared by hand as fig3 b . in fig3 b the granular matters depicted by a thick line are the aforesaid particles of vanadium oxide in insular form , wherein a single particle ( represented by reference symbol a ) is the aforesaid primary particle , and groups of two or more particles ( represented by reference symbol b ) are the aforesaid secondary agglomerated particles . for reference , the black portions seen on the left of the photomicrograph of fig3 a ( namely : the portions represented by reference symbol c in fig3 b ) are portions from which particles of vanadium oxide have been separated at the production of a replica necessary for photomicrographing . for comparison purposes , fig4 is an electron - photomicrograph , similar to that of fig3 a , on the surface of the taper - nose portion of the insulator of a commercially - available spark plug prior to being subjected to treatment according to the present invention . table a______________________________________ mean thicknessconcentration of particles in carbon - removalno . of v . sub . 2 o . sub . 5 ( wt %) insular form ( μ ) temperature (° c . ) ______________________________________1 5 8 . 0 4302 1 1 . 6 4303 0 . 5 0 . 8 4304 0 . 1 0 . 16 4505 0 . 01 0 . 016 450c . sub . 1none -- 550______________________________________ the aforesaid carbon removal temperature means a temperature at which unburnt carbon adherent to the taper nose portion of the insulator is completely removed from at least tip portion of the taper nose portion , so that the surface of the insulator surrounding a tip portion of the center electrode is maintained to be in an electric insulation state . this carbon removal temperature corresponds to a self - cleaning temperature and to improve the self - cleaning , lowering of this self - cleaning temperature is required . by varying the concentration of vanadium oxide in a suspension , a variety of spark plugs is produced in a manner similar to that of example 1 , and the durability of the self - cleaning ability of each spark plug is measured . more in detail , carbon is similarly made to adhere to respective spark plugs , which are the same as those in example 1 . the temperature at which such carbon is removed from the spark plug is measured , and then carbon is again made to adhere to the same spark plug according to the same procedure . the temperature at which this carbon is removed is then measured . such procedures for adhesion and removal of carbon to and from the spark plug are repeated six times for each spark plug . prior to the commencement of a succeeding procedure for adhesion of carbon , each spark plug is carefully examined to determine whether carbon adherent to the spark plug in the preceding cycle had been completely removed . carbon - removal - temperatures at respective cycles for each spark plug are shown in table b . the measurement for the commercially - available untreated spark plug ( no . c 2 ) is also given in table b . table b______________________________________ carbon - removal temperature (° c . ) concentration sec - no . of v . sub . 2 o . sub . 5 ( wt %) first ond third fourth fifth sixth______________________________________6 5 430 430 430 440 440 4407 1 &# 34 ; &# 34 ; &# 34 ; &# 34 ; &# 34 ; &# 34 ; 8 0 . 5 &# 34 ; &# 34 ; 440 &# 34 ; &# 34 ; 4509 0 . 1 450 450 450 460 460 46010 0 . 01 &# 34 ; &# 34 ; 460 &# 34 ; 480 480c . sub . 2none 550 550 550 550 550 550______________________________________ table b confirms that the removal temperature for adhering matter , such as carbon , is maintained low even after six cycles of carbon - adhesion and removal for spark plugs ( nos . 6 through 10 ) of the present invention and , particularly in the case of the spark plugs ( nos . 6 through 9 ) treated with a suspension having more than 0 . 1 % by weight of v 2 o 5 , the carbon removal temperatures are from 90 ° to 110 ° c . lower than that for the untreated spark plug ( no . c 2 ), thus reflecting an extended duration of self - cleaning ability resulting from the presence of vanadium oxide islands on the taper - nose portion of the insulator . by varying the v 2 o 5 concentration , spark plugs ( nos . 11 and 12 ) are produced in a manner similar to that of example 1 , and carbon is made to adhere thereto in like manner . the adhered carbon is then removed at 450 ° c . the electrically - insulating property of the surface of the taper - nose portion of the insulator of each plug is determined by measuring the electric resistance between the central electrode and the ground of each spark plug . for comparison purposes , a spark plug ( no . c 3 ) is prepared by applying a paste ( consisting of 70 % by weight of vanadium pentoxide and 30 % by weight of water ) to the surface of the taper - nose portion of the insulator of the spark plug , drying the spark plug , and baking the same at 750 ° c . in an electric furnace for 20 minutes . thus , there is obtained the spark plug ( no . c 3 ) having a layer of vanadium oxide formed uniformly over the entire surface of the taper - nose portion thereof . then , carbon is made to adhere to the spark plug , is removed at 450 ° c ., and the electrical insulation of the plug ( no . c 3 ) is measured in the same manner as in example 1 . the results are given in table c , together with a concentration of v 2 o 5 in the applied paste , a state of particles of vanadium oxide on the surface of the taper - nose portion of the insulator and the thickness of the layer . table c______________________________________ electricconcentration state of mean thickness resist - no . of v . sub . 2 o . sub . 5 ( wt %) particles of particles ( μ ) ance ( ω ) ______________________________________11 0 . 1 scattered in 0 . 16 infinite insular form12 1 . 0 scattered in 1 . 6 &# 34 ; insular form substantially over thec . sub . 370 entire surface 150 0 . 1 mω______________________________________ fig3 shows that spark plugs nos . 11 and 12 according to the present invention are unchangeably infinite in electric resistance even after service . in contrast thereto , the ignition plug ( no . c 3 ), having a uniform layer of 150μ in thickness , does not have any particles in insular form on the surface of the taper - nose portion , the electric insulation of the taper - nose portion is impaired by only one cycle of adhesion of carbon and removal thereof by heating , and the spark plug no . c 3 nearly lost its inherent function . with spark plugs nos . 11 and 12 in table c , there is no breakdown in electric insulation even after 6 cycles of a carbon - adhering and removing operation . no . c 3 spark plug turned light brown in an area of the taper - nose portion to which a large amount of v 2 o 5 had been applied , and turned black in the aforesaid area when heated for removal of the adhering matter , such as carbon . this change to a black color is considered to relate to a change in electric insulation of the leg portion . spark plugs are produced by the same procedures as in example 1 , with the exception that the drying subsequent to the application of the suspension is effected at 100 ° c . for 30 seconds , and heating after drying is omitted . the duration of the self - cleaning ability of these spark plugs is measured in the same manner as in example 2 . the results are given in table d . the results of the test for the untreated plug no . c 2 are also given in this table . table d______________________________________ carbon - removal temperature (° c . ) concentration sec - no . of v . sub . 2 o . sub . 5 ( wt %) first ond third fourth fifth sixth______________________________________13 5 430 430 430 450 450 46014 1 &# 34 ; &# 34 ; &# 34 ; &# 34 ; &# 34 ; 47015 0 . 5 &# 34 ; &# 34 ; 450 &# 34 ; 470 50016 0 . 1 450 450 470 500 550 55017 0 . 01 &# 34 ; &# 34 ; 500 530 &# 34 ; &# 34 ; c . sub . 2none 550 550 550 550 550 550______________________________________ as is obvious from table d , even the spark plugs which have not been heated after the drying present improved self - cleaning ability . a comparison of table d with table b shows that spark plugs subjected to heating after drying in table b have a more - extended duration of self - cleaning ability , as compared with those in table d , which are produced by a process excluding heating subsequent to drying or by a process including heating after drying are , respectively , mounted in an engine . the engine is run a short distance at a low speed , as in actual running . these spark plugs perform their function without causing smoldering . the invention and its advantages are readily understood from the foregoing description . various changes may be made in the process and in the products without departing from the spirit and scope of the invention or sacrificing its material advantages . the process , products and new use , hereinbefore described , are exemplary of preferred embodiments and are not intended to limit the claims which follow .	7
the biofilter 10 of the present invention is generally depicted in various embodiments in fig1 , 3 and 4 . the biofilter 10 is preferably provided with a container 12 having side walls 14 and a bottom wall 16 . a layer of particulate rubber 18 is at least partially disposed within the container 12 . in one preferred embodiment the rubber particulate is obtained from recycled rubber products , such as the automobile tire 20 depicted in fig2 a . although it is contemplated that substantially all portions of the recycled tire 20 and other rubber based products could be used , it is preferred that those portions having steel reinforcing wires or other such foreign matter be avoided or used sparingly due to the undesirable nature of long term exposure of such materials to wet environments , which may cause the foreign matter to oxidize . however , the sidewall 22 and tread 24 of most modern passenger vehicle tires will likely be sufficiently free of such foreign matter for many of the contemplated uses for the biofilter 10 . the chipped rubber 26 , depicted in fig2 b , and crumb rubber 28 , depicted in fig2 c , provide optimal shapes for use as the filter media in the biofilter 10 . both the chipped and the crumb shapes are fairly irregular in nature , providing a large surface area for each individual piece . this , combined with the porous nature of the rubber provides an optimal platform for the formation and maintenance of a microbial ecosystem , which naturally occurs in the treatment of organic waste material . moreover , the irregular shape of the chipped and crumb rubber allow the particulate layer 18 to settle into a loosely packed layer that permits a consistent flow of gas through the layer of particulate rubber 18 over extended periods of time . however , the irregular shape of the particulate function to “ interlock ” the pieces of particulate to one another to sufficiently reduce the incidence of erosion caused by wind and weather where the layer of rubber particulate 18 is directly exposed to the elements . after the organic material 30 passes through the layer of rubber particulate 18 , the layer of rubber particulate 18 will substantially recover any openings formed by the passing organic material 30 . one contemplated embodiment of the biofilter 10 of the present invention is depicted in fig3 , which closely resembles an open - air lagoon typically utilized for liquid and / or solid organic waste 30 . depending on the particular application and the specific organic waste 30 being treated , the side and bottom walls of the container 12 could be comprised of nearly any material , such as concrete , rubber , plastic , and various non - corrosive metals . it is further contemplated that the side walls 14 and bottom wall 12 could be comprised of earthen materials , as the container could be a lagoon formed directly in the ground adjacent an organic waste producing facility . the organic waste 30 may be dumped directly into the open upper end of the container 12 since the organic waste 30 , regardless of its composition , will substantially pass through the layer of rubber particulate 18 and settle at the bottom of the container 12 or become partially suspended within the layer of fluid 32 . in many applications , the fluid 32 will simply be comprised of water but may be comprised of sludge or other known organic slurry . it is further contemplated that a system of conduit 34 or the like could be used to deliver the organic waste 30 and / or fluid 32 to the container 12 from an adjacent or remote organic waste producing facility when top - loading of such materials is not practical or otherwise desirable . regardless of the manner in which the organic waste 30 is delivered to the container 12 , a naturally occurring microbial ecosystem will begin breaking down the organic waste 30 within and below the layer of fluid 32 . this microbial ecosystem will also inhabit the layer of rubber particulate 18 and feed on the contaminated gasses delivered upwardly through the layer of fluid 32 to the layer of rubber particulate 18 . a test facility was created to quantify the benefits of the biofilter 10 as the same could be used in the treatment of organic waste within a manure slurry pit that was set up similarly to that depicted in fig3 . a six week testing and sampling of the manure storage containers was completed and the results are presented in fig5 . the contents of the manure storage tanks were similar to those typically observed in under - barn pit storage . odor reduction was studied for one inch layer of rubber particulate ( sample 3 ) and three inch layer of rubber particulate with reference to a control tank ( sample 2 ). for the three inch layer , experiments were based on the mode of addition of manure to the storage structure simulating an under - barn pit ( sample 5 ) and an outdoor storage unit ( sample 4 ). a container filled with water and a three inch layer of rubber particulate ( sample 1 ) was used to obtain background readings for the rubber particulate . sludge , lagoon top water and manure for these experiments were produced from a swine facility . as the table in fig5 indicates , the one inch layer of rubber particulate resulted in more than eighty percent odor reduction during sampling weeks 2 , 3 , and 6 . odor reduction diminished in other weeks where high ambient temperatures were experienced or the manure additions were made by dropping the waste through the layer of rubber particulate , simulating under - barn tank conditions , thus temporarily disbursing portions of the layer of rubber particulate and exposing the waste being stored below . performance of the three inch layer of rubber particulate was superior compared to the one inch layer of rubber particulate , effecting an odor reduction to the extent of eighty to ninety five percent , irrespective of the manner in which the manure was added to the tanks or the ambient temperature . other important facts discovered in the testing of the layers of rubber particulate include a ninety nine percent reduction of hydrogen sulfide and a ninety eight percent reduction in ammonia . the biofilter 10 of the present invention is sufficiently simple in its structure and design that it is easily used as a much smaller biofilter than that depicted in fig1 or 3 . for example , it is contemplated that a plurality of biofilters such as the biofilter 10 ′ depicted in fig4 could be used throughout a waste treatment system , such as a municipal sewer system . in that particular application , the container 12 ′ will preferably be provided with a sidewall 14 ′ and a bottom wall 16 ′. the bottom wall 16 ′ will preferably have one or more apertures formed therethrough that are sized and shaped to substantially prevent the passage of the layer of rubber particulate 18 ′ therethrough . however , the apertures within the bottom wall 16 ′ will permit the contaminated gasses emanating from the organic waste 30 , which flows beneath the biofilter 10 ′ within the conduit 36 , to pass through to the layer of rubber particulate 18 ′. a slightly increased pressure of the air within the conduit 36 will tend to direct the contaminated gasses upwardly through the bottom wall 16 ′ and through the layer of rubber particulate 18 ′ which will host the naturally occurring microbial ecosystem . when a cover 38 is used , such as a manhole cover , it should be provided with a plurality of apertures similar to those formed within the bottom wall 16 ′ so that the treated air may freely pass therethrough . it is contemplated that the layer of rubber particulate 18 ′ could be divided into a plurality of layers using apertured dividing plates 39 that are coupled to the side walls 14 ′. additionally , a layer of activated carbon 40 may be provided to absorb a substantial portion of the small amount of contaminated gases that may pass beyond the layer of rubber particulate 18 ′. the biofilter 10 ′ is simply one example of the flexibility provided by the design of the biofilter of the present invention . the functionality of the biofilter 10 ′ will be nearly identical to that of the biofilter 10 and will be expected to have similar success in the treatment of the contaminated gases emanating from the organic waste 30 . any of the contemplated structural embodiments of the biofilter will be appropriate for use in the treatment of low and high volume contaminating air streams that are characterized by a low or high concentration of a plurality of different gases and compounds . the biofilter is particularly well suited for the treatment of hydrogen sulfide , ammonia , aldehydes , ketones , amines , aliphatic hydrocarbons and aromatic hydrocarbons . the use of recycled tires in particulate form makes the filter media easy to apply and nearly maintenance free over an indefinite lifetime . moreover , the use of recycled materials provides an added benefit to the environment . in the drawings and in the specification , there have been set forth preferred embodiments of the invention and although specific items are employed , these are used in a generic and descriptive sense only and not for purposes of limitation . changes in the form and proportion of parts , as well as a substitution of equivalents , are contemplated as circumstances may suggest or render expedient without departing from the spirit or scope of the invention as further defined in the following claims . thus it can be seen that the invention accomplishes at least all of its stated objectives .	1
the various features of the preferred embodiments will now be described with reference to the drawing figures , in which like parts are identified with the same reference characters . the following description of the presently contemplated best mode of practicing the invention is not to be taken in a limiting sense , but is provided merely for the purpose of describing the general principles of the invention . according to a preferred embodiment of the present invention , a pseudowire packet mtie and ppb estimator is provided that can be used to indicate that the derived t1 clock may be exceeding the wander specification for a t1 traffic interface , such as t1 . 403 (§ 6 . 3 . 1 . 2 ) either over one or multiple 15 minute intervals or a 24 hour interval . the packet mtie estimator according to a preferred embodiment of the present invention presumes a constant network propagation delay for the fastest packets during a static period of the network operation . the packet mtie estimator according to a preferred embodiment of the present invention selectively processes the time difference between the rtp packet timestamps , which are marked at the time the packet is generated by the t1 line timed node , and the marked timestamp that indicates when the packet is received by the respective pseudowire timed node . the clock used to generate the t1 signal timestamps the data packet when the data packet is generated . if one or other of the clocks runs faster ( conversely slower ) than the other , then the mtie will exhibit those errors . the goal is to lock the two clocks together so that timing differences between the two are substantially minimized , or preferably eliminated , according to an exemplary embodiment of the present invention . when the two nodes &# 39 ; clocks are synchronized , the timestamp difference is constant . if the clocks are not locked , then the time difference increases or decreases accordingly with the differential clock error . the t1 mtie is the peak value of the difference over a given period . the derivative of this mtie is used to estimate the t1 clock error . as discussed above , the embodiments of the present invention and discussion herein have been directed towards t1 pseudowire data signals ; however , those of ordinary skill in the art of the present invention can appreciate that the embodiments discussed herein can also be used for e1 pseudowire data signals , and / or bundled or unbundled t1 pseudowire data streams . fig2 illustrates the effect of an incorrectly configured switch that was inadvertently programmed to half duplex operation rather than full duplex . fig2 shows , as an example , the effects of an incorrectly configured cisco ® switch , which was inadvertently programmed to 100 mbps half duplex operation rather than full duplex . the vertical axis shows relative packet delays ( jitter ) through the cisco ® switch measured in uis , and the horizontal axis represents time ( in hundreds of microseconds ). each point indicates , the arrival of a pseudowire packet . fig2 represents approximately 10 minutes of traffic samples . fig2 illustrates anomalous link behaviour that resulted from programming the link speed from full to half duplex . part of this anomalous behaviour is the slow packets , listed as i , ii , iii , and iv , which although periodic in nature , can be filtered out by software that uses fastest packets for timing determination . also shown is the odd behaviour of bursts “ v ” and “ vi ” of fast packets which occurred as a result of the full to half duplex setting . these fast bursts of packets can affect timing recovery and result in a change that can only be seen through the mtie estimator according to an exemplary embodiment of the present invention . thus , in this example , a network change in which an interface is changed from full to half duplex , caused packet delay variations which resulted in an mtie alarm being raised . the mtie alarm is raised at the same time as the network change was implemented , allowing the network engineer to quickly flag the install crew that they changed a parameter which affected the clock recovery . accordingly , it is the ability to detect a clock fault condition as the condition where the control loop is not maintaining the t1 mtie requirements and alarm it that various exemplary embodiments of the present invention addresses . accordingly , a first aspect of the present invention provides for the selective use of the “ fastest packets ”, or more specifically , those packets with the lowest network transit delay . as is well known to those of ordinary skill in the art of the present invention , network delay changes with respect to network loading , such that higher network loading will cause greater packet latency . as is also well known to those of ordinary skill in the art of the present invention , average and maximum packet delays increase with network loading . as network loading approaches 100 %, average and maximum packet transit time delays increase exponentially . however , minimum packet transit times remain substantially constant over most network loading conditions , barring the exceptional case of near 100 % loading . fig3 illustrates theoretical timing packet network transit delays under light and heavily loaded networks . the minimum packet transit delay is shown as time t 0 in fig3 . this delay is achieved by the fastest packets and is a statistical data point . according to a preferred embodiment of the present invention , the static value of t 0 is used as an absolute reference point for zero packet delay maximum time interval error ( mtie ) for a given network topology . when the network topology changes , a new value of t 0 is calculated , and used as the reference point for a new zero packet mtie . zero packet mtie — t 0 — is a statistical parameter , calculated by processing as many packet delay samples as required to achieve an accurate estimate of minimum packet delay . once to is determined for a static network topology , control algorithms adjust the regenerated t1 clock to maintain to constant , representing a substantially zero mtie . thus , the system and method according to an exemplary embodiment of the present invention constantly re - estimate t 0 . the re - estimation of to is recorded as an ongoing measure of mtie and used to adjust the clock in the device ( e . g . a bts ) being controlled . as can be appreciated to those of ordinary skill in the art of the present invention , different algorithms can be used to estimate t 0 . an example of such an algorithm operates a proportional / integral / derivative ( pid ) control loop to optimize the clock . according to an exemplary embodiment of the present invention , the mtie estimator shows how far the pid or other control algorithm is swinging in t1 bit times based on the packet arrival time stamps . the different algorithms are designed to keep the relative time difference of the received packet stream small with respect to to , and bounded by allowed mtie of 28 ui per 24 hours . if there are any excursions beyond this limit implies then it can be ascertained , according to the present invention , that the data being fed to the pid or other control loop is misbehaving . as those of ordinary skill in the present art can appreciate , substantially all control algorithms employ models for both the system to be controlled as well as for the received data used to control the system . the models may be linear or non - linear . a linear control system would be a pid controller , where the feedback control signal is proportional to either the error of ( t n − t 0 ) multiplied by a constant k p , or the proportional to the derivative of ( t n − t 0 ) with respect to time multiplied by a different constant k d , or proportional to the integral of the error of ( t n − t 0 ) multiplies by a constant k i . a non - linear control system could be similar to a linear control system , but for example where the gain of the control loop is exponentially increased based on the error ( t n − t 0 ), so for example , the proportional gain is k p for error signal ( t n − t 0 )& lt ; 10 , but increases to 2 * k p for ( t n - t 0 )≧ 10 . the model for the crystal ( i . e ., to generate the receive clock ), for example , can define the allowed range of digital control values and corresponding relative frequency change in parts per billion . the non - linear model for the timing packet delay samples can assume network topology changes resulting in stepwise changes to the network delay . other non - linear aspects can address micro - beating of the timing packets with other similar timed packets . when the models are correct , the control system works as designed and maintains to within the specifications for a traffic t1 . this is shown in fig4 , which illustrates packet maximum time interval error rate when correct linear and non - linear models are used to replicate both the system and the data used within the system according to an embodiment of the present invention . fig4 , although theoretical , shows that the normal operation of the control loop is to work well within the defined mtie and ppb bounds required for t1 circuits . the control loop according to a preferred embodiment of the present invention is a phase locked loop control system , as shown in fig8 . fig5 illustrates a current packet maximum time interval error for a specific circuit for a first time period according to an exemplary embodiment of the present invention . the data for fig5 was extracted from an exemplary embodiment of the present invention , a live belair ® networks mesh network carrying pseudowire traffic . fig5 represents actual performance data of current packet maximum time interval error estimation over about a 24 hour ( 96 interval ) period . also shown on fig5 is an error estimation in ppb based on the recovered pseudowire streams and their relative position in the receive buffer . fig6 illustrates current packet maximum time interval error for a specific circuit for a second time period according to an exemplary embodiment of the present invention . fig6 illustrates the mtie and ppb error estimates based on the packet data streams over a shorter time period of about 3 hours , or twelve intervals of approximately 15 minutes each . according to a exemplary embodiment of the present invention , the ppb estimation , which is based on the differential of the packet mtie estimation , can be roughly approximated as : ppb error [ n ] =( mtie [ n ]− mtie [ n − 1 ])( 647000 ps )/( 15 minutes 60 seconds ), so that the scaling factor between ppb and differential mtie estimation is approximately 0 . 9 : 1 . if , however , the packet mtie exceeds a defined threshold , or the ppb estimate exceeds an alternate defined threshold , then most often , the packet timing samples are not behaving according to the model , indicating a problem with the network packet delay statistics . fig7 illustrates a current packet maximum time interval error with an alarm condition according to an exemplary embodiment of the present invention . in the case shown in fig7 , the high threshold alarm has been exceeded . an alarm would be raised if the condition persists for a specified period of time ( a process known as “ debouncing ”), or if the ppb estimate exceeded a defined allowed error threshold . for example , if the ppb estimate exceeded the 50 ppb specification for a single 15 minute interval , then the resulting t1 buffer error in the subtending equipment could be as high as 15 * 60 * 0 . 1 = 90 μs , or approximately 140 ui . this condition would need to be alarmed , as most t1 buffers in subtending equipment are rated only for ± 128 ui and the mtie estimate is not an absolute value . alarms raised as a result of mtie thresholds being exceeded , or ppb estimates being exceeded , do not inform the noc of the cause of the clock error , only that there is a clock error and that the recovered clock is not meeting required specifications . an alarm condition can be used by the noc to aid in the determination of the cause . as is often the case , the root cause is a direct result of noc intervention , either changing of circuits , and these changes can be retracted quickly if the alarm condition is presented . according to a further exemplary embodiment of the present invention , a system and method are provided to extrapolate the t1 timing error based on the packet mtie estimator . the system and method for extrapolation according to an exemplary embodiment of the present invention utilizes the transfer function of the control algorithm in conjunction with the calculated packet mtie estimate to estimate the t1 mtie value . the estimated t1 mtie values are then used to set the alarm thresholds . fig9 illustrates an exemplary control system wherein timing for recovery of a pseudowire data stream is derived from the pseudowire data stream according to an embodiment of the present invention . fig9 illustrates the control system wherein the pseudowire data stream is used as the timing source , and is timed from the pseudowire unit 4 which is locally timed from line interface unit ( liu ) 4 . as data enters liu 2 , a t1 data clock time - stamps each packet . the t1 data is then transmitted as packets wired or wirelessly via network 6 , and recovered at converter 8 , and liu 10 . liu 10 time - stamps the recovered data packet with its own t1 data clock which is free - running compared to the transmitting t1 data clock . the rate of change in the difference between the two clock &# 39 ; s time - stamps indicates whether one clock is faster than the other . a delta - t that is increasing means the receive clock is running faster ; and if delta - t is decreasing , then the local receive clock is running slower . fig9 further includes an exemplary proportional integral derivative ( pid ) controller which forms the pll control system 12 . part of control system 12 is a monitoring function , which includes two taps : a first limiter 14 for alarming excessive mtie events , and a derivative function block 16 followed by a second limiter 18 for alarming excessive clock error conditions . according to a preferred embodiment of the present invention , the clock error condition will alarm when clock errors exceeds a threshold of about 100 ppb . fig1 illustrates an exemplary control system wherein timing for recovery of a pseudowire data stream is derived from an ieee 1588 timed local clock 26 according to an embodiment of the present invention . fig1 is similar to fig6 ; however , the regenerated t1 timing is derived from an ieee 1588 local clock 26 and not from the pseudowire stream . the ieee 1588 local clock 26 relies on exchanging timing messages and control with an ieee 1588 timing source 24 located in the network . the ieee 1588 timing source 24 uses the same stratum traceable timing reference as liu 2 , so the end result is that the regenerated ieee 1588 clock in pseudowire box 20 should have the same timing as the network . accordingly , the exemplary embodiment of the present invention illustrated in fig1 illustrates a system to monitor and alarm the operation of the ieee 1588 using almost the same circuitry as shown in fig9 , with the addition of ieee 1588 timing source 24 . pseudowire alarm monitor 22 is also shown in fig1 , and includes two taps : a first limiter 14 for alarming excessive mtie events , and a derivative function block 16 followed by a second limiter 18 for alarming excessive clock error conditions . the output of the timestamp filtering is combined with an output from an ieee 1588 timed local clock to for the timestamp extraction used to receiver t1 data signals . according to a preferred embodiment of the present invention , the clock error condition will alarm when clock errors exceeds a threshold of about 100 ppb . exemplary embodiments of the present invention can be implemented as a computer program that can be embodied in any computer - readable medium for use by or in connection with an instruction execution system , apparatus , or device , such as a computer - based system , processor - containing system , or other system that can fetch the instructions from the instruction execution system , apparatus , or device and execute the instructions . as used herein , a “ computer - readable medium ” can be any means that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the computer readable medium can be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples ( a non - exhaustive list ) of the computer - readable medium can include the following : an electrical connection having one or more wires , a portable computer diskette , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), an optical fiber , and a portable compact disc read - only memory ( cdrom ). the present invention has been described with reference to certain exemplary embodiments thereof . however , it will be readily apparent to those skilled in the art that it is possible to embody the invention in specific forms other than those of the exemplary embodiments described above . this may be done without departing from the spirit and scope of the invention . the exemplary embodiments are merely illustrative and should not be considered restrictive in any way . the scope of the invention is defined by the appended claims and their equivalents , rather than by the preceding description . all united states patents and applications , foreign patents , and publications discussed above are hereby incorporated herein by reference in their entireties .	7
fig1 and 2 show a phone system demonstration station 100 configured in accordance with an embodiment of the present invention . the phone system demonstration station 100 includes a demonstration unit support platform 102 , a plurality of phone system demonstration units 104 secured to a top surface 106 of the demonstration unit support platform 102 , and phone system operating components 108 secured to a bottom surface 110 of the demonstration unit support platform 102 . alternatively , the phone system operating components 108 can be engaged with the top surface 106 or to both the top and bottom surfaces 106 , 110 of the demonstration unit support platform 102 . the platform 102 can be made using any suitable materials / construction and can include a suitable support structure such as , for example , a plurality of legs 114 . it is disclosed herein that , in some embodiments , one or more of the phone system demonstration units 104 are secured to the demonstration unit support platform 102 in a manner such that they are selectively detachable from and attachable to the top surface 106 of the demonstration unit support platform 102 . for example , one or more of the phone system demonstration units 104 can be desktop units that are fixedly secured to the top surface 106 of the demonstration unit support platform 102 and one or more of the phone system demonstration units 104 can be handheld / mobile units that are selectively detachable from and attachable to the top surface 106 of the demonstration unit support platform 102 . voice over internet protocol ( voip ) phone units such as those offered by polycom are examples of the phone system demonstration units 104 . furthermore , the phone system demonstration units 104 are one example of telecommunications equipment . it is disclosed herein that embodiments of the present invention can be configured to demonstrate telecommunications equipment other than that of a phone system . the phone system demonstration units 104 are operably connected to the phone system operating components 108 . the phone system operating components 108 include service interfaces 112 that are configured for being connected to services such as , for example , line power , a pots ( i . e ., plain old telephone service ( i . e ., landline service )) line , the internet ( i . e ., a public computer network system ) and the like for enabling fully functional actual and / or simulated operation of the phone system demonstration units 104 . the phone system operating components 108 is configured for providing demonstration enabling functionality thereof to the phone system demonstration units 104 when the phone system operating components 108 are provided with electrical power and a communication connection . in the case of the phone system demonstration units 104 operating over a computer network ( e . g ., a voip phone system ), an internet connection is a suitable type of communication connection ( i . e ., a communication network connection ) for enabling demonstration enabling functionality of the phone system operating components 108 to be implemented . it is disclosed herein that the communication connection can be provided in a wired and / or wireless manner . in view of the disclosures made herein , a skilled person will appreciate that the phone system operating components 108 is collectively an example of demonstration enabling circuitry configured in accordance with an embodiment of the present invention . it is disclosed herein that the demonstration enabling functionality enables the at least one phone demonstration unit to perform end - use communication services thereof . for a voip phone system or other suitably configured type of telecommunications equipment , examples of such end - use communication services include , but are not limited to , the functionalities listed in table 1 below . in view of the disclosures made herein , a skilled person will contemplate other end - use communication services that can be implemented via demonstration enabling functionality and demonstration enabling circuitry suitably configured for providing such demonstration enabling functionality . referring now to fig3 , a demonstration apparatus 200 ( i . e ., a phone system demonstration kit ) configured in accordance with an embodiment of the present invention is shown . the demonstration apparatus 200 includes a carrying case 202 ( i . e ., a equipment enclosure ) and the phone system demonstration station 100 . the carrying case 202 includes a carrying case base 204 and a carrying case lid 206 moveably mounted on the carrying case base 204 for allowing the carrying case lid 206 to be moved to an orientation with respect to the carrying case base 204 for allowing access to a cavity 208 of the carrying case base 204 . preferably , but not necessarily , the carrying case lid 206 is pivotably attached to the carrying case base 204 such as though one or more hinges . alternatively , the carrying case lid 206 can be configured for being entirely detached from the carrying case base 204 . the phone system demonstration station 100 is located ( e . g ., fixedly or removably ) within the cavity 208 of the carrying case base 204 . in this respect , the cavity 208 is a demonstration unit support platform receiving cavity . the phone system demonstration units 104 of the phone system demonstration station 100 are exposed within an opening 210 of the carrying case base 204 . the opening 210 is defined by an open end portion the cavity 208 . in this respect , particularly when the phone system demonstration station 100 is fixedly located within the cavity 208 of the carrying case base 204 , the portion of the phone system operating components 108 that are attached to the bottom surface 110 of the demonstration unit support platform 102 are located within an interior space of the carrying case 202 ( i . e ., a space jointly defined by the demonstration unit support platform 102 and the cavity 208 of the carrying case base 204 . the demonstration apparatus 200 includes a phone demonstration unit protection insert 220 . in one embodiment , the phone demonstration unit protection insert 220 is a protective foam insert . the phone demonstration unit protection insert 220 is positioned within the cavity 208 of the carrying case base 204 above the phone system demonstration station 100 . each one of the phone demonstration units 104 of the phone system demonstration station 100 is located within a respective phone demonstration unit receiving space 222 of the phone demonstration unit protection insert 220 . in this respect , the phone demonstration unit protection insert 220 supports and protects the phone demonstration units 104 during transport of the demonstration apparatus 200 . turing now to a method of use of the demonstration apparatus 200 , a set of steps for demonstrating a phone system is presented . after moving the carrying case lid 206 from its closed position ( fig3 ) to its open position ( fig4 ), the phone demonstration unit protection insert 220 is removed from within the cavity 208 of the carrying case base 204 . after removing the phone demonstration unit protection insert 220 from the cavity 208 of the carrying case base 204 , the phone system demonstration station 100 is removed from within the cavity 208 of the carrying case base 204 . in a first embodiment of the method ( i . e ., table top use with the phone system demonstration station 100 is removed from within the cavity 208 of the carrying case base 204 ), electrical power and one or more suitable communication connections are provided to the phone system operating components 108 after removal of the phone system demonstration station 100 is removed from within the cavity 208 of the carrying case base 204 thereby allowing demonstration of the phone demonstration units 104 to be implemented . electrical power can be provided via a power supply cable of the phone system operating components 108 being plugged into a power source and one or more suitable communication connection can be provided via an active ethernet cable being plugged into a network connector of the phone system operating components 108 to provide network ( e . g ., internet ) connectivity . in a second embodiment of the method ( i . e ., the phone system demonstration station 100 used while in the cavity 208 of the carrying case base 204 ), the phone demonstration unit protection insert 220 is placed back into the cavity 208 of the carrying case base 204 after the phone demonstration unit protection insert 220 is removed from the cavity 208 of the carrying case base 204 . thereafter , the phone system demonstration station 100 is placed back into the cavity 208 of the carrying case base 204 on top of the phone demonstration unit protection insert 220 . in this respect , the phone demonstration unit protection insert 220 serves as a stand - off for the phone system demonstration station 100 to maintain it at an elevated position within the cavity 208 of the carrying case base 204 . electrical power and one or more suitable communication connection are provided to the phone system operating components 108 after the phone system demonstration station 100 is placed back into the cavity 208 of the carrying case base 204 thereby allowing demonstration of the phone demonstration units 104 to be implemented . electrical power can be provided via a power supply cable of the phone system operating components 108 being plugged into a power source and one or more suitable communication connection can be provided via an active ethernet cable being plugged into a network connector of the phone system operating components 108 to provide network ( e . g ., internet ) connectivity . although the invention has been described with reference to several exemplary embodiments , it is understood that the words that have been used are words of description and illustration , rather than words of limitation . changes may be made within the purview of the appended claims , as presently stated and as amended , without departing from the scope and spirit of the invention in all its aspects . although the invention has been described with reference to particular means , materials and embodiments , the invention is not intended to be limited to the particulars disclosed ; rather , the invention extends to all functionally equivalent technologies , structures , methods and uses such as are within the scope of the appended claims .	7
referring again to the drawings , fig3 shows a modified logic cell which primarily utilizes npn transistors and which is capable of reliable low voltage operation . it should be noted that the present invention can be implemented using transistor types other than bipolar transistors , including fets and hbts . the modified cell includes an input differential pair including npn transistors q 1 and q 2 and an output differential pair which includes npn transistors q 3 and q 4 . the two differential pairs share common load resistors r l1 and r l2 . the output of the output differential pair ( q 3 / q 4 ) is coupled to the output of the cell by way of a pair of emitter - follower configured transistors q 7 and q 8 . transistors q 7 and q 8 are connected to current sources i x1 and i x2 , respectively . these transistors also provide feedback for increasing switching speed . current is provided to the input differential pair by npn transistor q 5 and to the output differential pair by npn transistor q 6 . transistors q 5 and q 6 are controlled by a switching circuit which is responsive to the clock signal . the switching circuit includes a differential pair of pnp transistors q 9 and q 10 connected to a common current source i x1 . the clock signal is fed to the bases of transistors q 9 and q 10 . the switching circuit further includes a pair of npn transistors q 11 and q 12 which function as active loads for transistors q 9 and q 10 , respectively . transistors q 11 and q 12 are diode connected with the base and collector electrodes shorted together . the base / collector electrodes of transistors q 11 and q 12 are coupled to the base electrode of transistors q 5 and q 6 , respectively . transistor pair q 11 and q 5 and pair q 12 and q 6 each function as current mirrors so that the current in the diode half of the pair is reflected in the transistor half . operation of the fig3 cell will now be described . when the clock is in a first phase , transistor q 9 is conducting and transistor q 10 is off . through the operation of the current mirror , transistor q 5 will be turned on and transistor q 6 will be off . thus , the input differential pair comprising transistors q 1 and q 2 will be active and will respond to the data input . in the second phase of the clock , transistor q 9 will be switched off and transistor q 10 will be switched on . this will cause the input differential pair comprising transistors q 1 and q 2 to become inactive and the output differential pair comprising transistors q 3 and q 4 to become active . the data stored in the input pair will be transferred to the output pair comprising transistors q 3 and q 4 and to the output of the cell by way of the emitter - follower transistors q 7 and q 8 . since the input pair are inactive , the cell will not respond to any further changes in the data input . the minimum operating voltage for the modified cell of fig3 is less than the voltage required by the conventional cell of fig2 . the minimum voltage for the input circuit to operate is limited by the voltage required for the output differential pair to operate . that voltage is determined by inspection and is as follows : v min is the minimum operating voltage for the modified cell ; v zl is the minimum quiescent voltage across the load resistors r l1 / r l2 ; v be ( q7 / 8 ) is the minimum quiescent base - emitter voltage of transistors q 7 / q 8 ; v be ( q3 / 4 ) is the minimum quiescent base - emitter voltage for transistors q 3 / 4 ; and v ce ( q6 ) is the minimum quiescent collector / emitter voltage for transistor q 6 . assuming that the minimum voltage for the three base - emitter voltages is 0 . 75 volts and the minimum voltage for the load resistors is 0 . 25 volts , it can be seen that the minimum voltage for reliable operation of the modified cell of fig3 is 2 . 75 volts , a significant improvement over the conventional cell of fig2 which requires 3 . 25 volts . as is the case with all of the circuits disclosed herein , the loads may be implemented either as resistive loads ( r l1 / r l2 ) or as active loads . the active loads may include , for example , a pair of transistors configured as a current mirror . fig4 depicts the complement of the modified cell of fig3 where pnp transistors have been replaced with npn transistors and npn transistors have been replaced with pnp transistors . further , the polarity of the supply voltage is reversed . operation of the fig4 circuit is the same as that of fig3 and the minimum operating voltage is also improved to the same extent as that of fig3 . referring to fig5 a further modified logic cell is disclosed which primarily utilizes npn transistors . the cell includes an input differential pair which includes transistors q 1 and q 2 having their emitters coupled to a common current source i x4 . the output of the input differential pair is coupled to an output differential pair which includes transistors q 3 and q 4 by way of emitter - follower configured transistors q 7 and q 8 . the input differential pair and the output differential pair share common load resistors r l1 and r l2 . the output differential pair transistors q 3 and q 4 have their emitters coupled to a common current source i x5 . in addition , emitter follower transistors q 7 and q 8 are coupled to separate current sources i x2 and i x3 . again , the output of the cell is at the emitters of transistors q 7 and q 8 . the fig5 cell includes a switching circuit which is responsive to the clock signal and which includes a pair of pnp transistors q 9 and q 10 having their emitters coupled to a common current source i x1 . current source i x1 has an output magnitude which matches that of both sources i x4 and i x5 . the collector of transistor q 9 is connected to current source i x5 and the collector of transistor q 10 is connected to current source i x4 . in operation , during one phase of the input clock , transistor q 9 is on and transistor q 10 is off . that means that all of the current from source i x1 flows through transistor q 9 into source i x5 . since the magnitude of the two current sources are the same , all of the current required by source i x5 is provided by source i x1 . there is no remaining current available for the output stage differential pair made up of transistors q 3 and q 4 so the output stage is inactive . at the same time , transistor q 10 is off so that all of the current required by source i x4 is provided by transistors q 1 and q 2 . thus , the input differential pair is active and the data input appears at the output of the circuit . when the clock changes phase , transistor q 10 is turned on and q 9 is turned off . the input differential stage then becomes inactive since all current for source i x4 is provided by transistors q 10 and the output stage is active since all current required by the stage is provided by transistors q 3 and q 4 . thus , the data from the input stage is transferred to the output stage and to the output . any further changes in the input data will not affect the cell since the input stage is inactive . the voltage required for reliable operation of the fig5 cell is less than that of the conventional cell of fig2 . the portion of the cell which requires the largest operating voltage is that which includes the output differential pair and therefore determines the minimum operating voltage . the minimum operating voltage , which is determined by inspection , is as follows : v min is the minimum operating voltage for the modified cell ; v zl is the minimum quiescent voltage across the load resistors r l1 / r 2 ; v be ( q7 / 8 ) is the minimum quiescent base - emitter voltage of transistors q 7 / q 8 ; v be ( q3 / 4 ) is the minimum quiescent base - emitter voltage for transistors q 3 / 4 ; and assuming that the minimum voltage for v be ( q7 / 8 ) v be ( q3 / 4 ) and v ix5 is 0 . 75 volts and the minimum voltage for v zl is 0 . 25 volts , the minimum operating voltage is 2 . 5 volts , a substantial improvement over the conventional cell of fig2 which , as previously noted , requires 3 . 25 volts . fig6 is a modified cell which is the complement of the fig5 cell . the npn transistors are replaced with pnp transistors and the pnp transistors are replaced with npn transistors . in addition , the polarity of the supply voltage is reversed . the improvement in minimum operating voltage over the conventional fig2 circuit is the same as the fig5 circuit . as previously noted , fig7 is a conventional cell which does not include the emitter - follower configured output transistors q 7 and q 8 of the conventional fig2 circuit . instead , the output of the input differential stage is connected directly to the input of the output differential stage and directly to the output of the cell . although the drive capability of the fig7 cell is somewhat less than that of the fig2 and the speed is reduced , the operating voltage is lowered . as can be seen from inspection , the minimum operating voltage is as follows : assuming that the minimum voltage for v ce , v be and v ix is 0 . 75 volts and is 0 . 25 volts for v zl , the minimum operating voltage v min is 2 . 75 volts . that is substantially less than the 3 . 25 volts required by the conventional cell of fig2 but still further reduced operating voltages are desirable . fig8 is a still further modified cell which does not include the emitter - follower configured output transistors q 7 and q 8 of the improved cell of fig3 . instead , the output of the input differential stage is connected directly to the input of the output differential stage and directly to the output of the cell . although the drive capability of the fig8 cell is somewhat less than that of the fig4 cell and the speed is reduced , the operating voltage is further lowered . as can be seen from inspection , the minimum operating voltage is as follows : v min is the minimum operating voltage for the modified cell ; v ix is the minimum quiescent voltage across the current sources ; and v ce ( q9 / 10 ) is the minimum quiescent collector - emitter voltage for transistors q 9 / 10 ; and v be ( q11 / 12 ) is the minimum quiescent base - emitter voltage for transistors q 11 / 12 . assuming that the minimum voltage for v be , v ce and v ix is 0 . 75 volts , the minimum operating voltage v min is 2 . 25 volts . that is a further reduction of minimum required operating voltage of 2 . 75 volts for improved cell of fig3 . it should be noted that a similar reduction of minimum operating voltage can be achieved in the fig4 complementary cell by removing transistors q 7 and q 8 connecting the output of the input differential pair directly to the output of the cell and directly to the input of the output differential pair . fig9 is a still further modified cell which does not include the emitter - follower configured output transistors q 7 and q 8 of the improved cell of fig5 . instead , the output of the input differential stage is connected directly to the input of the output differential stage and directly to the output of the cell . although the drive capability of the fig9 cell is somewhat less than that of the fig5 and the speed is reduced , the operating voltage is further lowered . as can be seen from inspection , the minimum operating voltage is as follows : v min is the minimum operating voltage for the modified cell ; and v ix is the minimum quiescent voltage across the current sources ; and v ce ( q9 / 10 ) is the minimum quiescent collector - emitter voltage for transistors q 9 / 10 . assuming that v ix and v ce ( q9 / 10 ) are each 0 . 75 volts , the minimum operating voltage for the fig9 cell is 2 . 25 volts . that represents a significant further improvement over the minimum operating voltage of the fig5 cell of 2 . 5 volts . a similar improvement in minimum operating voltage can be achieved for the complementary circuit of fig6 by deleting transistors q 7 and q 8 and connecting the output of the input differential pair directly to the output of the cell and the input of the output differential pair . the minimum operating voltage of the fig1 multiplier can also be improved . referring to fig1 , a modified multiplier circuit is depicted . again , the multiplier is configured as a mixer or frequency converter where the output of a local oscillator v lo is combined with a radio frequency signal v rf to produce an intermediate frequency signal v if . the fig1 converter includes a first differential pair of npn transistors q 1 and q 2 and a second differential pair of npn transistors q 3 and q 4 which drive a common load z l . the base electrodes of transistors q 2 and q 3 form the positive input for the differential input signal v lo and the base electrodes transistors q 1 and q 4 form the negative input . the inputs for the radio frequency signal v rf are the base electrodes of a pair of differentially - connected pnp transistors q 8 and q 9 . a current source i x1 is coupled to the common emitter connection of transistors q 8 and q 9 . the collectors of transistors q 8 and q 9 are connected to the base / collector terminals of npn transistors q 10 and q 11 , respectively . transistors q 10 and q 11 are both connected as diodes . the fig1 circuit further includes an npn transistor q 5 having a collector connected to the common emitter junction of transistors q 1 and q 2 and a second npn transistor q 6 having a collector which is connected to the common emitter junction of transistors q 3 and q 4 . the emitters of transistors q 5 , q 6 , q 10 and q 11 are connected to the negative supply vee . transistors q 10 and q 5 function together as a current mirror as do transistors q 11 and q 6 . accordingly , as signal v rf varies the current in transistors q 10 and q 11 , the current is caused to vary in transistors q 10 and q 11 . due to the action of the current mirrors , current also changes in transistors q 5 and q 6 . this causes changes in the transconductance of the two differential pairs so that the gain of the two pair change in the same manner as the conventional converter of fig1 . the minimum operating voltage of the fig1 circuit can be determined by inspection and is as follows : assuming that v zl is 1 volt and v ce is 0 . 75 volts , the minimum operating voltage v min is 2 . 50 volts . the minimum operating voltage of the conventional fig1 circuit is 3 . 25 volts . fig1 is the complement of fig1 , with the npn transistors of fig1 being replaced by pnp transistors , the pnp transistors of fig1 being replaced by npn transistors . in addition , the polarity of the supplies is reversed . the improvement in minimum operating voltage over the conventional circuit of fig1 is the same as the circuit of fig1 . fig1 is a still further modified converter . the converter circuit includes two differential pairs having a common load z l . the first differential pair includes npn transistors q 1 and q 2 and the second pair includes npn transistors q 3 and q 4 . the positive v lo signal is connected to the bases of transistors q 1 and q 4 and the negative v . sub . signal is connected to the bases of transistors q 2 and q 3 . the q 1 / q 2 differential pair has a current source i x2 connected to the common emitter junction . the q 3 / q 4 . differential pair has a current source i x3 connected to the common emitter junction of transistors q 3 and q 4 . the v rf signal is coupled to the base electrodes of a differential pair of pnp transistors q 8 and q 9 . the common emitter connection of transistors q 8 s and q 9 is coupled to a current source i x1 having a magnitude set equal to that of sources i x2 and i x3 . the collectors of transistors q 8 and q 9 are connected to the output of current sources i x2 and i x3 , respectively . in operation , signal v rf causes transistors q 8 and q 9 to conduct varying amounts of current provided by source i x1 . this causes the current available to the input and output differential pair to vary in accordance with signal v rf . since the current required by sources i x2 and i x3 is fixed , any current provided to either current source by transistors q 8 and q 9 will be subtracted from that available to the associated input or output differential pair . for example , if signal v rf causes transistor q 8 to conduct more current and q 9 to conduct less current , the current provided to the q 1 / q 2 differential pair will decrease and that provided to the q 3 / q 4 pair will increase . this action causes the transconductance of the differential pair to change so that the circuit will function as a multiplier circuit . the minimum operating voltage for the circuit of fig1 can be determined by inspection and is as follows : v ix is the minimum quiescent voltage across the current sources . assuming that v zl is 1 volt and v ce and v ix are 0 . 75 volts , v min is 2 . 5 volts . as previously noted in connection with the conventional multiplier of fig1 the minimum operating voltage of that circuit is 3 . 25 volts . fig1 is the complement of the fig1 circuit . the pnp transistors are replaced with npn transistors and the npn transistors are replaced with voltages are reversed . the operation of the fig1 circuit is the same as that of the fig1 circuit and the improvement in minimum operating voltage is the same . thus , various embodiments of circuit employing differential transistor pairs having low voltage operating capabilities have been disclosed . although these embodiments have been described in some detail , it is to be understood that changes can be made without departing from the spirit and scope of the invention as defined by the appended claims . by way of example , the input signals have been depicted and described as differential signals , but such signals could also be single - ended signals . in that event , one of the inputs to a differential pair will receive the single - ended signal and the remaining input will be held at a . c . ground .	7
referring to fig2 a preferred embodiment of a semiconductor device ( soj package ) according to the present invention will be described in detail . in fig2 a plurality of land patterns ( not shown here ) including through holes ( not shown here ) and connection leads 23 are formed on the lower surface of a main substrate 21 . a plurality of solder ball pads 25 are formed on the upper surface of the main substrate 21 , and a plurality of solder balls 26 are formed on the sold ball pads 25 of the main substrate 21 . a semiconductor chip 22 is mounted on the center , for example , of the lower surface of the main substrate 21 with an adhesive 29 , and bonding pads ( not shown ) of the semiconductor chip 22 are bonded to the connection leads 23 via wires 24 and are molded with emc to form a package body 20 . here , the connection leads 23 electrically connect the through holes with the land patterns , and are electrically connected to the wires 24 . the above construction will be more clearly understood with reference to fig3 which is a partially cutaway plan view of fig2 . referring to fig3 the land pattern 27 and through hole 28 are formed in the lengthwise direction of the main substrate 21 to be commonly and electrically connected by the connection lead 23 . the package body 20 is provided at the end of the connection lead 23 in the lengthwise direction . fig4 is a vertical sectional view showing another embodiment of the semiconductor device according to the present invention . referring to fig4 the semiconductor device has at least one semiconductor chip 32 mounted on the lower surface of a printed circuit board ( hereinafter referred to as &# 34 ; pcb &# 34 ;) 31 by interposing an adhesive 39 . bonding pads ( not shown ) of the semiconductor chip 32 and electrode connection terminals 33 of the pcb 31 are bonded by means of wires 34 . a connection portion of the semiconductor chip 32 and wire 34 are encapsulated with a resin to form a package body 30 . in the above - described semiconductor device , the pcb 31 is mounted upside down during a final mounting process , and the terminals of the pcb 31 are connected to external terminals via through holes . also , at least one other semiconductor device is stacked on the upper surface of the pcb 31 . in this case , the respective semiconductor devices are connected to each other by interposed solder balls 36 , and mounted to other pcbs by means of leads 38 , which function as the external terminals , resulting in as stacked semiconductor device having a three - dimensional structure . when viewed from the reversed direction , a die pad portion of the semiconductor chip 32 on the upper surface of the pcb 31 , a wire bonding pad portion for connecting the semiconductor chip 32 to the terminals of the package , and a solder bump pad portion formed of the solder balls 36 are plated with nickel ( ni ) and gold ( au ) to a thickness of 5 μm and 0 . 5 μm , respectively , using copper foil as a base , so that the device reliability is improved during the wire bonding . the above - described construction will be more clearly understood with reference to fig5 which is a partially cutaway plan view of fig4 . referring to fig5 a land pattern 47 and a through hole 48 are formed in the lengthwise direction of the pcb 31 , and are commonly and electrically connected by connection lead 33 . the external terminal lead 38 is connected via the through hole 48 . the package body 30 is provided on the end of the connection lead 33 in the lengthwise direction . the lead 38 , which is the external terminal of the pcb 31 , is plated with copper ( cu ) or an alloy thereof . meanwhile , referring to fig6 ( which is an enlarged , partial sectional view of region a fig4 ), a solder ball pad 35 on which solder ball 36 is mounted is a metal - coated layer obtained by sequentially plating copper 42 , nickel 43 and gold 44 on the pcb 41 . a disc - shaped solder ball mounting portion 37 is provided on the upper portion of the thus metal - coated layer . the pcb 41 is made of a thermostable material , such as bismaleimidetriazine ( bt ) resin and thermostable epoxy . the surface of the nickel plating is coated with gold ( au ) 0 . 5 μm thick . fig7 and 8 are both plan views illustrating the upper and lower portions , respectively , of the semiconductor substrate used in the semiconductor device according to the present invention , prior to forming the land pattern . referring to fig7 a disc - shaped terminal portion 55 is provided on an upper portion of a pcb 51 to allow another like pcb to be connected thereto by means of a respective solder ball . referring to fig8 ring - shaped through holes 52 are formed to individually correspond to the disc - shaped terminal portions 55 . the broken - lined region 53 on the center of the pcb 51 in fig8 indicates a molding region where a molding body is generally formed . therefore , the upper / lower surfaces of the pcb 51 connected by the solder balls become conductive by means of the through holes or via holes , and an interlayer connection terminal ( not shown ) on the lower surface of the pcb 51 is electrically connected to the through hole 52 . also , a conductive portion and a through hole portion , except the portions which will be connected by means of the solder balls in succeeding processes , are coated with a solder - resist , respectively . the above - described soj package may be manufactured in the following process , described by way of example with reference to fig4 to 8 . as shown in fig7 and 8 , after a through hole 52 is formed in the center of both ends of the lower surface and upper surface of the main substrate 51 , in which the through hole 52 in the lower surface is shaped as a ring to allow the external connection leads to be connected thereto , and the upper surface connected to the through hole 52 is provided as a disc form . the land portion , including the through hole , is shaped as a ring by eliminating a conductive material portion from the center to facilitate alignment during stacking of the bga packages . the land portion of the opposite side is shaped as a disc to prevent melted solder from flowing toward the opposite side during reflow soldering performed after mounting the solder ball . then , as shown in fig6 copper ( cu ), nickel ( ni ) and gold ( au ) are sequentially plated , centering around the through hole 52 via the plating process to form the metal - coated layer . thereafter , as shown in fig4 the land pattern , connection lead and ball grid array are provided in a predetermined pattern configuration around the metal - coated layer formed on the lower and upper surfaces of the main substrate 31 via a patterning process , and the solder - resist is coated . using an adhesive 39 , the semiconductor chip 32 is mounted onto the center of the main substrate 31 and is bonded to the connection lead 33 by means of the wire 34 , and the package body 30 is thereafter formed . at this time , the semiconductor chip 32 is attached on the center of the main substrate 31 by using the conductive adhesive 39 on the die pad portion for attaching the semiconductor chip 32 . the adhesive is then hardened at a temperature of approximately 150 ° c . then , the bonding pads of the semiconductor chip 32 are connected to the external leads 38 of the main substrate 31 with a thin gold wire under a temperature of about 170 ° c . at a heater block . upon completing connection of the thin metal wire , the body molding is performed with the emc . the solder ball mounting , in which the interlayer connection via the solder ball is accomplished by the land pattern , is then performed . thus , the manufacturing of the bga package is completed by forming the solder ball 36 of a predetermined shape onto the solder ball pads 35 having through holes therein . fig9 is a vertical sectional view showing still another embodiment of the semiconductor device according to the present invention , which illustrates one preferred embodiment of the soj package mounted with the bga package in a three - dimensional structure . however , this bga package has some disadvantages because of the different configuration of the land patterns between the upper and lower surfaces of the pcb . the terminals on both sides of the main substrate are thus connected via the through holes as shown in fig5 . in addition , by making the lower surface of the main substrate turn up after the molding , flux is coated over the land portion , and the solder balls are mounted on the land portion . then , reflow soldering is carried out to form bumps , and respective packages , cut as a unit product , are employed . in the semiconductor device illustrated in fig9 a semiconductor chip is adhesively mounted onto the central surface of a main substrate 61 including through holes , connection leads and land patterns and the semiconductor chip is wire - bonded to the connection leads , so that a main package body 60 molded with the emc is mounted in the opposite direction . after this , a first semiconductor chip is adhesively mounted onto the center of the lower surface of a first substrate 71 including first through holes , first electrode connection terminals and first land patterns over the land pattern , and is wire - bonded to the first connection leads , so that a first package body 70 molded with emc is mounted in the opposite direction , using first solder balls 76 as a connecting medium . then , a second semiconductor chip is adhesively mounted onto the center of the lower surface of a second substrate 81 including external leads 88 , second through holes , second electrode connection terminals and second land patterns over the first land patterns and is then wire - bonded to the second connection leads , so that a second package body 80 molded with the emc is mounted in the opposite direction , using second solder balls 86 as a connecting medium . a third semiconductor chip is adhesively mounted onto the center of the lower surface of a third substrate 91 including third through holes , third electrode connection terminals and third land patterns over the second land pattern and is wire - bonded to the third electrode connection terminals , so that a third package body 90 molded with the emc is mounted in the opposite direction , using third solder balls 96 as a connecting medium . a stacked semiconductor device having a three - dimensional structure is therefore completed . the semiconductor device having the three - dimensional structure constructed as above has external terminal leads 88 which are bent to be shaped as either &# 34 ; j - lead &# 34 ; or &# 34 ; gull - wing &# 34 ; for surface mounting onto a main substrate ( not shown ). the external shape of the high - density , three - dimensional mounting package of the soj package . internally , the bga packages are stacked to realize the interlayer connection . in other words , a substrate with leads and a substrate without leads are separately assembled to allow the upper surface having been molded to face upward , and the land portions that will be connected to solder bumps are coated with flux . the substrates are stacked , with the substrate with external leads generally in the center , and subjected to reflow soldering to achieve the interlayer connection . at this time , when applied to a memory device , the manufacturing process thereof is performed by designing signal lines in such a manner that common terminals are commonly connected and separately constructed terminals are connected by means of separate signal terminals . consequently , after reflow soldering , the memory device is molded with an encapsulation resin centering the substrate with external leads , hardened at a temperature around 175 ° c . for about 5 hours , and subjected to cutting and bending procedures to have a suitable lead shape required for the subsequent mounting thereof , thereby completing all processes . the semiconductor device and manufacturing method thereof according to the present invention as described above can be usefully applied to the soj package capable of attaining the three - dimensional surface mounting , out of the scope of the conventional two - dimensional flat mounting of the bga package . furthermore , the present invention is compatible with the currently - available mounting process on a main substrate and also improves reliability of the semiconductor device . in addition , since the three - dimensional mounting structure for performing the interlayer connection using the bga package , the mounting efficiency is improved to thus manufacture a semiconductor device that lowers manufacturing cost and enables mass production . as a result , since the semiconductor device and manufacturing method therefor is achieved by the three - dimensional mounting structure which utilizes the bga package capable of being stacked on the inside of soj package , it will be understood by those skilled in the art that various changes in form and details may be effected therein without departing from the spirit and scope of the invention as defined by the appended claims .	7
the charge capacity of a battery cell is a value , usually expressed in ampere hours ( ah ) or milliampere hours ( mah ), that indicates the maximum electrical charge that the battery cell is capable of holding . new battery cells are manufactured with certain nominal charge capacities , but as the battery cells age , their charge capacities generally decrease . when charging a battery cell , care must be taken so that its voltage does not exceed some maximum design voltage . when discharging a battery cell , care must be taken so that its voltage does not go below some minimum design voltage . for many battery cell electrochemical compositions , an over - voltage condition is a potential safety issue , and can cause fire or explosion . an under - voltage condition , while not a safety concern , can cause the battery cell to develop permanent degradation in charge capacity . battery packs are often made by connecting individual battery cells in series to obtain higher total voltage and higher total energy storage capacity . one consequence of individual battery cells connected in series is that all battery cells so connected will experience the same electrical current and the number of ampere - hours added or subtracted from each individual battery cell charge level will be the same . however , since the battery cells will have different individual charge capacities , one or more battery cells may limit the battery pack total energy capacity . a battery cell having lower charge capacity than others in the battery pack is more quickly charged to the maximum design voltage , and is more quickly discharged to the minimum design voltage . therefore , to maintain battery pack safety , not all battery cells will be fully charged when the battery cell having lowest charge capacity is fully charged , or not all battery cells will be fully discharged when the battery cell having lowest charge capacity is fully discharged . not all of the possible energy capacity of the battery pack will be realized unless all charge capacities are identical and the pack is perfectly balanced . at some point , a battery pack may be capable of higher total energy capacity if one or more of the battery cells having low charge capacity are removed from the pack so that they no longer limit the range of charge of the other battery cells . in some applications , these battery cells might be replaced with new battery cells . in other applications , that might not be practical , so the battery controller could then allow those battery cells to be abandoned . abandoning a battery cell means that that particular battery cell is ignored for the purposes of computing which battery cells to equalize , when determining maximum discharge power or energy , and when controlling the battery pack charging process ( except inasmuch as safety issues are necessary to consider ). that is , the lower voltage of these battery cells would no longer be restricted by the minimum design voltage during a discharge , and the battery cells &# 39 ; charge capacities would be allowed to collapse to zero ( a short - circuit condition ). this is a safe operating condition , and can result in higher overall battery pack energy capacity . therefore , in some applications it may be desirable to determine battery pack configurations that optimize the battery pack total energy capacity , possibly abandoning battery cells having low charge capacity . however , while abandoning a battery cell in this manner can result in higher overall battery pack energy capacity , it will also place greater stresses on the remaining battery cells in the battery pack , since they must provide greater power levels per battery cell than they did before . therefore , in other applications it may be desirable to optimize a different battery pack total energy metric that takes into account the battery pack total energy capacity and stress factors on remaining battery cells when some battery cells are abandoned . accordingly , there is a need for a method for efficiently determining a battery pack configuration based on present battery cell charge capacities that maximizes a battery pack total energy metric . in some applications , this battery pack total energy metric may be equal to battery pack total energy ; in other applications it may be equal to a modified function involving battery pack total energy . in every application , the goal is to maximize battery pack performance . to describe how the present embodiments determine which battery cells are limiting battery pack performance , the battery cell state - of - charge ( soc ) is first defined , which is a value between 0 % and 100 % that indicates the relative level of charge held by the battery cell . a state - of - charge of 100 % corresponds to a “ full ” battery cell , while a state - of - charge of 0 % corresponds to an “ empty ” battery cell . knowing this , the total energy capacity ( in watt hours ) of an individual battery cell can be computed as where v ( t ) is the battery cell voltage at time t , i ( t ) is battery cell current at time t , c is the charge capacity of the battery cell ( in ampere hours ), z 1 is the lower design limit soc value of the battery cell , z 2 is the upper design limit soc of the battery cell , and ocv ( ) is the open - circuit - voltage of the battery cell ( in volts ) as a function of soc . ( the second line of this equation relies on the relationship dz / dt = i ( t )/ c .) to compute battery cell energy , the battery cell charge capacity must be known , and the battery cell open - circuit - voltage function must be known . the battery cell open - circuit - voltage function is determined by the battery cell electrochemistry and may be measured using standard laboratory tests . additionally , it may be stored in a table in pre - integrated form in order to quickly look - up the desired values . battery pack energy capacity can be computed in a similar way . equation ( 2 ) recognizes that the charge capacities of each battery cell will be different , so denotes individual charge capacity values as c k where k is the index of the battery cell , from 1 to the number of battery cells in series . at any point in time , the voltages and states - of - charge of each battery cell will also differ , so are individually denoted as v k ( t ) and z k ( t ), respectively . the upper and lower limits on soc will also differ , so are denoted as z 2 , k and z 1 , k , respectively . battery pack total energy capacity will be maximized when all z 2 , k values are identical , since the open - circuit - voltage is an increasing function of soc . therefore , it is assumed that z 2 , k = z 2 for all k . ( this is not a requirement for the present invention , but makes the discussion simpler .) as the battery pack is discharged , the minimum z 1 , k may not go lower than z 1 . if all battery cells begin at soc level z 2 , the first battery cell to reach the soc level z 1 will be the battery cell with lowest charge capacity . without loss of generality , assume that battery cells are sorted by index in terms of increasing charge capacity . that is , c 1 ≦ c 2 ≦ c 3 . therefore , it is concluded that z 1 , 1 = z 1 . the lower soc limit for all other battery cells can be calculated by recognizing that the number of ampere - hours discharged from the battery cell with lowest charge capacity must be identical to the number of ampere - hours discharged from all other battery cells . therefore , there is now the capability of calculating the total energy capacity of a series - connected battery pack : 1 ) receive battery cell charge capacity estimates c k for all cells ; 2 ) determine the battery cell with lowest charge capacity , and label it as cell 1 ; 3 ) compute all z 1 , k values using equation ( 3 ); and knowing how to compute battery pack total energy allows for the embodiment using a method for maximizing a battery pack total energy metric . an exemplary embodiment receives battery cell charge capacity estimates c k for all cells , computes a battery pack total energy metric for hypothetical battery packs comprising subsets of the full set of battery cells , and selects the configuration having the largest battery pack total energy metric . in one exemplary embodiment , the battery pack total energy metric is selected to equal the battery pack total energy . the following steps are performed : 2 ) sort battery cell charge capacities in ascending order , indexed from 1 to n , where n is the number of battery cells . that is , c 1 ≦ c 2 ≦ l ≦ c n . 3 ) define battery pack configuration p k to comprise battery cells k through n . that is , p 1 comprises all battery cells , p 2 comprises all battery cells except the one with lowest charge capacity , and so forth . 4 ) compute the battery pack total energy e k using battery pack configuration p k . 5 ) select battery pack configuration with maximum value of e k . battery cells not included in this configuration are abandoned . fig4 shows results for this exemplary embodiment for a battery pack comprising 50 battery cells ( a lithium - ion battery chemistry is assumed for the ocv function , but the method works for any battery chemistry ). forty - eight of these cells have a capacity of 10 ampere hours , and two of the cells have a capacity of 9 . 5 ampere hours . in this example , the battery pack total energy is maximized if the two low - capacity battery cells are abandoned , and the pack is assumed to operate using only the remaining forty - eight battery cells . battery pack total energy might not be the only metric that is desired to be optimized . for example , by abandoning certain battery cells , greater stress is put on the remaining battery cells in the pack , potentially decreasing their lifetimes . an alternate embodiment optimizes a different battery pack total energy metric . the method receives battery cell charge capacity estimates c k for all battery cells , computes a different battery pack total energy metric me k for a hypothetical battery pack comprising subsets of the full set of battery cells , and selects the configuration having the largest modified battery pack total energy metric . 2 ) sort battery cell charge capacities in ascending order , indexed from 1 to n , where n is the number of battery cells . that is , c 1 ≦ c 2 ≦ l ≦ c n . 3 ) define battery pack configuration p k to comprise battery cells k through n . that is , p 1 comprises all battery cells , p 2 comprises all battery cells except the one with lowest charge capacity , and so forth . 4 ) compute the battery pack total energy metric me k using battery pack configuration p k . 5 ) select battery pack configuration with maximum value of me k . battery cells not included in this configuration are abandoned . fig5 shows results for this exemplary embodiment for a battery pack comprising 50 battery cells ( a lithium - ion battery chemistry is assumed for the ocv function , but the method works for any battery chemistry ). forty - eight of these battery cells have a capacity of 10 ampere hours , and two of the battery cells have a capacity of 9 . 5 ampere hours . the battery pack total energy metric in this exemplary embodiment is me k = 0 . 99 k e k . this performance metric penalizes removing cells , such that they will be abandoned only if it significantly increases the battery pack total energy . in the figure , the unmodified energy function e k is plotted as triangles , and the modified energy function me k is plotted as circles . in this example , the modified battery pack total energy is maximized by retaining all of the fifty battery cells and abandoning none of the battery cells . the system and method for maximizing a battery pack total energy metric provides a substantial advantage over other systems and methods . in particular , the system and method provide a technical effect of accurately determining an optimal battery pack configuration that maximizes a battery pack total energy metric that is computationally efficient to compute , and can take into account battery cell lifetime stresses while maximizing battery pack total energy . the above - described methods can be embodied in the form of computer program code containing instructions embodied in tangible media , such as floppy diskettes , cd roms , hard drives , or any other computer - readable storage medium , wherein , when the computer program code is loaded into and executed by a computer , the computer becomes an apparatus for practicing the invention . the above - described methods can also be embodied in the form of computer program code , for example , whether stored in a storage medium , loaded into and / or executed by a computer , or transmitted over some transmission medium , loaded into and / or executed by a computer , or transmitted over some transmission medium , such as over electrical wiring or cabling , through fiber optics , or via electromagnetic radiation , wherein , when the computer program code is loaded into an executed by a computer , the computer becomes an apparatus for practicing the methods . when implemented on a general - purpose microprocessor , the computer program code segments configure the microprocessor to create specific logic circuits . while the invention is described with reference to exemplary embodiments , it will be understood by those skilled in the art that various changes may be made and equivalent elements may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to the teachings of the invention to adapt to a particular situation without departing from the scope thereof . therefore , it is intended that the invention not be limited to the embodiments disclosed herein , but that the invention include all embodiments falling with the scope of the appended claims .	6
in order to explain the game , the playing grid , the pieces and the strategic elements of game play , it will be helpful to define the terminology that will be used herein . these terms will help one understand the features shown in the drawings . point : refers to the intersection of four or eight lines on the game board ; upon which a piece may rest . four - point : refers to the intersection of four diagonal lines on the game board . eight - point : refers to the intersection of eight lines ( four horizontal / vertical and four diagonal ) on the game board . base : one of five special points on the game board that is marked with any special symbol such as a darkened or bold plus (+) sign formed by the intersecting lines . territory : a defined region on the game board , denoted by darkened or bold lines , shading , coloration , or some other means . border - point : any point on the board that is part of a line marking the border between two territories . move : refers to one legal movement of a piece on the game board . turn : refers to one player &# 39 ; s total number of moves allowed before another player is allowed to move . a player may at times during the game have multiple moves per turn . movement number : refers to the maximum number of points that a given piece may move ( without capturing another piece ) during a player &# 39 ; s turn . attack number : refers to the maximum number of points away that a given piece may attack and capture another piece during a player &# 39 ; s turn . block / blocking direction : refers to any one of the faces on a given piece from which direction that piece cannot be captured by another piece . markings upon the piece to denote the blocking faces could be made with any convenient symbol such as stylized armor , a stylized brick shape , a solid color , or any other designation intended to aid the memory while playing . not block - able : a special property of a specific piece that allows that piece to capture other pieces regardless of their blocking directions . turning now to the drawings and referring initially to fig1 , fig1 is a diagrammatic illustration of an exemplary embodiment of a playing grid for a 2 player game of the present disclosure . depending on the specific embodiment of the game , grid 100 may be depicted on a wood or cardboard playing surface , for example , or on plastic or cloth surfaces , which are particularly advantageous for travel versions of the game . alternatively , grid 100 may be depicted on an electronic screen , including touch screens , for electronic embodiments . the standard two - player game board is a nine - by - nine grid of lines 100 , with each of the 64 resultant squares bisected by forty - five degree diagonal lines . the resulting network consists of 145 intersections — called points — upon which the game pieces may rest . preferred embodiments for both the 2 player and 4 - player grids provide alphanumeric coordinates along x - axis 102 and the y - axis 104 of the grid 100 layout . each territory contains one base . pieces may rest on any of the 145 board points , including the darkened edges of the board and the darkened border - points between territories . grid 100 is subdivided by straight lines that intersect at right angles and at 45 ° degree angles to make points . types of points include four - points 130 with 4 lines radiating from them , eight - points 140 with 8 lines radiating from them , border - points 150 , 152 , edge points 160 and bases . five specific points on the game board are called bases and marked in this case with a darkened (+). five regions called territories are denoted on the board by darkened lines . during game play , the player whose turn it is declares which territory the piece he or she intends to move is moving from . a piece on a border - point 150 may be declared to be in either territory of the border . a base is considered to be controlled or owned by a player when that player has a game piece of his or her color resting directly on the base point ( in this case marked with a darkened +). each player begins the game with the ownership of one base . a player must own at least one base to remain in the game . any player that at the start of his or her turn does not own at least one base is eliminated from the game . five bases 110 , 112 , 114 , 116 , 118 , are disposed around the grid . each base is in one territory and each territory 120 , 122 , 124 , 126 , 128 has one base . fig2 is a diagrammatic illustration of an exemplary embodiment of a playing grid for a 4 player game of the present disclosure . the four - player grid 200 is identical in layout to the two - player grid 100 , but is larger in proportion . instead of based on a nine - by - nine line grid , the four - player board is based on an eleven - by - eleven grid . the four - player board contains a total of 221 points but has the same five bases 210 , 212 , 214 , 216 , 218 and territories 220 , 222 , 224 , 226 , 228 . fig3 a is a side view schematic illustration of an exemplary embodiment of a scout piece of a game of the present disclosure . typical of a specific embodiment of a game piece , scout piece 300 has a footer 310 , upon which is mounted a figurine 320 . to more easily distinguish the types of game pieces , each figurine has a particular distinctive design . fig3 b is top view schematic illustration of the scout piece of fig3 a . features and attributes of a scout piece are displayed on the footer 310 . footer 310 , like the footers of the other pieces , has an octagonal perimeter shape with 8 sides or “ faces .” stylized arrowhead pointer 312 is a directional indicator which indicates the direction in which the piece is facing . the face of piece 300 to which the pointer 312 points is sometimes referred to as the “ front ” of the piece or “ front - facing .” as described herein , in specific embodiments , the attributes of the types of pieces are manifest on each piece , usually by printed or electronic display on the footer . alternative embodiments for experienced players , for example , dispense with the explicit manifestation of the piece attributes because the attributes are implicit in the shape of the figurine . stylized blocking brick 314 indicates the face at which an attack by an opposing player &# 39 ; s piece is blocked . piece identifier 315 indicates that the piece is a scout and therefore has the attributes of a scout . among the attributes of a scout piece is the movement number 318 , which is the number of points it is allowed to move and the attack number 316 , which is the number of points it may move to attack an opponent &# 39 ; s piece . in the case of a scout piece , a scout may move a maximum of 4 points and may attack an opponent &# 39 ; s piece that is 1 point away . fig4 a is a side view schematic illustration of an exemplary embodiment of a fighter piece of a game of the present disclosure . footer 410 of fighter 400 has affixed on top of it figurine 420 , which has a distinctive shape so that a fighter piece can be visually distinguished from the other types of pieces . fig4 b is top view schematic illustration of the fighter piece of fig4 a . directional indicator 412 , piece type indicator 415 , and attributes movement number 418 and attack number 416 are displayed on footer 410 . among the other attributes of a fighter 400 are blocking faces 414 a , 414 b , and 414 c , also displayed . fig5 a is a side view schematic illustration of an exemplary embodiment of a defender piece of a game of the present disclosure . footer 510 of defender 500 has affixed on top of it figurine 420 , which has a distinctive shape so that a defender piece can be visually distinguished from the other types of pieces . fig5 b is top view schematic illustration of the defender piece of fig5 a . directional indicator 512 , piece type indicator 515 , and attributes movement number 518 and attack number 516 are displayed on footer 510 . among the other attributes of a fighter 400 are blocking faces 514 a , 514 b , 514 c , 514 d , and 514 d , also displayed . fig6 a is a side view schematic illustration of an exemplary embodiment of a juggernaut piece of a game of the present disclosure . footer 610 of juggernaut 600 has affixed on top of it figurine 620 , which has a distinctive shape so that a juggernaut piece can be visually distinguished from the other types of pieces . fig6 b is top view schematic illustration of the juggernaut piece of fig6 a . directional indicator 612 , piece type indicator 515 , and attributes movement number and attack number 517 are displayed on footer 510 . the juggernaut piece has unlimited movement and unlimited attack numbers , indicated by the x - x designation . among the other attributes of a juggernaut 600 are blocking faces 614 a , and 614 b , also displayed . fig7 is a diagrammatic illustration of an exemplary embodiment of a game set up for a 2 person game of the present disclosure . game play involves a set of pieces , referred to herein as an army , of one player against an army of pieces of one or more opposing player attempting to eliminate all the bases of the opposing player ( s ). accordingly , preliminary to beginning game play , the pieces of each army are arranged on their assigned starting positions on the grid 100 . each army occupies one territory and owns one base . player 1 &# 39 ; s army 710 is arranged in territory 120 and controls base 110 . player 2 &# 39 ; s army 720 is arranged in territory 124 and controls base 114 . the pieces of each army are distinguished from the pieces of other armies by some convenient indicia such as color . fig8 is a diagrammatic annotated illustration of an exemplary embodiment of a game set up for a 4 person game of the present disclosure . the armies for player 1 and player 2 are set out as described for the two player game ( see fig7 ). player 3 &# 39 ; s army is arranged in territory 222 and controls base 212 . player 4 &# 39 ; s army is arranged in territory 226 and controls base 216 . in preferred embodiments , territory 228 is left vacant and base 218 in territory 228 is left unoccupied in both the 2 player and 4 player games . fig9 is a diagrammatic annotated illustration of game piece attributes of an exemplary embodiment of a game of the present disclosure . a portion of an exemplary embodiment of a game board of the present disclosure is depicted , with center base 118 of territory 228 in the upper left and base 114 of territory 224 in the lower right . border 910 / 912 is represented by bold lines . scout game pieces 310 a , 310 b and 310 c are deployed about points on the board . fighter piece 410 of an opposing player &# 39 ; s army is located on a point in territory 224 facing 412 scout 310 a . a fighter piece has the movement number attribute of 3 and the attack number attribute of 3 as well , therefore it can move 3 up to three points and capture a piece that is up to 3 points away ( counting the point the captured piece is resting on ). scout 310 a is safe from attack by fighter 410 because it is more than 3 points away . scout 310 b , however , can be captured and removed from the board by fighter 410 , so that fighter 410 occupies the point presently occupied by scout 310 b , because scout 310 b is within 3 points of fighter 410 . although scout 310 c is within 3 points of fighter 410 , scout 310 c is safe because its face 312 in line with fighter 410 is a blocking face 314 . it will be understood that the movement and attack attributes of the types of game pieces are displayed on the footer of each piece to assist those who are learning the game and to serve as a convenient reminder to players of the movement and attack numbers of each type of piece . however , as players become familiar with the attributes of each type of piece , the display will become less important . over time , alternative embodiments or versions of the game in which the pieces do not display the attributes will appear because , like chess pieces , players will be so familiar with the attributes that the attributes become second nature . specific alternative embodiments provide a printed legend of the attributes to which a player can refer in cases where the pieces themselves do not display the attributes . for example , versions of the game provide a printed legend on the game board and other versions provide a legend in a printed instruction booklet of the rules of the game . all pieces move in straight lines from one point to another point on the grid . the front facing direction of a piece has no relation to the allowed directions that piece may move — all pieces may move in any direction that is not directly blocked by another piece . all pieces may move up to the allowed maximum movement number for that piece type , unless directly blocked by another piece . the moving of pieces changes their facing on the game board . the facing of a piece is determined by the last direction that the piece moved . the arrow ( e . g ., reference number 312 of fig3 ) on the game piece ( which is to say the front - facing of the game piece ) always faces away from the last point on which the piece was resting . 1 . pieces may move any number of points up to the maximum for that piece type . 2 . pieces must move in a straight line , with no changing direction mid - move . 3 . pieces may not move through , over , or around other pieces that occupy points on the line they are traversing . 4 . a piece may move between two other pieces , so long as there is a visible line on the board between the starting point and the ending point . 5 . pieces may not change facing ( rotate in place ) without moving . 6 . except for attack ( capturing ), pieces may not move to a point on the board that is already occupied by another piece . attack is a special type of movement that allows one player to take another player &# 39 ; s piece off the board , by placing one of his or her own pieces on the point that the eliminated piece previously occupied . attack moves follow all the same rules as movement moves , with the exception that one piece may occupy the point upon which a different player &# 39 ; s piece currently rests . the attack number for the various piece types is different and usually smaller than the movement number . this means that a piece may move a certain number of points without capturing a piece , but may only capture a piece by moving within a different maximum number . in addition , one piece may only capture another piece if the line on which the first piece will move is not protected by one of the second piece &# 39 ; s blocking directions . 1 . pieces may capture other pieces any number of points away , up to the maximum attack number for that piece type . 2 . pieces must attack in a straight line , with no change of direction mid - move . 3 . pieces may not attack through , over , or around other pieces that occupy points on the line they are traversing . 4 . a piece may attack between two other pieces , so long as there is a visible line on the board between the starting point and the ending piece . 5 . pieces may not attack other pieces which have a blocking face in the direction of the attacking piece — except juggernaut pieces , which ignore all blocking faces when attacking . 1 ) player counts his or her bases to determine how many moves are allowed this turn . 3 ) player declares which territory the piece is moving from , so that all other players may hear . 5 ) the player repeats the declaration and movement , without moving one piece more than once , and without moving more than one piece per territory , and without violating any other rules of movement or attack , until all allowed moves have been finished . a player wins the game by being the last player in the game that owns one or more bases . a player loses the game if at the start of his or her turn , the player owns zero bases . if the player is unable to make a legal move for three consecutive turns , that player loses . if a player moves the same piece between the exact same two points for three consecutive turns ( while the other player ( s ) are able to make different moves ), that player loses . 2 ) all players in the game repeat the exact same move , with the exact same piece , between the exact same two points on the board , for three consecutive turns . 3 ) no player in the game is able to make a legal move . the following system of symbolic coordinate notation ( see fig1 ) may be used to record and replay games . the notation system could also be used to exchange moves in order to play games in real time with or without any game board or set — for example blindfolded games where moves are exchanged verbally , games by postal mail with moves exchanged in writing , games by email , or games played by any other means of relaying text verbally , electronically , or in writing . the following example outlines the general coordinate notation system , symbolic conventions , and examples of usage . the same system and conventions apply for both 2 - player and 4 - player games . sample game record demonstrating notation system the following game record shows 5 turns of an example game between two players . for four player games , an additional column is added for each additional player . the game is described herein without concern for the medium in which the components of the game are manifest . specific embodiments provide a physical playing grid with tangible playing pieces . alternative embodiments are adapted for play with an electronic device and provide a virtual playing environment wherein a virtual playing grid and virtual pieces are displayed electronically on a screen . a user interface may be provided for game play . examples of suitable user interfaces for electronic embodiments include but are not limited to interactive touch screens , keyboards , computer mice , virtual keyboards , voice recognition technologies and so forth . accordingly , for adaptation of the game to electronic embodiments , the present disclosure provides programs stored on machine readable media to operate computers and electronic devices according to the principles of the present disclosure to encode the rules of the game and to display the board and pieces . machine readable media include , but are not limited to , magnetic storage medium ( e . g ., hard disk drives , floppy disks , tape , etc . ), optical storage ( cd - roms , optical disks , etc . ), and volatile and non - volatile memory devices ( e . g ., eeproms , roms , proms , rams , drams , srams , firmware , programmable logic , thumb drives , downloadable files , etc .). furthermore , machine readable media include transmission media ( network transmission line , wireless transmission media , signals propagating through space , radio waves , infrared signals , etc .) and server memories . moreover , machine readable media includes many other types of memory too numerous for practical listing herein , existing and future types of media incorporating similar functionally as incorporate in the foregoing exemplary types of machine readable media , and any combinations thereof . the programs and applications stored on the machine readable media in turn include one or more machine executable instructions which are read by the various devices and executed . each of these instructions causes the executing device to perform the functions coded or otherwise documented in it . of course , the programs can take many different forms such as applications , for certain mobile devices applications that are known colloquially as “ apps ,” operating systems , perl scripts , java applets , c programs , compile - able ( or compiled ) programs , interpretable ( or interpreted ) programs , natural language programs , assembly language programs , higher order programs , embedded programs , and many other existing and future forms which provide similar functionality as the foregoing examples , and any combinations thereof . many modifications and other embodiments of the game , pieces , and playing apparatus described herein will come to mind to one skilled in the art to which this disclosure pertains having the benefit of the teachings presented in the foregoing descriptions and the associated drawings . therefore , it is to be understood that the disclosure is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims . although specific terms are employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation .	0
the present invention will preferably utilize microfabricated catheters for intravascular injection . the following description and fig1 - 8 provide three representative embodiments of catheters having microneedles suitable for the delivery of a neuromodulating agent into a perivascular space or adventitial tissue . a more complete description of the catheters and methods for their fabrication is provided in u . s . pat . nos . 7 , 141 , 041 ; 6 , 547 , 803 ; 7 , 547 , 294 ; 7 , 666 , 163 and 7 , 691 , 080 , the full disclosures of which have been incorporated herein by reference . the present invention describes methods and kits useful for the delivery of neuromodulating agents into the adventitia around renal arteries in order to reduce blood pressure in the treatment of hypertension . in each kit , a delivery catheter may be combined with instructions for use and a therapeutically effective amount of a neuromodulating agent as defined above . as shown in fig1 a - 2b , a microfabricated intraluminal catheter 10 includes an actuator 12 having an actuator body 12 a and central longitudinal axis 12 b . the actuator body more or less forms a u - shaped or c - shaped outline having an opening or slit 12 d extending substantially along its length . a microneedle 14 is located within the actuator body , as discussed in more detail below , when the actuator is in its unactuated condition ( furled state ) ( fig1 b ). the microneedle is moved outside the actuator body when the actuator is operated to be in its actuated condition ( unfurled state ) ( fig2 b ). the actuator may be capped at its proximal end 12 e and distal end 12 f by a lead end 16 and a tip end 18 , respectively , of a therapeutic catheter 20 . the catheter tip end serves as a means of locating the actuator inside a body lumen by use of a radio opaque coatings or markers . the catheter tip also forms a seal at the distal end 12 f of the actuator . the lead end of the catheter provides the necessary interconnects ( fluidic , mechanical , electrical or optical ) at the proximal end 12 e of the actuator . retaining rings 22 a and 22 b are located at the distal and proximal ends , respectively , of the actuator . the catheter tip is joined to the retaining ring 22 a , while the catheter lead is joined to retaining ring 22 b . the retaining rings are made of a thin , on the order of 10 to 100 microns ( μm ), substantially flexible but relatively non - distensible material , such as parylene ( types c , d or n ), or a metal , for example , aluminum , stainless steel , gold , titanium or tungsten . the retaining rings form a flexible but relatively non - distensible substantially “ u ”- shaped or “ c ”- shaped structure at each end of the actuator . the catheter may be joined to the retaining rings by , for example , a butt - weld , an ultra sonic weld , integral polymer encapsulation or an adhesive such as an epoxy or cyanoacrylate . the actuator body further comprises a central , expandable section 24 located between retaining rings 22 a and 22 b . the expandable section 24 includes an interior open area 26 for rapid expansion when an activating fluid is supplied to that area . the central section 24 is made of a thin , semi - flexible but relatively non - distensible or flexible but relatively non - distensible , expandable material , such as a polymer , for instance , parylene ( types c , d or n ), silicone , polyurethane or polyimide . the central section 24 , upon actuation , is expandable somewhat like a balloon - device . the central section is capable of withstanding pressures of up to about 200 psi upon application of the activating fluid to the open area 26 . the material from which the central section is made of is flexible but relatively non - distensible or semi - flexible but relatively non - distensible in that the central section returns substantially to its original configuration and orientation ( the unactuated condition ) when the activating fluid is removed from the open area 26 . thus , in this sense , the central section is very much unlike a balloon which has no inherently stable structure . the open area 26 of the actuator is connected to a delivery conduit , tube or fluid pathway 28 that extends from the catheter &# 39 ; s lead end to the actuator &# 39 ; s proximal end . the activating fluid is supplied to the open area via the delivery tube . the delivery tube may be constructed of teflon © or other inert plastics . the activating fluid may be a saline solution or a radio - opaque dye . the microneedle 14 may be located approximately in the middle of the central section 24 . however , as discussed below , this is not necessary , especially when multiple microneedles are used . the microneedle is affixed to an exterior surface 24 a of the central section . the microneedle is affixed to the surface 24 a by an adhesive , such as cyanoacrylate . alternatively , the microneedle maybe joined to the surface 24 a by a metallic or polymer mesh - like structure 30 ( see fig2 a ), which is itself affixed to the surface 24 a by an adhesive . the mesh - like structure may be - made of , for instance , steel or nylon . the microneedle includes a sharp tip 14 a and a shaft 14 b . the microneedle tip can provide an insertion edge or point . the shaft 14 b can be hollow and the tip can have an outlet port 14 c , permitting the injection of a neuromodulating or drug into a patient . the microneedle , however , does not need to be hollow , as it may be configured like a neural probe to accomplish other tasks . as shown , the microneedle extends approximately perpendicularly from surface 24 a . thus , as described , the microneedle will move substantially perpendicularly to an axis of a lumen into which has been inserted , to allow direct puncture or breach of body lumen walls . the microneedle further includes a neuromodulating or drug supply conduit , tube or fluid pathway 14 d which places the microneedle in fluid communication with the appropriate fluid interconnect at the catheter lead end . this supply tube may be formed integrally with the shaft 14 b , or it may be formed as a separate piece that is later joined to the shaft by , for example , an adhesive such as an epoxy . the microneedle 14 may be bonded to the supply tube with , for example , an adhesive such as cyanoacrylate . the needle 14 may be a 30 - gauge , or smaller , steel needle . alternatively , the microneedle may be microfabricated from polymers , other metals , metal alloys or semiconductor materials . the needle , for example , may be made of parylene , silicon or glass . microneedles and methods of fabrication are described in u . s . application ser . no . 09 / 877 , 653 , filed jun . 8 , 2001 , entitled “ microfabricated surgical device ”, the entire disclosure of which is incorporated herein by reference . the catheter 20 , in use , is inserted through an opening in the body ( e . g . for bronchial or sinus treatment ) or through a percutaneous puncture site ( e . g . for artery or venous treatment ) and moved within a patient &# 39 ; s body passageways 32 , until a specific , targeted region 34 is reached ( see fig3 ). the targeted region 34 may be the site of tissue damage or more usually will be adjacent the sites typically being within 100 mm or less to allow migration of the therapeutic or diagnostic agent . as is well known in catheter - based interventional procedures , the catheter 20 may follow a guide wire 36 that has previously been inserted into the patient . optionally , the catheter 20 may also follow the path of a previously - inserted guide catheter ( not shown ) that encompasses the guide wire . during maneuvering of the catheter 20 , well - known methods of x - ray fluoroscopy or magnetic resonance imaging ( mri ) can be used to image the catheter and assist in positioning the actuator 12 and the microneedle 14 at the target region . as the catheter is guided inside the patient &# 39 ; s body , the microneedle remains furled or held inside the actuator body so that no trauma is caused to the body lumen walls . after being positioned at the target region 34 , movement of the catheter is terminated and the activating fluid is supplied to the open area 26 of the actuator , causing the expandable section 24 to rapidly unfurl , moving the microneedle 14 in a substantially perpendicular direction , relative to the longitudinal central axis 12 b of the actuator body 12 a , to puncture a body lumen wall 32 a . it may take only between approximately 100 milliseconds and five seconds for the microneedle to move from its furled state to its unfurled state . the microneedle aperture , may be designed to enter body lumen tissue 32 b as well as the adventitia , media , or intima surrounding body lumens . additionally , since the actuator is “ parked ” or stopped prior to actuation , more precise placement and control over penetration of the body lumen wall are obtained . after actuation of the microneedle and delivery of the agents to the target region via the microneedle , the activating fluid is exhausted from the open area 26 of the actuator , causing the expandable section 24 to return to its original , furled state . this also causes the microneedle to be withdrawn from the body lumen wall . the microneedle , being withdrawn , is once again sheathed by the actuator . various microfabricated devices can be integrated into the needle , actuator and catheter for metering flows , capturing samples of biological tissue , and measuring ph . the device 10 , for instance , could include electrical sensors for measuring the flow through the microneedle as well as the ph of the neuromodulating being deployed . the device 10 could also include an intravascular ultrasonic sensor ( ivus ) for locating vessel walls , and fiber optics , as is well known in the art , for viewing the target region . for such complete systems , high integrity electrical , mechanical and fluid connections are provided to transfer power , energy , and neuromodulatings or biological agents with reliability . by way of example , the microneedle may have an overall length of between about 200 and 3 , 000 microns ( μm ). the interior cross - sectional dimension of the shaft 14 b and supply tube 14 d may be on the order of 20 to 250 um , while the tube &# 39 ; s and shaft &# 39 ; s exterior cross - sectional dimension may be between about 100 and 500 μm . the overall length of the actuator body may be between about 5 and 50 millimeters ( mm ), while the exterior and interior cross - sectional dimensions of the actuator body can be between about 0 . 4 and 4 mm , and 0 . 5 and 5 mm , respectively . the gap or slit through which the central section of the actuator unfurls may have a length of about 4 - 40 mm , and a cross - sectional dimension of about 50 μm to 4 mm . the diameter of the delivery tube for the activating fluid may be between 100 and 500 μm . the catheter size may be between 1 . 5 and 15 french ( fr ). referring to fig4 a - 4d , an elastomeric component is integrated into the wall of the intraluminal catheter of fig1 - 3 . in fig4 a - d , the progressive pressurization of such a structure is displayed in order of increasing pressure . in fig4 a , the balloon is placed within a body lumen l . the lumen wall w divides the lumen from periluminal tissue t , or adventitia a , depending on the anatomy of the particular lumen . the pressure is neutral , and the non - distensible structure forms a u - shaped involuted balloon 12 similar to that in fig1 in which a needle 14 is sheathed . while a needle is displayed in this diagram , other working elements including cutting blades , laser or fiber optic tips , radiofrequency transmitters , or other structures could be substituted for the needle . for all such structures , however , the elastomeric patch 400 will usually be disposed on the opposite side of the involuted balloon 12 from the needle 14 . actuation of the balloon 12 occurs with positive pressurization . in fig4 b , pressure (+ δp 1 ) is added , which begins to deform the flexible but relatively non - distensible structure , causing the balloon involution to begin its reversal toward the lower energy state of a round pressure vessel . at higher pressure + δp 2 in fig4 c , the flexible but relatively non - distensible balloon material has reached its rounded shape and the elastomeric patch has begun to stretch . finally , in fig4 d at still higher pressure + δp 3 , the elastomeric patch has stretched out to accommodate the full lumen diameter , providing an opposing force to the needle tip and sliding the needle through the lumen wall and into the adventitia a . typical dimensions for the body lumens contemplated in this figure are between 0 . 1 mm and 50 mm , more often between 0 . 5 mm and 20 mm , and most often between 1 mm and 10 mm . the thickness of the tissue between the lumen and adventitia is typically between 0 . 001 mm and 5 mm , more often between 0 . 01 mm and 2 mm and most often between 0 . 05 mm and 1 mm . the pressure + δp useful to cause actuation of the balloon is typically in the range from 0 . 1 atmospheres to 20 atmospheres , more typically in the range from 0 . 5 to 20 atmospheres , and often in the range from 1 to 10 atmospheres . as illustrated in fig5 a - 5c , the dual modulus structure shown in fig4 a - 4d provides for low - pressure ( i . e ., below pressures that may damage body tissues ) actuation of an intraluminal medical device to place working elements such as needles in contact with or through lumen walls . by inflation of a constant pressure , and the elastomeric material will conform to the lumen diameter to provide full apposition . dual modulus balloon 12 is inflated to a pressure + δp 3 in three different lumen diameters in fig5 a , 5 b , and 5 c for the progressively larger inflation of patch 400 provides optimal apposition of the needle through the vessel wall regardless of diameter . thus , a variable diameter system is created in which the same catheter may be employed in lumens throughout the body that are within a range of diameters . this is useful because most medical products are limited to very tight constraints ( typically within 0 . 5 mm ) in which lumens they may be used . a system as described in this invention may accommodate several millimeters of variability in the luminal diameters for which they are useful . the above catheter designs and variations thereon , are described in published u . s . pat . nos . 6 , 547 , 803 ; 6 , 860 , 867 ; 7 , 547 , 294 ; 7 , 666 , 163 and 7 , 691 , 080 , the full disclosures of which are incorporated herein by reference . co - pending application ser . no . 10 / 691 , 119 , assigned to the assignee of the present application , describes the ability of substances delivered by direct injection into the adventitial and pericardial tissues of the heart to rapidly and evenly distribute within the heart tissues , even to locations remote from the site of injection . the full disclosure of that co - pending application is also incorporated herein by reference . an alternative needle catheter design suitable for delivering the therapeutic or diagnostic agents of the present invention will be described below . that particular catheter design is described and claimed in u . s . pat . no . 7 , 141 , 041 , the full disclosure of which is incorporated herein by reference . referring now to fig6 , a needle injection catheter 310 constructed in accordance with the principles of the present invention comprises a catheter body 312 having a distal end 314 and a proximal 316 . usually , a guide wire lumen 313 will be provided in a distal nose 352 of the catheter , although over - the - wire and embodiments which do not require guide wire placement will also be within the scope of the present invention . a two - port hub 320 is attached to the proximal end 316 of the catheter body 312 and includes a first port 322 for delivery of a hydraulic fluid , e . g ., using a syringe 324 , and a second port 326 for delivering the neuromodulating agent , e . g ., using a syringe 328 . a reciprocatable , deflectable needle 330 is mounted near the distal end of the catheter body 312 and is shown in its laterally advanced configuration in fig6 . referring now to fig7 , the proximal end 314 of the catheter body 312 has a main lumen 336 which holds the needle 330 , a reciprocatable piston 338 , and a hydraulic fluid delivery tube 340 . the piston 338 is mounted to slide over a rail 342 and is fixedly attached to the needle 330 . thus , by delivering a pressurized hydraulic fluid through a lumen 341 tube 340 into a bellows structure 344 , the piston 338 may be advanced axially toward the distal tip in order to cause the needle to pass through a deflection path 350 formed in a catheter nose 352 . as can be seen in fig8 , the catheter 310 may be positioned in a blood vessel bv , over a guide wire gw in a conventional manner . distal advancement of the piston 338 causes the needle 330 to advance into tissue t surrounding the lumen adjacent to the catheter when it is present in the blood vessel . the therapeutic or diagnostic agents may then be introduced through the port 326 using syringe 328 in order to introduce a plume p of agent in the cardiac tissue , as illustrated in fig8 . the plume p will be within or adjacent to the region of tissue damage as described above . the needle 330 may extend the entire length of the catheter body 312 or , more usually , will extend only partially into the therapeutic or diagnostic agents delivery lumen 337 in the tube 340 . a proximal end of the needle can form a sliding seal with the lumen 337 to permit pressurized delivery of the agent through the needle . the needle 330 will be composed of an elastic material , typically an elastic or super elastic metal , typically being nitinol or other super elastic metal . alternatively , the needle 330 could be formed from a non - elastically deformable or malleable metal which is shaped as it passes through a deflection path . the use of non - elastically deformable metals , however , is less preferred since such metals will generally not retain their straightened configuration after they pass through the deflection path . the bellows structure 344 may be made by depositing by parylene or another conformal polymer layer onto a mandrel and then dissolving the mandrel from within the polymer shell structure . alternatively , the bellows 344 could be made from an elastomeric material to form a balloon structure . in a still further alternative , a spring structure can be utilized in , on , or over the bellows in order to drive the bellows to a closed position in the absence of pressurized hydraulic fluid therein . after the therapeutic material is delivered through the needle 330 , as shown in fig8 , the needle is retracted and the catheter either repositioned for further agent delivery or withdrawn . in some embodiments , the needle will be retracted simply by aspirating the hydraulic fluid from the bellows 344 . in other embodiments , needle retraction may be assisted by a return spring , e . g ., locked between a distal face of the piston 338 and a proximal wall of the distal tip 352 ( not shown ) and / or by a pull wire attached to the piston and running through lumen 341 . the perivascular space is the potential space over the outer surface of a “ vascular wall ” of either an artery or vein . referring to fig9 , a typical arterial wall is shown in cross - section where the endothelium e is the layer of the wall which is exposed to the blood vessel lumen l . underlying the endothelium is the basement membrane bm which in turn is surrounded by the intima i . the intima , in turn , is surrounded by the internal elastic lamina iel over which is located the media m . in turn , the media is covered by the external elastic lamina ( eel ) which acts as the outer barrier separating the arterial wall , shown collectively as w , from the adventitial layer a . usually , the perivascular space will be considered anything lying beyond the external elastic lamina eel , including regions within the adventitia and beyond . turning now to fig1 a - c , the renal arterial location and structure are shown . in fig1 a , the aorta ( ao ) is shown as the central artery of the body , with the right renal artery ( rra ) and left renal artery ( lra ) branching from the aorta to lead blood into the kidneys . for example , the right renal artery leads oxygenated blood into the right kidney ( rk ). in fig1 b , the nerves ( n ) that lead from the aorta to the kidney are displayed . the nerves are shown to surround the renal artery , running roughly parallel but along a somewhat tortuous and branching route from the aorta to the kidney . the cross - section along line 10 c - 10 c of fig1 b is then shown in fig1 c . as seen in this cross - sectional representation of a renal artery , the nerves ( n ) that lead from aorta to kidney run through the arterial adventitia ( a ) and in close proximity but outside the external elastic lamina ( eel ). the entire arterial cross section is shown in this fig1 c , with the lumen ( l ) surrounded by , from inside to outside , the endothelium ( e ), the intima ( i ), the internal elastic lamina ( iel ), the media ( m ), the external elastic lamina ( eel ), and finally the adventitia ( a ). as illustrated in fig1 a - f , the methods of the present invention may be used to place an injection or infusion catheter similar to those illustrated by fig1 - 5 into a vessel as illustrated in fig1 c and to inject a plume ( p ) of neuromodulating agent into the adventitia ( a ) such that the agent comes in contact with the nerves ( n ) that innervate the adventitia of the renal artery . as can be seen in fig1 a , a catheter in the same state as fig4 a , wherein an actuator is shielding a needle so that the actuator can be navigated through the vessels of the body without scraping the needle against the vessel walls and causing injury , is inserted into an artery that has a media ( m ), an adventitia ( a ), and nerves ( n ) within the adventitia and just outside the media . a cross - section along line 11 d - 11 d from fig1 a is shown in fig1 d . it can be seen from this cross section that a therapeutic instrument comprised similarly to those in fig1 - 3 , with an actuator ( 12 ) attached to a catheter ( 20 ) and a needle ( 14 ) disposed within the actuator . turning to fig1 b and 11e , we see the same system as that in fig1 a and 11d , again where fig1 e is a view of the cross - section along line 11 e - 11 e from fig1 b . in fig1 b and 11e , however , the actuator that has been filled with a fluid , causing the actuator to unfurl and expand , and the needle aperture to penetrate the media and into the adventitia where nerves are located . after the needle penetrates to the adventitia , a plume ( p ) that consists of either diagnositic agent such as radio - opaque contrast medium or neuromodulating agent such as guanethidine or a combination of the diagnostic and therapeutic agents is delivered beyond the eel and into the adventitia . the plume ( p ) begins to migrate circumferentially and longitudinally within the adventitia and begins to come into contact with the nerve fibers that run through the adventitia . at this point , the physician may begin to notice the therapeutic effects . usually , the plume p that is used to diagnose the presence of the injection and the location of the injection is in the range from 10 to 100 μl , more often around 50 μl . the plume will usually indicate one of four outcomes : ( 1 ) that the needle has penetrated into the adventitia and the plume begins to diffuse in a smooth pattern around and along the outside of the vessel , ( 2 ) that the plume follows the track of a sidebranch artery , in which case the needle aperture has been located into the sidebranch rather than in the adventitia , ( 3 ) that the plume follows the track of the artery in which the catheter is located , indicating that the needle has not penetrated the vessel wall and fluid is escaping back into the main vessel lumen , or ( 4 ) that a tightly constricted plume is forming and not diffusing longitudinally or cyndrically around the vessel , indicating that the needle aperture is located inward from the eel and inside the media or intima . the plume is therefore useful to the operating physician to determine the appropriateness of continued injection versus deflation and repositioning of the actuator at a new treatment site . in fig1 c and 11f , where fig1 f is a cross - sectional view across the line 11 f - 11 f from fig1 c , one can see that after the plume is used to diagnose the appropriate tissue location of injection , further injection can be performed to surround the vessel with the neuromodulating agent . the extent of the final plume p is usually fully circumferential around the artery and usually travels longitudinally by at least 1 cm when the injection volume is between 300 μl and 3 ml . in many cases , less than these volumes may be required in order to observe a therapeutic benefit to the patient &# 39 ; s hypertension . at this point , the neuromodulating agent has penetrated the nerves around the entire artery , blocking the transmission of nerve signals and thereby creating chemical , neuromodulating , or biological denervation . the following experiments are offered by way of illustration , not by way of limitation . studies were performed in a normal porcine model to determine if adventitial delivery of guanethidine could reduce kidney norepinephrine ( ne ), a marker for successful denervation . successful denervation is well known to reduce blood pressure in hypertensive patients . renal denervation evidenced by ne reduction : guanethidine monosulfate was diluted in 0 . 9 % nacl to a concentration of 12 . 5 mg / ml , then further diluted in iodinated contrast medium to a final concentration of 10 mg / ml . this solution was injected using a mercator medsystems bullfrog micro - infusion catheter ( further described in this application and detailed in fig1 a - f ) into the adventitia of both renal arteries , approximately halfway between the aorta and the hilum of the kidney . the injection was monitored with x - ray visualization of contrast medium to confirm adventitial distribution , which was confirmed to carry the injectate longitudinally and circumferentially around the artery , as well as transversely into the perivascular tissue . no injection was made into control animals , and historical controls from connors 2004 were used as comparators . twenty - eight days after injection , kidneys and renal arteries were harvested . kidney samples were taken using the method established by connors 2004 . briefly , cortex tissue samples from the poles of the kidneys were removed and sectioned into approximately 100 mg segments . from each kidney , samples from each pole were pooled for analysis . renal arteries were perfusion fixed in 10 % neutral buffered formalin an submitted for histopathology . histology : arteries appeared normal at 28 days , with no signs of vascular toxicity . perivascular indications of denervation were apparent from lymphocyte , macrophage and plasma cell infiltration into adventitial nerve bodies , with nerve degeneration characterized by hypervacuolization and eosinophilia . radio - immunoassay : ne levels in renal cortex tissue revealed average levels of 64 nanograms ( ng ) ne per gram ( g ) of renal cortex . when compared to normal controls of 450 ng / g , this represents a reduction in renal cortex ne of 86 %. these data are shown in fig1 . additional comparison can be made to the reduction in renal cortex ne from surgical denervation , which connors 2004 reported as 97 % and krum 2008 reported as 94 %. furthermore , the reduction in kidney ne reported with the use of radiofrequency catheter ablation of the renal nerves has been reported as 86 %. the radiofrequency method has since been used in clinical trials and evidence has been shown that the ablation of the nerves , resulting in reduced ne by 86 %, directly translates to reduced hypertension in patients , with reports of systolic pressure reduction of 27 mmhg and diastolic reduction of 17 mmhg , twelve months after treatment . while the above is a complete description of the preferred embodiments of the invention , various alternatives , modifications , and equivalents may be used . therefore , the above description should not be taken as limiting the scope of the invention which is defined by the appended claims .	0
the following representative descriptions of the present invention generally relate to exemplary embodiments and the inventors &# 39 ; conception of the best mode , and are not intended to limit the applicability or configuration of the invention in any way . rather , the following description is intended to provide convenient illustrations for implementing various embodiments of the invention . as will become apparent , changes may be made in the function and / or arrangement of any of the elements described in the disclosed exemplary embodiments without departing from the spirit and scope of the invention . a detailed description of an exemplary embodiment , namely an ejectable grid fin adapted for releasable engagement with a missile , is provided as a specific enabling disclosure that may be generalized to any application of the disclosed system , device and method for improving aerodynamic stability and / or control of an aeronautic vehicle in accordance with various other embodiments of the present invention . in accordance with a representative and exemplary embodiment , the present invention allows missiles to be safely launched and separated from an aircraft . thereafter , the disclosed stability augmentation device ( e . g ., grid fin ) may be jettisoned such that subsequent flight performance is not negatively affected . many aerodynamic structures ( conventional fins , ballutes , etc .) have been previously employed to improve the stability of a vehicle in a launched configuration ; however , conventional aerodynamic structures have not provided stability solutions that fit within specified geometric constraints . in an exemplary embodiment , the present invention provides a stability solution that meets the geometric constraints associated with the stowed disposition of missiles on the eject launcher of an aircraft where the stability solution is adapted for use during the launch phase and jettisoned subsequent to missile deployment . in a representative application , an ejectable aerodynamic stability augmentation device using grid fins , in accordance with an exemplary embodiment of the present invention as generally depicted for example in fig1 , provides a novel solution for passive static aerodynamic stability control for otherwise uncontrolled store separation . grid fin 100 comprises a plurality of grid array elements 130 , which generally provide turbulation surfaces configured to impart control forces on an attached aeronautic vehicle ( e . g ., a missile ). accordingly , grid fin 100 generally permits an attached missile to separate from its carrier vehicle in a more controlled fashion as compared with conventional separation techniques . in general , grid fin 100 may be suitably configured to impart aerodynamic stability and / or control forces which are capable of modifying the pitch , yaw and / or roll of the aeronautic vehicle attached thereto , as well as the lift or drag . conventional missile deployment systems have utilized autopilot systems to steer missiles away from their associated carrier vehicles ; however , launch separation safety issues related to missile stability immediately incident upon separation have generally remained unaddressed . specifically , the center of gravity of the missile must generally be concurrently disposed substantially in front of the center of pressure in order to accomplish a clean separation from the carrier vehicle . in accordance with a representative embodiment of the present invention , grid fin 100 may be configured to dispose the center of gravity of a missile substantially in front of the center of pressure in order to produce adequate lift concurrent with separation so as to maintain the pitch orientation of the missile during the separation sequence . when the separation sequence is substantially complete , grid fin 100 may be ejected to permit the air - vehicle to proceed with its mission . grid fin 100 may be configured with engagement / dis - engagement mechanisms for releasable attachment to a missile or other aeronautic vehicle . in general , this may be accomplished with a ball - lock , exploding bolt or other release mechanism , whether now known or otherwise hereafter described in the art . ejectable release of grid fin 100 from the missile may be actuated by a sensor or other device responsive to , for example : baric pressure ; relative orientation of the missile ( or other aeronautic vehicle ); relative orientation of grid fin 100 ; a timing sequence ; gps data ; and / or remote controlled deployment . it will be appreciated , however , that a variety of other release actuation mechanisms may be alternatively , conjunctively or sequentially employed to produce a substantially similar result in accordance with various other embodiments of the present invention . a variety of grid fin geometries may be employed . for example , grid fin 100 may comprise planar shape or a planar shape . for example , grid fin 100 may comprise a regular solid , an irregular solid , a regular polygon , an irregular polygon or a circular shape . additionally , the grid fin geometry may have a point , line and / or plane of symmetry . in the case of the grid fin 100 generally depicted in the figures , the geometry may conform , for example , to the c 2v point group . furthermore , the geometry of grid fin 100 may comprise occlusion areas 110 , 120 to accommodate packing of a plurality of missiles or other attached stores . in the case of a plurality of missiles , occlusion areas 110 , 120 may be configured to permit stored disposition of the missiles , for example , on an eject rail of an aircraft without the missile body fins contacting or otherwise substantially impeding the deployment of grid fins 100 corresponding to proximately disposed missiles . for example , the ‘ snow angel ’ shape representatively depicted in the figures , generally provides a grid fin geometry suitably adapted for mounting a trio of missiles on the triple eject rail of a fighter / bomber aircraft . it will be appreciated that various embodiments of the present invention may find useful application with a variety of aeronautic vehicles including , for example : missiles ; bombs ; munitions ; sub - munitions ; rockets ; pods ; sub - vehicles and / or the like . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments ; however , it will be appreciated that various modifications and changes may be made without departing from the scope of the present invention as set forth in the claims below . the specification and figures are to be regarded in an illustrative manner , rather than a restrictive one and all such modifications are intended to be included within the scope of the present invention . accordingly , the scope of the invention should be determined by the claims appended hereto and their legal equivalents rather than by merely the examples described above . for example , the steps recited in any method or process claims may be executed in any order and are not limited to the specific order presented in the claims . additionally , the components and / or elements recited in any device claims may be assembled or otherwise operationally configured in a variety of permutations to produce substantially the same result as the present invention and are accordingly not limited to the specific configuration recited in the claims . benefits , other advantages and solutions to problems have been described above with regard to particular embodiments ; however , any benefit , advantage , solution to problem or any element that may cause any particular benefit , advantage or solution to occur or to become more pronounced are not to be construed as critical , required or essential features or components of any or all the claims . as used herein , the terms “ comprise ”, “ comprises ”, “ comprising ”, “ having ”, “ including ”, “ includes ” or any variation thereof , are intended to reference a non - exclusive inclusion , such that a process , method , article , composition or apparatus that comprises a list of elements does not include only those elements recited , but may also include other elements not expressly listed or inherent to such process , method , article , composition or apparatus . other combinations and / or modifications of the above - described structures , arrangements , applications , proportions , elements , materials or components used in the practice of the present invention , in addition to those not specifically recited , may be varied or otherwise particularly adapted to specific environments , manufacturing specifications , design parameters or other operating requirements without departing from the general principles of the same .	5
turning to fig1 there is shown a block diagram of a system within which the method of the present invention could reside and be utilized . system 10 comprises a microprocessor 12 interoperatively connected to monitor 14 for viewing the representation of the medium ( such as an envelope or label ) to be acted upon by the design application 22 . the viewing of the media representation on monitor 14 promotes ease of use in selecting the various options available to the system user while formatting the medium , and provides an example of the human interface that can be brought to system 10 . the monitor 14 , under control of the design application 22 , is able to show the system user : the medium representation ; available menus from which option selections may be made ; the medium &# 39 ; s indicia ; the amount of postage that will be incorporated into the indicia ; and varied print fields available for printing to the selected medium . microprocessor 12 is interoperatively connected to scanner 16 . scanner 16 provides system 10 with the ability to scan address field data , barcodes , or other scannable data sources as an input to design application 22 . printer 26 is also interoperatively connected to microprocessor 12 and serves as the output device by which the print fields are printed to the selected medium . additionally , keyboard 20 is interoperatively connected to microprocessor 12 and serves as an input device for the input of data . modem 18 gives system 10 the ability to communicate with other systems via communications means of varied types or to download print fields for remote storage ; and , memory 24 allows the system to retain data for use in maintaining records or for storing data for future use . turning to fig2 there is shown a drawing of the face of an envelope 30 , and its component parts , which is representative of the medium that the subject invention is directed toward preparing . envelope 30 is shown comprising address block 32 which can be input by direct entry from the keyboard 20 or can be derived from access to a database introduced to the design application through the microprocessor 12 in connection with modem 18 , or by accessing memory 24 . the address indicated by the address block 32 can be subject to address hygiene routines prior to being saved within the print field represented by the face of envelope 30 . envelope 30 further comprises : return address block 34 ; postnet barcode 36 ; single - line message 38 ; graphic image 40 ; and , indicia 42 . bearing in mind the environment suggested by fig1 and 2 , we now turn to fig3 where there is shown an upper level flowchart of the method of the present invention . [ 0038 ] fig3 begins with the initialization of the design application at step 100 . from step 100 , the method advances to step 102 where the first of the application &# 39 ; s user screens is displayed to the system user on a monitor . the user screens will present menus , lists , and queries to the system user as the application routines are utilized ; this will provide the step - by - step building of the medium print field for printing . the system and method will guide the system user in the selection of a medium format beginning with the query at step 104 . at step 104 , the method queries as to whether or not an envelope design routine is required . if the response to the query is “” no ,” then the method displays a label routine for the system operator at step 106 . step 106 advances to step 110 where the characteristics of the selected medium are defined . if the response to the query at step 104 is “ yes ,” however , then the method displays an envelope routine for the system operator at step 108 . step 108 advances to step 110 where the characteristics of the selected medium are defined . the method advances from step 110 to step 112 where the selection of a printer type is made . printer characteristics may limit the characteristics available for designing the envelope or label media . the face of the envelope or label to be designed through the application is the print field for that medium . the print field is in turn comprised of component print field that , taken together , form the print field . from step 112 , the method advances to step 114 where the component print fields can be modified . after modification , the method queries , at step 116 , as to whether or not a component such as graphics , postnet barcodes , postal indicia , or single - line messages are to be attached at the request of the system operator . if the response to the query is “ yes ,” then the method advances to step 118 where the appropriate component is attached to the print field . from step 118 , the method advances to step 120 where confirmation of the modification and attachment , if any , is made . if , however , the response to the query , at step 116 , is “ no ,” then the method advances directly to step 120 . the modification , together with any attachments , define the design field to be printed to the medium . from step 120 , the method advances to step 122 where the design field is printed to the medium . the method then queries , at step 124 , as to whether or not another envelope or label is to be prepared . if the response to the query is “ yes ,” then the method returns to enter the method flow at step 104 . if the response to the query is “ no ,” however , then the method concludes its flow and the application is exited at step 126 . turning to fig4 there is shown a flowchart of the method utilized to create the address object 300 which is further described with reference to fig5 b . a detailed discussion of object oriented programming is not required for a full understanding of the method described hereunder . the creation of the address object 300 begins at step 150 when a system user initializes a data processing system which has an object creation functionality resident therein . from step 150 , the method advances to step 152 where the method instantiates an indicia control object by registering an object class with the object creation functionality . registration of the class establishes , at step 154 , a programming interface that will be used as a port of entry into the object . the port of entry will allow the system to place class properties within the object . the system user will determine the properties of the class at step 156 . the specific properties of the indicia control object are discussed in the description of fig5 a . from step 156 , the method advances to step 158 where object methods are placed within the indicia control object by entering them through the programming interface . the method then advances to step 160 where mailpiece ( envelope ) production functionality is placed within the indicia control object 300 by entering it through the programming interface . in succession , indicia production data tables , and a human interface are placed within the indicia control object by entering them through the programming interface in steps 162 and 164 respectively . it should be noted that steps 160 through 164 can be performed in any order so long as each of the step actions are performed prior to utilization of the object . when the properties of the indicia control object 300 have been placed into the object , the method advances to step 166 where the indicia control object is embedded or linked ( ole ) where the indicia control object can be used for its intended purpose when invoked at step 168 . the use of the indicia control object 300 reduces the steps necessary to apply mailpiece production functionality and is thus a significant improvement over the prior art . the properties of the indicia control object will now be discussed in detail with reference to fig5 a and 5b . turning to fig5 a , there is shown a block diagram of the indicia control object properties 200 that are input to the object through a programming interface 302 . the indicia control object properties 200 are divided into functional groupings 210 , 230 , and 240 . functional grouping 210 comprises table data ( hereinafter 210 ) that can be utilized by the object methods 230 or production functionality tools 240 within the indicia control object 300 or in its general environment . the data tables 210 further include : rules 211 for linking the indicia control object with postal rating engines of the type used to determine postage values so that a postal indicia can be printed ; print field data 212 ; rules 214 for determining sub - fields ; rules 216 for use of print field data ; rules 218 for calculating a postnet barcode ; and , rules 220 for linking the indicia control object 300 with a postal indicia printer . functional grouping 230 comprises object methods ( hereinafter 230 ) which include : display methods 306 for displaying the indicia characteristics to the system user ; storage methods 308 for storing document layouts within an associated memory of system 10 ; and , printing methods 310 which cause human interface 314 to direct a printer , such as printer 26 , to print data under the direction of the object . additional functionality for address object 300 is provided by functional group 240 . this functionality performs a unique role and includes : an envelope design functionality 242 which comprises a set of rules for indicia requirements with respect to placement of data on the face of the mailpiece ; mailpiece display functionality 244 which displays the face of the mailpiece or envelope on a monitor 14 for ease of use and manipulation by a system user ; and , mailpiece printing functionality 246 which includes those controls and interfaces for causing a printer 26 to produce a printed envelope . each of the functionalities works together so that the printed envelope effectively embodies the mailpiece that was intended by the system user . turning to fig5 b , there is shown a block diagram of the indicia control object 300 and its constituent sub - elements . the mailpiece object 300 contains a programming interface 302 which serves as the portal by which properties of the indicia control object 300 can be entered into it . the programming interface 302 is returned by the data processing system when the indicia control object 300 is instantiated , thus allowing the indicia control object 300 to be invoked as needed . in applications such as visual basic , an object oriented designer would use a command such as “ createobject ” to instantiate the object . the “ createobject ” command returns a programming interface such as “ interface . ______ ” which will allow the designer to place the necessary properties into the object by entering their file name after the interface command . the mailpiece object 300 has specific requirements ; therefore , through the programming interface 302 will come : a human interface 314 ; indicia production data tables 304 - 304 n ; indicia production functionality 312 ; and , a set of methods comprising display method 306 , storage method 308 , and printing method 310 . each of these elements is described in more detail hereinbelow . human interface 314 allows indicia control object 300 to provide a visual interface to the system user ; additionally , printing methods 310 as contained in indicia control object 300 cause human interface 314 to direct a printer , such as printer 26 , to print data under the direction of the object . thus , the purpose of human interface 314 is to provide the path for user interface functionality . additional functionality for indicia control object 300 is provided by indicia production functionality 312 . this functionality performs a unique role . indicia production functionality 312 includes : a indicia design functionality 242 which comprises a set of rules for applying postal coding requirements with respect to placement of data on the face of the envelope ; envelope display functionality which displays the face of the envelope , together with the indicia , on a monitor 14 for ease of use and manipulation by a system user ; and , indicia printing functionality which includes those controls and interfaces for causing a printer 16 to produce a printed envelope with its associated indicia . each of the functionalities works together so that the printed envelope effectively embodies the mailpiece that was intended by the system user . indicia production data tables 304 - 304 n provide much of the production capability data utilized by the indicia control object 300 . indicia production data tables 204 - 204 n include a number of fields from which an optimal data field will be constructed by indicia control object 300 ; these further include : print field data 212 ; rules 214 for determining indicia print field sub - fields ; rules 216 for use of print field data ; rules 218 for calculating a postnet barcode ; and , rules 222 for linking the mailpiece object 300 with a postal indicia printer . paths of movement are further dictated by indicia control object 300 through the use of its distinct method elements . display method 306 is used for instructing the data processing system 10 to display data on monitor 14 . storage method 308 is used for maintaining instructions for the data processing system 10 to store data in its associated memory or within a peripheral device . printing method 310 is used for instructing the data processing system 10 to print data on output means such as printer 26 . turning to fig6 there is shown a flowchart of the use of the indicia control object within a particular application . a preferred embodiment of the method flow begins at step 400 where the ocx control for the postal indicia is instantiated within an envelope design application . from step 400 , the method advances to step 402 where the design application attaches control to a windows routine within the application . the indicia control utilizes its programming interface to link with data being generated by a postage meter and the data is passed to the indicia control object at step 404 . the method advances from step 404 to step 406 where the method queries as to whether or not a postage value is to be entered into the indicia print field . if the response to the query is “ yes ,” then the method enters the postage value at step 410 before inquiring at step 412 as to whether or not postage meter data is to be entered into the indicia field as well . postage meter data includes an identification number , a zip code , and postage value determining data . if the response to the query at step 412 is “ no ,” then the method advances to step 414 . if , however , the response to the query at step 412 is “ yes ,” then the data is entered into the indicia fields at step 416 and the method then advances to step 418 . returning to step 406 , if the response to the query is “ no ,” then the default postage is set and placed into the indicia field at step 408 . step 408 then advances to step 412 where the method queries as to whether or not postage meter data is to be entered into the indicia field as well . if the response to the query at step 412 is “ no ,” then the method advances to step 414 . if , however , the response to the query at step 412 is “ yes ,” then the data is entered into the indicia fields at step 416 and the method then advances to step 418 . at step 418 , a representation of the envelope with its associated print fields is displayed to the system operator . the representation will show the indicia located in the upper right hand of the envelope field . the method advances from step 418 to a query at step 420 . step 420 queries as to whether or not the system operator would like to re - size the envelope within the design application framework . if the response to the query is “ yes ,” then the method repositions the indicia in accordance with the re - sized envelope field before advancing to a query at step 424 . if the response to the query at step 420 is “ no ,” however , then the method advances directly to the query at step 424 . at step 424 , the method queries as to whether or not sufficient postage value is available to the data processing system for this print transaction . if the response to the query is “ no ,” then the method advances to step 432 where the method queries as to whether the envelope should be printed anyway . if the response to the query is “ yes ,” the envelope fields , less the indicia which has exercised its control function because of the insufficient postage , will be printed at step 434 . from step 434 , the method exits , at step 436 , the application for this particular print transaction . if the response to the query at step 432 is “ no ,” then the method advances directly to the exit at step 436 . returning to step 424 , if the response to the query is “ yes ,” then the method causes the indicia to print , at step 426 , the indicia to the application print field which in turn causes the system to decrement the postage value of the transaction from available funds at step 428 . the method advances from step 428 to a query at step 430 . the query at step 430 questions as to whether or not another envelope is to generated . if the response to the query is “ yes , then the method advances along path a to re - enter the method flow at step 404 . if the response to the query at step 430 is “ no ,” then the method advances directly to the exit at step 436 . turning to fig7 there is shown a flowchart of the print function utilization of the present indicia printing application . the method begins at step 500 where the printer setup function is initiated . the method advances from step 500 to a query at step 502 which inquires as to whether the indicia is displayed to the system user on the system monitor . if the response to the query at step 502 is “ no ,” then the method advances to the query at step 504 where the system is prompted as to whether printing of the envelope print fields is required exclusive of the indicia . if the response to the query at step 504 is “ no ,” then the method advances to step 506 where the printer is re - initiated before the method returns to step 500 . if continuous re - initiation of the printer is not desired , then the system user can terminate the flow by exiting at any time . if the response to the query at step 504 is “ yes ,” however , then the method advances to step 516 where the envelope print fields are printed to the envelope without the associated indicia . the method advances from step 516 to step 520 . returning to step 502 , if the response to the query is “ yes ,” then the method advances to step 508 where the delivery point zip code is entered into the indicia print field . the method then advances from step 508 to the query at step 510 . at step 510 , the method queries as to whether or not the delivery point address has been cleansed . address correction and cleansing ensures more accurate delivery and may qualify the postage for automation discounts offered by the postal service and available to the indicia &# 39 ; s linking control methods . if the response to the query is “ no ,” then the method advances to step 512 where address cleansing is performed before advancing to step 514 . if the response to the query at step 510 is “ yes ,” then the method advances directly to step 514 . step 514 queries as to whether or not postage is to be dispensed for this transaction . if the response is to the query is “ no ,” then the method advances to step 516 where the envelope print fields are printed to the envelope without the associated indicia before advancing to step 520 . however , if the response to the query is “ yes ,” then the method advances to step 518 where the envelope print field , together with the indicia , is printed to the envelope . from step 518 , the method advances to step 520 which inquires as to whether or not another envelope is to be printed . if the response to the query is “ yes ,” then the method returns along path a to re - enter the method at step 502 ; otherwise , if the response is “ no ,” then the method advances to step 522 and exits the application . while certain embodiments have been described above in terms of the system within which the address object methods may reside , the invention is not limited to such a context . the system shown in fig1 is an example of a host system for the invention , and the system elements are intended merely to exemplify the type of peripherals and software components that can be used with the invention . in the foregoing specification , the invention has been described with reference to specific embodiments thereof . it will , however , be evident that various modifications and changes may be made thereto without departing from the broader spirit and scope of the invention . the specification and drawings are , accordingly , to be regarded in an illustrative rather than a restrictive sense .	6
next , detailed description will be made of the preferred embodiments of data rearrangement methods of the present invention with reference to the accompanying drawings . in the specification and the drawings , components having substantially similar functions will be denoted by similar reference numerals , and repeated explanation will be omitted . a data rearrangement method of the first embodiment includes a step of storing a specific rule in an address conversion table , and a step of sequentially reading addresses to store data for an arithmetic operation from the address conversion table by using a stack pointer . one - dimensional rearrangement will be described here in order to simplify explanation , but the invention is not limited to this rearrangement . fig1 is a view showing a state of the address conversion table and a position of the stack pointer in order to explain the data rearrangement method of the first embodiment which uses the address conversion table and the stack pointer . the stack pointer is a resister for holding a first address of the stack . it is generally incremented (+ 1 ) when data is pushed down ( stored ), and decremented (− 1 ) when data is popped up ( read ). the stack employs a last - in - first - out ( lifo ) structure in which first stored data is read . in fig1 , “ address : 0x8000 ” or the like represents an address in a hexadecimal form of a memory . first , information of rearrangement is pushed down in the stack to be stored as an address conversion table . addresses are sequentially stored : for example , an address ( 0x1002 ) is stored in an address ( 0x8000 ) of a memory 10 , an address ( 0x1000 ) is stored in an address ( 0x8001 ) of the memory 10 and so on . in the case of carrying out a sequential arithmetic operation by a dsp , the stack is popped up to refer to an address ( 0x1003 ) stored in an address ( 0x8004 ) indicated by the stack pointer , and data is read to be stored in the address ( 0x1003 ) of the memory 10 . after completion of the data arithmetic operation by the dsp , since a stack pointer 30 has been decremented by popping - up , an address ( 0x8003 ) is indicated this time , and reference is made to an address ( 0x1001 ) to be stored here . similarly thereafter , reference is made to the address conversion table ( fig1 ). fig2 shows a flowchart for realizing the rearrangement method of the first embodiment , and a program example . the flowchart and the program example of fig2 show a process after a conversion address is first stored in the address conversion table ( stack ), and then the stack pointer moves to a predetermined pointer position . here , a one address storage register r 0 and a one data storage register a 0 are used . in the program example , “ pop ” is a command for copying a value of a first address of the stack to a right register , “ mov ” is as previously described , a character / numeral in “( )” indicates a value of data stored in its address or register , and a character / numeral without “( )” indicates an address value or a register itself . first , in s 10 , the dsp starts an arithmetic operation , and its result is stored in the a0 register ( s 10 ). then , in s 11 , the stack is popped up , and an address ( 0x1003 ) to be stored in an address ( 0x8004 ) of the address conversion table indicated by the stack pointer is set to the r0 register ( s 11 ). then , in s 12 , the result of the arithmetic operation stored in the a0 register is stored in the address ( 0x1003 ) stored in the r0 register ( s 12 ). then , in s 13 , determination is made as so removal of the r0 register from an address conversion table area ( s 13 ). if a result of the determination shows the removal from the area , the stack pointer is returned to an initial area . if no removal is determined , the process proceeds to a next arithmetic operation ( fig2 ). if the stack pointer is returned to an initial state at a break point of the arithmetic operation , the steps s 13 , s 14 can be omitted . after the movement of the stack pointer from the address ( 0x8004 ) to an address ( 0x8000 ), an arithmetic operation is executed in an order pushed down beforehand in the stack . as described above , by using the stack pointer , data can be written in a predetermined address by a small number of processing operations . additionally , since optional rearrangement information can be written in the stack , optional rearrangement can be dealt with . these operations are difficult if a process is carried out only by hardware . the storage ( writing ) of data has been described . however , data reading can also be realized by a similar method . in this case , the program example of fig2 becomes as follows : in the program example of fig2 , the pop command and the mov command are separately executed . however , in a system which can execute a pop command and a mov command in one command , they can be executed by one command . in the program example of fig2 , the reading is carried out from the memory by the pop command , while the writing in the memory is carried out by the mov command . however , in the case of a system in which memory reading and memory writing are at separate stages , these operations are subjected to pipeline processing to enable execution by one command . an example is shown in fig3 . in the case of rearrangement during data reading shown in fig3 , if “ pop r0 ” and “ mov ( r0 ), a0 ” are in one command , reading is carried out from the memory by the pop command , and reading is also carried out from the memory by the mov command . accordingly , competition occurs at read of a state t3 . however , in the case of a system which avoids competition , even data reading can be executed by one command . as measures to avoid competition , when simultaneous reading operations occur , one reading is preferentially executed , and the other reading is executed later . this way , competition avoidance may be realized . in the case of reading from an independent memory , since no competition occurs , the operation can be executed by one command . the first embodiment has been described by way of case in which there is only one stack area . however , in the case of using a plurality of bits of rearrangement information , a plurality of stack pointers may be prepared to process a plurality of stacks . in such a case , pluralities of push commands for operating the stacks , pop commands , and mov commands to the stack pointers for “ initialize stack pointer ” are prepared . a data rearrangement method of a second embodiment further comprises , in addition to those of the method of the first embodiment , a step of calculating or or add of a read address and an offset register . the offset address is disposed , a low - order bit of a rearrangement address is stored in a stack , and or or add of a read address and the offset register is calculated to generate a rearrangement address . accordingly , a plurality of data rows can be rearranged . in this case , the “ or ” calculation means an “ or ” calculation for each bit , and the “ add ” calculation means an addition ” calculation . selection of “ or ” or “ add ” may be optionally controlled by disposing e . g ., a control register . according to the second embodiment , rearrangement of a plurality of data rows is enabled in addition to the effects provided by the first embodiment . according to a data rearrangement method of a third embodiment , a rearrangement only register is used in place of the stack pointer of the first embodiment . the use of the rearrangement only register enables updating of an optional pointer , and thus it is possible to carry out more efficient data rearrangement . fig4 is a view showing a state of an address conversion table and contents of a rearrangement only register ( rr ) in order to explain the data rearrangement method of the third embodiment which uses the address conversion table and the rearrangement only register ( rr ). fig5 shows a flowchart for realizing the rearrangement method of the third embodiment , and a program example . the flowchart and the program example of fig5 show a process after a state in which a conversion address is first stored in the address conversion table , and a predetermined pointer initial value is stored in the rearrangement only register rr . here , in addition to the rearrangement only register rr , a one address storage register r 0 and a one data storage register a 0 are used . in the program example , “ mov ” or the like is as - previously described . first , in s 30 , a dsp starts an arithmetic operation , and its result is stored in the a0 register ( s 30 ). then , in s 31 , an address ( 0x0003 ) to be stored in an address ( 0x8004 ) of the address conversion table indicated by an address value stored in the rearrangement only register rr is read , set to the r0 register , and the rearrangement only register rr is decremented (− 1 ) ( s 31 ). then , in s 32 , the result of the arithmetic operation stored in the a0 register is stored in the address ( 0x0003 ) stored in the r0 register ( s 32 ). then , in s 33 , determination is made as so removal of the r0 register from an address conversion table area ( s 33 ). if a result of the determination shows the removal from the area , the rearrangement only register rr is returned to an initial area . if no removal is determined , the process proceeds to a next arithmetic operation ( fig5 ). after the contents of the rearrangement only register rr are changed from the address ( 0x8004 ) to an address ( 0x8000 ), an arithmetic operation is executed in an order prestored in the memory . according to the third embodiment , effects similar to those of the first embodiment can be obtained . in the foregoing , the rearrangement only register rr is decremented by − 1 when the data is read from the rearrangement only register rr . however , modifications can be optionally made in accordance with purposes . for example , optional + or −, module addressing etc ., can be cited as modifications . for a modification , a register which supports all types of addressing disposed in a general register can be used . in the case of the module addressing , as in the case of the rearrangement only register , a register only for specifying a module width may be prepared , and necessary registers may also be prepared for other types of addressing . thus , the use of the module addressing eliminates a necessity of periodical resetting of the pointer to enable efficient rearrangement . according to a data rearrangement method of a fourth embodiment , data stored in an address conversion table contains byte - writing information . fig6 is a view showing a state of the address conversion table , a position of a stack pointer , and functions of a control register 40 and an offset register 50 according to the fourth embodiment . according to the first to third embodiments , the data writing is carried out with respect to a fixed bit length ( e . g ., 32 bits ). however , depending on an arithmetic operation , it is necessary to execute writing with respect to only optional bits ( e . g ., 8 bits ) of 32 bits . according to the fourth embodiment , when rearrangement information is stored in the address conversion table , a low - order bit is set as a byte - writing control bit to enable writing in an optional place . for example , as shown in table 1 , fig7 , low - order 2 bits of rearrangement information are set as byte - writing information . further , a byte - writing control register is disposed and , if byte - writing is permitted , low - order 2 bits of an address are supplied as byte - writing information to a memory . remaining high - order 14 bits are supplied as addresses to the memory ( see fig7 ). thus , according to the fourth embodiment , the setting of the low - order bit of the rearrangement information enables writing only in a predetermined bit . in the aforementioned example , 32 bits are divided into 8 bits . however , a way of division is not limited to this . when division is made , the number of bits of the byte - writing information may be set to a necessary number of bits . additionally , by installing the byte - writing control register , the memory used for rearrangement can also be used for general purposes . the preferred embodiments of the data rearrangement methods of the present invention have been described with reference to the accompanying drawings . however , the invention is not limited to the embodiments . it is apparent to those skilled in the art that various changes and modifications can be made within a scope of technical ideas specified in appended claims and , needless to say , such changes and modifications are also within the technical scope of the invention . the present invention relates to the digital processing method in digital communications or digital signal processing , and it can be applied especially to the data rearrangement method . as described above , according to the present invention , there can be provided a data rearrangement method which can reduce the number of processing operations ( the number of commands ) to shorten processing time more than the conventional method , which can be realized efficiently by a small memory capacity , and which can deal with optional rearrangement rules .	6
we have demonstrated , by using adenovirus type 5 , that we can reproduce human adenovirus infection in rabbit eyes and have shown both excellent antiviral activity and conjunctivitis therapy using ctc - 96 which we believe is unique as there is no effective drug against this virus and its pathology in the eye . in addition , we have shown ctc - 96 efficacy against adenovirus types 1 , 2 , 3 , 4 , 5 , and 7 in hela cells in tissue culture . since these human viruses cannot be grown in animal models , this provides an excellent indication of the effectiveness of ctc - 96 against a broad spectrum of adenovirus types . to determine ctc - 96 efficacy against several types of serotypes of adevirus the following procedure was followed : 1 . hela cells were confluent at the time of inoculation . 2 . virus dilutions were prepared from the known titers of the stock viruses ( 4 × 10 5 pfu / ml ; 4 × 10 4 / 0 . 1 ml ) of ad1 kmetz , ad2 wolf , ad3 holyfield , ad4 harris , , ad7a joseph , atcc . this virus inoculation yielded a virus infection with an m . o . i . ( multiplicity of infection ) of approximately 1 . 0 . 3 . 100 □ l of each ad serotype were inoculated onto cultures containing hela cells . 4 . during the adsorption period , doxovir concentrations of 500 , 250 , 100 , 50 , 10 , and 0 μg / ml were prepared in culture medium according to the dilution protocol . 5 . virus was adsorbed at 37 ° c . in a 5 % co 2 water - vapor atmosphere for 1 hour . 6 . after adsorption , the virus inocula were removed from all the wells and 2 wells each were overlayed with 1 ml of doxovir ( in tissue culture medium ) at concentrations of 500 , 250 , 100 , 50 , 10 , and 0 μg / ml . 7 . the plates were incubated at 37 ° c . in a 5 % co 2 water - vapor atmosphere for 24 hours . 8 . after 24 hours , the plates were washed . 9 . each well was refilled with 1 ml of fresh tissue culture medium without doxovir . 10 . the cells were scraped from the wells . 11 . the media and cells were then frozen at − 75 ° c . pending titrations . 12 . titration of duplicate samples were thawed from each ad serotype , doxovir concentration and its no drug control . 13 . viral titers were determined at each drug concentration . ctc - 96 has considerable advantages as an anti - viral drug : a ) because of its unique mode of action it is effective against herpes and hiv virus mutants which are resistant to currently used drugs ; b ) because the drug acts against two different viral targets in herpes virus the development of ctc - 96 - resistant mutants is deemed to be extremely rare ; and c ) because ctc - 96 has anti - inflammatory properties its use replaces the use of steroids in herpes virus and adenovirus therapeutics . steroids modulate the immune response in the areas where they are applied and increase tissue susceptibility to pathogens . efficacy of ctc - 96 against adenovirus types 1 , 2 , 3 , 4 , 5 , and 7 in culture anti - adenovirus activity of ctc - 96 was evaluated by standard cell culture using hela cells , a human cervical carcinoma immortalized cell line ( the usual host for laboratory grade adenovirus ) and anti - viral plaque - reduction assays . ctc - 96 has an inhibitory ( prophylactic ) effect on growth when virus is exposed to the drug prior to cell infection . fig1 shows adenovirus type 5 titers following direct exposure of the virus to ctc - 96 prior to hela cell infection . the data graphically depicted in fig1 were obtained as follows : varying concentrations of the ctc - 96 were mixed with concentrated human adenovirus , [ adenovirus type 5 ( ad5 )] and incubated at 37 ° c . for 60 minutes . aliquots were then diluted 500 fold into growth medium . hela cells were exposed to 100 μl of the diluted material to initiate infection . these monolayers were incubated for 24 hours at 37 % and 5 % co2 and then washed , scraped , sonicated , centrifuged and the supernatant serially diluted . these serial dilutions were plated onto indicator hela cell monolayers and adsorbed for 60 min , aspirated and a methycellulose overlay placed over the cells , which were then incubated for 3 days at 37 %. cultures were counterstained with 1 % methylene blue , allowed to dry and the plaques counted . results are expressed as mean ± sd ( where error bars are not visible they are contained within data point ). ctc - 96 also has a potentially therapeutic effect as can be seen by inhibition of viral growth in adenovirus infected cells , which are subsequently exposed to the drug . fig2 shows virus titers obtained after exposure of human adenovirus type 5 ( ad5 ) infected hela cells to ctc - 96 . these data were obtained as follows : adenovirus was adsorbed onto hela cell monolayers for 60 min at 37 %; serial dilutions of ctc - 96 were overlaid onto the minelayers . monolayers were then incubated for 24 hr at 37 ° c . and 5 % co2 . monolayers were then washed , scraped , sonicated , centrifuged and the supernatant serially diluted . these serial dilutions were plated onto indicator hela cell monolayers and adsorbed for 60 min , aspirated and a methylcellulose overlay placed over the cells , which were then incubated for 3 days at 37 %. cultures were counterstained with 1 % methylene blue , allowed to dry and the plaques counted . results am expressed as mean & amp ; sd ( where error bars are not visible they are contained within data point ). clinical results and plaque assay viral titers of three ctc - 96 treatment / dosing regimens of rabbit eyes infected with human adenovirus , adenovirus type 5 ( ad5 ), were evaluated . on “ day 1 ” animals were infected with human adenovirus type 5 by the installation of 10 6 pfu adenovirus according to our protocol of conjunctival and corneal scarification for the induction of keratoconjunctivitis . clinical conjunctivitis was observed in all animals by day 8 post - inoculation . animals were then randomized and the following experimental groups were treated with ctc - 96 or placebo in a double blind experiment : ( 1 ) placebo ( diluent alone ), 9 ×/ day , for 21 days : ( 4 rabbits ). ( 2 ) ctc - 96 50 μg / ml , 9 ×/ day , for 21 days : ( 4 rabbits ). ( 3 ) ctc - 96 50 μg / ml , 6 ×/ day , for 21 days : ( 4 rabbits ). ( 4 ) c t w 25 μg / ml , 6 ×/ day , for 21 bays : ( 4 rabbits ). clinical disease progression and resolution were evaluated by slit lamp microscopy on days 1 , 3 , 7 , 10 , 13 , 18 , 21 , 24 , 28 and 31 after initial drug dosing . the intensity of the keratitis was quantified using a clinical grading system ( 5 ). application of 25 μg / ml and 50 μg / ml prevented progression of disease severity . application of 50 μg / ml 6 or 9 times a day for 21 days resulted in complete resolution of clinical disease by day 21 while placebo treated animals continued to show symptoms for another 10 days . the results are depicted in fig3 which shows ctc - 96 treatment of adenovirus induced keratoconjunctivitis . the data in fig3 were obtained as follows : rabbits were infected with human adenovirus type 5 by the installation 10 6 pfu adenovirus according to our protocol of conjunctival and corneal scarification for the production of keratoconjunctivitis . on day 8 post - inoculation treatment with eye drops containing ctc - 96 or placebo was initiated . animals were examined for stromal keratitis and scored by the corneal disease scale of wander et al . ( 5 ). the following are the criteria for determination of conjunctival disease : area of conjunctival disease conjunctival severity 0 normal cornea . 0 normal conjunctiva . + 1 ≦ 25 % involved . + 1 mild conjunctival injection . + 2 & gt ; 25 %, ≦ 50 % involved . + 2 moderate conjunctival injection / chemosis . + 3 & gt ; 50 %, ≦ 75 % involved . + 3 severe conjunctival injection / chemosis . + 4 & gt ; 75 %, ≦ 100 % involved . + 4 pseudomembrane present . the efficacy of ctc - 96 treatment of rabbit eyes infected with human adenovirus , adenovirus type 5 ( ad5 ), was also evaluated by adenovirus recovery from tear film cultures adsorbed onto confluent hela cell monolayers . application of 50 μg / ml 6 or 9 times a day resulted in a rapid fall in viral presence in the eye with no detectable virus by day 13 while placebo treated eyes continued to show detectable virus until day 24 . fig4 shows adenovirus titers after treatment of rabbit eyes with ctc - 96 or placebo . these data were obtained by the following procedure : rabbits were infected with human adenovirus type 5 by the installation 10 6 pfu adenovirus according to our protocol of conjunctival and corneal scarification for the production of keratoconjunctivitis . on day 8 post - inoculation treatment with eye drops containing ctc - 96 or placebo was initiated . adenovirus recovery from tear film was evaluated by plaque assay on confluent hela cell monolayers . data are presented as average ± sd .	0
the static inflatable of the invention uses a single air source 20 to direct air to a single air outlet 30 . the directed air provides enough force on the interior of the figure to keep it in an upright position . for this reason , the figure cannot have inflated appendages . appendages can be wired in order to give them the inflated appearance but it is required that the air travel from the air source upward to a single exhaust in order to provide the necessary force to keep the figure upright . tether points 35 can be provided on the figure . the tethers are not needed to keep the upright position of the figure , but can be used to impart any desired movement of the figure or to counteract particularly strong winds when the figure is used outside . the air source can be made to cycle on and off . with the air source being intermittent , the figure will be provided with some degree of movement . with the air source off , the lack of air pressure provided by the air source will cause the figure to begin to deflate . as soon as the air source switches to the on condition , the figure will return to the upright position . this type of intentional imparting of movement to the figure is referred to as intentional air intervention technology . the air can be interrupted by the use of relays on fans . the use of relays can be set to a specific cycle . one such cycle is having the relays be two seconds on followed by two seconds off in a repeating pattern . if the relays on the fans are provided with sound sensing , light sensing or programmable controls , the figure can be made to move in any desired manner , including moving to music . when a single outlet is used for the exhaust of the air flowing through the figure , the vent is made large and baffles are used in the area of the vent to prevent the edges fo the vent from flailing . the elimination of flailing reduces wear and tear of the material about the vent , adding to the life span of the figure . this type of figure can be made in one of two ways . in a first manner , the figure is provided with a single leg and a single air source 20 at the base of the leg . this arrangement creates the necessary air movement in order to maintain upright positions . the singular outlet not only provides the outflow from the inflated figure , but the configuration and location of the outlet determines the magnitude and direction of reactive destabilizing forces produced by outflow from the singular outlet . this helps define and determine the particular movement pattern for the moving inflated figure . thus , the singular vent and its location , and the addition of ancillary sections of the figure provided by the arms produces a much more complex and sophisticated pattern of movement of the figure . preferably , the single outlet provides a release of gas generally symmetrically with reference to the torso central axis . while it is desirable to have this symmetrical release of gas , the ancillary sections need not be symmetrical to achieve this . in the second manner , shown in fig2 the figure has a pair spaced apart legs , a torso , a head and a pair of outwardly and upwardly extending arms . a singular vent 31 , preferably at the top of the head or at the end of only one of the arms , allowing for the continuous release of generally all of the gas being introduced into the figure at a predetermined controlled rate . for example , a figure might have one arm on one side with one large outlet and a plurality of arms on the other side with no outlets in them . baffles 51 , 52 , 53 in the figure ensure the equal distribution of internal pressure . in the second embodiment , the figure is provided with two legs 14 , 16 and an air source 22 , 24 at the base of each leg . in this instance , the torso of the figure is separated into two chambers 26 , 28 in a side by side relationship . the two air sources provide an air flow through each chamber . this type of figure is shown in fig3 . as can be seen , the figure operates as two singular tubes joined side by side , each with a single source and a single outlet . for many applications , the figure will be generally upright . this arrangement is simple and effective . on some occasions however , it may be desired that the object extend at an incline from the vertical . this could be done for visual aesthetic purposes or might simply be the convenient result of using the apparatus on an inclined surface such as a hillside . music may be provided to create the impression that the figure is dancing to the music . while the movement of the figure is random or apparently random , normally the illusion is nevertheless created that the figure is in fact dancing in the rhythm to the music . similarly lighting , particularly intermittent or internal or external strobe type lighting , may also be provided to enhance the overall effect . in the preferred form of the apparatus and method , a pair of fans are provided , each connected to the lower end of one of the legs of the figure . the fans provide a generally constant or fixed input airflow , which may be adjustable to different constant flow levels to accommodate different figures and different environmental conditions such as ambient wind . alternately , a single fan may be provided with a singular outflow , with the singular outflow going to one of the legs . similarly the figure might be provided with a single structural leg connected to a single fan . for miniature moving inflatable figures , two fans are preferred which exhaust into one port . this new design of miniature moving inflatables uses a new quiet squirrel cage fan enclosed in a housing and a figure with only one exhaust port in it . the arms of the figure are sealed . as the air is fed through the figure , the figure fills up and as the air exhausts , the weight of the figure , the fig . wants to collapse and in doing so creates a closure in the figure which causes the figure to fill up again . this process repeats itself over and over again as long as the fan continues to provide air to the figure . a squirrel cage fan , which is not only quieter , but has a higher static pressure . the opening in the head of the new design has been changed also to provide just enough air release to cause the figure to move around , but not freeze in a stall mode or fall down . there are no internal baffles inside of the new miniature moving inflatable figures but they may be added . single legged medium size moving inflatable figures can be made in an indoor version . the indoor design of the moving inflatable uses a new quiet squirrel cage fan and a redesigned figure with only one exhaust port and sealed arms . there are no internal baffles inside of this design . baffles may be added to change the form . baffles in the arm will make the arm not hollow and direct air flow . also , the exhaust port , does not necessarily need to be in the head portion for other effects . the control of the figure is built into the weight and balance of the figure as defined in the drawing . the weight of the fabric used and the angles of the cuts of the material are designed to enable the figure to dance as designed verses random movements . this figure and fan are designed primarily for indoor use , but may be used outdoors in very calm winds . the height of the figure may vary . the outdoor design is taller , and has different measurements than the indoor model . the figure has only one exhaust port in the head and has sealed arms . the only port may still be placed in the arm or other areas for different designs and effects . baffles may be used in the arms ( or other areas of the figures ) and therefore , the arms , or other areas , would not be hollow , as needed to direct the airflow . the fan used for this model is a 1 . 5 hp axial blade fan built by tubeworks , inc . other hp fans would work with other designs . a squirrel cage fan , which is not only quieter , but has a higher static pressure . the opening in the head of the new design has been changed also to provide just enough air release to cause the figure to move around , but not freeze in a stall mode or fall down . the existing single legged medium size moving inflatable figure has two sealed arms attached to it which cause drag and imbalance . that drag and imbalance is offset by the diameter of the exhaust port combined with the weight and shape of the figure itself which forces the figure to dance without touching the ground . there are no internal baffles inside of the new design but can be added for directional air as needed which would not make the figure hollow . the mid - size single fan moving inflatable figures use a new quiet squirrel cage fan and a redesigned figure with only one exhaust port in it . one arm in the design has an opening sewn into one arm at such a location that it creates movement in the figure as it appears to be waving . different figures may require placing the port in other areas , i . e ., a tail , fins , wings , ears , mouth , hats , hair , or other accessories , etc as custom designs dictate . the head and the other arm of the figure are sealed . as the air is fed through the figure , the figure fills up and as the air exhausts , the weight of the figure &# 39 ; s arm wants to collapse and in doing so creates a closure in the arm of the figure which causes the figure &# 39 ; s arm to fill up again . this process repeats itself over and over again as long as the fan continues to provide air to the figure . one air port may be placed in another area of a custom design that would react accordingly . a squirrel cage fan , which is not only quieter , but has a higher static pressure is used . the opening in the arm provides just enough air release to cause the figure &# 39 ; s arm to move around , but not freeze in a stall mode or fall down . there are no internal baffles inside of the new design but can be added to provide directional intentionally interrupted air needed in circumstances calling for this . large moving inflatable figures can be made in an indoor and an outdoor version . this new design of the indoor version uses a new quiet squirrel cage fan and only one exhaust port in it . the arms of the figure are sealed . the exhaust port is in the head of the figure . but depending on the design , the exhaust port could be in another area of the figure . while the design has two legs , two arms and a head , like a humanoid shape , ( or animal shape , or other custom shapes ) air is fed into only one leg of the figure ( or other areas , depending on design and desired effect ) and the air exhausts through one exhaust port in the head of the figure ( to achieve a desired effect , another location may be substituted , depending upon the design ). the other leg of the figure is generally the same length as the other leg , but instead of being open to accept intake air , it is sealed with a heavy material which can take the abuse of touching the ground when it bounces around in a dancing and sometime walking motion . any unlimited type of designs are possible using this technology . the trade secret is in the weight and balance of the figure and the diameter and shape of the exhaust port , combined with internal baffling . as the air is fed through the figure , the figure fills up and as the air exhausts , the weight of the figure wants to collapse and in doing so creates a closure in the figure which causes the figure to fill up again . this process repeats itself over and over again as long as the fan continues to provide air to the figure . this new design of the outdoor version generally uses a 1 . 5 hp axial blade fan but other hpfans could be used for other designs and a redesigned figure . a smaller or larger horsepower axial blade fan can be used , but it would require a redesign of the figure and the baffling to create the type of movement for each figure which was created . the actual shape of the figures can be almost any design , animal , vegetable or mineral . the key is in the weight and balance , baffling and exhaust air design which is configured specifically to each figure . the design uses a different fan , a squirrel cage fan , which is not only quieter , but has a higher static pressure , which is part of the secret to making our new design work with only one opening in the figure vs . three that we had before . the opening in the head of the new design has been changed also to provide just enough air release to cause the figure to move around , but not freeze in a stall mode or fall down . there are internal baffles inside of the new designs . the designs are multi theme characters , animals , and products , that can vary in size in dimension . in another embodiment of the invention shown in fig4 the figure is provided with an internal fly tube 40 tethered at both ends and having a base receiving the air from a single air source . the tube is sewn to the interior of the figure . this fly tube functions much like a figure having a single source and a single outlet . in this embodiment , the fly tube imparts its movements to the overall inflatable figure . appendages can be provided on the inflatable figure but they do not have outlets . the movement of the internal fly tube imparting movement to the overall figure is referred to as intentional internal intervention technology . this intentional internal intervention technology can be used in conjunction with the intentional air intervention technology , entailing the control of the air source to provide movement to the figure . i . by trapping an oversize inflated tubular structure inside of an outer inflatable structure , the interior tubular structure will hit the walls of the outer structure and cause it to move . when the outer structure is mounted atop a stable platform such that the outer structure is allowed to rock and roll on the platform , the figure will develop continuous and repetitive movements as air passes through the inflated tube and air is bled off that tube to inflate the outer structure . ii . by using a stable inflatable type figure and mounting it atop two sliding or semi rotating platforms which are mechanically driven , the legs of the figure will move with the platforms and cause movement in the figure , making it appear to walk or dance . iii . an inflatable vertically stable figure can also be made , as described in our earlier submission with multiple air outlets which do not cause the figure to move . design of the figure is such that outside forces , such as the wind , catch the figure and cause it to move or dance while the internal air causes the figure to remain somewhat stable as it fights the wind effects from outside . inflatables offer an option for those who desire less , or minimal movement in their figures than the other moving figures described herein . such figures could be preferred for users with limited space to mount the figures or those who have a printed message on the figures that they desire to be more readable as the result of the lesser movement . iv . by using an air driven , circulating air vent type mechanism , upon which a single legged , static type figure is mounted , the figure will spin around in circles as the air vent spins . while the invention has been described with reference to the preferred embodiments , variations and modifications would be apparent to one of ordinary skill in the art . the invention encompasses such variations and modifications .	6
various methods of designing printed planar reflectors are known . these methods include loading , dimensioning of microstrip patches , and blazed gratings . design of a planar reflector array for use in the present invention , is in accordance with these known design methods . a commercial cad package was used to fulfil design requirements of reflector arrays described herein . fig1 shows a side view of a planar reflector . a &# 34 ; quasi periodic &# 34 ; array of patches 61 is etched on a top surface of a grounded dielectric slab 7 having a feed 68 in the form of , for example , a horn at a &# 34 ; focal point &# 34 ; thereof . alternatively , another type of feed is used . in fig1 the dielectric slab 7 is grounded with a ground plane 5 disposed thereon on a side opposite the array of patches 61 . the attributes of the patches 61 -- dimension , loading , placement or a combination thereof -- are smoothly varied throughout the structure so that the feed location approximates the focal point of the planar reflector ; this is what is meant herein by &# 34 ; quasi periodic .&# 34 ; essentially , features of patches on a top surfaces of the planar reflector 60 are varied in a manner that enables the structure to transform an incoming spherical wave 1 emanated from the feed 68 into a reflected plane wave 2 . the function of the planar reflector 60 is analogous to a &# 34 ; planar phase front transformer &# 34 ;. of course depending upon design requirements , different features of an etched pattern on the top surface of the planar reflector are changed to obtain the required phase shift and transform the phase front of the wave that impinges on a specific locality of the reflector surface . this is well known in the art . the term top surface as used herein refers to a surface of the planar reflector 60 receiving a signal from the feed 68 ; of course , the antenna may be moved rendering the &# 34 ; top surface &# 34 ; on the bottom side of the antenna , but this is still referred to , for clarity , as the top surface . one method of creating a required phase shift pattern is by smoothly varying dimensions of reflective elements , in the form of rectangular patches , on a top surface of the planar reflector . first , the elements are arranged in a periodic configuration and cell dimensions are constant throughout the structure . it is known that a plane wave illuminating a periodic structure of rectangular patches goes through a phase shift as it is reflected . fig2 shows a typical curve of an amount of phase shift introduced in an incident wave as it is reflected from a planar reflector array , versus rectangular patch length that is used as a cell element of a periodic structure . as operating frequency of an antenna changes , the phase shift at some localities of the planar reflector goes to saturation resulting in beam squint . according to the embodiments described herein , rectangular patch lengths at each locality are dimensioned so as to introduce a required phase shift into the reflected wave from that locality . by applying this throughout the reflector array , a quasi - periodic structure -- not exactly periodic -- capable of acting as a &# 34 ; phase front transformer &# 34 ; results . the structure mimics a conventional reflector such as a parabolic reflector . a printed planar reflector is also realised by proper placement of the elements on a grounded dielectric slab . as in the previous example of planar reflector array design , a feed is disposed at a &# 34 ; focal point &# 34 ; of the planar reflector . for design , each locality of the planar reflector 60 is assumed to illuminated by a plane wave 1 whose direction is dictated by relative location of that locality with respect to a phase centre of the feed 68 . the periodicity of the elements at that specific location are adjusted so as to excite a higher order floquet &# 39 ; s mode , ( 0 ,- 1 ) in this case , in a desired direction . this procedure is applied throughout the planar reflector 60 in order to span the reflector elements in a certain lattice . a typical configuration of elements throughout the surface is shown in fig3 . the cell dimensions are adjusted to provide propagation of a desired higher order floquet &# 39 ; s mode . the direction of propagation of ( m , n ) th mode is obtained using the following relationships ; ## equ1 ## where ( m , n ) represent mode number , t x and t y are cell dimensions in x and y directions , φ inc and θ inc are propagation direction of an illuminating plane wave and φ . sub . ( mn ) and θ . sub . ( mn ) are propagation direction of a diffracted mode . the propagation direction of the ( 0 ,- 1 ) mode is determined by setting ( m , n ) to ( 0 ,- 1 ). using the above relations ( 1 ), ( 2 ) and ( 3 ) and knowing the position of the feed 68 and desired direction of propagation of the diffracted mode 2 , a lattice is determined for ensuring the propagation of the ( 0 ,- 1 ). floquet &# 39 ; s mode in the given direction . having determined the lattice , the length of the gratings -- reflective elements 61 -- and slab 7 thickness are optimised in order to maximise energy coupled into ( 0 ,- 1 ) mode . this is done for a central region of the planar reflector 60 . this region contains a highest number of reflector elements 61 . referring to fig4 a top view of a periodic structure of rectangular gratings -- reflector elements 61 -- printed on a grounded dielectric slab 7 is shown . this represents the central region of the planar reflector 60 . in the diagram of fig4 the central region is a periodic structure with a rectangular lattice . in order to determine an efficiency with which a desired ( 0 ,- 1 ) mode is excited by different localities of the planar reflector 60 , the locality is assumed to be a periodic structure of infinite extent illuminated by a plane wave 1 ( not shown ) whose direction matches the relative position of the feed 68 ( not shown ) with respect to that locality . then , the relative power coupled to each mode is derived throughout the operating frequency band . using such a method , each locality of a planar reflector array 60 is analysed to determine efficiency and so forth . of course , when only some localities are of interest , only those localities are analysed . the graph shown in fig5 shows power coupled into propagating modes for a periodic structure with characteristics of the central region of a planar reflector illuminated by a plane wave travelling along a line that connects the phase centre of the feed 68 to the central region . a moment method based algorithm was used to derive scattering characteristics of the periodic structure . such a method is described in 4 - r . mittra , c . h . chan and t . cwik , &# 34 ; techniques for analyzing frequency selective surfaces &# 34 ;, proc . of ieee . vol 76 , no . 12 , dec . 1988 , pp . 1593 - 1614 . it is evident from equations ( 1 ), ( 2 ) and ( 3 ) that k xmn and k ymn are functions of frequency and , therefore , that the planar reflector array 60 is subject to the effects of beam squint . though the embodiments described below are for reducing beam squint for planar reflectors with smoothly varying cell sizes , a same method is applicable to reduce beam squint for reflectarrays with smoothly varying element dimensions and / or other element parameters . a dual planar reflector according to the invention is shown in fig6 . the antenna is described in operation in the transmission mode . the first plane 60 is a planar reflector composed of quasi - periodic structure of rectangular grating 61 which are arranged in a smoothly varying lattice and the second plate 65 , which is parallel to the first plate 60 , is a regular periodic structure of rectangular gratings 66 arranged in a rectangular lattice . a ray 1 emanating from the feed 68 , impinges on the first reflector 60 and after being diffracted in the form of a higher order floquet &# 39 ; s mode , becomes the incident wave 2 for the second plate 65 . the second plate 65 is designed to excite ( 0 ,- 1 ) floquet &# 39 ; s mode when illuminated by ray 2 that originates from the first plate . as frequency shifts within an operating band , both the incident wave on the second plate 65 and the diffracted wave from the same plate undergo beam squint . therefore , the squint of ray 3 shown in fig6 is cancelled by the squint of the incident wave 2 on second plate 65 , which leads to stabilisation of the propagation of the outgoing ray 3 . a variational expression is derived below for use in determining dimensions of the second plate lattice so that the required cancellation occurs within the operating frequency range . ray 1 represents a spherical phase front , which is transformed into a planar phase upon reflection from the first plate 60 as ray 2 . since the second plate 65 is a regular periodic structure with rectangular lattice , ray 3 represents a planar phase front as well . noting the above descriptions of the rays 1 , 2 , and 3 and setting ( m , n ) as ( 0 ,- 1 ), φ . sub . ( 0 , 1 ). sup . ( 1 ) = 270 ° and φ inc . sup . ( 1 ) = 90 ° in equation 2 , the following relation results ; ## equ2 ## where θ inc . sup . ( 1 ) is an incident angle of the plane wave 1 travelling along a line that connects the phase centre of the feed 68 and the central region of the first plate 60 , θ . sub . ( 0 , 1 ). sup . ( 1 ) is the propagation direction of the diffracted plane wave 2 from the first reflector 60 , t y . sup . ( 1 ) is the lattice dimension along y in the central region of the reflector and λ 0 is the free space wavelength . the characteristics of the central region of the reflector are used in equation ( 4 ). beam squint of the outgoing wave from the central region of the first reflector 60 represents the beam squint caused by the whole reflector . this is due to the fact that the lattice configuration of the first reflector 60 is designed such that outgoing diffracted rays travel in a predetermined direction regardless of which locality is illuminated . a similar relation is determined for the second reflector 63 ; ## equ3 ## where θ inc . sup . ( 2 ) is the incident angle of the plane wave 2 that illuminates the second plate 65 , θ . sub . ( 0 , 1 ). sup . ( 2 ) is the propagation direction of the diffracted plane wave 3 from the second reflector 65 , t y . sup . ( 2 ) is the lattice dimension along y for the second reflector 65 and λ o is the free space wavelength . according to the present embodiment , the second plate 65 is a regular finite periodic structure of rectangular gratings . a small shift in the operating frequency of the antenna shown in fig6 causes a differential variation in the angular parameters of eq . ( 5 ). the following relation results between the angular variations and the frequency variations : ## equ4 ## recalling that the objective of the present invention is to cancel the beam squint resulting for the ray 3 , δθ . sub . ( 0 , 1 ). sup . ( 2 ) in the above equation is set to zero for a planar reflector array according to the invention . also it is evident from the geometry shown in fig6 that , combining equations ( 6 - 9 ), the following relation is defined for the lattice dimension of the second plate 65 ; ## equ5 ## where 0 . sub . ( 0 , 1 ). sup . ( 1 ) is the angle of ray 2 at the centre frequency and δθ . sub . ( 0 , 1 ). sup . ( 1 ) is the variation of the same angle throughout the operating band . both of these parameters are derived from eq . ( 4 ). calculation of the lattice dimension of the second plate 65 from eq . ( 10 ) ensures the stabilisation of the outgoing ray 3 . the lack of a constraint on t x . sup . ( 2 ), results in a degree of freedom in determining the second plate lattice geometry . this freedom allows optimisation of the second plate parameters to maximise the power coupled into the outgoing ray 3 , the outgoing ( 0 ,- 1 ) mode . the graph shown in fig7 shows simulation results for beam squint of a single planar reflector and a dual planar reflector according to the present invention . the graph of fig7 shows that the use of a second reflector according to the invention suppresses beam squint throughout a wide band . preferably , the size and location of the second reflector 65 is adjusted to maximise the energy that is captured by the second plate 65 and minimise the blockage caused by the first plate 60 . simple geometrical considerations suffice to fulfil these requirements . in an alternative embodiment , the feed is designed to reduce the effects of beam squint . the embodiment uses a feed comprising a plurality of feed elements with a single planar reflector array in order to provide signals of different frequencies from different locations . this , in effect , reduces or eliminates beam squint . referring to fig1 movement of the phase centre of a feed is classified into two types : movements along fm or tt &# 39 ;. as the reflector is located in the far field of the feed , a slight movement of the phase centre along fm does not significantly affect the relative phase of the rectangular grating elements with respect to each other . on the other hand , movement of the phase centre along tt &# 39 ;, changes the relative phase of the elements with respect to each other . this results in movement of main beam peak angle from its original position . array factor formulation is used to calculate the main beam peak angle for different locations of the phase centre . although array factor formulation is not reliable in side lobe or cross - pol . calculations , in the present example it was found to be sufficiently accurate for determining main beam angle . likely , it is sufficiently accurate for other applications of the embodiment of this 2invention . a number of computer simulations were performed and results are shown in fig8 and 9 . first , the phase centre was moved along fm as the antenna was operating in one and the same frequency and the radiation patterns were plotted for different phase centre locations . it is evident from fig8 that the main beam peak angle remains constant for slight movement of the phase centre along fm . the same numerical experiment was repeated for phase centre movement along tt &# 39 ; at two different operating frequencies . comparison of a second curve and a third curve with the antenna operating at 10 . 0 ghz shows that the main beam peak angle changes as the phase centre is shifted slightly along tt &# 39 ;. a closer look at fig9 establishes that , by proper adjustment of the location of feed phase centre along tt &# 39 ;, beam squint cancellation results . proper movement of the phase centre along tt &# 39 ; is shown to stabilise the beam peak angle in spite of a 0 . 4 ghz frequency shift . the antenna feed 168 shown in fig1 is useful for automatically altering the feed centre location relative to the planar reflector array 60 ( not shown ). this antenna feed is composed of four series fed patches 168a - 168d of different sizes . as the frequency changes within the operating band , resonance shifts from one patch to another . this results in a moving radiating region as the frequency is swept within band . the movement of the radiating region of the antenna feed is equivalent to the movement of the phase centre of the feed 168 . the antenna feed shown was designed to minimise return loss and then disposed in a location so as to substantially reduce beam squint . the planar reflector used in conjunction with the four stage feed 168 of fig1 is shown in fig1 . f 1 and f 2 represent the first 168a and last 168d -- smallest and largest -- patches of the four stage feed 168 . in this embodiment , several guidelines were used for optimising the feed design and placing it in a position that would result in beam squint cancellation . the feed dimensions were determined to minimise return loss . once design was complete , location was determined for the feed 168 such that resulting phase centre movement reduces beam squint . the procedure followed in the feed design is discussed in detail in 5 - h . pues , j . bogaers , r . preck , and van de capelle , &# 34 ; wideband quasi - log - periodic microstrip antenna &# 34 ;, iee proc . h , microwaves , opt . & amp ; ant ., 1981 , 128 , ( 3 ), pp . 159 - 163 . the initial design method comprises the following steps : dividing the desired opening band into sub - bands as wide as the bandwidth of a microstrip antenna and the resonant frequencies are selected log periodically ; calculating dimensions of the square patches and the resonant input impedance of each radiator ; dimensioning the branch lines as quarter wavelength transformers between the appropriate resonant input impedance of the resonating patch and 50 ω line where the main feed line is a simple 50 ω line ; and selecting the position of the branch lines so that the distance to the open circuit equals a multiple of half wavelength . the initial design , according to the present embodiment , assumed that a resonating patch appears as 50 ω load at an intersection of its respective branch line and a main line while other elements and the open circuit transform into high impedance at the same cross section . therefore , the incoming wave on the feed line is absorbed and radiated by the resonant patch . after completion of the initial design based on the above guidelines , a commercial software package is used to optimise the return loss performance of the feed 168 . having optimised the feed design , its location with respect to the reflector surface is determined , according to the invention , to suppress beam squint . the terms suppress , reduce , cancel , and eliminate as used herein with respect to beam squint indicate the cancellation of beam squint that would happen using a prior art reflector array antenna with a horn feed , for example . it is clear that using an embodiment with multiple feeds as herein proposed , avoids the problem of beam squint to some degree by moving the phase centre of the feed to compensate therefore . given a desired direction for the outgoing beam , the location of the four stage feed 168 is determined so that a point source that is located at f 1 or f 2 and operates at the resonant frequencies of the respective patches 168a , 168d at either of these two points gives rise to an outgoing beam 2 that travels in one same direction . the geometric locations of f 1 and f 2 are in the far field of the reflector and along ss &# 39 ; and tt &# 39 ;, respectively . as mentioned above , assuming that the planar reflector is an infinite periodic structure of the same lattice as its central region and illuminated by a plane wave propagating along the line that connects the feed phase centre and reflector centre , a straightforward method for calculating direction of higher order modes results . using these assumptions , equation ( 4 ) is used to calculate the direction of ss &# 39 ; and tt &# 39 ;. to apply equation ( 4 ) in this context , it is noted at θ . sub . ( 0 , 1 ). sup . ( 1 ) is the desired direction of the outgoing beam , λ 0 is the wavelength of the operating frequency in free space , t y . sup . ( 1 ) is the lattice dimension along y in the central region of the reflector for θ inc . sup . ( 1 ) is the unknown which gives the ss &# 39 ; or tt &# 39 ; direction depending on the valve provided for λ 0 . in summary , the geometrical location of the feed phase centre is located in the far field of the reflector 60 and on a line that stretches out from the centre of the reflector 60 along a direction given by equation ( 4 ). the same procedure is performed for upper and lower frequencies of the operating band to derive a geometric location of the feed phase centre at these two frequencies ( ss &# 39 ; and tt &# 39 ; shown in fig1 ). when θ 1 ( θ 2 ) is the direction of ss &# 39 ; ( tt &# 39 ;) and f 1 m is perpendicular to the feed surface , the following simple geometrical relation is used to derive f 1 m : ## equ6 ## as is evident to those of skill in the art , such a feed combined with a planar reflector according to the prior art and spaced therefrom as taught herein , results in a reflector antenna having substantially reduced beam squint over prior art planar reflector arrays . of course , there are practical limitations to a number of feed elements that can be implemented in such a structure . these limitations are easily determined through experimentation in design and construction of a multi - element feed for use with the present invention . measurement results for the dual planar reflector are presented below . a dual planar reflector was designed to compensate for beam squint of a single planar reflector antenna . the location of the second plate 65 was selected to minimise blockage by the first plate 60 . simple geometrical observations establish the following relation : ## equ7 ## where &# 34 ; l &# 34 ; is the first plate dimension along y axis and θ . sub . ( 0 , 1 ). sup . ( 1 ) ( θ . sub . ( 0 , 1 ). sup . ( 2 )) is the diffraction angle for the first ( second ) plate at the lowest frequency of the band . maximisation of the energy captured by the second reflector 65 is used as a constraint to determine d off and the dimension of the second reflector 65 . spatial beam broadening is taken into account in enforcing this constraint . fig1 shows a comparison between expectations as set out above and experimental results for beam squint in single and dual planar reflectors . experiments demonstrated that the array factor method provides sufficient accuracy to estimate the beam peak angle of a planar reflector . beam squint was reduced from 15 ° for a single reflector to approximately 3 ° for a dual reflector system in the band of 9 . 5 - 11 . 5 ghz . therefore , a properly designed dual planar reflector system is capable of significantly reducing beam squint over a single planar reflector . since for a given sweep angle as the distance between transmitter and receiver grows so does the sweep of a received signal measured in distance , reducing beam squint by 12 degrees is very significant even for relatively short distances such as those used terrestrially . for satellite implementation , a reduction of 12 degrees in beam squint is even more significant . the co - and cross - pol . radiation patterns for the single and dual planar reflectors are shown in fig1 and 14 . the size of the second reflector in the dual reflector system used for the simulations was not optimised . therefore , the second reflector only partially captures the incoming energy from the first reflector . therefore , lower gain and higher sidelobe levels result for the dual reflector compared to similar parameters for the single planar reflector antenna . on the other hand , the cross - pol . is approximately 5 db lower for the dual reflector antenna . this is due , in part , to the further polarisation selectivity that is introduced by the presence of the second reflector . hence , the cross - pol . of a single planar reflector is improved by using a second reflector . referring to fig1 , a graph showing measured return loss throughout the band of the phase matched feed ( shown in fig1 ) in isolation from the reflector . there are five resonances shown in the measured return loss . the simulated current distributions at various frequencies within the band indicate that the first and last resonance are attributable to the last and first ( largest 168d and smallest 168a ) patches respectively , while the second , third and fourth resonances are due to simultaneous resonance of first patch 168a and second patch 168b , second patch 168b and third patch 168c , and third patch 168c and fourth patch 168d , respectively . typical plots of the current distributions are shown in fig1 for two frequencies . this figure demonstrates the moving nature of the radiating region as the frequency shifts within the band . measured and simulated variation of the beam peak angle versus frequency is shown in fig1 for a single planar reflector fed by a four - stage microstrip feed . the microstrip feed was then substituted by an x - band horn and a similar measurement was performed . the measurement results for this later case are plotted in fig1 for comparison . the beam squint is approximately 5 ° for a microstrip fed single reflector while the same parameter was measured to be 14 ° for a horn fed reflector as the frequency is scanned from 9 . 4 ghz to 10 . 6 ghz . based on beam squint results for the microstrip fed reflector the operating band is divided into two sub - bands , namely , 9 . 4 ghz to 9 . 95 ghz and 10 . 1 ghz to 10 . 5 ghz . beam peak angle variation in each of these bands is less than 2 °. the sudden jump of the beam peak angle in the case of microstrip fed reflector around 9 . 95 ghz seems to correspond to a similar jump in current distribution . during simulation , the radiating region moves abruptly from the third patch 168c to the second patch 168d as the frequency is increased from 9 . 9 ghz to 10 . 1 ghz . the radiating region moves gradually for gradual increases of frequency beyond 10 . 1 ghz . though the above - described embodiments detail maximizing efficiency and minimising losses , this need not be performed according to the invention . preferably , an antenna is designed for maximum efficiency in a particular operation . numerous other embodiments may be envisaged without departing from the spirit and scope of the invention .	7
the present invention provides an 82 sr / 82 rb generator column for use in positron emission tomography cardiac perfusion imaging . in accordance with the invention , the generator column is filled with an ion exchange material that tightly binds 82 sr but not 82 rb . the ion exchange material is compacted to a density that permits fluid solutions to be pumped through the generator column at a rate of at least 5 ml / min at a fluid pressure of 1 . 5 pounds per square inch ( 10 kpa ). after the generator column is packed with the ion exchange material , it is conditioned with a source of excess sodium cations and loaded with a solution of 82 sr . the generator column in accordance with the invention enables low pressure injections using a peristaltic pump and facilitates precision flow control of patient elutions . advantageously , the generator column in accordance with the invention can also be reloaded with 82 sr a plurality of times . this has distinct advantages . first , residue 82 sr remaining in the column from a previous load is not wasted . second , the expense of building and conditioning the generator column is distributed over a plurality of 82 sr loads , so the overall cost of using , 82 rb for cardiac perfusion imaging is reduced . fig1 illustrates the packing of an 82 rb generator column 10 using a method in accordance with the invention . as is known in the art , the generator column 10 is constructed from stainless steel hardware components that are commercially available . in the embodiment shown in fig1 , a pair of swagelok ® reducing adaptors with nuts and ferrules 12 , 14 are connected to opposite ends of a stainless tubing 16 that is packed with an ion exchange material 18 . in one embodiment of the invention , the ion exchange material 18 is an α - hydrous tin dioxide ( sno 2 . xh 2 o , where x equals 1 - 2 ) wetted with a nh 4 oh / nh 4 cl buffer ( ph 10 ). a 25 micron filter 24 closes a bottom of the cylinder 16 at an outlet end thereof . likewise , a 25 micron filter 22 closes an inlet end of the cylinder 16 after the cylinder 16 is packed with the ion exchange material 18 . a feature of the invention is that , unlike prior art generator columns in which the ion exchange material is tightly packed so that high pressure elution is required , the ion exchange material 18 is packed only to a density that permits fluid solutions to be pumped through the generator column at a rate of at least : 5 ml / min at a fluid pressure of 1 . 5 pounds per square , inch ( 10 kpa ). as shown in fig1 , a simple and practical way of accomplishing , the required packing of the ion exchange material 18 is to repeatedly strike a side of the generator column 10 with an instrument 26 , such as a laboratory wrench , with a force that exerts about 0 . 1 joule . experience has shown that between 50 and 100 strikes are required to achieve the required density of the ion exchange material 18 . after packing of the generator column 10 is complete , a funnel 20 that was used to introduce the ion exchange material 18 into the cylinder 16 is removed and the ion exchange material is leveled with the top of the cylinder 16 . the ion exchange material packed into the generator column 10 has a density of not more than 3 g / cm 3 in the packed state . the filter 22 is then placed on top of cylinder 16 and the swagelok adapter , nut and ferrule 12 is secured to the top of the cylinder in a manner well known in the art . as will be understood by those skilled in the art , the generator column 10 in accordance with the invention is constructed under sterile conditions using sterile components and may be pressure tested for leaks after assembly . fig2 is a cross - sectional view of the generator column 10 suspended in a shielding body 40 . the shielding body 40 is made from a dense shielding material 42 , such as lead , tungsten or depleted uranium optionally encased in a stainless steel shell 44 . the shielding body 42 includes a shielding lid 50 having apertures through which extend an inlet line 34 and outlet line 36 . the inlet line 34 is connected to an inlet end 30 of the generator column 10 . the outlet line 36 is connected to an outlet end 32 of the generator column 10 . the inlet and outlet lines are connected to external tubing lines 60 , 62 using luer fittings 56 and 58 . the shielding lid 50 is likewise constructed of a shielding material 52 such as lead , tungsten or depleted uranium encased in a stainless steel shell 54 . after the generator column 10 is packed with ion exchange material 18 , as explained above with reference to fig1 , the generator column 10 must be loaded with 82 sr before patient elutions can begin . as schematically illustrated in fig2 , in one embodiment a syringe pump 80 is used to deliver 82 sr from a supply 70 through an inlet tube 60 to the generator column 10 . the 82 sr is bound by the ion exchange material 18 in the generator column 10 . waste fluid is evacuated through the outlet tube 36 and outlet line 62 to a shielded waste container 90 , in a manner known in the art . fig3 is a schematic diagram of the generator column 10 configured for daily use as an 82 rb source for cardiac perfusion imaging . a source of sterile saline solution 100 is connected to a saline supply tube 104 . the sterile saline solution 100 is pumped through the saline supply tube 104 by a pump 102 . in one embodiment of the invention , the pump 102 is a peristaltic pump . in accordance with an alternate embodiment , the pump 102 is the syringe pump 80 shown in fig2 . as understood by those skilled in the art , the pump 102 is controlled by a control algorithm that regulates a flow rate and volume of the sterile saline solution 100 pumped through the generator column 10 via the inlet tube 104 to provide an 82 rb eluate via an outlet tube 106 connected to a controlled valve 108 . the valve 108 directs the eluate through a delivery line 112 for a calibration elution or a patient elution 110 , or to a shielded waste container 90 . as is further understood by those skilled in the art , control of the system shown in fig3 is complex and not all of the fluid paths and control mechanisms are depicted because elution control is not a subject of this invention . fig4 is a flowchart illustrating principle steps in constructing the generator column 10 in accordance with the invention . the process begins by preparing the ion exchange material and packing the generator column as explained above with reference to fig1 ( step 200 ). the generator column is then conditioned by saturating the ion exchange material 18 with sodium cations . in one embodiment , this is accomplished by passing 120 ml of 2m nacl through the column at a flow rate of 0 . 5 ml / minute followed by waiting for a period of 12 hours . 500 ml of sterile saline solution is then passed through the column at a flow rate of 10 ml / minute . a nondestructive ph test is performed ( step 202 ) by testing a ph of the initial sterile saline solution passed through the column . this nondestructive ph test prolongs the life of the generator column 10 . if it is determined ( step 204 ) that the ph of the generator column 10 is not alkaline , the generator column 10 is defective and it is disposed of ( step 224 ). if the saline solution is determined in step 204 to be alkaline , the generator column is loaded with 82 sr ( step 206 ) in a manner well known in the art using the equipment briefly described above with reference to fig3 . after the 82 sr is loaded into the generator column 10 , the generator column 10 is flushed with 1 . 0 l of sterile saline solution to clear traces of tin : dioxide and any radionuclide impurities . the generator column is then eluted with sterile saline solution and the eluate is tested for trace metals ; sterility ; radionuclide purity ; pyrogens ; and ph ( step 208 ). if all of those tests are passed ( step 210 ) the generator column 10 is ready for use ( step 212 ). if any one of the tests fails , 82 sr is optionally recovered from the generator column 10 ( step 222 ) and the generator column 10 is disposed of ( step 224 ). during generator use , daily testing is performed for the purpose of patient safety and quality control , as will be described in detail with reference to fig5 . as long as all daily tests are passed , the generator column can continue to be used for patient elutions . as understood by those skilled in the art , one of the daily tests is a measure of 82 rb yield . if it is determined in step 214 that one of the daily tests failed , it is further determined whether a reload of the generator column 10 is permitted ( step 216 ). reloading is permitted if the daily test failed due insufficient 82 rb yield only . if the daily test failed for some other reason the generators column 10 cannot be further used , and the 82 sr is optionally recovered ( step 222 ) before the generator column is disposed of ( step 224 ), as described above . if an 82 sr reload is permitted , it is determined in step 218 whether the number of 82 sr reloads of the generator column 10 has exceeded a predetermined reload limit . a generator column in accordance with the invention can , be loaded with 82 sr at least three times before any significant 82 sr breakthrough occurs . if it determined in step 218 that the reload limit has been reached , certain jurisdictions require that the generator column be flushed and the eluate tested for : trace metals ; sterility ; radionuclide purity ; pyrogens ; and ph . if it is determined in step 218 that the reload limit , has not been reached , the process branches back to step 206 and the generator column is reloaded with 82 sr and steps 208 - 218 are repeated . fig5 is a flowchart illustrating principle steps involved in the daily use of the generator column 10 in accordance with the invention . prior to each day &# 39 ; s use of the generator column 10 , the generator column 10 is flushed with 50 ml of sterile saline solution ( step 300 ) in order , to remove any strontium breakthrough from the generator column 10 into the waste vessel 90 . the operator then waits for a predetermined period of time ( step 302 ) before performing a calibration elution ( step 304 ). as is well understood by those skilled in the art , under stable conditions the generator column maintains a 82 sr / 82 rb equilibrium which is achieved after about 10 minutes . consequently , the predetermined wait before a calibration elution is performed is at least 10 minutes . after the required wait , the generator column is eluted with about 15 ml of sterile saline solution at a constant flow rate of about 15 ml / minute . the calibration eluate is tested ( step 306 ) for 82 rb yield and 82 sr breakthrough . in step 308 it is determined whether the yield is above a predetermined radioactivity limit . as is understood by those skilled in the art , the half life of 82 rb is very short ( i . e . 76 seconds ). consequently , in one embodiment the 82 rb yield is measured using a positron counter during the elution , in a manner well known in , the art . in step 310 , it is determined whether the 82 sr , 85 sr breakthrough is less than a predetermined breakthrough limit . as is also understood by those skilled in the art , all jurisdictions define a threshold for permissible levels of 82 sr , 85 sr breakthrough . as is further understood by those skilled in the art , the strontium breakthrough is readily determined by testing the radioactivity of the elution after about 26 minutes has elapsed , at which time the amount of residual 82 rb is insignificant and does not distort the test results . before daily use begins , a cumulative volume of all fluids flushed and eluted through the generator column 10 is computed . since the generator column 10 in accordance with the invention is repeatedly reloaded with 82 sr , each generator column is identified by a unique identifier , in one embodiment a serial number . if the user of a generator column 10 does not have the facility to reload the generator column 10 , the user must return the generator column 10 to the manufacturer , along with a cumulative total of fluid flushed and eluted through the column during that use . likewise , when a reloaded column is supplied to a user , a cumulative volume of fluid used to flush and elute the column during all prior reload ( s ) and use ( s ) is provided to the user . control software used to control a volume of fluid used during generator column 10 flushes and elutions accepts the cumulative volume and stores it . the control software then recomputes the cumulative volume after each subsequent flush or elution of the generator column 10 . that computed cumulative volume is compared ( step 312 ) to a predefined volume limit . in accordance with one embodiment of the invention , empirical data has shown that 10 to 30 litres of sterile saline solution 100 can be pumped through the generator column 10 before significant 82 sr breakthrough is experienced , so the volume limit may be set between 10 and 30 litres . if each of the tests 308 - 312 is successfully passed , patient elutions ( step 314 ) may be performed in a manner well known in the art . after each elution , it is necessary to wait a predetermined period of time , about 5 to 10 minutes , ( step 316 ) to permit 82 rb to regenerate . after each elution , the cumulative volume is recomputed by adding to the cumulative volume a volume of fluid pumped through the generator column 10 during the patient elution . then it , is determined whether the control system date has , changed , i . e . a new day has begun ( step 318 ). if not , the cumulative volume is compared to the predetermined volume limit . if the volume limit has been exceeded , the generator column is disposed of ( step 324 ). if it is determined in step 318 that the control system date has changed , the generator column 10 must be flushed and re - tested per steps 300 - 312 , as described above . if those tests determine that the 82 rb yield is less than a predetermined limit ( step 308 ) then it is determined in step 320 whether the reload limit has been exceeded and if not the generator column 10 is returned for reload and pre - use testing ( step 322 ). otherwise , the generator column is disposed of ( step 324 ). it should be noted that if any of tests 308 - 312 fail , the generator column 10 may be returned to the manufacturer who determines whether the generator column 10 can be reloaded ( step 320 ) and disposes of the generator column 10 ( step 324 ) if it cannot be reloaded . the generator column 10 in accordance with the invention reduces the expense of cardiac perfusion imaging while ensuring compatibility with 3d pet imaging systems by enabling low pressure , low flow rate elutions that can be precisely flow controlled . research has conclusively established that the generator column 10 in accordance with the invention remains sterile and pyrogen - free for a period of at least six months when used in accordance with the procedures and limits described above . although the invention has been explained with reference to 3d pet imaging systems , it should be understood that the generator column 10 is equally compatible with 2d pet imaging systems and provides the same advantages of low cost , precise flow control , low pressure and low flow elution and a long service life . the embodiment ( s ) of the invention described above is ( are ) intended to be exemplary only . the scope of the invention is therefore intended to be limited solely by the scope of the appended claims .	0
for illustrative purposes the invention is shown as applied to an upright single door household refrigerator indicated generally at 20 . it will be understood , however , that the invention may be utilized in the construction of a wide variety of refrigerator cabinets including , for example , refrigerators having separate doors for the fresh food and frozen food compartments arranged vertically one above the other or side by side or for food freezers . with more particular reference to fig1 the refrigerator 20 comprises a main insulated cabinet 22 supported on a base 24 , the front of the cabinet being closed by a conventional door structure 26 which may be a single unit , as illustrated , or may be a dual unit depending upon the internal configuration of the refrigerator , the details of which do not form a part of the present invention and have been omitted for clarity . the major components , which comprise the cabinet , are illustrated separately in fig2 and include , in addition to the base 24 , an outer shell 28 , a plastic liner 30 and a rear panel 32 . it is a feature of the invention that the outer shell 28 is formed from a single piece of sheet metal preferably prefinished with the usual vinyl or enamel coating . the shell forms the top , side , and bottom walls 34 , 36 , 38 and 40 , respectively , of the insulated portion of the cabinet . as shown in fig4 the end edges of the shell are joined at one lower corner of the cabinet , the lower edge of the side wall 38 being inturned to form a flange 42 overlying the end of the bottom shell wall 40 to form a seam or joint held together as described below . as shown in fig3 the front and rear edges of the shell 28 are formed to receive and retain the liner 30 and the back cover plate 32 without separate attachment means . with continued reference to fig3 the forward edge of the shell 28 is turned inwardly in the form of an s - shaped section , the outer leg 44 providing a flat surface extending around the cabinet against which the door 26 seals . the two inner legs 46 and 48 of the s - shaped section provide a recess for the reception of a peripheral flange 50 formed integrally with the plastic liner 30 . also received between the legs 46 and 48 is a hot gas tube 52 connected to the refrigeration system , the tube extending around the top and two sides of the forward edge of the cabinet to prevent the accumulation of moisture at the front face of the cabinet . to insure a tight friction fit and seal between the parts , the outermost edge of the flange 50 is provided with an offset portion 54 which engages the innermost leg 48 of the s - shaped section while the main body of the flange engages the center leg 46 of the section . at its rear edge the shell is formed to provide a u - shaped section 56 with an inturned center leg 58 . received in u - shaped section is a flange 60 which extends around the periphery of the rear panel 32 . a plurality of locking tabs 62 , struck out from the body of the flange 60 , extend over the inner end of the inner leg 58 to hold the parts in assembled relation after the rear panel is snapped into place . in the manufacture of the shell 28 a piece of prefinished flat sheet stock is first punched or die cut to the form shown in fig5 . the flange portions along the forward and rearward edges of the shell are then formed after which the shell is bent along the dotted lines and brought into essentially its final configuration . the side edges of the blank from which the shell is formed are suitably notched as at 63 to accommodate the bending and to form smooth corner joints as shown in fig2 . when the shell is brought to final configuration as shown in fig2 openings 64 and 66 , punched out of the panel 40 and flange 42 , respectively , are brought into alignment as shown in fig4 . plastic corner pieces 67 as shown in fig6 are then snapped into place to cover the exposed corner joints on the front face of the shell . the base 24 , which is also of one - piece construction is formed in similar fashion from a sheet of prefinished stock . when formed in final configuration it is generally of u - shaped section having a main vertical leg 68 and upper and lower parallel inturned sections 70 and 72 , respectively . prior to the final bending operations , a plurality of hat - shaped projections 74 are struck upwardly from the upper flange 70 , the hat - shaped sections being equal in number and spacing and slightly smaller in diameter than the openings 64 and 66 formed in the cabinet shell . after the shell and base are formed to final configuration , they are assembled as shown in fig4 with the hat - shaped projections extending through the aligned openings in the shell . the hat shaped projections are then deformed by a stamping operation to the dotted line configurations shown in fig4 thus simultaneously locking the ends of the shell together , locking the base to the shell , and locking the base in final configuration . preferably the base is so arranged that its ends meet at a rear corner of the refrigerator for reasons of appearance . after assembly of the base to the shell , tubing for the refrigeration system is assembled between legs 46 and 48 of the formed front edge of the shell as shown in fig3 . the plastic liner 30 , which is also of one - piece construction and is formed in accordance with conventional methods , is then installed from the front of the cabinet by snapping the flange 50 into the front cabinet flange construction . to facilitate this operation the flange 50 is formed to the configuration shown in fig6 being of reduced depth adjacent the corners of the cabinet . when the liner is to be fitted into the shell the liner is deformed by pressing the sides inwardly , thus foreshortening the liner sufficiently to permit the outer edge of the flange 50 to pass inwardly of the inner edge of the shell flange structure . when the liner is released it snaps into the position shown in fig6 the liner being securely held in position and forming a tight peripheral seal . after assembly of the liner , the rear panel is snapped into place . the basic cabinet structure is then completed by injecting liquid foam components through suitable openings provided in the rear panel wall in accordance with conventional techniques to fill the entire space between the liner and the shell and between the liner and the rear panel with insulation which , upon hardening , also contributes substantially to the overall structural rigidity of the cabinet structure . the door structure 26 is then installed using conventional hinge and lock mechanisms . the cabinet construction of the present invention may accommodate any desired type of refrigeration system . the back panel 32 provides a convenient place for mounting the usual exterior condenser , and the back panel and liner are provided with complementary recesses 78 and 80 , respectively , to accommodate a conventional compressor , both the condenser and compressor being installed after assembly of the cabinet .	8
in the remainder of the description , analogous , similar or identical elements will be designated by the same reference number . in the remainder of the description an axial and radial orientation will be adopted , indicated by the arrows ‘ a ’ and ‘ r ’ in fig1 . in addition , radial faces oriented towards the middle of the core will be termed internal faces while the faces oriented in an opposite direction will be termed external faces . the internal and external radial faces are therefore axial end faces of the core . likewise , axial faces oriented towards the rotation axis of the shaft will be termed internal faces while axial faces oriented in an opposite direction will be termed external faces . referring to fig1 , this depicts a rotary electrical machine of the prior art , in the present case an alternator with internal ventilation of the polyphase type for a motor vehicle with a thermal engine functioning in alternator mode . naturally the alternator can also be reversible and consist of an alternator - starter also functioning in electric motor mode in particular in order to start the thermal engine of the vehicle as described in the document fr a 2 745 445 ( corresponding to u . s . pat . no . 6 , 002 , 219 ). when the machine is functioning in alternator mode it converts mechanical energy into electrical energy like any alternator . when the machine is functioning in electric motor mode , in particular in starter mode for starting the thermal engine of the vehicle , it converts electrical energy into mechanical energy . this machine comprises essentially a casing 10 and , inside it , a rotor 12 rotationally integral with a shaft , rotor shaft , single - piece shaft or central shaft 14 , referred to as the rotor shaft , and a stator 16 that surrounds the rotor 12 and comprises a body in the form of a packet of metal sheets provided with recesses , for example of the semi - closed type , for mounting a stator coil 18 forming , on each side of the stator 16 at each axial end thereof , a coil end . this stator coil 18 comprises for example a set of three - phase windings in a star or delta , the outputs of which are connected to a bridge rectifier ( not shown ) comprising rectifying elements such as diodes or transistors of the mosfet type , in particular when the machine is of the reversible type , and consists of an alternator - starter as described for example in the document fr - a - 2 . 745 . 445 ( u . s . pat . no . 6 , 002 , 219 ). the windings are obtained by means of a continuous electrically conductive wire covered with an insulating layer and mounted in the relevant recesses in the body of the stator 16 . in a variant that is not shown , for better filling of the recesses of the body of the stator 16 , the windings are produced by means of conductors in the form of bars , such as pins , connected together for example by welding . according to another variant that is not shown , in order to reduce the degree of ripple and magnetic noise , the stator coil 18 comprises two sets of three - phase windings to form a composite stator winding device , the windings being offset by thirty degrees electrical as described for example in the documents us - a1 - 2002 / 0175589 , ep - 0 . 454 . 039 and fr - a - 2 . 784 . 248 . in this case two bridge rectifiers are provided and all combinations of three - phase windings in star and / or delta are possible . in general terms the alternator is of the polyphase type and the bridge rectifier or rectifiers in particular rectify the alternating current produced in the windings of the stator 16 to a dc current in particular in order to charge the battery ( not shown ) of the motor vehicle and supply the loads and electrical consumers in the onboard system of the motor vehicle . the rotor 12 is produced in the example shown in the form of a claw rotor , as described for example in the documents us - a1 - 2002 / 0175589 and ep - a1 - 0 . 454 . 039 , comprising two pole pieces 20 , 22 , here axially juxtaposed and each having an annular - shaped transverse flange 24 provided at its external periphery with claws 26 . each claw 26 comprises an implantation portion 28 transversely oriented in the plane of the flange 24 concerned . this implantation portion 28 is extended at its external periphery by a tooth 30 of axial orientation overall . an annular air gap exists between the external peripheral face 32 of the teeth 30 and the internal periphery of the body of the stator 16 . the teeth 30 are overall trapezoidal or triangular in shape and are directed axially towards the flange 24 of the other pole piece 20 , 22 , the tooth 30 of one pole piece 20 , 22 penetrating the space existing between two adjacent teeth 30 of the other pole piece 20 , 22 , so that the teeth 30 of the pole pieces 20 , 22 are interleaved . an excitation coil 34 is located axially between the flanges 24 of the pole pieces 20 , 22 . it is carried by a part of the rotor 12 in the form of a cylindrical annular core 36 coaxial with the shaft 14 , which comprises a central bore 37 . the core 36 here consists of two axially distinct portions , each of which is produced in one piece with associated pole pieces 20 , 22 as shown in fig1 . according to a variant that is not shown , the central core 36 consists of a single piece and is distinct from the pole pieces 20 , 22 , which are arranged axially on each side of the core 36 . in the remainder of the description , the term ‘ coil ’ without qualification will be understood to be the excitation coil 34 rather than the stator coil 18 . the excitation coil 34 is therefore located in the space delimited radially by the claws 26 of the pole pieces 20 , 22 and the central core 36 . the pole pieces 20 , 22 and the core 36 are preferably made from ferromagnetic material and have the rotor shaft 14 , also made from ferromagnetic material , passing through it coaxially . for this purpose , each pole piece 20 , 22 comprises a central or fixing bore 38 that passes axially through the flange 24 and extends the central bore 37 of the part of the core 36 concerned . the wire of the excitation coil 34 is in fig1 wound on a support made from electrically insulating material ( not shown ) mounted , preferably forcibly , on the external periphery of the core 36 . this support here has a cross section roughly in the shape of a u in order to isolate the excitation coil 34 from the flanges 24 of the pole pieces 20 , 22 . according to a variant that is not shown , when the core 36 is in one part , the wire of the excitation coil 34 is wound on an insulator fixed to the core 36 and is conformed so as to prevent any contact with the flanges 24 and the teeth 30 of the pole pieces 20 , 22 . when the excitation coil 34 is activated , that is to say supplied electrically , the pole pieces 20 , 22 and the core 36 , which are produced from ferromagnetic material , are magnetized and the rotor 12 becomes an inducing rotor with the formation of magnetic poles at the claws 26 with teeth 30 on the pole pieces 20 , 22 . this inducing rotor 12 creates an induced alternating current in the stator 16 induced when the shaft 14 turns . the shaft 14 of the rotor 12 carries at its front end a pulley 40 belonging to a device for transmitting movements by means of at least one belt ( not shown ) between the alternator and the thermal engine of the motor vehicle , and carries at its rear end collecting rings 42 connected by cabled connections ( not shown ) to the ends of the excitation coil 34 of the rotor 12 . brushes belong to a brush holder shown in a general fashion at the reference 44 and are disposed so as to rub on the collecting rings 42 so as to supply the excitation coil 34 with electric current . the brush holder 44 is connected to a voltage regulator ( not shown ). the casing 10 is here in two parts , namely a front bearing 46 adjacent to the pulley 40 and a rear bearing 48 carrying the brush holder 44 and usually the bridge rectifier or rectifiers and the voltage regulator . the bearings 46 , 48 are hollow in shape and each carry centrally a ball bearing respectively 50 and 52 for the rotational mounting of the shaft 14 of the rotor 12 . for example , as illustrated in fig1 , the bearings 46 , 48 are perforated to allow the cooling of the alternator by the circulation of air . for this purpose the rotor 12 carries at least at one of its axial ends a fan intended to provide this circulation of air . in the example shown , a first fan 54 is provided on the forward frontal face of the rotor 12 and a second fan 56 , more powerful , at the rear face of the rotor 12 . each fan 54 , 56 is provided with a plurality of blades or sleeves 58 , 60 that are fixed to the external radial faces of the flanges 24 . according to a variant that is not shown , the alternator can also be cooled by a heat - transfer fluid , the casing 10 then being configured so as to comprise an appropriate circulation channel for the heat - transfer fluid . it should be noted that , in the example embodiment described , the rotor 12 comprises eight teeth 30 per pole piece and therefore eight pairs of poles . forty eight recesses are therefore provided in the body of the stator in the case in which one set of three - phase windings or two sets of three - phase windings are provided as described in the aforementioned document fr - a - 2 . 737 . 063 , or ninety six recesses in the solutions described in the aforementioned documents us - a1 - 2002 / 0175589 and ep - a1 - 0 . 454 . 039 . naturally the rotor 12 can , depending on the application , comprise a different number of pairs of poles . for example , each pole piece can comprise in a variant six teeth so that the rotor comprises six pairs of poles and the stator 16 or 72 recesses . according to a variant that is not shown , the performance of the machine , namely its power and efficiency , can also be increased using a rotor 12 that comprises , in a known fashion and for example as described in the french patent fr - 2 . 784 . 248 , a certain number of permanent magnets interposed between two adjacent teeth 30 at the periphery of the stator 16 , choosing the number of these magnets so that it is equal to or less than the number of poles on the rotor and their arrangement is symmetrical with respect to the axis of the rotor . for example , four , six or eight pairs of magnets are provided for eight pairs of poles . in a known fashion , the shaft 14 comprises portions with a non - smooth radial driving section or portion 57 , which are here knurled portions with axial serrations , as visible in fig1 , for fixing and driving the pole pieces 20 , 22 and the core 36 . the pole pieces 20 , 22 and the core 36 are thus mounted by force - fitting on the shaft 14 , so that the latter , by means of its serrations , cuts furrows in the central bore of the pole pieces 20 , 22 and in the core 36 when they are force - fitted for rotational connection of the shaft with the core 36 and the pole pieces 20 , 22 . as described previously , such a design of the rotor 12 poses problems when the rotor 12 is produced . the invention therefore proposes a rotor 12 , as shown in fig2 to 6 , that comprises at least one intermediate sleeve 58 interposed radially between each pole piece 20 , 22 and the central shaft 14 , and on which the said pole piece is mounted . in fig2 to 5 the driving portion 57 is force - fitted in a fixing bore 59 produced in the intermediate sleeve 58 distinct from the shaft 14 . in the embodiment in fig6 the shaft is axially force - fitted in a fixing bore produced in the core , the intermediate sleeve issuing from the shaft and being offset axially with respect to the fixing bore . in fig2 to 5 the intermediate sleeve 58 is interposed radially between the non - smooth driving portion 57 of the central shaft 14 and the fixing bore 38 of at least one pole piece 20 , 22 . this intermediate sleeve comprises , as described below , a cylindrical surface 60 coaxial with the shaft 14 and received in a complementary central cylindrical bore 38 , 138 of the associated pole piece 20 , 22 so as to position the pole piece coaxially with the shaft 14 . the portion 57 is here provided with reliefs so that it is non - smooth as in fig1 . the reliefs consist here of a knurling with serrations as in fig1 . according to a first embodiment of the invention that is depicted in fig2 , the rotor 12 is similar to the rotor 12 depicted in fig1 . the rotor 12 thus comprises a central shaft 14 , two pole pieces 20 , 22 that are arranged axially on each side of a core 36 , and an excitation coil 34 that extends radially around the core 36 . however , the rotor 12 comprises here an intermediate sleeve 58 that comprises a central fixing bore 59 . the driving portions 57 of the shaft 14 are force - fitted in the fixing bore 59 of the sleeve 58 . these portions 57 comprise reliefs in the form of serrations belonging to a knurling . the sleeve 58 comprises a cylindrical surface 60 , here axially oriented , that merges here with the external peripheral cylindrical surface of the sleeve 58 . the cylindrical surface 60 , which is by virtue of the invention coaxial as described below with the rotation axis of shaft 14 , is intended to receive the pole pieces 20 , 22 . according to this embodiment of the invention , the sleeve 58 is also fitted in the core 36 , so that the sleeve 58 is interposed radially between the shaft 14 and the core 36 , here in two portions , that is to say in two halves , each of which is made in one piece with its associated pole piece , 20 , 22 . for this purpose , the radial section of the cylindrical surface 60 has a shape complementary to the radial section of the central bore 38 of the pole pieces 20 , 22 . more particularly , the surface 60 has in radial section a circular shape and is in close contact with the internal periphery of the pole pieces 20 , 22 delimiting the axially oriented central bore 38 , which is therefore coaxial with the axis of the shaft 14 . the cylindrical surface 60 ( fig2 ) of the sleeve 58 is fitted in each central bore 38 of the pole pieces 20 , 22 , and consequently in the central bore of the core 36 , here in two halves and which is therefore made in one piece with the pole pieces 20 , 22 , so that the sleeve 58 is interposed radially between the driving portion 57 of the shaft 14 and the pole pieces 20 , 22 . here the sleeve 58 is also interposed radially between the driving portion 57 and the core 36 . more precisely , in fig2 and 3 , as in fig1 , two driving portions 57 are provided , with different axial lengths , namely a front portion longer than a rear portion . the front axial end of the front portion 57 extends in axial projection with respect to the front axial end of the front pole piece 20 and the sleeve 58 . this front portion extends to the rear through its rear end roughly as far as the internal end face or the internal radial face 62 of the core half 36 issuing from the front pole piece 20 and constituting the rear axial end of this core half and of the front pole piece . the rear end of this rear portion 57 extends roughly as far as a shoulder or collar 114 belonging , as in fig1 , to a collar of the shaft 14 adjacent to the rings 42 and therefore to the rear end of the shaft 14 . naturally in a variant the rear driving portion is omitted , all this depending on the torque to be transmitted . the rear end of the sleeve 58 is in abutment on the shoulder 114 , or more precisely on the front face of the collar 114 . the front end of the sleeve 58 is intended to come into abutment on the annular strut 150 in fig1 interposed axially between the front end of the sleeve 58 and the bearing 50 . the sleeve 58 is therefore intended to be mounted for axial clamping between the shoulder 114 and the strut 150 so that it makes it possible to reduce the stresses in the pole pieces 20 , 22 . in this example embodiment the front end of the shaft 14 is fitted in the sleeve 58 according to the method described below . the collar 114 limits the relative axial movement of the shaft with respect to the sleeve 58 and has here an outside diameter less than that of the tubular - shaped sleeve 58 in fig2 and 3 . the axial length of the sleeve 58 is at least equal to the sum of the axial lengths of the core 36 and the fixing bores 38 of each pole piece 20 , 22 . here each axial end of the sleeve 58 extends in the same radial plane as the external radial face of the flange 24 of the associated pole piece 20 , 22 . it should be noted that the strut 150 , in a variant , can also come into abutment on the internal periphery of the flange 24 of the front pole piece 20 . the sleeve 58 here consists of a single piece . however , the rotor 12 can also comprise a plurality of sleeves 58 that are arranged end - to - end around the shaft 14 . advantageously , the sleeve 58 is produced from a ferromagnetic material and preferably from the same material as the pole pieces 20 , 22 and the core 36 . the rotor 12 also comprises means for the axial positioning of the pole pieces 20 , 22 with respect to each other axially along the shaft 14 . in the first embodiment , the axial positioning of the pole pieces 20 , 22 is achieved by the facing internal radial faces 62 , 64 each core half 36 . these faces 62 , 64 respectively delimit the rear axial end of the pole piece 20 and the front axial end of the pole piece 22 . this is because , when the pole pieces 20 , 22 are mounted on the shaft 14 , the internal radial faces 62 , 64 of each core half 36 are in abutment against each other , thus allowing the axial positioning of the pole pieces 20 , 22 . it should be noted that each pole piece 20 , 22 comprises respectively at its rear axial end and at its front axial end a mounting bevel to facilitate its mounting on the sleeve 58 . these bevels are advantageously continuous . in addition , the rotor 12 comprises means for rotationally connecting the pole pieces 20 , 22 with the intermediate sleeve 58 , which is itself rotationally connected with here the driving portions 57 of the shaft 14 . here ( fig2 to 4 ) each pole piece 20 , 22 also comprises respectively at its front axial end and at its rear axial end a connection bevel or annular bevel part 66 . as shown in fig2 and 3 , each pole piece 20 , 22 therefore comprises two bevels , namely a connection bevel 66 and a continuous mounting bevel . thus at least one arc of the external circular rim of the central bore 38 of each pole piece 20 , 22 comprises a connection bevel 66 . as shown in fig4 , the connection bevel 66 is able to receive by crimping a deformed material part of the sleeve 58 . for this purpose , the sleeve 58 is advantageously produced from a ductile ferromagnetic material such as soft iron , which is particularly suited to crimping . the hardness of the sleeve is less than that of the central shaft 14 made from ferromagnetic material . in addition , each bevel 66 is here in two annular parts , roughly semicircular , delimited angularly by two radial end faces 68 that make it possible to rotationally lock the pole pieces 20 , 22 around the shaft 14 with respect to the sleeve 58 . it is therefore essential , in order to rotationally fix together each pole piece 20 , 22 and the sleeve 58 , for each annular bevel part 66 to extend only over an arc of the circumference of the central bore 38 of each pole piece 20 , 22 rather than over the entire circumference of the bore 38 . each annular bevel part 66 is filled with the material of the sleeve 58 , which flows , following the crimping operation , into the cavities formed by the bevel 66 . in a variant the bevel 66 comprises a number of parts greater than two , for example 3 or 4 parts . the crimping also makes it possible to lock axially , that is to say in translation , the pole pieces 20 , 22 with respect to the sleeve 58 . according to a variant of the invention that is not shown , the connection bevel is replaced or supplemented by recesses into which the material of the sleeve 58 flows . the circumferential length of the bevel 66 therefore depends on the application , in particular on the presence or not of recesses located between each bevel part . according to a variant of the invention that is not shown , the structures are reversed so that the bevel 66 in at least two parts and / or the recesses are carried by an external ridge of each axial end of the surface 60 of the sleeve 58 , and each pole piece 20 , 22 is crimped in the bevel 66 and / or the recesses . in fig2 to 4 , by virtue of the sleeve 58 , the thickness of the rotor , that is to say the distance between the front face of the front pole piece 20 and the rear face of the rear pole piece 22 , is controlled precisely . according to yet another variant of the invention depicted in fig5 , each pole piece 20 , 22 is fixed to its intermediate sleeve 58 by welding . thus a weld 69 , preferably continuous , is produced between the periphery of the external ridge of the central bore 38 of the pole piece 20 , 22 and the relevant sleeve 58 . it is possible for example to carry out welding of the tig type or welding of the laser type . it should be noted that , compared with the embodiments in fig2 and 3 , the core 36 is in this case integrated in the sleeve and constitutes the central part thereof . more precisely , in this embodiment a hub 158 is provided that replaces the sleeve 58 and the core 36 in fig2 and 3 . this hub 158 comprises a central core 36 that therefore extends in radial projection with respect to a front intermediate sleeve 58 and a rear intermediate sleeve 58 . the front sleeve 58 is dedicated to the mounting of the front pole piece 20 and the rear sleeve 58 to the mounting of the rear pole piece 22 . these intermediate sleeves 58 are arranged axially on each side of the core 36 . the pole pieces 20 , 22 are thus simplified and the central bore , here referenced 138 , of each pole piece is shorter axially than the central bore 38 in fig2 and 3 since it affects only the flange 24 of each pole piece . in addition , for the same outside diameter of the rotor , the height of the flanges 24 of the pole pieces 20 , 22 is reduced since in this embodiment the outside diameter of the surfaces 60 is greater than that in fig2 and 3 . it will be appreciated that , in this embodiment , the thickness of the rotor is controlled even more precisely . it will also be appreciated that wear on the excitation coil 34 is prevented since the distance between the pole pieces is precise , the pole pieces being in abutment against the projecting radial end faces 70 , 72 of the core 36 . in addition the external periphery of the core 36 can be of any shape , for example cylindrical , rectangular or polygonal in shape . naturally , in fig2 to 4 , the pole pieces can be fixed to the sleeve by welding . likewise in fig5 it is possible to fix the pole pieces to the sleeve by crimping . the invention also proposes a method of producing such a rotor 12 . hereinafter , the steps described and the operations that constitute them are numbered for reasons of clarity of the description ; however , these steps and these operations can be performed in any order unless mentioned otherwise . according to the teachings of the invention , the method of producing the rotor 12 of fig2 and 3 comprises a first step e 1 of mounting the intermediate sleeve 58 that is prior to the mounting of each pole piece 20 , 22 . step e 1 of mounting the sleeve 58 consists of axially force - fitting the driving portion or portions 57 of the shaft 14 in the fixing bore 59 of the sleeve 58 until the collar 114 comes into abutment on the sleeve 58 . here the shaft 14 is fitted from the front in the bore 59 in order to cut furrows in the latter by means of reliefs , here in the form of serrations , on the portion or portions 57 . this fitting is achieved with reduced forces compared with those used in fig1 so that the rear end of the shaft 14 with a smaller cross section for mounting the rings 42 is preserved . these rings , in one example embodiment , belong to a collector fitted on the smaller - diameter rear end of the shaft 14 . such a collector is described for example in the document fr a 2 710 200 , to which reference can be made . the production method also comprises a second step e 2 of adjusting the concentricity of each pole piece 20 , 22 with respect to the rotation axis of the shaft 14 . a first operation e 21 of step e 2 is implemented after the first step e 1 of mounting the sleeve 58 . during this first operation e 21 , the surface 60 of the sleeve 58 is produced before the mounting of each pole piece 20 , 22 . the surface 60 is machined in the external peripheral face of the sleeve 58 so that the cylindrical surface 60 is concentric with the rotation axis of the shaft 14 . this operation e 21 makes it possible to correct the lack of concentricity of the surface 60 of the sleeve 58 with respect to the rotation axis of the shaft 14 , due to the uneven plastic deformation of the fixing bore 59 of the sleeve 58 around the driving portion or portions 57 with reliefs , here knurled , of the shaft 14 . it will be appreciated that the sleeve 58 can be standardized in diameter and therefore that an assembly of shaft 14 and sleeve 58 can serve for mounting pole pieces 20 , 22 of different sizes in terms of diameter . the length of the sleeve 58 can easily be adjusted according to the application , the sleeve being obtained in fig2 and 3 from a tube . the second step of adjusting the concentricity e 2 also comprises a second operation e 22 of the machining the central bore 38 each pole piece 20 , 22 , and a third operation e 23 of machining the external peripheral cylindrical face of each pole piece 20 , 22 , that is to say here the external surface of the teeth 30 , in order to define a precise air gap between the rotor and stator of the rotary electrical machine . these last two operations e 22 , e 23 make it possible to adjust the concentricity of the external peripheral face 32 of each pole piece 20 , 22 with respect to the central bore 38 before the mounting of the pole piece 20 , 22 on the shaft 14 . these machining operations e 22 , e 23 can therefore be performed without any risk of damaging the excitation coil 34 . in addition , it is possible to use a lubricant during these machining operations , which makes the machining more rapid and less expensive . then a third step e 3 of adjusting the axial positioning of each pole piece 20 , 22 one with respect to the other is performed . this third step e 3 comprises here only an operation e 31 of machining the internal radial face of the associated half core 36 . this operation e 31 makes it possible to adjust the axial positioning of the pole pieces 20 , 22 with respect to each other . during a fourth step e 4 , the excitation coil 34 is positioned on the core 36 and then a fifth step e 5 of mounting the pole pieces 20 , 22 is performed . during this fifth step e 5 , the surface 60 of the sleeve 58 is fitted in the central bore 38 of the pole pieces 20 , 22 so that the internal radial faces 62 , 64 of each half core 36 are in abutment against each other . the pole pieces 20 , 22 are thus pressed against each other in order to ensure the passage of a magnetic flux between them through their internal radial faces 62 , 64 . this fifth step e 5 is implemented after the first four steps e 1 , e 2 , e 3 , e 4 . finally , a final sixth step e 6 of connection is performed after the step e 5 of mounting each pole piece 20 , 22 . during this step e 6 , the pole pieces and the sleeve 58 are connected together with respect to rotation about the axis of the shaft 14 and with respect to translation , for example by welding or crimping . according to a first variant , depicted in dotted lines in fig3 , of the first embodiment of the rotor 12 , the core 36 forms a single piece which is distinct from the pole pieces 20 , 22 . the sleeve 58 is interposed radially between the shaft 14 and each pole piece 20 , 22 on the one hand and between the shaft 14 and the core 36 on the other hand . the core 36 comprises two external radial end faces , delimiting the axial ends thereof , against each of which the internal face of the flange 24 of each pole piece 20 , 22 is pressed . in this variant , the axial positioning of one pole piece 20 , 22 with respect to the other is achieved by the internal radial face of each flange 24 , which is in abutment axially against a facing external radial face of the core 36 . thus , after easily fitting the excitation coil 34 on the core 36 , the fifth step e 5 is broken down into a step e 51 of mounting the core 36 on the shaft 14 during which the sleeve 58 is fitted in the core 36 and a step e 52 of mounting each pole piece 20 , 22 . preferably , the step e 51 of mounting the core is performed after the first step e 1 of mounting the sleeve 58 and before the fifth step e 52 of mounting each pole piece 20 , 22 . moreover , during the third step e 3 of adjusting the axial positioning , the operation e 31 of machining the internal faces 62 , 64 of the half core 36 is here replaced by an operation of machining the internal face 62 , 64 of each flange 24 . in addition , to allow a precise axial positioning of one pole piece with respect to the other , the third step e 3 of adjusting the positioning comprises a second operation e 32 of machining each external end radial face of the core 36 . then the step e 52 of mounting each pole piece 20 , 22 is implemented , after the implementation of the first five steps e 1 , e 51 , e 2 , e 3 , e 4 . the pole pieces 20 , 22 are axially fitted on each side of the core 34 on end positions of the cylindrical surface 60 of the sleeve 58 , which thus form cylindrical surfaces able to receive the pole pieces 20 , 22 . according to a second embodiment of the invention depicted in fig5 , the shaft 14 is directly fitted in the hub 158 and therefore in the central part thereof formed by the core 36 . the rotor 12 comprises here , in the aforementioned manner , two intermediate sleeves 58 that are arranged axially on each side of the core 36 and that are produced in one piece with the core 36 , and in which the driving portion or portions 57 of the shaft 14 is or are fitted . the outside diameter of the core 36 is greater than the outside diameter of the surface 60 of each sleeve 58 . thus the core 36 comprises two external end radial faces 70 , 72 that project radially with respect to the sleeves 58 and delimit the axial ends of the core 36 . the surface 60 of each sleeve 58 is fitted in the central bore 138 of the associated pole piece 20 , 22 so that the internal radial face 74 of the flange 24 of the pole piece 20 , 22 , delimiting respectively the rear axial end and the front axial end of the pole piece 20 , 22 , is in abutment against the projecting external radial face 70 , 72 facing the core 36 . the pole pieces 20 , 22 are thus positioned axially with respect to each other . in other words , the surfaces 60 are machined in a simple manner in each external cylindrical face of the axial end portions of the hub 158 comprising the core 36 . in the embodiment depicted in fig5 , each pole piece 20 , 22 is fixed to its associated intermediate sleeve 58 by welding 69 . for this purpose , two bevels 76 , 78 are produced so as to coincide respectively in the external radial face of the flange 24 of the pole piece 20 , 22 and in the external radial face of the associated sleeve 58 . according a variant shown in fig4 , the connection between each pole piece 20 , 22 and its sleeve 58 is effected by crimping . the production method described above is modified in order to be adapted to this second embodiment of the invention . thus the fifth step e 5 is broken down into a step e 51 of mounting the core 36 on the shaft 14 , during which the sleeve 58 is fitted in the core 36 , and a step e 52 of mounting each pole piece 20 , 22 . however , the step e 51 of mounting the core is performed concomitantly with the first step e 1 of mounting the sleeve since the sleeves 58 and the core 36 form a single piece in the form of a hub 158 . the step e 51 of mounting the core is therefore performed before the fifth step e 52 of mounting each pole piece 20 , 22 . in addition , during the third step e 3 of adjusting the axial positioning , the operation e 31 of machining the internal faces 62 , 64 of the half core 36 is here replaced by an operation of machining the internal face of each flange 24 . in addition , to permit a precise axial positioning of one pole piece with respect to the other , the third step of adjusting the positioning e 3 comprises a second operation e 32 of machining each external end radial face of the core 36 . advantageously the second operation e 32 of machining the core 36 is performed after the step e 51 of mounting the core 36 . this is because , when the sleeve 58 is force - fitted on the core 36 , each end face of the core 36 is liable to be deformed . thus , in order to guarantee a precise axial positioning of the pole pieces 20 , 22 and so as to permit optimum contact between each pole piece 20 , 22 and the core 36 , it is preferable to carry out the machining of the core 36 after it is mounted on the sleeve 58 . then the step e 52 of mounting each pole piece 20 , 22 is implemented , after the implementation of the first five steps e 1 , e 51 , e 2 , e 3 , e 4 . the pole pieces 20 , 22 are fitted axially on each side of the core 34 on end portions of the cylindrical surface 60 of the sleeve 58 , which thus form cylindrical surfaces able to receive the pole pieces 20 , 22 . according to a variant , not shown , of the rotor 12 , the core 36 and the two sleeves 58 are distinct elements . the shaft 14 is therefore fitted directly in the core 36 , and the driving portions of the 57 of the shaft 14 are force - fitted in the sleeves 58 , which are distributed axially on each side of the core 36 . the shaft 14 comprises in one embodiment a smooth portion between its two driving portions 57 associated with the sleeves 58 . this smooth portion serves as a centering device for the core 36 , the external periphery of the smooth portion of the shaft being in close contact with the internal periphery of the core 36 delimited by the internal bore of the core 36 . it should be noted that the driving portions 57 are shorter axially than in the embodiments in fig2 , 3 and 5 so that the sleeves 58 are less deformed than in these figures . the method of implementing this variant is similar to the method of implementing the second variant of the first embodiment . however , the step e 5 of mounting the core 36 precedes here the first step e 1 of mounting the sleeve 58 since the core 36 is mounted directly on the shaft 14 rather than on the sleeve 58 as is the case in the first embodiment . in a third embodiment depicted in fig6 , the two driving portions 157 , 257 of the central shaft 14 are shorter axially as in the aforementioned variant and , as in fig2 and 3 , the core of the rotor 12 comprises two portions 36 a , 36 b . a sleeve respectively 258 , 358 is associated with each portion of the core 36 a , 36 b . the sleeves 258 , 358 are externally smooth and are in a single piece with the central shaft 14 . these sleeves 258 , 358 therefore issue from the shaft 14 and have different outside diameters , just like the driving portions 157 , 257 . each portion 157 , 257 axially extends respectively the sleeve 258 , 358 . the portion 157 is adjacent to the collar 114 . the outside diameter of the driving portion 257 is roughly equal to the outside diameter of the sleeve 258 . the outside diameter of the sleeve 258 is less than the outside diameter of the driving portion 157 . the outside diameter of the sleeve 358 is less than the outside diameter of the portion 257 and is therefore less than the outside diameters of the sleeve 258 and of the portion 157 with the largest outside diameter . the internal bores of the portions 36 a , 36 b are also stepped in diameter . each core portion has internally two portions with different diameters in order to cooperate respectively each with one of the portions 157 , 257 and the associated sleeve 258 , 358 of the shaft 14 . as can be seen in this fig6 the portion 36 b has a first part with an inside diameter less than that of its second part . this first part is delimited centrally by a cylindrical centering bore intended to come into close contact with the smooth external periphery of the sleeve 358 thus constituting a centering sleeve for the portion 36 b and the pole piece 20 . the second part of this portion 36 b is shorter axially than the first portion and is intended to come into engagement with the driving portion 257 that is harder than the core portion 36 b so that , when the shaft 14 is force - fitted in the portion 36 b , the portion 257 cuts furrows in the second part for rotational connection of the shaft 14 with the pole piece 20 . the second part is therefore delimited centrally by a fixing bore . likewise the portion 36 a has internally two parts , referred to as the third and fourth parts , with different diameters . the third part has an inside diameter less than that of the fourth part . this third part is delimited centrally by a cylindrical centering bore intended to come into close contact with the smooth external periphery of the sleeve 258 , thus constituting a centering sleeve for the portion 36 a and the pole piece 22 . the fourth part of this portion 36 a is shorter axially than the third part and is intended to come into engagement with the driving portion 357 that is harder than the core portion 36 a so that , when the shaft 14 is force - fitted in the portion 36 a , the portion 357 cuts furrows in the fourth part for rotational connection of the shaft 14 with the pole piece 22 . the fourth part is therefore delimited internally by a fixing bore . thus the inside diameter of the first part is less than the inside diameter of the second part , roughly equal to the inside diameter of the third , which is less than the inside diameter of the fourth part . the result of the above and fig6 is that each intermediate sleeve 258 , 358 comprises at its external periphery a cylindrical surface coaxial with the central shaft 14 , which is associated with each pole piece 20 , 22 and which is received in a complementary central cylindrical bore of the associated pole piece 20 , 22 , so as to position the associated pole piece 20 , 22 coaxially with the shaft 14 . each intermediate sleeve 258 , 358 is interposed radially between the core portion 36 a , 36 b and the shaft 14 . in this fig6 the second part emerges at the internal end face 62 of the portion 36 b while the fourth part emerges at the external end face of the portion 36 a . a groove 300 is provided at the front end of the shaft 14 . during an operation of crimping the external face of the pole piece 20 the material of the pole piece 20 is made to flow into this groove 300 so that the pole pieces 20 , 22 are finally locked axially between the collar 114 and the material 301 of the pole piece 20 . thus the sleeves 258 and 358 and the pole pieces 20 , 22 are machined in advance . the step e 1 of mounting the sleeves 258 , 358 consists of producing a single - piece shaft with the sleeves 258 , 358 . the second step e 2 of adjusting the concentricity is easier since the first operation e 21 of step e 2 consists of machining the external periphery of the sleeves 258 , 358 of the single - piece shaft 14 , steps e 22 , e 23 , e 3 , e 4 being performed in the aforementioned manner . it should be noted that , during step e 23 , helical grooves 302 are produced at the external periphery of the rotor 12 in order to cut the eddy currents developed at the external peripheral face of the pole pieces as described in the document fr 2 774 524 . naturally this is applicable to the other embodiments . step e 5 consists of fitting the sleeves 258 , 358 in the central bore of the pole pieces so that the internal faces of the portions 36 a , 36 b are in abutment against each other and pressed so as to ensure passage of the magnetic flux . this step is performed easily since the sleeve 358 and the driving portion 257 pass through the cylindrical central bore of the pole piece 22 without any problem , the sleeve 258 coming into centering contact with the pole piece 22 before the driving portions are force - fitted in the second and fourth portions of the pole pieces 20 , 22 . afterwards the crimping in the groove 300 is carried out , the collar 114 being in abutment on the pole piece 22 so that step e 6 is simplified . for the requirements of the description , the rotor 12 has been described here arranged in an alternator . however , the rotor 12 is not limited to this application . in a rotor produced according to the prior art , the force that is necessary for mounting the pole pieces directly on the driving portion of the shaft is very high . consequently the axial distance between the two pole pieces is poorly controlled and it is necessary to provide a wide tolerance gap . by virtue of the teachings of the invention , the force sufficient for mounting the pole pieces 20 , 22 on their associated intermediate sleeve 58 is sufficiently reduced to substantially decrease this tolerance gap . in a rotor according to the prior art , it is thus necessary to provide a large clearance between each axial end of the excitation coil and the flange of each pole piece . the rotor 12 produced according to the teachings of the invention makes it possible to obtain a more precise axial positioning of the pole pieces 20 , 22 with respect to each other . it is therefore possible to install a longer excitation coil 34 between the two pole pieces 20 , 22 , which makes it possible to increase the power of the alternator . advantageously , the precision of the axial distance between the two pole pieces 20 , 22 of a rotor 12 according to the invention is improved compared with that of a rotor according to the prior art . it is thus possible to provide a excitation coil 34 that best occupies the space between the external periphery of the core 36 and the claws of the pole pieces , particularly in the context of the embodiment in fig5 . it is also possible to better adjust the axial length of the stator body with respect to the axial length between the two pole pieces . likewise , the axial distance between the two pole pieces 20 , 22 being better controlled , a rotor 12 according to the teachings of the invention makes it possible to arrange more powerful fans at the two ends of the rotor 12 without increasing the axial size of the alternator . thus the rear fan 56 in fig1 is in a variant a ventilation device comprising two superimposed fans as described for example in the document wo 2004 / 106748 ( corresponding to u . s . patent application 2007 / 041843 ), to which reference should be made . this ventilation device with two superimposed fans makes it possible to properly cool the excitation coil ends of the stator coil 18 , in particular when this stator coil 18 comprises , in the aforementioned manner , two three - phase windings in a delta offset by 30 ° and each connected to a bridge rectifier . this arrangement , associated with a mounting of permanent magnets between the teeth 30 , when the number of pairs can be less than or equal to the number of pairs of poles of the rotor , makes it possible to properly adjust the characteristic curve of the alternator ( current intensity according to the number of revolutions per minute of the alternator ) according to the application . another advantage is that it is also possible to reduce the axial size of the alternator . the ratio between the outside diameter of the core and the outside diameter of the rotor can also be better controlled . in general terms the power of the alternator is better controlled and the losses thereof are reduced . by virtue of the invention it is possible not to modify the shaft 14 of the rotor 12 and therefore to use a shaft 14 of the standard type . naturally all combinations are possible . thus in fig5 the internal bore of the hub 158 can be configured like that in fig6 and therefore comprise four parts for receiving the shaft 14 in fig6 . the groove 300 can comprise annular sectors separated by bands of material , each sector being filled by the material of the pole piece , which flows following the crimping operation so that a rotational locking is achieved as in fig3 and 4 . the presence of the collar 114 is not obligatory , the movement of the shaft being able to be programmed by means of a device . the driving portions 57 , 157 , 257 can have another shape and comprise for example a plurality of projections . while the form of apparatus herein described constitute a preferred embodiment of this invention , it is to be understood that the invention is not limited to this precise form of apparatus , and that changes may be made therein without departing from the scope of the invention which is defined in the appended claims .	7
next , exemplary embodiments according to the invention will be described with reference to the drawings . fig1 shows an image forming apparatus 10 according to a first exemplary embodiment of the invention . this image forming apparatus 10 has a main body 12 of the image forming apparatus , a paper feeding apparatus 14 disposed on the lower part of the main body 12 , and a paper discharge unit 16 formed on the upper part of the main body 12 . the paper feeding apparatus 14 has a sheet tray 18 and sheets to be used as a transfer medium are stacked on the sheet tray . a feed roll 20 is disposed on an upper part of one end of the sheet tray 18 , and a retard roll 22 is disposed being opposed to the feed roll 20 . the sheet positioned at the highest position of the sheet tray 18 is picked up by the feed roll 20 and then , the sheet is brushed and conveyed in combination with the feed roll 20 and the retard roll 22 . the sheet conveyed from the sheet tray 18 is temporarily stopped by a resist roll 24 , and at a timing , the sheet goes through between a photoconductor unit 26 and a transfer unit 28 and through a fixing apparatus 30 , and is discharged to the paper discharge unit 16 to be described later by a paper discharge roll 32 . on the front side of the image forming apparatus main body 12 ( namely , the right side in fig1 ), a front cover 11 as a first opening and closing unit is disposed . the front cover 11 is mounted rotatably ( movably ) by an axis 15 as a support unit with respect to the image forming apparatus main body 12 and the front cover 11 is rotated around the axis 15 so as to be opened to the front side of the image forming apparatus main body 12 . in addition , on the upper side of the image forming apparatus main body 12 , an upper cover 13 as a second opening and closing unit is disposed . the upper cover 13 is rotated by an axis 17 as a support unit with respect to for the image forming apparatus main body 12 so as to be opened to the upper side of the image forming apparatus main body 12 . the upper cover 13 is closed so as to overlap the front cover 11 in a closed state , from the front side . in other words , the upper cover 13 as being closed may interfere with the front cover 11 being opening or closing . therefore , unless the upper cover 13 is opened , the front cover 11 cannot be opened . in addition , after closing the front cover 11 , the upper cover 13 is closed . in the interior part of the image forming apparatus main body 12 , the photoconductor unit 26 , the transfer unit 28 , a power source unit 34 , and a control unit 36 are disposed . the photoconductor unit 26 is used as a mounted member detachably mounted in the interior part of the image forming apparatus main body 12 and includes a photoconductor unit main body 38 . for example , four sub units 50 are supported by the photoconductor unit main body 38 . each of sub units 50 has a photoconductor 40 . a charging apparatus 42 used as a charging unit provided with a charging roll for uniformly charging the photoconductor 40 , a developing apparatus 44 used as a developing unit for developing a latent image formed on the photoconductor 40 with a development agent image ( a toner ), a charge removal apparatus 46 used as a charge removing unit for removing electricity from the photoconductor 40 by irradiating a light to the transcribed photoconductor 40 , and a cleaning apparatus 48 as a development agent removing unit for removing the development agent remaining in the photoconductor 40 after transfer is made are provided around the photoconductor 40 . four sub units 50 may include one for forming a yellow toner image , one for forming a magenta toner image , one for forming a cyan toner image , and one for forming a black toner image , from an upstream in a sheet conveying direction , which is the lower side in the gravity direction , and a yellow toner image , a magenta toner image , a cyan toner image , and a black toner image are formed on the surfaces of respective photoconductors 40 . each of four sub units 50 can be attached and detached in the interior part of the photoconductor unit main body 38 . each of optical writing apparatuses 56 includes a laser exposure apparatus and they are arranged on the positions corresponding to respective photoconductors 40 on the rear face side of the photoconductor unit 26 so as to form a latent image by irradiating a laser to the uniformly charged photoconductor 40 . the transfer unit 28 is used as a structure and is arranged in a longitudinal direction being opposed to the photoconductor unit 26 on the front side of the photoconductor unit 26 . the transfer unit 28 has a transfer unit main body 29 . in the interior part of the transfer unit main body 29 , two support rolls 58 are mounted in a vertical direction and a conveying belt 60 is hanged on the two support rolls 58 . in addition , in the interior part of the transfer unit main body 29 , a transfer roll 62 is mounted so as to be opposed to each photoconductor 40 across the conveying belt 60 . the conveying belt 60 is a member for conveying the sheet and serves to realize a conveying function of the sheet ( the transfer medium ). in addition , the transfer roll 62 is a member used for transfer , which is a part of an image forming function . in this way , the transfer unit 28 has at least one member for realizing at least one of the image forming function and the transfer medium conveying function . in the image forming apparatus 10 that is constructed as described above , the photoconductor 40 is uniformly charged by the charging apparatus 42 , a latent image is formed by the optical writing apparatuses 56 , and the latent image is developed by the developing apparatus 44 so as to form a development agent image ( a toner image ). the development agent images formed on the photoconductor 40 are transferred on the sheet conveyed by the conveying belt 60 in the order from the lower one by using the transfer roll 62 of the transfer unit 28 to be fixed on the sheet by the fixing apparatus 30 . fig2 shows the front cover 11 and the transfer unit 28 , fig3 shows the front cover 11 , and fig4 shows the transfer unit 28 . as shown in fig2 and 4 , the transfer unit 28 is disposed on the side of the image forming apparatus main body 12 and by using an axis 94 used as a support unit , the transfer unit 28 is mounted so as to be capable of rotating with respect to the image forming apparatus main body 12 as shown by an arrow direction in the drawing . in addition , as shown in fig2 and 3 , as described above , the front cover 11 is mounted on the image forming apparatus main body 12 by using the axis 15 , and as shown by an arrow in the drawing , the front cover 11 is rotatably opened and closed with respect to the image forming apparatus main body 12 . in fig2 and 3 , the front cover 11 as being closed for the image forming apparatus main body 12 is illustrated . the image forming apparatus 10 according to the first embodiment has a fixing mechanism 130 used as a fixing unit , which is used for fixing the front cover 11 at a closed position . the fixing mechanism 130 has a fixing member 132 and the fixing member 132 is rotatably mounted in the image forming apparatus main body 12 around an axis 134 . in addition , the fixing member 132 has an operation unit ( not illustrated ) that is used for the operation by an operator and a contact unit 140 contacting a protrusion 138 for fixing , which is used for fixing the front cover 11 . in addition , the fixing mechanism 130 has a bias member 146 , for example , made of a coil spring , and the bias member 146 biases the fixing member 132 so as to be rotated around the axis 134 in a clockwise direction around the axis 134 . although the fixing mechanism 130 is disposed on the both sides , the right and left sides of the front cover 11 one by one , namely , two in total , fig2 shows the fixing mechanism 130 located on the left side . a constraining member 70 is mounted on the both sides , namely , the right and left sides of the front cover 11 . the constraining member 70 is used for constraining the front cover 11 and the transfer unit 28 and configures a constraining unit . the constraining member 70 is mounted on the front cover 11 by using the axis 72 to be supported around the axis 72 so as to be capable of rotating for the front cover 11 . in the constraining member 70 , a groove 74 is formed , into which a protrusion 80 of a transfer unit main body , formed on the transfer unit main body 29 as a protrusion portion , can be inserted , and a pressing face 76 for pressing the transfer unit main body &# 39 ; s protrusion 80 is formed . in addition , in a constraining member 70 , for example , a bias member 78 made of an elastic body such as a coil spring is mounted , and the bias member 70 is biased in a direction rotating in an anticlockwise direction around the axis 72 by the bias member 78 . on the both sides , namely , the right and left sides of the front cover 11 , a sliding member 82 is mounted so as to be capable of sliding with respect to the front cover 11 . a guide hole 83 is formed on the sliding member 82 and a protrusion 85 for mounting , formed on the side of the front cover 11 , is inserted into the guide hole 83 . on the protrusion 85 for mounting , for example , one end portion of a bias member 84 made of an elastic body such as a coil spring is mounted , and being pressed by other end portion of the bias member 84 , the sliding member 82 is biased in an inverse direction to the protrusion 85 for mounting ( the upper direction in fig2 ). in addition , on the both sides , namely , the right and left sides of the front cover 11 , a notch 86 is formed so as to be capable of inserting the transfer unit main body &# 39 ; s protrusion 80 disposed on the transfer unit main body 29 . on the lower side of the notch 86 in fig2 , a guide face 88 for guiding a movement of the transfer unit main body &# 39 ; s protrusion 80 is formed . in addition , one end portion of the bias member 98 , for example , made of an elastic member such as a coil spring is fixed to the side face in the inside of the front cover 11 via a fixing portion 90 . the bias member 98 has other end portion contacting the transfer unit main body 29 . therefore , the bias member 98 may press the transfer unit 28 to a main body frame 12 a forming a part of the image forming apparatus main body 12 so as to be rotated around the axis 94 in an anticlockwise direction . therefore , being biased by the bias member 98 , the transfer unit 28 is positioned and fixed to a usage position shown in fig2 where the transfer unit 28 is used for forming an image . due to the bias member 98 , an appropriate figuration other than a configuration that the transfer unit 28 is positioned being pressed to the main body frame 12 a can be selected , for example , a configuration that the transfer unit 28 is pressed to the photoconductor 40 of the photoconductor unit 26 and a configuration that the transfer unit 28 is positioned being pressed to the both of the main body frame 12 a and the photoconductor unit 26 or the like . in other words , the bias member 98 may bias the transfer unit 28 so as to be pressed to at least any of the image forming apparatus main body 12 and a mounted member such as the photoconductor 40 and the photoconductor unit 26 , mounted in the interior part of the image forming apparatus main body 12 . in this way , the bias member 98 is disposed between the front cover 11 and the transfer unit 28 and is used as a bias unit for biasing the transfer unit 28 to the image forming apparatus main body 12 or the like . further , in fig2 , the constraining member 70 , the bias member 78 , the sliding member 82 , the bias member 84 , and the notch 86 or the like disposed only on the left side are illustrated , however , as described above , they are disposed on the both sides , namely , the right and left sides one by one . fig5 shows a state in which the front cover 11 and the transfer unit 28 are assembled in the image forming apparatus main body 12 . further , in fig5 , the illustration of the constraining member 70 is omitted . as shown in fig5 and the above - described fig2 , the transfer unit main body 29 is assembled in the front cover 11 so that the transfer unit main body &# 39 ; s protrusion 80 as a protrusion portion of the transfer unit main body 29 is inserted from the inside into the notch 86 shaped in a reversed l as the notch portion of the front cover 11 . the transfer unit main body &# 39 ; s protrusion 80 contacts the sliding members 82 disposed on the both sides of the front cover 11 via the front cover 11 provided with the notch 86 . in addition , the upper part of the constraining member 70 contacts the upper cover 13 in the closed state as shown in fig2 . then , the contact unit 140 of the fixing member 132 of the fixing mechanism 130 may contact the protrusion for contact 138 , and the front cover 11 is fixed to the image forming apparatus main body 12 . the notches 86 are disposed on the both sides of the front cover 11 in a condition of a reversed l ( namely , shaped in a reversed l ) as described above , and the transfer unit main body &# 39 ; s protrusion 80 disposed in the transfer unit 28 is located at the positions shown in fig2 and fig5 so as to be released from constraint of the constraining member 70 , namely , is located at a constraining released position . with reference to fig6 to 9 , the opening and closing operation of the front cover 11 and the upper cover 13 and the moving operation of the transfer unit 28 will be described below . in fig6 to 9 , the illustration of the fixing mechanism 130 is omitted . in order to open the front cover 11 and the upper cover 13 from a state in which they are closed , as shown in fig6 , the operation to open the upper cover 13 is carried out by the operator . by opening the upper cover 13 , the front cover 11 can be opened moving from the position interfering with a locus of opening and closing of the front cover 11 . then , when the operator operates an operation unit ( not illustrated ) of the front cover 11 , the fixing mechanism 130 is released , and the operation for opening the front cover 11 is carried out . in this time , the transfer unit main body &# 39 ; s protrusion 80 is located at a constraint release position . then , if the front cover 11 is rotated in a clockwise direction around the axis 15 , the transfer unit main body &# 39 ; s protrusion 80 disposed on the transfer unit main body 29 may press down the sliding member 82 that is biased upward ( fig7 ), and when the front cover 11 is further rotated , the transfer unit main body &# 39 ; s protrusion 80 may move to the position of the guide face 88 in the notch 86 over the sliding member 82 ( fig8 ). describing this further in detail , fig8 shows the front cover 11 and the transfer unit 28 when the front cover 11 is opening . here , since the front cover 11 and the transfer unit main body 29 are supported by the support portions ( the axis 15 , the axis 94 ), which are disposed on different positions ( the position displaced horizontally or vertically from the main body of the image forming apparatus ) of the image forming apparatus main body 12 , a relative position with respect to the front cover of the transfer unit main body &# 39 ; s protrusion 80 may move in a vertical direction of the image forming apparatus main body 12 in accordance with opening and closing of the front cover 11 . therefore , in combination with opening of the front cover 11 , the transfer unit main body &# 39 ; s protrusion 80 may press down the sliding member 82 to overleap the sliding member 82 at an opening and closing position . then , when the transfer unit main body &# 39 ; s protrusion 80 moves to the guide face 88 , the transfer unit main body &# 39 ; s protrusion 80 is guided into the guide face 88 and this allows the front cover 11 to open . in accordance with this , the transfer unit 28 may move so as to be rotated in the clockwise direction around the axis 94 . then , the front cover 11 and the transfer unit 28 are continuously rotated in the clockwise direction up to the position where the transfer unit main body &# 39 ; s protrusion 80 contacts a lower end portion 104 of the notch 86 , and then , the front cover 11 and the transfer unit 28 are in the state to be opened with respect to the image forming apparatus main body 12 . fig9 shows a state in progress since the front cover 11 and the transfer unit 28 are opened with respect to the image forming apparatus main body 12 ( not illustrated ) till the front cover 11 shown in the above - described fig4 is closed to be arranged on the position where the transfer unit 28 is used for forming an image . in order to shift a state in which the front cover 11 and the transfer unit 28 are opened with respect the image forming apparatus main body 12 into a state in which the front cover 11 is closed to be arranged on the position where the transfer unit 28 is used for forming an image , the operation by the operator for closing the front cover 11 , namely , the operation for rotating the front cover 11 in an anticlockwise direction around the axis 15 will be carried out . when the front cover 11 moves so as to be rotated around the axis 15 in the anticlockwise direction due to the operation by the operator , the transfer unit main body &# 39 ; s protrusion 80 may move so as to be separated from the lower end portion 104 within the notch 86 as being guided by the guide face 88 of the notch 86 . then , in combination with closing of the front cover 11 , the transfer unit 28 may move in the anticlockwise direction around the axis 94 . when the transfer unit 28 moves in the anticlockwise direction , as shown in fig9 , the transfer unit main body &# 39 ; s protrusion 80 is in a state to be fitted in the groove 74 of the constraining member 70 . in other words , the transfer unit main body &# 39 ; s protrusion 80 is in a state in which the front cover 11 is constrained with the transfer unit 28 each other , namely , a constrained state . in this case , before the transfer unit main body &# 39 ; s protrusion 80 is fitted in the groove 74 , the transfer unit main body &# 39 ; s protrusion 80 may press the face of the sliding member 82 continued to the guide face 88 in a substantially vertical direction . however , since the sliding member 82 is disposed so as to move only in a direction in parallel with the guide face 88 , it is not feared that the transfer unit main body &# 39 ; s protrusion 80 is deviated from the guiding direction of the guide face 88 before the transfer unit main body &# 39 ; s protrusion 80 is fitted in the groove 74 , and the transfer unit main body &# 39 ; s protrusion 80 fails to be fitted in the groove 74 . in this way , the constraining member 70 and the transfer unit main body &# 39 ; s protrusion 80 are used as a constraining unit for constraining the front cover 11 and the transfer unit 28 . here , in order to prevent the constraining member 70 from being released upon receipt of a movement in the clockwise direction due to the force that the transfer unit main body &# 39 ; s protrusion 80 receives from the bias member 98 , it is desirable that the rotational axis 72 is arranged so that the direction of the force that the constraining member 70 receives from the transfer unit main body &# 39 ; s protrusion 80 due to the bias member 98 and a virtual line connecting the transfer unit main body &# 39 ; s protrusion 80 and the rotational axis 72 substantially coincide with each other . with the front cover 11 and the transfer unit 28 shown in fig9 constrained , the left end portion of the bias member 98 contacts the transfer unit main body 29 . therefore , the front cover 11 and the transfer unit 28 are in a state in which one member presses the other member with each other . in addition , in the state shown in fig9 , the transfer unit main body 29 is separated from the main body frame 12 a without contacting the main body frame 12 a . in this way , since the front cover 11 and the transfer unit 28 are constrained and the transfer unit main body 29 is separated from the main body frame 12 a , when closing the front cover 11 , the front cover 11 never receive a force in a direction opened to the image forming apparatus main body 12 due to the bias member 98 . in addition , even in the case that the transfer unit main body 29 contacts the main body frame 12 a , a reaction force that the front cover 11 receives is decreased because the front cover 11 and the transfer unit 28 are constrained . the operator carries out the operation that the operator opens the upper cover 13 from the state shown in fig9 in which the front cover 11 is closed . during closing of the upper cover 13 , the upper cover 13 may contact the constraining member 70 so as to press the constraining member 70 and rotate the constraining member 70 against a bias force of the bias member 78 in the clockwise direction around the axis 72 . then , when the constraining member 70 is rotated in the clockwise direction , the transfer unit main body &# 39 ; s protrusion 80 fitted in the groove 74 is detached from the groove 74 . then , since the transfer unit main body &# 39 ; s protrusion 80 is detached from the groove 74 , constraint between the front cover 11 and the transfer unit 28 is released . since constraint between the front cover 11 and the transfer unit 28 is released , the transfer unit 28 is biased in a direction so that the transfer unit 28 is rotated around the axis 94 in the anticlockwise direction by means of the bias member 98 and the transfer unit main body 29 is pressed by the main body frame 12 a . then , as shown in the above - described fig4 , the transfer unit 28 is positioned and fixed to a usage position where the transfer unit 28 is used for forming an image or the like . fig1 shows the front cover 11 that is used for a second exemplary embodiment of the invention . although the front cover 11 used for the above - described first embodiment is provided with the sliding member 82 , in this second embodiment , the front cover 11 is not provided with the sliding member 82 . in addition , according to this embodiment , a connection mechanism 110 used as a connecting unit for connecting the image forming apparatus main body 12 to the front cover 11 is mounted on the front cover 11 . the connection mechanism 110 has a first connection member 112 and a second connection member 114 . the first connection member 112 and the second connection member 114 are connected so that they can rotate with each other by using an axis 116 . on other end side of the axis 116 of the first connection member 112 , a protrusion 118 is formed toward the side of the front cover 11 , and the protrusion 118 is guided to a guide groove 120 formed on the front cover 11 . in addition , on the other end side of the axis 116 of the first connection member 112 , a press face 113 is formed . the second connection member 114 is mounted rotatably in the image forming apparatus main body 12 by using an axis 122 . in addition , according to this second embodiment , a support unit 124 is disposed on the front cover 11 so as to be protruded toward the inside of the image forming apparatus main body 12 . although the connection mechanism 110 and the support unit 124 are disposed on the both side , the right and left sides of the front cover 11 one by one , namely , two in total , fig1 only shows the connection mechanism 110 and the support unit 124 , which are located on the left side . in addition , the image forming apparatus 10 according to this second embodiment has the fixing mechanism 130 used as a fixing unit , which is used for fixing the front cover 11 at a position where the front cover 11 is closed , as in the first embodiment fig1 shows a state in which the front cover 11 and the transfer unit 28 are assembled in the image forming apparatus main body 12 . fig1 shows such a state that the transfer unit 28 is arranged at a usage position where it is used for forming an image or the like , and the front cover 11 and the upper cover 13 are closed to the image forming apparatus main body 12 . according to the above - described first embodiment , the transfer unit 28 is attached so as to be capable of rotating for the image forming apparatus main body 12 by using the axis 94 . on the contrary , according to this second embodiment , the transfer unit 28 is disposed to the support unit 124 of the front cover 11 so as to be capable of rotating by using the axis 94 . further , the same parts as the first embodiment are given the same reference numerals and the detailed explanation is herein omitted . with reference to fig1 to 15 , the opening and closing operations of the front cover 11 and the upper cover 13 and the moving operation of the transfer unit 28 according to the second embodiment will be described . further , in fig1 to 15 , the illustration of the fixing mechanism 130 is omitted . in order to open the front cover 11 and the upper cover 13 from a state in which they are closed , the operation to open the upper cover 13 is carried out by the operator as shown in fig1 , as in the above - described first embodiment . by opening the upper cover 13 , the upper cover 13 is separated from the constraining member 70 and the front cover 11 can be opened moving from the position interfering with a locus of opening and closing of the front cover 11 . then , when the operator operates an operation unit ( not illustrated ) of the front cover 11 , the fixing mechanism 132 is released , and as shown by an arrow in fig1 , the front cover 11 will start to rotate around the axis 15 in the clockwise direction . when the front cover 11 starts to rotate , in combination with this , the protrusion 118 is guided to the guide groove 120 and the first connection member 112 starts to rotate around the axis 116 in the clockwise direction . then , since the first connection member 112 starts to rotate , the transfer unit main body &# 39 ; s protrusion 80 29 is pressed in a right direction by the press face 113 . then , since the transfer unit main body &# 39 ; s protrusion 80 29 is pressed in the right direction , the transfer unit 28 starts to move so as to rotate around the axis 94 in the clockwise direction in combination with the front cover 11 . fig1 shows the front cover 11 that moves from the state shown in fig1 so as to be rotated around the axis 15 in the clockwise direction being biased by the bias member 98 and the transfer unit 28 that rotationally moves around the axis 94 in the clockwise direction in combination with movement of the front cover 11 . in this state , being pressed to the press face 113 of the first connection member 112 , the transfer unit main body &# 39 ; s protrusion 80 moves to the right side within the notch 86 . then , the transfer unit main body &# 39 ; s protrusion 80 moves to be fitted in the groove 74 of the constraining member 70 so as to be in the state such that the front cover 11 and the transfer unit 28 are constrained each other . in other words , in combination with opening of the front cover 11 , the front cover 11 and the transfer unit 28 are constrained each other . fig1 shows the state that the front cover 11 is further opened from the state shown in fig1 , for example , when the operator carries out the operation for opening the front cover 11 and the front cover 11 moves due to an effect by gravity . in this state , the front cover 11 may rest for the image forming apparatus main body 12 so that the protrusion 118 contacts the lower end portion of the guide groove 120 and the front cover 11 is opened to the maximum for the image forming apparatus main body 12 . fig1 shows the state in progress since the front cover 11 and the transfer unit 28 are opened for the image forming apparatus main body 12 ( refer to fig1 ) till the front cover 11 shown in the above - described fig1 is closed to be arranged on the position where the transfer unit 28 is used for forming an image . in order to shift a state in which the front cover 11 and the transfer unit 28 are opened with respect to the image forming apparatus main body 12 into a state in which the front cover 11 is closed to be arranged on the position where the transfer unit 28 is used for forming an image , the operation by the operator for closing the front cover 11 , namely , the operation for rotating the front cover 11 in an anticlockwise direction around the axis 15 will be carried out . in the state shown in fig1 , the front cover 11 and the transfer unit 28 are constrained each other and the left end portion of the bias member 98 contacts the transfer unit main body 29 . therefore , the front cover 11 and the transfer unit 28 are in the state that one presses other each other . in addition , in the state shown in fig1 , the transfer unit main body 29 is separated from the main body frame 12 a . in this way , since the front cover 11 and the transfer unit 28 are constrained and the transfer unit main body 29 is separated from the main body frame 12 a , when the transfer unit 28 is arranged on a usage position where the transfer unit 28 is used for forming an image or the like , the front cover 11 does not receive a force in a direction of being opened to the image forming apparatus main body 12 from the bias member 98 in the case of closing the front cover 11 , as in the first embodiment . the operator carries out the operation to close the upper cover 13 from the state in which the front cover 11 is closed shown in fig1 . in the progress of closing the upper cover 13 , the upper cover 13 contacts the constraining member 70 so as to press the constraining member 70 and rotate the constraining member 70 around an axis 72 in the clockwise direction against a bias force of a bias member 78 . then , when the constraining member 70 is rotated in the anticlockwise direction , the transfer unit main body &# 39 ; s protrusion 80 fitted in the groove 74 is detached from the groove 74 . then , since the transfer unit main body &# 39 ; s protrusion 80 fitted in the groove 74 is detached from the groove 74 , constraint between the front cover 11 and the transfer unit 28 is released , the transfer unit 28 is biased in a direction so that the transfer unit 28 is rotated around the axis 94 in the anticlockwise direction , and the transfer unit main body 29 is pressed by the main body frame 12 a . then , as shown in the above - described fig1 , the transfer unit 28 is positioned and fixed to the usage position where the transfer unit 28 is used for forming an image or the like . fig1 shows the front cover 11 and the transfer unit 28 that are used for a third exemplary embodiment according to the invention . according to the above - described first and second embodiments , the image forming apparatus 10 has the front cover 11 and the upper cover 13 . on the contrary , in this third embodiment , the upper cover 13 is not disposed but the front cover 11 is only disposed . in addition , the image forming apparatus 10 according to this third embodiment has a fixing mechanism 130 as a fixing unit , which is used for fixing the front cover 11 , as in the first and second embodiments and in addition , according to this third embodiment , the transfer unit 28 is mounted so as to be capable of being rotated for the image forming apparatus main body 12 by using the axis 94 , as in the above - described first embodiment . in addition , according to this third embodiment , a protrusion portion 71 is disposed so as to be protruded in a direction of a paper face , and in the state shown in fig1 , the downward face of an operation unit 136 contacts the protrusion portion 71 . in order to open the front cover 11 from the closed state , the operator may carry out the operation of the fixing member 132 . in other words , the operator may pull the operation unit 136 of the fixing member 132 upward . when the operation unit 136 is pulled upward , the fixing member 132 is rotated around the axis 134 in the anticlockwise direction against the bias force of a bias member 146 . then , since the fixing member 132 is rotated , the contact unit 140 is separated from the protrusion for fixing 138 to be in a state so that the front cover 11 can be opened . the front cover 11 and the transfer unit 28 are continuously rotated in the clockwise direction up to the position where the transfer unit main body &# 39 ; s protrusion 80 is in the state of contacting the lower end portion 104 of the notch 86 , and the front cover 11 and the transfer unit 28 are in the state of being opened to the image forming apparatus main body 12 . further , the same parts as the first embodiment are given the same reference numerals and the explanation thereof is herein omitted . fig1 to 19 illustrate the operation till the front cover 11 is closed and the moving operation of the transfer unit 28 . fig1 shows the state in progress since the front cover 11 is opened for the image forming apparatus main body 12 till the front cover 11 shown in the above - described fig1 is closed to be arranged on the position where the transfer unit 28 is used for forming an image . in order to shift a state in which the front cover 11 and the transfer unit 28 are opened for the image forming apparatus main body 12 into a state in which the front cover 11 is closed to be arranged on the position where the transfer unit 28 is used for forming an image , the operation by the operator for closing the front cover 11 , namely , the operation for rotating the front cover 11 in the anticlockwise direction around the axis 15 will be carried out . in the operation by the operator , if the front cover 11 is moved so as to be rotated around the axis 15 in the anticlockwise direction , the transfer unit main body &# 39 ; s protrusion 80 is guided into the guide face 88 and this allows the transfer unit main body &# 39 ; s protrusion 80 to move within the notch 86 so as to be separated from the lower end portion 104 . then , in combination with closing of the front cover 11 , the transfer unit 28 is moved in the anticlockwise direction in the anticlockwise direction around the axis 94 . in addition , when the transfer unit main body &# 39 ; s protrusion 80 is moved from the state shown in fig1 , the transfer unit main body &# 39 ; s protrusion 80 is fitted in the groove 74 of the constraining member 70 . then , when the transfer unit main body &# 39 ; s protrusion 80 is fitted in the groove 74 of the constraining member 70 , the front cover 11 and the transfer unit 28 are constrained each other . in this way , the constraining member 70 and the transfer unit main body &# 39 ; s protrusion 80 are used as a constraining mechanism for constraining the front cover 11 and the transfer unit 28 in combination with the operation for closing the front cover 11 . with the transfer unit main body &# 39 ; s protrusion 80 fitted in the groove 74 and the front cover 11 and the transfer unit 28 constrained , the left end portion of the bias member 98 contacts the transfer unit main body 29 . therefore , the front cover 11 and the transfer unit 28 are in a state in which one member presses the other member with each other . in addition , in this state , the transfer unit main body 29 is separated from the main body frame 12 a without contacting the main body frame 12 a . in this way , since the front cover 11 and the transfer unit 28 are constrained and the transfer unit main body 29 is separated from the main body frame 12 a , when the transfer unit 28 is arranged on the usage position where the transfer unit 28 is used for forming an image or the like , also in this third embodiment , upon closing of the front cover 11 , the front cover 11 does not receive a force in a direction of being opened to the image forming apparatus main body 12 from the bias member 98 . further , although it is preferable that the front cover 11 does not receive the bias force from the bias member 98 in the case of closing the front cover in any embodiment , there is no problem if the bias force is given to an extent such that the operability of the opening and closing unit is not damaged . from the state shown in fig1 , the operator will carry out the operation of the front cover 11 . in other words , the front cover 11 is moved so as to be rotated in the anticlockwise direction around the axis 15 . then , due to the above - described operation , the protrusion for fixing 138 formed in the front cover 11 is moved from the side of a press face 142 to the side of the contact unit 140 . when the protrusion for fixing 138 is detached from the press face 142 , the fixing member 132 is biased by the bias member 146 to be rotated around the axes 134 in the clockwise direction . then , as shown in fig1 , by rotating the fixing member 132 , the protrusion for fixing 138 is fitted in the contact unit 140 , the fixing member 132 contacts the constraining member 70 , and then , pressing the constraining member 70 , the constraining member 70 is rotated in the anticlockwise direction around the axis 72 against the bias force of the bias member 78 . then , if the constraining member 70 is rotated in the anticlockwise direction , the transfer unit main body &# 39 ; s protrusion 80 fitted in the groove 74 is detached from the groove 74 . then , since the transfer unit main body &# 39 ; s protrusion 80 is detached from the groove 74 , constraint between the front cover 11 and the transfer unit 28 is released . since constraint between the front cover 11 and the transfer unit 28 is released , the transfer unit 28 is biased in a direction so that the transfer unit 28 is rotated around the axis 94 in the anticlockwise direction by means of the bias member 98 and the transfer unit main body 29 is pressed by the main body frame 12 a . then , as shown in the above - described fig1 , the transfer unit 28 is positioned and fixed to the usage position where the transfer unit 28 is used for forming an image or the like . as described above , the invention can be applied to an image forming apparatus such as a copying machine , a facsimile , and a printer having an opening and closing unit and a structure , for example , a transfer unit .	6
there has thus been outlined , rather broadly , the more important features of the invention in order that the detailed description thereof that follows may be better understood and in order that the present contribution to the art may be better appreciated . there are , of course , additional features of the invention that will be described hereinafter and which will form the subject matter of the claims appended hereto . in this respect , before explaining at least one embodiment of the invention in detail , it is to be understood that the invention is not limited in its application to the details of construction and to the arrangements of the components set forth in the following description or illustrated in the drawings . the invention is capable of other embodiments and of being practiced and carried out in various ways . also , it is to be understood that the phraseology and terminology employed herein are for the purpose of descriptions and should not be regarded as limiting . looking at fig1 it can be seen that the feces collection device 2 has a rollable collection housing assembly 4 , a collection blade rotor assembly 6 rotatably affixed at the front of the collection housing assembly 4 , and a telescoping handle assembly 8 pivotally attached to the rear of the housing assembly 4 . looking at the combination of fig2 , 3 , 6 , 7 , 8 , 9 and 11 the collection housing assembly 4 has a generally cuboid physical configuration having a fixed bottom plate 10 with two side wall plates 12 extending therefrom to which a top curved front plate 14 and a rear handle bracket 16 are affixed . bounded by the side wall plates 12 , the bottom plate 10 and the handle bracket 16 is a rear disposal hatch 18 which is pivotally mounted to side wall plates 12 and encloses the back end of the collection housing assembly 4 . also pivotally mounted to the side wall plates 12 and residing between the handle bracket 16 and the front plate 14 is a top bag removal hatch 20 . on the front bottom of the collection housing assembly 4 is an adjustable , spring loaded scoop 22 . the scoop 22 has at least one torsion device 36 that biases the scoop 22 to its fully down position closest to the ground . the sides of the scoop 22 have threaded studs 32 extending normally therefrom and passing through arced slots 34 cut through the side wall plates 12 . these arced slots define the rotatable travel of the scoop 22 from its full down to fully up positions . there are threaded fasteners ( wingnuts ) 35 threadingly engaged with the studs 32 and a flat washer utilized so that the tightening of the threaded fasteners 34 will secure the scoop 22 in a fixed position relative to its fully down position . at the rear of the collection housing there are two fully rotatable caster wheels 24 affixed to the bottom plate 10 . looking at fig3 , 10 , 13 and 14 it can be seen that the collection blade rotor assembly 6 is a multi vaned rotor 42 made of an axle 38 from which a series or set of series of variable length blades 44 extend . the distal and proximate ends of the axle 38 pass through orifices in the side wall plates 12 and are affixed thereafter to substantially identical wheels 40 such that when the wheels rotate , the rotor 42 also rotates within the cavity of the collection housing device 4 . a bushing assembly may optionally be affixed to the side wall plates 12 and utilized to stabilize and smooth out the rotation of the axle 38 . as can be seen in fig1 and 12 the rotor assembly 6 may have differing physical configuration of the blades . however common to all of the rotor blade configurations is the sizing of the blades , relative to each other . experimentation has shown that optimally a series of three blades increasing length works best . in the present invention the front blade is ½ inch shorter than the intermediate blade which is ½ inch shorter than the back blade . in this way the feces is segmented and collected in three horizontal sections . this size differential is best implemented as 1 . 5 , 2 and 2 . 5 inch long blades . this ½ inch increasing blade length in the direction of rotation for the second and third blades in the three blade series has been experimentally proven to best effect collection of solid feces in the dimensions commonly excreted by dogs . when the rotor 42 is rotated such that the back blade resides perpendicular to the ground there is ⅛ inch clearance between the tip of the back blade and the scoop plate . this tolerance of clearance has been experimentally proven to best effect collection of semi - solid feces . the three blade series is repeated at least two times on the axle 38 to form the multi vaned rotor 42 . the leading edge or lip 46 of the longest blade ( the back blade ) is bent 33 degrees from the plane of the blade away from the direction of counterclockwise rotation as represented by arrow 48 . this prevents the collection of unwanted gravel and jamming of gravel between the rotor 42 and the spring loaded scoop 22 . although the lip 46 is bent for the size of gravel commonly encountered there is a broad range of angles that will work better on different sizes of gravel . these range between 10 and 50 degrees . the tip of each of the blades whether bent or not , has been beveled on at least one side to at least 30 degrees . the alternate embodiment blade 43 utilizes the same lip configuration and blade sizing as the preferred embodiment but has the blades configured in a helical manner . looking at fig1 and 14 it can be seen that the scoop 22 is a bucket with and open front and back adapted to ensure that the partial feces contacted and flung backwards by the collection blade rotor assembly 6 travels to its final destination of the internal cavity of the housing assembly 4 rather then back onto the user &# 39 ; s feet or legs . the scoop 22 has orifices in its side walls 50 that allow it to be mounted about the axle 38 for limited pivotable motion about the axle 38 . the scoop 22 can only move through the range of pivotable motion allowed by the physical interference between the studs 32 extending from the scoop &# 39 ; s side walls 50 and the arced slots 34 on the scoop &# 39 ; s housing &# 39 ; s side wall plates 12 through which the studs 32 pass . in the preferred embodiment , the torsion devices 36 are wound springs with one end affixed to the scoop 22 and the other end affixed to the collection housing assembly 4 , although there is a plethora of torsion devices well known in the field that would work equally as well . the scoop &# 39 ; s bottom plate 52 has a pointed tip 54 that is bent upward 33 degrees from the plane of the bottom plate 52 . this helps eliminate the collection of non fecal mater such a stones and twigs . the pointed tip 54 has an included angle of 114 degrees . this configuration works well to slide under the feces and support it from movement while the three rotor blades dissect the feces into three longitudinal sections and fling them into the internal cavity of the housing 4 . fig1 and 14 illustrate the movement of the scoop 22 from its upper position ( fig1 ) to its bottom position ( fig1 ). regardless of the position of the scoop 22 , the ⅛ inch clearance between the tip of the back rotor blade and the pointed tip 54 of the scoop &# 39 ; s bottom plate 52 is always maintained as both rorate about the axle 38 . inside the housing 4 there is a feces collection bag retention flange 60 adapted to secure a feces collection bag 62 for the collection of feces flung into the housing by the action of the collection blade rotor assembly 6 . the flange 60 is constrained by a set of guides in the housing 4 and may be accessed by opening the top bag removal hatch 22 and sliding out the flange 60 with the attached fecal collection bag 62 for disposal . when there is no fecal collection bag 62 installed , the feces flung into the housing 4 will just remain in the inner cavity . the device 2 can then be emptied by tilting rearward the device 2 with the tip handle 64 and opening rear disposal hatch 18 . the tip handle is a curved extension of the top curved front plate 14 and is adapted for three finger operation . looking at fig4 and 5 it can be seen that the handle assembly 8 is both extendable in a telescoping manner via the handles consecutive hollow tube sizes and the spring loaded locking button 26 . the handle t bar 28 is also made of hollow tubing such that a flexible water line 30 can be extended from one side of the t bar 28 , down through the hollow handle telescoping tubes and extend down into the collection housing assembly 4 from the top through a slot formed through the bag removal hatch 20 . with this design , the handle assembly 8 can be pivoted fore and aft to direct a jetted spray of water throughout the internal cavity of the collection housing assembly 4 to cleanse it . for ease of washing the internal surfaces of the housing 4 and the rotor 42 are to be coated in a non sticking surface treatment or coating such as polytetrafluoroethylene ( ptfe ). the water is introduced through a hose connector 66 affixed to one side of the t bar 28 . in operation the user need only open the top bag removal 22 , slide out the feces collection bag retention flange 60 , wrap the open end of a feces collection bag 62 around the flange 60 and reinstall the flange 60 . if the surface for feces collection is extremely rocky , the scoop 22 may be raised to a higher position that the torsion springs bias it to , and the threaded fasteners 34 tightened to secure the scoop 22 in a fixed position . otherwise the scoop 22 will be left in its automatic tensioning mode , biased downward by torsion to the lowest position . the handle assembly 8 is telescopically adjusted to the correct height for the user and the device 2 is pushed over a feces while the user walks at a normal cadence . the combination of the larger front wheels 40 and the pivotable caster wheels 34 at the rear provide optimal turning and steering in tight spaces . the pointed tip 54 of the scoop &# 39 ; s bottom plate 52 slides under the feces and the multi vaned rotor 42 segments the feces into three horizontal sections and flings the sections into the internal cavity of the housing 4 . if a feces collection bag 62 was not initially installed , the user need only empty the housing 4 by tilting the device 2 rearward with the tip handle 64 and opening rear disposal hatch 18 . after emptying the feces collection bag 62 or the housing 4 , a hose is attached to the hose connector 66 on the t bar 28 , the rear disposal hatch 18 and top bag removal hatch 20 are closed , and the water is turned on . the user tilts the handle assembly 8 fore and aft to flush out the internal cavity of the housing . the end of the water line 30 may optionally have a watter spinning or jetting device to direct the water spray pattern to optimally reach all areas of the internal cavity as is well known in the art . it is known that the collection blade rotor 42 may be comprised of various combinations of different sized blades in repeating series or not . however experimentation has shown that using 2 series of the three blade grouping with the blade configurations as detailed herein works optimally for the collection of solid and semi solid feces over a wide variety of terrains . the above description will enable any person skilled in the art to make and use this invention . it also sets forth the best modes for carrying out this invention . there are numerous variations and modifications thereof that will also remain readily apparent to others skilled in the art , now that the general principles of the present invention have been disclosed . it is important , therefore , that the claims be regarded as including such equivalent constructions insofar as they do not depart from the spirit and scope of the present invention .	4
the programmable logic controller together with the inputs - outputs system according to the invention is a logic controller having a basic structure of the type shown in fig1 . each coupler including on / off couplers has a coupler memory me . the dialogue between each coupler c1 , c2 , etc . and the processing unit cpu is structured by logical channels that are characterized firstly by one or several &# 34 ; job &# 34 ; functions . for example for the &# 34 ; counting &# 34 ; job , a logical channel may carry out one or several of the following &# 34 ; job &# 34 ; functions : counting , discounting , counting / discounting , frequency meter , position measurement . secondly , the logical channel is characterized by the physical channels that it uses . for example in the case of a counting coupler with four counters , a logical channel contains physical interface channels for counting sensors such as proximity detectors or optical position encoders and physical channels for inputs from services such as validation of counting or counter pre - selection . the user program is broken down into tasks . a task is a set of instructions periodically executed by the processing unit processor p . the manufacturer &# 39 ; s program activates the inputs - outputs manager i before executing a task in order to acquire information originating from a logical channel . at the end of the task , the manufacturer &# 39 ; s program activates the inputs - outputs manager ( mark i on the fig1 ) to make it send information to the logical channel . a data structure is associated with each logical channel of a given coupler ( see fig2 to 4 ), that we will call language interface . this data structure is invariable regardless of the coupler and regardless of the logical channel . its size and contents depend on the job function to be carried out . it is stored in a coupler memory mc , the contents of this memory being swapped ( received or sent ) on or to an identical memory area in the processing unit memory m2 . the data structure is structured by exchange type ( see fig3 ): periodic input exchange : the contents are sent from memory mc to memory m2 . it generally contains information produced periodically , for example the numeric value of a sensor . periodic output exchange : the contents are received from memory m2 . it generally contains information communicated periodically by the user program . exchange at the request of the user program : this area has parts with contents which are received from memory m2 , and parts with contents which are sent to memory m2 . it contains information processed &# 34 ; non - periodically &# 34 ; by the user program . configuration exchange when the user program is started ; this area is received from memory m2 . it contains information defined by the user to start the job function . the user program accesses information stored in the memory m2 of the processing unit cpu in the form of the data structure using the syntax described above . if a logical channel , for example 0 or 1 is considered , area i contains information that is generated by this logical channel . area q contains orders or commands of the processing unit that are to be sent to the logical channel . area m depends on the job function and may contain &# 34 ; status &# 34 ; type information , specific command parameters , and setting parameters . this information is exchanged at the request of the user program . the status parameters contain channel faults and possibly the operating state of the logical channel . specific command parameters are commands which are different from the q area , only in that they are sent at the request of the user program , for example an order to move to a given position at a given speed . setting parameters are information sent to the logical channel to describe the variable characteristics of the operations part . for example , one of the parameters for an axis control coupler is the gain of the process position . area k contains configuration parameters , in other words parameters of sensors or actuators working with the coupler . these are constants for a given operations part . referring to fig5 the various areas i , q , m and k are also structured into memory sub - areas called object types . these sub - areas are as follows : &# 34 ; bits &# 34 ; sub - area coded x or default sub - area ( if nothing is specified for the object type ): the information stored is binary , for example start counting ; the &# 34 ; words &# 34 ; sub - area coded w : the information stored is of the numeric type coded on 16 bits , for example the numeric value of a temperature sensor . the &# 34 ; double words &# 34 ; sub - area coded d : the information stored is of the numeric type coded on 32 bits , for example the numeric value of a temperature sensor . each sub - area contains several items of information or elements of the same type . a given element is identified by its &# 34 ; rank &# 34 ;, the value of which is equal to the position of the element relative to the beginning of the sub - area . therefore each information element is defined by an object type and a rank inside each area . the rank identifies the position of the element measured from the beginning of the sub - area . therefore each information element is defined by an object type and a rank inside each area . the topological address is defined by the coupler address associated with the logical channel number . couplers such as c1 and c2 installed in the main rack r are accessed by an address equal to the coupler number defined on 1 or 2 digits . for example the address 1 . 0 is the logical channel 0 of the coupler located in slot 1 in the main rack r . % id 1 . 0 will then be the value of the logical counting channel 0 on the counting coupler located in slot 1 in the main rack r . now referring to fig3 exchanges concerning i , m and k are implicitly handled by the manufacturer &# 39 ; s program . a set of user program instructions manages exchanges in the m area between the processing unit and logical channels . m setting parameters are accessible in read / write in the processing unit memory by the user program . a data structure may be associated with each coupler . it is called a coupler language interface and has the same structure and the semantic as the interface associated with the channel . its size and contents depend on the coupler type . the language interface syntax associated with the coupler is : the logical channel may also send information to the processing unit in addition to the various exchange types defined above . this exchange type is called an event controlled exchange . for example in a logical counting channel , exceeding a limit may cause the value of the current measurement ( counter value ) to be transmitted to the processing unit . when an event controlled exchange takes place , the logical channel sends information to the processing unit cpu to update all or part of area i . when an event is received , the manufacturer &# 39 ; s program activates part of the manufacturer &# 39 ; s program associated with this event . thus referring to fig7 it is seen that a &# 34 ; capture order &# 34 ; event generated by the logical channel triggers processing that forms part of the manufacturer &# 39 ; s program . this processing is denoted % evt5 . event controlled processing enables the user to associate a program sequence with each event sent by a logical channel of a coupler to the processing unit . the configuration of the coupler will now be described , with reference to fig6 . it is firstly necessary to choose the coupler family ( on / off , communication , analog , axis positioning or control , counting ), and then to choose a coupler reference ( reference 1 , 2 , 3 , etc . ), belonging to this job . when the coupler has been chosen , a logical channel can then be configured by making it support a number of job functions . for example if a logical counting channel is chosen , the job function will be configured by choosing one or several of the following job functions : counting function , discounting function , counting / discounting function , frequency meter function . the system reserves the processing unit memory area which will be used by the language interface , when associating the job function . the operation is called &# 34 ; instantiation &# 34 ;. when the job function has been chosen , the values in area k and area m can then be defined using the software screens . obviously , it is possible to imagine alternatives and improvements to details , and even to use equivalent means , without departing from the scope of the invention .	6
various examples for the preparation of the coating layers according to the invention are described below . 460 parts by weight of 1 , 6 - hexanediol and 70 parts of trimethylolpropane are esterified with 167 parts of adipic acid , 56 parts of o - phtalic acid and 247 parts of i - phtalic acid , until a free oh radical content of about 4 . 3 % by weight is reached and the acid index ( din 53 . 402 ) is about 1 . the slightly ramified polyesterpolyalcohol thus obtained constitutes the polyalcohol component for the reactive mixture . to the polyesterpolyalcohol , one adds 0 . 1 % by weight of a fluoroalkyl ester as an extending agent and 1 % by weight of bissebacate ( 1 , 2 , 2 , 6 , 6 - pentamethyl - 4 - piperidyle ) as a light - protective agent . for the preparation of the reactive mixture , 100 g of an essentially trifunctional polyisocyanate , namely a biuret of 1 , 6 - hexamethylenediisocyanate , having a free nco radical content of 23 % by weight , is heated with 216 g of the above described polyester polyalcohol , to a temperature of 80 ° c . ; they are agitated at this temperature for 10 minutes . the nco / oh equivalent ratio of the reaction mixture is thus 1 . after these two components are mixed , the reactive mixture is spread with a scraper , forming a layer , which is 0 . 5 mm thick , on flat sheets which have been preheated to 70 ° c . for the hardening of the layer , the coated glass sheets are kept at a temperature of 90 ° c . for 30 minutes , for example , in a thermostatically controlled forced air oven . after the coating layers thus prepared are hardened and conditioned at 20 ° c . under a relative humidity of 50 %, the polyurethane layers are detached from the glass supports so that their mechanical properties can be determined ; the sheets are measured for their traction resistance and extension under traction according to din standard 53455 , as well as the e module conforming to din standard 53457 . resistance to the spread of cracks is also determined according to graves , in compliance with din standard 53515 . in addition , abrasion resistance is determined according to ece standard r - 43 and resistance to scratching according to erichsen is measured on polyurethane layers attached to glass supports . in the determination of scratch resistance according to erichsen , an experimental assembly as described in din standard 53799 is utilized , with the exception that the conical scratching diamond utilized has a conical angle of 50 degrees and a curve radius of 15 μm at the vertex of the cone . to evaluate scratch resistance , the highest applied load of the scratching diamond for which no visible , permanent damage to the surface can be identified , is relied on . the evaluation of the state of the surface of the polyurethane layers is effected visually . the results of the mechanical measurements are summarized in table 1 below . the table also indicates , for the various mechanical properties , the ranges in which the measured values must be located so that the polyurethane coating meets the criteria concerning usage comportment and , specifically , concerning the self - repairing properties . the same procedure as in example 1 is followed , but taking 81 . 3 g of a polyetherpolyalcohol having a molecular weight of about 450 , obtained by the condensation of 1 , 2 propylene oxide with 2 , 2 bis ( hydroxymethyl )- 1 - butanol having a free oh radical content of about 11 . 5 as a polyalcohol , and adding to the polyalcohol , 0 . 05 % by weight with respect to the weight of the polyalcohol , dibutyltin dilaurate , as a catalyst , 0 . 1 % by weight of a fluoroalkyl ester , as an extending agent , 1 % by weight of 1 , 2 , 2 , 6 , 6 - pentamethyl - 4 - piperidyle , as a light - protective agent . table 1__________________________________________________________________________ extentsion resistance traction under to crack e abrasion scratch resistance traction spreading module cloudness resistance n / mm . sup . 2 % n / mm n / mm . sup . 2 % p__________________________________________________________________________limit values 5 - 40 60 5 - 20 2 - 20 4 10of the requiredrangeexample 1 9 . 87 131 . 1 11 . 8 6 . 46 2 . 71 24comparative 10 . 4 115 6 . 5 13 . 0 3 . 5 12example__________________________________________________________________________ table 1 shows that all of the mechanical properties of the layer according to the example are within the required limits . to examine the influence of the open atmosphere on the condition of the surface , a certain number of test pieces are exposed openly to the elements , in this case , for a duration of several months . at the end of this period , no alteration of the surface of the polyurethane layer could be seen . luster measurements indicate a very low rate of loss , under 1 %, of luster . this loss of luster is more than 50 % in the case of the control sample , despite the utilization of a light - protective agent . for the preparation of the reactive mixture , 100 g of an essentially trifunctional polyisocyanate containing 1 , 6 hexamethylenediisocyanate - based isocyanurate radicals , having a free nco radical content of 21 . 5 % by weight , is mixed vigorously , for 10 minutes at 40 ° c ., with 94 . 2 g of a trifunctional polycaprolactone having a free oh radical content of 9 . 3 % by weight . the nco / oh ratio is thus 1 . additives previously incorporated into the the polycaprolactone are 0 . 015 % by weight with respect to the weight of the polycaprolactone , dibutyletain dilaurate as a reaction catalyst , 0 . 1 % by weight of a fluoroalkyl ester as an extending agent and 1 % by weight of bis sebacate ( 1 , 2 , 2 , 6 , 6 - pentamethyl - 4 piperidyle ) as a light - protective agent . after mixing these two components , the reactive mixture is applied , with a scraper , forming a coating which is 0 . 5 mm thick , on glass sheets which have been preheated to 70 ° c . the layer is again hardened at 90 ° c . for a period of 30 minutes in a thermostatically controlled forced air oven . to examine the effects of aging under different surrounding conditions , glass plates coated with this polyurethane layer are kept under these different conditions , and the mechanical and optical properties are subsequently determined . table 2 below is a summary of the results of the mechanical property measurements , with the various test pieces having been exposed to the following operations : test piece a : measurement immediately after the hardening of the polyurethane layer . test piece b : kept for 21 days in the laboratory under normal surrounding conditions . test piece c : kept for 2 hours at 60 ° c . in a forced air oven . test piece d : kept for 7 days at 50 ° c . under relative atmospheric humidity of 100 %. table 2__________________________________________________________________________ extension resistance traction under to crack e abrasion scratch resistance traction spreading module cloudness resistance n / mm . sup . 2 % n / mm n / mm . sup . 2 % p__________________________________________________________________________limit values 5 - 40 60 5 - 20 2 - 20 4 10of the requiredrangetest piece a 24 . 0 119 . 9 9 . 5 8 . 8 2 . 3 34test piece b 22 . 4 100 . 8 11 . 7 11 . 8 2 . 1 46test piece c 24 . 0 121 . 5 13 . 1 9 . 7 2 . 5 41test piece d 29 . 5 114 13 . 8 13 . 1 2 . 15 35__________________________________________________________________________ the measurement results again show that even after the most varied artificial aging treatments , the physical - mechanical properties fall within the required limits , i . e ., no significant alteration in these properties could be seen . another series of test pieces was exposed directly to the elements for several months , by exposing glass panes endowed with the coating layers , to the direct action of the outside atmosphere . after exposure , a visual examination of the coating layer was conducted as well as luster measurements according to din standard 67530 . the visual evaluation indicated that there was no visible alteration of the surface or in the depth of the coating layer . the luster measurements indicate an extremely small degree of decrease in superficial luster , of about 0 . 5 % compared with the values measured on the same samples before exposure to the elements . the coating layer according to the invention can be utilized in all of the aforementioned applications . it is also utilized in combination with a polyurethane coating having energy absorbant properties to form a two - layer sheet , as described , for example , in european patent publication nos . 0 132 198 and 0 133 090 , with this two - layer sheet being advantageously utilized in compound safety panes . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein .	1
for a detailed description of the preferred embodiment the reader is referred to the appended figures in which like components are given like numerals for ease of reference . for quick reference all of the reference numerals are listed in table i below and their corresponding parts identified with the figures in which the parts are identified . the parts may be shown in other figures but are identified by the reference numerals in the listed figures only . referring first to fig1 and 2 , the device is shown in its initial state with the applicator holding body 1 and the applicator plunger body 2 are molded as one plastic part along with and connected by a flexible living hinge 13 . the two bodies are in the form of rectangular leaves or slabs . in fig4 the needle carrier 3 is seen to be captured laterally and vertically by a carrier track slot 31 contacting the carrier sliding track 18 . fig3 shows that actuator pin 11 is captured by applicator locking slot 10 on the needle carrier 3 preventing any angular motion around the pivot point defined by the living hinge 13 . locking slot detent 37 , located in the applicator locking slot 10 , allows a light snap fit between actuator pin 11 and the needle carrier 3 to temporarily retain the needle carrier 3 in this locked position . the distal end of the hypodermic needle 12 is safely stowed in the needle safety cavity 14 . referring now to fig1 , 6 a and 18 , capsule assembly 35 comprising collapsible vessel or container 4 , capsule closure 6 and capsule closure inner ring 28 , is positioned in the applicator holding body 1 . this capsule assembly contains a pre - loaded medication dose in the capsule inner cavity 22 . the inner cavity 22 is sealed by compressing the vessel neck 36 between the capsule closure wall 29 and the capsule sealing ring 30 located on the capsule closure inner ring 28 . this seal is retained by the capsule closure retainer latch 25 snapping into the capsule closure inner ring 28 . the inner cavity 22 is also sealed by membrane 8 located in the capsule closure 6 . the sealing label 34 , as shown on fig1 , seals the capsule luer seal cavity 24 and the membrane 8 from contaminants . the capsule assembly 35 is positioned by capsule holding cavity 5 . due to the elastic properties of the vessel 4 , an additional retainer comprising capsule retaining ring slot 26 on applicator holding body 1 and capsule retaining ring 7 , part of the capsule closure 6 , is required to hold the capsule assembly 35 stable . referring to fig5 and 5a , needle carrier is pushed by means of finger push interface 21 to a position where the actuator pin 11 is in the driving track 9 . this allows angular movement of living hinge 13 between applicator holding body 1 and applicator plunger body 2 . as seen in fig1 , the plastic needle carrier 3 is molded around the hypodermic needle 12 creating piercing needle 20 at the proximal end and hypodermic needle 12 at the distal end . hypodermic needle 12 is thus a double ended canula and sharp at both ends . as seen in fig7 and 8 , folding the applicator plunger body 2 along living hinge 13 toward the applicator holding body 1 drives actuator pin 11 towards the distal end of the applicator holding body 1 in a circular motion as defined by a pivot point along the axis of living hinge 13 . this motion is translated to the needle carrier 3 by means of the driving track 9 . the needle carrier 3 travels through the carrier aperture 16 and along sliding track 18 , captured by carrier track slot 31 , until the circular driving track 9 axis becomes coincident with the axis of the living hinge 13 . at this point the actuator pin 11 travels concentric to the circular driving track 9 and further lateral movement of the needle carrier 3 is stopped . at this point , as seen in fig1 a , the needle carrier 3 has pushed needle 20 through membrane 8 in the capsule closure 6 allowing medication to flow through to hypodermic needle 12 . also , carrier retainer ring 17 has permanently snapped into carrier locking notch 23 and carrier luer seal body 19 on the needle carrier 3 has seated into capsule luer seal cavity 24 to form a luer seal . in the injection phase , further folding of the applicator plunger towards the applicator holding body 1 as shown in fig7 and 8 causes the plunger 15 to contact the vessel 4 . the vessel 4 is made from a pliable elastomer and is collapsed by the plunger 15 which is shaped to substantially conform to the vessel . the vessel collapses , reducing the volume of the inner cavity 22 thereby pushing the contents of the vessel through hypodermic needle 12 . referring now to fig1 – 16 , storage of the needle is shown after injecting the medication . the needle 12 is stowed in a safe position inside plunger 15 by folding the applicator body 2 180 ° allowing the hypodermic needle 12 to pass through the carrier aperture 16 and into the safety slot 27 . continuing to fold causes the hypodermic needle 12 to be sprung to one side by deflecting surface 33 and then captured by snapping back to its normal position in the top of the safety slot 27 . the foregoing description of the invention has been directed to a particular preferred embodiment of the present invention for the purposes of explanation and illustration . it will be apparent to those skilled in the art that many modifications and changes in the apparatus may be made without departing from the scope and spirit of the invention . it is therefore intended that the following claims cover all equivalent modifications and variations as fall within the scope of the invention as defined by the claims .	0
many of the functional units described in this specification have been labeled as modules , in order to more particularly emphasize their implementation independence . for example , a module may be implemented as a hardware circuit comprising custom vlsi circuits or gate arrays , off - the - shelf semiconductors such as logic chips , transistors , or other discrete components . a module may also be implemented in programmable hardware devices such as field programmable gate arrays , programmable array logic , programmable logic devices , or the like . modules may also be implemented in software for execution by various types of processors . an identified module of executable code may , for instance , comprise one or more physical or logical blocks of computer instructions which may , for instance , be organized as an object , procedure , or function . nevertheless , the executables of an identified module need not be physically located together , but may comprise disparate instructions stored in different locations which , when joined logically together , comprise the module and achieve the stated purpose for the module . indeed , a module of executable code could be a single instruction , or many instructions , and may even be distributed over several different code segments , among different programs , and across several memory devices . similarly , operational data may be identified and illustrated herein within modules , and may be embodied in any suitable form and organized within any suitable type of data structure . the operational data may be collected as a single data set , or may be distributed over different locations including over different storage devices , and may exist , at least partially , merely as electronic signals on a system or network . fig1 illustrates a schematic block diagram of one embodiment of a representative virtual tape system 100 in accordance with the present invention . the system 100 includes an automated library unit 102 , at least one virtual tape server 104 , and at least one host 106 . each host 106 may be a mainframe computer . alternatively , the host 106 may be a server or personal computer using a variety of operating systems . the host 106 and the virtual tape server 104 are connected via a storage area network ( san ) 108 or similar communications channel . the communications channel 108 in one embodiment may be a ficon or escon . the automated tape library unit 102 includes a library manager 110 , one or more data drive devices , which may be tape drive units 112 , an accessor 114 , and a plurality of media cartridges 116 . the plurality of media cartridges 116 may be stored in one or more media cartridge storage bins ( not identified ). the library manager 110 , which includes at least one computing processor ( not shown ), is interconnected with , and controls the actions of , the tape drive units 112 and the accessor 114 . the library manager 110 typically also includes one or more hard disk drives ( not shown ) for memory storage , as well as , a control panel or keyboard ( not shown ) to provide user input . the control panel may be a computer in communication with the library manager 110 so that a user can control the operating parameters of the automated tape library unit 102 independently of the host 106 . in fig1 , three tape drive units 112 a , 112 b , and 112 c are shown . the present invention is operable with one or any larger number of tape drive units 112 . the tape drive units 112 may share one single repository of cartridges 116 . alternatively , the tape drive units 112 may independently correspond to and utilize multiple repositories of cartridges 116 . the tape drive units 112 may advantageously be distributed over multiple locations to decrease the probability that multiple tape drive units 112 will be incapacitated by a disaster in one location . the interconnections between the library manager 110 , the tape drive units 112 , and the accessor 114 are shown as dashed lines to indicate that the library manager 110 transmits and receives control signals , rather than data to be stored or retrieved , to the tape drive units 112 and / or the accessor 114 . data for storage or retrieval may instead be transmitted directly between the virtual tape server 104 and the tape drive units 112 via a network 118 , which may be a storage area network ( san ), a local area network ( lan ), a wide area network ( wan ), or a different type of network , such as the internet or a direct connection between the virtual tape server 104 and the tape drive devices 112 . the accessor 114 may be a robotic arm or other mechanical device configured to transport a selected cartridge 116 between a storage bin and a tape drive unit 112 . the accessor 114 typically includes a cartridge gripper and a bar code scanner ( not shown ), or similar read system , mounted on the gripper . the bar code scanner is used to read a volume serial number ( volser ) printed on a cartridge label affixed to the cartridge 112 . in alternative embodiments , the tape drive units 112 may be replaced by optical disk drives or other magnetic drives . similarly , the cartridges 116 may contain magnetic media , optical media , or any other removable media corresponding to the type of drive employed . fig2 illustrates a schematic block diagram depicting one embodiment of the virtual tape server 104 of fig1 . the virtual tape server 104 may take the form of a computer with a bus , processor , memory , and the like . these elements have been omitted from fig2 to more clearly depict the various executable modules and data blocks of the virtual tape server 104 . as shown , the virtual tape server 104 includes a file system manager 202 , a hierarchical storage manager 204 , a storage manager server 206 , an automated storage manager administrator 208 , and at least one direct access storage device ( dasd ) cache 210 . the dasd cache 210 may take the form of one or more virtual tape drives to contain data in the form of a logical , or virtual , volume 212 . the dasd cache 210 may also be the location where a database 214 for the storage manager server 206 is stored . other executable modules and data blocks may also be present on the dasd cache 210 , but are omitted to focus on the present invention . the file system manager 202 handles the actual dasd 210 read and write commands from the host 106 , in one embodiment , via the hierarchical storage manager 204 . the storage manager server 206 controls the interface communications between the dasd 210 and the drive devices 112 . the storage manager server 206 is controlled by the automated storage manager administrator 208 . the automated storage manager administrator 208 monitors and directs the operation of the file system manager 202 , the hierarchical storage manager 204 , and the storage manager server 206 , and communicates control information to and from the library manager 110 . the dasd cache 210 is used to hold a plurality of logical , or virtual , volumes 212 from the physical volumes , or memory cartridges 116 . a read or write command from the host 106 is processed by the virtual tape server 104 via the dasd 210 prior to transferring the updated logical volume 212 from the dasd cache 210 to the physical volume 116 . the transfer of the updated logical volume 212 from the dasd cache 210 to a physical volume 116 may occur in a variety of ways . in one embodiment , the logical volume 212 resident on the dasd cache 210 may be the only copy of that logical volume 212 . at a time determined by the virtual tape server 104 , the logical volume 212 maybe premigrated to a physical volume 116 . such volume premigration provides for the virtual tape system 104 to make a copy of the logical volume 212 resident on the dasd cache 210 and store it on a physical volume 116 . the principal copy of the logical volume 212 remains on the dasd cache 210 for potential accesses by the host 106 . if the host 106 does not access the logical volume 212 on the dasd cache 210 within a certain time frame , the virtual tape server 104 may decide to complete the migration of the logical volume 212 to the physical volume 116 . in this instance , the virtual tape server 104 insures that the copy on the physical volume 116 is the most recent , or active , data and removes the logical volume 212 from the dasd cache 210 to provide memory for other data as required . the virtual tape server 104 illustrated also includes a read - only recovery module 216 that is configured to recover a selective dual copy of a logical volume that is on a read - only physical volume . referring to fig3 , a schematic block diagram illustrates one embodiment of a read - only recovery module 302 given by way of example of a read - only recovery module 216 as shown in fig2 . the read - only recovery module 302 depicted includes an identification module 304 , a recall module 306 , and a reconciliation module 308 . the identification module 304 is configured to identify a logical volume 212 on physical volume 116 . in one embodiment , the identification module 304 may be further configured to identify the location of a selective dual copy of the logical volume 212 that is located on a separate and distinct physical volume 116 . the selective dual copy of the logical volume 212 may be referred to as a backup copy of the logical volume 212 . identification of these logical volumes 212 , their locations on respective physical volumes 116 , and attributes associated with each logical volume 212 provides the virtual tape server 104 with at least some of the information necessary to recall the selective dual copy of the logical volume 212 when the primary copy may become unavailable , either temporarily or permanently . the recall module 306 is configured to recall the selective dual copy of the logical volume 212 to the dasd cache 212 of the virtual tape server 104 when the primary logical volume 212 is on a read - only physical volume 116 that is inaccessible . a physical volume 116 may be placed in a read - only state when the vts system 100 is unable to access part or all of the information stored on the media cartridge 116 . such inaccessibility is very likely to be due to physical damage or wear on the cartridge 116 that may not be reparable . the vts system 100 may attempt to recover information from the primary physical volume 116 using multiple techniques commonly known in the preset art . among these techniques are switching media drives 112 , reverse - reading , and the like . following this attempted recovery , the read - only recover module 302 may , in one embodiment , employ the recall module 306 to recall the selective dual copy of any or all logical volumes 212 not presently recovered from the primary physical volume 116 . the reconciliation module 308 is employed by the read - only recovery module 302 following a successful recovery of at least one logical volume 212 or portion thereof . the reconciliation module 308 in one embodiment includes a stripping module 310 and a removal module 312 . the stripping module 310 is configured to remove active data dependencies from the read - only physical volume 116 following a successful recall of at least some of the data on the physical volume 116 . the removal module 312 is configured to remove reference to the physical volume 116 from which the data has been recovered from a data management software database of physical volume 116 . referring to fig4 , a schematic flowchart diagram depicts one embodiment of a logical volume access method 400 that may be employed by the vts system 100 . the method 400 starts 402 by querying 404 the storage manager server 106 within the virtual tape server 104 for a list of physical volumes 116 that are indicated as read - only . the method 400 continues with the selection of one of the read - only physical volumes 116 and further selection 406 of a logical volume stored on the selected physical volume 116 . the selected logical volume 212 may be identified by a corresponding volser that is unique to the logical volume 212 . having identified a target logical volume 212 that the virtual tape server 104 attempts to access , the virtual tape server 104 in one embodiment determines 408 if a copy of the identified logical volume 212 is resident on the dasd cache 210 . if a copy of the identified logical volume 212 is resident on the dasd cache 210 , the virtual tape server 104 determines 410 if the logical volume 212 on the dasd cache 210 is a premigrated copy . a copy of the logical volume 212 that is not premigrated is assumed to be active data ( the most recent copy of the logical volume ) and the method 400 ends 412 . a copy of the logical volume 212 that is a premigrated copy may be marked 414 as an active copy . alternately , it may be assumed that the premigrated copy of the logical volume 212 that resides on the dasd cache 210 is active data . in either case , the logical volume access method 400 ends 412 . if it is determined 408 that a copy of the target logical volume 212 is not resident on the dasd cache , the virtual tape server 104 attempts to access 416 a copy of the logical volume on the primary physical volume 116 that is indicated to be in a read - only state . if such access is determined 418 to be successful , for example if the logical volume 212 on the physical volume 116 is accessible , the virtual tape server recalls 420 the logical volume 212 or accessible portions thereof to the dasd cache 210 . any data recalled at this point is marked 422 as active data and the database 214 of the storage manager server 206 is reconciled 424 as discussed previously . the method 400 then ends 412 . if it is determined 418 that the logical volume 212 on the physical volume 116 is not accessible , the read - only recovery module 302 attempts to recover 426 the selective dual copy of the logical volume 212 . the method 400 then ends 412 . referring to fig5 , a schematic flowchart diagram depicts one embodiment of selective dual copy recovery method 500 given by way of example of a selective dual copy recovery step 426 of fig4 . the method 500 begins 502 as the recall module 306 of the recovery module 302 accesses 504 the selective dual copy of the logical volume 212 on the secondary physical volume 116 . after the recall module 306 accesses 504 the selective dual copy , the recovery module 302 determines 506 if the data in the selective dual copy is active data . if it is determined 506 that the selective dual copy does not contain active data , the selective dual copy recall and recovery fails 508 and the method 500 ends 510 . a selective dual copy of a logical volume 212 that does not contain active data is of no use to the host 106 because some or all of the information has been superceded by revised or new data . if it is determined 506 that the selective dual copy does contain active data , and is therefore the data requested by the host 106 , the recovery module 302 recalls 512 the selective dual copy of the logical volume 212 and stores it in the dasd cache 210 of the virtual tape server 104 . the recalled logical volume 212 now residing in the dasd cache 210 is marked 514 as active data ready to be accessed by the host 106 . at a time determined by the virtual tape server 104 , the logical volume 212 may be premigrated or migrated to at least one physical volume 116 , as described previously . in one embodiment , at a time determined by the virtual tape server 104 , the virtual tape server 104 reevaluates the constructs associated with the logical volume 212 to determine if the logical volume still requires a selective dual copy . the logical volume 212 is premigrated or migrated to at least one physical volume 116 , as described previously . in some implementations , if a selective dual copy is required , the logical volume 212 is premigrated or migrated to at least one other physical volume 116 , as described previously . once the selective dual copy of the logical volume 212 is recalled 512 and marked 514 as active data , in one embodiment , the database 214 of the storage manager server 206 is reconciled 516 in a manner similar to that of step 424 and the method 500 ends 510 . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .	6
according to the invention , butyrolactam alkoxylate ( bla ) of formula ( b ) and mixtures of formula b with compounds ( a ), and ( c ) to ( k ) generally reduce the level of deposits produced in bench prescreening tests for auto engine intake valve deposits ( ivd ) [ e . g ., see stride test ] and / or combustion chamber deposits ( ccd ) [ e . g ., see torid test ]. gasolines with bld additives of formula ( a ) give higher torid values than gasoline without bld . we have discovered that our compositions ( e . g ., bla + piba ) lower the level of bench test ivd deposits without increasing the level of bench test ccd deposits , even though each alone gives a higher or equivalent level of bench ccd deposits . we have found that mixtures of bla ( formula ( b )), with at least one of polyethers ( pe ) and polyisobutylene amine ( piba ) generally lower the level of bench test ivd deposits ( table 4 ) and generally improves ( above ) the level of bench test ccd deposits ( table 5 ). table 3 &# 39 ; s torid values show that gasolines with mixtures of these additives have lower ccd values than the gasoline alone and gasoline with piba alone . this is in contrast to results which show that piba and similar compounds in the absence of the polymeric butyrolactam alkoxylates increase the level of bench ccd deposits . we have also found that mixtures of bld with alkoxylates and / or piba generally lower the level of bench test ivd deposits and generally improves ( above ) the level of bench test ccd deposits . preferred compounds ( cmpd .) and mixtures of compounds ( e . g ., cmpd . a & amp ; d ) of this invention are shown below . n is an integer from 9 to 35 inclusive ( preferably 20 - 35 ) r 1 , r 2 , r 3 , and r 4 are independently selected from the group consisting of h , and c 1 - c 100 alkyl , or taken together with the two carbons between r 1 and r 2 , or r 3 and r 4 form an aliphatic ring of 5 - 8 carbon atoms ( preferably h and c 1 - c 80 alkyl , more preferably h and c 1 - c 10 alkyl , most preferably h and c 1 - c 3 alkyl ), e , f and g are integers from 0 to 50 inclusive ( preferably 1 - 35 , more preferably 20 - 35 ) wherein at least one of e , f and g are not 0 , r 5 and r 5 ′ are independently selected from the group consisting of h , ch 3 , and ch 2 ch 3 , y is an integer from 1 - 50 inclusive ( preferably 1 - 35 , more preferably 20 - 35 ), r 6 is h or c 1 - c 20 alkyl , and r 7 is c 1 - c 25 alkyl or cycloalkyl , preferably c 1 - c 4 linear or branched alkyl . alkyl groups may be branched or unbranched . branched alkyl groups are generally preferred . compound a can be used alone . compound b can be used alone . any combination of compounds a through k , inclusive can be used . preferred two component mixtures comprise : a & amp ; c , a & amp ; d , b & amp ; c , and b & amp ; d . preferred three component mixtures comprise : a & amp ; c & amp ; d , and b & amp ; c & amp ; d . the above compounds alone or in combination can also be mixed with propylene oxide and / or propylene glycol . these butyrolactam derivatives and mixtures are preferably employed at concentrations of 5 - 5 , 000 ppm , preferably 100 - 2 , 500 ppm , most preferably 100 - 1 , 000 ppm . additized gasoline mixtures preferably contain 0 . 0005 - 0 . 5 wt % additive in the gasoline with economically maximum levels of 1 wt % additive ( and additive by - products ) of the gasoline . the gasolines which may be additized either by blending or by separate injection of the additive directly into the gas tank or into the engine utilizing such gasolines , can be ordinary unleaded gasoline of any grade , containing other , typical gasoline additives ordinarily added to such gasolines , e . g ., other detergents , deicing additives , anti - knock additives , corrosion , wear , oxidation , anti - rust , etc ., additives known to the art . as is readily apparent and already known in the industry , however , the skilled practitioner will have to ensure compatibility between the additives employed . the gasoline can also be any of the currently fashionable reformulated gasolines , i . e ., those containing various oxygenated compounds such as ether ( mtbe , etbe , tame , etc .) or alcohols ( methanol , ethanol ) in various concentrations . preferred base fuels include unleaded gasoline , oxygenated unleaded gasoline , and petroleum hydrocarbons in the gasoline boiling range . examples of functionalized polymeric detergents include polyolefinic amines , polyolefinic ether amines , polyolefin oxides , alkyl pyrrolidones and their copolymers with olefins or dienes . the polymers employed are those which depolymerize at the conditions typically encountered in the engine combustion chamber , i . e ., about 400 ° c . preferred polyolefin amines include : polybutylene amine , polyisobutylene amine , polypropylene amine ( mw 800 - 2000 ). preferred polyetheramines include : polyethylene oxide amines , polypropylene oxide amines , polybutylene oxide amines , polyisobutylene oxide amines , and mixed polyolefinic oxide amines ( mw 800 - 2000 ). the additives described above can be added directly to the gasoline or separately injected into the fuel system of the engine . alternatively , the additives can be added to the lubricating oil and from that environment favorably affect ccd and ivd . the additives can also be encapsulated to overcome any odor , toxicity or corrosivity concerns which may arise with any one or group of additives within the aforesaid recitations . the compounds and mixtures shown in table 1 , as added to the gasoline , are the preferred embodiments of this invention . because the additives are usually not 100 % pure , mixtures of these compounds with smaller amounts of reaction products , contaminants , enantiomers , degradation products , and similar compounds are considered to be part of this invention . not only are monomers rarely pure , but polymerization almost never produces perfect polymers . this invention includes polymers based on the listed monomers , but incorporating a minority of polymer chain units that differ from the ideal units shown in the specification . for example , different atoms of the monomer can sometimes be used as polymer linkages . also , reaction products , contaminants , enantiomers , degradation products , and monomer by - products can be incorporated into the polymer . tables 2 and 4 contain data on the performance of the above additives in the stride test . this is a bench test for intake valve deposits . the ivd bench test apparatus ( called stride ) has been disclosed in u . s . pat . no . 5 , 492 , 005 , which is incorporated by reference . surrogate test related to intake deposit evaluation ( stride ) is a laboratory apparatus that can be used to study the effects of fuel composition , additives , and transport on intake valve deposit ( ivd ) formation . the apparatus uses a syringe pump to slowly deliver fuel to the horizontal end face of a small cylindrical nub where the deposit is formed and weighed . unlike other surrogate tests the cyclic temperature of intake valves in engines is simulated by cycling the nub temperature . in the stride test , deposits are formed on the end face of a metal nub . the nub is small ( 6 . 35 mm diameter by 17 . 5 mm long ). the shape of the nub face is a concave shallow cone . compared with flat or convex shapes the concave shape increases the amount of gasoline retained on the nub face . it also makes the deposit formation less sensitive to slight misalignments of the nub from vertical . initially nubs were fabricated from 410 stainless steel because of its similarity to bmw 325 engine intake valves , however the amount of stride deposit formed on aluminum and brass nubs was similar to the amount made on steel nubs . in a stride test the nub is forced inside the coils of a cable heater . a shielded thermocouple is inserted into the hole on the axis of the nub . the thermocouple tip is about 0 . 5 mm below the nub surface . the nub &# 39 ; s small mass , about 3 . 5 g , makes it possible to cycle its temperature during the stride test by controlling the electric power to the coiled cable heater . to assure that the increase in nub weight is due solely to the deposit , the thermocouple , cable heater , and nub are held together solely by friction . no cement or heat transfer compounds are used . a bell shaped glass shield surrounds the nub and cable heater . the glass shield prevents turbulence within the fume hood from disturbing the delivery of gasoline and from affecting the nub temperature . it carries a blanketing flow of air that is filtered through molecular sieves and a drier . other atmospheres could be supplied , such as inert gas , simulated engine exhaust , or blow - by gas . the nub temperature is programmable . the maximum heating rate is 100 ° c ./ min ; the maximum cooling rate is 50 ° c ./ min ; and the operating range is from room temperature to 400 ° c . during initial construction , the nub surface temperature was measured by a thermocouple spot - welded to the nub face . the surface temperature was found to be less than the control thermocouple temperature . typically , with the control thermocouple temperature at 300 ° c ., the surface temperature is 270 ° c . except in the film boiling regime described below , each drop impact , which occurs about once every 3 seconds , temporarily decreases the surface temperature an additional 20 ° c . until the drop has completely vaporized . temperatures mentioned in this paper are the control thermocouple temperature , not surface temperature . gasoline is delivered to the nub face through a hypodermic needle attached to a syringe pump . the flow rates are usually constant during a test , between 1 . 5 ml / h and 40 ml / h . ( if desired , by wiring the syringe pump power through the alarm relays on the temperature controller , the fuel delivery can be stopped at nub temperatures greater than the high - alarm temperature setting or less than the low - alarm temperature setting .) the fuel supply needle is usually pressed into contact with the center of the nub face . for low flow rates ( about 1 . 5 ml / h ) or when making deposits from heavier liquids such as lubricants or diesel fuel , the needle is raised about 1 mm above the surface allowing drops to fall freely onto the nub face . raising the needle prevents deposit from accumulating on the needle tip . special procedures were necessary for weighing the stride deposit . the amount of stride deposit is typically less than one milligram . therefore , the nubs are weighed on a five - place balance ( 0 . 00001 g displayed resolution ). to improve the repeatability of the determination of the deposit mass the nub is weighed five consecutive times before and five consecutive times after each stride test . the five nub weights are then averaged to get a final nub weight . the procedure for weighing nubs is further complicated because the unloaded balance seldom returns to exactly zero tare after each weighing . so , the residual tare ( usually within ± 0 . 05 mg of zero ) is subtracted from the indicated nub weight after each of the five weighings . this procedure of subtracting the residual tare after each weighing decreases the variance and was recommended by the balance manufacturer . for the above procedure , ninety - four weighings of the same unused nub over a period of a year gave a standard deviation of 0 . 029 mg , in good agreement with the advertised standard deviation of 0 . 03 mg . the invention is further illustrated by the following non - limiting examples and comparison . in the preferred stride test , gasoline is delivered at a rate of 10 ml / hour to a 0 . 3 cm 2 stainless steel nub surface ( e . g ., a stride nub ). the surface temperature is cycled from 150 to 300 ° c . over 8 minutes . the test length is 4 hours . additives that reduce ivd in ic engines give low levels of stride deposits relative to base fuel . the results in tables 2 and 4 are reported on a relative basis as % reduction (−) or increase (+) over the base fuel deposits . table 2 shows that compounds b ( 1 ) to b ( 10 ) reduce the level of stride deposits . table 2 and 4 shows that compound d ( piba ), and compounds c & amp ; d ( piba + pe ) substantially lower the level of stride deposits . the stride test compared to an engine test is shown in fig1 . the stride procedure successfully emulates ivd from a honda es6500 generator set . the honda generator &# 39 ; s engine is a two cylinder carbureted gasoline engine of 360 ml displacement . for non - additized base gasolines and base gasolines containing commercial additive packages ( a ) and ( b ), ivd was measured after operating the generator at 2 . 4 kw and 3000 rev / min for 20 h . fig1 shows the percentage below base gasoline &# 39 ; s stride deposit for commercial additive packages ( a ) and ( b ) together with the percentage below the base gasoline &# 39 ; s ivd from the honda generator . both commercial additive package ( a ) and ( b ) significantly reduce the level of deposits below base fuel levels in both the stride and honda generator engine test . in another example , bla lowers base deposits levels associated with ccd . additives were tested for their propensity to produce ccd or lower base gasoline ccd levels using the torid - asd ( additive severity diagram ) bench test . the generic ccd bench test apparatus ( called torid ) has been partially disclosed in u . s . patent application ser . no . 021 , 478 , filed feb . 10 , 1998 , which is incorporated by reference . the torid - asd test involves placing several mg of a sample onto a sample holder surface . the sample is prepared from a mixture of the candidate additive and ccd precursors ( toluene soluble ccd from a 1993 trc fleet test ). the sample is held at constant temperature for one hour while it is exposed to a pulsing hexane flame . the concentration of base gasoline ccd precursors and surface temperatures are chosen to be close to those that exist on the walls of a combustion chamber . 2 mg of the additive is combined with 2 mg of soluble ccd deposit precursors . the ccd precursors are the toluene soluble fraction of homogenized ccd collected from a ten car fleet test for ccd ( sae paper # 972836 ). the 4 mg mixture of additive and ccd precursor is placed on a stainless steel nub surface and held at a constant temperature for one hour while hexane is delivered into a surrounding chamber and ignited with a glow coil every 0 . 5 sec to simulate the combustion chamber flame . the weight of the deposit formed on the nub surface reflects the deposit forming tendency . torid - asd results at 300 ° c . are associated with deposit forming tendency at higher mileage . table 3 contains the torid - asd performance on the base ccd deposit precursors . at 300 ° c . compound d ( piba ) and mixture c & amp ; d ( pe & amp ; piba ) increase the level of deposits . at 300 ° c . compounds b ( 1 ), b ( 2 ), b ( 5 ), b ( 6 ), b ( 7 ), b ( 8 ), b ( 9 ), and b ( 10 ) lower the level of deposits . the torid - asd test compared to an engine test is shown in fig2 . commercial additive packages ( a ) and ( b ) were tested at 300 ° c . in torid - asd and referenced to the deposits produced from 2 mg . of soluble ccd deposit precursors from base gasoline . the torid - asd procedure successfully emulates ccd from a honda es6500 generator set . the honda generator &# 39 ; s engine is a two cylinder carbureted gasoline engine of 360 ml displacement . for non - additized base gasolines and base gasolines containing commercial additive packages ( a ) and ( b ), ccd was measured after operating the generator at 2 . 4 kw and 3000 rev / min for 20 h . fig2 shows the percentage above base gasoline &# 39 ; s ccd for commercial additive packages ( a ) and ( b ). commercial additive package ( a ) significantly increases the level of deposits over base fuel levels in both the torid - asd and honda generator engine tests . commercial additive package ( b ) resulted in only slightly elevated level of deposits over base fuel levels in both the torid - asd and honda generator engine tests . table 4 shows that compound d ( piba ), and mixture c & amp ; d ( pe + piba ) substantially lower the level of stride deposits . table 4 shows that bla + piba , all bla + piba + pe mixtures , and mixtures of c & amp ; f and c & amp ; k listed substantially lower the level of stride deposits . in another example , mixtures of bla with piba and piba + pe lower deposits levels associated with ccd relative to piba alone . table 5 contains the torid - asd performance on the base ccd deposit precursors and mixtures of bla with piba and mixtures of bla with piba and pe . for reference , table 5 also shows the performance of piba and pe . below base deposit levels are found at 300 ° c . for bla + piba + pe additives cmpd . b ( 4 )& amp ; c & amp ; d , cmpd . b ( 5 )& amp ; c & amp ; d , and cmpd . b ( 11 )& amp ; c & amp ; d and bla + piba additive cmpd b ( 6 )& amp ; d . above base deposit levels are found for cmpd . d ( piba ). while the mixtures cmpd . b ( 4 )& amp ; d and cmpd . b ( 6 )& amp ; d ( dld + piba ) are above base at 300 ° c . there is substantially less deposits than would be expected based on their individual behavior . the synergistic relationship of mixtures is shown in table 6 . [ 0046 ] table 6 observed predicted torid - asd torid - asd deposit deposit gasoline additive mg at 300 ° c . mg at 300 ° c . 2 mg base + 2 mg cmpd . b ( 4 ) & amp ; d 0 . 64 0 . 80 2 mg base + 2 mg cmpd . b ( 6 ) & amp ; d 0 . 52 0 . 79 in another example , mixtures of bla compound b with compounds a , c , and / or k lower base deposits levels associated with ccd . additives are tested for their propensity to produce ccd or lower base gasoline ccd levels using the torid - asd ( additive severity diagram ) bench test as in example 2 . torid - asd results at 300 ° c . are associated with deposit forming tendency at higher mileage . mixtures of compound b with compounds c , f , i , or k are also tested with and without compound d ( piba ). in another example , mixtures of bld compounds a , g , and i with compounds g , h , and / or j lower base deposits levels associated with ccd . additives are tested for their propensity to produce ccd or lower base gasoline ccd levels using the torid - asd ( additive severity diagram ) bench test as in example 2 . torid - asd results at 300 ° c . are associated with deposit forming tendency at higher mileage . mixtures of compound b with compounds c , f , i , or k are also tested with and without compound d ( piba ). in another example , mixtures of compounds c through k lower base deposits levels associated with ccd . additives are tested for their propensity to produce ccd or lower base gasoline ccd levels using the torid - asd ( additive severity diagram ) bench test as in example 2 . torid - asd results at 300 ° c . are associated with deposit forming tendency at higher mileage . compound c , e , f , g , h , i and k individually and in mixtures with each other are also tested with and without compound d ( piba ).	2
the makers of this invention propose that survival of pps derived cardiomyocyte grafts can be improved by suppressing danger signals that typically triggers the process of rejection . in particular , it is a theory of this invention that uric acid and other factors made by graft cells that do not survive the transplant exacerbate a rejection response . this can stimulate inflammatory or immune meditated tissue destruction , causing the lysis of more cells — leading to a snowball effect that may prevent any of the engrafted cells from surviving . this disclosure shows how decreasing the amount of uric acid in or around the engrafted tissue can improve graft survival . decrease in the concentration of uric acid can be effected by inhibiting the transplanted cells from producing it , or by providing a mechanism ( in the transplanted cells , or the host , or both ) that enables the uric acid to be removed more quickly . uric acid accumulation from transplanted cells can be decreased either by pretreating the cells with allopurinol which inhibits xanthine oxidase , by pretreating the intended recipient with allopurinol or uricase ( which diminishes endogenous uric acid ), or by pretreating both the cells and the recipient in this way . this in turn prevents exacerbation of the rejection response directed against the engrafted tissue , which improves survival and leads to extended function of the graft . decreasing the amount of uric acid present can be combined with a treatment that diminishes the extent of apoptosis in the graft . for example , heat shock , culturing with erythropoietin , pretreatment with anti - inflammatory agents , or a combination of these manipulations can greatly enhance survival of engrafted pps derived cells . by treating the cells both to decrease apoptosis and limit uric acid production , the number of cells that initially survive the transplant is increased , and the immune effects of the non - surviving cells is minimized . prototype “ primate pluripotent stem cells ” ( pps cells ) are pluripotent cells derived from pre - embryonic , embryonic , or fetal tissue at any time after fertilization , and have the characteristic of being capable under appropriate conditions of producing progeny of several different cell types that are derivatives of all of the three germinal layers ( endoderm , mesoderm , and ectoderm ), according to a standard art - accepted test , such as the ability to form a teratoma in 8 - 12 week old scid mice . the term includes both established lines of stem cells of various kinds , and cells obtained from primary tissue that are pluripotent in the manner described . pps cell cultures are described as “ undifferentiated ” when a substantial proportion of stem cells and their derivatives in the population display morphological characteristics of undifferentiated cells , clearly distinguishing them from differentiated cells of embryo or adult origin . cell populations described as over 75 %, 90 %, or 98 % homogeneous for cells of one tissue type contain cells that are typical of that organ or tissue type as a stated minimum percentage . it is recognized that cell populations either in vivo or in tissue culture vary someone in phenotype , comprising cells bearing different markers and having different functions . for example , skin may contain epithelial cells , fibroblasts , and endothelial cells . nevertheless , if taken from a single tissue , the population will typically still be homogeneous according to this definition . the term “ uric acid ” means not only the acid form of the compound ( c 5 h 4 n 4 o 3 ), but also the conjugate base , salts thereof , and any chemically equivalent form that may be present in a biological environment such as an allograft transplant site . general methods in cell biology , protein chemistry , and antibody techniques can be found in current protocols in protein science ( j . e . colligan et al . eds ., wiley & amp ; sons ); current protocols in cell biology ( j . s . bonifacino et al ., wiley & amp ; sons ) and current protocols in immunology ( j . e . colligan et al . eds ., wiley & amp ; sons .). reagents , cloning vectors , and kits for genetic manipulation referred to in this disclosure are available from commercial vendors such as biorad , stratagene , invitrogen , clontech , and sigma - aldrich co . cell culture methods are described generally in the current edition of culture of animal cells : a manual of basic technique ( r . i . freshney ed ., wiley & amp ; sons ); general techniques of cell culture ( m . a . harrison & amp ; i . f . rae , cambridge univ . press ), and embryonic stem cells : methods and protocols ( k . turksen ed ., humana press ). tissue culture supplies and reagents are available from commercial vendors such as gibco / brl , nalgene - nunc international , sigma chemical co ., and icn biomedicals . other references include allopurinol : a medical dictionary , bibliography , and annotated research guide ( icon health publications ), and how do you solve a problem like urea ( r . rogers & amp ; o . hammerstein ii , rca ). this invention can be practiced using stem cells of various types . particularly suitable for use in this invention are primate pluripotent stem ( pps ) cells derived from tissue formed after gestation , such as a blastocyst , or fetal or embryonic tissue taken any time during gestation . non - limiting examples are primary cultures or established lines of embryonic stem cells or embryonic germ cells , as described below . the techniques of this invention can also be implemented directly with primary tissue , deriving differentiated cells such as neural cells directly from early embryonic cells without first establishing an undifferentiated cell line , or harvesting committed progenitors from neural tissue or other samples obtained from fetal or adult material . embryonic stem cells can be isolated from blastocysts of primate species ( u . s . pat . no . 5 , 843 , 780 ; thomson et al ., proc . natl . acad . sci . usa 92 : 7844 , 1995 ). human embryonic stem ( hes ) cells can be prepared from human blastocyst cells using the techniques described by thomson et al . ( u . s . pat . no . 6 , 200 , 806 ; science 282 : 1145 , 1998 ; curr . top . dev . biol . 38 : 133 ff ., 1998 ) and reubinoff et al , nature biotech . 18 : 399 , 2000 . equivalent cell types to hes cells include their pluripotent derivatives , such as primitive ectoderm - like ( epl ) cells , outlined in wo 01 / 51610 ( bresagen ). hes cells can be obtained from human preimplantation embryos ( thomson et al ., science 282 : 1145 , 1998 ). alternatively , in vitro fertilized ( ivf ) embryos can be used , or one - cell human embryos can be expanded to the blastocyst stage ( bongso et al ., hum reprod 4 : 706 , 1989 ). the zona pellucida of the blastocyst is removed , and the inner cell masses are isolated . the intact inner cell mass can be plated on mef feeder layers , and after 9 to 15 days , inner cell mass derived outgrowths are dissociated into clumps , and replated . es - like morphology is characterized as compact colonies with apparently high nucleus to cytoplasm ratio and prominent nucleoli . resulting es cells are then routinely split every 1 - 2 weeks . hps cells can be propagated continuously in culture , using culture conditions that promote proliferation while inhibiting differentiation . traditionally , es cells are cultured on a layer of feeder cells , typically fibroblasts derived from embryonic or fetal tissue ( thomson et al ., science 282 : 1145 , 1998 ). scientists at geron have discovered that hps cells can be maintained in an undifferentiated state even without feeder cells . the environment for feeder - free cultures includes a suitable culture substrate , such as matrigel ® or laminin . the cultures are supported by a nutrient medium containing factors that promote proliferation of the cells without differentiation ( wo 99 / 20741 ). such factors may be introduced into the medium by culturing the medium with cells secreting such factors , such as irradiated primary mouse embryonic fibroblasts , telomerized mouse fibroblasts , or fibroblast - like cells derived from hps cells ( u . s . pat . no . 6 , 642 , 048 ). medium can be conditioned by plating the feeders in a serum free medium such as knock - out dmem ( gibco ), supplemented with 20 % serum replacement ( u . s . 2002 / 0076747 a1 , life technologies inc .) and 4 ng / ml bfgf . medium that has been conditioned for 1 - 2 days is supplemented with further bfgf , and used to support hps cell culture for 1 - 2 days ( wo 01 / 51616 ; xu et al ., nat . biotechnol . 19 : 971 , 2001 ). alternatively , fresh non - conditioned medium can be used , if supplemented with added factors ( like a fibroblast growth factor or forskolin ) that promote proliferation of the cells in an undifferentiated form . exemplary is a base medium like x - vivo ™ 10 ( biowhittaker ) or obsf ™- 60 ( quality biological inc . ), supplemented with bfgf at 40 - 80 ng / ml , and optionally containing stem cell factor ( 15 ng / ml ), or flt3 ligand ( 75 ng / ml ). these medium formulations have the advantage of supporting cell growth at 2 - 3 times the rate in other culture systems ( wo 03 / 020920 ). under the microscope , es cells appear with high nuclear / cytoplasmic ratios , prominent nucleoli , and compact colony formation with poorly discernable cell junctions . primate es cells typically express the stage - specific embryonic antigens ( ssea ) 3 and 4 , and markers detectable using antibodies designated tra - 1 - 60 and tra - 1 - 81 . undifferentiated hes cells also typically express the transcription factor oct - 3 / 4 , cripto , gastrin - releasing peptide ( grp ) receptor , podocalyxin - like protein ( podxl ), and human telomerase reverse transcriptase ( htert ), as detected by rt - pcr ( us 2003 / 0224411 a1 ). the illustrations provided in the example section ensue from work done with human embryonic stem cells . however , except where otherwise specified , the invention can be practiced using multipotent cells of any vertebrate species , including pluripotent stem cells from humans ; non - human primates , and other non - human mammals . by no means does the practice of this invention require that a human blastocyst be disaggregated in order to produce the hps or embryonic stem cells for practice of this invention . hes cells can be obtained from established lines obtainable from public depositories ( for example , the wicell research institute , madison wis . u . s . a ., or the american type culture collection , manassas va ., u . s . a .). human embryonic germ ( heg ) cells can be prepared from primordial germ cells as described in shamblott et al ., proc . natl . acad . sci . u . s . a . 95 : 13726 , 1998 and u . s . pat . no . 6 , 090 , 622 . u . s . patent publication 2003 / 0113910 a1 reports pluripotent stem cells derived without the use of embryos or fetal tissue . it may also be possible to reprogram other progenitor cells into hps cells by using a factor that induces the pluripotent phenotype ( chambers et al ., cell 113 : 643 , 2003 ; mitsui et al ., cell 113 : 631 , 2003 ). under appropriate conditions , any cell with appropriate proliferative and differentiation capacities can be used for the derivation of differentiated tissues for use according to this invention . differentiated cell preparations for use in transplantation can be made from pps cells according to established methods . by way of illustration , neural cells can be generated from pps cells according to the method described in international patent publication wo 01 / 88104 and wo 03 / 000868 ( geron corporation ). undifferentiated pps cells or embryoid body cells are cultured in a medium containing one or more neurotrophins and one or more mitogens , generating a cell population in which at least ˜ 60 % of the cells express a2b5 , polysialylated ncam , or nestin and which is capable of at least 20 doublings in culture . exemplary mitogens are egf , basic fgf , pdgf , and igf - 1 . exemplary neurotrophins are nt - 3 and bdnf . the proliferating cells can then be caused to undergo terminal differentiation by culturing with neurotrophins in the absence of mitogen . cell populations can be generated that contain a high proportion of cells staining for tyrosine hydroxylase , a characteristic of dopaminergic neurons . oligodendrocytes can be generated from pps cells by culturing them as cell aggregates , suspended in a medium containing a mitogen such as fgf , and oligodendrocyte differentiation factors such as triiodothyronine , selenium , and retinoic acid . the cells are then plated onto a solid surface , the retinoic acid is withdrawn , and the population is expanded . terminal differentiation can be effected by plating on poly - l - lysine , and removing all growth factors . populations can be obtained in which over 80 % of the cells are positive for oligodendrocyte markers ng2 proteoglycan , a2b5 , and pdgfrα , and negative for the neuronal marker neun . see pct publication wo 04 / 007696 ( keirstead ). hepatocytes can be generated from pps cells according to the method described in u . s . pat . no . 6 , 458 , 589 and pct publication wo 01 / 81549 ( geron corporation ). undifferentiated pps cells are cultured in the presence of an inhibitor of histone deacetylase . in an exemplary method , differentiation is initiated with 1 % dmso ( 4 days ), then 2 . 5 mm of the histone deacetylase inhibitor n - butyrate . the cells obtained can be matured by culturing 4 days in a hepatocyte culture medium containing n - butyrate , dmso , plus growth factors such as egf , hepatocyte growth factor , and tgf - α . other effective hepatocyte differentiation protocols are described in u . s . ser . no . 10 / 810 , 311 . cardiomyocytes or cardiomyocyte precursors can be generated from pps cells according to the method provided in wo 03 / 006950 . the cells are cultured in a growth environment comprising fetal calf serum or serum replacement , and optionally a cardiotrophic factor that affects dna - methylation , such as 5 - azacytidine . spontaneously contracting cells can then be separated from other cells in the population , by density centrifugation . further process steps can include culturing the cells so as to form cardiac bodies , removing single cells , and then dispersing and reforming the cardiac bodies in successive iterations , as described in u . s . ser . no . 10 / 805 , 099 . hematopoietic cells can be made by coculturing pps cells with murine bone marrow cells or yolk sac endothelial cells was used to generate cells with hematopoietic markers ( u . s . pat . no . 6 , 280 , 718 ). hematopoietic cells can also be made by culturing pps cells with hematogenic cytokines and a bone morphogenic protein , as described in u . s . 2003 / 0153082 a1 and wo 03 / 050251 . osteoblasts and their progenitors can be generated from pps cells according to the method described in wo 03 / 004605 . pps - derived mesenchymal cells are differentiated in a medium containing an osteogenic factor , such as bone morphogenic protein ( particularly bmp - 4 ), a ligand for a human tgf - β , receptor , or a ligand for a human vitamin d receptor . cells that secrete insulin or other pancreatic hormones can be generated by culturing pps cells or their derivatives in factors such as activin a , nicotinamide , and other factors listed in wo 03 / 050249 . chondrocytes or their progenitors can be generated by culturing pps cells in microaggregates with effective combinations of differentiation factors listed in wo 03 / 050250 . in principle , any transplanted cells or tissue at risk for rejection will benefit from the immunotolerance strategy described in this application . according to this invention , the allograft cells or the recipient subject , or both , are prepared for transplantation in such a way so as to decrease the production of uric acid , related compounds , and other factors that exacerbate inflammation , immune recognition or rejection of the transplanted tissue . improved survival of the allograft tissue can be accomplished by adapting the therapeutic cell population to decrease production of factors such as uric acid , or to increase the rate that uric acid is metabolized or removed , or both . xanthine oxidase which dying cells use to produce uric acid can be inhibited with compounds such as allopurinol , oxypurinol , and bof - 4272 ( kogler et al ., cardiovasc res . 59 : 582 , 2003 ; naito et al , biol pharm bull . 25 : 674 , 2002 ; shi et al ., nature 425 : 516 , 2003 ). pre - treatment of the cells with low levels of tungsten would deplete cellular levels of molybdenum , a necessary co - factor for xanthine oxidase ( suzuki et al ., proc . natl . acad . sci . usa 95 : 4754 , 1998 ), and may also reduce uric acid production . another way to reduce xanthine oxidase activity in the cells is to decrease the amount of xanthine oxidase mrna . transient inactivation just before administration can be accomplished by treating the cell with mrna antisense , ribozyme , or sirna that is complementary or specific for the xanthine oxidase gene sequence . longer - term activation can be accomplished by inactivating or modifying the gene encoding xanthine oxidase on one or both alleles , or by introducing a transgene encoding rna antisense , ribozyme , or sirna . the transgene can be placed under control of a promoter inducible with compounds such as tetracycline ( shockett et al ., proc . natl . acad . sci . usa 92 : 6522 , 1995 ; rossi et al ., molec . cell 6 : 723 , 2000 ) or heavy metals ( yan et al ., biochim . biophys . acta 1679 : 47 , 2004 ). in this way , the genetic alteration can be done at any stage , allowing xanthine oxidase to be down - regulated just before administration by combining the cells with the inducing compound . alternatively or in addition , the allograft tissues can be adapted by causing them to express an enzyme that degrades or causes sequestration of the exacerbating factor . for uric acid , suitable enzymes are uricase , and natural or recombinant forms of urate oxidase ( e . g ., rasburicase ™, fasturtec ™, elitek ™). a gene sequence encoding the enzyme ( or a catalytically active fragment thereof ) is used to transfect the cell , either at the stage of the undifferentiated pps cell , or subsequent to differentiation . the enzyme may be expressed within the cell , or exported so as to create a milieu free of uric acid near the transplant site . vectors such as lipofectamine conjugates and adenovirus can be used for transient expression , or vectors such as retrovirus , lentivirus , and adeno - associated virus can be used in situations where long - term expression by the cell and its progeny is more desirable . methods and reagents for producing genetically altered pps cells and their progeny are described in u . s . ser . no . 09 / 849 , 022 , which is hereby incorporated herein by reference . a further adaptation of the allograft cells before transplant can be done to minimize the extent of initial cell death , which otherwise provides the initial burst of uric acid production . one means of making the cells less subject to apoptosis is to activate akt kinase activity ( matsui et al ., circulation 104 : 330 , 2001 ). this can be done , for example , by culturing with growth factors such as erythropoietin ( epo ), insulin , and igf - 1 , and gp130 activators such as il - 6 , cardiotropin , il - 11 , and cntf . another way of activating atk kinase is by heat shock : raising the temperature of the cells by about 6 ° c . above normal culture temperatures for 15 min to 2 h at a suitable period ( say , 1 or 3 days ) prior to use for transplantation or preparation of the medicament . alternatively or in addition , the cells can be treated with a non - steroidal anti - inflammatory agent such as ibuprophen . the subject to receive the transplant can also be adapted to reduce exacerbating factors from accumulating in the milieu of the allograft . for uric acid , the subject can be treated locally or systemically with one or more of the aforementioned inhibitors of xanthine oxidase . they can also be treated locally or systemically with one or more of the enzymes and other substances that metabolize or sequester uric acid , such as uricase or urate oxidase . local treatment with a vector causing transient expression of uricase or urate oxidase is also contemplated , preceding , concurrently , or shortly following implantation of the allograft tissue . once the cells or the transplant subject , or both , have been adapted as described , the allograft can then be put in place by a suitable procedure for administration of cells to the target site . the use of the materials of this invention in accordance with standard surgical methods is the responsibility of the treating clinician . following treatment , patients are monitored for general health , survival of the allograft cells , and recovery of physiological function associated with the transplant tissue . the prepared cell population is typically supplied in the form of a pharmaceutical composition , comprising an isotonic excipient prepared under sufficiently sterile conditions for human administration . effective cell and medicine combinations can be packaged and distributed separately , or in separate containers in kit form , or ( for simultaneous administration to the same site ) they can be mixed together . this invention also includes reagent systems for the production of differentiated cells to be used with this invention . an example is a set or combination of cells that exist at any time during manufacture , distribution , or use of the differentiated cell populations , comprising any combination of two or more cell populations described in this disclosure , such as the differentiated cell population used for therapy , in combination with undifferentiated pps cells from which they were derived . for general principles in formulating cell compositions , the reader is referred to cell therapy : stem cell transplantation , gene therapy , and cellular immunotherapy ( g . morstyn & amp ; w . sheridan eds ., cambridge university press , 1996 ). compositions and combinations intended for pharmacological distribution and use are optionally packaged with written instructions for a desired purpose , such as the regeneration of tissue function , genetic therapy , or induction of immune tolerance . the example that follows is provided by way of further illustration , and is not meant to limit the claimed invention . experiments conducted elsewhere have shown that the vast majority of engrafted cardiomyocytes derived from neonatal or adult animals , die within 1 - 7 days after transplant into the hearts of recipient animals . a significant fraction of cell death is attributed to apoptosis , and the inclusion of a heat shock treatment to the cells before transplant confers significant protection from apoptosis ( zhang et al ., j mol cell cardiol . 33 : 907 , 2001 ). under some conditions , when hes - derived cardiomyocytes are transplanted into the hearts of acutely infarcted scid / bg mice , only a small percentage of cells survive . the makers of this invention have discovered that cardiac improvement upon grafting with hes derived cardiomyocytes ( measured by echocardiography ) is considerably enhanced when the grafts are pre - treated with erythropoietin , ibuprophen , allopurinol , or a combination of these agents , followed by transplantation into animals optionally pre - conditioned with allopurinol and uricase . cardiomyocytes were differentiated from human embryonic stem ( hes ) cells and purified by density gradient centrifugation on percoll ™, according to established methods ( wo 03 / 006950 ). they were adapted to decrease uric acid production upon engraftment by culturing for 24 hours in standard differentiation medium ( containing 20 % fbs ) to which had been added 50 μg / ml allopurinol , or 0 . 5 units / ml human recombinant erythropoietin ( epo ). alternatively , the cells were heat shocked in standard differentiation medium ( 20 % fbs ) by incubating at 43 ° c . for 45 minutes , and then transferring to a 37 ° c . incubator 24 h prior to harvest . recipient mice were prepared to decrease uric acid production by the engrafted cells by daily injection of 800 μg allopurinol and / or 10 μg uricase intramuscularly for each of the 3 days before transplant . the transplant experiments were performed using a mouse model for coronary infarction in an external research laboratory under a research agreement with geron corporation . the left anterior descending artery was ligated as follows . mice were anesthetized in an isoflurane inhalation chamber and received intraperitoneal injection of ketanest / xylazine ( 50 mg / kg ). they were then intubated and ventilated for the entire surgical procedure . rectal temperature was maintained at 37 ° c . by a thermostatically regulated heating pad . one ligation with a 9 . 0 silk stitch was performed on the proximal 2 mm portion of the artery . a pale area demarcated on the surface of the left ventricle resulted in significant left ventricular ischemia encompassing the middle and apical portion of the ventricle . using a 25 g needle , 0 . 25 - 2 × 10 6 cells ( suspended in differentiation medium without serum ) were injected into the demarcated area . immediately afterwards , a chest tube ( 16 g angio - cath ) was inserted and the chest was closed in layers . ventilation was maintained until there was sufficient spontaneous breathing , and extubation followed . the ventricular diameter was measured after three weeks by echocardiography . fractional shortening ( a measure of ventricular diameter )≡[( diameter at diastole minus diameter at systole )÷( diameter at diastole )]. results are shown in table 1 . reduction of uric acid by adapting the cardiomyocytes or recipient animals with allopurinol correlates with an increased functional improvement ( 24 %) compared with the control ( 13 %), or animals transplanted with cardiomyocytes without any adaptation ( 19 %). this is consistent with improved acceptance of the transplanted cells by the host , due to decreased uric acid production leading to a less severe rejection response . pretreating the cells with epo or heat shock also correlated with improved function . epo protects cells in both the brain and the heart from ischemia - induced death by activation of the akt kinase pathway , the same pathway that is activated in some cells by heat shock . the inventors hypothesize that the beneficial effects of epo shown in table 1 are due to its anti - apoptotic effects on the hes - derived cells . the lower fractional shortening observed after engraftment of heat shocked hes - derived grafts may be due to either less efficient induction of protective effects , or the fact that heat shock actually stimulates apoptosis in some cell types . the compositions and procedures described in this disclosure can be effectively modified by routine optimization without departing from the spirit of the invention embodied in the claims that follow .	2
fig3 depicts a wireless communication device 302 configured to receive power from its own transmissions , according to an embodiment . as shown , the wireless communication device 302 includes direct current ( dc ) power source ( s ) 306 that provide power to a modulator 310 , power amplifier ( s ) 312 , and components performing other functions of the wireless communication device transmitter ( tx ) 308 which may include a transmit processor having a time variant transmit carrier frequency or frequencies ( fc or fc ( s )). the wireless communication device 302 further includes ( optional ) regulators 314 , 316 , 318 that respectively provide correct voltage and / or current regulation to the components 308 , the modulator 310 , and the power amplifier ( s ) 312 . the modulator 310 may include a voltage controlled oscillator and phase lock loop to select a given transmit frequency from a range of possible transmit frequencies . the power amplifier 312 amplifies a power of a modulated signal output from the modulator 310 . the output of the power amplifier 312 ( also referred to herein as “ tx signal power ”) is transmitted through a transmit antenna 328 into free space . remote receiver antenna ( s ) 332 may then receive the radiated signal and process the received signal , thus allowing wireless communication of information between the wireless device 302 and the remote wireless device 340 . rf transmit ( tx ) signal power radiated by transmit antenna ( s ) 328 may be high in order to compensate for the distance from remote receiver antenna ( s ) 332 and to compensate for any signal power lost due to dc power signal ( s ) circuitry objects blocking the signal path . as is well known , rf signal power degrades by distance squared . for example , if transmit antenna ( s ) 328 transmit 1 - 2 watts of rf signal power , the remote receiver antenna ( s ) 332 might only receive a few uw of rf signal power . this low level of rf signal power is typically enough for functional wireless communication . as shown , the wireless communication device 302 includes an energy receiver 320 that includes an energy receiver ( erx ) antenna 330 and energy receiver circuitry element ( s ) 322 configured to receive a time variant communication signal and alternating current ( ac ) to dc converter ( s ) 324 configured to convert the received communication signal into dc power . that is , rf transmission signal power generated by the transmit antenna ( s ) 328 is received and converted into dc power which can provide electrical power to the wireless device 302 for operation and / or battery charging . the energy receiver 320 further includes a dc power management circuit 326 that can provide proper voltage levels of dc power to circuits ( or components ) within the wireless communication device 302 . as shown , the energy receiver antenna ( s ) 330 are placed within a short , fixed distance d short ( s ) from transmit antenna ( s ) 328 . because the distance between the transmit antenna ( s ) 328 and the energy receiver antenna ( s ) 330 is short , a substantial amount of transmission signal power can be received at the energy receiver antenna ( s ) 330 and converted for dc power use . one approach for receiving and converting such transmission signal power is described in u . s . pat . no . 8 , 416 , 721 , which is hereby incorporated by reference in its entirety . fig4 illustrates matched energy receiver antennas substantially covering the surface of a wireless communication device 400 , according to an embodiment . as shown in panel a , the wireless communication device 400 includes transmit antenna ( s ) 402 and one or more matched energy receiver antenna ( s ) 404 covering a surface of the wireless phone device 400 . illustratively , the frequency of the energy receiver antenna ( s ) 404 are deliberately matched to the transmission frequency of the wireless device &# 39 ; s 400 own transmit antenna ( s ) 402 . panel b illustrates a graph of the transmission signal power spectral envelope density versus frequency in the wireless communication device 400 having energy receiver antenna ( s ) 404 matching the frequency of transmit antenna ( s ) 402 . as shown , the frequency 401 of the energy receiver antenna is matched to the frequency center of the transmit antenna . the matching of the frequency of the energy receiver antenna ( s ) 404 to the transmission frequency of the transmit antenna ( s ) 402 permits the energy receiver antenna ( s ) 404 to most efficiently receive the transmission power radiated onto the surface of the wireless phone device 400 . in one embodiment , the surface of the wireless device 400 may be maximally covered by energy receiver antenna ( s ) 404 , except for areas needed for other critical functions , such as the screen , key pad , and transmit / receiver antennas . in another embodiment , energy receiver antenna ( s ) 404 may also be placed under the key pad , screen , etc . trial and error and / or antenna software simulation may be used to determine the spacing needed between energy receiver antenna ( s ) 404 and transmit antenna ( s ) 402 to prevent interference to the transmission and receiving functions required by the wireless device 400 . more specifically , an effective distance between the energy receiver antenna ( s ) 404 and the transmit / receiver antenna ( s ) may be determined based on various optimization factors , such as maximizing the energy received , with the least amount of interference to the transmission , and placing the energy receiver antenna ( s ) at an effective distance to the transmit antenna ( s ) 404 . experience has shown that , in a particular embodiment , a 34 % power consumption reduction was achieved when the surface of a typical wireless device was covered with matched antenna ( s ), with the entire back surface and the left , right , and bottom sides covered with matched antenna ( s ) and only the keypad , screen and half an inch within the transmit / receiver antenna being left un - covered . further , no significant transmission / reception signal impairment was measured . fig5 illustrates mismatched energy receiver antennas substantially covering the surface of a wireless communication device 500 , according to an embodiment . as shown , the wireless communication device 500 includes antenna ( s ) for transmission of signals as well as energy receiver antenna ( s ) 504 configured to receive transmission power from the transmit antenna ( s ) 502 so that the transmission power can be converted to energy for use by the wireless communication device 500 . the energy receiver antenna ( s ) 504 are deliberately weakened so as to not efficiently receive the transmission power radiated by the transmit antenna 502 ( s ). a number of organic and non - organic materials such as human tissue , printed circuit boards , wireless device casing , are capable of absorbing radiated rf transmission power to varying degrees . for example , human tissue acts as an inefficient antenna which does not match a transmit antenna frequency center . in one embodiment , the energy receiver antenna ( s ) 504 may be constructed from such materials . in another embodiment , energy receiver antenna ( s ) 504 may be deliberately weakened by shifting the frequency center of the energy receiver antenna ( s ) 504 away from the frequency center of the transmit antenna ( s ) 502 by , e . g ., calibrating the energy receiver antenna ( s ) 504 to be mismatched with the transmit antenna ( s ) 502 . panel b illustrates a graph of the transmission signal power spectral envelope density versus frequency in the wireless communication device 500 having mismatched energy receiver antenna ( s ) 504 . this mismatching makes the energy receiver antenna ( s ) 504 less efficient at receiving the transmission power radiated onto the surface of the wireless device 500 . as a result , one or more mismatched energy receiver antenna ( s ) 504 may be placed next to the transmit / receiver antenna 502 , at a closer distance than matched energy receiver antennas could be placed , without affecting normal rf functions . because transmission rf power degrades by distance squared , less efficient energy receiver antennas placed closer to the transmit antenna ( s ) 502 may actually be equal to or more efficient than matched energy receiver antennas placed further away from the transmit antenna ( s ) 502 . illustratively , the wireless device 500 is maximally covered by the mismatched energy receiver antenna ( s ) 504 , except for regions needed for other critical functions , such as a key pad , display screen , and transmit / receiver antenna ( s ). in another embodiment , energy receiver antenna ( s ) may also be placed underneath the key pad and / or the display screen . if necessary to prevent interference to transmission / reception functions , the spacing between the energy receiver antenna ( s ) 504 and transmit / receiver antennas may be obtained by trial and error and / or antenna software simulation . experience has shown that in a particular embodiment , in which a wireless devices with non - matching transmit antennas having different communication standards / frequencies than energy receiver antennas were placed in close proximity to the energy receiver antennas , the energy receiver antennas still received non - matching transmission power which could be converted to dc power . in addition , no substantial transmission / reception signal power degradation was measured . fig6 illustrates combining matched and mismatched energy receiver antennas to substantially cover the surface of a wireless communication device 600 , according to an embodiment . as shown in panel a , the wireless communication device 600 includes two rows of mismatched , and deliberately less efficient , antenna ( s ) 604 placed close to the wireless device &# 39 ; s 600 transmit antenna ( s ) 602 . as discussed , the deliberately less efficient antenna ( s ) 604 may be , e . g ., made of materials capable of absorbing radiated rf transmission power but not interfering with transmission or reception of rf signals . the less efficient antenna ( s ) 604 may also have frequency center ( s ) that are mismatched with frequency center ( s ) of the transmit antenna ( s ) 602 . the wireless device 600 also includes rows of matched antennas 606 placed further away from the wireless device &# 39 ; s 600 transmit antenna ( s ) 602 than the mismatched antenna ( s ) 604 are placed . as discussed , the matched antenna ( s ) 606 can receive radiated transmission power more efficiently than the mismatched antennas 604 . panel b illustrates a graph of the transmission signal power spectral envelope density versus frequency in the wireless communication device 600 having both matched energy receiver antenna ( s ) 606 and mismatched energy receiver antenna ( s ) 604 . once again , to prevent interference to the transmission / reception functions of the wireless device 600 , the spacing needed between energy receiver antenna ( s ) 604 , 606 and transmit / receiver antenna ( s ) may be obtained by trial and error and / or antenna software simulation . by using both mismatched antennas 604 and matched antennas 606 , it is possible to maximize the space on the surface of the wireless device 600 on which energy receiver antennas are placed . fig7 depicts use of energy receiver antennas as electrical shields in a wireless communication device 700 , according to an embodiment . as shown , the wireless communication device 700 includes a transmit antenna 710 and electronic circuitry components 740 mounted on a substrate 730 . the transmit antenna 710 , electronic circuitry components 740 , and substrate 730 may be similar to the transmit antenna 110 , electronic circuitry components 140 , and substrate 130 of the wireless communication device 100 , discussed above . rather than the electrical signal shields 150 of the wireless communication device 100 , however , the wireless communication device 700 includes energy receiver antennas 750 . the energy receiver antenna ( s ) 750 may have any feasible shape , including the same shape as the electrical signal shields 150 . in addition to receiving radiated transmission power , the energy receiver antenna ( s ) 750 may also perform the same function as the electrical signal shields 150 , namely preventing internally generated electrical signals from radiating out and affecting the function of other devices and preventing externally generated electrical signals from radiating in to affect the function of the electronic circuitry components 740 . as a result , energy receiver antennas 750 may replace electrical signal shields which are grounded . replacing such electrical signal shields with energy receiver antennas 750 permits maximal use of available space for energy receiver antennas . advantageously , wireless devices disclosed herein include energy receiver antennas that receive the wireless devices &# 39 ; own transmission signals that are radiated onto the surfaces of the wireless devices . the received transmission signals are then converted to dc power that can be provided to various components of the wireless devices . doing so reduces power consumption by the wireless devices and extends battery life . while the forgoing is directed to embodiments of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof .	8
it has now been unexpectedly discovered that topically applied n - acetyl - d - glucosamine or n - acetylgalactosamine containing compositions exfoliate the skin . combinations of n - acetyl - d - glucosamine and n - acetylgalactosamine can also be used . these compositions which exfoliate the skin can also include chitin to enhance the process of exfoliation . it is known that amino sugars are capable of modulating the adhesion of keratinocytes , in vitro . it is disclosed by brysk , m . in “ glycoproteins modulate adhesion in terminally differentiated keratinocytes ,” that n - acetylglucosamine , n - acetylneuraminic acid and n - acetylgalactosamine are involved in the dissociation of aggregates of glycoproteins that bind corneocytes together . specifically , amino sugars are known to inhibit the reaggregation of corneocytes which have been dissociated into single squames by homogenization in ether . further , amino sugars in the form of n - acetylglucosamine have been used as an oral nutrient supplement in conjunction with other topical cosmetic products , such as for example , products offered by life - force , inc . which include n - acetyl - d - glucosamine in the form of a pill taken as a nutritional supplement . however , it is not suggested in the prior art to formulate a pharmaceutical or cosmetic composition for topical application to the skin using n - acetylglucosamine as an exfoliant . in fact , in wo97 / 12597 it is disclosed that when studied to determine its efficacy as a topical desquamating agent , n - acetyl - d - glucosamine was not found to be effective . the exfoliant in wo97 / 12597 is a compound comprising a chain of carbohydrates linked by a linking moiety to an alkyl or alkenyl chain . further , wo97 / 12597 , incorporated herein by reference , only includes n - acetyl - d - glucosamine as one of the units forming the carbohydrate portion which is linked by the linking moiety to the alkyl or alkenyl chain for desquamation of the skin . it is not disclosed in wo97 / 12597 that n - acetyl - d - glucosamine alone can exfoliate the skin . compositions for topical application containing n - acetyl - d - glucosamine have been disclosed for example , in jp 59013708 , wo 98 / 152576 , and u . s . pat . no . 5 , 866 , 142 , each incorporated herein by reference . to soften and moisturize the skin , a cosmetic containing an n - acetyl amino sugar is disclosed in jp 59013708 . a composition for alleviating itching and pain containing n - acetyl - d - glucosamine is disclosed in wo 98 / 52576 . in u . s . pat . no . 5 , 866 , 142 , a composition for exfoliating the skin has been disclosed , which includes n - acetyl - d - glucosamine . the presence of n - acetyl - d - glucosamine contributes to enhancing the amount of hyaluronic acid which the skin naturally produces in greater quantities in response to exfoliation , induced by other compounds such as histidine . however , no exfoliating activity is attributed to n - acetyl - d - glucosamine . a cosmetic composition containing n - acetylglucosamine and having good adhesion to the skin ( i . e ., does not lift off of the skin ) is disclosed in jp 8188526 . however , the prior art does not disclose the ability of glucosamine , and particularly , n - acetyl - d - glucosamine , to exfoliate the skin . the composition of the present invention contains an exfoliating - effective amount of n - acetyl - d - glucosamine , n - acetylgalactosamine , or a combination thereof . by the term “ exfoliating - effective amount ,” as used in the present specification , is meant an amount which is effective to cause exfoliation of the skin . the amount of n - acetyl - d - glucosamine , n - acetylgalactosamine , or a combination thereof , in the present invention will vary depending on the desired strength or intensity of exfoliation . the n - acetyl - d - glucosamine or n - acetylgalactosamine is present in the composition in an amount of about 0 . 01 to about 25 . 0 percent of the weight of the composition ; preferably 0 . 5 to about 10 . 0 percent , and more preferably about 1 . 0 to 5 . 0 percent of the weight of the composition . the n - acetyl - d - glucosamine or n - acetylgalactosamine per se is added directly to the cosmetic or pharmaceutical composition by admixing ; alternatively , extracts of materials containing substantial quantities of n - acetylglucosamine or n - acetylgalactosamine as a component can be used to provide the same concentration . these compositions can also contain chitin . the amounts of chitin in the composition are also present in exfoliating - effective amounts as previously described . the intensity of exfoliation can also be controlled by the frequency with which the compositions are applied to the skin and the compositions are applied periodically for a period of time sufficient to exfoliate the skin . accordingly , the compositions are applied to the skin for a period of at least 2 months , and preferably for at least 4 months , during which time the compositions are applied on a weekly basis . however , a preferred method of obtaining the benefits of the composition is via chronic topical application of the composition to exfoliate the skin . it is suggested , as an example , that “ chronic ” application be within a range of from about once per week to about 4 to 5 times weekly , preferably daily , most preferably twice daily . by “ chronic ” application , it is meant herein that the period of topical application may be over the lifetime of the user , preferably for a period of at least about 6 months to about 20 years , more preferably from about 1 year to about 10 years , and still more preferably from about 2 years to about 5 years , thereby resulting in regular desquamation , which may aid in reducing the appearance of fine lines and wrinkles due to chronological aging or photoaging . the method of the present invention may include applying in addition to the exfoliating effective amount of n - acetyl - d - glucosamine or n - acetylgalactosamine , other optional components , depending on the intended end use of the compositions . these include , but are not limited to , additional exfoliants , preservatives , fragrances , emollients , antiseptics , antiinflammatories , antibacterials , stabilizers , antioxidants , vitamins , pigments , dyes , humectants , and propellants , as well as other classes of materials the presence of which in the compositions may be cosmetically , medicinally , or otherwise desired . such components can be found in the ctfa international cosmetics ingredients dictionary . examples of additional exfoliants include but are not limited to chemical exfoliants such as ahas , for example , lactic acid , or bhas , for example , salicylic acid , or physical exfoliants such as pumice , polyethylene , walnut shell powder , and the like , or combinations thereof . the amount of additional exfoliants alone or in combination will depend on the type of exfoliant and the strength of exfoliation desired . preservatives employed , may be in an amount of from about 0 . 01 to about 2 . 00 percent , preferably from about 0 . 02 to about 1 . 00 percent , of the formula weight . examples of suitable preservatives are bha , bht , propyl paraben , butyl paraben or methyl paraben or an isomer , homolog , analog or derivative thereof . for topical application , according to the method of the present invention , the compositions can also be formulated with a variety of cosmetically and / or pharmaceutically acceptable vehicles . accordingly , the compositions of the present invention comprise a pharmaceutically or cosmetically acceptable carrier , in an amount appropriate to accommodate the other components of the formulation . the term “ pharmaceutically and / or cosmetically acceptable vehicle ” refers to a base , for either pharmaceutical or cosmetic use , within which n - acetyl - d - glucosamine or n - acetylgalactosamine is soluble and which will not cause harm to humans or other recipients . as used herein , “ pharmaceutical ” or “ cosmetic ” will be understood to encompass both human and animal pharmaceuticals or cosmetics . there are few limitations on the type of base which is suitable for the compositions containing n - acetyl - d - glucosamine or n - acetylgalactosamine . the vehicle may be aqueous , nonaqueous or a combination thereof appropriate for the formulation desired . the compositions can be prepared in any form convenient for topical application to the skin . such forms include , but are not limited to gels , creams , dispersions , emulsions ( water - in - oil or oil - in - water ), suspensions , creams , lotions , gels , foams , mousses and the like . in a preferred embodiment , the carrier is a suspension , dispersion or emulsion . the emulsion may be an oil - in - water emulsion , or a water - in - oil emulsion . these emulsions contain one or more oil components , an aqueous component , and a specific emulsifier component chosen depending on the nature of the desired emulsion . a composition , according to the present invention is prepared as follows : to prepare the composition , the materials are combined in the order above by mixing . the composition is topically applied to the skin for exfoliation . a composition , according to the present invention is prepared as follows : to prepare the composition , the materials are combined in the order above by mixing . the composition is topically applied to the skin for exfoliation . a composition according to the present invention , containing n - acetyl - d - glucosamine , is studied to determine the effect on desquamation . a panel of individuals is selected to participate in the test . the selected participants are 15 females between ages 21 and 65 years . participants are given the composition to take home and self administer on their right hand two times a day , once in the morning after washing and once in the evening at least 15 minutes before bedtime for 4 weeks . the left hand is the untreated control sample . participants are allowed to use only the composition being studied and are to log its use in a daily diary . at intervals of 2 and 4 weeks , the participants return for testing without applying the composition for at least 12 hours . the participants are tested without moisturizer or any other product on the skin of their hands . their skin is acclimated to an environment of about 70 ° f ., and about 40 percent relative humidity for about 20 minutes . skin exfoliation is measured with d - squame discs and image analysis . specifically , the amount of flakes removed from the skin surface using d - squame discs are measured . firmly and evenly , 4 d - squame discs are pressed on the back of each hand using a hand held uniform pressure device . the discs are removed by gently pulling them away from the skin . after removal , the discs are mounted on clear microscope slides and evaluated with an image analyzer , optima . a camera takes a picture of the slide and the average gray value is measured to determine the corresponding density of stratum corneocytes . denser samples have higher gray value differences . results show that the composition reduces skin flakiness after 2 weeks and 4 weeks of treatment when compared to untreated control hand area . after 2 weeks there is about a 15 . 8 percent decrease and after 4 weeks there was about 16 . 3 percent decrease in skin flakiness , thereby showing its utility in desquamation .	8
referring now in detail to the drawings for the purpose of illustrating a preferred embodiment of the present invention , the safety boat assembly as shown in fig1 and 3 includes a body member 1 which contains a front cabin 3 and a rear cabin 4 disposed in the middle and rear portions thereof , respectively , and a front chamber 2 disposed in the front portion thereof for containing an air bag 2 &# 39 ; disposed therein . the body member 1 is provided with a plurality of side chambers 5 attached to both sides thereof for containing a plurality of air bags 5 &# 39 ; disposed therein . the front cabin 3 is provided with an air passing cylinder attached to the interior of a front wall 3 &# 39 ; for containing a rectangular , tubular air inlet member 7 at an opening 6 &# 39 ; disposed at the air passing cylinder 6 . the air inlet member 7 extends to the bottom surface of the front cabin 3 and contains a circular tube 7 &# 39 ; disposed therein for readily introducing the air through apertures 16 , as shown in fig8 when the boat assembly is capsized . a tubular supporting member 17 attached to the interior of the front wall 3 &# 39 ; of the front cabin 3 is adapted to receive a tubular pole 8 . the tubular supporting member 17 and tubular pole 8 have a rectangular configuration for tightly engaging the pole 8 within the supporting member 17 . the tubular pole 8 contains a dense material 8 &# 39 ; disposed in lower portion thereof for increasing the pole &# 39 ; s weight and that of the boat assembly so as to stabilize the boat assembly in heavy waves . the tubular pole 8 is made of a solid material such as metal , hard plastic , or the like . also , the tubular pole 8 has a plurality of apertures 18 for adjusting the pole 8 to the supporting member 17 by aligning a bolt 19 through an aperture 18 disposed in the supporting member 17 . if necessary , the pole 8 can be moved to jut out of the bottom surface of the boat assembly as shown in fig4 so as to allow one to easily grasp it and return the capsized boat assembly 1 to its upright position . a light device 9 -, as shown in fig1 and 2 , is attached to the interior of the wall 3 &# 39 ; of the front cabin 3 . the light device 9 contains a battery b , a on / off gravity switch 9 &# 39 ;, and a light bulb 20 . the light bulb 2 . is automatically lighted by the gravity switch when the boat assembly is turned over ( fig1 ). the light device 9 is provided near a view finding window 10 for allowing one to observe the outside scene with the lightened bulb 20 when the boat assembly 1 is capsized . a wall 4 &# 39 ; disposed between the front cabin 3 and the rear cabin 4 is provided with a rectangular u - shaped pipe 13 having an engagement member 13 &# 39 ;. the u - shaped pipe 13 is arranged on both sides of the wall 4 &# 39 ; for introducing fresh air from the front cabin 3 to the rear cabin 4 when the boat assembly is capsized as shown in fig9 , and 11 . the u - shaped pipe 13 is mounted to the wall 4 by a screw 14 having a short rubber cover 15 through the engaging member 13 &# 39 ; thereof ( fig1 ). air bag side chambers 5 are attached to the body member 1 by the screws 14 having the short rubber cover 15 disposed at both ends thereof . also , the screws 14 disposed in the lower portion of the side wall in the cabins 3 and 4 have a long rubber cover 15 &# 39 ; for use by passengers as a grasping handle ( fig1 and 4 ). the cabins 3 and 4 are adapted to receive hooks 12 &# 39 ; of a safety belt 12 for securing the passengers to the cabins 3 and 4 ( fig1 ). in operation , when the boat assembly is turned over during sailing , the passenger is prevented frm being separated from the boat assembly since the passenger is secured to the safety belt i2 which is attached to the interior walls of the cabins 3 and 4 , and the passenger is able to grasp the handle 15 &# 39 ;. at this time , as shown in fig7 the fresh air in the atmosphere is introduced into the front cabin 3 through the plurality of apertures 16 disposed in the tubular air inlet member 7 and the opening 6 &# 39 ; of the air passing cylinder 6 . and the fresh air is introduced from the front cabin 3 to the rear cabin 4 through the u - shaped pipe 13 for supplying the fresh air to the victim ( fig1 ). at this time , simultaneously , the light bulb 20 is lighted by the on / off gravity switch and the victim can observe the outside scene through the view finding window 10 ( fig1 ). also , the capsized boat assembly can be easily returned to its upright position by using the end portion of the pole 8 which extends out of the bottom surface thereof with little effort being required by the rescuer . further according to the present invention , the probability of being capsized by a strong wind or waves is greatly reduced because of the gravity function of the dense material 8 &# 39 ; disposed in the lower portion of the rectangular pole 8 . this dense material may be mercury , for example . also , the safety boat assembly of the present invention contains the plurality of air bags 2 &# 39 ; and 5 &# 39 ; disposed within the cabins 3 and 4 , and air bag side chambers 5 for improving the floating force thereof . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included in the scope of the following claims .	1
the plug 1 of the invention has the shape of an elongated rod or pin ( see fig1 to 4 ). the plug has a side surface 10 and at least one end surface 11 and an opposite end 12 . the exact shape of this opposite end 12 is not critical ; it may be a tapered point or a flat surface , as shown in the drawings . on the side surface 10 it is possible to provide grooves 13 which start at said opposite end 12 and terminate at a distance spaced from said end face 11 , as shown in fig3 . these grooves are intended to facilitate the passage of air to the outside of the mold . such plugs can very easily be provided by molding a plastic material . in accordance with one aspect of the present invention , the grooves 13 , when they are present , do not extend to the molding surface of the walls of the tire mold . they therefore do not extend to the end surface 11 . a ring 14 , having a uniform , non - grooved surface , which is , for instance , cylindrical or slightly frustoconical , remains . as can be clearly noted from fig3 and 4 , said side surface 10 , which is at least partially frustoconical , is such that the cross section of said plug 1 decreases in the direction towards the side where said grooves 13 extend to the opposite end 12 . the vent of the invention is therefore embodied by a simple insert mounted in a hole made on the mold in the manner explained below . in fig5 there can be noted one of the conventional parts constituting a tire mold , namely a shell 2 intended to mold one of the sidewalls of the tire . the inner surface 20 of said shell 2 constitutes an exact image of the outer surface of the sidewall of the tire which it is desired to mold . at all the desired places , a hole such as 3 is drilled through said shell 2 . it therefore makes it possible to place the interior molding cavity i in communication with the exterior e of the mold . the hole 3 and the plug 1 are designed so as to present , for instance , an h7 / m6 fitting . the next step consists in inserting the plug 1 in the hole 3 , preferably from the side on which the molding surface 20 is located ( see fig5 and 6 ), until the side face 11 arrives practically at the level of the molding surface 20 of the shell 2 ( see fig7 ). of course , if the plug 1 has grooves 13 , it is necessary that the end 130 of these grooves be inserted to the inside of the thickness of the shell 2 in order that these grooves do not extend to the level of the molding surface 20 . in view of the fittings provided , there is no operating clearance between the plug 1 and the shell 2 . due to the fact that the hardness of the plastic material is definitely less than the hardness of the metallic material constituting the shell 2 , when the plug 1 is embedded within the hole 3 , the metallic material effects a slight machining of the side surface 10 of the plug 1 . this causes the appearance of small chips such as 15 which remain on the side of the inner cavity of the mold . the final step for the building of a vent consists in leveling the plug 1 by means of a cutting tool in order to produce a molding surface 19 which is located exactly , in its entirety , along the extension of the molding surface 20 of the wall which surrounds the plug 1 ( fig8 ). the mold which is thus obtained therefore has a plug 1 made of a material the hardness of which is definitely less than the hardness of the material essentially constituting the said wall 2 , said plug 1 having , prior to mounting , a cross section circumscribed in the cross section of the said hole 3 , at least on the side intended to be flush with said molding surface , said plug 1 being force - fitted in said hole 3 . in the final step , the said end face 11 of said plug 1 , possibly after leveling in order to form a molding surface 19 , is located completely along the extension of the molding surface 20 of the wall 2 bordering said hole 3 . of course , on basis of the present description , many variations and adaptations would be apparent to a person skilled in the art . the fittings cited are by way of example . it is sufficient in order to prevent the flow of rubber causing burrs that the plug 1 remains fixed firmly on the inside of the molding wall . it is necessary , of course , that the pressure of the raw rubber which acts on the molding surface 11 does not make it possible to drive the plug 1 further into the hole 3 . the propensity towards crushing of vents designed in this manner is far less than that which could be noted in the case of slit - shaped vents or in the case of holes of extremely small diameter . however , it is possible that in the long run a loss of effectiveness of the venting produced will be noted . in such case , the renewal operation is extremely simple and inexpensive . it is sufficient , by the use of a punch of a suitable diameter less than the diameter of the hole 3 which can be inserted in the hole 3 from the outside e of the mold to remove the plug 1 from the hole 3 and replace it with a new plug . the vent proposed by the present invention does not have any moving parts . it does not rely on any deformation or internal flexibility in order to permit the venting . if the materials used for this plug have a hardness which is very much less than the hardness of the material constituting the mold , it is possible to use force - fittings without it being necessary to respect a narrow tolerance for the molding of the plug 1 . it is possible to use plastic materials without it being possible to detect harmful influences due to the smaller thermal conductivity of the plugs as compared with the molding wall . the state of vulcanization of the rubber molded by means of a mold equipped in this manner is entirely comparable to that which is obtained with molds equipped with metal vents or mold not equipped with a venting vent . the present invention , used with other venting techniques of greater rate of flow , makes it possible to obtain the necessary venting in all the final molding places which present a greater difficulty in venting . it contributes to producing a mold which permits the molding of a tire which has no defect in appearance . its industrial use proves extremely reliable .	8
hereinafter , the orally administrable sebum secretion inhibiting composition comprising a collagen hydrolysate of the present invention and the food or drink product containing the composition are described . collagen is a main protein component constituting connective tissue in animals and is characterized by having a collagen triple helical structure . a total of not less than 30 types of collagen have been reported which are respectively termed type i , type ii , and so on . type i collagen is the primary component of the derma , ligaments , tendons , bones and the like ; and type ii collagen is the primary component of articular cartilage . further , type iv collagen is mainly contained in a basal membrane , which is the undercoat of all epithelial tissues . type i collagen is the most abundant collagen in the body . in the sebum secretion inhibiting composition of the present invention , the collagen origin is not limited , and usable are those derived from mammals such as cow , pig , etc ., birds such as chicken , ostrich , etc ., fishes such as sharks , etc . those derived from livestock such as cow , pig , chicken , etc ., are easily obtainable in a large amount , hence particularly preferable . further , the type of collagen is not limited and any type can be used , or a plurality of collagen types may be used in mixture . in the present invention , the collagen hydrolysate ( hereinafter sometimes referred to as collagen peptide ) refers to a low molecular collagen obtained by hydrolyzing collagen with an acid , alkali or enzyme . for example , a collagen hydrolysate can be obtained by immersing skins and joints of animals such as pig , cow and chicken or scales and skins of fish in an acid or alkali solution to extract gelatin and treating the extracted gelatin with an enzyme or acid . the gelatin refers to the collagen pre - treated with an acid or alkali and then solubilized by heat hydrolysis . the sebum secretion inhibiting composition of the present invention is for oral administration , but the dosage form is not limited and can be administered in the form of , for example , tablets , capsules , drinks , etc . further , the sebum secretion inhibiting composition of the present invention may be administered by being contained in a food or drink product , and , in that case , the food or drink product in which the composition is contained are not limited , and examples include carbonated drinks , nutritional drinks , liquors , sweets , nutritional food products , frozen sweets , dairy products , meats , etc ., and food products as a raw material to be used for these products . the sebum secretion inhibiting composition of the present invention refers to a composition which inhibits sebum secreted from skin and the skin may be derived from any site of the body , but face , head , chest , back , armpits , genital area , etc ., known as the areas where sebaceous glands are dense have abundant sebum secretion , hence are included as target sites . hereinafter , the present invention will be described in detail with reference to examples . however , the present invention is not limited to the following examples . for the collagen hydrolysate , a commercial “ collagen peptide ” ( pig ) having a molecular weight of 20000 or less was used . the collagen peptide used was obtained by immersing the pig skin in an acid or alkali solution to extract gelatin and further enzymolyzing the extracted gelatin . the collagen peptide is mainly derived from pig type i collagen . for the test meal containing the collagen peptide , a powder test meal comprising the composition shown in table 1 was prepared . the powder test meal contains 10000 mg of collagen peptide and 100 mg of vitamin c per meal . vitamin c is added because it is required to synthesize collagen in vivo . sixteen men in their twenties and thirties as the subjects orally ingested the powder test meal . the subjects took one meal of the powder test meal added to milk , juice , miso soup or the like at any convenient time once a day for 12 consecutive days . the sebum amount of the subjects was measured before , during and after the ingestion of the powder test meal . on the measurement day , the subjects washed their faces with warm water and a facial soap at 1 p . m ., and 2 hours later , i . e ., around 3 p . m ., the measurement was carried out . the measurement was carried out , using an optical sebum measurement apparatus , triplesense ( moritex precision corporation ), by pressing the sensor part of the measurement apparatus against a spot about 3 cm below the eye on the face of the subject . the value ( arbitrary unit a . u .) indicated as an oil content measurement value by the measurement apparatus was referred to as the sebum value . before ingesting the powder test meal , 10 of the subjects had a sebum amount of 40 a . u . or more , whereas 6 subjects had a sebum amount of below 40 a . u . these groups were termed as the preingestion sebum amount ≧ the 40 - group and the preingestion sebum amount & lt ; the 40 - group , respectively . table 2 shows the average value of the sebum amount of all subjects , the average value of the sebum amount of the preingestion sebum amount ≧ the 40 - group and the average value of the sebum amount of the preingestion sebum amount & lt ; the 40 - group before ingesting the powder test meal , 1 week and 2 weeks after the start of ingestion and 1 week after the completion of ingestion . similarly , the results in the form of graph are shown in fig1 . in fig1 , δ represents the average value for all subjects , ∘ represents the average value of the sebum amount of the preingestion sebum amount ≧ the 40 - group , and □ represents the average value of the sebum amount of the preingestion sebum amount & lt ; the 40 - group . after ingesting the powder test meal , all groups had reduced sebum amounts in comparison with before ingestion which revealed that the sebum secretion was inhibited owing to the ingestion of the powder test meal . in particular , the sebum secretion inhibitory effect was significant in the preingestion sebum amount ≧ the 40 - group which leads to the presumption that people with oily skin inherently are most likely to benefit the effect . the effect already started showing within 1 week after the ingestion and the sebum amount increased again 1 week later from the ingestion which leads to the presumption that the effect can be attained in a comparatively short period of time . the same test was also carried out for the group which did not ingest the powder test meal but the sebum inhibitory effect was not observed . examples of application of the deodorized collagen peptide obtained based on the above test results to drink or food products or compositions , are shown below . using the present product ( collagen peptide ) prepared by the methods described in example 1 , a drink , a powder , a tablet , a chewing gum , a candy , a tablet candy , a gummy jelly , a chocolate and a sorbet were produced with the following formula . collagen peptide 5 . 0 parts by weight high fructose corn syrup 8 . 0 parts by weight sugar 4 . 0 parts by weight flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . collagen peptide 5 . 0 parts by weight sucralose 0 . 005 parts by weight stevioside 0 . 008 parts by weight rebaudioside 0 . 008 parts by weight acesulfame potassium 0 . 01 parts by weight peach flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 6 . 5 using sodium bicarbonate , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 6 . 5 using sodium bicarbonate , the drink was prepared to be 100 parts by volume with purified water . hereinabove , the present invention has been described with reference to examples but can be carried out without being limited to these embodiments of the present invention . this application claims the priority to the japanese patent application no . 2009 - 297848 , filed on dec . 28 , 2009 , and the contents of which is hereby incorporated by reference as a part of the present application .	0
fig1 illustrates the pin - out required for a chip package 2 to perform a typical binary multiplication of two 32 - bit words 4 , 6 to generate a 64 - bit product word 8 , each bit requiring an individual external pin 9 on the chip package 2 for connection . this leaves only four additional pins for connection to power and control 10 , assuming the total pin - out of the chip package 2 in fig1 is 132 , which is equal to the proposed next largest industry standard . of course , fig1 is only an example and the connection of power and control 10 to the chip package 2 may require more than 4 pins . what fig1 establishes is that there are many cases in which the pin - out is so critical that each pin on the package 2 must be used to connect a different signal to the chip without duplication . fig2 illustrates a semiconductor chip 20 embodying a large scale integrated circuit having input / output ports comprising a plurality of conductive pads 22 located on its top surface along its periphery , the pads 22 surrounding complex integrated circuitry defined in thin film layers on the top surface thereof . the integrated circuit 20 is mounted on a thin metal film 30 deposited on a recessed floor 32 of a chip package 34 . the chip package 34 typically comprises an insulator material such as plastic or alumina or other ceramic , as is well known in th art . many of the elements on the chip 20 require a common supply voltage to be connected to each of them , thus requiring the supply voltage to be distributed throughout the top surface of the chip 20 . this is accomplished by means of a conductive bus 24 defined in one of the same thin film layers , the bus meandering about the top surface of the chip 20 . in the prior art , one end 24 ( a ) of the bus 24 would be connected to the nearest pad 22 ( a ) only . accordingly , the width of the bus must be sufficiently large in order to avoid unacceptable voltage drops along the length of the bus . the width of the bus 24 can be reduced without increasing such voltage drops by connecting the opposite end 24 ( b ) of the bus 24 to another nearby pad 22 ( b ), which would in turn be connected to the same supply voltage to which the first pad 22 ( a ) is connected . in this case , the width of the bus 24 can be reduced by a factor of four for a given voltage drop per - unit length along the bus 24 . however , the prior art requires the dedication of two external circuit package pins to carry the same supply voltage to the bus 24 where both ends of the bus 24 are connected to two different pads as shown in fig2 . as discussed previously in connection with fig1 there are many cases in which the use of more than one external pin to carry the same signal or voltage is unacceptable because there are no extra pins or at least the margin of pin - out is extremely limited . external connection of the pads 22 is achieved by forming or patterning a plurality of conductive bases 36 on the surface of a raised floor 38 surrounding the recessed floor 32 . each conductive base 36 is associated with an external pin 40 which is bonded on to the corresponding conductive base 36 . in an alternative embodiment , the conductive film 30 on which the integrated circuit 20 rests acts as a ground plane and is connected to one of the conductive bases 36 ( a ) located at one corner of the raised floor 38 . in the prior art , the pad 22 ( a ) is connected to the nearest conductive base 36 ( b ) by a thin wire and the corresponding pin 40 ( a ) is connected to the supply voltage to be carried by the bus 24 . the trade - off is immediately apparent because either : ( a ) the width of the bus 24 must be disadvantageously large to minimize resistive losses , or ( b ) the opposite bus end 24 ( b ) must be connected through the pad 22 ( b ) and an additional pin 40 ( c ) to the same supply voltage to which the pin 40 ( a ) is connected ( thus using more than one pin for the same voltage ). in the present invention , this trade - off is avoided by means of a surrounding conductive ring 50 which is patterned or formed at the same time the conductive bases 36 are formed on the raised floor 38 . the surrounding ring 50 is integrally formed with one of the bases 36 ( c ) which is bonded to a pin 40 ( b ). the width of the surrounding conductive ring 50 is sufficiently large so that there are no significant voltage drops along its length . as illustrated in fig2 both ends 24 ( a ), 24 ( b ) of the bus 24 are connected to the corresponding pads 22 ( a ) 22 ( b ) through wires 52 ( a ) 52 ( b ) to different nearby points on the conductive ring 50 . as described previously , the double - ended connection of the bus 24 to the supply voltage or signal applied to the pin 40 ( b ) permits a four - fold reductin in the width of the bus 24 . if the integrated circuit 20 has a plurality of such busses , the resulting savings in space on the chip is potentially enormous . while the number of pins 40 formed on the package is necessarily limited by considerations described previously , the number of chip pads 22 is at the discretion of the circuit designer . accordingly , many such busses similar to the bus 24 may be formed on the chip and may be connected to a plurality of points through various ones of the pads 22 to the ring 50 to permit a significant decrease in bus geometry and attendant savings in space on the chip without increasing the required pin - out . the extra space thus saved may be occupied by additional integrated circuitry , thus increasing the versatility of the chip . in another embodiment of the invention , a second surrounding conductive ring 54 may be provided and used in the same manner that the surrounding conductive ring 50 is used as illustrated in fig2 . although the presently preferred embodiment includes only one such surrounding conductive ring 50 , it is contemplated that a plurality of such rings may be provided and would be limited in number only by the available space on the raised floor 38 . a surrounding ring may also be provided on the bottom floor 32 or elsewhere near the chip 20 .	7
as shown in fig1 the system is provided on vehicle 10 which has a body section 12 outlined in dot - dash line and wheels with inflated tires indicated as a , b , c and d . the tire air pressure monitoring system of the present invention is electrically operated and derives its power from the battery 14 , one side of which , preferably the negative side , is connected to ground as indicated at 16 and the other or positive side is connected through an ignition switch 18 to activate a timer 20 which , when the ignition switch 18 is initially turned on , closes a switch 22 ( see fig2 ) in the line 24 leading to the pickup solenoid or sensor actuator , as will be described hereinbelow , is indicated at 26 ( see fig3 ). the timer switch 22 and the motion detector switch 30 individually and in combination provide a means to prevent activation of the solenoid unless certain conditions are met . a motion detector 28 controls a switch 30 by holding the switch 30 in closed ( conducting ) position if no motion is sensed but is immediately moves the switch 30 to an open ( non - conducting ) position ( not shown ) to break the connection in line 24 and disconnect the pickup or activating solenoids 26 . the solenoids each have a base retracted position to which the solenoid ( and the contact elements mounted thereon is driven , for example , by a spring or the like as represented by the arrow 25 so that the retracted position is a fail safe position with the electrical contact elements 66 , 68 and 70 withdrawn as will be described below to review , as shown in fig2 when the ignition switch 18 is initially closed , the timer 20 is activated and closes the switch 22 and since the switch 30 will normally be closed if the vehicle is not in motion , power is sent to the solenoids 26 via the line 24 until the timer 20 completes its cycle at which time the switch 22 will open . the timer is set to provide sufficient time ( e . g . about 10 to 60 seconds ) for the operator to read the pressures in the tires a , b , c and d as will be described below . in the illustrated arrangement , the line 32 delivers power to the sensor system 34 and via one of the movable contact elements 66 , 68 or 70 delivers power to the pressure sensor 62 on the wheel ( a , b , c , or d ) when the solenoids 26 are activated , if power is required to operate the sensor which of course will depend on the type of sensor being used . referring back to fig1 a sensor system 34 is provided on each of the wheels a , b , c and d and each sensor system 34 includes a set of non - rotating contact elements 66 , 68 and 70 mounted for movement by the solenoid 26 and a set of movable contact ( annular contact ribbons 52 , 54 and 56 ) that are mounted to rotate with the sensor 62 that is fixed relative to the wheel . when the solenoids 26 are activated , the sensor systems 34 feeds back signals to the display unit 36 on chassis 12 ( see fig1 ). the digital display unit 36 displays the left front displays the left front tire pressure as indicated by display unit lf , the right front tire pressure as indicated by display unit rf , the left rear tire tire pressure as indicated by display unit lr and the right rear tire tire pressure as indicated by display unit rr . these display units indicate the tire pressure in their respective tire when both the timer switch 22 and the motion detector switch 30 are in the closed ( conducting ) position and the solenoid 26 for each of the tires is activated . if the system is employed with vehicles having more ( or less ) tire that are to be monitored obviously the number of sensors and the number of displays will be changed as required . attention is directed to fig3 which further illustrates one form of the sensor system 34 , which includes three annular contact ribbons 50 , 52 and 54 that are connected via lines 56 , 58 and 60 to the pressure sensor 62 mounted on the wheel and in communication with the tire to determine the air pressure or sense the air pressure within its tire . in the version illustrated in fig3 the annular contact rings 50 , 52 and 54 are mounted on a disk 64 which rotates with the wheel . in the illustrated arrangement , the side of the disk to be contacted by the movable , retractable , electrical contact elements 66 , 68 and 70 is covered by a protective coating 72 which overlies the front face of the disk 64 ( face facing the contacts 66 , 68 and 70 ). obviously it is unnecessary to cover the whole face of the disk with coating , only the conductor strips need be protected and thus only the strips need be coated sufficiently to protect them . one system for mounting the annular conductive strips or ribbons 50 , 52 and 54 is to place them in a groove and then fill the groove with the protective coating . obviously the ribbons must each be electrically isolated from the other and from the disk or mounting e . g . wheel rim . each of these contact elements 66 , 68 and 70 is provided with a sharpen end point 74 which will penetrate the coating 72 when the solenoid 26 is activated to move the contacts 66 , 68 and 70 toward the disk 64 . i . e . extension of the solenoid 26 to activated position forces the sharpen ends 74 through the protective coating 72 and into contact with the annular connectors 50 , 52 and 54 respectively . in the arrangement shown in fig4 the pickup disk 64 is shown in position to be mounted on the disk 80 of the disk brake and is connected to the pressure sensor 62 via the connectors schematically indicated at 82 , i . e . equivalent to the wires 56 , 58 and 60 . mounted fixed to the axial 84 is a backup plate 86 to which the pickup solenoid 26 is fixed . in this illustration to the left of the two vertical dotted lines , all of the elements rotate with the wheel , whereas those elements to the right of the two vertical dotted lines are fixed to the chassis . the system shown in fig5 is essentially the same as the system shown in fig4 with the exception that a brake drum 88 replaces the disk 80 and the annular conducting ribbons extends circumferentially around the inner side of the wheel rim so that they in effect to form a right circular cylinder as opposed to a flat disk . however , other than this , the ribbon connections will be the same and the protective 72 will simply overlie these contacts . obviously , this positioning of the annular ribbons requires that the motion of the solenoid 26 be at right angles to the motion of the solenoid shown in fig4 i . e . in fig4 the motion of the solenoid is indicated by the arrow 90 is substantially parallel to the axis of rotation whereas in fig5 the movement of the solenoid as indicated by the arrow 92 is substantially radial to the axis or rotation of the tire . it is preferred to have the solenoid move the contacts in an axial direction relative to the axis of rotation i . e . as shown in fig4 but in those cases where the wheel structure does not easily accommodate such a system radial movement of the contacts by the solenoid will be used as indicated in fig5 . while the system of fig4 has been shown with disk brakes and the system of fig5 with drum brakes the systems may be interchange and the system of fig5 used with disk brake or the system of fig4 with drum brakes , if the wheel configuration is suitable . the contacts 66 , 68 and 70 will now be described in more detail with in relation to fig6 , 8 and 9 . in each case , a block 100 is mounted on the solenoid rod 102 and is thus moved by action of the solenoid 26 when the solenoid 26 is activated from a retracted or inactive position as illustrated to an active position wherein the contact elements 66 , 68 and 70 are projected forward as indicated by the arrow 104 to drive the sharpen ends 74 through the protective coating 72 and into contact with their respective ribbons 50 , 52 and 54 . in the arrangement shown in fig6 the contact elements 66 , 68 and 70 are simply clamped in an insulated block and the wiring connections are connected from these contact elements 66 , 68 and 70 to their respective display 36 ( in each of the below described embodiments the contact elements 66 , 68 and 70 are similarly connected to their respective portion of the display 36 ). in the fig7 embodiment , a spring schematically indicated at 106 , 108 and 110 is used to bias its respective the contact elements 66 , 68 and 70 to an extended position while permitting each one of these contacts 66 , 68 or 70 to independently move rearwardly , i . e . in the direction of the arrow 112 . this springing of the contact elements better ensures that the coating 72 is not damaged should there be some relative movement between the contacts 66 , 68 or 70 and their respective rings 54 , 52 and 50 i . e . such movement will simply drive the contact elements in the direction of the arrow 112 to minimize any damage to the coating 72 . fig8 shows a system similar to fig6 and 7 but wherein in a single spring 114 biases all of the contact elements 66 , 68 and 70 in the direction of the arrow 104 while permitting movement of all simultaneously in the direction of the arrow 112 . in the embodiment of fig9 each of the contact elements 66 , 68 and 70 is wound to form its respective coil springs 116 , 118 and 120 each of which operates similarly to its corresponding springs 106 , 108 and 110 in the fig7 embodiment to permit rearward movement should the vehicle accidentally be put into motion when the solenoid 26 is in extended position and the contact elements are in their active position . having described the invention , modifications will be evident to those skilled in the art without departing from the scope of the invention as defined in the appended claims .	1
referring now to the drawings , fig1 shows a perspective view of a vehicle 1 with a part of the roof broken away to show the driver 16 operating the vehicle 1 . in fig1 , the vehicle 1 is depicted as an automobile but the invention is equally suitable for other types of vehicles , including but not limited to vans , trucks , pick - up trucks , and sports utility vehicles . in fig1 , the invention is shown as installed on all corners of vehicle 1 . however , this depiction is to illustrate several possible embodiments and it is not intended or required that the invention be installed on all corners of the vehicle 1 to achieve the desirable objects of the invention . a left front corner camera mirror assembly 102 is located at the left front corner of the vehicle 1 , and a right front corner camera mirror assembly 103 is located at the right front corner of the vehicle 1 . also shown in fig1 is a left rear corner camera mirror assembly 104 and a right rear corner camera mirror assembly 105 . in fig1 , these camera mirror assemblies 102 , 103 , 104 and 105 are shown on the exterior of the vehicle 1 , but it is not intended that these camera mirror assemblies be limited to external installation . also depicted in fig1 is a left monitor 106 and a right monitor 119 within the vision of the driver 16 . also shown in fig1 is a left light image 107 entering the left front corner camera mirror assembly 102 , and a left light image 108 entering the right front corner camera mirror assembly 103 , as well as a right light image 109 entering the right front corner camera mirror assembly and a right light image 110 entering the left front corner camera mirror assembly 102 . in addition a forward light image 111 is shown entering the right front corner camera mirror assembly and a forward light image 112 is shown entering the left front corner camera mirror assembly . fig1 also shows a left light image 113 entering the left rear corner camera mirror assembly 104 , a left light image 114 entering the right rear corner camera mirror assembly 105 , a right light image 115 entering the left rear corner camera mirror assembly 104 and a right light image 116 entering the right rear corner camera mirror assembly 105 . in addition a rear light image 117 is shown entering the right rear corner camera mirror assembly and a rear light image 118 is shown entering the left rear corner camera mirror assembly . fig2 shows the left side view of a vehicle 1 operated by a driver 16 with certain embodiments of the invention . a left front corner camera mirror assembly 102 is shown on the left front exterior of the vehicle 1 and a left rear corner camera mirror assembly 104 is shown on the left rear exterior of the vehicle 1 . the forward light image 112 is shown entering the left front corner camera mirror assembly 102 and a rear light image 118 is shown entering the left rear corner camera mirror assembly 104 . fig3 shows a plan view of a vehicle 1 with certain embodiments of the invention . a left front corner camera mirror assembly 102 is located at the left front corner of the vehicle 1 , and a right front corner camera mirror assembly 103 is located at the right front corner of the vehicle 1 . also shown in fig3 are a left rear corner camera mirror assembly 104 and a right rear corner camera mirror assembly 105 as well as a left monitor 106 and a right monitor 119 . also shown in fig3 is a left light image 107 entering the left front corner camera mirror assembly 102 , and a left light image 108 entering the right front corner camera mirror assembly 103 , as well as a right light image 109 entering the right front corner camera mirror assembly and a right light image 110 entering the left front corner camera mirror assembly 102 . in addition a forward light image 111 is shown entering the right front corner camera mirror assembly and a forward light image 112 is shown entering the left front corner camera mirror assembly . fig3 also shows a left light image 113 entering the left rear corner camera mirror assembly 104 , a left light image 114 entering the right rear corner camera mirror assembly 105 , a right light image 115 entering the left rear corner camera mirror assembly 104 and a right light image 116 entering the right rear corner camera mirror assembly 105 . in addition a rear light image 117 is shown entering the right rear corner camera mirror assembly and a rear light image 118 is shown entering the left rear corner camera mirror assembly . fig4 shows a schematic view of a camera mirror assembly 102 installed in the left front corner of a vehicle 1 . in fig4 a left facing mirror 123 is shown in position ahead of a left front camera 120 with a receiving lens 120 a . in this arrangement the left facing mirror is positioned at an angle to receive a left light image 107 and reflect the left light image to the receiving lens 120 a and into the left front camera 120 . by means of a transmission cable 121 , the left light image 107 is displayed on the left monitor 106 within the vision of the driver 16 . in this embodiment as depicted in fig4 , the left facing mirror 123 will only block a portion of the receiving lens 120 a allowing a forward light image 112 to be received by the receiving lens 120 a . into the left front camera 120 and transmitted by the transmission cable 121 to the left monitor 106 within the vision of the driver 16 . the left light image 107 would be displayed as a lower image 125 on the left monitor 106 and the forward light image 112 would be displayed as an upper image 124 on the left monitor 106 or the images could be reversed . while the embodiment depicted in fig4 is shown with a transmission cable 121 for transmitting a light image from the camera 120 to the left monitor 106 , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . as shown in fig4 left front camera 120 is not aimed directly forward but is angled to the right at an angle 112 a to enhance the vision of the driver 16 in left turn situations where the vehicle 1 is turning into the direction of oncoming traffic which is difficult to see because of vehicles directly ahead . it is intended that this orientation be reversed in right hand drive vehicles and countries . while the angle 112 a may be fixed to suit an optimum placement to enhance the vision of the driver 16 , an alternate embodiment not shown would comprise a pivotal mount and turning means to turn the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . although not shown it is understood that the camera mirror assemblies and monitors will normally receive power from the vehicle electrical service and such electrical service may be wired directly to such elements or wired integrally with the transmission cables . fig5 shows a schematic view of a camera mirror assembly 103 installed in the right front corner of a vehicle 1 . in fig5 a right facing mirror 129 is shown in position ahead of a right front camera 126 with a receiving lens 126 a . in this arrangement the right facing mirror is positioned at an angle to receive a right light image 109 and reflect the right light image to the receiving lens 126 a and into the right front camera 126 . by means of a transmission cable 127 , the right light image 109 is displayed on the right monitor 119 within the vision of the driver 16 . in this embodiment as depicted in fig5 , the right facing mirror 129 will only block a portion of the receiving lens 126 a allowing a forward light image 111 to be received by the receiving lens 126 a into the right front camera 126 and transmitted by the transmission cable 127 to the right monitor 119 within the vision of the driver 16 . the right light image 109 would be displayed as a lower image 131 on the right monitor 119 and the forward light image 111 would be displayed as an upper image 130 on the right monitor 119 or the images could be reversed . while the embodiment depicted in fig5 is shown with a transmission cable 127 for transmitting a light image from the camera 126 to the right monitor 119 , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . it is intended that the embodiments depicted in fig4 and 5 can be used together or separately . likewise , while not shown an alternate embodiment would comprise a pivotal mount and turning means to turn either or both cameras on pivotal mounts to the most advantageous position at the control of the driver 16 . fig6 shows a schematic view of an alternative right front camera mirror assembly 103 . in this embodiment the right front camera 126 and receiving lens 126 a are in line with a right pivoting mirror assembly 132 and a left pivoting mirror assembly 133 . the right pivoting mirror assembly 132 is hinged to swing a mirror 132 a on pivot 132 b into position to receive a right light image 109 and reflect the right light image 109 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . likewise , the left pivoting mirror assembly 133 is hinged to swing a mirror 133 a on pivot 133 b to receive a left light image 108 and reflect the left light image 108 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . when not in a position to receive and reflect a light image each mirror is retracted to allow the other mirror to receive and reflect a light image or both mirrors are retracted to allow a forward light image 111 to be received by the receiving lens 126 a into the right front camera 126 and transmitted by the transmission cable 127 to the left monitor 119 within the vision of the driver 16 . while the embodiment depicted in fig6 is shown with a transmission cable 127 for transmitting a light image from the camera 126 to the left monitor 106 , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . an alternate embodiment not shown would comprise a pivotal mount and turning means to turn the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . likewise , it is not intended that the position of the pivoting mirrors be limited to one of two positions . in fig6 , the left monitor 106 is depicted with a forward image 134 showing the forward light image 111 , a left image 135 showing the left light image 108 , and a right light image 136 showing the right light image 109 . also shown are a forward image control button 134 a , a left image control button 135 a , and a right image control button 136 a . when the forward image control button 134 a is activated , both the right pivoting mirror assembly 132 and the left pivoting mirror assembly 133 are in their retracted positions allowing the forward light image 111 to reach the receiving lens 126 a . when the left image control button 135 a is activated , the mirror 133 a swings into position on pivot 133 b to receive a left light image 108 and reflect the left light image 108 to the receiving lens 126 a . when the right image control button 136 a is activated , the mirror 132 a swings into position on pivot 132 b to receive a right light image 109 and reflect the left light image 109 to the receiving lens 126 a . the pivoting mirror assemblies may be activated by any suitable mechanism such as an electrical solenoid , vacuum control or gears . fig7 shows a schematic view of another alternative right front camera mirror assembly 103 installed in the right front corner of the vehicle 1 . in this embodiment the right front camera 126 and receiving lens 126 a are in line with a pyramid pivoting mirror assembly 137 with a right pivoting mirror 137 a and a left pivoting mirror 137 b . the right pivoting mirror 137 a is hinged on pivot 137 c to swing into position to receive a right light image 109 and reflect the right light image 109 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . likewise , the left pivoting mirror 137 b is hinged on pivot 137 d to swing into position to receive a left light image 108 and reflect the left light image 108 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . when not in a position to receive and reflect a light image each mirror is retracted to allow a forward light image 111 to be received by the receiving lens 126 a into the right front camera 126 and transmitted by the transmission cable 127 to the left monitor 119 within the vision of the driver 16 . while the embodiment depicted in fig7 is shown with a transmission cable 127 for transmitting a light image from the camera 126 to the left monitor 106 , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . the pivoting mirror assemblies may be activated by any suitable mechanism such as an electrical solenoid , vacuum control or gears . as shown in fig7 , the left light image 108 would be displayed as a left image 139 on screen 122 of the left monitor 106 and the right light image 109 would be displayed as right image 138 on screen 122 of the left monitor 106 . when the mirrors 137 a and 137 b were retracted then the screen 122 would display the forward image 111 . an alternate embodiment not shown would comprise a pivotal mount and turning means to turn the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . likewise , it is not intended that the position of the pivoting mirrors be limited to one of two positions . fig8 shows a schematic view of a camera mirror assembly 105 installed in the right rear corner of a vehicle 1 . in fig8 a left facing mirror 143 and a right facing mirror 142 are shown in crisscross position one above the other and ahead of a right rear camera 140 with a receiving lens 140 a . in this arrangement the left facing mirror 143 is positioned at an angle to receive a left light image 114 and reflect the left light image 114 to the receiving lens 140 a and into the right rear camera 140 . likewise , the right facing mirror 142 is positioned at an angle to receive a right light image 116 and reflect the right light image 116 to the receiving lens 140 a and into the right rear camera 140 . by means of a transmission cable 141 , the left light image 114 and right light image 116 are displayed on either the left monitor 106 or the right monitor 119 within the vision of the driver 16 . although not shown , it is understood that the left light image 114 and right light image 116 could be displayed as side by side images or top and bottom images on either monitor in a manner similar to that depicted in fig4 and fig7 . likewise , the mirror arrangement depicted in fig8 would be equally applicable to any corner camera mirror assembly , both front and rear . also , while the embodiment depicted in fig8 is shown with a transmission cable 141 for transmitting a light image from the camera 140 to a monitor , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . an alternate embodiment not shown would comprise a pivotal mount and turning means to turi the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . fig9 shows a schematic view of another alternative right front camera mirror assembly 103 installed in the right front corner of the vehicle 1 . in this embodiment the right front camera 126 and receiving lens 126 a are in line with a pyramid mirror assembly 144 with a right facing mirror surface 144 a and a left facing mirror surface 144 b . the right facing mirror surface 144 a is in a position to receive a right light image 109 and reflect the right light image 109 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . likewise , the left facing mirror surface 144 b is in a position to receive a left light image 108 and reflect the left light image 108 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . while the embodiment depicted in fig9 is shown with a transmission cable 127 for transmitting a light image from the camera 126 to the left monitor 106 , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . an alternate embodiment not shown would comprise a pivotal mount and turning means to turn the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . as shown in fig9 , the left light image 108 would be displayed as a left image 139 on screen 122 of the left monitor 106 and the right light image 109 would be displayed as right image 138 on screen 122 of the left monitor 106 . fig1 is a schematic of a camera installed in the left front corner of vehicle 1 to receive a forward light image 112 into the receiving lens 120 a and into the left front camera 120 for transmission by cable 121 to the left monitor 106 within the vision of the driver 16 . the left front camera 120 is not aimed directly forward but is angled to the right at an angle 112 a to enhance the vision of the driver 16 in left turn situations where the vehicle 1 is turning into the direction of oncoming traffic which is difficult to see because of vehicles directly ahead . it is intended that this orientation be reversed in right hand drive vehicles and countries . while the angle 112 a may be fixed to suit an optimum placement to enhance the vision of the driver 16 , an alternate embodiment not shown would comprise a pivotal mount and turning means to turn the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . fig1 shows a perspective view of the dashboard 145 of a vehicle with the driver observation system and depicts the steering wheel 146 and a left monitor 106 and a right monitor 119 both mounted on the dashboard 145 in the sight of the driver . on the steering wheel are also shown a set of left control buttons 148 and right control buttons 147 to control the screen images presented on the monitors as generally depicted in the embodiments shown in fig4 through 10 in accord with the camera mirror assemblies installed on a vehicle . it is understood that these controls could select left , right , forward and rear light images or any combination and said controls would serve to activate any motors or driving devices to position the mirrors , the cameras or the camera mirror assemblies in the desired position or otherwise activate any feature of the camera such as focus or zoom . likewise , it is understood that these controls could be mounted on the monitors or other location within the reach of the driver . fig1 shows a schematic of a camera mirror assembly housing 149 for encasing a right front corner camera mirror assembly 103 as depicted in fig6 , where the right front camera 126 and receiving lens 126 a are in line with a right pivoting mirror assembly 132 and a left pivoting mirror assembly 133 . the right pivoting mirror assembly 132 is hinged to swing a mirror 132 a on pivot 132 b into position to receive a right light image 109 and reflect the right light image 109 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . likewise , the left pivoting mirror assembly 133 is hinged to swing a mirror 133 a on pivot 133 b to receive a left light image 108 and reflect the left light image 108 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . in fig1 , a right pivoting mirror motor 150 is shown to move the mirror 133 a on pivot 133 b , and a left pivoting mirror motor 151 is shown to move the mirror 132 a on pivot 132 b . also shown is a control module 155 to activate the motors 151 and 150 in accord with the control instructions from the driver 16 . it is intended that the camera mirror assembly housing 149 be of material of adequate strength and stiffness to hold the components in proper position and to be impervious to weather conditions . as shown in fig1 , the housing 149 has right light image aperture 152 to permit the reception of a right light image ; a left light image aperture 153 to permit the reception of a left light image ; and a forward light aperture 154 to permit the reception of a forward light image . it is intended that said apertures be of rigid transparent material such as tempered glass or plastic and made an integral part of the housing 149 to maintain protection against weather and entrance of foreign matter into the camera mirror assembly . it is understood also , that the pivoting mirror motors 150 and 151 may be any suitable drive mechanism whether electrically , hydraulically , vacuum or pneumatically powered . although not shown an alternate embodiment would comprise a pivotal mount and turning means to turn the housing 149 on the pivotal mount to the most advantageous position at the control of the driver 16 . fig1 shows a plan view of a vehicle 53 with the invention attempting a left turn from a common turning lane 57 across an oncoming traffic lane 59 with an oncoming vehicle 56 while facing an opposing turning vehicle 55 in the common turning lane 57 . in this depiction , the vehicle 53 will have moved from the traffic lane 58 into the common turning lane 57 to turn left across the opposing lane 59 . in this situation the driver of vehicle 53 would have a clear view of oncoming traffic in lane 59 except for the opposing vehicle 55 coming in the opposite direction and attempting a left turn across traffic lane 58 . at this point , the driver of vehicle 53 must nose the vehicle out into the oncoming lane to see any oncoming vehicles 56 . when equipped with the driver observation system , the left front corner of the vehicle 53 need only extend slightly to the left so that a forward light image 112 would be received at the left front corner camera mirror assembly and transmitted to the vision of the driver . in contrast , a vehicle 54 without the invention would have to turn into the oncoming traffic lane 59 a sufficient distance to allow the driver to see the oncoming traffic from the controls of the vehicle . this increased distance could be enough to cause an accident . fig1 shows a plan view of a vehicle 60 with the invention attempting to turn left onto an intersecting street from a cross street 66 by crossing an opposing lane 64 to reach a merging lane 65 . a parked vehicle 61 obstructs the vision of the driver of vehicle 60 . when equipped with the driver observation system , vehicle 60 need only proceed slightly forward to receive a left light image 107 at the left front corner camera mirror assembly and have that image transmitted to the driver . in contrast , a vehicle 63 without the invention would have to proceed almost half the length of the vehicle forward to allow the driver to see oncoming traffic . the camera can be any commercially available unit with or without focusing or zoom features .	1

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.