Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
in the payment process via a credit card transaction , shown in fig1 the network operator is only involved as service provider for communication services . he / she is excluded from the actual flow of money of the transactions . his / her income is low in relation to the credit card turnover . the billing accounts offered by the network operator ( conventional billing or credit account ) are also excluded from an international utilization given these prerequisites . the problem for the provider is that he / she must conclude billing contracts with the popular financial institutes , which can demand relatively high fees in comparison with the turnover , in order to reach a large circle of customers . if the provider does not support a method of payment preferred by the customer , the business will probably not be transacted . [ 0025 ] fig2 then shows the flows of money in a case where a purchase contract for goods or services has been concluded . customer and provider are , in each case , at home in different networks . when a payment is carried out , the customer ( consumer ) has a contract with a first credit card institute ( c 21 ). the provider ( merchant ) also has a contract with a credit card institute ( 12 m ). in the best case , it is the same credit card institute ( cci ); otherwise , it is still necessary again to conclude contracts . if not , the transmission of money will not function . the present invention can be implemented , for example , by the “ payment @ vantage ” system of siemens . this is a real - time accounting system which administers accounts both for customers and for providers . this accounting system is thus operated by the payment service provider . [ 0027 ] fig3 shows , by way of an example , the case of the use of a credit card by a customer ( consumer ) for making a payment to a provider ( merchant ). the customer has a business relationship with another network provider ( pspc ) in the home network of the customer ( mhn ) than the provider ( pspm ), who has his / her own home network ( chn ). in this example , the customer has a contract with a credit card institute ( cci ), but the provider does not need to have a contract with this credit card institute . at this point , it should be mentioned that other forms of payment are also possible : prepaid by pps ( prepaid server ), or postpaid by abc ( administration and billing center ). these “ internal ” forms of payment of the consumer psp will present for him / her the most attractive way of paying because , in this case , the consumer psp does not have to pay for any commissions ( such as , for example , in the case of credit cards ). according to the present invention , the home network of the customer ( chn ) provides the following services : debiting the credit card of the customer on order by the “ foreign ” provider ; use of ( debit ) accounts instead of billing via credit cards ( prepaid accounts or telephone account ) is also useful . this additionally simplifies the scenario and , in addition , is much more attractive for the network operators , ( see above ). the flows of money belonging to the scenario shown in fig3 are found again in fig4 . it can be seen that there only needs to be one business relationship as a basis for the provider ( merchant ). as such , there is a single point of entry for the payments and transactions for the provider . this point of entry charges additional fees for performing an international payment . the payment service provider at the customer end ( pspc ) maintains business relationships with all financial institutes ( cci ) at which his / her customers ( consumers ) have contracts . in the case of credit payments , he / she acts as dealer who wishes to receive a payment from the customer ( 2 ), with respect to the credit card institute ; i . e ., the credit card institute cannot recognize the actual provider ( merchant ). on the invoice paid by the customer ( 1 ), the network operator appears as dealer . information about the original dealer and the service received can be made visible , for example , in the transaction details so that the customer also obtains a detailed overview of his / her transactions . the clearing between the payment service provider of the customer ( pspc ) and provider ( pspm ) occurs directly between these two ( 3 ) and can take place by extending the pre - existing roaming agreement , and the existing technical means such as “ tap3 ” for gsm or other clearing formats ( e . g ., ciber ) can be used . the provider obtains his / her money ( 4 ) from his / her own payment service provider ( pspm ). he / she receives additional fees from the dealer for carrying out the transaction . although the present invention has been described with reference to specific embodiments , those of skill in the art will recognize that changes may be made thereto without departing from the spirit and scope of the present invention as set forth by the hereafter appended claims .	6
an improvement is to change the gain of the watermark depending upon the dynamic attributes of the local area around the watermark . specifically , if the pixel represents a changing or moving area , the watermark is reduced in value , unless the movement is chaotic or noise - like , in which case the gain can remain large . more specifically , given the current value for one pixel , if that current value is similar to the values before and after the current frame ( for the same pixel ), the watermark gain , labeled time - gain , for that pixel should be near 1 . the time - gain should drop as the values of that pixel change in time , as long as the change is steady over time . the more the steady change , the smaller the time gain , where change can be measured as absolute difference or statistical variance . this should be repeated for each pixel or group of pixels in the frame . however , if the change in the pixel or group of pixels is chaotic or noise - like , the time gain can remain near 1 since noisy environments are a good place to hide watermarks . in addition , we may want to look only at the frame before and after or two or more frames in each time - direction . to this end , if the pixel represents a changing or moving area , the watermark is reduced in value . alternatively , one may want to determine the gain only from past values so that the system is causal and the embedder causes no delay . this can be accomplished by using the past values to calculate the gain directly or to estimate the future value and calculate the gain using this estimate . in one embodiment , the estimate ( s ) can be dependent upon the slope and change in slope of the current pixel value and previous values , and the resulting time - gain can be based upon the variance of the three existing values and estimated value ( s ). the predictive frames used in most video compression schemes , such as mpeg p and b frames , can be used to set the time gain . fig1 illustrates a diagram of a digital watermark embedder for video using time based perceptual masking to reduce visibility of the watermark . the inputs to the embedder include a video stream 100 and an auxiliary data message to be imperceptibly embedded into the video stream . conceptually , there are two components of the embedder : a message pre - processor for transforming the auxiliary data into an intermediate signal for embedding into the host video stream , and a human perceptibility system analyzer for computing a mask used to control the embedding of the intermediate signal into the host video stream . the message pre - processor transforms the message signal into an intermediate signal according to a protocol for the desired digital watermark application . this protocol specifies embedding parameters , like : the size of the message as well as number and meaning of data fields in the message ; the symbol alphabet used for the message elements , e . g ., binary , m - ary etc . the type of error correction coding applied to the message ; the type of error detection scheme applied to the message ; the type and nature of the carrier signal modulated with the message signal ; the sample resolution , block size , and transform domain of the host signal to which elements of the intermediate are mapped for embedding ; etc . the example shown in fig1 pre - processes as follows ( 104 ). first , it applies error correction coding to the message , such as turbo , bch , convolutional , and / or reed solomon coding . next it adds error detection bits , such as parity bits and / or cyclic redundancy check ( crc ) bits . the message 102 includes fixed bits ( e . g ., a known pattern of bits to verify the message and synchronize the reader ) and variable bits to carry variable data , such as frame number , transaction id , time stamp , owner id , content id , distributor id , copy control instructions , adult rating , etc . the embedder modulates the message with a carrier signal , such as a pseudo random sequence , features of the host video signal 100 , or both . the embedder also maps elements of the intermediate signal to samples in the host video signal ( e . g ., particular samples in the spatial or frequency domain of the video signal ). the mapping function preferably replicates instances of the message throughout the video signal , yet scrambles the message instances such that they are more difficult to visually perceive and detect through analysis of the video stream . for more about message processing for digital watermark embedding , see u . s . pat . nos . 6 , 122 , 403 and 6 , 614 , 914 . the human perceptibility analyzer calculates an “ intraframe ” perceptual mask ( 106 ) based on spatial visual attributes within a frame . this mask provides a vector of gain values corresponding to locations within the frame and indicating the data hiding capacity of the image at these locations in the frame . these gain values are a function of signal activity ( e . g ., a measure of local variance , entropy , contrast ), luminance , and edge content ( as measured by an edge detector or high pass filter ) at locations within the frame . locations with higher signal activity and more dense edge content have greater data hiding capacity , and therefore , the signal energy with which the intermediate signal is embedded can be increased . similarly , the changes made to the host signal due to the embedding of the watermark can be increased in these areas . further examples of such perceptual masking are provided in u . s . pat . nos . 6 , 122 , 403 and 6 , 614 , 914 . the human perceptibility analyzer also calculates a time based perceptual mask ( 108 ) as introduced above . the time based perceptual analyzer determines how pixels in a local area change over time ( e . g ., from frame to frame ), and adjust the gain of the perceptual mask accordingly . if the pixels in the local area change less then a predetermined threshold , then the gain in the perceptual mask is relatively unchanged . if the pixels in the local area change in a smoothly varying manner over time , then the gain in the perceptual mask is reduced to reduce the visibility of the digital watermark . finally , if the pixels in the local area change in a highly varying manner , e . g ., in a chaotic or substantially random manner , then the gain in the perceptual mask is increased to reflect the increased data hiding capacity of that location in the video stream . as noted previously , there are a variety of ways to measure the time varying changes of pixels at a location . one way is to use a statistical measure such as the mean , variance or standard deviation , and change in variance or standard deviation of pixel values ( e . g ., luminance ) over time at a location . for example , a variance near 0 , i . e . below a pre - determined threshold , identifies a stationary area - results in a time - gain near or greater than 1 . a variance greater than the threshold with minimal change in variance identifies a smoothly varying location , resulting in a time - gain below 1 . a variance greater than the threshold but with a large change in variance identifies a noisy area , resulting in a time - gain near or greater than 1 . another measure is the absolute change of a pixel value at a location , along with the time - derivative or rate of change of the absolute change in pixel value . a related measure is to determine how a pixel is changing by measuring absolute value and / or changes in motion vectors for that location ( e . g ., pixel or block of pixels ). calculating motion vectors is well known in the state of the art of video compression . for compressed video streams , this motion vector data is part of the data stream , and be used to determine the gain for embedding the intermediate signal in spatial domain samples or frequency domain coefficients ( e . g ., dct or wavelet coefficients ). for example , a non - near zero ( i . e . above the pre - determined threshold ) smoothly varying motion vector identifies a smoothly changing location and results in a reduced time - gain value . a near zero motion vector or chaotically changing motion vector identifies a stationary or noisy location , respectively , and both result in a time - gain value near or above 1 . alternatively , the system may use color values or combinations of colors that are more accurate than luminance to predict perceptibility of the watermark . for example , psycho - visual research may determine that watermarks are more visible in red during motion , and the system can be adapted to accommodate this finding . the optimal value of the time - gain will be determined via human perception experiments with actual video . after computing the perceptual mask in blocks 106 and 108 , the embedder uses the mask to control embedding of the intermediate signal into the host video stream . in one implementation , for example , the gain is applied as a scale factor to the intermediate signal , which in turn , is added to corresponding samples of the video signal ( e . g ., either spatial or frequency domain samples ). the result is a video stream with a hidden digital watermark 112 . a further innovation is to apply a time varying dither signal to control the strength of the digital watermark signal at locations corresponding to pixels or groups of pixels ( e . g ., 8 by 8 block of dct coefficients , group of wavelet subband coefficients , etc .) in the host video stream . this dither signal is preferably random , such as a pseudo random signal generated by a pseudorandom number generator ( a cryptographic hash ). it may be implemented by applying it to the intra frame gain or to the time - varying gain of the digital watermark signal . the dither creates a perturbation of the gain value . for example , if the gain value is one , the dither creates a fractional perturbation around the value of one . in one implementation , the dither for a pixel or group of neighboring pixel locations in a video stream varies over time and relative to the dither for neighboring pixel or group locations . in effect , the dither creates another form of time varying gain . the dither signal improves the visual quality of the digitally watermarked video signal , particularly in areas where the watermark might otherwise cause artifacts due to the difference in time varying characteristics of the host video signal relative to the watermark signal . the dither signal may be used with or without the time varying gain calculations described in this document . further , the user should preferably be allowed to turn the dither on or off as well as vary the gain of the dither in the digital watermark embedding environment ( on a frame , video object , or video scene basis ). another method to provide invisible watermarks for video is object - based masking . the method is to segment objects and have the watermarks move with each object , referred to as object - based masking . the digital watermark for one or each video object is designed to be invisible spatially within the object , and since the watermark moves with the object , motion cannot make the watermark visible . the segmentation must be accurate to alleviate edge effects . the segmentation can be performed on the composite video or on each video stream before the final mixing . if all objects are embedded , the system should take care to make sure that the watermarks do not interfere with each other . in one such embodiment , the background is not watermarked . in another , the objects contain payloads that are all spatially synchronized with a low - level background calibration signal ( for example , subliminal graticules disclosed in u . s . pat . no . 6 , 122 , 403 ). this calibration signal is not perceptible and helps the system synchronize with each object &# 39 ; s bit carrying payload . after one or more objects are watermarked , the video is saved as composite , such as in mpeg - 2 , or in an object based method , such as mpeg - 4 formatted video . in other words , the composite video may be created before distribution or at the player . for mpeg - 2 , the embedding system can guarantee that payloads for each object do not interfere with each other . for mpeg - 4 , each object &# 39 ; s watermark payload can be read before rendering , or can be designed not to interfere with the composite video . having described and illustrated the principles of the technology with reference to specific implementations , it will be recognized that the technology can be implemented in many other , different , forms . to provide a comprehensive disclosure without unduly lengthening the specification , applicants incorporate by reference the patents and patent applications referenced above . the methods , processes , and systems described above may be implemented in hardware , software or a combination of hardware and software . for example , the embedding processes may be implemented in a programmable computer or a special purpose digital circuit . similarly , detecting processes may be implemented in software , firmware , hardware , or combinations of software , firmware and hardware . the methods and processes described above may be implemented in programs executed from a system &# 39 ; s memory ( a computer readable medium , such as an electronic , optical or magnetic storage device ). the particular combinations of elements and features in the above - detailed embodiments are exemplary only ; the interchanging and substitution of these teachings with other teachings in this and the incorporated - by - reference patents / applications are also contemplated .	7
according to the invention , in the method for the treatment and / or prophylaxis of multiple sclerosis in mammals , in particular in humans , the erythropoietin is now applied intermittently . this means that , with the present invention , an interval treatment is proposed . it is thereby particularly advantageous if the treatment comprises a sequence of periods of time with application of epo ( application period ) and periods of time without application of epo ( application - free periods ). the individual periods of time thereby comprise several weeks . a sequence has emerged as particularly advantageous in which each application period lasts 12 to 48 weeks , advantageously 18 to 36 weeks , advantageously 24 to 28 weeks , whilst the application - free periods last 8 to 53 weeks , advantageously 16 to 28 weeks . within the application periods , the dosage can be varied , for example firstly a period of time with a weekly application and a subsequent period of time with a two - weekly application . the present invention serves in particular for the use of erythropoietin in a method of this type or the use of erythropoietin for the production of a drug with which the described method can be implemented . the dosage is thereby respectively in the values described in the claims , particularly advantageously in a dosage range of 5 , 000 iu to 100 , 000 iu ( international units ) per week or per administration . with the mentioned interval dosage schemes , the result surprisingly is a constant improvement in the clinical symptoms during treatment . the improved level is maintained astonishingly in the interval and the second cycle produces a further improvement . surprisingly , an improvement in the symptoms was shown not only in the case of chronic - progressive multiple sclerosis but also in the case of relapsing - remitting multiple sclerosis . in particular in the case of chronic - progressive multiple sclerosis , a deterioration in the symptoms would have been expected during the treatment - free interval . however stabilisation also occurred here . the interval treatment according to the invention is an innovative approach to the entire concept of neuroprotection which , in the case of epo with multiple sclerosis , exploits in addition the fact that the result with half - yearly erythropoietin treatment is a latent , desired lack of iron . since lack of iron can be advantageous in addition for the known neuroprotective epo effect in chronic inflammatory diseases such as multiple sclerosis , advantageously iron is substituted neither in the treatment nor in the treatment - free phase . the treatment - free phase serves therefore also for slow replenishment of the depleted iron stores , as a result of balanced nutrition . in particular in the case of use of epo with haematopoietic effect , the neuroprotective effect is consequently supplemented by the latent lack of iron produced by the epo treatment . the effect according to the invention is however also achieved already by using epo derivatives or variants without haematopoietic effect . the above explanation relates to the method but the invention is not only directed to the therapeutic method but also to the use of epo in a method of this type and also the use of epo for the production of a drug for use in a method of this type . in the following , a few examples of use according to the invention of erythropoietin - α ( commercial name erypo / eprex ) or erythropoietin - β ( commercial name neorecormon ) are given . fig1 shows the course of the maximum walking distance ( prototype of motor function measurement in multiple sclerosis ) in a female patient ( case example ) who had an epo interval treatment over a period of 58 weeks . as is evident from the figure , the patient had an introductory phase of in total five weeks in order to determine the baseline values of her walking distance . there followed a weekly administration of epo over 14 weeks . after the 15 th week till the 28 th week inclusive , she received epo every two weeks . from week 29 to 45 , a treatment phase was provided , i . e . the patient obtained no epo . from week 46 to 58 , she was again treated weekly with epo . the illustrated “ trend line ” shows a constant increase in the maximum walking distance over the total course of examination . this course should be expected in the reverse direction ( progressive deterioration in the walking distance ) with chronic - progressive ms . fig2 shows , with the same patient as in fig1 ( epo interval treatment ), an improvement in attention capacity over the various treatment phases without setbacks in performance being able to be observed in the therapy - free interval . fig3 demonstrates the course of the haematocrit value in the same patient as in fig1 over the entire examination period . the result in this case example is that no value falls outside of the normal range . in this patient , no blood - letting was necessary over the entire treatment duration . fig4 summarises the functional improvement in walking distance with four patients who were treated in the same manner as the patient represented in fig1 . over ten weeks of epo treatment , a significant improvement is already shown . fig5 shows a summary of the attention capacity ( visual scanning ) in the four patients shown in fig4 over a period of time of in total nine weeks . the improvement in cognitive performance is significant . fig6 likewise shows a significant improvement in fine motor - function in the group of four patients , who were represented in fig4 , over the first nine weeks of the weekly epo treatment . fig7 demonstrates , using the group of patients illustrated in fig4 , that , with very good clinical safety / tolerance also of the classic ( haematopoietic ) epo , the necessity for blood - letting with ms patients is restricted to a small number . four patients in total were thereby treated with erythropoietin α ( eprex ) or erythropoietin β ( neorecormon ). in summary , it can be established that it was proved that long - term treatment of this type with epo is well tolerated by the patients . it was shown in particular that the therapy regime applied improved the motor and cognitive as well as the neurophysiological performance .	0
referring now in more detail and by reference characters to the drawings which illustrate practical embodiments of the present invention , fig1 illustrates a circuit arragement of circuit switching device c forming part of the present invention connected to a two lamp high power factor ballast 20 and a pair of fluorescent lamps designated as l - 1 and l - 2 , respectively . the ballast 20 receives electrical power from a source thereof , over a pair of conductors designated as &# 34 ; black &# 34 ; and &# 34 ; white &# 34 ;. the normal two - lamp , high power factor ballast will also have a pair of conductors designated as &# 34 ; red &# 34 ; for operating the first lamp l - 1 , and a second pair of conductors designated as &# 34 ; blue &# 34 ; for operating the second lamp l - 2 . it can also be observed that a single yellow lead extends from the ballast 20 to the circuit device c and then to the opposite terminals of the pair of lamps l - 1 and l - 2 . fig2 more fully illustrates the circuit device c of the present invention . in this respect , the dotted line designated by reference numeral 22 would represent the outer casing or housing for the circuit device . it should be understood that the circuit device would normally be mounted within a housing of any suitable construction , such as a metal housing , plastic housing or the like . moreover , the housing would contain the electical components forming part of the circuit switching device , as hereinafter described in more detail and which would normally be sealed or relatively permanently enclosed . the housing would be provided with leads extending therefrom for connection to a ballast or plurality of ballasts and to the lamps . referring again to fig2 it can be observed that the circuit device c of the present invention comprises a switching relay mechanism 24 comprised of a switch means 26 , such as a four - pole , double - throw switch assembly . the four pole , double throw switch assembly 26 normally includes individual switches s - 1 , s - 2 , s - 3 and s - 4 . each of these switches have a pair of contacts and each of the contacts are connected to a pair of leads which extend from the housing 22 . the switching relay mechanism 24 also includes a relay means 28 or &# 34 ; so - called &# 34 ; relay which is comprised of a first relay coil normally referred to as a &# 34 ; set &# 34 ; relay coil 30 and a second relay coil 32 , normally referred to as a &# 34 ; reset &# 34 ; relay coil . it can be observed that each of the relay coils are connected to a conductor 34 which is , in turn , connected to one of the terminals of the switch s - 4 forming part of the double - throw four - pull switch 26 . moreover , the relay coils 30 and 32 are connected in such manner that diodes 36 and 38 are respectively connected across the coils 30 and 32 , in the manner as illustrated in fig2 . connected between the pair of diodes 36 and 38 is a resistor - capacitor circuit arrangment 40 which comprises a capacitor 42 and a resistor 44 connected across the capacitor in parallel arrangement therewith . this resistor - capacitor arrangement 40 often referred to as an &# 34 ; r - c circuit &# 34 ;, is then connected to the ballast and connected to one of the switches s - 2 in the manner as illustrated in fig2 . the resistance - capacitive circuit arrangement 40 is designed with a resistance and capacitive value so as to provide a desired time delay . in this circuit arrangement 40 will provide a continued feedback voltage to the set relay coil 30 and the reset relay coil 32 . the resisitive - capacitive circuit arrangement 42 has a time delay sufficient so that the reed of any one of the switches s - 1 - s - 4 will reach the opposite pole before the coil is discharged . moreover , each of the switches are magnetically operable so that the reed will magnetically latch at the opposite pole . it has been found that only about 1 / 10th of a second energization of any of the coils is required to obtain the desired latching effect . more specifically , it can be observed that the four - pole double - throw switch assembly 26 has a first lead 46 , which in this embodiment is connected to the ballast over a conductor designated as &# 34 ; red &# 34 ;, and a second lead 48 , which in this embodiment is connected to the ballast over another conductor designated as &# 34 ; red &# 34 ;, and which are , in turn , connected at the reeds of the switches s - 1 and s - 2 , respectively . the assembly 26 includes a third lead 50 which may be connected to the lamp l - 1 over one of the conductors designated as &# 34 ; red &# 34 ; and a fourth lead 52 which may be connected to the lamp l - 2 over one of the conductors designated as &# 34 ; blue &# 34 ;. the switch reed for this switch s - 1 is connected directly to the ballast over one of the &# 34 ; red &# 34 ; conductors 48 from the circuit device c to the ballast 20 . the second switch element s - 2 has a lead 54 which , in this case , may be connected to the lamp l - 1 over one of the conductors designated as &# 34 ; red &# 34 ; and another lead 56 connected to the lamp l - 2 over one of the conductors designated as &# 34 ; blue &# 34 ;. in this embodiment the switch s - 3 has a pair of leads 58 and 60 , but which remain unconnected in the circuit . the reed of this switch s - 3 also remains unconnected in this particular circuit arranement . finally , the switch s - 4 has a first lead 62 and a second lead 64 and which also extends internally within the housing 22 . the leads 62 and 64 are connected to the set relay coil and reset relay coil 32 in the manner as illustrated . the switch reed of the switch element s - 4 is connected to the ballast over one of the conductors designated as &# 34 ; red &# 34 ; and includes a diode 66 in the line connecting the switch reed to the ballast conductor , also in the manner as illustrated in fig2 . by analyzing the circuit of fig2 it can be observed that the lamp l - 1 remains energized when the four pole double throw switch assembly 26 is in the position as illustrated in fig2 . however , it can also be observed that when power is discontinued and reapplied , the coils 30 and 32 will be initially energized to cause the switches s - 1 , s - 2 , s - 3 and s - 4 to shift to the opposite position . in this case , by analyzing the circuitry , it can be observed that the lamp l - 2 will be energized . each time that the power from the ballast is interrupted , the four - pole , double throw switch assembly 26 will immediately switch to its opposite condition and thereby cause energization of the opposite of the lamps . in my u . s . pat . no . 4 , 348 , 614 , dated sept . 7 , 1982 , it was taught that a capacitor of sufficient value could be utilized as a substitute for one of the lamps in a plural lamp fixture . thus , if one of the lamps in a two lamp fixture were removed , the remaining lamp would not operate properly or efficiently . however , that problem was overcome by the use of a capacitive element inserted in place of the removed lamp . it has also been found in accordance with the present invention that it is possible to literaly short circuit the contacts from which a lamp is removed or de - energized . by carefully examining the circuit of fig2 it can be observed that a blue conductor from the ballast may be connected to the yellow conductor which was to be connected to the lamp which has been removed . in effect , this provides a short which takes the place of the actual capacitor and enables the remaining lamp or lamps to operate with at least the same degree of efficiency as if the any one or more lamps had not been removed . the circuit device c of the present invention , as illustrated in fig2 also has additional components which are not connected in the circuit arrangement for this particular type of two - lamp , high power factor ballast . these additional circuit components are hereinafter described in more detail in connection with the ballasts with which they would be used . fig3 illustrates a circuit arrangement of the circuit switching device c of the present invention connected to the pair of lamps l - 1 and l - 2 and to a single lamp , normal power factor ballast 70 . however , the single lamp normal power factor ballast 70 , in this case , is shown as being connected in circuit with a pair of fluorsecent lamps , such as the lamps l - 1 and l - 2 . with reference to fig3 it can be observed that only a single pair of conductors connect the circuit device c to the ballast 70 . the remaining portions of the circuit arrangement are similar to those illustrated in fig1 . however , one of the high power ballast conductors from the source of electrical power is connected directly to one of the terminals on each of the lamps l - 1 and l - 2 in the manner as illustrated . moreover , the lamps do not have one of the terminals connected to the circuit device c , but rather , they are directly to the ballast 70 in this particular circuit arrangement . referring now to fig4 it can be observed that only the leads 46 and 48 are connected to the ballast and the leads 50 , 52 , 54 and 56 are connected to the lamps l - 1 and l - 2 . by analyizing the circuit of fig4 it can be observed that this circuit device will operate in a manner similar to the circuit device of fig1 and 2 with the single lamp , normal power factor ballast operating the lamps alternately . fig5 illustrates a circuit arrangement with a single lamp , high power factor ballast 74 but which is also connected to a pair of lamps l - 1 and l - 2 . it can be observed that a circuit arrangement for connecting the circuit device c in a circuit relationship with respect to the lamps l - 1 and l - 2 and the high power ballast 74 is quite similar to that circuit arrangement employed in connection with fig3 . fig6 illustrates , in more detail , the connection of the circuit device c to the various conductors in the arrangement of fig5 . the leads 46 , 48 , 50 , 52 , 54 , and 56 are essentially connected in the same manner as in the circuit arrangement of fig2 . by examining the circuitry of figure 6 , it can be observed that when the four - pole , double - throw switch assembly 26 is in the position as illustrated , the lamp l - 1 will be energized and when the switch is in the opposite position , the lamp l - 2 will be energized . fig7 illustrates the circuit arrangement where a two lamp ballast 76 is provided for operating the initial lamps l - 1 and l - 2 at one time as well as two additional lamps l - 3 and l - 4 alternately when power is cut - off and reapplied . thus , the two lamp ballast 76 in the arrangement as illustrated in fig7 will energize and maintain the operation of four lamps , as illustrated . fig8 more fully illustrates in detail the circuit connections of the lamp switching device c to the various lamps and the ballast 76 in the circuit arrangement of fig7 . in this configuration , the circuit switching device c also utilizes the additional components forming a part thereof and which was mentioned with respect to the circuit configuration of fig2 . the switching circuit device c comprises a pair of additional switches s - 5 and s - 6 as illustrated in fig8 and which may constitute a double - pole , double throw switch assembly 80 . the switches s - 5 and s - 6 are respectively operated by means of a set relay coil 82 and reset relay coil 84 , in the manner as illustrated . the set relay coil 82 is connected to the lead 64 and hence , to one terminal of the switch s - 4 . the reset relay coil 84 is connected to the lead 62 , and hence , to the other terminal of the switch s - 4 . moreover , diodes 86 and 88 are respectively connected in parallel across each of the coils 82 and 84 . a resistor - capacitor circuit 90 is similarly connected to the coils 82 and 84 in the manner as illustrated in fig8 and comprises a capacitor 92 with a resistor 94 connected in parallel therewith . it can also be observed that the resistor - capicator circuit 90 is also connected to the common connection of the coils 30 and 32 and to the ballast . the circuit switching device c of the present invention is also provided with additional leads , such as a lead 96 , adapted for connection to a ballast over a conductor designated as &# 34 ; blue &# 34 ;, and additional leads 98 and 100 which are connected to the terminals of the switch s - 5 . a further pair of leads 102 and 104 and connected to the terminals of the switch s - 6 , and an additional lead 106 in also connected to the reed of the switch s - 6 and again adapted for connection to a ballast . in a circuit configuration using a two lamp ballast 76 and the four individual lamps l - 1 through l - 4 in the arrangement as shown in fig7 the additional components forming the circuit switching device c are also connected in the manner as illustrated in fig8 . thus , and for this type of arrangement , essentially all of the leads to the switches s - 5 and s - 6 are connected to the ballast and to the lamps . the leads to the switches s - 1 through s - 4 remain unconnected . it can be observed , by examining the circuit configuration of fig7 and 8 , that when the switches s - 1 , s - 2 , s - 3 , s - 4 , s - 5 and s - 6 are in the position as illustrated in fig8 lamps l - 1 and l - 2 will be energized . however , after power is discontinued and reapplied to the ballast 76 , the switches s - 1 , s - 2 , s - 3 , s - 4 , s - 5 and s - 6 will all switch to the opposite postions and then the lamps l - 3 and l - 4 will be energized when power is reapplied . the circuit switching device c of the present invention is highly effective in an arrangement of one ballast operating four lamps , in the manner as illustrated . in recent years , reflectors have been used in lamp fixtures which employ , for example , four individual lamps and which may be operated from a single ballast in the manner as shown in fig7 . reflectors are located in the fixture and two of the lamps are removed . if the two outermost lamps are removed , or otherwise , the two innermost lamps are removed , then there is a noticeable elimination of the lamps from the fixture , even with a defuser located over the remaining lamps . while the light output with the reflectors is actually greater than that which would normally be obtained from a pair of lamps without the reflectors , the noticeable effect of the eliminated lamps is still disconcerting . it would be desirable to disconnect one of the inner lamps and one of the outer lamps which are not adjacent to each other . however , and in many cases , this requires the removal of the entire fixture for purposes of re - wiring the fixture . the circuit device of the present invention eliminates this problem inasmuch as the lamps can be wired to the circuit device in the desired fashion so as to energize any two of the four lamps as may be required . for example , it if is desired to energize lamps one and three with lamps two and four de - energized , this can be easily accomplished by properly wiring the lamps and the ballast through the circuit device of the present invention . fig9 illustrates a circuit arrangement using the circuit switching device of the present invention connected to a pair of two lamp high power factor ballasts 110 and 112 with each operating a pair of lamps . thus , the two lamp high power factor ballast 110 operates lamps designated as l - 1 and l - 2 and the two lamp high power factor ballast 112 operates lamps l - 3 and l - 4 . accordingly , each of the ballasts 110 and 112 normally operate an individual pair of lamps much in the same manner as if the two ballasts and associated pair of lamps were separate and apart from one another . fig1 illustrates in more detail the connection of the various components of the circuit switching device c connected to the ballasts 110 and 112 and the lamps as shown . the power line designated as &# 34 ; white &# 34 ; is connected directly to the resistive - capacitive circuit 90 and the power line designated as &# 34 ; black &# 34 ; is connected directly to the reed of the switch s - 6 . in the circuit arrangements of fig9 and 10 , the four pole double throw switch assembly 26 is not connected to any of the lamps or to the ballast . it can be observed that the ballasts are connected directly to the lamps in a manner in which a pair of two high power factor ballasts would be connected to two individual pairs of lamps . in this case , it is necessary only to switch between the two ballasts 110 and 112 . fig1 illustrates the use of the circuit switching device c of the present invention in connection with a pair of two lamp instant start ballasts 110 and 112 . in this case , it can be observed that the black electrical conductor from the source of electrical power is connected directly through the circuit switching device of the present invention to one of the pair terminals of each of two of the instant start lamps in the manner as illustrated . in like manner , the white electrical conductor from the source of electrical power is connected through the circuit switching device of the present invention to the opposite terminal of the paired terminals on the same two instant start lamps . by simple examination of fig1 , it can be easily observed that the wiring connection through the circuit switching device c could be achieved to easily obtain the operation of four lamps with the two instant start ballasts of fig1 . fig1 illustrates a circuit arrangement in which a circuit device c in accordance with the present invention is used with a two lamp instant start ballast 120 . in this case , it can be observed that the electrical conductors from the power source , designated as &# 34 ; black &# 34 ; and &# 34 ; white &# 34 ; are connected through the circuit switching device c to lamps l - 1 and l - 2 in the manner as illustrated . moreover , the ballast 120 is connected to the circuit device c as shown . in this embodiment of the invention , the circuit switching device c may actually employ mechanically actuable switches , such as the switch 122 the switch 124 and the switch 126 . the circuit switching device c of this embodiment of the invention , illustrated in fig1 , comprises a bi - stable flip - flop 128 which controls a pair of relay coils 130 and 132 , in the manner as illustrated . thus , when the bi - stable flip - flop 128 is energized in one application of the power to the lamps , it will permit the switches 122 , 124 and 126 to remain in one position , as for example , the position as shown in fig1 . however , when power is interrupted and next applied to the circuit device c , the bi - stable flip - flop 128 will switch position and cause the relay coils 130 and 132 to move the switches 122 and 124 and 126 to the opposite positions . by tracing the circuitry in fig1 , it can be observed that the opposite of the lamps namely , the lamp l - 2 will be energized , whereas in the previous condition , the lamp l - 1 was energized . the circuit device of fig1 utilizes a bi - stable flip - flop as well as mechanically actuable switches . the circuit devices as shown in fig1 - 10 actually utilize solid state switching and solid state switch components . nevertheless , the switches as shown in the circuit switching device c utilized in fig1 - 10 , and in the other embodiments hereinafter described , actually were shown in a mechanically actuable switch form in order to facilitate the understanding in accordance with the present invention and to illustrate current flow through the various conductors . the circuit arrangement of fig1 also shows the circuit switching device c employing a 24 hour cycler 134 . in this case , the 24 hour cycler is normally used to automatically change the state of the bi - stable flip - flop 128 every 24 hours . it should be understood that any time period could be employed , for this purpose . in this embodiment , the cycler 134 which operates as a type of switch , will automatically change the state of the flip - flop 132 to thereby change the position of the switches 122 , 124 and 126 . in this way , the switching of the switches 122 , 124 , and 126 will cause the opposite of the lamps l - 1 or l - 2 to be energized when current is next applied . it should be understood that the 24 hour cycler 134 could be replaced by a random cycler such that it will randomly cause the bistable flip - flop 128 to change positions on a random basis . thus , such a random cycler will cause the circuit switching device c to randomly energize one of the lamps l - 1 or l - 2 any time that power is applied . in this way , each of the lamps will be energized on an average of about 50 percent of the time . fig1 and 14 illustrate an alternate arrangement of a two lamp high power factor ballast , such as the ballast 20 , operating a pair of lamps l - 1 and l - 2 . however , in this arrangement , the circuit switching device c of the present invention operates so as to cause the energization of one lamp and thereafter cause the simultaneous energization of both of the lamps l - 1 and l - 2 in an alternate arrangement , each time that power is re - applied to the high power factor ballast 20 . in other words , only the lamp l - 1 will operate as power is applied to the ballast and when power is discontinued and re - applied , both lamps l - 1 and l - 2 will operate . fig1 more fully illustrates in more detail the circuit arrangement using the circuit switching device c of the present invention in this circuit arrangement of fig1 . thus , fig1 illustrates in more detail the connection of the circuit switching device c to the pair of lamps l - 1 and l - 2 and the ballast 20 . by examining this fig1 , it can be observed that only one of the lamps , namely the lamp l - 1 is energized when the switches s - 1 through s - 4 are in the position as illustrated in fig1 . however , when power to the ballast is interrupted and re - applied , it can be observed that the reset relay coil 32 will be energized and will cause the reeds of the switches to shift to the opposite position . in this arrangement , it can be observed that each of the lamps l - 1 and l - 2 will be energized . the circuit switching arrangement utilized in fig1 and 14 is highly effective where it is desired to obtain two levels of light in a particular room or other environment . it may be desirable to energize both lamps l - 1 and l - 2 in a normal work environment but to energize only one of the lights , such as the lamp l - 1 , when it is only desirable to obtain a background light . as an example , in the case where one or more computer monitors are being used , a bright overhead light source would tend to create glare on the computer screen . thus , the reduced light would enable effective use of the computer monitor . the user of the environment or other room can merely obtain the desired amount of light by turning the switch which controls the light source off and on . by virtue of using the resistive capacitive network in the circuit switching device , there is no inefficiency of operation in the one lamp or bank of lamps which remain energized when the other lamp or bank of lamps are de - energized . in essence , the resistive - capacitor network eliminates a high degree of inefficiency would otherwise result in the energization of only one lamp as opposed to a pair of lamps connected to a ballast . the circuit switching device c of the present invention is highly unique in that it is capable of being used with several conventional lamp operating voltage circuits as for example , a 120 volt circuit to about a 600 volt circuit and with lamps of most commercially available wattage ranges . thus , the circuit switching device of the present invention is highly useful and versatile . in addition to the foregoing , it can also be observed that the circuit switching device c of the present invention is capable of being used with both rapid start lamps and instant start lamps and the associated ballasts which would be used for powering both such lamps . the circuit switching device of the present invention may also be incorporated in a small compact housing which is constructed so that it will have eyelets for screws or similar mechanical fasteners , in order to be secured to a fluorescent lamp fixture . moreover , the circuit switching device c will be manufactured primarily on a circuit board with standardized circuit components and standard circuit boards may be employed . in this way , it will be possible to produce this device at a relatively low cost . in addition , the circuit switching device c may be manufactured in the form of a cubical construction to allow for compact packaging within a container housing . it is only necessary that leads extend from the circuit outwardly from the container housing for connection to the various components of the lamp circuit in the manner as previously described . fig1 illustrates an embodiment of a circuit switching device fully incorporated in a ballast 140 and which is designed to operate a pair of lamps l - 1 and l - 2 in the manner as illustrated . the ballast 140 includes a primary coil 142 connected to a source of power over conductors 144 and 146 . a pair of secondary coils 148 and 150 are operable by the primary coil 142 , much in the same manner that a conventional ballast is constructed . for this purpose , one or more capacitors would be included within the transformer section of the ballast 140 . this ballast 140 also includes a circuit switching device c as illustrated in fig1 . this switching device c is similar to the previously described circuit switching device and is operated in a similar manner . moreover , and for purposes of operating a pair of lamps in the manner as illustrated in fig1 , the circuit switching device c would be connected somewhat in a manner similar to that arrangement used in fig2 . it should be understood that the ballast and circuit switching device incorporated , as shown in fig5 therein would be packaged in a suitable housing in a manner similar to that of a conventional ballast . in this embodiment , the ballast is designed as a two lamp ballast . however , with proper wiring , this ballast could become a direct replacement for an instant start ballast , a rapid start ballast and could also be wired to operate as a high power factor ballast or a normal power factor ballast . thus , there has been illustrated and described a unique and novel circuit switching device and method which enables alternate operation of one or more lamps in a series of lamps to thereby reduce lumen output and correspondingly reduce power consumption . thus , the present invention fulfills all of the objects and advantages which have been sought . it should be understood that many changes , modifications , variations and other uses and applications will become apparent to those skilled in the art after considering this specification and the accompanying drawings . therefore , any and all such changes , modifications , and other uses and applications which do not depart from the spirit and scope of the invention are deemed to be covered by the invention which is limited only by the following claims .	8
before describing the features of the present invention , it is appropriate to briefly describe the construction of one type of known cochlear implant system with reference to fig1 . known cochlear implants typically consist of two main components , an external component including a speech processor 9 , and an internal component including an implanted receiver and stimulator unit 2 . the external component includes a microphone 7 . the speech processor 9 is , in this illustration , constructed and arranged so that it can fit behind the outer ear 1 . alternative versions may be worn on the body . attached to the speech processor 9 is a transmitter coil 4 which transmits electrical signals to the implanted unit 2 via a radio frequency ( rf ) link . the implanted component includes a receiver coil 3 for receiving power and data from the transmitter coil 4 . a cable 41 extends from the implanted receiver and stimulator unit 2 to the cochlea 30 and terminates in an electrode array 20 . the signals thus received are applied by the array 20 to the basilar membrane 8 and the nerve cells within the cochlea 30 thereby stimulating an auditory nerve 5 . the operation of such a device is described , for example , in u . s . pat . no . 4 , 532 , 930 . one embodiment of a cochlear implant electrode assembly according to the present invention is depicted generally as 10 in fig2 and 3 . the depicted electrode assembly 10 has an electrical lead extending back to a stimulator / receiver housing , such as the stimulator unit 2 depicted in fig1 . in considering this invention , it is to be understood that each electrode 12 may have one or more wires ( not depicted ) electrically connected thereto and extending from each respective electrode 19 back through the lead to the stimulator / receiver . the assembly 10 comprises an elongate electrode carrier member 11 having a plurality of electrodes 12 mounted thereon . for the purposes of clarity , the electrodes 12 depicted in fig1 are not necessarily shown to scale . a larger number of electrodes than that depicted in fig2 can also be envisaged . the electrodes 12 are not depicted in fig3 for reasons of clarity . the depicted elongate member 11 is preformed from a resiliently flexible silicone with memory and is preformed to a curved configuration suitable for insertion in the scala tympani 31 of a human cochlea 30 . while an assembly that normally adopts a curved configuration when in a relaxed condition is depicted in the drawings , it will be appreciated that the present invention also could be utilised with respect to assemblies that are normally straight when in a relaxed condition . the elongate member 11 has a first end 13 that is firstly inserted into the cochlea 30 upon insertion of the assembly 10 . as depicted in fig2 , there is disposed within a lumen 14 , prior to insertion of the assembly 10 into the cochlea 30 , a substantially straight platinum stylet 15 . in the depicted embodiment , the stylet 15 has a stiffness that is sufficient to retain the silicone elongate member 11 in a straight configuration . the stylet could be constructed so as to have a stiffness that was insufficient alone to retain the elongate member 11 in a straight configuration . in this case , the elongate member could have a stiffening sheath 18 that at lest partially envelops the elongate member 11 . the stiffening sheath 18 could be formed of a bioresorbable material which prior to implantation assists the platinum stylet in maintaining the elongate member 11 in the straight configuration . while a platinum stylet is depicted , a bioresorbable stylet - like member formed from a bioresorbable material , such as polyacrylic acid ( paa ), that is also impregnated with a bio - active substance and which is adapted to dissolve or soften on exposure to cochlear fluids , could be utilised with appropriate modification to the elongate carrier member 11 . a stiffening polymer stylet could also be utilised which could be impregnated with a bio - active substance . such a stylet would soften quickly , but not dissolve quickly , with its very slow dissolution rate allowing the drug to effectively elute to the body . equally , whilst a substantially cylindrical lumen is depicted , the lumen 14 could indeed be any shape necessary to perform the function . again , the paa stylet - like member in this invention can have a stiffness that is either sufficient or insufficient to retain the silicone elongate member 11 in a straight configuration as depicted in fig2 . it will be appreciated that a bioresorbable stylet - like member could be formed from other suitable bioresorbable materials . a stylet - like member made from a shape memory or heat sensitive material could also be utilised instead of stylet 15 . in the depicted embodiment , the elongate member 11 is adapted to also act as a system for delivery of one or more pharmaceutical or bioactive substances to the cochlea 30 . in the depicted embodiment , this system is provided by an additional lumen 21 that acts as a reservoir for a fluid 23 constituting or including the one or more pharmaceutical or bioactive substances . the lumen 21 is pre - filled with the pharmaceutical or bioactive substances during manufacture and then sealed by the plug closure 22 . provided at the first end 13 of the member 11 is a fluid egress means comprising a valve 24 in the form of a slit formed in the structure of the elongate member 11 . other embodiments with more than one slit 24 can be envisaged . the slit 24 is adapted to allow fluid 23 within the lumen 21 to exit the lumen 21 but prevents fluid flow from external the member 11 back into the lumen 21 . to prevent flow of fluid through the slit 24 prior to implantation , the slit is covered with a layer 25 of bioresorbable paa . other suitable bioresorbable materials could be envisaged and the material could also be impregnated with the pharmaceutical substance . while only depicted as covering the slit 24 , the layer 25 could coat a greater portion or the entire surface of the elongate member 11 . on insertion of the elongate member 11 into the scala tympani 31 , the cochlear fluid commences to soften and dissolve the layer 25 of paa . in addition to lubricating the first end 13 , the dissolution of the layer 25 allows the fluid 23 to commence to flow from the lumen 21 into the scala tympani 31 . it is also possible that the pharmaceutical or bioactive substance 23 could be released from the lumen 21 by way of a mechanical means . such a means may include pushing the stylet 15 through the slit 24 at the end of the assembly 10 to break the seal just prior to insertion . as shown in fig6 a and 6b , another method of releasing the pharmaceutical substance would be to include a suture 26 down the lumen 21 and through the seal 25 . the suture 26 could then be pulled in an action similar to a “ rip - cord ” to open the end of the assembly 10 . in the embodiments shown in fig4 , lumen 21 is in fluid communication with an additional reservoir 45 for fluid 23 . additional reservoir 45 can be placed under the skin of the implantee and be tillable by a needle and syringe assembly when required . a pump 47 , such as an osmotic pump , can be used to transfer fluid from additional reservoir 45 to lumen 21 . while depicted with a lumen 21 , it can also be envisaged that the elongate member 11 could be impregnated with a pharmaceutical agent or other bioactive substance prior to implantation . the pharmaceutical agent or bioactive substance would then be free to leach from the elongate member 11 following insertion . in this embodiment , it can be envisaged that a layer of bioresorbable paa material may coat the entire impregnated portion of the elongate member 11 so ensuring that the pharmaceutical agent or bioactive substance does not leach from the elongate member 11 prior to implantation . while the elongate member 11 is manufactured with a preformed curved configuration , the depicted assembly 10 is typically delivered to a surgeon in a sterile package with the stylet 15 and pharmaceutical fluid 23 in place ( as depicted in fig2 ). on removal from the package and insertion into the scala tympani 31 of the cochlea 30 , the cochlear fluids commence to dissolve and soften the layer 25 . as the elongate member 11 is inserted into the scala tympani 31 of the cochlea 30 , the surgeon can commence to withdraw the stylet 15 from the lumen 14 through opening 17 . on withdrawal of the stylet 15 , the elongate member 11 is free to adopt the spiral configuration depicted in fig3 with the electrodes 12 facing the modiola within the cochlea 30 so that they are positioned as close as possible to the spiral ganglia thereof . the provision of a system for delivering a pharmaceutical substance that promotes healing and / or more efficient neural stimulation while preventing the formation of substantial scar tissue in the cochlea , enhances the likelihood of successful long - term placement of the assembly 10 in the cochlea and subsequent successful use of the cochlear implant by the implantee . while the preferred embodiment of the invention has been described in conjunction with a cochlear implant , it is to be understood that the present invention has wider application to other implantable electrodes , such as electrodes used with pacemakers . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive . all documents , patents , journal articles and other materials cited in the present application are hereby incorporated by reference . it is to be understood that the detailed description and specific examples , while indicating embodiments of the present invention , are given by way of illustration and not limitation . many changes and modifications within the scope of the present invention may be made without departing from the spirit thereof , and the invention includes all such modifications .	0
the lightening conductor 10 illustrated in fig1 comprises a mast 12 to which is connected , via an insulating element 14 having a length of about 1 . 5m , a lightning rod 16 for capturing lightning , which rod is made of aluminum and has a length of about 2m . the lightning rod 16 , being insulated from the mast 12 which has a length of about 6m , has connected thereto an electrical conduit 18 which is vertically guided in parallel to mast 12 with the aid of mast spacers 20 . for this purpose , the electrical conduit 18 is guided through eyes 22 formed in the mast spacers 20 . in the lower region of mast 12 , conduit 18 is deflected by about 900 , thus extending substantially horizontally . in its horizontal part , conduit 18 is held at a distance to the underlying ground 26 by means of bottom spacers 24 . at a distance of about 10m from mast 12 , conduit 18 is connected to one or a plurality of deep grounding means 28 extending about three meters into the ground 26 . the mast spacers 20 attached to mast 12 can also be provided as cable ties which , by the effect of their own stiffness , keep the conduit 18 guided on mast 12 at a distance of about one meter from the mast . mast 12 is further fastened to a tripod 30 which , by use of anchor stakes 32 , is tightly fastened to the underlying ground 26 on a temporary basis . in case of a thunderstorm , lightning will tend to strike primarily into the lightning rod 16 of lightening conductor 10 so that the lightning current can be dissipated into the ground 26 via conduit 18 . as a result , the lightening conductor 10 generates a protection cone 36 starting from an upper tip 34 of the lightening conductor . within this cone , objects such as e . g . a tent 37 can be arranged for protection from lightening . mast 12 is arranged to be telescopically extended and retracted ( fig2 ) and comprises a first mast element 38 guided for movement in a second mast element 40 . for guidance of the first mast element 38 in the second mast element 40 , the first mast element 38 in an upper region thereof is passed through a guide ring 42 wherein the contact of a the guide ring 42 with the first mast element 38 is accomplished by a slide ring 44 preferably made of teflon . the guide ring 42 is tightly connected to the second mast element 40 , e . g . by clamping , and may be provided with a fastening element ( not shown ) for locking the first mast element 38 to the second mast element 40 . in the lower region , the first mast element 38 is guided in the second mast element 40 via a piston 46 , the contact of the piston 46 to the second mast element 40 being effected via further slide rings 44 . for pneumatic actuation of the telescopable mast 12 , air pressure is caused to press against piston 46 and / or a closure member of mast 12 in the upper region whereby the first mast element 38 is pressed or pulled out from the second mast element 40 in the direction schematically indicated by arrow 48 . to avoid escape of the pressurized air , piston 46 is provided , at the site of its contact to the first mast element 38 and at the site of its contact to the second mast element 40 , with a respective o - ring 50 and / or a sealing means of a comparable effect . in a further embodiment of a lightning protection system 52 illustrated in fig3 , four preferably identical lightening conductors 10 are provided , with their protection cones 36 forming a common lightning protection space 54 which is suited for arrangement of e . g . a plurality of tents 37 therein . the lightening conductors 10 each are provided with two electrical conduits 18 leading away from the tents 37 and the lightning protection space 54 at an angle α = about 90 ° c . relative to each other . this means that the conduits 18 arranged in the lightning protection space 54 are oriented to point away in outward directions from the lightning protection space 54 . depending on the lengths of the conduits 18 the deep grounding means 28 can be arranged inside or outside the lightning protection space 54 .	7
in the following the invention is described in more detail by means of embodiments and figures . the invention uses the already existing information element request type of the location_report message for determining the recipient of a location information . the determination is executed in a control node . in the case that the request is a packet switched location request it is executed by a sgsn , in the case that it is a circuit switched request it is executed by a mobile services switching centre msc . fig3 depicts a flow chart of the invented method . in a first step , a control node sends a location_reporting_control message to a radio network controller . this message comprises an information element request type that identifies the type of request . the type of request is identified for example that the radio access network is requested to send location information in a location_report message at a change of service area by a user equipment or as a direct response on the location_reporting_control message . in a next step , the radio network controller receives the location_reporting —: - control message . it analyses it whether the value of the information element request type indicates to send a location_report message immediately , or not . if a location_report message is required immediately , the radio network controller determines the location of a user equipment and sends the location information together with the request type value received in the location_reporting_control message to the core network node . if the location_report message is required after a certain trigger event , in this example a change of service area by the user equipment , the radio network controller sets the respective trigger event and monitors , whether the user equipment changes the service area . if so , the radio network controller detects this trigger event , determines the location information of the user equipment and sends it together with the received request type value to the control node . the control node receives the location_report message including the request type . it checks whether the request type value indicated an immediate response . if so , the location information is intended for an external entity and the control node sends it to said external entity . if not , the information is used internal of the network . fig4 depicts another flow chart of an alternative of the invented method to the implementation as described by fig3 . in a first step , a control node sends a location_reporting_control message to a radio network controller . this message comprises an information element request type that identifies the type of request . the type of request is identified for example that the radio access network is requested to send location information in a location_report message at a change of service area by a user equipment or as a direct response on the location_reporting_control message . in a next step , the radio network controller receives the location_reporting_control message . it analyses it whether the value of the information element request type indicates to send a response , that is a location_report message , immediately , or not . if a location_report message is required immediately , the radio network controller determines the location of a user equipment and sends the location information together with the request type value received in the location_reporting_control message to the core network node . if the location_report message is required after a certain trigger event , in this example a change of service area by the user equipment , the radio network controller sets the respective trigger . the radio network controller monitors , whether the user equipment changes the service area . if so , the radio network controller detects this trigger , determines the location information of the user equipment and sends it to the control node . in this embodiment , the lack of the request type information element value in the location_report message , indicates that the message is to be used network internal . the control node receives the location_report message including the request type . it checks whether a request type value is returned . if so , the location information is intended for an external entity and the control node sends it to said external entity . if not , the information is used network internal , fig4 depicts an embodiment of the invention by means of a flow chart , wherein the determining is handled vice versa to the embodiment of fig3 . in the embodiment of fig3 , a request type value has been returned in the case that the location information is to be used network internal . in the embodiment of fig4 the request type value is returned , when the location information is to be forwarded to an external entity . request type values indicating that an immediate response is required are for example : “ request of current location ” or “ request of current or last known location ”. the invention further relates to software stored on a computer readable medium or in a form that can be loaded into a memory of a computing device . a computing device is for example a control node or a control node server that executes a stored program .	7
this embodiment is an apparatus and process for processing mine tailings employing a slow cooling schedule , which results in applicant &# 39 ; s composition and corresponding articles of manufacture . a sample of tailings from the idaho - maryland gold mine , having the general composition shown in table 1 , was air - dried to less than 3 % moisture and screened to remove material larger than 516 microns ( 30 mesh ). the raw tailings material was calcined in air at 900 degrees c . following calcining , the material , without additives , was mechanically compacted using a ram at a pressure of approximately 350 psi within a nitride - bonded - silicon - carbide process tube at a temperature of 1130 degrees c . for an extended period of time , approximately 60 hours at temperature . the material was then slowly cooled , at a rate of 1 to 3 degrees c . per minute , forming a synthetic rock hybrid material , which was then removed from the process tube . test specimens of the resulting synthetic rock hybrid material had an average modulus of rupture of about 85 mpa ( 12320 psi ), and an average water absorption of about 0 . 3 % as determined by method astm c373 . other resulting data are shown in table 2 . fig4 is the scanning electron microprobe back - scattered electron ( bse ) image of this synthetic rock hybrid material of idaho maryland mine tailings feedstock . fig4 illustrates the three characteristic phases typical of the unique microfabric of this synthetic rock material . these three phases include clasts ( partially dissolved remnant primary grains of the tailings feedstock ); a glass phase derived from the partial melting of primary mineral grains ; and a secondary crystalline phase comprised of similarly sized crystallites that occur in the glass phase . the latter secondary minerals crystallized from the melt prior to cooling and formation of the glass phase . fig4 shows a remnant primary quartz grain with rounded edges indicating dissolution of its formerly angular grain boundaries ( 31 ). the nearly complete melting of most other primary mineral constituents of the original feedstock components such as feldspar leaves little evidence of their existence in this synthetic rock other than mottled areas that retain the chemical signature of the parent mineralogy ( 32 ). the glass phase ( 33 ) with an aluminosilicate composition contains trace amounts of cations such as potassium , calcium , sodium , magnesium , and iron ( 33 ). eds microchemical analysis of the glass throughout the ceramic indicates that the glass composition is heterogeneous and varies with respect to the aluminum : silicon ratio as well as the trace cation content ( 34 ). the newly formed ( secondary ) crystallite comprises the crystalline phase of this synthetic rock . the longer processing time resulted in secondary crystallites comprising 40 - 50 % of the volume of this material . the crystallites appear in two recognizable morphologies each with distinct chemistries as determined by eds . some crystallites appear in narrow lath and skeletal shapes and occur singly and in clusters ( 35 ). crystallites of this morphology uniformly possess a chemistry most similar to the bronzite species of pyroxene having high magnesium but low calcium and iron contents ( 35 ). the size of the lath shaped crystallites ranges from 1 to 3 μm in width and from 5 to 25 μm in length . the other common morphology of crystallites is an equant blocky shape similarly occurring singly and in clusters ( 36 ). this latter crystallite morphology is associated with calcium to iron ratios similar to augite or pigeonite varieties of pyroxene having high calcium but low iron contents . the size of these blocky crystallites ranges from 4 to 15 μm . the continuous glass phase in this synthetic rock material leaves widely spaced isolated voids with little or no communication between them resulting in very low absorption values ( 37 ). this embodiment is a method of processing mine tailings employing a fast cooling schedule , which results in applicant &# 39 ; s composition and corresponding articles of manufacture . a sample of tailings from the idaho - maryland gold mine , having the general composition shown in table 1 , was air - dried to less than 3 % moisture and screened to remove material larger than 516 microns ( 30 mesh ). the raw tailings material was calcined in air at 900 degrees c . following calcining , the material , without additives , was mechanically compacted using a ram at a pressure of approximately 300 psi within a nitride - bonded - silicon - carbide process tube at a temperature of 1140 degrees c ., with a residence time of approximately 6 hours at temperature . the material was then extruded through a rectangular die ( 15 . 2 by 1 . 3 cm ) with a land length of 3 . 5 cm , and subsequently cooled at a rate of about 10 to 20 degrees c . per minute , forming a synthetic rock hybrid material . test specimens of the resulting synthetic rock hybrid material had an average modulus of rupture of about 42 mpa ( 6060 psi ), and an average water absorption of about 3 . 2 % as determined by method astm c373 . other resulting data are shown in table 2 . fig5 shows the scanning electron microprobe back - scattered electron ( bse ) image of the resulting synthetic rock hybrid material . fig5 illustrates the three characteristic phases typical of the unique microfabric of this synthetic rock material . these three phases include clasts ( partially dissolved remnant primary grains of the tailings feedstock ); a glass phase derived from the partial melting of primary mineral grains ; and a secondary crystalline phase comprised of similarly sized crystallites enveloped in the glass phase . the latter secondary minerals crystallized from the melt during cooling , likely prior to the formation of the glass phase . fig5 shows a remnant primary quartz grain with rounded edges indicating dissolution of its formerly angular grain boundaries ( 41 ). the nearly complete melting of most other primary mineral constituents of the original feedstock components leaves little evidence of their existence in this synthetic rock . the glass phase ( 42 ) with an aluminosilicate composition contains trace amounts of cations such as potassium , calcium , sodium , magnesium , and iron ( 42 ). eds microchemical analysis of the glass throughout the ceramic indicates that the glass composition is heterogeneous and varies with respect to the aluminum : silicon ratio as well as the trace cation content ( 43 ). four newly formed secondary crystalline phases are apparent in this synthetic rock material including two distinct pyroxene types , anhydrite and ilmanite . pyroxene crystallites appear in two morphologies each with distinct chemistries as determined by eds . one pyroxene crystallite morphology is a narrow lath shape ( 44 ). the lath type pyroxenes uniformly possess a chemistry most similar to the bronzite species having high magnesium but low calcium and iron contents ( 44 ). the crystallite sizes range from 1 . 5 to 3 μm in width and from 5 to 50 μm in length . the faster processing time to produce this material ( relative to example 1 ) prevented complex cluster development of the crystallites . other pyroxene crystallites occur with an equant blocky shaped morphology ( 45 ). this latter type pyroxene occurs singly and in simple clusters . this latter pyroxene crystallite morphology is associated with calcium to iron ratios similar to augite or pigeonite varieties with high calcium but low iron contents . the blocky crystallites range from 1 to 5 μm . sulfur in this synthetic rock has combined with calcium to form crystallite clusters of anhydrite ( 46 ). individual crystallites within the clusters range from 2 to 7 μm in size . small similarly sized crystallites of ilmanite ( iron titanium oxide ) of 1 to 5 μm in size appear randomly arranged in the glassy matrix ( 47 ). the continuous glass phase in this synthetic rock material leaves few and widely spaced isolated voids ( 48 ) with little or no communication between them , resulting in very low absorption values . this embodiment is a method of processing metavolcanic mine development rock employing a fast cooling schedule , which results in applicant &# 39 ; s composition and corresponding articles of manufacture . a composite of drill - core samples taken from metavolcanic ( andesite , dacite , diabase , and others ) rock from the idaho - maryland mine (“ development rock ”) was air - dried to less than 3 % moisture , and ground to a size fine enough to pass 100 % through a 516 - micron ( 30 - mesh ) screen . the development rock powder had a composition as shown in table 1 . the development rock powder , without additives , was processed through the apparatus described in u . s . pat . no . 6 , 547 , 550 ( guenther ) at a temperature of 1160 degrees c ., with a mechanical pressure oscillating between about 160 psi and 30 psi with a period of oscillation of 10 minutes , in a partial vacuum atmosphere ( about 170 mbar absolute pressure ), with a residence time of about 60 minutes before extruding the consolidated plug of synthetic rock hybrid material . following the extrusion , the plug was cooled at a rate of about 5 to 15 degrees c . per minute . test specimens of the resulting synthetic rock hybrid material had an average modulus of rupture of about 64 mpa ( 9280 psi ), and an average water absorption of about 0 . 8 % as determined by method astm c373 . other resulting data are shown in table 2 . fig6 is the scanning electron microprobe back - scattered electron ( bse ) image of the resulting synthetic rock material from composite idaho maryland development rock feedstock . fig6 illustrates the three characteristic phases typical of the unique microfabric of this synthetic rock material that collectively comprise an aggregate ( or breccia ) arrangement . these three phases include partially dissolved remnant primary grains of the original metavolcanic feedstock constituents ; a glass phase derived from the partial melting of primary mineral grains ; and secondary crystalline phases comprised of similarly sized crystallites enveloped in the glass phase . the latter secondary minerals crystallized from the melt during cooling , likely prior to the formation of the glass phase . fig6 shows numerous remnant grains of a variety of primary constituents forming a relatively coarse clasts fraction . these primary lithic grains include polymineralic metavolcanic rock fragments ( 51 ) and monomineralic mineral grains ( 52 ). specific minerals that occur either in monomineralic grains comprised of a single mineral or polymineralic rock fragments comprised of multiple minerals include plagioclase feldspar ( 53 ); pyroxene ( 54 ); and remnants of degraded chlorite ( 55 ). other primary minerals inherited from the feedstock constituents that also occur but not illustrated in fig6 include sphene , quartz and hematite . the partial melting of feldspar ( 53 ) occurring in the metavolcanic feedstock contributes to the formation of a melt phase that created a glass matrix upon cooling ( 56 ). the rounded feldspar grain margins indicate dissolution or melting of its formerly angular grain boundaries . the glass phase ( 56 ) with an aluminosilicate composition contains trace amounts of cations such as potassium , calcium , sodium , magnesium , and iron . eds microchemical analysis of the glass throughout the ceramic indicates that the glass composition is heterogeneous and varies with respect to the aluminum : silicon ratio as well as the trace cation content ( 57 ). fig6 illustrates the formation of the dominant secondary crystalline phase that crystallized from the melt . clusters of pyroxene crystallites appear in various locations enveloped by the glass phase ( 58 ). the individual pyroxene crystallites within the clusters possess an equant blocky morphology with calcium to iron ratios similar to augite or pigeonite varieties . other secondary minerals that crystallized from the melt but not illustrated in fig6 include maghemite ( spinel group ) and ilmanite ( iron titanium oxide ). the continuous glass phase of this synthetic rock material envelops nearly the entire grain margin of the clasts resulting in widely spaced isolated voids ( 59 ). there is little or no communication between the isolated voids resulting in the very low absorption values determined for this synthetic rock hybrid material . the unique structural attribute of this synthetic rock material is the aggregate breccia microfabric created by the three important components that includes 1 ) the primary remnant clasts , 2 ) the glass phase , and 3 ) the secondary crystallite phase . this aggregate breccia structural arrangement of components ( or constituents ) creates a strong aggregate microfabric with superior strength and durability properties unique to this synthetic rock material . this embodiment is a method of processing coal fly ash employing a fast cooling schedule , which results in applicant &# 39 ; s composition and corresponding articles of manufacture . coal fly ash material was obtained from a coal power plant , specifically valmy train 2 in winnemucca , nev . the composition of the raw material is shown in table 1 . the material was air - dried to less than 3 % moisture , and screened to pass 100 % through a 516 - micron ( 30 - mesh ) screen . following calcining , the calcined coal fly ash material , without additives , was mechanically compacted using a ram at a pressure of approximately 300 psi within a nitride - bonded - silicon - carbide process tube at a temperature of 1115 degrees c ., with a residence time of approximately 10 hours at temperature . the material was then extruded through a cylindrical die , and subsequently cooled at a rate of about 10 to 20 degrees c . per minute , forming a synthetic rock hybrid material . test , specimens of the resulting synthetic rock hybrid material had an average modulus of rupture of about 57 mpa ( 8230 psi ), and an average water absorption of about 0 . 7 % as determined by method astm c373 . other resulting data are shown in table 2 . fig7 is the scanning electron microprobe back - scattered electron ( bse ) image of the synthetic rock material fabricated from coal fly ash waste material feedstock . fig7 illustrates the three characteristic phases typical of the unique microfabric of this synthetic rock material that collectively comprise an aggregate structural arrangement . these three phases include clasts of partially dissolved remnant primary grains of the original fly - ash feedstock constituents ; a glass phase derived from the partial melting of primary mineral and fly - ash grains ; and secondary crystalline phases comprised of similarly sized crystallites enveloped in the glass phase . the latter secondary minerals crystallized from the melt during cooling , likely prior to the formation of the glass phase . fig7 shows remnant grains of primary constituents that remain in this synthetic rock including quartz ( 61 ) and fly - ash glass spherules ( 62 ). the partial melting of fly - ash glass spherules — the dominant feedstock constituent — created a melt phase that formed a continuous glass matrix upon cooling ( 63 ). the glass phase ( 63 ) with an aluminosilicate composition contains trace amounts of cations such as potassium , calcium , sodium , magnesium , and iron . eds microchemical analysis of the glass throughout the ceramic indicates that the glass composition is heterogeneous and varies with respect to the aluminum : silicon ratio as well as the trace cation content ( 64 ). fig7 illustrates the formation of up to four secondary crystalline phases that crystallized from the melt during the cooling process . these secondary crystalline phases include : clusters of wollastonite crystallites ( 65 ) some of which nucleated on remnant primary quartz grains ( 61 ); lath - shaped plagioclase feldspar ( 66 ) and pyroxene ( 67 ) crystallites randomly distributed in the glass phase ; and blocky anhydrite crystallites ( calcium sulfate ) not shown in fig7 . the anhydrite phase is a major component of this synthetic rock material and serves as a major receptacle for the sulfur that was a dominant constituent of the coal fly - ash waste material . individual wollastonite crystallites range in size from 1 to 6 μm . the lath shaped plagioclase and pyroxene crystallites range from 1 to 5 μm in width and 2 to 15 μm in length . the larger blocky anhydrite phenocrysts are a size that can be resolved with the polarized light microscope with typical sizes ranging from 10 to 70 μm . the continuous glass phase of this synthetic rock material envelops the entire grain margin of the primary and secondary mineral grains resulting in few if any isolated voids ( 68 ). the predominant void space in this synthetic rock was inherited and associated with the primary fly - ash spherules ( 69 ). there is little or no communication between any of the isolated voids resulting in the very low absorption values determined for this synthetic rock material . the unique structural attribute of this synthetic rock material is the aggregate breccia microfabric created by the three important components that includes 1 ) the primary remnant clasts , which in this example include mineral grains and mineraloid grains such as glassy fly - ash spherules , 2 ) the glass phase , and 3 ) the secondary crystallite phase . the cluster development of the large wollastonite crystallites the crystallized around primary quartz grains contributes to the coarse aggregate fraction ( 65 ). this aggregate breccia structural arrangement of components ( or constituents ) creates a strong aggregate microfabric with superior strength and durability properties unique to this synthetic rock material . this embodiment is a method of processing waste mineral materials such as mine tailings , ash , slag , slimes , and the like , which results in applicant &# 39 ; s composition and corresponding articles of manufacture . referring to fig8 , raw material for synthetic hybrid rock manufacture 100 , may be for example mine tailings , waste rock , quarry fines , slimes , fly ash , bottom ash , coal ash , incinerator ash , wood ash , slag , or blends of these materials with each other or with pure ceramic feed materials such as clay , feldspar , quartz , talc , and the like . silicate waste materials are particularly well - suited for use as raw material . raw material 100 is delivered to screening apparatus 120 , which has an outlet 121 for oversize particles 122 with a size larger than a predetermined screen opening size , and which further has an outlet 123 for undersize particles 124 with a size smaller than a predetermined screen opening size . oversize particles 122 may be recycled to screening apparatus 120 via a grinding process ( not shown ), or disposed of . undersize particles of raw material 124 are conveyed to a hopper 131 of rotary calciner 130 . feed auger 137 is driven , for example by motor 136 , and particulate raw material is thereby conveyed to a heated rotating barrel 132 . barrel 132 is heated by any of various means including but not limited to electric resistance heaters , gas burners , and exhaust or waste heat from other processes . drive 139 rotates barrel 132 , which may have a smooth interior surface , or alternatively may have a surface that is corrugated or otherwise roughened , for example with lifters , to provide a means for the material to be repeatedly lifted and dropped as it moves through the barrel . barrel 132 is inclined at a shallow angle from horizontal in order to slowly drive the powder toward the discharge assembly 133 . calciner 130 optionally has gas inlet 135 for the addition of air or other gases and vent 134 for the removal of combustion products or other gaseous decomposition products . calciner 130 is operated at temperatures below the point where the material begins to soften and sinter , but at elevated temperatures such that the material is preheated and dried . other useful chemical transformations can be carried out in the calciner , including but not limited to combustion of organic materials , conversion of hydrated minerals to dehydrated oxides , desulphurization , decomposition of carbonates , and the like . the process temperature for each of these operations varies , but is generally in the range of 100 to 1000 degrees celsius . calcined particulate material 139 exits at a temperature within this range , preferably about 800 to 1000 degrees celsius , and passes through valve 140 to hopper 150 . valve 140 can be closed to provide a vacuum - tight seal between hopper 150 and calciner 130 . preferably valve 140 is a high - temperature rotary valve that can continuously flow material through while maintaining a pressure differential . hopper 150 is preferably thermally insulated , or alternatively provide with a source of heat to maintain the temperature of particulate material . vacuum outlet 151 may be provided for connection to vacuum 152 . vacuum removes entrained and interstitial gas from particulate material and contributes to the production of void - free synthetic hybrid rock material from a subsequent extrusion step . vacuum can also reduce the oxidation of minerals and can increase the variety or level of crystallization in the resulting product . outlet 61 of hopper 150 is connected to feeder 160 at inlet flange 161 . feeder 160 may function as a reciprocating ram , or as an auger , or as both . auger 162 is rotated by shall 163 and drive 164 , thereby conveying particulate synthetic hybrid rock material forward into extruder barrel 180 . the entire auger / drive assembly may be moved axially , for example by means of hydraulic ram 165 moving axially in hydraulic cylinder 166 due to pressure created by pump or hydraulic power unit 167 . the axial motion of auger 162 also conveys particulate material into extruder barrel 180 . a typical operation cycle for using both auger and ram aspects of the invention together is as follows . under little , or none , or perhaps backward force from the hydraulic ram 165 , drive 164 rotates auger 162 , which conveys particulate material into extruder barrel 180 . when the available space in extruder barrel 180 is filled with newly conveyed particulate material , drive 164 is shut down and auger 162 stops rotating . ram 165 is then energized by power unit 167 to provide an axial force on auger 162 , which in turn pushes on material in extruder barrel 180 . material is conveyed axially down extruder barrel 180 in this manner for a predetermined distance . once said predetermined distance has been reached , the force applied by hydraulic ram is reduced , and the cycle may be repeated . extruder barrel 180 may be constructed from a material with excellent resistance to high temperatures , good thermal conductivity , acceptable strength , and excellent resistance to wetting by or reaction with materials to be processed in the extruder . preferably , extruder barrel 180 is constructed from silicon carbide ( sic ). most preferably , extruder barrel 180 is constructed from nitride - bonded silicon carbide ( sin — sic ), for example advancer ™ material available from st . gobain industrial ceramics . extruder barrel 180 is compressed between feeder 160 and spider 190 and supported within furnace 170 . furnace 170 provides heat , for example by electrical resistance heaters or by gas combustion , and is preferably a split - tube design for ease of maintenance , and also preferably has multiple zones of temperature control along its length . furnace 170 provides heat to increase the temperature of extruder barrel 180 high enough to fuse , sinter , partially melt , or otherwise accomplish the desired vitrification of the material within . within extruder barrel 180 , particulate material fed by feeder 160 is conveyed axially toward reducer die 181 and heated , thereby consolidating and vitrifying particulate material into at least partially molten synthetic hybrid rock material . reducer die 181 connected to the end of extruder barrel 180 provides a resistance to the flow of said at least partially molten synthetic hybrid rock material and thereby increases the necessary pressure applied by ram 165 to convey the material , providing a mechanism for consolidation of the material . optional land die 182 connected to the end of reducer die 181 may further increase the resistance to flow . in the absence of land die 182 , a spacer may be used , for example an additional short length of barrel similar to extruder barrel 180 . at the discharge end of the extruder , that is where the land die or spacer exits furnace 170 , an insulator ring 183 made of strong , thermally insulating material , preferably zirconia , is placed . insulator ring 183 minimizes heat conduction from the furnace to spider 190 , and is captured in a recessed opening within spider 190 . spider 190 is a stiff plate that allows passage of extruded synthetic hybrid rock product 130 through a hole in the center while providing mechanical compression to insulator ring 183 , land die 182 , reducer die 181 and extruder barrel 180 . spider 190 is supported by a plurality of stiff springs 191 , each reacting against a load cell 192 mounted on a fixed rigid support . extruded synthetic hybrid rock product 130 exits land die 182 , proceeds through insulator ring 183 and spider 190 , and is supported and conveyed by a plurality of rollers 201 within heated chambers 200 and 220 . the temperature in heated chambers 200 and 220 is maintained such that extruded synthetic hybrid rock material 230 remains deformable enough to be cut by cutters 210 attached to actuators 212 . after cutting , extruded synthetic hybrid rock material 230 may be removed from heated chamber 220 and cooled by various means to produce useful products . alternatively , extruded synthetic hybrid rock material 230 may be conveyed to subsequent operations such as pressing , forming , rolling , molding , or glazing at a high temperature , thereby efficiently using the heat in the material .	1
the present invention is generally directed to a window assembly 100 , such as the window assembly 100 shown in fig1 and 1 a . the window assembly 100 is preferably comprised of a window frame 102 , and a window sash assembly 104 that has pivot pins 500 and a glass window unit or windowpane 106 . the window assembly 100 is constructed and arranged so that the window sash assembly 104 and window frame 102 cooperate with one another to permit the rotation of the window sash assembly 104 relative to the window frame 102 . specifically , as shown in fig1 a , pivot pins 500 are able to move within kidney shaped receptacles 210 located on the window frame 102 that guide the tilting movement of the window sash assembly 104 relative to the window frame 102 . the window sash is therefore able to achieve a plurality of positions , including an open - tilted and closed position . while the present invention will be described primarily with respect to a single - hung window assembly , it should , however , be appreciated that the present invention can be used in connection with various other types of pivotal windows or structures including , but not limited to , a double - hung window assembly , a vertical pivot window assembly , and the like , wherein it is desired to install a window that is efficient in terms of time and cost . the window frame 102 comprises a plurality of members joined together at their respective ends . as shown in fig2 , the header 202 is joined at a first end 218 with a second end 232 of the left window jamb 206 . at its second end 220 , the header 202 is joined with the first end 222 of the right window jamb 208 . the second end 224 of the right window jamb 208 is joined with the first end 226 of footer 203 ( see fig1 a ). at its second end 228 , the footer 203 is joined with the first end 230 of the left window jamb 206 . as seen in fig1 a and 2 , the water dam 204 is located in front of footer 203 so as to prevent water , wind , or other elements of the outdoors from invading the interior of a building . as will be discussed in greater detail herein , the water dam 204 may also serve as a means for supporting the window sash in its open - tilted position . it should be appreciated , however , that the water dam 204 may be integrally formed with the footer 203 in order to save on the cost of materials during manufacture of the window frame 102 . referring to fig2 , a sash support 207 is located inwardly of the water dam 204 ( see also fig1 a ) and extends the length around the left window jamb 206 , header 202 , and right window jamb 208 of the window frame 102 . the sash support 207 supports the window sash 104 ( see fig1 a ) when the window sash 104 is in its closed position . it should be appreciated that the sash support 207 need not extend the length of left window jamb 206 , header 202 , and right window jamb 208 of the window frame 102 , nor does it need to be located on all three parts of the window frame 102 . an important feature of the present invention is best shown in fig3 - 3a , which are cross - sectional views of the left window jamb 206 and right window jamb 208 , respectively . specifically , a pair of kidney shaped receptacles 210 , 212 are located on the lower regions of the left window jamb 206 ( see fig3 ) and right window jamb 208 ( see fig3 a ), respectively , as well as , close to the water dam 204 . the kidney shaped receptacles have an upper kidney end 304 and a lower kidney end 302 . as shown in fig3 a , there is an insertion channel 214 located on the right window jamb 208 that is connected to the upper kidney end 304 of the kidney shaped receptacle 212 . additionally , there is a transition region 402 , located at the beginning of the insertion channel 214 . it should be appreciated that the insertion channel 214 may instead be located on the left window jamb , or alternatively on both left and right window jambs 206 , 208 . as can be seen in fig2 , the kidney - shaped receptacles 210 , 212 are disposed in a line substantially in parallel with the footer 203 to provide for tilting movement of the window sash 104 by means of the pivot pins 500 . referring back to fig2 , the depth d 1 of the kidney shaped receptacles 210 , 212 ranges from 0 . 325 - 0 . 425 inches . the depth d 2 of the insertion channel 214 is dependent upon the depth of the kidney shaped receptacle 212 to which the insertion channel 214 is connected . accordingly , the depth of the insertion channel 214 will also range from 0 . 325 - 0 . 425 inches . the depth of the transition region 402 of the insertion channel 214 is gradually shallower in depth than the remainder of the insertion channel 214 . however , at the point where the transition region 402 and insertion channel 214 meet , the depth of the transition region 402 will equal the depth of the insertion channel 214 . fig4 and 4 a show cross - sectional cut away portions of the lower portions of the left and right window jambs 206 , 208 that illustrate the kidney shaped receptacles 210 , 212 and insertion channel 214 in greater detail . in a preferred embodiment , the radii r 1 of the upper and lower kidney ends 302 , 304 of the kidney shaped receptacles 210 , 212 preferably range from approximately 0 . 20 - 0 . 30 inches . the length l 1 of the kidney shaped receptacles ranges from approximately 0 . 725 - 0 . 825 inches , and the width w 1 of the kidney shaped receptacles 210 , 212 ranges from 0 . 45 - 0 . 55 inches . as shown in fig3 a , the insertion channel 214 that connects to the kidney shaped receptacle 212 on the right window jamb 208 has a length ranging from 5 to 10 inches , and a width ranging from 0 . 45 - 0 . 55 inches . as shown in fig4 a , the insertion channel 214 has several curves at or near the point where it intersects the kidney shaped receptacle 212 . it is believed that such a configuration enables greater ease during installation and mounting of the window sash assembly 104 ( see fig1 a ) within the window frame 102 , as it helps to facilitate movement of the pivot pin 500 through the insertion channel 214 and into the kidney shaped receptacle 212 . a lower inner curve 410 is formed at the point where the insertion channel 214 is connected to the kidney shaped receptacle 212 . the lower inner curve 410 has a radius of curvature r 3 ranging from 0 . 075 - 0 . 175 inches . an intermediate curve 450 is located above the lower inner curve 410 and adjacent to the open - tilt support 300 . intermediate curve 450 has a radius of curvature r 4 ranging from approximately 0 . 20 - 0 . 30 inches . a right insertion channel curve 430 is located above the intermediate curve 450 and has a radius of curvature r 6 ranging from approximately 0 . 075 - 0 . 175 inches . a left insertion channel curve 440 is located above the upper inner curve 420 and has a radius r 5 ranging from approximately 0 . 20 - 0 . 30 inches . it should be appreciated , however , that the aforementioned dimensions of the kidney shaped receptacles 210 , 212 and insertion channel 214 may vary based on the size of the window frame . additionally , in insertion channel may have more or fewer curves without departing from the scope of the present invention . a preferred window sash assembly 104 according to the present invention is shown in fig5 . the window sash assembly 104 is formed by the union of the left sash rail 502 , right sash rail 504 , upper sash rail 506 , and lower sash rail 508 ( see fig1 a ) at their outermost ends . the pivot pins 500 are located on the outer portion of opposed lower ends of the window sash assembly 104 . the window pane 106 is embedded in the window sash assembly 104 . the window pane 106 may be comprised of any number of materials , such as plastic , glass , or a screen material . based on these features of the window sash assembly 104 and window frame 102 , mounting of the window sash assembly 104 into the window frame 102 is easily accomplished as compared with prior art windows which require the installation and assembly of additional window assembly parts . referring to fig6 , the window sash assembly 104 is mounted on the window frame 102 by first horizontally tilting the window sash assembly 104 so that the right sash rail 504 is higher than the left sash rail 502 . the pivot pin 500 located on the right sash rail 504 is then placed into the transition region 402 of the insertion channel 214 , while the pivot pin 500 located on the left sash rail 502 is placed into and engages the kidney shaped channel 210 located on the left window jamb 206 . once the pivot pin 500 located on the left window jamb 206 is secured within the kidney shaped receptacle 210 , the pivot pin 500 located on the right window jamb 208 is able to slide into the insertion channel 214 , beginning at the transition region 402 . due to the transition region 402 , the pivot pin 500 of the window sash assembly 104 is able to easily move through the insertion channel 214 , and down into the kidney shaped receptacle 212 on the right window jamb 208 . in an alternative embodiment of a window assembly 100 of the present invention , retractable pins , which could be the pins 500 , can be used on either or both the left and right sash rails 502 , 504 . the retractable pins can be retracted into the window sash assembly 104 , such that during window assembly , it is unnecessary to horizontally tilt the window sash assembly 104 so as to allow a pin to engage the insertion channel 214 . instead , retraction of the pins allows the window sash assembly 104 to fit directly into the opening of the window frame 102 , such that the pivot pins 500 are able to easily engage the kidney shaped receptacles 210 , 212 . this configuration eliminates the need for the construction and arrangement of the insertion channel 214 in the right window jamb 208 . accordingly , in such a configuration , only the kidney shaped receptacles 210 , 212 need be located on the lower regions of the left and right window jambs 206 , 208 . referring to fig7 - 10 , when mounted in the window frame 102 , the window sash assembly 104 is capable of achieving a plurality of angular positions . however , the kidney shaped receptacles 210 , 212 advantageously permit the window sash assembly to achieve two stationary or stable positions . a lower stable position provides a fully closed window , and a higher stable position provides a sufficient tilt - opening when a water dam is employed . accordingly , the window sash assembly 104 has a stable closed position , and a stable open - tilted position . it should be further appreciated that the window can also maintain various stable angular positions due to further construction and arrangement of the window assembly , without departing from the spirit and scope of the present invention . the window sash assembly 104 is in a non - pivoted or closed position when it rests within the left and right window jambs 206 , 208 of the window frame 102 . as shown in fig7 and 8 , this occurs when the pivot pin 500 of the left and right sash rails 502 , 504 ( see fig6 ) engage the lower end 302 of the kidney shaped receptacles 210 , 212 of the left and right window jambs 206 , 208 respectively . the window sash assembly 104 can then be locked in the window frame 102 when the left lock control 512 ( see fig5 ) and right lock control 513 manipulate a locking mechanism , such as a lock pin ( not shown ), to engage the lock openings 216 ( see fig2 ) of the window frame 102 . use of the two handles is advantageous to better secure the window frame , as well as , to help better insulate a building against the outdoor elements , such as wind and water . alternatively , one lock control may be utilized to secure the window sash . in such an alternative embodiment , the lock control is preferably located in the center of the upper rail of the window sash assembly 104 . referring to fig9 and 10 , the window sash assembly 104 is in an open - tilted stationary position when the window sash assembly 104 is at its maximum open position . this occurs when the pivot pins 500 of the left and right sash rails 502 , 504 engage the upper kidney end 304 of the kidney shaped receptacles 212 of the right and left window jambs 206 , 208 . additionally , in another important feature of the present invention , a support means is provided for holding the window sash assembly 104 in its open - tilted position . in a preferred embodiment , a water dam 204 is used to support the window sash assembly 104 in its open - tilted position . as such , the water dam 204 serves a dual purpose . first , it is a water barrier that minimizes the amount of water that may enter the interior of a building during a rainstorm . second , it is a support for the window sash assembly 104 when the window sash assembly 104 is in its open tilted position . the window sash assembly 104 will rest on the open - tilt support 300 , of the water dam 204 , so as to maintain an open - tilted position . the open - tilt support 300 preferably provides a flat surface at an angle that mates with the window sash . in a preferred embodiment , the height of the water dam 204 ranges from 1 - 2 inches . it should be appreciated that the height of the water dam 204 and / or angle of the open tilt - support 300 can be varied in order to alter the maximum open - tilted position of the window sash assembly 104 . this may be especially advantageous if the window assembly 100 is to be located above a tall object and it is desired to position the window such that it will not contact the object when in its open - tilted position . referring to fig1 - 13 , an alternative embodiment for a window assembly 1100 according to the present invention is shown . fig1 shows a front view of an alternative window assembly 1100 according to the present invention comprising a window frame 1102 and a window sash assembly 1104 . the window sash assembly 1104 is comprised of a left sash rail 1106 , a right sash rail 1108 , an upper sash rail 1110 , and a lower sash rail 1112 , each joined together at their respective ends , pivot pins ( not shown ), a sill lift 1114 located across the bottom of the window sash assembly 1100 , and right handle 1150 and left handle 1151 . the sill lift 1114 is constructed and arranged similar to the sill lift handle commonly utilized in a double hung window assembly . such sill lifts are manually used to lift a window into an open position . the window jambs include cooperating kidney shaped channels , one kidney shaped channel 1210 in a first vertical window jamb 1116 , and one kidney shaped channel 1200 ( see fig1 ) in a second vertical window jamb 1118 . the window frame 1102 further includes an upper border 1120 , and a lower border 1121 ( see fig1 ). a water dam 1122 is located in front of said lower border 1121 , and is integrally formed with said lower border 1121 . it should be appreciated , however , that the water dam 1122 may be formed separately from the lower border 1121 . referring to fig1 , there is a cross - sectional cut - away view of the window sash assembly 1104 located in its closed position within a first vertical window jamb 1116 and a second vertical window jambs 1118 ( see fig1 ), of the window frame 1102 . a kidney shaped receptacle 1200 is shown in the lower region of the second vertical window jamb 1118 ( see fig1 ). an insertion channel 1202 connects to the kidney shaped receptacle 1200 in the second vertical window jamb 1116 . a corresponding kidney shaped receptacle 1210 ( see fig1 ) is located on the first vertical window jamb 1116 without the insertion channel 1202 . however , it should be appreciated that the first vertical window jamb 1116 can be constructed and arranged so as to be a mirror image of the second vertical window jamb 1116 , thereby having an insertion channel 1202 . referring to fig1 , a cross - sectional cut - away view of the window sash assembly 1104 is shown in its open - tilted position . the pivot pins 500 engage the upper kidney end 1206 . the sill lift 1114 rests against the water dam 1122 , which preferably has a cam - shaped supporting surface 1123 , so as to support the window sash assembly 1104 in its open - tilted position . referring to fig1 - 19 there is shown an alternative window assembly according to the present invention comprising a window sash 1400 ( see fig1 and 15 ) and a window frame 1600 ( see fig1 ). in addition to the typical components of a window sash , such as the top , bottom , right and left sash rails , the window sash further comprises a sash mating surface 1402 . as shown in fig1 , the sash mating surface 1402 comprises an inner edge 1404 and a sash curve 1406 . the window frame 1600 shown in fig1 - 19 comprises a header ( not shown ), a right window jamb 1410 ( see fig1 ), a left window jamb 1412 ( see fig1 ), a footer 1604 , and a water dam 1606 . the footer 1604 and water dam 1606 are preferably formed from a unitary piece of material such that there is a uniform frame mating surface 1602 . the water dam 1606 is greater in height than the footer 1604 , such that the frame mating surface 1602 has an angular slope that is complementary to the sash mating surface 1402 ( see fig1 ). the angular slope of the frame mating surface 1602 preferably has a radius of curvature r10 ranging from 0 . 388 - 0 . 488 inches . there is also a frame mating edge 1608 located at the top of the water dam 1606 . at the point where the frame mating edge 1608 of the frame mating surface 1602 connects with the remainder of the frame mating surface 1602 , there is an upper radius of curvature r 12 preferably ranging from 0 . 15 - 0 . 20 inches . as shown in fig1 and 17 , the window frame is further characterized by kidney shaped receptacles 1610 , 1611 respectively located on the right and left window jambs 1410 , 1412 that receive the pivot pins 1401 of the window sash 1400 . the center c 1 of the lower kidney end 1616 of the kidney shaped receptacles 1610 , 1611 is located approximately 1 . 2 inches from the base of the footer 1604 . the center c 2 of the upper kidney end 1618 is displaced approximately 0 . 031 inches from c 1 . referring to fig1 , on the right window jamb 1410 , there is an insertion channel 1612 ( that connects to the kidney shaped receptacle 1610 . accordingly , a connection curve 1614 is formed at the point where the kidney shaped receptacle 1610 and insertion channel 1612 meet . in a preferred embodiment , the connection curve 1614 has a radius of curvature r 14 ranging in size from 0 . 045 - 0 . 55 inches . the insertion channel 1612 of this alternative embodiment is similar in function to the insertion channel 214 of fig2 and 3 a . it should be appreciated that there are slight differences between the insertion channel 1612 and insertion channel 214 of fig2 and 3 a . for example , the displacement between c 1 and c 2 is 0 . 045 , whereas the displacement between a 1 and a 2 of fig2 and 3 a is 0 . 068 . additionally , there are fewer radii of curvature in the present embodiment , as compared to fig2 and 3 a . despite such differences , both embodiments fall within the scope of the present invention . the window assembly 1400 has two stationary positions , an open - tilted and a closed position . as shown in fig1 and 17 , in its closed position , the sash mating surface 1402 of the window sash 1400 is complementary to the frame mating surface 1602 of the window frame 1600 . furthermore , the pivot pins 1407 are located in the lower kidney ends 1616 . referring to fig1 and 19 , in its open - tilted position , the pivot pins 1401 are located in the upper kidney ends 1618 . the window sash is able to maintain a stable and open - tilted position when the inner edge 1404 of the window sash 1400 rests on top of or over the frame mating edge 1608 of the water dam 1606 . although the invention herein has been described with reference to particular embodiments and preferred dimensions or ranges of measurements , it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention . additionally , it is to be appreciated that the present invention may take on various alternative orientations . it is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the appended claims .	8
the invention provides a coagulant composition and a method of using the same . the invention provides improved coagulation and improved drainage of water from coal tailings in a twin belt press process . the invention uses a polymer containing vinylamine to accomplish this goal . in thickener applications , the polymers of the invention may be added before or after the slurry is flocculated with a standard flocculant in the industry . preferably , in twin belt press applications , the coagulants of the invention are added after the slurry is flocculated . for purposes of this invention , polyvinylamine consists of vinylamine and those monomers which are hydrolyzable to the following formula : ## str1 ## wherein : r is , preferably , one substituent group selected from the group consisting of hydrogen and an alkyl group having from 1 - 10 carbon atoms . more preferably , r is hydrogen or is an alkyl group having 1 - 4 carbons . in a preferred embodiment of the invention , the vinylamine - containing polymer is a homopolymer of polyvinylamine . in an alternative embodiment , the vinylamine - containing polymer is a copolymer comprised of from about 1 to 99 percent by weight vinylamine and from about 99 to 1 percent by weight vinylformamide . in yet another embodiment of the invention , the vinylamine - containing polymer is a copolymer of two compounds selected from the group consisting of an amide , an ester , nitriles and salts of acrylic acid or methacrylic acid . the vinylamine - containing polymers of the invention are preferably used in conjunction with a high molecular weight flocculant . preferably , the flocculant has a molecular weight greater than 2 million daltons . the preferred flocculants include anionic copolymers selected from the group consisting of acrylamide / sodium acrylate , acrylamide / acrylamidopropyl sulfonic acid ( amps ) and poly ( sodium acrylate ). the polyvinylamine polymers of the invention preferably have molecular weights of from about 10 , 000 to about 5 , 000 , 000 daltons ( da ). more preferably , the polyvinylamine polymers of the invention have a molecular weight of from about 100 , 000 to about 3 , 000 , 000 da . most preferably , however , the poly - vinylamine polymers of the present invention have molecular weight of from about 750 , 500 to about 3 , 000 , 000 da . the coagulant compositions of the present invention are applied to the coal tailings slurry as a dilute aqueous solution . preferably , the aqueous solution is applied to the coal tailings slurry in a dosage of from about 0 . 1 to about 200 . 0 parts per million ( ppm ) of the polymers of the invention based on the total volume of the slurry . more preferably , the polymers of the invention are added to the slurry in a dosage of from about 1 . 0 to about 100 parts per million . most preferably , the polymers of the invention are added to the slurry in a dosage of from about 2 . 0 to about 50 . 0 parts per million . processes for making the polymers of the invention are well known in the art . u . s . pat . nos . 5 , 126 , 395 , 5 , 037 , 927 , 4 , 952 , 656 , 4 , 921 , 621 , 4 , 880 , 497 and 4 , 441 , 602 all describe methods for preparing the polymers of the invention . solution polymerization produces the desirable molecular weight range . the resulting polymers are susceptible to alkaline hydrolysis which converts all of the amide groups to amine groups . this hydrolysis phenomena is described in u . s . pat . no . 4 , 421 , 602 , the disclosure of which is incorporated herein by reference . unlike other amine - containing polymers like poly ( dadmac ) or epichlorohydrindimethylamine polymers the amine containing polymers of this invention do not possess a permanent charge . these polymers can best be described as having a transient positive charge that is dependent on the ph of the system . at high ph the amines are unprotonated , at low ph they adopt a positive charge , at intermediate ph only a portion of the amines are protonated , the other amine groups can be viewed as &# 34 ; free &# 34 ; amines that can interact as a 1 ° amine . the following examples are presented to describe preferred embodiments and utilities of the invention and are not meant to limit the invention unless otherwise stated in the claims appended hereto . the coagulants of the invention were evaluated using a gravity dewatering test . the gravity dewatering test is a standard test in the industry and is a valuable tool for reliably screening and evaluating coagulants for twin belt press dewatering . results obtained in testing can be directly translated to the plant process . the following procedure outlines the steps used in performing the test . five to ten gallons of untreated coal tailing slurry feed was obtained . using a mixer , the slurry was mixed to uniformly disperse any coarse solids . five hundred ml of slurry was transferred into a 500 ml graduated cylinder . the coagulant was prepared as a 1 % aqueous solution . the cylinder was inverted four times to thoroughly disperse the solids , then immediately 68 ppm of flocculant was added to the slurry . the cylinder was then inverted four additional times . the flocculant used was nalco ® 9810 , a standard flocculant in the industry . the coagulant solution is then immediately added to the slurry and inverted two additional times . the coagulants used are identified in table 1 below . the control was coagulant &# 34 ; a &# 34 ;. coagulant a was nalco ® 9853 , a standard coagulant used in this application in the industry . table 1______________________________________a nalco ® 9853 -- b pva 2 - 6 millionc pva 1 - 2 milliond pva 200 , 000 - 500 , 000e pva coagulant ( cat ) f pva 10 , 000 - 20 , 000______________________________________ pva polyvinylamine the conditioned slurry was poured over a fine mesh , and immediately the amount of water draining was collected and measured as a function of time . the drainage was collected and recorded every ten seconds for a time period greater than actual plant process time for gravity drainage . it is desirable to have the water drain as fast as possible at the lowest possible polymer dose . the results are summarized in table 2 . table 2__________________________________________________________________________reagent dose ( ppm ) inversions free drainage volume ( mi )# floc cat floc cat floc cat 10 sec 20 sec 30 sec 40 sec 60 sec__________________________________________________________________________1 9810 a 68 7 . 50 4 2 42 64 70 74 802 9810 a 68 3 . 75 4 2 32 48 58 66 713 9810 a 68 1 . 88 4 2 28 46 52 60 684 9810 b 68 7 . 50 4 2 56 76 82 88 925 9810 b 68 3 . 75 4 2 44 61 78 84 906 9810 c 68 7 . 50 4 2 42 58 70 76 827 9810 c 68 3 . 75 4 2 46 66 74 80 848 9810 d 68 7 . 50 4 2 40 52 66 72 809 9810 d 68 3 . 75 4 2 36 46 58 66 7610 9810 e 68 7 . 50 4 2 50 68 77 80 8611 9810 e 68 3 . 75 4 2 44 59 70 77 8412 9810 f 68 7 . 50 4 2 30 46 56 62 7013 9810 f 68 3 . 75 4 2 25 36 42 52 66__________________________________________________________________________ as shown in table 2 , the polymers of the invention consistently outperformed the standard coagulant in the industry ( polydadmac ). focusing on the 10 and 20 second drainage values ( since they most effectively model the drainage times in industry ), the vinylamine - containing coagulants of this invention provide equivalent or greater drainage at 3 . 75 ml than the industry standard . in fact , in selected samples , vinylamine polymers at 1 / 2 the dose give better drainage then the dadmac coagulants . a possible explanation may lie in the fact that the amine polymers of the invention are not fully charged and &# 34 ; free amine &# 34 ; groups may interact with the coal and or flocculant to provide more effective drainage . changes can be made in the composition , operation and arrangement of the method of the present invention described herein without departing from the concept and scope of the invention as defined in the following claims	1
these are rearrangement reactions of silanes of the general formulae ( 2 ) and ( 3 ) to silanes of the general formula ( 1 ). in the moving bed reactor , the catalyst is moved and spent catalyst is discharged continuously at the same time . there is thus a constant exchange of the catalyst . emptying and refilling of the reactor and the associated problems are avoided . examples of moving bed reactors include sliding bed reactors , screw reactors and fluidized bed reactors . in the case of the moving bed and sliding bed reactor , the catalyst moves by virtue of gravity as a fixed bed through the reactor and leaves it at the reactor base . in the screw reactor , the catalyst is moved through the reactor by means of a screw and leaves it at its end through an orifice . in the case of the fluidized bed reactor , spent catalyst is discharged continuously with the gas stream and can be separated out , for example , by means of cyclones . the deactivated catalyst removed from these reactors can then be disposed of or regenerated either batchwise or continuously in separate plants , and then fed back to the reaction . the product mixture is worked up by known methods . preferably , the r radical has 1 to 3 carbon atoms . more particularly , the r radical is a methyl or ethyl radical . ( ch 3 ) 3 sicl + hsicl 3 →( ch 3 ) 2 sicl 2 + ch 3 hsicl 2 +( ch 3 ) 2 hsicl [ 6 ] ( ch 3 ) 4 si + hsicl 3 →( ch 3 ) 2 sicl 2 +( ch 3 ) 3 sicl +( ch 3 ) 2 hsicl [ 11 ] preferably , the alumina catalyst has 2 to 8 , especially 3 to 6 , parts by weight of aluminum chloride per 100 parts by weight of alumina . the aluminum chloride content of the alumina catalyst can be generated by treatment of alumina by known methods with hydrogen chloride , for example , and subsequent drying in a hot gas stream , under reduced pressure or with ( ch 3 ) 3 sicl . the alumina catalyst may contain up to 10 % by weight of a metal oxide selected from magnesium oxide , copper oxide , zinc oxide and mixtures thereof . preferably , the alumina catalyst includes 0 . 5 % to 5 % by weight of the metal oxide . metal oxides or mixed oxides used may be any oxides or mixed oxides of the metals magnesium , copper and zinc . particular preference is given to magnesium oxide . preferably , the alumina catalyst has a bet surface area of at least 100 m 2 / g , more preferably at least 200 m 2 / g , and preferably at most 600 m 2 / g . preferably , the alumina catalyst has an hg pore volume of at least 0 . 2 cm 3 / g , more preferably at least 0 . 5 cm 3 / g , and most preferably at most 1 . 5 cm 3 / g . the particle size distribution of the alumina catalyst should be chosen for achievement of optimal operating conditions for the particular reactor type , for example for attainment of a well - defined fluidized bed . preferably , the alumina catalyst for use in a fluidized bed reactor has a particle size distribution of 20 to 1000 μm , more preferably of 30 to 5000 μm and especially of 40 to 250 μm . for use in a moving bed reactor , preference is given to pellets of a diameter of from 1 - 10 mm . the process is preferably conducted at at least 200 ° c ., more preferably at least 300 ° c ., and especially at least 350 ° c ., and preferably at most 600 ° c ., more preferably at most 550 ° c ., and especially at most 520 ° c . the process is preferably conducted at at least 0 . 5 bar , more preferably at least 2 bar , and especially at least 4 bar , and preferably at most 30 bar , more preferably at most 10 bar , and especially at most 7 bar . since silanes of the general formula ( 3 ) in which e has the value of 1 or 2 also promote reactions between silanes of the general formulae ( 2 ) and ( 3 ) in which e in the general formula ( 3 ) has a value of 0 , preference is given , in the case of such reactions , to adding silane of the general formula ( 3 ) in which e has the value of 1 or 2 . silanes of the general formula ( 3 ) in which e has the value of 1 or 2 therefore have cocatalytic action . the proportion of silane of the general formula ( 3 ) in which e has the value of 1 or 2 in the mixture of silanes of the general formulae ( 2 ) and ( 3 ) is preferably at least 0 . 5 % by weight , more preferably at least 5 % by weight , and especially at least 10 % by weight . the silanes of the general formula ( 3 ) in which e has the value of 1 or 2 that are used may also be used in the form of mixtures , for example in the form of distillate fractions in which , for example , ch 3 hsicl 2 , ( ch 3 ) 2 hsicl and hsicl 3 are present . the alumina catalyst is preferably prepared by treating alumina containing the metal oxides with hydrogen chloride , preferably at least 100 ° c ., more preferably at least 180 ° c ., and most preferably at most 250 ° c . subsequently , the alumina catalyst thus prepared is dried in the hot gas stream , preferably under reduced pressure , or with trimethylchlorosilane . all the above symbols in the above formulae are each defined independently of one another . in all the formulae , the silicon atom is tetravalent . in the examples and comparative examples which follow , unless stated otherwise in each case , all the amounts and percentages stated are based on weight and all the reactions are conducted at a pressure of 1 bar ( abs .). the examples which follow are based on a continuously operated glass fluidized bed reactor heated electrically to 500 ° c ., having diameter 30 mm and length 450 mm , with an upstream reactant evaporator in the case of operation without elevated pressure . the gas distributor used was a glass frit . the fluidized material used was 100 ml ( 46 g ) of a screen fraction of 50 - 180 μm gamma - alumina with 1 % by weight of mg as oxide , having a bet surface area of 276 m 2 / g and an hg pore volume 0 . 89 cm 3 / g , in which 4 . 5 % by weight of aluminum chloride had been formed from the alumina beforehand by treatment in a hydrogen chloride stream . the products were analyzed by means of gc ( calibrated for % by mass ). here , the space - time yields of m2 silane in the reactions of m1 + m3 = 1 : 1 mol from de 102008043331 ( not in accordance with the invention , mgo - containing catalyst at 300 ° c . ; 6 . 5 bar ( abs .)) were compared with the yields in the fluidized bed ( in accordance with the invention , with similar mgo - containing catalyst ; 1 bar , 500 ° c . ): the catalyst density was assumed to be equal . the cocatalytic action of a silane of the general formula ( 3 ) having si - bonded hydrogen is maintained in the process of the invention . under the same conditions , m3 is reacted with sicl 4 : not in accordance with the invention in a tubular reactor at 6 . 5 bar ( abs . ); and at 300 ° c . and 500 ° c ., 1 bar in accordance with the invention in a fluidized bed :	2
fig1 a , 1b and 1c show a semiconductor device assembly 10 . generally , as disclosed in the aforementioned , commonly - owned , copending u . s . patent application ser . no . 380 , 174 , the semiconductor device assembly 10 includes an upper , segmented plastic film layer 14 ( formed of segments 14a , 14b , 14c and 14d ), a lower plastic film layer 16 , metallic leads 18 sandwiched between the two plastic layers 14 and 16 , a metallic ( preferably copper ) die attach pad 20 supported between the two plastic layers 14 and 16 , a semiconductor device 22 mounted on the die attach pad 20 and bond leads 24 connecting the semiconductor device 22 to the leads 18 . as disclosed in the aforementioned u . s . patent application ser . no . 115 , 228 , in lieu of employing bond wires 24 , conductive bumps may be employed to provide a conductive path from the device 22 to the leads 18 in a tape automated bonding ( tab ) process . more particularly , the semiconductor device assembly 10 is formed as follows . the upper plastic layer 14 does not form a continuous surface , but rather is segmented to include an inner ring portion 14a , an intermediate ring portion 14b disposed outside of the inner ring portion , an outer ring portion 14c disposed outside of the intermediate ring portion and an exterior ring portion 14d disposed outside of the outer ring portion . the upper plastic layer 14 is preferably formed of kapton , and forms a thin , insulating supportive structure for the leads 18 . in a region between the inner and intermediate ring portions 14a and 14b , respectively , &# 34 ; inner &# 34 ; portions of the leads 18 are very closely spaced . in a region between the intermediate and exterior ring portions 14b and 14d , respectively , &# 34 ; outer &# 34 ; portions of the leads 18 are more spread out . the inside periphery of the inner ring portion 14a supports the outside periphery of the die attach pad 20 , and the outside periphery of the inner ring portion 14a supports the innermost ends of the leads 18 , in essence forming a &# 34 ; bridge &# 34 ; between the die attach pad and the leads . a rubber - like or plastic - like ring (&# 34 ; body frame &# 34 ;) 26 is disposed atop the leads 18 between the intermediate ring portion 14b and the outer ring portion 14c . the body frame 26 is preferably formed of ryton , and is joined to the leads 18 by an adhesive , such as a b - stage adhesive such as rt - 4b ( trademark of rjr polymers ). as shown , a layer - like quantity of silicone gel 28 , such as dow corning q1 - 4939 , having a 1 to 10 mixing ratio of curing agent to base , encapsulates the leads 24 . the quantity of silicone gel acts as a moisture barrier and a stress relief for the leads 24 during assembly of the semiconductor device assembly , and further prevents an ultimate encapsulation epoxy ( not shown ) disposed over the semiconductor device in an area defined by the body frame from contacting the semiconductor die . surface tension between the silicone gel and the leads 24 keeps the silicone gel in place around the leads during assembly of the semiconductor device assembly . the lower plastic layer 16 covers the bottom of the die attach pad 20 , and generally over the entire area described by the outer ring portion 14c , on the opposite side of the leads 18 and die attach pad 20 . the lower plastic layer 16 is preferably formed of kapton . as disclosed in the aforementioned u . s . patent application ser . no . 380 , 174 , a surrogate lead frame ( edge ring ) 12 is provided for handling the semiconductor device assembly during manufacture thereof , and shorts the outer ends of the leads 18 to support the leads and to facilitate electroplating . further , the semiconductor device assembly is encapsulated with epoxy extending over the semiconductor device 22 , bond leads 24 ( including the silicone gel layer 28 ) and inner and intermediate ring portions 14a and 14b , respectively , up to the ryton ring 26 . further , after completion of the manufacturing process the semiconductor device assembly is excised from the lead frame 12 and exterior ring portion 14d , neither of which properly form any part of the ultimate semiconductor device assembly 10 . the ryton ring 26 also prevents the intermediate kapton ring portion 14b from &# 34 ; wicking &# 34 ; moisture into the semiconductor device assembly . four corner sections ( regions ) 30 of the intermediate ring portion 14b are enlarged in area , each extending inwardly toward the inner ring portion 14a and forming a square kapton &# 34 ; pad &# 34 ;. further , at each of the four corners of the inner ring portion , a first kapton &# 34 ; bridge &# 34 ; 32 is formed connecting the inner ring portion 14a to the intermediate ring portion 14b at a pad 30 . further , at each of the four corners of the intermediate ring portion 14b , a second kapton bridge 34 is formed connecting the intermediate ring portion 14b to the outer ring portion 14c . further , at each of the four corners of the outer ring portion 14c , a third kapton bridge 36 is formed connecting the outer ring portion 14c to the exterior ring portion 14d . ultimately , the second and third kapton bridges 34 and 36 may be excised from the semiconductor device assembly , as is illustrated in fig1 a . with particular attention to fig1 c , two cornermost leads 18 ( as shown in fig1 c ) radiate ( extend ) outwardly from each of the four corners of the die 22 ( as attached by corresponding bond leads 24 , passing underneath the four corner regions 30 ( one corner region 30 illustrated in fig1 c , 2a and 3a ). these two cornermost leads 18 would typically carry power to the semiconductor device 22 , and the pattern of two corner leads 18 carrying power to the device is repeated four times , once at each corner of the semiconductor device assembly , since power levels typically exceed signal levels for semiconductor devices . it should be noted that the pair of power leads do not have to be adjacent , because the pads ( 30 ) are insulating . there may be other , non - power leads passing between the pair of power leads . fig2 a and 2b shows an embodiment of the internal capacitor arrangement for semiconductor device assembly of the present invention . as discussed with reference to fig1 a , 1b and 1c , the semiconductor device assembly includes an upper , segmented plastic film layer 14 ( including portions 14a , 14b . 14c and 14d ), a lower plastic film layer 16 , metallic leads 18 sandwiched between the two plastic layers 14 and 16 , a metallic die attach pad 20 supported between the two plastic layers 14 and 16 , a semiconductor device 22 mounted atop the die attach pad 20 and bond leads 24 connecting the semiconductor device 22 to the leads 18 . as further discussed with reference to fig1 a , 1b and 1c , the upper plastic layer 14 does not form a continuous surface , but rather is segmented to include an inner ring portion 14a , an intermediate ring portion 14b disposed outside of the inner ring portion and an outer ring portion 14c disposed outside of the intermediate ring portion . the upper plastic layer 14 is preferably formed of kapton . the inside periphery of the inner ring portion 14a supports the outside periphery of the die attach pad 20 , and the outside periphery of the inner ring portion 14a supports the innermost ends of the leads 18 . a rubber - like or plastic - like ring 26 , preferably formed of ryton , is disposed atop the leads 18 between the intermediate ring portion 14b and the outer ring portion 14c . a layer - like quantity of silicone gel 28 encapsulates the leads 24 , and the semiconductor device assembly is eventually encapsulated with &# 34 ; glop - top &# 34 ; epoxy . of the above - described elements of the semiconductor device assembly , only the intermediate ring portion 14b , some of the leads 18 , and the kapton pad 30 are illustrated in fig2 a and 2b . further , the &# 34 ; bridges &# 34 ; 32 and 34 are illustrated . directing attention now to the kapton pad 30 , four pads 30 ( one pad illustrated ) are disposed in the semiconductor device assembly just inside the four interior corners of the body frame ( ryton ring ) 26 . a pair of ( two ) leads 18 pass directly underneath each pad 30 . these two leads 18 carry power ( typically vdd and vss ) to the semiconductor device 22 . ( the remaining intermediate leads 18 , illustrated in fig1 a , which may number in the hundreds , carry signals to and from the semiconductor device ). for each of the four pads in the semiconductor device assembly , a pair of power leads pass directly underneath a corresponding pad . each pad 30 is provided with four cutouts 30 . 1 , 30 . 2 , 30 . 3 and 30 . 4 , which are arranged as follows . the cutout 30 . 1 extends into the pad 30 from the outside edge of the intermediate ring portion 14b , from one side of the bridge 34 . the cutout 30 . 2 extends into the pad 30 from the outside edge of the intermediate ring portion 14b , from an opposite side of the bridge 34 . the cutout 30 . 3 extends into the pad 30 from an inside edge of the intermediate ring portion 14b , from one side of the bridge 32 . the cutout 30 . 4 extends into the pad 30 from an inside edge of the intermediate ring portion 14b , from an opposite side of the bridge 32 . the cutouts 30 . 1 and 30 . 4 are aligned along the extent of one of the pair of power leads 18 , and the cutouts 30 . 2 and 30 . 3 are aligned along the extent of another of the pair of power leads 18 . a capacitor 40 is disposed atop the pad 30 , and has a body portion and two conductive legs 42 . the capacitor 40 is a readily available &# 34 ; chip &# 34 ; capacitor . the capacitor 40 is sized and oriented so that the each of the conductive legs are aligned with one of the pair of power leads 18 . as best viewed in fig2 a , each of the conductive legs 42 is spaced from a corresponding power lead 18 by the thickness of the kapton pad 30 . in order to effect a connection between a power lead 18 and a respective conductive leg 42 , the void formed by the cutouts aligned with the power lead is filled with conductive epoxy 44 . alternatively , the conductive leg 42 is connected to the respective power lead by soldering or spot welding . as mentioned hereinbefore , the capacitor 40 is a readily - available chip capacitor . preferably , the capacitor has a low inductance characteristic . an inportant advantage of the internal capacitor arrangement of the present invention is that four capacitors can be arranged symmetrically about the semiconductor device , and that the capacitors are well protected within the semiconductor device assembly package . the invention also has utility in connection with bridging multiple semiconductor devices within a single package . fig3 a and 3b show an alternate embodiment of the internal capacitor arrangement for semiconductor chip assembly of the present invention . this embodiment differs from the previously - discussed embodiment ( of fig2 a and 2b ) primarily with respect to the shape and configuration of the cutouts in the pad 30 . ultimately , the arrangement of the capacitor 40 is the same as that previously discussed in that the two conductive legs 42 are connected to the pair of power leads 18 , such as by conductive epoxy filling voids left by the cutouts in the pad 30 . again , it is anticipated that four capacitors will be arranged within the semiconductor device assembly , each capacitor residing atop a pad underneath which passes two leads powering the semiconductor device . each pad 30 is provided with a plurality of cutouts 30 . 11 , 30 . 12 , 30 . 13 , 30 . 14 , 30 . 15 and 30 . 16 , which are arranged as follows . the cutouts 30 . 11 , 30 . 12 and 30 . 13 are simply holes disposed in the pad 30 along the extent of one of the pair of power leads 18 . the cutouts 30 . 14 , 40 . 15 and 30 . 16 are simply holes disposed in the pad 30 along the extent of another of the pair of power leads 18 . it should be understood that the capacitor ( 40 ) is any suitable edge - contact type chip capacitor . typically , the legs ( 42 ) are simply conductive regions disposed along two opposing edges of the capacitor , and do not protrude as significantly as illustrated . a generally flat , edge - contact chip capacitor is suitable . the important feature is that the &# 34 ; legs &# 34 ; ( conductive regions ) of the capacitor line up with the cutouts ( e . g ., 30 . 1 - 30 . 4 or 30 . 11 - 30 . 16 ) for making contact with a pair of leads ( 18 ).	8
when the bit patterned storage media is used in a data storage device , it is necessary to detect and control the relative position of a read and / or write transducer , e . g ., a recording head , with respect to the islands on the media . in one aspect , this invention provides a method and apparatus for providing a position signal that can be used for timing recovery in a data storage device including a bit patterned media . a non - magnetic sensor can be used to sense the presence of islands in the media . fig1 is a schematic representation of portions of a data storage device 10 including a slider 12 and an associated data storage media 14 . in this example , the data storage media is a patterned media including a plurality of islands 16 of magnetic material separated by trenches 18 , which may be filled with non - magnetic material . a slider or carrier is positioned adjacent to a surface of the storage media in accordance with known techniques , and includes a write head 20 , a read head 22 , and a bit pattern sensor 24 . the write head includes a write transducer 26 that applies a magnetic field to the storage media to control the direction of magnetization of the islands . the read head includes a sensor 28 , such as a magnetoresistive ( mr ) element , tunneling magnetoresistive ( tmr ) element , or giant magnetoresistive ( gmr ) element , which produces an analog voltage signal in response to magnetic fields produced by the magnetized islands . the bit pattern sensor 24 produces a signal that contains information about the relative locations of the bit pattern sensor and islands on the media . an arm 30 can be used to position the slider with respect to the media . the arm can be controlled in accordance with known servo techniques . in normal operation , the slider flies over a track ( or a pair of sub - tracks if staggered ) and the tracks include a plurality of bit islands separated by trenches . the write head passes close enough to the islands to magnetize the whole bit island to the desired polarization ( up or down , for example ) depending on the information bit being written . however the write head field does not penetrate the trenches well and no information can be written in the trenches . in effect the trenches act as stable domain - wall boundaries between neighboring bits . the read and write heads are connected to a control circuit 32 that includes a write channel 34 for delivering voltage or current write pulses to the write head and a read channel 36 for processing signals produced by the read head . a timing recovery circuit 38 uses the signals from the bit pattern sensor to provide a control signal that can be used to adjust the timing of the write pulses . the control circuit can contain other elements that are not specifically related to this description , and are therefore not shown . the write channel can communicate with other components in the control circuit and / or with a host device on a bus 40 . the read channel can communicate with other components in the control circuit and / or with a host device on a bus 42 . fig2 is a schematic plan view of a bit patterned media 50 . the media includes a plurality of islands 52 of magnetic material separated by trenches 54 . in this example , the islands are arranged in linear arrays to form data tracks 56 . in other examples , the islands could be arranged in a staggered array , with the data tracks being formed by two adjacent sub - tracks . fig3 is a cross - sectional view of the bit patterned media of fig2 . the magnetic islands are arranged in a recording layer 60 that is supported by a substrate 62 . other layers , such as a heat sink layer 64 may also be included . to form a planarized media , a non - magnetic dielectric material 66 may be positioned between the islands . in an unplanarized media , the islands can be spaced apart without any solid material in the spaces between the islands . a bit pattern sensor 68 is positioned adjacent to the track . in one aspect , this invention uses a non - magnetic bit pattern sensor 68 to sense the bit island locations . a non - magnetic sensor can use physical properties of the bit patterned media to produce a signal that is related to the relative position of the sensor and bit islands on the media . by using a non - magnetic sensor , interference with the magnetic fields produced by the write head or sensed by the read head , is avoided . in one example used for simulation purposes , the islands were assumed to have a square cross - sectional shape in a plane parallel to or coincident with the surface of the media , with each bit island being in the form of a pillar having a 24 nm by 24 nm square cross - sectional shape . in this example , the islands are separated by a distance of 24 nm . the islands can be a magnetic material , and dielectric material can be for example sio 2 . it should be understood that the islands may have other cross - sectional shapes and the shapes may not be uniform . in one example , the bit pattern sensor includes an optical transducer to direct light onto the media and an optical detector to detect light reflected from the media to produce a position signal that can be processed and used to control the relative position of a read and / or write transducer with respect to the islands on the media . since the bit islands have a different coefficient of reflectivity from the trenches , or dielectric material in the trenches , light reflected from the surface of the media can be used to track the bit islands and synchronize the head to write bits at those locations . fig4 is a block diagram of a timing recovery circuit 70 . the timing circuit includes a front end including an input 72 to a channel 74 , and a low pass filter 76 . the signal produced by a sensor is a signal a n that is transmitted through the channel , resulting in a received signal r ( τ ). the received signal is filtered by the low pass filter to produce filtered signal s ( τ ). the filtered signal is then sampled as illustrated by a sampling switch 78 to produce a sampled signal y n on line 80 . the sampled signal is processed by an equalizer 82 to produce an equalized signal z n on line 84 . the equalized signal is then detected in a detector 86 to produce an output signal . a timing error detector 88 uses the equalized signal and the output signal to produce an error signal on line 90 . the error signal is filtered by a loop filter 92 and the output of the loop filter is used to control the frequency of a voltage controlled oscillator 94 . the voltage controlled oscillator then controls the sampling times that are used to take samples of the filtered signal s ( τ ). thus it can be seen that for timing detection , a pattern sensor can be used to produce a signal that is sampled to produce a plurality of samples . timing recovery architectures include a timing error detector that processes the received samples to produce a quantity that is a measure of the timing phase error . this quantity is further passed through a loop filter to produce a correction signal that is used to control the sampling timing , for example by driving a sampler through a voltage controlled oscillator ( vco ). the detected bits are used by the timing recovery algorithm with the assumption that they are error free . fig5 is a schematic representation of an optical tracking system 100 for use with a bit patterned storage media . the system includes a light source 102 that directs light 104 through a semi - transparent mirror 106 to a near field optical transducer 108 . the near field optical transducer 108 concentrates the light into a small spot 110 on the surface 112 of the bit patterned storage media 114 . a portion 116 of the incident light is reflected back toward the mirror and reflected by the mirror to a detector 118 . the detector produces an error signal 120 that can then be processed by a servo system 122 to control the position of the recording head . fig6 is a schematic representation of a near field optical transducer 108 positioned adjacent to a surface 112 of a bit patterned storage media 114 , including a recording layer 124 positioned adjacent to an electrically conductive heat sink layer 126 , which is positioned adjacent to a substrate 128 . in this example , the near field optical transducer 108 includes an objective lens 130 , a solid hemispherical lens 132 and a metallic pin 134 . the near field optical transducer condenses and delivers the light to the surface of bit patterned media . a radially polarized beam of light 136 is brought to focus onto the center of the hemispherical lens by the objective lens , and illuminates the metallic pin , which may be , for example gold . the end of the metallic pin can be positioned about 10 nm from the surface of the storage medium . in one example , the gold pin has a 12 nm pointed tip and its dimension is optimized for maximum optical efficiency . the storage media includes square granular islands , separated by a dielectric material such as sio 2 . each granule has size 24 nm by 24 nm in the recording film plane . the separation between granules is also 24 nm . fig7 is an enlarged plan view of a portion 140 of a surface 142 of a bit patterned storage media 144 , including islands 146 , 148 , 150 , 152 and 154 . the numbers on and around island 148 represent approximate locations of a center of an optical spot . in the example of fig5 the optical spot 156 is centered at the lower and right corner of the central bit ( i . e ., position 1 ). the incident light spot is reflected and the reflected beam can be monitored while the optical spot is placed at different positions , as shown in fig7 . a quadrant detector can be used to detect the reflected intensity . fig8 is a schematic representation of a quadrant detector 158 . the quadrant detector detects light in four quadrants numbered 1 , 2 , 3 and 4 . from the four quadrants 1 , 2 , 3 and 4 , the detector produces signals s 1 , s 2 , s 3 and s 4 , respectively . signals s 1 , s 2 , s 3 and s 4 can be combined to produce various error signals . for example , a differential phase detection ( dpd ) error signal can be defined as : [( s 2 + s 4 )−( s 1 + s 3 )]. for comparison purposes , the dpd signal can be normalized by the total intensity ( s 1 + s 2 + s 3 + s 4 ) to produce a normalized dpd signal sdpd : it was found that the normalized dpd signal is only about 10 − 5 . the signal reverses sign between positions 3 and 4 . fig9 is a graph of a push - pull error signal with respect to the position of an optical spot on an island of the media . fig9 shows the push - pull error signal when the optical spot scans from position 5 to 2 and from position 1 to 3 . it is seen that the push - pull error signal is 1 . 5 × 10 − 3 . fig9 shows the push - pull error signal as the optical spot scans across the middle of a bit , from position 5 to position 2 , or scans along the edge of a bit , from position 1 to position 3 . this signal may be used for a servo , because it is a differential signal and the noise level is also low . however , this signal is zero when the optical spot is in the middle between two rows of bits . fig1 is a graph of an edge detection error signal with respect to the position of an optical spot on an island of the media . fig1 shows the push - pull error signal when the optical spot scans from position 5 to 2 and from position 1 to 3 . fig1 shows the edge detection signal as the optical spot scans across the middle of a bit , from position 5 to position 2 , or scans along the edge of a bit , from position 1 to position 3 . it is evident that the edge detection signal has the same magnitude as the push - pull signal but it behaves differently from the push - pull signal . it may be used to pinpoint the spot position on the bit . the reflection also changes as the optical spot moves . the amount of change is about 0 . 8 % since it is a sum signal , and the noise level is high . in another implementation , the optical sensor need not have the resolution of an individual bit on the media . for example , the sensor could sense light reflected from a plurality of n bit islands , and the write clock can be multiplied to account for sensing of multiple bit islands . if the phase of the signal resulting from light reflected from n bit islands is accurate enough , then there is no need to resolve each bit island with the optical sensor . as an example , if one of every 10 bits is missing , or if every 10 bit islands is shifted by half a bit , then a sensor that detects light reflected from at least 10 bit islands can be used . while the invention has been described in terms of several examples , it will be apparent that various changes can be made to the described examples without departing from the scope of the invention as set forth in the following claims . the implementation described above and other implementations are within the scope of the following claims .	6
as is well - known , flash memory card arrays and media are organized in erase units , including full and transfer erase units . such erase units are described in detail below . as part of a clean - up operation , the full and transfer erase units cooperate to ensure the removal of all valid data units from full erase unit to corresponding memory locations in transfer erase unit , prior to erasure of full erase unit . clean - up is performed when predetermined conditions are met . for example , if there are no bad blocks , clean - up begins when there are only two free blocks available , beyond any free blocks required to account for flash translation layer structure blocks . if there are bad blocks , depending on the number of bad blocks , cleanup is undertaken much earlier , before the number of free blocks diminishes below a threshold which is a function of no less than twice the number of bad blocks and twice the number of flash translation structure blocks , plus a constant , which is preferably two . as is known , an erase unit includes an erase unit header ; a block allocation map ( bam ); a plurality of bam indications of the status of particular blocks in full erase unit as valid , invalid , or free ; and a plurality of memory locations for data storage in sectors as will be described in detail below in the text accompanying fig1 . valid blocks of a full erase unit are moved to corresponding free memory locations in a transfer unit . thus , memory units of the transfer erase unit which were formerly designated &# 34 ; free &# 34 ; are now redesignated as &# 34 ; valid ,&# 34 ; by the movement of the associated data in full erase unit to corresponding memory locations in transfer erase unit . once all valid blocks of data in a full erase unit have been moved to corresponding locations in a transfer unit , the full erase unit is erased . next , the erased full erase unit is redesignated as a new transfer unit . additionally , the flash translation layer structures and tables are updated to reflect new address locations for information which has been relocated from the full erase unit to the transfer erase unit . fig1 is a detailed map or diagram of a typical erase unit 25 including an erase unit header 25a and a block allocation map 25b , according to the prior art . in particular , fig1 shows a typical sector organization of erase unit 25 . erase unit 25 includes a plurality of sectors . 25 ( 1 )- 25 ( n ), which each may be 512 byte in size . erase unit 25 further includes a distribution of block allocation map 25b over several 512 byte sectors . as shown in fig1 erase unit header is located in first 512 byte sector 25 ( 1 ). block allocation map 25b is located in both first and second 512 byte sectors 25 ( 1 ) and 25 ( 2 ). erase unit header 25a includes a count of the number of erase units in a block of memory subject to memory management . erase unit header 25a further includes an indication of the size of the particular erase unit . additionally , erase unit header 25a includes an indication of the size of the sectors in the erase unit . fig2 is a block diagram showing the relationship between an operating system file management system 25 and a flash medium 27 in terms of a flash translation layer 26 , using first and second file indication maps 25 &# 39 ; and 31 , respectively held in the operating system of file manag 25 and in flash translation layer 26 . a well - known flash translation layer is disclosed to interface between flash memory card erase blocks and the file system used by a pc operating system . this is described in u . s . pat . no . 5 , 404 , 485 issued in 1995 , which is hereby incorporated in its entirety by reference and made a part hereof . the ftl connects flash memory card 27 to file management system 25 used by operating system 503 ( fig4 ) of personal computing system 500 ( fig4 ). according to an embodiment of the present invention , non - tabular , distributed indications or pointers are used to associate files with sectors in flash memory . in operation , when the operating system reads or writes to or from flash memory medium 27 , flash translation layer 26 translates the addresses of flash memory medium 27 to addresses used by the operating system file management system 25 . thus , a particular location of file indication map 25 &# 39 ; contains a reference to a corresponding location in file indication map 31 , which in turn can refer to one or more locations in flash memory medium 27 . thus , when the key generated is stored by operating system 503 ( fig4 ) on flash memory card 27 , the operating system directs storage to a location in file indication map . the actual storage will however be directed to the locations on flash memory card which are established in virtual file indication map 31 , according to the reference linkage provided by file indication map 25 &# 39 ;. thus , as per the former example , ultimate storage of the key would be to one or more flash memory card locations . cleanup is undertaken responsive to a determination as to whether there are any bad blocks . if not , the threshold , freethold , is set equal to a value of two ( 2 ). however , if there are bad blocks , the number of bad blocks is determined , and the threshold at which cleanup is to be undertaken equals the value of two ( 2 ) plus twice the number of bad blocks , plus twice the number of flash translation structure blocks . in other words , if the number of free blocks left available in an erase unit is less than the indicated threshold , then cleanup is undertaken . with no bad blocks , only two free blocks need to be available , and cleanup can be delayed until only two free blocks are left . two blocks are required as a minimum , because one block needs to be reserved for the virtual map page and one needs to be reserved for data transferred to the transfer erase unit . however , if there are bad blocks present within the particular erase unit , then cleanup must begin much earlier , i . e ., at least two free blocks earlier for each bad block . thus , for one bad block , the threshold at which cleanup is required occurs when there are four free blocks left within the erase unit . according to the present invention , this number is increased by twice the number of flash translation structure blocks . accordingly , assuming one flash translation structure block and one bad block exists , then cleanup must begin at a threshold of 6 free blocks . the first two are reserved for the data transferred and for the virtual map page . the next two are reserved to accommodate bad blocks . the final two of the six total are required for the flash translation structure block . fig3 is a flow chart of a method according to the present invention , showing redesignation of deleted file memory locations are invalid , permitting an end to any preservation of the deleted file information during erase unit transmittal of valid data to a transfer erase unit . in particular , according to the present invention , a selected flash memory card medium is formatted and an associated file indication map is stored 400 in the flash medium at a particular memory location as well as in operating system memory . next , a particular file is deleted 401 by action of a user acting through the operating system . the file system working with the operating system next changes 402 the file indication map at the operating system and writes the file indication map to the file transfer layer . next , the file transfer layer reads 403 the original fim version from flash memory . then , the file transfer layer compares 404 the versions of the fim it has resident and makes the blocks associated with each deleted file invalid in the block allocation map . this making invalid in the block allocation map of deleted files , means that when blocks are moved to a transfer erase unit during cleanup , the blocks containing deleted files will not be moved . instead , they are left behind to face erasure , when the full or fuller erase unit is in fact erased , after the valid files thereon have been moved to the targeted transfer erase unit . fig4 is a block diagram showing the relationship between a computer system 500 and a flash memory card array and medium 501 in terms of a flash translation layer 502 . computer system 500 includes an operating system 503 which in turn includes a file indication map 504 . flash memory card array and medium 501 includes a file indication map 505 . file indication maps 504 and 505 are related to each other and may at points of time be similar or the same . flash translation layer 502 includes first and second file indication maps respectively 504a and 505a . first file indication map 504a is derived from file indication map 504 , and second file indication map 505a is derivative of file indication map 505 . when a file is deleted by action of operating system 503 , this deletion is reflected in file indication map 504 , and in derivative file indication map 504a . when the deletion is reflected in derivative file indication map 504a , this is reflected in a difference which will be detected in a comparison between respective file indication maps 504a and 505a . as a result of any such difference being detected , a block allocation map is modified to reflect invalidity of the particular file . thus , during cleanup , the deleted file will not be transferred and preserved to live on at another location . instead , the file will be left behind with other invalid files to be erased . a well - known flash translation layer is disclosed to interface between flash memory card erase blocks and the file system used by a pc operating system . this is described in u . s . pat . no . 5 , 404 , 485 issued in 1995 , which is hereby incorporated in its entirety by reference and made a part hereof . fig4 is a block diagram of a computer system 500 and a flash memory card array and medium 501 interfaced with a flash translation layer 502 . computer system 500 includes an operating system 503 which in turn includes a file system 503 &# 39 ; which in turn includes a file indication map 504 . flash memory card array and medium 501 includes flash translation layer structures 501a including block allocation map 501a ( 1 ) and virtual map table 501a ( 2 ). flash memory card array and medium 501 further includes file indication map 505 which is derived , as will be seen , from file indication map 504a . according to the present invention , file indication map 504a in fig4 is written over file indication map 505 , thus replacing former file indication map 505 . according to one embodiment of the present invention , the replacement is made without a comparison between file indication map 504a and file indication map 505 for possible file deletions in file indication map 504a over a version of files indicated in file indication map 505 . according to this embodiment , that determination is made by comparing file indication map 504a with file indication map 505a . according , to another embodiment of the present invention , the replacement is made after a comparison for the indicated purpose between file indication map 504a and fieindication map 505 . fig4 particularly shows the multiplication scheme of a file indication map 504 according to one embodiment of the present invention . originally file system 503 &# 39 ; directs the establishment of a file indication map 504a in flash translation layer 502 . when file system 503 &# 39 ; in fig4 modifies file indication map 504a it reads table 504a , modifies it , and writes it back in modified form in flash translation layer 502 . accordingly , file system 503 &# 39 ; includes a version of file indication map 504 . according to the present invention , flash translation layer 502 stores file indication map 504a at a location in flash memory card array and medium 501 , as map 505 . further , flash translation layer 502 , according to one embodiment of the present invention , stores a copy of file indication map 5o5 in flash translation layer 502 , as file indication map 505a . according to the present invention , file indication maps 504a and 505a are compared to determine whether the files indicated in table 505a and 504a are the same . simply stated , if file system 503 &# 39 ; has modified file indication map 504a by deleting a file in the table which was formerly there , as evidenced by a reference to the file in another version of an old or earlier file indication map , for example either file indication map 505 or file indication map 505a , then the deletion of the file is evidenced by the noted discrepancy , i . e ., the absence of a file reference in file indication map 504a which is made in either file indication map 505 or file indication map 505a . if there is a discrepancy in files referenced in file indication map 504a and either of file indication maps 505 or 505a , then , according to an embodiment of the present invention , block allocation map 501a ( 1 ) is updated to delete the association between the physical location at which the identified deleted file was stored and the virtual address formerly connected with the particular physical location . the block allocation map is a physical to virtual map which associates particular physical sectors of the flash medium with a related virtual address , provided that a relationship exists . if a relationship exists , the sector of the flash memory affected is no longer free , but valid . after a file is deleted , the sector of flash memory referred to in the block allocation map is indicated as other than valid , preventing preservation by transfer out to a transfer unit prior to erase operation . since no copy of the data is transferred out , the sector and its data are completely erased during erase operation . according to another embodiment of the present invention , when there is a file deletion noted by comparison with file indication map 504a , virtual map table 501a ( 2 ) is modified to delete an association established between virtual and logical addresses expressed in the virtual map table , which corresponds to a physical address containing data to be erased without preservation on a transfer erase unit . fig5 is a flow chart of a method according to the present invention in which the flash translation layer receives 600 an updated file indication map sector . according to the method of the present invention , a check is made 601 for updated changes in the updated file indication map sector against the corresponding old file indication map sector . further , a determination is made 602 whether one or more file deletions have occurred . then , according to one embodiment , block allocation map 501a ( 1 ) and virtual map table 501a ( 2 ) are updated on flash memory card array and medium 501 . according to another embodiment , only block allocation map 501a ( 1 ) is updated . finally , the updated file indication map sector is written in flash memory card array and medium 501 . according to one embodiment of the present invention , a copy of the updated file indication map sector is made or stored in flash translation layer separately from file indication map 504a . this provides a status record of a former file indication map for comparison agyainst subsequent modifications of file indication map 504a . according to the present invention , comparisons to determine file deletion are made between file indication map 504a and file indication map 505 or 505a . the comparison between file indication maps 504a and 505a is speedy , because tables in the flash translation layer are being compared without reference to storage of a file indication map 505 in flash memory card array and medium 501 .	6
the present invention is best understood by reference to the detailed figures and description set forth herein . embodiments of the invention are discussed below with reference to the figures . however , those skilled in the art will readily appreciate that the detailed description given herein with respect to these figures is for explanatory purposes as the invention extends beyond these limited embodiments . for example , it should be appreciated that those skilled in the art will , in light of the teachings of the present invention , recognize a multiplicity of alternate and suitable approaches , depending upon the needs of the particular application , to implement the functionality of any given detail described herein , beyond the particular implementation choices in the following embodiments described and shown . that is , there are numerous modifications and variations of the invention that are too numerous to be listed but that all fit within the scope of the invention . also , singular words should be read as plural and vice versa and masculine as feminine and vice versa , where appropriate , and alternative embodiments do not necessarily imply that the two are mutually exclusive . it is to be further understood that the present invention is not limited to the particular methodology , compounds , materials , manufacturing techniques , uses , and applications , described herein , as these may vary . it is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only , and is not intended to limit the scope of the present invention . it must be noted that as used herein and in the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include the plural reference unless the context clearly dictates otherwise . thus , for example , a reference to “ an element ” is a reference to one or more elements and includes equivalents thereof known to those skilled in the art . similarly , for another example , a reference to “ a step ” or “ a means ” is a reference to one or more steps or means and may include sub - steps and subservient means . all conjunctions used are to be understood in the most inclusive sense possible . thus , the word “ or ” should be understood as having the definition of a logical “ or ” rather than that of a logical “ exclusive or ” unless the context clearly necessitates otherwise . structures described herein are to be understood also to refer to functional equivalents of such structures . language that may be construed to express approximation should be so understood unless the context clearly dictates otherwise . unless defined otherwise , all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs . preferred methods , techniques , devices , and materials are described , although any methods , techniques , devices , or materials similar or equivalent to those described herein may be used in the practice or testing of the present invention . structures described herein are to be understood also to refer to functional equivalents of such structures . the present invention will now be described in detail with reference to embodiments thereof as illustrated in the accompanying drawings . from reading the present disclosure , other variations and modifications will be apparent to persons skilled in the art . such variations and modifications may involve equivalent and other features which are already known in the art , and which may be used instead of or in addition to features already described herein . although claims have been formulated in this application to particular combinations of features , it should be understood that the scope of the disclosure of the present invention also includes any novel feature or any novel combination of features disclosed herein either explicitly or implicitly or any generalization thereof , whether or not it relates to the same invention as presently claimed in any claim and whether or not it mitigates any or all of the same technical problems as does the present invention . features which are described in the context of separate embodiments may also be provided in combination in a single embodiment . conversely , various features which are , for brevity , described in the context of a single embodiment , may also be provided separately or in any suitable subcombination . the applicants hereby give notice that new claims may be formulated to such features and / or combinations of such features during the prosecution of the present application or of any further application derived therefrom . as is well known to those skilled in the art many careful considerations and compromises typically must be made when designing for the optimal manufacture of a commercial implementation any system , and in particular , the embodiments of the present invention . a commercial implementation in accordance with the spirit and teachings of the present invention may configured according to the needs of the particular application , whereby any aspect ( s ), feature ( s ), function ( s ), result ( s ), component ( s ), approach ( es ), or step ( s ) of the teachings related to any described embodiment of the present invention may be suitably omitted , included , adapted , mixed and matched , or improved and / or optimized by those skilled in the art , using their average skills and known techniques , to achieve the desired implementation that addresses the needs of the particular application . detailed descriptions of the preferred embodiments are provided herein . it is to be understood , however , that the present invention may be embodied in various forms . therefore , specific details disclosed herein are not to be interpreted as limiting , but rather as a basis for the claims and as a representative basis for teaching one skilled in the art to employ the present invention in virtually any appropriately detailed system , structure or manner . it is to be understood that any exact measurements / dimensions or particular construction materials indicated herein are solely provided as examples of suitable configurations and are not intended to be limiting in any way . depending on the needs of the particular application , those skilled in the art will readily recognize , in light of the following teachings , a multiplicity of suitable alternative implementation details . embodiments of the present invention will be described which provide means and methods for delivering a charged particle beam to arbitrary points in a region controlled by small angle deflection of the charged particle beam . a non - limiting example of an application for deflection and delivery of a charged particle beam includes particle therapy associated with the practice of medicine . a multi - pole electromagnet when disposed with an appropriate excitation may operate to steer a charged particle beam with energy in a typical range of 60 mev to 6 gev , via a sequence of trajectories in order to deliver an ion beam to desired positions located in a transverse surface located at a distance from the electromagnet . the multi - pole electromagnet may be connected to a multiplicity of power amplifiers . the power amplifiers may be connected to opposing coils associated with the multi - pole electromagnet . furthermore , the multiplicity of power amplifiers may be connected to a power supply . as an example associated with particle beam therapy , the control of particle beam position combined with kinetic energy adjustment may operate to control the lateral distribution and range of particles projected into a body . furthermore , modulation of the particle beam intensity may allow a desired volumetric dose distribution to be delivered . the multi - pole electromagnet , via appropriate currents applied to the coils of the electromagnetic , may operate to position a charged particle beam at a location associated with a traverse plane defined in polar coordinates as r and θ . for sinusoidal currents applied to six or more coils as a function of the pole angles , the resulting magnetic field created between the coils may provide a good quality dipole magnetic field which can be rotated to any arbitrary angle . furthermore , the size of associated electromagnets may be reduced , and higher quality beams may be produced as compared to conventional means and methods . in other embodiments of the present invention , methods and means will be described for providing a multi - pole electromagnet with modified tips for improving the quality of the generated magnetic field . the modified tips may be configured with various geometric shapes . non - limiting examples of geometric shapes include circular and elliptical . in other embodiments of the present invention , methods and means will be described for providing a multi - pole electromagnet with modified air gaps for providing greater clearance for a charged particle beam , resulting in less likelihood of sustaining particle beam losses . in other embodiments of the present invention , methods and means will be described for providing magnetic field probes for providing feedback in order to support systems operating with non - linear configurations . fig3 presents an illustration of an example multi - pole deflection apparatus for deflecting a charged particle , in accordance with an embodiment of the present invention . a multi - pole deflection apparatus 300 may operate to deflect a received charged particle via a generated magnetic field . for simplicity , a yoke for magnetic flux return is not shown . multi - pole deflection apparatus 300 includes an electromagnetic portion 302 , an electromagnetic portion 304 , an electromagnetic portion 306 , an electromagnetic portion 308 , an electromagnetic portion 310 , an electromagnetic portion 312 , an electromagnetic portion 314 , an electromagnetic portion 316 , an amplifier 318 , an amplifier 320 , an amplifier 322 , an amplifier 324 and a power supply 326 . as a non - limiting example , power supply 326 may be configured as direct current ( dc ). electromagnetic portions 302 , 304 , 306 , 308 , 310 , 312 , 314 and 316 may operate to generate an associated magnetic field . amplifier 318 , 320 , 322 , 324 may operate to provide amplified power . power supply 326 may operate to provide electrical power . the electromagnetic portions may be configured in a circular fashion about a z - axis 328 . a first node of electromagnetic portion 310 may be connected to a first node of amplifier 318 via a conductor 330 . a second node of electromagnetic portion 310 may be connected to a first node of electromagnetic portion 302 via a conductor 332 . a second node of electromagnetic portion 302 may be connected to a second node of amplifier 318 via a conductor 334 . electromagnetic portion 302 and electromagnetic portion 310 may be configured as physically opposing . electromagnetic portions 302 , 304 , 306 , 308 , 310 , 312 , 314 and 316 may be configured and connected ( not shown ) to amplifiers 320 , 322 and 324 in a similar fashion as described previously with reference to electromagnetic portion 302 , 310 , amplifier 318 and conductors 330 , 332 and 334 . amplifiers 318 , 320 , 322 and 324 may be connected to power supply 326 via a power conduit 336 . a charged particle 338 may initially be moving in the direction of z - axis 328 . after transitioning through electromagnetic portions 302 , 304 , 306 , 308 , 310 , 312 , 314 and 316 and subjected to a dipole magnetic field located in the central channel of multi - pole deflection apparatus 300 , charged particle 338 may be moving in a different trajectory as denoted by a trajectory 340 . the operation of multi - pole deflection apparatus 300 with appropriated electrical currents traversing the coils of electromagnetic portions 302 , 304 , 306 , 308 , 310 , 312 , 314 and 316 may provide a high quality dipole magnetic field . for the number of electromagnetic portions six or greater and a pattern of currents with an associated sinusoidal function of the pole angles , a high quality dipole magnetic field may be created which can be rotated to any angle . the present invention combines the small physical size of the quadrupole structure as illustrated with reference to fig2 and the high quality magnetic field of the dipole pair as illustrated with reference to fig1 . fig4 presents a cross - section illustration of an example sextupole deflection apparatus for deflecting a charged particle , in accordance with an embodiment of the present invention . a sextupole deflection apparatus 400 includes six electromagnetic portions with a sampling denoted as an electromagnetic portion 402 , six coils with a sampling denoted as a coil 404 and a yoke structure 406 . non - limiting examples of materials for constructing yoke structure 406 include iron and steel . the six electromagnetic portions may be arranged in a circle about a central axis 408 . magnetization may be produced by applying electrical currents to electrical coils for opposing electromagnetic portions using three independent power amplifiers ( connections between coils and amplifiers not shown ). a desired dipole magnetic field may be created in the region enclosed by the electromagnetic portions . the created magnetic flux may be returned via yoke structure 406 . fig5 presents a cross - section illustration of an example octupole ] deflection apparatus for deflecting a charged particle , in accordance with an embodiment of the present invention . an octupole deflection apparatus 500 includes eight electromagnetic portions with a sampling denoted as an electromagnetic portion 502 , eight coils with a sampling denoted as a coil 504 and a yoke structure 506 . non - limiting examples of materials for constructing yoke structure 506 include iron and steel . the eight electromagnetic portions may be arranged in a circle about a central axis 508 . magnetization may be produced by applying electrical currents to electrical coils for opposing electromagnetic portions using four independent power amplifiers ( connections between coils and amplifiers not shown ). a desired dipole magnetic field may be created in the region enclosed by the electromagnetic portions . the created magnetic flux may be returned via yoke structure 506 . the dipole magnetic quality increases with the number of electromagnetic portions , but so does the complexity of the apparatus ( e . g . number of power amplifiers required — one for every opposing electromagnetic portion ). common applications for the present invention may be configured with six or eight electromagnetic portions . fig6 presents a geometrical illustration for calculating coil currents for an example n - pole deflection apparatus for deflecting a charged particle , in accordance with an embodiment of the present invention . a deflection apparatus 600 includes n electromagnetic portions with a sampling denoted as an electromagnetic portion 602 , an electromagnetic portion 604 , an electromagnetic portion 606 and an electromagnetic portion 608 . the excitation pattern for the associated coils of the electromagnetic portions for deflection apparatus 600 for steering a charged particle via a high quality dipole field may be explained with reference to fig6 . the electromagnetic portions may be configured in a circle about a z - axis 610 with z - axis 610 projected into the page . furthermore , electromagnetic portions may be configured with respect to an x - axis 612 directed to the left with respect to the page and a y - axis 614 directed vertically upwards with respect to the page . a charged particle ( not shown ) may enter deflection apparatus 600 parallel and in close proximity to z - axis 610 . magnetic poles , denoted as p k , k = 1 to n , associated with n magnetic portions may be arranged in a circular array at angles , denoted as a k , with respect to x - axis 612 . a positive charged particle deflection angle , denoted as an angle 616 , resulting from a uniform dipole field 618 may be generated by coil currents denoted as i k , k = 1 to n / 2 . the zero degrees direction of particle deflection may be taken to be along x - axis 612 . angle 616 may be considered as the direction of deflection relative to zero degrees with respect to x - axis 612 . a deflection for a positive ion with a value of 0 degrees for angle 616 may be associated with magnetic field vectors for uniform dipole field 618 rotated from the arbitrary angle illustrated so that they are pointing from the top of the page to the bottom of the page and positioned in the plane of the page . furthermore , the n magnetic poles p k , k = 1 to n , may be arranged in a circular array with an even value for n . furthermore , the first n / 2 magnetic pole tips may be centered at angles a k , k = 1 to n / 2 , with an increasing positive angle denoted in the clockwise direction . furthermore , corresponding opposing magnetic portions may be positioned at a k + 180 degrees . furthermore , every opposing pole pair may be powered by a single power amplifier whereby coils may be connected in series such that the same electrical current may traverse the coil pairs . furthermore , the operation may be considered similar as in the case of a conventional magnetic dipole deflection apparatus . for purposes of explanation and as a non - limiting example , the magnetic poles and coils may be identical and arranged at regular angles starting from zero degrees , however , any known configuration may be considered . a regular distribution of magnetic poles about z - axis 610 may operate to generate a high quality magnetic field . to generate a particular dipole magnetic field for deflecting a charged particle zero degrees for angle 616 , the exciting currents i k , k = 1 to n / 2 may be represented by equation ( 1 ) as shown below : for equation ( 1 ), i p may represent a particular electrical current determining an amount of deflection to be applied in the direction associated with the magnetic pole . a positive value for the electrical current for i p may be associated with a clockwise flow of electrical current when viewing a magnetic portion from z - axis 610 . a negative value for i p may be associated with a counter - clockwise flow of electrical current when viewing a magnetic portion from z - axis 610 . furthermore , a coil for a pole may be considered as similar and connected in series with a coil 180 degrees opposed , in a fashion similar to a conventional dipole magnet . in order to rotate the dipole magnetic field direction for producing a deflection in another direction θ , the excitation for i k , k = 1 to n / 2 may be represented as equation ( 2 ) as shown below : the variable θ may be associated with any known value . furthermore , the rotation of the magnetic field may be associated with any direction and as a result , the deflection direction may also be associated with any direction . furthermore , the magnitude of the dipole magnetic field may remain constant , independent of θ . fig7 presents an example illustration of traverse plane magnetic field vectors associated with the bore of a multi - pole electromagnetic apparatus , in accordance with an embodiment of the present invention . a multi - pole electromagnetic apparatus 700 includes a multiplicity of electromagnetic tip portion with a sampling denoted as an electromagnetic tip portion 702 and an electromagnetic tip portion 704 . multi - pole electromagnetic apparatus 700 may be oriented with respect to an x - axis 706 , a y - axis 708 with a z - axis 710 projected into the page . the electromagnetic tip portions may be separated by a multiplicity of gaps with a sampling denoted as a gap 712 . for example , gap 712 may be located between electromagnetic tip portion 702 and electromagnetic tip portion 704 . furthermore , the electromagnetic tip portions may be located such as to surround a bore area 714 . a magnetic field may be created by multi - pole electromagnetic apparatus 700 with the resultant magnetic field illustrated by a multiplicity of magnetic field vectors with a sampling denoted as a field vector 716 . magnetic field vectors presented as black arrow heads may be oriented at a traverse plane with respect to multi - pole electromagnetic apparatus 700 . the equal magnitude and direction orientation for the magnetic field vectors illustrates the quality of the dipole magnetic field . for example , the more diversity observed for the magnetic field vectors with respect to magnitude and direction orientation , the less the quality of magnetic field generated . for this example , the calculation for coil current pattern produced a deflection angle of 260 degrees , which illustrates that there may be no constraint that the field direction is aligned with the angular arrangement of the electromagnetic tip portions . the illustration presented by fig7 provides a visual indication of the dipole magnetic field quality for a magnetic field rotated to an arbitrary angle . the associated magnetic field quality may be confirmed quantitatively by evaluating legendre polynomial coefficients for the region where charged particles may travel and by measuring the aberrations introduced into a known beam transverse profile resulting from the beam traversing through multi - pole electromagnetic apparatus 700 . fig8 presents an example illustration of an electromagnetic portion deflecting a beam of charged particles and the orientation of the charged particles with respect to a downstream plane , in accordance with an embodiment of the present invention . the illustration of fig8 includes a charged particle beam 802 , a multi - pole electromagnetic portion 804 and an intersect plane 806 . charged particle beam 802 , multi - pole electromagnetic portion 804 and intersect plane 806 may be orientated with respect to an x - axis 808 , a y - axis 810 and a z - axis 812 . multi - pole electromagnetic portion 804 may operate to receive and deflect charged particle beam 802 . multi - pole electromagnetic portion 804 may be located a distance 814 , denoted as d , from intersect plane 806 and with z - axis 812 traversing through its longitudinal center . typical values for d may be in the range of 1 m to 10 m . charged particle beam 802 may be deflected from z - axis 812 in the plane of the deflection direction by an angle 816 , denoted as α , and intersect plane 806 at a point 818 . typical values for a may be in the range of − 10 degrees to + 10 degrees . point 818 may be located a distance 822 from x - axis 808 , a distance 824 from y - axis 810 and a distance 820 , denoted as r , from z - axis 812 . furthermore , point 818 may be located at an angle 826 , denoted as θ , with respect to x - axis 808 . charged particle beam 802 may be considered as intersecting intersect plane 806 at a polar location as denoted by r and θ . the intersection of charged particle beam 802 with intersect plane 806 at point 818 may also be resolved into x and y coordinates . multi - pole electromagnetic portion 804 may operate to rotate a fixed strength dipole magnetic field to any angle and as a result deflect charged particle beam 802 to any angle . furthermore , multi - pole electromagnetic portion 804 may control the deflection of charged particle beam 802 via parameters r and θ . for multi - pole electromagnetic portion 804 operating sufficiently far from yoke saturation , the relationship between i p and the dipole magnetic field may be considered as linear with r a linear function of i p . thus , maintaining i p constant and incrementing θ transfers the location of point 818 ( i . e . where charged particle beam 802 intersects intersect plane 806 ) in a circle about intersect plane 806 . for any particular set of circumstances , point 818 may lie within a maximum diameter circle . the diameter may be set by d and α . in a non - limiting example , typical values for particle therapy are diameters of 100 cm and less , although some treatments such as the spine require larger fields . this may be achieved by increasing d because a may be constrained by practical magnet design issues . furthermore , the maximum diameter of the circle may be dependant upon a particular configuration and associated circumstances . non - limiting examples of circumstances contributing to the maximum diameter of the circle include particle beam magnetic rigidity , multi - pole electromagnetic portion 804 configuration , power supply and distance of electromagnetic portion from intersect plane 806 . charged particle beam 802 movement may not be dependant upon any particular axis . conversion from coordinates associated with intersect plane 806 defined by cartesian coordinates x , y to polar parameters r , θ may be accomplished via conventional mathematical transformations . for small angles of deflection for α , the i p , θ values for a given x , y position located on intersect plane 806 may be given by equation ( 3 ) and equation ( 4 ) shown below : standard sign conventions may be applied to θ based upon whether point 818 lies within the right or left hand halves of intersect plane 806 . the element c in equation ( 4 ) may represent a proportionality constant . non - limiting examples of parameters for determining the value of c include coil design , size of electromagnetic portion air gap , length of electromagnetic portion and permeability of the magnetic flux for the return yoke . non - limiting examples of methods for determining the value of c include direct measurement or electromagnetic modeling and ray tracing . as a good approximation , a may be expressed in terms of the beam rotation angle θ ( or angle 826 ) and other geometric parameters as given by equation ( 5 ) below : for equation ( 5 ) d ( or distance 814 ) may represent the displacement along z - axis 812 from the center of multi - pole electromagnetic portion 804 to intersect plane 806 and x ( or distance 824 ) may represent the displacement along x - axis 808 . the power amplifiers connected to the coils for supplying power to electromagnetic portions may be of four - quadrant design for supporting a charged particle beam placement at any geometric location of intersect plane 806 . the n / 2 power amplifiers may provide high - current and be supplied via a single dc power supply with associated energy storage capacitors . the inductance of the electromagnetic portion may be considered an energy storage device which exchanges energy with the storage capacitors while maneuvering the charged particle beam . high efficiency may be experienced for a circular motion about z - axis 812 , as the total energy stored in multi - pole electromagnetic portion 804 remains constant with small associated changes in electrical current , resulting in small power amplifier switching losses . dipole magnetic field quality improves with an increased number of poles . furthermore , for most real - world cases , an eight pole electromagnetic portion may be considered adequate for practical and economic considerations . furthermore , a six - pole electromagnetic portion may yield sufficient dipole magnetic field quality for many applications . fig9 presents a cross - section illustration of an example multi - pole deflection apparatus with modified pole tips for improving the quality of the associated dipole magnetic field for deflecting a charged particle , in accordance with an embodiment of the present invention . a multi - pole deflection apparatus 900 has a similar construction as sextupole deflection apparatus 400 ( fig4 ) except the pole tips , with a sampling denoted as a pole tip 902 , may be configured with an associated circular profile in order to improve the quality of the dipole magnetic field . pole tips shaped as shown for an inscribed circle 904 may operate to improve the magnetic field quality at distances removed from a central axis 906 . furthermore , the pole tips shaped for inscribed circle 904 may operate to reduce charged particle beam aberrations at larger angles of deflection . fig1 presents an illustration of an example multi - pole deflection apparatus with modified air gap between poles for providing greater clearance for a charged particle beam as it deflects in the magnetic dipole field , in accordance with an embodiment of the present invention . a multi - pole deflection apparatus 1000 includes a multiplicity of poles ( some not shown ) with a sampling denoted as a pole 1002 and a pole 1004 . pole 1002 and pole 1004 may be oriented with a z - axis 1006 running longitudinally through an air gap 1008 located between pole 1002 and pole 1004 . a charged particle 1014 may enter air gap 1008 at an entry gap 1010 and exit at an exit gap 1012 . a smaller distance between pole 1002 and pole 1004 may be provided at entry gap 1010 than at exit gap 1012 . furthermore , the distance between pole 1002 and pole 1004 may increase as a charged particle progresses from entry gap 1010 to exit gap 1012 . as a result of the magnetic field provided by multi - pole deflection apparatus 1000 , charged particle 1014 may follow a trajectory path 1016 . large deflection angles result in a charged particle beam coming in close proximity to poles . in order to reduce the risk of a charged particle beam coming in contact with a pole and an associated charged particle beam loss , the inscribed diameter for the air gap may be increased along the length of the electromagnetic portion . the associated flaring of the inscribed diameter may be continuous along the full length of the electromagnetic portion or may initiate at some distance along the length of the electromagnetic portion . the resulting deflection for a given set of excitation currents may be reduced by the associated flaring . fig1 presents a cross - section illustration of an example multi - pole deflection apparatus with a non - circular bore , in accordance with an embodiment of the present invention . a multi - pole deflection apparatus 1100 has a similar construction as octupole deflection apparatus 500 ( fig5 ), except with a non - circular bore 1102 . for this example , an elliptical bore has been presented for non - circular bore 1102 , however any known geometrical shape may be applied . an electromagnetic portion with a non - circular bore may operate in a similar manner as described previously for a circular bore ( e . g . fig5 ). for example , for an elliptical bore , a rotating magnetic field with constant i p generates an elliptical path at an intersection plane , rather than a circular path . coil currents may be delivered to the coils not conforming to the sinusoidal pattern described previously . other patterns of coil currents introduce higher order terms into the magnetic field and result in distortion in the shape of the charged particle beam . in some embodiments additionally imposed pattern of currents may be non - sinusoidal or sinusoidal to produce beam shaping . in a non - limiting example an additional superimposed sinusoidal pattern , at twice the spatial frequency of the basic pattern that gives the dipole field , may produce a useful quadrupole field component that gives beam shaping typical of a quadrupole magnet . application of particular patterns of coil currents may be applied in order to introduce deliberate charged particle beam shaping such as , but not limited to , the beam transverse shape to be more like a line than a circle . furthermore , a separate power amplifier may be connected to individual coils , rather than to pairs of opposed coils as described previously , providing further control over charged particle beam shaping . in a non - limiting example , a useful use of this beam shaping capability is to make the quadrupole field component of this multipole magnet one half of a quadrupole doublet . the other member of the doublet would be a conventional quadrupole magnet structure positioned before the multipole magnet in the beam path . this combination may provide focusing in both transverse axes orthogonal to the beam axis , which is the typical function of a quadrupole doublet . the benefit is that the need for a second conventional quadrupole is avoided , and thus cost and space are saved . for many applications , the ability to perform timely magnetic field changes may be required . a beam scanning magnetic apparatus may be considered as a non - limiting example for an application making use of a fast changing magnetic field . furthermore , to support a fast changing magnetic field , the return yoke structure may be constructed from thin laminations in order to minimize losses and field distortions associated with eddy currents . furthermore , as a non - limiting example , the yoke structure maybe constructed of laminated steel , ferrite or any material with relative permeability greater than 1 . furthermore , to support a fast changing magnetic field , the coils may have a relatively small number of turns in order to minimize the inductance . furthermore , to support a fast changing magnetic field , the power amplifiers may support high current capability , typically hundreds of amperes , in order to support the small number of turns in the coils . furthermore , to support a fast changing magnetic field , the power amplifiers may support a wide voltage range , typically up to +/− 800v with currents up to 800 a , in order to allow the inductive load to transition to a new current level . furthermore , to support a fast changing magnetic field , the power amplifiers may support a wide bandwidth , typically dc to a multiplicity of kilohertz in order to minimize the settling time after transitioning to a new current level . fig1 presents a cross - section illustration of an example multi - pole deflection apparatus incorporating a hall effect probe to provide magnet field feedback for monitoring and control , in accordance with an embodiment of the present invention . a multi - pole deflection apparatus 1200 has a similar construction as octupole deflection apparatus 500 ( fig5 ), except with a multiplicity of hall effect probes , with a sampling denoted as a hall effect probe 1202 , configured in a multiplicity of recesses , with a sampling denoted as a recess 1204 . for applications where large magnetic field strengths may be required , assumptions previously described for a magnetic field as a linear function of i p may not hold . the magnetic field as a linear function of i p may also not hold for conditions of significant eddy currents and steel hysteresis . for these types of applications and conditions , hall effect probe 1202 may be configured for accurately measuring magnetic fields . the signal provided by hall effect probe 1202 may be used as a confirmatory function or as a process feedback for closed - loop electromagnetic field control . hall effect probe 1202 may be positioned at the tips of individual poles in order to enable measurement of the individual contributions to the net magnetic field . those skilled in the art will readily recognize , in accordance with the teachings of the present invention , that any of the foregoing steps and / or system modules may be suitably replaced , reordered , removed and additional steps and / or system modules may be inserted depending upon the needs of the particular application , and that the systems of the foregoing embodiments may be implemented using any of a wide variety of suitable processes and system modules , and is not limited to any particular computer hardware , software , middleware , firmware , microcode and the like . for any method steps described in the present application that can be carried out on a computing machine , a typical computer system can , when appropriately configured or designed , serve as a computer system in which those aspects of the invention may be embodied . having fully described at least one embodiment of the present invention , other equivalent or alternative methods of performing electromagnetic deflection of a charged particle beam according to the present invention will be apparent to those skilled in the art . the invention has been described above by way of illustration , and the specific embodiments disclosed are not intended to limit the invention to the particular forms disclosed . for example , the particular implementation of the power amplifiers described with reference to fig3 may vary depending upon the particular application the apparatus is to be applied . the exemplary power amplifiers described in the foregoing were directed to medical implementations ; however , similar techniques may be demonstrated for other applications such as for semiconductor manufacture . implementations of the present invention are contemplated as within the scope of the present invention . the invention is thus to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the following claims . claim elements and steps herein may have been numbered and / or lettered solely as an aid in readability and understanding . any such numbering and lettering in itself is not intended to and should not be taken to indicate the ordering of elements and / or steps in the claims .	6
referring now specifically to the drawings , wherein like numerals indicate like parts throughout , the water purification system of the present invention is generally designated 10 and comprises a cylindrical pressure vessel 12 with a circular support leg 14 designed to provide stable disposition when the system is placed on a level surface such as a countertop . the pressure vessel 12 comprises a top member 16 and a base member 18 which can be adjoined and sealed to provide an interior compartment for housing water purification mediums in concentric disposition . the base member 18 and the support leg 14 are configured to define a storage compartment 19 between the base member 18 and the surface upon which the system 10 rests and as enclosed by the support leg 14 . in a preferred embodiment , as shown in fig1 - 4 , the top member 16 is secured to the base member 18 by threaded engagement , top member 16 has male threads 20 which are capable of secure connection by engagement with female threads 22 disposed on the base member 18 . to seal the connection from leakage through the threaded engagement area , an o - ring 24 is disposed between the top member 16 and the base member 18 at a sealing point such that the pressure inside the pressure vessel 12 forces the o - ring 24 to seal the connection . although it is preferred that the top member 16 and the base member 18 be connected using square threads such as is shown in the drawings , it should be understood that other types of threads or other forms of connection may be used so long as the connection maintains the integrity of the pressure within the pressure vessel 12 . the pressure vessel 12 further comprises interior seals and gussets for positioning the purification mediums and defining flow paths of the water as it passes through the system 10 . a circular base seal 26 and a circular top seal 28 are provided to seal the influent water from bypassing the first purification medium , as shown in fig1 . a circular base gusset 30 and a circular top gusset 32 are provided to position a perforated core cylinder 34 about the core area of the pressure vessel 12 and to secure the perforated core cylinder 34 from lateral or longitudinal movement . the perforated core cylinder 34 has a plurality of perforations 35 and is sealed into position by o - rings 36 . the base member 18 also comprises an inlet 38 , a reject water outlet 40 , and a receiving portal 42 . the inlet 38 is easily connectable to a source of influent potable water from a tap or faucet by tubing ( not shown ). the reject water outlet 40 is equipped with a flow restrictor 44 such as a small capillary tube or a larger diameter tube of a length sufficient to restrict the flow of effluent reject water from the system 10 and to maintain water pressure within the system 10 so that the purification mediums can operate at optimum efficiency . the receiving portal 42 is configured to receive in sealed engagement any of a plurality of center tubes for disposition within the perforated core cylinder 34 . in the embodiment shown in fig1 the center tube in use is an activated carbon 46 filled filter center tube 48 with a top portal 50 . turning now to the purification mediums shown in the preferred embodiment illustrated in fig1 it should be understood that the disposition of the purification mediums in concentric stages eliminates the need for interconnecting tubing , thus eliminating a great deal of complexity from the system 10 . the first purification medium comprises a sediment filter 52 impregnated with carbon . the primary purpose of the sediment filter 52 is to remove chlorine and sediment from the water before it enters the next stage of purification . a preferred type of sediment filter 52 is a batting with carbon powder impregnated within the fiber , but other types of sediment filters 52 may be used . the sediment filter 52 is disposed between a base annular barrier 54 and a top annular barrier 56 each of which are impermeable to water so that there is no leakage of water through the seals formed by the top seal 28 and the top annular barrier 56 and by the base seal 26 and the base annular barrier 54 . the base annular barrier 54 contacts an o - ring 55 disposed between the base annular barrier 54 and the second purification medium , thereby restricting the flow of water from bypassing the second purification medium . in the embodiment shown in fig1 through 4 , the second purification medium comprises a conventional reverse osmosis module 58 . the reverse osmosis module 58 comprises a reverse osmosis membrane which is wound spirally around the perforated core cylinder 34 . typically , a reverse osmosis membrane comprises a three - layer combination wherein one layer is an open netted material , the center layer is the membrane of cellulose acetate , polyamide , or some other suitable membrane material , and the third layer is a material such as sail cloth . the reverse osmosis membrane acts like an envelope which captures the water within the envelope and the water traverses the membrane in a type of molecular traversal separating the water from impurities which are carried out in the reject water which does not traverse the membrane . configured or rolled reverse osmosis membranes are commonly called leafs and can be made to various lengths . in the preferred embodiments of the present invention , a plurality of leafs are wound spirally about the perforated core cylinder 34 , one to three leafs have been found to be ideal depending on the length of the leafs to achieve an acceptable amount of purified water passing through the reverse osmosis stage . it should be understood ; however , that more than three leafs may be used . to achieve the most efficient separation by reverse osmosis , water pressure must be maintained at a level conducive to the process . the flow restrictor 44 through which reject water ( i . e ., water that does not go through the reverse osmosis stage ) passes is instrumental in maintaining the pressure within the system 10 at between 25 and 150 psi when the influent water from the water source is supplied at typical household water pressure . if the discharge flow of reject water was not restricted , but allowed to flow freely out of the pressure vessel 12 , the water pressure in the system 10 would be lost and reverse osmosis could not efficiently occur . in the preferred embodiment shown in fig1 a third purification stage is provided which utilizes the cylindrical filter center tube 48 filled with activated carbon 46 . by directing potable water through the three stages of purification shown in fig1 chlorine , organics , undesirable chemicals , heavy metals , dissolved solids , and particulate solids are removed from the water . because the filter center tube 48 may be removed from the pressure vessel 12 easily , the activated carbon 46 filter is readily replaceable without requiring the user to discard the entire system 10 . additionally , three devices for water purification are housed in one attractive , appliance - shaped apparatus . fig2 illustrates a preferred embodiment of the present invention which utilizes essentially the same three stage purification system as is shown in fig1 except a modified first purification stage is used . instead of the sediment filter described in fig1 an assembly comprising a pre - filter 60 and a bed of activated carbon 62 is used . the bed of activated carbon 62 is disposed in an annular casing 64 and the casing 64 is wound with a fibrous material which serves as the pre - filter 60 . although fig2 shows a space between the inside wall of the pressure vessel 12 and the pre - filter 60 , it should be understood that the pre - filter 60 may occupy most all of the space between the inside wall of the pressure vessel 12 and the casing 64 housing the bed of activated carbon 60 . referring now to fig3 an alternative preferred embodiment of the present invention is shown . the system 10 utilizes the same first two stages of purification as is shown in fig1 namely , the sediment filter 52 and the reverse osmosis module 58 , but the third stage of purification differs . fig3 shows a hollow center tube 66 with a quartz envelope 67 enclosed an ultraviolet tube 68 disposed therein . the use of the ultraviolet tube 68 gives the user an option for disinfecting the water by eliminating bacteria and viruses . as water circulates through the hollow center tube 66 , it is exposed to the radiation from the ultraviolet tube 68 before it is discharged from the system 10 for use . although the embodiment shown in fig3 shows a sediment filter 52 and a reverse osmosis module 58 as the first two mediums , it should be understood that alternative filtration and / or separation mediums may be used as the first two purification stages without departing from the spirit of the present invention . with reference now to fig4 an alternative preferred embodiment is shown in which an additional purification stage is introduced to the system 10 without detracting from the outward attractiveness of the apparatus . a modified center tube 70 is provided which comprises an annular base filter 72 and does not have a top portal . in the absence of the top portal , a bridge plug 73 ( see fig1 - 3 ) is removed thereby altering the flow direction of the water . removal of the bridge plug 73 can be accomplished by striking it with a solid object . the modified center tube 70 then assists to direct the flow of the water leaving the reverse osmosis module 58 towards the base member 18 and through a conduit 74 into the base filter 72 which is disposed within the storage compartment 19 . internal of the base filter 72 is a fibrous mat 76 which serves to disperse the water flow evenly across the face of an activated carbon ring 78 . a second fibrous mat 80 , within the base filter 72 , serves to collect the water percolating through the carbon ring 78 and direct the water to a feeder channel 82 connected to a feeder tube 84 directed into the modified center tube 70 . within the modified center tube 70 is an ultraviolet tube 68 for disinfecting the water passing therethrough . in this embodiment , both filtration and disinfection is accomplished after the water is separated from impurities by traversing the reverse osmosis module 58 . referring now to fig5 a type of twist - lock connection is shown for connecting the perforated core cylinder 34 to either a filter center tube 48 , a hollow center tube 66 , or a modified center tube 70 . each of the center tubes has an ear 86 disposed on the exterior of the center tube , a bevelled lip 88 , and o - rings 90 . ears 86 are disposed and configured to engage a slot 92 and a notch 94 formed in the interior wall of the perforated core cylinder 34 . also formed in the interior wall of the perforated core cylinder 34 is a bevelled annular seat 96 . when one of the interchangeable center tubes is inserted into engagement with the perforated core cylinder 34 , the ear 86 slides up the slot 92 until the bevelled lip 88 engages the bevelled annular seat 94 and then the center tube is rotated to position the ear 86 in locking engagement with the notch 94 . the o - rings 90 serve to seal the connection from leakage . to remove the positioned center tube , the center tube is rotated in an opposite direction to release the ear 86 from the notch 94 so that the center tube can be retracted from the core area of the pressure vessel 12 . the removed center tube may be re - inserted or one of the interchangeable center tubes may be inserted . although a twist - lock connection is shown in fig5 for connecting one of the center tubes to the perforated core cylinder 34 , it should be understood that any other type of detachable connection that seals the connection from the water pressure inside the pressure vessel may be used without departing from the spirit of the invention . the methods for purifying potable water by using the preferred embodiments of the present invention vary according to which embodiment is used . such methods are best understood by following the flow path of the water through each embodiment . in fig1 influent potable water is introduced into the system 10 by connecting a tube or hose ( not shown ) to a water source such as a faucet or tap ( not shown ) and passing that tube or hose through a doorway 100 in the circular support leg 14 for connection with the inlet 38 . the connections for connecting the hose or tube to a faucet or tap and to the inlet 38 may be of a conventional type , and a quick - release pressure connection is preferred . water enters into the pressure vessel 12 through inlet 38 as shown by arrow a . upon entering the pressure vessel 12 , the water fills an entry plenum 102 which is an annular space between the inside wall of the pressure vessel 12 and the sediment filter 52 of the first purification stage . due to the water pressure typically supplied by the water source , water is forced through the sediment filter 52 , as shown at arrows b . in passing through the sediment filter 52 , the water is filtered to remove certain impurities such as chlorine , sediment and the like . as the water exits the sediment filter 52 , it enters into an annular internal plenum 104 which directs the water flow into the reverse osmosis module 58 , as shown at arrows c . water that traverses the reverse osmosis module 58 is separated from impurities ( e . g ., dissolved solids ) in manner that can be characterized as a molecule filter . such traversal of the water in the spirally wound reverse osmosis module 58 is signified by the curved arrows d . the water that does not traverse the reverse osmosis membrane collects in a reject water reservoir 106 where such reject water makes its way into and through the flow restrictor 44 and is discharged ( typically to a drain ) through the reject water outlet 40 , as shown at arrow e . as was explained with regard to the hose or tube connected to the water source , a hose or tube ( not shown ) is connected in conventional fashion to the reject water outlet 40 and is directed through the doorway 100 to a drain or to some other use for the reject water . the water traversing the reverse osmosis module 58 exits through the perforations 35 ( see arrows f ) in the perforated core cylinder 34 into a core area 108 of the pressure vessel 12 . this purified water , having passed through two stages of purification , enters into the filter center tube 48 through top portal 50 ( see arrow g ) and percolates through the activated carbon 46 to a purified water outlet 110 where the water is discharged to the user ( see arrow h ). the purified water passes through the purified water outlet 110 into a hose or tube ( not shown ) connected in a conventional fashion to the outlet 110 . the hose or tube carries the effluent purified water through the doorway 100 to the user for consumption or use . in a similar manner , the water travels through the system 10 in the preferred embodiment illustrated in fig2 except that instead of passing through the sediment filter described in fig1 the potable water entering the system 10 passes through the pre - filter 60 before entering into and percolating through the bed of activated carbon 62 . such pre - filtering is designed to remove impurities that can damage the reverse osmosis membrane . turning now to fig3 water travels inwardly through the concentric first and second purification mediums , as described above , into the core area 108 . the purified water is then directed through top portal 50 into the hollow center tube 66 ( arrow g ) where it is exposed to ultraviolet radiation from the ultraviolet tube 68 . the now disinfected water exits the hollow center tube 66 at the purified water outlet 110 ( arrow h ) for delivery to the user . with reference now to the embodiment of the present invention shown in fig4 the water travels inwardly through the concentric first and second purification mediums , as previously described , and enters the core area 108 where it is directed through conduit 74 ( as shown by arrow i ) into the base filter 72 . the fibrous mat 76 disperses the water evenly over the face of the activated carbon ring 78 . the water percolates through the carbon ring 78 and is collected by the second fibrous mat 80 which delivers the newly filtered water into the feeder channel 82 . the pressure within the system 10 then forces the water within the feeder channel 82 into the feeder tube 84 which communicates with the feeder channel 82 . the water is then directed into the modified center tube 70 where it is exposed to the disinfecting ultraviolet radiation from the ultraviolet tube 68 . the purified water , having also been disinfected , is discharged to the user through the purified water outlet 110 in a manner as previously described . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .	2
referring now to fig1 and 2 , there is shown a hinge 10 in its closed position , having first hinge member 12 and second hinge member 11 . the hinge 10 has holes 14 , 15 for receiving fasteners , for example bolts , to secure the first and second hinge members to a post and gate ( not shown ), respectively . it will also be appreciated that the hinge can be used with a door , with the first hinge member 12 being mountable to the door frame and the second hinge member 11 being mountable to the door . the holes 15 are preferably of elongate form to allow some adjustment of the height of the hinge relative to the gate or door during installation . once the hinge is positioned appropriately , a further fastener can advantageously be attached through hole 16 to prevent movement of the hinge under the weight of the door or gate . the first hinge member 12 has a substantially cylindrical body portion 30 . the second hinge member 11 may rotate about the longitudinal axis of the body portion 30 in order for the hinge to move between the closed and open position . the second hinge member 11 has a pair of collars 21 a , 21 b , one at each end . as best shown in fig4 , collar 21 a acts as a sleeve for end piece 60 , which is engaged with the flattened terminal segment 52 of a first end 55 of a biasing means 50 , via slot 62 . the biasing means 50 of the embodiments shown in the figures is a helical spring . end piece 60 also has a hole ( not shown ) to receive a pin or bolt ( or any other suitable fastener ) 80 . when the hinge is assembled , pin or bolt 80 passes through the hole 81 in collar 21 a into the hole in end piece 60 to secure end piece 60 to collar 21 a . a first end 55 of the helical spring 50 is thus fixed with respect to the end of the second hinge member 11 . the second end 56 of helical spring 50 also has a flattened terminal segment ( not shown ) which fits into a slot ( also not shown ) in a tooth portion 42 of an adjustment member 40 ( fig1 ), which also has a tool - receiving portion 41 . the adjustment member 40 is fixed with respect to the first hinge member 12 by virtue of the engagement of the second face 43 b ( fig2 ) of at least one of the teeth 43 with one of the stops 33 . stops 33 are asymmetric teeth located on the lower surface of a flange 31 which is located on the inner surface of the body portion 30 of first hinge member 12 . since opposite ends 55 , 56 of the helical spring are fixed with respect to respective hinge members 12 , 11 , rotational movement of the hinge members with respect to each other , for example by opening a gate to which the hinge 10 is attached , will tend to create a torsional restoring force to move the hinge 10 back to its original ( i . e . closed ) position . in fig1 and 2 it will be observed that the asymmetric teeth 43 have an inclined face 43 a . when a hex key ( not shown ) of appropriate dimensions is placed in the hexagonal recess 44 of the tool - receiving portion 41 of adjustment member 40 and turned clockwise ( as indicated by the arrows on tool - receiving portion 41 ), the inclined faces 43 a of teeth 43 will slide over the inclined faces 33 a of stops 33 , thereby compressing the spring 50 and increasing the longitudinal and torsional components of the tension as they do so . when the second faces 43 b of teeth 43 pass the ends of the inclined faces 33 a of the stops 33 , the longitudinal component will decompress the spring 50 in the longitudinal direction , but the spring 50 is restrained from decompression in the torsional direction as the teeth 43 bear against the second faces 33 b of the stops 33 . the teeth 43 of the adjustment member 40 thus act as a ratchet means by allowing rotational movement of the adjustment member 40 in one direction only ( in this example , the clockwise direction ). the second faces 33 b , 43 b need not be non - inclined faces as shown in the figures . angled faces could also provide the ratcheting mechanism described above . referring now to the exploded view of fig4 , it will be seen that the tool - receiving and tooth portions 41 , 42 of adjustment member 40 can be formed as two separate parts to form a releasable ratchet means . the portions 41 , 42 are engaged via the placement of boss 72 of tooth portion 42 in the corresponding aperture 71 of tool - receiving portion 41 . in the assembled hinge , the lower surface 73 of tool - receiving portion 41 sits on the upper surface 32 of the flange 31 ( fig3 ), while the teeth 43 of tooth portion 42 bear against the teeth 33 on the lower ( opposite ) surface of flange 31 . the recess 44 has a substantially flat base in which is formed an aperture or bore ( not shown ), the aperture having smaller diameter than the recess 44 and passing through tool - receiving portion 41 . a tool having sufficiently small diameter may then be inserted into the aperture and a compression force applied to the boss 72 of tooth portion 42 . this serves to disengage the teeth 43 from stops 33 , allowing the spring 50 to snap back to its original position . although it is of course highly advantageous for the teeth 43 and stops 33 to be located directly adjacent the tool - receiving portion 41 for efficient transfer of force to the ratchet means , the skilled person will appreciate that other arrangements are possible in which the teeth 43 and stops 33 are located at the end opposite the tool - receiving portion 41 . for example , tooth portion 42 could be in engagement with end portion 60 and the first end 55 of spring 50 . a shaft ( for example , a much more elongate version of the boss 72 ) passing through the centre of spring 50 and in engagement with tool - receiving portion 41 would be used to transmit force to the ratchet means . the second end 56 of spring 50 could be fixed with respect to hinge member 11 by any suitable means , for example by providing a sleeve around tool - receiving portion 41 , the sleeve being adapted to receive the second end 56 . it will be appreciated that many other modifications of the specific embodiments described herein are possible without departing from the scope of the present invention , as defined by the claims appended hereto . for example , the roles of the first and second hinge members may be reversed with suitable rearrangement of the internal components . the terminal segments 52 of the spring 50 need not be transverse to the axis of the cylindrical body portion 30 as shown , but may be aligned longitudinally to fit into recesses in end portion 60 and tooth portion 42 . end portion 60 could also be replaced with a second adjustment member to provide additional scope to adjust the spring tension . the number of teeth 43 on tooth portion 42 is not fixed , and indeed may be increased to provide even finer stepped adjustment of the tension , if so desired .	8
the arrangement of the print hammer striking surfaces and the print magnets 2 thereof is as shown in fig1 . in such a printing device , as is well known in the art , printing data codes for one line to be printed by the above - described print hammers are received from a data source such as a cpu ( central processing unit ) and stored in the above - described plb 11 , as shown in fig2 . during a printing cycle , whenever a type on a type carrier ( not shown ) is moved by one pitch , the plb 11 is scanned so that the code of a type confronting a print hammer is compared with the code of a character to be printed . when the two codes coincide with each other as a result of the comparison , the print hammer of that column is driven to print the character . for convenience in description , the method of scanning the plb 11 will be described with reference to a band printer in which during one main scan , i . e ., whenever a type is moved by one pitch , sub - scan is carried out five times . in a printing device carrying out the sub - scan five times , the columns of print hammers driven in each sub - scan are as listed below : in this connection , 132 columns are provided for one line . in the sub - scan 1 , the plb 11 is scanned in the order of 1st , 6th . . . and 131st columns . each printing data code is outputted by the plb , and the codes of types confronting respectively with the print hammers of the columns are outputted by a type code generator 14 ( hereinafter referred to as &# 34 ; a ccg 14 &# 34 ;). the printing data codes and type codes are subjected to comparison in a comparator 15 . before the comparison is carried out to drive a print hammer , detection is carried out as to whether the print magnets 2 on both sides of the relevant column have been excited or not . this detection method will now be described . in the plb 11 , in addition to a printing data code memory region 111 , a flag memory 112 is provided which stores a logic value &# 34 ; 1 &# 34 ; ( hereinafter referred to as &# 34 ; 1 &# 34 ;) while each print hammer and accordingly each print magnet 2 is being excited and stores a logic value &# 34 ; 0 &# 34 ; ( hereinafter referred to as &# 34 ; 0 &# 34 ;) while it is not driven . accordingly , when the printing data code of each column is received from the data source , &# 34 ; 0 &# 34 ; is written into all of the columns of the flag memory 112 . when the sub - scan 1 is started in the printing cycle , the 1st column print hammer can be driven first . the 3rd column and the - 1st column ( which does not exist and is a phantom column ) are next to the column of the 1st column print magnet 2 . thus , it is detected whether or not these columns &# 39 ; print magnets 2 are being excited . when a memory scan is started in the sub - scan 1 , the top address (- 1st column ) of the sub - scan 1 in a plb address memory 21 is specified by a signal c 1 , c 2 , c 3 indicating the sub - scan number , and a plb counter 12 specifies the - 1st column with the aid of a preset signal d . the output of the plb 11 for this column is ineffective but scans the plb 11 . thereafter , four count - up clock pulses a are outputted by a scan controller 13 . as a result , the content of the plb counter 12 is increased by four counts and the 3rd column is specified . since the 3rd column of the flag memory 112 is &# 34 ; 0 &# 34 ;, a latch 18 is maintained reset , and the output of the latch 18 is &# 34 ; 0 &# 34 ;. thereafter , the scan controller 13 outputs two count - down clock pulses b . as a result , the content of the plb counter 12 is decreased by two counts , and the 1st column is specified . the plb 11 outputs a printing data code for the 1st column , and the printing data code is applied to a comparator 15 . the code of a type confronting with the 1st column print hammer is outputted by the ccg 14 and is applied to the comparator 15 . when the printing data code coincides with the type code , then the output e of the comparator 15 is set to &# 34 ; 1 &# 34 ;. in this case , the outputs of a latch 17 and the latch 18 are &# 34 ; 0 &# 34 ;, that is , the adjacent print magnets 2 are not being excited . therefore , the output of a nand gate 20 is &# 34 ; 1 &# 34 ;. if , when the output of the comparator 15 is &# 34 ; 1 &# 34 ;, a hammer firing signal f is provided , then a nand gate 19 is opened to output a signal hamset . as a result , the 1st column print hammer is driven by a drive circuit and a print magnet ( not shown ). the 6th column print magnet can be excited next . the columns of the print magnets adjacent thereto are the 4th and 8th columns . in order to detect whether or not these adjacent print magnets are excited , three count - up clock pulses a are outputted by the scan controller 13 . as a result , the content of the plb counter 12 is increased by three counts , and the 4th column is specified . in this operation , the latches 17 and 18 are reset by a signal k from the scan controller 13 . because the 4th column of the flag memory 112 is &# 34 ; 0 &# 34 ;, the latch 17 is maintained reset and the output of the latch 17 is &# 34 ; 0 &# 34 ;. thereafter , four count - up clock pulses a are outputted by the scan controller 13 and the content of the plb counter 12 is increased by four counts . hence the 8th column is specified . as the 8th column of the flag memory 112 is &# 34 ; 0 &# 34 ;, the latch 18 is maintained reset . thereafter , two count - down clock pulses b are provided by the scan controller 13 , the content of the plb counter 12 is decreased by two counts , and the 6th column is specified . the printing data code for the 6th column is provided by the plb 11 and is applied to the comparator 15 . the code of a type confronting with the 6th column print hammer is outputted by the ccg 14 , and is applied to the comparator 15 . when the printing data code coincides with the type code , then the output e of the comparator 15 is raised to &# 34 ; 1 &# 34 ;. in this case , the output of the nand gate 20 is &# 34 ; 1 &# 34 ;. therefore , if the output of the comparator 15 is &# 34 ; 1 &# 34 ;, the signal hamset is set to &# 34 ; 0 &# 34 ;, and the 6th column print hammer is driven . similarly , the information in the flag memory 112 of the plb with respect to the - 2nd and + 2nd columns from the column of a print hammer which can be driven in the sub - scan 1 is detected . when the information in the flag memory 112 is &# 34 ; 1 &# 34 ;, the latches 17 and 18 are set . however , when the information in the flag memory 112 is &# 34 ; 0 &# 34 ;, the latches 17 and 18 are maintained reset . the printing data code for the column of the print hammer is applied from the plb 11 to the comparator 15 , where it is compared with the respective type code . when the sub - scan 2 is started after the completion of the sub - scan 1 , the plb counter 12 presets the top address of the sub - scan 2 in the plb address memory 21 and specifies the 0 - th column ( which does not exist and is a phantom column ). the output of the plb 11 for this column is ineffective but scans the plb 11 . thereafter , four count - up clock pulses a are provided by the scan controller 13 and as a result , the content of the plb counter 12 is increased by four counts and the 4th column is specified . since the 4th column of the flag memory 112 is &# 34 ; 0 &# 34 ;, the latch 18 is maintained reset , and the output of the latch 18 is &# 34 ; 0 &# 34 ;. then , two count - down clock pulses b are outputted by the scan controller 13 . consequently the content of the plb counter 12 is decreased by two counts and the 2nd column is specified . a printing data code for the 2nd column is applied from the plb 11 to the comparator 15 . on the other hand , the code of a type confronting the 2nd column print hammer is outputted by the ccg 14 , and it is applied to the comparator 15 . when the two codes are coincident with each other , the output e of the comparator 15 is set to &# 34 ; 1 &# 34 ;. the output of the nand gate 20 is &# 34 ; 1 &# 34 ; and therefore the signal hamset is set to &# 34 ; 0 &# 34 ;. hence , the 2nd column print hammer is driven . thereafter , similarly as in the sequence of the sub - scan 1 , the information in the flag memory 112 of the plb with respect to the - 2nd and + 2nd columns from the column of a print hammer which can be driven in the sub - scan 2 is detected . when the information in the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latches 17 and 18 are set , whereas if the information is &# 34 ; 0 &# 34 ;, then the latches 17 and 18 are maintained reset . thereafter , the printing data code for the column of the print hammer is applied from the plb 11 to the comparator 15 , where it is compared with the type code . when the sub - scans 3 , 4 and 5 are started , the plb counter 12 specifies the 1st , 2nd and 3rd columns with the aid of the plb address memory 21 , respectively . thereafter , as in the above - described sequence , the information in the flag memory 112 with respect to the - 2nd and + 2nd columns from the column of a print hammer which can be driven in each subscan is detected . when the information in the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latches 17 and 18 are set . however , if the information is &# 34 ; 0 &# 34 ;, then the latches 17 and 18 are maintained reset . thereafter , the printing data code for the column of the print hammer from the plb 11 is compared with the respective type code in the comparator 15 . the case where the device according to the invention becomes effective will be described with reference to fig3 . it is assumed that in the sub - scan 5 of the n - th main scan , the 5th column print hammer is driven . in this operation , &# 34 ; 1 &# 34 ; is written into the 5th column of the flag memory 112 . furthermore , it is assumed that at this time none of the 1st , 3rd , 7th and 9th print hammers are driven . in the sub - scan 1 of the ( n + 1 )- th main scan , the 1st print hammer is driven and &# 34 ; 1 &# 34 ; is written into the 1st column of the flag memory 112 . in driving the 7th column print hammer in the subscan 2 of the same main scan , first the 5th column of the flag memory 112 is &# 34 ; 1 &# 34 ;, therefore the latch 17 is set , and the output of the latch 17 is set to &# 34 ; 1 &# 34 ;. next , the 9th column of the flag memory 112 is &# 34 ; 0 &# 34 ;, and therefore the latch 18 is maintained reset . accordingly , the output of the nand gate 20 is &# 34 ; 1 &# 34 ;, and the printing data code for the 7th column from the plb 11 is compared with the type code in the comparator 15 . when the two codes are coincident with each other , the signal hamset is set to &# 34 ; 0 &# 34 ;, and the 7th column print hammer is driven . however , if the printing data code does not coincide with the type code , then the 7th column print hammer is not driven , and the 7th column of the flag memory 112 is maintained at &# 34 ; 0 &# 34 ;. in driving the 3rd column print hammer in the subscan 3 of the same main scan , first the 1st column of the flag memory 112 is &# 34 ; 1 &# 34 ;, and therefore the latch 17 is set , and the output of the latch 17 is set to &# 34 ; 1 &# 34 ;. next , the 5th column of the flag memory 112 is also &# 34 ; 1 &# 34 ;, therefore , the latch 18 is set , and the output of the latch 18 is set to &# 34 ; 1 &# 34 ;. accordingly , the output of the nand gate 20 is &# 34 ; 0 &# 34 ;. thereafter , the printing data code for the 3rd column from the plb 11 is compared with the type data . it is assumed that as a result of the comparison the two data are coincident with each other . in this case , the output of the nand gate 20 is &# 34 ; 0 &# 34 ; as described above , and accordingly the signal hamset is not set to &# 34 ; 0 &# 34 ;. therefore , the 3rd column print hammer is not driven . that is , driving the 3rd column print hammer is postponed until the next coincidence of the data occurs . signals g and h applied from the scan controller 13 to and gates 16 and 16 respectively are timing signals . more specifically , in exciting the print magnet 2 of each column , the timing signals are employed to specify the information in the flag memory with respect to the - 2nd and + 2nd columns adjacent to the each column . this embodiment of the invention has been described with reference to the band printer . in the case of a drum printer , the magnetic interference of the adjacent print magnets 2 ca be prevented according to the invention . in a drum printer , all of the columns are scanned by one scanning operation to perform one memory scanning in one main scan . in this case , the flag bits of the ( n - 2 )- th and ( n - 2 )- th columns are checked before the n - th column print hammer is driven . if the print hammers of the two adjacent columns are driven , driving the n - th column print hammer is inhibited . when the memory scan of each main scan is started , the plb counter 12 specifies the - 1st column ( which does not exist and is a phantom column ). although the output of the plb 11 for this column is ineffective , it carries out the scan . thereafter , four count - up clock pulses are provided by the scan controller 13 , the content of the plb counter 12 is increased by four counts , and the 3rd column is specified . if the 3rd column of the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latch 18 is set , whereas if it is &# 34 ; 0 &# 34 ;, then the latch 18 is maintained reset . thereafter , two count - down clock pulses are produced by the scan controller 13 . as a result , the content of the plb counter 12 is decreased by two counts , and the 1st column is specified . in the case of driving the 1st column print hammer , the latch 17 is maintained reset , and therefore the output of the nand gate 20 is &# 34 ; 1 &# 34 ;. when the printing data code is coincident with the type code for the 1st column , then the 1st column print hammer is driven . then , one count - down clock pulse is provided by the scan controller 13 , the content of the plb counter 12 is decreased by one count , and the 0 - th column ( which does not exist and is a phantom column ) is specified . in this operation , the latches 17 and 18 are reset . the output of the plb 11 for the 0 - th column is ineffective , but carries out the scanning . thereafter , four count - up clock pulses are provided by the scan controller 13 . as a result , the content of the plb counter 12 is increased by four counts and the 4th column is specified . when the 4th column of the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latch 18 is set , whereas if it is &# 34 ; 0 &# 34 ;, then the latch 18 is maintained reset . then , two count - down pulses are outputted by the scan controller 13 , so that the content of the plb counter 12 is decreased by two counts , and the 2nd column is specified . in driving the 2nd column print hammer , the latch 17 is maintained reset , and therefore the output of the nand gate 20 is &# 34 ; 1 &# 34 ;. therefore , if the printing data code and the type code for the 2nd column are coincident with each other , then the 2nd column print hammer is driven . thereafter , one count - down clock pulse is provided by the scan controller , the content of the plb counter 12 is decreased by one count , and the 1st column is specified . in this operation , the latches 17 and 18 are reset . if the 1st column of the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latch 17 is set , and if it is &# 34 ; 0 &# 34 ;, then the latch 17 is maintained reset . thereafter , the scan controller 13 provides four count - up clock pulses , the content of the plb counter 12 is increased by four counts , and the 5th column is specified . when the 5th column of the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latch 18 is set , and when it is &# 34 ; 0 &# 34 ;, then the latch 18 is maintained reset . then , the scan controller 13 outputs two count - down clock pulses , so that the content of the plb counter 12 is decreased by two counts , and the 3rd column is specified . in the case of driving the 3rd column print hammer , when both the 1st and 5th columns of the flag memory 112 are &# 34 ; 1 &# 34 ; and the output of the nand gate 20 is &# 34 ; 0 &# 34 ;, the signal hamset is not set to &# 34 ; 0 &# 34 ;. this happens even if the printing data code coincides with the type code and the output of the comparator 15 is therefore &# 34 ; 1 &# 34 ;. that is , in this case , the 3rd column print magnet 2 is not excited . succeedingly , the scan controller 13 outputs one count - down clock pulse . hence the content of the plb counter 12 is decreased by one count , and the 2nd column is specified . thereafter , the flag bits of the - 2nd and + 2nd columns from the column of a print hammer to be driven are checked . when both of the columns are &# 34 ; 1 &# 34 ;, the latches 17 and 18 are set , and the output of the nand gate 20 is set to &# 34 ; 0 &# 34 ;. even if the printing data code coincides with the type code , driving of the print hammer for the column is inhibited . in the above - described embodiment , the adjacent print magnets occur every two columns ; however , it should be noted that the invention is not limited thereto or thereby . for instance , in a printing device in which the print magnets 2 are disposed adjacent to one another as shown in fig4 before the n - th column print hammer is driven , the flag bits of the ( n - 1 )- th and ( n + 1 )- th columns are checked , and when both are &# 34 ; 1 &# 34 ;, driving the n - th column print hammer is inhibited . a second preferred embodiment invention will be described with reference to fig5 - 8 . fig5 is an excitement timing diagram of the print magnet 2 shown in fig1 . fig6 is a characteristic diagram indicating the change of flight time due to the magnetic interference . if the n - th column print magnet 2 is excited x time and y time respectively after the excitement of the ( n - 2 )- th column and ( n + 2 )- th column print magnets , then the change in flight time of the n - th column print hammer is as indicated in fig6 because of the change of the x time and y time , i . e . the change of the n - th column print magnet &# 39 ; s excitation timing . in fig5 reference character t w designates the pulse width of the print magnet 2 which is for instance 1140 μs , and reference character t f designates the flight time of the print hammer which is for instance 1350 μs . if it is assumed that the movement speed of the type carrier is 6 . 7 m / s , then the printing shifts corresponding to the flight time shifts 10 μs , 20 μs , 30 μs , 40 μs and 50 μs are 0 . 067 mm , 0 . 134 mm , 0 . 201 mm , 0 . 268 mm and 0 . 335 mm , respectively . accordingly , in order to accept a printing shift less than 0 . 2 mm and to prevent the occurrence of a printing shift more than 0 . 2 mm , the excitation of the n - th column print magnet 2 should be inhibited only when the aforementioned x time and y time , i . e . both of the excitement lapse time of the adjacent print magnets on both sides of the n - th column print magnet 2 are in the range of from about 474 μs to about 948 μs . before a method of monitoring the excitement lapse times of the print magnets 2 is described with respect to this embodiment it is appropriate to review the operation of a band printer having 132 columns per line in which five sub - scans are carried out in one print scan operation , i . e . whenever the types of a type carrier running horizontally is moved by one type pitch . this embodiment uses the technique of dividing into various cycle periods . the exciting pulse widths of the print magnets of all of the columns can be collectively controlled by employing a method in which , in the sub - scan , the comparison period of a column is divided into the first half period ( hereinafter referred to as &# 34 ; the reset cycle &# 34 ;) and the second half period ( hereinafter referred to as &# 34 ; the set cycle &# 34 ;), and in the reset cycle the excitement ending timing of each column is controlled while in the set cycle the excitation starting timing of the print magnet 2 of each column is controlled . listed below are the columns for which the comparison is carried out in the sub - scans . numerals in the parentheses () designate the numbers of columns which are read out in the reset cycle , and numerals outside the parentheses () designate the numbers of columns which are read out in the set cycle . all the columns are regularly and sequentially read out . ______________________________________ sub - scan 1 ; 1 ( 4 ), 6 ( 9 ), 11 ( 14 ),..... 126 ( 129 ), 131 ( x ) sub - scan 2 ; 2 ( 5 ), 7 ( 10 ), 12 ( 15 ),..... 127 ( 130 ), 132 ( x ) print sub - scan 3 ; 3 ( 1 ), 8 ( 6 ), 13 ( 11 ),...... scan 128 ( 126 ), x ( 131 ) sub - scan 4 ; 4 ( 2 ), 9 ( 7 ), 14 ( 12 ),..... 129 ( 127 ), x ( 132 ) sub - scan 5 ; 5 ( 3 ), 19 ( 8 ), 15 ( 13 ),..... 130 ( 128 ), x ( x ) ______________________________________ the above - described exciting pulse width collective control can be achieved by adding at least three flag bits to a printing data code transferred from a data source . the flag bits correspond to the respective printing data codes . first , if when a printing data code is transferred from the data source , data to be printed are available for the column , then flag bits ( 000 ) are added to the printing data code . if not , then flag bits ( 111 ) are added to the printing data code . thereafter , in the printing operation , the printing data code is compared with the type code in the set cycle of each sub - scan . if both of the codes are coincident with each other , the print magnet 2 of the column is excited , while the flag bits ( 000 ) of the column is changed to the flag bits ( 001 ). the flag bits of the column the print magnet 2 for which has been excited are changed from ( 001 ) to ( 010 ) when read out in the set cycle of the respective sub - scan in the next print scan . the flag bits are changed from ( 010 ) to ( 011 ) when read out again in the next print scan . in the reset cycle of each sub - scan , if the flag bits of a column read out are ( 011 ), then the excitement of the column is ended , and the flag bits are changed from ( 011 ) to ( 111 ). in the reset cycle , if the flag bits are not ( 011 ), then the operation is not carried out . this can be readily understood by reference to fig8 which is a timing diagram indicating the excitation of the 1st , 3rd and 5th column print magnets 2 . the excitation lapse time of each print magnet 2 can be detected by reading the flag bit data of the relevant column . if it is assumed that the period of each sub - scan is 95 μs , then the flag bits are ( 010 ) in the excitation lapse time of from 474 μs to 948 μs described above . accordingly , in exciting the print magnet 2 of a column , the flag bits of columns corresponding to the adjacent print magnets on both sides of the firstly - mentioned print magnet are read out . if both of the flag bits are ( 010 ), then the excitation of the print magnet is inhibited . if they are not ( 010 ), then the excitement is started . fig7 is a block diagram showing a second embodiment of the device according to this invention . the same elements as in the first embodiment have been similarly numbered . a buffer memory 11 ( hereinafter referred to as &# 34 ; a plb 11 &# 34 ;) stores separately according to the columns the printing data codes for one line which are transferred from the above - described data source . the plb 11 comprises : a printing code memory 111 , and flag memories 112 and 113 for storing the above - described excitation lapse time information , i . e . the flag bits . the flag memory 112 is employed to control the exciting pulse width of the print magnet 2 , while the other flag memory 113 is employed to control whether or not the excitation of the print magnet 2 should be started for the prevention of magnetic interference . the addresses in the printing code memories 111 and the flag memory 112 are accessed in a predetermined sequence by an address controller 23 in the above - described sub - scan &# 39 ; s set and reset cycles . writing is effective for the flag memories 112 and 113 simultaneously in the sub - scan &# 39 ; s set cycle as described above . however , the writing method and the method of accessing with the address controller 23 will not be described because the technical concept of controlling the exciting pulse width with the flag bits is well known in the art . the printing data code from the plb 11 is applied to a comparator 15 , where it is compared with a type code which is applied to the comparator 15 from a type code generator 14 ( hereinafter referred to as &# 34 ; a ccg 14 &# 34 ;) and corresponds to the print hammer of the relevant column . when both of the codes are coincident with each other , the comparator 15 outputs a coincidence signal e having &# 34 ; 1 &# 34 ;. the flag memory 113 is accessed by a plb scan controller 13 with the aid of a plb counter 12 and a plb address memory 21 as described later . among the flag bits b 0 , b 1 and b 2 of the flag memory 113 , the flag bits b 0 and b 2 are applied through inverters 27 to an and gate 28 , and the flag bit b 1 is applied directly to the and gate 28 . when the flag bits are ( 010 ), the and gate 28 provides an output having &# 34 ; 1 &# 34 ;. the output &# 34 ; 1 &# 34 ; is applied to the &# 34 ; d &# 34 ; input terminals of d - type flip - flops 30 and 31 . a timing signal g for designating the ( n - 2 )- th column and a timing signal h for designating the ( n + 2 )- th column are applied from the plb scan controller 13 to the trigger input terminals t of the flip - flops 30 and 31 , respectively , when the n - th column scanning is effected . the &# 34 ; q &# 34 ; outputs of the flip - flops 30 and 31 are applied through a nand gate 32 to one input terminal of an and gate 29 , to the remaining two input terminals of which the coincidence signal e from the comparator 15 and a fire timing signal f having &# 34 ; 1 &# 34 ; from the scan controller 13 are applied , respectively . when all of these input signals are &# 34 ; 1 &# 34 ;, the gate 29 is opened to apply a signal having &# 34 ; 1 &# 34 ; to a print magnet drive circuit ( not shown ). accordingly , when both of the flag bits of the ( n - 2 )- th and ( n + 2 )- th columns are ( 010 ), both of the &# 34 ; q &# 34 ; outputs of the flip - flops 30 and 31 are raised to &# 34 ; 1 &# 34 ;, and the nand gate 32 is opened . that is , the output of the nand gate 32 is set to &# 34 ; 0 &# 34 ;. therefore , the and gate 29 is not opened , so that the excitation of the print magnet is inhibited . the operation of the device of the invention shown in fig7 will be described . in the sub - scan 1 , the column of the print magnet 2 which can be excited is the 1st column . the - 1st column ( which does not exist and is a phantom column ) and the 3rd column are adajacent to the 1st column . accordingly , the excitation lapse times for these adjacent columns should be detected . in starting the memory scanning of the sub - scan 1 , the plb address memory 21 specifies the top address - 1st columns of the sub - scan 1 with the aid of a signal c 1 , c 2 , c 3 indicating the sub - scan number . the plb counter 12 specifies the - 1st column with the timing of a preset signal d from the scan controller 13 . as a result , the flag bits in the flag memory 113 , which corresponds to the - 1st column , i . e . the excitation lapse time information having &# 34 ; 0 &# 34 ; is produced by the flip - flop 30 with the timing of the above - described timing signal g . then , the scan controller 13 outputs four count - up clock pulses a to increase the content of the plb counter 12 by four counts . as a result , the 3rd column is specified . the excitation lapse time information having &# 34 ; 0 &# 34 ; corresponding to the 3rd column is produced by the flip - flop 31 with the timing of the aforementioned timing signal h . thereafter , two count - down clock pulses b are provided by the scan controller 13 , the content of the plb counter 12 is decreased by two counts , and the 1st column is specified . simultaneously , in the printing code memory 111 , the 1st column is accessed by the address controller 23 , and the printing code thereof is applied to the comparator 15 . when the printing code is coincident with the type code from the ccg 14 , then the comparator 15 outputs the coincidence signal e having &# 34 ; 1 &# 34 ;. the and gate 29 is opened with the timing of the timing signal f to thereby start the excitation of the 1st column print magnet 2 . the 6th column can be excited next , and the 4th and 8th columns are adjacent to the 6th column . therefore , the scan controller 13 successively produces three count - up clock pulses a , four count - up clock pulses a and two count - down clock pulses b to specify the 4th column , the 6th column and 8th column , respectively . the above - described operations are repeatedly carried out . thereafter , as in the above - described case , the scan operation of the sub - scan 1 is carried out . the excitation of the 3rd column print magnet in the sub - scan 3 will be described . in this connection , it is assumed that the excitations of the 1st and 5th print magnets adjacent to the 3rd column print magnet are as indicated in fig8 . the plb address memory 21 specifies the top address 1st column with the aid of the aforementioned signal c 1 , c 2 , c 3 designating the sub - scan number , and the plb counter 12 specifies the 1st column with the timing of the preset signal d from the scan controller 13 . the flag bits for the 1st column of the flag memory 113 are ( 001 ) in the ( n + 1 )- th print scan , ( 010 ) in the ( n + 2 )- th print scan , and ( 111 ) in the ( n + 3 )- th print scan . therefore , the &# 34 ; q &# 34 ; output of the flip - flop 30 is set to &# 34 ; 0 &# 34 ; in the ( n + 1 )- th print scan and in the ( n + 3 )- th print scan , and it is set to &# 34 ; 1 &# 34 ; in the ( n + 2 )- th print scan . as in the above - described case , the plb counter 12 next specifies the 5th column . similar to the case of the 1st column , the flag bits for the 5th column in the flag memory 113 are ( 001 ), ( 010 ) and ( 111 ) respectively in the ( n + 1 )- th , ( n + 2 )- th and ( n + 3 )- th print scans , and therefore the &# 34 ; q &# 34 ; output of the flip - flop 31 is raised to &# 34 ; 1 &# 34 ; only in the ( n + 2 )- th print scan . accordingly , the start of excitation of the 3rd column print magnet 2 is inhibited only in the ( n + 2 )- th print scan . however , it is allowed in the ( n + 1 )- th and ( n + 3 )- th print scans . the above - described exciting pulse width and flight time are merely examples ; that is , they can be changed as desired depending on the speed of the type carrier , etc . furthermore , in the above - described embodiment , the start of excitation is inhibited in the case where both of the flag bits for the columns on the both sides are ( 010 ). however , the values of the flag bits can be changed if necessary . as is apparent from the above description , according to the invention , the magnetic interference attributing to the leakage flux can be positively prevented . as a result , characters can be printed with high quality , and the size of the print hammer module , or the actuator module , can be reduced . furthermore , according to the invention , even if the adjacent print magnets on both sides of a central print magnets are excited , the excitation of the central print magnet is not immediately inhibited . that is , the start of excitation thereof is inhibited only for the predetermined excitation lapse time during which the effect of the magnetic interference is significant . accordingly , the number of times of inhibitions is reduced , which leads to the prevention of the lowering of the printing speed .	1
as used herein , a hosf is a microprocessor circuit and associated memories with busses coupling them that configured to perform the steps described herein . the vanc is a microprocessor controller circuit and associated memories and busses coupling them that are configured to perform the steps described herein . referring to fig4 , an embodiment of the invention is shown . as seen therein , an lte attachment or tau will trigger ue 401 to start the register or register update procedure . the ue 401 may not start the register or register update procedures during an active call . the vanc 402 will upon receiving the register or register update check if a plurality of hosfs 403 a - n ( shown as hosf 1 - 3 ), have been informed before that the ue 401 is registered to the vanc 402 . if not , the vanc 402 will send data with the vanc name / address and international mobile subscriber identity ( imsi ) of the ue 401 , all in parallel , to the plurality of hosfs 403 a - n in the network . the addresses of each of the plurality of the hosfs are provisioned via operations and maintenance ( o & amp ; m ) activity . the addresses could either be ip addresses or fully qualified domain names ( fqdns ). each of the plurality of hosfs acknowledge the request with a response . the method of the first embodiment are the steps of triggering , by an lte attachment or tau , a ue 401 to start the register or register update procedure , provided the ue 401 may not start the register or register update procedures during an active call ; then checking , by the vanc 402 , upon receiving the register or register update , if a plurality of hosfs 403 a , 403 b , 403 c , have theretofore been notified that the ue 401 is registered to the vanc 402 . if not , then the next step is sending , by the vanc 402 , data with the vanc name / address and imsi of the ue 401 , all in parallel , to the plurality of hosfs 403 a , 403 b , 403 c in the network . to accomplish this step , the step also includes provisioning the addresses of each of the plurality of the hosfs via o & amp ; m activity . in such case , the addresses could either be ip addresses or fqdns . the final step is acknowledging , by each of the plurality of hosfs , the request with a response . fig5 illustrates another embodiment 500 of the invention . as seen therein , an lte attachment or tracking area update ( tau ) will trigger the ue 501 to start the registration / registration update procedure . the ue 501 will start the registration update procedures during an active call , thus at every ho , if there is a tau , the registration update procedures will start . the vanc 502 will , upon receiving a register and register update , select a hosf 503 based on the ta id received . note that the ta will have 2g / 3g neighbors that an enb will select for ho targets . the vanc 502 will then check if the selected hosf 503 has been theretofore notified that ue 501 is registered to said vanc 502 . if not so notified , vanc 502 will send a signal with the vanc name / address and imsi of the ue 501 to the selected hosf 503 . the address of the hosfs in the network and the ta 2g / 3g neighboring cell relation are pre - provisioned via o & amp ; m activity . the addresses could either be ip addresses or fqdns . the hosfs then acknowledge the request with a response . the handover procedures are then performed as in the ims based solution without database as disclosed in applicant &# 39 ; s co - pending patent application u . s . ser . no . 61 / 105 , 623 . as disclosed therein , at ho to 2g / 3g , the mme will , based on target cell , select a hosf ( instead of an msc as in srvcc ), then the hosf will determine at which vanc the ue is registered , and forward the ho signaling to that vanc . the hose does this based on the imsi received in the first phase as disclosed therein . all ho signaling will pass the hosf for this ho . referring to fig6 a , the method starts at step 601 a . at step 602 a , the register or register update is received at the vanc . at step 603 a , the vanc will select a hose based on received ta and configured data . at step 604 a , it will check if the hosf has already been informed about the ue &# 39 ; s whereabouts , via its imsi . if so , the vanc will not contact the selected hosf , and the method will stop at step 606 a , otherwise , at step 605 a , the vanc will signal the hosf to inform that the ue is registered within this vanc . referring to fig6 b , the method starts at step 601 b . at step 602 b , the register or register update is received at the vanc . at step 603 b , the vanc will select a number of hosfs based on received ta and configured data . at step 604 b , it will check if these hosfs have already been informed about the ue &# 39 ; s whereabouts , via its imsi . if so , the vanc will not contact the selected hosfs and the method will stop at step 606 b , otherwise , at step 605 b , the vanc will signals to all the selected hosfs in parallel to inform that the ue is registered within this vanc . the invention may be realized in hardware , software , or a combination of hardware and software . the invention may be realized in a centralized fashion in at least one computer system , or in a distributed fashion where different elements are spread across several interconnected computer systems . any kind of computer system or other apparatus adapted for carrying out the methods described herein is suited . a typical combination of hardware and software may be a general - purpose computer system with a computer program that , when being loaded and executed , controls the computer system such that it carries out the methods described herein . the invention may also be embedded in a computer program product , which comprises all the features enabling the implementation of the methods described herein , and which when loaded in a computer system is able to carry out these methods . computer program in the present context means any expression , in any language , code or notation , of a set of instructions intended to cause a system having an information processing capability to perform a particular function either directly or after either or both of the following : a ) conversion to another language , code or notation ; b ) reproduction in a different material form . while the invention has been described with reference to certain embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from its scope . therefore , it is intended that the invention not be limited to the particular embodiment disclosed , but that the invention will include all embodiments falling within the scope of the appended claims .	7
as shown in fig1 feedstock used oil passes through a filter 1 and a pump 2 before being heated to the required temperature in a heat exchanger 3 , from which it then passes to the cyclonic evaporator 4 by way of a flowmeter 5 which controls a valve 6 so as to regulate the flow of feedstock . the feedstock is then tangentially injected into the evaporator 4 , in which predetermined temperature and pressure conditions are applied . since the pressure in the evaporator 4 is less than atmospheric pressure , a predetermined fraction of the feedstock will be flashed off and pass upwards through a spray condenser 7 , while the remaining fractions will fall to the bottom of the evaporator to form the bottoms product 8 . the bottoms product 8 is recirculated by way of a pump 9 and a heat exchanger 10 to the evaporator 4 . a temperature sensor 11 controls a valve 12 in the thermal oil supply 13 to the heat exchanger 10 , thereby enabling control over the temperature of the recirculating bottoms product 8 . a level controller 14 in the evaporator 4 controls a valve 15 which allows a proportion of the recirculating bottoms product 8 to be passed on for further processing as the bottom of the evaporator 4 fills up . part of the vapour fraction evaporated from the feedstock tangentially injected into the evaporator 4 is condensed in the spray condenser 7 . this distillate is recirculated to the spray head 16 by way of a holding tank 17 , a pump 18 and a heat exchanger 19 . the cooling water input to the heat exchanger 19 is controlled by a temperature sensor 20 connected to the spray condenser 7 , thereby enabling control of the temperature in the spray condenser to be achieved . a level controller 33 in the holding tank 17 controls a valve 21 which allows a proportion of the recirculating distillate to be fed to storage . the vapour fraction which is not condensed in the spray condenser 7 passes to a subsequent condenser 22 . the liquid fraction condensed in the condenser 22 is recirculated by way of a holding tank 23 , a pump 24 and a heat exchanger 25 . the cooling water input to the heat exchanger 25 is controlled by a temperature sensor 26 connected to the condenser 22 , thereby enabling control of the temperature in the condenser to be achieved . a level controller 34 in the holding tank 23 controls a valve 27 which allows a proportion of the recirculating distillate to be fed to storage . the vapour fraction which is not condensed in the condenser 22 passes to a vacuum system comprising two pumps 28 and 29 , a cooler 30 and a holding tank 31 . the primary function of the vacuum system is to maintain the vacuum in the main evaporator 4 . a distillate produced in the vacuum circuit may be fed to storage , while the remaining vapour fraction may be fed through pipe 32 for incineration . fig2 shows four interconnected evaporator stages similar to that shown in fig1 . in the first stage , water and some light ends are obtained in the spray condenser 7 , while further light ends are obtained in the secondary condensation circuit 35 . the evaporator 4 of the first stage may operate at a temperature of 160 ° to 180 ° c . and a pressure of 400 mbar vacuum to atmospheric pressure . a proportion of the bottoms product of the first stage is passed on to the second stage for further processing . in the second stage , the evaporator 4 ′ is operated at a temperature of 260 ° to 290 ° c . and a pressure of 40 to 100 mbar vacuum . light oil and light fuel oil are condensed in the spray condenser and gas oil is condensed in the secondary condensation circuit 35 ′. the bottoms product of the second stage is fed to the third stage , where the evaporator 4 ″ is operated at a temperature of 290 ° to 330 ° c . and a pressure of 15 to 25 mbar vacuum . 150 sn base oil distillate is obtained in the spray condenser and 100 sn base oil distillate in the secondary condensation circuit 35 ″. finally , the bottoms product of the third stage is fed to the fourth stage , where the evaporator 4 ′″ is operated at a temperature of 320 ° to 345 ° c . and a pressure of 5 to 15 mbar vacuum . 350 + sn base oil distillate is obtained in the spray condenser and 250 sn base oil distillate in the secondary condensation circuit 35 ′″. the various base oil distillates are stored at 36 , from where they may be passed blockwise for finishing treatment . fig3 shows a re - refining plant in which each evaporator 4 and its associated ancillary apparatus , such as condensers 22 and 37 , is mounted in a frame 38 so as to form a modular unit , indicated generally at 39 . input and output to each modular unit is arranged so that two or more modular units may be brought together and interconnected to a straight - forward manner , thereby allowing a plant to be built up quickly and simply . fig4 is an end elevation of the plant of fig3 . the following tables give the results , respectively , of an analysis performed on used lubricating oil , on base oil distillate produced from the used oil by an embodiment of the present invention , and on rerefined base oil to which a finishing treatment has been applied :	1
fig1 and 2 illustrate a plurality of overlying tear sheets 2 which define a pad 4 . any number of tear sheets 2 may be used although as a practical matter at least two tear sheets 2 would normally be utilized . the plurality of tear sheets 2 are adapted to cling to one another by means of static cling . such action tends to unitize the plurality of tear sheets 2 as they are attracted to one another so as to define a flip - chart pad 4 . each tear sheet 6 from the plurality of tear sheets 2 comprise of material capable of generating static cling . it has been found that sufficient static forces are generated when each tear sheet 6 has a thickness between one and three thousandths of an inch ; and generally good results are exhibited when the thickness of each tear sheet 6 is in the vicinity of two thousandths of an inch . furthermore , in the preferred embodiment each tear sheet 6 comprises of oriented polypropylene film , and particularly good static cling characteristics have been experienced by utilizing polypropylene film sold by mobil chemical company , putsford , n . y . under the trade marks oppalyte and bicor . the &# 34 ; oppalyte &# 34 ; trade mark film presents a white surface for writing thereon , while the &# 34 ; bicor &# 34 ; trade mark film presents a clear transparent surface . more particularly the polypropylene film sold under the trade mark oppalyte has the following characteristics : ______________________________________ approximate approximatetrade mark thickness yielddesignation description ( microns ) ( m . sup . 2 / kg . ) ______________________________________oppalyte high opacity 38 . 1 49 . 8350 tw white core , non - heat sealable , modified opp two sidesoppalyte high opacity 50 . 8 39 . 6278 tw white core , non - heat sealable , modified opp two sidesoppalyte high opacity 63 . 5 33 . 2233 tw white core , non - heat sealable , modified opp two sidesoppalyte high opacity 50 . 0 32 . 0220 tw white core , non - heat sealable , modified opp two sides______________________________________ particularly good results are exhibited through the use of oppalyte 278 tw . furthermore transparent sheets having the following characteristics have exhibited good static cling characteristics : ______________________________________ approximate approximatetrade mark thickness yielddesignation description ( microns ) ( m . sup . 2 / kg . ) ______________________________________bicor 240 b non - sealable , 32 . 0 34 . 1 unmodified homopolymer polypropylene______________________________________ other film or sheets 6 which have exhibited good static cling characteristics are : ( a ) polyester film sold by ici america , inc ., wilmington , del . under the trade mark melinex which is a polyethylene terephtharate ( pet ) polymer , ( b ) vinyl film sold by ici america , inc ., wilmington , del . under the trade mark mela sheet . each sheet 6 is adapted for writing thereon by means of a pen , felt pen or the like . in the preferred embodiment a felt pen may be used to write information on the sheet 6 . the information written on the sheet 6 is erasable by a brush , tissue paper or the like , when the ink is still wet or even when the ink is dry . in other words , each sheet 6 is dry erasable so as to be capable of reuse . each tear sheet 6 is adapted to be removeable from the pad 4 for releaseable securement to a surface by means of static cling as best illustrated in fig3 . each tear sheet 6 is self - adherent to most surfaces by means of static cling . if the surface 8 is such that the sheet 6 is not capable of retention thereto by static cling no securement will occur . in other words the static cling forces generated between the sheet 6 and surface 8 must be great enough to overcome the gravitational forces exerted on the sheet 6 . for example , it has been found that tear sheet 6 made of vinyl best adhere to smooth surfaces , while sheet 6 made of polypropylene film adhere to surfaces commonly used for walls which are either painted , wallpapered , or drywalled . therefore the user of the flip - chart pad 4 may either write upon the top sheet 6 of pad 4 and then remove such sheet 6 for releaseable securement or adhesion to a wall 8 by means of static cling , and then continue writing on the fresh sheet 6 exhibited on flip - chart pad 4 ; or the user may first remove a tear sheet 6 from pad 4 to place the sheet 6 on the wall 8 for securement by means of static cling and then write on the sheet 6 . before writing on the tear sheet 6 , four to five strokes of the hand smoothing out the sheet 6 on the surface 8 will increase the static cling charge and allow the tear sheet 6 once removed from the flip - chart pad 4 to self - adhere to the wall surface without tape or tacks . in this manner the tear sheet 6 may be used in the same fashion as a white board but with considerable cost savings as well as being able to secure the sheet 6 to a wall 8 without the need of tape fasteners or the like . furthermore , since the tear sheet 6 is adapted to be dry erasable any writing on the tear sheet 6 may be erased so as to enable the user to reuse same . the flip - chart pad 4 may also include a backing sheet or cover stock 10 for supporting the plurality of overlying sheets 2 as best illustrated in fig2 . the backing 10 presents a folded edge 12 which is adapted to overlie a portion of the overlying tear sheets 2 . staples 16 are presented in the region of the folded edge portion 12 so as to fasten the plurality of tear sheets 2 between the folded edge 12 and backing 10 so as to define the flip - chart pad 4 . the backing sheet may be made of any suitable material such as for example bristol board . furthermore the backing sheet 10 may overlie only a portion of the tear sheets 2 so as for example to be similar in size and extent to the folded edge 12 as illustrated in fig1 and 2 ; or backing 10 may be coextensive with the tear sheets 2 ( not shown ). each tear sheet 6 may be removed from the stapled pad by sharply pulling downward on each tear sheet 6 so as to tear the tear sheet 6 away from the flip - chart pad 4 and particularly away from the staples 16 . the flip - chart pad 4 illustrated in fig2 also includes a transparent film 14 disposed between the plurality of overlying tear sheets 2 and backing 10 . the transparent film 14 is also adapted to be capable of generating static cling so as to cling to the plurality of tear sheets 2 as well as being adapted to be removed from the flip - chart pad 4 for securement to a wall surface 8 by means of static cling . in a particular advantageous application the transparent film 14 may be adapted to overlie a tear sheet 6 which has adhered to a wall surface 8 by means of static cling so as to allow the user to show interaction of information included on the transparent film 14 with information included on tear sheet 6 , or to permit the user to write on the transparent film 14 while overlayed over the tear sheet 6 so as not to mark up the information included on tear sheet 6 . the flip - chart pad 4 also includes apertures 18 through folded edge 14 , plurality of tear sheets 2 , transparent film 14 and backing 10 for receiving hooks or the like ( not shown ) so as to hang the flip - chart pad 4 from a suitable surface . furthermore in one particular embodiment the staples 16 are located below apertures 18 so as to present a design weakness in the tear sheets thus faciliting the removal of the tear sheets 6 from the flip chart pad 4 . by tearing tear sheets 6 from pad 4 torn corners 40 are presented which represent the material left in the pad 4 between staples 16 and the corners of the tear sheets 6 located in the region of the folded portion 12 . in one particular embodiment of the invention tear sheets 16 are heat sealed together along edge 42 in a manner so that tear sheet 6 will &# 34 ; tear &# 34 ; along a straight line 42 so as to eliminate the presence of any torn corners 40 . such heat sealing may be accomplished by utilizing sealing bars or ultrasonic welding which welds the film 6 together by agitating the molecules of the sheets 6 and generating heat for welding . the flip - chart pad 4 may be shipped in a corrugated package 20 best illustrated in fig4 . the corrugated package 20 comprises a back support 22 and flaps 24 , 26 , 28 and 30 which are adapted to move from an open position as illustrated in fig4 so a to permit insertion of a flip - chart 4 therein to a closed position as illustrated by the phantom lines in fig4 for shipment . corrugated package 20 also includes holes 32 which may be adapted to hold flip - chart pad 4 by means of the apertures 18 . furthermore the corrugated package 22 may be used as a backing for the flip - chart pad 4 by removing the flaps 24 , 26 , 28 and 30 . it has been found that the best results occur when the plurality of tear sheets 2 include the following characteristics : the plurality of tear sheets 2 may also be adapted to be permanently fastened together in a colouring book form so as to present caricatures or designs adapted to be filled in by children with felt pens . each sheet 2 could then be erased for reuse as a colouring book at a later date . in another embodiment each sheet 6 may also include advertising material printed thereon and adapted to be placed on a transparent surface such as a glass or the like for securement thereto by means of static cling . for example , such sheet 6 may include advertising material and have particular advantages for use for the sale of new or used cars as the sheet 6 could be placed against the inside of the front window of a ca for securement thereto by static cling for advertising the price and financing features of the used car . such adaptation would eliminate the need to paint such information on the outside surface of a front window of a new or used car . although the preferred embodiment as well as the operation and use has been specifically described in relation to the drawings it should be understood variations in the preferred embodiment could easily be achieved by a man skilled in the art without departing from the invention . accordingly , the invention should not be understood to be limited to the exact form revealed in the drawings .	8
referring to the drawings and , in particular , to fig1 a flexible , twin - blade wet - shaving razor unit 10 is shown . razor unit 10 includes a seat portion 12 having a guard bar 14 , a cap portion 16 , a seat blade 18 and a cap blade 20 . disposed between the blades is a corrugated spacer 22 . as best shown in fig2 spacer 22 extends along the entire length l of seat blade 18 . spacer 22 includes a plurality of corrugations 24 , which increase the flexibility of the spacer , interconnected by a plurality of plates 26 . plates 26 extend across a substantial portion of the width w of seat blade 18 . as will be apparent to those skilled in the art , the design and configuration of spacer 22 will increase the rigidity of the blades , while , at the same time , still allowing such blades to flex in response to forces encountered during shaving . in this regard , a preferred embodiment of the present invention may provide that the plates are fixedly connected to the seat blades by means of spot welds 28 . fixedly connecting the spacer to the blade ensures that the alignment of such components remains constant and , in addition , further increases the rigidity of the blade . however , it is not necessary to fixedly connect the spacer to the seat blade ; instead , as explained below , merely sandwiching the uniquely designed components together can provide the desired increase in rigidity of the blade . referring to fig3 it can be seen that cap blade 20 , spacer 22 and seat blade 18 are sandwiched between cap portion 16 and seat portion 12 . more specifically , cap portion 16 includes a plurality of securing pins 30 that pass through a series of co - linear openings in the cap blade , spacer and seat blade . the securing pins are received by openings in seat portion 12 that are dimensioned so that pins 30 can be &# 34 ; snapped &# 34 ; in and , thereafter , not withdrawn . in addition , the pins are dimensioned so that once the unit is assembled , the components of such units are tightly sandwiched between the cap and seat portion . to allow relative movement of the blades during flexing , the openings in these components ( except for the centrally - positioned openings ) may be formed in the configuration of a slot . with respect to the spacer , the openings ( except for the centrally - positioned opening ) are formed with a diameter slightly larger than the diameter of the securing pins . together , the design allows the components to slide pass one another as the razor unit is flexed . when the razor unit is assembled , upper surface 32 of corrugations 24 will contact and , hence , support the lower surface of cap blade 20 . the support these corrugations provide to the cap blade translates into increased rigidity of such blade . in addition , it is possible to configure the components of the razor unit such that both the cap blade and the seat blade are equally supported . finally , as already mentioned above , the corrugated spacer provides increased rigidity to the blades , which , in turn , decreases the amplitude of vibration introduced into such blade . while there have been described what are presently believed to be the preferred embodiments of the invention , those skilled in the art will realize that various changes and modifications may be made to the invention without departing from the spirit of the invention and it is intended to claim all such changes and modifications as fall within the scope of the invention .	1
a magnetization curve is shown in fig1 for an anti - theft security strip constructed in accordance with the principles of the present invention have a soft - magnetic inner constituent and a hard - magnetic outer constituent . the induction is shown on the ordinate in tesla given low modulation , i . e ., given field strengths of + 400 ma / cm through - 400 ma / cm . as can be seen from the curve of fig1 the coercivity field strength of the wire lies at approximately 0 . 17 a / cm , so that fields beginning at 0 . 2 a / cm already cause a magnetic reversal of the soft - magnetic part , and can thus cause an alarm to be triggered in the examination zone . the magnetization loop of the same composite member is shown in an enlarged scale in fig2 . it can be seen from fig2 that field strengths above 200 a / cm are required for the complete magnetization of the hard - magnetic constituent , and that changes in the magnetic field of the hard - magnetic constituent are only identifiable at all given magnetic field of more than 10 a / cm . given an alternating field of between 0 . 2 and 10 a / cm in the examination zone , therefore , a reliable magnetic reversal of the soft - magnetic part will occur with the frequency of the alternating field without a change in the magnetization of the hard - magnetic constituent occurring . the defined mechanical prestress of the soft - magnetic constituent , which can be set using manufacturing parameters ( selection of material , tempering and annealing treatments ), insures a defined barkhausen effect in the magnetic reversal , so that voltage pulses having a steep edge are produced . it is desirable to produce voltage pulses having a steep edge because this insures that a large number of evaluatable harmonics , characteristic for the security strip , will be present given relatively slow field changes ( for example , 50 hz ) of the alternating field . in the manufactured state of the anti - theft security strip , the hard - magnetic constituent is always demagnetized , and therefore the strip is in the active condition , because during manufacture annealing will take place above the curie temperature . if for some reason the curie temperature is not exceeded during manufacture , the strip would have to be demagnetized by the application of an alternating field having decreasing amplitude in order to place the security strip in the active condition . it is sufficient for deactivation to bring the anti - theft security strip into contact with sufficiently strong magnets having alternating polarity . because , in contrast to the strip disclosed in german os no . 38 24 075 , the demagnetizing boundary phenomena are not prevented in the security strip disclosed herein by magnetized permanent magnetic material , it is necessary to provide a minimum length of the strip , dependent on the cross section of the soft - magnetic part . for this purpose , it has been found that the length in millimeters should be more than approximately 4000 times the cross section in square millimeters . for example , an anti - theft security strip having a length of slightly more than 30 mm or greater can be employed if the diameter of the soft - magnetic part is less than or equal 0 . 1 mm . fig3 illustrates an exemplary embodiment of a wire having a hard - magnetic constituent 10 and a soft magnetic constituent 12 . the hard - magnetic constituent 10 and soft magnetic constituent 12 are formed into a composite elongated member . the hard - magnetic constituent 10 and soft magnetic constituent 12 mechanically support one another . the hard - magnetic constituent 10 is demagnetized in an activated condition of the security strip . the soft magnetic constituent 12 has a coercivity field strength which is below the field strength of the alternating field in the examination zone . the hard - magnetic constituent 10 has a coercivity field strength which is higher than the field strength of the alternating field in the examination zone . the hard - magnetic constituent 10 is disposed at an exterior 14 of the elongated member , and the soft magnetic constituent 12 is disposed in an interior 16 of the elongated member . the composite member can also be formed of a wire consisting of the soft magnetic constituent 10 disposed inside a tube consisting of the hard - magnetic constituent 12 . fig4 illustrates an exemplary embodiment of a foil including the soft magnetic constituent 12 and hard - magnetic constituent 10 formed into a composite elongated member . the soft magnetic constituent 12 and the hard - magnetic constituent 10 mechanically support one another . the hard - magnetic constituent 10 is demagnetized in an activated condition of the security strip . the soft magnetic constituent 12 had a coercivity field strength which is below the field strength of the alternating field in the examination zone . the hard - magnetic constituent 10 has a coercivity field which is higher than the field strength of the alternating field in the examination zone . the hard - magnetic constituent 10 can be disposed at the exterior 14 of the elongated member , and the soft magnetic constituent 12 can be disposed in the interior 16 of the elongated member . fig5 illustrates the magnetization of the hard - magnetic constituent 10 for deactivation of the security strip , wherein deactivation of the security strip is undertaken by sections having different polarities . the hard and soft and magnetic constituents , 10 , 12 , mechanically support each other as illustrated in fig3 and 4 respectively . for example , where the core is the soft magnetic constituent 12 and the hard - magnetic constituent 10 centrally surrounds the core , the two constituents can be drawn together and thus formed as a unit , as illustrated in fig3 . further , if the core of the security strip has a rectangular cross section , the exterior portion can be connected to the core by rolling the hard - magnetic constituent 10 onto the core at both sides , and by annealing at a temperature preferably higher than 1000 ° c . a deactivatable anti - theft security strip manufactured in accordance with the principles of the present invention results in a defined barkhausen effect in the magnetic reversal of the deactivatable anti - theft security strip . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventor to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of his contribution to the art .	6
plasma - channel drilling , as explained herein , is the process of delivering electrical power to an electrode assembly acting as a drill bit , in a sequence of discrete high power pulses to form highly destructive short lived electrical plasma channel discharges , which in turn cause localised fragmentation and disintegration of a material , such as a rock structure , ahead of the electrode assembly . referring to fig1 , there is illustrated a plasma - channel drilling apparatus , generally represented by reference numeral 10 , for removal of surface material 12 from a body of material 16 . the apparatus 10 comprises a high voltage pulsed generator 18 which is coupled by an hv cable 9 to an electrode assembly 20 . the electrode assembly 20 is arranged such that a plasma channel 22 is produced within or on the surface of the body of material 16 , which causes a localised region of the surface material 12 to fracture and fragment . the high voltage pulsed generator 18 includes a drive circuit capable of producing high voltage pulses , between 10 - 50 kv at an energy level of about 10 - 500 joules per pulse . the drive circuit also enables a pulse repetition rate of 1 - 100 pulses per second to be produced at the electrode assembly 20 , thereby forming a plasma channel at up to 100 times per second resulting in an effective and controlled drilling process . an increase in the pulse repetition rate of the hv generator 18 does not necessarily result in an increase in the drilling rate of the plasma channel drilling apparatus 10 . in one test bore holes drilled using a drive circuit set to 35 kv at an energy level of 122 . 5 joules per pulse , resulted in a drilling rate of 5 cm per minute at a pulse repetition rate of 10 pulses per second . however , in a different sample a drilling rate of 6 . 5 - 7 . 5 cm per minute was achieved with a pulse repetition rate of 5 pulses per second . furthermore , the pulse repetition rate has a direct effect on the energy efficiency of the apparatus , with a decrease in the pulse repetition rate resulting in a decrease in the specific energy consumption . thus a 20 % decrease in the specific energy consumption was achieved at a pulse repetition rate of 5 pulses per second compared to that of 10 pulses per second , when drilling with apparatus set at an energy level of 207 . 5 joules per pulse , 38 . 5 kv and output generator capacitance of 280 nf . the pulse repetition rate as regards removal of material is related to the time taken for the created plasma - channel to deplete to a sufficient level , before a succeeding generated plasma channel can have full effect on removal of material . this is due to the fact that the plasma channel causes the material to fracture and fragment by rapid expansion of the plasma channel on or within the surface of the material , and it is therefore necessary to wait until the created plasma channel has subsided sufficiently before the next plasma channel is created . an increase in the pulse energy of the hv generator has a direct effect on the specific energy consumption of the plasma channel drilling process . the increase of the energy available per pulse results in improvement of the energy efficiency of the plasma drilling channel apparatus . in test bore holes drilled in sandstone samples using a drive circuit set to 35 kv at an energy level of 61 j / pulse resulted in a specific energy of drilling of 803 j / cm 3 at a pulse repetition frequency of 10 pulses per second , and in a specific energy of drilling of 474 j / cm 3 at a pulse repetition frequency of 5 pulses per second at an energy level of 122 . 5 j / pulse . increasing the energy available per pulse by a factor of 2 for a constant voltage resulted in a 59 % reduction in the specific energy of drilling . further increase of the energy would result in saturation and a consequent decrease in the efficiency of the drilling apparatus . therefore for maximising of the efficiency of the plasma channel drilling apparatus it is necessary to determine the optimal parameters ( particularly applied voltage , pulse repetition frequency , energy available per pulse ) for different materials to which the plasma - channel drilling apparatus is being applied . referring to fig2 , there is shown a cross section of the electrode assembly 20 of fig1 . the electrode assembly 20 comprises a hv electrode 32 which is made from a material such as stainless steel in order to increase the lifetime and reliability of the overall assembly . the hv electrode 32 is coupled to an hv shank 34 by a threaded and pinned portion 36 so as to secure the electrode 32 in position . the hv shank 34 is in turn coupled via a connector 40 to the core 38 of hv cable 9 connecting pulse generator 18 to the electrode assembly 20 . the connector 40 is arranged such that at one end of the connector 40 there is provided a threaded portion 58 into which the hv shank 34 is coupled , and at an opposite end there is provided a bore 60 into which the cable core 38 is fitted . the hv cable core 38 is secured in place via grub screws 62 . surrounding the shank 34 , connector 40 and cable core 38 are plastic insulators 42 , 43 , 44 which prevent electrical breakdown from occurring between the hv components of the electrode assembly and the return , or grounded portions of the electrode assembly . a cup - shaped grounded electrode 46 surrounds the hv electrode 32 , there being a predetermined inter - electrode gap spacing 48 between the two electrodes 32 , 46 . electrode 46 at its exposed annular end lies in the same plane as the exposed outer surface of the disc electrode 32 ( and may have a sharpened end face or edge ). the grounded electrode 46 is electrically connected to a grounded metal tube or pipe 50 , such as copper , via a conductive sleeve 52 , which has male and female threaded portions , to which the metal pipe 50 and grounded electrode 46 are respectively connected . the metal pipe 50 is electrically connected at an opposite end , via cable 9 to the pulse generator 18 , creating a return path for the flow of current to pass when the plasma channel 22 is created . the upper portion of the grounded electrode 46 is provided with slots 70 and with through holes 54 to which are connected pipes 72 allowing a fluid such as water to be passed to the inter - electrode gap 48 . as is schematically shown in fig3 this arrangement enables a flow of fluid such as water to be supplied to cutting surface 66 to entrain and remove cuttings or debris 68 by circulating water down through the copper pipes 72 and up into the drilled bore 74 , such that the water will pick up and carry away the cuttings 68 from the cutting surface 66 . the cuttings 68 may be carried away from the cutting surface 66 either traversing the gap 48 between the two electrodes , or , without traversing the gap 48 , through venting slots 70 provided in the grounded electrode . the plasma channel 22 is also shown in fig3 at two of its instantaneous positions during a drilling period . channel 22 at each time instant is elongate and extends in an arc from an edge or face of electrode 32 to a local region of an inner edge or lower face of the outer electrode 46 . fig3 also illustrates the applied electrical pulse in the form of a fast - rise impulse . now referring to fig4 , the pulsed generator 18 comprises ( typically ) an energy storage capacitor 78 which is charged by a primary power source 80 at a voltage level up to 50 kv , via a coupling resistor 82 ( e . g . 100 ohms ) and a wavetail or decoupling resistor 84 ( e . g . 10 kilo - ohms ) with switch 86 open . when the capacitor 78 is fully charged , switch 86 is closed on command . the switch closure transfers energy from the capacitor into the electrode assembly 20 via the high voltage co - axial feed 9 . energy from the capacitor 78 and the high voltage co - axial feed 9 is dissipated in the plasma - channel with a current waveform determined by the natural oscillatory frequency of the circuit . this energy dissipation in the plasma - channel results in the drilling process . fig5 illustrates typical current and voltage waveforms generated during plasma channel formation . thus , on the micro second timescale denoted in fig5 , the first voltage pulse commences at about 6 μs and rises very rapidly in far less than 1 μs to about 35 kv . the voltage level remains in the range 35 kv dropping to 26 kv over the time interval 6 μs to about 13 μs during which time the body of material is electrically stressed but without breakdown occurring . electrical breakdown occurs at about 13 μs when the conductive plasma channel is formed ( and physically expands rapidly ) and the voltage collapses in damped oscillation to terminate at about 40 μs whilst concurrently the plasma channel current is established as a damped oscillation also terminating at about 40 μs . when the energy in the capacitor 78 has been dissipated in the plasma - channel circuit , the power source 80 recharges the capacitor 78 by opening of switch 86 , ready for another cycle of the circuit . plasma channel creation between the electrodes of the electrode assembly is dependent upon a number of factors , which include the electrode profile , electrical properties of the fluid on or in the material and the material itself ; temperature , pressure , voltage magnitude and pulse profile . furthermore , if the apparatus is self - firing , i . e ., there is no trigger signal to initiate the creation of the plasma channel , it is important to provide an electrode assembly having a pre - characterised geometry for the fluid and material present to ensure that the applied high voltage pulse initiates the desired plasma formation . if the electrode assembly is not configured for the specific environmental conditions , then a significant amount of the energy available may be lost through ionic conduction in the fluid . it has been found that for fast rising voltages ( approximately 10 mv per microsecond ), solids suffer dielectric breakdown ( plasma formation ) earlier than fluids such as water and oil . referring to fig6 , there is provided a graph showing breakdown delay time against voltage characteristics of sandstone and water for different inter - electrode distances . it can be seen for these sets of curves , that if the applied voltage is high enough the sandstone will suffer electrical breakdown ( plasma formation ) more rapidly than the water . fig7 shows the relationship between applied electric field and breakdown delay time for different rock structures , transformer oil and water . these sets of curves show the same trend as in fig6 , in that if the applied voltage is high enough the different rocks will suffer electrical breakdown more rapidly than water or transformer oil . however , for the transformer oil , it can be seen that the electric field applied to the electrode assembly must be greater than that of water to ensure electrical breakdown in the rock structure before that of the transformer oil . therefore , for plasma channel drilling it is desirable to apply as high a voltage with as rapid a rise time as possible to the electrodes , in order that the rock suffers electrical breakdown before the water or oil . this would theoretically maximise the efficiency of the drilling process , except that for certain applications it is desirable to restrict the maximum operating voltage of the system to less than 50 kv . voltages above this value , of 50 kv , result in system insulation requirements becoming of significance , which may result in an increase in the overall size of the drill , electrical feed and power supply . fig8 shows the relationship for negative polarity pulses between the delay time and electrode gap spacing for water - saturated red sandstone . it can be seen that for both applied voltages (− 30 kv and − 35 kv ) the delay time increases with increasing gap spacing . this is expected since the electric field , which influences the delay time , decreases with increasing gap size . the disadvantage that the delay time has with respect to plasma channel drilling , is that as the delay time increases , the amount of energy available to the plasma channel is reduced due to losses through the water . plasma channel drilling can be conducted in rock formations saturated in brine or oil . in spite of the fact that the salinity of connate water in oil bearing rock formation can be as high as 100 g of electrolyte per one liter of water , the use of low conductive water as a drilling fluid significantly reduces the delay time and ionic conduction losses and provides an effective plasma channel drilling process . in test bore holes in sandstone samples the plasma channel drilling apparatus demonstrated a drilling rate of 7 . 0 cm / min for water - saturated sandstone , and 5 . 5 cm / min for brine - saturated sandstone with the use of tap water as the drilling fluid . in order to produce efficient plasma channel drilling lower conductivity drilling fluids such as tap water or mineral oil should be used . therefore , to maximise the energy available to the plasma channel , the gap spacing must be reduced or the voltage increased in order to reduce the delay time . as previously stated , plasma - channel drilling uses a plasma discharge that is formed on the surface or through the material to be drilled . therefore , in order to produce an efficient plasma channel drilling process it is necessary to maximise the rate of pressure rise during the fast expansion period , that is during the first few hundreds of nanoseconds of creating the plasma channel . this may be achieved by maximisation of mean power dissipated in the active load of the plasma channel during the first half period of the current oscillation , which may be accomplished by producing a pulse having a duration in the region of 1 - 50 microseconds and having a rise time of less than 150 nanoseconds , preferably in the order of 100 nanoseconds . the pulse generator used to drive the drilling process can generate high peak powers of between 10 - 100 mw at the electrode assembly . however , due to known pulsed power and energy consumption techniques , the average power output for the generator is in the region of a few kilowatts whilst drilling . this enables the pulse generator and associated equipment to be compact and portable , such that the apparatus can be deployed by wire - line or coiled - tubing equipment into a bore , with the plasma channel apparatus split into a downhole electrode assembly and a surface pulse generator . alternatively , the pulse generator may be incorporated into an electrical cartridge such that the pulse generator and the electrode assembly may be deployed together within the bore . by exploiting the differences in temporal dielectric strength between the fluid within the bore and the rock formation , as can be derived from the graphs shown in fig6 and 7 , the plasma - channel is forced to form along the surface of , or inside the formation ahead of the apparatus . in addition , by utilising single or multiple annular electrode geometries within the electrode assembly , the plasma - channel will change position around the electrode gap so as to seek out new areas of material , such that different sections of the formation are removed . this is achieved because the plasma - channel seeks out the path of least resistance , and because the rock formation electrically breaks - down before that of the fluid , at high voltages , the plasma - channel will be formed within or on the surface of . the formation . the plasma - channel will therefore rotate with time through 360 ° seeking out the path of least resistance through the material , thereby removing the material ahead of the electrode assembly and eliminating the requirement to rotate the electrode assembly itself . the electrical breakdown of solids by plasma - channel drilling results in the formation of a gas plasma filled breakdown conductive channel . the resistance of this plasma filled breakdown channel is related to the electrical and physical properties of the channel and depends upon the physical properties of the solids ( ionisation potential , molecular weight ) and also depends on characteristics of the discharge circuit ( initial potential of output , capacitance of the circuit , inter - electrode spacing ). for optimal performance of the plasma - channel drill , the inter - electrode gap spacing together with the parameters of the electrical drive circuit need to be optimised , such that the current waveform produced is close to its critically damped response . in practice , this means that the optimal inter - electrode gap spacing must be determined for the different materials to which the plasma - channel drilling apparatus is being applied . it is desired to produce a current waveform that is close to its critically damped response as this has been seen to result in the highest rate of energy deposition in the plasma breakdown channel . it will be appreciated that various modifications may be made to the embodiment hereinbefore described without departing from the scope of the present invention , e . g ., a pulse generator which is deployed downhole with the electrode assembly may be powered by a downhole power source , such that there is no need for any surface power to be provided . in this way , the entire apparatus may deployed on drill pipe or the like and power supplied by the downhole power source . the electrode assembly may include more than two electrodes , and the cutting removal fluid may be mud based so as to help balance well conditions . it will be appreciated that a principal advantage of the present invention is that the above apparatus is small , compact and readily deployable , making the apparatus ideal for work - over applications on platforms , rigs or the like , to maintain maximum well production . furthermore , the apparatus can produce small bore holes , typically up to 100 mm , that can be exploited to enhance production zones so as to ensure maximum productivity from the well . in addition , this method of drilling produces sub - millimetre drill cuttings in the region of 300 micrometres , in comparison to that of known systems in which cuttings in the region of 2 - 7 millimetres are produced . the reduction in the size of the cuttings reduces the need to use equipment to further reduce the cutting size , as is common practice , such that the cuttings can be transported via a pipe network to a storage area . in addition , this method of drilling enables the drill cuttings to be readily re - injected into the subsurface formation , thereby reducing the environmental impact , and the amount of waste produced . other advantages of the invention include the possible reduction in fluid pump rates ; eliminating the need for rotary equipment to drive the drill bit ; and a reduction in the specific energy needed to create a bore hole . initial results have shown that the specific energy for plasma channel drilling is in the region of 250 - 290 joules per cm 3 , compared to 350 - 560 joules per cm 3 for rotary ( oilfield ) drilling , of a medium hardness rock .	1
it is to be understood that the figures and descriptions of the present invention have been simplified to illustrate elements that are relevant for a clear understanding of the present invention , while eliminating , for purposes of clarity , many other elements found in typical digital multimedia content delivery methods and systems . however , because such elements are well known in the art , a detailed discussion of such elements is not provided herein . the disclosure herein is directed to all such variations and modifications known to those skilled in the art . the exemplary embodiment comes within the framework of digital television in the scope of mpeg compression , but the invention is not limited to this particular environment and may be applied within other frameworks where content may be compressed in a high and low resolution . the system according to the embodiment is illustrated in fig2 . a server 6 receives a video source 1 and encodes the video source with a video encoder 2 . it is encoded into a full resolution stream and a low resolution stream . the streams can be received at a video receiver 4 through an internet protocol network 3 . the video receiver 4 can decode the stream . when decoded a stream is sent to a video display that displays the video . a video receiver 4 according to the embodiment is illustrated in fig3 . a front end 41 selects a signal received at a given frequency and transmits this signal in baseband to a demultiplexer 42 which extracts there from a digital data stream , for example according to the mpeg standard . this data stream is then translated into a video signal and into an audio signal by an audio / video decoder 47 . as illustrated the demultiplexer extracts a video in a full resolution that is sent to a first buffer 43 . it also extracts a video in a low resolution that is sent to a second buffer 44 . the decoder 47 may access either the first or the second buffer . this is controlled and managed by a decoding controller 45 . the decoding controller is adapted to carrying out the arbitration between the buffered decompressed pictures to be decoded , according to the compressed pictures type ( i , p , b ), the decoding time stamps ( dts ) and presentation time stamps ( pts ) of the access unit and the system time clock ( stc ) slave 46 to the program clock reference ( pcr ). the decoding controller reads these values in the compressed pictures header . it selects a picture to decode according to the method described herein below . it also selects the buffer that is made accessible to the decoder . the pictures that are not decoded are removed from the buffer . the selected picture is then sent to the video decoder . when decoded , the video is buffered 48 before being sent to a display device 5 . according to the embodiment , the receiver comprises a decoder . in an alternative , the decoder could be comprised in another device . the receiver then arbitrates in a same manner the pictures that are transmitted to the decoder for being decoded and transmitted to the display . fig4 depicts a channel change process illustrating the waiting time before an i - frame is received and the video decoder buffer delay . the receiver device starts receiving data for the new service from the “ zap ” arrow point , which is around the middle of a compressed “ i ” picture . the decoder buffer delay for a given access unit is noted δ pcr / pts . this is the delay of the pcr at the beginning of the decoder buffer loading of an access unit with respect to its presentation time stamp ( pts ) which represents the time that decoded access unit will be rendered . here , the compressed “ i ” picture with pts = 20 is sent before the pcr = 20 packet , and their relative time difference is δ pcr / pts . the decoder buffer delay δ pcr / pts is implicitly related to the end - to - end delay , from the input of the encoder to the output or presentation of the decoder , which is defined in the standard iso / iec 13818 - 1 amendment 5 dated 2005 on “ information technology — generic coding of moving pictures and associated audio information : systems ”, noted iso / iec 13818 - 1 hereinafter . it is a constant value determined by the encoding process . the encoder ensures that a given access unit of the stream can be decoded with a decoder buffer size fixed to δ pcr / pts . in other words it ensures that no access unit will buffer more than δ pcr / pts . the δ pcr / pts is generally not longer than the gop length . in fig4 , when the receiver changes channel , it first waits for the waiting time corresponding to the next compressed “ i ” picture . then when this “ i ” picture is received , it checks the corresponding pts ( pts = 30 ) and has to wait for the decoder “ buffer ” time which corresponds to a pcr = 30 , before starting the picture rendering process . the tune - in companion stream is used to improve the waiting time by configuring a shorter gop . in order to maintain the synchronization of both services presentation , the encoding process configures the gops of the two streams in such a way that they remain aligned with respect to the pcr . moreover the encoding process of the two services is based on the same constant end - to - end delay , which means that the delay from the input to the encoder to the presentation from the decoder of the two services is the same . fig5 depicts an original lmb service with an additional “ tune - in ” companion service , carried respectively in the full and low resolution streams . in this example the tune - in companion service has a gop length which is half the length of the full resolution stream . when the receiver changes or selects a channel , it waits for the waiting time corresponding to the next compressed “ i ” picture , in both the full - resolution and the low - resolution streams . as indicated in fig5 most of the time the first compressed “ i ” picture found is the low - resolution one . then the buffer is filled normally until the rendering of the low resolution stream can start , the decoder “ buffer ” time . this is indicated in fig5 by the “ start rendering ” arrow which indicates the rendering of low resolution compressed “ i ” picture with a pts = 25 , carried out when pcr = 25 . compared to fig4 , the waiting time has been reduced . finally the “ switch ” arrow at pcr = 30 shows when the full resolution stream is ready to be presented ; this is equivalent to the “ start rendering ” arrow in fig4 . at this time the low - resolution video is no longer rendered . the companion stream can be disconnected from by the receiver . the full - resolution video is displayed . the channel change phase is finished . fig6 depicts the tune - in companion service and an original lmb service carried respectively in the low and full resolution streams . each service has its own encoding constraints . the original lmb service is encoded with a constant end - to - end delay noted “ end - to - end - delay - full - res ” which leads for a given access unit to the decoder buffer delay “ δ pcr / pts full - res ”. the tune - in companion service is encoded with a shorter constant end - to - end delay “ end - to - end - delay - low - res ” which leads for a given access unit to the decoder buffer delay “ δ pcr / pts low - res ”. in order to maintain synchronization during the presentation of both services , the tune - in companion service is delayed as compared to the original service before the encoding process . the value of the delay is equal to the difference between the values of the end - to - end delay used during the encoding process of each of the two streams : “ end - to - end - delay - full - res ”-“ end - to - end - delay - low - res ”. indeed it is known from iso / iec 13818 - 1 that the end - to - end delay is a constant value . so when the low resolution stream is encoded with a lower end - to - end delay compared to the full resolution stream , the pictures in the low resolution stream are presented before the corresponding pictures of the full resolution stream . then to synchronize the presentation of the two streams it is necessary to delay the low resolution stream compared to the full resolution stream . delaying it before the encoding process allows encoding the two streams with the same system time clock ( stc ), keeping the pcr alignment between the full resolution and the delayed low resolution streams . in fig6 , the compressed “ i ” picture with pts = 20 of the two streams are not transported in a synchronized way anymore . after being buffered in the video decoders they resynchronize themselves because the buffer decoder delays configured by the encoder are such as the difference between the end - to - end delays used to encode them equals the transport delay . when the receiver changes or selects a channel , it first waits for the waiting time corresponding to the next compressed “ i ” picture that is found in the low resolution stream . then it fills the video decoder buffer and waits for the “ δ pcr / pts low - res ” decoder buffer time that is shorter than the “ δ pcr / pts full - res ”. this is indicated in fig6 by the “ start rendering ” arrow which indicates the rendering of the low resolution compressed “ i ” picture with a pts = 20 , carried out at pcr = 20 . compared to fig5 , the buffer time has been reduced . finally the “ switch ” arrow at pcr = 30 is the same as in fig4 . the companion tune - in service is presented during a longer time to the end - user : this is because the presentation of the new service is much faster . the decoding controller performs the selection between the full resolution stream and the low resolution stream as illustrated in fig5 and 6 . the full and low resolution streams are stored in respective buffers . the controller selects the appropriated picture to be decoded so that this picture is sent to the decoder . a decoding arbitration strategy according to the embodiment is illustrated in fig7 . after a channel change request , the receiver stops receiving the old service and performs the necessary actions to receive and buffer the new original service , the one encoded in full resolution , and its tune - in companion service , the one encoded in low resolution . then the receiver waits for a compressed “ i ” picture to be decoded in both services streams ( step 1 . 1 ). if the first compressed “ i ” picture to be decoded ( step 1 . 2 ) belongs to the original service stream ( step 2 . 1 ), the receiver stops to process the tune - in companion service , processes the original service and the channel change is effective . if the first compressed “ i ” picture to be decoded ( step 1 . 2 ) belongs to the companion service stream ( step 2 . 2 ) the receiver begins to decode that picture and continues to process that stream until a compressed “ i ” picture in the original stream has to be decoded ( step 4 . 2 ). if the compressed “ i ” picture of the original stream has to be presented in the next time slot ( pts = dts + 1 / frame rate ) ( step 5 . 1 ) then the original stream is processed . otherwise ( step 5 . 2 ) the decoding of this compressed “ i ” picture is delayed up to the time slot ( 1 / frame rate ) just before their presentation and during this time the tune - in companion service is decoded . when arbitration between compressed pictures of the two streams to be decoded is necessary and the compressed picture of the original service is chosen , the corresponding picture of the tune - in service is deleted from its buffer . in this case the presented picture in a time slot where no decode picture is available leads to the presentation of the previous decoded picture . fig8 illustrates the way the decoding conflicts are managed in the receiver of the embodiment . it shows the same streams as the one indicated in fig1 . the decoding process is different , which conducts to a different display order . this fig8 also shows that when any decoded picture is available in a time slot of the tune - in companion stream then the strategy to present the previous decoded picture is adopted . in the last two examples , there is no conflict when switching from the low resolution stream to the full resolution one . this is due to the fact that the first i - frame of the full resolution stream is presented in the time slot following the one in which this frame is decoded . and , the frame of the low resolution stream to be presented during the time slot the decoder decodes the first i - frame of the full resolution stream is already decoded . in the third example , in the time slot the decoder decodes the high resolution “ i 11 ” frame , it is presenting the low resolution “ p 10 ” frame which is already decoded . after this last frame , the decoder presents the high resolution “ i 11 ” frame . consequently the switch between both streams is seamless . in the first two examples , the switch is achieved seamlessly with the decoder . the first example is further illustrated in fig9 that also shows the time slots 1 to 19 . the user performs a channel change after the high resolution “ i 1 ” frame was delivered but before the low resolution “ i 7 ” frame was received by the decoder . the decoder decodes respectively the low resolution frames “ i 7 ”, “ p 10 ”, “ b 11 ” and “ b 12 ” during the time slots 7 , 10 , 11 and 12 and presents them respectively during the time slots 10 , 13 , 11 and 12 . then the decoder receives the high resolution i - frame “ i 13 ” that should be decoded during time slot 13 as well as the low resolution i - frame “ i 13 ”. only one of them is decoded during this time slot . the decoding controller checks if the high resolution “ i 13 ” frame should be presented during the next time slot , i . e . time slot 14 . as “ i 13 ” should be presented during time slot 16 and not during time slot 14 , the decoding controller makes the decoder decoding the low resolution “ i 13 ” frame . it also delays the high resolution “ i 13 ” frame decoding . during this time slot the decoder presents the low resolution “ p 10 ” frame . when the time slot 14 starts , the decoding controller checks if the high resolution “ i 13 ” frame should be presented during the next time slot , i . e . time slot 15 . as it should not be presented , the decoding controller makes the decoder decoding the low resolution “ b 14 ” frame and delays the high resolution “ i 13 ” frame decoding . during this time slot the decoder presents the low resolution “ b 14 ” frame . when the time slot 15 starts , the decoding controller checks if the high resolution “ i 13 ” frame should be presented during the next time slot , i . e . time slot 16 . as it should be presented , the decoding controller makes the decoder decoding this frame and stops making decoding the low resolution stream . during this time slot , the decoder has no decoded frame to present as both low resolution and high resolution “ b 15 ” frames were not decoded . the decoder manages this transition by repeating during a second time slot the low resolution “ b 14 ” frame . the end user sees the same frame during 2 frame periods . of course , if the decoder stops decoding the low resolution stream as soon as the high resolution i - frame should be decoded , during time slot 13 in fig9 , the same low resolution “ p 10 ” frame is displayed during three frame periods . alternatively the transition is not managed by the decoder but by the controller . the controller indicates to the decoder that it should present the last decoded frame again . references disclosed in the description , the claims and the drawings may be provided independently or in any appropriate combination . features may , where appropriate , be implemented in hardware , software , or a combination of the two . reference herein to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment can be included in at least one implementation of the invention . the appearances of the phrase “ in one embodiment ” in various places in the specification are not necessarily all referring to the same embodiment , nor are separate or alternative embodiments necessarily mutually exclusive of other embodiments . reference numerals appearing in the claims are by way of illustration only and shall have no limiting effect on the scope of the claims .	7
fig5 is a circuit diagram showing an active matrix panel according to a first embodiment of the present invention . in fig5 numeral 10 indicates a display area where a plurality of scanning lines s 1 , s 2 . . . and a plurality of data lines d 1 , d 2 . . . are arranged in such a manner that they are perpendicular to each other , and near the points of intersection , tfts 101 , 102 . . . are formed . a gate electrode of the respective tfts is connected to the respective scanning lines ( s 1 . . . sn ) and a drain electrode is connected to the respective data lines ( d 1 . . . dn ). on the other hand , each source electrode of the tfts 101 , 102 . . . is connected to respective pixel electrodes 111 , 112 . . . which are arranged in the form of matrix , and liquid crystal is sealed in between the pixel electrodes and common electrodes ( coms ) which are arranged facing to each other . in this panel , a scanning line drive circuit and a data line drive circuit 3 are built in together with the display area , and scanning line signals are supplied to the scanning lines s 1 , s 2 . . . from the scanning line drive circuit which is not shown in the drawings . further , the data line drive circuit 3 is comprised six color video signal lines 1 r , 1 g , 1 b , 2 r , 2 g , and 2 b for receiving two series of rgb color video signals in the panel ; switching elements 11 , 31 . . . for connecting the data lines d 1 , d 7 . . . to the color video signal line 1 r ; switching elements 12 , 32 . . . for connecting the data lines d 2 , d 8 . . . to the color video signal line 1 g ; switching elements 13 , 33 . . . for connecting the data lines d 3 , d 9 . . . to the color video signal line 1 b ; switching elements 21 , 41 . . . for connecting the data lines d 4 , d 10 . . . to the color video signal line 2 r ; switching elements 22 , 42 . . . for connecting the data lines d 5 , d 11 . . . to the color video signal line 2 g ; switching elements 23 , 43 . . . for connecting the data lines d 6 , d 12 . . . to the color video signal line 2 b ; and a drive pulse generating circuit 6 comprising a series of shift register 60 for sequentially generating drive pulses pc 1 , pc 2 , pc 3 . . . in response to clock signals clks . drive pulse pc 1 at the first stage of the shift register 60 is applied to the switching elements 11 , 12 , and 13 , drive pulse pc 2 at the next stage is applied to the switching elements 21 , 22 , and 23 , and the same processes are subsequently repeated . in other words , the respective drive pulses at different stages of the shift register are applied to each three switching elements . more specifically , the drive pulses pc 1 , pc 3 . . . at odd stages of the shift register 60 are applied to each three switching elements of the same series which are connected to the first series of video signal lines 1 r , 1 g , and 1 b . the drive pulses pc 2 , pc 4 . . . at even stages of the shift register 60 are applied to each three switching elements of the same series different from the above - mentioned series which are connected to the second series of video signal lines 2 r , 2 g , and 2 b . here , the shift register 60 is constituted such that a latch circuit which operates in response to a rise of clock signal clk and a latch circuit which operates in response to a fall of clock signal clk are alternately connected . a start signal sth which becomes high level for about one cycle of the clock signal clk is input to an input terminal at the first stage . the clock signal clk is used for determining timing of writing each signal corresponding to a pixel into crystal liquid , synchronizes with a dot clock , and its cycle is set to be six times that of the dot clock . first , a case of applying the panel to the three dots corresponding system will be described . in this case , as shown in fig9 at the exterior of the panel , there are provided the sample hold circuit 100 for a series of rgb color video signals for sequentially sampling each rgb color video signal and simultaneously outputting hold signals for a prescribed period , and the inversion amplifier 200 for amplifying each rgb signal which has under gone sample hold , and outputting the signals after inverting them at every horizontal and vertical period . there is also provided an external color video signal line 210 for branching a series of three outputs from the inversion amplifier 200 into two series of six outputs and leading them out to the panel . it is arranged so that six outputs from the external color video signal line 210 are input to the six color video signal lines ir , 1 g , 1 b , 2 r , 2 g , and 2 b in the panel . in the sample hold circuit 100 , the sample hold circuits 101 , 102 , 103 perform sample hold of the respective analog color signals r , g , and b to be input at a timing which is successively delayed by one third of the cycle of clock signal clk in response to sampling clocks ckr , ckg , and ckb which are shown by waveforms ( a ), ( b ), and ( c ) in fig6 . further , sample hold circuits 104 and 105 further perform sample hold of output of the sample hold circuits 101 and 102 at the same timing as that of the sample hold circuit 103 in response to the sampling clock ckb which is shown by waveform ( c ). thus , rgb video signals equivalent to three dots vr 1 , vg 1 , and vb 1 which constitute one pixel are simultaneously input to the first series of color video signal lines 1 r , 1 b , and 1 g in the panel , as shown by a waveform ( j ) in fig6 . these video signals are held for a half cycle of the clock signal clk , and afterward new video signals are input every half cycle . further , since the external video signal line 210 merely branches the same video signal , as shown by a waveform ( k ) in fig6 video signals vr 2 , vg 2 , and vb 2 identical to the video signals vr 1 , vg 1 , and vb 1 are input to the second series of color video signal lines 2 r , 2 b , and 2 g in the panel , too . on the other hand , when a start signal sth as shown by waveform ( e ) in fig6 is input to the shift register 60 , a drive pulse pc 1 from the first stage becomes high level in response to a rise of the clock signal clk as shown by waveform ( f ) in fig6 and the high level is maintained for a cycle of the clock signal clk . further , in response to a fall of the clock signal clk , a drive pulse pc 2 from the next stage becomes high level as shown by a waveform ( g ) in fig6 and the high level is maintained for a cycle of the clock signal clk . the same processes are repeated , or , in other words , respective drive pulses pc 3 , pc 4 . . . which become high level for a cycle are sequentially output at every half cycle of the clock signal clk , as shown by waveforms ( h ) and ( i ) in fig6 . as described above , among these drive pulses , drive pulses from odd stages pc 1 , pc 3 . . . are applied to each three switching elements which are connected to the first series of video signal lines 1 r , 1 g , and 1 b , and drive pulses from even stages pc 2 , pc 4 . . . are applied to each three switching elements which are connected to the second series of video signal lines 2 r , 2 g , and 2 b . therefore , during a period t 1 of the drive pulse pc 1 being high level , three switching elements 11 , 12 , and 13 are turned on and three dots video signals o 1 from the first series of video signal lines 1 r , 1 g , and 1 b are supplied to the data lines d 1 , d 2 , and d 3 . and , during the next period t 2 of the drive pulse pc 2 of being high level , three switching elements 21 , 22 , and 23 are turned on and three dot video signals o 2 from the second series of video signal lines 2 r , 2 g , and 2 b are supplied to the data lines d 4 , d 5 , and d 6 . similarly , when drive pulses pc 3 , pc 4 . . . sequentially become high level , the first and second series of each three dots video signals are alternately supplied to the respective corresponding data lines . here , although two series of video signal lines are provided in the panel , video signals for the same dot are input to the first and second series of signal lines ( vr 1 = vr 2 , vg 1 = vg 2 , and vb 1 = vb 2 ), and therefore new video signals are inputted to each video signal line at every three dots . in other words , driving by the three dots corresponding system is realized . next , a case which the panel is applied to a six dots corresponding system will be described . here , when , for example , for the purpose of displaying computer graphics , video signals to be input are 8 - bit - per - dot digital signals and three dots rgb video signals corresponding to one pixel are simultaneously supplied . in this case , as shown in fig1 , at the exterior of the panel are provided a sample hold circuit 600 for two series of rgb color video signals for sequentially sampling each series of rgb color video signals and outputting hold signals equivalent to three dots at different timing , a d / a converter 400 for converting digital signals equivalent to six dots from the sample hold circuit 600 into analog signals , and an inversion amplifier 500 for amplifying the converted analog signals equivalent to six dots and outputting the signals after inverting them at every horizontal period and vertical period . it is arranged so that six outputs of the amplifier 500 are input to six color video signal lines 1 r , 1 g , 1 b , 2 r , 2 g , and 2 b in the panel . the sample hold circuit 600 comprises d flip flops 601 , 602 , and 603 equivalent to three dots for sample hold input digital video signals in response to a sample clock ck 1 and d flip flops 604 , 605 , and 606 equivalent to three dots for sample hold input digital video signals in response to a sample clock ck 2 . further , as shown by waveforms ( 1 ) and ( n ) in fig6 the sample clock ck 1 is identical to the clock signal clk shown by the waveform ( d ) and the sample clock ck 2 is an inverted clock signal clk . thus , as shown by a waveform ( m ), three dots rgb video signals vr 1 , vg 1 , and vb 1 which constitute one pixel are simultaneously input to the first series of color video signal lines 1 r , 1 b , and 1 g in the panel in response to a rise of the sample clock ck 1 . these video signals are held for a cycle of the clock signal clk and then new video signals are input at every cycle . further , as shown by a waveform ( o ) in fig6 , three dots rgb video signals vr 2 , vg 2 , and vb 2 which constitute one pixel are simultaneously input to the second series of color video signal lines 2 r , 2 b , and 2 g , in the panel in response to arise of the sample clock ck 2 . these signals are held for a cycle of the clock signal clk , and then new video signals are input at every cycle . therefore , during the period t 1 of the drive pulse pc 1 being high level , three switching elements 11 , 12 , and 13 are turned on , and three dots video signals o 1 from the first series of video signal lines 1 r , 1 g , and 1 b are supplied to the respective corresponding data lines d 1 , d 2 , and d 3 . during the next period t 2 of the pc 2 being high level , three switching elements 21 , 22 , and 23 are turned on , and three dots video signals o 2 from the second series of video signal lines 2 r , 2 g , and 2 b are supplied to the respective corresponding data lines d 4 , d 5 , and d 6 . similarly , when drive pulses pc 3 , pc 4 . . . sequentially become high level , the first and second series of video signals equivalent to three dots are alternately supplied to the respective corresponding data lines . here , since the sample hold circuit 600 performs sampling at different timing at intervals of one pixel ( rgb signals equivalent to three dots ), unlike the circuit shown in fig9 video signals corresponding to different pixels are input to the first and second series of video signal lines in the panel . therefore , new video signals are input to each of the video signal lines only at every six dots . in other words , driving by the six pixel corresponding system can be realized and this system enables optimum graphics display . with respect to the constitution of a circuit shown in fig5 since the drive pulse generating circuit 6 is comprised one series of shift register 60 , it is necessary to operate the shift register 60 using high speed clock signals clks . if it is difficult to do so , the drive pulse generating circuit 6 may be composed of a plurality of series of shift registers . fig7 shows an example drive pulse generating circuit 6 comprises two series of shift registers 61 and 62 . in this example , the constitution of the respective shift registers is nearly identical to that of the shift register 60 , and the frequency of clock signals ck 1 , ck 2 and the start signal sth to be applied is half as much as that of the signals to be applied the shift register 60 . further , and gates 63 , 65 . . . which calculate logical product of an output are provided at a certain stage and an output at the next stage of the shift register 61 , and these outputs are intended to be drive pulses pc 1 , pc 3 . . . for the switching elements connected to the first series of video signal lines 1 r , 1 g , and 1 b . similarly , and gates 64 and 66 . . . which calculate product of an output are provided at a certain stage and an output are provided at the next stage of the shift register 62 , and these outputs are intended to be drive pulses pc 2 , pc 4 . . . for the switching elements connected to the second series of video signal lines 2 r , 2 g , and 2 b . with the constitution described above , as shown by the waveform ( d ) in fig8 from each stage of the first series of shift register 61 , outputs pd 1 , pd 2 , pd 3 . . . whose pulse width is equivalent to one cycle of the clock signal ck 1 , namely , two cycles of the clock signal clk are sequentially output synchronizing with a rise of the clock signal clk . further , as shown by waveforms ( h ) to ( j ) in fig8 from each stage of the second series of shift register , outputs pe 1 , pe 2 , pe 3 . . . whose pulse width is equivalent to one cycle of the clock signal ck 2 , namely , two cycles of the clock signal clk are sequentially output synchronizing with a fall of the clock signal clk . thus , as shown by waveforms ( k ), ( l ), ( m ), and ( n ) in fig8 from the and gates 62 , 63 , 64 . . . , drive pulses pc 1 , pc 2 , pc 3 . . . which are identical to those shown by waveforms ( f ), ( g ), ( h ), and ( i ) in fig6 are output . in other words , the drive pulse generating circuit which is composed of two series of shift registers 61 and 62 shown in fig7 only requires a half operating frequency and performs the same operation as that of a series of shift register 60 shown in fig5 . although a circuit having two series of video signal lines has been described above , it may also be preferable to have three or more series of video signal lines .	6
the invention now will be described more fully hereinafter with reference to the accompanying drawings , in which embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . like reference numerals refer to like elements throughout the description of the figures . it will be understood that when an element is referred to as being “ on ” another element , it can be directly on the other element or intervening elements may be present . in contrast , when an element is referred to as being “ directly on ” another element , there are no intervening elements present . it will be understood that when an element is referred to as being “ connected ” or “ coupled ” to another element , it can be directly connected or coupled to the other element or intervening elements may be present . in contrast , when an element is referred to as being “ directly connected or coupled ” to another element , there are no intervening elements present . furthermore , “ connected ” or “ coupled ” as used herein may include wirelessly connected or coupled . as used herein , the term “ and / or ” includes any and all combinations of one or more of the associated listed items . it will be understood that , although the terms first , second , etc . may be used herein to describe various elements , these elements should not be limited by these terms . these terms are only used to distinguish one element from another . for example , a first layer could be termed a second layer , and , similarly , a second layer could be termed a first layer without departing from the teachings of the disclosure . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” or “ includes ” and / or “ including ” when used in this specification , specify the presence of stated features , regions , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , regions , integers , steps , operations , elements , components , and / or groups thereof . furthermore , relative terms , such as “ lower ” or “ bottom ” and “ upper ” or “ top ,” may be used herein to describe one element &# 39 ; s relationship to other elements as illustrated in the figures . it will be understood that relative terms are intended to encompass different orientations of the device in addition to the orientation depicted in the figures . for example , if the device in one of the figures were turned over , elements described as being on the “ lower ” side of other elements would then be oriented on “ upper ” sides of the other elements . the exemplary term “ lower ”, can therefore , encompass both an orientation of “ lower ” and “ upper ,” depending of the particular orientation of the figure . similarly , if the device in one of the figures is turned over , elements described as “ below ” or “ beneath ” other elements would then be oriented “ above ” the other elements . the exemplary terms “ below ” or “ beneath ” can , therefore , encompass both an orientation of above and below . unless otherwise defined , all terms ( including technical and scientific terms ) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . it will be further understood that terms , such as those defined in commonly used dictionaries , should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and the present disclosure , and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein . embodiments of the present invention are described herein with reference to cross section illustrations that are schematic illustrations of idealized embodiments of the present invention . as such , variations from the shapes of the illustrations as a result , for example , of manufacturing techniques and / or tolerances , are to be expected . thus , embodiments of the present invention should not be construed as limited to the particular shapes of regions illustrated herein but are to include deviations in shapes that result , for example , from manufacturing . for example , a region illustrated or described as flat may , typically , have rough and / or nonlinear features . moreover , sharp angles that are illustrated may be rounded . thus , the regions illustrated in the figures are schematic in nature and their shapes are not intended to illustrate the precise shape of a region and are not intended to limit the scope of the present invention . in the description , a term “ substrate ” used herein may include a structure based on a semiconductor , having a semiconductor surface exposed . it should be understood that such a structure may contain silicon , silicon on insulator , silicon on sapphire , doped or undoped silicon , epitaxial layer supported by a semiconductor substrate , or another structure of a semiconductor . and , the semiconductor may be silicon , germanium , indium gallium arsenide ( ingaas ), or lead sulfide . ingaas is a semiconductor composed of indium gallium arsenic . other combinations thereof , may not be used in combination but not limited to the above . in addition , the substrate described hereinafter may be one in which regions , conductive layers , insulation layers , their patterns , and / or junctions are formed . as stated in wikipedia , a photodiode is a type of photodetector capable of converting light into either current or voltage , depending upon the mode of operation . when used in zero bias or photovoltaic mode , the flow of photocurrent out of the device is restricted and a voltage builds up . the diode becomes forward biased and “ dark current ” ( internally generated current ) begins to flow across the junction in the direction opposite to the photocurrent . this mode is responsible for the photovoltaic effect which is the basis for solar cells . as further stated in wikipedia , in the photoconductive mode , the diode is often reversed biased dramatically reducing the response time at the expense of increased noise . this increases the width of the depletion layer , which decreases the junction &# 39 ; s capacitance resulting in faster response times . the reverse bias induces only a small amount of current ( known as saturation or back current ) along its direction while the photocurrent remains virtually the same . the photocurrent is linearly proportional to the illuminance . one facet of the invention , which is simply an option , is to build the led and solar cell using a common substrate . in so doing , the device becomes more integral for stability and lighter for energy conservation . for example , shown in fig1 are the semiconductor layers forming a photodiode . as reported in science daily , in an article titled “ advance brings low - cost , bright led lighting closer to reality ,” jul . 21 , 2008 , a new breakthrough in solid state lighting led solid - state lights on regular metal - coated silicon wafers . inside a reactor , gallium nitride is deposited on silicon at temperatures of about 1 , 000 degrees celsius , or 1 , 800 degrees fahrenheit . in the new silicon - based led research , the purdue engineers “ metallized ” the silicon substrate with a built - in reflective layer of zirconium nitride . ordinarily , zirconium nitride is unstable in the presence of silicon , meaning it undergoes a chemical reaction that changes its properties . the purdue researchers solved this problem by placing an insulating layer of aluminum nitride between the silicon substrate and the zirconium nitride . fig1 is a side view of a preferred embodiment of the present invention . the assembly shown in fig1 is a preferred embodiment assembly 10 comprising solar panel support surface 2 , led support 3 , central portion 4 , cover 5 , wind direction detector 7 , and motor / generator 9 . it can be readily appreciated by those of ordinary skill in the art that the solar support surface 2 may comprise one or a plurality of panels 2 p and may take a variety of forms , such as circles , squares , rectangles or arcuate sections . the solar panels 2 may range in dimensions from 1 inch by one inch to two square feet depending on the application , power requirements , and resources available . the led support 3 is shown as a “ disk ” but can be any configuration or form . led support 3 supports led 3 l ; which may be a plurality of up to 50 depending on the intensity desired . moreover , the selection of leds 3 l is exemplary and any type of light may be used without departing from the scope of the invention . the function of the solar support 2 and led support 3 may be combined and a single support may perform both functions . additionally , the solar support 2 and led support 3 as well as solar diodes 2 s and leds 3 l may be one integral unit . inasmuch as both leds 3 l and photodiodes 2 s comprise substrates , a preferred embodiment utilizes the same substrate for both the photodiode and leds . in this regard , the leds 3 l may be formed using , for example , a sapphire substrate . the same substrate may be used for the photodiode configuration . by doing so , the assembly weight and material requirements are reduced . moreover , an integral unit comprising the solar support 2 and led support 3 provides for ease of assembly and greater strength and durability . assembly 10 further comprises vanes 6 mounted on the support 3 . the vanes may be plastic or aluminum or any material which provides a light weight , durable , rigid construction . the vanes cause the support 3 to turn in response to the force of the wind . wind screen 5 is substantially semicircular in configuration and shields one side of the led support 3 while the other side is subjected to the wind . wind screen 5 is rotatably mounted and is controlled by central vane 7 which responds to wind direction . in addition , led support 3 is operatively attached to central portion 4 so as to rotate as motor / generator 9 turns , as will be described later . as shown in fig2 , the wind screen covers half of the vanes 6 so that the force applied by the wind to the vanes cases them to turn in a single direction . other configurations which achieve this result are contemplated within the scope of the invention . the wind screen is substantially clear so as to allow the sun rays to penetrate to the solar panels 2 . optionally the vanes 6 may be solar panels or mirrors that form the blades of the wind turbine . on the opposite side to solar panels 2 s , led support 3 may comprise additional vanes 6 which mirror or focus light from the led support 3 . in other words , mirrors operate to focus light onto solar panel as well as focus light onto subject area . turning of turbine creates strobe effect to decrease light energy being used . the turbine blades 6 are optionally adjustable so that maximum wind speed does not damage generator / battery charger and / or structural supporting structure . shown in fig3 is a preferred embodiment in which the vanes 6 are positioned between the solar panels 2 and led support 3 . this configuration effectively channels the wind between the solar panels 2 and led structure . the wind dissipates the heat energy given off by the leds so as to facilitate cooling or temperature control . in the absence of wind , the vanes 6 may be turned by motor 9 to facilitate cooling . fig3 further shows a side view of the led support 3 , photodiodes or solar panels 2 , wind screen or cover 5 and wind directional vane 7 , wind directional vane 7 operates in a manner similar to a weather vane in that it points in the wind direction . wind directional vane 7 may be a variety of configurations the directional vane 7 and wind screen form an integral unit and are designed so the weight is evenly distributed each side of the axis of rotation , but the pointer can move freely on its axis . the area of the directional vane 7 is distributed so that the side with the larger area is blown away from the wind direction . the optional directional pointer may be mounted such that is always on the smaller side . for the wind direction reading to be accurate , the directional vane must be located well above the ground and away from buildings , trees , and other objects which interfere with the true wind direction . but the same is not necessary for the basic functioning of the assembly 10 . shown in fig4 is a “ see - through view ” showing the overlay of the photodiode panels 2 vis - à - vis the led support 3 , and the central pivot or rotating shaft - like portion or housing 4 . these elements are not intended to be transparent , but are shown as being transparent for illustrative purposes only . although four panels 2 occupying quarter sections are shown in fig4 , any number of panels may be utilized . the panels may be shaped in the form of a rectangle , square , circle , arcuate segment or can be solid or contain holes for the passage of air . fig5 illustrates the support 3 which can be rotatably attached to a central shaft . the led segments 3 a or blocks may be of any configuration and the four arcuate segments are but an example of a variety of possible configurations . led modules which are commercially available may be placed on the led support 3 in a conventional manner . fig5 illustrates an optional shaft 4 s , housing 4 , key 8 k and solenoid 8 s . when solenoid 8 s is energized , the central portion of the solenoid 8 s engages the key 8 k in the shaft 4 s causing the shaft to turn with the support 3 . fig5 a is an overhead illustration of a cut - away view of led support 3 illustrating optional vanes 6 a which can be used to propel rotation of the support 3 and provide an additional cooling effect . optionally , cover 5 may cover one half the circumference of vanes 6 a so that the wind imparts only vanes turning in the direction of the wind . shown in fig6 is a plan view of a preferred embodiment of the present invention . as shown in fig6 , for a prevailing wind direction from right to left ( as shown in the figure ) the wind direction detector 7 would point to the left and the cover 5 would cover half of the vanes 6 so that the support 2 and the support 3 would turn in a counterclockwise direction on central portion 4 . central portion 4 may be a shaft which is operatively connected to shaft 11 and motor / generator 9 . although four vanes ( or eight vane segments are shown in fig6 , any number of vanes could be used to enable the wind to propel or rotate the subassembly . shown in fig7 is a plan view of a preferred embodiment of the present invention . as shown in fig7 , for a prevailing wind direction from bottom to top ( as shown in the figure ) the wind direction detector 7 would point to the top and the cover 5 would cover half of the vanes 6 so that the solar panels 2 and the led support 3 would turn in a counterclockwise direction on central portion 4 . central portion 4 may be a shaft which is operatively connected to shaft 11 and motor / generator 9 . although four vanes ( or eight vane segments are shown in fig7 , any number of vanes could be used to enable the wind to propel or rotate the subassembly . shown in fig8 is a plan view of a preferred embodiment of the present invention . as shown in fig8 , for a prevailing wind direction from bottom left to top right ( as shown in the figure ) the wind direction detector 7 would point to the top right and the cover 5 would cover half of the vanes 6 so that the solar panels 2 and the support 3 would turn in a counterclockwise direction on central portion 4 . although the cover 5 is shown as solid and not transparent to like , the cover 5 may be transparent or translucent to allow passage of sunlight to panels 2 . shown in fig9 is a preferred embodiment subassembly that is an optional portion of the invention . the subassembly comprises a central portion 4 which is operatively connected to a shaft 11 , which may be solid or hollow . although only a portion of the support 3 is shown in fig9 , it can be appreciated that the support 3 extends outward from the portion shown in fig9 . in an optional embodiment , the shaft 11 has a first electrical contact which may be a metal such as copper , gold , silver or aluminum . as the support 3 turns on the shaft 11 , a second electrical contact 8 b makes intermittent electrical connection with the contact 8 a . when powering the leds through this contact , a strobe - like effect is achieved when the leds are turned on and off as intermittent contact is made through the connection of contacts 8 a and 8 b . the contact portion 8 b may be adjustable thought the expansion and contraction of the area of the contact 8 b . this strobing effect conserves energy and creates a decorative effect . in an embodiment in which the battery level is monitored , when the battery reaches a low charge level , the assembly may automatically be switched to a mode in which the leds are flashed on and off in the strobe mode to conserve energy from the battery . optionally , controller 21 may control the operation of contacts 8 a , 8 b and shaft 11 . moreover , the shaft and support 3 may have an integral setting or mode in which the support 3 is substantially locked ( such as for example by a solenoid 8 s ) so as to turn integrally with the shaft 11 . this may be accomplished mechanically , such as by using a sliding pin , or remotely such as by using magnetism to lock the contacts 8 a , 8 b in place . when the contacts are locked into position freely relative to one another , in this mode , the contacts 8 a and 8 b remain in direct contact as the shaft 11 turns . alternately , the shaft 11 may turn freely in one direction , yet be prevented from turning in another such as by a rachet - type system well known to those of ordinary skill in the art . contacts 8 a and 8 b are merely examples of a strobe element which function may be perform by other means which cause power to the leds 3 l to be intermittent . the strobe element may be controlled through the use of programmable controller 21 . shown in fig1 is an example of a preferred embodiment support 3 section and led modules 3 l . more specifically , conventional led modules 3 l are shown . the modules may be connected to the battery 13 in a conventional manner . any variety or type of led may be used without departing from the scope of the invention . fig1 is a schematic side view of a preferred embodiment of the present invention in which assembly 10 c comprises support 3 , solar panels 2 , cover 5 , and wind direction vane 7 . motor - generator 9 is pivotally mounted by supports 14 . each of supports 14 are attached to a pivot or shaft or pivot 15 . shaft or pivot 15 is in turn driven by a motor ( shown in fig1 b ) inside housing 12 which causes the entire assembly 10 c to pivot as shown in fig1 . as a result the solar support 2 and elements 2 s on the assembly 10 c can track the sun as it rises in the east and sets in the west . for example , a motor 16 slowly turns the pulley which drives the belt resulting in the angular disposition of the elements 2 s . fig1 b is a schematic showing the inside of housing 12 , which may for example comprise a motor 16 , timer 18 and belt 17 which drives a pulley 15 p mounted on shaft 15 to drive the pivoting of the subassembly shown in fig1 . timer 18 is set so that the solar cells 2 s will face in a predetermined direction at a predetermined time in order to maximize the sunlight or environmental light on the solar panels , elements , or diodes 2 s . the timer 18 activates the motor 16 which drives belt 17 to drive pulley 15 p on pivot or shaft 15 that causes the entire assembly 10 to pivot . as a result the solar elements 2 s on the assembly 10 can track the sun as it rises in the east and sets in the west . fig1 is an illustration of an alternate solar panel assembly 2 sa comprising a positive grid , n - type layer , active section , p - type layer and metal electrode . the solar element is connected to the circuit 20 and battery 13 as described herein . fig1 is an illustration of an alternate solar panel assembly 2 sb comprising a negative grid , p - type layer , active section , n - type layer and metal electrode . the solar element is connected to the circuit 20 and battery 13 as described herein . fig1 is a schematic illustration of an optional embodiment in which the led and solar cell are integrally formed or combined after manufacture . specifically , shown in fig1 is a top anode or transparent electrode . shown next is a grid , p - type layer , active section , n - type layer , metal electrode ( cathode ), silicon layer , insulating layer of aluminum nitride , built - in reflective layer of zirconium nitride , and gallium nitride . schematically shown in fig1 is circuit subassembly 20 and battery 13 . fig1 is a schematic diagram showing a device 19 for regulating the voltage , controlling the charge into , and / or current from the battery 13 which also may optionally function as an on / off switch which prevents overcharging of the battery 13 and / or effectively removes battery 13 from the circuit 20 a . motor generator 9 operates to recharge battery 13 when in the generator mode and when a low battery indicator 23 indicates the need for a charge . the motor / generator 9 is optional in that the solar diodes may optionally be the sole means for recharging the battery 13 . also , when the motor / generator 9 is operating in the circuit 20 a , in cases where the wind is causing the rotation of the vanes 6 , the battery may be bypassed using device 19 to disconnect the battery from the circuitry entirely . similarly , a device 19 a may optionally be position in series with the motor / generator 9 to disconnect it from the circuitry when desired . as a further option , devices 19 and 19 a may be combined into a combined voltage regulator , charge controller and / or charge level indicator . when the battery is determined to be low , ( from optional low battery indicator 23 or the function could be incorporated into the power controller / regulator 19 ) the contacts 8 a , 8 b may be positioned such that the contacts are only intermittently connected to create a strobe - like effect for the activation of the leds 3 l . similarly , temperature sensor 22 may be operatively connected to the contacts 8 a , 8 b shorten the contact duration through contacts 8 a , 8 b or optionally may operate to open the optional switch 16 l to prevent over heating of the leds 3 l , and / or activate motor / generator 9 to rotate the support 3 to create a cooling effect . moreover , alternatively the light detector 25 ( such as commonly used part 2n3904 ) may operate to turns the leds on and off at daylight and dusk either by sensing the intensity of light from the sun and / or environment or by a timer which turns the led on and off at specified times and also be responsive to the temperature sensor . fig1 is a schematic diagram showing circuitry 20 b comprising an optional controller 21 , with control lines represented by dashed lines . controller 21 may be a microprocessor , programmable controller , processor , programmable chip device , computer , microcomputer , controller or the like . controller 21 may receive control signals from the low battery indicator 23 and , in turn , regulate the contacts 8 a , 8 b such that the contacts are only intermittently connected to create a strobe - like effect for the activation of leds 3 l . similarly , if temperature sensor 22 sends a high temperature control signal to the controller 21 , controller 21 may send control signals via the control lines to any one of or in tandem open the optional switch 16 l to prevent over heating of the led , activate motor / generator 9 to rotate the support 3 to create a cooling effect , and / or shorten the contact duration through contacts 8 a , 8 b . moreover , alternatively controller 21 may have a light detector which turns the led on and off at daylight and dusk either by sensing the intensity of light from the sun and / or environment or by a timer which turns the led on and off at specified times . moreover the controller 21 may be a programmable controller includes a feedback routine for measuring the intensities of the leds 3 l and using the actual intensities as feedback . optionally , the controller may cause the leds 3 l to be supplied with approximately 50 % of said maximum current capacity or some fraction thereof to either conserve power or reduce the temperature of the leds . optionally , the programmable controller may operate to adjust the intensity , with the programmable controller including an intensity compensation routine for adjusting the intensity of the led , based on the intensity as detected by feedback means . fig1 is a schematic diagram showing the circuitry of a preferred embodiment assembly 20 c comprising an optional controller 21 with control lines being represented by dashed lines illustrating the sending of control signals and receiving of data signals . these control lines may be wired or connect wirelessly such as for example , by bluetooth technology . the circuit assembly 20 c may further comprise an optional remote control and bypass circuitry . shown in fig1 is a controller 21 which is optionally controlled by a remote control 26 . controller 21 , which is optionally programmable , controls switch 17 which causes the motor / generator 9 and battery 13 to become connected to the solar cell and leds 3 l . controller 21 may operate to select one of the motor or generator to rotate the support 3 using the motor mode of motor / generator 9 or select the generator mode in order for the rotation of the support 3 to be used to generate electricity in the generator mode of motor / generator 9 . optionally , the extent of the battery charge may trigger the mode of the motor / generator 9 . such as , for example , if the battery is low , and the wind is causing the support 3 to turn , power from the rotation can be used to generate electricity to power to leds 3 l or for storage into battery 13 . controller 21 is linked by control lines to the low battery indicator 23 . if a low battery is sensed and the solar cells are not in the process of recharging the battery ( such as for example , during nighttime ), the controller , which includes a day / night photosensor , may either disconnect the battery from the led circuitry or cause the leds to flash intermittently through contacts 8 a , 8 b in strobe - like fashion to conserve power . inasmuch as controller 21 is also optionally connected by control lines to motor / generator 9 , if the operator who operates the remote control 26 decides that a turning of the support 3 is beneficial to cause rotation of the leds 3 l , then the operator turns the motor 9 on via the remote control . similarly , the control lines are connected to an optional direct activation circuit which bypasses the photoelectric light detector 25 and turns on the leds 3 l for purposes of testing or daylight operation . optionally , a motion senor 27 may be used to activate the leds 3 l when motion is sensed by the motion sensor 27 . controller 21 may optionally be connected to the motion sensor 27 to deactivate the motion sensor 27 through either programming or through operator activation via the remote control 26 . as depicted in fig1 , an optional controller 19 which may be or include a voltage regulator / charge control that optionally functions as a switch to effectively regulate the charging of the battery 13 , regulate the voltage / current or electrical power being sent to and / or from the battery 13 and / or disconnect the battery 13 from the remaining circuitry . for example , if wind power is driving the wind vanes and producing electric power via the motor / generator 9 and the battery is not in need of a charge , the controller 19 may receive control signals from the controller 21 which effectively opens a switch within controller 19 to remove the battery 13 from the remainder of circuit 20 . if the wind power is available , but either the leds 3 l are nonoperational or power is in excess of that needed to power the leds , then the controller 21 in conjunction with the controller 19 may cause the current generated by the motor / generator 9 to charge the battery 13 . controller 21 may be optionally connected to the motor generator 9 . control signals may be used to set the motor / generator into either the motor mode , which operates to turn the support 3 or in the generator mode whereby rotation of the support 3 drives the generator 9 . controller 21 may be connected to sense the motion of the support 3 to determine if the wind is driving the turbine blades 6 so that power from the generator 9 may be used to either recharge the battery or power the leds . controller 21 may also connected via control lines to temperature sensor 22 . should the temperature being sensed exceed a predetermined temperature above which the circuitry or leds 3 l or solar elements 2 s may be damaged or effected by to much heat , the controller may ( 1 ) turn off the leds , ( 2 ) intermittently activate the leds and / or ( 3 ) cause the motor 9 to rotate support 3 effectively operating as a fan to cool down the leds 3 l . fig5 a is an overhead illustration of a cut - away view of support 3 including led panels 3 a . fig5 a illustrates optional vanes 6 a which can be used to propel rotation of the support 3 and provide an additional cooling effect . optionally , cover 5 may cover one half the circumference of vanes 6 a so that the wind imparts only vanes turning in the direction of the wind . with the vanes placed in the proximity of the leds 3 l , the cooling effect is enhanced . with the optional embodiment shown in fig5 a , the vanes may be placed in the proximity of the leds 3 l to enhance the cooling effect . the leds 3 l shown in fig5 a are merely illustrative as to a potential location of 3 leds 3 l are exemplary and not limiting . the light from the leds 3 l as shown is reflected by the mirrored surfaces of the wind vanes 6 a to either scatter or intensify the light depending upon the nature of the application , environment and purpose of the light . for example , the mirrored vanes may provide a decorative effect or may be used to increase coverage of the light being emitted from the leds 3 l . controller 21 may optionally be programmed to turn on and off certain of the leds 3 l at either specific times or in a specific sequence . optionally , the leds may vary in color and the controller 21 may be used to vary the colors and / or the sequence of colors . this may be programmable and / or operator activated through remote control 25 . moreover , in conjunction with the motion activated circuitry or motion sensor 27 , the leds may flash red , for example , when an intruder is sensed . thus , the device is operable as a security system . optionally , an alarm may be activated upon the sensing of motion . the controller may optionally be used to select a security mode or the remote control may be used by the operator to select a security mode . controller 21 is also connected by control lines ( shown in fig1 and 17 by dashed lines ) to a controller 19 a which optionally may include voltage regulator or charge control functions . controller 19 a may optionally include a switch which effectively removes the motor generator 9 from the circuit 20 . for example , in extreme wind conditions , it may be desirable to remove the generator completely from the circuitry . the terminology controller as used herein may be a microprocessor , computer , programmable controller , programmable chip , processor or the like . the terminology motor / generator as used herein means a combination motor / generator or , in the alternative , a motor operatively connected to a generator . the motor / generator having a motor mode when it is used to turn a shaft and a generator mode in which a turning shaft generates electrical power . although a few exemplary embodiments of the present invention have been shown and described , it would be appreciated by those skilled in the art that changes may be made in these embodiments , without departing from the principles and spirit of the invention , the scope of which is defined in the claims and their equivalents .	5
hereinafter , a board connector of an embodiment of the invention will be described with reference to the accompanying drawings . as shown in fig1 to 4 , the board connector 1 is used for electrically connecting a board ( pcb ) 2 a and another board ( pcb ) 2 b which are juxtaposed , and configured by : a board connector 6 a which is configured by adding a cover member 5 a to a pair of a plug 3 a and a socket 4 a ; another board connector 6 b which is configured by adding another cover member 5 b to a pair of a plug 3 b and a socket 4 b ; and an insulating member 7 . in the plug 3 a , plural thin contact grooves 31 are disposed in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction in a plug body 30 which is made of an insulating material ( synthetic resin ), and which has an approximately rectangular parallelepiped shape that is laterally elongated . one - end sides 11 a of plug contacts 10 which are configured by plural thin plate - like conductors , and which are easily bent or bendable are fitted into the contact grooves 31 from the side of the lower end ( insertion side end ) of the plug body 30 . the one - end sides 11 a are bent into a substantially u - like shape along the longitudinal direction of the plug contacts . in the plug contacts 10 , outer - side pieces elongating from lower - end bent portions of the one - end sides 11 a are pressingly inserted into and fixed to the respective contact grooves 31 so as to be substantially flush with the rear side face of the plug body 30 , and inner - side pieces elongating from lower - end bent portions of the one - end sides 11 a are fitted into the contact grooves 31 in an elastically deformable manner in the front side of the plug body 30 , so that the one - end sides 11 a of the plug contacts 10 are fixed in an insulated state in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction . on the rear side face of the plug 3 a , therefore , the outer - side pieces elongating from the lower - end bent portions of the one - end sides 11 a are exposed in a substantially flush manner , and , from an upper portion of the front side face of the plug 3 a , the plug contacts 10 are drawn out . in order to attach the cover member 5 a to the plug 3 a , a horizontal laterally - directed fulcrum shaft 32 which is perpendicularly projected from upper portions of the right and left side faces of the plug body 30 is integrally disposed . in the socket 4 a , a plug fitting recess 41 into which the plug 3 a is inserted from the upper face side and fitted is disposed in a front portion of a socket body 40 which is made of an insulating material ( synthetic resin ), and which has an approximately rectangular parallelepiped shape that is laterally elongated . plural thin contact grooves 42 in which the lower ends are opened in the bottom face of the socket body 40 , and which communicate with the plug fitting recess 41 with breaking a partition wall with respect to the plug fitting recess 41 are disposed in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction in a rear portion of the socket body 40 . plural legged socket contacts 20 which are configured by plural thin plate - like conductors , and which are bent into a substantially inverted u - like shape along the longitudinal direction are fitted into the contact grooves 42 from the bottom face side of the socket body 40 . in the socket contacts 20 , rear side pieces elongating from upper - end bent portions are pressingly inserted into and fixed to the respective contact grooves 42 so as to elongate along the rear wall faces of the contact grooves 42 , and front side pieces elongating from the upper - bent portions , i . e ., movable contact pieces 21 which are disposed in one - end sides of the socket contacts 20 , and which are elastically displaceable are fitted into the contact grooves 42 in an elastically deformable manner . tip end portions ( free - end portions ) of the movable contact pieces 21 are projected in the plug fitting recess 41 . in a state where leg portions which are horizontally rearward extended from lower ends of the rear side pieces with respect to the upper - end bent portions of the socket contacts 20 , i . e ., soldering portions 22 which are disposed in the other - end sides of the socket contacts 20 are projected in the rear outer side of the socket body 40 so as to be substantially flush with the bottom face of the socket body 40 , the socket contacts 20 are fixed in an insulated state in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction . thin groove holes 43 are disposed in a front portion of the socket body 40 and in right and left outer sides of the plug fitting recess 41 . one piece of a reinforcing terminal 44 which is an l - like metal part is pressingly inserted into and fixed to each of the groove holes 43 from the side of the bottom face of the socket body 40 , and the other piece of the reinforcing terminal 44 , i . e ., a soldering portion ( leg portion ) is projected to each of the right and left outer sides of the socket body 40 so as to be substantially flush with the bottom face of the socket body 40 . therefore , a plug insertion port ( the open end of the plug fitting recess 41 ) is opened in a front portion of the upper face of the socket 4 a , and the soldering portions 22 of the socket contacts 20 and the soldering portions of the reinforcing terminals 44 are exposed on the bottom face of the socket 4 a so as to be substantially flush with each other . the soldering portions 22 of the socket contacts 20 are projected to the rear outer side of the socket 4 a , and the soldering portions of the reinforcing terminals 44 are projected to the right and left outer sides of the socket 4 a . in order to fix the cover member 5 a when the plug 3 a and the socket 4 a are fitted to each other , engagement claws 45 are integrally disposed in right and left or two places of the rear side face of the socket body 40 . the socket 4 a is surface - mounted on the board 2 a , whereby the soldering portions 22 of the socket contacts 20 and the soldering portions of the reinforcing terminals 44 are fixed by soldering to the board 2 a , and the socket contacts 20 are electrically connected to the board 2 a . in the socket 4 a , positioning protrusions 47 are integrally disposed in two places of the bottom face of the socket body 40 in order to fit the socket to positioning holes 60 disposed in the board 2 a and position the socket with respect to the board 2 a . the cover member 5 a is a molded piece made of an insulating material ( synthetic resin ), and covers the plug 3 a and the socket 4 a in the fitting state from the upper and rear sides . as shown in fig6 also , in the cover member 5 a , the following components are integrally disposed : a rectangular plate - like cover top plate portion 50 which covers the plug 3 a and the socket 4 a in the fitting state from the upper side ; a rectangular plate - like cover rear side plate portion 51 which is perpendicularly continuous to the rear edge of the cover top plate portion 50 , which covers the plug 3 a and the socket 4 a in the fitting state from the rear side , and which covers the soldering portions 22 of the socket contacts 20 from the upper side ; and cover right and left side plate portions 52 which are perpendicularly bent so as to extend along the right and left side edges of the cover top plate portion 50 and those of the cover rear side plate portion 51 , which are projected from a front portion of the upper side face of the socket 4 a into which the plug 3 a is fitted , and which laterally integrally cover rear portions of the right and left side faces of the socket 4 a from upper portions of the right and left side faces of the plug 3 a . in the cover member 5 a , front portions of the right and left side plate portions 52 are pivotally supported via mounting holes 53 by the fulcrum shaft 32 which is disposed on the plug 3 a . the cover member 5 a is swingably attached to the plug 3 a via the fulcrum shaft 32 . the plug 3 a is set by the cover member 5 a to a state where the upper , rear , and right and left sides are covered , and the front side in the direction of drawing out the plug contacts 10 , and the lower side in the direction of inserting the contacts into the socket 4 a are opened . in the cover member 5 a , a protrusion 54 in which the tip end continuously butts against the upper end face of the plug 3 a in a range from the left end to the right end at a swing position where the cover top plate portion 50 is perpendicular to the plug 3 a is integrally disposed on the inner face of the cover top plate portion 50 , and engagement claws 55 which , when the plug 3 a and the socket 4 a are fitted to each other , are engaged in the plug extraction direction with the engagement claws 45 disposed on the socket body 40 to fix the cover member 5 a to the socket 4 a are integrally disposed in right and left or two places of the inner face of the cover rear side plate portion 51 . furthermore , joining portions 46 , 56 which , when the plug 3 a and the socket 4 a are fitted to each other , are joined to each other in a front side with respect to the fulcrum shaft 32 are disposed in the socket 4 a and the cover member 5 a . when the plug 3 a and the socket 4 a are fitted to each other , front - end portions of the lower end faces of the cover right and left side plate portions 52 are joined to right and left end portions of the upper end face of the front sidewall of the socket body 40 . the right and left end portions of the upper end face of the front sidewall of the socket body 40 are set as the joining portions 46 on the side of the socket 4 a , and the front end portions of the lower end faces of the cover right and left side plate portions 52 are set as the joining portions 56 on the side of the cover member 5 a . in the cover member 5 a , u - like cutaways 57 which are upward opened are formed in right and left or two places of an upper portion of the cover rear side plate portion 51 , right and left side portions of the cutaways 57 are elongated from a rear portion of the cover top plate portion 50 , and movable plate portions 58 which are surrounded by the cutaways 57 , which are configured by parts of the cover rear side plate portion 51 and a part of the cover top plate portion 50 , and which are perpendicularly bent are integrally disposed . in the movable plate portions 58 , operation levers 59 which are projected from and flushly with parts of the cover top plate portion 50 more rearward than parts of the cover rear side plate portion 51 are integrally disposed , and the engagement claws 55 on the side of the cover member 5 a are integrally disposed on the inner faces of lower end portions of parts of the cover rear side plate portion 51 which are free - end portions of the movable plate portions 58 . in order to facilitate elastic deformation , parts of the cover rear side plate portion 51 in the movable plate portions 58 are thinned . as described above , the board connector 6 a is configured as a board connector with a dust - proof cover in which the cover member 5 a is added to the pair of the plug 3 a and the socket 4 a . next , the other pair of plug 3 b and socket 4 b of the other board connector 6 b , and the cover member 5 b to be added to the plug and the socket have the same structure as the pair of plug 3 a and socket 4 a of the board connector 6 a and the cover member 5 a to be added to the plug and the socket , and the other board connector 6 b is configured as the same board connector with a dust - proof cover as the board connector 6 a . therefore , the identical components are denoted by the same reference numerals , and there detailed description is omitted . as shown in fig3 , however , the other plug 3 b of the other board connector 6 b is configured so that other one - end sides 11 b which are bent into a substantially u - like shape along the longitudinal direction of the plug contacts 10 are fixed to the plug body 30 in an insulated state in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction . furthermore , the other socket 4 b of the other board connector 6 b is surface - mounted on the other board 2 b , whereby the soldering portions 22 of the socket contacts 20 and the soldering portions of the reinforcing terminals 44 are fixed by soldering to the board 2 b , and the socket contacts 20 are electrically connected to the board 2 b . next , a plug insertion method in which , in order to fit the plug 3 a and socket 4 a of the board connector 6 a to each other , the plug 3 a is inserted into the plug fitting recess 41 of the socket 4 a will be described with reference to fig7 to 10 . as shown in fig7 , first , the cover member 5 a which is swingably attached via the fulcrum shaft 32 to the plug 3 a is swung about the fulcrum shaft 32 , and held to a swing position where the cover top plate portion 50 is perpendicular to the plug 3 a and the tip end of the protrusion 54 butts against the upper end face of the plug 3 a . by butting ( surface contact ) between the tip end of the protrusion 54 and the upper end face of the plug 3 a , the plug 3 a is held to a posture perpendicular to the cover top plate portion 50 . in this state , the cover member 5 a is positioned directly above the socket 4 a mounted on the board 2 a , and the cover member 5 a is lowered to approach the board 2 a , whereby the rear lower end side of the cover member 5 a is fitted from the upper side into the tall rear outer side of the socket 4 a . as result of this fitting , the cover member 5 a and the plug 3 a are positioned with respect to the socket 4 a , and the plug 3 a is positioned directly above the plug fitting recess 41 of the socket 4 a . in this state , the cover member 5 a is further lowered to approach the board 2 a , whereby , while the rear portion of the cover member 5 a is further fitted into the rear outer side of the socket 4 a , the lower end portion of the plug 3 a is fitted into the plug insertion port opened in the low - height front upper face side of the socket 4 a ( start of plug insertion ). in this state , the cover member 5 a is further lowered to approach the board 2 a , whereby , while the rear portion of the cover member 5 a is further fitted into the rear outer side of the socket 4 a as shown in fig8 , the plug 3 a is inserted into the plug fitting recess 41 of the socket 4 a until the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 hit the tip end portions of the movable contact pieces 21 of the socket contacts 20 which are projected in the plug fitting recess 41 of the socket 4 a . in the subsequent insertion , the movable contact pieces 21 of the socket contacts 20 produce an insertion resistance against the plug 3 a . when the cover member 5 a is pressed down to cause the protrusion 54 of the cover top plate portion 50 to press down the plug 3 a , therefore , the rear portion of the cover member 5 a presses the movable contact pieces 21 of the socket contacts 20 to cause the contacts to be elastically deformed , while the rear portion of the cover member 5 a is further fitted into the rear outer side of the socket 4 a , and the tip end portions of the movable contact pieces 21 are pressed back from the plug fitting recess 41 into the contact grooves 42 . when the plug 3 a passes beyond the tip end portions of the movable contact pieces 21 to be further inserted into the plug fitting recess 41 of the socket 4 a , the tip end portions of the movable contact pieces 21 of the socket contacts 20 are pressed against and contacted with the outer - side pieces elongating from the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 which are exposed on the rear side face of the plug 3 a so as to be substantially flush with each other . in this state , the cover member 5 a is further pressed down , and the plug 3 a is pressed down by the protrusion 54 of the cover top plate portion 50 . as a result , as shown in fig9 and 10 , while the rear portion of the cover member 5 a is further fitted into the rear outer side of the socket 4 a , the plug 3 a is completely inserted into the plug fitting recess 41 of the socket 4 a until the lower end of the plug 3 a bumps against the bottom face of the plug fitting recess 41 of the socket 4 a , whereby the plug 3 a and the socket 4 a are fitted together ( completion of the plug insertion ). during fitting of the plug 3 a and the socket 4 a ( when the plug 3 a and the socket 4 a are to be fitted to each other ), the plug 3 a is hidden by the cover member 5 a . since the positioning of the plug 3 a with respect to the socket 4 a can be performed by the cover member 5 a , however , it is not difficult to insert the plug 3 a . as the number of contacts of the plug contacts 10 and socket contacts 20 is more increased because of multiplication of the number of pins of the board connector 6 a , the insertion resistance on the plug 3 a in fitting of the plug 3 a and the socket 4 a becomes higher . the protrusion 54 disposed on the cover top plate portion 50 of the cover member 5 a continuously butts against the upper end face of the plug 3 a in the range from the left end to the right end to press the plug 3 a in the insertion direction , and hence the force of inserting the plug can be evenly transmitted by the cover member 5 a to the whole plug 3 a . even when the number of contacts is increased as a result of multiplication of the number of pins , therefore , insertion of the plug 3 a can be easily performed . in the embodiment , the protrusion 54 is disposed on the side of the cover member 5 a . alternatively , the protrusion may be disposed on the side of the plug 3 a . as shown in fig1 to 3 , 9 , and 10 , from the timing just before the fitting of the plug 3 a and the socket 4 a , the engagement claws 55 disposed on the movable plate portions 58 of the cover member 5 a ride on the engagement claws 45 disposed on the socket 4 a while producing elastic deformation of the movable plate portions 58 , the engagement claws 55 disposed on the movable plate portions 58 of the cover member 5 a pass beyond the engagement claws 45 disposed on the socket 4 a to enter below the claws when the plug 3 a and the socket 4 a are fitted together , and at the same time the engagement claws 55 disposed on the movable plate portions 58 of the cover member 5 a are engaged with the engagement claws 45 disposed on the socket 4 a in the plug extraction direction by an elastic return of the movable plate portions 58 . therefore , the cover member 5 a is fixed ( locked ) to the socket 4 a , the plug 3 a is fixed ( locked ) to the socket 4 a by the fixed cover member 5 a , and the fitting states of the plug 3 a and the socket 4 a , and the cover member 5 a and the socket 4 a are held . as a result , in the plug fitting recess 41 of the socket 4 a , the contact between the outer - side pieces elongating from the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 , and the tip end portions of the movable contact pieces 21 of the socket contacts 20 is held , and the one - end sides 11 a of the plug contacts 10 are electrically connected to the board 2 a . when the plug 3 a and the socket 4 a are fitted together , the plug 3 a and the socket 4 a in the fitting state are covered from the upper and rear sides by the cover member 5 a fixed to the socket 4 a , and contact portions of the plug 3 a and socket 4 a in the fitting state , i . e ., the plug fitting recess 41 of the socket 4 a is covered to cause dust and the like to hardly enter the plug fitting recess 41 . therefore , occurrence of a contact failure between the contacts 10 , 20 of the plug 3 a and socket 4 a because of a narrowed pitch of the contacts 10 , 20 can be suppressed . furthermore , the soldering portions 22 of the socket contacts 20 are covered from the upper side by the cover member 5 a , so that dust and the like hardly fall and deposit on the surfaces of the soldering portions 22 and gaps therebetween . therefore , an insulation failure in the soldering portions 22 of the socket contacts 20 because of a narrowed pitch of the contacts 10 , 20 of the plug 3 a and socket 4 a can be suppressed . when the plug 3 a and the socket 4 a are fitted together , the joining portions 46 on the side of the socket 4 a , and joining portions 56 on the side of the cover member 5 a which are disposed in the front side with respect to the fulcrum shaft 32 are joined to each other . namely , the right and left end portions of the upper end face of the front sidewall of the socket body 40 are joined to the front - end portions of the lower end faces of the cover right and left side plate portions 52 . a plug insertion method in which , in order to fit the plug 3 b and socket 4 b of the other board connector 6 b to each other , the plug 3 b is inserted into the plug fitting recess 41 of the socket 4 b , and a fitting state of the plug 3 b and the socket 4 b are identical with the plug insertion method of the board connector 6 a and the fitting state of the plug 3 a and the socket 4 a shown in fig7 to 10 . therefore , their detailed description and corresponding drawings are omitted . as shown in fig1 to 3 , in the board connector 6 a , the plug 3 a is inserted and fitted into the plug fitting recess 41 of the socket 4 a , and , in the plug fitting recess 41 of the socket 4 a , and the outer - side pieces elongating from the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 , and the tip end portions of the movable contact pieces 21 of the socket contacts 20 are contacted and held to each other , thereby electrically connecting the one - end sides 11 a of the plug contacts 10 to the board 2 a . by contrast , in the other board connector 6 b , the other plug 3 b is inserted and fitted into the plug fitting recess 41 of the other socket 4 b , and , in the plug fitting recess 41 of the socket 4 b , and the outer - side pieces elongating from the lower - end bent portions of the other - end sides 11 b of the plug contacts 10 , and the tip end portions of the movable contact pieces 21 of the socket contacts 20 are contacted and held to each other , thereby electrically connecting the other - end sides 11 b of the plug contacts 10 to the board 2 b . therefore , the board 2 a and the other board 2 b can be electrically connected together via the plug contacts 10 , the socket contacts 20 of the socket 4 a , and the socket contacts 20 of the other socket 4 b . next , a plug extraction method in which , in order to separate from each other the plug 3 a and socket 4 a of the board connector 6 a in the fitting state shown in fig1 to 3 , 9 , and 10 , the plug 3 a is extracted from the plug fitting recess 41 of the socket 4 a will be described with reference to fig1 . first , in the board connector 6 a in the fitting state shown in fig1 to 3 , 9 , and 10 , an operation of lifting up a rear portion of the cover member 5 a is performed by engaging the fingers with the operation levers 59 disposed on the movable plate portions 58 of the cover member 5 a . when the rear portion of the cover member 5 a is lifted up in this way , the engagement claws 55 disposed on the movable plate portions 58 of the cover member 5 a separate from the rear side face of the socket body 40 while producing elastic deformation of the movable plate portions 58 , and the engagement with the engagement claws 45 disposed on the socket 4 a is canceled . in this state , as shown in fig1 , the cover member 5 a is swung with setting as a lever fulcrum the joining portions 46 , 56 joined to each other in the front side with respect to the fulcrum shaft 32 by which the cover member 5 a is swingably attached to the plug 3 a . in accordance with the swinging operation of the cover member 5 a , the plug 3 a is pulled up in the plug fitting recess 41 of the socket 4 a via the fulcrum shaft 32 ( with setting the fulcrum shaft 32 as a point of action ). namely , the plug 3 a can be pulled up in the plug fitting recess 41 of the socket 4 a with using the cover member 5 a as a lever . by the operation of pulling up the plug 3 a , the plug 3 a is pulled up in the plug fitting recess 41 of the socket 4 a by the degree at which the lower end portion of the plug 3 a is lifted up to the vicinity of the tip end portions of the movable contact pieces 21 of the socket contacts 20 . then , the cover member 5 a is lifted up substantially directly above the socket 4 a , whereby the plug 3 a is extracted away from the plug fitting recess 41 of the socket 4 a . in the process of pulling up the plug 3 a in the plug fitting recess 41 of the socket 4 a , in an initial stage of the extraction in which the tip end portions of the movable contact pieces 21 of the socket contacts 20 are in contact with the outer - side pieces elongating from the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 , the contact pressure functions as a large pulling resistance on the plug 3 a . when the lower end portion of the plug 3 a is lifted up to the vicinity of the tip end portions of the movable contact pieces 21 of the socket contacts 20 , the tip end portions of the movable contact pieces 21 of the socket contacts 20 are contacted with the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 . at this timing , the contact pressure ( the pulling resistance on the plug 3 a ) is reduced . as the contact pressure is further reduced when the lower end portion of the plug 3 a passes beyond the tip end portions of the movable contact pieces 21 of the socket contacts 20 and the one - end sides 11 a of the plug contacts 10 separate from the tip end portions of the movable contact pieces 21 of the socket contacts 20 , the pulling resistance on the plug 3 a is further substantially eliminated . when , as described above , the plug 3 a is pulled up with using the cover member 5 a as a lever in the plug fitting recess 41 of the socket 4 a by the degree at which the lower end portion of the plug 3 a is lifted up to the vicinity of the tip end portions of the movable contact pieces 21 of the socket contacts 20 , the pulling and extraction of the plug 3 a in the plug fitting recess 41 of the socket 4 a can be easily performed with applying a small force . as the number of contacts of the plug contacts 10 and socket contacts 20 is increased as a result of multiplication of the number of pins of the board connector 6 a , the pulling resistance on the plug 3 a is larger in extraction of the plug 3 a fitted to the socket 4 a . since the plug 3 a can be pulled up by a small force with using the cover member 5 a as a lever in the plug fitting recess 41 of the socket 4 a , however , extraction of the plug 3 a can be easily performed even when the number of contacts is increased as a result of multiplication of the number of pins . a plug extraction method in which , in order to separate the plug 3 b and socket 4 b of the other board connector 6 b in the fitting state shown in fig1 to 3 from each other , the plug 3 b is extracted from the plug fitting recess 41 of the socket 4 b is identical with the plug extraction method of the board connector 6 a shown in fig1 . therefore , its detailed description and corresponding drawings are omitted . the socket contacts 20 which are configured by plural thin plate - like conductors are formed in parallel into a state where end portions of the soldering portions 22 are continuous to a carrier ( not shown ) with forming predetermined intervals at predetermined pitches therebetween , by punching and bending a thin conductive metal plate . in this state , the socket contacts 20 are fitted into the contact grooves 42 of the socket body 40 , and fixed to the socket body 40 in parallel in an insulated state with forming predetermined intervals ( regular intervals ) in the right and left or lateral direction , and then the carrier is separated from the socket contacts 20 , thereby configuring the sockets 4 a , 4 b . the plug contacts 10 which are configured by plural thin plate - like conductors , and which are easily bent or bendable are formed in parallel into a state where end portions of the one - end sides 11 a are continuous to a carrier ( not shown ), and end portions of the other - end sides 11 b are continuous to another carrier ( not shown ), by punching and bending a thin conductive metal plate with disposing predetermined intervals at predetermined pitches between the carrier and the other carrier . in this state , the one - end sides 11 a of the plug contacts 10 are fitted into the contact grooves 31 of the plug body 30 , the one - end sides 11 a of the plug contacts 10 are fixed to the plug body 30 in an insulated state in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction , and then the carrier is separated from the one - end sides 11 a of the plug contacts 10 , thereby configuring the plug 3 a . by contrast , the other - end sides 11 b of the plug contacts 10 are fitted into the contact grooves 31 of the plug body 30 , the other - end sides 11 b of the plug contacts 10 are fixed to the plug body 30 in an insulated state in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction , and then the carrier is separated from the other - end sides 11 b of the plug contacts 10 , thereby configuring the other plug 3 b . as shown in fig1 to 3 , and 5 , in the plug contacts 10 through which the plug 3 a is linked with the other plug 3 b , intermediate portions 12 , 13 ( between the one - end sides 11 a and the other - end sides 11 b ) between the plug 3 a and the other plug 3 b are formed into a linear shape so as to elongate in parallel to the boards 2 a , 2 b , except their both end portions . the both end portions are formed into an inclined state which is upward inclined toward the respective end portions . the lengths of the linear portions of the intermediate portions 12 , 13 are set on the basis of the distance between the board 2 a and other board 2 b which are placed in parallel to each other , i . e ., the connecting distance . one - end side inclined upper ends of the intermediate portions 12 , 13 , and upper end portions of the inner - side pieces elongating from the lower - end bent portions of the one - end sides 11 a are continuously integrally linked with each other , and other - end side inclined upper ends of the intermediate portions 12 , 13 , and upper end portions of the inner - side pieces elongating from the lower - end bent portions of the other - end sides 11 b are continuously integrally linked with each other . the plug contacts 10 are formed so as to be symmetrical about a point where the length of the linear portion of the intermediate portion 12 or 13 is bisected . as shown in fig2 , and 7 to 10 , the inclined portions of the both end portions of the intermediate portions 12 , 13 of the plug contacts 10 are drawn out obliquely downward from the front side faces of the plugs 3 a , 3 b . as shown in fig1 , therefore , the front portions of the cover members 5 a , 5 b which are lowered by the swing of the cover members 5 a , 5 b in pulling of the plugs 3 a , 3 b in the plug fitting recesses 41 of the sockets 4 a , 4 b with setting the cover members 5 a , 5 b as a fulcrum do not interfere with the plug contacts 10 drawn out from the front side faces of the plugs 3 a , 3 b , and hence it is possible to prevent the plug contacts 10 from being bent and damaged . as shown in fig1 to 5 , the plug contacts 10 are formed into two kinds in which only the level positions of the linear portions are differentiated by changing the lengths of the inclined portions of the both end portions in the intermediate portions 12 , 13 . the plug contacts 10 having the intermediate portion 12 in which the level of the linear portion is high , those having the intermediate portion 13 in which the level of the linear portion is low are alternately arranged . therefore , the linear portions of the intermediate portions 12 , 13 of the plug contacts 10 are positionally shifted from each other in the thickness direction ( the vertical direction ) of the contacts , so that predetermined gaps 14 in a side view are ensured in the linear portions of the intermediate portions 12 , 13 of the plug contacts 10 . the both ends of the gaps 14 are closed by the inclined portions of the both end portions of the intermediate portions 13 in which the level of the linear portion is low . as shown in fig1 to 4 , an insulating member 7 is disposed in the intermediate portions 12 , 13 of the plug contacts 10 between the plug 3 a and the other plug 3 b . a predetermined gap is ensured between the adjacent plug contacts 10 by the insulating member 7 , so that the plug contacts are prevented from contacting with each other . the insulating member 7 is made of an insulating material ( synthetic resin ), and has an approximately rectangular parallelepiped shape that is laterally elongated . plural thin contact grooves 70 through which the intermediate portions 12 , 13 of the plug contacts 10 are to be passed at a predetermined pitch with forming predetermined intervals are alternately distributively disposed in the upper and lower faces of the insulating member 7 . the linear portions of the intermediate portions 12 of the plug contacts 10 having the intermediate portion 12 in which the level of the linear portion is high are fitted from the upper face side into and passed in the anteroposterior direction through the contact grooves 70 disposed in the upper face of the insulating member 7 , and those of the intermediate portions 13 of the plug contacts 10 having the intermediate portion 13 in which the level of the linear portion is low are fitted from the lower face side into and passed in the anteroposterior direction through the contact grooves 70 disposed in the lower face of the insulating member 7 . a plate - like core part 71 that is the insulating member 7 the thickness of which is reduced by the contact grooves 70 is interposed in the thickness direction ( the vertical direction ) of the core part between the linear portions of the intermediate portions 12 of the plug contacts 10 having the intermediate portion 12 in which the level of the linear portion is high , and those of the intermediate portions 13 of the plug contacts 10 having the intermediate portion 13 in which the level of the linear portion is low , and the insulating member 7 is interposed between the intermediate portions 12 , 13 of the plug contacts 10 so as to be movable in the contact length direction , whereby a predetermined gap is ensured between the adjacent plug contacts 10 by partition walls 72 which are the insulating member 7 between the contact grooves 70 , so that the plug contacts are prevented from contacting with each other . the adjacent plug contacts 10 are prevented from contacting with each other by the insulating member 7 which is simply interposed between the intermediate portions 12 , 13 of the plug contacts 10 so as to be movable in the contact length direction , and which is not fixed . therefore , the attachment position and number of the insulating member 7 can be easily changed , and can readily cope with the connecting configuration such as the connecting distance between the boards 2 a , 2 b and the connecting direction thereof . the predetermined gaps 14 in a side view are ensured from the beginning between the linear portions of the intermediate portions 12 of the plug contacts 10 which are passed through the contact grooves 70 disposed in the upper face of the insulating member 7 , and those of the intermediate portions 13 of the plug contacts 10 which are passed through the contact grooves 70 disposed in the lower face of the insulating member 7 . therefore , interposing of the insulating member 7 can be easily performed . when the attachment position or number of the insulating member 7 is changed , furthermore , a deforming force is not applied to the plug contacts 10 , and hence plastic deformation can be prevented from occurring . in the embodiment , the board connector 1 used for electrically connecting the board 2 a and other board 2 b which are placed in parallel has been described . alternatively , the plug contacts 10 may be bent in the linear portions of the intermediate portions 12 , 13 , thereby enabling also stepped or angled boards to be connected to each other . the sockets 4 a , 4 b of the surface - mount type have been described . alternatively , sockets of the pin - mount type may be used .	7
in the following detailed description of the preferred embodiments , reference is made to the accompanying drawings which form a part hereof , and in which is shown by way of illustration specific preferred embodiments in which the invention may be practiced . the preferred embodiments are described in sufficient detail to enable these skilled in the art to practice the invention , and it is to be understood that other embodiments may be utilized and that logical changes may be made without departing from the spirit and scope of the present invention . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined only by the appended claims . referring to fig1 , a block diagram of a frequency synthesizer in accordance with one preferred embodiment of the present invention is schematically illustrated . in fig1 , the frequency synthesizer of the present invention comprises a divider 10 , a noise - shaped quantizer 12 and an analog phase locked loop ( pll ) device 14 . a high speed very stable digital clock dclk , normally based on a crystal oscillator reference , is employed as a stable reference baseline period . the reference clock dclk provided with a higher frequency will give the preferable results . for example , in the application of flat panel display controllers , 200 mhz or above can be provided for the reference clock dclk . in order to obtain a desired output clock frequency , the reference clock dclk is received and divided by a time - varying value nd ( t ) in the divider 10 so as to generate an output clock clkq having a time - varying period td ( t ). although the output clock clkq has the time - varying period td ( t ), the time - varying algorithm will be arranged to give the output clock clkq a very precise average period such that precise average output clock frequency can be obtained . as shown in fig1 , the output clock clkq is fed back to the noise - shaped quantizer 12 which receives a period control word . the noise - shaped quantizer 12 is employed to quantize the period control word to the time - varying value nd ( t ) in response to the feedback output clock clkq . according to the present invention , the noise - shaped quantizer 12 can be a delta - sigma quantizer so that the time - varying value nd ( t ) is spectrally shaped by the noise - shaped quantizer 12 using a digital delta - sigma algorithm . preferably , the period control word is configured with a bit resolution greater than that of the time - varying value nd ( t ). in this preferred embodiment , the period control word is a precise word of 24 - bit resolution which is quantized into a low precision value nd ( t ) of 5 - bit resolution . as mentioned above , the noise - shaped quantizer 12 of the present invention converts the high resolution input , that is , the period control word , to the low resolution output nd ( t ) in such a way as to spectrally shape the quantization error , most of which is at very high frequency range . noted that the quantization error is directed to the difference between the period control word and time - varying integer value nd ( t ). with delta - sigma quantization , the spectral density of the quantization error in nd ( t ) or td ( t ) is very low at low frequencies and rises with increasing frequency . in some systems no further processing need be done to the output clock clkq if cycle - cycle jitter is not critical . in other systems , the output clock clkq may not be useful as a low jitter output clock due to the large amount of jitter from the time - varying nature of the period td ( t ). to reduce the jitter , the output clock clkq may be input to the analog pll 14 which can filter the jitter to produce a stable output clock clkp . if the spectral properties of the time - varying period td ( t ) are properly designed , the amount of jitter reduction from the analog pll 14 can be very significant . in other words , the output clock clkq can be filtered by using the analog pll 14 to suppress the high frequency jitter if the cycle - cycle jitter is a design concern . thus , the analog pll 14 serves as a filter means for effectively filtering the jitter from the output clock clkq . moreover , the divider 10 can take any value between minimum and maximum given by the noise - shaped quantizer 12 . thus , using the time - varying divider 10 to divide down the high frequency fixed - period clock reference clock dclk to synthesize a precise long - term average frequency output clock clkq directly in digital domain . therefore , the average period of the output clock clkq or the filtered output clock clkp is kept very precise . referring to fig2 , a detailed block diagram of the noise - shaped quantizer of fig1 is schematically depicted as an example . in fig2 , a delta - sigma quantizer is exemplified in 2 nd - order shaping for reference . however , such a detailed example is not to be taken in a limiting sense , and it is to be understood that other embodiments may be utilized and that logical changes may be made without departing from the spirit and scope of the present invention . fig3 and 4 depict power spectral plot diagrams of clkq and clkp , respectively , where y - axis is dbc and x - axis is frequency . these simulation fig3 and 4 are plotted upon dclk = 214 . 6 mhz , the period control word = 0 × 2864d2 ( fractional divider equivalent = 0 × 05 . 0c9a4 ), m ( feedback divider for the analog pll 14 )= 2 and the required clkp = 85 mhz . by comparing fig3 and 4 , the use of the analog pll 14 as the jitter low pass filter to filter out the high frequency jitter from the output clock clkq . thus , the low - jitter output clock clkp can be produced such that aliasing effect can be suppressed effectively . accordingly , the frequency synthesizer , in accordance with the present invention , uses the time - varying divider 10 to divide down the high frequency fixed - period clock reference clock dclk to synthesize the precise long - term average frequency output clock clkq directly in digital domain . therefore , no look - up table , digital - to - analog converter , phase locked loop or delay locked loop is required for the divider 10 . also , no conventional approach of n , n + 1 divider is required for the frequency synthesizer of the present invention . moreover , the frequency synthesizer of the present invention uses the delta - sigma algorithm to quantize the precise period control word to the low precision time - varying integer value nd ( t ). such a way forces most of the jitter of the reference clock dclk to be at high frequency by making the divider value nd ( t ) be selected from a set of small integer values . in addition , higher frequency jitter decreases the cost of the subsequent jitter low - pass filtering block when required . if the frequency of the reference clock dclk is chosen properly , the required integer values can be less than 60 for the time - varying value nd ( t ). furthermore , the frequency synthesizer of the present invention uses the very precise digital input , that is , the high resolution period control word , to the noise - shaped quantizer 12 to ensure that the average period of the output clocks clkq and , subsequently , clkp are kept very precise . though no further processing need be done to the output clock clkq if cycle - cycle jitter is not critical in some systems , the output clock clkq can be filtered by using the analog pll 14 to suppress the high frequency jitter when the cycle - cycle jitter is a design concern . the frequency synthesizer of the present invention uses the analog pll 14 as the jitter low pass filter to filter out the high frequency jitter from the output clock clkq to produce low - jitter output clock clkp . although the description above contains much specificity , it should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of the present invention . thus , the scope of the present invention should be determined by the appended claims and their equivalents , rather than by the examples given .	7
as used herein , spatial or directional terms , such as “ inner ”, “ outer ”, “ left ”, “ right ”, “ up ”, “ down ”, “ horizontal ”, “ vertical ”, and the like , relate to the invention as it is shown in the drawing figures . however , it is to be understood that the invention can assume various alternative orientations and , accordingly , such terms are not to be considered as limiting . further , all numbers expressing dimensions , physical characteristics , and so forth , used in the specification and claims are to be understood as being modified in all instances by the term “ about ”. accordingly , unless indicated to the contrary , the numerical values set forth in the following specification and claims can vary depending upon the desired properties sought to be obtained by the present invention . at the very least , and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims , each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques . moreover , all ranges disclosed herein are to be understood to encompass any and all subranges subsumed therein . for example , a stated range of “ 1 to 10 ” should be considered to include any and all subranges between ( and inclusive of ) the minimum value of 1 and the maximum value of 10 ; that is , all subranges beginning with a minimum value of 1 or more , e . g . 1 to 6 . 3 , and ending with a maximum value of 10 or less , e . g ., 5 . 5 to 10 . also , as used herein , the terms “ deposited over ”, “ applied over ”, or “ provided over ” mean deposited , applied , or provided on but not necessarily in direct surface contact with . for example , a material “ deposited over ” a substrate does not preclude the presence of one or more other materials of the same or different composition located between the deposited material and the substrate . in the following discussion , the invention will be described for use on vehicular laminated transparencies . as will be appreciated , the invention is not limited thereto , and may be practiced on any laminate that has an internal member responsive to stimuli and an interconnecting activating member , and leads to providing external access to the interconnecting activating member to stimulate the internal member . for example , but not limiting the invention thereto , the invention may be practiced on laminated windows for residential homes , commercial buildings and refrigerator doors having a viewing area . the internal member may be , but not limiting to the invention thereto , an electric conductive member that generates heat as current moves through the member , or a thermally or electrically sensitive coating that changes transmittance upon heating or application of current . the interconnecting activating member may be a pair of spaced bus bars between which current is passed through the internal member . further and not limiting to the invention , the internal member may be an electric circuit to activate the windshield wipers , and the interconnecting activating member may be an electric lead connecting the sensor to a monitoring , circuit . types of conductive members that may be used in the practice of the invention , but not limiting the invention thereto are discussed in u . s . pat . nos . 4 , 401 , 609 ; 5 , 040 , 411 and 5 , 066 , 111 ; pct application u . s . 02 / 06153 filed feb . 28 , 2002 , for “ moisture detection system and method of use thereof ”; u . s . patent application ser . no . 09 / 738 , 306 filed dec . 15 , 2000 , in the names of chia cheng lin et al . for “ electrochromic transparency incorporating security system ”, and u . s . patent application ser . no . 09 / 591 , 572 filed jun . 9 , 2000 , in the name of c . b . greenberg for “ electrochromics ”, which documents are hereby incorporated by reference . the vehicular transparence in the following discussion is an automotive windshield ; however , the invention is not limited thereto and can be any type of a vehicular transparency such as , but not limiting the invention thereto , an automotive sidelight for example of the type disclosed in european patent application no 00936375 . 5 which document is hereby incorporated by reference , a moon roof and a backlite or rear window . further , the transparency can be for any type of vehicle such as but not limiting the invention thereto land vehicles such as but not limiting the invention thereto trucks , cars , motorcycles , and / or trains , to air and / or space vehicles , and to above and / or below water vehicles . with reference to fig1 , there is shown an automotive windshield 10 incorporating features of the invention . the windshield 10 includes a pair of glass sheets or blanks 12 and 14 , and an internal member 16 on inner surface of one of the glass sheets , e . g . outer surface of the inner sheet 14 also referred to as the no . 3 surface of the laminate or windshield assembly . in this discussion the internal member 16 is an electrically conductive member that is heated as current moves through the member to heat both the outer surfaces of the windshield 12 by conduction to remove fog , ice and / or snow , as the case may be . an interlayer composite 20 incorporating features of the invention laminates the glass sheets 12 and 14 together and provides facilities discussed below to move current between the sheets 12 and 14 and through the conductive member 16 . although the invention is not limited thereto , the electrically conductive member 16 is usually on or against the outer surface of the inner sheet as the windshield is mounted in the automobile . as can be appreciated by those skilled in the art , the invention is not limited to the composition of the glass sheets 12 and 14 , for example and not limited to the invention the glass sheets may be clear or tinted glass , for example , of the type disclosed in u . s . pat . nos . 5 , 030 , 592 ; 5 , 240 , 886 , and 5 , 593 , 929 which patents are hereby incorporated by reference . the glass sheets can be annealed , tempered or heat strengthened . the glass sheets can have uniform thickness or can be wedged as viewed in cross section . the glass sheets can be soda - lime - silicate glass or borosilicate glass or any type of refractory glass . further the invention is not limited to the electrically conductive member 16 . the conductive member 16 may be a plurality of spaced conductive elements such as wires , e . g . as discussed in u . s . pat . no . 5 , 182 , 431 ; or strips of conductive material , e . g . a plurality of discreet spaced areas of conductive coating , or a continuous conductive coating . in the practice of the invention and without limiting the invention thereto , the conductive member 16 is a coating having two metal films usually infrared reflecting films , e . g . silver , separated by dielectric layers , e . g . a film of an oxide of a tin zinc alloy and / or a zinc oxide film . the coating is of the typed disclosed in european patent application no . 00939609 . 4 , which application is hereby incorporated by reference . it is the normal practice , but not limiting to the invention , when using a sputtered type coating having multiple films to terminate the coating short of the edges of the glass sheet on which it is applied , e . g . short of the edges of the sheet 14 to provide uncoated marginal edge portions or non - conductive strip 21 between the perimeter of the conductive coating and the peripheral edge of the sheet 14 as shown in fig1 . this can be accomplished by coating the total surface of the sheet and deleting the coating e . g . as disclosed in u . s . pat . no . 4 , 587 , 769 or using a mask during sputtering e . g . as disclosed in u . s . pat . no . 5 , 492 , 750 to provide the non - conductive strip . the disclosures of u . s . pat . nos . 4 , 587 , 769 and 5 , 492 , 750 are hereby incorporated by reference . with reference to fig2 – 4 as needed , the discussion will be directed to the interlayer composite 20 incorporating features of the invention . for ease of discussion , and an appreciation of the elements and the cooperation of the elements of the interlayer composite 20 , the interlayer composite shown in fig2 – 4 is prior to laminating the glass sheets and interlayer composite together as discussed below . the composite 20 includes a sheet of interlayer material 22 , a pair of spaced bus bars 24 , 26 adhered to the sheet 22 in any convenient manner and a lead assembly 28 and 30 associated with each of the bus bars 24 and 26 , respectively . the interlayer sheet 22 is not limiting to the invention and any of the types used in the laminating art to join two substrates , e . g . two transparent sheets such as glass sheets of an automotive transparency may be used in the practice of the invention . in the case of an automotive transparency the material of the interlayer sheet can be polyvinyl butyral (“ pvb ”), polyvinyl chloride (“ pvc ”), or polyurethane . the sheet 22 can have a uniform thickness though out its length and width or it can have varying thickness , e . g . as disclosed in u . s . pat . no . 4 , 998 , 784 , which patent is hereby incorporated by reference , to provide an interlayer in cross section having one or more wedged portions . the thickness , outer dimensions and configuration of the interlayer sheet 22 are not limiting to the invention ; however in the practice of the invention it is preferred that the interlayer sheet 22 have dimensions and a configuration to laminate the glass sheets 12 and 14 together . usually after lamination about 1 / 16 inch ( 0 . 16 centimeters (“ cm ”)) of the interlayer extends beyond the peripheral edges of the glass sheets to insure a complete lamination of the surfaces of the glass sheets . the thickness of the sheet 22 is not limiting to the invention and should be of sufficient thickness to laminate the two sheets 12 and 14 together . the bus bars 24 and 26 are made of metal foil 32 , e . g . gold , silver , aluminum , or copper foil to name a few metal foils that may be used in the practice of the invention . in the practice of the invention , it is preferred to use copper foil because unlike gold and silver foils , it is inexpensive and unlike aluminum foil , it is non - reactive with most other current conducting materials . the width and thickness of the copper foil is not limiting to the invention ; however it should be of sufficient thickness and width to carry the current required to heat the conductive member 16 to heat the outer surfaces of the windshield . the voltage and current usually carried by the bus bars to heat an automotive windshield is 42 volts and 31 amperes . in one nonlimiting embodiment the thickness of the copper foil of the bus bars used was 2 . 8 mils . the width of the copper foil of the bus bar 24 having an electrical power feed located at the center of the bus bar was 7 millimeters , and the width of the copper foil of the bus bar 26 having an electrical power feed located at the side of the bus bar was 14 millimeters . a wider bus bar is preferred when using a side feed instead of a center feed to provide for an even current flow along the extended path of the bus bar . more particularly , the current moving through the right portion of the metal foil 32 of the bus bar 26 as viewed in fig2 has to travel a longer distance and has more surface of the conductive member to pass current than the length of the bus bar 24 on each side of its respective lead . therefore , the bus bar 26 should have a greater cross sectional area than the bus bar 24 . because a metal foil is used and because different thickness bus bars may cause laminating concerns , it is preferred , although not limiting to the invention to have bus bars of uniform thickness and increase the width of the bus bar to increase its cross sectional area . the length of the bus bars is not limiting to the invention and should be sufficient to extend across the surface of the conductive member 16 . a more detailed discussion regarding the length of the bus bars is presented below . with reference to fig2 – 4 , the metal foil 32 of the bus bars is attached to surface 34 of the sheet 22 by a layer 36 of adhesive , e . g . an adhesive layer that has tacky surfaces at room temperature and adheres the sheet and foil together by biasing the sheet 22 and foil 32 together , i . e . a pressure sensitive adhesive . as can be appreciated , in place of a single layer of pressure sensitive adhesive , a double backed tape may be used , i . e . a tape having a layer of pressure sensitive adhesive on each side of a substrate . the material or type of adhesive of the layer 36 is not limiting to the invention and any type of adhesive . in selecting an adhesive material to mount the metal foil of the bus bars on the sheet 22 , the adhesive material selected should be compatible with the material of the interlayer sheet 22 and the laminating process . more particularly , the adhesive should not chemically react with the material of the interlayer sheet , or any other material it comes into contact with , to produce by products such as gas that may result in delamination of the laminate . the adhesive material should also be compatible with the process , e . g . withstand the edge sealing temperature in the range of 200 to 275 ° f . ( 93 . 3 to 135 ° c .) and the autoclave temperature in the range of 275 to 300 ° f . ( 134 to 148 . 8 ° c .). in the practice of the invention , a pressure sensitive adhesive of the types sold by 3m corporation and fralock company of california were used . with continued reference to fig2 – 4 , and in particular to fig3 and 4 , the lead assembly 28 and 30 provides external electrical access to the bus bars . each of the lead assemblies includes an electrically conductive lead 40 connected to one of the bus bars 24 or 26 , and each lead 40 has a protective sleeve 42 adhered thereto by an adhesive layer to prevent air from moving through the sleeve and between the glass sheets after edge sealing and during autoclaving . for ease of discussion and not limiting to the invention , the adhesive layers are shown and discussed as adhesive layers 44 and 46 . the material of the lead , physical thickness and configuration is not limiting to the invention . the lead provides a path to move current from a power supply , e . g . a car battery ( not shown ) to its respective bus bar . for an automotive transparency it is expected that the lead will carry 42 volts and 32 amps . although not limiting to the invention and as shown in fig1 and 2 , the lead 40 is an extension of its respective bus bar , i . e . the lead is contiguous with its respective bus bar . the bus bars and leads may be considered to have a “ t ” shaped configuration with the bus bar or horizontal member or first elongated member of the “ t ” adhered to surface 34 of the interlayer sheet 22 . the lead or vertical member or second elongated member of the “ t ” extends outwardly from its respective bus bar beyond the edges of the laminate . the protective sleeve 42 protects the lead 40 against mechanical damage resulting from bending the lead about the edges of the glass sheets 12 and 14 of the laminate during handling and shipping of the laminates , and electrically insulates a portion of the lead , e . g . exposing only that portion of the lead need to make electrical contact with the connector to connect the lead to the power supply ( not shown ). the protective sleeve has one end portion between the sheets 12 and 14 , and the other end extending beyond the laminate and terminating short of the end of its respective lead as shown in fig2 . the protective sleeve can be made of any material that electrically insulates the lead and prevents damage to the lead , and is compatible with the material of the interlayer sheet 22 , and the edge sealing and autoclaving processes . in one nonlimiting embodiment of the invention , the material of the protective sleeve was a polyamide of the type sold by dupont chemical company under its trademark kapton . the polyamide material selected for its electrically insulating and mechanical properties maintains its structural stability at the edge sealing and autoclave temperatures , but is not viscid those temperatures . in those instances when the material of the protective sleeve is not viscid or does not become viscid at the sealing and autoclaving temperatures , it is necessary to prevent air from moving around the sleeve and between the sheets after edge sealing , and during autoclaving . in accordance to the invention , an air barrier is provided to prevent air from moving between and through the protective sleeve , and an air barrier is provided to prevent air from moving around the protective sleeve and thereafter between the glass sheets , i . e . prevent the ingress of air between the sheets . the layer 46 as viewed in fig3 – 5 and the adjacent inner surface of the protective sleeve blocks the air path to prevent the ingress of air between the bottom surface of the lead 40 and adjacent inner surface of the sleeve . the layer 46 can be provided by extending the adhesive layer 36 along the bottom surface of the lead 40 beyond the end of the protective sleeve as shown in fig3 and 4 . there is no air path between the bottom surface of the bus bar and the interlayer because of the adhesive layer 36 eliminates or blocks the ingress of air . there is no air path or ingress of air between the outer surface of the sleeve 42 and the glass sheet 12 because the interlayer sheet 22 flows around the outer surface portion of the sleeve during edge sealing . the air path between the upper surface of the lead and the adjacent inner surface of the protective sleeve 42 as viewed in fig3 – 5 is between the upper surface of the bus bar and the glass sheet and continues between the bus bars and the conductive coating . the air path or ingress of air between the upper surface of the lead 40 and the adjacent inner surface of the protective sleeve 42 is blocked by providing a layer 44 of adhesive between the upper surface of the lead and adjacent inner surface of the sleeve . the adhesive layer 44 may be similar to the adhesive of the layer 36 or 46 , or may be pieces of pvb , pvc or polyurethane . the air path or ingress of air between the upper outer surface of the protective sleeve 42 and the glass sheet 14 , and between the upper surface of the bus bar and the non - conductive strip 21 of the glass sheet 14 and coating 16 on the glass sheet 14 is blocked by an adhesive layer 48 ( see fig3 – 5 ) between the upper surface of the protective sleeve and adjacent surface of the sheet 14 . it is preferred that the layer 48 be a non - tacky material at the temperatures at which the two glass sheets 12 , 14 and interlayer composite 20 are assembled prior to the edge sealing operation so that the interlayer composite and glass sheets may be easily moved relative to one another to properly position the bus bars on the conductive coating . further , the adhesive should be compatible with the materials of the interlayer and the protective sleeve to prevent the formation of chemical by - products such as gas . any adhesive that does not deteriorate at the edge sealing and autoclaving temperatures to the extent that it does not prevent the ingress of air , and is compatible with the materials of the laminate , may be used in the practice of the invention . types of adhesives that may be used for the layer 48 include but are not limiting to thermo - set adhesives , polyvinyl butyral , rubber cement , acrylic adhesives and pressure sensitive adhesives . in the discussion of the invention , the layers 44 , 46 and 48 were discussed as adhesive layers ; however , the invention is not limited thereto and any material that reduces or prevents ingress of air between the sheets 12 and 14 may be used in the practice of the invention . for example , compressible material held in place by friction may be used . the amount of air prevented from flowing around and through the protective sleeve is not limiting to the invention , and the amount of airflow restricted should be that amount to prevent damage to the laminate , e . g . by delamination . in the case of an automotive laminate of the type discussed above , it is preferred , but not limiting to the invention , to maintain the laminate substantially free of air to prevent subsequent delamination of portions the windshield . the structural strength of the layers 44 , 46 and 48 that make up the air barriers should be sufficient to withstand the pressure forcing air through and around the protective sleeve after edge sealing and autoclaving . in the figs ., especially in fig3 – 5 , the physical dimensions , e . g . thickness of the elements or components are not to scale in order that an appreciation of the relationship of the components to one another can be had . the physical dimensions used to make a windshield incorporating features of the invention have or will be discussed . as can be appreciated , the exit location of the lead assemblies 28 and 30 from the laminate is not limiting to the invention . for example , both lead assemblies 28 and 30 can exit from the same side of the windshield as disclosed in u . s . pat . no . 5 , 213 , 828 , which disclosure is hereby incorporated by reference ; the lead assemblies can exit from opposite sides as shown in fig1 ; the lead assemblies can each exit from the same location on their respective side of the laminate or from different locations on their respective side of the laminate as shown in fig1 . in the practice of the invention , the edge sealing of the windshield subassembly ( the interlayer composite 20 positioned between the glass sheets prior to edge sealing ) is enhanced by the practice of the invention . more particularly , after edge sealing , the ingress of air between the glass sheets is prevented by the adhesive layers 44 and 46 provided between the inner surface of the protective sleeve and the lead 40 , and the adhesive layer 48 on the upper surface of the protective sleeve as shown in fig3 – 5 . in one experiment ( the first experiment ), ten ( 10 ) pieces of copper foil having a pressure sensitive adhesive on one surface were mounted on a pvb sheet having a generally trapezoidal shape . the pieces of copper foil were each 3 . 5 mils ( 0 . 089 millimeters ( mm )) thick , 8 to 10 inches ( 20 . 32 to 25 . 4 cm ,) long ( the length was not actually measured ) and ½ inch ( 13 mm ) wide . two pieces were positioned completely within the perimeter of the pvb sheet , and eight ( 8 ) pieces had a portion positioned on the pvb sheet and had 1 inch ( 2 . 54 cm ) extend beyond the perimeter of the pvb sheet . a piece of kapton polyamide having a layer of pressure sensitive adhesive on one surface was adhered to each side of the portion of the foil extending beyond the perimeter of the pvb sheet . the pieces were 1 inch ( 2 . 54 cm ) in length , 6 mils ( 15 mm ) wide and 3 mils ( 0 . 08 mm ) thick . one - half inch ( 1 . 27 cm ) of each of the eight pieces extended out from the pvb sheet . six ( 6 ) of the pieces ( nos . 1 – 6 ) partially on the pvb sheet were spaced along one short side , e . g . the right side of the pvb sheet as viewed in fig1 , and one piece ( no . 7 ) was placed at the right side completely within the perimeter of the sheet . one piece ( no . 8 ) extended out of the center of one long side , e . g . the bottom side of the pvb sheet ; one piece ( no . 9 ) extended out of the center of the top side of the pvb sheet and one piece ( no . 10 ) was completely within the perimeter of the pvb sheet adjacent the top side of the pvb sheet as shown in fig1 . no . 3 and 4 pieces had rubber cement on the outer surface - of both polyamide pieces within the perimeter of the pvb ; no . 5 and 6 pieces had a layer of acrylic pressure sensitive adhesive one the outer face of both polyamide pieces . nos . 1 , 2 and 7 – 10 did not have . adhesive on the outer surface of the polyamide pieces . the pvb sheet having the pieces of foil was placed between two glass sheets with the sleeve halfway between the glass sheets and the remaining half out of the glass sheets . a vacuum channel was placed around the edges of the subassembly and a vacuum was pulled for 5 minutes at room temperature after which the laminate with the vacuum applied was heated in an oven at a temperature set at 250 ° f . ( 212 ° c .) for 12 minutes ; the subassembly attained a temperature 225 ° f . ( 107 ° c .) . after edge sealing , the laminate was autoclaved . after autoclaving , portions of the pvb sheet that extended out from between the glass sheets around the sleeve were pushed inwardly around the sleeve . the laminate was tested for air bubbles within the laminate by boiling the laminate for 2 hours in water heated to 212 ° f . ( 100 ° c .). the pieces of foil within the laminate were viewed by the unaided eye to observe the presence of bubbles around the pieces of foil . the no . 1 , 2 , 8 and 9 pieces that did not have any sealant between the outer surface of the polyamide pieces and the glass sheets and pvb sheet had air bubbles along the edges of the copper foil . the no . 3 and 4 pieces that had rubber cement , and the no . 5 and 6 pieces that had acrylic adhesive , on the outer surfaces of the polyamide pieces had no air bubbles along the edges of the copper foil . the no . 7 and 10 pieces within the perimeter of the glass sheets had no bubbles around the edges of the copper foil . the first experiment demonstrated that providing an adhesive , e . g . rubber cement or acrylic around the outer surfaces of the polyamide pieces prevented the ingress of air between the glass sheets during the laminating process . a second experiment was conducted to determine if the pvb , a thermo - set adhesive , would adhere to the polyamide to prevent ingress of air between the glass sheets . in the second experiment , 10 pieces of copper foil similar in size to the copper foil pieces of the first experiment were mounted using pressure sensitive adhesive on a pvb sheet in the following arrangement . the no . 11 – 16 pieces were placed in positions similar to the no . 1 – 5 and 7 pieces with the end portions of the no . 11 – 15 pieces extending beyond the perimeter of the sheet , and the no . 16 piece within the perimeter of the sheet . the no . 17 piece was placed at the center portion of the top edge of the sheet with an end potion extending beyond the edge , similar to the no . 9 piece . the no . 18 piece was placed at the center portion of the bottom edge of the sheet as viewed in fig1 with an end portion extending beyond the bottom edge of the sheet , similar to no . 8 piece . the no . 19 piece was placed at the upper left corner of the sheet with an end portion extending beyond the top edge of the sheet , similar to the no . 17 piece . the no . 20 piece was placed at the bottom left corner of the sheet with an end portion extending beyond the bottom edge of the sheet , similar to the no . 18 piece . pieces of polyamide were placed on the portions of the pieces extending beyond the edge of the pvb sheet as discussed in the first experiment . the surface of the polyamide piece facing away from the pvb sheet had either rubber cement or acrylic adhesive applied to the surface . the pvb sheet was placed between two glass sheets and laminated ; thereafter the laminated was boiled tested . the laminating and boil test procedures were similar those practiced in the first experiment . the boiled laminate was viewed with the unaided eye . no bubbles were observed around the copper foil within the glass sheets ; however , air bubbles were observed around the polyamide pieces . it was and is believed that the pvb did not attain the heat softening temperature during the edge sealing operation , i . e . the subassembly needed more soak time . a third experiment was conducted to test three types of adhesives discussed below . in the third experiment , 16 pieces of copper foil similar in size as the pieces of the first experiment were mounted on the pvb sheet with pressure sensitive adhesive in the following arrangement . four ( 4 ) pieces spaced from one another were positioned along each edge of the pvb sheet with a portion of each piece extending beyond the edge of the pvb sheet . each of the pieces had polyamide pieces around portion of the foil pieces at the edge of the pvb sheet as discussed in the first experiment . the surface of the polyamide piece facing away from the pvb sheet was coated with one of three adhesives . one adhesive was liquid paper glue sold by stockwell office products under the mark glue stick ; the other adhesive was contact cement sold by avery dennison , under the mark gluepen , and the third adhesive was contact cement sold by avery dennison under the mark glue stic . the adhesives were applied in a liquid state and were allowed to dry before the pvb sheet was placed between two glass sheets . the subassembly was laminated and boil tested as in the first experiment . the laminate was viewed with the unaided eye , and a few very minor air bubbles were observed around the pieces of copper foil . although the presence of even minor amounts of air bubbles are of concern for automotive windshields and other laminated automotive transparencies , there can be applications where laminates are used and a few minor bubbles can be managed . as can now be appreciated , the above - discussed embodiments of the invention are not limited to the position of the bus bars on the conductive member or the relationship of the ends of the bus bars to the perimeter of the coating . it is however , preferred in the practice of the invention to use the relationship of the ends of the bus bar to the perimeter of the coating to minimize , if not eliminate hot spots at the end potions of the bus bar as disclosed in u . s . patent application ser . no . 07 / 759 , 971filed even date . “ hot spots ” as the term is used herein are areas of the bus bar that are at a temperature higher than the adjacent portions of the bus bar as a result of more current moving through the area than through the adjacent portions of the bus bar . with reference to fig1 , and as disclosed in the u . s . application ser . no . 07 / 607 , 947 filed even date , the top bus bar 24 , the bottom bus bar 26 and the non - conductive strip or uncoated area 21 have a relationship to minimize , if not eliminate hot spots at the end portions of the bus bars . although not limiting to the invention , the parameters of interest in this non - limiting embodiment of the invention include ( 1 ) the position of the ends of the bus bar relative to the perimeter of the conductive member , ( 2 ) the spacing between the bus bars and ( 3 ) the change in the horizontal distance between the sides of the conductive member between the bus bars . regarding the position of the ends of the bus bar relative to the perimeter of the conductive member , as shown in fig1 end portions 60 of the top bus bar 24 and the bottom bus bar 26 extend beyond perimeter 61 of the conductive member 16 into the non - conductive strip 21 , with the ends of the bus bars preferably terminating short of the periphery 62 of the sheet 14 . through observations of ir photographs , it has been concluded that with the ends of the bus bars terminating short of the perimeter of the conductive coating while maintaining the remaining parameters constant , hot spots are observed at the end of the bus bar . as the distance between the end of the bus bar and the perimeter 61 of the coating 16 increases , the hot spots increase in size and temperature and vice versa . extending the ends of the bus bars into the non - conductive strip 21 while keeping the remaining parameters constant reduces the temperature and / or area of the hot spots when compared to ends of the bus bars that terminate short of the perimeter of the coating . it is believed that the hot spots result from more current moving through the end portions of the bus bar to heat the surrounding area of the conductive member between the end portions of the bus bar and the perimeter of the coating . based on the forgoing , it is expected that perfect alignment of the ends of the bus bar with the perimeter of the conductive coating while maintaining the other parameters constant , will reduce the current distribution at the end portions of the bus bars when compared to ends of the bus bar that terminate short of the perimeter of the coating . although it is expected that hot spots are minimized with perfect alignment of the ends of the bus bars with the perimeter of the conductive member , because of the difficulty in a production environment of continuously aligning the ends of the bus bars with the perimeter of the conductive coating , it is preferred in the practice of the invention to have the ends of the bus bars extend into the non - conductive strip 21 . the length of the end portions 60 of the bus bars 24 , 26 extending into the non - conductive strip 21 is not limiting to the invention . as long as the ends of the bus bars extend beyond the perimeter of the coating , the temperature and area of the hot spots decrease as compared to hot spots at the end portions of the bus bars terminating short of the perimeter of the conductive member . in the practice of the invention , it is preferred to have the ends of the bus bars terminate short of the peripheral edge 62 of the laminate 10 to avoid shorting of the bus bar when the windshield is mounted in the opening of the automotive body . consider now the spacing between the bus bars 24 and 26 . with continued reference to fig1 , the upper and lower edges of the glass sheet 14 and of the windshield 10 usually have a radius . the upper edge of the sheets 12 and 14 has a smaller radius and length than the bottom edge of the sheets 12 and 14 , which is the normal configuration of sheets used in the fabrication of windshields . the perimeter configuration of the conductive coating usually has the same or similar peripheral configuration as the sheets to heat the vision area of the windshield . with the bus bar 24 generally following the shape of the top edge of the conductive coating , and the bus bar 26 generally following the shape of the bottom edge of the conductive coating as viewed in fig1 , the length of the bottom bus bar is greater than the length of the upper bus bar . as the difference in length between the bus bars increases , the area of conductive coating to be heated by the bottom bus bar increases . the result of this differential is the end portions of the bottom bus bar on the coating 16 carrying more current to heat more area of the conductive coating 16 , which contributes to temperature increases at the end portions of the bottom bus bar . one solution to the problem is to provide a conductive member with a rectangular shape . however , since the windshield does not have a rectangular shape , a significantly large portion at the bottom of the windshield ( where the snow and ice usually accumulate ) would not be heated . in the practice of the invention , the solution to this problem is to reduce the space between the bus bars . for example and not limiting to the invention , the bus bar 24 is spaced from the top edge of the conductive coating 16 , and the bottom bus bar 24 is spaced from the bottom edge of the conductive member to decrease the area of the conductive member between the bus bars . in other words , the distance between the bus bars is reduced . in this manner the difference in the area to be heated by the top bus bar and the bottom bus bar is reduced . the invention is not limited to the distance between the bus bar and the adjacent side of the conductive coating ; however in the practice of the invention it is preferred to keep the bus bars out of the vision area of the windshield . consider now the change in the distance between the vertical sides or edges of the coating 16 between the bus bars 24 and 26 . in the practice of the invention , it is preferred that no portion of the vertical edges of the conductive member as viewed in fig1 between the bus bars extend beyond one or both ends of the longer bus bar . as viewed in fig1 , no portion of the coating 16 between the bus bars extends beyond the bottom bus bar 26 , the longer of the two bus bars . although not limiting to the invention , the distance between the vertical edges of the conductive member increases as the distance from the bottom bus bar decreases . portions of the conductive member between the bus bars that extend beyond the an end of the longer bus bar will result in the bus bar having to heat more area of the conductive coating . in the practice of the invention , a sputtered infrared reflecting coating was deposited onto the surface of a flat piece of glass . a mask was positioned on the glass piece to provide an uncoated marginal edge portion , the non - conductive strip 21 , after the glass sheet is cut from the glass piece . since the process of sputtering and the sputtered coating is not limiting to the invention and are well known in the art , the sputtering process and coating will not be discussed . the coating 16 terminated 16 millimeters from the peripheral edge of the sheet to provide the uncoated area 21 shown in fig1 . the coating had a generally trapezoidal shape with the width of the coating generally increasing moving from the top edge to the bottom edge of the coating as shown in fig1 . a black band of ceramic paste was silk screened on the marginal edges ( not shown ) of the sheet 12 to provide uv protection for the underlying adhesive securing the windshield in position in the automotive body . the sheet 14 having the conductive coating 16 and the sheet 12 having the black band on the marginal edge were shaped and annealed . since the process of shaping and annealing of sheets for automotive windshields is well known in the art and is not limiting to the invention , the procedures will not be discussed . with reference to fig3 and 4 , an interlayer composite 20 incorporating features of the invention had a pvb sheet 30 mils ( 0 . 76 mm ) thick and a surface area and configuration to overlay and cover the surface of the sheet 12 . the bus bars had a length sufficient to extend across the conductive coating and 0 . 25 inch ( 6 mm ) into the non - conductive strip 21 of the sheet 14 . the top bus bar , i . e . bus bar 24 , and its respective lead 40 were contiguous with another and were made of a copper foil having a thickness of 2 . 8 mils ( 0 . 07 mm ). the top bus bar was 27 mils ( 7 mm ) wide and its associated lead was 54 mils ( 14 mm ) wide with the lead exiting the center portion of the sheet 22 as shown in fig1 and 2 . the bottom bus bar 26 and its respective lead 40 were contiguous with one another and were made of a copper foil having a thickness of 2 . 8 mils ( 0 . 07 mm ). the bottom bus bar and it associated lead were 54 mils ( 14 mm ) wide with the lead exiting the left side portion of the sheet 22 as shown in fig1 and 2 . each of the leads had sufficient length to extend 1 to 1½ inches ( 2 . 54 to 3 . 81 centimeters ) from the edge of the windshield . the copper foil was secured on the sheet 22 by a pressure sensitive adhesive having a thickness of 1 mil ( 0 . 0254 mm ) and a width similar to the width of its associated metal foil . the pressure sensitive adhesive was of the type sold 3m . the pressure sensitive adhesive extended along the surface portion of the lead 40 extending beyond the sheet and is designated by the numeral 46 in fig3 – 5 . the bus bars were generally parallel to one another and spaced 36 . 5 inches ( 92 . 7 cm ). two pieces of kapton polyamide each having a thickness of 0 . 5 mils ( 0 . 013 mm ) and a width and length of 0 . 79 inch ( 20 mm ) provided the protective sleeve 42 . one piece of the polyamide was place around the bottom of each lead 40 and held in position by the adhesive layer 46 . a polyamide piece was secured on the top of each lead by providing a layer 44 of a pressure sensitive adhesive similar to the adhesive of the layer 46 . one - half ( ½ ) inch ( 1 . 27 cm ) of the polyamide was within the edge of the sheet 22 . a layer 48 of a thermo - set - adhesive no . 1500b100 ( r / flex ) supplied by roger corporation of connecticut was purchased from fralock company of california was applied to the outer surface of the protective sleeves 28 and 30 as shown in fig3 and 4 . the thermo - set adhesive had a thickness of 1 mil ( 0 . 25 mm ) and a width and length to cover the portion of the sleeve to be positioned between the glass sheets . the interlayer composite was positioned on the shaped sheet 14 with the bus bars in electrical contact with the coating 16 . the shaped sheet 12 was placed over the composite 20 . a vacuum ring of the type used in the manufacture of laminated windshields was positioned over the periphery of the assembly ( the interlayer composite 20 positioned between the sheets 12 and 14 as discussed above ) and vacuum of 20 – 28 inches of mercury was pulled . the windshield subassembly having the vacuum applied was place in an oven set at 260 ° f . ( 126 . 7 ° c .) for 15 minutes to heat the subassembly to a temperature of about 225 ° f . ( 127 . 2 ° c .). while the windshield subassembly was in the oven , the vacuum was continuously pulled through the channel to pull air from between the blanks . the heat and vacuum sealed the marginal edges of the windshield subassembly . thereafter the edge sealed windshield subassembly was placed in an air autoclave and laminated . as can be appreciated by those skilled in the art of laminating , the edge sealing of the subassembly and laminating of the edge sealed subassembly is not limiting to the invention . for example , the subassembly may be sealed using nipper rollers or bagging the subassembly , and the edge sealed subassembly may be laminated by oil autoclaving . providing the air barriers of the invention between the inner surface of the protective sleeve and the surfaces of the lead , and between the outer surface of the protective sleeve , e . g . the upper outer surface of the protective sleeve and the surface of the sheet 14 , prevents the ingress of air between the sheets 12 and 14 and between the surfaces of the conductive coating and the adjacent surfaces of the bus bars after edge sealing and during autoclaving . as can be appreciated , the outer surface of the windshield may be provided with a coating to keep the surface clean such as the type disclosed in u . s . pat . no . 6 , 027 , 766 , or a hydrophobic coating of the type sold by ppg industries , inc . under the trademark aquapel and disclosed in u . s . pat . no . 5 , 523 , 162 , which patents are hereby incorporated by reference . the particular embodiments described in detail herein are illustrative only and are not limiting to the scope of the invention , which is to be given the full breadth of the appended claims and any and all equivalents thereof .	1
fig1 is a perspective view of the chassis of a fork lift truck incorporating features of the invention . fig1 shows the battery compartment 1 , which is open on the bottom and on a side , e . g ., the right side of the fork lift truck in the figure . on the left side of the fork lift truck , the battery compartment 1 is delimited by one side wall 2 of the chassis . toward the top , the battery compartment 1 is delimited by a plate 3 , and toward the front by an additional plate 4 . as will be appreciated , directional terms , such as “ left ”, “ right ”, “ vertical ”, “ horizontal ”, “ top ”, “ bottom ”, “ front ”, “ rear ”, and the like , used in the specification and claims refer to the invention as it is shown in the drawing figures . however , it is to be understood that the invention can assume various other orientations and , thus , such terms are not to be considered as limiting . to give the chassis a desired rigidity , e . g ., sufficient rigidity for typical industrial uses , the invention teaches that a beam 5 that extends in the longitudinal direction of the fork lift truck is located directly above the battery compartment 1 on its open side ( i . e ., the right side in the illustrated embodiment ). the beam 5 can be the primary load - bearing chassis component on the open side ( right side ) of the fork lift truck and can be used to transmit forces and moments between the front and the rear sections of the fork lift truck . in its forward area , the beam 5 can be curved downwardly and can run along ( e . g ., can contact ) the front plate 4 of the battery compartment 1 . the beam 5 can be rigidly connected in the forward area with a receptacle 6 for the front axle of the fork lift truck . in the rear area , the frame , and thus also the beam 5 , directly or indirectly can be rigidly connected with the rear counterweight r of the fork lift truck , for which purpose , in the illustrated exemplary embodiment , threaded holes 7 are provided . the battery compartment 1 , which is open on the bottom , makes it possible to change a battery block b by running a pallet truck underneath the battery compartment 1 , lifting the battery block , and moving it out of the battery compartment 1 . the procedure for inserting a new battery block is in the reverse order . as the battery block is being removed or inserted , the forks of the pallet truck are located between the contact points 8 that are located on the chassis . the battery block can sit on these contact points during the operation of the fork lift truck . fig2 – 4 show a number of exemplary configurations of the cross section of the beam 5 . the cross section shapes are thereby selected so that the beam 5 has a high section modulus in torque around a horizontal or vertical axis . at the same time , it is advantageous to manufacture the beam 5 using the smallest possible amount of material which , in turn , makes it more economical . in the application in the form of a beam , the cross sections described below can be used in the illustrated orientation or they can also be rotated , e . g ., by 180 degrees . in the variant illustrated in fig2 , the beam has a t - shaped profile and includes a first ( horizontal ) metal plate 10 and a second ( vertical ) metal plate 11 that is attached perpendicular to it . the two metal plates 10 , 11 can be welded to each other , for example . the variant illustrated in fig3 also includes a first ( horizontal ) metal plate 10 and a second metal plate 12 that is attached perpendicular to it . although , on the end farther from the metal plate 10 , the metal plate 12 makes a transition to the horizontal ( e . g ., an end portion extends substantially perpendicular to the rest of the metal plate 12 ). in the variant illustrated in fig4 , instead of a vertical metal plate , there is a hollow section 13 which is placed on a horizontal ( e . g ., flat ) metal plate 10 . it will be readily appreciated by those skilled in the art that modifications may be made to the invention without departing from the concepts disclosed in the foregoing description . accordingly , the particular embodiments described in detail herein are illustrative only and are not limiting to the scope of the invention , which is to be given the full breadth of the appended claims and any and all equivalents thereof .	1
the following description and the drawings sufficiently illustrate specific embodiments to enable those skilled in the art to practice them . other embodiments may incorporate structural , logical , electrical , process , and other changes . portions and features of some embodiments may be included in , or substituted for , those of other embodiments . embodiments set forth in the claims encompass all available equivalents of those claims . fig1 illustrates a mmw bss , in accordance with some embodiments . the mmw bss 100 includes a plurality of mmw stations 104 that may communicate using millimeter waves . one of the mmw stations 104 , the central coordinator 102 , may operate as central coordinator for the mmw bss 100 to coordinate communications among the mmw stations 104 and control access to the wireless medium . in some embodiments , the central coordinator 102 may broadcast a beacon frame that indicates the length of a beacon interval during which communications are to take place . the beacon frame may be received by the other mmw stations 104 , thereby allowing the other mmw stations 104 to know when the next beacon interval will occur . the central coordinator 102 and the mmw stations 104 may utilize directional antennas and may employ beamforming , beam steering or beam directing techniques to communicate therebetween . these embodiments are described in more detail below . in accordance with some embodiments , a simplified and unified frame - format scheme for both station and information discovery is provided . the frame - format scheme may be suitable for use in both a mmw wpan and a mmw wlan . as described in more detail below , through the use of a station - capability information element , an information - request action frame , and an information - response action frame , the mmw stations 104 of the mmw bss 100 may be able to discover each other and exchange station - capability information so that non - central coordinator devices , such as mmw station 104 a and mmw station 104 b , can communicate directly in a peer - to - peer ( p2p ) manner . in some embodiments , the central coordinator 102 and the mmw stations 104 are configured to operate as part of a personal bss ( pbss ). the central coordinator 102 may be a pbss control point ( pcp ) operating as a central coordinator for the pbss , and the pbss may be configured to operate in accordance with a wireless gigabit alliance ( wigig or wga ) specification or an ieee 802 . 11 specification such as the task group ad ( ieee 802 . 11ad ) draft specification for multi - gigabit speed wireless communications technology operating over an unlicensed 60 ghz frequency band . the pbss may be configured to operate in accordance with the wigig media - access control ( mac ) or physical layer ( phy ) specifications , version 1 . 0 or later , although this is not a requirement . in some other embodiments , the pbss may be configured to operate in accordance with an ieee 802 . 15 . 3 specification for high - rate wpans , including the ieee 802 . 15 . 3 task group 3c ( tg3c ). in some embodiments , the central coordinator 102 and the mmw stations 104 comprise an infrastructure bss ( ibss ). the central coordinator 102 may be an access point ( ap ) operating as a central coordinator for the ibss . the ibss may be configured to operate in accordance with the wigig specification or the ieee 802 . 11ad specification referenced above . the mmw stations 104 may include wireless display devices , laptop and portable computers , mobile communication devices ( e . g ., cell phones , smart phones or personal digital assistant ( pdas )), hard drives and other storage devices , digital audio players ( e . g ., mp3 players ), web tablets , wireless headsets , pagers and instant messaging devices , digital cameras , televisions , medical devices ( e . g ., a heart rate monitor , a blood pressure monitor , etc . ), or other device that may receive and / or transmit information using millimeter waves . through the use of the frame - format scheme described herein , the mmw stations 104 may discover each other and exchange station - capability information , which may allow for p2p communications therebetween . for example , wireless docking and sync & amp ; go techniques for a laptop computer may be achieved . furthermore , a laptop computer will be able to determine that a wireless display device is indeed a display and not a wireless hard drive , for example , which will allow for wireless use of the display by the laptop computer . a cell phone may be able to discover and determine the capabilities of an mp3 player so that it can synchronize music files with the mp3 player . the mmw stations 104 associated with a laptop ( which may be operating as the central coordinator 102 ) may be able to discover , each other , learn each other &# 39 ; s capabilities , and subsequently establish wireless connections therebetween . in a conventional wlan or wifi network configured in accordance with conventional ieee 802 . 11 specifications , station and service discovery are less important since wean devices use microwave frequencies ( which are less directional the mmw frequencies ) and because wlan devices are generally configured to communicate directly with an access point . fig2 illustrates communications between a central coordinator 102 and anon - central coordinator station 104 a , in accordance with some embodiments . a non - central coordinator station , such as mmw station 104 a ( fig1 a ), may be configured to transmit a station - capability ie 204 to the central coordinator 102 during association 202 with the bss 100 ( fig1 ). the station - capability ie 204 may be configured to provide station - capability information to the central coordinator 102 . the non - central coordinator station 104 a may also be configured to transmit an information - request action frame 206 to a target station to either discover or request information about the one or more other mmw stations 104 ( fig1 ) of the bss 100 . the target station may be either the central coordinator 102 ( as illustrated in fig2 ) or one of the other mmw stations ( e . g ., non - central coordinator station 104 b ( fig1 )). the non - central coordinator station 104 a may receive an information - response action frame 208 from the target station ( e . g ., the central coordinator 102 ) that includes the requested information . in some embodiments , an unsolicited information - response action frame 210 may be sent unsolicited ( i . e ., not in response to an information - request action frame 206 ) by one of the mmw stations 104 , such as by the central coordinator 102 , to provide updated information to the mmw stations 104 of the bss 100 . in some of these embodiments , the unsolicited information - response action frame 210 may be transmitted by the central coordinator 102 to the associated mmw stations 104 upon association of a new mmw station 104 with the bss 100 or upon disassociation of a mmw station 104 with the bss 100 . the unsolicited information - response action frame 210 may include station - capability information of all currently associated mmw stations 104 and may include the station - capability information of the central coordinator 102 . an unsolicited information - response action frame 210 may also be sent at any time by the central coordinator 102 . in these embodiments , the transmission of the unsolicited information - response action frame 210 by the central coordinator 102 to all mmw stations 104 associated with bss 100 allows currently associated mmw stations 104 to maintain up - to - date information about the other currently associated mmw stations 104 . an unsolicited information - response action frame 210 may also be sent by a non - central coordinator station 104 to provide an information update directly to one or more other non - central coordinator stations 104 in the bss 100 . as described in more detail below , the station - capability information provided in the station - capability ie 204 , requested and / or provided in the information - request action frame 206 , or provided in the information - response action frame 208 allows a mmw station 104 to know the capabilities of other mmw stations 104 . the station - capability information may include one or more of beamforming capabilities , the number of antennas and antenna capabilities , the number of elements per antenna , supported modulations and modulation capabilities , supported channels , and multi - user ( mu ) multiple - input output ( mimo ) capabilities , among other things . this exchange of information may allow any non - central coordinator station 104 to subsequently perform beamforming training for subsequent communication therebetween . fig3 illustrates communications between two non - central coordinator stations , in accordance with some embodiments . an initiating non - central coordinator station 304 a may transmit an information - request action frame 306 to another non - central coordinator station 304 b to either discover or request information about the other the other non - central coordinator station 304 b . the other non - central coordinator station 304 b may be configured to respond by transmitting an information - response action frame 308 that includes the requested information . in some embodiments , the initiating non - central coordinator station 304 a may transmit the information - request action frame 306 to the other non - central coordinator station 304 b after the initiating non - central coordinator station 304 a has received station - capability information about the other non - central coordinator station 304 b from the central coordinator 102 ( fig1 ), although this is not a requirement . the initiating non - central coordinator station 304 a may correspond to non - central coordinator station 104 a ( fig1 ) and the other non - central coordinator station 304 b may correspond to non - central coordinator station 1049 ( fig1 ). fig4 illustrates a station - capability ie , in accordance with some embodiments . station - capability ie 400 may be suitable for use as station - capability ie 204 ( fig2 ) and may be transmitted from one mmw station 104 ( fig1 ) to another mmw station 104 to provide station - capability information to the other mmw station 104 . in some embodiments , the station - capability ie 400 may be transmitted by a mmw station 104 to the central coordinator 102 ( fig1 ) during association 202 ( fig2 ) with the bss 100 ( fig1 ) to provide station - capability information to the central coordinator 102 . in some embodiments , one or more station - capability fe 400 may be included as part of the information - request action frame 206 ( fig2 ) or the information - request action frame 306 ( fig3 ) to provide station - capability information within the frame . one or more station - capability ie 400 may also be included as part of the information - response action frame 208 ( fig2 ) or the information - response action frame 308 ( fig3 ) to provide station - capability information within the frame . in accordance with some embodiments , the station - capability if 400 may include a station ( sta ) address 402 of the sending mmw station ( e . g ., mmw station 104 a ( fig1 )), an association identifier ( aid ) 404 of the sending mmw station , and station - capability information 406 of the sending mmw station . the station address 402 may be a mac address of the sending mmw station , and the association id 404 may have been assigned by the central coordinator 102 during association 202 . the station - capability information 406 may include station - capability information of the sending mmw station and may include at least some basic capabilities of the sending mmw station . as discussed in more detail below , the information included in the station - capability ie 400 may be distributed by the central coordinator 102 in an information - response action frame 208 ( fig2 ) when requested or in an unsolicited information - response action frame 210 ( fig2 ). fig5 illustrates an information - request action frame 500 , in accordance with some embodiments . information - request action frame 500 may be suitable for use as information - request action frame 206 ( fig2 ) and information - request action frame 306 ( fig3 ). in some embodiments , a sending mmw station , such as non - central coordinator station 104 a ( fig1 ), may transmit the information - request action frame 500 to a target station to either discover or request information about the one or more other mmw stations 104 ( fig1 ) in the bss 100 ( fig1 ). the target station may be either the central coordinator 102 ( fig1 ) or one of the other mmw stations ( e . g ., non - central coordinator station 104 b ). in some embodiments , the information - request action frame 500 may also include station - capability information of the sending mmw station . the sending mmw station may also configure the information - request action frame 500 to include station - capability information of other mmw stations 104 that are known to the sending mmw station , in addition to the station - capability information of the sending mmw station . the information - request action frame 500 may allow the sending mmw station to either discover other mmw stations 104 or request information about the one or more other mmw stations 104 of the bss 100 . in some embodiments , the information - request action frame 500 includes at least a target address field 503 and a request ie field 504 . the target address field 503 may include an address of the target station , and the request ie field 504 may be configured to indicate the types of information elements that the sending mmw station is requesting from the target station ( e . g ., either the central coordinator 102 or anon - central coordinator station such as mmw station 104 b ). when the information - request action frame 500 is transmitted to the central coordinator 102 ( as illustrated in fig2 ) and when the target address field 503 includes a broadcast address , the sending mmw station may be requesting information about all the other mmw stations 104 that are associated with the central coordinator 102 . the request ie field 504 may allow the sending mmw station to specify which types of ies are being requested from the target station . in some embodiments , almost any type of ie may be requested in the request ie field 504 . as further illustrated in fig5 , the information - request action frame 500 may also include a category field 501 to indicate that the information - request action frame 500 is a frame applicable to a mmw bss , and an action field 502 to indicate that information - request action frame 500 is requesting information . in some embodiments , category field 501 , action field 502 , and request ie field 504 may be configured in accordance with section 7 . 3 . 2 . 12 of the ieee 802 . 11ad specification , although this is not a requirement . when the information - request action frame 500 is transmitted to another non - central coordinator station , such as non - central coordinator station 304 b ( as illustrated in fig3 ), the target address field 503 may include a mac address of the other non - central coordinator station 104 b indicating that the sending mmw station is requesting information about the other non - central coordinator station 104 b directly from the other non - central coordinator station 104 b . accordingly , peer non - central coordinator stations may discover each other and request information about each other . furthermore , this exchange of information may allow direct - link setup ( dls ) performed between peer non - central coordinator stations . accordingly , an information - request action frame 500 may be used by a mmw station 104 to request information about either a single station in the bss 100 or about all of the associated mmw stations 104 in the bss 100 . if a mmw station 104 is requesting information about only a single mmw station 104 in the bss 100 ( fig1 ), the requesting station may set the target address field 503 in the frame to the mac address of that single mmw station 104 . if a mmw station 104 is requesting information about all of the mmw stations 104 in the bss 100 , it may set the target address field 503 in the frame to the broadcast address and may transmit the information - request action frame 500 to the central coordinator 102 . in some embodiments , the information - request action frame 500 may also include a station - capability field 505 that includes station - capability information about the sending mmw station ( i . e ., the source station ) and station - capability information about other mmw stations 104 that are known to the sending mmw station . the information - request action frame 500 may also include an optional ie - provided field 506 that includes an actual ie that the sending mmw station is providing to the target station . in these embodiments , an information - request action frame 500 may provide the capabilities and any other ies of the sending mmw station ( i . e ., the source station ). this reduces the number of handshakes between the two mmw stations 104 . as illustrated in fig5 , a station - capability field 505 may be included in the information - request action frame 500 for each mmw station for which station - capability information is being provided . as also illustrated in fig5 , an ie - provided field 506 may also be provided for each ie that is provided . as also illustrated in fig5 , one or more vendor - specific ie 507 may also be included in the information - request action frame 500 . accordingly , a simplified and unified frame - format scheme for both station and information discovery suitable for use in a mmw wpan or a mmw wlan is provided . fig6 illustrates an information - response action frame 600 , in accordance with some embodiments . the information - response action frame 600 may be suitable for use as information - response action frame 208 ( fig2 ) or information - response action frame 308 ( fig3 ). the information - response action frame 600 may transmitted by a mmw station either unsolicited or in response to receipt of the information - request action frame 500 ( fig5 ). when the information - response action frame 600 is sent in response to an information - request action frame 500 , it may be referred to as a solicited information - response action frame because it was requested by another mmw station . when the information - response action frame 600 is not sent in response to an information - request action frame 500 , it may be referred to as an unsolicited information - response action frame 210 ( fig2 ). in accordance with the embodiments illustrated in fig6 , the information - response action frame 600 may include a target address field 603 and a request ie field 604 . the target address field 603 may include an address of a target station ( i . e ., that station that is to receive the information - response action frame 600 ) when the information - response action frame 600 is solicited . the target address field 603 may include a broadcast address when the information - response action frame 600 is unsolicited . the request ie field 60 . 4 may be configured to indicate the types of information elements that are being provided in the information - response action frame 600 . the information - response action frame 600 may also include one or more optional station capability fields 605 to indicate station capability of one or more mmw stations 104 . the information - response action frame 600 may also include one or more optional ie - provided fields 606 to include the actual information elements that the mmw station 104 transmitting the information - response action frame 600 is providing to the mmw station 104 receiving the information - response action frame 600 . as also illustrated in fig6 , the information - response action frame 600 may also include a category field 601 , an action field 602 , and one or more vendor - specific fields 607 , similar to fields 501 , 502 and 507 , respectively , as discussed above . fig7 illustrates a functional block diagram of a mmw station 700 , in accordance with some embodiments . the mmw station 700 may be suitable for use as any one of mmw stations 104 ( fig1 ), including the central coordinator 102 ( fig1 ). the mmw station 700 may include one or more antennas 701 that may be configured for communicating millimeter wave signals either in a directional manner or in a non - directional manner . in accordance with embodiments , the mmw station 700 may configure the antennas 701 for non - directional communications for establishing an initial contact with another mmw station , and may configure the antennas 701 for directional communications after establishing an initial contact with the other mmw station . in these embodiments , station - capability information received from the other station or received from the central coordinator 102 may be used for the directional communications . in some embodiments , beam - forming training may be performed and beamforming coefficients may be employed for the directional communications . the mmw station 700 may include mmw phy layer 702 , mac layer 704 , and memory 706 . in some embodiments , the mmw station 700 may implement the mmw phy layer 702 and the mac layer 704 in accordance with a wigig pew and mac specifications ( or the ieee 802 . 11ad specification ) for multi - gigabit speed wireless communications technology operating over the unlicensed 60 ghz frequency band . memory 706 may be configured to store , among other things , the station - capability information received from other mmw stations for use in communicating with the other mmw stations . although mmw station 700 is illustrated as having several separate functional elements , one or more of the functional elements may be combined and may be implemented by combinations of software - configured elements , such as processing elements including digital signal processors ( dsps ) and / or other hardware elements . for example , some elements may comprise one or more microprocessors , dsps , application specific integrated circuits ( asics ), radio - frequency integrated circuits ( rfics ) and combinations of various hardware and logic circuitry for performing at least the functions described herein . in some embodiments , the functional elements of mmw station 700 may refer to one or more processes operating on one or more processing elements . antennas 701 may comprise one or more directional or omnidirectional antennas , including , for example , dipole antennas , monopole antennas , patch antennas , loop antennas , microstrip antennas or other types of antennas suitable for transmission of rf signals . in some embodiments , instead of two or more antennas , a single antenna with multiple apertures may be used . in these embodiments , each aperture may be considered a separate antenna . in some mimo embodiments , antennas 701 may be effectively separated to take advantage of spatial diversity and the different channel characteristics that may result between each of antennas 701 and the antennas of a sending mmw station . in some mimo embodiments , antennas 701 may be separated by up to 1 / 10 of a wavelength or more . in some embodiments , the mmw station 700 may be configured to perform association beam - forming training ( a - bft ) with collision avoidance , in accordance with u . s . patent application ser . no . 12 / 559 , 770 , filed sep . 15 , 2009 , entitled “ millimeter - wave communication station and method for scheduling association beamforming training with collision avoidance ,” in some embodiments , the mmw station 700 may be configured to perform multiple - access beamforming and beamforming training in accordance with u . s . patent application ser . no . 12 / 574 , 140 , filed oct . 6 , 2009 entitled “ millimeter - wave communication station and method for multiple - access beamforming in a millimeter - wave communication network .” referring to fig1 - 6 , in accordance with some embodiments , the mmw stations 104 and the central coordinator 102 may implement a set of protocol procedures . for example , a sending mmw station 104 may transmit an information - request action frame 500 to a destination station 104 in the bss 100 with a length field of the request ie 504 set to zero to determine if the destination mmw station is still present in the bss 100 and is within range of the sending mmw station 104 . a sending mmw station 104 , such as non - central coordinator station 104 a , may transmit an information - request action frame 500 that includes its station - capability information element 400 and other information elements . however , a sending mmw station 104 , such as non - central coordinator station 104 a , may be prohibited from including the station - capability information of another station within an information - request action frame 500 . as discussed above , a sending mmw station 104 may transmit an information - response action frame 600 either as a response to an information - request action frame 500 , or it may be sent unsolicited . if the sending mmw station 104 is providing information about a single other mmw station of the bss 100 , the sending mmw station 104 may set the target address field 603 in information - response action frame 600 to a mac address of that single other mmw station . if a sending mmw station 104 is providing information about all of the stations in the bss 100 in the information - response action frame 600 , it may set the target address field 603 in information - response action frame 600 to the broadcast address . in accordance with some embodiments , a responding station 104 ( either a station 104 or the central coordinator 102 ) may be configured to include , an information - response action frame 600 , the information elements that were requested by the station requesting the information . a responding station ( either a station 104 or the central coordinator 102 ) may also be configured to send an information - response action frame 600 with an empty payload in response to a received information - request action frame 500 for which the requesting mmw station solicits information about a single station that is not a member of the bss 100 and the responding station is the central coordinator 102 ( or that is not the responding station itself ). otherwise , the responding station may send an information - response action frame 600 with the information requested by the requesting station . embodiments may be implemented in one or a combination of hardware , firmware and software . embodiments may also be implemented as instructions stored on a computer - readable storage device , which may be read and executed by at least one processor to perform the operations described herein . a computer - readable storage device may include any non - transistor mechanism for storing information in a form readable by a machine ( e . g ., a computer ). for example , a computer - readable storage device may include read - only memory ( rom ), random - access memory ( ram ), magnetic disk storage media , optical storage media , flash - memory devices , and other storage devices and media . in some embodiments , system 100 may include one or more processors and may be configured with instructions stored on a computer - readable storage device . the abstract is provided to comply with 37 c . f . r . section 1 . 72 ( b ) requiring an abstract that will allow the reader to ascertain the nature and gist of the technical disclosure . it is submitted with the understanding that it will not be used to limit or interpret the scope or meaning of the claims . the following claims are hereby incorporated into the detailed description , with each claim standing on its own as a separate embodiment .	7
synthetic peptides were prepared by normal fmoc - chemistry using preloaded tentagel resins , pybop / nmm for in situ activation and 20 % piperidine in nmp for fmoc removal [ h . s . hiemstra et al ., proc . natl . acad . sci . u . s . a . 94 : 10313 - 10318 ( 1997 )]. couplings were performed for 60 minutes with six - fold acylating species . after final fmoc removal , peptides were cleaved with tfa / h 2 o 19 / 1 ( v / v ) containing additional scavengers when c ( triethylsilane ) or w ( ethanethiol ) were present in the peptide sequence . peptides were isolated by ether / pentane 1 / 1 ( v / v ) precipitation and isolation of the product by centrifugation . after air - drying at about 40 ° c ., peptides were dissolved in acetic acid / water 1 / 10 ( v / v ) and lyophilized . peptides were checked on purity using uplc - ms ( acquity , waters ) and on integrity using maldi - tof mass spectrometry ( microflex , bruker ), showing the expected molecular masses . the clinical isolate of methicillin - resistant staphylococcus aureus ( mrsa ), luh14616 was kindly provided by dr . s . croes , maastricht university medical center , maastricht , netherlands ( see s . b . m . c . croes , microbiol . 2009 ; 9 : 229 . doi : 10 . 1186 / 1471 - 2180 - 9 - 229 ) and that of mupirocine - resistant mrsa luh15051 was a gift from dr . m . e . o . c . heck ( laboratory for infectious diseases and screening , national institute for public health and environment , rivm , bilthoven , netherlands ). s . aureus jar is described in campoccia et al . ( int . j . artif . organs , 2008 september ; 31 ( 9 ): 841 - 7 ). bacteria were stored at - 80 ° c . until use . inoculi of mid - log phase bacteria were prepared by incubating isolated mrsa colonies from blood agar plates in tryptic soy broth ( tsb ) medium ( becton dickinson , le pont de clax , france ) for 2 . 5 hours and then diluted to the concentration needed . for the in vitro killing assay on mid - log phase bacteria , mrsa luh14616 and mrsa luh15051 were resuspended to a concentration of 1 × 10 6 bacteria / ml in pbs . subsequently , 200 μl was added to a concentration range of peptides ll - 37 , p60 . 4ac ( op - 145 ) and p10 that were lyophilized in advance . subsequently , the bacteria - peptide mixture was incubated for 1 hour at 37 ° c . to establish the killing capacity of these peptides , the suspensions were serially diluted and plated onto dst agar plates to measure viable cfu counts . ic90 , ic99 and ic99 . 9 values are calculated by linear regression analysis . for the in vitro killing assay with p10 variants , s . aureus jar ( 1 min cfu / ml ) were incubated for 2 hours at 37 ° c . with various concentrations of the peptides in pbs or in pbs / human plasma ( 1 / 1 , v / v ). depicted in tables 2 - 6 is the concentration of the peptide that resulted in killing of 99 . 9 % of the bacteria ( 1000 cfu / ml remaining ). the lc99 . 9 is the average value of two independent experiments . human skin equivalents were prepared as described in el ghalbzouri et al . ( lab . invest . 2004 january ; 84 ( 1 ): 102 - 12 ). in brief , 5 × 10 5 normal human keratinocytes were seeded onto fibroblast - populated rat - tail collagen matrices . the collagen matrices were prepared in advance by making a basal ( 0 . 1 % acetic acid , 4 mg / ml collagen , hank &# 39 ; s balanced salt solution ( hbss , 10 ×), 1 m naoh and fcs ) and a top collagen layer in which normal human fibroblasts were seeded ( 4 mg / ml collagen , 10 × hbss , 1 m naoh , fcs and fibroblasts ). transwell filters with 3 μm pore size ( corning 3414 , costar ) were used to culture the human skin equivalents . the collagen matrices were cultured in fibroblast medium for a week . the full thickness human skin equivalents were first cultured submerged in keratinocyte medium for 2 or 3 days at 37 ° c . and 7 . 3 % co 2 and were then cultured in keratinocyte medium as described above , but with 1 % fcs and supplemented with 2 m l - serine , 10 mm l - carnitine , 1 μm dl - α - tocopherol - acetate , 50 μm ascorbic acid , a lipid supplement that contained palmitic acid , linoleic acid and arachidonic acid in a 1 : 1 : 1 ratio and 2 . 4 × 10 − 5 m bovine serum albumin . after 2 or 3 days , the hses were then cultured at the air - liquid interface for 14 days in keratinocyte medium as described above , but without serum and supplemented with 2 m l - serine , 10 mm l - carnitine , 1 μm dl - α - tocopherol - acetate , 50 μm ascorbic acid , a lipid supplement that contained 25 μm palmitic acid , 30 μm linoleic acid and 7 μm arachidonic acid ( 2 : 1 : 1 ) and 2 . 4 × 10 − 5 m bovine serum albumin . culture medium was refreshed twice a week . full - thickness skin models were reconstructed as described above using transwell filters with a pore size of 0 . 4 μm , corning 3460 , costar ). after 10 days of culturing at the air - liquid interphase , burn wounds of 20 mm 2 were made by applying liquid nitrogen on the skin equivalents for 15 seconds . the thermally injured skin equivalents were incubated for 1 hour at 37 ° c . and 7 . 3 % co 2 before infection . infection was done by applying an inoculum of 1 × 10 5 mrsa onto the skin equivalents . after incubation for 1 hour , the non - adherent bacteria were removed . treatment started 1 hour or 8 hours after infection and one dose ( 100 μg in 100 ml of pbs ) of ll - 37 , p60 . 4ac or p10 was given . treatment was prolonged for 4 hours or 24 hours before processing . the skin equivalents were washed with 1 ml of pbs to remove all non - adherent bacteria . then two biopsies of 4 mm were taken and homogenized in 1 ml of pbs . the homogenates and the washes were serially diluted to measure viable cfu counts on diagnostic sensitivity test ( dst ) agar plates . a set of 15 peptides was synthesized . the peptides were designed to either strengthen or weaken the predicted amphipathic structure when compared to p60 . 4ac ( m . j . nell et al ., peptides ( 2006 ) 649 - 660 ), as based on computer - assisted structure predictions . anti - biofilm activity is highly variable among the peptides ( both higher and lower activity antimicrobial peptides were generated in this way ). it was anticipated that a delicate relation exists between modification of the amphipathic helical structure and anti - biofilm activity within antimicrobial peptides . therefore , a series of short synthetic peptides were developed based on these observations , and their antimicrobial activity was evaluated . the activity of these peptides varied from no antimicrobial activity , to peptides with an activity that exceeded that of ll - 37 on a molar basis . peptide p10 kills mrsa lyh14616 very efficiently . it has the highest activity against mrsa luh14616 of all peptides tested , and is even considerably more effective than p60 . 4ac ( op - 145 ), see fig2 a and 2b . for instance , p10 has an ic99 . 9 of 0 . 59 μm , meaning that at this concentration , p10 kills 999 out of 1000 bacteria . p60 . 4ac , at a similar , even slightly higher concentration of 0 . 75 μm , kills only 900 out of 1000 bacteria ( ic90 of 0 . 75 μm ). thus , 100 times more bacteria survive after treatment with p60 . 4ac as compared to treatment with p10 at a similar concentration . hence , p10 has an approximately 100 times better activity than p60 . 4ac . peptide 10 was more effective than ll - 37 and p60 . 4ac in killing mrsa and mupirocine - resistant mrsa and in eliminating these bacteria from thermally wounded human skin equivalents ( fig3 - 5 ). p 10 is highly effective against mrsa bacteria in log phase , stationary bacteria and bacteria residing in biofilms . 1 ) gram - positive bacteria , e . g ., various strains of methicilline - resistant as well as - sensitive strains ( see fig4 and 5 ), staphylococcus epidermidis , 2 ) gram - negative bacteria including various ( drug - resistant ) pseudomonas aeruginosa strains , ( drug - resistant ) acinetobacter baumannii strains , 3 ) mycobacteria , and 4 ) the fungal pathogens ( fluconazole - resistant ) candida albicans and aspergillus niger . p10 variants in which one or all amino acids have been replaced by their corresponding d - amino acid , or one amino acid has been replaced by another l - amino acid have antimicrobial activity that is comparable to that of p10 . also , variants having an elongated n - terminal or c - terminal with different groups including acetyl , amide , nh —( ch 2 — ch 2 — o ) 11 — co , hexanoyl , decanoyl , myristoyl , propionyl , one or two amino - hexanoyl groups , and shorter p - 10 variants have antimicrobial activity that is comparable to that of p10 . the sequence and activity of these p10 variants are shown in tables 2 , 3 , 5 and 6 . peptides in which proline substitutions were introduced to break the helix were mostly inactive ( see table 4 ).	0
fig1 shows diagrammatically an x - ray examination apparatus which comprises an image pick - up apparatus according to the invention . an x - ray source 1 irradiates an object 2 , notably a patient to be examined , by means of an x - ray beam 3 and an x - ray image is picked up by an entrance screen 4 of an x - ray image intensifier which converts the x - ray image into a light image on the exit window 6 . via a lens system 7 , the light image is imaged on an image sensor 8 in the form of a charge - coupled ( ccd ) sensor 8 which forms part of a camera 9 which forms an electronic image signal from the light image . a control circuit 10 is arranged to adapt the adjustments of the electric gate voltages of the ccd sensor to the selected mode of operation , for example x - ray imaging or fluoroscopy . the camera 9 and the control circuit 10 constitute an image pick - up apparatus 12 . the electronic image signal is applied to a monitor 11 so as to be observed , for example by a radiologist , or is applied to a buffer circuit 13 to await further processing . the x - ray examination apparatus also comprises an adjusting unit 14 for adjusting the x - ray examination apparatus , notably the x - ray source 1 in respect of energy , dose and pulse duration of the x - rays emitted by the x - ray source . the adjusting unit 14 is coupled to a control unit 15 of the image pick - up apparatus . the adjusting unit 14 supplies the x - ray source 1 and the control unit 15 with an adjustment signal . the control unit selects a mode of operation of the image pick - up apparatus in conformity with the adjustment of the x - ray source . selection of such a mode of operation implies the supply of a selection signal to the control circuit 10 for adjustment of a selection signal for supply to a gate circuit in order to adjust the gate voltages so as to obtain a desired spatial resolution , but also for the adjustment of a diaphragm 16 or for the adjustment of an electronic amplifier unit 17 for amplifying the electronic image signal . fig2 is a diagrammatic front view of a ccd sensor of the image pick - up apparatus shown in fig1 . the ccd sensor comprises an image pick - up section 20 and a storage section 21 . the image pick - up section 20 comprises a plurality of gate electrodes 22 1 , 1 - 22 n , m which are arranged in a matrix . a gate circuit 28 applies electric voltages to the gate electrodes of the image pick - up section 20 . the gate electrodes are arranged on an isolator layer which is composed , for example of silicon oxide , or of silicon nitride , or of a combination of silicon dioxide and silicon nitride . the isolator layer is provided on a crystalline silicon substrate . the electric voltages applied to the various gate electrodes co - determine the potential variation in the depth direction of the substrate . regions in the substrate which are situated underneath gate electrodes carrying a positive electric voltage constitute light - sensitive elements . when an image - carrying light beam which is emitted , for example by the exit window 6 of the x - ray image intensifier , is incident on the image pick - up section of the ccd sensor , charge carriers are released in the light - sensitive elements , which charge carriers are collected underneath the collecting gate electrodes and the isolator layer and the substrate . these charge carriers may be electrons , but also holes . for the description of the figures of the drawings , it is assumed , by way of example , that the charge carriers collected are electrons . gate electrodes carrying a positive electric voltage operate as collecting gate electrodes which collect electrons released by radiation absorption . gate electrodes carrying a negative electric voltage isolate light - sensitive elements from one another , so that they act as isolating gate electrodes . the charges collected in the light - sensitive elements correspond to the light intensities incident on the light - sensitive elements ; a light image is thus converted into an electron image in the image pick - up section of the ccd sensor . the gate circuit 28 supplies groups 23 of gate electrodes , electrically connected to the gate circuit via contact lines 29 , with an electric voltage which is positive relative to the gate electrodes adjoining said groups , the groups 23 being isolated from one another by gate electrodes which receive a negative electric voltage via the gate circuit . the light - sensitive elements are thus formed by metal oxide semiconductor ( mos ) capacitances operating in deep depletion , and the light - sensitive elements are isolated by mos capacitances connected in the reverse direction . after formation of the charge carrier image , being an electron image when electrons are collected by the collecting gate electrodes , the gate circuit repeatedly shifts the pattern of applied electric voltages through one matrix row in the direction of the storage section 21 so as to transfer the electron image from the image pick - up section to the storage section . to this end , the image sensor also comprises a storage section having a matrix of gate electrodes 24 1 , 1 - 24 n , m on an isolator layer which is composed of , for example silicon dioxide provided on a silicon substrate . the image pick - up section is shielded from light incident on the ccd sensor by way of a light - impermeable shield 25 . the gate electrodes 24 k , 1 of the storage section receive electric voltages via a transfer circuit 26 which electrically connects the gate electrodes 24 to the transfer circuit via contact lines 29 . a read - out circuit 27 is formed as a horizontal read - out register and is connected to the columns of gate electrodes of the storage section 21 . in order to read - out an electron image stored in the storage section , the transfer circuit transfers the charges constituting the picked up electron image to the read - out circuit 27 by repeatedly shifting the pattern of the electric voltages applied to the gate electrodes 24 k , 1 of the storage section 21 in the direction of the read - out circuit 27 . from the read - out circuit 27 the charges of successively read - out matrix rows are applied to an amplifier which converts the charges into electric voltage pulses which constitute an electronic video signal . fig3 a , 3 b and 3 c offer a diagrammatic impression of respective lateral dimensions , i . e . dimensions in the face of the image sensor which faces the light beam incident on the image sensor , of a light - sensitive element for different electric gate voltages applied to the ccd sensor of the image pick - up apparatus of fig1 . the electric voltages applied to the gate electrodes are controlled by the control circuit . the control circuit 10 applies a selection signal to the gate circuit 28 and to the transfer circuit 26 in order to select an electric voltage pattern in conformity with a selected mode of operation of the x - ray examination apparatus or the image pick - up apparatus 12 . the spatial resolution of the ccd sensor is determined by the lateral dimensions of the groups of gate electrodes 23 whereto positive electric voltages are applied during the picking up of an image . fig3 a shows a 5 × 5 part of the gate electrodes of the image pick - up section . as is shown in fig3 a , a group 23 a of 3 × 3 gate electrodes 23 k + 1 , 1 + 1 23 k + 3 , 1 + 3 receives an electric voltage which is positive relative to the gate electrodes surrounding the group 23 a , the group 23 a being surrounded by gate electrodes which receive a negative electric voltage relative to the group 23 a . the electric voltage pattern for the entire image pick - up section consists of a periodic continuation in the row and column directions of the spatial resolution of the ccd sensor ; thus , the smallest detail in the light image that can still be distinguished in the electron image derived therefrom is now determined by the lateral dimensions of the surface of the region 30 a as determined by the group 23 a . the enclosure of the group 23 b by gate electrodes carrying a negative electric voltage consists of regions having a width of one gate electrode in the row direction as well as in the column direction . image details in the light image , imaged on the image sensor by means of the lens system 7 , of dimensions smaller than the dimensions of the region 30 b cannot be distinguished from one another in the electron image formed when the applied electric voltages are adjusted in this manner . using the control circuit 10 , an alternative electric voltage pattern can be applied to the gate electrodes of the image pick - up section 20 by application of a selection signal during the picking up of an image . an example of a first alternative electric voltage pattern is shown in fig3 b in which a group 23 b of 2 × 2 gate electrodes receives a positive electric voltage , said group being enclosed by gate electrodes carrying a negative electric voltage . the enclosure of the group 23 b by gate electrodes carrying a negative electric voltage consists of regions having a width of two gate electrodes in the row direction as well as the column direction . the region 30 b underneath which electrons are collected after absorption of light has a light collecting surface area whose dimensions are smaller than those of the corresponding region 30 a in fig3 a . as a result , the modulation transfer function of the image sensor is increased for the electric voltage pattern of fig3 b , so that smaller details can be distinguished in the electron image and the spatial resolution of the image pick - up apparatus is enhanced by using the electric voltage pattern shown in fig3 b . fig3 c shows an example of a second alternative electric voltage pattern ; a group 23 c of 2 × 3 gate electrodes then receives a positive electric voltage , said group being enclosed by gate electrodes carrying a negative electric voltage relative to the group 23 c . in the column direction the enclosure of the group 23 c consists of regions of a width of one gate electrode , whereas in the row direction it consists of regions of a width of two gate electrodes . the region 30 c underneath which electrons are collected has a light collecting surface whose dimension in the row direction is smaller than that of the corresponding region 23 a in fig3 a . as a result , the modulation transfer function is increased , and hence also the spatial resolution of the image pick - up apparatus in the row direction of the ccd sensor , whereas the spatial resolution remains the same in the column direction . increasing the spatial resolution in one direction , for example the row direction , is advantageous in an image pick - up apparatus in which two or more ccd sensors are used , each of which picks up the same image , be it with a shift amounting to a fraction of the distance between adjacent rows relative to one another . in the case where use is made of two ccd sensors , said fraction preferably amounts to half the distance between adjacent rows . from the electronic image signals of the two image sensors there is formed one electronic image signal in that image lines of the electronic image signal of one ccd sensor constitute the odd image lines in the composite image and the image lines of the other ccd sensor constitute the even image lines in the composite image . by adjusting the electric gate voltages in conformity with fig3 c it is achieved that the spatial resolution becomes substantially equal in both directions in the composite image . fig3 d is a plan view of an alternative embodiment of an image sensor of an image pick - up apparatus according to the invention ; this figure offers a diagrammatic impression of lateral dimensions of a light - sensitive element of an image sensor provided with isolating barriers between the columns of light - sensitive elements . a group of collecting gate electrodes 23 d is formed by gate electrodes which have been selected as collecting gate electrodes . the region 30 d defines the active surface area of a light - sensitive element . the gate electrodes 22 k + 1 , 1 + 2 and 22 k + 1 , 1 + 3 have been selected as collecting gate electrodes by applying an electric voltage thereto which is positive relative to adjoining gate electrodes 22 k + 1 , 1 and 22 k + 1 , 1 + 4 . the columns of light - sensitive elements are isolated from one another by isolating barriers 31 . fig4 a is a sectional view , taken along the line i — i , of the image sensor shown in fig3 d . the image sensor is described , by way of example , as an image sensor in which the collected charge carriers are electrons . to this end , an n - type crystalline silicon layer which acts as a charge channel 41 is provided on a p - type crystalline silicon substrate 40 . on the charge channel 41 there is provided an isolator layer 42 of , for example silicon dioxide and on the isolator layer there are provided the gate electrodes which are made of polycrystalline silicon and which are rendered adequately conductive by doping . the contact lines 29 are also made of such polycrystalline silicon . it is thus achieved that gate electrodes are electrically connected to the gate circuit 28 by conductors which are also transparent to the incident radiation . light incident on the image sensor releases electron - hole pairs in the n - type charge channel ; the holes are drained to the p - type substrate and the electrons are collected in the charge channel 41 , notably underneath the collecting gate electrodes . fig4 b is a sectional view , taken along the line ii — ii , of the image sensor shown in fig3 d . fig4 b shows notably that the charge channel 41 is bounded on both sides by isolating barriers 31 made of p - type silicon . migration of electrons to adjacent columns is impeded by the isolating barriers 31 because a p - n - junction in the reverse direction is formed at the interface between the charge channel 41 and the isolating barriers 31 . instead of being made of p - type silicon , the substrate may also be made of n - type silicon which is isolated from the charge channel 41 by a p - type silicon intermediate layer . this version of an image sensor according to the invention also offers the advantage that deeply penetrating radiation , for example infrared radiation , releases charge carriers in the n - type substrate which cannot reach the charge channel because the intermediate layer constitutes a barrier . when in the event of high incident light intensities such large quantities of charge are collected underneath the collecting gate electrodes that diffusion to an adjacent light - sensitive element could occur , diffusion is avoided in that superfluous charge is drained , through the intermediate layer , to the n - type silicon substrate instead of to an adjacent light - sensitive element . fig5 shows diagrammatically an image pick - up apparatus 12 , comprising a beam splitter 50 for splitting a light - image - carrying beam into an image - carrying reflected sub - beam 51 r and an image - carrying transmitted sub - beam 51 t . these image - carrying sub - beams are projected onto separate image sensors 52 and 53 , each of which comprises a plurality of gate electrodes 22 . the image sensors convert the image - carrying sub - beams into collected charge carriers which from electronic sub - images in the image sensors and which are converted into electronic sub - image signals which are applied to signal combiner 54 in which the electronic sub - image signals are combined to form an electronic image signal of a composite image . the image sensors 52 and 53 are , for example ccd sensors , each of which picks up the same image , be it with a shift of a fraction , for example half , of the distances between adjacent rows of gate electrodes in one direction . from the electronic sub - image signals of the two image sensors an electronic image signal is composed in that image lines of the electronic image signal of one image sensor constitute the odd image lines in the composite image and the image lines of that of the other image sensor constitute the even image lines in the composite image . such combination enhances a spatial resolution in a direction transversely of the direction of the image lines . the control circuit 10 is coupled to the image sensors 52 and 53 in order to adjust the electric gate voltages on the gate electrodes 22 in such a manner that the spatial resolution in the composite image is substantially the same in directions parallel to and transversely of the image lines .	7
fig1 illustrates an example system 80 that efficiently acquires signals received from a global navigation satellite system ( gnss ) in accordance with an embodiment of the present invention . the system 80 includes a code multiplication and frequency downconversion unit 84 , a code generation component 86 , a local oscillator ( lo ) 88 , a filter and downsample component 90 and a signal power metric and frequency offset estimator 94 . the code multiplication and frequency downconversion unit 84 receives signals from the gnss via an antenna and front end receiver components ( not shown ) and generates a plurality of downconverted intermediate frequency ( if ) signals representing varied relative time shifts between local code replica and incoming signal based on spreading codes received from the code generation component 86 and only a single frequency signal generated by the lo 88 . the filter and downsample component 90 further reduces ( decimates ) the sample frequency ( f s ) of the signals outputted from the code multiplication and frequency downconversion unit 84 . filtering also occurs at the filter and downsample component 90 as will be described later . the signal power metric and frequency offset estimator 94 receives the output of the filter and downsample component 90 and generates both a signal power metric value and estimate of the frequency offset of that received signal . the estimator 94 performs signal power metric and frequency offset estimation based on each of the time - varied spreading codes . the output of the estimator 94 is sent to an acquisition and tracking controller 96 that uses the output of the estimator 94 for detection of signal presence , estimation of its parameters and initialization of tracking . the functions performed by the downconversion unit 84 , the code generation component 86 , the lo 88 and the filter and downsample component 90 are performed by the prior art except that the lo 88 in the prior art produces a plurality of frequencies stepped by some δf through a range of frequencies based on a predefined estimation of possible frequencies of the gnss signals that may be received . also , in the present invention , the filter and downsample component 90 is implemented with hardware components not found in the prior art , although the function performed is known by the prior art . fig2 illustrates a system 100 that is a more detailed example of the system 80 as shown in fig1 . the example system 100 includes a plurality of slices of hardware components that receive a preprocessed if signal . in this embodiment , a single code generation component 86 can be used to supply time delay spreading codes across each of the slices . the code generation component 86 includes a code generator 140 , a code clock 142 , and a shift register 144 . the code generator 140 generates spreading codes based on input information from the acquisition and tracking controller 96 and a clock signal from the code clock 142 . the output of the code generator 140 is sent to the shift register 144 , which performs a time delay delivery of the spreading codes to the slices . alternatively only a single code can be outputted from code generator 86 and the shift register 144 can be placed at the preprocessed if input to deliver time delayed samples of incoming signal to multiple slices . within each of the slices , the code multiplication and frequency downconversion unit 84 receives the spreading code at a first multiplier 150 that multiplies it with the preprocessed if signal . the lo 88 includes a local oscillator 156 and a phase delay component 160 . the local oscillator 88 produces i and q signals that are sent to multipliers 158 and 162 in the downconversion unit 84 in order to perform frequency downconversion of the signal outputted from the multiplier 150 . the i and q signals from the downconversion unit 84 are fed to the cascaded integrator - comb ( cic ) filters 90 - 1 and 90 - 2 of the filter and downsample component 90 . the cic filters 90 - 1 and 90 - 2 perform further downsampling and filtering . other hardware devices may be used in place of the cic filters 90 - 1 and 90 - 2 . one of the major advantages of described acquisition method is the possibility of using a fixed lo 156 for relatively slow spreading codes ( gps c / a and boc ( 1 , 1 ) planned for gps and galileo li ). the easiest and most hw economical implementation is with lo running at ¼ of sampling frequency f s . however it must be noted that for fast spreading codes ( gps military p - code and codes planned for gps and galileo l 5 ) the integration time is limited by received code drift caused by doppler and local clock error . thus for sensitive acquisition ( long integration times ) at least code clock and optionally local oscillator used to generate local replica must be adjustable and size of frequency bins evaluated by herein presented method must be limited by generation of replica at an appropriate number of frequency offsets . this way the method becomes similar to classical approach , however it can still be beneficial in some implementations , e . g . due to possible frequency estimate accuracy improvement . also the number of evaluated frequency bins can still be significantly lower than with classical methods . also , it can be expected that in most applications independent acquisition of fast codes ( l 5 ) will not be necessary as it can be aided by results obtained from li acquisition . code multiplication and frequency downconversion can be done in any order . also , the input signal can be downconverted to zero if externally by an analog quadrature mixer , i . e ., conversion to zero if can be done as part of the receiver front end . fig3 and 4 illustrate two different embodiments for the signal power metric and frequency offset estimator 94 . as shown in fig3 , an estimator 200 receives a combination of the in - phase i and quadrature q signals from the cics 90 - 1 and 90 - 2 ( fig2 ). the received combined signal is applied to a multiplier 210 and is multiplied with the same signal that is delayed by a delay device 206 and acted upon by a complex conjugate component 208 , which operations are known to those having ordinary skill in the art . i δ and q δ are outputted from the multiplier 210 and sent to an averaging component 214 . an example averaging component is an integration and dump ( i & amp ; d ) device . the output ( avg ( i δ )+ javg ( q δ )) of the component 214 is then supplied to a device 220 that performs a cartesian to polar conversion to produce an amplitude component ( signal power metric ) and a phase component ( frequency offset estimate ). an example algorithm that performs cartesian to polar conversion is the coordinate rotation digital computer ( cordic ) algorithm . other conversion algorithms may be used . the amplitude and phase components are then sent to the acquisition and tracking controller 96 . the cartesian to polar conversion device 220 generates the signal power metric ( amplitude ) in accordance with the following embodiment : where j is imaginary unit and s k is complex number representing i and q components coming from the cic filters 90 - 1 and 90 - 2 at time k / f s ( f s is sample frequency at output of cic filters ). a is amplitude of harmonic signal ( if present ) and 0 if no signal is present . depending on particular hw implementation usage of square of amplitude ( a 2 ) can be also advantageous . the cartesian to polar coordinate conversion device 220 generates phase as follows : frequency is estimated directly from angle of averaged i δ and q δ as : where f s is sampling frequency ( at input of multiplier 210 ). to avoid biased estimates , additive noise at the input of the multiplier 210 needs to be white , i . e . consecutive samples need to be independent of each other . this condition is well satisfied if cic filter with single delay in comb section is used and no additional smoothing is applied . fig4 illustrates an alternate embodiment for the signal power metric and frequency offset estimator 94 as shown in fig1 and 2 . an example estimator 250 receives the i and q signals from the cics 90 - 1 , 90 - 2 into optional filtering components 256 and 258 . one example is moving average filtering ( sum of n consecutive samples optionally divided by n ) but generally any other digital filter can be applied . to achieve maximum sensitivity , as much additive noise as possible needs to be filtered out . depending on particular implementation phase modulo arithmetic can require sampling frequency significantly higher than 2f ifmax ( nyquist sampling theorem ). in this case , additional filtering ( smoothing ) is applied . this can be achieved either by more than one sample delay in cic &# 39 ; s comb section or by additional filtering in component 256 . a cartesian to polar conversion device 260 generates amplitude and phase values from the received i and q signals . cartesian polar conversion can be accomplished using e . g . cordic algorithms . the outputted phase value ( φ ) is subtracted at a combiner 266 from phase delayed by a delay device 264 . next , the output of the combiner 266 is sent through a phase unwrap component 268 for performing smoothing of the phase value to produce a delta phase ( δφ ). the δφ outputted by the phase unwrap component 268 is sent to an i & amp ; d ( averaging ) component 270 . the averaged output avg ( δφ ) is then sent to an optional scaling device 274 in order to generate the frequency offset estimate according to the following equation : the δφ is also sent to a variance estimator 282 that produces a phase increase variance value ( var ( δφ )) or a modified second moment of phase increase value ( var mod ( δφ )) depending upon a predefined option . a power discriminator 284 receives the averaged amplitude value ( avg ( a )) from an i & amp ; d device 280 and one of the outputs of the variance estimator 282 to determine signal power metric value . see the following power discriminator options : option 3 ( not depicted ): for strong signals only one of the discriminator inputs is used . option 4 ( not depicted ): any of these metrics can be used in combination with that shown in fig3 to support weak signals detection . the present invention can exploit data and pilot channels that are going to be used in galileo and modernized gps systems . each data and pilot channel use different spreading codes but are modulated on the same carrier . data and pilot channels can thus be combined at various levels . out of all the options combining data and pilot metrics at input of integrate and dump ( i & amp ; d ) blocks depicted in fig3 and 4 is believed to be most reasonable : i δ = i δ , pilot + i δ , data , q δ = q δ , pilot + q δ , data fig4 : fig5 illustrates an example process 300 performed by the acquisition and tracking controller 96 . first , at a block 310 , the amplitudes / power metrics from all the slices are compared to a predetermined threshold and eventually to each other to determine potential signal presence . the concrete implementation of block 310 may be varied , however methods similar to those used in standard acquisition methods for correlation peak search can be used . if the peak is positively detected at the output of particular slice ( decision block 316 ), the controller proceeds to standard acquisition refinement ( fine carrier and code synchronization in phase locked loops and delay locked loops , bit synchronization and frame synchronization — block 312 ) and tracking performed in tracking units 96 . code offset and rough frequency offset estimates corresponding to slice where the peak was detected are used as initial conditions for this subsequent process . if the peak is not detected at the output of particular slice ( decision block 316 ), the controller selects a new code delay bin or a new satellite ( block 320 ). the present invention describes processing after analog to digital conversion , i . e . in digital hw like a field programmable gate array ( fpga ) or application specific integrated circuit ( asic ). while the preferred embodiment of the invention has been illustrated and described , as noted above , many changes can be made without departing from the spirit and scope of the invention . accordingly , the scope of the invention is not limited by the disclosure of the preferred embodiment . instead , the invention should be determined entirely by reference to the claims that follow .	6
fig1 is a perspective view of a continuous lateral circulator , generally indicated at 10 , installed within a cultivation pond 12 . the continuous lateral circulator 10 has the general form of a conveyor belt turned on its side , such that the breadth of the belt 14 extends vertically . the belt 14 is endless and is trained over two vertically - extending pulleys 16 , 18 . a motor 20 coupled to one of the pulleys 16 drives the belt 14 in a loop . a series of angled cleats 22 , arranged at a regular pitch along the length of the belt 14 , help to push the water in the pond as the belt 14 is driven . the pond 12 itself is typical for a cultivation pond , and as can be seen in fig1 , the circulator 10 is installed in the center of it and extends substantially the entirety of the length of the pond 12 , evenly spaced between the sides and the two ends . for example , if the pond 12 is 1 , 000 feet ( 305 meters ) long and 100 feet ( 30 meters ) wide , the circulator 10 may be approximately 900 feet long , leaving an equal distance at each end . of course , the circulator 10 need not be perfectly centered in the pond 12 in all embodiments , and ponds 12 may be of any size . as will be described below in more detail , one advantage of circulators 10 according to embodiments of the present invention is that they may remove agitation - based size restrictions on cultivation ponds 12 , thereby allowing for larger ponds . the pond 12 may be of any depth , although typical cultivation ponds are relatively shallow — depths of less than 1 foot ( 0 . 3 meters ) are common . as shown in fig1 , the circulator 10 in the illustrated embodiment is taller than the illustrated depth or water level of the pond 12 in which it is placed . that is , the illustrated water level in the pond 12 is lower than the top of the belt 14 and pulleys 16 , 18 . in most embodiments , the circulator 10 will extend at least substantially the entire depth of the pond 12 , and in many of those embodiments , the circulator 10 may be taller than the average expected pond depth . the extra height allows the water level in the pond 12 to be increased , as might be done for temperature control and for various other reasons known to those skilled in the art . as one example , if a typical water height of a pond 12 is about 12 inches ( 30 cm ), the circulator may be about 18 inches ( 46 cm ) tall . while the cultivation pond 12 illustrated in fig1 is uncovered and open , cultivation ponds 12 may be covered and closed , as is known in the art . there is no particular limitation to the height of the belt 14 and its pulleys 16 , 18 , or to the length of the belt 14 . particularly with long belts , it may be helpful to include idler pulleys or rollers , also oriented vertically , which would provide support along the length of the belt 14 . additionally , the circulator 10 may include belt tensioners and other such devices . the length of the belt 14 , its height , and the speed at which it is to be driven are among the factors that dictate how much power is required to drive the belt 14 . in the illustrated embodiment , a motor 20 directly drives one of the pulleys 16 to move the belt 14 . that motor 20 may , in some embodiments , be as small as ½ horsepower or , in other embodiments , as large as 10 horsepower . the placement of the motor 20 , however , is not critical . in some embodiments , the motor 20 may be placed on the other pulley 18 . in yet other embodiments , the motor 20 may be located elsewhere , and one or both pulleys 16 , 18 may be driven by a drive - train connected between the motor 20 and the pulleys 16 , 18 . generally speaking , various methods of driving conveyor belts are known , and any compatible method may be used in embodiments of the present invention . in fig1 , the circulator 10 is relatively narrow , with nothing between the two sides of the belt 14 . that may not be the case in some embodiments . in some cases , the belt 14 may be arranged around a berm , wall , or other structure , with more pulleys or rollers , if needed , to dictate its path around that structure . for example , many cultivation ponds have walls and other dividing structures , and a belt 14 may be arranged around those walls and structures . as another example , a belt 14 may be placed around a pair of parallel walls that are about as high as the belt 14 and are spaced from each other at a distance of about 3 feet ( 1 meter ). such walls could be used , for example , to support an elevated horizontal walkway , located between the two sides of the belt 14 , that allows maintenance workers to walk along the center of the pond 12 in order to service the circulator 10 or the pond 12 itself . additionally , while the belt 14 of fig1 is trained over the pulleys 16 , 18 such that it has two long sides that are parallel to one another , that need not be the case in other embodiments . instead , the belt 14 may be trained over any number of pulleys , rollers , idlers , and other structures to have any desired shape , e . g ., polygonal or serpentine , if the geometry of the cultivation pond or other factors dictate it . fig2 is a side elevational view of the circulator 10 in isolation . in fig2 , the evenly - spaced cleats 22 can be seen . cleats 22 are used to drive the water in the pond 12 . in the illustrated embodiment , each cleat 22 is a continuous bar of constant cross - section that extends across the height of the belt 14 at an angle . the cleats 22 of the illustrated embodiment overlap such that if one draws a straight line down the belt 14 , that line may intersect several cleats 22 , e . g ., 4 - 6 cleats , depending on their number and angle . the cleats 22 are arranged at a regular pitch , which will vary from embodiment to embodiment , but may be on the order of , e . g . 3 - 6 inches . it should be understood that for reasons of legibility and ease in illustration , the drawing figures show fewer cleats at a greater pitch than would be used in most typical operational embodiments . fig3 is a cross - sectional view of one of the cleats 22 . as shown , it has a generally trapezoidal cross - section in the illustrated embodiment , such that it is narrower at the top ( i . e ., the outermost point ) than it is at the base . in a typical embodiment , a cleat 22 might have a height in the range of about 1 - 2 inches ( 2 . 5 - 5 centimeters ), and a width in that range as well . the cleat 22 of fig3 has a base of about 1 inch ( 2 . 5 centimeters ) and an outward extent of about 2 inches ( 5 centimeters ). it may be helpful if the cleats 22 , taken together , have at least the same effective surface contact area as a paddlewheel suitable for use in the same size of cultivation pond 12 . (“ effective surface contact area ” in this context refers to the area that actually contacts and drives water at any point in time .) in some cases , if numerous cleats 22 are on the belt 14 , the effective surface area of those cleats 22 may be greater than that of a paddlewheel that would be used in the same pond , which may allow the belt 14 to move more slowly and provide the same quality of effective circulation . of course , the cleats 22 may vary in form and arrangement from embodiment to embodiment , depending on any number of factors . for example , the cleats may instead have a rectilinear cross - section , but may curve downwardly as they extend outwardly from the belt 14 . ultimately , the cleats 22 are present to push water , and any cross - sectional shape that accomplishes that purpose may be used . additionally , the cleats 22 need not be continuous bars , they may have different cross - sectional shapes , and they may be inclined at different angles . the forces developed by each cleat 22 are shown in fig4 , a schematic view of the belt 14 with only a single cleat 22 . if the belt 14 is driven forward with a longitudinal velocity v l , the cleat 22 will generate a forward force ( f l ) and a forward velocity ( v l ), as well as a downward force ( f d ) and a downward velocity ( v d ). the amount of forward versus downward force ( i . e ., the forward and downward components of the overall force vector ) is in proportion to the inclination angle of the cleat , θ , and can be readily determined trigonometrically . in most embodiments , the angle θ will be in the range of about 10 - 45 °, although a more preferable range for at least some embodiments might be 10 - 30 °, and in some cases , the range might be narrower still , e . g ., 18 - 22 °. the cleat of fig4 is inclined at an angle of 22 °, although it should be understood that the angles shown and described above assume that it is desirable to push the water down ; if one wished to push the water up , instead of down , the orientation of the cleats 22 would be reversed . in some embodiments , the ratio of v d to v l may be , e . g ., 3 : 1 , 4 : 1 , etc . fig4 is a two - dimensional schematic illustration of the effect of the cleats 22 on the water . the cross - section of the cleats 22 may be chosen specifically to cast water outward , away from the belt 14 . fig5 is a top plan view of the pool 12 and the circulator 10 . as shown in fig5 , the belt 14 is driven forward at some longitudinal velocity , v l , that is aligned with the central long axis of the pond . however , the motion of the belt 14 also drives water forward , down , and away from the belt 14 , creating continuous lateral circulation ( i . e ., in the direction indicated by arrows v t ) between the circulator 10 and the sides and the bottom of the pool 12 . fig6 is a schematic end - elevational view of the pool 12 illustrating the circulation from that perspective . as fig5 and 6 make clear , the circulator 10 is not a point - source agitator placed , for example , on one end of the pond 12 . rather , by extending over virtually the entire length of the pond 12 , it provides continuous circulation and agitation energy to essentially the entirety of the pond 12 . in so doing , it may remove agitation - based size restrictions on cultivation ponds 12 . while in many cases , the circulator 10 will be operated continuously , in this context , the term “ continuous circulation ” to the fact that the circulator 10 spans and is physically continuous over substantially the entirety of the pond 12 . the circulation or agitation in the pond 12 is distributed across almost the entire pond 12 ; the circulator 10 is not a point source for agitation , like a paddlewheel . in a typical scenario , the belt 14 is driven and the cleats 22 are adapted to ensure a relatively mild turbulent flow in the direction of belt movement , but a relatively strong turbulent flow in the lateral direction . with conventional ponds that use paddlewheels as point - source agitators , reynolds numbers of 60 , 000 or more are commonly achieved , indicating very strong turbulent flow . however , large amounts of energy are expended in maintaining those flow conditions , and some of the invested energy may be lost . by contrast , with lateral circulators 10 according to embodiments of the present invention , reynolds numbers of 15 , 000 - 30 , 000 in the lateral ( i . e ., transverse ) direction may be more commonly used . the belt 22 itself may be driven at relatively low velocity longitudinally , e . g ., on the order of 2 inches ( 5 cm ) per second . as those of skill in the art will realize , the velocity at which the belt 14 is driven and the velocity of the water around the belt 14 are , in many cases , two different things . the degree to which the belt 14 pushes the water , the momentum imparted , and the direction will vary with the drive velocity ; the orientation , number , and shape of the cleats 22 ; and a number of other fluid - dynamic factors . as those of skill in the art might also appreciate , even without cleats 22 to aid in moving water , a belt 14 driven at a high enough velocity could probably produce a desired lateral velocity of the water , but the fraction of that energy that would be transferred to the water would likely be much less than it would be with cleats 22 . ultimately , the desired water velocities will also depend on non - mechanical factors , such as the type of algae or other organism , and the presence of wind and other environmental factors . as was described above , the belt 14 will typically be given a longitudinal velocity , referred to in this description as v l . while that velocity may be continuous over long periods of time , it need not necessarily be . the overall velocity may be varied from moment to moment , if necessary , based on conditions within the cultivation pond 12 , the needs of the particular organism being cultivated , and environmental factors that affect the pond 12 . it should also be understood that the speed at which the motor 20 runs may not be equal to v l ; in most cases , gearing or a drive train between the motor 20 and the pulley 16 that it drives will alter the speed of the motor 20 . in many cases , a gearbox may be integrated into the motor . beyond imparting motion to the belt , other drive signals may be used , and in some cases , superposed on the main drive signal that creates the longitudinal velocity of the belt 14 . for example , it has long been known that vibrations introduced into mechanical systems can help to prevent friction and make mechanisms operate more smoothly — a technique called dithering . embodiments of the present invention may use dithering — for example , by altering the velocity , acceleration , or direction of the belt 14 at a rate that is significantly different than the velocity of the belt 14 or the rate at which it drives the water . for example , if v l is selected to drive the water at a rate of 1 hz , a lower - amplitude , low frequency signal equivalent to about 0 . 1 hz may be used for dithering . the resulting movement may be an oscillation , a vibration , or a non - cyclic pattern of acceleration , velocity , or directional changes . the nature and amplitude of the dithering may vary from embodiment to embodiment , and is not particularly limited , so long as the dithering does not detract from the primary motions that the moving belt 14 is to impart to the water . of course , depending on the belt velocity and other factors , dithering may not be required . in a typical embodiment , the turbulent flows that surround the belt 14 and impinge on it during operation may vibrate the circulator 10 in the same way that dithering would — without the need to drive the belt 14 in any special way . the belt 14 itself may be made in any of a variety of ways . for example , the belt may be made of a rubber , or of a rubberized or coated fabric or other textile . as was described above , the exterior of the belt 14 has cleats in order to better interact with the water in the cultivation pond 12 . the inward - facing side of the belt 14 may also have grooves , cleats , or other features in some embodiments . because the belt 14 is mounted vertically , slippage of the belt 14 on the pulleys 16 , 18 may be more of an issue than in a belt 14 of similar dimensions that is mounted horizontally . thus , grooves , cleats , or other inward - facing gripping features may be helpful in retaining the belt 14 on the pulleys 16 , 18 . for example , the belt 14 and pulleys 16 , 18 may have the cleats and pulley - grooves shown in u . s . pat . no . 4 , 011 , 939 to conrad , the contents of which are incorporated by reference in their entirety . additionally , while the pulleys 16 , 18 in the illustrated embodiment are rounded , additional features may be included to prevent slippage or other tracking problems . in some cases , sprockets mounted near or at the edges of the pulleys 16 , 18 may be made to insert into series of complementary slots cut or formed in coincident positions near the edges of the belt 14 . in other words , the belt 14 and pulleys 16 , 18 may have male and female complementary engaging structures to prevent belt slippage and so - called tracking problems . in some cases , the male structures may be carried by the belt 14 and the female structures may be carried by the pulleys 16 , 18 , while in other cases , the opposite may be true . belts 14 may also be made of a number of rigid sections of plastic , rubber , or metal connected together to articulate or flex . as one example of this , fig7 is an elevational view of a section of a belt 100 , that is comprised of a number of modular sections 102 , 104 , 106 , 108 , 110 , 112 , each of which is rigid or semi - rigid . the sections 102 , 104 , 106 , 108 , 110 , 112 have edges that define a series of complementary projections and grooves , allowing the sections 102 , 104 , 106 , 108 , 110 , 112 to be essentially enmeshed in one another . a series of openings 114 , which line up when the sections 102 , 104 , 106 , 108 , 110 , 112 are enmeshed , allow for the insertion of pins 116 , about which the sections 102 , 104 , 106 , 108 , 110 , 112 hinge to allow the belt 100 to flex . in the description above , it was briefly explained that the cleats 22 need not be continuous bars . on the belt 100 , the cleats are not only discontinuous , but portions of them are carried by different sections 102 , 108 , 110 . more specifically , in the illustration of fig7 , three cleat sections 118 , 120 , 122 are each carried by a different section 102 , 108 , 110 of the belt . the cleat sections 118 , 120 , 122 have the inclination angle described above , and may have the cross - sectional shape described above or any other desirable shape . as shown , when the sections 102 , 108 , 110 are assembled , the cleat sections 118 , 120 , 122 roughly line up , although there may be some discontinuity . additionally , the two segments 102 , 104 that define the top of the belt 100 and the two segments that define the bottom of the belt 100 in the illustration of fig7 include a series of slots 124 at a regular pitch positioned to engage a drive sprocket on one of the belt - drive pulleys . fig8 illustrates the engagement of the belt 100 trained over a pulley 130 with sprockets 134 . in the description above , a single circulator 10 with a single belt 14 , 100 spans the length of the cultivation pond 12 . however , that need not be the case in all embodiments . instead , in some embodiments , multiple circulators arranged in series or , in some cases , in parallel , may be used . fig9 is a top plan view illustrating three circulators 10 a , 10 b , 10 c arranged in series , aligned end - to - end , to cover the same length of a cultivation pond 12 . each of the circulators 10 a , 10 b , 10 c has its own endless belt 14 , trained over its own set of pulleys 18 , 20 . the ends of the circulators 10 a , 10 b , 10 c are spaced closely together , although the spacings may be modified to effect control over circulation in the areas between the circulators 10 a , 10 b , 10 c . of course , any number of circulators 10 a , 10 b , 10 c may be used to cover any desired length or distance . smaller circulators 10 a , 10 b , 10 c may be used in parallel when the cultivation pond , or a channel within the pond , is particularly wide . circulators 10 a , 10 b , 10 c may also be used in parallel when the pond 12 is divided or partially divided such that a single circulator 10 or in - series line of circulators 10 a , 10 b , 10 c is unlikely to produce a lateral circulation that will reach essentially the entire pond . although this description places some emphasis on the circulator 10 providing continuous circulation or agitation across an entire cultivation pond 12 , and that arrangement has a number of advantages , it need not be used in that way in all embodiments to be effective . in some cases , a lateral circulator may be considerably shorter than the circulator 10 of fig1 . in cases where the circulator is relatively short or small compared to the size of the cultivation pond 12 , that circulator essentially becomes a point source for circulation or agitation , in which case , its longitudinal velocity may be significantly greater than a circulator 10 with a more extensive area in order to achieve the same degree of circulation or agitation . while the invention has been described with respect to certain embodiments , the description is intended to be exemplary , rather than limiting . modifications and changes may be made within the scope of the invention , which is defined by the appended claims .	8
a dual leash 10 is illustrated in side perspective views in fig1 a and 1 b . the dual leash 10 has a handle portion 11 with an opening for a user &# 39 ; s hand 16 and a main body portion 12 . extending from the body portion 12 are two clips 13 for securing to an animal collar wherein each clip 13 is attached to a retractable lead cable 14 . the retractable lead cables 14 may be locked from retracting by compression of the push button lock 15 . a dual leash 10 is illustrated in a first exploded perspective view in fig2 . the main body 12 is hollow with a support spindle 21 inserted centrally within . the support spindle 21 extends across the hollow opening of the main body 12 and is mounted at the top of the main body 12 with a spindle top cap 32 and at the bottom of the main body 12 with a spindle bottom cap 33 . a compression spring ( not shown ) is inserted over the support spindle 21 external to the spindle bottom cap 33 and biases the hollow opening of the main body 12 towards a push button lock 15 in the handle portion 11 . compression of the push button lock 15 causes the hollow opening of the main body 12 to move relative to the support spindle 21 by sliding along the longitudinal axis of the support spindle 21 and as a result compressing the compression spring ( not shown ) and engaging the spool stop features 22 on the main body 12 . engagement of the down position lock 42 may be utilized for hands - free locking of the cord spools 31 . when the push button lock 15 is released , the compression spring forces the hollow opening of the main body 12 to move back towards the mounting point of the push button lock 15 in the handle portion 11 thereby releasing the spool stop features 22 . two cord spools 31 are mounted on the support spindle 21 within the hollow opening of the main body 12 . the cord spools 31 rotate about a vertical rotation axis as a function of spring steel contained within the central chamber 25 of each cord spool 31 . the cord spools 31 are secured within the main body 12 on the top by a spindle top cap 32 and on the bottom by a spindle bottom cap 33 . a body top plate 35 secured by screws 36 holds a precision thin section ball bearing 34 in position above the top cord spool 31 . the ball bearing 34 enables the main body 12 to rotate freely in relation to the handle portion 11 with minimal friction thereby ensuring the non - entangling of the separate retractable lead cables 14 . eyelets 41 provide guidance for the smooth extension and retraction of the cord within the main body 12 . a dual leash 10 is illustrated in a second exploded perspective view in fig3 . the push button lock 15 is shown mounted over the support spindle 21 and provides a lever - like action to push the hollow opening of the main body 12 relative to the support spindle 21 . the cord spools 31 are secured within the main body 12 on the top by a spindle top cap 32 and on the bottom by a spindle bottom cap 33 . a body top plate 35 secured by screws 36 holds a precision thin section ball bearing 34 in position above the top cord spool 31 . the cord spools 31 within the main body 12 and the main body 12 rotate relative to the handle portion 11 about a vertical rotation axis . the push button lock 15 shares the same rotation axis as the cord spools 31 and main body 12 , providing that the push button lock 15 can be depressed no matter the rotational position of the main body 12 to the handle portion 11 . the locking of the cord spools 31 is triggered by a series of teeth 37 that extend from the circular flat surface of the cord spools 31 . the teeth 37 are arranged in a radial pattern . spool stop features 22 ( see fig2 ), not visible in fig3 , are provided within the hollow opening of the main body 12 , extending from the inner wall of the main body 12 . at least one spool stop feature 22 is configured to engage the teeth 37 . when the push button lock 15 is compressed , the hollow opening of the main body 12 is shifted such that the cord spools 31 are moved toward the spool stop features 22 inside the main body 12 and the teeth 37 on each cord spool 31 engage the spool stop features 22 to prevent the rotation of the cord spools 31 . eyelets 41 provide guidance for the smooth extension and retraction of the cord within the main body 12 . engagement of the down position lock 42 may be utilized for hands - free locking of the cord spools 31 . a dual leash 10 is illustrated in a cross - section perspective view in fig4 . the handle portion 11 with an opening for a user &# 39 ; s hand 16 is adjacent to the push button lock 15 , shown in the “ up ” position such that the cord spools 31 and the retractable lead cables 14 ( not shown ) can retract in and out of the main body 12 . eyelets 41 provide guidance for the retractable lead cables 14 . a down position lock 42 allows the user to stop the rotation of the cord spools 31 by securing the push button lock 15 in a compressed position without the need to continually compress the push button lock 15 . when the push button lock 15 is compressed , the spindle 21 is forced downward causing tension in the compression spring 45 at the base of the main body 12 . the precision thin section ball bearing 34 , secured in place by the body top plate 35 , allows for the free movement of the handle portion 11 in relation to the main body 12 about the vertical axis . spring steel positioned within the central chamber 25 of the cord spools 31 provides the automatic retraction of the lead cables 14 once the tension on the spring steel is released . a dual leash 10 is illustrated in a cross - section perspective view in fig5 . the compression of the push button lock 15 results in the vertical downward movement of the support spindle 21 / cord spool 31 assembly as shown by the large downward arrow , which allows for the engagement of the teeth 37 with the spool stop features 22 to prevent the rotation of the cord spools 31 . a handle portion 11 of a dual leash 10 is illustrated in a close - up cross - section perspective view in fig6 . the spool stop features 22 on the main body 12 are shown in fig6 a . when the push button lock 15 is in the “ down ” position , as shown in fig6 b , the down position lock 42 can be pushed forward to engage a hook to secure the push button lock 15 in the “ down ” position without having to hold down the locking mechanism 15 , as shown in fig6 c . the down position lock 42 can be disengaged by a downward motion and a compression spring will force the support spindle / cord spool assembly upwards further allowing the cord spools to rotate and the cables to retract or extend ( not shown ). details of a single retractable lead cable 14 and attached cord 75 are shown in fig7 . the internal end 71 connected to the spooling portion 72 of cord 75 is shown in fig7 a . the internal end 71 is a loop that is secured about the cord spool 31 ( not shown ). the external end of the retractable lead cable 14 which contains a clip 13 for attaching to an animal collar ( not shown ) is shown in fig7 b . the securing of the internal end 71 of the spooling portion 72 is shown attached to a cord spool 31 in fig7 c . a retraction blocking element 74 , positioned on the spooling portion 72 of the cord 75 where the cord 75 connects to the external end of the retractable lead cable 14 is shown in fig7 d . the retraction blocking element 74 prevents the external end of the retractable lead cable 14 from retracting into the main body 12 . the spring steel 82 within each cord spool 31 ( not shown ) is shown in fig8 . a single spring steel 82 placed within a cord spool 85 is shown in fig8 a . a single spring steel 82 is shown in fig8 b . when in a native position , the spring steel 82 is coiled as shown in 8 b devoid of tension resulting in the complete retraction of the spooling portion 72 if the cord 75 . the center of the spring steel 83 is secured to the support spindle 21 ( not shown ) such that when the retractable lead cable 14 is extended , the cord spool 31 ( not shown ) rotates vertically about the support spindle 21 causing the spring steel to move into a tensioned state about the support spindle 21 . when the tension in the spring steel 82 is released the retractable lead cable 14 and the spooling portion 72 of the cord 75 are automatically retracted into the main body 12 by means of the cord spool 31 rotating about the support spindle 21 . the present invention provides a multi - cabled retractable pet leash for walking two pets simultaneously using a single compact design . one embodiment of the present invention provides a multi - cabled retractable pet leash , the leash comprising : a main body extending vertically , defined by a top portion and a bottom portion and defining the main chamber within said main body ; a stationary support spindle located centrally within the main body and extending between the top portion and the bottom portion ; a first cord spool positioned vertically in relation to a second cord spool within the main body such that each cord spool may rotatably engage with the support spindle about a vertical rotational axis ; a first cord coiling about said first cord spool ; a second cord coiling about said second cord spool ; a spindle top cap positioned externally to said first cord spool ; a spindle bottom cap positioned externally to said second cord spool ; a precision thin section ball bearing located above said first cord spool ; a body top plate positioned above the precision thin section ball bearing secured with screws ; a handle positioned above the support spindle and exterior to the precision thin section ball bearing ; a first lead cable and a second lead cable extending from the main body wherein the end of each lead cable comprises a clip ; and a locking feature in said handle . in another embodiment of the present invention , the multi - cabled retractable pet leash contains a main chamber within the main body which is further divided into an upper chamber positioned vertically in relation to a lower chamber within the main body . in a preferred embodiment , the lower floor of the first chamber further contains spool stop features which protrude vertically from said floor and the lower floor of the second chamber further contains spool stop features which protrude vertically from said floor . in another embodiment of the present invention , the multi - cabled retractable pet leash is further comprised of a single cord spool located within each of said upper chamber and said lower chamber . in a preferred embodiment , a first cord is coiled about said first cord spool and a second cord is coiled about said second cord spool . in yet another embodiment , the lower surface of said first cord spool and said second cord spool contain teeth which engage the spool stop features in the upper and lower chamber when the locking mechanism is compressed . in another embodiment of the present invention , the multi - cabled retractable pet leash is further comprised of a spring steel retractable feature located in the center of each of said first cord spool and said second cord spool . in a preferred embodiment , the spring steel is secured at one end to the support spindle . in yet another embodiment , the first cord spool and second cord spool extend and retract independent of each other . in another embodiment of the present invention , the multi - cabled retractable pet leash has a retraction lock feature wherein the retraction of the cord may be locked without the user having to continue to compress the locking mechanism . in another embodiment of the present invention , the multi - cabled retractable pet leash has a precision thin section ball bearing mounted at the juncture of the main body and the handle such that the ball bearing allows the main body and the handle to rotate independently with minimal friction thereby ensuring the non - entanglement of the separate lead cables . in a preferred embodiment , when the push button lock is engaged , the central spindle is pressed in the downward position , causing the cord spools to interact with the spool stop features on the main body . the stop features will engage each spool independent of the position of the housing in relation to the handle and allow the housing to rotate freely about the ball bearing ring even when the locking mechanism is engaged . this feature is a key improvement over the prior art because the dual leashes described in the prior art become locked when the spools are locked . pet owners will appreciate the continued free rotation of the housing while locking the rotation of the spools because dogs may continue to roam and move about in relation to each other and the leash housing even when the owner has the desire to control the length of leash released from the spool . in addition to the rotation of the housing , even when spool rotation is locked , the simplified locking mechanism is an improvement over the prior art . the use of a central spindle for the positioning of the spools as well as the action point of the locking mechanism eliminates the requirement of the shaft mounted to the housing , which is a required element in the prior art . the direct action of the locking mechanism on the central spindle to press the spools into a locked position ( i . e . engaging with the spool stop features ) requires fewer components compared to the prior art . the requirement of fewer components translates to fewer points of malfunction in the locking mechanism as well as a lower cost in manufacturing because of fewer , less complex internal components . it will be appreciated that details of the foregoing embodiments , given for purposes of illustration , are not to be construed as limiting the scope of this invention . although several embodiments of this invention have been described in detail above , those skilled in the art will readily appreciate that many modifications are possible in the exemplary embodiments without materially departing from the novel teachings and advantages of this invention . accordingly , all such modifications are intended to be included within the scope of this invention , which is defined in the following claims and all equivalents thereto . further , it is recognized that many embodiments may be conceived that do not achieve all of the advantages of some embodiments , particularly of the preferred embodiments , yet the absence of a particular advantage shall not be construed to necessarily mean that such an embodiment is outside the scope of the present invention .	0
illustrative embodiments of the system of the present disclosure are described below . in the interest of clarity , all features of an actual implementation may not be described in this specification . it will of course be appreciated that in the development of any such actual embodiment , numerous implementation - specific decisions must be made to achieve the developer &# 39 ; s specific goals , such as compliance with system - related and business - related constraints , which will vary from one implementation to another . moreover , it will be appreciated that such a development effort might be complex and time - consuming but would nevertheless be a routine undertaking for those of ordinary skill in the art having the benefit of this disclosure . in the specification , reference may be made to the spatial relationships between various components and to the spatial orientation of various aspects of components as the devices are depicted in the attached drawings . however , as will be recognized by those skilled in the art after a complete reading of the present disclosure , the devices , members , apparatuses , etc . described herein may be positioned in any desired orientation . thus , the use of terms such as “ above ,” “ below ,” “ upper ,” “ lower ,” or other like terms to describe a spatial relationship between various components or to describe the spatial orientation of aspects of such components should be understood to describe a relative relationship between the components or a spatial orientation of aspects of such components , respectively , as the device described herein may be oriented in any desired direction . referring to fig1 in the drawings , a rotorcraft 102 is illustrated . rotorcraft 102 has a rotor system 101 with a plurality of rotor blades 103 . rotorcraft 102 further includes a fuselage 104 , landing gear 106 , and an empennage 108 . a main rotor control system can be used to selectively control the pitch of each rotor blade 103 in order to selectively control direction , thrust , and lift of rotorcraft 102 . it should be appreciated that even though the system of the present application is depicted on a rotorcraft 102 having certain illustrated features , it should be appreciated that the system of the present application can be implemented on other aircraft and aircraft configurations , as one of ordinary skill in the art would fully appreciate having the benefit of this disclosure . referring to fig2 , rotor hub 101 includes a plurality of rotor blades 103 coupled to a central yoke 109 , via a rotor grip 107 . yoke 109 is coupled to a rotor mast 105 such that rotation of rotor mast 105 , in a direction 113 , causes the yoke 109 and rotor blades 103 to rotate about the rotor mast axis of rotation . it should be appreciated that even though rotor hub 101 is illustrated with four rotor blades 103 , the system of the present application is equally applicable to rotor hubs having an alternative number of rotor blades 103 . referring now also to fig3 - 6 , an electrical wiring system 301 is illustrated . system 301 is configured for the routing of electrical lines in a dynamic environment . in the illustrated embodiment , system 301 includes a wiring harness 303 a routed between a powered unit 305 and a connector 313 a . system 301 further includes a connector 313 b and wiring harness 303 b . one feature of system 301 is a contoured recess 307 in a cap member 311 located at the root end of spar 309 . in the illustrated embodiment , spar 309 is a partially hollow member ; however , cap member 311 functions in part to seal off the interior portion of spar 309 . connectors 313 a and 313 b allows the wiring harness 303 a to be routed in the interior of rotor blade 103 to powered unit 305 , thus protecting harness 303 a from damage . in the illustrated embodiment , powered unit 305 is a de - icing heater blanket ; however , it should be appreciated that powered unit 305 can be any power consuming device , such as a light , an actuator for a moveable airfoil , or a vibration reduction system , to name a few examples . further , harnesses 303 a and 303 b can alternatively be hydraulic hoses instead of power wire harnesses . further , harnesses 303 a and 303 b can provide a data or control signal in addition or in lieu of providing power . for example , harnesses 303 a and 303 b can provide hydraulic power to a hydraulic actuator in rotor blade 103 . harness 303 b can be secured with one or more harness clips located within recess 307 . recess 307 forms a contoured radius along the chordwise direction at the root end portion of cap member 311 . recess 307 and harness 303 b are configured such that an operationally generated centrifugal force 315 acts to position a slack portion of harness 303 b into the trailing edge side of recess 307 . a slack portion of harness 303 b can be necessary to compensate for all the flap , lead / lag , and pitch motions of rotor blade 103 . in the illustrated embodiment , the harness 303 b is routed away from the body of the rotor blade 103 toward a lead / lag damper 317 ; however , it should be appreciated that an alternative embodiment may not include lead / lag damper 317 . harness 303 b is routed along the axis of lead / lag damper 317 , and further extends back towards the axis of rotation . a loop or slack in the harness 303 b can be implemented where the lead / lag damper 317 joins yoke 109 , allowing for relative motion therebetween . system 301 is configured to minimize aerodynamic drag penalties that may otherwise be associated with conventional harness routing . further , system 301 allows connectors 313 a and 313 b , and its terminals , to be enclosed in recess 307 of blade 103 , away from potential environmental damage . further , potential manufacturing damage to harness 303 a is reduced by reducing the exposed amount of harness 303 a . further , coupling harness 303 b to the blade portion harness 303 a at connectors 313 a and 313 b reduces damage to may otherwise occur to conventional wire attachments that are susceptible to fatigue induced breakage . connector 313 a is mounted on a wall 321 near a leading edge portion of recess 307 . wall 321 can be a flat surface suitable for mounting connector 313 a . in the illustrated embodiment , wall 321 is approximately normal to an inner surface of recess 307 such that the harness 303 b is directed inboard toward the rotor mast until approximately reaching a centerline 100 of the root end , in which recess 307 is contoured in an outboard direction until reaching the trailing edge termination . this trailing edge portion of recess 307 provides a secure housing for the slack portion of harness 303 b as centrifugal forces acts upon harness 303 b . in the illustrated embodiment , rotor blade 103 is coupled to rotor grip 107 with bolts 319 a and 319 b . it can be particularly desirable to fold and stow rotor blades 103 . system 301 is configured to allow folding of rotor blade 103 without having to disconnect connectors 313 a and 313 b from each other . for example , bolt 319 b can be removed such that rotor blade 103 is allowed to rotate about bolt 319 a in a rotation r 1 . in such a configuration , when rotor blade 103 is rotated towards its leading edge , slack in harness 303 b is generated and allowed to build within recess 307 . such a configuration of system 301 saves time and maintenance costs associated with disconnecting a harness for rotor blade folding . the particular embodiments disclosed herein are illustrative only , as the system may be modified and practiced in different but equivalent manners apparent to those skilled in the art having the benefit of the teachings herein . modifications , additions , or omissions may be made to the system described herein without departing from the scope of the invention . the components of the system may be integrated or separated . moreover , the operations of the system may be performed by more , fewer , or other components . furthermore , no limitations are intended to the details of construction or design herein shown , other than as described in the claims below . it is therefore evident that the particular embodiments disclosed above may be altered or modified and all such variations are considered within the scope and spirit of the disclosure . accordingly , the protection sought herein is as set forth in the claims below . to aid the patent office , and any readers of any patent issued on this application in interpreting the claims appended hereto , applicants wish to note that they do not intend any of the appended claims to invoke paragraph 6 of 35 u . s . c . § 112 as it exists on the date of filing hereof unless the words “ means for ” or “ step for ” are explicitly used in the particular claim .	1
while the invention is susceptible of various modifications and alternative constructions , certain illustrated embodiments thereof have been shown in the drawings and will be described below in detail . it should be understood , however , that there is no intention to limit the invention to the specific form disclosed , but , on the contrary , the invention is to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the invention as defined in the claims . the present invention includes an engineered lumber unit , a method of making said engineered lumber unit , and a wall made of said engineered lumber units . other embodiments of the present invention likewise exist and are considered within the disclosure herein . referring initially to fig1 , shown is one embodiment of the present invention . fig1 shows the formation of one embodiment of an engineered lumber stud 10 . this embodiment &# 39 ; s engineered lumber stud 10 created by first creating or providing a panel body 12 . this panel body 12 comprising a first structural skin 14 and a second structural skin 18 , said skins preferably comprised of oriented strand board ( osb ). other skins other than osb can be used , including but not limited to sheetrock . the preferred thickness of the osb is 7 / 16 ″, however other sizes of osb ( and other materials such a sheetrock , cement board , etc . ), including but not limited to ⅜ ″, ⅝ ″, and ¾ ″ may be used . the osb serves ( among other things ) like a lumber stud , to serve as a location to attach pictures , etc . the osb could likewise be replaced by cement , board , plywood , metal , mineral , plastic , dimensional lumber , etc . a foam core 16 , preferably of expanded polystyrene ( eps ), is injected or otherwise adhered there between thereby forming the aforementioned panel body 12 . while a foam core is preferred , other types of material can likewise be utilized . other types of panel bodies exist in the prior art , namely current sip wall panels , these sip wall panel bodies likewise could be cut into the invented engineered studs . in the preferred construction , the structural skins are placed within a jig and the eps is injected into the cavity defined there - between . the eps adhering to both of the structural skins , thereby forming a integrated wall panel . the eps serving , among other things , as a spacer , spacing the structural skins apart . referring still to fig1 , this embodiment of the invented stud 10 of the present invention is manufactured by taking such a panel body 12 ( including a preformed sip panel ) and cutting it into at least one engineered lumber stud 10 . each of these lumber studs 10 having a width 20 and a depth 22 . it is preferred that the depth 22 be greater than the width 20 . the resulting engineered lumber stud 10 having a first structural skin 114 , a foam core 116 , and a second structural skin 118 . the resulting engineered stud can be of any size and shape so created by its manufacturer , however it is envisioned that studs having a width of 1 . 50 inches and a depth of 3 . 50 inches , forming a generally right rectangular parallelepiped shape . however , other size , shapes , and manufactures are likewise possible . it is preferred that the engineered stud 10 be formed with a first end 46 and a second end 48 . preferably , the first end 46 has defined therein a first channel 42 and the second end 48 has defined therein a second channel 44 . these channels configured for receiving in structural spacers ( fig4 , ## 38 , 40 ) and / or framing plates ( fig3 , ## 24 , 26 , 124 ) for instance a top plate ( s ) and a bottom plate ( s ). in the embodiment shown , the foam core 116 does not extend to the first end 46 or the second end 48 , thereby defining said channels between the respective ends of the first structural skin , the foam core , and the second structural skin . the stud 10 could be formed with the channels therein , the channels could be cut into the stud through removal of excess foam , etc . alternatively , the first structural skin and the second structural skin could be independently cut and joined in a sandwich fashion with the foam core . this foam core itself can be precut , can be formed between the structural skins , etc . such embodiments are less preferred , in that substantial savings in time and labor could be achieved in preparing one panel body from which multiple engineered studs can be cut . referring now to fig2 , shown is one embodiment of a modular wall panel 28 built with the present invention &# 39 ; s engineered studs 10 , 110 . this figure showing studs 10 of the construction shown in fig3 and studs 110 of the construction shown in fig4 . other stud constructions are likewise envisioned . while this figure shows use of two different kinds of stud constructions ( 10 , 110 ), it is unlikely that more than one stud construction type will be used within a particular wall , the diversity shown for illustrative purposes only . the studs 10 , 110 are spaced apart at a predetermined space and attached between one or more top plates 24 , 124 and at least one bottom plate 26 . while the utilization of dimensional lumber for the top and bottom plates is shown , other types and styles of structures can likewise be utilized , including but not limited to the invented engineered studs , other engineered studs , steel studs , etc . the embodiment shown in fig2 utilizes a pair of top plates 24 , 124 and a single bottom plate 26 . it is preferred that the top plate extend ¾ ″ out of the channel . the preferred construction of the wall shown would be done by laying the studs on the floor , installing the top and bottom plate ( s ) thereon ( attaching them to the studs ), and standing said wall up . the attachment of the studs to the plates can be through the usual construction means , including but not limited to nails , screws , adhesives , etc . the studs can be placed a desired distance apart , for instance 24 ″ o . c ., 19 . 2 ″ o . c ., 16 ″ o . c ., 12 ″ o . c ., etc . it is preferred that the studs 10 , 110 ( shown in fig3 - 4 ) additionally comprise conduits 50 ( shown in fig3 - 4 ) for ease of installation of wiring , plumbing , and other subcomponents . for instance , a 1 - ½ ″ horizontal wire chase at 46 ″ and / or a 1 - ½ ″ horizontal wire chase at 16 ″. fig2 shows the utilization of conduits to permit wiring 30 to be easily ( without the use of a drill at the job site ) run through a fabricated wall panel . such conduits are frequently found in sip construction . one novel feature of the present invention is shown in fig2 . the electrical wiring 30 can be looped 34 through the foam of a stud 10 before connecting with an outlet box 32 or other electrical feature . by looping the wiring through the foam , the wiring becomes fixed to the stud , removing the necessity of stapling the wiring to the stud ( as can be found in dimensional lumber walls ). alternatively , a wire or plastic tie 36 could be wrapped around the electrical wiring 30 and attached to the stud 10 before connection with outlet box 32 . referring now to fig3 , shown is one embodiment of an engineered stud 10 of the present invention . this stud 10 having , as discussed before , a first structural skin 114 , a foam core 116 , and a second structural skin 118 . the stud 10 having a first end 46 extending to a second end 48 . the first end 46 defining a first channel 42 and the second end 48 defining a second channel 44 . the first channel 42 receiving therein the top plate ( s ) 24 , 124 . these top plates being preferably affixed to said stud , preferably through fasteners affixed through the first and second structural skins , however other manners of attachment are likewise envisioned . the second channel 44 receiving therein the bottom plate ( s ) 26 . this bottom plate being preferably affixed to said stud through the use of fasteners affixed through the first and second structural skins . however , other manners of attachment can likewise be utilized . a conduit 50 is likewise provided in or through the foam core 116 . in such a configuration , typically , figuring that the first and second skins are each 7 / 16 ″ thick , and the foam core is 3 . 5 ″ thick , the resulting engineered stud has a depth 22 of 4 - ⅜ ″. obviously , other dimensions and depths are included within the present invention , this depth illustrative only . referring now to fig4 , shown is another embodiment of an engineered stud 110 of the present invention . this stud 110 having , as discussed before , a first structural skin 114 , a foam core 116 , and a second structural skin 118 . the stud 110 having a first end 46 extending to a second end 48 . the first end 46 defining a first channel 42 and the second end 48 defining a second channel 44 . the first channel 42 receiving therein at least one top spacer 38 , this spacer preferably comprising a 1 - ⅛ ″× 2 - ⅝ ″ piece of osb . this spacer serving as a nailer for the 2 × 4 top and bottom top plates , this spacer could be comprised of other thicknesses ( other than 1 - ⅛ ″), for instance , 7 / 16 ″, ⅝ ″, ¾ ″, ⅞ ″, and could obviously be comprised of other materials , including but not limited to plywood , dimensional lumber , metal , and plastic . this spacer affixed therein , preferably through fasteners affixed through the first and second structural skins , however other manners of attachment are likewise envisioned . the top plates 24 , 124 would then be affixed to the top spacer 38 . the second channel 44 receiving therein at least one bottom spacer 40 , this spacer preferably comprising a 1 - ⅛ ″× 2 - ⅝ ″ piece of osb . this spacer affixed therein , preferably through fasteners affixed through the first and second structural skins . however , other manners of attachment are likewise envisioned . the top plates 24 , 124 would then be affixed to the top spacer 38 . a conduit 50 is likewise provided in or through the foam core 116 . in such a configuration , typically , figuring that the first and second skins are each 7 / 16 ″ thick , and the foam core is 2 - ⅝ ″ thick , the resulting engineered stud has a depth 22 of 3 - ½ ″ ( the depth of a typical interior wall framed in dimensional lumber ). obviously , other dimensions and depths are included within the present invention , this depth illustrative only . referring now to fig5 , shown is another embodiment of an engineered stud 210 of the present invention . this stud 210 having , similar to what was discussed before , a first structural skin 214 , a foam core 216 , and a second structural skin 218 . a conduit 250 is provided in or through the foam core 216 . the stud 210 having a first end 246 extending to a second end 248 . the first end 246 defining a first channel 242 and the second end 248 defining a second channel 244 . the first channel 242 receiving therein at least one top spacer 238 , this spacer 238 preferably comprising a 2 ″× 4 ″ piece of dimensional lumber that has had a pair of channels or notches dado cut along the lumber &# 39 ; s longitudinal axis . these notches configured for receiving the ends of the first structural skin 214 and second structural skin 218 . this spacer 238 serving as a nailer for the 2 ″× 4 ″ top plate 224 and / or the bottom plate ( not shown ). while it is preferred that the spacer be comprised of a modified 2 ″× 4 ″, other manners and methods of construction are likewise possible . this spacer affixed therein , preferably through fasteners affixed through the first and second structural skins , however other manners of attachment are likewise envisioned , including but not limited to adhesives . the second channel 244 receiving therein at least one bottom spacer 240 , this spacer 240 preferably comprising a 2 ″× 4 ″ piece of dimensional lumber that has had a pair of channels or notches dado cut along the lumber &# 39 ; s longitudinal axis . these notches configured for receiving the ends of the first structural skin 214 and second structural skin 218 . this spacer 240 affixed therein , preferably through fasteners affixed through the first and second structural skins . however , other manners of attachment are likewise envisioned . in such a configuration , typically , figuring that the first and second skins are each ¾ ″ thick , and the foam core is 2 ″ thick , the resulting engineered stud has a depth 222 of 3 - ½ ″ ( the depth of a typical interior wall framed in dimensional lumber ). obviously , other dimensions and depths are included within the present invention , this depth illustrative only . while the present invention is preferably utilized as an interior wall , finished with sheetrock or other surface , it is likewise envisioned , although not preferred , that the present invention could be used as an exterior wall , or other building component . while it is preferred that the invented wall panel be built on the job site , it is expressly envisioned that the wall panel could be build off site , even finished ( sheetrock and / or paint , etc .) off site before installation at the job site . a problem with such off site construction is in protecting the finished panels from damage and wear in transit to the job site , the absence of such a problem is one benefit to building the studs on site . the resulting wall is square , plum , and easy to wire . the invented studs , due to their construction , do not warp or twist , are straight and light weight . these studs likewise being easier to sheetrock , are made of readily available materials , and are more environmentally friendly than using traditional dimensional lumber . while there is shown and described the present preferred embodiment of the invention , it is to be distinctly understood that this invention is not limited thereto but may be variously embodied to practice within the scope of the following claims . from the foregoing description , it will be apparent that various changes may be made without departing from the spirit and scope of the invention as defined by the following claims .	4
the following detailed description is merely exemplary in nature and is not intended to limit the invention or the application and uses of the invention . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding technical field , background , brief summary or the following detailed description . as used herein , the word “ wheel ” whether singular or plural is intended to be inclusive of the tire mounted thereon . for example , reference to data from a particular wheel is understood to include the desired information about the tire mounted thereon . further the words “ receiver ” and “ transmitter ” or “ sender ” are not intended to be limited merely to signal incoming and outgoing functions , respectively , but are intended to include the meaning of “ transceiver ” that is , be capable of two - way wireless communication as the need arises . for convenience of explanation , it is assumed for purposes of the present invention that the learning mode has been completed and that each wheel is capable of transmitting its individual id and its relevant function codes that define the wheel location on the vehicle and the wheel status , e . g ., tire pressure , temperature , and so forth . the exact nature of the status information being transmitted by each wheel is not important to the present invention . fig2 is a simplified schematic diagram of five vehicle wheels 10 a – 10 e interacting with on - board vehicle electronics system 20 comprising wheel data receiver 14 and data - processing sub - system 30 , for monitoring wheel id , location and status , according to the present invention . rf signals 18 a – 18 e are transmitted by senders 11 a – 11 e of individual wheels 10 a – 10 e and received by on - board antenna 15 and receiver 14 . the learning mode is presumed to be complete so that signals 18 a – 18 e contain for each wheel , at least the wheel id , location and status information . for convenience of explanation , reference number 10 is intended to refer to any and all of wheels 10 a – 10 e , reference number 11 is intended to refer to any and all of senders or transmitters 11 a – 11 e and reference number 18 is intended to refer to any and all of signals 18 a – 18 e . further , for convenience of explanation and not intended to be limiting , signals 18 are referred to as comprising id and “ function code ” information where the functions codes carry the status information ( e . g ., temperature , pressure , rotating or stationary , etc .). receiver 14 demodulates signals 18 and sends the id and function code information for each sending wheel to processor 16 via leads or bus 17 . sub - system 30 further comprises speed sensor 24 , display 22 and memory 28 , coupled to processor 16 via leads or buses 23 , 21 , 25 , respectively . processor 16 desirably but not essentially includes timer or timing function 26 . timing function 26 may be a software timer or a hardware timer as a part of processor 16 or separate from processor 16 . either arrangement is useful . the learning process is presumed to have been already accomplished according to arrangements described in the prior art ( e . g ., using individual wheel well transmitters sending location info to the wheel electronics ) and each particular wheel id has been associated with a wheel location , e . g ., left front ( lf ), right front ( rf ), left rear ( lr ), right rear ( rr ) and spare ( sp ), and that information stored in memory 28 . thus , during routine operation when signal 18 arrives with id and status function codes , processor 16 is able to correlate the wheel id with the wheel locations by retrieving the locations from memory for each wheel id . speed sensor 23 is conveniently included to provide processor 16 with information on the vehicle motion but this is not essential , since in most cases , the function codes received from the individual wheels will include an indication as to whether that wheel is moving or stationary . when a flat has occurred and the spare ( sp ) used to replace the flat tire , unless the learning mode is repeated , the location information stored in memory 28 is no longer correct and should be updated . the process flow in fig3 illustrates how system 20 of the present invention updates the location - id correlation information stored in memory 28 without having to repeat the learn mode process . this is a significant advantage , especially with those automotive electronics systems where manual intervention is needed to initiate a learn mode sequence to correlate wheel ids with altered wheel locations . fig3 is a simplified flow chart illustrating method 100 of the present invention for determining whether the spare tire ( sp ) has been mounted on a rotating wheel ( rw ) position and vice - versa . for convenience of explanation and not intended to be limiting it is assumed that the data transmitted by each wheel and recovered in receiver 14 are assigned to particular fields ( e . g ., time slots ) in the transmitted message , for example , that there is a data field for wheel id , another data field for tire pressure data , a further data field for motion data , and so forth . this is intended to be merely exemplary and any method of encoding and distinguishing the wheel information and function codes may be used . method 100 begins with start 102 that conveniently occurs on power up or at least when the vehicle begins to move as determined by speed sensor 24 or by examining the function codes on any message received from sender 11 . in receive sp sender message step 104 , receiver 14 receives message 18 from sender 11 of the spare ( sp ) wheel , e . g ., wheel 10 e . method 100 then executes sp motion sensor active ? query 106 wherein it is determined whether or not the function codes contained in signal 18 from the spare , e . g ., signal 18 e , show that the spare is rolling or stationary . this may be determined by processor 16 by , for example , comparing the function code received from wheel 10 e in the appropriate ‘ motion ’ field in detected signal 18 e with the function codes for ‘ moving ’ and / or ‘ stationary ’ stored in memory 28 . if the outcome of query 106 is no ( false ), that is , the spare is not moving , then vehicle in motion ? query 108 is executed wherein it is determined whether or not the vehicle is moving . query 108 may be performed , for example , by processor 16 interrogating speed sensor 24 or by any other available means , as for example but not limited to , examining the ‘ motion ’ field codes of signals 18 received from other wheels 10 . if the outcome of query 108 is no ( false ), meaning that the vehicle is not moving , then as shown by path 109 method 100 returns to start 102 and initial query 104 . if the outcome of query 108 is yes ( true ), then method 100 executes initialize usage timer step 110 , wherein timer 26 is set to an initial value , e . g ., zero for a count - up timer and t for a count - down timer or whatever pother value is appropriate depending upon the type of timer used . timer 26 is conveniently used to measure the amount of time that signal 18 e from the spare tire shows that the spare tire is ‘ moving ’. persons of skill in the art will understand that initialize usage timer step 110 refers to setting timer 26 with the initial start value . any type of counter or other timing arrangement may be employed . thus , as used herein , the words “ initialize usage timer ” are intended to include any means of initializing a counter or timer of any type . thereafter , method 100 returns again to start 102 and initial query 104 . returning now to sp motion sensor active ? query 106 , if the outcome of query 106 is yes ( true ) indicating that the spare ( sp ) wheel is moving , e . g ., rotating , then sp usage timer active ? query 112 is executed wherein it is determined whether timer 26 or equivalent measuring how long the spare tire has been rotating , is active or not , i . e ., still measuring motion time for the spare tire . if the outcome of query 112 is no ( false ) then method 100 proceeds to start usage timer step 114 wherein timer 26 or equivalent is started to measure the time during which the spare tire is in motion . thereafter method 100 returns to start 102 and initial query 104 as shown by path 115 . returning now to query 112 , if the outcome of query 112 is yes ( true ) indicating that timer 26 is active ( e . g ., from a prior loop through step 114 ), then method 100 proceeds to sp usage timer expired ? query 116 . if the outcome of query 116 is no ( false ) then method 100 returns to start 102 and initial query 104 as shown by path 117 . during first portion 118 of method 100 , processor 16 has determined that the spare wheel , e . g ., wheel 10 e is in motion and has been in motion for predetermined time duration t measured by timer 26 . steps 104 , 106 , 112 , 116 of portion 118 repeat until either unit 11 e on spare wheel 10 e stops sending signal 18 e indicating that spare wheel 10 e continues in motion or until time t has expired . time duration t is chosen to be greater than those accidental movements of spare tire 10 e as might from time to time occur in the life of the vehicle aside from mounting the spare on a rolling wheel location . about 5 to 60 minutes is suitable for time interval t with about 15 minutes being preferred . system 20 has now logically determined that the spare wheel , e . g ., wheel 10 e , is no longer on the customary spare tire location , since where it still there it would not be in motion for time t . knowing that the spare tire is no longer in its normal position , second portion 120 of method 100 determines where it has probably been placed by determining which of the four other tires is no longer moving . this is accomplished by processor 16 executing some or all of steps 122 – 136 . steps 122 , 126 , 130 , 134 may be executed in any order . for example , processor 16 examines the detected signal received from another of wheels 10 , e . g ., the wheel correlated in memory 28 with the left - front ( lf ) wheel location on the vehicle , by executing lf sender stopped ? query 122 . it does this , for example , by examining the ‘ motion ’ field code in the detected signal for that wheel . if the outcome of query 122 is yes ( true ) indicating that that wheel is not moving , then in step 124 , processor 16 swaps the sp and lf sender ids in memory 28 so that the id for the spare is now correlated with the lf wheel location , and the id for the lf wheel is now correlated with the sp location . following step 124 , then as shown by path 125 , method 100 returns to start 102 and initial query 104 . if the outcome of query 122 is no , them method 100 performs the same test on another wheel location , e . g ., rf sender stopped ? query 126 . if the outcome of query 126 is yes ( true ) indicating that that wheel is not moving , then in step 128 , processor 16 swaps the sp and rf sender ids in memory 28 so that the id for the spare is now correlated with the rf wheel location , and the id for the rf wheel is now correlated with the sp location . following step 128 , then as shown by path 129 , method 100 returns to start 102 and initial query 104 . if the outcome of query 126 is no , them method 100 performs the same test on another wheel location , e . g ., rr sender stopped ? query 130 . if the outcome of query 130 is yes ( true ) indicating that that wheel is not moving , then in step 132 , processor 16 swaps the sp and rr sender ids in memory 28 so that the id for the spare is now correlated with the rr wheel location , and the id for the rr wheel is now correlated with the sp location . following step 132 , then as shown by path 133 , method 100 returns to start 102 and initial query 104 . if the outcome of query 130 is no , them method 100 performs the same test on another wheel location , e . g ., lr sender stopped ? query 134 . if the outcome of query 134 is yes ( true ) indicating that that wheel is not moving , then in step 136 , processor 16 swaps the sp and lr sender ids in memory 28 so that the id for the spare is now correlated with the lr wheel location , and the id for the lr wheel is now correlated with the sp location . if the outcome of query 134 is no , them method 100 conveniently but not essentially proceeds to set alarm step 138 wherein for example , processor 16 causes display 22 to indicate that a malfunction condition has occurred , since an ‘ in motion ’ outcome from all wheels including the spare indicates a malfunction in a vehicle with only four rolling wheels . nevertheless , step 138 is not essential and in place of or following step 138 , method 100 returns to start 102 and initial query 104 . those of skill in the art will appreciate that method 100 can include providing on display 22 a wheel status indication after any of steps 124 , 128 , 132 , 136 , 138 or any other step where such indication would be useful to the driver . while steps 120 are described in terms of swapping in memory 28 the sp id with the id of whichever of lr , rf , rr , lr wheel positions is not moving , this is merely one way of correcting the wheel id - wheel location correlation information stored in memory 28 and is not intended to be limiting . persons of skill in the art will understand based on the description herein that any way of correcting the wheel id - wheel location correlation information may be used . what is important is that after method 100 is executed , the wheel ids associated with the various wheel locations are correct , even though a new learn mode has not been executed . the present method does not depend upon re - executing a learn mode , but deduces the current wheel locations by executing method 100 . the wheel id versus wheel location information stored in memory 28 is updated to accurately reflect the current situation . thus , as used herein , the words “ swap sp & amp ; lf / rf / rr / lr sender id locations ” are intended to encompass these alternative methods of correcting the wheel id versus wheel location information stored in memory 28 or equivalent . it will also be noted that if no tire rotation - replacement has occurred , method 100 leaves the wheel id versus wheel location information in memory 28 unchanged . fig1 – 3 depict the situation for a vehicle with four rolling wheels and one spare , for a total of five wheels . however , persons of skill in the art will understand that the present invention applies to a vehicle with any number of rolling wheels more or less than four . thus , in the general case , the present invention applies to vehicles with two or more rolling wheels . the present invention is useful even when there are multiple spares provided that both are not changed at the same time . for example , in a vehicle with multiple spares , if one spare is swapped for a previously rolling wheel , e . g ., because of a flat on that previously rolling wheel location , then method 100 corrects the wheel id versus wheel location data stored in memory 28 for that post - flat situation . if subsequently , a further rolling wheel goes flat ( e . g ., in the same or another rolling wheel location ) and a second spare is mounted in place of the new flat , then method 100 once again unequivocally corrects the wheel id versus wheel location data in memory 28 . it does not matter how many spare wheels there are nor how many rolling wheels there are on the vehicle nor how many flats occur , method 100 will correct the wheel id versus wheel location information without uncertainty as long as two or more previously rolling wheels are not replaced at the same time . this is a significant advantage , particularly with vehicles having larger numbers of rolling wheels and spares . when multiple spares are present , steps 118 , 120 are repeated for each spare . when two ( or more ) flats occur at the same time and , for example , two spares are mounted at the same time before the vehicle resumes normal operation , method 100 can still determine useful information : specifically , that both simultaneously mounted spares are rolling and that two of the previously rolling wheels are now in the spare positions , but cannot determine unequivocally which spare has gone into which of the two replaced rolling wheel positions . thus , the spare wheel ids can be in either of two replaced rolling wheel locations , but not elsewhere . this information while not completely precise is useful because it can alert the driver to the fact that two spares are now rolling in either of two wheel locations . the larger the number of wheels on the vehicle , the more useful this information . when multiple spares are changed , steps 118 , 120 are repeated for each spare . where the multiple spares are mounted sequentially , then method 100 determines the spare locations exactly . where two spares are mounted at the same time , then , on a first pass , method 100 will swap the id of the first spare with the id of the first location in steps 122 , 126 , 130 , 134 leading to one of steps 124 , 128 , 132 , 136 , and on a second pass it will swap the id of the second spare with the next location in steps 122 , 126 , 130 , 134 leading to one of steps 124 , 128 , 132 , 136 . however , it cannot tell unequivocally which of the two newly mounted spares is in which of the two replaced rolling wheel position , but can tell that these spares are not on other rolling wheel positions . while at least one exemplary embodiment has been presented in the foregoing detailed description , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing the exemplary embodiment or exemplary embodiments . it should be understood that various changes can be made in the function and arrangement of elements without departing from the scope of the invention as set forth in the appended claims and the legal equivalents thereof .	1
the preferred embodiment of the present invention will now be described in connection with the above - mentioned drawings . refer now to fig1 , which is an overall conceptual drawing of a preferred embodiment of the “ hitch - mounted fold - out camper ”, hereafter referred to as the “ camper ”, in its folded , covered state . here we can see the compacted “ camper ” [ fig1 ( 1 )] covered with a weather - proof cover [ fig1 ( 2 )]. a preferred cover , due to its light weight , would be vinyl but any lightweight , weather proof , material including hard - sided material could be used . in this case the “ camper ” is mounted on an extended hitch - arm [ fig1 ( 3 ) and fig1 ( 3 )] with an additional rear hitch receiver [ fig1 ( 4 ) and fig1 ( 4 )]. a regular 2 inch hitch arm utilizing a 2 - inch , ¼ inch walls , square pipe ( class 3 hitch ) will allow a 1 . 5 - inch hitch - arm to be fitted inside said 2 inch arm , creating a class 2 hitch [ fig1 ( 5 )], enough to tow a mid - size trailer / boat . fig2 is a conceptual drawing of a preferred embodiment of the “ camper ” in its unfolded , for camping , usable state . in this case the unit is still connected to the car but it could very well be unhooked as an independent camper by pulling the pin [ fig1 ( 7 )] holding the hitch - arm to the vehicle &# 39 ; s hitch - receiver [ fig1 ( 8 )]. as the unit is totally supported by the ground with its adjustable fold - out legs [ fig2 ( 9 )] there is no need to keep it attached to the vehicle . fig1 show a close - up of the “ height - adjustable fold - out legs ”, hereafter referred to as the “ legs ”, with its lockable support arm ( 6 ) and adjustable inner tube ( 34 ). fig3 is a cut - away drawing of the basic concept to better illustrate the invention . in basic terms , the unit is comprised of one or more floor board [ fig3 ( 10 )] with at least one of them attached to the vehicle &# 39 ; s receiver . in this case the forward floor board [ fig3 ( 10 )] , from here on referred to as the “ base - plate ”, is mounted to the vehicles hitch - arm [ fig1 ( 3 )] . to this “ base - plate ” are possibly one or more floor - boards attachedreleasably attached floor - boards . in this sample three additional floor - boards [ fig3 ( 12 )( 13 )( 14 )] . they are in turn connected with the means of quick - release hinges [ fig1 ( 15 ) with detailed drawing [ fig1 ] , so as to be able to unfold the said floor - boards into a largely flat surface ( floor ) supported to the ground with the “ legs ” [ fig1 ] . around the peripheral of this “ floor ” is an easily erected tent enclosure [ fig3 ( 16 )] semi - permanently , by means of readily available canvas - snaps , mounted to create a living space while unfolded . optionally , as shown in fig3 , the floor can be wholly or partly covered by semi - permanently installed mattresses [ fig3 ( 17 )] . the “ camper ” is designed to be able to hold each and all of the bedding equipment as well as the semi permanently mounted tent structure [ fig3 ( 16 )] including its tent poles ( 35 ), both in its folded state [ fig5 ( 35 )] as well as unfolded state [ fig3 ( 35 )] . while not in use as a camper the floor sections can all be disassembled as single floor sections and reassembled in the home to be used as a regular everyday bed or a guest bed . in this sample , floor boards [ fig3 ( 12 )( 13 )( 14 )] can be assembled to create a light - weight king size bed . although the unit can be made in any size , the preferred sizes are , u . s . double , queen and king not counting the base - plate [ fig3 ( 10 )]. the “ base - plate ” is designed to be used for storage , heaters , camping gears and such . for larger trucks and vans a 74 - inch - wide unit allowing two double beds , arranged crosswise to the vehicles travel direction , can be made . in either case this will allow the “ camper ” to use regular form - fitted bedding sheets for the respective size . fig4 illustrates the additional advantage of being able to simultaneously utilize the towing hitch &# 39 ; s normal function , in this case towing a boat . here the optional class 2 hitch [ fig1 ( 5 )] fitted into the extended hitch - arm [ fig1 ( 3 )] was used to connect the trailer to the “ camper ”. refer now to fig5 to 8 for an illustrated step - by - step instruction on how to unfold the “ camper ”. to make the procedure clear the tent canvas has been removed for this demonstration . step 1 . [ fig5 ] remove the cover . the interior of the camper ” can now be seen with , in this case , the folded mattresses ( 17 ) and tent poles ( 35 ). step 2 . unfold the “ legs ” ( 9 ) on the rear vertical floor board ( 12 ) and swing the unit backward until the “ legs ” rest on the ground as in ( fig6 ). step 4 . do the same with floor board ( 13 ) and lower it to the ground . [ fig7 ]. step 5 . again do the same with floor board [ fig8 ( 14 )]. in case a foldable mattress is used it can now be flipped [ fig7 ( 19 )] into place . the only thing left at this point is to erect the normally attached tent . again for this demonstration the tent canvas has not been shown to make the demonstration clear although the steps with the canvas attached are the same . while in its folded state the whole unit can be folded back , as illustrated in [ fig9 ], to be able to access the vehicle &# 39 ; s back door . this is accomplished by adding a hinged swing arm [ fig1 ( 20 )] to each side of the extended hitch - arm [ fig1 ( 3 )] with a rear pivot point [ fig1 ( 21 )]. by pulling the forward pin [ fig1 ( 22 )] the compacted , folded , “ camper ” can swing back as a unit [ fig9 ] and thereby allow easy access to the rear of the vehicle . fig1 shows the framework for the “ camper ” as well as the suggested hardware used in the assembly . the frame ( 23 ) is preferably made of lightweight aluminum covered by any light - weight material , solid or soft , such as plywood or stretched canvas [ fig3 ( 10 )]. each fold - out frame has at least two “ legs ” ( 9 ), detailed in fig1 . it also illustrates the locations of the quick release hinges between the fold - out sections [ fig1 ( 15 )]. a detailed illustration of the hinges can be found in fig1 . as seen on this partially cut - away drawing [ fig1 ] of the quick - release hinge , the two sections a and b can be easily separated by pressing the two release levels ( 24 ) compressing the spring ( 26 ). this forces the two hinge pins ( 25 ) to pull out of the two hinge sections ( 27 ) attached to section a , thereby disconnecting the two floor sections . this will allow for quick assembly as well as disassembly of the unit , breaking it down to smaller , light - weight , floor boards that can be easily handled , stored as flat units , or used as a regular bed by reassembling the sections in the home . to prevent the floor sections from folding beyond 90 degrees while folding the unit and to make the unit more rigid while folded , each section also contains an angulation limiting device ( 28 ) detailed in fig1 and 14 . this angulation device is comprised of a tube ( 29 ) and a rod ( 30 ) inserted to each other and attached in one end of each rod / tube to a hinge - bracket ( 31 ) which in turn is fixed to the frames for the floor - boards . the length of the rod is so designed as to reach the tube &# 39 ; s hinge pin ( 32 ) when the two sections reach an angle of 90 degrees preventing further angulation . although not a required addition , it greatly helps in handling the unit . fig1 illustrates the use of an optical rear light - bar / license plate holder ( 33 ) inserted into the rear end of the extended hitch - arm ( 3 ). this is only needed in case the folded “ camper ” would cover the vehicles rear lights or license plate . the electrical hookup to the vehicle is made by using the regular trailer light outlet just like a trailer . this light bar could in addition be outfitted with a tow hitch as illustrated in fig1 ( 5 ). fig1 ( 3 ) is a perspective view of a preferred extended hitch - arm that the “ camper ” is resting on . the rear end of the extended hitch arm ( 4 ) with its square hole ( hitch receiver ) can also be seen . this “ receiver ’ will allow for an optional hitch arm / ball - holder and / or the previously mentioned light - bar ( 33 ) to be fitted to said extended hitch - arm . the forgoing description of the preferred embodiment of the invention has been presented for the purpose of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of the above teaching . it is intended that the scope of the invention be limited not only by this detailed description , but rather by the claims appended hereto .	4
having reference to the drawings , wherein like reference characters designate identical or corresponding parts throughout the different views , and more particularly to fig1 thereof , one embodiment of an improved machine safety guard arrangement , 4 , is shown in its relation to a drop hammer machine 5 . equipment of the latter type occasions a distinctive risk possibility , inasmuch as it involves a movable work - forming member , 6 , which must at times be permitted to travel essentially unchecked , if it is to perform its intended functions , and which is then unfortunately in a condition to cause harm in the unlikely event that an operator or some foreign object should somehow come in contact with it . the specific form which the movable member 5 takes in the case of the illustrated pneumatic drop - hammer machine is that of a massive weight or &# 34 ; hammer &# 34 ; which has its vertical movements guided by two stationary columns 7 and 8 which extend upright from above a work table surface 9 atop a base or anvil 10 . an operator controls such a machine from its front , 11 , where there may be a seat 12 , and from that position may cause the hammer 6 to be raised relatively slowly in a known manner by compressed air forced into a piston - cylinder unit 13 so as to lift the piston rod 14 and the depending weight 6 . for that purpose , the work table mounts at the right a pneumatic control handle 15 fixed with a upright control shaft 16 leading upwardly to the pneumatic control valving 17 fed from the compressed - air line 18 . the handle must be pushed in direction away from the operator to cut off the air supply to unit 13 , and , when that is done , the hammer 6 is no longer restrained from free fall by the air supply . however , unless the operator also pushes a second control lever , 19 , at the left , in direction away , the hammer 6 will remain elevated by virtue of its being caught upon the known form of mechanical stop or so - called &# 34 ; safety - dog &# 34 ; 20 fixed with the upright shaft 21 . typically , such known control levers , 15 and 19 , must be turned about 45 to 60 degrees , by the operator , to free the weight for its intended work - forming fall , and , preferably , unless the operator continues to push those levers in opposite directions laterally away , they are automatically urged back to the positions where they respectively cause air pressure to keep the hammer raised and cause the safety dog to be interposed as a mechanical stop against fall of the hammer . spring 22 may serve that angular - return function for shaft 21 , for example . in addition , a known further safety for such a machine includes an air - safety dog or trigger unit 23 , and , if for any reason the hammer should unintentionally commence its drop without the operator having first pushed handle 15 to cause that drop , the unit 23 will be engaged by the hammer and will in turn trigger a supply of compressed air into unit 13 which attempts to raise it and halt its descent . the raising and dropping of weight 6 is for forming purposes , such as the striking of design or ornamentation onto precut blanks of metal , and cooperating male and female dies 24 and 25 which effect that result are disposed atop the anvil table 9 and at a lower end of the movable weight 6 , respectively . an operator working at such a machine normally confronts it in a conditon wherein the weight has been raised and is so being maintained . any previously - struck piece in die 24 is anually removed and an unstruck blank inserted in its place , after which the operator &# 39 ; s left and right hands are placed upon the levers 19 and 15 , which normally are self - turned inwardly , and those levers are then simultaneously pushed outwardly away from the operator to effect cut - off of the supply to unit 13 and displacement of safety dog 20 to an out - of - the - way position , whereupon the hammer free - falls to forcefully close the dies about the blank . release of the levers allows them to turn back inwardly , such that the weight is again raised by the compressed air , the safety - dog again occupies a stopping position , and the dies are parted , to allow another such operating cycle to occur . the region between the operator and the opening - and - closing dies is one which could become a danger zone if , somehow , an operator were to improperly push control lever 15 but release lever 15 and very swiftly and improvidently move a hand or object to the zone of closure where the falling weight is about to strike . accordingly , that region is temporarily blocked , at all critical times , by a broad - area mechanical guard membrer 26 which is interposed on anvil table 9 in front of the operator position and which is pivotably mounted on a stanchion 27 for limited angular movements between a first substantially horizontal position where it blocks the said zone of closure , as characterized by dashed linework 26 &# 39 ;, and a second relatively elevated and out - of - the - way position , as illustrated in full linework in fig1 wherein it does not block that zone . the actuations of the guard member into the aforesaid first blocking and protective position cannot be left to any choice or chance if the intended safeguards are to be realized , and , on that account , the guard member 26 is mechanically linked in a secure slaved relationship with one of the control levers , preferably the lever 19 associated with safety - dog shaft 21 , which establishes that the lever will not free the weight to drop unless the lever movement which does so has also first physically displaced the guard member into its protective position . details of the aforementioned type of linkage appear in fig2 and 3 , and it will be observed there that the guard - member pivoting between the first or &# 34 ; blocking &# 34 ; position , as shown in fig3 and the second or out - of - the - way position , as shown in fig2 as well as fig1 takes place about the horizontal axis 28 -- 28 of a shaft 29 mounted near the top of the stanchion 27 . member 26 must be able to withstand rigorous usage and should therefore be of an appropriately sturdy heavy construction ; in turn , even though it may have numerous openings therethrough , as illustrated , it can be expected to exhibit enough mass and inertia to warrant the use of a counterbalancing weight , 30 , at the opposite end of its support about pivot shaft 29 , on cross - arm 31 . for proper operation , the tendency of safety - dog shaft 21 to turn normally in the direction of arrow 32 , clockwise about its vertical axis 33 -- 33 in fig2 as urged by a spring or the like , should be consistent with a normal out - of - the - way positioning of guard member 26 , and that tendency is in fact exploited by way of a yoke - like crank arm 34 angularly movable with shaft 21 and forcing a longitudinally - reciprocatable member 35 to crank the cross - arm 31 counterclockwise about axis 28 -- 28 . to implement those purposes , the wrist pin 36 of crank arm 34 is fitted within a transverse slot or slide 37 of member 35 , and , at its opposite end , the member 35 carries a transverse wrist pin 38 fitted within a slot or slide 39 in a part of cross - arm 31 which is suitably displaced radially about its pivot axis 28 -- 28 and can therefore help develop a desirably large turning moment for positioning the guard member . upon the operator &# 39 ; s pushing the control lever 19 away and in the opposite , clockwise , direction about axis 33 -- 33 , the crank arm 34 must turn with it , pulling the slide 37 and member 35 to the left , and thereby causing the pin 38 to force a turning of cross arm 31 clockwise about its pivot axis 28 -- 28 , via its slide coupling 39 . by the time the control lever has reached the point in its turning when its attached safety - dog or catch 20 ( fig1 ) becomes clear of the elevated weight and will allow it to drop , the guard member will thus have necessarily been forced into its horizontal protective position ( fig3 ) blocking the danger zone , and it protects the operator . the illustrated linkage involving mutually - perpendicular wrist pins and slides or slots ( 36 , 37 and 38 , 39 ) achieves a difficult translation of cranking motions from about a vertical axis to about a laterally - spaced horizontal axis , and it affords mechanical freedom or play which prevents the parts from binding or catching which might impair system operation . in other arrangements , the couplings might be specifically different , so long as the results are of like advantage and effect . guard - member configurations may be modified to complement other machines with which they may be used , and foot - operated or power - actuated control shafts may be utilized in place of a control lever , and the guard mechanism may of course be oriented somewhat differently but with like improvement of operator safety . it should therefore be understood that the specific embodiments and practices shown and described herein have been presented by way of disclosure rather than limitation , and that various modifications , combinations and substitutions may be effected by those skilled in the art without departure in spirit or scope from this invention in its broader aspects and as set forth in the appended claims .	8
before the description of the present invention proceeds , it is to be noted that like parts are designated by like reference numerals throughout the accompanying drawings . referring now to the drawings , there is shown in fig1 an etching apparatus of si wafer according to a first embodiment of the present invention , which includes isopropanol 1 as liquid soluble with treatment liquid 2 , the treatment liquid 2 employed as an etching liquid for si wafer , rinsing water 3 , a retaining jig 4 ( hereinafter referred to as hanger ) for si wafer , the si wafer 5 as a substrate to be treated , an exhaust port 6 for evacuating gaseous isopropanol or fluorine , and a drain port 7 for draining overflown water 3 . with the above , the experimental , practical method according to the embodiment of the present invention will be described in detailed hereinafter . hot sio 2 films of 3000 å , 10 , 000 å and 20 , 000 å are formed through the various period of treatment time by a pyrogenic method on the face of the si wafer 5 having a diameter of 5 inches and sliced by the crystalline face of ( 1 , 0 , 0 ). thereafter , the photoresistance is applied on the face of si wafer 5 in the thickness of 1 . 2 μm so that many line - shaped patterns lack being 1 . 5 μm in width , 0 . 5 in length , separated by 5 μm are developed on the entire si wafer 5 . the si wafer 5 is dry - etched in sio 2 film by the use of the mixed gas ( pressure 700 m torr ) between chf 3 and c 2 f 6 . thereafter , the photoresistances are removed by the resistance ascha of the oxygen plasma . according to the observation by a microscope , the si wafer 5 , even in the si wafer of any film thickness , provides at this time a hydrophilic sio 2 pattern 22 formed in the rectilinear shape on the hydrophobic si monocrystal 21 as shown in fig2 . on the other hand , the etching liquid 2 of sio 2 including fluoric acid and water having a mixing ratio of 1 : 200 as treatment liquid of the si wafer 5 , and the isopropanol having surface tension of 22 . 9 dyne / cm as liquid soluble with the etching liquid are put separately into a cell in the etchinhg apparatus shown in fig1 . it is to be noted that the isopropanol is normally circulated by a bellows pump and filtered by the filter ( 0 . 1 μm ) made of fluorine - resin film ( not shown ). pure water 3 having specific resistance value of 18 mω · cm as the rinsing water is overflowed from the cell top - portion , normally flowing . after the si wafers 5 formed in the pattern are retained one by one by the hanger 4 and are quietly dipped in the isopropanol 1 for three minutes , they are pulled up from the isopropanol and are dipped in the etching liquid 2 for five minutes . according to the visual observation of the surfaces of the si wafer 5 from the tower upper portion while the si wafer 5 is dipped in the etching liquid , no air bubbles are attached on the si wafers 5 of the film thickness . the si wafers whose etching is finished are spin - dried after the sufficient washing operation with the pure water 3 . according to the microscope observation of the si wafers 5 , whose treatment operation is completed , the sio 2 film is etched and is made smaller in film thickness and width even in any si wafer pattern , with no unevenness on the patterns . on the other hand , as a first comparison embodiment for comparison , the si wafer 5 provides the pattern of the sio 2 film formed through the dry etching to remove the resistance . then , the si wafer is quietly dipped in etching liquid 2 directly without being dipped in the isopropanol 1 . according to the observation the surfaces of the si wafer 5 from the upper portion of the cell , several air bubbles are observed on the surface of the si wafer 5 . the si wafer 5 is dipped for five minutes in the etching liquid 2 , thereafter is dipped sufficiently in pure water 3 , and is spin - dried . then , according to the microscope observation of the surface of the si wafer 5 , the rectilinear pattern is out of shape , the pattern is recognized in which the convex portion 23 non - etched is provided on the end face of sio 2 film . the sio 2 films are observed particularly in the si wafer 5 of 10 , 000 å and 20 , 000 å . this is because the air bubbles are attached when the si wafer 5 is dipped in the etching liquid 2 , and the bubble - attached locations remain without being etched . also , the similar experiments are performed even about n - propanol having surface tension of 25 . 3 dyne / cm , methanol having surface tension of 24 . 0 dyne / cm , ethanol having surface tension of 24 . 1 dyne / cm , acetic acid having surface tension of 29 . 6 dyne / cm , acetone having surface tension of 26 . 3 dyne / cm , acetic methyl having surface tension of 28 dyne / cm , methyl ethyl ketone having surface tension of 26 . 8 dyne / cm , instead of isopropanol as liquid soluble with treatment liquid , but the convex portion 23 non - etched of fig3 is not observed . ( the mixing ratio of each liquid is defined by volume ratio .) the material soluble with the treatment liquid to be used in the present embodiment is required to be properly selected in accordance with the type of the treatment , the properties of the substrate to be treated , the nature of the treatment liquid or the like . as the water treatment liquid is mainly used in the washing or the etching of the si wafer , alcohols such as methanol , ethanol , n - propanol , isopropanol , glycol and so on , ketones such as acetone and so on , carboxylic - acid such as acetic acid and so on , esters such as methyl acetate , ethyl acetate and so on , amines such as ethyl amine and so on , further sulfonic acid , electro - kinetic activator or the like , including the above - described materials used , are provided as the material soluble with the treatment liquid to be used . howerver , in the present invention , the simple substances or mixtures of any substance among them may be used . the methanol , ethanol , ethyl amine , acetic acid , methyl acetate , ethyl acetate , acetone , isopropanol , n - propanol or the like which is small in adsorption ability into the si wafer , is likely to be displaced by the treatment liquid , and is 30 dyne / cm or smaller in surface tension . these materials have a hydrophilic group of 13 oh , & lt ; o , -- cooh , -- coo --, so 3 h or the like and a hydrophobic alkyl group within the molecule . when the si wafer is exposed to the liquid or the steam ( gas ), the hydrophilic group is preferentially adhered on the hydrophilic portion of the si wafer , the hydrophobic group is preferentially adhered on the hydrophobic portion of the si wafer to form an accumulation film so that the entire si wafer is likely to get wet with the hydrophilic treatment liquid or lipophilic treatment liquid . also , as these materials are soluble with the treatment liquid such as water , they are dissolved in the treatment liquid during the treatment , and are decomposed in the treatment liquid . furthermore , the air bubbles are likely to be disconnected from the compound of 30 dyne / cm or less in surface tension with no air bubbles remaining on the si wafer surface . thus , the uniform treatment may be performed without the air bubbles attached on the si wafer so that the si surface is not polluted . furthermore , a method of dipping the si wafer in the liquid material , a method of jetting and spraying the liquid material from the nozzles or the like onto the si wafer retained horizontal or vertical , a method of heating the material soluble with the treatment liquid , or applying ultrasonic waves producing gas to expose the si wafer to the atmosphere , or other methods are available as a method of exposing the si wafer to the material soluble with the treatment liquid . in the present invention , any method may be used . the dipping method is more preferable , because the apparatus is simple and the risk of the gas explosion is small . also , a method of dipping the si wafer in the pure water or jetting the pure water in a shower condition to perform the washing operation is generally used as a method of removing the treatment liquid attached on the si wafer . in order to increase the washing effect , the functions of oscillating the si wafer , causing the bubbling of the ultrasonic waves or the gas in the rinsing cell , or rapidly exchanging the rinsing water are added . in the present invention , any method may be used or the combination of a plurality of methods from them may be used . the present invention may use any method of spin drying , steam drying , blow - off drying or the like as the method of drying the si wafer , or may use the combined method . the above method of the present invention can be applied to the same treating performance even in the sheet - number treatment or the patch treatment independently of the number of the sheets to be treated . the second embodiment of the present invention will be described hereinafter . the isopropanol placed in the glass beaker is dipped in the water bath heated to 100 ° c . to heat the isopropanol to 70 ° c . thereafter , the glass beaker with the isopropanol in it is placed in a covered desiccator . the desiccator is filled with the steam of the isopropanol . on the other hand , in the first embodiment , the pattern of the sio 2 film is formed through the dry etching and the resistances are removed . thereafter , the si wafer 5 of 10 , 000 å in sio 2 film thickness is quietly placed for thirty minutes in the desiccator filled with the isopropanol steam , and is exposed to the isopropanol steam . the si wafer 5 is retained by the hanger 4 of the etching apparatus used in the first embodiment , is dipped for five minutes in the etching liquid 2 including fluoric acid and water with a mixing ratio of 1 : 200 , is washed with the pure water 3 , thereafter is spin dried . the pattern of the si wafer 5 is examined after the drying operation as in the first embodiment , but unevenness caused by a non - etched portion of the sio 2 pattern does not exist . also , the same experiments are performed with the methanol , ethanol as the liquid soluble with the treatment liquid , thus showing the same results . the third embodiment will be described hereinafter . the mixed liquid between ethanol and acetic acid , ( for example , with mixing ratios of ethanol to acetic acid being 6 : 4 , 5 : 5 and 4 : 6 ), the mixed liquid between the ethanol and the water ( for instance , with mixing ratios of ethanol to water being 8 : 2 , 6 : 4 , 5 : 5 and 4 : 6 ), the mixed liquid between the acetic acid and the water ( for instance , with mixing ratios of acetic acid to water being 8 : 2 , 6 : 4 , 5 : 5 and 4 : 6 ), the mixed liquid between isopropyl alcohol and water , for instance , with mixing rations being 6 : 4 , 5 : 5 and 4 : 6 , and the mixed liquid of 1 : 1 between the isopropyl alcohol and ethanol are used as the liquid soluble with the treatment liquid on the etching apparatus used in the first embodiment . the pattern is examined after the etching , washing and drying as in the first embodiment , and uneven surfaces caused by a non - etched portion remaining are not recognized . furthermore , the rca washing liquid ( nh 4 oh : h 2 o 2 : h 2 o - 1 : 2 : 7 ; volume ratio , 80 ° c .) instead of the etching liquid in the first embodiment , and the isopropanol , methanol , ethanol as the liquid soluble with the rca washing liquid , and the various kinds of mixed liquid are used to form the rectilinear sio 2 pattern on the si base plate in the method similar to that of the embodiment 1 . the si wafer is dipped for three minutes in the above - described liquid soluble with the rca washing liquid , thereafter is dipped for ten minutes in the rca washing liquid . thereafter , the si wafer is sufficiently washed with water , is dried , and the surface is observed , by sem ( scanning type electronic microscope ), for foreign materials attached on the si wafter surface . five through ten foreign materials ( per fifty linear patterns ) are sparsely recognized independently of the unevenness on the si wafer surfaces . a large difference is not caused in the condition of the foreign - material attached due to the differences among the liquids soluble with the rca washing liquid . the si wafer is directly dipped in the rca washing liquid without being dipped in the liquid soluble with the rca washing liquid , is washed , water - washed , dried . thereafter , according to the observation of the si wafer surface by the sem , comparatively more foreign materials are recognized on the contact portion between the side face of the linear pattern 22 of the sio 2 and the si crystal face 21 , and a group of large foreign materials are confirmed to be located in places . the fourth embodiment of the present invention will be described hereinafter with reference to the drawings . there is shown in fig4 a container in section provided with a rotary pump 113 as means for reducing the pressure therein in the fourth embodiment of the present invention , which includes a container 111 , a cell 112 for having the treatment liquid therein , a vacuum pump 113 as means for reducing the pressure , a stand 114 for having the si wafer mounted thereon ( hereinafter referred to as hanger ), treatment liquid 115 , a valve 116 , an si wafer as the substrate to be treated . the sio 2 film of 10 , 000 å is formed by the pyrogenic method on the si wafer ( 5 inches in diameter ), whose surfaces are finished into mirror face through the slicing operation with the crystal face of ( 1 , 0 , 0 ), thereafter the photo - resistance is applied into the thickness of 1 . 2 μm . the line - shaped pattern of 100 μm in length , 0 . 5 μm through 4 . 0 μm in width ( every 0 . 5 μm ) is developed by plurality on the entire si wafer . si wafer is etched in sio 2 by the dry etching ( with gas to be used , for instance , mixed gas of chf 3 + c 2 f 6 having pressure of 700 m torr ). the si wafer is etched further by the dry etching ( with gas to be used , for instance , mixed gas of ccl 4 + o 2 having pressure of 80 m torr ) into the various depths ( hereinafter referred to as the depths of the groove ) of 1 , 3 , 5 , 7 μm in the si monocrystal through the variation of the etching time . thereafter , the photoresistances are removed by the oxygen plasma . to observe the cross - sectional shape of the etching portion at this time by an electronic microscope ( hereinafter referred to as sem ), one portion of the si wafer is broken by the pattern forming portion . the condition is shown in fig5 . the bottom portion where the si mono - crystal is etched ( hereinafter referred to as groove ) is made v in shape . the si wafer , whose groove depth is etched by 5 μm is placed into the hanger of fig4 the mixed acid between the fluoric acid and nitric acid ( hf : hno 3 = 3 : 97 ( volume ratio ), hereinafter referred to as mixed acid ) as treatment liquid is placed into the cell 112 . thereafter , the container 111 is sealed , the hanger 114 is thrust in so that the si wafer 117 is sunk completely into the mixed acid 115 . thereafter , the pressure within the container 111 is immediately reduced down to 30 torr ( 15 ° c . at the liquid temperature of the mixed acid 115 ) by the use of the rotary pump 113 . thereafter , the hanger 114 is vibrated several times from the outside of the decompression container 117 , the valve 116 is opened to introduce the air into the container 111 to restore the pressure to the atmospheric pressure . after the lapse of 15 minutes from the dipping of the si wafer 117 in the mixed acid 115 it is removed from the hanger 114 with a pincette . immediately the si wafer is washed with a large amount of superpure water having specific resistance value of 18 mω · cm , and , thereafter , is spin - dried at 5000 rpm . the etching is performed in the same manner even about the other si wafers each being different in the groove depth . according to the observation of the si wafer by the sem , the side wall of the groove is uniformly etched with mixed acid to extend the groove width even in any pattern different in the groove width and the groove depth as shown in fig6 with the groove bottom portion being changed to have such round shape from the v - shape like in fig6 . the mixed acid which is the wet etching treatment liquid of the si wafer is penetrated into the entire groove so that the uniform treatment can be performed . also , although many grooves are observed in the same manner across the entire si wafer faces , the result is completely the same . also , although the similar experiments are performed respectively at 50 , 70 , 100 , 150 torr , the results are the same . on the other hand , the si wafer is etched with the mixed acid without the pressure reduction within the container 111 with the use of the treatment apparatus shown in the fourth embodiment as a second comparison embodiment for comparison , by the method completely the same as that of the fourth embodiment in the other processes . it is found by the sem observation ( hereinafter referred to as the second comparison embodiment ) that the portions where the interior portion of the groove is etched to extend the groove width are mixed with the portions where the groove width is not extended without the etching operation so as to cause the unevenness within the groove to make the etching unequal although the groove is etched with the mixed acid near the entrance thereof to extend the groove width even in any si wafer different in the groove width and depth . the operation of the treatment method in the above - described fourth embodiment will be described hereinafter . the si wafer which is the substrate to be treated is brought into contact against the treatment liquid within the container for decreasing the pressure therein . the pressure within the container is restored again to the atmospheric pressure after the pressure inside the container is reduced . the air bubbles which remain within the small unevenness on the si wafer surface and are large enough to exert harmful influences upon the treatment are inflated to a large extent in the treatment liquid to disconnect them from the si wafer surface through buoyancy . accordingly , the air bubbles do not prevent the concaved inner face of the si wafer surface from coming into contact against the treatment liquid . the treatment liquid may be poured deep into the rear of the indentation by the atmospheric pressure if it may be different in size , thus resulting in uniform treatment ( the thickness of the si wafer of 5 inches in diameter with respect to the atmospheric pressure of 760 mm hg &# 39 ; is 0 . 5 through 0 . 6 mm ). also , the corrosion of the pressure - decreasing apparatus does not progress in the third treatment process of the conventional art even if the corrosive gas is caused , thus resulting in longer service life , because the pressure decreasing operation is temporarily performed . furthermore , the treatment method of the fourth embodiment has effects of applying the mechanical vibrations on the si wafer , performing oscillations , and taking the si wafer out of the treatment liquid for short time during the pressure reduction or stirring the treatment liquid by a pump , stirrer , ultrasonic waves or the like so as to disconnect the air bubbles as soon as possible . a fifth embodiment of the present invention will be described hereinafter . in the fifth embodiment of the present invention , the rca washing liquid including nh 4 oh , h 2 o 2 and h 2 o in a mixing volume ratio of 1 : 2 : 7 at 80 ° c ., instead of the mixed acid for wet etching in the fourth embodiment , is used . in the other processes , the si wafer is etched , washed with water , dried in the completely same manner as in the fourth embodiment . the number of particle - shaped foreign materials on the side wall of the groove is observed by the sem . also , the above - described rca washing liquid , instead of the mixed acid in the second comparison embodiment is used for comparison . the number of the particle - shaped foreign materials on the groove side - walls ( hereinafter referred to as the third comparison embodiment ) is counted in the same manner as that of the second comparison embodiment . the counted number of the particle - shaped foreign materials in the fifth embodiment and the third comparison embodiment will be shown in the following table 1 . it is to be noted that the counted value of table 1 is the total of the foreign materials each being 0 . 3 μm or more in diameter among the fifth line - shaped grooves , which are of 1 . 5 μm in width , 100 μm in length , respectively . it may be found from the results that the treatment operation may be performed with the washing liquid down to the bottom of the deep concave portion by the use of the treatment method of the present invention . table 1______________________________________method of washing number of particlessi wafer on groove side wall______________________________________fifth embodiment 7third embodiment 30______________________________________ a sixth embodiment of the present invention will be described hereinafter . in the sixth embodiment of the present invention , the line - shaped groove is formed on the si wafer through the dry etching as in the fourth embodiment . the si wafer is set in the hanger 114 shown in fig4 . thereafter , the water which is liquid soluble with the mixed acid is put into the cell 112 to seal the pressure decreasing container 111 . the hanger 114 is thrust in . the wafer 117 is dipped in the water . then , the pressure - decreasing container is reduced inside as low as 20 torr ( 15 ° c . at the low temperature ) by a vacuum pump 113 . also , the hanger 114 is rotated in the pressure - decreased condition by four times or five times at the angle of about 45 °. thereafter , the valve is opened to restore the pressure of the decompression apparatus to the atmospheric pressure . thereafter , the si wafer is dipped in the mixed acid , is etched , washed with water and dried . according to the observation of the groove - shaped pattern portion by the sem , the groove - bottom portion is changed into the round v - shape as in fig6 also the side wall of the groove is uniformly wet - etched , and can be uniformly treated as in the fourth embodiment . on the other hand , by the use of the apparatus shown in the sixth embodiment for comparison , the pressure within the decompression container 111 is not decreased , but the si wafer is etched in the mixed acid in completely the same method as in the fifth embodiment . according to the sem observation ( hereinafter referred to as the fourth comparison embodiment ), the groove is etched near the entrance thereof to extend the groove width even in any si wafer different in the groove depth . however , the interior of the groove can be treated only in the unequal way as in the second comparison embodiment . a seventh embodiment of the present invention will be described hereinafter . methanol having surface tension of 24 dyne / cm , ethanol having surface tension of 24 . 1 dyne / cm , n - propyl alcohol and isopropyl alcohol having surface tension of 22 . 9 dyne / cm , acetone having surface tension of 26 . 3 dyne / cm , and methyl ethyl ketone having surface tension of 26 . 8 dyne / cm , acetic acid having surface tension of 29 . 6 dyne / cm , in methyl acetate , ethyl acetate and nonionic series interfacial activator diluted to 0 . 5 % with water , mixture of 1 : 1 between ethanol and acetic acid , mixed liquid between ethanol and water at a mixing ratio of either 6 : 4 or 4 : 6 , the mixed liquid between acetic acid and water at a mixing ratio of either 6 : 4 or 4 : 6 are used as the liquid soluble with the mixed acid which is the wet etching agent of the si wafer . the wet etching is performed as in the sixth embodiment so that the groove bottom portion is changed into the round v - shaped likewise and the mixed acid for etching use is penetrated through the entire groove . also , the similar examinations are performed with the use of the mixed liquid between methanol and water , isopropyl alcohol and water , or acetic acid and water , with the results being completely the same . an eighth embodiment of the present invention will be described hereinafter . in the eighth embodiment of the present invention , the rca washing liquid including nh 4 oh , h 2 o 2 and h 2 o at a ratio of 1 : 2 : 7 , at 80 ° c ., instead of the mixed acid for the wet etching in the sixth embodiment , is used . in the other processes , the si wafer is etched , washed with water and dried in completely the same manner as in the sixth embodiment the number of particle - shaped foreign materials on the side wall of the groove is observed by the sem . also , the above - described rca washing liquid , instead of the mixed acid in the fourth comparison embodiment , is used for comparison . the number of the particle shaped foreign materials on the groove side walls ( hereinafter referred to as the fifth comparison embodiment ) is counted in the same manner as that in the fourth embodiment . the counted number of the particle - shaped foreign materials in the eighth embodiment and the fifth comparison embodiment will be shown in the following table 2 . it is to be noted that the counted value of table 2 is the total of the foreign materials each being 0 . 3 μm or more in diameter among the fifty line - shaped grooves , which are of 1 . 5 μm in width , 100 μm in length respectively . it may be found from the results that the treatment operation may be performed with the washing liquid down to the bottom of the deep concave portion by the use of the treatment method of the eighth embodiment . it is to be noted that each of the above - described embodiments shows only the examples of the wet etching and the washing process of the si wafer . the present invention may be applied not only to the examples , but also to all the processes of treating , with the use of the treatment liquid , a substrate which is shaped like a plate and has unevenness on the surfaces . table 2______________________________________ number of particle - shapedmethod of washing foreign materials onsi wafer groove side wall______________________________________eighth embodiment 7fifth embodiment 35______________________________________ in the treatment method of embodiment 6 through embodiment 8 , the liquid which is soluble with such treatment liquid as described hereinabove is contacted with the surface of the substrate to be treated , thereafter the pressure in the container is reduced , then the pressure is restored to atmospheric pressure , and the large air bubbles in the concave portion are inflated by the decompression , are removed with buoyancy , and the liquid is gradually penetrated into the surface between the very few small air bubbles remaining on the surface of the substrate to permit the entire surfaces of the substrate to be wetted with the treatment liquid . it is possible for the interior of the decompression container to be made completely vacuum . the degree of vacuum increases only up to the steam pressure when the liquid exists with the decompression container . for example , it is about 20 torr at 20 ° c . in the case of water . accordingly , the air which is originally located in the concave portion of the substrate may be mostly removed by the decompression de - airing operation , but air in an amount equivalent to 20 / 760 of the volume of the concave portion remains as it is . the decompression degree of the treating method in the sixth through the eighth embodiments is determined by the steam pressure of the treatment liquid . the vacuum arrival degree is up to about 20 torr at 20 ° c . in the diluted liquid through the fluoric - acid water , the effective vacuum degree is within the range of 150 through 20 torr ( 20 ° c . ), preferably 40 through 20 torr . the various pumps such as rotary pump , diffusion pump , mechanical booster pump , water seal pump and so on which are generally used as vacuum pumps are provided as apparatuses for decreasing the pressure within the container . in the present invention , any pump may be used , and a plurality of combinations from among them may be used . a ninth embodiment of the present invention will be described hereinafter with reference to the drawings . in sample and the apparatus used in the present embodiment are the same as those manufactured and used in the fourth embodiment . the line - shaped pattern of 100 μm in length , every 0 . 5 μm in width ( or there may be employed a value of 0 . 5 through 4 . 0 μm in width ), and 1 , 3 , 5 , 7 μm in depth is formed on the surface , and , thereafter , the photoresistance is removed . the si wafer like this is used . the treatment apparatus of fig4 which is the same as that of the fourth embodiment , is used . the si wafer , whose groove depth is etched by 5 μm is placed into the hanger of fig4 the mixed acid between the fluoric acid and the nitric acid ( hf : hno 3 ) in a mixing volume ratio of 3 to 97 ( hereinafter referred to as a mixed acid ) as treatment liquid is placed into the cell 112 . thereafter , the container 111 is sealed , the pressure within the container 111 is reduced to 30 torr at 15 ° c . of the liquid temperature of the mixed acid 115 by the use of the rotary pump 113 . then , the hanger 114 is thrust in so that the si wafer 117 is sunk completely into the mixed acid 115 . thereafter , the valve 116 is opened to introduce the air into the container 111 to restore the pressure to the atmospheric pressure . after the lapse of 15 minutes from the dipping of the si wafer 117 in the mixed acid 115 , the si wafer 117 is lifted from the mixed acid 115 to take it out from the hanger 114 with a pincette . immediately , the si wafer is washed with a large amount of super - pure water having specific resistance value of 18 mω · cm , and thereafter , is spin - dried at 5000 rpm . the etching is performed in the same manner even about the other si wafers each being different in the groove depth . according to the observation of the si wafer by the sem , the side wall of the groove is uniformly etched with mixed acid to extend the groove width even in any pattern different in the groove width and the groove depth as shown in fig6 with the groove bottom portion being changed to have such round shape as in fig6 from the v - shape . the mixed acid which is wet etching treatment liquid of the si wafer is penetrated into the entire groove so that the uniform treatment can be performed . also , although many grooves are observed in the same manner across the entire si wafer faces , the result is completely the same . also , although the similar experiments are performed respectively at 50 , 70 , 100 , 150 torr , the results are the same . on the other hand , the si wafer is etched with the mixed acid without the pressure reduction within the container 111 with the use of the apparatus shown in the fourth embodiment for comparison by the method which is completely the same method as that of the ninth embodiment in the other processes . it is found by the sem observation ( hereinafter referred to as the fifth comparison embodiment ) that the portions where the interior portion of the groove is etched to extend the groove width are mixed with the portions where the groove width is not extended without the etching operation so as to cause the unevenness within the groove to make the etching unequal although the groove is etched with the mixed acid near the entrance thereof to extend the groove width even in any si wafer different in the groove width and depth . a tenth embodiment of the present invention will be described hereinafter . in the tenth embodiment of the present invention , the rca washing liquid including nh 4 oh , h 2 o 2 , h 2 o in a volume ratio of 1 : 2 : 7 at 80 ° c ., instead of the mixed acid for the wet etching use in the ninth embodiment , was used . in the other processes , the si wafer is etched , washed with water , dried in the completely same manner as in the ninth embodiment . the number of particle - shaped foreign materials on the side wall of the groove is observed by the sem . also , the above - described rca washing liquid , instead of mixed acid used in the ninth comparison embodiment is used for comparison . the number of the particle - shaped foreign materials on the groove side walls ( hereinafter referred to as the sixth comparison embodiment ) is counted in the same manner . the counted number of the particle - shaped foreign materials is the tenth embodiment and the sixth comparison embodiment will be shown in the following table 3 . it is to be noted that the counted value of table 3 is the total of the foreign materials each being 0 . 3 μm or more in diameter among the fifty line - shaped grooves , which are of 1 . 5 μm in width , 100 μm in length , respectively . it may be found from the results that the treatment operation may be performed with the washing liquid down to the bottom of the deep concave portion by the use of the treatment method of the present embodiment . table 3______________________________________method of washing number of particles onsi wafer groove side wall______________________________________tenth embodiment 3sixth embodiment 32______________________________________ an eleventh embodiment of the present invention will be described hereinafter . in the eleventh embodiment of the present invention , the line - shaped groove is formed on the si wafer through the dry etching as in the ninth embodiment . the si wafer it set in the hanger 114 shown in fig4 . thereafter , the water which is liquid soluble with the mixed acid is put into the cell 112 to seal the pressure - decreasing container 111 . the pressure - decreasing container 111 is reduced inside as low as 20 torr at 15 ° c . of the low temperature , by a rotary vacuum pump 113 . then , the hanger 114 is rotated in the pressure - decreased condition by four times or five times at the angle of about 45 °, where the hanger is thrust in , and the wafer 117 is dipped in the water . thereafter , the valve is opened to restore the pressure of the decompression apparatus to the atmospheric pressure . thereafter , the si wafer is dipped in the mixed acid , is etched , washed with water and dried . according , to the observation of the groove - shaped pattern portion by the sem , the groove - bottom portion is changed into the round v - shape as in fig6 also the side wall of the groove is uniformly wet - etched , and can be uniformly treated as in the ninth embodiment . on the other hand , by the use of the apparatus shown in the eleventh embodiment for comparison , the pressure within the decompression container 111 is not decreased , in the other process steps the si wafer is etched in the mixed acid in completely the same method as in the ninth embodiment . according to the sem observation ( hereinafter referred to as the seventh comparison embodiment ), the groove is etched near the entrance thereof to extend the groove width even in any si wafer different in the groove depth . however , the interior of the groove can be treated only in the unequal way as in the fifth comparison embodiment . in the treatment method in the ninth through eleventh embodiments , the si wafer and the treatment liquid are placed separately within the container provided with an apparatus for decreasing the pressure within the container , and the pressure within the container is decreased . thus , the air on the wafer surfaces can be removed even if unevenness caused by fine or deep grooves exists . the si wafer is brought into contact against the treatment liquid in this condition , thereafter the pressure is restored to the atmospheric pressure . accordingly , the air bubbles do not prevent the concaved inner face of the si wafer surface from coming into contact against the treatment liquid . the treatment liquid may be poured deep into the rear of the indentation by the atmospheric pressure if it may be different in size , thus resulting in uniform treatment . in this embodiment , the thickness of the si wafer of 5 inches in diameter with respect to the atmospheric pressure 760 mmhg is 0 . 5 through 0 . 6 mm . a twelfth embodiment of the present invention will be described hereinafter . in the treatment method of the twelfth embodiment of the present invention , the liquid soluble with the treatment liquid is brought into contact with the surface of the substrate to be treated under the decreased pressure , thereafter the pressure is restored to the atmospheric pressure . the liquid is gradually penetrated into the boundary between very few air bubbles remaining on the surfaces of the substrate so that the entire surface of the substrate may be wetted with the treatment liquid . the concrete contents of the twelfth embodiment using the liquid will be described hereinafter . the kind of the liquid soluble with the treatment liquid to be used in the treatment method of the twelfth embodiment is the same as that used in the treatment method of the sixth through eighth embodiments , and the operation is also similar . methanol having surface tension of 24 dyne / cm , ethanol having surface tension of 24 . 1 dyne / cm , n - propyl alcohol and isopropyl alcohol having surface tension of 22 . 9 dyne / cm , acetone having surface tension of 26 . 3 dyne / cm , and methyl ethyl ketone having surface tension of 26 . 8 dyne / cm , acetic acid having surface tension of 29 . 6 dyne / cm , in methyl acetate , ethyl acetate and nonionic series interfacial activator diluted to 0 . 5 % with water , mixture of 1 : 1 between ethanol and acetic acid , mixed liquid between ethanol and water at a ratio of either 6 : 4 or 4 : 6 , the mixed liquid between acetic acid and water at a ratio of either 6 : 4 or 4 : 6 are used as the liquid soluble with the mixed acid which is the wet etching agent of the si wafer . the wet etching is performed as in the eleventh embodiment so that the groove bottom portion is changed into the round v - shape likewise and the mixed acid for etching use is penetrated through the entire groove . also , the similar examinations are performed with the use of the mixed liquid between methanol and water , isopropyl alcohol and water , or acetic acid and water , with the results being completely the same . a thirteenth embodiment of the present invention will be described hereinafter . in the thirteenth embodiment of the present invention , the rca washing liquid including nh 4 oh , h 2 o 2 , h 2 o at a ratio of 1 : 2 : 7 at 80 ° c ., instead of the mixed acid for wet etching use in the twelfth embodiment , is used . in the other processes , the si wafer is etched , washed with water , dried in the completely same manner as in the twelfth embodiment . the number of particle - shaped foreign materials on the side wall of the groove is observed by the sem . also , the above - described rca washing liquid , instead of the mixed acid used in the seventh comparison embodiment is used for comparison . the number of the particle - shaped foreign materials on the groove side walls ( hereinafter referred to as the eighth comparison embodiment ) is counted in the same manner . the counted number of the particle - shaped foreign materials in the thirteenth embodiment and the eighth comparison embodiment will be shown in the following table 4 . it is to be noted that the counted value of table 4 is the total of the foreign materials each being 0 . 3 μm or more in diameter among the fifty line - shaped grooves , which are of 1 . 5 μm in width , 100 μm in length , respectively . it may be found from the results that the treatment operation may be performed with the washing liquid down to the bottom of the deep concave portion by the use of the treatment method of the present invention . table 4______________________________________ number of particle - shapedmethod of washing foreign materials of groovesi wafer on groove side wall______________________________________thirteenth embodiment 2eighth comparison 35embodiment______________________________________ although the present invention has been fully described by way of example with reference to the accompanying drawings , it is to be noted here that various changes and modifications will be apparent to those skilled in the art . therefore , unless otherwise such changes and modifications depart from the scope of the present invention , they should be construed as being included therein .	7
the drip stopper shown in fig1 comprises a substantially cylindrical pipe part 1 which , for the purpose of drip - free pouring , is to some extent inserted in the neck of an opened bottle . the lower part of the pipe part in the drawing which , in its inserted state extends into the bottleneck , is denoted as insertion part 3 , and the upper part which , in its inserted state protrudes from the bottleneck , is denoted as pouring - out part 4 . the upper opening of the pouring - out part 4 is shaped such that a defined pouring - out edge 4 is formed . in the present example , this is achieved by cutting the pipe part at the top at an angle to its axis . between the pouring - out part 4 and the insertion part 3 , a plurality of radially outwardly oriented position elements 6 are arranged which , in the inserted state of the drip stopper , rest on the upper edge of the bottleneck , thus delimiting the insertion depth . at the lower end section of the insertion part 3 , a plurality of guide elements 7 are attached through molding . they are oriented downward obliquely to the axis of the insertion part 3 and facilitate the accurate insertion of the drip stopper in narrower bottlenecks . on the side opposite of the pouring - out edge 5 , the substantially cylindrical wall of the pipe part has a nook - shaped recess 8 which extends in axial direction over the entire length of the pipe part and is formed by two side walls 9 and a rear wall 10 . as shall be explained in the following using fig2 , the front edges 11 of the recess , formed by the side walls with the lateral surface , are brought closer to one another by pressing together the cylindrical area . as a result , the recess folds up and shall in the following description thus also be denoted as folding zone 8 . fig2 a shows schematically a cross - section of the insertion part 3 , i . e . a section perpendicular to the axis of the pipe part , with the preferred folding zone 8 in the operational basic position the way the drip stopper is delivered . in this basic position , the outer diameter of the insertion part 3 is minimally greater than the inner diameter of the largest bottleneck provided . when the drip stopper is inserted in the bottleneck , the insertion part 3 is narrowed . simultaneously , the front edges 11 are pushed closer to one another . the rear wall 10 is tensioned and slightly bent toward the axis of the insertion part 3 . the tilting side walls 9 are forced to position themselves between the rear wall 10 and the outer wall . inevitably , the rear wall 10 is also radially pulled outward , as can be seen in fig2 b which shows the state of the folding zone 8 , when the drip stopper is inserted in a bottleneck with the smallest aforementioned diameter . the force required to insert the drip stopper in the bottleneck generates a tension in the insertion part 3 as well as in the side walls 9 and the rear wall 10 of the folding zone 8 . the functioning of the sealing is thus based on pressure and counter - pressure generated between the insertion part 3 and the folding zone 8 due to the narrowing when the drip stopper is pushed into the bottleneck . the angle adjustments between rear wall 10 , side walls 9 , and insertion part 3 determine , how and in which direction the side walls 9 must move , when the insertion part 3 is narrowed . in order to ensure this function , primarily the pressing against the inner side of the bottleneck , it is necessary that the front edges 11 and the inner edges between rear wall 10 and the side walls 9 are able to transfer tension forces between the adjacent areas . in other words , they must not be bent so sharply that they can be folded free from tension . preferably , this is achieved in that the edges have a curvature radius of a few millimeters . due to the narrowing of the insertion part 3 , the folding zone 8 is tensioned , while this tension simultaneously presses the insertion part 3 everywhere and evenly against the bottleneck , thus generating a seal . as a result , no wine can penetrate between insertion part 3 and bottleneck . wine can also not flow through the area of the folding zone 8 because this is prevented by the backwards flowing air . in addition , if poured correctly , the wine only flows in the lower area of the passage . fig3 shows another option for the design of a folding zone with an open angle , namely on the left side in an operational state , i . e . as delivered ; in the middle with an approximately right - angled position of the folding zone in a bottleneck with medium inner diameter ; and on the right in a bottleneck with the smallest inner diameter . fig4 shows a similar version as fig2 , but with an outwardly oriented bend in the rear wall 10 . in this version , the rear wall 10 is pressed closer to the bottle wall when the insertion part 3 narrows than in the version according to fig2 . the drip stoppers can be stacked by inserting one into another to save space . in order to make this possible , the following is provided : the pouring - out part 4 has thinner walls than the insertion part 3 . the inner diameter of the pouring - out part 4 corresponds approximately to the outer diameter of the insertion part 3 . as a result , on the wall inner side between the pouring - out part and the insertion part , a continuous recess is created in the area , in which the position elements 6 are attached on the outside through molding . in the area of the pouring - out part 4 , on the same level with the upper edge of the folding zone 8 , a support is molded on the inside . the lower area of the insertion part is tapered in a short section in order to facilitate the insertion into the bottleneck . for the same length as said tapering , the folding zone 8 is omitted . the guide elements 7 are arranged such that they are located in the stack on the side of the folding zone 8 and the support . therefore , when the drip stoppers are inserted into one another , the insertion part 3 of the upper drip stopper sits on the folding zone 8 and the support of the lower drip stopper . when stacked , a drip stopper only takes up space that is equal to the length of the insertion part 3 . the drip stopper is made of resilient , tough , hydrophobic plastic , e . g . pe . there are several possibilities for designing the folding zone . for example , an inward bulge can be formed instead of the side walls and the rear wall . the principle remains the same . fig5 shows a drip stopper , in which , contrary to the drip stopper with guide elements , the lower area of the insertion part is tapered . due to this tapering , the accurate insertion of the drip stopper in the bottleneck with the smallest aforementioned diameter is facilitated . the rear wall or the apex of the folding zone is incised all the way to the end of the tapering . as a result , the tapering cannot influence the even contact pressure of the insertion part on the bottleneck . fig6 and 7 schematically show a packaging , in which individual or stacked drip stoppers are stored without being able to be touched by fingers . the packaging comprises a decorative , flat cardboard box with a folding lid , similar to a box of chocolates . in the interior , there is a foil 20 which is downwardly deep - drawn , having a flat surface . this foil 20 comprises a plurality of annular indentations as staking space 21 , in which drip stoppers 1 can be stored individually or preferably stacked with the pouring - out parts 4 on top . the outer diameter of this stacking space 21 corresponds approximately to the outer diameter of the circle of the end sections of the position elements 6 . an also deep - draws column 22 if formed in the center of the stacking space 21 , said column 22 being adjusted , at some distance , to the inner contours of the drip stopper 1 . the column serves as an orientation element . the drip stoppers 1 are thus oriented and stacked in the stacking space 21 at a depth , where they cannot be touched by fingers , i . e . a gap is formed between the surface of the packaging and the pouring - out edge 5 of the topmost drip stopper 1 . the stacking space , in which the drip stoppers are located , is smaller than the thickness of a finger . in the stack , the upper drip stopper 1 sits in the pouring - out part 4 of the corresponding subjacent drip stopper 1 . the inner diameter of the pouring - out part 4 of each of the subjacent drip stoppers 1 corresponds , as mentioned before , approximately to the outer diameter of the insertion part of the next drip stopper 1 above , and so the upper drip stopper is held slightly by the subjacent drips stopper 1 . in the lower area , the indentations in the foil 20 are designed so as to be narrower than in the upper area . the lower area of the indentation is adjusted to the drip stopper such that the position elements 5 of the lowermost drip stopper are slightly clamped . since , as a result , the drip stopper is pressed against the packaging , and the upper drip stoppers are held by the corresponding subjacent ones , there is no danger that the stack can slide out of the packaging , even if it is turned on its head . the insertion device 25 shown in fig8 consists of a handle 26 and a push part 27 . the handle 26 consists of a pipe which is open at the bottom and extends to the lower end section of the push part 27 . the inner diameter of the pipe is minimally smaller than the outer diameter of the circle of the pouring - out part 2 of the drip stopper 1 , when the drip stopper 1 is not tensioned . the outer diameter of the push part 27 is approximately equal to the outer diameter of the indentation in the foil 20 and somewhat smaller than the outer circle of the position elements 6 of the drip stopper 1 . the lower end section of the pipe is cut straight and , similar to the lower surface of the push part 27 , is positioned at a right angle to the axis of the pipe . at the bottom , the push part 27 is closed all the way to the edge of the pipe . for removal from the packaging and insertion in the bottleneck , the insertion tool is gripped by the handle and the push part is guided into the annular indentation of the packaging , i . e . into the stacking space 21 . in the indentation , a drip stopper 1 points upward with its pouring - out part 4 . the pipe , having a short expansion in the lower section , is pulled over this pouring - out part 4 . the pipe clamps the pouring - out part 4 of the drip stopper and holds it tight by pressing it together . simultaneously , the circumference of the insertion part 3 of the drip stopper 1 is becoming smaller , and so it can come loose from the lower drip stopper . the pipe ( handle ) is lifted with the clamped pouring - out part 4 . now the drip stopper with the insertion device 25 is pressed into the bottleneck until the position elements 6 are positioned on the edge of the bottleneck . the drip stopper 1 is now securely positioned in the bottleneck . due to the pressing into the bottleneck , the diameter of the drip stopper 1 as well as the diameter of the pouring - out part 4 becomes smaller . the pouring - out part 4 thus comes loose from the insertion device 25 . the insertion device 25 can be lifted and placed into the packaging , or a new drip stopper can be collected and inserted in a bottleneck . in a different version , the pipe is supplemented by a flat section in the receiving space for the pouring - out part 4 , said flat section being located in the interior of the insertion part 3 , when receiving the drip stopper , and pressing slightly against the rear wall 10 . this flat section can extend to the lower end section of the insertion part 3 . this version is advantageous with a very short pouring - out part . of course , the deep - drawn packaging foil 20 is adjusted .	1
referring to fig1 , a system and apparatus in accordance with an embodiment of the present invention , for treating fecal incontinence , are illustrated in schematic form . the system includes an apparatus comprising an implantable stimulator 1 and a device comprising contractile tissue 2 which is arranged to be stimulated by a signal that is generated by the stimulator 1 and , in this embodiment , applied to the contractile tissue 2 via an electrode 3 conductively connected between the stimulator 1 and contractile tissue 2 . in this embodiment , the stimulator 1 includes a signal generator for producing a pulsatile signal which is housed in a bio - compatible housing 4 . the stimulator 1 will be described in more detail later . the contractile tissue 2 in this embodiment is formed into a sphincter which is implanted about the fecal sphincter region , in this embodiment proximate to the anus . in fig1 , the external fecal sphincter is designated by reference numeral 5 and the internal fecal sphincter by reference numeral 6 . failure of operation of the external and / or internal fecal sphincters perhaps because of nerve damage , or other reason ) have led to fecal incontinence in this patient . stimulation of the contractile tissue sphincter 2 , in operation , causes the contractile tissue 2 to contract and maintain closure of the fecal canal 7 , maintaining fecal continence . in this embodiment , the contractile tissue is smooth muscle tissue . the smooth muscle tissue may be obtained from elsewhere in the body , formed into a sphincter and surgically implanted . alternatively , the smooth muscle tissue may be grown from smooth muscle stem cells and / or proliferative smooth muscle cells . alternatively , the smooth muscle tissue may be transplanted smooth muscle tissue augmented by smooth muscle stem cells and / or proliferative smooth muscle cells . alternatively , the smooth muscle tissue may be the tissue of the internal fecal sphincter . international patent application no : pct / 2006 / 001301 , referred to above , discloses augmentation of contractile tissue using proliferative smooth muscle cells or smooth muscle stem cells . growth , maturation and stability of the tissue may be influenced by growth factors ( trophic and / or neurotrophic factors ) that are a component of the treatment . smooth muscle may be taken from anywhere or grown ( as discussed above ). in an embodiment the smooth muscle may be taken from the smooth muscle of the bladder and transplanted about the urethra , with its circulation intact . alternatively , the muscle is venous smooth muscle , anococcygeus smooth muscle or terminal ileum transplanted as a segment devoid of mucosa and having its circulation intact . a further alternative is the dartos smooth muscle from the scrotum or a portion of the vagina or labia . in an embodiment , smooth muscle may be taken as a free graft . in this case , the tissue is separated from its normal circulation and becomes vascularised by ingrowth of blood vessels at the site of implant . the stimulator 1 includes a signal generator arranged to provide a stimulation signal for stimulating the smooth muscle sphincter 2 . a lead 8 extends from the stimulator 1 to the electrode 3 at the smooth muscle sphincter 2 , for providing the stimulation signal 2 to the smooth muscle sphincter 2 . the stimulation signal may be a signal of frequency and amplitude determined to maintain contraction of the smooth muscle sphincter 2 to facilitate continence . the stimulator 1 may also be arranged to produce a further electrical signal to stimulate the sphincter 2 to relax , to enable the patient to defecate . as an alternative to a further electrical signal , the stimulator 1 may be arranged to stop producing any electrical signal and it is the absence of the signal that causes the sphincter 2 to relax . in this embodiment , the stimulator 1 is arranged to have the stimulation signal varied under control of the patient by way of an external controller . fig2 shows an alternative embodiment . in the fig2 drawing , the same reference numerals have been used as in fig1 for equivalent components . those components have the same function as in fig1 and no further description will be given here . in the fig2 embodiment , the contractile tissue sphincter 2 is placed further up the colorectum , in the abdomino - pelvic region , away from the anus . this different positioning may be used if surgically convenient . in some cases , this different position may be utilised where there is some damage to the anus . such damage may occur , for example , from the former use of prosthesis in an attempt to correct the incontinence problem . there does not have to be any damage to the anus for this alternative positioning to be used . in a further alternative embodiment , the sphincter 2 may be positioned about the external fecal sphincter . in a further alternative embodiment , a neosphincter may not be utilised , instead stimulation may be applied directly to the internal fecal sphincter 6 . the stimulator 1 is shown in more detail in fig3 . in this embodiment , a signal generator that is arranged to provide the electrical signal for stimulation of the sphincter 2 is in the form of a control unit 9 and stimulus driver 10 . the control unit 9 encodes the stimulus and provides a signal to the stimulus driver 10 which provides the stimulation signal at output 16 . the output 16 outputs to conductor 32 and to one or more electrodes 3 . in this embodiment , the control unit 9 and stimulus driver 10 form , together with a demodulator 18 , a processing unit for generating the stimulation signal ( s ) at output 16 . the demodulator 18 is arranged to demodulate a signal received by transceiver 15 . an external control unit and external programmer unit ( both to be described later ) are able to communicate via the transceiver 15 with the processing unit 14 in order to control application of stimuli and / or vary the stimuli . in addition , as described in more detail later , the processing unit 14 may transmit , via control unit 9 , demodulator 18 and transceiver 15 , signals to the control unit or programmer unit . the transmitted signals may deliver telemetry information indicative of parameters of the stimulator , for the purposes of calibration and control . the entire stimulator 1 ( including components 14 and 15 ), is enclosed in a housing which includes a casing made from a bio - compatible material , such as titanium , silicone polymer or other acceptable materials , or combinations of materials , including , but not limited to inert materials . the frequency of the rf signal for transmission and reception by the transceiver 15 may depend on the material of the casing of the stimulator . fig4 shows a system in accordance with an embodiment of the present invention . the system incorporates the implanted stimulator 1 , with transceiver 15 . the electrode ( s ) 3 is shown schematically together with cable 32 . the system also comprises an external controller 17 which includes a transmitter 11 . the controller 17 is intended for operation by a patient with the stimulator implanted , for control of the stimulator 1 . the controller 17 includes an actuator ( such as a button , not shown ) operable by the patient to selectively send signals to the implanted stimulator 1 , for control of the stimulation signals being sent to the electrode ( s ) 3 . in one embodiment , the stimulator is “ fail safe ”. unless a signal is received from the controller 17 , the stimulator produces a signal which maintains tone in the smooth muscle implant 2 , maintaining fecal continence . when the patient wishes to defecate , the patient actuates the controller 17 to send , via the transmitter 11 , a signal to the stimulator 1 . in response to receiving the signal , the control unit 9 operates to turn the stimulating signal off causing the sphincter 2 to relax and allow the patient to defecate . the controller 17 may also be arranged to provide a further signal under patient control , once the patient has finished defecating , the further signal causing stimulator 1 to resume providing the stimulation signals to the electrode ( s ) 3 . in “ fail safe ” mode , if the further signal is not produced , the stimulator may resume providing the stimulation signal to the electrode ( s ) 3 after a predetermined period of time . the stimulation signal 16 provided to contract the smooth muscle sphincter 2 is selected so as to provide a substantially continuous tone in the sphincter 1 . a generally rectangular and symmetrically biphasic pulse may be suitable for this . the signal has a substantially constant current less than or equal to 50 ma , 15 ma , 10 ma , or 5 ma , and in some preferred embodiments may be in the order of 4 ma , 8 ma , 12 ma , or 15 ma . stimulation pulse frequency provided to sphincter 1 is in the range of 0 . 1 hz to 5 hz , 0 . 2 hz to 4 . 0 hz . 0 . 25 hz to 3 . 0 hz , 1 hz to 3 . 0 hz , 1 . 5 hz to 3 hz , 1 . 75 hz to 2 . 5 hz , or a 0 . 25 hz to 2 . 25 hz , and in one embodiment , is 1 hz , 2 hz , 2 . 5 hz or 3 hz . stimulation phase width of each phase is in the range of 0 . 05 ms to 2 . 0 ms , 0 . 1 ms to 1 . 5 ms , 0 . 2 ms to 1 ms , 0 . 25 ms to 0 . 75 ms , and in one embodiment is 0 . 2 ms , 0 . 4 ms , 0 . 5 ms or 1 ms . the stimulator is current regulated , and accordingly the stimulation voltage will vary with the resistance of the muscle tissue between the electrodes . typical values for the voltage are between 0 . 1 and 15 volts , 0 . 2 and 12 volts , 0 . 5 and 12 volts , 0 . 5 and 10 volts , or 0 . 5 and 7 . 5 volts . in one embodiment , the voltage is 2 . 5 volts , 5 volts , 7 . 5 volts or 10 volts . either a current source ( voltage limited ) or a voltage source ( current limited ) stimulator may be used . it is also possible to use an asymmetric biphasic pulse , in which , for example , the first phase is shorter in duration than the second phase . fig5 shows a system in accordance with an embodiment of the present invention , including a programmer unit 13 which may be utilised by a physician to set and adjust parameters of the implanted stimulator 1 . the programmer unit is arranged for communication with the stimulator via transceiver 11 , and may comprise a computing device . the control unit 9 is also arranged to transmit stimulator telemetry information indicative of one or more of the parameters of the stimulator 1 , for detection by the programmer 13 via transceiver 1 . the programmer unit 13 can therefore determine parameters of the stimulator from telemetry information and can adjust the parameters by transmitting control signals to the stimulator 1 . the signal from the programmer may be able to selectively vary the output current , shape , frequency and / or pulse width of the stimulation signal ( s ). in operation , a physician adjusts parameters of the stimulation signal ( s ). the physician will note feedback from the patient as to the effect of the stimulus on fecal continence control , and may subsequently re - adjust the parameters until the stimulation is optimum . for example , patient perceived feedback may be used to set the maximum stimulation threshold of the smooth muscle sphincter . in the above - described embodiments , signals between the controller or programmer and the stimulator are rf signals . other types of transmission media other than rf may be used . for example , microwave signals may be used for transmission , optical signals may be used , and in another embodiment magnetic transmission may be used . magnetic transmission may be used for the controller 17 to cause the stimulator to stop producing stimulation signals and therefore allow the patient to defecate . in this embodiment , the controller 17 may be a simple magnet which , when passed over a magnetic receiver of the stimulator 1 , results in the stimulator ceasing to provide stimulation signals for contracting the sphincter . in the above embodiments , any suitable electrode ( s ) may be utilised to stimulate the implant 2 . for example , button electrodes , cuff electrodes or any other suitable electrode may be utilised . in embodiments , an electrode arrangement such as a disclosed in pct / au / 20054 / 001698 may be utilised . fig6 illustrates an embodiment of the present invention where a “ peg ” electrode 3 a such as disclosed in pct / au20054 / 001698 is utilised to transmit signals to the implant 2 from the stimulator 1 . in fig6 , the same reference numerals as used in previous embodiments have been utilised to designate similar components , and no further description will be given here of these components . the electrode 3 a will now be described in more detail . the electrode comprises a number of components . these include an electrode cover 100 ( shown in most detail in fig1 through 18 ). the components also include an electrode shroud ( shown in best detail in fig1 through 13 ) and also an electrode lead 102 ( shown in fig7 , 8 & amp ; 9 , together with the other components of the electrode arrangement ). in this embodiment first and second electrode elements are formed by the electrode cover 100 , which includes insulating elements 103 , 104 extending from a base 105 . the insulating extending elements 103 , 104 are formed with a slot 106 , 107 , respectively , extending substantially along the length of the extending elements 103 , 104 . when the electrode arrangement is assembled , platinum foil electrodes 108 , 109 ( fig7 ) are placed on the outer surfaces of the elements of the elements 103 , 104 so that they are insulated from the gap 110 formed between the elements 103 , 104 apart from the slots 106 , 107 , which expose portions of the conductive plates 108 , 109 to the gap 110 ( and , in use , to any tissue seated within the gap ). when assembled , the electrode cover 100 and platinum electrode foils 108 , 109 seat within the electrode shroud 101 as best shown in fig1 , 11 , 12 & amp ; 13 . fig1 in particular shown in cross - section where the electrode cover seats . electrode shroud 1 is formed from silicone . in order to provide reinforcement , pet mesh covers 111 , 112 are provided to fit to upper 113 and lower 114 extending portions of the shroud 101 . suture holes 115 , 116 are provided in the covers 111 , 112 and also in the elements 113 , 114 of the shroud 101 . note that the reinforcement can be provided by other means and is not limited to pet mesh . further , the electrode shroud need not be in silicone but could be of other bio - compatible material and may not require reinforcement . further , note that other means for affixing to the tissue may be provided other than suture holes or instead of suture holes . the electrode lead 102 is a multi - component arrangement which includes an outer insulating cover 120 , a tine collar 121 including tines 122 for retaining the lead in position within a patient . it also includes a sutured collar 123 including suture holes 124 for suturing to patient tissue to also facilitate retaining the lead 102 in position . there is also bifurcation moulding 125 which enables the lead to split into two parts 126 , 127 which may contain separate conductors , and connectors 128 , 129 which may be arranged to contact to a simulation device . in the above embodiments , the electrode arrangement includes a pair of electrode elements which extend away from a base which joins them together at their proximal ends . in a further embodiment , a single electrode element which is not joined at any base is provided . this single electrode element may be used to provide stimulation to contractile tissue on its own , or may be used together with one or more similar electrode elements to provide stimulation . in the above described embodiments , each electrode element is provided with a single electrode . the single electrode is an elongate electrode extending substantially the majority of the length of the electrode element . one advantage of having thin electrodes bounded by insulating material on either side is that the arrangement operates to confine the electric field produced by the electrode to the tissue immediately adjacent the electrode . this reduces or prevents stimulation of tissue that it is not desirable to stimulate e . g . tissue external to a contractile tissue sphincter being controlled . in operation , the electrodes 108 , 109 and extending elements 103 , 104 are positioned either side of the smooth muscle implant to enable signals to be transmitted to the implant for operation . electrode arrangement 3 a allows application of an electric field between the opposing electrode elements to stimulate the tissue between them . the electric field in one embodiment is confined so that stimulation is to a band of tissue between the electrodes . in one embodiment , innervation runs within the implant 2 perpendicular to the band of tissue being stimulated . the elements in electrode 3 a extend over the tissue in a manner analogous to that of a clothes peg . the elements in electrode 3 a extend over the tissue in a manner analogous to that of a clothes peg . other electrode patterns then a single line electrode on the surfaces of the elements may be utilised . as discussed above , in an embodiment , the stimulater implant is preferably sealed and encased in a biologically inert material such as a biocompatible silicone material . metallic electrodes and leads may be of plantinum - iridum alloy . the connecting wires are , in one embodiment , insulated with a silicon coating . the implant may be placed between the abdominal muscle and the skin . in the above embodiment , the stimulator is a totally implantable device . in an alternative embodiment , the stimulator may not be implantable . the stimulator in this embodiment may comprise a stimulator device having similar componentry to that discussed above in relation to the embodiment of fig3 , 4 and 5 , but being ranged to be placed externally of the patient . in one embodiment , signals are coupled to electrodes placed within the patient in order to stimulate the contractile tissue . coupling may be by way of inductively coupling the signals across the patient &# 39 ; s skin to an internally positioned electrode arrangement . in another embodiment , part of the stimulator componentry may be placed outside the patient and part inside the patient . in the above embodiments a single stimulation signal generator is used to provide the electrical signal . other embodiments may use two or more signal generators . other embodiments may use two or more stimulators , which may be placed in different locations . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive . in the claims which follow and in the preceding description of the invention , except where the context requires otherwise due to express language or necessary implication , the word “ comprise ” or variations such as “ comprises ” or “ comprising ” is used in an inclusive sense , i . e . to specify the presence of the stated features but not to	0
fig3 shows a digital data sampling circuit 30 according to a first embodiment of the invention . digital data sampling circuit 30 comprises ( n − 1 ) stages flip - flop 32 ( 1st ˜( n − 1 ) th ), logic circuits ( 36 a , 36 b and 36 c ) and sample latch circuits 34 ( 1st ˜ nth ). each stage flip - flop 32 ( 1st ˜( n − 1 ) th ) respectively receives start pulse horizontal signal sth and clock horizontal signal ckh , and transmits and receives output signal ( out 1 , out 2 . . . out ( n − 1 )). each stage sample latch circuit 34 ( 1st ˜ nth ) serially receives digital data data according to each control signal ( sp 1 ˜ spn ). first stage logic circuit 36 a comprises an inverter 38 a and an and logic gate 39 a . inverter 38 a inverts second stage output signal out 2 from second stage flip - flop 32 ( 2nd ) and generates an inverting logic signal . and logic gate 39 a is coupled between inverter 38 a and first stage sample latch circuit 34 ( 1st ). and gate 39 a receives the inverting logic signal from inverter 38 a and first stage output signal out 1 from first stage flip - flop 32 ( 1st ) producing first control signal sp 1 . nth stage logic circuit 36 b comprises an inverter 38 b and an and logic gate 39 b . inverter 38 b inverts ( n − 2 ) th stage output signal out ( n − 2 ) from ( n − 2 ) th stage flip - flop 32 (( n − 2 ) th ) and generates an inverting logic signal . and logic gate 39 b is coupled between inverter 38 b and nth stage sample latch circuit 34 ( nth ). and gate 39 b receives the inverting logic signal from inverter 38 b and ( n − 1 ) th stage output signal out ( n − 1 ) from ( n − 1 ) th stage flip - flop 32 (( n − 1 ) th ) for producing nth control signal spn . according to the embodiment of the invention , each stage logic circuit 36 c may be an and logic gate . using a second stage logic circuit as an example , the second stage and logic gate 36 c is coupled between second stage sample latch circuit 34 ( 2nd ) and second stage flip - flop 32 ( 2nd ), and receives first stage output signal out 1 from first stage flip - flop 32 ( 1st ) and second stage output signal out 2 from second stage flip - flop 32 ( 2nd ) for producing second control signal sp 2 . fig4 shows first stage flip - flop 32 ( 1st ) and second stage flip - flop 32 ( 2nd ) according to the embodiment of the invention . the embodiment uses the d - type flip - flop as each stage flip - flop 32 ( 1st ˜( n − 1 ) th ) and the circuit structure of each two stage d - type flip - flops is similar . first stage flip - flop 32 ( 1st ) receives clock horizontal signal ckh and start pulse horizontal signal sth respectively and transmits first stage output signal out 1 . first stage flip - flop 32 ( 1st ) comprises inverters 43 ˜ 45 . the output of inverter 44 is coupled to the input of inverter 45 . the output of inverter 45 is coupled to the input of inverter 44 . inverter 43 receives and inverts start pulse horizontal signal sth and outputs to the input of inverter 44 . second stage flip - flop 32 ( 2nd ) receives clock horizontal signal ckh and first stage output signal out 1 respectively and transmits second stage output signal out 2 . second stage flip - flop 32 ( 2nd ) comprises inverters 46 ˜ 48 . the output of inverter 47 is coupled to the input of inverter 48 . inverter 46 receives and inverts first stage output signal out 1 and output to the input of inverter 47 . when clock horizontal signal ckh is at high voltage level , first stage d - type flip - flop 32 ( 1st ) transfers the voltage level of start pulse horizontal signal sth to first stage output signal out 1 . when clock horizontal signal ckh is at low voltage level , second stage d - type flip - flop 32 ( 2nd ) transfers the voltage level of first stage output signal out 1 to second stage output signal out 2 . the other stage flip - flop is similar to the above d - type flip - flop . fig5 shows that digital data data and control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) are synchronous according to the embodiment of the invention . using the digital data sampling circuit of the first embodiment of the invention illustrates the relationship of each signal in time domain . when one of control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) is triggered to high voltage level , the corresponding sample latch circuit 34 ( 1st ˜ nth ) receives digital data data . therefore , if it can trigger each control signal ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) in serial , it can serially transmit digital data data to an lcd display . in the first embodiment of the invention , clock horizontal signal ckh transmits to each stage flip - flop 32 ( 1st ˜( n − 1 ) th ) and triggers each stage flip - flop to receive output signal ( out 1 , out 2 . . . out ( n − 1 )) from each prior stage flip - flop . for example , when clock horizontal signal ckh is at high voltage level , first stage flip - flop 32 ( 1st ) receives start pulse horizontal signal sth and transmits first stage output signal out 1 to second stage flip - flop 32 ( 2nd ). when clock horizontal signal ckh is at low voltage level , second stage flip - flop 32 ( 2nd ) receives first stage output signal out 1 and transmits second stage output signal out 2 to third stage flip - flop 32 ( 3rd ). when first stage output signal out 1 is triggered to high voltage level and second stage output signal out 2 is at low voltage level , first inverter 38 a inverts second stage output signal out 2 to high voltage level . the inverting second stage output signal out 2 ( high voltage level ) and the first stage output signal out 1 ( high voltage level ) both input to and logic gate 39 a . thus , first stage control signal sp 1 is also triggered to high voltage level . when second stage output signal out 2 is triggered to high voltage level and first stage output signal out 1 is at high voltage level , simultaneously second stage control signal sp 2 is triggered to high voltage level and first control signal sp 1 switches to low voltage level . when n − 2 stage output signal out ( n − 2 ) is at high voltage level and n − 1 stage output signal out ( n − 1 ) is also triggered to high voltage level , n − 1 stage control signal sp ( n − 1 ) is triggered to high voltage level simultaneously . when n − 2 stage output signal out ( n − 2 ) switches to low voltage level , inverter 38 b inverts n − 2 stage output signal out ( n − 2 ) to high voltage level . inverting n − 2 stage output signal out ( n − 2 ) ( high voltage level ) and n − 1 stage output signal out ( n − 1 ) ( high voltage level ) both input to and logic gate 39 b . thus , n stage control signal spn is triggered to high voltage level and n − 1 stage control signal sp ( n − 1 ) switches to low voltage level . therefore , each control signal ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) is triggered to high voltage level serially . fig6 shows a digital data sampling circuit 60 according to a second embodiment of the invention . the difference between the first embodiment and the second embodiment is the circuit structure of the n stage logic circuit 66 . according to the second embodiment of the invention , an n stage logic circuit 66 comprises an inverter 68 and a nor logic gate 69 . inverter 68 inverts n − 1 stage output signal out ( n − 1 ) from n − 1 stage flip - flop 32 (( n − 1 ) th ) and generates an inverting logic signal . nor logic gate 69 is coupled between inverter 68 and n stage sample latch circuit 34 ( nth ). nor logic gate 69 bases on the receiving inverting signal from inverter 68 and n − 2 stage output signal out ( n − 2 ) from n − 2 stage flip - flop 32 (( n − 2 ) th ) to generate n stage control signal spn . fig7 shows a digital data sampling circuit 70 according to a third embodiment of the invention . the difference between the second embodiment and the third embodiment is the circuit structure of the first stage logic circuit 36 a . according to the third embodiment of the invention , a first stage logic circuit 76 comprises an inverter 78 and a nor logic gate 79 . inverter 78 inverts first stage output signal out 1 from first stage flip - flop 32 ( 1st ) and generates an inverting logic signal . nor logic gate 79 is coupled between inverter 78 and first stage sample latch circuit 34 ( 1st ). nor logic gate 79 bases on the receiving inverting signal from inverter 78 and second stage output signal out 2 from second stage flip - flop 32 ( 2nd ) to generate first stage control signal sp 1 . fig8 shows a digital data sampling circuit 80 according to a fourth embodiment of the invention . the difference between the first embodiment and the fourth embodiment is the circuit structure of the first stage logic circuit 36 a . according to the fourth embodiment of the invention , a first stage logic circuit 76 comprises an inverter 78 and an nor logic gate 79 . inverter 78 inverts first stage output signal out 1 from first stage flip - flop 32 ( 1st ) and generates an inverting logic signal . nor logic gate 79 is coupled between inverter 78 and first stage sample latch circuit 34 ( 1st ). nor logic gate 79 bases on the receiving inverting signal from inverter 78 and second stage output signal out 2 from the second stage flip - flop 32 ( 2nd ) to generate first stage control signal sp 1 . fig9 shows three kinds of logic circuits . a logic circuit 91 comprises an and logic gate 95 and an inverter 94 . a logic circuit 92 comprises an nor logic gate 97 and an inverter 96 . a logic circuit 93 comprises two mos ( metal oxide semiconductor ) transistors 99 and an inverter 98 . because the boolean result of three kinds of logic circuits in fig9 are the same , logic circuits 91 , 92 and 93 in fig9 have the same function and can substitute for logic circuit 36 a . for example , logic circuit 91 is logic circuit 36 a in fig3 and logic circuit 92 is logic circuit 76 in fig7 . fig1 shows three kinds of logic circuits . a logic circuit 101 comprises an and logic gate 105 and an inverter 104 . a logic circuit 102 comprises an nor logic gate 107 and an inverter 106 . a logic circuit 103 comprises two mos ( metal - oxide - semiconductor ) transistors 109 and an inverter 108 . because the boolean result of three kinds of logic circuits in fig1 are the same , logic circuits 101 , 102 and 103 in fig1 have the same function and can substitute for logic circuit 36 b . for example , logic circuit 101 is logic circuit 36 b in fig3 and logic circuit 102 is logic circuit 66 in fig6 . therefore , the digital data sampling circuit 60 in fig6 , the digital data sampling circuit 70 in fig7 and the digital data sampling circuit 80 in fig8 all have the same function which the digital data sampling circuit 30 in fig3 has . fig1 schematically shows another embodiment of a system for displaying images which , in this case , is implemented as a display panel 400 or an electronic device 600 . as shown in fig1 , the display panel 400 comprises a digital data sampling circuit 200 . the display panel 400 can form a portion of a variety of electronic devices ( in this case , electronic device 600 ). generally , the electronic device 600 can comprise the display panel 400 and a power supply 500 . further , the power supply 500 is operatively coupled to the display panel 400 and provides power to the display panel 400 . the electronic device 600 can be a mobile phone , digital camera , pda ( personal data assistant ), notebook computer , desktop computer , television , or portable dvd player , for example . according to the embodiment of the invention , digital data sampling circuit ( 30 , 60 , 70 and 80 ) can in advance generate control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ). for example , according to the embodiment of the invention , control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) of digital data sampling circuit 30 in fig5 are half clock period earlier than control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) in fig2 . therefore , it can use less delay buffers to achieve the same goal that digital data data and control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) synchronize and consume less power , less layout area and cost less in circuit design . while the invention has been described by way of example and in terms of preferred embodiment , it is to be understood that the invention is not limited thereto . to the contrary , it is intended to cover various modifications and similar arrangements ( as would be apparent to those skilled in the art ). therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements .	6
referring now to the drawings and , first , particularly to fig1 thereof , there is diagrammatically and schematically shown therein a feeder of an otherwise non - illustrated sheet - processing machine in the form of a printing press . sheets 5 are taken from a sheet pile 6 by a non - illustrated conventional suction head , and transported to a conveyor table 1 . sheet transport in the region of the conveyor table 1 is either in single sheets or in shingled sheet streams . when a sheet 5 arrives at the conveyor table 1 , a cycled or timed feeder roller 7 sets down on the sheet and pushes it in a direction towards a conveyor belt 2 . in particular , the timed feeder roller 7 also serves to hold the leading edge of the sheet on the sheet conveyor table 1 until a suction box 4 , which is disposed below the conveying plane , assumes this task . by means of the conveyor belt 2 , which is guided over deflection rollers 3 , the sheet 5 is transported to front stops 8 of the conveyor table 1 . the sheet briefly comes to rest at these front stops 8 , and can then be transferred in - register to the printing press , which is represented by only one cylinder 9 thereof . a motor 10 is assigned to one of the deflection rollers 3 . according to the invention , this motor 10 is triggered via a velocity profile especially formed and optimally adapted to existing conditions in accordance with the printing - press operating cycle . this velocity profile is made available to the motor 10 with the inclusion of the signals of an angle encoder 12 by a computing and control device 11 . to the computing and control device 11 , there is also assigned a memory device 13 , in which the velocity profiles are stored both as a function of the angular position , as well as of the respective printing velocity . fig2 shows different velocity profiles 15 and 20 with which the motor 10 is triggered to drive the conveyor belt 2 . in particular , this fig2 shows velocity profiles for both maximum velocities v max1 and v max2 over the course of one machine revolution . both velocity profiles start at the same minimum velocity . this type of configuration offers the advantage that the setting of the feeder for all printing velocities is made uniform and thereby simplified . choosing the &# 34 ; maximum printing velocity &# 34 ; variable as a parameter in the velocity profiles affords the advantage that the separate drive for the conveyor table 1 can be adapted optimally to the maximum operating velocity of the sheet - processing printing press . the velocity profiles shown in fig2 have a characteristic shape : in the vicinity of the front lays 8 of the illustrated embodiment of fig1 i . e ., the region around 0 ° or 360 ° in fig2 the curves show a constant value , a so - called plateau . the curves also have a plateau in the region of the maximum velocity . this formation has a positive effect upon the synchronism of the feeder because , within certain given angular ranges , constant velocities of the conveyor belt are expected . in a region around the 180 ° angular position of the printing press , the drive of the conveyor belt 2 exhibits a further minimum which , however , does not reach the minimum velocity of the conveyor belt 2 . that minimum occurs in a region in which the feed roller 7 is set onto the sheet 5 and the sheet stream , respectively . the reduction in the velocity of the conveyor belt 2 in this region is selected precisely so that negative effects of the timed feed roller 7 on sheet advancement will be virtually entirely compensated for . without major problems , the device according to the invention is also suitable for compensating for errors in adjustment of the velocity of the conveyor belts 2 , by means of suitably modified velocity profiles in the drive of the conveyor belt 2 . for that purpose , the pressman is given the opportunity , via a device 14 , of making a corrective change in the particular velocity profile being used . in an advantageous further feature of the device according to the invention , as shown in another embodiment thereof in fig3 sensors 16 are provided for detecting so - called &# 34 ; out - of - square or misaligned , late or early sheets &# 34 ;. the sensors 16 are disposed in the front region of the conveyor table 1 , in the vicinity of the front stops 8 , and are connected to the computing and control device 11 by suitable conducting elements ( electric lines or leads ). fig4 represents a further development of velocity profiles in the field of industrial process technology , which simultaneously takes into account both early and late sheets . the mean velocity v of the conveyor belt 2 is so modulated in velocity profile 17 during one revolution ( 360 °) of the sheet - processing machine that only one velocity minimum 18 is present . this velocity minimum is advantageously shifted into the region of sheet arrival at the front stop 8 of the sheet - processing machine and is kept constant over an angular range 22 , which corresponds to the inaccuracy of sheet arrival . consequently , within the limits of permissible sheet arrival inaccuracy , all the sheets have the same low sheet arrival velocity and , as a result thereof , an exact alignment of the sheet 5 can be assured prior to the transfer of the sheet to the sheet - processing machine . a velocity maximum 19 is preferably located in a region in which there are no feeder events critical to the paper path , preferably approximately 180 ° away from the velocity minimum 18 , so that the necessary accelerations can still be maintained . referring to fig3 by defining the overlap length s of the successively transported sheets 5 as an integral divisor n of the conveying table length l , so that n × s = l ( where n = 1 , 2 , 3 , . . . ), the preferred conveying state is obtained , wherein a sheet 5 to be fed to the front stops 8 is slowed down precisely in the region minimum velocity represented in the characteristic curve 17 when a trailing sheet 5 , which is offset in accordance with the number of overlaps s on the conveyor table 1 , is transported by means of the feed roller 7 onto the conveyor table 1 . accordingly , during the operation of the sheet - processing printing press , both the overlap or stagger length s and , with reference thereto , the course of the velocity profile 17 can be varied . a further modification , i . e ., shift , in the velocity profile 17 takes place within the context of sheet arrival regulation or control : upon a detection of early and late sheets , respectively , by the sensors 16 , the velocity profile 17 , i . e ., the characteristic curve of the mean velocity course of the conveyor belt 2 , is lowered and raised , respectively , by means of the computer and control device 11 , by a value corresponding to the amount of failed arrival of the sheet 5 . if an early sheet is detected , a &# 34 ; negative offset &# 34 ; results , which is a parallel shift of the velocity profile 17 downwardly . if a late sheet is detected , a &# 34 ; positive offset &# 34 ; results , which is a parallel shift of the velocity profile 17 upwardly . the raising and lowering of the velocity profile as a function of the sheet arrival measured by the sensors 6 leads to an overlap or stagger length which varies continuously during operation of the sheet - processing machine . accordingly , the location of the velocity minimum 18 relative to the sheet arrival at the front stops 8 and relative to the paper transfer to the conveyor table 1 by the feed roller 7 is advantageously not shifted , and constant transfer conditions are thereby achieved . in an advantageous further development of the method according to the invention , it is proposed that the velocity profiles are so formed as to be a function of the material to be imprinted . fig5 shows not only the contemplated velocity profile 17 , which in essence corresponds to a velocity course for cardboard or pasteboard , but also a further velocity profile 21 , which by way of example is employed with thin paper , such as onionskin paper . onionskin paper , because of its very low inertia , has a favorable or , in other words , reduced tendency to slip relative to the conveyor belt 2 , so that with onionskin paper , greater accelerations of the conveyor belt 2 can be performed and , accordingly , lower velocity minimums can be achieved , which in turn lead to reduced paper deformations at the moment the sheet arrives at the front stops 8 . conversion from one velocity profile 17 to another , for example to the velocity profile 21 , is effected by means of the input device 14 . naturally , measuring instruments for measuring the sheet thickness , and so forth , may also be provided , which transmit the measurement values directly to the computer and control device 11 , so that an automatic conversion is also possible . in this regard , ( standard ) velocity profiles stored in the memory device are called up by the control or regulating device as a function of the material being imprinted in order to regulate the motor 10 . the velocity profiles , adapted individually to the quality , thickness and size of material being printed on , differ in number and location from freely selectable velocity specifications for freely selectable angular positions . thus , even the acceleration conditions can be varied in the individual velocity profile segments . a given final predetermined value , respectively , for the angle and appertaining velocity within a velocity profile , preferably the maximum 19 , is selected so that the desired overlap or stagger length s is established , or in other words the area below the velocity profile 19 becomes as large as the area below the mean velocity value . depending upon the quality , thickness , size , and so forth , of the material being printed on , individually desirable velocity profiles 17 , 21 can be transmitted to the computer and control or regulating device 11 by means of the input device 14 . the slopes , zero points and turning points for the desired velocity profile 17 , 21 can be selected freely . in controlling or regulating the velocity of the conveyor belt 2 , the computer and control or regulating device 11 provided for controlling the electric motor 10 receives a signal which is a function of the velocity of the sheet - processing machine . a signal stored in the memory device 13 , with one minimum 18 and one maximum 19 per machine cycle , is superimposed on the aforementioned signal . in addition , as a consequence of the measured sheet arrival , a signal is generated and fed to the computer and control or regulating device 11 , and the overall result thereof is a raising or lowering , respectively , of the conveyor belt velocity . a suitable input device 14 and memory device 13 are provided in a personal computer such as that of the digital equipment corporation . the computer / control device 11 may be a microcomputer such as that known as type t805 - 6255 of the firm inmos or may also be a personal computer such as that of the aforementioned digital equipment corporation .	1
the door assembly illustrated in fig1 , generally referred to as 10 , includes : a frame assembly 20 , a prime door 40 , and a screen door 60 . frame assembly 20 has a u - shaped main frame member 21 with an open lower end 211 , which is closed by an extruded aluminum threshold 23 , attached to the main frame member by screws ( not shown ) that extend through the frame member into semicircular screw bosses 233 shown in fig2 . threshold 23 rests on the body of the vehicle v in which the door assembly is installed . as shown in fig2 and 3 , the main frame member is fastened to the vehicle by screws ( not shown ) extending through a mounting flange 213 and a layer of butyl tape 33 , which seals any gaps between the main frame member and the side of the vehicle . a screw cover 31 , which snaps into mounting flange 213 , covers these screws . a laterally extending flange 29 on the main frame , and a trim ring 39 , attached to the inner wall of the vehicle , close any gaps between the inside wall and the frame . a sill filler strip 27 , attached to the vehicle by screws ( not shown ) extending through the filler strip and through a layer of butyl tape 33 , closes any gap between the lower edge of the threshold and the vehicle . the doors are attached to the frame by three hinge assemblies 80 , shown in fig3 , 4 , and 6 - 10 . each hinge assembly consists of a fixed leaf 81 bolted to the main frame 21 , a prime leaf 83 which supports the prime door 40 , a screen leaf 85 which supports the screen door 60 , and associated hardware described below . fig3 provides a horizontal cross - sectional view of a hinge , with the doors in the closed position . the enlarged fragmentary cross - sectional view in fig4 shows the frame 21 and screen door 60 rotated clockwise 90 ° and 45 °, respectively , for ease of understanding . the prime door 40 has a core 41 of an expanded material such as polystyrene , a smooth skin 43 of a material such as fiberglass or aluminum on the outside of the core , and a similar smooth skin 45 on the inside of the core . a generally u - shaped steel stile 47 protects the edges of the foam core , and provides substantial strength and rigidity . the inner and outer skins 43 , 45 , are laminated to the core 41 and to the stile 47 . as also shown in fig2 - 4 , an extruded aluminum door surround 49 encloses and reinforces the outer and inner door skins 43 , 45 and the stile 47 . surround 49 has a seal flange 491 which , in connection with hinge assemblies 80 , supports a substantially continuous weather seal assembly 55 , as explained below . an unbroken u shaped weather seal member 555 , mounted in cruciform - shaped kerfs 493 in the door surround seal flange 491 , and in kerfs 835 in the prime hinge leafs 83 , as shown in fig8 a , 8 b and 10 , provides an unbroken u - shaped weather seal around the sides and top of the prime door 40 . weather seal member 555 , in conjunction with a lower seal member 553 mounted in the door surround seal flange 491 at the bottom of the prime door , forms a substantially continuous unbroken weather seal 55 around the prime door . the kerf 835 in the prim hinge leaf 83 supports weather seal member 555 , as shown in fig7 and 8b , across the notch 816 ( in the fixed hinge leaf 81 ) or the prime hinge leaf . the kerf 493 in surround seal flange 491 supports the weather seal 555 around the rest of the main frame , as shown in fig8 a and 10 , and supports the weather seal assembly 553 across the bottom of the door . kerfs 493 and 835 are aligned . thus , they provide continuous support for the unbroken weather member 555 , and eliminate any requirement for short seal pieces in the hinge area . as shown in fig5 , weather seal members 555 and 553 have two parts : a relatively rigid spine 551 which is inserted into kerfs 493 and 835 , and a more flexible serpentine member 557 . the spine is preferably made of a relatively rigid material such as polypropylene , and the serpentine member is preferably made of a more flexible material such as santoprene ® shore 65a flexible , which are made by monsanto . these materials can be co - extruded to make a single integrated strip . a noise reduction seal 57 may optionally be used with weather seal member 555 . as shown in fig5 and 10 , noise reduction seal 57 is l - shaped . the shorter leg fits into the outer curve of the seal member 555 . adhesive secures the other leg to the outside of the door surround seal flange 491 . when used , the noise reduction seal preferably extends from the threshold to the top of the straight portion of the hinge side of the prime door . the noise reduction seal may be an extruded foam . when the prime door is closed , weather seal 55 presses against a substantially continuous and coplanar sealing surface formed by main frame member 21 , threshold 23 , and the hinge assemblies 80 . as best seen in fig6 and 10 , the main frame member 21 has an outwardly extending rib 35 with an outwardly facing surface 215 which is one of the main parts of this continuous sealing surface . the threshold 23 has a similar outwardly facing surface 235 . as may be seen in fig2 , surfaces 215 and 235 are substantially coplanar , and are substantially parallel to the outer and inner skins 43 , 45 of the door when the door is closed . as also best seen in fig6 , the rib 35 on the main fame has notches 37 for the hinge assemblies 80 . similarly , the fixed leaf 81 of each hinge assembly has notches 813 for the screen door leaf . the outwardly facing , unnotched sections 215 of the main same seal rib 217 , the outwardly facing , unnotched sections of the fixed hinge leaves and the outwardly facing sections 853 in the screen hinge leaves 85 are substantially coplanar and provide a continuous outwardly facing sealing surface across the hinges . thus , an unbroken seal can be provided across the hinges with a single unbroken weather sealing member 555 , which contributes significantly to performance , dependability and manufacturing economy . referring to fig6 and 10 , there are two small ribs 821 on the back side of the rearwardly extending or laterally facing step 823 in the fixed hinge leaf 81 . they minimize the risk that flash or scrap from the cutting of the notches 813 in the fixed hinge leaf will keep the hinge assemblies from being positioned properly in the main frame notches 219 . the main frame member , hinge assemblies and prime door are also designed for ease of assembly and structural integrity . as best seen in fig4 , the main frame assembly has a groove 221 20 with an inwardly sloping or dove - tailed side 223 . the fixed hinge leaf and screen hinge leaf have ribs ( 815 and 855 respectively ) with complimentary front edges 817 , 857 that fit into and interlock with the sloping side 223 of groove 221 . this facilitates alignment of the hinge assembly during assembly , and provides additional strength . in addition to providing a continuous mount for weather seal member 555 , as described above , prime hinge leaf 83 and door surround 49 contribute to ease of assembly , structural integrity , and effective sealing . as may be seen in fig8 a and 8b , a rib on the door surround seal flange 491 extends into a mating groove 837 on the prime hinge leaf 83 . this ensures perfect alignment of the kerf 493 in the surround and the kerf 835 in the prime hinge leaf , and also contributes to structural rigidity . the prime hinge leaf also has a rib 839 , on the opposite side of the leaf from groove 837 . as seen in fig1 , this closes the gap created by the notch 815 for the prime hinge knuckle 831 when the prime door is closed . the weather seal provided by seal assembly 55 is supplemented by a screen door seal assembly 61 , shown in fig2 , consisting of a u - shaped strip 611 of pile , preferably polypropylene , mounted in a screen door seal flange 221 at the inner end of mainframe member , and a similar strip 613 , mounted in the bottom of the screen door . as best seen in fig6 , the filler plug 24 has a rib 241 which fits into the groove 222 in the main frame member , and 2 prongs 243 which are inserted into spaces in the outer ( and lowest ) section of threshold 23 . as best seen in fig7 , the fixed hinge leaf has three knuckles 811 for a hinge pin 91 . these knuckles are separated by two notches : a smaller notch 814 for the prime hinge leaf 83 and a larger notch 815 for the screen hinge leaf 85 . the prime hinge leaf and screen hinge leaf have similar knuckles ( 831 and 851 respectively ), partially cut away to accommodate acetal plastic hinge bushings 87 , which are inserted into the top of the bores 825 in the fixed hinge leaf knuckles 811 and the bottom of the bores 845 , 856 in the prime hinge leaf knuckle 831 and screen hinge leaf bushing 851 . hinge pin 91 extends through the bushings , through plugs 89 in each knuckle , one of which is illustrated in the cut - away portion of the screen leaf bushing in fig7 , and through a washer 93 beneath the lowest fixed hinged bushing . the lower end 91 of the hinge pin is swedged to provide a secure assembly . with the positive location afforded by the notches in the weather seal rib 217 , the hinge assemblies lend themselves to removal of an entire door and / or replacement of an individual hinge , if damaged through negligence . the bushings in hinge knuckles 811 , 831 and 851 may be designed to hold one or both doors in a certain open position . fig9 a and 9b illustrate two types of bushings 86 , 88 . the bodies 861 , 881 of both bushings , i . e . the smaller parts of the bushings that are inserted into the bores in the hinge knuckle , have a number of relatively narrow , “ v ” shaped ribs 871 , 891 designed to fit into complimentary v shaped grooves in the bores of the hinge knuckles 811 , 831 and 851 , best seen in fig1 , and one or more wider ribs designed to fit into wider grooves 823 in the bores of the knuckles . as best seen in fig1 , the illustrated bores and bushings have two wider grooves or ribs , on opposite sides of the bore or bushing . thus , the illustrated bushings can be inserted into the illustrated bushings in two positions , 180 ° apart . bushing 86 has a head 875 with a flat contact surface 876 that does not influence the position of either door , but indexing bushing 88 is designed to hold either door in place when it is opened 90 °. the head 885 of the indexing bushing 88 has two steps 886 on opposite sides of head 875 , and two indentation is 887 separating the steps . inclined surfaces 888 connect the steps and indentations . each of the steps and indentations surfaces spans an arc of approximately 30 ° with these indexing bushings , the steps 886 of the bushings in the prime hinge knuckle 831 and the screen hinge knuckle 851 rest on the steps 886 of bushings in fixed hinge knuckles 811 when the doors are closed . however , when a door is opened 90 °, the steps of the bushings in the pivoting leaves will rest in the indentations of bushings in fixed hinge knuckles 811 , and the door will remain in this position until it is closed , manually , or opened further . the doors described above are considerably thicker than conventional doors . this provides extra stiffness and allows the doors to be manufactured as a flat assembly , unlike conventional doors that bowed to provide compression against seals to provide additional compression against seals and reduce door vibration and “ flutter ” in motion . the ability of the doors to seal as a flat rather than a concave assembly reduces closing force and adds to the perceived quality of the door during operation . as those skilled in the art will recognize , the structures described above , shown in the accompanying drawings and defined by the following claims offer substantial advantages over door assemblies previously available for recreational vehicles , including a substantially continuous sealing surface around the entire periphery of the main door frame , which in turn makes it feasible to use a substantially continuous weather seal around substantially the entire periphery of the door , including the area where the hinges are mounted . the substantially continuous sealing surface is formed , in part , with an interfitting frame and hinges . the hinges are also mechanically locked into the frame , which increases structural integrity and eases assembly . knuckles of the pivoting leaves of the hinges are spaced from the fixed leaf knuckles by bushings , and further separated from the hinge pin by plugs . the bushings and plugs eliminate metal - to metal wear . the bushings may also serve as indexing function , holding the doors in position when open . of course , those skilled in the art will readily appreciate that many modifications may be made in the structure disclosed above . the foregoing description is merely illustrative , and is not meant to limit the scope of this invention , which is defined by the following claims .	8
the present invention adapts electrical - based metrology of near surface doping ( nsd ) using surface photovoltage ( spv ) to meet the requirements of the semiconductor industry in terms of sensitivity and reproducibility of implant dose and energy measurements . the method in the present invention consists of the following principal steps : 1 : forming a dielectric layer ( preferably a layer of thermally grown oxide ) on the semiconductor surface followed by the determination of the nsd using spv . the latter makes use of the non - equilibrium depletion transient condition created by charging the semiconductor surface with charge density , q ( c · cm − 2 ). the relationship between q and said depletion layer is shown in equation 1 : where w is the depletion width , q s , is the induced charge density and na is the acceptor density . when a known amount of charge , of density q , is injected into a semiconductor surface , a portion of the induced charge may be imaged into the semiconductor space charge region , while the rest will be imaged into the interface traps between the layer of native oxide and the semiconductor surface . as native oxide is known to be very leaky , the decay of resulting surface barrier ( v sb ) is expected to behave as shown in fig1 . in order to confine the induced charge density , q s , within the semiconductor depletion layer , a layer of a good quality dielectric ( preferably thermal oxide ) is formed on the semiconductor surface prior to implantation . alternatively , this dielectric layer can be grown after implantation as part of the activation process . normally , rapid thermal annealing ( rta ) is used as the activation process after implantation . however , in order to grow this dielectric layer after implantation , rta can be replaced by rapid thermal oxidation . having the surface of the semiconductor capped with thermal oxide helps to minimize the density of surface traps and charge leakage . 2 : tailoring the implant profile so that implanted peak concentration is at or close to the dielectric - semiconductor interface . the effective depth of nsd measurements relates to the semiconductor depletion layer . eqn . ( 2 ) shows the relationship between the depletion width , w , the surface barrier , v sb , and the doping , n a : w =[ ( 2 ∈ 0 ∈/ q · n a )·( v sb − kt / q )] ½ eqn . ( 2 ) where ∈ 0 is the permitivity of free space , ∈ is the si dielectric constant , q is the elementary charge , and kt is the thermal energy . depletion width , w , is dependent on the junction voltage , thus a change in bias will bring about readjustment of w to a new appropriate value . the various examples shown in fig2 are plots of resistivity as a function of distance from the oxide - semiconductor interface . as shown there , when the bias changes between q + δq and q − δq , the depletion width varies by w ± δw . the doping concentration in the depletion region , which corresponds to the area under the curve there , will also therefore vary . under conditions of non - uniform doping , measurements done where the implant profile slopes significantly are highly susceptible to the introduction of variations in w ( fig2 a examples ) as compared with measurements done at the peak of the implant profile ( see fig2 b examples ). if the depletion width remains unchanged for every measurement , as shown in fig3 a and 3 b , changes in dose can still be accurately resolved . however , a surface concentration that changes as the depletion width changes ( going from 3 a to 3 c ) will result in large errors because of the varying nature of the implant profile slope . however , if the concentration within the original and expanded depletion regions is relatively flat ( going from 3 b to 3 d ) the possibility for error is greatly reduced . thus , it is necessary to adjust the implant profile so that its peak comes closer to the semiconductor - dielectric interface . there is more than one way to tailor the implant profile . by varying the thermal oxide thickness and freezing the implant energy or by varying the implant energy based on a fixed thermal oxide thickness . to confirm the effectiveness of the invention , the second way was selected . a layer of thermal oxide having a thickness of 10 nm was formed on the semiconductor wafers . these oxidized wafers are implanted with boron at different implant energies ranging from 16 kev to 20 kev so as to determine the optimum implant energy . the nsd of the wafers were then measured for different surface barrier voltages ( v sb ) using spv techniques on our equipment ( sdi faast230 ). as seen in fig4 , doping at an implant energy of 18 kev provided the flattest curve , implying that , at this implant energy , the concentration is least dependent on v sb . 3 : determining the surface barrier , v sb , measurement range such that surface concentration is independent of v sb for a given implant dose : from the experimental result obtained in step 2 , it is possible to determine a range of surface barrier voltage over which the nsd remains relatively constant for small changes in the surface barrier voltage . in this invention , nsd remains almost constant for v sb ranging from 0 . 29 v to 0 . 36 v at 18 kev . this constant v sb range is different for different implant energies , as shown in fig4 . 4 : selecting v sb for starting measurement and determine the total amount of charge density needed to bias surface into the space - charge region . as the initial surface condition of a si / sio 2 is arbitrary , v sb on the oxidized semiconductor surface has to be adjusted so as to ensure that it is biased into depletion at the start of the optimum range . this adjustment is done by introduction of charges to bias the semiconductor surface . in order to determine the total amount of charge density needed to bias the surface into space - charge measurement , repetitive charging and contact potential difference measurements were performed . fig5 shows the results of the measurements with interface traps both present and absent . when there is no interface trap , as shown in fig5 ( a ), total amount of charge needed to bias the semiconductor surface is q c at v sb = 0 . 29 . however , in the presence of interface trap 51 , as shown in fig5 ( b ), a plateau occurs at v sb = 0 . 29 . selecting the correct v sb is important if interface traps are to be avoided . in the case of fig5 ( b ), when v sb = 0 . 20 the total amount of charge required is q c1 but when v sb = 0 . 35 the total amount of charge required is q c2 which can then be selected . 5 : compensating for variations in the initial wafer surface condition by controlling the charging dose and sequence . after the total amount of charge density needed to bias surface into space - charge measurement for a predefined v sb has been determined , the next step is to define the charge density for each successive pulse of charging . this is done by dividing the total charge density by half the allowed charging sequence provided by the equipment . as illustrated in fig6 , a single pulse of large charge ( e . g . 1 . 3e12 c / cm 2 ) can bring about large variations in the surface barrier for the starting measurement due to the initial surface variations . so , instead of applying a single charging pulse to bias the surface barrier into depletion , the charging dose is reduced to ( e . g . 2 . 2e11c / cm 2 ). each small pulse is then successively applied until the predefined v sb ( e . g . 0 . 20v ) is reached . using this technique , the number of pulse required to bias v sb to 0 . 20v can be varied to ensure that every measurement starts at almost the same surface barrier setting for all wafers , despite wide initial surface variations . 6 : obtaining spv signals to determine the near surface doping concentration . the spv measurement to determine the nsd value is performed . for the present invention this measurement was performed using metrology tool , sdi faast230 . as the noise of a spv signal can also contribute to the reproducibility problem for such a measurement , the filter of the doping diode in the measuring tool was replaced to enhance the signal - to - noise performance . such filter replacement may not be necessary for other spv measurement tools . implementing the methodology of the present invention , as detailed in the above steps , has resulted in a tremendous improvement for electrical - based measurement of ion implant dose in terms of reproducibility and sensitivity , as shown below in fig7 and 8 respectively . highly reproducible measurements of dopant concentration , especially for low dose implants . highly sensitive measurements of dopant concentration , especially for low dose implant ; can serve as a powerful resource for process improvement , monitoring , and control of the implant process . can give early warning of potential problems if incorporated in spc control .	6
the preferred embodiments of the present invention will now be explained with reference to the accompanying drawings . it should be understood however that the disclosed embodiments are merely exemplary of the invention , which may be embodied in various forms . the following description and drawings are not to be construed as limiting the invention and numerous specific details are described to provide a thorough understanding of the present invention , as the basis for the claims and as a basis for teaching one skilled in the art how to make and / or use the invention . however in certain instances , well - known or conventional details are not described in order not to unnecessarily obscure the present invention in detail . in one embodiment , the present invention provides a method for tracking the mobile equipment ( me ) by initiating the me to detect possible misuse ( i . e ., when the phone is stolen and subscriber identity module / user services identity module ( sim / usim ) replaced , or if the device is not a phone , when the device accesses a network ), and reporting the misuse to the actual mobile device owner , without the network initiating any queries . fig2 illustrates a block diagram of a mobile electronic device according to the present invention used within a telecommunications network . in fig2 , the mobile electronic device includes a tracking control module 100 , which described below with respect to fig3 . in operation , whenever the sim / usim card is changed or powered up with a different sim / usim card , the mobile device automatically send an alert - sms / mms / email to a preset destination . the mobile device also initiates the camera application , stealthily , ( e . g ., without showing a preview screen on the device display and then captures a few pictures or records a short video clip which is configurable , depending on available memory . these pictures or video clips will then be sent to a preset destination stored in the device by the original user using a multimedia message service ( mms ) or email . furthermore , the mobile device provides the user with a menu option having password protection or a tracking control key ( tck ). in this case , the menu option choices allow the user to turn on / off password protection feature , to edit the destination email - address / phone number , or to edit the user - defined part of the message content for sending the alert sms / mms / email . when the user tries to activate the tracking feature , the user is prompted for the tracking control key . to access / change the alert - message destination and the customizable contents , the user has to input the tracking control key . if the user wishes to access / change a password , a destination email - id / phone number , or a customized message content for sending the sms / mms / email message , the configured password has to be input by the user . in the sms / mms / email message , the location information and mobile station integrated services digital network / international mobile subscriber identity ( msisdn / imsi ) of the current user is included in addition to customized message . the user - authentication information stored in the nvram is the imsi of the current sim / usim card for a mobile phone supporting the sim / usim card . if there is no sim / usim card , the user is prompted to insert the sim / usim card . if the initial attempt to send an sms / email fails , the mobile device keeps trying periodically or with increased delay after each attempt , until successful , where the number of permitted attempts is preset in the mobile device . if the sim / usim card of the new user has ‘ outgoing calls barred ’ option already set , when the card is inserted the mobile device sends an alert sms / mms / email when call barring is removed . fig3 illustrates a block diagram of the tracking control module of the mobile electronic device according to the present invention . in fig3 , there is shown a tracking control module , including a tck authentication module 110 , a customization module 120 , a subscriber identity module / universal subscriber identity module ( sim / usim ) info access module 130 , a location information access module 140 , a call barring status check module 150 , an info display module 160 , a network - access check module 170 , and a camera module 180 . the tck authentication module 110 handles activation / deactivation of tracking control and for accessing the customization of the information to be sent in the message . the customization module 120 maintains the message format and content information . the sim / usim information access module 130 receives the required information ( e . g ., the imsi , the call barring status , etc .) from the sim / usim and detects a change of sim / usim card . the location info access module 140 receives the information concerning the current location information of the device , if the user has opted for it to be sent in an alert message . the call barring status check module 150 , if an outgoing call is barred , periodically checks if the status has changed and sends the alert message . the network access check module 170 detects if a mobile device does not use a sim card and thus triggers the alert sms / mms when the mobile device is connected to a network . the camera module 180 stealthily takes pictures or video clips whenever a new sim / usim card is detected . these pictures and video are included as part of the mms or email which is sent to a pre - defined destination as determined by the mobile device user . in another embodiment , the tracking control module 100 includes an instant messaging module , which has instant messaging applications . fig4 illustrates a process of activating the tracking control feature of the tracking control module of the mobile device according to the present invention . when the user tries to activate the feature , the user is prompted for a password ( i . e ., the tracking control key ( tck )). thereafter , the user is prompted for the alert - message destination and optionally the customizable contents of the alert message . the tracking control module is then activated . if the user then chooses to access / change any of these features , the tck has to be input by the user . in the alert - sms / mms / email - message , the location information , mobile station integrated services digital network / international mobile subscriber identity ( msisdn / imsi ), etc . of the current mobile device user can be included , in addition to any user - defined text information . the mobile device then initiates the camera application ( without activating the display preview setting on the display module ), and through the camera module takes a few pictures or records a short video clip of the immediate surroundings . advantageously , with a non - activated display preview , the non - authorized users of the mobile device will be unaware that their actions are being recorded . furthermore , these recordings may be stored in memory unit of the mobile device . also , these recorded pictures or video clips will then be sent to a preset destination stored in the mobile device by the original owner using the mms feature . these picture and video recordings can also be sent if the sim is supporting general packet radio service ( gprs ) or third generation ( 3g ) services , even by email . in addition , with the user - authentication information which accesses the sms / mms / email message , the destination email address / phone number , or any other pre - defined text to be sent will be stored in non - volatile random access memory ( nvram ) of the mobile device . in the present invention , when the tracking control feature is activated as for a mobile device supporting a sim / usim card , the imsi of the current sim / usim card is stored in the nvram , or if there is no sim / usim card , the user is prompted to insert sim / usim card . once the tracking control feature is successfully activated as above , whenever a new sim card is inserted , the device will compare the imsi stored in the nvram with the new imsi and if there is a mismatch , will send an sms / mms / email to the destination that was specified by the owner . the current location information of the mobile device ( based on the location identity ) as obtained from the radio access technology ( e . g ., global system for mobile communications / universal mobile telecommunications system / code division multiple access ( gsm / umts / cdma )), will also be included in the message . if the initial attempt to send the sms / mms / email message fails , the device keeps trying periodically until successful . here , the number of times the mobile device tries to send the sms / mms / email message can be configured by the user through the mobile device . however , if the sim / usim card of the new user has an ‘ outgoing calls barred ’ option already set , when the sim / usim is inserted , the device can be programmed to remember that the sim / usim card was changed and can , subsequently , send the sms / mms message later when the call barring function is removed . fig5 illustrates a sequence of events between various functions when the tracking feature of the mobile device is activated according to the present invention . when the device is powered on in step 501 the sim / usim information access module 130 is initialized and receives the required information from the sim / usim , like , for example , imsi data and call , barring status etc , and detects the change of sim / usim card . if the tracking feature is enabled , the current imsi value is retrieved from the sim and compared with the nvram information in step 505 wherein the user - authentication information for accessing the sms / mms / email message feature , the destination email address / phone number , and any predefined text to be sent are stored . if the imsi from the sim is the same as that stored in the nvram , the sim / usim information access module 130 takes no action in step 507 . otherwise , the imsi mismatch flag is set in step 509 . if the mismatch flag is set , the system then checks whether the registration has been successful or not in step 515 . if it is not successful the system waits until the registration status changes in step 521 . if the registration is successful the system checks whether the outgoing calls are barred . if the outgoing call is barred then the system waits until the call barring status changes . on change of call barring status , the system checks whether the tracking feature is enabled and the imsi mismatch flag is set . moreover , if the user wanted to include location information , the location information access module 140 is activated to obtain location information . the camera module 180 is initiated without showing the preview display setting on the display , and takes on or more pictures or a video snapshot of the immediate surroundings . a sms / mms / email message is then sent to a configured destination from the tracking control module 100 with all the relevant data in step 517 . if the user has specified both a phone number and an email id , then the sms , mms and email are sent . moreover , the sms / mms / email are sent multiple times to increase reliability in step 519 . thereafter , the system then checks whether the secret sms / mms / e - mail has been send successfully in step 523 . if transmission of the sms / mms / email is successful , the process ends , or the mobile device may continue sending the sms / mms / email with an increased delay between each attempt to increase transmission reliability and to ensure that the mobile device owner receives any other related details in step 525 . however , if the message was not sent successfully , a staggered periodic timer is initialized . upon expiration of the timer , the system tries to send an alert sms / mms / e - mail to the configured destination from tracking control module 100 with all the relevant data . if transmission is not successful , the system increases the timer duration in step 527 and restarts the timer and repeats the process . it will also be obvious to those skilled in the art that other control methods and apparatuses can be derived from the combinations of the various methods and apparatuses of the present invention as taught by the description and the accompanying drawings and these shall also be considered within the scope of the present invention . further , description of such combinations and variations is therefore omitted above . it should also be noted that the host for storing the applications include but not limited to a microchip , microprocessor , handheld communication device , computer , rendering device or a multi function device . although the present invention has been fully described in connection with the preferred embodiments thereof with reference to the accompanying drawings , it is to be noted that various changes and modifications are possible and are apparent to those skilled in the art . such changes and modifications are to be understood to be within the scope of the present invention as defined by the appended claims .	7
the compounds of formula iv wherein hal is iodo are novel compounds . they may be prepared from the known compound 2 - amino - 4 , 5 - difluoro benzoic acid by reaction with sodium nitrite in a solution of dilute sulfuric acid at a temperature of about - 10 ° to 0 ° c . and ambient pressure . the formed diazonium compound is then treated with a solution of potassium iodide in dilute sulfuric acid at a temperature between about - 10 ° to 0 ° c ., and the resulting dark slurry stirred for about 12 to 24 hours on slow warming to ambient temperature . the preparation of anthranilic acid compounds of the formula iii from compounds of the formula iv proceeds in the presence of catalytic amounts of copper ( 0 ) or a copper compound such as cupric oxide or cuprous oxide , or a copper salt such as cupric acetate , cupric sulfate , cupric chloride , cupric bromide , cupric triflate , cuprous chloride , cuprous bromide , and cuprous triflate . the copper catalyst is generally present in amounts of at least about 5 mole %, and generally about 10 to 20 mole %. the reaction is in the presence of an inert , dipolar , aprotic solvent such as dimethylformamide , tetrahydrofurane , dimethoxyethane , n - methyl - pyrrolidinone , dimethyl acetamide or dimethyl sulfoxide , and in the presence of an organic base such as pyridine or dimethylaminopyridine in the optional presence of a tertiary amine base such as triethyl amine or diisopropylethyl amine . the organic base is generally present in amounts of 1 to 2 mole equivalents , usually 1 . 5 mole equivalent . the reaction temperature depends on whether hal in formula iv is iodo , bromo or chloro . when hal is iodo , the reaction may be conducted at about 10 ° to 40 ° c ., and advantageously at ambient temperature such as about 20 ° to 25 ° c . when hal is bromo , the reaction temperature is from about 20 ° to 50 ° c . when hal is chloro , the reaction temperature is about 50 ° to about 100 ° c ., generally about 70 ° c ., and the reaction is conducted in a sealed vessel causing a reaction pressure of between one atmosphere to about two atmospheres . when hal in formula iv is iodo or chloro , the reaction is at least initially in the absence of air , for instance by introduction of an inert gas such as nitrogen into the reaction vessel , or by conducting the reaction in a sealed vessel . it was found that high yields are obtained by using about two mole equivalents of the reagent of the formula r 3 nh 2 , about 1 . 5 mole equivalents of the organic base pyridine in dimethyl formamide , and about 0 . 2 mole equivalent of the copper catalyst . the reaction may also be conducted with one equivalent of r 3 nh 2 , one equivalent of copper or its salts and 1 . 5 equivalent pyridine in dimethyl formamide . the isatoic anhydrides of formula ii are prepared from compounds of formula iii by reaction with a reagent of the formula r 5 r 6 c ═ o wherein r 5 and r 6 are as defined above . for instance , the reagent is phosgene or , preferably , bis -( trichloromethyl ) carbonate ( triphosgene ) which is commercially available and , as a solid , is easy to handle . when the above reagent is a solid , the reaction is conducted in an inert solvent such as a chlorinated alkane , e . g . methylene chloride , chloroform , carbon tetrachloride or dichloroethane , or an aromatic solvent such as toluene , benzene , or xylene . the reaction is conducted at about - 10 ° to 15 ° c . for about 15 minutes to 1 . 5 hours , usually for half an hour . when the reagent is phosgene , the solvent may also be an aqueous acid such as hydrochloric acid . when the reagent is a liquid such as methyl chloroformate or ethyl chloroformate , the solvent may be omitted and an excess of the reagent may be used instead . the reaction mixture is then heated between about 150 ° and 200 ° c . for about 18 to 24 hours . the reaction to form the isatoic anhydrides of formula ii is performed in the presence of an organic base such as pyridine or dimethylaminopyridine in the optional presence of a tertiary amine such as triethyl amine or diisopropylethylamine . the quinolones of formula i are prepared from the isatoic anhydrides ii by reaction with at least about one equivalent of the alkali metal salt of c 1 - c 3 - alkyl 3 - hydroxyacrylate . the alkali metal is sodium , lithium or potassium . the reaction is conducted in a dipolar aprotic solvent such as dimethylformamide , tetrahydrofurane , dimethoxyethane , n - methylpyrrolidinone , or dimethylacetamide . the reaction temperature ranges from about 20 ° to 100 ° c ., usually about 50 ° c ., and the reaction time is about 1 to 24 hours , usually about 1 hour . the reaction is advantageously conducted in the presence of a chelating agent for alkali metal ions . examples of suitable chelating agents are n , n &# 39 ;- dimethylimidazolidinone , hexamethyl phosphoric triamide , n , n &# 39 ;- dimethylpropylene urea , and tris [ 2 -( methoxyethoxy ) ethyl ] amine . the quinolones of formula i wherein r 4 is hydroxy may be prepared from the corresponding esters of formula i wherein r 4 is c 1 - c 4 alkoxy by conventional hydrolysis , for instance by heating with an acid such as hydrochloric acid . to a 1 liter four neck round bottom flask equipped with mechanical stirrer , two dropping funnels and a thermometer was introduced 20 g ( 86 . 71 mmol ) of 2 - amino - 4 , 5 - difluorobenzoic acid and a solution of 12 . 3 ml concentrated sulfuric acid in 90 ml water . the slurry was cooled to between 0 ° and - 5 ° c . in an ice - acetone bath . one of the dropping funnels was charged with a solution of 6 . 57 g ( 95 . 22 mmol ) sodium nitrite in 30 ml of water and slow addition of the solution was begun . the internal reaction temperature never rose above 0 ° c . and all the solution has been introduced after 5 minutes . the second dropping funnel was charged with a solution of 21 . 6 g ( 128 . 31 mmol ) potassium iodide in 45 ml of 1n sulfuric acid . this solution was then added dropwise over a period of 10 minutes with the internal temperature at or below 0 ° c . during addition , the reaction mixture releases nitrogen gas which causes some foaming . once the addition was completed , the dark mixture was stirred overnight while slowly warming to room temperature . the reaction mixture was quenched with a solution of 30 g of sodium bisulfite in 165 ml water and the suspension was adjusted to ph 2 . 5 with 5 ml of 6n hydrochloric acid . the resulting slurry was stirred at 0 ° c . for 30 minutes and then filtered . purification of the dark material was effected by dissolving the majority of the solid in ethyl acetate followed by clarification and treatment with activated charcoal . after filtration through a filter aid ( celite ) and evaporation there was obtained 20 g ( 82 %) of 2 - iodo - 4 , 5 - difluorobenzoic acid ; m . p . : 126 °- 127 ° c . to a 35 ml single neck round bottom flask equipped with magnetic stir bar and nitrogen inlet was charged 45 mg ( 0 . 704 mmol ) copper bronze , 5 ml of anhydrous dimethylformamide ( dmf ), 430 μl ( 5 . 28 mmol ) of pyridine and 537 μl ( 7 . 75 mmol ) cyclopropylamine . the resulting suspension was then treated with a solution of 1 g ( 3 . 52 mmol ) 2 - iodo - 4 , 5 - difluorobenzoic acid in 5 ml of dmf and the mixture was stirred overnight at room temperature . the reaction mixture , now a near solution , was clarified and then added to water ( 100 ml ) at ph 4 . 5 . a slurry forms immediately but before filtration the mixture was once again adjusted to ph 4 . 5 with 6n hydrochloric acid and cooled to 0 ° c . filtration of the white solid afforded 0 . 720 g ( 95 %) of 2 - n - cyclopropylamino - 4 , 5 - difluorobenzoic acid ; m . p . : 175 °- 176 ° c . to a 10 ml resealable pressure reaction flask equipped with a magnetic stirrer and teflon septum cap was charged a solution of 1 . 0 g ( 5 . 19 mmol ) 2 - chloro - 4 , 5 - difluorobenzoic acid , 792 μl ( 11 . 43 mmol ) cyclopropylamine , 800 mg ( 4 . 15 mmol ) copper ( i ) iodide and 630 μl ( 7 . 79 mmol ) pyridine in 8 . 0 ml of n , n - dimethylacetamide . the flask was sealed and was heated to 70 ° c . during stirring for a period of 16 hours . the reaction mixture was allowed to cool to room temperature and was then added to 100 ml of water . the suspension was adjusted to ph 13 with sodium hydroxide solution and was stirred for 15 minutes at room temperature . the suspension was filtered and the filtrate was adjusted to ph 4 . 5 with concentrated aqueous hcl . filtration of the resulting slurry provided 451 mg ( 41 %) of 2 - cyclopropylamino - 4 , 5 - difluorobenzoic acid ; m . p . : 175 °- 176 ° c . to a 10 ml single neck round bottom flask equipped with a septum and magnetic stirring bar was charged a solution of 100 mg ( 0 . 46 mmol ) of 2 - n - cyclopropylamino - 4 , 5 - difluorobenzoic acid and 62 μl ( 0 . 44 mmol ) of triethylamine in 2 ml of methylene chloride . the solution was cooled to 0 ° c . and was treated with a solution of 45 mg ( 0 . 147 mmol ) bis -( trichloromethyl )- carbonate in 0 . 5 ml methylene chloride . finally a catalytic amount of dimethylaminopyridine ( 10 mg ) was introduced as a solution in methylene chloride ( 0 . 5 ml ). after stirring at 0 ° c . for 1 . 5 hours , the reaction mixture was quenched by adding a small amount of 1n hydrochloric acid . the organic phase was dried over sodium sulfate and then concentrated to a yellow oil to afford 114 mg of n - cyclopropyl - 6 , 7 - difluoro - 2h - 3 , 1 - benzoxazine - 2 , 4 ( 1h ) dione ( 100 %). the product was crystallized from hot ethanol ; m . p . : 138 °- 139 ° c . to a 15 ml single neck round - bottom flask equipped with magnetic stirrer and under nitrogen atmosphere was added 60 mg ( 0 . 484 mmol ) of the sodium salt of methyl 3 - hydroxyacrylate in 1 . 5 ml of dmf . the resulting solution was stirred in the presence of 4a molecular sieves overnight and then filtered into another reaction vessel fitted with condenser , nitrogen line and a magnetic stirrer . to the mixture was charged 52 μl ( 0 . 467 mmol ) n , n &# 39 ;- dimethylimidazolidinone and the solution was heated to 55 ° c . to this reactor was added a solution of 93 mg ( 0 . 388 mmol ) of n - cyclopropyl - 6 , 7 - difluoro - 2h - 3 , 1 - benzoxazine - 2 , 4 ( 1h ) dione in 1 . 5 ml of dmf . the reaction mixture was stirred at 55 ° c . for 1 hour . the system was allowed to cool to room temperature and was then added to 30 ml of water at ph 4 . 0 . the ph of the resulting suspension was adjusted to 5 . 5 and the mixture was cooled to 0 ° c . and filtered . after drying there was obtained 50 mg ( 46 %) of methyl 1 - cyclopropyl - 6 , 7 - difluoro - 1 , 4 - dihydro - 4 - oxo - 3 - quinolinecarboxylate , m . p . : 223 ° - 224 ° c . the filtrate was extracted with methylene chloride and after drying and evaporation there was obtained an additional 47 mg ( 43 . 5 %, total yield : 89 . 5 %) of the desired product . a suspension of triethyl amine ( 15 ml , 0 . 11 mol ), 2 , 4 - difluoroaniline ( 25 ml , 0 . 24 mol ), copper bronze ( 2 . 7 g ., 0 . 04 mol ), in hot dmf ( 25 ml ) was treated with a solution of 2 - chloro - 4 , 5 - difluorobenzoic acid ( 23 g ., 0 . 12 mol ) in 25 ml of dmf and the temperature was maintained at 85 ° c . for 8 hours . the reaction mixture was allowed to cool to room temperature and was then stirred overnight . the reaction mixture was evaporated in vacuo and the residue was partitioned between ether and aqueous ammonium chloride . the organic phase was washed with 2n hcl and saturated aqueous lithium chloride solution . the ether was dried over sodium sulfate , treated with darco and then filtered and evaporated . the residue was crystallized from hexane - ether to afford 21 . 6 g ( 62 %) of 2 -( 2 , 4 - difluorophenylamino )- 4 , 5 - difluorobenzoic acid ; m . p . : 215 °- 216 ° c .	2
fig1 is a block diagram illustrating an embodiment of a musical key determining device in accordance with the present invention . this musical key determining device , which is adapted for being incorporated into an automatic performance device or an automatic arrangement device , has a function of determining a key of a music piece on the basis of automatic performance data of the music piece . although not described here in detail , once a musical key has been determined , control is made of automatic accompaniment , automatic arrangement etc . to a central processing unit ( cpu ) 10 are connected , via a bus 11 , a program memory 12 , a melody memory 13 , a chord memory 14 , a key memory 15 and a working memory 16 . the program memory 12 has a program stored therein which will be described later using flowcharts . in the melody memory 13 and chord memory 14 , there are stored automatic performance data which comprise melody data and chord data . the musical key memory 15 stores data indicative of a key determined on the basis of the automatic performance data . fig2 a through 2c illustrate memory formats in the memory 13 , chord memory 14 and musical key memory 15 , respectively . fig2 a illustrates the memory format in the melody memory 13 . each tone data of a melody ( melody tone data ) is composed of pitch data mdi and duration data dli , and these melody tone data are sequentially stored in the melody memory 13 in the performance order of the melody . &# 34 ; i &# 34 ; is a suffix that represents the order in which the melody tone changes ( melody tone change order ). fig2 b illustrates the memory format in the chord memory 14 . each chord data is composed of root data tn , chord type data typen and chord duration data cdln . &# 34 ; n &# 34 ; is a suffix that represents the order in which the chord changes ( chord change order ). further , fig2 c illustrates the memory format in the musical key memory 15 . this memory 15 stores key data indicative of keys having been determined on the basis of the automatic performance data , in the order in which the key changes . each key data is composed of tonic data tnlym , major / minor key data modem and key change timing data tmm . &# 34 ; m &# 34 ; is a suffix that represents the order in which the key changes ( key change order ). fig3 is a flowchart illustrating the operation of the musical key determining device . in the illustrated example , a single possible key is nominated on the basis of whether or not a dominant motion is present in a chord progression . when it has been confirmed that the nominated possible key is also not inconsistent with the melody , the possible key is made confirmed key . first , in step s1 , every register is initialized . more specifically , the following procedures are taken for the initialization purposes . root0 which is the first chord data in the chord memory is set into a root register rt provided for a chord in the current section ( current chord ). type0 is set into a type register tp provided for the current chord , and &# 34 ; 1 &# 34 ; is set into a section number register n . further , &# 34 ; ffh &# 34 ; ( which is the maximum value of the hexadecimal number system and represents &# 34 ; undetermined &# 34 ;) is set into a tonic register otn provided for the key of a chord in the last section ( last key ) and into a mode ( major / minor ) register omd provided for the last key . the section number n , which corresponds to the chord change order , is &# 34 ; 1 &# 34 ; at first and then increments its value one by one (&# 34 ; 2 &# 34 ;, &# 34 ; 3 &# 34 ;, . . . ) whenever a chord change occurs . in subsequent steps s2 to s9 , the following procedures are taken to determine a key in section n . first , the contents in the root register rt and type register rt ( root0 , type0 ) are copied into the root register ort and type register otp provided for the chord in the last section ( last chord ) ( step s2 ). next , the root rootn and type typen of the chord in the current section are set into the registers rt and tp for the current chord ( step s3 ). then , in view of the last chord , it is examined whether or not the progression or change to the current chord is a dominant motion ( step s4 ). the dominant motion means a chord progression from the dominant seventh chord to the tonic chord . namely , if the relation between the last and current chords corresponds to that between the dominant seventh and tonic chords , the chord progression is determined as being a dominant motion . for this purpose , the following conditions are confirmed in step s4 : tp = morm ( the current chord is a triad of major or minor key ), ( ort + 12 - rt )= 7 ( the interval between the last and current chords is perfect five degrees ( seven semitones ). if the above conditions are all satisfied , the transfer from the last chord to the current chord can be said to be a dominant motion . when such a dominant motion is detected , the current chord is judged as a tonic chord , and therefore data indicative of this key is set into a provisional new key tonic register tn and a provisional key mode register md , as a provisional new key ( i . e ., possible new key commencing in this section ). in other words , root data of the current chord is set into the register tn as tonic data , and data indicative of the type ( major / minor ) of the current chord is set into the register md as mode data . further , on the basis of the melody in the section , it is confirmed whether the provisional new key is correct or not ( step s6 ). namely , the provisional new key is confirmed as being correct , if note which is among the scale notes of the last key identified by the data stored in a last key tonic register otn and a last key mode register omd but is among the scale notes of the provisional new key identified by the data stored in the provisional key registers tn and md is contained among the melody notes in the current section . once the provisional new key has been confirmed as being correct , various data tnlty , mode , tm are stored into the musical key memory 15 at such addresses designated by order data m ( step s7 ); that is , the chord section number n is set as key change timing data tmm , the data in the register tn is set as tonic data tnltym , and the data in the register md is set as major / minor data modem . in addition , the data in the provisional new key registers tn and md are transferred to the last key registers otn and omd . on the other hand , if the provisional new key has not been confirmed as being correct , it is considered that no key determination has been made this time , and so the last key ( otn and omd ) is set into the provisional registers tn and md ( step s8 ). in step s9 , it is determined whether or not the section number n is now indicative of the last section ( i . e ., the end of automatic performance ). if the determination result is &# 34 ; no &# 34 ;, the program goes to step s10 . in step 10 , the section number n is incremented , and the program goes back to step s2 to repeat the above - mentioned procedures . the order data m for designating storage addresses in the musical key memory 15 is &# 34 ; 1 &# 34 ; ( m = 1 ) at first . further , the last key registers otn and omd are initially set at an undetermined value ffh , and thus , when a first dominant motion is detected , the determination result in step s6 always becomes &# 34 ; yes &# 34 ; so that the program goes to step s7 . accordingly , when the first dominant motion is detected , the data tmm , tnltym and modem corresponding to m = 1 , i . e ., tm , tnlty and mode are stored in step s7 into respective predetermined addresses ( see fig2 c ). in the case where the above - mentioned procedure has been done with respect to m = 1 , condition of m = 0 is resumed , and the same data as tnlty1 and mode1 are stored into the memory as the first tonic data tnlty0 and major / minor data mode0 ( fig2 c ). this means that a key determined when the first dominant motion has been detected represents an original key of the music piece . namely , tnlty0 = tnlty1 and mode0 = mode1 . after that , the order data m is incremented to m = 2 , so that when the procedure of step s7 is done next time , data tm2 , tnlty2 and mode2 will be stored into respective predetermined addresses . subsequently , the order number m increases one by one each time the program takes step s7 . however , in many cases , the value of m remains very small since modulation , i . e ., key transfer generally does not occur so often in one music piece . in the embodiment described above , key determination is carried out by detecting a dominant section in connection with the chord progression and by examining the scale notes of provisional new key and last key in connection with the melody . alternatively , the key determination may be performed taking other factors into consideration . fig4 illustrates another embodiment of the key determining process . this process determines a key only on the basis of chord and melody of a section in question , without taking a chord progression into consideration . first , &# 34 ; 1 &# 34 ; is set as the section number n ( step s21 ), and ffh ( value indicating &# 34 ; undetermined &# 34 ;) is set into tonic register tn and mode register md for a key to be determined ( step s22 ). in subsequent steps s23 to s29 , the following procedures are taken to determine a key in section n . first , the contents in the tonic register tn and mode register md are set into tonic register orn and mode register omd for the key in the last section ( last key ) ( step s23 ). next , root data rootn and type typen of the chord in the current section are set into the root register rt and type register tp ( step s24 ). then , a key having this chord as diatonic chords is nominated as a possible key ( step s25 ). at the greatest , six keys will be nominated as this possible key . for example , c major chord cab be diatonic chords of c major key , f major key , g major key , a minor key , d minor key and e minor key , and thus these keys will be the possible keys . a final possible key is selected on the basis of those of the melody notes corresponding to the section n that are not among the scale notes of the last key but are among the scale notes of specific one of the nominated possible keys ( step s26 ). if more than one possible keys are selected in step s26 , then one specific key is determined as the final key on the basis of some priority order ( for example , related keys ) obtained from the last key , and its tonic and mode are written into the register tn and register md , respectively ( steps s27 and s28 ). the priority order may be stored in , for example , a table in advance . subsequently , while incrementing the section number n , the above - mentioned steps s23 to s28 are repeated until the last section ( steps s29 and s30 ). the repetition of routine passing step s10 or step s30 may be effected at each of predetermined fixed clock timings or in synchronism with automatic performance timings . furthermore , although the foregoing embodiment has been described as determining keys by the use of memory - stored automatic performance data , the key determination may be made by inputting data which are obtained from real - time performance on a keyboard or other suitable input instruments .	8
the disclosed target &# 39 ; s 10 unique implementation of a target border 14 as a containment vessel for a solid amorphous material 12 possessing properties of plasticity and malleability that assure imperviousness to the wear inflicted on a medium used to stop broadhead - tipped arrows provides exponential improvements , many unanticipated , over previously existing art . turning first to fig1 we see a block type target 10 having a solid , clay center core 12 . as seen in the cross section view of fig2 the clay core 12 is integral with and completely surrounded by urethane foam 14 . it is preferred that a good grade of poured - in - place , high density , closed cell , urethane foam 14 be used , having a density of 8 - 10 pounds per cubic foot , thereby providing excellent structural rigidity with a maximum plasticity and tough outer skin . no perimeter frame is required due to the structural integrity of the foam . the foam is poured in a mold having a wood core member , thereby creating a cavity in the foam to allow for insertion of the clay core . however , in some cases , it may be advantageous to pour the foam with the clay core in place . it is anticipated that the foam may be poured in any geometrical configuration , such as the geometric - shaped foam target 20 illustrated in fig4 or take the form of any animal shape , such as the deer 30 depicted in fig3 . the clay core 12 as seen in fig1 may also be shaped in any configuration , for example a square 22 as seen in fig4 . although a number of commercially available clays may be used or formulated for such use , it has been found through trial and error that not all clays have the proper characteristics . such characteristics include : the ability to prevent through penetration of an arrow having a velocity between 200 to 350 feet per second without damage to the shaft or its broadhead tip ; the ability to release the arrow with minimal force and with little or no residue remaining on the arrow and broadhead ; the ability to be relatively easily reformed by compaction and also be economical to construct and maintain . the preferred embodiment as seen in fig7 utilizes high density urethane foam 14 surrounding a clay core 12 considered to be a semi - self - healing type , composed essentially of a special formulation of calcium carbonate and petrolatum and other additives , such as limestone , wax , oils , and talc . such clays are highly malleable , absorbing the impact energy of arrows tends to seal the holes left by the penetration of others previously shot into the target as illustrated in fig5 and 6 . to produce such a quality , the clay core 12 must be non - hardening , even under extreme outdoor weather conditions . it must be of a high density type with good temperature stability . it is also essential that the clay core 12 be highly compacted . therefore , as seen in fig5 when an arrow 16 is removed from the clay core 12 , it leaves a penetration wound 20 , 21 and , when the clay core 12 is then struck by a second arrow 18 in the vicinity of the first wound 20 , 21 , as seen in fig6 the clay material 12 tends to shift , thus closing the previous wound 20 , 21 produced by the first arrow 16 . tamping the clay core 12 periodically by pounding with a two pound maul effectively solidifies the core . the clay core 12 also must be sufficiently dense to prevent deep penetration of the arrows 16 , 18 . therefore , the clay should have a density of 90 - 110 pounds per cubic foot and may be selected from the plasticene group , containing plasticisers which allow the material to be malleable . however , it is obvious that the greater the velocity of the arrow , the greater the penetration . since the diameter and depth of the clay core should be kept to a minimum to remain economical , it is essential that the density be maintained by periodic repacking and compacting . the clay core 12 is generally between 10 and 13 inches deep and between 6 and 8 inches in diameter and should be fully enclosed on all sides by the foam , except for the face . however , there is no limitation as far as size or number of clay cores which may be used in a target . for example , multiple clay cores 32 , 34 of different sizes may be enclosed in a foam body 36 as seen in fig3 . it should be understood that as the clay core 12 is pounded during the compaction process , usually after every 20 to 30 shots , the clay expands diametrically , thus imparting a force on the foam 14 , which tends to help close wounds in the foam , but also reduces the core depth . it should be noted that the foam target may be several inches deeper than the clay core depth , thus serving to provide a rigid , structural backing for the clay core . when the target &# 39 ; s border is penetrated by an arrow , the self - healing foam is compressed radially outward from the center of an arrow shaft . once an arrow has been removed , it &# 39 ; s an intrinsic property of the material to gradually return to its former state , thus sealing the hole . regardless of its position on the target surface , half of any arrow perforation faces the target core ; as the clay core is compressed by the impact of a maul , portions of that energy are directed radially outward through the target and will facilitate the foam returning to its normal state . in the event the border adjacent to the clay core begins to sustain damage , during recommended restoration of the core ( i . e ., laying the target on it &# 39 ; s back and striking the core &# 39 ; s surface with a two pound maul several times to compress the clay ), clay expands into the areas in which the foam has degraded . this procedure not only assures that the core is securely mounted in the target , but because it induces pressure radiating outward from the target &# 39 ; s center , facilitates the self - healing properties of the polyurethane foam , thereby reinforcing the body of the target . if a broadhead tip becomes dislodged in the clay core , it can be retrieved by simply digging the clay from around the tip . when the broadhead has been extracted , the clay can be repacked by returning the extracted clay and compacting the clay by pounding with a two pound maul . it is this reforming process that makes this combination target impervious to wear , thus outlasting all other broadhead targets . the targets described herein have an inestimable product life span , based on clay cores having proven ability to sustain in excess of 10 , 000 broadhead shots without a single arrow pass - through and having no foreseeable point of exhaustion - while enabling the restoration of a like new target surface innumerable times by compressing the clay and making a circular impression therein to serve as a bull &# 39 ; s - eye . it is , therefore , safe to say that the clay core is virtually indestructible as an archery target . clay core targets may also be used with any weapon , provided such targets have adequate encasements surrounding the foam portion and that the foam has sufficient density for the load used . because many varying and different embodiments may be made within the scope of the inventive concept herein taught , and because many modifications may be made in the embodiments herein detailed in accordance with the descriptive requirement of the law , it is to be understood that the details herein are to be interpreted as illustrative and not in any limiting sense .	5
detailed description of the preferred embodiments of the present invention will be made in connection with the drawings . the measurement method for substance surface property parameters of this embodiment includes the following steps : 1 ) performing a saturation treatment to a surface of an object to be measured , comprising the following steps : 11 ) taking 3 - 5 g sample to be measured into a sample container , and using 150 - 250 ml hcl solution of 0 . 1 ml / l to flow though the substance to be measured at a uniform speed of 1 ml / min , to have the surface charges of the object to be measured all saturated by h + and cl − ; and , using hno 3 solution to perform saturation treatment to the sample to be measured ; 12 ) using 150 - 250 ml water to flow though the object to be measured at a uniform speed of 1 ml / min , to wash off redundant h + and cl − ; 13 ) using a constant - flow pump to draw interstitial water out of the object to be measured , until no water flows out . 2 ) adding 50 ml mixed solution of kcl , hcl ( or koh ) and cacl 2 with known concentration into the sample pool , stirring sufficiently , and then disposing and balancing for over 24 hours ; wherein kcl and cacl 2 use as indicator electrolytes , and hcl and koh use for adjusting ph value . concentration of the above individual electrolytes can be determined based on the requirements of the researcher , but it is preferred to control the ionic strength of the system during equilibrium within 0 . 2 mol / l . in this step , other indicator electrolytes can also be used , but there are at least two types of indicator electrolytes , including at least one type of bivalent metallic positive ion , such as ca 2 + , mg 2 + , and one type of monovalent metallic positive ion , such as li + , na + , na + . the negative ion of the indicator electrolytes shall be same as the negative ion of the acid in step 11 ). for example , if using hno 3 solution to perform saturation treatment to the surface of the sample to be measured in step 11 ), then in this step nano 3 and ca ( no 3 ) 2 can be used as indicator electrolytes , and hno 3 and naoh are used to adjust ph value . in the following context , description will be made to the present invention by using hcl solution to perform saturation treatment to the surface of the sample to be measured and using kcl and cacl 2 as indicator electrolytes as an example : 3 ) upon the mixture from step 2 ) reaching ion - exchange equilibrium ( i . e ., balancing for 24 hours under constant stirring ; and , balancing for at least 72 hours under non - stirring condition , in which the balancing time may be vary based on the sample type ), measuring the equilibrium concentration of the indicator electrolyte positive ion and hydrogen ion in the bulk solution of the mixture , comprising the following steps : 31 ) measuring activity values a h , a k and a ca of h + , k + , and ca 2 + in the bulk solution ; 32 ) using the activity values from step 31 ) as initial values of corresponding ion concentration , and performing iteration operation through the following steps to obtain activity coefficients and concentration of k + , ca 2 + and h + ; iterating until to ( i = k + 1 ) th time , when ( i k + 1 − i k )/ i k + 1 & lt ; 0 . 001 , terminating the iteration operation ; 321 ) using the activity values from step 31 ) as initial values , and obtaining ionic strength of the system through the following formula : wherein , i i is the ionic strength of i th iteration , the unit of which is mol / l ; c i h is concentration of h + at i th iteration , c i k is concentration of k + at i th iteration , and c i ca is concentration of ca 2 + at i th iteration . 322 ) based on the ionic strength , activity coefficients of na + , ca 2 + and h + can be calculated through the following formula : wherein , γ i h , γ i k and γ i ca respectively are activity coefficients of h + , k + and ca 2 + at i th iteration , and t is temperature , the unit of which is k . 323 ) base on the activity coefficients from step 322 ), the equilibrium concentration values of k + , ca 2 + and h + can be calculated through the following formula : wherein , c i h , c i k c i ca respectively are the equilibrium ion concentration of h + , k + and ca 2 + at i th iteration ; 4 ) substituting the equilibrium ion concentration of k + and ca 2 + ( equilibrium concentration obtained from last iteration operation ) from step 3 ) into the following formula , to obtain the substance surface potential φ 0 : wherein , φ 0 is substance surface potential , r is gas constant , t is temperature , f is faraday constant , c k 0 is concentration of k + in the system when beginning to add kcl , c ca 0 is concentration of ca 2 + in the system when beginning to add cacl 2 , c k ∞ is equilibrium concentration of k + , c ca ∞ is equilibrium concentration of ca 2 + , β k is the relative effective charge coefficient of k + that associates with k + hydrated radius in the system containing “ k + + ca 2 + ”; and β ca is the relative effective charge coefficient of ca 2 + that associates with ca 2 + hydrated radius in the system containing “ k + + ca 2 + ”. using the final value i of ionic strength in the iteration operation to calculate the effective charge coefficient with the following formula : 5 ) based on the surface potential value from step 4 ), specific surface area of the substance is calculated by the following formula : wherein , v is total volume of water , the unit of which is 1 ; s is specific surface area , the unit of which is dm 2 / g ; κ is debye - hückel parameter , the unit of which is dm − 1 , and κ is calculated by the following formula : wherein , ∈ is medium dielectric constant , in which ∈ of water is ∈= 8 . 9 × 10 − 10 c 2 / jdm . based on the surface potential value from step 4 ), the surface charge density of the substance is calculated by the following formula : wherein , σ 0 is surface charge density , the symbol of which is same as that of the surface potential and the unit of which is c / dm 2 ; 6 ) based on the surface charge density from step 5 ), the surface electric field strength of the substance is calculated by the following formula : wherein , e 0 is surface electric field strength of the substance , the unit of which is v / dm . based on the surface charge density and specific surface area from step 5 ), the surface charge quantity is calculated by the following formula : wherein , t c is the surface charge quantity of the substance , the unit of which is c / g . an analysis system of substance surface property parameter of this embodiment comprises a sample treatment device and a detection system . referring to fig1 , the sample treatment device includes a sample container 11 for containing the sample to be measured ; and a liquid intake pipe 12 and a liquid offtake pipe 13 , wherein the liquid offtake pipe 13 is in communication with a bottom of the sample container 11 , the liquid intake pipe 12 is in communication with the sample container 11 ; and the liquid offtake pipe 13 is connected to a constant - flow pump . a stirring device 15 is provided in the sample container 11 . an ion activity detecting unit for detecting individual ion activity in the solution in the sample container 11 , including a detecting electrode 16 disposed in the sample container 11 , millivoltmeters 22 and an ion activity operator ; the detecting electrode is “ h + — k + — ca 2 + ” combined electrode ; inputs of three millivoltmeters 22 are respectively connected to outputs of h + electrode , k + electrode , and ca 2 + electrode of the “ h + — k + — ca 2 + ” combined electrode ; outputs of the three millivoltmeters 22 are respectively connected to inputs of ph operator 23 , na + activity operator 24 , and ca 2 + activity operator 25 ; the millivoltmeters preferably use high - impedance millivoltmeter ; and a data processing unit which can be programmable processor such as single chip microcomputer , the data processing unit receives detected results from the ion activity detecting unit and analyzes the surface parameters of the sample to be measured , comprising : “ h + , ca 2 + , and k + ” concentration operation module 26 connecting to outputs of the ph operator 23 , k + activity operator 24 , and ca 2 + activity operator 25 , to receive the detected results from the above operators , to calculate ion concentration , and surface parameter operation module 27 for receiving the ion equilibrium concentration from the “ h + , ca 2 + , and k + ” concentration operation module 26 to calculate surface potential , surface charge quantity , surface charge density , surface electric field strength , and specific surface area of the sample to be measured . referring to fig1 and 2 , the analysis system of substance surface property parameter further includes a temperature probe 14 disposed in the sample container 11 ; and an electronic thermometer 21 , input of which is connected to the temperature probe 14 , and output of which is connected to inputs of the ph operator 23 , k + activity operator 24 and ca 2 + activity operator 25 , concentration operator , and surface property parameter operator . the ph operator 23 , k + activity operator 24 and ca 2 + activity operator 25 convert the potential values detected by the millivoltmeters into individual ion activity values through the following method : upon individual ions are standardized by standard solution ( the ph value of which shall be same as that of the solution to be measured ) with known activity , the activity operator calculates individual ion activity values of the solution to be measured by using nernst equation . the “ h + , ca 2 + , and k + ” concentration operation module 26 calculates concentration of k + , ca 2 + , and h + through the following method : using the activity values from the ph operator 23 , k + activity operator 24 , and ca 2 + activity operator 25 as initial values of individual ion concentration , and performing iteration operation through the following steps : a ) obtaining the ionic strength of the solution through operation of the following formula : wherein , i i is ionic strength at i th iteration , the unit of which is mol / l ; c i h is concentration of h + at i th iteration ; c i k is concentration of k + at i th iteration ; and c i ca is concentration of ca 2 + at i th iteration . b ) based on the ionic strength , activity coefficients of k + , ca 2 + and h + at i th iteration can be calculated through the following formula : wherein , γ i h , γ i k and γ i ca respectively are activity coefficients of h + , k + and ca 2 + at i th iteration ; and t is temperature , the unit of which is k . c ) base on the activity coefficients , concentration values of k + , ca 2 + and h + for the next iteration operation can be obtained through the following formula : wherein , c i h , c i k c i ca respectively are concentration of h + , k + and ca 2 + of this iteration . using such concentration values as the concentration for the next iteration , repeating steps a ) to c ) to perform iteration operation until the ( i = k + 1 ) th time , when ( i k + 1 − i k )/ i k + 1 & lt ; 0 . 001 , terminating the iteration operation , and using individual ion concentration from last time iteration as the final output equilibrium ion concentration . the surface parameter operation module 27 receives equilibrium ion concentration ( final value of the iteration operation ) of k + and ca 2 + outputted from the “ h + , ca 2 + , and k + ” concentration operation module 26 to substitute to the following formula , to obtain the substance surface potential φ 0 : wherein , φ 0 is substance surface potential , r is gas constant , t is temperature , f is faraday constant . c k 0 is the initial concentration of k + in the system when beginning to add kcl ; and c ca 0 is the initial concentration of ca 2 + in the system when beginning to add cacl 2 . the two concentration values are calculated based on the total mole number of individual ions added into the system divided by the total volume of water . c k ∞ is equilibrium concentration of k + ; c ca ∞ is equilibrium concentration of ca 2 + ; β k is the relative effective charge coefficient of k + that associates with k + hydrated radius in a system containing “ k + + ca 2 + ”; and , β ca is the relative effective charge coefficient of ca 2 + that associates with ca 2 + hydrated radius in a system containing “ k + + ca 2 + ”. using the final value i of ionic strength from iteration operation , the effective charge coefficient is calculated through the following formula : the surface parameter operation module 27 calculates the specific surface area of the substance through the following formula based on the substance surface potential φ 0 : wherein , v is the total volume of water , the unit of which is 1 ; s is specific surface area , the unit of which is dm 2 / g ; κ is debye - hückel parameter , the unit of which is dm − 1 , and κ is calculated through the following formula : wherein , ∈ is medium dielectric constant , in which ∈ of water is ∈= 8 . 9 × 10 − 10 c 2 / jdm . the surface parameter operation module 27 calculates surface charge density of the substance through the following formula based on the surface potential value : wherein , σ 0 is surface charge density , the symbol of which is same as that of surface potential and the unit of which is c / dm 2 . the surface parameter operation module 27 calculates surface electric field strength of the substance through the following formula based on the surface charge density : wherein , e 0 is substance surface electric field strength , the unit of which is v / dm . the surface parameter operation module 27 calculates surface charge quantity through the following formula based on the surface charge density and specific surface area : wherein , t c is surface charge quantity of a substance , the unit of which is c / g . the above are only preferable embodiments of the present invention , and are not used to limit the present invention . apparently , people skilled in the art can make various modifications and variations to the present invention without departing from the spirit and scope of the present invention . therefore , the present invention intends to include all of the modifications and variations that fall into the appended claims or equivalence thereof .	6
certain compressed drilling fluid additives used experimentally evidenced difficulty in dispersion . this invention addresses that difficulty by delivering additives in a softened tablet that disperses specifically in a target drilling fluid . the present invention advantageously includes a delivery system for controlling functions , such as lost circulation , seepage , fluid loss , viscosity , lubricity , foaming , shale , and ph in drilling operations . the delivery system preferably includes the soft dispersible tablet , which includes drilling fluid additives and a softening agent . in use , the soft dispersible tablet is deployed within a drilling fluid for carrying the drilling fluid additives to a zone of lost circulation or the like . when the soft dispersible tablet is deployed within the drilling fluid , the drilling fluid advantageously disperses the soft dispersible tablet quickly , allowing delivery of the drilling fluid additives . the drilling fluid transports the drilling fluid additive to within the drilling fluid . the current invention includes a soft tablet to maximize the rate of incorporation of contained additive into the drilling fluid . in preferred embodiments of the present invention , the soft dispersible tablet contains around 85 % to around 95 % of drilling fluid additives and around 5 % to around 15 % of the softening agent delivered in the readily - dispersible system in the form of the soft tablet . the tablet is advantageously deformable due to being soft . water - based drilling fluids , or drilling muds , are generally understood as those in which water or saltwater is the major liquid phase as well as the wetting ( external ) phase . general categories of water - based drilling fluids are freshwater , seawater , salt water , lime , potassium and silicate . if the drilling fluid to be used is water - based , then the softening agent for use in the inventive delivery system can be selected from the following compounds : ethylene oxide adducts of phenol and nonyl phenol , a mixture of ethylene glycol and propylene glycol , high molecular weight water soluble polyethylene glycols , modified water dispersible lecithins , and the like . synthetic - based drilling fluids are known to come in a broad range . popular fluid types include several olefin oligomers of ethylene . esters made from vegetable fatty acid and alcohol were among the first of such type of fluids . ethers and polyethers , made from alcohols and polyalcohols , have been used , along with paraffinic hydrocarbons and linear alkyl benzenes . mixtures of these fluids are also used to make synthetic - based drilling fluids . other examples will be known to those skilled in the art . an oil - based mud is a type of drilling mud with diesel oil as its external phase . diesel - oil mud is the traditional oil mud and has a history of excellent performance for drilling difficult wells . it has been used because the base oil is low - cost and is a widely available motor fuel . in - gauge holes can be drilled through all types of shales , salt , gypsum and other difficult strata using diesel - oil mud systems . diesel - oil mud is often the mud of choice for drilling high - pressure , high - temperature zones . if the drilling fluid to be used is a synthetic or oil based fluid , then the specific softening agent can be selected from at least one of the following compounds : sodium dodecyl benzene sulfonate , fatty acid amides and imidazolines of polyamines , and phospholipids , such as lecithin . the additives useful for the present invention are standard or industry - acceptable materials that perform various functions in the drilling fluid , such as lost circulation and seepage control , fluid loss , viscosity , lubricity , foaming shale , and ph control . as such , the additives are typically standard materials recognized by one of ordinary skill in the art for use in drilling fluid . the tablet can deliver one or more additives , the delivery being triggered by the injection of the soft tablet into the target drilling fluid . among the inorganic materials useful in this invention , mineral components are readily available , such as calcium carbonate , mica , diatomaceous earth , fuller &# 39 ; s earth and other silicates , activated charcoal , bauxite , alumina gel , graphite , gilsonite and the like . such materials are frequently provided in fiber or ground form . carbonate can be used alone or in combination with other desirable additives . the effect of adding carbonate to organic additives is an improved acid solubility . this also results in a tablet of increased density . also useful are plastics such as thermosets , thermoplastics and rubber compounds including melamine , polyvinylchloride ( pvc ) and cellophane . these plastics can be ground into granules or powders . other materials to be delivered to the system useful for managing the rheological characteristics of drilling fluid include the rheological additives of lignites containing calcium hydroxide , leonardite , leonardite with potassium , leonardite with gyp , organophilic leonardite , lignin - based powders , bitumens . also useful are lignosulfonates , including those with chrome or chrome - free , and those containing calcium , iron , tin , zinc and other heavy metals . asphalt and various forms of asphalts are included in as rheological additives , including sodium sulfonate asphalt and potassium sulfonate asphalt . rheological additives also include various clays including organophilic clays , attapulgite clays , montmorillonite clays , kaolinite clays and calcined clays . polyacrylate powders , polyacrylamide homopolymers and copolymers , polyanionic cellulose , cellulosic polymers and the like are also rheological additives useful in the invention . xantham gums , metal silicates , starches ( including corn ), sugarbeet , wood and potato starches , and guar gum are included . fatty acids , including tall , refined , unrefined , and polyaminated are also rheological additives . other rheological additives include amphoterics such as aluminum salts and the like , carboxymethyl cellulose , sodium carboxymethyl cellulose , welan gum , hydrocarbon resins , hydroxyethylcellulose , and polyphosphate . other drilling fluid additives can include barium sulfate , hematite , sodium chloride , calcium chloride , potassium chloride , bromides , sodium , calcium , zinc , gilsonite , graphite , petroleum coke and calcine coke . fibrous insulation material such as rockwool insulation can be used as theological additives . the present invention also advantageously includes a method of delivering a drilling fluid additive to a drilling fluid . in this embodiment of the present invention , drilling fluid additives are supplied or prepared and then the drilling fluid additivies are mixed with the softening agent . any type of mixer can be used that can adequately mix the materials . an example of such a blender is a ribbon blender . once the materials are mixed , the materials are formed into the soft dispersible tablet . the soft dispersible tablet is dispersed into the drilling fluid , which breaks down , or reverts , the drilling fluid additive back into the original particle size distribution prior to placement of the drilling fluid additive in the drilling fluid . the original particle size distribution will be understood to be based upon the size of the particles forming the drilling fluid additive prior to being mixed with the softening agent . the reversion of the drilling fluid additive into the original particle size distribution can occur downhole , or more preferably topside . topside refers to the portion of the well bore prior to the drill string . from the mud pit to the drill string is typically considered to be topside . the softening agent assists tablets included in the inventive delivery system to disperse in various types of drilling fluids , including oil - based and synthetic - based drilling fluids . initial trials with pelletized lost circulation materials generally did not utilize wetting agents , surfactants , or emulsifiers . when these trials were made in hydrocarbon fluids , such as diesel , mineral oil , and low aromatic content alpha olefins as used in many offshore drilling applications or other hostile environments , it was noted that dispersion rate was difficult to predict . it is believed that , since most of the lost circulation materials are produced from natural fibers and granules , these materials are more hydrophilic than oleophilic making dispersion in hydrocarbon fluids less rapid . the present invention advantageously provides rapid dispersion in hydrocarbon fluids through the use of the soft tablet . similarly , wetting agents , surfactants , and emulsifiers aid in the dispersion of the soft tablets in water based fluids . the softening agent of the present invention prevents plugging of well pumps , drill pipe , drill bits , and screens since all of the tablet material is dispersed , leaving no materials that are not dispersed . the particles are small enough to pass through the screens and machinery without damaging them . the use of the proper wetting agent , surfactant , and emulsifier , such as the softening agent , prevents any degradation of the drilling fluid , particularly emulsion stability or viscosity . in one embodiment of the present invention , high concentration slurries of dispersed tablet material can be prepared in the “ slugging pit ” prior to pumping downhole to the affected zone . as another advantage of the present invention , the inventive delivery system delivers lost circulation materials that disperse in oil and / or water based drilling fluids , thereby avoiding reliance on mechanical energy to disperse the tablets throughout the drilling fluids . the present invention &# 39 ; s provision of hydrodynamic or oleodynamic dispersion of the tablet rather than mechanically - aided dispersion avoids high cost mechanical dispersion equipment and extensive mixing time at the rig site . dispersion is generally understood as the act of breaking up large particles into smaller ones and distributing them throughout a liquid or gaseous medium . dispersion is conventionally accomplished by various methods depending upon the type of drilling fluid that is used in an application . in a water - base drilling mud application , dispersion is generally the act of degrading clay materials , starches , carboxymethylcellulose , biopolymer , synthetic polymers or oils into submicroscopic particles . in oil - mud emulsion terminology , dispersion is generally the act of forming a fine - grained emulsion of an aqueous phase into an oil . this is conventionally accomplished by mechanical shearing or heating in the presence of surfactants . as previously described , the present invention &# 39 ; s dynamic dispersion feature eliminates the need for the equipment necessary to mechanically disperse the lost circulation materials within the drilling fluids . the inventive delivery system further includes breaking down the additives into their original particle size distribution , which tends towards effective use of the materials . as noted , if the materials do not revert to their original particle size distribution during dispersal , their effectiveness in eliminating loss of fluids in the well bore is reduced . conventionally , the original particle size distribution is typically optimized by the manufacturer prior to tabletization . this tabletization process compresses and densifies the materials , which , without more , can reduce the effectiveness of the materials to return to their original particle size distribution during dispersal . the present invention avoids such disadvantages . the present invention is particularly effective at delivering cellulostic lost circulation and seepage control materials , although the invention is not limited in this regard . in particular , the invention is particularly effective at delivering one or more of the following cellulostic materials , alone or in combination : ground wood , pine bark , fruit pomace , vegetable pomace , yellow pine , pine bark , corn cobs , peanut hulls , pecan piths , almond shell , corn cob outers , bees wings , cotton burrs , oat hulls , rice hulls , seed shells , sunflower , flax , linseed , cocoa bean , feathers , peat moss , jute , flax , mohair , wool , sugar cane , bagasse , sawdust , bamboo , cork , popcorn , tapioca , and grain sorghum . the invention is also effective at delivering inorganic lost circulation and seepage control materials , although the invention is again not limited in this regard . such inorganic materials include mineral components that are readily available , such as calcium carbonate , mica , diatomaceous earth , fuller &# 39 ; s earth and other silicates , activated charcoal , bauxite , alumina gel , graphite , gilsonite and the like . such inorganic materials are frequently provided in fiber or ground form . carbonate can be used alone or in combination with other desirable additives . the effect of adding carbonate to organic additives is known to improve acid solubility . this also results in a tablet of increased density . the inventive system can also deliver plastics such as thermosets , thermoplastics and rubber compounds including melamine , polyvinylchloride ( pvc ) and cellophane . these plastics can be ground into granules or powders . another advantage of use of the inventive softened dispersible tablet is the reduction of dust during addition to the drilling fluid . traditional powders added through a hopper create volumes of dust that create a hazard to the environment and to the working personnel . certain areas , such as the north sea , have stringent regulations on dust . the use of the inventive delivery system reduces the creation of dust substantially . from the foregoing it will be seen that this invention is one well adapted to attain all of the ends and objects hereinabove set forth , together with other advantages that are obvious and that are inherent to the apparatus and structure . it will be understood that certain features and subcombinations are of utility and can be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the claims . because many possible embodiments can be made of the invention without departing from the scope thereof , it is to be understood that all matter herein set forth is to be interpreted as illustrative and not in a limiting sense . for example , without limitation , the soft dispersible tablets can also include insecticides , biocides or other biological operatives to reduce susceptibility to various types of degradation or to repel pests .	2
the following description is presented to enable a person of ordinary skill in the art to make and use the embodiments of the disclosure . the following detailed description is exemplary in nature and is not intended to limit the disclosure or the application and uses of the embodiments of the disclosure . descriptions of specific devices , techniques , and applications are provided only as examples . modifications to the examples described herein will be readily apparent to those of ordinary skill in the art , and the general principles defined herein may be applied to other examples and applications without departing from the spirit and scope of the disclosure . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding field , background , summary or the following detailed description . the present disclosure should be accorded scope consistent with the claims , and not limited to the examples described and shown herein . embodiments of the disclosure are described herein in the context of one practical non - limiting application , namely , an information device . embodiments of the disclosure , however , are not limited to such mobile information devices , and the techniques described herein may also be utilized in other applications . for example , embodiments may be applicable to mobile phones , digital books , digital cameras , electronic game machines , digital music players , personal digital assistance ( pda ), personal handy phone system ( phs ), lap top computers , and the like . as would be apparent to one of ordinary skill in the art after reading this description , these are merely examples and the embodiments of the disclosure are not limited to operating in accordance with these examples . other embodiments may be utilized and structural changes may be made without departing from the scope of the exemplary embodiments of the present disclosure . when a user engages in an operation related to a call , the mobile terminal apparatus related to the embodiments of the present invention detects the orientation of the mobile terminal apparatus and informs the user , if it is determined to be an incorrect orientation . the embodiments of the present invention are described , referring to fig1 through fig1 . first , the configuration of the mobile terminal apparatus is described , referring to fig1 through fig7 . fig1 is an oblique view of the appearance of a mobile terminal apparatus . the case of the mobile terminal apparatus 100 , as shown in fig1 , comprises a touch panel 105 , an operating part 120 , a light - emitting part 130 , a speaker 140 , a microphone 150 , etc . fig2 is a block diagram of the mobile terminal apparatus 100 . the mobile terminal apparatus 100 shown in fig2 comprises a touch panel 105 , operating part 120 , light - emitting part 130 , speaker 140 , d / a converter 145 , microphone 150 , a / d converter 155 , oscillating part 160 , angle - detecting part 165 , controlling part 170 , rom 180 ( read only memory ), ram 190 ( random access memory ), i / f ( input / output interface ) 200 , external memory 210 , wireless circuit 240 , antenna 250 , imaging part 260 , recording part 270 , and proximity sensor 280 . the touch panel 105 comprises a display control part 106 , display part 110 , and touch panel input part 115 . the display control part 106 causes the display part 110 to display image data stored in any one of rom 180 , ram 190 , or external memory 210 , based on control signals output from the controlling part 170 . furthermore , the display control part 106 causes the display part 110 to display image data after inverting the same based on the operation of the user . herein , the control of inverting the orientation of the image data to be displayed on the display part 110 is described using fig3 . fig3 a is a state in which the speaker 140 of the mobile terminal apparatus 100 is in a position higher than the microphone 150 . in such a state , the display control part 106 causes the display part 110 to display the image data as in the orientation of fig3 a . fig3 b is a state in which the speaker 140 of the mobile terminal apparatus 100 is in a lower position than the microphone 150 . in such a state , the display control part 106 causes the display part 110 to display the image data after inverting the same . that is , as in fig3 b , even if the user is operating the mobile terminal apparatus 100 in an incorrect orientation , because the image to be displayed in the display part has been inverted , the user may operate the mobile terminal apparatus 100 without correcting the orientation . the display part 110 displays various kinds of information required for executing functions provided with the mobile terminal apparatus 100 based on the output from the display control part 106 . the various kinds of information are , for example , function menus , emails , address book , incoming history or outgoing history of calls , sent history or received history of emails , and text data as well as image data , etc ., stored in a data folder . the display part 110 is , for example , a liquid crystal display , organic el ( electroluminescence ) display , plasma display , electronic paper , etc . the display part 110 in the present embodiment is a liquid crystal display . the touch panel input part 115 is a pointing device that detects a position touched by a user using a finger or a pen etc ., and outputs coordinates to the controlling part 170 , according to the position . the touch panel input part 115 is arranged on the upper surface of the display part 110 . the user touches the touch panel input part 115 using a means such as a finger or a pen ; for example , pushing , stroking , drawing on the surface of the touch panel input part 115 using a finger or a pen , etc . that is , the touch panel input part 115 outputs , to the controlling part 170 , the coordinates of the pushed position , the direction of the stroke , and the graphic drawn by the user . the touch panel input part 115 is , for example , a capacitance binding system which detects electric signals by static electricity , a resistance film system , an optical system , etc . the operating part 120 receives operations from a user as inputs . the inputs received at the operating part 120 are output to the controlling part 170 as signals . the operating part 120 is arranged on the side surface of the mobile terminal apparatus 100 in the present embodiment . the light - emitting part 130 emits light to the outside , in accordance with control signals output from the controlling part 170 . the light - emitting part 130 is a light - emitting element , etc ., for example , an led . the light - emitting part 130 informs a user of incoming calls , outgoing calls , received emails , sent emails , replay of music data , advent of an alarm date / time , etc ., by emitting light toward the outside . the speaker 140 has the function of outputting sound toward the outside in accordance with control signals output from the controlling part 170 . the speaker 140 is connected to the controlling part 170 via the d / a converter 145 . the d / a converter 145 converts digital signals output from the controlling part 170 to analog signals . the d / a converter 145 outputs the converted analog signals to the speaker 140 . the microphone 150 has a function to input sound from outside such as voice etc . the microphone 150 outputs the input sound to the a / d converter 155 as analog signals . the microphone 150 is connected to the controlling part 170 via the a / d converter 155 . the a / d converter 155 converts analog voice signals input from the microphone 150 to digital signals so as to be output to the controlling part 170 . the oscillating part 160 generates mechanical oscillations by control signals output from the controlling part 170 . the oscillating part 160 is , for example , a motor etc . the oscillating part 160 informs a user of incoming calls , received emails , advent of alarm date / time , etc ., via mechanical oscillations . the angle - detecting part 165 detects the angle of inclination of the mobile terminal apparatus 100 from a preliminarily prescribed normal state . the preliminarily prescribed normal state means , for example , a state in which the surface where the display part 110 is arranged becomes horizontal with respect to the ground . the angle - detecting part 165 outputs information regarding the detected angle to the controlling part 170 . the angle - detecting part 165 is , for example , an angle sensor or an acceleration sensor , etc . next , the angle of inclination detected by the angle - detecting part 165 is described using fig4 and fig5 . the rotary axis 410 shown in fig4 is perpendicular to the longitudinal direction of the mobile terminal apparatus 100 and is a line passing through the center of the mobile terminal apparatus 100 . fig5 is a simplified drawing of a side view of the mobile terminal apparatus 100 seen from the direction of the arrow shown in fig4 . fig5 a shows a normal state of the mobile terminal apparatus 100 in the present embodiment . in the present embodiment , the normal state of the mobile terminal apparatus 100 is defined as a state in which the surface that comprises the display part 110 becomes horizontal with respect to the ground 515 , as in fig5 a . that is , a surface that becomes horizontal to the ground and comprises the display part 110 is defined as a normal surface 510 . the angle - detecting part 165 detects an angle of inclination when the mobile terminal apparatus 100 is inclined from the normal state when a center axis is a rotary axis 410 . fig5 b , fig5 c , fig5 d , and fig5 e show examples in which the mobile terminal apparatus 100 is inclined . as shown in fig5 b , fig5 c , fig5 d , and fig5 e , a surface that is the same as the display part 110 at the time when the mobile terminal apparatus 100 is inclined is defined as an inclining surface 520 . fig5 b and c are drawings showing a state in which the mobile terminal apparatus 100 is inclined so that the speaker 140 is in a position higher than the normal surface 510 . in such a case , the angle - detecting part 165 detects an angle formed by the normal surface 510 and the inclining surface 520 as shown in fig5 b and c . fig5 d and fig5 e are drawings showing a state in which the mobile terminal apparatus 100 is inclined so that the speaker 140 is in a state lower than the normal surface 510 . in such a case , the angle - detecting part 165 detects an angle formed by the normal surface 510 and the inclining surface 520 as shown in fig5 d and fig5 e . the controlling part 170 controls software and hardware provided for the mobile terminal apparatus 100 . for example , the controlling part 170 executes various kinds of functions provided for the mobile terminal apparatus 100 based on inputs received from the user at the operating part 120 or the touch panel input part 115 . furthermore , the controlling part 170 executes programs stored in the rom 180 , ram 190 , and external memory 210 . configurations provided for the controlling part 170 to execute the programs are described using fig6 . fig6 shows an arrangement of information stored in the ram 190 ( hereinafter referred to as a memory map ). the memorymap comprises a program storage region 610 and data storage region 630 . the program storage region 610 comprises an incoming / outgoing call program 620 etc . the data storage region 630 comprises an address book 640 , angle detection buffer 650 , phone number selection buffer 660 , phone number input buffer 670 , and notification data 680 etc . programs stored in the program storage region 610 are described . the incoming / outgoing call program 620 determines whether or not the mobile terminal apparatus 100 is held in a correct orientation by the user while a call is being made and , when it is determined that the mobile terminal apparatus 100 is being held in an incorrect orientation that may cause a problem for the mobile terminal apparatus 100 in making a call , the user is informed and the process starting the call is carried out when the orientation is corrected . the incoming / outgoing call program 620 is described in detail later , referring to fig8 and fig1 . an email text display program executes a process of displaying an email text on the display part 110 when an operation to display the email text is executed at the time of receiving an email . data stored in the data storage region 630 is described . the data storage region 630 comprises an address book 640 , angle detection buffer 650 , phone number selection buffer 660 , phone number input buffer 670 , and notification data 680 . the address book 640 stores information regarding addresses input by a user and required for outgoing calls , and for sending emails to other communication terminal devices . the information regarding addresses is information that comprises phone numbers and email addresses etc . furthermore , for example , name , memory number , residential address , date of birth and group ( for example , information related to affiliations such as school or work ) are linked to a phone number and an email address , and stored in the information regarding addresses . the angle detection buffer 650 temporarily stores an angle of inclination that is detected by the angle - detecting part 165 from the normal state of the mobile terminal apparatus 100 . the phone number selection buffer 660 temporarily stores a phone number that is selected from the address book 640 via the operating part 120 or the touch panel input part 115 when an outgoing call is made by a user . the phone number input buffer 670 is a buffer for temporarily storing a phone number that is input via the operating part 120 or the touch panel input part 115 by a user . the proximity buffer 675 is a buffer for temporarily storing results detected by the proximity sensor 280 . the notification data 680 stores data to inform a user that the mobile terminal apparatus 100 is not being held in a correct orientation . in addition to those cited above , the program storage region 610 and the data storage region 630 store programs and data required for executing various kinds of functions provided with the mobile terminal apparatus . return to the description of fig2 . the rom 180 stores programs and data for executing functions provided with the mobile terminal apparatus 100 . the ram 190 is accessible from the controlling part 170 , and is used as a temporary storage region for the controlling part 170 to execute various kinds of processes . the i / f 200 is equipped with an external memory 210 that is attachable / detachable . the controlling part 170 is capable of accessing the external memory 210 via the i / f 200 and , for example , reads out and executes programs as well as data etc . that have been stored in the external memory 210 . the external memory 210 is a medium for storing programs or data and , for example , there are memory card , hdd ( hard disk drive ), and sim card ( subscriber identity module card ) etc . furthermore , the above programs and the data are not limited to programs that may directly be read out from the external memory 210 and executed , but may also be coded programs , compression - processed programs , image data , voice data , and text data etc . the wireless circuit 240 converts a prescribed high frequency signal input from the antenna 250 to a digital voice signal via demodulation processing and decoding processing . furthermore , the wireless circuit 240 converts digital voice signals input from the controlling part 170 to high frequency signals via encoding processing and modulation processing . subsequently , the wireless circuit 240 outputs the high frequency signals to the antenna 250 . the antenna 250 receives magnetic waves of a prescribed frequency and outputs the same to the wireless circuit 240 as high frequency signals . furthermore , the high frequency signals output from the wireless circuit 240 are output as magnetic waves of a prescribed frequency . the imaging part 260 comprises camera functions as well as video functions . images or video acquired by the imaging part 260 are stored in the rom 180 , ram 190 , and external memory 210 . the imaging part 260 is , for example , a ccd ( charge coupled device ) camera , or a cmos ( complementary metal oxide semiconductor ) camera etc . the imaging part 260 is arranged in the rear surface of the case of the mobile terminal apparatus 100 shown in fig1 , and thus , is not illustrated in fig1 . the recording part 270 comprises a function to record sound from outside such as sound input from the microphone 150 . furthermore , if a user does not respond to an incoming call from another terminal , the recording part 270 records sound from the other terminal input from the wireless circuit 240 . sound recorded by the recording part 270 is output via the speaker 140 by an input from the touch panel input part 115 and the operating part 120 by a user . the proximity sensor 280 detects that a subject to be detected is in proximity to the mobile terminal apparatus 100 . furthermore , the proximity sensor 280 outputs the detected results to the controlling part 170 as an electric signal . moreover , the results detected by the proximity sensor 280 are stored in the proximity buffer 675 . for example , when a user talks and brings an ear close to the terminal , the proximity sensor 280 detects as in proximity . on the other hand , when a user moves the terminal away from an ear , the proximity sensor 280 detects as not in proximity . the proximity sensor 280 is , for example , an infrared sensor and an ultrasound sensor etc . fig7 is a drawing showing a configuration provided in the controlling part 170 for executing the programs stored in the ram 190 . the controlling part 170 comprises an incoming / outgoing call - processing part 710 , determining part 720 , state - detecting part 730 , and notifying part 740 . the incoming / outgoing call - processing part 710 executes incoming / outgoing call program 620 stored in the ram 190 . the determining part 720 determines what is to be executed by an input received from a user at the operating part 120 or at the touch panel input part 115 . for example , the determining part 720 determines an input received at the operating part 120 or at the touch panel input part 115 from a user is whether or not an input to open the address book 640 , whether or not an input to start talking , whether or not an input to start an incoming call . furthermore , the determining part 720 determines whether or not the mobile terminal apparatus 100 is being held by a user . the determination is made based on whether or not the operating part 120 or the touch panel input part 115 has received an input from the user . the state - detecting part 730 determines whether the orientation of the mobile terminal apparatus 100 is correct or not based on the angle of inclination detected by the angle - detecting part 165 . the correct orientation means an orientation that does not cause a problem for a user to talk using the mobile terminal apparatus 100 while the speaker 140 is in a position higher than the microphone 150 . the incorrect orientation means an orientation that causes a problem for a user to talk using the mobile terminal apparatus 100 while the speaker 140 is in a position lower than the microphone 150 . next , a method of determining the orientation of the mobile terminal apparatus 100 conducted by the state - detecting part 730 is described . a state in which the microphone 150 is on the upper side from the normal surface 510 is defined as an inclining direction of +, and in a case of an angle detected by the angle - detecting part 165 is 1 degree to + 180 degrees , the determining part 720 determines that the mobile terminal apparatus 100 is held in a correct orientation . and a state in which the microphone 150 is on the lower side from the normal surface 510 is defined as an inclining direction of −, and in a case of an angle detected by the angle - detecting part 165 is 0 degree to − 179 degrees , the determining part 720 determines that the mobile terminal apparatus 100 is held in an incorrect orientation . that is , in a state illustrated in fig5 b and fig5 c , because the state of the microphone 150 is in a position lower than the speaker 140 , the determining part 720 determines that the mobile terminal apparatus 100 is held in an orientation that does not cause a problem for a user to talk . on the other hand , in a state illustrated in fig5 d and fig5 e , because the state of the microphone 150 is in a position higher than the speaker 140 , the determining part 720 determines that the mobile terminal apparatus 100 is held in an orientation that causes a problem for a user to talk . the notifying part 740 notifies a user when the state - detecting part 730 determines that the orientation of the mobile terminal apparatus 100 is incorrect . as a notifying method , for example , the notification data 680 stored in the ram 190 is displayed on the display part 110 via the display control part 106 . furthermore , when the state - detecting part 730 determines that the orientation of the mobile terminal apparatus 100 is incorrect , the notifying part 740 notifies the user that the orientation of the mobile terminal apparatus 100 is incorrect by controlling the speaker 140 as well as the light - emitting part 130 via the controlling part 170 . here , one example of the notification data 680 to be displayed on the display part 110 is shown in fig9 and fig1 . fig9 is notification data 680 for a notification when the mobile terminal apparatus 100 had an incoming call . in the image shown in fig9 a , a user is urged to hold the mobile terminal apparatus 100 in a correct orientation by being informed of the position of the microphone 150 and the speaker 140 . in the image shown in fig9 b , the user is urged to hold the mobile terminal apparatus 100 in a correct orientation by being informed of the position of the microphone 150 and the speaker 140 , with a warning to the user that the mobile terminal apparatus 100 is being held in an inverse orientation . while such an image as in fig9 ) is being displayed , if the user holds the mobile terminal apparatus 100 in a correct orientation , a phone call can be started either by selecting “ answer ”, which is displayed on the screen or inputting to start a call on the operating part 120 . the image shown in fig1 is an image to be displayed on the display part 110 when the user makes an outgoing call while the user is holding the mobile terminal apparatus 100 in an incorrect orientation . in the image shown in fig1 a , the user is urged to hold the mobile terminal apparatus 100 in a correct orientation by being informed of the position of the microphone 150 and the speaker 140 . in the image shown in fig1 b , the user is urged to hold the mobile terminal apparatus 100 in a correct orientation by being notified that the mobile terminal apparatus 100 is being held in an inverse orientation . while the notifying part 740 is in the middle of notifying , if there is an input from a user to respond to an incoming call or start an outgoing call at the operating part 120 or the touch panel input part 115 , the operation control part 750 controls to cancel these inputs as invalid . the risk that the user will start talking while in an orientation that could cause a problem for the call may be reduced by controlling the inputs as invalid . next , the incoming / outgoing call program 620 processed by the incoming / outgoing call - processing part 710 is described using fig8 . in the incoming / outgoing call program 620 , first , the determining part 720 determines whether there is an incoming call or not at the mobile terminal apparatus 100 ( s 150 ). if the determining part 720 determines that there is no incoming call at the mobile terminal apparatus 100 , the incoming / outgoing call - processing part 710 moves to a process in the flow chart shown in fig1 . on the other hand , when the controlling part 170 determines that there is an incoming call via the antenna 250 , next , the angle - detecting part 165 detects the angle of inclination of the mobile terminal apparatus 100 ( s 160 ). next , the state - detecting part 730 determines whether or not the mobile terminal apparatus 100 is being held by the user in a correct orientation based on the angle detected by the angle - detecting part 165 ( s 170 ). in s 150 , if the state - detecting part 730 determines that the mobile terminal apparatus 100 is being held in a correct orientation by the user , subsequently , the determining part 720 determines whether there was an input or not by the user to start a call at the operating part 120 or the touch panel input part 115 ( s 180 ). if the determining part 720 determines that there was an input to start a call , next , a talking part starts a call by controlling the wireless circuit 240 ( s 190 ). on the other hand , if the determining part 720 determines that there was no input to start a call , the incoming / outgoing call - processing part 710 again executes a process s 160 . in the process s 170 , if the state - detecting part 730 determines that the mobile terminal apparatus 100 is being held by the user in an incorrect orientation , the incoming / outgoing call - processing part 710 executes the process s 175 . in the process s 175 , the notifying part 740 displays an image as shown in fig9 on the display part 110 via the display control part 106 . displaying such an image as shown in fig9 notifies the user that the mobile terminal apparatus 100 is being held in an incorrect orientation and reduces the risk of starting to talk while the mobile terminal apparatus 100 is being held in an incorrect orientation . after executing the process s 175 , the incoming / outgoing call - processing part 710 again executes the process s 160 . next , a process related to an outgoing call when determined by the controlling part 170 that there is no incoming call in the process s 150 is described using fig1 . in s 150 , when the controlling part 170 determines that there is no incoming call with respect to the mobile terminal apparatus 100 via the antenna 250 , next , the determining part 720 determines whether there was an input or not by the user at the operating part 120 or at the touch panel input part 115 to open the address book 640 ( s 210 ). if the determining part 720 determines that there was an input by the user to open the address book 640 using the operating part 120 or the touch panel input part 115 , the display control part 106 causes the display part 110 to display information regarding address that has been stored in the address book 640 ( s 220 ). next , based on an input by the user using the operating part 120 or the touch panel input part 115 to select a phone number that is included in the information regarding address , the controlling part 170 temporarily stores the selected phone number in the phone number selection buffer 660 ( s 230 ). on the other hand , if the determining part 720 determines that the input by the user to open the address book 640 using the operating part 120 or the touch panel input part 115 has not been received , subsequently , it is determined whether an input of a phone number was received or not ( s 212 ). if the determining part 720 determines that there was an input of a phone number by the user , the display control part 106 displays a phone number display image on the display part 110 ( s 214 ). next , the controlling part 170 temporarily stores , in the phone number input buffer 670 , the phone number that has been input by the user at the operating part 120 or the touch panel input part 115 ( s 216 ). on the other hand , if the determining part 720 determines that there was no input of a phone number , the incoming / outgoing call - processing part 710 again executes the process s 110 in fig8 . after receiving the input to select a phone number by the user using the operating part 120 or the touch panel input part 115 in the process of either s 230 or s 216 , next , the angle - detecting part 165 detects the angle of inclination of the mobile terminal apparatus 100 ( s 240 ). next , the state - detecting part 730 determines whether or not the mobile terminal apparatus 100 is being held by the user in a correct orientation based on the detected angle of inclination ( s 250 ). if the state - detecting part 730 determines that the mobile terminal apparatus 100 is being held in a correct orientation by the user , next , the determining part 720 determines whether or not there was an input at the operating part 120 or the touch panel input part 115 by the user to start a call ( s 260 ). if the determining part 720 determines that there was an input at the operating part 120 or the touch panel input part 115 to start a call by the user , the controlling part 170 controls the wireless circuit 240 and start the call ( s 270 ). on the other hand , if the determining part 720 determines that the operation to start a call was not input by the user at the operating part 120 or the touch panel input part 115 , the incoming / outgoing call - processing part 710 again executes the process s 240 . in the process s 250 , if the state - detecting part 730 determines that the mobile terminal apparatus 100 is being held by the user in an incorrect orientation , the notifying part 740 displays an image as shown in fig1 on the display part 110 via the display control part 106 . by displaying such an image shown in fig1 on the display part 110 , the user is notified that the mobile terminal apparatus 100 is being held in an incorrect orientation , thus , it reduces the risk of starting a call while the mobile terminal apparatus 100 is being held in an incorrect orientation . the embodiment above is one example of the embodiments related to the mobile terminal apparatus 100 in the present invention and may be changed appropriately within the scope according to the aspect of the embodiment of the present invention . for example , the timing for the notifying part 740 to notify may also be a time when a user enters an input at the operating part 120 or the touch panel input part 115 to open the address book 640 . the other timing for the notification may also be a time when a numerical key pad is displayed on the display part 110 that the mobile terminal apparatus 100 comprises and when the user starts entering a phone number at the operating part 120 or the touch panel input part 115 . the other timing for the notification may also be a time when the user completes the input of the phone number at the operating part 120 or the touch panel input part 115 . for example , the method of notification conducted by the notifying part 740 may also be conducted by the display control part 106 as a result of inverting an image to be displayed on the display part 110 . for example , the notifying part 740 notifies the user that the orientation of the mobile terminal apparatus 100 is incorrect by controlling the speaker 140 as well as the light - emitting part 130 via the controlling part 170 , but the notification may also be conducted by the controlling part 170 by controlling the speaker 140 and the light - emitting part 130 without intervention by the notifying part 740 . for example , the notification method conducted by the notifying part 740 may also be conducted by the display control part 106 , by not displaying a button on the display part 110 to start a call . specifically , it is also possible to not display the “ answer ” on the display part 110 in the images shown in fig9 a and b . furthermore , it is also possible not to display a “ call ” button on the display part 110 in the images shown in fig1 a and b . as described above , the risk of the user being in a situation where a call becomes difficult is reduced by not displaying the “ answer ” for a response to an incoming call and the “ call ” to start an outgoing call . for example , the operating part may also be provided on the same plane as the display part 110 that is provided with the mobile terminal apparatus 100 . for example , as for the incoming / outgoing call program 620 , if there is an input by a user to interrupt the incoming / outgoing call program 620 either at the operating part 120 or the touch panel input part 115 , the incoming / outgoing call program 620 may be interrupted even in a case when any of processes is being executed . for example , in the present embodiment , while the notifying part 740 is notifying , if the operating part 120 or the touch panel input part 115 receives an input from the user to respond to an incoming call or receives an input to start an outgoing call , the operation control part 750 controls to cancel these inputs as invalid . however , as another example , it is also possible to start a call , regarding an input from the user to start a call as valid without controlling , by the operation control part 750 , the input operation from the user as invalid . for example , if a user is holding the mobile terminal apparatus 100 in an inverse orientation , images or video acquired by the imaging part 260 are stored in the rom 180 , ram 190 , or the external memory 210 after inverting the orientation . in such a case , in the event of displaying the stored images and the video on the display part 110 , the notifying part 740 may also notify that the orientation has been inverted for the display . for example , if the user is holding the mobile terminal apparatus 100 in an inverse orientation , operations related to functions that could cause a problem for the use are cancelled as invalid by the operation control part 750 . specifically , if the user is holding the mobile terminal apparatus 100 in an inverse orientation , operations related to the imaging part 260 are cancelled as invalid by the operation control part 750 . and the notifying part 740 may also display such an image as shown in fig9 b on the display part 110 . in the above embodiment , if the user corrects the way of holding the mobile terminal apparatus 100 in a correct orientation , it is also possible to regard input operations from the user with respect to the imaging part 260 as valid . for example , the present invention may also be implemented when an input is received from the user using the operating part 120 or the touch panel input part 115 to replay sound recorded in the recording part 260 , or when an input is received to start recording sound in the recording part 260 . that is , if the mobile terminal apparatus 100 detects the orientation in a case of replaying the recorded sound by an operation from the user and in a case of recording sound by the user , and if it is determined that the mobile terminal apparatus 100 is being held by the user in an incorrect orientation , a notification may also be provided . such a process executed by the mobile terminal apparatus 100 reduces the risk of generating a problem in the event when the recording function is used by the user . for example , while a user is holding the mobile terminal apparatus 100 in an incorrect orientation and if an incoming call is received at the mobile terminal apparatus 100 , it is also possible not to display a button for responding to the incoming call on the display part 110 as shown in fig1 a . furthermore , as shown in the dotted line in fig1 b , a button related to a response to be displayed on the display part 110 may also be displayed with a lower luminance . such a display on the display part 110 by the mobile terminal apparatus 100 reduces the risk of creating a state in which a phone call becomes difficult when a user responds to the incoming call . furthermore , also when a user makes an outgoing call , screens as shown in fig1 a and 13b may be displayed on the display part 110 by the mobile terminal apparatus 100 . such a display on the display part 110 by the mobile terminal apparatus 100 reduces the risk of creating a state in which a phone call becomes difficult when a user talks . for example , when the proximity sensor 280 detects a subject to be detected is in proximity during a call , the mobile terminal apparatus 100 switches off the display of the display part 110 . furthermore , the mobile terminal apparatus 100 may also switch off a back - light arranged at a liquid crystal display constituting the display part 110 . that is , while a user is using the mobile terminal apparatus 100 against an ear , it is also possible for the mobile terminal apparatus 100 to not display an image on the display part 110 for the purpose of saving power . moreover , after the proximity is detected by the proximity sensor 280 during a call , when the proximity is no longer detected , such processes in s 160 to 5175 shown in fig8 or s 240 to s 255 shown in fig1 may also be executed again . that is , while a user is on the phone with an ear against the mobile terminal apparatus 100 , after placing the mobile terminal apparatus 100 on the desk etc . when the same is held in a hand again , the mobile terminal apparatus 100 detects the orientation of being held . and if the mobile terminal apparatus 100 is being held in an incorrect orientation and such is detected , the matter of the incorrect orientation may also be notified to the user . such a process executed by the mobile terminal apparatus 100 reduces the risk of the user causing a problem in talking . while at least one exemplary embodiment is presented in the foregoing detailed description , the present disclosure is not limited to the above - described embodiment or embodiments . variations may be apparent to those skilled in the art . in carrying out the present disclosure , various modifications , combinations , sub - combinations and alterations may occur in regard to the elements of the above - described embodiment insofar as they are within the technical scope of the present disclosure or the equivalents thereof . the exemplary embodiment or exemplary embodiments are examples , and are not intended to limit the scope , applicability , or configuration of the disclosure in any way . rather , the foregoing detailed description will provide those skilled in the art with a template for implementing the exemplary embodiment or exemplary embodiments . it should be understood that various changes can be made in the function and arrangement of elements without departing from the scope of the disclosure as set forth in the appended claims and the legal equivalents thereof . furthermore , although embodiments of the present disclosure have been described with reference to the accompanying drawings , it is to be noted that changes and modifications may be apparent to those skilled in the art . such changes and modifications are to be understood as being comprised within the scope of the present disclosure as defined by the claims . terms and phrases used in this document , and variations hereof , unless otherwise expressly stated , should be construed as open ended as opposed to limiting . as examples of the foregoing : the term “ including ” should be read as mean “ including , without limitation ” or the like ; the term “ example ” is used to provide exemplary instances of the item in discussion , not an exhaustive or limiting list thereof ; and adjectives such as “ conventional ,” “ traditional ,” “ normal ,” “ standard ” “ known ” and terms of similar meaning should not be construed as limiting the item described to a given time period or to an item available as of a given time , but instead should be read to encompass conventional , traditional , normal , or standard technologies that may be available or known now or at any time in the future . likewise , a group of items linked with the conjunction “ and ” should not be read as requiring that each and everyone of those items be present in the grouping , but rather should be read as “ and / or ” unless expressly stated otherwise . similarly , a group of items linked with the conjunction “ or ” should not be read as requiring mutual exclusivity among that group , but rather should also be read as “ and / or ” unless expressly stated otherwise . furthermore , although items , elements or components of the present disclosure may be described or claimed in the singular , the plural is contemplated to be within the scope thereof unless limitation to the singular is explicitly stated . the presence of broadening words and phrases such as “ one or more ,” “ at least ,” “ but not limited to ” or other like phrases in some instances shall not be read to mean that the narrower case is intended or required in instances where such broadening phrases may be absent . the term “ about ” when referring to a numerical value or range is intended to encompass values resulting from experimental error that can occur when taking measurements .	7
description will now be given in detail of the present invention , with reference to the accompanying drawings . the present invention can be implemented in a supl network . however , the present invention may be employed to radio ( wireless ) communication systems which are operated based upon different specifications . hereinafter , the preferred embodiments of the present invention will be explained . the present invention proposes a periodic positioning method in a supl based position information ( positioning ) system . especially , the present invention proposes a method for performing a periodic positioning by allowing each of server and terminal to manage a trigger generating the periodic positioning . in general , location services provided in a supl based positioning system may classified into a service by a network ( i . e ., network - initiated case ) and a service by a set ( i . e ., set - initiated case ). the location services may be classified into a proxy mode that the set performs positioning by directly exchanging messages with a h - slp of a home network , and a non - proxy mode that the set performs positioning by exchanging messages with a supl location center ( slp ) and a supl positioning center ( spc ) within the h - slp . in the present invention , a periodic positioning is divided into a network - trigged case or a set - trigged case according to a subject which manages trigger information . the divided cases will be re - classified into a service by a network ( i . e ., network - initiated case and a service by the set ( i . e ., set - initiated case ) to thusly be explained . fig1 is a view illustrating a periodic positioning procedure in accordance with a first embodiment of the present invention . the first embodiment of the present invention illustrates a network - trigged case and a network - initiated case for a non - roaming proxy mode . here , the slp corresponds to a network side , while a target set ( referred to as set hereafter ) corresponds to a terminal side . when an outer lcs client requests a periodic positioning , a supl agent requests the positioning from the slp using a mobile location protocol ( mlp ) trigged location reporting request ( tlrr ) message ( s 10 ). the mlp tlrr message may include parameters such as ms - id , client - id , qop , and tlrr_event which is a positioning related trigger parameter . here , ms - id denotes a positioning target ( set ), qop denotes an accuracy ( e . g ., a time delay and a spatial accuracy ) of a result for the positioning ( location tracking ) desired by the client , and tlrr_event denotes a definition of the ‘ periodic ’, namely , a starting time and ending time of the periodic positioning ( e . g ., 8 am to 10 am ) and a request period for the periodic positioning ( e . g ., a one - hour interval ). the mlp tlrr message may further include parameters related to types of the positioning values ( which , for example , represent a current value or a value obtained in the latest time when it is difficult to tracking the current value ), and parameters for setting priorities with respect to each positioning request for several positioning requests . the slp having received the mlp tlrr message checks whether the set can supports the supl by using a lookup table , and then checks whether the target set is currently supl roaming using routing information ( s 11 ). if it is checked that the set supports the supl and is not roaming , the slp sends a supl initiating message supl init to the set to start a supl procedure with the set ( s 12 ). the supl init message may include session - id , slp mode , supl mode , positioning method ( posmethod ) to be used , and the like . here , the slp mode denotes an operation mode of the slp ( i . e ., a proxy mode or a non - proxy mode ), the supl mode denotes types of positioning ( e . g ., immediate , periodic , deferred ), namely , trigger type information . here , the supl mode denotes a periodic service type positioning . also , the slp confirms a privacy of the set prior to performing the step s 11 . if the user requires a notification related to location ( position ) information , the slp further includes a notification parameter in the mlp tlrr message . hence , the slp sends the supl init message by including periodic trigger information therein . this parameter may be used to inform of information related to the periodic positioning and of the corresponding positioning being executed by the slp ( i . e ., network - trigged case ). here , the supl init message may be sent in forms of a wireless application protocol ( wap ) push , a short message service ( sms ) trigger , a session initiation protocol ( sip ) push , or the like , for example . the set having received the supl init message requests a data connection from a packet data network ( i . e ., 3gpp or 3gpp2 ) when any data connection is not currently set between the set itself and a certain network ( s 13 ). once setting the data connection , the set stores the trigger information sent by the supl init message , and then sends a supl start message to the slp ( s 14 ). here , the set sends set capability information by including it in the supl start message . the slp sends acknowledgement ( i . e ., whether the positioning can be performed ) with respect to the corresponding positioning request to the supl agent by using a mlp trigged location reporting answer ( tlra ) message exchanged ( s 15 ). thereafter , the slp sends a supl response message to the set in response to the supl start message ( s 16 ). here , the supl response message may be replaced with a supl trigger message . in this case , the step s 16 is not performed . afterwards , when a particular event is generated ( for every certain period ) based upon the stored trigger information , the slp sends the supl trigger message to the set to start a positioning procedure ( s 17 ). the set then sends a supl position initiating message ( i . e ., supl pos init ) to the slp so as to start a trigger session with the slp ( s 18 ). the supl pos init message may include at least location identifiers lid indicating a session id , a base station id , or the like , versions , set capabilities , and the like . accordingly , the slp and the set exchange ( send and receive ) consecutive messages to execute an actual positioning , and then the slp or set calculates a position of the set by virtue of the consecutive messages ( s 19 ). preferably , the messages exchanged between the slp and the set may include a session id , protocols to be used for the positioning ( e . g ., rrlp , rrc or tia - 801 ), etc . here , the positioning for the set may be performed by the slp based upon a positioning measurement value received from the set ( i . e ., set - assisted mode ), or be performed by the set based upon assistance obtained from the slp ( i . e ., set - based mode ). fig1 illustrates an example that the positioning is performed in the set - assisted mode . however , if the positioning is performed in the set - based mode , the set sends the calculated position value ( i . e ., posresult ) to the slp using a supl report message ( s 20 ). therefore , the slp sends the position value , which is calculated by the slp itself or transferred from the set , to the supl agent using a tlrep message ( s 21 ). afterwards , in the succeeding positioning period , the slp and the set perform the positioning for the corresponding period by using the supl trigger message , the supl pos init message , the supl pos procedure , the supl report message , the mlp tlrep message , and thereafter send a calculated position value of the set to the supl agent ( s 22 ˜ s 26 ). then , when the series of periodic positioning procedures are all terminated ( ended ) ( i . e ., when a positioning ending time arrives ), the slp sends a supl end message to inform the set of the termination of the supl procedure ( or supl session ) ( s 27 ). the set then releases an ip connection with the slp and releases all of the resources related to the positioning session . on the other hand , in fig1 , the supl start and supl response may be omitted . in this case , the mlp tlra message may be sent following the supl pos init message . fig2 is a view illustrating a periodic positioning procedure in accordance with a second embodiment of the present invention , which illustrates an example that a period for the periodic positioning is relatively longer than that in the first embodiment . as illustrated in fig2 , for a long period for the periodic positioning , the slp terminates ( ends ) the positioning for one period at the end of every period using a supl end message ( here , the supl connection other than the supl session is released ( disconnected )) ( s 41 ). the slp then executes the positioning for the succeeding period at a starting point of the succeeding period by using the supl trigger again ( s 43 ). here , the steps ( s 30 ˜ s 40 ) are the same as the steps ( s 10 ˜ s 20 ) of fig1 except their numerals , detailed explanation for which will not be repeated accordingly . that is , when the periodic positioning procedure with respect to one period is terminated ( ended ) ( s 39 ), the slp sends a supl end message to the set to release the supl pos connection with respect to one period ( s 41 ). the slp then sends a corresponding periodic positioning value to the supl agent using the mlp tlrep message ( s 42 ). afterwards , the slp connects ( opens ) the released supl pos connection using the supl trigger message , and informs the set of the performance of the positioning with respect to the succeeding period ( s 43 ). accordingly , when the corresponding event is generated , the slp and the set execute the positioning for the corresponding period using the supl pos init message , the supl pos procedure , and the supl report and mlp tlrep messages , and then sends the corresponding position value to the supl agent ( s 44 ˜ s 47 ). when the series of the periodic positioning procedures are all terminated ( ended ), the slp sends the supl end message to the set to inform of the termination of the supl procedure ( s 48 ). fig3 is a view illustrating a periodic positioning procedure in accordance with a third embodiment of the present invention . the third embodiment of the present invention illustrates a network - trigged case and a set - initiated case for a non - roaming proxy mode . here , the slp corresponds to a home network side , while a target set ( referred to as set hereafter ) corresponds to a terminal side . first , when a supl agent requests a periodic positioning , the set requests a data connection from a packet data network ( e . g ., 3gpp or 3gpp2 ) when any data connection is not currently set between the set itself and a certain network ( s 50 ). once setting the data connection , the set sends a supl start message to the slp to start a periodic positioning request procedure ( s 51 ). the set includes a report_criteria parameter in the supl start message so as to set a period , a starting time and an ending time of the periodic positioning request . the set then sends the set information to the slp . the slp having received the supl start message stores the periodic positioning information , and checks whether the set is currently supl roaming using routing information ( s 52 ). if it is checked that the set is not supl roaming , the slp sends a supl response message in response to the supl start message ( s 53 ). afterwards , when the corresponding event is generated , the slp sends a supl trigger message to the set to start the periodic positioning procedure ( s 54 ). the set sends the supl pos init message to the slp so as to start a trigger session with the slp ( s 55 ). here , for the initial period positioning generated , the supl trigger message may be replaced with the supl response message of the step ( s 53 ), or the supl response message may be replaced with the supl trigger message of the step ( s 54 ). accordingly , the slp consecutively exchanges ( sends and receives ) positioning protocols ( e . g ., rrlp , rrc , tia - 801 , etc .) with the set using the supl pos message for performing the positioning , thereby calculating the position of the set ( s 56 ). here , the positioning for the set can be performed by the slp based upon a positioning measurement value received from the set ( i . e ., set - assisted mode ), or be performed by the set based upon assistance obtained from the slp ( i . e ., set - based mode ). if the positioning is performed in the set - assisted mode , the slp sends the calculated position value ( i . e ., posresult ) to the set using a supl report message ( s 57 ). if the positioning is performed in the set - based mode , the slp does not send the supl report message to the set hence , the set sends the position value calculated by the set itself or the position value received from the slp to the supl agent . afterwards , in the succeeding positioning period , as aforementioned , the slp and the set performs the positioning for the corresponding period using the supl trigger message , the supl pos init message , the supl pos procedure , and the supl report message to thereafter send the calculated position value of the set to the set ( s 58 ˜ s 61 ). then , when the entire periodic positioning procedures are terminated ( ended ), the slp sends the supl end message to the set to inform the set of the termination of the supl procedure ( or the supl session ) ( s 62 ). the set then releases the ip connection with the sip and releases all of the resources related to the positioning session . fig4 is a view illustrating a periodic positioning procedure in accordance with a fourth embodiment of the present invention , which illustrates an example that a period for the periodic positioning is relatively longer than that in the third embodiment . as illustrated in fig4 , for a long period for the period positioning , the slp terminates ( ends ) the positioning with respect to one period at the end of every period using the supl end message ( i . e ., releases or disconnects the supl connection ) ( s 78 ). the slp then performs the positioning for the succeeding period at the starting point of the succeeding period by using the supl trigger again ( s 79 ). here , the steps ( s 70 ˜ s 77 ) are the same as the steps ( s 50 ˜ s 57 ) except their reference numerals , detailed explanation for which will not be repeated accordingly . that is , when the periodic positioning procedure for one period is terminated ( ended ) ( s 76 ), the slp sends the supl end message to the set and then releases the supl pos connection ( or trigger connection ) with respect to one period ( s 78 ). afterwards , the slp sends the supl trigger message to the set to inform the set of the performance of the positioning with respect to the succeeding period ( s 79 ). here , when any data connection is set between the set itself and a certain network , the set can request the data connection from a packet data network ( e . g ., 3gpp or 3gpp2 ). accordingly , when the corresponding event is generated , the slp and the set perform the positioning for the corresponding period using the supl pos init message , the supl pos procedure , and the supl report message , and , in some cases , send the corresponding position value to the set ( s 80 ˜ s 82 ). when the series of the periodic positioning procedures are terminated ( ended ), the slp sends the supl end message to the set to inform the set of the termination of the entire supl procedure ( or the trigger session ) ( s 83 ). fig5 is a view illustrating a periodic positioning procedure in accordance with a fifth embodiment of the present invention . the fifth embodiment of the present invention illustrates a set - trigged case and a network - initiated case for a non - roaming proxy mode . here , the slp corresponds to a home network side , while a target set ( referred to as set hereafter ) corresponds to a terminal side . first , when an outer lcs client requests a periodic positioning , the supl agent requests the positioning from the slp using a mlp tlrr message ( s 90 ). the mlp tlrr message , as aforementioned , may include parameters such as ms - id , client - id , qop , tlrr_event , and the like . tlrr_event denotes a definition of the ‘ periodic ’, namely , a starting time and ending time of the periodic positioning ( e . g ., 8 am to 10 am ) and a request period for the periodic positioning ( e . g ., a one - hour interval ). the mlp tlrr message may further include parameters related to types of the positioning values ( which , for example , represent a current value or a value obtained in the latest time when it is difficult to tracking the current value ), and parameters for setting priorities with respect to each positioning request for several positioning requests . upon receiving the mlp tlrr message , the slp checks whether the set can support the supl using a lookup table , and checks whether the target set is currently supl roaming using routing information ( s 91 ). if it is checked that the set supports the supl and not roaming , the slp sends a supl init message to the set to start a supl procedure ( s 92 ). the supl init message must at least include parameters such as session - id , posmethod , slp mode , supl mode , and the like . the supl mode denotes trigger type information , which indicates a periodic service type in the fifth embodiment of the present invention . the slp checks a privacy of the set prior to performing the step s 91 . if a user requires a notification related to position information , a notification parameter is additionally included in the mlp tlrr message . the slp includes a report_criteria parameter which is a trigger parameter ( or trigger information ) in the supl init message for sending . the slp uses the report_criteria parameter to send trigger information related to the periodic positioning received from the outer lcs client to the set . that is , the slp forwards the trigger information which generates the periodic positioning to the set ( i . e ., set - trigged case ) so as to allow a performance of an actual positioning procedure when the corresponding event is generated in the set . for example , the report_criteria may include a period , a starting time and an ending time for requiring the periodic positioning request . when any data connection is not set between the set itself and a certain network , the set having received the supl init message requests the data connection from a packet data network ( e . g ., 3gpp or 3gpp2 ) ( s 93 ). upon setting the data connection , the set stores the trigger information sent through the supl init message and thereafter sends a supl start message to the slp ( s 94 ). here , the set sends set capability information by including it in the supl start message . the slp sends acknowledgement with respect to the corresponding positioning request to the supl agent by using a mlp tlra message ( s 95 ). the slp then sends a supl response message in response to the supl start message to allow the set to start the positioning procedure when the corresponding event is generated ( s 96 ). afterwards , when the corresponding event is generated based upon the stored trigger information ( i . e ., per period for the periodic positioning ), the set sends the supl pos init message to the slp to start the positioning procedure with the slp ( s 97 ). here , if a tcp / ip connection set between the slp and the set is terminated ( released ) after sending the supl response message , the set must reset the data connection prior to sending the supl pos init message . accordingly , the set consecutively exchanges messages for performing an actual positioning with the slp to calculate the position of the set ( s 98 ). here , the positioning for the set may be performed by the slp based upon a positioning measurement value received from the set ( i . e ., set - assisted mode ), or be performed by the slp based upon assistance obtained from the slp . upon performing the positioning in the set - based mode , the set sends the calculated position value ( i . e ., posresult ) to the slp using the supl report message ( s 99 ). upon performing the positioning in the set - assisted mode , the slp does not send the supl report message . accordingly , the slp sends the corresponding positioning value to the supl agent using the tlrep message ( s 100 ). in the succeeding positioning period , the slp and the set perform the positioning of the corresponding period by using the supl pos init message , the supl pos procedure , the supl report message , and the mlp tlrep message , and thereafter send a calculated position value of the set to the supl agent ( s 101 ˜ s 104 ). afterwards , when the series of the periodic positioning procedures are terminated ( ended ) ( i . e ., at the positioning ending time ), the slp sends a supl end message to the set to inform the set of the termination of the supl procedure ( or supl session ). the set then releases the ip connection with the slp and releases all of the resources related to the positioning session . in fig5 , on the other hand , the supl start and supl report messages may be omitted . in this case , the mlp tlra message may be sent after sending the supl pos init message . fig6 a view illustrating a periodic positioning procedure in accordance with a sixth embodiment of the present invention , which illustrates an example that a set can open or connect a supl session for every period when a period for the periodic positioning is relatively longer than that in the fifth embodiment . as illustrated in fig6 , for a long period for the periodic positioning , the slp terminates ( ends ) the positioning for one period at the end of every period using a supl end message ( here , the supl connection is released ( disconnected )) ( s 120 ). the set then re - sends the supl start message to the slp at a starting point of the succeeding period to perform the positioning for the succeeding period ( s 122 ). here , the steps ( s 110 ˜ s 119 ) are the same as the steps ( s 90 ˜ s 99 ) except their reference numerals , detailed explanation for which will not be repeated accordingly . that is , when the periodic positioning procedure for one period is terminated ( s 118 ), the slp sends the supl end message to the set to release a supl pos connection for the one period ( s 120 ). the slp thereafter sends the corresponding periodic positioning value to the supl agent using the mlp tlrep message ( s 121 ). then , in the succeeding positioning period , the set performs the positioning for the corresponding period using the supl start , supl reponse , supl pos init messages , the supl pos procedure , and the supl report and mlp tlrep messages , and thereafter sends the corresponding position value to the supl agent ( s 122 ˜ s 127 ). here , the supl start message may be used for informing the slp of the starting of the positioning for the succeeding period . when the series of the periodic positioning procedures are terminated ( ended ), the slp sends the supl end message to the set to inform the set of the termination of the supl procedure ( s 128 ). fig7 is a view illustrating a periodic positioning procedure in accordance with a seventh embodiment of the present invention . the seventh embodiment illustrates an example that the slp sends the report_criteria using a new supl trigger request message when the slp can not send the report_criteria using the supl init message due to a limitation on the size of the supl init message . that is , the seventh embodiment of the present invention is different from the fifth embodiment in view of the addition of supl trigger request and supl trigger response message , and also in view of the addition of a supl mode ( which is a parameter for identifying immediate , periodic , or deferred positioning ) to the supl init message . other steps are the same as those in the fifth embodiment except their reference numerals . hence , upon performing the aforementioned steps ( s 130 ˜ s 134 ), the slp sends information related to the periodic positioning to the set using a supl trigger request message ( s 135 ), so as to make the set arrange the periodic positioning according to the corresponding information and to allow the set to separately perform a user confirmation . the set stores the periodic trigger information sent by the supl trigger request message and thereafter sends a supl trigger response message in response to the supl trigger request message ( 136 ). however , unlike fig5 , as illustrated in fig7 , the slp receives the supl trigger response message from the set and then sends a mlp tlra message to the supl agent ( s 137 ). since the slp sends to the set the supl trigger request message which includes the trigger information related to the periodic positioning , and then receives from the set the supl trigger response message in response to the supl trigger request message , only the reception of the supl trigger response message can inform that the trigger information related to the periodic positioning has completely sent to the set . however , the supl trigger response message can be omitted . in this case , the slp sends the supl trigger request message and then immediately sends the mlp tlra message to the supl agent . the supl init message can be sent in a sms sending manner . accordingly , when the report_criteria parameter can not be all included in the sms , the supl trigger request message may denote a message for separately sending the report_criteria parameter , and the supl trigger response message corresponds to a message in response to the supl trigger request message . therefore , both the supl start message and the supl response message can be omitted in fig5 . in fig7 , however , for sending the trigger information related to the periodic positioning by the supl trigger request message and receiving the supl trigger response , the set must first send the supl start message to the slp to obtain an acceptance from the slp with respect to the periodic positioning included in the supl init . accordingly , only the supl response message may be omitted . even in the seventh embodiment of the present invention , for the long period for the periodic positioning , a procedure can be changed so as to be able to open ( connect ) the supl session by the set per every period . in this case , the supl start message and the supl response message are added for every positioning period prior to sending the supl pos init message . if the supl report message is not used ( required ), the supl end message is added following the supl pos procedure . if the supl report message is used , the supl end message is added following the supl report message . fig8 is a view illustrating a periodic positioning procedure in accordance with an eighth embodiment of the present invention . the eighth embodiment illustrates a set - trigged case and a set - initiated case for a non - roaming proxy mode . first , when a supl agent requests a periodic positioning , if any data connection is not set between the set and a certain network , the set requests the data connection from a packet data network ( e . g ., 3gpp or 3gpp2 ) ( s 150 ). upon setting the data connection , the set sends a supl start message to the slp to start a periodic positioning request procedure ( s 151 ). here , the set includes a tlrr_event parameter in the supl start message to set a period , a starting time and an ending time of the periodic positioning request , thereby sending the supl start message to the slp . that is , the set is performing the periodic supl procedure with managing trigger information , and accordingly the set may not send the tlrr_event parameter to the slp . however , the sending of the tlrr_event to the slp is to previously inform the slp of information related to resource management and the periodic positioning . the slp having received the supl start message checks whether the set is currently supl roaming using routing information ( s 152 ). if the set is not roaming , the slp sends a supl response message in response to the supl start message ( s 153 ). afterwards , when a certain event is generated based upon pre - stored trigger information ( at the positioning period ), the set sends a supl pos init message to the slp to start the periodic positioning procedure ( s 154 ). here , the set can inform the slp using an event_trigger parameter that the periodic positioning period has currently arrived and also can inform the slp of the remaining period of the entire positioning period using the event_trigger parameter . here , if a tcp / ip connection between the slp and the set is terminated after sending the supl response message , the set must reset the data connection prior to sending the supl pos init message . therefore , the set consecutively exchanges messages for performing an actual positioning with the slp to calculate the position of the set ( s 155 ). here , the positioning for the set may be performed by the slp based upon a positioning measurement value received from the set ( i . e ., set - assisted mode ), or be performed by the set based upon assistance obtained from the slp ( i . e ., set - based mode ). fig8 illustrates the positioning performed in the set - based mode . however , if the positioning is performed in the set - assisted mode , the slp sends the calculated position value ( i . e ., posresult ) to the set using the supl report message ( s 156 ). accordingly , the set sends the position value calculated by the set itself or the position value received from the slp to the supl agent . afterwards , in the succeeding positioning period , the slp and the set , as described above , perform the positioning for the corresponding period using the supl pos init message , the supl pos procedure , and the supl report message to thusly calculate the position value of the set ( s 157 ˜ s 159 ). then , when the series of periodic positioning procedures are all terminated ( ended ), the slp sends the supl end message to the set to inform the set of the termination of the supl procedure ( s 160 ). the set then releases the ip connection with the slp and also releases all of the resources related to the positioning procedure . fig9 is a view illustrating a periodic positioning procedure in accordance with a ninth embodiment of the present invention , which illustrates an example that a period for the periodic positioning is relatively longer than that in the eighth embodiment . as illustrated in fig9 , for a long period for the periodic positioning , the slp terminates ( ends ) the positioning for one period at the end of every period using the supl end message ( i . e ., releases or disconnects the supl connection ) ( s 176 ). the set re - sends the supl start message to the slp at the starting point of the succeeding period to perform the positioning for the succeeding period ( s 177 ). here , the steps ( s 170 ˜ s 175 ) are the same as the steps ( s 150 ˜ s 155 ) except their reference numerals , detailed explanation for which will not be repeated accordingly . that is , when the periodic positioning procedure for one period is terminated ( ended ) ( s 175 ), the slp sends the supl end message to the set and terminates ( ends ) the supl pos session for the one period ( s 176 ). afterwards , in the succeeding positioning period , the set re - performs the positioning for the corresponding period using the supl start , supl response , supl pos init , and supl pos procedure messages ( s 177 ˜ s 180 ). in this case , the tlrr_event of the supl start message includes a decreased period value . if any data connection is not set between the set itself and a certain network , the set requests the data connection from a packet data network ( e . g ., 3gpp or 3gpp2 ) prior to sending the supl start message . accordingly , when the series of periodic positioning procedure is terminated , the slp sends the supl end message to the set to inform the set of the termination of the supl procedure ( s 181 ). as described above , in the present invention , the periodic positioning method in the supl based position information system can be provided so as to enable a provisioning of various positioning methods to a user . as the present invention may be embodied in several forms without departing from the spirit or essential characteristics thereof , it should also be understood that the above - described embodiments are not limited by any of the details of the foregoing description , unless otherwise specified , but rather should be construed broadly within its spirit and scope as defined in the appended claims , and therefore all changes and modifications that fall within the metes and bounds of the claims , or equivalents of such metes and bounds are therefore intended to be embraced by the appended claims .	6
the present invention may be employed in detecting and / or quantifying targeted analytes present in chemical or biological substances . generally any analyte interaction that is stable under chemiluminescence activation conditions may be prepared in this assay system . although various types of chemiluminescent compounds having an acridinium , benzacridinium , or acridan type of heterocyclic ring systems are preferred labels , use of equivalent chemiluminescent compounds and means for activating the labels do not depart from the scope of this invention . acridinium and benzacridinium esters are currently the more preferred chemiluminescent compounds , with preferred acridinium esters including those compounds having heterocyclic rings or ring systems that contain the heteroatom in a positive oxidation state including such ring systems as acridinium , benz a ! acridinium , benz b ! acridinium , benz c ! acridinium , a benzimidazole cation , quinolinium , isoquinolinium , quinolizinium , a cyclic substituted quinolinium , phenanthridinium , and quinoxalinium , as are well - known in the art . the tracer may be prepared by attaching the selected binding conjugate either directly or indirectly with a reactive functional group present on the acridinium or benzacridinium ester , as is well known to those skilled in the art , e . g . weeks et al ., clinical chemistry , 29 ( 8 ), 1474 - 1479 , 1983 . particularly preferred compounds are acridinium and benzacridinium esters with an aryl ring leaving group and the reactive functional group present in either the para or the meta position of the aryl ring . particularly stable acridinium and benzacridinium esters are those having an aryl ring leaving group , with the aryl ring having an electron donating species ( preferably c 1 - c 4 alkyl or alkoxy group , most preferably methyl ) present in both ortho positions of the aryl ring and having the reactive functional group ( preferably a -- cooh which is converted to a n - succinimidyloxycarbonyl group prior to the attachment of the binding partner ) in the meta or para position ( most preferably para ), as described in u . s . pat . no . 4 , 745 , 181 and wo 94 / 21823 , both of which are incorporated by reference . the solid phase is preferably a metal oxide material preferably chromium oxide , iron oxide , nickel oxide , or any mixture thereof . the solid phase should be water insoluble and maintain structural integrity when exposed to water or biological fluids and may be particulate in nature ( varying from a finely divided material , such as that in a magnetic ferrofluid , to a coarse granular material ), or a shaped article ( such as beads , test tube trays , microtiter plate , membrane , film , filter paper , discs , and so on ). more preferably the solid phase particles comprise a core of iron oxide as described in u . s . pat . no . 4 , 554 , 088 , issued to whitehead , et al ., 1985 ( hereby incorporated by reference ). to assist in the attachment of the binding conjugate , preferably the metal oxide solid phase has present a bioaffinity substance present thereon . silane polymeric coatings are particularly preferred bioaffinity substances and generally may be defined as organofunctional and silicon - functional compounds that are characterized in that the silicon portion of the molecule has an affinity for inorganic materials while the organic portion of the molecule is tailored to combine with organics . preferably chemical reactions to attach the binding conjugate to the solid phase include , but are not limited to , diazotization , carbodiimide and glutaraldehyde couplings . coupling techniques that may be used are described in method of enzy ., 70 , p . 159 - 165 ( 1980 ), and groman , e . v ., et al , in bio techniques , vol . 3 , pp . 156 ( 1985 ), and u . s . pat . no . 4 , 672 , 040 , issued to josephson in 1987 ( each of which are hereby incorporated by reference ). if the present invention is practiced with gene probes , nucleic acid hybridization may be accomplished using the metal oxide solid phase where the hybridizations are carried out by dispersing a nucleic acid - coupled solid phase ( most preferably a dna oligomer ) in a reaction mixture containing molecules to be isolated , allowing the nucleic acid - coupled solid phase to hybridize to a complementary target sequence . chemiluminescent light emission of the acridinium ester compounds may be triggered by known activating reagents , typically a base and h 2 o 2 ( including h 2 o 2 producing compounds ) or o 2 present in a solvent ( s ) including water , ethers , esters , alcohols , and ketones , and mixtures thereof . according to the invention , the activating reagent ( s ) is contacted with the entire reaction mixture after the binding reaction has occurred ( i . e . the specific binding complex bound to the solid phase is not separated from the free fraction ). preferably , the activating agent is actually two separate reagents as described below as the &# 34 ; first &# 34 ; reagent ( added first to the reaction mixture ) and the &# 34 ; second &# 34 ; reagent ( added to the reaction mixture promptly after the first reagent ). the first reagent is an aqueous acidic hydrogen peroxide solution and the second reagent is a basic aqueous reagent and the chemiluminescent light is measured promptly (&# 34 ; promptly &# 34 ; defined herein as a time period not to exceed several minutes , more preferably less than one minute , most preferably about 0 . 1 second or so after the second reagent is added to the reaction mixture ). the acid of the first reagent may be any suitable acid including nitric acid , hydrochloric acid , sulfuric acid , and mixtures thereof , and the like . most preferably the acid in the first reagent is nitric acid present in a concentration from about 0 . 05n to about 0 . 5n ( most preferably about 0 . 1n ) in an aqueous solution having from about 0 . 1 % to about 10 % ( v / v ) hydrogen peroxide present , said % based on the total volume of aqueous solution . the base present in the second reagent is any suitable base , including sodium hydroxide , potassium hydroxide , lithium hydroxide , and mixtures thereof , and the like . generally , sodium hydroxide is preferred as the base in the second reagent , and may be used in a concentration level of from about 0 . 25n to about 1 . 25 n , ( most preferably about 0 . 25n ). additionally , the usual constituents known to those skilled in the art may be included in the activating reagent ( s ), such as , buffer substances ( including phosphate buffer , citrate buffer , borate buffer , and so on ), various surfactants and / or preservatives ( such as described in u . s . pat . no . 4 , 927 , 769 and pending u . s . pat . no . 08 / 339 , 870 , filed nov . 14 , 1994 , both commonly assigned to ciba corning diagnostics corp . ), and proteins ( including bovine serum albumin , gelatin , casein , and so on ). the most preferred activating reagents are : first reagent : aqueous solution of nitric acid ( preferably 0 . 1n ) in from about 0 . 1 % to about 10 % ( preferably from 0 . 5 % to 1 %) of hydrogen peroxide ; and second reagent : aqueous solution of from about 0 . 25n to about 1 . 25n of naoh ( preferably 0 . 25n ) in water containing from about 0 . 1 to about 1 % ( v / v ) surfactant ( most preferably n - alkyl trimethyl ammonium chloride ), with said % based on the total volume of the aqueous reagent solution . as used herein , the modulated chemiluminescent signal is inclusive of the total chemiluminescent signal provided by the reaction mixture . this includes the quenched chemiluminescent signal provided by tracer bound to the solid phase as well as any tracer that is left in the free fraction solution once the specific binding reaction on the solid phase has transpired . the percent quenching of the chemiluminescent signal is calculated by the following equation : ## equ1 ## the unquenched signal counts are the counts measured from the chemiluminescent flash of a given amount of the unbound tracer taken in the absence of solid phase . the given amount is defined as the same quantity of tracer as is added to the assay . the % quench calculation may then be associated with a reference ( including , for example , a synthetic target sequence dna and so on ) to determine the amount or presence of the analyte in the sample . it has been observed that chemiluminescence is quenched in proportion to the mass of solid phase present during flashing when the solid phase is coated with an irrelevant binding partner . the signal modulation described here is in addition to and of greater magnitude than quenching due to solid phase mass , and is due to the specific binding reaction of the acridinium ester labeled analyte and the binding partner covalently attached to the solid phase . the evaluation and measurement of the light emission generated by the activation ( e . g . flashing ) of the chemiluminescent label in all embodiments may be accomplished by techniques known to those skilled in the art . for example , luminometer instruments that may be utilized in measuring the chemiluminescence signals are commercially available , such as the magic ® lite analyzer ( mla i ) instrument manufactured by ciba corning diagnostic corp ., medfield , mass . the assay may also be prepared for usage in an automated system that includes a luminometer , with one or more photomultiplier tubes , with multiple photomultiplier tubes described in wo 94 / 22002 , priority filed mar . 19 1993 , commonly assigned and hereby incorporated by reference . the inventive method may be practiced with various assay systems and formats by techniques known to those skilled in the art . both competitive and non - competitive ( e . g . sandwich ) assay formats may be practiced with immunological binding , chemical binding , complementary binding , and combinations thereof . according to the invention , the following are illustrative of immunological formats that may be used . labeled antigen - competitive : in this format , the sample containing the targeted antigen to be measured is incubated with a solution comprising ( 1 ) a limited amount of antibody coupled to metal oxide solid phase and ( 2 ) a tracer comprising an antigen or antigen analogue having attached thereto an acridinium ester label . during an incubation of the reaction solution , the antigen in the sample competes with the labeled antigen ( or antigen analogue ) for binding to the antibody attached to the solid phase . after the incubation period there may be up to three components left in the reaction solution : ( 1 ) a complex comprising the sample antigen bound with the antibody attached to the solid phase ( yielding no signal upon activation ); ( 2 ) a complex comprising the tracer antigen ( or antigen analogue ) bound with the antibody attached to the solid phase ( yielding a quenched signal upon activation ); and , possibly , ( 3 ) unreacted tracer ( yielding an unquenched signal ). the amount of labeled antigen ( or antigen analogue ) bound to the solid phase is inversely proportional to the amount of antigen in the sample . labeled antibody - competitive : in this format , the sample containing the targeted antigen to be measured is incubated with a solution comprising : ( 1 ) a limited amount of antigen ( or antigen analogue ) coupled to metal oxide solid phase and ( 2 ) a tracer comprising an antibody having attached thereto an acridinium ester label . during an incubation of the reaction solution , the antigen in the sample competes with the solid phase antigen ( or antigen analogue ) for binding to the tracer antibody . after the incubation period there may be up to three components left in the reaction solution : ( 1 ) a complex comprising the sample antigen bound with the tracer antibody ( yielding an unquenched signal upon activation ); ( 2 ) a complex comprising the tracer antibody bound with the antigen ( or antigen analogue ) attached to the solid phase ( yielding a quenched signal upon activation ); and , possibly , ( 3 ) unreacted tracer antibody ( yielding an unquenched signal ). the antigen in the sample and the antigen ( or analogue ) on the solid phase compete for the labeled antibody . the amount of labeled antibody that becomes bound to the solid phase is inversely proportional to the amount of antigen there is in the sample . labeled antibody - sandwich : in this format , which is typically done on antigens which are large enough to bind two antibodies ( the same or different ) simultaneously , the sample is incubated with an excess of one antibody attached to solid phase together with an excess of another tracer antibody that is labeled with an acridinium ester . the antigen becomes attached to the solid phase via one of its antigenic determinants , and the labeled antibody in turn becomes bound to the antigen via a different determinant . the complex formed on the solid phase ( i . e . solid phase antibody - antigen - tracer antibody ) yields a quenched chemiluminescent signal upon activation and the unreacted tracer yields an unquenched signal . the amount of labeled antibody that becomes bound to the solid phase is directly proportional to the amount of antigen in the sample . with regard to hybridization assays ( e . g . gene probe assays ), the competitive and sandwich formats may be practiced . when employed with hybridization assays , the inventive assay may take advantage of solid phase already present in the assay from the initial hybridization - capture step . for the hybridization quenching phenomenon to be utilized for an assay for specific nucleic sequences , preferably the quenching effect is modulated by partitioning of the labeled oligomer probe between the immobilized and solution phase sequences . in the competitive format , the immobilized oligomer and target sequence therefore preferably share a substantially common sequence that is capable of hybridizing to at least a portion of the labeled oligomer probe . when practicing the invention in gene probe assays , the acridinium ester may be placed on any desired position of the oligomer , but most preferably the label is placed at the 5 &# 39 ; terminus of the molecule . the gene probe assays preferably incorporate an amplification step utilizing a dna or rna replicase to generate dna or rna copies for each target nucleic acid sequence in the sample by techniques well known to those skilled in the art , such as for example , those described in ep - a - 0 481 704 ( commonly assigned and incorporated herein by reference ). after or during this amplification step , an acridinium ester labeled oligomer is added to the sample . the polynucleotide sequence permits it to hybridize specifically to a portion of the sequence which is being amplified as well as the same sequence immobilized to a metal oxide solid phase which has been added earlier in the assay procedure . the amount of labeled oligomer that will be captured upon the solid phase will depend upon the relative amounts of the complementary sequence present in solution or immobilized on the solid phase . the amount of amplified target sequence produced from the replicase reaction is expected to be in excess over that immobilized upon the solid phase . using the non - separation chemiluminescent detection method , samples containing no or lower than a threshold amount of target will result in a quench of the light emission of the labeled oligomer while for samples containing targets , the chemiluminescence of the labeled oligomer will remain unquenched . the percent quenching of the labeled oligomer chemiluminescence that occurs upon hybridization to an oligomer attached to the solid phase may be calculated by the following formula : ## equ2 ## where q represents quenching and rlu represents relative light units . as shown in the calculation , the hybridization reaction and control reaction are preferably incubated under substantially the same conditions , as the chemiluminescence of the labeled oligomer may generally vary with time , temperature , and buffer conditions . according to the invention , hybridization of the labeled oligomer to the oligomer attached to the solid phase will result in maximum reduction of the chemiluminescent signal when the solid phase capacity is in excess of the input labeled oligomer . additionally , an excess labeled oligomer relative to the solid phase will result in less quenching ( i . e . excess labeled oligomer that is not hybridized will be detected with higher efficiency by generating more chemiluminescence relative to the control ). the invention may be practiced using complementary substances attached to the tracer and solid phase conjugate . preferred complementary substances include biotin and avidin . exemplary biotin compounds include , for example , biocytin ( i . e . biotinε - n - lysine ), biocytin hydrazide , amine or sulfhydryl derivatives of 2 - imminobiotin and biotinyl - ε - aminocaprioic acid hydrazide and derivatives of biotin , including , for example , biotin - n - hydroxysuccinimide ester , biotinyl - ε - aminocaprioic acid - n - hydroxysuccinimide ester , sulfosuccinimidyl 6 -( biotin amido )- bromoacetylhydrazide , p - diazobenzoyl biocytin and 3 -( n - maleimidopropoionyl ) biocytin , which can be attached to linking proteins ( preferably attached to the solid phase polymeric coating ), as is well known to those skilled in the art . avidin compounds that may be used include streptavidin , succinylated avidin , monomeric avidin , and so on . the method of attaching the avidin and biotin ( or derivative of either ) either directly or indirectly to the specified tracer or solid phase conjugate may be accomplished through techniques known to those skilled in the art , e . g . through reacting the amino or sulfhydryl groups of the avidin or biotin . with regard to immunological assays , the invention is particularly useful for detecting or quantifying theophylline and dinitrophenol ( dnp ) protein and derivatives thereof . with regard to hybridization assays , the invention is particularly effective in detecting or quantifying enteric pathogens , such as , for example , salmonella and campylobacter species . it is to be understood that various modifications to the invention will be apparent to and can readily be made by those skilled in the art , given the disclosure herein , without departing from the scope and materials of this invention . it is noted that the following examples given herein are intended to illustrate and not to limit the invention thereto . the solid phase in all examples consisted of paramagnetic particles ( pmp ) having a silane polymeric coating around the iron oxide core ( purchased from advanced magnetics inc ., cambridge , mass ). the pmp were activated by glutaraldehyde and conjugated with the various specific binding partners according to the two - step procedure as described by groman , e . v ., et al . ( bio techniques , 70 , p . 159 - 165 ). the acridinium ester ( ae ) used in the examples was of the following structure : ## str1 ## wherein x is ch 3 so 4 , r 1 is methyl ; r 2 , r 3 , r 5 and r 7 are hydrogen ; r 4 and r 8 are methyl , r 6 = is an cooh converted to a n - succinimidyloxycarbonyl group to assist in attachment of a specific binding partner . a description of a technique that was used in attaching acridinium esters with binding conjugates is as found in weeks et al ., clinical chemistry , 29 ( 8 ), 1474 - 1479 ( 1983 ) and ep - a - 0 537 994 ( each of which are hereby incorporated by reference ). the assays were flashed with two reagents , as follows : flash reagent 1 = about 0 . 3 ml of 0 . 1n hno 3 in approx . 0 . 5 % aqueous solution of h 2 o 2 . flash reagent 2 = about 0 . 3 ml of 0 . 25n naoh in a approx . 0 . 5 % aqueous solution of arquad ® 16 - 50n - alkyl trimethyl ammonium chloride ( 50 % active purchased from akzo chemical inc ., chicago , ill .). flash reagent 1 was added to the reaction mixture first , followed immediately with flash reagent 2 . relative light units ( rlu &# 39 ; s ) were measured over a 2 second interval after injection of flash reagents 1 and 2 using a luminometer ( magic ® lite analyzer &# 34 ; mla i &# 34 ;, ciba corning diagnostics corp ., medfield , mass .). the % quench was calculated by the following equation : ## equ3 ## the modulated signal counts were a measurement of the total signal provided by the reaction mixture after the reaction between specific binding partners transpired . the unquenched signal counts were a measurement of the light emitted from an amount of tracer added to the assay , as flashed in the absence of solid phase . monoclonal antibodies to 2 , 4 - dinitrophenol ( dnp ) were prepared by standard methods , after immunizing mice with a conjugate of dnp with thyroglobulin ( dnp - tg ). this conjugate was prepared by reaction of equal weights of thyroglobulin and 2 , 4 - dinitrobenzenesulfonic acid in 0 . 15m na 2 co 3 solution for 18 hours , followed by exhaustive dialysis against 0 . 001m sodium phosphate buffer , ph 7 . 4 . the antibody ( anti - dnp ) was purified from ascites fluid by precipitation of unwanted protein with caprylic acid , followed by dialysis of the supernatant against 0 . 1m sodium phosphate buffer , ph 7 . 4 . for immobilization of the antibody , 10 mg of pmp were activated with 6 . 25 % glutaraldehyde in 0 . 1m phosphate , ph 7 . 4 , for 2 hours . after washing to remove excess glutaraldehyde , the pmp were mixed with 1 ml of a solution of antibody ( diluted to 1 . 5 mg / ml ), and let stand overnight . the particles were then washed several times in phosphate buffer , and finally resuspended to a concentration of 10 mg / ml in 0 . 05m sodium phosphate , ph 7 . 4 , 0 . 15m nacl , 1 mg / ml bovine serum albumin ( pbs / bsa ). dnp - tg ( prepared as above ) and a conjugate of fluorescein isothiocyanate with bovine serum albumin ( fitc - bsa ) ( purchased from sigma chemical co ., st . louis , mo .) were labeled with the acridinium ester ( ae ) as follows : 2 mg of conjugate in 1 ml of 0 . 1m sodium phosphate , 0 . 15m nacl , ph 8 . 0 , was mixed with 80 μl of ae ( 1 mg / ml in dimethylformamide ) and incubated for 1 hr at room temp . the mixture was then added to 0 . 5 ml of a 10 mg / ml solution of dl - lysine and incubated for 15 minutes . the labeled conjugate was then purified by gel filtration on a 20 cm column of sephadex g 25 . dnp - β - alanine was prepared as follow : one gram of β - alanine was dissolved in 50 ml of 1m nahco 3 . seven milliliters of 2 , 4 - dinitrofluorobenzene ( dnfb ) was added to 100 ml of ethanol , and this was added to the β - alanine and stirred at room temperature for two hours . the ethanol was removed by rotary evaporation and the remainder extracted with ether to remove excess dnfb . normal hcl was added to the aqueous part until a precipitate formed . the latter was recovered by filtration , washed with ether , and air dried . the material was recrystallized twice : first from water with the addition of 1n hcl , then from nahco 3 / na 2 co 3 , ph = 9 , washed with ether , and dried . one hundred microliters of the anti - dnp pmp ( diluted 1 : 30 with pbs / bsa ) was incubated with either 100 μl of ae - dnp - tg ( diluted with 1 : 15000 with pba / bsa ) or with 100 μl of ae - fitc - bsa ( diluted 1 : 60000 with pba / bsa ). after one hour , the chemiluminescent light emission of each mixture was measured and compared to that of the same amount of each ae - labeled conjugate in the absence of the anti - dnp pmp . for the ae - dnp - tg conjugate , 52 % of the light output was quenched by the particles carrying the specific anti - dnp antibody . for the ae - fitc - bsa conjugate , which is not bound by this antibody , only 26 % of the light was quenched by the particles . these data support that quenching is increased upon the formation of the specific binding reaction complex on the solid phase . these findings are contrary to the expectation that the amount of quenching of light emission from a given amount of labeled tracer by a given mass of solid phase would be the same . the following example illustrates the effect of addition of a dnp derivative ( not labeled with acridinium ester ) to the system described in example 1 . one hundred microliters of anti - dnp - pmp ( diluted 1 : 30 with pbs / bsa ) was incubated with 50 μl of ae - dnp - tg ( diluted 1 : 7500 with pbs / bsa ) and with 50 μl of a solution of dnp - β - alanine at concentrations of 50 to 500 ng / ml . after one hour , the chemiluminescence of each mixture was measured . the results are shown in table 1 below and graphically represented in fig1 . table 1______________________________________effect of addition of a dnp derivativednp - β - alanine ( ng / ml ) chemiluminescence ( rlu ) ______________________________________0 545 , 00050 566 , 000100 802 , 000250 983 , 000500 1 , 040 , 000______________________________________ the data show that addition of increasing concentrations of an unlabeled dnp derivative resulted in a progressive increase in light output . this effect is presumably due to the unlabelled dnp competing for the immobilized antibody &# 39 ; s available binding sites , resulting in less of the ae - labeled dnp binding to the particles , and thus diminishing the quenching of chemiluminescent light emission . monoclonal antibodies to theophylline and lutenizing hormone ( lh ) were generated by standard techniques after immunization of mice with 8 - carboxypropyltheophylline - thyroglobulin and lh respectively . polyclonal antibody to theophylline was produced by immunization of rabbits with 8 - carboxypropyltheophylline - thyroglobulin . monoclonal and polyclonal antibody ( anti - lh ) were purified as described above for examples 1 and 2 except that activation and coupling were done in 0 . 01m sodium acetate buffer ( ph 5 . 5 ). particles were finally resuspended at 25 mg / ml in pbs / bsa buffer . theophylline standards were prepared by diluting a stock solution of theophylline ( sigma ) into pbs / bsa for buffer based standards or drug - free human serum for serum standards . standards from a theophylline ria kit obtained from clinical assays were also used . pmp immobilized with either theophylline monoclonal antibody ( theo ) or lh monoclonal antibody was serially diluted from 2 . 5 mg / ml to 0 . 156 mg / ml in pbs / bsa buffer . five hundred microliters of pmp was dispensed to test tubes , the buffer was removed after magnetic separation of the particles and 100 μl of water was added to resuspend the particles . ae - theo ( 0 . 4 million rlu / tube ) diluted in pbs / bsa was added to each tube . the chemiluminescent light emission was immediately measured using the mla i . the rlu observed for the solution of ae - theo with the anti - theophylline pmp and the anti - lh pmp ( modulated signal total counts ) were compared to the rlu measured in the absence of pmp ( unquenched total counts ). the results are summarized in table 2 as follows . table 2______________________________________quenching of ae - theophylline in the presence of anti - theophylline antibody pmp ( anti - theo ) andanti - luteotropic hormone antibody pmp ( anti - lh ) antibodyon pmp ( pmp ) mg / tube rlu quench % ______________________________________ 0 335937 ( utc ) 0anti - lh 0 . 075 294570 13anti - lh 0 . 156 244583 27anti - lh 0 . 312 215243 36anti - lh 0 . 625 157693 53anti - lh 1 . 25 105153 69 0 412450 ( utc ) 0anti - theo 0 . 075 39865 90anti - theo 0 . 156 30915 92anti - theo 0 . 312 24900 94anti - theo 0 . 625 19635 95anti - theo 1 . 25 13255 97______________________________________ non - separation theophylline assays were run as follows . standards , controls or patient samples were incubated with ae - theophylline and monoclonal anti - theophylline pmp at room temperature for 10 minutes . chemiluminescence was measured in the mla i without further manipulation of the tubes . at low analyte concentration , most of the tracer was bound to the solid phase and did not flash , thus giving low counts . as the analyte concentration increased , more tracer remained unbound , thus giving a higher signal . a sample standard curve is shown in fig3 . the results of an assay of 14 patient samples are given in table 3 . a commercially available theophylline assay ( tdx assay purchased from abbott ) was used as the control , with the control data shown in table 3 . table 3______________________________________non - separation theophylline assay theophylline , μg / ml control non - separation assay tdx inventionpatient ( μg / ml ) ( μg / ml ) ______________________________________1 5 . 2 8 . 32 16 . 0 13 . 03 7 . 1 6 . 84 11 . 1 12 . 95 13 . 2 9 . 36 4 . 6 4 . 87 23 . 2 19 . 88 14 . 6 14 . 69 5 . 0 6 . 410 15 . 9 10 . 511 8 . 7 6 . 812 5 . 6 6 . 113 11 . 4 7 . 714 14 . 4 9 . 0______________________________________ correlation : non separation assay = 2 . 42 + 0 . 656 tdx r = 0 . 874 the nucleic acid sequences used in the hybridization assays described in examples 5 - 7 are provided in sequence listing herewith , where the following abbreviations are used in presenting the hybridization assays : adenine ( a ); thymine ( t ); uracil ( u ); guanine ( g ); cytosine ( c ). pm979 : shown as seq . no . 1 , where bases 1 - 10 constitute a spacer arm , bases 11 - 46 consist of the 5 &# 39 ; sequence of the nanovariant (+) template , and bases 47 - 70 are complementary to a salmonella specific target sequence . masa5 : shown as seq . no . 2 , where bases 1 - 10 constitute a spacer arm , bases 11 - 71 consist of the 5 &# 39 ; sequence of the midivariant (+) template , and bases 72 - 95 are complementary to a salmonella specific target sequence . pm1076 : shown as seq . no . 3 , where half of the salmonella target , complementary to pm979 and masa5 was employed . pm2058 : shown as seq . no . 4 , where the salmonella target , complementary to pm979 and masa5 was employed . some versions of this sequence have a 5 &# 39 ;- amino group for conjugation with acridinium ester , as described herein . md24 : shown as seq . no . 6 , where a probe complementary to bases 34 - 57 of the midivariant (+) template ; i . e . bases 44 - 67 of masa5 was used . some versions of this sequence have a 5 &# 39 ; amino group for conjugation with acridinium ester , as described herein . mdv - sa2 rna transcript : shown as seq . no . 7 , where bases 1 - 61 consist of the 5 &# 39 ; end of the midivariant (+) template , bases 62 - 69 and 118 - 123 are plasmid linker sequences , bases 70 - 117 are complementary to a salmonella specific target sequence , and bases 124 - 282 consist of the 3 &# 39 ; end of the midivariant (+) template . the solid phases consisted of pmp to which one of the amplification oligomer probes was covalently attached ( via a 5 &# 39 ;- terminal amino group using a hetero - bifunctional coupling reagent for pm979 , or by glutaraldehyde activation of the pmp for masa5 ). the ae - pm1076 and 5 &# 39 ; 32 p - pm2058 sequences are complementary to the anti - target portion of the immobilized probes ( therefore hybridization and capture occur simultaneously ). the pm979 - pmp was prepared using pm 979 oligomer ( obtained from promega corp ., madison , wis .) and a thio - terminated pmp ( purchased from advanced magnetics , cambridge , mass ). the ae labeled pm1076 ( ae - oligomer ) was prepared using the dimethyl acridinium ester label and pm1076 oligomer obtained from promega corp . the masa5 - pmp was prepared using masa5 oligomer ( obtained from promega corp .) and a thio - terminated pmp purchased from advanced magnetics . the pm 2058 oligomer was also obtained from promega corp . the sodium citrate was purchased from mallinckrodt , inc ., st . louis , mo . the nacl , tris edta and tween - 20 were all purchased from sigma chemical , co ., st . louis , mo .) and the bsa ( fraction v ) from miles , inc . this example illustrates the quenching of ae - oligomer chemiluminescence by hybridization to oligomer - pmp . hybridization reactions containing pm979 immobilized on pmp ( pm979 - pmp ) and ae - pm1076 ( ae - oligomer ) were set up on ice by adding 40 μl of 60 mm sodium citrate , 600 mm sodium chloride , 10 mm tris -( hydroxymethyl ) aminomethane ( tris ) hcl , 1 mm ethylene diaminetetraacetic acid ( edta ), 0 . 1 % ( w / v ) bsa , and 0 . 02 % ( v / v ) polyoxyethylene ( 20 ) sorbitan monolaurate ( tween - 20 ) at ph 7 . 5 ( hereinafter &# 34 ; buffer &# 34 ;) to ten tubes . secondly , 5 μl of buffer containing 50 μg of pm979 - pmp was added to five of the ten tubes , and 5 μl of buffer alone was added to the remaining five tubes for control reactions . finally , 5 μl of buffer containing 10 , 32 , 100 , 320 , and 1000 femtomoles ( 1 fmol = 1 × 10 - 15 moles ) of ae - pm1076 was added to pairs of tubes , one group containing pmp and one control group without pmp ( control for ae decomposition during hybridization ). all reactions were incubated at 56 ° c . and 5 μl samples were removed at 0 , 75 , 120 , and 180 minutes , added to 100 μl of water , flashed with reagents 1 and 2 in a luminometer to determine the chemiluminescent activity . the % quench was calculated from the signals measured from the various tubes and are presented in fig4 . as shown in fig4 the chemiluminescence of all reactions containing oligomer - pmp decreased dramatically relative to the corresponding control without oligomer - pmp , up to a maximum of 74 %, upon hybridization . also the data demonstrate conditions where the relative input of ae - oligomer and oligomer - pmp generated significant quenching . the conditions of the reaction having 100 fmol input of the ae - oligomer , where the solid phase capacity is five - times the input of ae - oligomer , were chosen to test the feasibility of the competitive assay of example 6 . hybridization reactions were set up on ice by adding 10 μl of buffer ( described in example 5 ) alone or 10 μl of buffer containing 100 μg of pm979 - pmp to each of five tubes . next , 10 μl of buffer containing 0 , 10 - 14 , 10 - 13 , 10 - 12 , and 10 - 11 moles of standard , pm979 ( the oligomer that was immobilized on the pmp ), was added to one of the tubes containing pm979 - pmp and one control tube without pmp for each amount of added standard . finally , 80 μl of buffer containing 200 fmol of ae - pm1076 was added to all reactions . all tubes were incubated at 56 ° c . duplicate 10 μl samples were removed from each reaction at the indicated times ( 0 , 20 , 40 , and 60 minutes ), added to 100 μl of water and processed in a luminometer to determine chemiluminescent activity . results are shown in tables 4 ( fig5 ) and 5 . table 5 shows data derived from the 20 minute data from table 4 . the results shown are consistent with theoretical expectations , i . e . the same maximum extent of quenching was achieved in all hybridizations except where the input of pm979 in solution exceeds the solid phase capacity . table 4______________________________________competitive hybridization quenching assay standard hybrid . total signal input . sup . 1 . time ( rlu × 10 . sup .- 5 ) reaction ( moles ) ( min ) (+) pmp (-) pmp quench %. sup . 2 . ______________________________________a 10 . sup .- 11 0 8 . 27 8 . 66 4 20 4 . 61 5 . 65 18 40 4 . 78 5 . 78 17 60 4 . 38 5 . 30 17b 10 . sup .- 12 0 7 . 82 8 . 60 9 20 2 . 60 5 . 28 51 40 2 . 71 5 . 31 49 60 2 . 63 5 . 39 51c 10 . sup .- 13 0 7 . 62 9 . 36 19 20 1 . 43 5 . 43 74 40 1 . 48 5 . 56 73 60 1 . 51 5 . 21 71d 10 . sup .- 14 0 8 . 05 8 . 57 6 20 1 . 21 5 . 21 77 40 1 . 28 5 . 26 76 60 1 . 26 5 . 11 75e 0 8 . 00 8 . 45 5 1 . 15 5 . 41 79 1 . 26 5 . 27 76 1 . 24 4 . 82 74______________________________________ . sup . 1 . standard was added pm979 . . sup . 2 . 1 - (+ pmp rlu ) ÷ (- pmp rlu )! × 100 % = % quenching table 5______________________________________competitive hybridization quenching assay20 minute data point - standard (+) pmp net (+) pmp input signal signalreaction ( moles ) ( rlu ). sup . 1 . ( rlu ). sup . 2 . ______________________________________a 10 . sup .- 11 461 , 480 346 , 830b 10 . sup .- 12 259 , 560 144 , 910c 10 . sup .- 13 142 , 860 28 , 210d 10 . sup .- 14 120 , 720 6 , 070e 0 114 , 650 0______________________________________ . sup . 1 : derived from the 20 minute data point of table 4 . . sup . 2 : (+ pmp rlu ). sub . i ÷ (+ pmp rlu ). sub . e . i = &# 34 ;+ pmp rlu &# 34 ; value e = &# 34 ; reaction e &# 34 ; value as shown by the data above , this example demonstrates a hybridization competition assay for synthetic dna oligomer . varying amounts of the same oligomer that had been immobilized on the pmp were added in solution to compete with the solid phase immobilized oligomer for hybridization of the ae - oligomer , i . e . the added oligomer functioned as a competitive standard . this mimics the competition that would take place due to the presence of amplified probe in the proposed assay of example 7 . amplification reactions that had started with 0 , 10 - 16 , 10 - 18 , 10 - 19 , and 10 - 20 moles of midivariant template , respectively , were terminated by addition of edta and put on ice . hybridization reactions were set up on ice by adding 5 , 20 , 70 , or 75 μl of buffer to 12 tubes , so that the final volume would be 100 μl after addition of all other components , as described above . next 50 μl of buffer containing 5 of pm979 - pmp was added to six tubes . then 5 μl of buffer or one of the five replication reactions was added to pairs of tubes , one with and one without pmp . finally , 25 μl of buffer containing 10 fmol of ae - md24 was added to all tubes . all tubes were incubated for 20 minutes at 56 ° c . then flashed with reagents 1 and 2 in a luminometer to determine the chemiluminescent activity . the results , shown in table 6 , do not reflect the presence of abundant replicated midivariant rna ( estimated to be on the order of 5 pmol per reaction ). the failure of the assay to detect the presence of midivariant sequence was not due to reagent quality , since reagents had been validated by titration and mock assays with synthetic target . additional trials , with heat denaturation of the target prior to addition and increased input of ae - oligomer , also failed . subsequent experiments using 32 p - labeled md24 suggest that the failure is due to inefficient hybridization of the probe to the target , presumably due to higher stability of a midivariant duplex . this hypothesis is supported by the results of a quench assay for transcribed single stranded midivariant target , which produced a standard curve with quench values consistent with theoretical expectations with respect to the molar ratio of target and ae - probe . table 6______________________________________hybridization quench assayfor replication products + pmp added template orreaction ( mol ) - pmp mean rlu % quench . sup . 1 . ______________________________________a buffer only - 235 , 545 70 + 71 , 325b 0 - 190 , 240 65 ( mock + 66 , 690 reaction ) c 10 . sup .- 16 - 190 , 055 65 + 66 , 570d 10 . sup .- 18 - 189 , 950 64 + 67 , 820e 10 . sup .- 19 - 178 , 270 64 + 63 , 780f 10 . sup .- 20 - 164 , 590 63 + 60 , 190______________________________________ . sup . 1 . % q = 1 - (+ pmp value )/(- pmp value )! × 100 __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 7 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 70 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , pm979 , having a portion complementary to a salmonella specifictarget sequence , where bases 1 - 10 constitute a spacerarm , bases 11 - 46 consist of the 5 &# 39 ; sequence of thenanovariant (+) template , and bases 47 - 70 arecomplementary to the salmonella specific targetsequence . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 1 : cctagtccaaggggaaatcctgttaccaggataacggggt40tttctcataagcgccattgatgttgtcgcc70 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 95 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , masa5 , having aportion complementary to a salmonella specific targetsequence , where bases 1 - 10 constitute a spacer arm , bases 11 - 71 consist of the 5 &# 39 ; sequence of the midivariant (+) template , and bases 72 - 95 are complementary to thesalmonella specific target sequence . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 2 : cctagtccaaggggaccccccggaaggggggacgaggtgc40gggcacctcgtacgggagttcgaccgtgacaggtcaactg80aacgccctgagcttt95 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 24 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , pm1076 , half of thesalmonella target , complementary to pm979 and masa5 , defined herein . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 3 : ggcgacaacatcaatggcgcttat24 ( 2 ) information for seq id no : 4 :( i ) sequence characteristics :( a ) length : 48 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , pm2058 , a salmonellatarget , complementary to pm979 and masa5 , defined herein . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 4 : ggcgacaacatcaatggcgcttataaagctcagggcgttc40agttgacc48 ( 2 ) information for seq id no : 5 :( i ) sequence characteristics :( a ) length : 48 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , sa7 , an anti - salmonellatarget . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 5 : ggtcaactgaacgccctgagctttataagcgccattgatg40ttgtcgcc48 ( 2 ) information for seq id no : 6 :( i ) sequence characteristics :( a ) length : 24 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , md24 , complementary tobases 34 - 57 of the midivariant (+) template ; i . e . bases44 - 67 of masa5 , defined herein . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 6 : acggtcgaactcccgtacgaggtg24 ( 2 ) information for seq id no : 7 :( i ) sequence characteristics :( a ) length : 282 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , mdv - sa2 rna transcript , where bases 1 - 61 consist of the 5 &# 39 ; end of themidivariant (+) template , bases 62 - 69 and 118 - 123 areplasmid linker sequences , bases 70 - 117 are complementaryto a salmonella specific target sequence , and bases124 - 282 consist of the 3 &# 39 ; end of the midivariant (+) template . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 7 : ggggaccccccggaaggggggacgaggugcgggcaccucg40uacgggaguucgaccgugacgagccucgaggcgacaacau80caauggcgcuuauaaagcucagggcguucaguugaccucg120aggagucacgggcugcgcuuucgcgcaucucccaggugac160gccucgagaagaggcgcgaccuucgugcguuucggcgacg200cacgagaaccgccacgcugcuucgcagcguggccccuucg240cgcagcccgcugcgcgaggugacccccgaagggggguucc280cc282__________________________________________________________________________	6
it is evident from fig1 that a transport device 4 , which conveys specimen slides to the various processing stations 9 , is provided in stainer 1 . also provided is a charging station 6 for loading specimens to be treated or racks 5 carrying specimens to be treated . for removing racks 5 from the stainer , a removal station 7 is provided from which racks 5 can be manually conveyed by a user into a downstream element . both charging station 6 and removal station 7 are charged by way of transport device 4 . the specimen slides present in charging station 6 can thus be removed and delivered to the actual processing stations 9 using transport device 4 . after the last processing station 9 , racks 5 are conveyed into removal station 7 so that they are ( together ) removable therefrom . removal is accomplished once again automatically by way of the transport device , or the specimen slides can be conveyed directly from a processing station 9 into a transfer position 30 ( fig3 ) of the downstream further element of the system . in the exemplary embodiment selected here , transport device 4 is embodied as a robot arm 8 . an opening 33 , through which racks 5 with specimen slides 5 a can be conveyed to a downstream station or into transfer position 30 , is configured in a side wall 32 of stainer 1 . fig2 schematically depicts an exemplary embodiment of a coverslipper 3 . coverslipper 3 comprises a housing 11 that has on one side wall 13 multiple attachment elements 13 a that coact with attachment elements on the corresponding side wall 22 of transfer device 2 . side wall 13 also comprises an opening 14 through which specimen slides are conveyed by transfer device 2 into coverslipper 3 . the individual specimen slides are arranged in special racks ( not depicted ). the interior of coverslipper 3 is covered by a pivotable hood 15 . front wall 16 of the coverslipper comprises a first drawer 17 in which is configured a further opening 17 a into which a user interface ( not depicted ) can be inserted . provided next to first drawer 17 for the user interface and the access to the electronics of coverslipper 3 is a detachable panel 18 through which the user once again gains access to the interior of coverslipper 3 . an output tray 19 for specimen slides equipped with coverslips is also provided on coverslipper 3 . coverslipper 3 can be switched on with a switch 12 . fig3 discloses an element ( transfer device 2 ) of the system according to the present invention that creates communication between stainer 1 and coverslipper 3 . transfer device 2 is provided between stainer 1 and coverslipper 3 , and thus connects stainer 1 to coverslipper 3 . transport device 4 of stainer 1 places rack 5 with the stained specimen slides 5 a onto a transfer position 30 of transfer device 2 . for that purpose , transfer device 2 has a passage 20 that is defined by a cutout 21 in first side wall 22 and a cutout 23 in second side wall 24 . transfer device 2 possesses a front panel 25 through which access to the interior of transfer device 2 is possible . transfer device 2 is followed by coverslipper 3 . opening 14 , in a side wall 13 of coverslipper 3 opposite second side wall 24 of transfer device 2 , is configured so that transfer device 2 can transfer racks 5 with specimen slides 5 a into coverslipper 3 and can remove racks 5 without specimen slides from coverslipper 3 . communication between coverslipper 3 and stainer 1 occurs as follows : stainer 1 queries whether it can place a rack 5 in coverslipper 3 . the response from coverslipper 3 can be “ yes ” or “ no .” if “ no ,” the query is repeated at periodic intervals . if “ yes ,” the rack is put in place and a “ rack transferred ” message is generated . coverslipper 3 responds “ rack received .” this procedure eliminates long waiting times for the rack in the transfer position . a quick transfer is advantageous because the specimen slides usually sit in a bath of solvent ( often xylene ), and wet specimen slides that were just recently stored in solvent exhibit considerably better flow behavior for the coverslip adhesive . fig4 is a side view of transfer device 2 , which is connected to one side wall 32 of stainer 1 . for simplicity &# 39 ; s sake , only side wall 32 of stainer 1 is depicted . attachment elements 26 , which are provided with corresponding attachment elements ( not depicted ) on side wall 32 of stainer 1 , are again provided on first side wall 22 of transfer device 2 . attachment elements 26 , which coact with attachment elements 13 a on side wall 13 of coverslipper 3 , are also provided in second side wall 24 of transfer device 2 . transfer device 2 comprises a housing 27 that has a bottom 28 , a front panel 25 , a back wall 29 opposite front panel 25 , and the first and the second mutually opposite side wall 22 and 24 already mentioned . also configured in transfer device 2 is a passage 20 that is defined substantially by a first and a second cutout 21 and 23 in first and second side wall 22 and 24 . transfer position 30 for racks 5 is provided in the region of first cutout 21 in first side wall 22 . cutout 21 in first side wall 22 is arranged opposite an opening 33 in side wall 32 of stainer 1 . through the opening in side wall 32 of stainer 1 , racks with specimen slides are transferred out of stainer 1 to the transfer device . the transfer once again occurs through cutout 21 in first side wall 22 of transfer device 2 . transfer device 2 is additionally equipped with a covering hood 34 so as thereby to offer protection against contamination . as depicted in fig5 the elements of the system are shown separated from one another for better clarity . in operation , stainer 1 ( only one side wall 32 shown here ), transfer device 2 , and coverslipper 3 are connected to one another . stainer 1 possesses lateral opening 33 , through which transport device 4 of the stainer can pass . specifically , transport device 4 is used on the one hand to accept racks with specimen slides from other processing stations and to transfer racks with specimen slides for transfer to transfer device 2 . transfer device 2 comprises passage 20 , which is constituted by a cutout 21 in first side wall 22 and a cutout 23 in second side wall 24 . a transport apparatus 35 , which passes out through cutout 23 in second side wall 24 and extends into coverslipper 3 , is provided in transfer device 2 . transport apparatus 35 extends through opening 14 in side wall 13 of coverslipper 3 . fig6 schematically depicts the system according to the present invention in which the individual elements are assembled . stainer 1 , transfer device 2 , and coverslipper 3 are here connected to one another and form a system substantially closed off externally . the invention has been described with reference to a particular exemplary embodiment . it is nevertheless self - evident that changes and modifications can be made without thereby leaving the range of protection of the claims below .	6
the present invention will be described in detail hereinafter with reference to the illustrated embodiments . fig1 is a sectional view showing the arrangement of a principal part of a camera when a line of sight detection apparatus is applied to a single - lens reflex camera according to the first embodiment of the present invention , and fig3 shows the finder field of the single - lens reflex camera shown in fig1 . referring to fig1 a phototaking lens 1 is constituted by two lenses 1a and 1b for the sake of simplicity . however , in practice , the lens 1 is constituted by a larger number of lenses . a main mirror 2 is obliquely inserted into or retracted from a phototaking optical path in correspondence with the observation state and the phototaking state . a sub mirror 3 reflects downward a light beam transmitted through the main mirror 2 . a shutter 4 is arranged behind these mirrors . a photosensitive member 5 comprises a silver halide film or a solid - state image pick - up element such as a ccd , a mos type element , or the like . a focus detection device 6 adopts a known phase difference method , and is constituted by a field lens 6a disposed in the vicinity of the imaging surface , reflection mirrors 6b and 6b , a secondary imaging lens 6d , an aperture 6e , a line sensor 6f consisting of a plurality of ccds ( to be described later ), and the like . the focus detection device 6 shown in fig1 can perform focus detection on a plurality of areas ( three distance measurement point marks 200 to 202 ) in a finder field ( observation screen ) 213 , as shown in fig3 . a focusing plate 7 is disposed on a prospective imaging surface of the phototaking lens 1 , and a pentagonal prism 8 is used for bending the finder optical path . an imaging lens 9 and a photometric sensor 10 are used for measuring the object luminance in the observation screen . the imaging lens 9 defines a conjugate relationship between the focusing plate 7 and the photometric sensor 10 via the reflection optical path in the pentagonal prism 8 . an eyepiece lens 11 is disposed behind the exit surface of the pentagonal prism 8 , and is used for observing the focusing plate 7 by an eye 15 of a photographer . the eyepiece lens 11 comprises , e . g ., a beam splitter 11a comprising a dichroic mirror which transmits visible light therethrough and reflects infrared light . a light - receiving lens 12 is arranged above the eyepiece lens 11 . an area sensor 14 is constituted by two - dimensionally arranging photoelectric conversion element arrays such as ccds . the area sensor 14 is disposed to be conjugate with a position in the vicinity of the iris of the eye 15 of the photographer , which is located at a predetermined position , with respect to the light - receiving lens . the detailed circuit arrangement of the area sensor 14 will be described later . ireds 13 ( 13a to 13d = ired1 to ired4 ) serve as illumination light sources for illuminating the eyeball 15 of the photographer . high - luminance superimposed leds 21 can be visually confirmed even in a bright object . light emitted by each superimposed led 21 is reflected by the main mirror 2 via a light projection prism 22 , and is bent in the vertical direction by micro - prism arrays 7a formed on a display portion of the focusing plate 7 . then , the light reaches the eye 15 of the photographer via the pentagonal roof prism 8 and the eyepiece lens 11 . thus , the micro - prism arrays 7a are formed in frame patterns at positions corresponding to the focus detection areas on the focusing plate 7 , and are respectively illuminated with the corresponding superimposed leds 21 ( led - l1 , led - l2 , led - c , led - r1 , and led - r2 ). as can be seen from the finder field shown in fig3 the distance measurement point marks 200 , 201 , and 202 shine in the finder field 213 to display the focus detection areas ( distance measurement points ) ( this display will be referred to as a superimposed display hereinafter ). a field mask 23 forms the finder field area . an lcd 24 in the finder is used for displaying phototaking information on a portion outside the finder field , and is illuminated with an illumination led ( f - led ) 25 . light transmitted through the lcd 24 in the finder is guided into the finder via a triangular prism 26 , and is displayed on a portion 207 outside the finder field shown in fig3 . the photographer can observe the displayed phototaking information . the phototaking lens 1 includes an aperture 31 , an aperture driving device 32 including an aperture driving circuit 114 ( to be described later ), a lens driving motor 33 , and a lens driving member 34 consisting of , e . g ., a driving gear and - the like . a photocoupler 35 detects the rotation of a pulse plate 36 interlocked with the lens driving member 34 , and supplies the rotation information to a lens focus adjustment circuit 113 . the lens focus adjustment circuit 113 drives the lens driving motor 33 by a predetermined amount on the basis of this rotation information and information of a lens driving amount supplied from the camera side , thereby moving a focusing lens la of the phototaking lens 1 to an in - focus position . mount contacts 37 serve as a known interface between the camera and the lens . fig2 is a block diagram showing the electrical arrangement of the single - lens reflex camera with the above - mentioned arrangement , and the same reference numerals in fig2 denote the same parts as in fig1 . a central processing device ( to be referred to as an mpu hereinafter ) 100 comprises a microcomputer serving as a built - in camera control means of the camera main body . the mpu 100 performs its internal operations on the basis of clocks generated by an oscillator 101 . a clock control circuit 100a determines the operation frequency of the mpu 100 by &# 34 ; not frequency - dividing &# 34 ;, &# 34 ; frequency - dividing to 1 / 2 &# 34 ;, or &# 34 ; frequency - dividing to 1 / 16 &# 34 ; the original oscillation frequency generated by the oscillator 101 in accordance with an internal signal of the mpu 100 . an eeprom 100b is a memory which can store a film counter and other phototaking information . an a / d converter 100c a / d - converts analog signals from a line of sight detection circuit 104 , a focus detection circuit 105 , and the multi - split photometric sensor 10 ( photometric circuit 106 ), as will be described later . the mpu 100 is connected to an led driving circuit 102 , an ired driving circuit 103 , the line of sight detection circuit 104 , the focus detection circuit 105 , the photometric circuit 106 , a shutter control circuit 107 , a motor control circuit 108 , a film running detection circuit 109 , a switch sense circuit 110 , and a liquid crystal display circuit 111 . the mpu 100 exchanges signals with a lens control circuit 112 arranged in the phototaking lens via the mount contacts 37 shown in fig1 . the led driving circuit 102 turns on the superimposed leds 21 in accordance with a signal from the mpu 100 . the ired driving circuit 102 turns on the ireds 13 in accordance with a signal from the mpu 100 . the line of sight detection circuit 104 performs an accumulation operation and a read operation of the area sensor 14 in accordance with a signal from the mpu 100 , and supplies picture element output analog signals of respective picture elements to the mpu 100 . note that the line of sight detection circuit 104 will be described in detail later . the mpu 100 a / d - converts these analog signals using the a / d converter 100c , extracts the respective feature points of the eyeball image required for line of sight detection in accordance with a predetermined algorithm on the basis of each picture element information , as will be described later , and calculates the rotation angle of the eyeball of the photographer on the basis of the positions of the feature points . in the single - lens reflex camera to which this embodiment is applied , the line of sight ( gazing point ), on the finder , of the photographer is extracted by the calculations , one of the three distance measurement points 200 to 202 is selected , and automatic focus detection is performed using the selected distance measurement point . a regulator 115 supplies a power supply voltage to the line of sight detection circuit 104 in accordance with a signal from the mpu 100 , and is controlled to supply the power supply voltage only when the line of sight detection operation is performed . the line sensor 6f comprises a ccd line sensor constituted by three line sensors line - l , line - c , and line - r corresponding to the three distance measurement points 200 to 202 in the screen , as described above . the focus detection circuit 105 performs accumulation control and read control of these sensor portions of the line sensor 6f , and outputs each picture element information to the mpu 100 . the mpu 100 a / d - converts this information , and performs focus detection based on the phase difference detection method . then , the mpu 100 performs focus adjustment of the lens by exchanging signals with the lens control circuit 112 . the photometric circuit 106 outputs the output signal from the photometric sensor 10 to the mpu 100 as a luminance signal in each area in the screen . the mpu 100 a / d - converts the luminance signal , and adjusts an exposure amount of a phototaking operation . the shutter control circuit 107 runs forward and rearward shutter curtains ( mg - 1 and mg - 2 ) in accordance with a signal from the mpu 100 , thus performing an exposure operation . the motor control circuit 108 controls a motor in accordance with a signal from the mpu 100 , thus performing an up / down operation of the main mirror 2 , a shutter charging operation , and a film feeding operation . the film running detection circuit 109 detects if the film is wound up by one frame in a film feeding operation , and supplies a signal to the mpu 100 . a switch sw1 is turned on at the first stroke position of a release button ( not shown ), and is used for starting photometric , af , and line of sight detection operations . a switch sw2 is turned on at the second stroke position of the release button , and is used for starting an exposure operation . signals from these switches sw1 and sw2 , and other operation members ( not shown ) of the camera are detected by the switch sense circuit 110 , and are then supplied to the mpu 100 . the liquid crystal display circuit 111 controls the lcd 24 in the finder and a monitor lcd 42 in accordance with a signal from the mpu 100 . the lens control circuit 112 communicates with the mpu 100 via the lens mount contacts 37 to operate the lens focus detection circuit 113 and the aperture control circuit 114 , thereby controlling the focus adjustment and aperture of the lens . the detailed circuit arrangement and operation of the line of sight detection circuit 104 will be described below with reference to fig4 . the area sensor is assumed to have a size of 150 picture elements in the horizontal direction × 100 picture elements in the vertical direction . however , for the sake of simplicity in the description of the circuit , the area sensor illustrated in fig4 has a size of four picture elements in the horizontal direction × four picture elements in the vertical direction . in addition to a function of reading the respective picture element outputs of the sensor , the line of sight detection circuit has a function of reading a picture element output maximum value ( peak output ) of a block as one horizontal line of the sensor , and a function of analyzing image information by performing analog processing of the peak output . one photoelectric conversion element comprises a bipolar transistor 203 which accumulates a light charge on its base , and has double emitters . the first emitter of the bipolar transistor is connected to an output line 201 , and the second emitter is connected to an output line 202 . in each element , a capacitor 204 controls the base potential of the bipolar transistor 203 , and a pmos transistor 205 resets the base . mos transistors 206 are used for connecting the corresponding vertical output lines 201 to the ground potential , and a terminal 207 is used for applying a pulse to the gates of the mos transistors 206 . horizontal driving lines 208 control the base potentials of the bipolar transistors 203 via the capacitors 204 to perform a reset / read operation of the picture elements . buffer mos transistors 209 are enabled when an output from a vertical shift register 232 is applied to their gates , and select picture element rows to be driven . a terminal 210 is used for applying a picture element driving pulse . a wiring line 211 is connected to the drains of the pmos transistors 205 at the right and left ends . an emitter follower circuit 212 has an output connected to the wiring line 211 . amos transistor 213 controls the base potential of the emitter follower circuit 212 . a power supply terminal 214 is connected to the drain terminal of the mos transistor 213 . a terminal 215 is used for applying a pulse to the gate of the mos transistor 213 . each of pmos transistors 216 has a drain fixed at a positive potential . a terminal 217 is used for applying a pulse to the gates of the transistors 216 . capacitors c11 , c21 , . . . , c14 , c24 accumulate picture element output potentials output via the vertical output lines 201 , and mos transistors m11 , m21 , . . . , m14 , m24 are used for performing switching operations between the output lines 201 and the capacitors c11 , c21 , . . . , c14 , c24 . terminals 234 and 235 are used for applying pulses to the gates of the transistors m11 , m21 , . . . , m14 , m24 . a horizontal output line 221 has a parasitic capacitance c2 . switch mos transistors m41 , . . . , m44 electrically connect the capacitors c11 , c21 , . . . , c14 , c24 to the horizontal output line 221 when they are selected by an output from a horizontal shift register 231 . a mos transistor m5 is used for connecting the horizontal output line 221 to the ground potential . a terminal 222 is used for applying a pulse to the gate of the transistor m5 . the transistor m5 is connected to a ground level 223 . an amplifier 224 receives the potential on the output line 221 , and has an output terminal 220 . capacitors 225 accumulate picture element output potentials output via the output lines 202 . mos transistors 226 are used for performing switching operations between the output lines 202 and the capacitors 225 . a terminal 227 is used for applying a pulse to the gates of the transistors 226 . an output line 228 supplies the potentials from the capacitors 225 , and has an output terminal 229 . switch mos transistors 230 are selected by an output from a vertical shift register 233 , and sequentially electrically connect the capacitors 225 and the output line 228 . the vertical shift register 232 receives a driving pulse via a terminal 238 . the vertical shift register 233 receives a driving pulse via a terminal 239 . the horizontal shift register 231 receives a driving pulse via a terminal 237 . mos transistors m31 , . . . , m16 directly connect the capacitors c11 , c21 , . . . , c14 , c24 in units of blocks , and a terminal 236 is used for applying a pulse to the gates of these mos transistors . a comparator 241 compares the output from the amplifier 224 with a reference potential vref1 , and the output from the comparator 241 is output from an output terminal 242 . a mos transistor m6 is used for clamping the input to a comparator 243 to the output from the amplifier 224 in response to a pulse signal 240 input to its gate . after application of the pulse signal 240 , a capacitor c3 inputs the potential difference between the clamped output potential of amplifier 224 and that after clamping to the comparator 243 . the potential difference is compared with a reference voltage vref2 , and a comparison result is output from a terminal 244 . the operation of the single - lens reflex camera according to the embodiment of the present invention will be described below with reference to fig5 a to 9 . referring to fig5 a and 5b , when the operation of the camera is started , the mpu 100 detects the state of the switch sw1 , which is turned on at the first stroke position of the release button , in step (# 01 ). as a result , if the switch sw1 is on , the operation frequency of the mpu 100 is set to be 1 / 1 in step (# 02 ), and a &# 34 ; line of sight detection &# 34 ; subroutine is called to the line of sight detection circuit 104 in step (# 03 ). at this time , since the operation frequency is 1 / 1 , the consumption current becomes maximum . the &# 34 ; line of sight detection &# 34 ; subroutine will be described below with reference to fig7 . when the line of sight detection operation is started in step (# 000 ), data are initialized in step (# 001 ). a variable edgcnt is used for counting the number of extracted edges of the boundary between the iris and pupil . variables ip1 , ip2 , jp1 , and jp2 represent the positions of cornea reflection images ( p images ) of the ireds 13a to 13d , and two p images are present in an area of an eyeball reflection image surrounded by a range from ip1 to ip2 in the horizontal direction ( x - axis ) and a range from jp1 to jp2 in the vertical direction ( y - axis ). the area sensor 14 is assumed to have a size of 150 picture elements in the horizontal direction × 100 picture elements in the vertical direction . thus , the variables ip1 , ip2 , jp1 , and jp2 respectively store central positions ( 75 , 50 ) of the entire sensor as initial values . in step (# 002 ), the ireds 13 for illuminating the eye of the photographer are turned on , and the accumulation operation of the area sensor 14 is performed . fig1 and 11 are timing charts showing the operation of the line of sight detection circuit 104 including the area sensor 14 . the accumulation operation of the area sensor 14 in step (# 002 ) will be described below with reference to fig1 . first , a pulse φp ( 215 ) changes to low level to set the emitter follower circuit 212 to have a positive output potential . at this time , the potential of the driving line 208 connected to the bases of the pmos transistors 205 is at low level , and the pmos transistors 205 are turned on , thus setting the base potentials of the bipolar transistors 203 in all the picture elements to be equal to the output potential of the emitter follower circuit 212 . the pulse φp ( 215 ) changes to high level to set the emitter follower circuit 212 to have a gnd ( ground ) output potential , and thereafter , a pulse φvc ( 207 ) changes to high level to ground the vertical output lines 201 . with this operation , the emitter potentials of the first emitters are supplied to the bipolar transistors 203 of the respective picture elements , thereby lowering their base potentials . furthermore , the vertical shift register 232 is activated by a driving pulse φv1 ( 238 ) to apply a pulse φr ( 210 ) to the horizontal driving lines 208 in units of rows . the base potential of each picture element in a row corresponding to the driving line 208 which changes to high level is temporarily raised by capacitor coupling of the capacitor 204 , but lowers since the emitter current of the first emitter flows . when the potential of the line 208 goes low , the base potential of each picture element becomes a minus potential due to the capacitor coupling , and the first emitter - base path is set in a reverse bias state . at the time of the reverse bias state , the ireds 13 are turned on , and the eyeball image of the photographer is projected onto the area sensor 14 . in each picture element , a charge generated by incident light is accumulated on its base , and the base potential rises in correspondence with the accumulated charge amount . after an elapse of a predetermined accumulation time , the ireds 13 are turned off , thus completing the accumulation . referring back to fig7 upon completion of sensor accumulation in step (# 002 ), the flow advances to step (# 003 ) to perform a pre - read operation . the pre - read operation is the important point of this embodiment , and will be described below in two embodiments . the pre - read operation according to the first embodiment of the present invention will be described below with reference to the timing chart of fig1 showing the operation of the line of sight detection circuit 104 . a pulse φrc ( 217 ) changes to low level to turn on the pmos transistors 216 , thus setting all the horizontal driving lines 208 at high level . at this time , the base potential of each picture element is raised by the capacitor coupling , and its base - emitter potential is set in a forward bias state . as a result , the output values from maximum output picture elements in the respective row appear on the corresponding output lines 202 , and the potentials on the output lines 202 are accumulated on the accumulation capacitors 225 via the mos transistors 226 in response to a pulse φvt ( 227 ). then , the vertical shift register 233 is activated in response to a pulse φv2 ( 239 ) to sequentially output the potentials on the capacitors 225 from the output terminal 229 . these signals are a / d - converted by the internal a / d converter 100c of the mpu 100 , and the mpu 100 compares the a / d - converted output values of the maximum output picture elements in the respective horizontal lines with a predetermined discrimination level . referring back to fig7 if at least one a / d - converted value exceeds the predetermined level , it is determined in step (# 004 ) that p images based on the eyeball images of the photographer are present on the area sensor 14 , and the flow advances to step (# 009 ) and the subsequent steps . on the other hand , if none of the a / d - converted values exceed the predetermined level , no eyeball image is present on the area sensor 14 . that is , it is determined that the photographer does not look into the finder , and the flow advances to step (# 018 ), thus ending the line of sight detection operation . in step (# 009 ), so - called &# 34 ; loop processing &# 34 ; is executed , i . e ., the processing steps in the frame are executed while counting up a loop variable j from 0 to 99 . if it is determined in step (# 010 ) that the y - coordinate falls outside the range from 0 to 99 , it is determined that the loop processing in step (# 009 ) ends , and the flow advances to step (# 015 ). on the other hand , if the y - coordinate falls within the range from 0 to 99 , the flow advances to step (# 011 ), and photoelectric conversion signals in one line in the horizontal direction ( x - axis ) of the area sensor 14 are read . the read operation ( main read ) will be described below with reference to the timing chart in fig1 . the vertical shift register 232 is activated in response to a driving pulse φv1 ( 238 ), and the first horizontal driving line 208 ( v1 ) changes to high level in response to a pulse φr ( 210 ). at the same time , the respective picture element outputs of the first line are accumulated on the capacitors c11 , . . . , c14 via the transistors m11 , . . . , m14 in response to a pulse φt1 ( 234 ). the horizontal shift register 231 is activated by a driving pulse φh ( 237 ), and the respective picture element outputs of the first line accumulated on the capacitors c11 , . . . , c14 are read from the output terminal 220 by the mpu 100 via the amplifier 224 . upon completion of the processing for the first line , the second horizontal driving line 208 ( v2 ) changes to high level in response to a driving pulse φ1 ( 238 ), and respective picture element outputs of the second line are read by the mpu 100 by the similar operations . the same applies to the third and fourth lines . the one - line read operation is executed in the form of a subroutine , and fig8 is a flow chart showing the &# 34 ; one - line read &# 34 ; subroutine . referring to fig8 when this &# 34 ; one - line read &# 34 ; subroutine is called in step (# 100 ), step (# 101 ) is executed . step (# 101 ) and step (# 102 ) in the frame of step (# 101 ) execute the same loop processing as that in step (# 006 ) described above . processing in the frame is executed in step (# 101 ) while counting up a variable k from 0 to 3 , and processing in the frame is executed in step (# 102 ) while counting up a variable i from 0 to 149 . therefore , steps (# 101 ) and (# 102 ) execute so - called &# 34 ; nested &# 34 ; loop processing of the variables k and i . in step (# 103 ) in the loop processing in step (# 102 ), a re - storage operation of array variables im ( i , k ) is performed . in this embodiment , the mpu 100 executes signal processing . in general , the storage capacity of an internal ram ( random access memory ) of a microcomputer is not large enough to simultaneously store all the pieces of picture element information from the area sensor . thus , in this embodiment , only the latest image signals corresponding to five lines in the horizontal direction ( x - axis ) are stored in the internal ram of the microcomputer , and processing for line of sight detection is executed each time signals for one line are read . the execution contents of the double loop processing from steps (# 101 ) to (# 103 ) include an operation for the updating stored image signal data for last five lines so as to read image signals for one new line . more specifically , of the array variables im ( i , k ), the variables im ( i , 0 ) i = 0 to 149 ! represent image data for the oldest line , and the variables im ( i , 4 ) i = 0 to 149 ! represent image data for the latest line . then , data are updated as follows to prepare for storing image signals for a new line in the variables im ( i , 4 ) i = 0 to 149 !. upon completion of the loop processing for updating data in steps (# 101 ) to (# 103 ), loop processing in step (# 104 ) is executed . in the loop processing in step (# 104 ), only signals in a limited area are a / d - converted and stored in the ram , and a minimum value of these image signals is detected while outputting image signals for one line ( 150 picture elements ) in the horizontal direction ( x - axis ) of the area sensor . if it is determined in step (# 105 ) that the value i ( x - coordinate ) falls outside the range from 0 to 149 , the loop processing in step (# 104 ) ends . on the other hand , when the value of the variable i falls within the range from 0 to 149 , the flow advances to step (# 106 ), and the mpu 100 temporarily stores an a / d - converted value adc of each image signal in a variable eyedt . in step (# 107 ), the value eyedt is stored in the corresponding array variable im ( i , 4 ). the variable i is counted up from 0 to 149 in outer loop processing step (# 104 ). steps (# 108 ) and (# 109 ) execute minimum value detection processing of image signals . a variable eyemin holds a minimum value of image signals . if it is determined in step (# 108 ) that eyedt is smaller than eyemin , the flow branches to step (# 109 ), and eyemin is updated by the smaller value eyedt . upon completion of the loop processing in steps (# 104 ) to (# 109 ), i . e ., upon completion of the storage operation of image signals for one new line and the detection operation of the minimum value , the control returns from the &# 34 ; one - line read &# 34 ; subroutine to the main routine in step (# 110 ). referring back to the flow chart in fig7 when the &# 34 ; one - line read &# 34 ; subroutine ends in step (# 011 ), the flow advances to step (# 012 ) to check if the loop variable j in the outer loop processing step (# 009 ) is equal to or larger than 5 . the loop variable j represents the picture element line in the vertical direction ( y - axis ) of the area sensor . in this embodiment , since the number of picture elements of the area sensor is assumed to be &# 34 ; 150 × 100 &# 34 ;, j is counted up from 0 to 99 . if it is determined in step (# 012 ) that the loop variable j is equal to or larger than 5 , the flow branches to step (# 013 ). this is because when the number of lines of the read image signals becomes equal to or larger than 5 , processing in the vertical direction ( y - axis ) of the area sensor is allowed . in step (# 013 ) as the branch destination , a &# 34 ; p image detection &# 34 ; subroutine is executed . the &# 34 ; p image detection &# 34 ; subroutine is the above - mentioned processing for detecting the positions of the p images , and is executed each time one line in the horizontal direction ( x - axis ) of the area sensor is read . fig9 is a flow chart showing the &# 34 ; p image detection &# 34 ; subroutine . referring to fig9 when the &# 34 ; p image detection &# 34 ; subroutine is called in step (# 200 ), loop processing in step (# 201 ) is executed . in this step , loop processing is performed within the range from i = 0 to 149 . in the loop processing , the position of a p image in image data stored in the array variables im ( i , k )! is searched . if the position of a p image is found , the position on the area sensor is stored . in this embodiment , since two p images are generated , two pieces of position information are stored . in first step (# 202 ) in the loop , it is checked if image data at a predetermined position satisfies a condition as a p image . the condition is as follows : the condition is defined in two directions , i . e ., the horizontal and vertical directions ( x - and y - axes ) while paying attention to the fact that the p image is like a spot image , as has been described above with reference to fig1 . if this condition is satisfied , it is determined that a p image is present at a position ( i , 2 ). as described above , the array variables im ( i , k ) are updated each time one line in the horizontal direction ( x - axis ) of the area sensor is read , and data for a line at the position j in the vertical direction ( y - axis ) are stored in im ( i , 4 ) i = 1 to 149 !. therefore , an address ( i , 2 ) with respect to the variable im corresponds to a position ( i , j - 2 ) on the area sensor . if image data satisfying the p image condition is found in step (# 202 ), the flow branches to step (# 203 ) and the subsequent steps ; otherwise , the outer loop variable i is counted up . in step (# 203 ) and the subsequent steps , processing for determining the presence range ( the range ip1 to ip2 ! in the x - axis direction and the range jp1 to jp2 ! in the y - axis direction of the two p images is performed . in step (# 203 ), the variable i representing the position , in the horizontal direction ( x - axis ), of the area sensor is compared with the variable ip1 . if &# 34 ; i & lt ; ip1 &# 34 ;, the flow branches to step (# 204 ). more specifically , if the position of the variable i is present on the left side of the left p image position ip1 in the horizontal direction , in the presence range of the p image , ip1 is rewritten . in step (# 204 ), the value of the variable i is stored in the variable ip1 , and the position ( j - 2 ) in the vertical direction at that time is stored in the variable jp1 . in steps (# 205 ) and (# 206 ), the right p image position ip2 in the horizontal direction and the position jp2 in the vertical direction in the p image presence range are updated . as described above , in the loop processing in step (# 201 ), upon completion of the processing for one line corresponding to the position i = 0 to 149 in the horizontal direction , the flow advances to step (# 207 ). in step (# 207 ), variables xp1 , xp2 , yp1 , and yp2 to be looked up in image processing are calculated using formulas shown in fig9 . these variables are used for removing pupil edge information generated around the p image positions upon detection of the center of the pupil . upon completion of the processing in step (# 207 ), the control returns from the &# 34 ; p image detection &# 34 ; subroutine to the main routine in step (# 208 ). a description will be continued with reference to the flow chart in fig7 again . upon completion of the &# 34 ; p image detection &# 34 ; subroutine in step (# 013 ), a &# 34 ; pupil edge detection &# 34 ; subroutine is executed in step (# 014 ). the &# 34 ; pupil edge detection &# 34 ; subroutine detects the position of the pupil edge ( the boundary between the iris and pupil ) in the eyeball reflection image . the pupil edge is detected by a predetermined algorithm . however , since this algorithm is not directly related to the gist of this embodiment , a detailed description thereof will be omitted . upon completion of the &# 34 ; pupil edge detection &# 34 ; subroutine in step (# 014 ), the loop variable j ( representing the position in the vertical direction , i . e ., the y - coordinate of the area sensor ) in the outer loop processing step (# 009 ) is counted up , and the processing in step (# 010 ) and the subsequent steps is executed until j reaches 99 . if the loop variable j has reached 99 and the read processing of all the picture elements of the area sensor has ended , the flow advances from step (# 009 ) to step (# 015 ). in step (# 015 ), a &# 34 ; pupil designation range setting &# 34 ; subroutine is executed . this subroutine removes false edge points which are generated by various noise components and included in a plurality of edge points detected in the &# 34 ; pupil edge detection &# 34 ; subroutine in step (# 104 ) in addition to those representing the pupil circle ( a circle defined by the boundary between the iris and pupil ). in this subroutine , the coordinates of probable edge points are limited based on the p image position information . however , a detailed description of this subroutine will be omitted here . in step (# 016 ), a &# 34 ; pupil center detection &# 34 ; subroutine is executed . this subroutine estimates the shape of the pupil circle on the basis of the probable pupil edge points so as to obtain the central coordinate , and uses the &# 34 ; method of least squares &# 34 ;. a detailed description of this subroutine will be omitted here . in step (# 017 ), a &# 34 ; line of sight detection &# 34 ; subroutine is executed . the &# 34 ; line of sight detection &# 34 ; subroutine detects the line of sight ( gazing point ) on the basis of the p images and the central position of the pupil circle detected in the above - mentioned processing . basically , as in the above - mentioned prior art , the rotation angle θ of the eyeball optical axis can be calculated in accordance with formula ( 2 ). referring back to fig5 upon completion of the line of sight detection subroutine in step (# 03 ), the flow advances to step (# 04 ). in step (# 04 ), the power supply of the line of sight detection circuit is turned on , and the operation frequency of the mpu 100 is decreased to 1 / 2 , thus suppressing the consumption current in the subsequent routines . in step (# 03 ) for performing the line of sight detection operation , since a very large amount of calculation processing is generated , a very long time is required for line of sight detection unless the operation frequency of the mpu 100 is maximized . however , since a step other than the line of sight detection operation , e . g ., step (# 05 ) for performing a focus detection operation does not require a large calculation processing amount , unlike in the line of sight detection processing , the operation frequency of the mpu 100 can be lowered to attain power saving . in step (# 05 ), the focus detection operation is performed . this operation is performed based on the known phase difference detection method using the focus detection circuit 105 , as described above . in step (# 06 ), the mpu 100 controls the lens control circuit in accordance with the focusing state detected by the focus detection operation , thus attaining focus adjustment of the lens . in step (# 07 ), since a photometric operation to be executed in the next step (# 08 ) requires a further smaller amount of calculation processing , the operation frequency is decreased to be 1 / 16 . in step (# 08 ), the mpu 100 determines an exposure amount on the basis of luminance information of an object from the photometric circuit 106 . in step (# 09 ), a feeding finish flag indicating whether or not the camera is in a film feeding state is checked . if the flag is 0 , since a continuous feeding operation is being performed currently , the flow returns to step (# 01 ) to repeat the operations in steps (# 01 ) to (# 09 ). on the other hand , if the feeding finish flag is 1 , the flow advances to step (# 10 ) to check if the switch sw2 , which is turned on at the second stroke position of the release button , is on . if the switch sw2 is off , the flow returns to step (# 01 ) to repeat the operations in steps (# 01 ) to (# 10 ). if the feeding finish flag is 1 and the switch sw2 is on , a series of &# 34 ; exposure operations &# 34 ; in steps (# 11 ) to (# 15 ) are started . in step (# 11 ), the main mirror 2 is moved upward prior to the exposure operation , and is retracted from the phototaking optical path . in step (# 12 ), the aperture 31 in the lens 1 is driven via the lens control circuit 112 to have an aperture value based on the determined exposure amount . in step (# 13 ), the shutter is controlled by the shutter control circuit 107 to have a shutter release time ( shutter speed ) based on the determined exposure amount . in step (# 14 ), the main mirror 2 , which was retracted from the phototaking optical path , is moved downward , and is obliquely inserted in the phototaking optical path again . in step (# 15 ), the motor control circuit 108 starts a film feeding operation to wind up the film by one frame , and the feeding finish flag is set to be 0 , thus setting interruption processing . thereafter , the control waits for a film feeding finish signal from the film running detection circuit 109 , and returns to step (# 01 ). the feeding finish interruption routine will be described below with reference to fig6 . when the camera operation is in any one of steps (# 01 ) to (# 09 ), if the film running detection circuit 109 generates a film feeding finish interruption , the flow advances from step (# 20 ) to step (# 21 ). in step (# 21 ), the mpu 100 supplies a signal to the motor control circuit 108 to stop the feeding operation , thus ending the wind - up operation of the film by one frame . in step (# 22 ), the feeding finish flag is set to be 1 , and the flow returns to the main routine in step (# 23 ). as has been described above with reference to the flow charts , when the on state of the release button is held at its first stroke position , the &# 34 ; line of sight detection operation &# 34 ;, &# 34 ; focus detection operation &# 34 ;, and &# 34 ; photometric operation &# 34 ; are repetitively performed . on the other hand , when the on state of the release button is held at its second stroke position , the &# 34 ; line of sight detection operation &# 34 ;, &# 34 ; focus detection operation &# 34 ;, &# 34 ; photometric operation &# 34 ;, and &# 34 ; exposure operation &# 34 ; are performed . fig1 a and 12b show a change in consumption current when the on state of the release button is held at its first stroke position in the camera operation of this embodiment . when the photographer looks into the finder and p images for line of sight detection exist ( see fig1 a ), since the line of sight detection operation continues for a long period of time and the consumption current is large , the average consumption current in the entire sequence has a value close to the consumption current in the line of sight detection operation . however , when the photographer does not look into the finder , and no p images for line of sight detection exist ( see fig1 b ), since the line of sight detection operation finishes within a short period of time , the average consumption current in the entire sequence lowers very much . as described above , in the first embodiment , prior to the calculations of the gazing point ( line of sight ) of the observer by a / d - converting respective picture element outputs from the area sensor 14 and executing sequential processing of the a / d - converted values , the area sensor 14 is divided into blocks in units of horizontal lines , and the output values from maximum output picture elements in the respective lines ( blocks ) are a / d - converted to detect the presence / absence of p images . in this case , if it is detected that the observer does not look into the finder , the line of sight detection operation is suspended . as a result , the time required for operating the mpu 100 at the maximum operation frequency 1 / 1 can be shortened , and the consumption current can be greatly reduced in the entire camera operation . the second embodiment of the pre - read operation in step (# 003 ) will be described below with reference to the timing chart in fig1 . in fig1 , the & lt ; base clamp & gt ;, & lt ; sequential reset & gt ;, and & lt ; accumulation & gt ; operations are the same as those in fig1 . the pre - read operation in fig1 is the same as the main read operation in fig1 in a hardware manner , and signals are read from a terminal 220 in turn by an mpu 100 from the first line . at this time , a comparator 241 compares the picture element of interest with a reference potential vref1 , and if the picture element output is equal to or higher than a predetermined level , an output c1 ( 242 ) generates a signal &# 34 ; 1 &# 34 ; in association with the picture element of interest . when a pulse φcl ( 240 ) is enabled , the picture element output of the previous picture element is clamped at one terminal of the capacitor c3 , and thereafter , the pulse φcl ( 240 ) is disabled to read the next picture element output , thereby inputting the difference output from the previous picture element to a comparator 243 . the comparator 243 compares the input difference with a reference potential vref2 , and if a difference picture element output equal to or higher than a predetermined level is found , an output c2 ( 244 ) generates a signal &# 34 ; 1 &# 34 ; in association with the picture element of interest . if both the outputs c1 ( 242 ) and c2 ( 244 ) are &# 34 ; 1 &# 34 ; for the picture element of interest , the picture element is considered to be a p image candidate , since it satisfies the p image detection condition that a picture element is like a spot image having a predetermined luminance level or higher . the method of searching p image candidates on the basis of the output signals c1 ( 242 ) and c2 ( 244 ) from the mpu 100 can be completed within a shorter period of time than the method of obtaining the p images by calculations of the a / d - converted values , as has been described above with reference to fig9 . if it is determined in step (# 004 ) in fig7 that two or more p image candidates are obtained , it is determined that p images exist , and the photographer looks into the finder , and the flow advances to step (# 009 ) and the subsequent steps . on the other hand , if the number of p image candidates is one or fewer , it is determined that the photographer does not look into the finder , and the line of sight detection operation ends in step (# 018 ). the operations in step (# 009 ) and the subsequent steps are the same as those in the first embodiment , and a detailed description thereof will be omitted . as described above , according to the second embodiment , prior to the calculations of the gazing point ( line of sight ) of the observer by a / d - converting respective picture element outputs from an area sensor 14 and executing sequential processing of the a / d - converted values , the feature points of the eyeball image are detected by analog processing simultaneously with the high - speed read operation of the area sensor 14 . if it is detected based on the presence / absence of the feature points that the observer does not look into the finder , the line of sight detection operation is suspended immediately . the first embodiment may erroneously detect that the observer looks into the finder when an image on the area sensor simply has a predetermined luminance level , even through the observer does not actually look into the finder . however , in the second embodiment , although the time required for the pre - read operation is not much shorter than that in the first embodiment , a discrimination probability increases in consideration of the feature point indicating that a p image is a spot image , thus realizing further power saving . the third embodiment of the line of sight detection operation in step (# 03 ) will be described below with reference to the flow chart in fig1 . the same step numbers denote steps that execute the same operations as in fig7 . in the third embodiment , after sensor accumulation (# 002 ), the loop processing in step (# 009 ) and the subsequent steps are executed without performing the pre - read operation (# 003 ) and p image discrimination (# 004 ). upon completion of this loop processing , p image discrimination in step (# 004 ) is performed . if it is determined that no p images formed by the eyeball image of the photographer exist on an area sensor 14 , i . e ., if variables ip1 , ip2 , jp1 , and jp2 indicating the positions of the p images remain set in initial values , since the subsequent line of sight detection operation need not be performed , the flow advances to step (# 018 ), thus ending the line of sight detection subroutine . if the variables ip1 , ip2 , jp1 , and jp2 are updated from the initial values , and it is determined that p images exist , the flow advances to step (# 015 ) and the subsequent steps . as described above , since the third embodiment has a larger number of steps than in the first and second embodiments before discrimination of the presence / absence of p images , the effect of reducing the consumption current and increasing the processing speed slightly lowers . however , since this embodiment does not require any new hardware circuits for the pre - read operation , the effect of the present invention can be attained by modifying only software programs of the conventional circuit , thus providing a merit of a simple arrangement . according to each of the above embodiments , after a line of sight detection sensor , which detects the line of sight by accumulating and reading an eyeball image of the observer , a / d - converting picture element information , and executing sequential processing of the a / d - converted values , and accumulates the eyeball image , the pre - read operation which is completed in a short period of time as compared to the sequential processing is performed , and it is discriminated if the eyeball image of the observer is present . therefore , a line of sight detection apparatus which can systematically attain power saving , e . g ., when the observer does not look into an observation unit in a mode for continuously performing line of sight detection , can be realized . in this embodiment , the ireds 13a to 13d correspond to an illumination means of the present invention , the area sensor 14 corresponds to a light - receiving means of the present invention , a portion for performing the main read operation attained by the mpu 100 and the line of sight detection circuit 104 corresponds to a first signal read processing means of the present invention , and a portion for performing a / d conversion , p image detection , pupil edge detection , and the like attained by the mpu 100 corresponds to a feature point extraction means . a portion for performing the pre - read operation attained by the mpu 100 and the line of sight detection circuit 104 corresponds to a second read processing means of the present invention , and a portion for performing p image discrimination in step (# 004 ) in fig7 by the mpu 100 corresponds to a discrimination means of the present invention . a portion for performing the pre - read operation of the first embodiment corresponds to a means for reading and processing signals associated with respective blocks in claim 4 , and a portion for performing the pre - read operation of the second embodiment corresponds to a means for reading and processing analog - processed second signals in claim 6 . in each of the above embodiments , the present invention is applied to a single - lens reflex camera . however , the present invention may be applied to other cameras such as a lens - shutter camera , a video camera , and the like . furthermore , the present invention may be applied to other optical equipment , other apparatuses , and a constituting unit of other equipment . furthermore , the present invention may be applied to an arrangement as an appropriate combination of the above embodiments or their techniques . as described above , according to the present invention , a peak signal read by a peak read processing means before a line of sight detection operation is a / d - converted , and it is checked based on the a / d - converted value if a purkinje image associated with an eyeball image of an observer is present on a light - receiving means , or the peak signal is analog - processed , and it is checked based on the analog value if a purkinje image associated with an eyeball image of an observer is present on the light - receiving means . if the purkinje image is present on the light - receiving means , since the observer looks into the finder with a high possibility , read processing in units of picture elements of the area sensor is performed , image information associated with the eyeball image of the observer is extracted from the read processing result , and the line of sight of the observer is detected based on the image information . if the purkinje image is not present on the light - receiving means , since the observer does not look into the finder with a high possibility , the line of sight detection operation is suspended . therefore , when the observer does not look into an eyepiece portion with a high possibility , the line of sight detection operation is suspended , thus reducing the consumption power .	6
previous efforts to improve the wear rates of c — c composites have attempted to do so by adding particulates such as ceramics or by changing the type of fiber and matrix carbons or their heat treatments . however , the present invention focuses on taking advantage of the lubricating effect of graphite in the presence of moisture to lower wear rates and increase the life of the brake material through controlled use of carbon additives . this invention describes a method of processing c — c composites that incorporates specific carbon additives that selectively and preferentially interact with the moisture in the atmosphere to reduce the wear rates of the friction material and increase the life of c — c composites while maintaining good stable friction performance . in one embodiment , this invention provides a method of manufacturing a carbon - carbon composite brake disc that has improved wear rates and consistent friction performance . the method of this invention includes several sequential steps , as follows . first , an annular carbon fiber preform is provided . the carbon fiber preform may be , for instance , a nonwoven preform or a preform that consists of chopped fibers which are randomly oriented or a preform that consists of chopped fibers which are oriented to provide strength and thermal and friction and wear performance . then , the carbon fiber preform is infiltrated with carbon using pitch , resin , or cvi / cvd processing to increase the density of the preform . in the case of pitch densification , the pitch - infiltrated preform is optionally stabilized to rigidize it and prevent pitch exudation from the preform during subsequent carbonization . an oxidative stabilization step may be carried out , e . g ., at a temperature between about 150 and 250 ° c . in the case of pitch and resin densification , the pitch and / or resin infiltrated preform is carbonized between 900 - 2540 ° c ., generally in an inert ( nitrogen or vacuum ) atmosphere . between densification cycles , the surfaces of the preform are optionally machined to open surface porosity after carbonization or cvi / cvd processing , thereby facilitating weight increases in the preform during subsequent densification steps . any of the foregoing infiltration ( densification ) steps is repeated sufficient times to achieve a final density in the preform of approximately 1 . 6 to 1 . 85 g / cc . in accordance with the present invention , a step of infiltrating the carbon fiber preform with 0 . 1 to 5 weight -% ( preferably 1 to 2 weight -%) based on the weight of the preform , of a carbon additive which adsorbs moisture from the atmosphere is performed prior to one or more of the foregoing infiltration ( densification ) steps . the maximum particle size of the carbon additive is normally between 1 and 10 microns . the carbon additive may be , for instance , an activated carbon powder with high surface area or a carbon black with high surface area or a combination of activated carbon with carbon black . the additive may be introduced into the composite through vacuum infiltration of a suspension of the carbon particles held in a solvent such as water or acetone . the solvent would then typically be removed , e . g . by drying the additive - infiltrated composite at 110 ° c . for 24 hrs or by heating it to 110 ° c . for 24 hrs under vacuum . alternatively , the solvent may be allowed to evaporate without heating , or the solvent may be dried out of the composite by subjecting the preform to vacuum . often , a final heat - treatment step is carried out at a temperature between about 1200 and 2540 ° c . in an inert ( nitrogen or vacuum ) atmosphere . in another embodiment , the present invention provides a carbon - carbon composite brake disc produced by the process described above . preferred additives in accordance with the present invention include : ( 1 ) carbon black ; and ( 2 ) activated carbon , including but not limited to fibers , powders , and activated carbon black . this invention provides a c — c composite that can be used as a friction material in braking application for automobiles and aircraft and that overcomes some of the difficulties associated with changes in the moisture level of the brake &# 39 ; s environment . this invention adds carbon black or activated carbon to the c — c composite . this additional carbon adsorbs available humidity and retains the moisture within the micropores of the additive . the chemically adsorbed water is retained within the carbon structure , and helps to provide low wear rates by allowing the lubrication properties of the 3 rd body friction films to be realized for an extend period . this process continues through the life of the brake . the method of the present invention includes several sequential steps . first , an annular carbon fiber preform is provided . this carbon fiber preform may be made from nonwoven fabric or may be made up with randomly oriented chopped fibers . this carbon fiber preform is carbonized or heat - treated at 1200 - 2540 ° c ., preferably between about 1200 and 2200 ° c . in an inert nitrogen atmosphere ( nitrogen or vacuum ). the carbon fiber preform is then infiltrated with gaseous carbon using cvi / cvd processing or with pitch or resin . the pitch / resin infiltrated or gaseous carbon infiltrated preform is carbonized between 1200 - 2540 ° c . carbonization may be preceded by an optional stabilization step , for instance oxidative stabilization carried out at 150 - 250 ° c ., to rigidize the pitch and prevent exudation from the preform during carbonization . carbonization may be followed by an optional machining step to “ clean ” the surfaces of the preform and open surface porosity . since cvi / cvd processing is normally performed above 1000 ° c ., there is usually no need to perform a separate carbonization step following a cvi / cvd densification . thus , in the context of the present invention , cvi / cvd processing may be considered to include a carbonization step . the infiltration and subsequent carbonization steps as described above are repeated at least once , to achieve a density in the carbon fiber preform of approximately 1 . 5 - 1 . 7 g / cc . prior to one or more of the densification steps , the carbon fiber preform is infiltrated with a carbon additive designed to adsorb moisture from the atmosphere . the carbon additive particles used in accordance with this invention will typically have sizes ranging from 1 to 10 microns . the additive may be introduced into the preform through vacuum infiltration of a suspension of the carbon particles in a solvent such as water or acetone . the solvent can be dried out of the additive - infiltrated preform by drying . drying may be accomplished by heating to a suitable temperature ( e . g ., 110 ° c . for 24 hours ), with or without the use of vacuum . alternatively , the solvent may be allowed to evaporate out of the preform without a specific heating step , with or without vacuum assistance . the inventive processing described above may be followed by additional steps . for instance , one may conduct an optional final heat treatment of the densified c — c composite to 1200 - 2540 ° c ., typically in an inert nitrogen or vacuum atmosphere . the composite will generally be machined to its final dimensions , and then will typically have anti - oxidant coating applied to it to protect the carbon from oxidation . the present invention makes use of carbon - carbon composite densification techniques which are , in general , well known to persons skilled in the art of manufacturing carbon - carbon composite friction materials for use in such applications as high performance brake discs . outlines of such techniques follow . cvd / cvi . chemical vapor deposition ( cvd ) of carbon is also known as chemical vapor infiltration ( cvi ). in a cvd / cvi process , carbonized , and optionally heat treated , preforms are heated in a retort under the cover of inert gas , typically at a pressure below 100 torr . when the parts reach a temperature of 900 ° to 1200 ° c ., the inert gas is replaced with a carbon - bearing gas such as methane , ethane , propane , butane , propylene , or acetylene , or combinations of these gases . when the hydrocarbon gas mixture flows around and through the porous structures , a complex set of dehydrogenation , condensation , and polymerization reactions occur , thereby depositing the carbon atoms within the interior and onto the surface of the porous structures . over time , as more and more of the carbon atoms are deposited onto the structures , the porous structures become more dense . this process is sometimes referred to as densification , because the open spaces in the porous structures are eventually filled with a carbon matrix until generally solid carbon parts are formed . depending upon the pressure , temperature , and gas composition , the crystallographic structure and order of the deposited carbon can be controlled , yielding anything from an isotropic carbon to a highly anisotropic , ordered carbon . us 2006 / 0046059 a1 ( arico et al . ), the disclosure of which is incorporated herein by reference , provides an overview of cvd / cvi processing . vpi . vacuum pressure infiltration (“ vpi ”) is a well known method for impregnating a resin or pitch into a preform . the preform is heated under inert conditions to well above the melting point of the impregnating pitch . then , the gas in the pores is removed by evacuating the preform . finally , molten pitch is allowed to infiltrate the part , as the overall pressure is returned to one atmosphere or above . in the vpi process a volume of resin or pitch is melted in one vessel while the porous preforms are contained in a second vessel under vacuum . the molten resin or pitch is transferred from vessel one into the porous preforms contained in the second vessel using a combination of vacuum and pressure . the vpi process typically employs resin and pitches which possess low to medium viscosity . such pitches provide lower carbon yields than do mesophase pitches . accordingly , at least one additional cycle of pitch infiltration of low or medium char - yield pitch ( with vpi or rtm processing ) is usually required to achieve a final density of 1 . 7 g / cc or higher . rtm . resin transfer molding (“ rtm ”) is an alternative to the use of vpi for the production of polymer - based composites . in resin transfer molding , a fibrous preform or mat is placed into a mold matching the desired part geometry . typically , a relatively low viscosity thermoset resin is injected at low temperature ( 50 to 150 ° c .) using pressure or induced under vacuum , into the porous body contained within a mold . the resin is cured within the mold before being removed from the mold . u . s . pat . no . 6 , 537 , 470 b1 ( wood et al .) describes a more flexible rtm process that can make use of high viscosity resin or pitch . the disclosure of u . s . pat . no . 6 , 537 , 470 b1 is incorporated herein by reference . carbonization . the carbonization process is generally well known to those skilled in the art . the cvd / resin / pitch - infiltrated fiber preforms are heated in a retort under inert or reducing conditions to remove the non - carbon constituents ( hydrogen , nitrogen , oxygen , etc .) from the fibers and matrix carbons . this process may be performed , for instance , by burying the foam preforms in a bed of activated carbon , enclosed in a superalloy retort with a sand seal . carbonization of the infiltrated pitch can be carried out either in a furnace , a hot isostatic press , an autoclave , or in a uniaxial hot press . in each of these techniques , the impregnated part is heated to the range of 600 ° to about 1000 ° c ., while maintaining an inert atmosphere in the pressure range of 1 to 1000 atmospheres . in one approach , for instance , the retort is purged gently with nitrogen for approximately 1 hour , then it is heated to 900 ° c . in 10 - 20 hours , and thence to 1050 ° c . in 1 - 2 hours . the retort is held at 1050 ° c . for 3 - 6 hours , then allowed to cool overnight . carbonization can be carried out up to 1800 ° c . the higher the pressure , the higher the carbon yield achieved , although the biggest gains in carbon yield are achieved at moderate pressures up to 5000 psi . stabilization / carbonization . carbonization refers to the heating of carbon materials in an inert atmosphere to temperatures typically between 700 and 1600 ° c . the purpose of carbonization in the manufacture of carbon - carbon composites from fibers , pitches , etc . is to remove non - carbon elements such as h , n , o , s , and other impurities from the pitch matrices to form a solid , carbon rich matrix . during carbonization , the volatiles from the pitch are released on porosity is generated in the composite , which has to be filled with pitch during subsequent pitch densification cycles . a stabilization step may be conducted to rigidize the pitch and prevent exudation from the preform during subsequent carbonization processing . the stabilization step may be oxidative stabilization carried out at a temperature of about 150 - 250 ° c . to rigidize the pitch and prevent its exudation during carbonization . alternatively , mechanical or gaseous pressure can be used during carbonization , with or without a containment vessel , to prevent the preform from bloating and to limit the amount of pitch exudate . in some instance , the pitch - densified preforms do not require stabilization prior to carbonization . in such cases , the preforms are typically restrained and / or contained to limit the amount of pitch exudate . heat treatment . intermediate and / or final heat treatment of the preforms is usually applied to modify the crystal structure of the carbon . heat treatment is employed to modify the mechanical , thermal , and chemical properties of the carbon in the preform . heat treatment of the preforms is typically conducted in the range of 1400 ° to 2800 ° c . the effect of such a treatment on graphitizable materials is well known . higher temperatures increase the degree of crystalline order in the carbon material , as measured by such analytical techniques as x - ray diffraction or raman spectroscopy . higher temperatures also increase the thermal conductivity of the carbon in the products , as well as the elastic modulus , and typically result in lower wear rates . machining the surfaces of the preform . standard machining processes , well know to persons skilled in the art of manufacturing carbon - carbon composite brake discs , are used in the manufacture of the carbon - carbon composite friction discs provided by the present invention . between densification processing steps , the surfaces of the annular discs are ground down to expose porosity in the surfaces . once the final density is achieved , the annular discs are ground to their final thickness using standard grinding equipment to provide parallel flat surfaces , and then the inside diameter and outside diameter regions are machined , typically using a cnc ( computer numerical control ) mill to provide the final brake disc geometry , including such features as rivet holes and drive lugs . a nonwoven carbon fiber preform is carbonized at 1600 - 2400 ° c . the carbonized preform is densified by cvi / cvd , and / or pitch ( using vpi ), and / or resin ( using rtm ) to a density in the range of about 1 . 1 g / cc to about 1 . 5 g / cc . the densified preform is infiltrated with a solution containing carbon black or with a solution containing activated carbon . this infiltration is continued until the preform achieves a weight increase of from 0 . 1 % to 2 %. the preform is then densified by cvi / cvd to a final density of at least 1 . 7 g / cc . the fully densified preform is subjected to a final heat treatment at 1600 - 2400 ° c . the preform is then machined to its final dimensions for use as a brake disc . anti - oxidant paint is applied thereto , and the anti - oxidant coated brake disc is charred to prepare it for use , for instance in an aircraft landing system . in a preferred embodiment of the invention , a pan fiber preform is first densified by cvi ( pitch / or resin can also be used ). further densification is performed with either cvi , pitch or resin to achieve a density of approx 1 . 6 - 1 . 7 g / cc . prior to the final densification cycle the selective additive suspended in water or solvent is infiltrated into the composite to form a uniform distribution throughout the bulk of the composite . the additive contained within the open porosity of the carbon composite is then dried to remove the solution / solvent and then the composite densified a final time to bind the carbon additive into the composite . infiltration with the moisture - adsorbing carbon additive may be performed prior to the final carbon densification process and the final heat treatment , since the carbon additive is not adversely impacted by the heat treatment processing . alternatively , the carbon additive may be infiltrated into the carbon preform prior to any one or more of the cvi / cvd densification steps . the present invention has been described herein in terms of preferred embodiments . however , obvious modifications and additions to the invention will become apparent to those skilled in the relevant arts upon a reading and understanding of the foregoing description . it is intended that all such modifications and additions form a part of the present invention to the extent that they fall within the scope of the several claims appended hereto .	2
the present invention will now be described in detail with reference to the accompanying drawings , which are provided as illustrative examples of preferred embodiments of the present invention . notably , the figures and examples provided below are not meant to limit the scope of the present invention . moreover , where certain elements of the present invention can be partially or fully implemented using known components , only those portions of such known components that are necessary for an understanding of the present invention will be described , and detailed descriptions of other portions of such known components will be omitted so as not to obscure the invention . further , the present invention encompasses present and future known equivalents to the known components referred to herein by way of illustration . fig5 illustrates an example implementation of the present invention . this example implementation is based on the texas instruments tms320c6x ( ti &# 39 ; c6x ) architecture . although described in detail in connection with the ti &# 39 ; c6x architecture , those of skill in the art will understand how to adapt the implementation described herein to other processor architecture such as x86 , pentium , sparc , powerpc , mips , sharc , lsi logic , starcore , mcore , and itanium . accordingly , the example implementation described herein is intended as illustrative rather than limiting . for example , although fig5 illustrates an example implementation in an architecture including decode stage registers , it should be apparent that other architectures not including decode stage registers may be adapted for use with present invention , as will be understood by those skilled in the art after being taught by the present disclosure . in such a case , the instructions issued from the dispatch stage to the functional units , rather than being unencoded instructions will be decoded instructions in the form of functional unit control signals . as is known , in the ti &# 39 ; c6x architecture , the dispatch stage of the pipeline consists of a network that routes instructions in the fetch packet ( eight aligned instructions ) to their correct functional units . see , for example , the “ tms320c6000 cpu and instruction set reference guide ,” tech . rep . spru1691 , texas instruments , march 1999 , the contents of which are incorporated herein by reference . dispatch stage 502 of the present invention shown in fig5 , as in the conventional architecture , includes a routing network 512 from each instruction dispatch register 504 - 0 to 504 - 7 to each instruction decode register 506 - 0 to 506 - 7 ( beginning of the path to each associated functional unit fu 0 to fu 7 ). also , as in the conventional architecture and as illustrated in fig4 b , the assembler insures that there is only a single instruction in each execute packet ( subset of the instructions in the fetch packet that can be issued in parallel ) for any functional unit ; i . e . there is no hardware contention for the routing wires or the functional units in a given cycle . this is because in the &# 39 ; c6x hardware , there must be a dispatch register for each instruction in an execute packet , while there must at least as many decoders and functional units as there are instructions in an execute packet . in other words , some implementations may have more decoders and function units than possible instructions in an execute packet , but there must be at least enough decoders and function units to accommodate every possible allowed combination of instructions in the packet . initially , the &# 39 ; c6x hardware and algorithms were designed to function correctly on unroll - based scheduled loops as well as modulo scheduled loops , but explicit prologue and epilogue code were required for the latter . as will be discussed in more detail below , rather than needing to specify each of the prologue , kernel , and epilogue in the user code provided to the hardware , the present invention allows only a single copy of the loop to be specified in the code and uses special hardware to collect the instructions , thereby allowing the prologue , kernel , and epilogue to be formed at runtime . as will be explained in more detail below , the compiler understand that the execution of the loop iterations will overlap and properly schedules and inserts any necessary no operation instructions ( nops ) to prevent resource contention . in accordance with the present invention and in contrast with the prior art , therefore , as shown in fig5 the dispatch pipeline stage 502 further includes modulo schedule buffers ( msbs ) 510 - 0 to 510 - 7 and associated control logic ( not shown ) that collect the fetched instructions for selective and subsequent issue to the functional units . each msb 510 consists of an array of entries indexed by the current cycle of the executing stage of the modulo scheduled loop . the number of entries in the buffer 510 is a design choice , for example 32 , with the choice of entries limiting the modulo scheduled loops that can use the msbs to those which have equal or fewer cycles per stage than the number of entries . as shown in fig6 , each buffer entry 602 in msb 510 consists of an instruction 604 and a stage bit mask field 606 indicating the stage to which the instruction belongs ( e . g . as shown in fig6 a “ 1 ” in the second significant bit position indicates that the instruction is active in stage 1 of the loop , and a “ 0 ” in the first significant bit position indicates that the instruction is inactive in stage 0 of the loop ). during the first iteration of the loop , all instructions to be executed by the functional unit associated with msb 510 during the loop are both issued to the functional unit and inserted into the instruction portion 604 of different entries 602 in msb 510 and tagged with their appropriate stage of execution via bit mask field 606 for subsequent issue to the functional unit . the different entries 602 correspond to the n different cycles within a stage of the modulo scheduled loop . for example , if the loop body for one iteration of the loop consists of four stages and there are two cycles per stage , only the first 2 entries 602 in msb 510 will be needed for executing the loop ( although certain of the entries may include nop instructions ), and only the first 4 bits ( representing stages 0 through 3 ) of the stage bit mask 606 . the specific cycle of an instruction within the first iteration can be computed by multiplying the stage number by the number of cycles per stage and then adding the cycle number . as should be apparent from this example , the number of loop stages that can be implemented is directly proportional to the number of bit positions in the stage bit mask field 606 , for example , 16 . as subsequent iterations of the loop are started , instructions for those iterations are issued from msb 510 , even as instructions for the first iteration may be inserted into buffers 510 associated with other functional units for successive stages . there is never any contention for a functional unit or a buffer entry 602 in a particular cycle because the standard modulo scheduling algorithm already insures that a particular resource used in a particular cycle in a particular stage is never used in that same cycle in any other stage . as will be explained in more detail below , in addition to loading the instructions and associated stage fields in the msbs , three pieces of information must be passed to the control logic associated with the msbs to correctly setup execution of the loop . first , the initiation interval ( ii ) is needed so that new iterations of the loops may be started every ii cycles . second , the number of loop iterations ( loop iters ) to be executed must be supplied . third , the number of cycles ( loop cycles ) required to execute a loop iteration must be supplied . these set up requirements are for traditional ‘ for ’ loops where the iteration count is known prior to execution of the loop . however , ‘ while ’ loops , where it is not known until the end of an iteration whether or not the next iteration will execute , can also be implemented . these loops are supported in the standard modulo scheduling algorithms through the use of control speculated instructions . fig7 depicts a more detailed view of a portion of the dispatch stage 502 of the processor pipeline . as shown , in addition to msb 510 , the dispatch stage includes control logic 700 . in this example of the invention , there is only one set of control logic 700 for the dispatch stage of the processor , whereas the other components of the dispatch stage 502 shown in fig7 , such as buffer 510 , are respectively provided for each functional unit . control logic 700 includes an initiation interval register 702 for storing the ii for the loop , a loop iteration register 704 for storing the number of loop iterations ( loop iters ) to be executed , and a loop cycles register 706 for storing the number of cycles for each iteration in the loop ( loop cycles ). a global counter 708 is used to track the current cycle of the executing stages . whenever this counter increments to the ii ( as determined by comparator 714 that compares the contents of counter 708 with the contents of initiation iteration register 702 ), it is reset to zero , and an active signal from comparator 714 that indicates the end of the current stage is generated . the initiation interval specifies how often a new iteration is started . this is also , then , inherently the number of cycles per stage . the new iteration begins at the first cycle of the first stage , counts cycles until ii is reached , at which time the current iteration enters cycle 0 of the second stage and the new iteration beings at the first cycle of the first stage . because the ii is variable across a variety of loops , extra buffer entries in msb 510 not containing instructions for execution during the loop may exist . thus , the comparison and reset of this counter is necessary rather than a simple modulo table indexing approach . a first iteration stage counter 710 is used to track the current executing stage of the first loop iteration . this counter is used to tag the instructions being added to msb 510 . each time that comparator 714 indicates the end of the current stage , this counter 710 is incremented . this counter may be implemented as a traditional counter or as a bit mask . if implemented as a traditional counter , the value must be converted into the correct bit mask when written into the tag field of an instruction entry , where the first stage has the first bit set , the second stage has the second bit set , the third stage the third bit set , etc . otherwise , the counter may be implemented as a bit mask which is initialized to all 0s with a 1 in the first bit position indicating the first stage , and simply left shifted entering a zero in the vacated position each time the global counter 708 indicates the end of the current stage . loop cycles register 706 is initialized with the number of cycles required to execute one iteration of the loop . this register is used to control the writing of instructions into msb 510 . register 706 is decremented each clock cycle , and when non - zero ( as determined by comparator 718 ), the “ accumulate first iter instructions ” signal from comparator 718 is active , allowing for the insertion of instructions into msb 510 from the dispatch registers 504 . some cycles may contain nop instructions for particular functional units , requiring nothing to be written into that cycle for that functional unit . however , a later stage may write an instruction into that entry later in the iteration . likewise , later stages are required to have nops for a particular cycle and functional unit when the functional unit is used by an earlier stage of another iteration . such later stage nops must not write over earlier stage actual instructions . when register 706 reaches 0 , there are no more instructions in the first iteration of the loop , and the accumulate signal from comparator 718 is inactive . in fact , the next instruction waiting in the instruction dispatch registers is the first instruction after execution of the entire loop . at this point , the fetch unit may be disabled , saving power , until all iterations ( all of which are completely dispatched from the msbs 510 ) are complete . the active stages bit vector register 712 contains a bit for each active loop stage . the register is initialized to 0 . . . 01 ( binary ). the number of bits in the vector is a design choice , for example 16 , which should be the same number of bits as the bit mask field 606 . the initialized value of the vector indicates that only the first stage is ready to execute , in this case for the first iteration . each time the current cycle counter 708 resets ( end of stage signal from comparator 714 is active ), a bit is left shifted into the register . a 1 is shifted in if the loop iteration register 704 indicates that more iterations remain to be executed , i . e . the contents of loop iteration register 704 is greater than zero ( indicated by an active signal from comparator 716 ), otherwise a 0 is shifted in . the loop iteration register 704 is then decremented . as the bits are shifted to the left , the 1 - valued bit representing an iteration executing in a particular stage proceeds to the next stage . generally , when this bit register contains all zeros ( i . e . each bit representing a stage is set to zero ) for the bit positions associated with the stages for the particular loop , all iterations have completed , and execution continues after the loop with the code waiting in the dispatch registers . in an alternative implementation that also supports while loops , an evaluation of a conditional expression in the loop determines whether or not another iteration will begin . this conditional expression can not typically be evaluated until late in the iteration . the standard modulo scheduling algorithm for while loops likely begins successive iterations of the loop before knowing if they should be executed ( speculatively ). for these loops , a conditional evaluation that causes another iteration to execute would cause the shift of a 1 into the active stages bit register 712 rather than the iteration count register 704 . when the conditional evaluates to false , a 0 is shifted in . the proposed design currently requires that the loop back branch to the next iteration be the last instruction in the modulo scheduled loop ( last cycle of the last stage ), as is common with many modulo schedulers . when this is the case , the loop has complete execution when the first zero is shifted into the active stages register 712 . even though portions of other iterations may be currently executing out of the msbs , they are speculative iterations that should not be completed , and execution can proceed with the post - loop code waiting in the dispatch registers . as shown in the example of fig7 , there is additional control circuitry that is provided for each functional unit in addition to msb 510 . decoder 724 provides the index into the msb 510 in accordance with the current cycle stored in counter 708 . comparator 720 compares the contents of the indexed stage bit mask field for the instruction with the contents of the active stage register 712 . if the 1 bit ( indicating the instruction &# 39 ; s active stage ) is also set to 1 in the active stages bit mask ( which contains 1 bits for all active stages ), an active (“ 1 ”) signal is generated , and the indexed instruction corresponding to the indexed bit mask is provided to the instruction decode register 506 ( by operation of or gate 722 and register 728 ). otherwise , a nop instruction is provided . selector 726 selects between instructions issued to decode register 506 from the msb 510 or directly from the dispatch stage . selector 726 thus allows instructions to issue to the decode register 506 from the dispatch stage when processing instructions that are not using the msbs . furthermore , when the first iteration is executing , those instructions are written into the msbs and passed through to the decode register 506 . when instructions from other iterations are executing out of the msbs 510 , these instructions should be passed to the decode register 506 . however , it should be noted that there should never be contention for a particular functional unit . when a non - nop is issued from the dispatch registers , it must be issued to the decode register , and optionally written to the appropriate msb when handling modulo scheduled code . otherwise , when in modulo scheduled code and an instruction with an active stage is in an msb , it must be issued to the decode register . a contention indicates that the compiler incorrectly modulo scheduled two instructions from different stages into the same functional unit in the same cycle . the following describes an example operation of a processor implementing the modulo scheduling buffer scheme of the present invention , as further illustrated in fig8 a and 8b . the example depicts three iterations of a loop on a 4 - issue machine with fully pipelined load ( lat . 2 ), multiply ( lat . 2 ), add ( lat . 1 ), and shift ( lat . 1 ) units . the loop body , as illustrated at the upper right corner of fig8 , consists of two loads , one multiply , one add , and one shift instruction . the loop is modulo scheduled into three stages . thus , each iteration requires 6 cycles to execute , with a throughput of one iteration per two cycles ( i . e ., ii = 2 ). also , assume that all register and memory dependences have been satisfied for the modulo schedule by the scheduler . dashed lines indicate instructions that are dispatched from the dispatch unit to the decoders and simultaneously stored into the appropriate msb 510 . solid lines indicate stored instructions that are issued from the msbs 510 . pre - loop ) initialize the ii (= 2 ), loop cycles (= 6 ), and loop iterations (= 3 for three iterations of the loop ) registers , all as detailed above . this happens in the s units on the ti &# 39 ; c6x and the registers can be written in the exi stage , like other 1 - cycle instructions . at this time , the instructions following the values for the loop initialization registers are already in the dispatch registers and therefore cannot be routed into the msbs 510 . thus , another instruction , possibly a nop , must fill the slot immediately after the initialization instructions before the first loop instructions . the loop iters register is decremented by 1 as the first iteration is about to issue . the active stages bit register 712 is initialized to 0 . . . 01 to indicate that the first stage is active . cycle 0 ) the first instruction execute packet ( containing the first load ) in the loop is sitting in the dispatch registers ready to be routed to its decode instruction registers ( functional unit ). this packet may maintain from one instruction up to the issue width , or even no instructions . all instructions in this execute packet are routed and issued to the dispatch registers 504 , and simultaneously inserted into their appropriate functional unit msb 510 . in this case , the load is issued and stored in the cycle 0 entry of msb 510 - 0 and given a stage bit mask indicating the first stage . the current cycle counter 708 is incremented to the second cycle . the loop cycles register 706 ( remaining cycles for the first iteration ) is decremented to 5 more cycles . cycle 1 ) the second instruction is also a load . this is inserted into the cycle 1 entry of msb 510 - 0 . at the end of this cycle , the current cycle register 708 is reset to 0 . because the loop iters register 704 indicates that more loop iterations remain to be executed , a 1 bit is left shifted into the active stages register 712 , the result of which can be seen in the cycle 2 . the loop iters register 704 is then decremented . the first iter stage register 710 is incremented to 1 . cycle 2 ) no instruction is added to any of the msbs 510 because of the nop in the schedule . however , the load instruction for the stage 0 of the second loop iteration is automatically issued by msb 510 - 0 . cycle 3 ) the mul instruction is issued and added to the second cycle entry of msb 510 - 1 , and the load instruction is automatically issued from msb 510 - 0 . the third loop iteration is ready to be initiated after this cycle . cycle 4 ) the load instruction for the third loop iteration is automatically issued from msb 510 - 0 . cycle 5 ) the add and shift instructions are issued from the dispatch registers and added to msbs 510 - 2 and 510 - 3 from the dispatch , and the second load instruction for the third iteration and the mul instruction for the second loop iteration are automatically issued from msbs 510 - 0 and 510 - 1 , respectively . there are no more iterations left to initiate as the loop iters register 704 is at 0 . shift a 0 into the active stages register 712 . any instructions tagged with the first stage will no longer be issued ; i . e . no load instruction will be issued from msb 510 - 0 in cycle 6 and thus no new iterations will be performed . the loop cycles register 706 is decremented to zero , indicating there are no more instructions in the first iteration . cycle 6 ) the loop cycles register 706 has now reached zero so no more instructions will be issued or added from the dispatch unit . the fetch unit can be powered down . no instructions are issued from the msbs 510 since no active stages have instructions in cycle 0 . cycle 7 ) the mul instruction for the third loop iteration , and the add , and shift instruction for the second loop iteration are issued from msbs 510 - 1 , 510 - 2 and 510 - 3 , respectively . no new iterations are to be started , so another 0 is left shifted into the active stages register 712 . cycle 9 ) the add and shl instructions for the third loop iteration are issued from msbs 510 - 2 and 510 - 3 . a zero is left shifted into active stages register 712 . this register is now all zeroes . the modulo scheduled loop has completed , and the dispatch and fetch units are re - enabled to begin post - loop code execution . further advantages and aspects of the present invention will now be described with reference to fig9 to 14 . as is known , two primary scheduling models exist for non - unit assumed latency ( nual ) architectures . the ti &# 39 ; c6x is an example of the equals model ( eq ), where each operation executes for exactly its specified latency , and writes back the result exactly after that latency has expired . consider the example in fig9 . in cycle 0 , register r 1 is initialized to a value of 1 . in cycle 1 , the multiply operation begins using the value of 1 for r 1 . because the latency of the multiply is 3 cycles , the result of the multiple will not be written back to r 1 until the end of cycle 4 . meanwhile , in cycle 2 , the value of r 1 is guaranteed to still be 1 , and the add completes writing a value of 9 to r 1 . the store of r 1 in cycle 3 is also guaranteed to be unaffected by the multiply and will correctly write to memory a value of 9 . as can be seen in this example , registers can effectively be reused during long latency operations , often resulting in fewer register needed for a computation . ti calls this particular type of reuse multiple assignment . the other model is called the less than or equal model ( le ). under this model , the result latency is specified as the maximum time that a particular operation may take to complete and write back its result . in other words , the result may be written back at any time up until and including the cycle at which its latency expires . coding for this model disallows the register reuse allowed in the equals model . fig1 a , 10 b and 10 c show the execution of the example code as executed on an eq machine and on an le machine where the actual multiply latency varies from three , two , to one , respectively . ti calls this type of register allocation single assignment . while registers cannot be reused during long latency operations , interrupt handling in code scheduled for the le model is much simpler . whenever an interrupt is taken , several instructions are already in the execute pipeline . precise interrupts are maintained by completing execution of code already in the functional units and squashing code in the fetch or decode units . after processing the interrupt , execution can continue from a single program counter value . from the vantage point of the first instruction after resumption , all instructions scheduled prior to it have completed , even though some may have had a maximum latency well beyond the first instruction after resumption . clearly , when scheduling and register allocating for an le machine , a single assignment methodology must be used . if an instruction finishes early and overwrites a register , another usage of that register might read the new value rather than the old value . however , for an eq machine , either single assignment or multiple assignment scheduling and allocation may be used . if the instruction is guaranteed to take a certain number of cycles , assuming that it can finished early is a safe , conservative assumption . correctly handling interrupts in the le model is simple , as all instructions that have started executing are allowed to finish . these instructions may finish early ( before their maximum latency ) relative to instructions that execute after the interrupt is processed . however , scheduling for the le model required that the code be scheduled with this uncertainty in mind . likewise , correctly handling interrupts in the eq model under single assignment it simple , as all instructions prior to the interrupt can be allowed to finish . since the schedule assumed that they may finish early , the computation will be correct . however , interrupt handling in the eq model under multiple assignment is more difficult . consider the situation when an interrupt is taken immediately after instruction 1 in the example in third column of fig9 . a precise interrupt cannot be taken because there is no single program counter value where all instructions prior to the pc have been executed and all after have not . the multiply was issued prior to the interrupt and has not yet completed . furthermore , if that instruction is allowed to complete before the interrupt is actually taken , then the value of r 1 would be prematurely overwritten with the result of the multiply . the results of the total computation would be as shown in the last column of fig9 . therefore , in the ti processors , interrupts must be disabled for any portion of the code that use multiple assignment . this is of particular concern for long - running modulo scheduled loops that use multiple assignment . all interrupts must wait until the modulo scheduled loop has completed all iterations . this could significantly delay processing of the interrupts . however , by using the modulo schedule buffers of the present invention , interrupts will only have to wait until the end of the current loop iteration before they can be processed . this is a benefit of having the control logic actually issuing iterations of the loop . when an interrupt occurs , iterations will stop being issued from the modulo schedule buffers , just like when the last iteration of the loop has been issued , as shown in fig1 . this means that the loop counter 704 will no longer be decremented , and zeroes will be shifted into the active stages bit register 712 until all previously issued iterations have completed . at this point , the interrupt can be taken . note that the current loop counter register 704 contains the number of iterations that remain in the loop and will need to be saved across context switches . upon return from the interrupt , the modulo schedule buffers 510 are cleared , and filling and issue resumes just like when the first iteration was begun , only now with the saved loop counter value in register 704 . when a loop is modulo scheduled , the ii is chosen to be as small as possible , thus starting successive iterations as early as possible . the limiting factor in choosing an ii is often a cross - iteration flow dependence , otherwise known as a recurrence . such a dependence often consists of a producer operation late in the loop body that feeds a value to an earlier operation in that loop body but in the next iteration . a simple example is an accumulator operation , where the accumulate instruction feeds the result to itself in the next iteration . therefore , beginning a successive loop iteration before the minimum recurrence ii will result in incorrect results because the cross - iteration flow dependence would not have been met . however , one can start the next iteration at any time later than the recurrence ii , such as after the prior iteration has completed . at the end of each iteration of the loop body , a set of registers and memory locations exist that communicate state to the next iteration . in general practice , these physical registers are not reused for other temporary values , and thus will be live until the next iteration consumes them . consider the loop body depicted in fig1 a . in this example , two virtual registers are used in the loop body , where virtual register 1 is live across the end of the first iteration into the next iteration . when register allocating this loop , two different physical registers are required , as the lifetimes of the two virtual registers overlap . however , a register allocator that understands the effects of modulo scheduling may see the register lifetimes as depicted in fig1 b and allocate a single physical register for them both . such a register optimization must be avoided to properly handle interrupts in the present invention because the values which are live into the next iteration must be preserved . normally , the ii is small enough that no opportunities exist for such a register optimization . similarly , modern machines that use modulo scheduling generally have enough registers where such an optimization is not necessary . consider an example loop , depicted in fig1 , from table 6 - 7 of the ti programmer &# 39 ; s guide ( texas instruments , “ tms320c62x / c67x programmer &# 39 ; s guide ,” tech . rep . spru198c , texas instruments , texas , may 1999 .) this loop executes a dot product , two terms per cycle , with an ii of 1 cycle , and uses multiple assignment . the loop body consists of two loads that feed 2 multiplies 5 cycles later . the multiplies take two cycles to complete before the results are fed to the adds . note also the cross - iteration dependences : each load is a post - increment load where the address operand is automatically incremented and passed on to the load in the next iteration ; each add is an accumulator which passes its result on to the add in the next iteration . at the end of cycle zero , the two loads for the first iteration have been executed , there are n − 1 iterations which remain to be started , and the active stages bit register 712 shows that only the first stage ( one cycle per stage in this example ) is active . in the second cycle , cycle one , the two loads are issued from the modulo scheduling buffers 510 for iteration two , and no instructions are issued for the first iteration . even though there are no instructions for stage two of the first iteration , the active stages bit register 712 indicates that the stage is active . in cycle seven , an interrupt request is received . as described earlier , the complexity with multiple assignment is that there are five different outstanding result values for each of the load instructions , values for iterations three through seven . processing an interrupt at this point would require that all five values be saved along with the timing information in order to switch context , a functionality not present in most architectures . the iterations that have begun executing must be allowed to finish with proper timing in order to obtain the correct results . however , with traditional modulo scheduling , as iterations are allowed to finish , new iterations are begun which also must be allowed to finish , resulting in the rule that such loops must totally complete before processing an interrupt . or , normal epilogue code could be entered and completed , but then program flow would not be able to restart the loop to finish the iterations without the additional overhead of an encapsulating outer loop to catch this case . the present invention allows for the ability to execute the epilogue code when needed and then to resume later . the loop state is held in the cross - iteration values , as previously mentioned , along with the loop control state maintained by the loop hardware . one potential drawback to using the modulo schedule buffers scheme of the present invention concerns the execution of loop initialization code . when the instructions for the prologue are completely inserted into the binary , it may be possible to also schedule initialization code in parallel with those prologue instructions . it may also be possible to execute post - loop code in parallel with the epilogue . these optimizations may reduce the total number of cycles required to execute the loop . in the hardware scheme of the present invention , however , such overlap is not possible . the reduction in cycles due to the aforementioned overlap is generally small compared to the cycles spent executing the loop itself . many loops have iteration counts that are not determined until run - time . however , the compiler , by using heuristics and profile information , may decide to modulo schedule such loops anyway . provided that the loop iterates at least as many times as the number of overlapped iterations in the kernel , the fully generated code will work correctly . however , in some code generation schemes , the entire prologue and at least one copy of the kernel must be executed , thus beginning a minimum number of iterations . there are two primary methods for allowing for the short iteration count loops . first , by adding some extra branching instructions to the prologue and possibly some specialized copies of the epilogue , the kernel may be skipped . however , this may significantly increase the code size . second , rather than execute the modulo scheduled version of the loop at all , another piece of code is branched to that handles short iterations , such as one with a traditional loop structure ( called pre - or post - loop conditioning ). this , too , increases code size . unlike either of these two methodologies , the modulo schedule buffer hardware scheme of the present invention automatically handles short iteration count loops , by simply initiating the correct number of iterations . in many loop bodies , some temporary values must be stored longer than the ii . this poses a problem as the write to the register in the second iteration will be completed before the read in first iteration is executed . one method for solving this problem is to require that writes in the overlapped loop iterations actually use different registers , which is called modulo variable expansion ( mve ). see , for example , m . s . lam , “ software pipelining : an effective scheduling technique for vliw machines ,” in proceedings of the acm sigplan 1988 conference on programming language design and implementation , pp . 318 - 328 , june 1988 ; b . r . rau , m . s . schlansker , and p . tirumalai , “ code generation schemas for modulo scheduled do - loops and while - loops ,” tech . rep . hpl - 92 - 47 , hewlett packard labs , april 1992 ; and d . m . lavery , modulo scheduling for control - intensive general - purpose programs . ph . d . thesis , department of electrical and computer engineering , university of illinois , urbana , ill ., 1997 . this requires that the several copies of the kernel , one for each different version , execute in round robin fashion . the hardware scheme of the present invention may be extended to handle mve code . the simplest method is to combine the original with the altered iterations into a single code sequence that performs the work of multiple iterations . fig1 a shows the loop body , iter a , with two mve copies , iters b and c . the combined loop body is shown in fig1 b , along with the new issue pattern and ii in fig1 c . this scheme requires no clean up code , as the last iteration is always a type c iteration , but does require pre - or post - conditioning if the total number of loop iterations is not divisible by the amount of overlap in the combined loop body . as mentioned earlier , heavy use of predication can also be used to reduce code size . see j . c . dehnert , p . y . hsu , and j . p . bratt , “ overlapped loop support in the cydra 5 ,” in proceedings of the third international conference on architectural support for programming languages and operating systems , pp . 26 - 38 , april 1989 . predication allows any instruction to be conditionally executed depending on the value of a predicate , or condition , bit . predication is often used to eliminate branching by instead setting a predicate bit based on a comparison , then conditionally executing the otherwise branched - to code when that predicate is true . predication can also be used in a clever way to support modulo scheduling . with kernel - only modulo scheduling , only the kernel itself need be inserted into the program code , without any prologue or epilogue . the key is to maintain a predicate register for each stage of the modulo schedule , which allows or prevents execution of the instructions for that stage depending on the predicates . in essence , the active stages bit vector 712 is a set of predicate registers that do exactly the same thing . in kernel - only modulo scheduling , it is the programmer / compiler &# 39 ; s responsibility to correctly assign the predicate registers and maintain them at runtime . the architecture does provide assistance in the form of a rotating register file . each time a new iteration is initiated ( ii cycles ), the names of the registers are shifted by one . thus the active stages bit register in our scheme is maintained in the predicate register file in the kernel - only scheme , where the shifting happens automatically . although the present invention has been particularly described with reference to the preferred embodiments , it should be readily apparent to those of ordinary skill in the art that changes and modifications in the form and details may be made without departing from the spirit and scope of the invention . it is intended that the appended claims include such changes and modifications .	6
a pre - bunking apparatus usable according to principles of the present invention is depicted in fig1 and 2 schematically . fig1 is an end planar view of pre - bunking apparatus 10 , showing portable bunk 14 and chain and cord assembly 16 . chain and cord assembly 16 is connected at one end to cord tie loop 20 and wrapped around a load of logs 12 . once wrapped around load of logs 12 , chain and cord assembly 16 is connected to a hand winch 18 and pulled tightly around the load of logs 12 to contain the load of logs 12 within portable bunk 14 . the portable bunk 14 is explained in greater detail with reference to fig5 - 7 . generally , portable bunk 14 is of a similar configuration to bunks mounted on prior art truck trailers , having generally a u - shape cradle and a width from one end of the u to the other that is about the same distance as the width of a regular trailer bed for hauling freight . in the embodiment depicted by fig1 - 3 , there are at least two portable bunks 14 and 15 . the portable bunks 14 and 15 depicted in fig1 - 3 are generally of the same configuration . portable bunk 14 includes a bunk base member 24 upon which the load of logs 12 rests . the bunk base member 24 rests on top of a portable skid 21 which is comprised generally of first and second sledding members 22 and cross - members 26 . portable bunks 14 and 15 are detachable from portable skid 21 . in the depicted embodiment , as seen best in fig3 , bunk base member 24 may be hollow creating a bunk tube 65 wherein a lifting surface 30 can be received . as shown in fig3 , a tractor 28 is used to lift the portable bunk 14 from the portable skid 21 once the load of logs to be transported 12 is secured by way of chain and cord assembly 16 through hand winch 18 . one of skill in the art will recognize that there are a variety of ways to securely hold a load of logs to be transported 12 within portable bunk 14 and that chain and cord assembly 16 along with hand winch 18 are but one . referring now to fig4 , portable bunks 14 and 15 including a load of logs to be transported 12 are loaded by tractor 28 into trailer 32 which has been adapted to receive and securely fasten portable bunks 14 and 15 through the use of bunking hardware ( not depicted ). suitable bunking hardware is explained below with reference to fig9 a - 9c . with continuing reference to fig4 , trailer 32 may be of the kind disclosed by u . s . pat . no . 4 , 700 , 985 granted to whitehead . trailer 32 includes a retractable side wall disposed between a first end wall 35 and second end wall 37 and opposite a first side wall 39 . logs to be transported 12 , being securely fastened to portable bunks 14 and 15 through the use of chain and cord assemblies 16 and 17 , are loaded through the retractable side wall and securely fastened to the trailer bed 36 through the use of bunking hardware described below with reference to fig9 a - 9c . it is important to note that the invention is not limited to use of a trailer as disclosed by u . s . pat . no . 4 , 700 , 985 . any trailer adapted to carry both portable bunks 14 and 15 and a load such as wood residuals is usable with the present invention . for example , any trailer that has been adapted to secure portable bunks 14 and 15 and subsequently adapted to carry a load is within the spirit and scope of the invention . by way of example only , trailer 32 is adapted to carry wood residuals or any other load by extending the retractable side wall ( not depicted ) through the use of vertical straps 34 . according to the depicted embodiment , trailer 32 has a soft retractable side wall that rolls up around a torque roller through the use of a winch ( not depicted ). the invention is not limited to the use of a trailer with walls ; a flatbed trailer adapted to secure portable bunks 14 and 15 is also usable with apparatuses and methods of the invention . through the use of trailer 32 and portable bunks 14 and 15 as depicted in fig1 - 4 , the depicted embodiment permits hauling of cut timber as well as pick - up and hauling of wood residuals or any other load . a load may be contained within trailer 32 by affixing into place the retractable side wall . alternatively , trailer 32 could have four hard walls and an open top through which portable bunks 14 and 15 are top - loaded and thereafter secured to the bed through bunking hardware . one of ordinary skill in the art will recognize that trailer 32 could be configured in a variety of other ways to permit both the fastening of portable bunks 14 and 15 and the ability to carry a load . for example , trailer 32 could be loaded with portable bunks secured with logs to be transported 12 by first removing first end wall 35 or second end wall 37 . with continued reference to the embodiment depicted by fig1 - 4 , pre - bunking apparatus 10 can be connected to a scale ( not shown ) providing gross weight of logs to be transported after the same have been loaded onto portable bunks 14 and 15 and portable skid 21 . a suitable scale is available from structural instrumentation , inc ., seattle , wash ., model no . 91 - 00910 . the scale usable with the invention can also be connected to a remote display , model no . 9400rmd also available from structural instrumentation , inc ., seattle , wash . the remote display provides an accurate readout of gross weight of logs to be transported after the same have been loaded onto pre - bunking apparatus 10 . methods of the present invention permit the operator or operators to adjust the load of logs to be transported 12 according to predetermined trailer or truck capacities . one of the benefits of the present invention permits operators to maximize value of the load of logs to be transported by accurately pre - bunking logs to be transported that are of varying sizes and species . referring now to fig1 and 12 where a pre - bunking apparatus utilizing principles of the present invention is depicted . fig1 shows a portable skid 21 fully laden with long logs to be transported 122 . fig1 shows a portable skid 21 fully laden with logs of varying lengths and sizes 124 . through reference to fig1 and 12 , one aspect of the invention incorporating removable bunking hardware 72 is further described . suitable removable bunking hardware 72 is explained in greater detail with reference below to fig9 a - 9c . in general , bunking hardware 72 is comprised of a plurality of guide members and locking means mounted width - wise on either the trailer bed 36 or portable skid 21 . bunking hardware 72 generally includes a receiving end 84 and a shoe end 90 ( in fig9 b ), both of which include locking means and a plurality of gusseted guide members extending vertically from either trailer bed 36 or portable skid 21 and adapted generally to guide portable bunk 14 into place and securely fasten portable bunk 14 on either portable skid 21 or trailer bed 36 . according to the embodiment depicted by fig1 and 12 , removable bunking hardware 72 can be alternately switched and secured into a plurality of bunking hardware stations 132 , 134 , 136 , 138 , 140 , and 142 , respectively . suitable bunking hardware stations usable with the depicted embodiment are described in greater detail with reference to fig1 below ; however , in general they are comprised of fixed assemblies , built into either portable skid 21 or on trailer bed 36 at various positions , underneath bunking hardware 72 . the bunking hardware stations generally include a bored hole adapted to receive a locking member mounted to the underside of removable bunking hardware 72 at each end . locking pins may engage a locking member mounted to the underside of bunking hardware 72 in a manner suitable to securely hold bunking hardware 72 onto the bunking stations . trailer bed 36 as well as portable skid 21 include a plurality of bunking hardware stations 132 , 134 136 , 138 , 140 , 142 equipped with bored holes 131 adapted to receive locking members from the bunking hardware 72 . according to the depicted embodiment , pre - bunking hardware 72 can be moved to any pre - bunking hardware station 132 , 134 , 136 , 138 , 140 , or 142 . in the case of the trailer 32 ( as seen in fig4 ), where it is desirable to carry a load of wood residuals or other material , the ability to remove the bunking hardware 72 provides the added benefit of providing a flat bed whereupon a load may slide freely , aiding methods of loading and unloading trailer 32 . with reference now to fig5 a , portable bunk 14 will be described in greater detail . portable bunk 14 is generally comprised of u - shaped bunk cradle 38 and bunk base member 24 . according to one embodiment , bunk base member 24 is an elongated hollow member disposed lengthwise at the base of u - shaped bunk cradle 38 . a u - shaped bunk cradle 38 is comprised of a first collapsible member 40 that extends vertically from one end of bunk base member 24 , terminating with a tapered edge 43 . at the other end of base bunk member 24 , a second collapsible member 41 is disposed vertically from the end of base bunk member 24 opposite first collapsible member 40 and ending with a tapered edge 47 . both second collapsible member 41 and first collapsible member 40 are rotatably attached to either end of bunk base member 24 through pin assemblies 70 and 58 , respectively . in operation , second collapsible member 41 may be collapsed through rotation of approximately 90 ° from vertical such that second collapsible member 41 is ultimately laid at rest substantially parallel to bunk base member 24 . additionally , first collapsible member 40 is also rotatable approximately 90 ° from vertical such that it rests substantially parallel to bunk base member 24 . with continuing reference to fig5 a , portable bunk 14 includes both a heel end 61 and a toe end 52 . heel end 61 is located at the base of second collapsible member 41 while toe end 52 is located at the base of first collapsible member 40 . the portable bunk &# 39 ; s toe end 52 is referred to as such because it is at this end that the portable bunk 14 is slid securely into the bunking hardware 72 which is described in greater detail with reference to fig9 a - 9c . in general , bunking hardware 72 includes a plurality of vertically extending gusseted guide members that form a “ shoe ” adapted to receive and lock into place toe end 52 . furthermore , bunking hardware 72 includes a receiving end opposite that of the “ shoe ” end and also comprised of a plurality of gusseted guiding members and at least one locking surface wherein the heel end 61 of portable bunk 14 is guided and locked into place as described in further detail below with reference to fig9 a - 9c . heel end 61 includes a container lock 44 which in fig5 a is partially covered by container lock housing 42 . container lock 44 is described in greater detail below , however , in general it includes a rotatable locking member 46 that is adapted to engage a locking surface located on bunking hardware 72 . on either side of bunk base member 24 welded into place are cradle side plates 55 and 51 . cradle side plates 55 and 51 are welded onto the heel end 61 and toe end 52 respectively . container lock housing 42 is welded on cradle side plate 55 located at the heel end 61 of bunk base member 24 . with reference now to fig5 b , container lock 44 is mounted to the heel end 61 of portable bunk 14 . container lock 44 can be any locking mechanism suitable for securely fastening portable bunk 14 to suitable bunking hardware 72 , such as that described below . in the disclosed embodiment , container lock 44 is an off - the - shelf item available from buffers usa inc ., saf - t - loc ® model no . 3133 - 1 . container lock 44 is mounted on cradle side plate 55 at the heel end 61 of portable bunk 14 . as seen best in fig8 , container lock 44 includes a locking member 46 which is generally rectangular in shape with both a short end 66 and a long end 68 . in operation , locking member 46 is rotatably retractable within housing 42 through opening 64 . opening 64 is sized slightly larger than locking member 46 to permit the upward retraction of locking member 46 within housing 42 , once locking member 46 has been rotated to match an orientation permitting its retraction through opening 64 . once portable bunk 14 has been loaded with logs to be transported 12 , it is unlocked from the portable skid 21 through rotation of the container lock 44 and especially the locking member 46 , through a twisting and lifting manipulation of handle 60 in a manner that orients the locking member 46 in alignment with the opening 64 of the housing 42 , thereby permitting locking member 46 to retract up and inside of housing 42 , freeing portable bunk 14 and permitting its removal from portable skid . once the portable bunks 14 and 15 have been lifted and removed from the portable skid 21 , they are transported to the trailer 32 whereupon they are slid into bunking hardware 72 with toe end 52 being slid in first . subsequently , container lock 44 is again rotated such that locking member 46 is in alignment with the opening 64 of housing 42 sufficient to permit locking member 46 to protrude from housing 42 and be rotatably engaged with a locking surface upon bunking hardware 72 , thereby locking portable bunk 14 securely into place on the trailer 32 . fig6 a shows a side planar view of heel end 61 of bunk base member 24 . as discussed above , heel end 61 is hingedly connected to a second collapsible member 41 which extends essentially vertically from bunk base member 24 . second collapsible member 41 is rotatably collapsible about pin assembly 70 which is transversely mounted through cradle side plate 55 . cradle side plate 55 is welded at heel end 61 and flush with bunk tube opening 63 . bunk tube opening 63 is a rectangular space at the heel end 61 of bunk base member 24 . bunk tube opening 63 is an entrance space for bunk tube 65 , which extends through the length of bunk base member 24 . in this particular embodiment , bunk tube 65 and especially bunk tube opening 63 are of a size sufficient to receive a lifting surface such as the fork of a forklift or tractor which can be slid through the length of bunk tube 65 . with reference now to fig6 b and 7 , toe end 52 of portable bunk 14 is described in greater detail . as discussed briefly above , toe end 52 is hingedly connected to a first collapsible member 40 extending essentially vertically from the toe end of bunk base member 24 . first collapsible member 40 is hingedly connected by way of pin assembly 58 which is transversely interposed through cradle side plates 51 . welded on the side of cradle side plate 51 is chain link fastener 48 which is used in this particular embodiment to secure chain and cord assembly 16 ( not depicted ). toe end 52 includes gusseted sides 56 and toe end plate 54 . gusseted sides 56 extend away from the terminus of the toe end 52 of bunk base member 24 such that toe end side plate is disposed in a plane slightly beyond the terminus of bunk base member 24 . toe end plate 54 thus protrudes away from a vertical plane in which bunk base member 24 ends . the protruding nature of toe end 52 and especially toe end plate 54 permits the engagement of a locking pin through end hole 50 . a suitable locking pin is rotatably connected to bunking hardware 72 which is described in greater detail with reference to fig9 a - 9c . with reference now to fig9 b , bunking hardware 72 is described in greater detail . bunking hardware 72 does not differ in configuration when mounted on either trailer bed 36 or portable skid 21 . fig9 b is a top view of bunking hardware 72 showing receiving end 84 and shoe end 90 ; these respective ends are disposed opposite one another at locations along the width of either trailer bed 36 or portable skid 21 . receiving end 84 , when mounted on trailer bed 36 is preferably located on the side of trailer bed 36 where portable bunks 14 and 15 , after having been secured to a load of logs to be transported 12 are loaded . as discussed previously , a trailer usable with the invention has a retractable sidewall through which portable bunks 14 and 15 are loaded . accordingly , receiving end 84 is preferably mounted on the side of trailer bed 36 that will receive a load of logs to be transported 12 after the same have been securely mounted to portable bunks 14 and 15 . disposed opposite of receiving end 84 is shoe end 90 and the distance between shoe end 90 and receiving end 84 is about equal to the width of trailer bed 36 , or the width of portable skid 21 . receiving end 84 includes a first guide block 74 and a second guide block 78 . first guide block 74 and second guide block 78 are generally of the same configuration and each are comprised of elongated , vertically extending , rectangular box - like members welded at their respective bases onto a bunking hardware plate 89 . extending from second guide block 78 and towards receiving end 84 is a gusseted catch 80 which is generally configured as an angled plate welded at one end to bunking hardware plate 89 and extending to the length of bunking hardware plate at its terminus at receiving end 84 . gusseted catch 80 as best seen in fig9 c is bent at its top end along an acute angle away from a position normal to the plane containing bunking hardware plate 89 . through the use of an acute angle away from a normal position perpendicular to bunking hardware plate 89 , gusseted catch 80 serves to guide bunk base member 24 when the same is loaded into bunking hardware 72 along a direction 91 . in operation , portable bunks 14 and 15 are loaded into bunking hardware 72 along a direction 91 from both a distance away from receiving end 84 and above bunking hardware plate 89 such that it is preferable to use a gusseted catch 80 , in case the alignment of bunk base member 24 is slightly off from the mid - point of bunking hardware plate 89 . with continuing reference to fig9 b , first guide block 74 is disposed opposite second guide block 78 at a width substantially equal to the width of bunk base member 24 such that when bunk base member 24 sits between first guide block 74 and second guide block 78 it is substantially prevented from sliding laterally . as best seen in fig9 c and 9b , extending towards receiving end 84 at a level lower than the top of first guide block 74 , locking surface 76 is disposed in a horizontal plane . locking surface 76 includes a space 82 for receiving rotatable locking member 46 . receiving space 82 and locking surface 76 permit the passage therethrough of rotatable locking member 46 ( as seen in fig8 ). thus , locking surface 76 may securely hold portable bunk 14 at receiving end 84 of bunking hardware 72 through rotation of rotatable locking member 46 after portable bunk 14 has been loaded into bunking hardware 72 along direction 91 . extending from the horizontal plane in which locking surface 76 is disposed , and at a gradually decreasing downward angle , slide 81 is positioned . slide 81 has a width no greater than the width of receiving space 82 and preferably , slide 81 is tapered , as best seen in fig9 b . slide 81 serves to prevent the abrupt catch , or “ snag ” of rotatable locking member 46 when during operation , rotatable locking member may extend below bunk base member 24 if it has not been retracted up inside container lock housing 42 . with continuing reference to fig9 a and 9b , shoe assembly 86 is described in greater detail . shoe assembly 86 is disposed at the shoe end 90 of bunking hardware plate 89 and it is generally adapted to receive the toe end 52 of portable bunk 14 . shoe assembly 86 is comprised of a first gusseted guide member 92 and a second gusseted guide member 94 . first gusseted guide member 92 is generally constructed from a plate rectangular in construction and bent at an acute angle away from a position normal to toe end surface 102 . as best seen in fig9 b , both first gusseted guide member 92 and second gusseted guide member 94 are constructed to angle laterally away from one another such that distance 99 is greater than distance 101 . greater distance 99 permits guiding of the toe end 52 of portable bunk 14 as the same is loaded into bunking hardware 72 along direction 91 . with continuing reference to fig9 a and 9b , shoe assembly 86 includes locking pin 88 which is sized to be inserted into end hole 50 which is bored through toe end plate 54 . shoe assembly 86 further includes a latch 100 and locking pin handle 98 both of which are affixed to the outside of toe end surface 102 and adapted to rotate locking pin 88 into place . with reference now to fig1 , bunking hardware 72 and bunking station assembly 108 are described in greater detail . fig1 shows the bunking hardware 72 locked into bunking station assembly 108 . bunking station assemblies 108 are disposed generally at locations opposite one another on either the trailer bed 36 or the portable skid 21 . the bunking station assemblies 108 have a recessed area 107 which in this particular embodiment takes the form of a bored hole , sized to receive a hardware locking member 110 . locking member 110 can take the form of a pen that extends downward from the underside of the bunking hardware 72 adjacent the heel and toe ends . if the locking station assembly 108 is located on the portable skid 21 , the recessed area 107 could take the form of a hole through the sledding members 22 with a tube through which hardware locking member 110 could be slidably engaged and thereby locked with a first transverse locking pin 112 . with continuing reference to fig1 , first transverse locking pin 112 is connected securely to the bunking hardware stations through the use of a first retention chain 116 . as seen in fig1 , element 120 represents either the trailer bed 36 or the skid cross - member 26 , depending upon whether the bunking station assembly 108 is located on the portable skid 21 or the trailer 32 . in this particular embodiment , bunking hardware 72 is mounted above bunking station assemblies 108 and a space 105 is created by spacers 104 and 106 . spacers 104 and 106 are disposed beneath bunking hardware plate 89 and are physically connected to hardware locking members 110 providing a point of rest for bunking hardware 72 on the top of bunking station assembly 108 . spacers 104 and 106 can optionally be load cells for measuring gross weight . spacers 104 and 106 can vary in size to increase or alternatively decrease space 105 as desired . while the preferred embodiment of the invention has been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention .	1
fig1 illustrates the current detection head 70 of a first example . the reference symbol 22 denotes a fixing member , integrally molded using a resin ; a magneto - optical element 28 , lens 24 , the lower end of an incidence optical fiber 14 which guides light to the lens 24 , and the lower end of an emission optical fiber 16 which guides light from the lens 24 , are fixed to the fixing member 22 . further , mounting holes 30 and 32 are formed at prescribed positions in the fixing member 22 , and mounting holes 36 and 38 are also formed at prescribed positions in the conducting plate 34 . if a bolt 18 is passed through the mounting holes 30 and 36 and tightened with a nut 40 , and a bolt 20 is passed through the mounting holes 32 and 38 and lightened with a nut 42 , the fixing member 22 is fixed to the conducting plate 34 . using the mounting hole 30 of the fixing member 22 , the mounting hole 36 of the conducting plate 34 , and the bolt 18 , the position of the mounting hole 30 relative to the conducting plate 34 is fixed , and using the mounting hole 32 of the fixing member 22 , the mounting hole 38 of the conducting plate 34 and the bolt 20 , the position of the mounting hole 32 relative to the conducting plate 34 is fixed . because two places of the fixing member 22 are positioned relative to the conducting plate 34 , the position and direction of the fixing member 22 are positioned constantly relative to the conducting plate 34 . through use of the mounting holes 30 and 32 in the fixing member 22 and the mounting holes 36 and 38 in the conducting plate 34 , the relative positional relationship between the fixing member 22 and the conducting plate 34 is positioned in a constant position . the mounting holes 30 and 32 formed in the fixing member 22 and the flange portion in which the mounting holes 30 and 32 are formed serve as a fixing portion which fixes the fixing member 22 to the conducting plate 34 . because the lower end of the incidence optical fiber 14 , the lens 24 , the magneto - optical element 28 , the lower end of the emission optical fiber 16 , and the conducting plate 34 are all positioned and fixed by the fixing member 22 , the relative positional relations between all of the lower end of the incidence optical fiber 14 , the lens 24 , the magneto - optical element 28 , the lower end of the emission optical fiber 16 , and the conducting plate 34 are always adjusted to be constant and fixed . the base plate 6 is disposed in a position facing the conducting plate 34 . penetrating holes 8 and 10 are formed in the base plate 6 ; the upper end of the incidence optical fiber 14 is inserted into the penetrating hole 8 and fixed , and the upper end of the emission optical fiber 16 is inserted into the penetrating hole 10 and fixed . the reference symbol 12 denotes the fixing member which fixes the upper end of the incidence optical fiber 14 and the upper end of the emission optical fiber 16 , and is positioned on the base plate 6 . the light source 2 , which makes polarized light incident on the upper end of the incidence optical fiber 14 , is fixed at the upper portion of the penetrating hole 8 . the light - receiving device 4 , which receives polarized light emitted from the upper end of the emission optical fiber 16 , is fixed at the upper portion of the penetrating hole 10 . the light source 2 and light - receiving device 4 are fixed by the base plate 6 . details of the light source 2 are illustrated in fig3 . the light source 2 comprises a semiconductor laser 52 , a polarizing prism 54 and a lens 56 ; laser light polarized by the polarizing prism 54 is input to the incidence optical fiber 14 . the light - receiving device 4 comprises a lens 58 , beam splitter 60 , first photodiode 62 , second photodiode 64 , and op - amp 66 . the beam splitter 60 is provided with a function to divide light into two depending on the polarization direction , and the polarization plane of light incident on the first photodiode 62 and the polarization plane of light incident on the second photodiode 64 are orthogonal . the value of the difference in the intensity of light with the first plane of polarization and the intensity of light with the second plane of polarization , amplified by the op - amp 66 , changes corresponding to the rotation angle of the plane of polarization . in the structure of fig1 , the conducting plate 34 with the current detection head 70 fixed is mass - produced . optical fibers 14 and 16 extend from the current detection head 70 . the upper ends of these optical fibers 14 and 16 are fixed to the base plate 6 . the optical fiber 14 connects the light source 2 and magneto - optical element 28 , and the optical fiber 16 connects the magneto - optical element 28 and the light - receiving device 4 , to complete the current detection device . action of the current detection device of fig1 is explained . the semiconductor laser 52 emits laser light . this laser light passes through the polarizing prism 54 , and consequently only a light component polarized in a specific plane of polarization passes through the lens 56 and is incident on the optical fiber 14 . as illustrated in fig2 , the optical path of the polarized light reaching the lower end of the optical fiber 14 is changed to an oblique direction by the lens 24 , and the polarized light reaches the upper face of the magneto - optical element 28 . having reached the upper face of the magneto - optical element 28 , the polarized light is reflected by the upper face of the magneto - optical element 28 . the conducting plate of fig1 is long in the direction perpendicular to the plane of the paper , and current i flows in a direction perpendicular to the plane of the paper . fig1 corresponds to a cross - sectional view along line a - a in fig4 . hence the magnetic field h in the left - right direction in fig1 and fig2 acts on the magneto - optical element 28 . when polarized light is reflected by the upper face of the magneto - optical element 28 on which the magnetic field h is acting , a magnetic kerr effect ( in this case , the longitudinal kerr effect ) occurs . a crystal which exhibits the magnetic kerr effect is selected for the magneto - optical element 28 . because the magnetic kerr effect occurs , the plane of polarization of the polarized light reflected by the upper face of the magneto - optical element 28 rotates . that is , the plane of polarization of the incident light 46 is not the same as the plane of polarization of the reflected light 48 , and rotation occurs . light reflected by the upper face of the magneto - optical element 28 passes through the lens 24 , emission optical fiber 16 , lens 58 , and beam splitter 60 , and is incident on the first photodiode 62 and second photodiode 64 . the amplitude value of the difference in the intensity of light with a first polarization plane detected by the first photodiode 62 and the intensity of light with a second polarization plane ( orthogonal to the first polarization plane ) detected by the second photodiode 64 changes depending on the rotation angle of the polarization plane occurring due to the magnetic kerr effect . from the output of the op - amp 66 , the angle of rotation of the polarization plane occurring due to the magnetic kerr effect , the intensity of the magnetic field h acting on the magneto - optical element 28 which caused the rotation angle , and the magnitude of the current i which caused the magnetic field intensity , are detected . when mass - producing the conducting plate 34 with a current detection head 70 of fig1 to fig3 , in order to mass - produce the conducting plate 34 with a stabilized relation between detection value and current value , it is important that the relative positional relationships and the relative directional relationships between members contributing to current detection be adjusted and fixed in constant relations . as illustrated in fig4 , the intensity of the magnetic field h metalling when a current i is flowing in the conducting plate 34 changes with the position relative to the conducting plate 34 . hence the relative positional relationship between the conducting plate 34 and the magneto - optical element 28 is important . the magneto - optical element 28 is provided with an easy magnetization axis j . the angle of rotation of the polarization plane occurring due to the magnetic kerr effect is also affected by the angle θ 1 made by the easy magnetization axis i and the magnetic field h . hence the angle θ 1 made by the easy magnetization axis i of the magneto - optical element 28 and the conducting plate 34 is also important . the angle of rotation of the polarization plane occurring due to the magnetic kerr effect is also affected by the angles made by the easy magnetization axis j and the incident light 46 ( the horizontal - direction angle θ 2 and the perpendicular - direction angle θ 3 ). the relative positional relationships between the optical fiber 14 , the lens 24 , the magneto - optical element 28 , and the optical fiber 16 are important . in the current detection device of fig1 to fig3 , the optical fiber 14 , lens 24 , magneto - optical element 28 , optical fiber 16 , and conducting plate 34 are respectively fixed to the fixing member 22 , so that the relative positional relationships and relative directional relationships of the optical fiber 14 , lens 24 , magneto - optical element 28 , optical fiber 16 , and conducting plate 34 are adjusted in constant relationships and fixed . in this example , all of the members 14 , 24 , 28 , 16 and 34 contributing to current detection are fixed to the fixing member 22 , so that the relative positional relationships and relative directional relationships ( angular relationships ) of all of the members 14 , 24 , 28 , 16 and 34 contributing to current detection are adjusted in constant relationships and fixed . by using the current detection device of fig1 to fig3 , conducting plates 34 with current detection heads 70 with a stabilized relation between detection value and current value can be mass - produced . further , using the base plate 6 the relative positional relationships and relative angular relationships between the upper end of the optical fiber 14 , the semiconductor laser 52 , the polarizing prism 54 , and the lens 56 are adjusted in constant relationships and fixed . moreover , using the base plate 6 , the relative positional relationships and relative angular relationships of the upper end of the optical fiber 16 , lens 58 , beam splitter 60 , first photodiode 62 , and second photodiode 64 are adjusted in constant relationships and fixed . these elements also contribute to mass production of conducting plates 34 with current detection devices in which the relation between detection value and current value is stabilized . the fixing member 22 may be formed as a single physical object , as illustrated in fig1 , or may be formed using two physical objects , as illustrated in fig5 . in the case of fig5 , an example is illustrated in which the optical fibers 14 and 16 are fixed to a first fixing member 22 a , and the lens 24 and magneto - optical element 28 are fixed to a second fixing member 22 f . a pair of concavities 22 b and 22 e is formed in the first fixing member 22 a , and a pair of engaging claws 22 d and 22 e is formed on the second fixing member 22 f when the first fixing member 22 a and the second fixing member 22 f are combined , in a state in which the engaging claw 22 d meshes with the concavity 22 b and the engaging claw 22 e meshes with the concavity 22 c , the first fixing member 22 a and second fixing member 22 f are fixed . in this state , the relative positional relationship of the first fixing member 22 a and second fixing member 22 f is adjusted in a constant relationship and fixed . upon combining the first fixing member 22 b and second fixing member 221 , the relative positional relationship of the first fixing member 22 a and second fixing member 22 f is stabilized , and the relative positional relationships and relative angular relationships of the lower end of the optical fiber 14 , lens 24 , magneto - optical element 28 , and lower end of the optical fiber 16 are adjusted in constant relationships and fixed . on the second fixing member 22 f are formed a flange 22 g for positioning and fixing to the conducting plate 34 , and mounting holes 30 and 32 . the flange 22 g and mounting holes 30 and 32 formed on the second fixing member 22 f serve as a fixing portion to fix the second fixing member 22 f to the conducting plate 34 . if a bolt 18 is passed through the mounting hole 30 and the mounting hole 36 and is tightened with a nut 40 , and a bolt 20 is passed through the mounting hole 32 and the mounting hole 38 and is tightened with a nut 42 , then the relative positional relationships and relative angular relationships of the lower end of the optical fiber 14 , the lens 24 , the magneto - optical element 28 , the lower end of the optical fiber 16 , and the conducting plate 34 are adjusted in constant relationships and fixed . in this example , a concavity 34 a is formed in the conducting plate 34 , and the magneto - optical element 28 is accommodated within the range of the thickness of the conducting plate 34 . the intensity of the magnetic field acting on the magneto - optical element 28 is increased , and the current detection sensitivity is increased . as illustrated in the examples of fig1 and fig5 , the shape of the lens 24 is selected according to the characteristics . fig6 indicates the range of variation in the relation between detection values ( the values of the op - amp 66 ) and true current values when the conducting plate 34 to which the current detection head 72 of fig5 is fixed is mass - produced . the range of variation is small . fig7 indicates the range of variation in the relation between detection values and current values when conducting plates with current detection heads are mass - produced using a method in which a magneto - optical element is fixed to a conducting plate , a lens is positioned relative to the magnetic - optical element , and an optical fiber is positioned relative to the lens . the range of variation is large . when conducting plates with current detection heads are mass - produced using techniques of the prior art , the relation between detection values and current values varies widely among mass - produced items . fig8 illustrates a third example . optical fibers 14 and 16 and a lens 24 are fixed to a first fixing member 22 j , and a magneto - optical element 28 is fixed to a second fixing member 22 o . the lens 24 may be fixed to the first fixing member 22 j as illustrated in fig8 , or may be fixed to a second fixing member 22 f as illustrated in fig5 . fig9 illustrates an example in which a conducting plate 34 , magneto - optical element 28 , lens 24 , and lower end of an optical fiber 15 are insert - molded using a resin material and manufactured . the relative positional relationships of all of the conducting plate 34 , magneto - optical element 28 , lens 24 , and lower end of the optical fiber 15 are fixed in a state of adjustment to be constant by a fixing member 22 r . the conducting plate 34 can be mass - produced with a stabilized relationship between detection values and current values . an opening 34 b is formed in the conducting plate 34 , and there is no separation of the fixing member 22 r from the conducting plate 34 . in the case of fig9 , a core ( first core ) 14 a which guides light toward the magneto - optical element 28 , and a core ( second core ) 16 a which guides light reflected by the magneto - optical element 28 , are accommodated within a single optical fiber 15 . because only a single optical fiber 15 is used , connection tasks and similar are simplified . fig1 illustrates an example in which a fixing member 22 s , magneto - optical element 28 , lens 24 , lower end of an optical fiber 14 , and lower end of an optical fiber 16 are insert - molded using a resin material on one face of the conducting plate 34 and manufactured . if grooves 34 c and 34 d extending diagonally are formed in the conducting plate 34 , there is no separation of the fixing member 22 s from the conducting plate 34 . fig1 illustrates an example in which a fixing member 22 t , manufactured by insert - molding a magneto - optical element 28 , lens 24 , lower end of an optical fiber 14 , and lower end of an optical fiber 16 are insert - molded , is fixed to a conducting plate 34 and manufactured . in this example , the diameter of a hole 34 e formed in advance in the conducting plate 34 and the diameter of a cylindrical portion provided in advance in the lower face of the fixing member 22 t are managed in a relationship such that the two fit closely . by inserting the cylindrical portion of the fixing member 22 t into the hole 34 e of the conducting plate 34 , the position of the fixing member 22 t relative to the conducting plate 34 can be accurately positioned . further , screws 18 a and 20 a are used to accurately adjust to a constant angle the mounting angle of the fixing member 22 t relative to the conducting plate 34 . in the above , specific examples of the invention have been explained in detail ; but the above are merely exemplifications , and do not limit the scope of claims . the technique disclosed in the scope of claims includes various modifications and alterations of the above - presented specific examples . the technical elements explained in the specification or drawings exhibit technical utility whether independently or in various combinations , and are not limited to combinations disclosed in the claims at the time of filing . further , techniques exemplified in the specification or the drawings can attain a plurality of objects simultaneously , and technical utility is attained by the attainment itself of one among these objects .	6
fig4 shows the front portion of the section of intake lip 50 at the keel position of a nacelle on a longitudinal cross - section containing the engine axis . the intake lip 50 has inner 50 a and outer 50 b surfaces , which meet at a highlight h at the front of the nacelle . the highlight h lies in a curved highlight surface s which , in fig4 , is viewed edge - on . in fig4 , the highlight surface s is curved in the vertical direction of the page and is uncurved in the direction perpendicular to the page , i . e . it is curved in only one principle direction . however , in other examples , the highlight surface s may simply be planar . the inner 50 a and outer 50 b surfaces are tangency matched at the highlight h , and indeed are tangential to the highlight surface s at the highlight h . the inner 50 a and outer 50 b surfaces also have their maximum curvatures at the highlight h . however , these curvatures are different for the inner 50 a and outer 50 b surfaces , whereby there is a discontinuity in curvature across the highlight . the intake lip axis a lying in the plane of the drawing of fig4 extends from the highlight h parallel to the engine axis , or to the intake droop axis in the case of a drooped intake . the intake lip shown in fig4 represents a geometry for the nacelle , resulting , for example , from an initial nacelle design procedure . a next step in the design procedure is to pivot , in the plane of the respective longitudinal section , the front portion of the intake lip about the highlight h in a direction which rotates axis a either towards the engine axis (+ θ , dot - dashed lines ) or away from the engine axis (− θ , dotted lines ), as shown in fig5 , and in more detail in fig6 , which is a close - up view of the forwardmost part of the rotated intake lip . the tangent t to the highlight surface s at the highlight h is indicated with a dashed line in fig6 . of course , if the highlight surface s is planar , the tangent t to the highlight surface s will be coincident with that surface . because the inner 50 a and outer 50 b surfaces of the intake lip 50 are tangential to the highlight surface s at the highlight h in the initial geometry of fig4 , the + θ rotation has the effect of causing the inner surface 50 a to cross the tangent t inwards of axis a , whereas the − θ rotation has the effect of causing the outer surface 50 b to cross the tangent t outwards of axis a . having rotated the part of the front portion of the intake lip at the keel position , the next step in the design procedure is to adjust the surfaces of neighbouring parts of the intake to smoothly blend the surfaces of the rotated front keel part with the surfaces of unadjusted parts of the intake further removed from the rotated part . this blending can be performed by methods known to the skilled person . if the intake lip is rotated at just one position , such as the keel section discussed above , the adjustment procedure effectively results in an altered nacelle geometry in which the angle of rotation of the intake lip reduces around the highlight from a maximum amount at that section down to zero at a circumferential distance from the section , those parts of the intake lip having some rotation defining a transitional sector . thus , for example , lip rotation can be by an appropriate angle ± θ at a specific circumferential location to locally address a specific aerodynamic performance issue ( e . g . high incidence at the keel , or crosswind at the sidelines ), with θ smoothly transitioning to zero away from that circumferential location . the extent of the transition can be varied and the variation of θ within the transitional sector can be linear or controlled by an appropriate non - linear expression as a function of circumferential location . however , more complicated adjustments can be effected . for example , lip rotation can be by an appropriate angle ± θ at a specific circumferential location to locally address a specific aerodynamic performance issue , with θ smoothly transitioning to a different ± θ elsewhere on the intake , itself transitioning to another ± θ at yet another part of the intake and so on , such that the θ variation is determined by respective rotations on multiple control sections . the variation of θ within each transitional sector can be linear or controlled by an appropriate non - linear expression as a function of circumferential location . the external frontal area of the nacelle may be altered as a result of the altered geometry . in the case of a − θ rotation the pivoting results in a shift of the local throat forwards , whereas in the case of a + θ rotation the pivoting results in a shift of the local throat rearwards . in general , care should be taken to ensure that the throat area does not become too small as a result of rotations . typical rotation angles are between 1 ° and 2 . 5 °. however , even small rotations , for example around 0 . 25 ° or even 0 . 1 °, can have significant aerodynamic impacts . some situations may call for rotation angles of up to about 5 °. pivoting the intake lip at specific positions around the highlight allows intake lip profiles to be de - coupled and individually optimised to locally address specific aerodynamic performance issues . for example : higher angles of attack can be produced by rotating lip sections in the lower half of the intake towards the engine axis (+ θ ). for a negatively scarfed intake , more aggressive diffusion can be generated at the keel without dropping the intake bottom line by rotating the keel intake lip towards the engine axis (+ θ ). the larger diffuser angles further rearward in the duct which can then be produced can provide benefits in terms of reduced diffuser length , increased nacelle ground clearance and reduced fan face pressure distortion . for a positively scarfed intake , less diffusion at the keel may be beneficial and can be generated by rotating the keel intake lip away from the engine axis (− θ ). enhanced crosswind capabilities can be obtained by rotating the sideline lips towards the engine axis (+ θ ). elimination or reduction of shock buzz noise during ground static operation can be obtained by rotating the crown lip axis to better align the intake lip with the bulk flow . external drag benefits may also be produced due to resulting changes in the shape of the external nacelle top surface . the rotation at the crown can be towards (+ θ ) or away from (− θ ) the engine axis , depending on local flow conditions . more generally , locally pivoting the intake lip can also provide the following benefits : lip profiles , throat area and local throat positions can be redistributed without changing the highlight shape . the greater control over lip geometry enables nacelle designs in which asymmetries in the flow entering the intake duct are minimised , resulting in noise benefits due to reduced flow asymmetry around the intake lip and / or benefits associated with reduced fan forcing or fan face pressure distribution further downstream . intake lip rotation can enhance the design of negatively scarfed intakes , such that duct flow asymmetry downstream of the lip is reduced while tolerance to off - design external flows is maintained . while the invention has been described in conjunction with the exemplary embodiments described above , many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure . for example , although the procedures of pivoting a part of the front of the intake lip and then adjusting neighbouring surfaces are described above in relation to a nacelle having a highlight surface which is a plane or is curved in only one principle direction and having inner and outer surfaces which are tangential to the highlight surface at the highlight , they may also be applied to nacelles having highlights which do not lie in such highlight surfaces , and / or having inner and outer surfaces which are not tangential to the highlight surface at the highlight . for example , a nacelle which has undergone the pivoting and adjusting procedures will have inner and outer surfaces which are not tangential to the highlight surface at the highlight . however , the procedures can nonetheless be reapplied to this nacelle . accordingly , the exemplary embodiments of the invention set forth above are considered to be illustrative and not limiting . various changes to the described embodiments may be made without departing from the spirit and scope of the invention .	8
referring now to fig1 , a prior - art system is depicted , which uses two lenses and sensors to span the desired range of ambient illumination . daylight operation is accomplished using daylight lens 2 and color image sensor 4 . nighttime scenes are captured by lens 6 and image sensor 8 , which is a monochrome area sensor optimized for high sensitivity . typically , the overall ambient illumination is detected by , as an example , a photodiode 3 . the resulting signal is buffered by buffer 9 , compared with a reference value by comparator 5 , and used to drive a video source selection relay 7 . the disadvantages of such a typical system are readily apparent . the overall size , weight and cost are dramatically increased by the inclusion of the additional lens . an enhanced system , subject of the present invention , is depicted in fig2 . a single lens 10 is used to direct a desired scene onto the sensor optics , consisting of beamsplitting mirror 12 , sensitive monochrome sensor 16 and color sensor 14 . the relative positions of the respective sensors 14 and 16 may be exchanged , if necessary , without departing from the spirit and scope of the invention . the beamsplitting mirror 12 is partially reflective , in some proportion designed to optimize the desired optical behavior . for example , if absolute nighttime sensitivity is the highest goal of the design , then the beamsplitter may be 5 percent reflective and 95 percent transmissive , so as to maximize the amount of optical flux that reaches the nighttime sensor . the appropriate sensor output is selected by switch 18 . note that switch 18 could be automated as sensor output signal 22 is optionally displayed on viewfinder 20 . in fig3 , the basic system of fig2 is enhanced with a driven iris , which serves to limit the amount of incident light that arrives at the monochrome sensor 16 or , indeed , at the color sensor 14 . the overall output video signal 22 is sampled by diode 72 , filtered by capacitor 68 , given a time constant via resistor 70 , and applied to iris driver 66 . the iris driver , in turn , drives the iris actuator 64 and the iris 60 , so as to limit the output signal 22 if it increases to some predetermined level . this serves to limit and stabilize the amount of light incident on the sensors 14 and 16 . fig4 depicts the basic system of fig2 , as supplemented by the inclusion of an image intensifier 24 . since the image on the rear surface of the image intensifier is a simple planar image , a relay lens system 26 may be necessary to transfer the image from the rear surface of the intensifier 24 to the monochrome sensor 16 . other techniques may also be employed to transfer the image , such as the fusion of fiber optic bundles between the intensifier and imager , or direct bonding of the intensifier to the imager . fig5 depicts an enhancement to the system of fig4 . in fig5 , a second iris 80 is added , immediately in front of the monochrome sensor 16 . this second iris is used to limit the amount of illumination reaching the sensitive monochrome sensor 16 , preventing it from suffering from saturation when the intensifier output image is bright . the output signal from the monochrome sensor 16 is sampled by diode 90 , filtered by capacitor 86 , given a time constant by resistor 88 , buffered by buffer 84 , and drives the iris 80 via actuator 82 . this effectively stabilizes and limits the output signal from the monochrome sensor 16 . this approach frees the first iris 60 to control the overall output from the system , as depicted earlier in fig3 . fig6 depicts a multiple - imager version of the system . multiple digital imagers 100 , 102 , and 104 , share a common address bus 108 and data bus 106 . a camera selection signal 110 is applied to multiplexer 112 , which thereupon selects one of the sensors via enable lines 114 , 116 , and 118 . this method allows the selection of a desired camera . the individual cameras 100 , 102 , and 104 may share a common optical path , as in previous examples which use a two - way beamsplitting mirror . the individual cameras 100 , 102 , and 104 may seperately optimized for different purposes , such as day vs . night , 1 × zoom vs . 2 × zoom , etc . fig7 depicts an enhancement to the basic system of fig2 , wherein the analog sensors are replaced with high - resolution digital sensors 14 ( color ) and 16 ( monochrome ). as before , a image sensors 14 and 16 . images captured by these digital sensors are transferred to a suitable signal processor 30 with associated program / data memory 32 . the processor 30 , among other tasks , controls the scanning of the selected image sensor 14 or 16 , and produces a corresponding output signal 22 in a desired signal format , such as ntsc , pal , or a digital format such as d - 1 . a pair of orthogonal gyroscopic accelerometers 34 and 36 is disposed in a plane parallel to the image plane of the monochrome sensor 16 . angular accelerations detected by sensors 34 and 36 are twice - integrated by processor 30 , to derive a knowledge of the instantaneous angular position of the device . this information is then used to temporally offset the image sensor scanning signals produced by the processor 30 , effectively stabilizing the image position . alternatively , the instantaneous position information previously described may be used to variably offset the read addresses driven to the imager or it &# 39 ; s bugger , again effectively stabilizing the image . a variety of user input pushbuttons 38 are provided to allow user control of various camera parameters , for instance brightness , stabilization on / off , day / night mode , power on / off , etc . an additional benefit of the dual - digital - sensor system of fig7 is the ability to scan the imager in reverse - pixel or reverse - line order . this ability overcomes the optical problem imposed by the inclusion of the mirror ; images that have been reversed vertically or horizontally by the mirror may be “ re - reversed ” electronically . an additional benefit of the dual - digital - sensor system of fig7 is the ability to ‘ fuse ’ the two images . the monochrome sensor 16 is used to provide scene luminance information , while the color sensor 14 is used to provide chrominance information . note that , since luminance information is provided by camera 16 , it is possible to use non - traditional color filters on color sensor 14 to increase its resolution and sensitivity . for example , a simple crcb filter could be used on color sensor 14 , with no pixels wasted for detecting luminance . this effectively increases the color resolution by one - third . the processor 30 may be used to scale and merge the two information streams into one signal . this method is not possible in prior - art systems , which used movable mirrors . fig8 depicts an enhancement to the digital system of fig7 , wherein the dual - iris arrangement of fig5 is used to optimize the dynamic range of the system . as before , incident light reaching monochrome sensor 16 is controlled by iris 80 , as driven by actuator 82 under processor control . this effectively prevents the sensitive monochrome imager from suffering saturation or overload . the intensifier 24 is protected by iris 60 , driven by actuator 64 , also under processor control . this iris serves to protect the intensifier device from excessive illumination . the dynamic range of both imagers may also be improved by the inclusion of automatic gain control , used in conjunction with the irises . without moving optical parts and without reduction of image resolution . while the example in fig9 depicts a pair of digital imagers , analog imagers could be used to the same effect . a lens captures a desired scene and passes it to an optional image intensifier 24 . the image thereupon passes to a beamsplitting mirror 12 , thence to a pair of imagers 140 and 146 via relay lenses 142 and 144 respectively . the relay lenses are selected to have differing magnification ratios . in the example shown , relay lens 142 exhibits a magnification of 1 : 1 , while relay lens 144 exhibits a magnification of 2 : 1 . imager 140 or imager 146 may be selected via cam select signal 152 and inverter 148 . this effectively allows selection of a desired image , or selection of the same image with different magnification . as an example , lens 140 and imager 142 may render a scene 154 , of some given angular field of view . when lens 144 and imager 146 are selected , a smaller field of view 156 is rendered , but at the same resolution as the previous , larger image . fig1 depicts a preferred embodiment a handheld version of the device . a housing 46 10 contains a lens 10 , user controls 38 , eyepiece 42 , battery compartment access panel 46 , and carrying strap 44 . while certain features and embodiments of the invention have been described in detail herein it should be understood that the invention includes all improvements , modifications	7
fig1 depicts a flight vehicle , in this case a supersonic missile 20 , having a fuselage 22 with a curved window 24 attached thereto . the window 24 is a nose dome that protrudes at least partially into the air of the missile 20 . the fuselage is elongated along an axis of elongation 25 , and in a preferred application the window 24 is rotationally symmetric about the axis 25 . the missile 20 with the nose - dome window 24 is the preferred application of the optical system of the invention , but it is applicable in other contexts as well such as other missile windows and windows on manned aircraft . the window 24 is part of an optical system 26 , which is shown generally in fig2 . the optical system 26 includes the window 24 attached to the fuselage 22 , which serves as a housing for the optical system 26 . a curved inner surface 28 of the window 24 is the concave surface of the window 24 that faces the inside of the fuselage 22 . a curved outer surface 30 of the window 26 is the convex surface of the window 24 that faces outwardly and projects into the airstream as the missile 20 flies . the window 24 has a spatially dependent curvature . an optical corrector 32 is located adjacent to the inner surface 28 of the window 24 . the optical corrector 32 is a curved piece of material transparent to the radiation being sensed by the optical system 26 and its sensor . for example , for a visible radiation optical system the optical corrector 32 may be glass . the optical corrector 32 is preferably formed as a piece of the transparent material whose shape has an axial component x z extending along the axis of elongation 25 ( fig2 ), a radial component x r extending outwardly from the axis of elongation 25 ( fig2 ), and a circumferential component x 0 ( fig3 b ). fig3 a - 3c illustrative one form of the optical corrector 32 . as shown in fig3 a , the optical corrector 32 lies adjacent to the inner surface 28 of the window 24 , and therefore extends outwardly from the axis of elongation 25 ( the x r component ) and rearwardly from a vertex 34 ( the x z component ) of the optical corrector 32 . the cross section of the optical corrector 32 may be circularly symmetric or nearly circularly symmetric about the axis of elongation 25 at a location near to the vertex 34 , as shown in fig3 b . at locations further rearwardly from the vertex 34 , the optical corrector 32 is formed as at least one strip 32a of the transparent material and preferably two strips 32a as illustrated to balance the loading on its support in longitudinal section , fig3 a , the strips 32a generally follow the curvature of the window 24 , but may deviate from that curvature to some extent in transverse section perpendicular to the axis of elongation 25 , fig3 c , each strip 32a is preferably two - fold symmetric about a corrector transverse axis of symmetry 35 and subtends a total arc a about the axis of elongation 25 . the use of the strip form of the optical corrector 32 allows the optical corrector to have a curvature and thickness different from that of the window 24 , when viewed transversely to the a of elongation 25 , as in fig3 c . in the illustrated preferred case of fig3 , the transverse curvature and thickness variation of the strip 32 are different from the transverse curvature and thickness variation of the window 24 . the optical corrector 32 functions as a lens to correct the aberrations introduced into an optical ( light ) ray passing through the window 28 . because the aberrations are spatially dependent upon the vector of the optical ray , the optical corrector 32 is formed so that its correction is spatially dependent as well . the aberrations introduced into the optical ray depend upon the exact shape of the window 24 , and therefore no specific design may be set forth for the shape of the optical corrector 32 . however , some generalizations may be made . as shown in the longitudinal sectional view of fig3 a and the transverse sectional view of fig3 c , the optical corrective characteristics ( i . e ., curvature and / or thickness ) of the optical corrector 32 are , in general , a functions of position . the optical corrective characteristics of the optical corrector 32 may vary as a function of location along the axis of elongation 25 , as shown in fig3 a , and / or as a function of angle about the axis of elongation 25 , as shown in fig3 c . the curvature and thickness , and hence the optical properties , of the optical corrector 32 are selected to correct aberrations introduced when a light ray passes through the window 24 and thereafter through the optical corrector 32 . the optical corrector 32 is mounted on an movable optical corrector support 36 , shown in fig2 . the optical corrector support 36 is preferably movable by rotation about the axis of elongation 25 , as schematically indicated by arrow 38 . the optical corrector support 36 may also be movable by linear movement parallel to the as of elongation 25 , as schematically indicated by arrow 40 . the rotational and linear movement are produced by conventional actuators , which are known for other purposes . the rotational movement of the optical corrector support 36 , and thence of the optical corrector 32 , allows the strip 32a of the optical corrector 32 to be rotationally positioned according to the rotational angle of regard of the optical train to be discussed subsequently . that is , when the optical in is positioned to look downwardly , the optical corrector support 36 would normally be rotationally positioned as shown in fig3 c , so that an optical ray entering the optical train must pass through the optical corrector 32 . if the optical train is rotated by 90 degrees to look to the left or right , the optical corrector support 36 would normally also be rotated by 90 degrees from the position shown in fig3 c so that the incident optical ray must pass therethrough . the axial movement of the optical corrector support 36 , and thence of the optical corrector 32 , allows different portions of the optical corrector 32 to be used to correct the aberration introduced by the window 24 . an optical train 42 is positioned such that the optical corrector 32 lies between the window 24 and the optical train 42 . the optical train 42 includes at least one optical element operable to alter an optical ray incident thereon . in fig2 the optical element is illustrated as a refractive lens 44 , but it may also include a mirror , a prism , or any other operable optical element the optical element may also include a combination of such lenses , mirrors , and / or prisms . the detailed design of optical trains is known in the art , and the present invention is not concerned with such design specifics . the optical train 42 directs incident optical rays , which previously passed first through the window 24 and then through the optical corrector 32 , into a sensor 46 . the sensor 46 is illustrated as a focal plane array sensor , but may be of any operable type . the sensor 46 is selected according to the nature of the energy to be sensed , and is typically a sensor of visible light or infrared energy . the design of such sensors 46 is known in the art . the sensor 46 provides its output as an electrical signal to processing electronics , which are not illustrated but which are known in the art . the optical train 42 is mounted on a movable optical train support 48 . the movement characteristics of the optical train support 48 are selected to permit the optical train 42 to point in the desired directions , and also to take advantage of the corrective properties of the optical corrector 32 . to allow the optical train 42 to point in the desired directions , a roll / nod movement is illustrated in fig2 . the optical train support 48 rotates about the axis of elongation 25 , as indicated by arrow 50 . a gimbal 52 produces a nodding movement indicated by arrow 54 about a traverse axis 56 that is perpendicular to the axis of elongation 25 ( and thence the axis of rotation ). the combination of movements 50 and 54 allows the optical train 42 to be pointed in any desired rotational and azimuthal directions . in another approach within the scope of the present invention , the optical train may be mounted on an x - y rotational gimbal support , which permits the optical train to move about two transverse axes , so that the rotational movement is not required . the entire optical an 42 may be moved forwardly or rearwardly parallel to the axis of elongation 25 by a linear axial movement , indicated by arrow 58 . the axial movement 58 of the optical train support 48 allows the optical train 42 to be positioned for optimal performance relative to the window 24 and to the optical corrector 32 . the movements 50 , 54 , and 58 are produced by conventional actuators which are known for other purposes . the movements 38 and 40 of the optical corrector 32 , and the movements 50 , 54 , and 58 of the optical train 42 , may be rely independent of each other or may be mechanically and / or electrically linked . for example , the rotational movement 38 of the optical corrector 32 may be linked together with , or even accomplished by the same actuator as , the rotational movement 50 of the optical train 42 . in that case , the optical in 42 looks through the same portion of the optical corrector 32 for all angles of rotation about the axis of elongation 25 . similar linkages are possible for the axial movements 40 and 58 , for example . fig4 depicts a preferred approach for designing , tailoring , and operating the optical system 26 . the physical components of the optical system , as described previously , are provided , numeral 70 . the optical corrector 32 is designed and fabricated , and the movements 38 , 40 , 50 , 54 , and 58 are interrelated and programed for subsequent service applications , using an iterative procedure , numerals 72 , 74 , 76 , and 78 . first , the optical characteristics of the window 24 are evaluated , numeral 72 . this evaluation establishes the nature of the aberration introduced into the wavefront of an incident optical ray as it passes through the window 24 , for all relevant incident positions and angles . this evaluation may be performed using conventional optical ray analysis and the known and / or measured shape of the window 24 . the shape of the window 24 is dictated to a degree by aerodynamic requirements , but it may also be fine - tuned according to optical requirements . the required shape and position of the optical corrector 32 are calculated as a function of its position and the incident optical ray positions and angles , using conventional optical ray analysis . the shape and positioning of the optical corrector 32 are chosen to establish selected optical characteristics of the optical beam after it has passed through the window 24 and the optical corrector 32 . examples of such characteristics include deviation of the apparent angle to the target , optical power or focal length as a function of optical ray position and angle , and axially symmetric aberration . the designed shape of the optical corrector 32 is then changed to adjust for asymmetric aberrations such as coma and astigmatism . in this analysis , the symmetric aberrations are chosen to be constant as the elevation angle is changed , whereas the asymmetric aberrations that change with elevation angle are corrected to acceptably small values . the optics of the optical train may also be designed to correct symmetrical aberrations to acceptably small values . in the final stages of the design process the optical elements of the optical train 42 are designed to correct all of the symmetrical aberrations to acceptably small values . these aberrations have been rendered nearly constant by the prior design steps . based upon this designing process , the optical corrector is fabricated , numeral 74 . the window 24 , the optical corrector 32 , and the optical train 42 are mounted on the fuselage 22 , optical corrector support 36 , and optical train support 48 , respectively , numeral 76 . test optical signals received at the sensor 46 are evaluated during manufacturing . the associated values of the movements 38 , 40 , 50 , 54 and 58 that yield the optimal optical properties are determined and stored , numeral 78 . if these received optical signal properties are acceptable and within specifications , the manufacturing and assembly process is complete . errors and aberrations are also detained and stored , so that they may be accounted for by other processing . if the results achieved are not acceptable , the steps 72 , 74 , 76 , and 78 are repeated as necessary until acceptable results are obtained . typically , the modification is achieved by reworking the optical corrector 32 until its properties are acceptable , by polishing , grinding , machining and other known working operations . the shape of the optical corrector 32 may not be stated in any general form , inasmuch as it depends upon the shape and optical characteristics of the window 24 , and is determined in the above - described design process . however , in a typical case , as shown in fig2 and 3a , the optical corrector typically conforms to the shape of the window 24 fairly closely but not necessary exactly , when the window and the optical corrector are viewed in the longitudinal section of fig3 a . however , the optical corrector 32 typically does not conform to the shape of the window 24 when viewed in transverse section in the strip section of the optical corrector , as seen in fig3 c . once the optical corrector 32 is fabricated and the positions of the movements 38 , 40 , 50 , 54 , and 58 yielding acceptable optical properties are known , the missile is placed into service , numeral 80 . when the optical system 26 is to be used during service , the angular positions of the movements 50 and 54 are typically chosen in order to point the optical train 42 along a desired line of sight . the optimum angular positions of the other movements 38 , 40 , and 58 ( collectively , the &# 34 ; support positions &# 34 ;), associated with those desired angular positions of the movements 50 and 54 , are recalled from the memory established during the initial manufacturing and calibration operation , steps 72 , 74 , 76 , and 78 , and set using the respective actuators . the result is an optimum image reaching the sensor 46 for all desired viewing ( pointing ) angles of the optical train . although a particular embodiment of the invention has been described in detail for purposes of illustration , various modifications and enhancements may be made without departing from the spirit and scope of the invention accordingly , the invention is not to be limited except as by the appended claims .	6
broadly , the instant invention relates to a method and system to produce electric power . the system comprises a sub - system to produce and store a liquid from a lower pressure gas stream ; a sub - system to produce a higher pressure gas from the stored liquid ; and a sub - system to generate electric power by heating the higher pressure gas with an external heat source ( e . g ., csp ), decreasing the pressure of the gas through a device which produces shaft work , and applying that shaft work to operate an electric generator . one embodiment comprises using atmospheric gas as the feed gas . this is a readily available gas supply , and permits the system to be operated as an open system , so that the lower pressure feed gas is atmospheric gas at atmospheric pressure and the decreased pressure gas discharge from the work - producing device is discharged to the atmosphere . another embodiment comprises using concentrated solar thermal energy ( also known as “ concentrating solar power ”, or simply “ csp ”) as the external heat source . while any suitable source of csp can be employed , an example of suitable csp comprises a circular or fan shaped array of spherical , concave mirrors which are mounted for individual rotation and track the sun to concentrate reflected solar rays onto a defined area of a tower . another embodiment comprises operating the system such that gas liquefaction and storage occurs during a time period , and the production of higher pressure gas , heating and power generation occurs during another time period . this permits the power - consuming liquefaction step to be operated at a time - of - day when grid power is underutilized , and the power - generating heating / pressure decrease step to be performed when grid power is in demand . one aspect of the system and method is illustrated in fig1 . referring now to fig1 , lower pressure gas stream , 100 , which may be comprised of atmospheric gas , is a feed stream to a liquefier , 1 , to produce a liquid , 110 , which is stored in liquid storage container , 2 . in the case of the use of atmospheric gas as the feed stream , the liquid is stored at a cryogenic temperature . after the liquid is stored for a period of time , the liquid , 110 ′, is removed from the liquid storage container and converted to higher pressure gas , 210 , in system 3 . higher pressure gas , 210 , is conducted to a heating device , 4 , which may be a csp solar collector / heat exchanger . device 4 transfers heat into the gas stream to provide exit stream 220 at an elevated temperature . stream 220 is conducted to a pressure reducing device , 5 , such as an expander , which produces shaft work . the shaft work is applied to power generation system , 6 , to produce electrical energy . gas exiting device 5 , stream 300 , is now at a reduced pressure . in the case of an open system employing atmospheric gas as the feed , stream 300 is discharged to the atmosphere . one embodiment of the system illustrated in fig1 comprises liquefaction by increasing the pressure of the feed gas stream to a pressure above its critical pressure , cooling the fluid , and reducing its pressure to form liquid fluid stream , 110 . another embodiment of the system illustrated in fig1 comprises producing the higher pressure gas stream , 210 , provided to the heater by removing the liquid , 110 ′ from liquid storage , 2 , pumping the liquid to a pressure greater than its critical pressure , and heating the fluid to produce stream 210 . another embodiment is the incorporation of a regenerator to sequentially cool and heat the fluid . the regenerator removes and stores sub - ambient heat from a fluid as part of the liquefaction step during a time period , and restores the heat to a fluid during the step of producing the higher pressure gas provided to the power generation system , during a separate time period . various aspects and configurations of a system which cools , stores and heats an atmospheric gas are described in the previously identified copending and commonly assigned patent applications . another embodiment , also described in previously identified commonly assigned patent application ser . no . 12 / 817 , 627 is the provision for supplemental cooling to be provided to the gas stream being liquefied , so that the process can be operated on a continual basis . the supplemental cooling may be provided by an auxiliary refrigeration source or may be provided by compressing , cooling , and depressurizing a portion of the feed gas , and then using this portion to remove heat from the other portion of the feed gas . another embodiment is the incorporation of a supplemental heating step prior to heater 4 . this heating step utilizes heat from other sources , including heat of compression , or waste heat from the pressure reducing device discharge gas , or other external heat sources , or any combination . the additional heating step improves net power output relative heat input in heater 4 . referring now to fig2 , fig2 depicts one embodiment which utilizes a regenerator , auxiliary refrigeration and supplemental heating . feed gas , 100 , is compressed to create in multiple stages to a pressure greater than its critical pressure in compression steps 10 and 30 to form supercritical fluid , 105 . in certain case , particularly with the use of atmospheric gas as feed gas , additional purification step , 20 , is provided to remove undesirable impurities . at least a major portion of fluid 105 is cooled in regenerator 40 and heat exchanger 60 . another portion of fluid 105 is cooled by heat transfer with an auxiliary refrigeration source in heat exchanger 50 and heat exchanger 60 . the combined cooled stream is reduced in pressure through pressure reducing device 70 , which may be a valve or may be an expander , to produce liquid stream 110 . liquid stream 110 is conducted to liquid storage container 80 . after the liquid is stored for a period of time , the liquid , 110 ′, is removed from the liquid storage container , pumped to a pressure greater than its critical pressure and reheated in regenerator 40 to form stream 210 . stream 210 is further heated to form stream 215 in heater 510 by heat exchange with stream 300 . stream 215 is further heated in heater 4 to form stream 220 . stream 220 is reduced in pressure in an expander or gas turbine , 5 , which produces useful shaft in order to operate an electric power generator . the exhaust stream 230 from expander 5 provides heat to heater 510 , and then is removed as stream 300 . an example of operating the system of fig2 is a case wherein feed gas 100 is ambient air at 1 kg / s . this air is compressed in compressors 10 and 30 to 60 bara to form supercritical fluid 105 . compressors 10 and 30 are multistage compressors with intercoolers . at an intermediate compression stage , most water and carbon dioxide are removed from the air stream in adsorber purifier 20 . approximately 1 . 2 % of 105 is removed to heat exchanger 50 and cooled to − 188 c . the combined fluids from heat exchange 50 and regenerator 40 are further cooled in heat exchanger 60 to − 191 c , then expanded through dense fluid expander 70 to 1 . 3 bara , producing a lower pressure , liquefied fluid 110 for storage in storage container 80 . at such time when it is desired to produce electric power , fluid 110 is pumped to 60 bara and heated in regenerator 40 to 100 c to form supercritical fluid 210 . 210 is further heated in recuperative heater 510 to a temperature of 146 . 3 c . concentrated solar energy is provided as a heat source to heater 4 , increasing the temperature of exit fluid 220 to 800 c . this high temperature , high pressure supercritical fluid is reduced in pressure to near atmospheric through expander 5 , which may be a multi - stage gas turbine . expander 5 provides shaft work which drives electric generator 6 to produce electric power . the exit stream 230 from expander 5 provides heat to heater 510 , and then is exhausted to atmosphere as stream 300 . the energy and material balance for this example are listed in table 1 below , and the heat exchange duties , machinery power and efficiency are listed in table 2 . it is desirable for cost optimization to have an option to provide high pressure gas to the heating / power generating system at pressure selected from a range of pressures including pressures below the gas supercritical pressure . several embodiments of the invention include the provision to provide the gas stream , 210 , to the heating device at a selected pressure below the critical pressure of the gas in order to provide an improved overall net power output relative to the net power output from the process in which supercritical gas is provided to the power generation system . the pressure is selected so that , relative to the supercritical gas case , the power requirement reduction to produce the gas feed is greater than the power generation reduction from the heater / pressure - reducer / generator . an additional consideration of pressure selection is an overall cost optimization considering both the capital cost of equipment in addition to operating efficiency . it is desirable to operate the regenerator 40 at supercritical pressure during both cooling and heating steps to avoid phase change . therefore , several different embodiments are provided so that pressurized gas can be provided to the heating / power generation at a selected pressure below supercritical pressure . one embodiment which provides sub - critical , pressurized gas to the heating / power generation system includes a pressure reduction step in which the pressure of the gas from regenerator is fed to pressure reducing device such as a valve . another embodiment which provides sub - critical , pressurized gas to the heating / power generation system includes a pressure reduction step in which the pressure of the gas from regenerator is fed to pressure reducing device which is an expander producing shaft work . another embodiment which provides sub - critical , pressurized gas to the heating / power generation system includes a pressure reduction step in which the pressure of the gas from regenerator is fed to pressure reducing device which is an expander producing shaft work . further , said shaft work is applied to provide drive force to a compressor . another embodiment which provides sub - critical , pressurized gas to the heating / power generation system includes a pressure reduction step in which the pressure of the gas from regenerator is fed to pressure reducing device which is an expander producing shaft work . further , said shaft work is applied to provide drive force to a compressor , in which the compressor is used to compress additional gas feed to the heating / power generating system . another embodiment which provides sub - critical , pressurized gas to the heating / power generation system includes a pressure reduction step in which the pressure of the gas from regenerator is fed to pressure reducing device which is an expander producing shaft work . further , said shaft work is applied to provide drive force to a compressor , in which the compressor is used to compress gas feed , a portion of which is subsequently liquefied and conducted to the liquid storage container . another embodiment which provides sub - critical , pressurized gas to the heating / power generation system includes a pressure reduction step in which the pressure of the gas from regenerator is fed to pressure reducing device which is an expander producing shaft work . further , said shaft work is applied to provide drive force to a generator system which produces electrical power . another embodiment which provides sub - critical , pressurized gas to the heating / power generation system includes a supplemental heating step followed by a pressure reduction step in which the pressure of the gas from regenerator is fed to pressure reducing device which is an expander producing shaft work . the supplemental heating step increases the temperature of the gas feed to the pressure reducing device such that the gas formed from pressure reducing device is discharged at a super - ambient temperature . another embodiment which provides sub - critical , pressurized gas to the heating / power generation system includes an additional , closed loop fluid circuit which is in communication with the regenerator . liquid from the liquid storage container is pumped to a pressure less than its supercritical pressure and then heated by exchange with the fluid in closed - loop fluid circuit . another embodiment which provides additional selection of the time period for power generation is accommodation of high temperature heat storage in a portion of regenerator 40 . heat is removed from the high temperature gas exiting from heater 4 during a time period . during another time period , pressurized gas is heated by recovering heat from the high temperature portion of regenerator 40 then conducted to pressure reducing device 5 . this allows the heating step performed in heater 4 and the pressure - reducing / power generation step performed in devices 5 and 6 to be operated during separate time periods . this is particularly advantageous in combination with an embodiment using a csp heat source which is only available during daily insolation periods , which may not entirely coincide with preferred power generation periods . the present invention is not to be limited in scope by the specific aspects or embodiments disclosed in the examples which are intended as illustrations of a few aspects of the invention and any embodiments that are functionally equivalent are within the scope of this invention . various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art and are intended to fall within the scope of the appended claims .	5
an embodiment of the present invention will now be described with reference to the accompanying drawings . fig1 is a block diagram showing an arrangement of a mobile unit associated with one embodiment of the invention . referring to fig1 mobile unit 10 comprises antenna coupler 11 for transferring signals from transmitter section 12 to antenna 13 and for transferring signals from antenna 13 to receiver section 14 , microprocessor 15 for controlling elements of mobile unit 10 , oscillator 16 for generating tones , displaying unit 17 for displaying information sent from microprocessor 15 , speaker 18 for outputting signals from receiver section 14 or from tone generated 16 , microphone 19 for inputting signals to transmitter section 12 , switch 34 controlled by microprocessor 15 , and speech synthesis unit 35 for synthesizing predetermined speech patterns . transmitter section 12 includes baseband unit 20 coupled to an input speech signal for processing signals at baseband frequency and transmitter 21 coupled to the output of baseband unit 20 for modulating the output signal to be broadcast via antenna coupler 11 and antenna 13 . receiver section 14 includes receiver 22 coupled to antenna coupler 11 for demodulating received signals , baseband unit 23 coupled to the output of receiver 22 for processing the received signals , and a / d converter 24 for converting an analog signal supplied thereto to a digital signal responsive to control of microprocessor 15 . more specifically , as shown in fig2 receiver 22 includes first signal source 25 , mixer 26 for combining an incoming radio - frequency signal with the signal from first signal source 25 , first i - f ( intermediate - frequency ) amplifier 27 for amplifying the output signal of mixer 26 , second signal source 28 , mixer 29 for combining the output signal of first i - f amplifier 27 with signal from second signal source 28 , second i - f amplifier 30 for amplifying the output signal of mixer 29 , and i - f integrated circuit ( ic ) 31 . i - f ic 31 may comprise a plurality of linear amplifiers 32 for amplifying received signals and a plurality of diodes 33 for detecting the strength of received signals . fig3 shows the relationship between the voltage value detected by the plurality of didoes 33 and field intensity indicative of received radio frequency signal strength . the detected voltage value , for example 0 - 5 volts is converted to a digital value having a range , for example of 00000000 - 11111111 by a / d converter 24 . this digital value is applied to microprocessor 15 . when the detected voltage value decreases to a first predetermined value , for example , 1 volt , microprocessor 15 controls switch 34 so that the tone output of oscillator 16 is applied to speaker 18 and transmitter section 12 , thereby an alarm sound generated via speaker 18 is likewise transmitted to the radio channel via transmitted section 12 . when the detected voltage value decreases to a second lower predetermined value , for example , 0 volts microprocessor 15 controls transistor section 12 so as to terminate broadcasting and receiver section 14 so as to receive signals of a telephone signal link control channel . a voice synthesized alarm may also be provided by voice synthesis unit 35 as described below . now the operations of mobile unit 10 in accordance with the embodiment will be described in reference to fig4 and 3 . in this embodiment , the strength of received radio frequency signals is checked after a predetermined time interval ( steps 401 , 402 , and 403 ), for example , every five seconds . the time interval is counted down by a timer of microprocessor 15 or , alteratively , a peripheral unit thereto . after the time delay expires at step 402 , the microprocessor continues to step 403 . if the digital value corresponding to the detected signal voltage at step 403 is equal to or lower than the digital value corresponding to the first predetermined voltage value ( step 404 ), for example 1 volt , microprocessor 15 activates switch 34 so that the output of oscillator 16 is applied to speaker 18 and to transmitter section 12 , thereby an alarm tone generated by oscillator 16 is sounded via speaker 18 and also transmitted to the radio channel via transmitter section 12 . therefore this alarm may also be heard by the other party to the conversation . if the overall duration of the alarmer is 400 ms , for example , comprising a repeating nonsilence duration of 100 ms and a silence duration of 50 ms as shown in fig5 users may easily perceive the alarm sound as distinct from other telephone signals and the alarm may not significantly interfere with the telephone conversation . furthermore microprocessor 15 may control display unit 17 so that an alarm message , for example , &# 34 ; near boundary &# 34 ; or &# 34 ; speech line disconnect soon &# 34 ; is displayed . microprocessor 15 may simultaneously control speech synthesis unit 35 so that an alarm message is sounded via speaker 18 and , on the other hand , transmitted to the radio channel via transmitted section 12 typically after the audible periodic tone ( fig5 ) is sounded . in this case , speech synthesis unit 35 may artificially synthesize speech on the basis of prestored data or reproduce spoken words of the user which have been stored in advance ( step 405 ). on the other hand , in the event that the digital value corresponding to the detected voltage returns to a level above the digital value corresponding to the first predetermined value ( step 404 ) in the next iteration ( the predetermined time interval has lapsed ) or measurement at step 411 , microprocessor 15 terminates displaying the alarm message if appropriate and the operation of microprocessor 15 returns to step 401 ( via steps 414 and 415 ). next microprocessor 15 checks whether the detected voltage value determined at step 403 is below a second predetermined value or has fallen to 0 voltage ( step 407 ) after setting a timer to a second predetermined interval of , for example , 5 seconds ( step 406 ). if the detected signal voltage is not below or has not fallen to the second predetermined value , the operation of microprocessor 15 returns to step 401 to check the signal strength again to determine if it is below the first predetermined level . first , however , the timer turned on at step 406 is turned at step 413 . if the detected voltage value determined at step 403 is at or below the second predetermined voltage value ( step 407 ), it would be normally expected that the five second interval established at step 406 has not yet expired at step 408 . then the timer is set to a third predetermined interval of , for example , 5 seconds at step 409 . once the time expires at step 410 , the signal level is checked against at step 411 . at box 407 , it is again determined that the signal value , for example , is 0 volts and the signal level has remained at or below the second predetermined level . now time has expired at step 408 and the mobile telephone receiver returns to a standby mode at step 412 . this entails causing a disconnection from the telephone link at a telephone central office including terminating a broadcasting from transmitter section 12 . also , receiver section 14 returns to a control channel for receiving telephone link controls signals . it may be seen that two sequential measurements of signal level at , for example , 0 volts are required before the link is caused to be disconnected . from the above description , the first predetermined value for signal strength may be assumed to equal the second predetermined value in one embodiment or may be greater than the second predetermined value in a second embodiment . if at step 403 ( fig4 ) the signal strength value decreases below either the first or second predetermined value ( the values being equal in the first embodiment , an alarm tone generated by oscillator 16 may be immediately sounded via speaker 18 and also transmitted to the radio channel via transmitter section 12 ( and other appropriate indications made , for example , via display 17 ). furthermore , microprocessor 15 sets the timer to a second predetermined interval at step 406 of , for example , 5 seconds . consequently , unless the signal strength value recovers within the second predetermined interval , the communication link will be disconnected at step 412 . during the second predetermined interval of time , the several indications of an alarm initiated at step 405 continue to be indicated to at least one party to the conversation . in accordance with the second embodiment and in the event that the second predetermined value is not the same value but may be less than the first predetermined value for signal strength , two types of alarm indications may be initiated . a first alarm message of form in accordance with the above i . e . near boundary may be ordered at step 405 . however , in the second embodiment a second indication step may be provided between steps 409 and 410 such that in the first passage through loop 407 - 411 a more urgent indication is provided for the third predetermined interval . for example , if the signal strength value decreases below the second predetermined value , urgent types of indicia such as a more rapid periodic alarm tone or a more important displayed message such as &# 34 ; speech line disconnect imminent &# 34 ; may be provided until the third predetermined interval lapses . the first , second and third predetermined intervals at steps 401 , 406 and 409 and preferably as short as 4 - 5 seconds to insure that in - use channels are freed for use by others after a reasonable period of time .	8
preferred embodiments will be described in detail below referring to the accompanying drawings . fig1 shows the whole configuration of an image display according to a first embodiment of the invention . the image display includes a image processing function section including a tuner 11 , a y / c separation circuit 12 , a chroma decoder 13 , a switch 14 , a delay circuit 15 , a luminance signal correction section 2 and an image processing circuit 3 and an image display function section including a matrix circuit 41 , a driver 42 and a display 5 . an image correction circuit and an image correction method according to a first embodiment of the invention are embodied by the image display according to the embodiment , so they will be also described below . image signals inputted into the image display may be outputs from a vcr ( video cassette recorder ), a dvd ( digital versatile disc ) or the like in addition to a tv signal from a tv ( television ). it has become common practice for recent televisions and personal computers ( pcs ) to obtain image information from a plurality of kinds of media and display an image corresponding to each of the media . the tuner 11 receives and demodulates the tv signal from the tv , and outputs the tv signal as a composite video burst signal ( cvbs ). the y / c separation circuit 12 separates the composite video burst signal from the tuner 11 or a composite video burst signal from a vcr or a dvd 1 into a luminance signal y 1 and a chrominance signal c 1 to output them . the chroma decoder 13 outputs the luminance signal y 1 and the chrominance signal c 1 separated by the y / c separation circuit 12 as yuv signals ( y 1 , u 1 , v 1 ) including the luminance signal y 1 and color - difference signals u 1 and v 1 . the yuv signals are image data of a digital image , and a set of pixel values corresponding to a position on a two - dimensional image . a luminance signal y represents a luminance level , and takes an amplitude value between a white level which is 100 % white and a black level . moreover , a 100 % white image signal is 100 ( ire ) in a unit called ire ( institute of radio engineers ) representing a relative ratio of an image signal . the black level is 0 ire . on the other hand , the color - difference signals u and v correspond to a signal b - y produced by subtracting the luminance signal y from blue ( b ), and a signal r - y produced by subtracting the luminance signal y from red ( r ), respectively , and when the signals u and v are combined with the luminance signal y , colors ( color phases , chroma saturation , luminance ) can be shown . the switch 14 switches yuv signals from a plurality of kinds of media ( in this case , the yuv signals ( y 1 , u 1 , v 1 ) and yuv signals ( y 2 , u 2 , v 2 ) from a dvd 2 ) so as to output selected signals as yuv signals ( yin , uin , vin ). the luminance signal correction section 2 corrects the luminance signal yin of the yuv signals ( yin , uin , vin ) outputted from the switch 14 , and includes a dc transmission rate correction section 21 , a black level adjusting section 22 and a γ correction section 23 . fig2 shows the circuit configuration of the dc transmission rate correction section 21 . the dc transmission rate correction section 21 includes an apl detection circuit 211 , a dc shift circuit 212 , a black level correction function generating circuit 213 , a correction function determining circuit 214 and a correction execution circuit 215 . moreover , fig3 shows input / output characteristics in the dc transmission rate correction section 21 , and shows an image correction function defining a relationship between an inputted luminance signal yin and an outputted luminance signal yout 11 . a line l 10 in fig3 shows a reference image correction function ( before dc transmission rate correction ) in which the inputted luminance yin = outputted luminance yout 11 . the apl detection circuit 211 detects an average peak level ( apl ) in each image frame on the basis of the luminance signal yin . the detected average peak level is outputted to the dc shift circuit 212 . for example , as shown in fig3 , the dc shift circuit 212 generates an intermediate • high luminance function part l 12 , which lowers a luminance level in an intermediate • high luminance region to lower than an original luminance level ( the luminance level of the reference image correction function l 10 ) according to the average peak level in each image frame detected by the apl detection circuit 211 , in an image correction function ( for example , an image correction function l 14 in fig3 ) in the dc transmission rate correction circuit 21 . more specifically , the amount of dc shift is fixed irrespective of average luminance , and the whole image is shifted to darker side , thereby the intermediate • high luminance function part l 12 is generated . for example , as shown in fig3 , the black level correction function generating circuit 213 generates a low luminance function part ( a black level correction function ) l 11 , which is a part continuously connecting between a minimum luminance point p 0 and the intermediate • high luminance function part l 12 at a connection point p 1 so as to reduce a luminance signal in a low luminance region from an original luminance level though at a predetermined rate , in the image correction function ( for example , the image correction function l 14 in fig3 ) in the dc transmission rate correction circuit 21 . for example , in fig3 , the low luminance function part l 11 connects between the minimum luminance point p 0 and the intermediate • high luminance function part l 12 with a line with a predetermined change rate ( a gradient k 1 ). as a method of generating such a low luminance function part l 11 , the following two methods are cited . at first , as one of the methods , for example , as shown in fig4 a , a line l 110 having a given gradient except for 0 and passing through the minimum luminance point p 0 is predetermined , and the points of intersection of the line l 110 and intermediate • high luminance function parts ( for example , intermediate • high luminance function parts l 12 a and l 12 b ) are set as connection points ( for example , connection points p 1 a and p 1 b ) to the intermediate • high luminance function parts . in other words , irrespective of the dc fluctuation amounts of the intermediate • high luminance function parts , the low luminance function part l 11 with a fixed gradient continuously connects to the intermediate • high luminance parts at the connection points along the line l 110 . as another method , for example , as shown in fig4 b , a given output luminance yt 12 is predetermined , and points at which intermediate • high luminance function parts ( for example , intermediate • high luminance function parts l 12 c and l 12 d ) meet the output luminance yt 12 are set as connection points ( for example , connection points p 1 c and p 1 d ) to the intermediate • high luminance function parts . in other words , in the low luminance function parts l 11 c and l 11 d , the gradients of lines are changed according to the dc fluctuation amounts of the intermediate • high luminance function parts ( for example , gradients k 1 c and k 1 d ). a low luminance function part is represented by formula 1 , and an intermediate • high luminance function part is represented by formula 2 , and the output luminance at the point ( connection point ) of intersection of these function parts is yt 12 , so the gradient k of the line in this case is represented by formula 3 . in other words , as the value of α in formula 3 is increased with an increase in the dc fluctuation amount of the intermediate • high luminance function part , the gradient k of the line is decreased . the low luminance function part l 11 generated by the black level correction function generating circuit 213 in such a manner is outputted to the correction function determining circuit 214 . referring back to fig2 , the correction function determining circuit 214 determines an image correction function ( for example , an image correction function l 14 in fig3 ) including these function parts on the basis of the intermediate • high luminance function part l 12 generated by the dc shift circuit 212 and the low luminance function part l 11 generated by the black level correction function generating circuit 213 . moreover , the correction execution circuit 215 actually corrects the luminance signal yin from the switch 14 on the basis of the image correction function determined by the correction function determining circuit 214 . the luminance signal corrected in such a manner is outputted to the black level adjusting section 22 as a luminance signal yout 11 . referring back to fig1 , the black level adjusting section 22 detects a low luminance level region ( a blackest level region ) in an image frame on the basis of the inputted luminance signal yout 11 , and in the case where the blackest level region exists in a certain area range , for example , as shown in fig5 , the black level adjusting section 22 shifts the luminance signal in the blackest level region to black side ( the luminance level is lowered ) so as to correct the luminance signal yout 11 to a luminance signal yout 12 . thus , in the black level adjusting section 22 , the luminance signal is corrected so that a black level in a displayed image is enhanced , and the corrected luminance signal is outputted to the γ correction section 23 as the luminance signal yout 12 . for example , as shown in fig6 , the γ correction section 23 detects the histogram distribution of the luminance signal in each image frame on the basis of the inputted luminance signal yout 12 , and , for example , as shown in fig7 , the γ correction section 23 adaptively changes an input / output characteristic ( a γ characteristic ) ( for example , changes a γ characteristic l 30 into a γ characteristic l 31 or l 32 ) on the basis of the luminance histogram distribution , and corrects the luminance signal yout 12 into a luminance signal yout 13 on the basis of the γ characteristic . thus , in the γ correction section 23 , the luminance signal is corrected on the basis of the detected luminance histogram distribution so that the contrast is improved , and the corrected luminance signal is outputted to the image processing circuit 3 as the luminance signal yout 13 . the delay circuit 15 delays the color - difference signals um and vin outputted from the switch 14 , and synchronizes the color - difference signals um and vin and the corrected luminance signal yout 13 outputted from the luminance signal correction section 2 to output them to the image processing circuit 3 . the image processing circuit 3 performs predetermined image processing such as , for example , sharpness processing on the corrected luminance signal yout 13 outputted from the luminance signal correction section 2 and uv signals ( uout 1 , vout 1 ) which are outputted from the switch 14 and pass through the delay circuit 15 . the yuv signals ( yout 2 , uout 2 , vout 2 ) after image processing in such a manner are outputted to the matrix circuit 41 . the matrix circuit 41 reproduces rgb signals from the yuv signals ( yout 2 , uout 2 , vout 2 ) after image processing by the image processing circuit 3 , and outputs the reproduced rgb signals ( rout , gout , bout ) to the driver 42 . the driver 42 produces a driving signal for the display 5 on the basis of the rgb signals ( rout , gout , bout ) outputted from the matrix circuit 41 , and outputs the driving signal to the display 5 . the display 5 displays an image on the basis of the yuv signals ( yout 2 , uout 2 , vout 2 ) after the luminance signal is corrected by the luminance signal correction section 2 , and image processing is performed by the image processing circuit 3 according to the driving signal outputted from the driver 42 . the display 5 may be any kind of display device . for example , a crt ( cathode - ray tube ) 51 , a lcd ( liquid crystal display ) 52 , a pdp ( plasma display panel ; not shown ) or the like is used . the yuv signals ( yin , uin , vin ) correspond to specific examples of “ input image data ” in the invention . the dc transmission rate correction section 21 corresponds to a specific example of “ an image correction circuit ” in the invention , and the apl detection circuit 211 corresponds to a specific example of “ a luminance detection means ” in the invention , and the dc shift circuit 212 , the black level correction function generating circuit 213 , the correction function determining circuit 214 and the correction execution circuit 215 correspond to specific examples of “ an image correction means ” in the invention . the dc shift circuit 212 , the black level correction function generating circuit 213 and the correction function determining circuit 214 correspond to specific examples of “ a function determination means ” in the invention , and the correction execution circuit 215 corresponds to a specific example of “ a correction execution means ” in the invention . next , the operation of the image display according to the embodiment will be described below . at first , an image signal to be inputted into the image display is demodulated into the yuv signals . more specifically , a tv signal from the tv is demodulated into a composite video burst signal by the tuner 11 , and a composite video burst signal is directly inputted into the image display from the vcr or the dvd 1 . then , the composite video burst signals are separated into the luminance signal y 1 and the chrominance signal c 1 in the y / c separation circuit 12 , and then the luminance signal y 1 and the chrominance signal c 1 are decoded into the yuv signals ( y 1 , u 1 , v 1 ) in the chroma decoder 13 . on the other hand , yuv signals ( y 2 , u 2 , v 2 ) are directly inputted into the image display from the dvd 2 . next , in the switch 14 , either the yuv signals ( y 1 , u 1 , v 1 ) or the yuv signals ( y 2 , u 2 , v 2 ) are selected to be outputted as the yuv signals ( yin , uin , vin ). then , the luminance signal yin of the yuv signals ( yin , uin , vin ) is outputted into the luminance signal correction section 2 , and the color - difference signals uin and vin are outputted to the delay circuit 15 . in the luminance signal correction section 2 , the following operation of correcting the luminance signal is performed on the basis of the inputted luminance signal yin . at first , in the dc transmission rate correction section 21 , the apl detection circuit 211 detects the average peak level in each image frame on the basis of the inputted luminance signal yin , and the dc shift circuit 212 generates the intermediate • high luminance function part l 12 which lowers the luminance level in the intermediate • high luminance region according to the detected average peak level . on the other hand , the black level correction function generating circuit 213 generates the low luminance function part l 11 which is a part continuously connecting between the minimum luminance point p 0 and the intermediate • high luminance function part l 12 at the connection point p 1 so as to reduce the luminance signal in the low luminance region though at a predetermined rate . then , the correction function determining circuit 214 determines the image correction function including the intermediate • high luminance function part l 12 and the low luminance function part l 11 , and the correction execution circuit 215 corrects the luminance signal yin from the switch 14 on the basis of the determined image correction function . as described above , the determined image correction function is generated so that the input luminance signal is lowered according to the average peak level in the intermediate • high luminance region , and the input luminance signal is maintained at a level lower than an original level in the low luminance region ( refer to the intermediate • high luminance function part l 12 and the low luminance function part l 11 in fig3 ), so while the dc level conversion is performed in the intermediate • high luminance region , a loss of gray levels in the low luminance region of the converted luminance signal can be prevented . next , the black level adjusting section 22 detects the blackest level region in the image frame on the basis of the luminance signal yout 11 , and in the case where the blackest level region exists in a certain area range , the black level adjusting section 22 shifts the luminance signal in the blackest level region to black side ( the luminance level is lowered ) so as to correct the luminance signal so that the black level in the displayed image is enhanced . then , the γ correction section 23 detects the luminance histogram distribution in each image frame on the basis of the luminance signal yout 12 , and corrects the luminance signal on the basis of the characteristic adaptively changed according to the luminance histogram distribution so that the contrast is improved . the luminance signal corrected in such a manner is outputted to the image processing circuit 3 as the luminance signal yout 13 . on the other hand , the delay circuit 15 delays the color - difference signals uin and vin , and as a result , the color - difference signals um and vin and the luminance signal yout 13 outputted from the luminance signal adjusting section 2 are synchronized . next , the image processing circuit 3 performs predetermined image processing such as , for example , sharpness processing on the corrected luminance signal yout 13 outputted from the luminance signal correction section 2 and the uv signals ( uout 1 , vout 1 ) which are outputted from the switch 14 and pass through the delay circuit 15 . then , the matrix circuit 41 reproduces rgb signals ( rout , gout , bout ) from the yuv signals ( yout 2 , uout 2 , vout 2 ) after image processing , and the driver 42 produces a driving signal on the basis of the rgb signals ( rout , gout , bout ), and an image is displayed on the display 5 on the basis of the driving signal . as described above , in the embodiment , in the dc transmission rate correction section 21 , while the luminance signal level in the low luminance region is reduced from the original luminance signal level though at a predetermined rate , the luminance signal level in the intermediate • high luminance region is lowered according to the average peak level detected by the apl detection circuit 211 , so even if the dc level conversion is performed in the intermediate • high luminance region as in the case of a related art , a loss of gray levels in the low luminance region after the conversion can be prevented . therefore , gray levels in the low luminance region can be reliably displayed , and the quality of a displayed image can be improved . moreover , for example , as shown in fig3 , 4 a and 4 b , the low luminance function part is represented by a line continuously connecting between the minimum luminance point p 0 and the intermediate • high luminance function part , so the image correction function including these function parts can be easily generated . therefore , the configurations of the black level correction function generating circuit 213 and the correction function determining section 214 can be simplified , and the circuit sizes can be reduced . further , in the correction function determining circuit 214 , in the low luminance region , a smaller value ( the low luminance function part ) is selected and determined between the intermediate • high luminance function part and the low luminance function part , so also in this viewpoint , the image correction function can be easily generated . next , a modification of the first embodiment will be described below . in the modification , for example , as shown by an image correction function l 14 a in fig8 , in the dc transmission rate correction section 21 , a low luminance function part which includes a part l 11 a passing through the minimum luminance point p 0 and having the same shape as the image correction function l 10 before dc level conversion is generated , and the luminance signal is corrected by the image correction function including such a low luminance function part . more specifically , for example , in fig8 , the low luminance function part l 11 includes a line part l 11 a connecting between the minimum luminance point p 0 and a connection point p 20 on the image correction function l 10 and a line part l 11 b connecting between the connection point p 20 and the intermediate • high luminance function part l 12 at a connection point p 21 . in other words , in the image correction function in the first embodiment , the minimum luminance point p 0 and the intermediate • high luminance function part are directly connected by a line with a fixed gradient , but in the modification , they are connected by the part l 11 a having the same shape as the image correction function l 10 before dc level conversion . therefore , in the modification , for example , as shown by the image correction function l 14 in fig9 , even if the luminance level of the corrected luminance signal yout 11 is further lowered by the dc transmission rate correction section 21 in the low luminance region , for example , as in the case of an image correction function l 24 , a loss of gray levels can be prevented . therefore , even if the black level adjusting section 22 is arranged before the dc transmission rate correction section 21 , or the dc transmission rate correction section 21 , the black level adjusting section 22 and the γ correction section 23 are arranged in parallel , for example , as shown in luminance signal correction sections 2 a and 2 b in fig1 a and 10b , respectively , as described above , a loss of gray levels can be reliably prevented . as described above , in the modification , in the dc transmission rate correction section 21 , the low luminance function part which includes the part l 11 a passing through the minimum luminance point p 0 and having the same shape as the image correction function l 10 before dc level conversion is generated , and the luminance signal is corrected by the image correction function including such a low luminance function part , so , for example , even if the luminance level in the low luminance region is further lowered after the dc transmission rate correction , a loss of gray levels can be reliably prevented . therefore , in addition to the effects in the first embodiment , irrespective of the arrangement of the luminance signal correction section 2 or the like , gray levels in the low luminance region can be displayed more reliably , and the quality of a displayed image can be further improved . moreover , as the line part l 11 a , the image correction function l 10 before dc level conversion may be used as it is , so the image correction function can be easily generated and achieved . further , irrespective of the arrangement of the luminance signal correction section 2 or the like , the modification can be applied to luminance signal correction sections with various configurations , so flexibility in device design can be improved . next , a second embodiment of the invention will be described below . an image display according to the embodiment adjusts an image correction function in a high luminance region ( a white level region ) in addition to the adjustment of an image correction function in a low luminance region ( a black level region ) described in the first embodiment . fig1 shows the circuit configuration of a dc transmission rate correction section 21 a according to the embodiment . the dc transmission rate correction section 21 a further includes a white level correction function generating circuit 216 in the dc transmission rate correction section 21 described in the first embodiment . like components are denoted by like numerals as of the first embodiment and will not be further described . for example , as shown in fig1 , the white level correction function generating circuit 216 generates a high luminance function part ( a white level correction function ) l 13 , which is a part continuously connecting between a maximum luminance point p 4 and an intermediate luminance function part l 14 while maintaining the maximum luminance point p 4 at the maximum luminance point in the image correction function l 10 , in an image correction function ( for example , an image correction function l 15 in the drawing ) in the dc transmission rate correction section 21 a . for example , in fig1 , the high luminance function part l 13 connects between the maximum luminance point p 4 and the intermediate luminance function part l 12 with a line with a predetermined change rate ( a gradient k 2 ). the dc shift circuit 212 , the black level correction function generating circuit 213 , the white level correction function generating circuit 216 , the correction function determining circuit 214 and the correction execution circuit 215 in the embodiment correspond to specific examples of “ an image correction means ” in the invention . the dc shift circuit 212 , the black level correction function generating circuit 213 , the white level correction function generating circuit 216 and the correction function determining circuit 214 correspond to specific examples of “ a function determination means ” in the invention . by the structure of such an image correction function , in the dc transmission rate correction section 21 a in the embodiment , while the luminance level of the luminance signal yin in the intermediate luminance region is lowered according to the detected average peak level by a predetermined level , the maximum luminance point p 4 is maintained in the high luminance region . therefore , while dc level conversion is performed in the intermediate luminance region , a decline in the luminance level can be prevented in the high luminance region of the luminance signal yout 11 after the conversion . as described above , in the embodiment , while the maximum luminance point p 4 is maintained in the high luminance region , the luminance level of the luminance signal yin in the intermediate luminance region is lowered according to the detected average peak level , so even if the dc level conversion is performed in the intermediate luminance region , a decline in the luminance level in the high luminance region after the conversion can be prevented . therefore , in addition to the effect of preventing a loss of gray levels in the low luminance region in the first embodiment , gray levels in the high luminance region can be reliably displayed , and the quality of a displayed image can be improved . moreover , for example , as shown in fig1 , the high luminance function part is also represented by a line continuously connecting between the maximum luminance point p 4 and the intermediate luminance function part , so an image correction function including these function parts can be easily generated . therefore , the configuration of the white level correction function generating circuit 216 can be simplified , and the circuit size can be reduced . further , the black level correction function generating circuit 213 and the white level correction function generating circuit 216 are separately arranged , so the operation of adjusting an image correction function in the low luminance region and the operation of adjusting an image correction in the high luminance region can be individually performed . also in the image correction function described in the embodiment , for example , as shown by an image correction function l 15 a in fig1 , like the modification of the first embodiment ( refer to fig8 ), the low luminance function part l 11 may include a part l 11 a which passes through the minimum luminance point p 0 and has the same shape as the image correction function l 10 before dc level conversion . in such a configuration , in addition to the effects in the embodiment , irrespective of the arrangement of the luminance signal correction section or the like , gray levels in the low luminance region can be displayed more reliably , and the quality of a displayed image can be further improved . although the invention is described referring to the first embodiment and the second embodiment ; however , the invention is not limited to them , and can be variously modified . for example , in the above embodiments , the case where the image correction function in the low luminance region ( the black level region ) is adjusted ( the case of the first embodiment ) and the case where in addition to the image correction function in the low luminance region , the image correction function in the high luminance region ( the white level region ) is adjusted ( the case of the second embodiment ) are described ; however , for example , as shown by an image correction function l 15 b in fig1 , only the image correction function in the high luminance region ( the white level region ) may be adjusted . in such a configuration , while the dc level conversion is performed in the intermediate luminance region , a decline in the luminance level in the high luminance region after the conversion can be prevented . therefore , gray levels in the high luminance region can be reliably displayed , and the quality of a displayed image can be further improved . moreover , in the above - described embodiments , the case where the low luminance function part or the high luminance function part is represented by a line with a fixed gradient is described ; however , as long as a loss of gray levels in the low luminance region or a decline in the luminance level in the high luminance region can be prevented , and the low luminance function part or the high luminance function part can continuously connect to the intermediate luminance function part , the function part may be represented by a curve instead of a line . further , in the above - described embodiments , the luminance signal correction section 2 includes the black level adjusting section 22 and the γ correction section 23 in addition to the dc transmission rate correction section 21 ; however , the luminance signal correction section 2 may include only the dc transmission rate correction section 21 , or the luminance signal correction section 2 may further include another luminance signal correction circuit in addition to them . it should be understood by those skilled in the art that various modifications , combinations , sub - combinations and alterations may occur depending on design requirements and other factors insofar as they are within the scope of the appended claims or the equivalents thereof .	7
the method described herein will be referred to as the edge - restricted spline - under - tension ( ersut ) interpolation method . the ersut image interpolation method is based on a computer graphics curve interpolation algorithm . therefore , a brief explanation of that curve interpolation algorithm will be presented before the ersut image interpolation method will be described . in general , the interpolating graphics curves are called &# 34 ; splines under tension &# 34 ;. while the curves are not truly splines , they are built up from basic curves similar to the uniform b - spline . the &# 34 ; tension &# 34 ; portion of the name of the curves refers to the tension control parameter employed in the algorithm to decrease or increase the slack in the curve . advantages of the &# 34 ; splines under tension &# 34 ; are that they interpolate through given points and the computation of the interpolation is relatively simple , as opposed to interpolation curves such as the cubic b - spline . the &# 34 ; spline under tension &# 34 ; algorithm uses four consecutive points ( these are the control points or knots ) to interpolate points between the two middle points . if ( 1 ) the four consecutive points are designated as p i + 1 , p i , p i + 1 , and p i + 2 , ( 2 ) the variable c represents the tension control parameter , and ( 3 ) the variable u indicates the fractional position of interpolated point p i + u between original points p i and p i + 1 , then the interpolating curve c ( u ) can be expressed as ## equ1 ## the useful range of values for the tension control parameter , c , is given by { cεr : 0 . 0 ≦ c ≦ 1 . 0 }. values of c less than 0 . 0 lead to loops in the curve at the control points , while c values greater than 1 . 0 cause loops between the control points . the greatest tension in the interpolated curve results from c = 0 . in this case , the &# 34 ; curve &# 34 ; is essentially linear connections of the control points . the curve exhibits the greatest slack when c = 1 . when the tension control parameter has a value of 0 . 5 the curve is known as a catmull - rom curve . see , pokorny et al , computer graphics : the principles behind art and science , pp . 260 - 262 ( franklin , beedle and assoc . 1989 ). the values of the variable u are determined by the number of points to be interpolated between each two control points , and are always fractional values between 0 and 1 . if just one point is interpolated between each two , the u = 1 / 2 . if two points are interpolated between each two , u ={ 2 / 3 , 1 / 3 }. in general , if n represents the number of points to be interpolated , ## equ2 ## if the product given in equation ( 1 ) is multiplied through , then the value of the curve at interpolated point p i + u is given by if ## equ3 ## represents the weight placed on the point p i - 1 in calculating then a one - dimensional mask of weights for interpolating n points is given by specifically , if the number of points being interpolated is n = 2 , then those two interpolated points are denoted p i + 2 / 3 and p i + 1 / 3 , and , for each point , equation ( 3 ) simplifies to ## equ4 ## incorporating the weights given in equations ( 5 ) and ( 6 ), the general one - dimensional mask of weights given in ( 4 ) becomes the specific one - dimensional mask ## equ5 ## the symmetry about the center weight , 1 , in the mask above is independent of the number of points being interpolated . any n - point interpolation will exhibit such symmetry . this fact greatly simplifies the next step in the development of the ersut interpolation method . the discussion thus far has only been concerned with the &# 34 ; spline under tension &# 34 ; curve interpolation algorithm . in order to find application for image interpolation , the concept of curve interpolation must be extended one more dimension to surface interpolation . a two - dimensional mask of weights is created by forming a cartesian product of the one - dimensional mask of weights , given in ( 4 ), with itself . due to the symmetry of the one - dimensional mask , if the two - dimensional mask is separated into four quadrants , these quadrants are symmetric about the weight in the center of the mask , which will again be a weight of 1 . therefore , only the weights in one quadrant of the mask need be calculated ; the other three quadrants are merely reflections of that quadrant . if the weights are calculated for the upper left quadrant of the mask , then the upper right quadrant is a reflection to the right , and the two lower quadrants are formed by reflecting the two upper quadrants down . for the specific case of a two - point interpolation , the upper left quadrant of the two - dimensional mask is shown below . this was formed from the one - dimensional mask in ( 7 ). ## equ6 ## with the introduction of this second dimension , some additional notation must be included in the discussion . in the first dimension , pixels were indexed with the subscript i , and p i + u indicated a pixel interpolated between p i and p i + 1 . in the second dimension , pixels shall be indexed with the subscript j , and p i + u , j + v will indicate a pixel interpolated between p i , j , p i , j + 1 , and p i - 1 , j + 1 . if the pixel to be interpolated , p i - u , j - v , is in line with a row or column of control pixels , then its gray - level value will be a weighted sum of the gray levels of the four closest control pixels in line with it , as described previously for curve interpolation . however , if the pixel to be interpolated is not in line with any row or column of control pixels , then its gray - level value will be a weighted sum of the gray levels of the sixteen nearest surrounding control pixels . specifically , the sixteen pixels form a four - by - four square with the upper left pixel identified as p i - 1 , j - 1 and the lower right pixel identified as p i + 2 , j + 2 . in the ersut interpolation method , and referring to the flowchart diagram in fig1 the actual interpolation process is preceded by a preprocessing stage at 10 and 12 intended to produce well - defined edges in the interpolated image . the goals of this stage are ( 1 ) to identify locations of edges in the original image , and then ( 2 ) to predict the locations of edges in the interpolated image . in the first part of this stage , shown at 12 , the original image is convolved with a laplacian gaussian filter . if the gaussian distribution , in two dimensions , is represented by ## equ7 ## then the laplacian (∇ 2 ) of this is represented by ## equ8 ## according to marr , vision , pp . 54 - 61 ( w . h . freeman and co . 1982 ), the ∇ 2 g filter is the most satisfactory means of locating intensity changes in an image . the result of the convolution of the ∇ 2 g filter with the original image will be referred to as the ∇ 2 g - filtered image . the ∇ 2 g - filtered image contains positive and negative values with an overall average of zero . neighboring values of opposite sign indicate a zero - crossing in the second derivative of the image , which corresponds to an intensity change in the image . by thresholding the difference of neighboring values having opposite signs , the locations of edges in the original image can be accurately identified , and this information can be used to achieve better contrast along edges in the interpolation process . bearing in mind that the ∇ 2 g - filtered image contains positive and negative values , the actual location of edges generally lies between original pixels that correspond to opposite - signed neighboring values . since new pixel values will be determined in the interpolation process and placed between original pixels , it is important to predict the location of edges in the interpolated image before the interpolation begins . accordingly , in this second part of the preprocessing stage , the ∇ 2 g - filtered image is interpolated to the same size to which the original image will be interpolated . the interpolation of the ∇ 2 g - filtered image is performed by the two - dimensional catmull - rom &# 34 ; spline under tension &# 34 ; algorithm . recall that the catmull - rom specification indicates that the mask of weights employs a tension control parameter of c = 0 . 5 . with the completion of this preprocessing stage , locations of edges for the yet - to - be - interpolated image are determined , and this information , stored in the ∇ 2 g - filtered - interpolated image , will be used to influence the interpolation of the actual image . the image interpolation process involves three different &# 34 ; splines under tension &# 34 ;. the three masks of weights are formed with three different tension control parameters values : c = 1 . 0 , c = 0 . 5 , and c = 0 . 0 . for each known pixel , an examination is made of the pixel &# 39 ; s neighbors at 14 . the mask based on c = 1 . 0 is used to interpolate pixels along edges and in detailed areas of the image . such edges and details are indicated by inspecting the ∇ 2 g - filtered - interpolated image for adjacent values of opposite sign and thresholding the difference of those values by a preselected edge threshold value , as described above and shown at 16 and 18 . for smooth areas of the image , the c = 0 . 0 mask performs the interpolation . these smooth areas are indicated by adjacent ∇ 2 g - filtered - interpolated values whose difference does not exceed the preselected smooth threshold value . see blocks 20 and 22 . if neither edges nor smoothness are indicated by thresholding adjacent ∇ 2 g - filtered - interpolated image values , then the pixels that correspond to those values are interpolated using the c = 0 . 5 catmull - rom mask of weights shown at 20 and 24 . the selection of the two threshold values are based on individual preference . the choice of a threshold value for edges depends on how &# 34 ; hard &# 34 ; or &# 34 ; soft &# 34 ; the interpolated image is to appear . a &# 34 ; hard &# 34 ; image has sharp edges that are defined by significant intensity differences . conversely , the edges of a &# 34 ; soft &# 34 ; image are blurred and indistinct . if the edge threshold is chosen to be a small value , the image will appear harder . this is because a lower edge threshold will identify smaller differences as edges . increasing the edge threshold value causes the appearance of the image to become softer as fewer differences will be identified as edges . based on our experience , a gray scale difference of 20 or more is perceived as a significant edge by human eyes . in the ersut method , an image gray scale difference of 20 most closely corresponds to ∇ 2 g - filtered - interpolated values that differ by 5 . 0 . therefore , in the simulations of the algorithm , an edge threshold value of 5 . 0 has been adopted . similarly , it has been found that neighboring ∇ 2 g - filtered - interpolated values that differ by 3 . 0 or less correspond to smooth areas in the image . accordingly , the method incorporates a smooth threshold value of 3 . 0 . once the mask with the appropriate tension control value ( c = 1 . 0 , 0 . 5 , or 0 . 0 ) has been selected for the interpolation of a particular pixel , p i + u , j + v , all of the ∇ 2 g - filtered - interpolated values that lie within the square region from upper left corner corresponding or original pixel p i - 1 , j - 2 to lower right corner corresponding to original pixel p i + 2 , j + 2 are examined at 26 for indication of an edge , using the same edge threshold described above . since the ∇ 2 g - filtered image has undergone interpolation , both ∇ 2 g - filtered values originally calculated from the image and ∇ 2 g - filtered values interpolated from those calculated values are inspected for evidence of zero - crossings . if evidence of an edge is found within that square region , the ersut method branches at 28 to an edge - restricted version of the &# 34 ; spline under tension &# 34 ; interpolation , which will be discussed shortly . if , however , there is no indication of an edge , the &# 34 ; spline under tension &# 34 ; mask explained above ( with c = 0 . 5 or 0 . 0 ) is used at 30 to weight the gray - level values of the sixteen nearest pixels to determine the gray - level value of interpolated pixel p i + u , j + v . if an edge is detected in the search of the surrounding square region , the edge - restricted branch of the algorithm will adjust the weights of the &# 34 ; spline under tension &# 34 ; mask ( c = 1 . 0 , 0 . 5 , or 0 . 0 ) before applying it to the sixteen nearest pixels . the adjustments made to the mask depend upon the sign of the ∇ 2 g - filtered - interpolated image value corresponding to the pixel being interpolated . if , for example , that pixel has a ∇ 2 g - filtered - interpolated value that is negative , then only those original pixels that correspond to negative ∇ 2 g - filtered - interpolated values will be used in the calculation of that pixel value . in order to keep the mask one - weighted , the sum of the weights that would have been applied to original pixels with positive ∇ 2 g - filtered - interpolated values is evenly distributed to the weights for original pixels with negative ∇ 2 g - filtered - interpolated values . the effect of this adjustment of weights is that the gray level of a pixel interpolated close to an intensity edge is calculated only from those original pixels on the &# 34 ; same side &# 34 ; of the edge ; pixels on the &# 34 ; opposite side &# 34 ; of the edge make no contribution . this edge - restricted branch of the method should lead to an interpolated image which exhibits significant , visually - pleasing contrast along edges and enhancement of image details . the ersut interpolation method produces a higher contrast image than the image resulting from bilinear interpolation , and at the same time , ersut interpolation introduces minimal artifacts . this minimization of artifacts is due primarily to the ∇ 2 g - filtered - interpolated image . therefore , a video signal which is interpolated by the ersut interpolation method before printing should result in a print of high quality . while the methods described herein constitute preferred embodiments of this invention , it is to be understood that the invention is not limited to these precise methods , and that changes may be made therein without departing from the scope of the invention , which is defined in the appended claims .	6
a traditional stator of a line - start electric motor comprises a plurality of windings of a stator winding or of several stator windings . the stator is made of several stator sheets , which are substantially shaped as annulus discs . the accommodating chambers for the windings are open inside and are therefore also called slots . the windings are made of copper wire and distributed in the individual slots in different numbers . the distribution of the windings per slot usually follows the rule of a sine distribution . thus , it is achieved that the rotating field resulting from the interaction of stator and rotor during operation of the line - start electric motor has an approximately sine - shaped course , when , as shown in fig1 , the magneto - motoric force mmk is distributed over the slots . in fig1 , the magneto - motoric force is distributed over the slots 1 to 24 . in the fig2 and 3 , the magneto - motoric force mmk or the relative magneto - motoric force , respectively , distributed over the sequence of the harmonics 1 to 30 . from the fig2 and 3 it appears that with a substantially sine - shaped distribution of the winding wires a large first harmonic occurs , whereas the particularly critical third harmonic as well as the fifth and the seventh harmonics are only weakly pronounced . the copper comprised in the winding wires causes a copper loss , which reduces the efficiency of the line - start electric motor . when a reduction of the copper amount comprised in the stator was possible , the efficiency of the line - start electric motor would increase . within the scope of the present invention it has been established that the copper amount comprised in the stator can be reduced , in that the concentration of the copper wires in some slots is increased . a line - start motor supplies the same torque , when , for example , the copper wires are distributed over four slots instead of over five slots . through the concentration increase of the winding wires , the magnetic poles in the stator are concentrated . however , when concentrating the winding wires in a smaller number of slots , the rotating field will lose its sine - shape to become approximately square . in the diagrams shown in the fig4 to 6 , the copper winding wires are distributed on only two slots , which are located to be diametrically displaced , that is , by 180 °, in relation to each other . the course of the magneto - motoric force mmk over the slots 1 to 24 is square . from the slots 1 to 12 , the magneto - motoric force mmk has a value of plus 10 and then drops to minus 10 . from the slots 12 to 24 the magneto - motoric force mmk has the value minus 10 . the fig5 and 6 show the result of a fourier analysis . the distribution of the magneto - motoric force over the harmonics shows that particularly the third , fifth and seventh harmonic have a rather high value , which causes an unacceptable reduction of the efficiency . through the design of the stator in accordance with the invention , the copper amount in the stator can be reduced , which at the same time reduces the reducing influence of the harmonics or the harmonic frequencies , respectively , on the efficiency . fig7 shows a cross - section of a stator sheet . the stator sheet substantially has the shape of an annulus disc , in which a plurality of slots 1 to 24 are undercut , which are open on the radial inside . in the stator sheet 30 is formed a rotor accommodating chamber , which substantially has an annular shape . however , the inner radius of the rotor accommodating chamber 32 is not constant . the rotor accommodating chamber has a plurality of different radii 41 to 52 . in fig8 , some of the slots accommodate windings of a main winding and an auxiliary winding . in the embodiment according to fig8 , the main winding comprises two windings , which enter the drawing level at 61 and 63 in the slots 21 and 22 and leave the drawing level at 62 and 64 in the slots 9 and 10 . during operation of the line - start electric motor , the windings 61 to 64 of the main winding generate a magnetic field , whose main axis is called 71 . the auxiliary winding comprises two windings , which enter the drawing level at 65 and 67 in the slots 3 and 4 and leave the drawing level at 66 , 68 in the slots 15 , 16 . during operation of the line - start electric motor , the windings 65 to 68 of the auxiliary winding generate a magnetic field , whose auxiliary axis is called 72 . the auxiliary axis 72 is arranged to be vertical to the main axis 71 . in fig8 it can be seen that the two windings 61 to 64 of the main winding are distributed on four slots 21 , 22 , 9 , 10 , which are arranged in pairs diametrically opposite each other . the two windings 65 to 68 of the auxiliary winding are distributed on four slots 3 , 4 , 15 , 16 , which are arranged in pairs diametrically opposite each other . the remaining slots accommodate no windings . in the area of the slots 3 , 4 , 9 , 10 , 15 , 16 and 21 , 22 , in which windings 61 to 68 of the main winding and the auxiliary winding are located , the radius of the rotor accommodating chamber 32 is smaller than in the neighbouring areas . the slots , in which the windings 61 to 68 are located , are also called stator winding accommodating chambers or stator winding accommodating slots 3 , 4 , 9 , 10 , 15 , 16 , 21 , 22 . in the area of the stator winding accommodating slots , the radius 44 of the rotor accommodating chamber 32 has a value of 31 . 52 mm . at 41 , 43 , 45 , 46 , 47 , 49 , 50 and 52 , the radius of the rotor accommodating chamber 32 has a value of 31 . 7 mm . at 42 , 76 , 48 and 51 , the radius of the rotor accommodating chamber 32 has a value of 32 mm . thus , the radius of the rotor accommodating chamber 32 is smallest in the area of the stator winding accommodating slots , and then increases steadily in the area of the empty slots , up to the angle halvings between the main axis and the auxiliary axis . the size of the radius of the rotor accommodating chamber 32 varies substantially in a wave - shape between the stator winding accommodating slots of the different windings , to achieve a substantially sine - shaped course of the magnetic field occurring during operation . thus , the amplitude of the harmonic frequencies can be reduced in relation to a stator with a constant inner radius . the varying radius causes a reduction of the magnetic field in the air gap between stator and rotor , where the radius is largest . when the stator shown in fig8 would only have one stator winding , for example , the main stator winding with the windings 61 to 64 , the radius of the rotor accommodating chamber 32 would be largest in the area of the main stator winding accommodating slots 9 , 10 ; 21 , 22 , and would decrease steadily in the area of the empty slots . the largest radius of 32 mm of the rotor accommodating chamber 32 would then be in the areas , in which the largest copper concentration of the stator would be . fig9 shows the magneto - motoric force over the slots 1 to 24 of a stator . in the area of the slots 1 , 5 to 8 , 13 , 17 to 20 and 24 , the inner rotor chamber of the stator has a radius of 32 mm . in the area of the slots 2 , 4 , 9 , 11 , 14 , 16 , 21 , 23 , the radius of the rotor accommodating chamber has a value of 31 . 7 mm . in the area of the slots 3 , 10 , 15 , 22 , the radius of the radiator accommodating chamber has a value of 31 . 52 mm . in the slots with a radius of 32 mm no windings of the main and the auxiliary windings are arranged . in the remaining slots , windings are arranged . from the fig1 and 11 , it appears that particularly the size of the particularly critical third harmonics could be reduced by the distribution of the windings and by the varying inner rotor accommodating chamber diameter . the diagram in fig1 refers to a stator , which only has a smaller radius in the area of the slots 2 , 11 , 14 and 23 than in the area of remaining slots . however , the fig1 and 14 show that the effect on particularly the third harmonics is then no longer as large as in the embodiment example above . a solution with several different radii is preferred . tests have shown that the differences of the radii of the rotor accommodating chamber must not be too large . otherwise , they will have a negative effect on the efficiency of the line - start electric motor . in the area between the slots , the inner rotor accommodating chamber radius can be constant , so that the inner radii of the slot interspaces , which are also called teeth , vary from tooth to tooth . however , it is also possible that the inner radius of a tooth is not constant , but varies . while the present invention has been illustrated and described with respect to a particular embodiment thereof , it should be appreciated by those of ordinary skill in the art that various modifications to this invention may be made without departing from the spirit and scope of the present invention .	7
an embodiment of the device according to the present invention will hereinafter be described by reference to the fragmentary plan view of fig5 the front view of fig6 and the cross - sectional views of fig7 and 8 . a casing 14 for the cleaning device has an engaging member 14 1 engageable with a rail 15 secured to the body of a copying apparatus , thus making the cleaning device removable from the apparatus body . a blade 16 is nipped by and between adapters 18 and 19 and mounted on a shaft 17 . by rotating the shaft 17 counterclockwise to lock the blade , the end edge portion of the blade 16 may be urged against a photosensitive drum 20 which is rotating clockwise . cleaning of the photosensitive drum 20 may be accomplished by the sharp end edge portion 16 1 of the blade 16 . a guide plate 21 , which keeps an appropriate gap 16 2 with respect to the blade edge portion 16 1 , may be formed of a thin sheet of such material as mylar or the like , and is suspended from a shaft 24 substantially at the center of the longitudinal dimension of the drum 20 by means of a resilient member 22 of urethane foam or like material and a back metal 23 . this ensures uniform contact of the guide plate 21 with the photosensitive drum 20 . a suitably resilient sheet 26 secured to the adapter 18 by a screw 25 is sandwiched at one end portion between the blade 16 and the adapter 18 . the other end portion of the sheet 26 is sandwiched between the resilient member 22 on the guide plate 21 and the back metal 23 and secured to the latter . the end portion 21 1 of the guide plate 21 is vertically movable with vertical movement of the blade 16 . the sheet 26 is formed with a window 26 1 having a width substantially conforming to the gap 27 between the blade 16 and the back metal 23 . a screw 29 accommodated within a pipe 28 is disposed substantially above the blade edge portion 16 1 . the pipe 28 has a window 28 1 at a portion thereof which faces the blade edge portion 16 1 . the screw 29 is supported and sealed at the opposite ends of the pipe 28 by bearings 30 and seals 31 , and rotatively driven from a drive source ( not shown ), which is common to the photosensitive drum 20 , through a lever 32 attached to one end of the pipe . a flexible wrap sheet 33 ( which may be formed of , for exaple , mylar ) extends over the window 26 1 of the sheet 26 and the window 28 1 of the pipe 28 and is secured to the sheet 26 and the pipe 28 , thus forming a sealed cylindrical chamber or space 33 1 . the wrap sheet 33 has a window 33 1 at a portion which is also substantially in conformity with the window 26 1 of the sheet 26 . on the other hand , as shown in fig8 a resilient seal 34 of urethane foam or like material secured to the sheet 26 extends into intimate contact with the end edge of the blade 16 near the opposite side edges thereof corresponding to the non - image - bearing area 20 1 of the photosensitive drum 20 , and the resilient seal 34 frictionally slides relative to the photosensitive drum 20 while making intimate contact therewith , whereby the gaps 16 2 and 27 defined by the blade 16 , the guide plate 21 and the back metal 23 are closed at the opposite ends thereof . the windows 26 1 and 33 1 of the sheet 26 and the wrap sheet 33 , respectively , terminate substantially in conformity with the position of the resilient seal 34 . the cylindrical wrap sheet 33 has the opposite ends thereof tied to the pipe 28 by bands 35 to close the opening of the cylindrical space 33 1 . with the above - described construction of the cleaning device , the toner removed by the blade edge portion 16 1 is forced upwardly through the gap 21 1 between the blade and the guide plate 21 to fill the space 33 1 within the wrap sheet 33 . subsequently , the toner is conveyed forwardly through the pipe 28 by the rotating screw 29 . at the same time , that part of the toner which spreads axially of the drum along the blade edge portion 16 1 at the opposite side edges thereof , as already mentioned , is prevented from further advancing by the resilient seal 34 and also forced upwardly into the overlying space 33 1 . since the space 33 1 is closed at the opposite ends thereof by the bands 35 , the toner filling the space 33 1 is all conveyed forwardly through the pipe 28 without leaking outwardly . thus , there is no contamination of the apparatus interior which would otherwise result from scattered toner near the opposite ends of the photosensitive drum 20 . description will now be made of a mechanism for preventing the toner within the space 33 1 from dropping through such opening as the gap 16 2 between the blade 16 and the guide plate 21 when the cleaning device is in non - cleaning condition such as inoperative condition or when it is being mounted or dismounted . fig9 is a fragmentary plan view illustrating the operative position of such mechanism , fig1 is a side view thereof , fig1 is a cross - sectional view along line c -- c in fig9 and fig1 illustrates the operative condition of the present mechanism in the cross - sectional view of fig7 . a shutter 43 has a length ( axial ) equal to or slightly greater than that of the blade 16 , and is situated between the guide plate 21 and the photosensitive drum 20 . as shown in fig1 , it is supported by a shaft 46 at one end and also supported from therebelow for movement on a support member 44 . the shaft 46 is extended rightwardly as viewed in fig1 and engages each of shutter arms 47 provided within the casing 14 at the opposite ends thereof . each shutter arm 47 is secured to a rotatable shaft 48 extending through the casing 14 laterally thereof , and a shutter lever 49 is secured to that portion of the shaft 48 which is projected beyond the casing 14 . with such construction , the shutter 43 may be substantially horizontally moved to right and left in fig1 or 11 by moving the shutter lever 49 sidewise from its position shown in fig1 . when the cleaning device is in its cleaning position , the shutter lever 49 is pivoted clockwise in fig1 ( the position indicated by dot - and - dash line ), whereby the shutter 43 is displaced leftwardly as indicated by dots - and - dash line in fig1 or in solid outline in fig7 ( the &# 34 ; open &# 34 ; position of the shutter 43 ), thus making no interference with the cleaning operation . subsequently , the shaft 17 is rotated by means of a knob 50 and a lever 51 ( fig1 ) on the front of the device shown in fig9 to thereby raise the blade 16 away from the photosensitive drum 20 , whereupon the edge portion of the guide plate 21 is also raised by the described action of the sheet 26 . when the shutter lever 49 is then pivoted back to the solid - line position shown in fig1 , the shutter 43 is displaced rightwardly so that the forward end thereof passes below the blade edge portion 16 1 and is finally raised slightly due to the angular movement of the shutter arm 47 . by this , the upper surface of the shutter 43 is urged against the blade edge portion 16 1 and also against the guide plate 21 and the resilient seal 34 at the opposite ends ( the &# 34 ; closed &# 34 ; position of the shutter 43 ). thus , the lower opening 16 2 of the cleaning device is completely sealed to prevent dropping of the toner perfectly . a slight amount of toner would then remain on the photosensitive drum 20 , but such slight amount of toner would not slip down the surface of the photosensitive drum to contaminate the interior of the apparatus . by bringing the shutter 43 into &# 34 ; closed &# 34 ; position as described , the toner cannot drop from anywhere even if the present device is tilted during the removal thereof from the apparatus , because the toner at the opening 16 2 is blocked by the shutter 43 and the toner on the blade 16 and the guide plate 21 is blocked by the seal at the opposite ends of the wrap sheet 33 . the device according to the present embodiment of the invention further incorporates therein a safety mechanism for the shutter mechanism . if one tries to lower the blade 16 with the shutter remaining in &# 34 ; closed &# 34 ; position or to close the shutter 43 with the blade 16 remaining lowered , then there will be a possibility that damages may be imparted to the shutter 43 , the guide plate 21 , the blade 16 , the photosensitive drum 20 , etc . in the present embodiment , therefore , a knob 50 for controlling the blade 16 and the shutter lever 49 for controlling the shutter 43 are associated together to prevent malfunctioning . the end portion 50 1 of the knob 50 lies on an arm rest 52 provided on the casing 14 when the blade 16 is in raised position . to lower the blade 16 to urge it against the photosensitive drum , the know 50 is first pulled upwardly in fig9 to cause the end portion 50 1 thereof to escape from the arm rest 52 , and then the knob 50 is depressed downwardly in fig1 to cause the arm 51 to rotate the shaft 17 counter - clockwise to urge the blade and finally , the end portion 50 1 of the knob is forced in to underlie pressure plate 53 ( in fig9 the knob 50 is depressed back ), thus accomplishing the setting ( the dots - and - dash line position in fig1 ). in order to associate such movement with the movement of the shutter lever 49 , a link 54 is pivotally supported on the shutter lever 49 . the other end portion of the link 54 extends to the neighborhood of the end portion 50 1 of the knob 50 and is slidable in a groove 55 formed in the casing 14 . when the blade 16 is in raised position with the shutter 43 in &# 34 ; closed &# 34 ; position ( the solid - line position of fig1 ), the upper surface 54 1 of the end of the link 54 may interfere with the path followed by the end portion 50 1 of the knob 50 as the blade 16 is lowered . thus , the blade 16 cannot be lowered when the shutter 43 is in &# 34 ; closed &# 34 ; position . next , when the shutter lever 49 is pivoted rightwardly to bring the shutter 43 into &# 34 ; open &# 34 ; position , the link 54 is displaced rightwardly in fig1 to cause the upper surface 54 1 of the end portion of the link to escape from the path of the end portion 50 1 of the knob ( dot - and - dash line ), thus permitting the blade 16 to be lowered . when the blade 16 is in its lowered position , namely , when the end portion 50 1 of the knob underlies the pressure plate 53 , the bent end 54 2 of the link 54 strikes against the end portion 50 1 of the knob so that the shutter 43 cannot be &# 34 ; closed &# 34 ; by cocking up the shutter lever 49 . when the knob 50 is lifted to return the end portion 50 1 thereof onto the arm rest 52 ( namely , when the blade 16 is raised ), the interference of the bent end 54 2 of the link is eliminated so that the shutter 43 can now be &# 34 ; closed &# 34 ; by cocking up the shutter lever 49 . such a safety mechanism can entirely prevent the accidents as already described . further , in the device of the present embodiment , the operation of bringing the shutter 43 from its &# 34 ; open &# 34 ; position to its &# 34 ; closed &# 34 ; position is automated to simplify the manipulation . the shutter lever 49 is normally biased leftwardly in fig1 , namely , in a direction to bring the shutter 43 into &# 34 ; closed &# 34 ; position . thus , in the cleaning position of the device , the bent end 54 2 of the link is urged against the knob end portion 50 1 to &# 34 ; open &# 34 ; the shutter 43 , but when the knob 50 is lifted to raise the blade 16 , the intereference of the bent end portion 54 2 of the link is eliminated to permit the shutter lever 49 to be rotated counter - clockwise by the force of the spring 55 , whereby the shutter is automatically brought to its &# 34 ; closed &# 34 ; position . this simplifies the operation and also prevents the risk of the toner reserved in the cleaning device dropping to contaminate the apparatus interior and its environment when the operator forgets to close the shutter 43 during mounting or dismounting of the cleaning device or the photosensitive drum 20 . it will be noted that this shutter mechanism is applicable for the opening portion not only in the blade cleaning device of the present invention but also in other types of cleaning device , and also as the toner scatter preventing mechanism during inoperative condition of the developing device . fig1 and 14 are cross - sectional views illustrating a modified form of the device . in the embodiment shown there , the guide member is in the form of a roller and the blade serves also to perform the function of the shutter . the members similar to those in the previous embodiment are given similar reference numerals . the guide roller 46 disposed adjacent to the blade 16 may be formed of rubber or synthetic resin , for example , delrin , and is pivotally supported by a shaft 56 1 . the guide roller may preferably rotate at a velocity substantially equal to that of the photosensitive medium 20 . a conveyor screw 29 for laterally conveying the developer extends substantially parallel to the roller . members 57 and 58 together define a passage space leading from a slit opening , formed by the roller 56 and the blade 16 , to the screw 29 . disposed in the gap between the pivotally supported blade 16 and the member 58 is a seal member 59 formed of a material such as sponge or the like having a high compression deformation factor , while a seal member 60 formed of mylar or like material is disposed in the gap between the guide roller 56 and the member 57 , thus providing good sealing for the conveyance passage space . with such construction , the developer separated from the surface of the photosensitive medium by the blade may be moved along the passage for collection . on the other hand , when the blade is pivoted to its inoperative position , as shown in fig1 , the blade edge portion makes intimate contact with the surface of the guide roller to close the slit opening completely . thus , the blade , when maintained in its inoperative position , performs the function of the shutter and eliminates the risk of the collected developer leaking and scattering during the mounting or dismounting of the device , just as in the previous embodiment . the guide member is disposed in proximity to or in intimate contact with the surface of the photosensitive medium but the guide member may preferably be designed to be movable away from the surface of the photosensitive medium , in order to facilitate the mounting or dismounting of the device . reference will now be had to fig1 and 16 to describe a mechanism whereby the toner removed by the present cleaning device may be directed to the developing section . a pipe 28 extends outwardly through the casing 14 at the front thereof and has a discharge port 28 2 thereat . a screw 29 within the pipe 28 extends to the vicinity of the discharge port 28 2 , and is succeeded by a screw 36 threaded oppositely to the screw 29 to ensure positive discharge into the discharge port 28 2 . a bearing 30 and a seal 31 are provided at the front end of the pipe 28 to support the screws 29 and 36 , and this is also the case with the rear end of the pipe 28 . a collecting duct 37 is removably fitted over the outwardly projected portion of the pipe 28 to cause the toner discharged through the discharge port 28 2 of the pipe 28 to be directed to the developing section from gravity . the toner tends to scatter upwardly when delivered from the pipe 28 into the collecting duct 37 , but the sufficiently close fit of the collecting duct 37 to the pipe 28 prevents the upwardly scattered toner from leaking outwardly to contaminate the environment . since the collecting duct 37 is somewhat inclined with respect to the vertical because of the arrangement of the cleaning and the developing section , toner may possibly be deposited on the inner wall of the collecting duct 37 and even clog the duct to cause some accident . for this reason , a coil spring 38 is provided and rotated within the collecting duct 37 to assist in conveying the toner , thereby preventing deposition of the toner onto the inner wall of the duct . the rotative drive for the coil spring 38 may be transmitted by converting an axial drive into a vertical drive through such means as a bevel gear 39 on the forward end of the screw shaft of the cleaner , an unshown bevel gear 40 , an unshown spur gear 41 and a spur gear 42 . according to the present invention , as noted above , a seal 34 is provided at the opposite ends of the gap between the blade 16 and the guide plate 21 so that all the removed toner may be forced upwardly into the space 33 1 completely sealed except for the inlet and outlet , from which the toner may be discharged . thus , no toner leaks from either end of the blade or from anywhere else when the device is tilted , and the delivery of the toner to the collector device can occur easily and without the toner being scattered during the delivery . also , according to the present invention , a shutter mechanism including a shutter 43 for closing the opening portion of the device is provided to prevent dropping of toner within the device during its non - cleaning conditions and thus , no scattering of toner occurs during the mounting or dismounting of the device or of the photosensitive drum 20 . further , the shutter mechanism of the present invention has a safety mechanism for preventing the resilient blade from being interfered with when in its cleaning position , thus preventing occurrence of such malfunctioning that the shutter closes the slit opening and the blade strikes against the surface of the photosensitive medium . this completely eliminates the possibility that the shutter may be closed during the cleaning operation to prevent the developer separated by the blade from being removed from the vicinity thereof and to permit such developer to build up there to reduce the cleaning efficiency or impart to the blade and / or the surface of the photosensitive medium any abnormal load which would result in damages thereof . further , the automatic shutter closing mechanism is useful to eliminate the occurrence of the risk of toner being scattered during the mounting or dismounting of the cleaning device or of the photosensitive medium . the device of the present invention , as has hitherto been described in detail , performs the cleaning operation by the use of a resilient blade and this contributes to a very compact construction of the device . moreover , the set position of the device may be arbitrarily selected by the use of the blade and the guide member and this means a great advantage when the present invention is applied to copying machines . furthermore , the device of the present invention is constructed with a good sealing effect maintained and thus eliminates the risk of the removed developer being scattered and contaminating the interior and exterior of the apparatus . in addition , the collected developer may be conveyed back into the developing device for reuse and this means highly efficient recycling and economy of the material .	6
as is shown in the drawings , which are included for purposes of illustration and not by way of limitation , the invention is embodied in a radiopaque marker 10 ( fig1 a , 1b , 2a , 2b , and 5 ). conventional radiopaque markers are limited in that they may comprise undesirable projections extending from a stent , may be arduous to attach , restrict the expansion capabilities of an expandable stent and may be ineffective in the identification of the position , orientation and configuration of a stent . the radiopaque marker 10 of the present invention defines an acceptable , very low profile , may be conveniently affixed to a stent , does not impede the expansion capabilities of an expandable stent , and may be useful in identifying the position , orientation and configuration of a stent within a blood vessel . the radiopaque marker of the present invention , therefore , provides superior means of marking a stent . the present invention facilitates precise placement of a stent 12 by way of its novel configuration , position upon a stent , and material properties . the characteristics of a radiopaque marker 10 are selected to assure that a stent 12 embodying the radiopaque marker 10 may benefit from the advantages which the invention provides . thus , radiopaque marker 10 may have various geometric shapes , comprise various materials and may be positioned anywhere on a stent 12 , so long as the desired advantages of the invention are achieved . while stent 12 can include any number of configurations , one preferred embodiment includes a plurality of cylindrical elements 13 which are interconnected so as to be generally aligned on a common longitudinal axis . stent 12 includes proximal end 14 and distal end 16 , and cylindrical elements 13 are attached by one or more connecting elements 17 . the connecting elements 17 interconnect the cylindrical elements so that each connecting element 17 connects only cylindrical elements that are adjacent to each other . each cylindrical element is formed from straight segments 18 connected by curved portions 20 which together form a generally serpentine pattern 21 . in a preferred embodiment , radiopaque marker 10 is plated upon an outer circumference of a generally cylindrical stent 12 and upon a proximal end 14 and a distal end 16 of the stent 12 . in another embodiment , it is contemplated that an inner circumference underlying the outer circumference be plated as well . by utilizing plating as the means for affixing radiopaque marker 10 to a stent 12 , a minimum profile may be achieved . it is contemplated that the thickness of radiopaque marker 10 be in the range of about 0 . 0003 to 0 . 003 inches . as such , the radiopaque marker 10 does not appreciably alter the profile of stent 12 and therefore , does not result in stent 12 having substantial projections extending into the blood flow or into the walls of the blood vessel being repaired . in addition , by plating or similarly affixing radiopaque material upon a stent , radiopaque markers 10 can be easily and accurately affixed to a stent . that is , plating is an improved means of affixing radiopaque material to stent 12 over conventional means of affixing radiopaque markers , such as sewing or bonding , which can be tedious and imprecise . although it is not necessary for all embodiments , the preferred embodiment contemplates that the entire circumference of the stent be plated at both its proximal end 14 and distal end 16 . it is also contemplated that the plating material may be gold or a material , such as platinum , which has similar radiopaque characteristics . it is significant that gold , or a similar material , is contemplated as the preferred radiopaque marker material . other metals suitable as radiopaque markers include , for example , platinum and silver . by selecting such a material , the stent may be effectively identified under fluoroscopy . in various conventional stents , the radiopaque material employed glows so brightly under fluoroscopy so as to obscure the lesion being repaired . in contrast , the images of radiopaque markers comprised of gold or platinum do not , under fluoroscopy , substantially obscure the lesion being repaired . it is also significant that the preferred embodiment contemplates affixing radiopaque markers 10 to the ends of stents 12 having various geometric configurations ( see fig2 a and 2b ). by doing so , the orientation or configuration of the stent 12 , irrespective of its geometric configuration , can be ascertained , which is particularly important to the determination of whether a stent has completely repaired a blood vessel . by noting the distance between the radiopaque bands , the length of the stent 12 can be ascertained and compared to an expected stent length . by observing the height or width of the radiopaque markers 10 , the extent of expansion of an expandable stent 12 can be ascertained and compared with expected values . similarly , by examining the radiopaque markers of the present invention under fluoroscopy , it can be determined whether the stent 12 is twisted or otherwise improperly seated within a vessel . the plating of radiopaque markers upon a stent may add some rigidity to a stent in the areas of plating . since this is the case , the preferred embodiment contemplates affixing radiopaque markers 10 to only those portions of an expandable stent 12 that do not deform upon expansion . as shown in fig1 a and 1b for example , radiopaque markers 10 may be affixed to straight segments 18 of the proximal end 14 and distal end 16 of a stent . upon expansion , the curved portions 20 of the stent 12 may deform so as to allow the stent 12 to expand , while the straight portions 18 may remain undeformed . by affixing radiopaque markers 10 to the straight portions 18 of stent 12 as shown in fig1 a and 1b , the additional rigidity added to the stent 12 by the radiopaque markers 10 does not impede expansion . therefore , an expandable stent having radiopaque markers 10 of the present invention can uniformly and predictably expand . in order to plate a radiopaque marker 10 upon a stent 12 , a mandrel 30 may be employed ( see fig3 a ). the mandrel 30 may comprise any suitable material formed into an elongate cylindrical shape having a main portion 21 with a cross - sectional diameter sized for receiving stent 12 . the mandrel may further embody a collar 22 formed or attached to one end of the mandrel 30 that has a cross - sectional diameter larger than that of stent 12 and two annular recesses 23 formed in the main portion 21 which have cross - sectional diameters less than that of the main portion 21 . the collar 22 functions as a stop and may aid in registering stent 12 upon the mandrel 30 . annular recesses 23 function to allow interior surfaces of stent 12 to be plated . in another embodiment of mandrel 30 ( fig3 b ), recesses 23 may be sufficiently shallow or be missing entirely from mandrel 30 so that , where desirable , interior surfaces of stent 12 are not plated with radiopaque material . in a preferred method , stent 12 is placed upon mandrel 30 and heat shrink tubing 32 ( see fig4 a and 4b ) is slipped over stent 12 . the heat shrink tubing 32 is then exposed to heat to shrink the tubing on the stent 12 . it is contemplated that the heat be concentrated at a midpoint of the heat shrink tubing 32 and then gradually apply heat towards each end so as to prevent distortion of the stent . the shrink tubing 32 may be any polyester having heat shrink properties and the ability to mask the stent during the electroplating process . once the heat shrink tubing 32 is snug upon stent 12 , the stent may be precisely positioned on the mandrel 30 and then temporarily secured in place using a high temperature wax . where it is desired to plate an interior as well as an exterior surface of stent 12 , the annular recesses 23 may be aligned with the interior portions of the stent 12 desired to be plated ( see fig4 a ). where it is deemed undesirable to plate the interior surface , no such further alignment is necessary ( see fig4 b ). next , the curved portions 20 ( fig1 b ) of stent 12 as well as the ends of the mandrel 30 can be dipped in high temperature wax to prevent them from being plated . in order to plate the desired portions of stent 12 , the heat shrink tubing 32 surrounding portions of the stent 12 to be plated may be cut away using a standard co 2 laser or its equivalent . the laser output is to be limited so that stent 12 and mandrel 30 are not affected . by utilizing a mandrel 30 without annular recesses ( see fig3 b and 4b ), portions of the heat shrink tubing 32 may be lased away so that only the outer circumferences of stent 12 may be plated . by employing the mandrel 30 illustrated in fig3 a and 4a , portions of the heat shrink tubing 32 overlaying annular recesses 23 may be lased away , thereby resulting in a stent 12 having desired portions of its interior as well as its exterior 12 plated with radiopaque material ( see fig2 b ). as with any electroplating process , an electrical current is used in the process of putting a metallic coating on a metal or other conducting surface . in the preferred embodiment , a gold solution exists in the form of positively charged ions that have lost one or more electrons . the stent is connected to the cathode or negative terminal and the anode , or positive electric terminal , is connected to the stainless steel mandrel 30 which is dipped into the gold solution . the ions are attracted to the cathode and the coating is deposited on the stent metal surface . as is known in the art , the thickness of the layer deposited depends on the amperage of the electric current , the concentration of the metallic ions and the length of time that the stent is plated . the plating process should be at a low enough amperage to prevent mapping , nodules , and a matte surface . after plating the gold on the stent , the wax is removed from stent 12 and mandrel 30 by inserting them in acetone or an equivalent solution . as can be appreciated from the drawings ( fig2 a and 2b ), the end portions 36 , 38 of a stent 12 which are not masked , are plated with radiopaque material and the portions of the stent 12 which are masked , are not plated . once the stent 12 is plated with a radiopaque marker 10 , it is removed from the mandrel 30 and the heat shrink tubing 24 is stripped away . the heat shrink tubing 24 may be removed , for example , by cutting it with a laser or in the alternative , dissolved with chemicals . finally , the mandrel is withdrawn from the plated stent 12 and the stent 12 may be cleaned with an alcomox or equivalent solution . in another embodiment , the entire exterior surface of a stent may be plated with radiopaque material . subsequent to plating , the stent 12 is masked and subjected to etching . in this embodiment , the areas designated to retain radiopaque material are masked and the radiopaque material is etched away from the remaining portions of the stent . in yet another embodiment , radiopaque markers having some pattern are affixed to a generally cylindrical stent so as to facilitate the identification , position and configuration of a stent 12 within a blood vessel . for example , the pattern of a radiopaque marker 10 may be in the form of a sine wave . as the sine wave expands along with the stent during deployment , it is visible under fluoroscopy and it can be determined whether the stent 12 is properly seated within a blood vessel by viewing the amplitude and shape of the sine wave radiopaque marker . as another example , as depicted in fig5 the pattern of a radiopaque marker 10 may be a continuous or dashed line extending from the proximal end 14 to the distal end 16 of stent 12 . a longitudinal marker of the type described will allow the doctor to determine if the stent has twisted upon deployment or if it expanded unevenly . in an alternative embodiment , a radiopaque plastic may be coated or affixed to all or a portion of a stent . in this embodiment , a radiopaque plastic is formed by loading a plastic material with a radiopaque material such as barium sulfate or bismute trioxide . the resultant mixture is then coated or affixed to the stent . several methods of affixing the radiopaque material to the stent are contemplated and include : ( 1 ) melting the radiopaque material and then dipping the stent into the melt ; ( 2 ) solvent casting ; and ( 3 ) vacuum deposition . these methods are generally known and various process steps are apparent to those skilled in the art . as with the plating process steps described above , the stent can be masked and mounted on a mandrel and then coated by dipping , solvent casting , or vacuum deposition . from the foregoing it will be appreciated that the radiopaque marker of the invention effectively identifies the location and configuration of a stent within a patient &# 39 ; s body lumen and provides a method and apparatus for constructing the same . while several particular forms of the invention have been illustrated and described , it will also be apparent that various modifications can be made without departing from the spirit and scope of the invention . thus , it should be understood that various changes in form , and detail , and application of the present invention may be made without departing from the spirit and scope of this invention .	0
the present invention provides a method for recovery and purification of isoamylase , said method comprising : using raw starch to adsorb isoamylase in the fermentation broth of an isoamylas - producing bacterium . fermentation broth of any isoamylase - producing bacterium is useful in the present invention . the bacteria useful in the present invention only produce isoamylase but no other protein adsorbable by raw starch . among such bacteria , pseudomonas amyloderamosa is the most preferred . the raw starch useful in the present invention include corn starch , rice starch , potato starch , or wheat starch , for example , that available from sigma chemical co . ( usa ) and sweet potato starch , for example , that available from wako pure chemical co . ( japan ). the condition for isoamylase adsorption onto raw starch is preferably acidic , for example , ph 2 - 7 and most preferrably ph 3 . 5 - 5 . 2 . the temperature is preferably 0 °- 50 ° c . and more preferably below 10 ° c . generally known methods for isolation of isoamylase adsorbed onto raw starch such as column separation or elution are useful in the present invention . elution method is preferred , for example , using buffer solution containing saccharide as eluant . the saccharide is preferably of low molecular weight such as soluble starch , amylose , dextran and maltose wherein maltose is the most preferred . there follows a detailed description of certain preferred embodiments of the present invention , but these are intended to be illustrative only , and not in any way a limitation of the present invention . pseudomonas amyloderamosa wu 2130 used in this study is an isoamylase - hyperproducing mutant derived from p . amyloderamosa jd210 deposited in the culture collection and research center , food industry research and development institute ( hsinchu , taiwan ). the seed medium ( sm ) is composed of ( w / v ) 1 . 0 % maltose , 0 . 2 % peptone , 0 . 1 %( nh 4 ) 2 hpo 4 , 0 . 05 % mgso 4 . 7h 2 o ( ph 5 . 0 ); production medium ( pm ) is composed of ( w / v ) 2 . 0 % maltose , 0 . 5 % proteimax ( sanbra co ., brazil ), 0 . 3 % kh 2 po 4 , 0 . 05 % mgso 4 . 7h 2 o ( ph 5 . 0 ). 0 . 5 ml bacterial cells stored in glycerol was used to inoculate a hinton flask containing 10 ml sm . incubation was at 30 ° c . on a rotary shaker at 150 rpm for 24 hours to activate bacterial cells . 5 ml culture broth was used to inoculate 100 ml sm and was incubated on a rotary shaker under the same condition for 16 to 20 hours to generate seed culture . 20 ml seed culture was used to inoculate 400 ml pm . incubation was at 30 ° c . on a rotary shaker at 150 rpm for 2 days . the culture broth was collected and centrifuged in a frozen centrifuge ( 9000 × g ) for 40 minutes . the supernatant was used as crude enzyme solution . enzyme activity was determined according to the method described in harada , t ., k . yokobayashi , and a . misaki . appl . microbiol . 1968 , 16 , 1439 . 100 mg raw starch was added to 5 ml crude enzyme solutions of different ph ( 1n hcl and 1n naoh were used to adjust the solution to a desired ph ). the solution was vigorously shook , incubated at 4 ° c . for 1 hour , centrifuged ( 12 , 000 × g ) for 1 minute and the enzyme activity remaining in the supernatant was then determined . the control group was operated similarly except that no raw starch was added . ## equ1 ## as shown in fig1 optimum adsorption to corn starch or potato starch occurred in a broad ph range of 3 . 2 - 5 . 2 . at any ph , enzyme adsorption onto corn starch was higher than that onto potato starch . 100 mg raw starch was added to 5 ml crude enzyme solution ( ph 5 . 2 ). the solution was vigorously shook , incubated in a water bath of indicated temperature for 1 hour , centrifuged ( 12 , 000 × g ) for 1 minute and the enzyme activity remaining in the supernatant was then determined . adsorption reaction was conducted at various temperatures . as shown in fig2 the lower the temperature , the higher the adsorption . adsorption to corn starch and potato starch respectively decreased 67 % and 55 % when the temperature was raised from 0 ° c . to 40 ° c . at any temperature , adsorption onto corn starch was higher than those onto other starches . one gram of raw starch was added to suitable amount of crude enzyme solution ( ph 5 . 2 ) with agitation for 1 hour followed by standing for 3 hours at 4 ° c . most of the supernatant was removed by vacuum pump and the residue was centrifuged ( 12 , 000 × g ) to remove the remaining supernatant . the enzyme activity of the original crude enzyme solution and that of the supernatant were determined . the enzyme activity adsorbed onto raw starch was defined as the activity of the original crude enzyme solution -- the activity of the supernatant !. the starch pellet with adsorbed enzyme was washed in 50 ml cold acetate buffer ( 0 . 05m , ph5 . 2 ), centrifuged and decanted of supernatant for three times . the sample was suspended in 20 ml eluant buffer solution at 40 ° c ., stirred for 1 hour to elute the enzyme , and centrifuged . the supernatant was collected and the enzyme activity in the supernatant was assayed . the eluted isoamylase activity was compared with the adsorbed enzyme activity to calculate the elution percentage . ## equ2 ## the result showed that acetate buffer containing 10 % maltose gave an elution percentage of higher than 56 %. the isoamylase adsorption capability of five starches including rice starch , corn starch , sweet potato starch , potato starch and wheat starch was tested . as shown in table 1 , corn starch and rice starch had highest isoamylase adsorption capability , wheat starch the second and potato starch the lowest . the elution percentage of isoamylase from various raw starches were in the range of 52 - 60 %. table 1______________________________________the effect of various raw starches on the adsorptionand elution of isoamylase . sup . a adsorbed isoaylase eluted isoamylase total total activity adsorption activity elutionstarch ( u ) (%) ( u ) (%) ______________________________________corn 73 , 520 90 . 1 44 , 280 60 . 2rice 75 , 000 91 . 9 41 , 520 55 . 4sweet potato 58 , 740 72 . 0 31 , 600 53 . 8potato 42 , 000 51 . 5 21 , 960 52 . 3wheat 64 , 560 79 . 1 34 , 860 54 . 0______________________________________ . sup . a one gram of raw starch was used to adsorb the isoamylase in 100 ml crude enzyme solution ( 816 u / ml ). the eluant was 20 ml of 0 . 05m acetate buffer ( ph 5 . 2 ) containing 10 % maltose . protein was estimated by the coomassie blue binding method ( scopes , r . k . in &# 34 ; protein purification : principles and practice &# 34 ; second edition , springer - verlag press , new york , heidelberg , berlin , london , paris , tokyo , p . 306 ) with bovine serum albumin as standard . 1 . 5 ml sample was added to 1 . 5 ml coomassie brilliant blue g - 250 reagent ( 600 mg coomassie brilliant blue in 1 liter 2 % perchloric acid with insoluble materials removed ) and incubated for 2 to 30 minutes . adsorption at 595 nm was determined and compared with the standard curve . preparation of gel , electrophoresis and cbr staining were all performed according to the method described in the doctoral thesis by r . h . chaung in graduate school of agricultural chemistry , national taiwan university . raw corn starch was used in the crude enzyme solution containing isoamylase to perform the adsorption and elution of isoamylase . the isoamylase purification effect is illustrated in table 2 . a 13 . 3 - fold purification and 54 % recovery were resulted . purity was determined on sds - page . as shown in fig4 the purified isoamylase had desirable purify and a molecular weight of 80 , 300 . table 2______________________________________purification of isoamylase by adsorption - elution oncorn starch . sup . a total total specific purifi - activity activity protein activity cation recovery ( u / ml ) ( u ) ( mg ) ( u / mg ) fold (%) ______________________________________crude 805 80 , 500 14 . 74 5 . 461 1 100enzymesolutionadsorption - 2 , 112 42 , 200 0 . 58 72 . 828 13 . 3 54elution______________________________________ . sup . a one gram of raw starch was used to adsorb the isoamylase in 100 ml crude enzyme solution ( 816 u / ml ). the eluant was 20 ml of 0 . 05m acetate buffer ( ph 5 . 2 ) containing 10 % maltose . raw starch was repeatedly used in the adsorption - elution reaction . as shown in table 3 , no significant decrease in the adsorption and elution rates was detected . on the other hand , raw starch before and after isoamylase adsorption and elution was washed in cold distilled water and freeze - dried . the freeze - dried sample was coated with a thin layer of gold on an ion coater ( model ib - 2 , hitachi koki ltd ., japan ) and scanning electron microscopy was performed ( model s - 450 , hitachi koki co ., japan ). as shown in fig3 isoamylase had no hydrolytic capacity on raw starch . the above results show that raw starch can be repeatedly used in isoamylase adsorption - elution reaction . table 3______________________________________repeated use of raw corn starch for the adsorptionand elution of isoamylase . sup . aruns adsorption (%) elution (%) ______________________________________1st 90 . 7 57 . 82nd 89 . 3 57 . 53rd 90 . 2 55 . 44th 92 . 1 61 . 2______________________________________ . sup . a one gram of raw starch was used to adsorb the isoamylase in 100 ml crude enzyme solution ( 816 u / ml ). the eluant was 20 ml of 0 . 05m acetate buffer ( ph 5 . 2 ) containing 10 % maltose .	2
referring now more particularly to the drawings , and specifically to fig1 thereof , a doorway is there generally designated 10 , being formed in a building wall 11 , and composed of generally upright doorway sides or jambs 12 and 13 , and a generally horizontal top or head 14 extending between the upper ends of the jambs . door stop strips 15 and 16 extend around the doorway , specifically along the jamb 12 and head 14 , respectively . a door 20 is hinged , as at 21 , to door jamb 12 , for swinging movement between the illustrated open position and a closed position limited by the door stop elements 15 and 16 . the door stop 15 and 16 are formed with longitudinally extending grooves 22 and 23 facing toward the door 20 when the latter is closed . the grooves 22 and 23 of the respective door stop elements 15 and 16 open at their adjacent ends into each other , and extend at right angles to each other , as do the door stop elements . thus , the door stop grooves 22 and 23 combine to define a continuous elongate groove having a relatively sharp bend , being a right angle bend in the illustrated embodiment . seated in the grooves 22 and 23 , and suitably secured therein , as by adhesive or other means , may be an elongate , generally tubular , flexible hollow sensor body 25 . this hollow sensor body 25 is essentially of constant cross sectional configuration in its undistorted condition , and may be fabricated by extrusion of resiliently flexible material , such as vinyl , or other suitable material . the sensor body 25 is best seen in fig2 and may be of generally rectangular external configuration conformably seated in and projecting slightly beyond the groove 22 of the stop element 15 . the hollow body may include a bottom wall 26 seated on the bottom wall of groove 22 , and side walls 27 and 28 generally normal to the bottom wall and extending along opposite sides of the groove . the body 25 projects from the groove 22 outwardly beyond the stop element 15 and is there provided with an outer wall 29 , which may be externally convexly rounded , if desired . formed coextensively of and within the sensor body 25 , longitudinally thereof , is an internal hollow or passageway 30 . in the illustrated embodiment of fig2 the internal hollow 30 is of a rectangular internal cross section , but may be of other configuration , as will appear hereinafter . extending longitudinally along and within the hollow 30 of body 25 is a flexible , elongate inner member or body 31 . the inner body 31 may be longitudinally coextensive with the outer body , but not necessarily coextensive . however , it is advantageous that the inner body 31 , or length of inner body be located at each bend or turn of the outer body , for reasons which will presently become apparent . the cross sectional configuration of the inner body 31 is necessarily of a shape different from that of the internal hollow 30 of the outer body 25 , and of a cross sectional area or size less than that of the hollow . this assures the provision of openings or interstices , as at 32 , between the internal surface of hollow 30 and the external surface of inner body 31 . thus , even under circumstances of extreme pressure , bending or kinking of the assembled outer and inner bodies 25 and 31 , the internal hollow 30 is never completely closed or occluded , but by the aforesaid openings or interstices there remain fluid passageways in the hollow 30 communicating through and onto opposite sides of a kink , bend or pressure point . in fig3 is shown the condition of a severe bend of the hollow body 25 causing a constriction of the internal hollow 30 . however , the filamentary inner body 31 , being of a different external cross section from the internal cross section of the hollow 30 effectively assures one or more intersticial passageways 32 remaining between the outer and inner bodies . in practice , flexible wire stock , either insulated or noninsulated , has been found suitable for use as the inner body 31 . for example , round wire stock in a polygonal hollow has been found entirely satisfactory . completing the pressure change sensing system of fig1 is a fluid operated switch 35 suitably connected to energize an alarm 36 , or other desired device . the switch 35 may be seen in cross section in fig4 as including a hollow body or chamber 36 , and interiorly of the hollow body 36 a flexible wall , partition or diaphragm subdividing the interior into a pair of separate subchambers 38 and 39 . the hollow body or casing 36 may be plastic , or nonconducting , and the internal wall or diaphragm may be rubber or elastic , also nonconducting , and normally subdividing the casing interior into subchambers 38 and 39 of generally equal size . a pair of nipples 40 and 41 are provided on the hollow casing 36 each communicating into a respective subchamber 38 and 39 . a selectively adjustable needle valve 42 and 43 is provided on each side of the casing 36 for communication with respective subchambers 38 and 39 . the needle valves 42 and 43 may be identical , each including a hollow boss , as at 44 and 45 opening through a respective constriction 46 and 47 with the adjacent subchamber 38 and 39 . the hollow bosses 44 and 45 are each provided with ports 46 and 47 communicating between the interior and exterior of the respective boss ; and , externally threaded valve elements 48 and 49 extend from exteriorly of each respective boss 42 and 43 , in threaded engagement therethrough , into and toward the associated orifice 46 , 47 . thus , the threaded needle elements 48 and 49 are selectively adjustable toward and away from the apertures 46 and 47 to achieve the desired constriction thereof . centrally of the diaphragm may be a movable contact 50 connected to a conductor 51 extending exteriorly of the casing 36 . a central boss 52 may be provided on the casing 36 , having therein a threaded insert 53 extending between the interior and exterior of the casing . an elongate externally threaded conductive member 54 extends in threaded engagement through the insert 53 into the adjacent subchamber 39 . the insert 53 may be of conductive material , and a conductor 55 may extend from the insert 53 exteriorly of the casing 36 . thus , the threaded member or screw 54 combines with the contact 50 to define a complementary contact for engagement with the contact 50 to switch closed an electrical circuit . it will be appreciated that the diaphragm is illustrated in a distended condition , being normally substantially flat and spaced from the contact screw 54 . however , the illustrated closing of switch contacts 50 , 54 will occur either by an increase of pressure in subchamber 38 or a decrease in pressure in subchamber 39 , either of which will distend the diaphragm to the illustrated position . the switch contacts 50 and 54 will close momentarily upon a rise in pressure in subchamber 38 or a decrease in pressure in subchamber 39 ; and , upon the bleeding of excess pressure from subchamber 38 outwardly through port 46 or the bleeding of environmental pressure into subchamber 39 through port 47 , the diaphragm will be restored to its spaced condition from contact 54 . the length of momentary switch closure is predetermined by the constriction of orifice 46 and 47 by its respective needle element 48 and 49 . the alarm 36 in fig1 is shown as connected to electrical supply conduits 60 and 61 which , in turn , may be connected to an electrical power source . the switch 35 may be connected in one of the conductors 60 and 61 , say the latter , as by conductors 55 and 51 , to open and close the alarm 36 to electric power . in the illustrated embodiment of fig1 with the door 20 closed and in depressing engagement with the hollow sensor body 25 , the interior hollow 30 of the sensor body may be connected in fluid communication , as by tube 65 , with the switch 35 . that is , the sensor body 25 is connected in fluid communication with the pressure reduction or vacumn side ( subchamber 39 ) of the switch casing 36 . the door 20 in its closed condition effectively depresses or compresses the sensor body 25 ; and upon tampering which tends to relieve the compression by the slightest opening movement of the door , a pressure reduction or vacumn is transmitted from the sensor body 25 , through tubing 65 to subchamber 39 , which closes the switch contacts 50 , 54 momentarily , as illustrated in fig4 . of course , it is appreciated that the sensing of increased pressure requires only connection of the sensor body 25 through tubing 65 to nipple 40 of the subchamber 38 . in fig5 is shown a modification wherein a hollow flexible , elastic sensor body 25a is provided with an internal hollow or passageway 30a having an elongate , rectangular cross sectional configuration . this embodiment illustrates that a pair of flexible , filamentary inner bodies or wires 31a may be interposed in the hollow 30a . however , the essential requirements remain , that the cross sectional area of the inner body or bodies be less than that of the internal hollow ; and that the cross sectional shape of the internal bodies be different from that of the internal hollow . from the foregoing , it is seen that the present invention provides a pressure change sensor which is extremely simple in construction and operation , highly sensitive throughout a long useful life , and otherwise fully accomplishes its intended objects . although the present invention has been described in some detail by way of illustration and example for purposes of clarity of understanding , it is understood that certain changes and modifications may be made within the spirit of the invention .	4
embodiments of the present invention will now be described in detail with reference to the accompanying drawings . it should be noted that the present invention is not limited to these embodiments . fig1 shows a block diagram of an imaging apparatus , or a magnetic resonance imaging ( mri ) apparatus , which is an embodiment of the present invention . the configuration of the apparatus represents an embodiment of the apparatus in accordance with the present invention . the operation of the apparatus represents an embodiment of the method in accordance with the present invention . as shown in fig1 the present apparatus has a magnet system 100 . the magnet system 100 has a main magnetic field coil section 102 , a gradient coil section 106 and an rf ( radio frequency ) coil section 108 . these coil sections have a generally cylindrical shape and are concentrically disposed . an object to be imaged 300 is rested on a cradle 500 and carried into and out of the generally cylindrical internal space ( bore ) of the magnet system 100 by carrier means , which is not shown . the main magnetic field coil section 102 generates a static magnetic field in the internal space of the magnet system 100 . the direction of the static magnetic field is generally in parallel with the direction of the body axis of the object 300 . that is , a “ horizontal ” magnetic field is generated . the main magnetic field coil section 102 is made using a superconductive coil , for example . it will be easily recognized that the main magnetic field coil section 102 is not limited to the superconductive coil , but may be made using a normal conductive coil or the like . the gradient coil section 106 generates gradient magnetic fields for imparting gradients to the static magnetic field strength . the gradient magnetic fields to be generated are the following three : a slice gradient magnetic field , a readout gradient magnetic field and a phase encoding gradient magnetic field . the gradient coil section 106 has three gradient coils , which are not shown , corresponding to these three gradient magnetic fields . the rf coil section 108 generates a high frequency magnetic field for exciting spins within the object 300 in the static magnetic field space . the generation of the high frequency magnetic field will be sometimes referred to as transmission of an rf excitation signal hereinbelow . the rf coil section 108 also receives electromagnetic waves , i . e ., magnetic resonance signals , generated by the excited spins . the rf coil section 108 has transmitting and receiving coils , which are not shown . for the transmitting and receiving coils , the same coil or separate dedicated coils may be used . the gradient coil section 106 is connected with a gradient driving section 130 . the gradient driving section 130 supplies driving signals to the gradient coil section 106 to generate the gradient magnetic fields . the gradient driving section 130 has three driving circuits , which are not shown , corresponding to the three gradient coils in the gradient coil section 106 . the rf coil section 108 is connected with an rf driving section 140 . the rf driving section 140 supplies driving signals to the rf coil section 108 to transmit the rf excitation signal , thereby exciting the spins within the object 300 . the rf coil section 108 is connected with a data collecting section 150 . the data collecting section 150 gathers receive signals received by the rf coil section 108 , and collects the signals as view data . the gradient driving section 130 , rf driving section 140 and data collecting section 150 are connected with a control section 160 . the control section 160 controls the gradient driving section 130 , rf driving section 140 and data collecting section 150 to carry out imaging . the output of the data collecting section 150 is connected to a data processing section 170 . the data processing section 170 is , for example , constituted using a computer . the data processing section 170 has a memory , which is not shown . the memory stores programs for the data processing section 170 and several kinds of data . the function of the present apparatus is implemented by the data processing section 170 executing a program stored in the memory . the data processing section 170 stores the view data gathered from the data collecting section 150 into the memory . a data space is formed in the memory . the data space constitutes a two - dimensional fourier space . the two - dimensional fourier space is sometimes referred to as a k - space . the data processing section 170 performs a two - dimensional inverse fourier transformation on the data in the two - dimensional fourier space to produce ( reconstruct ) an image of the object 300 . the image reconstructed by the two - dimensional inverse fourier transformation has pixel values of a complex number . the absolute value of the complex number is used to construct an absolute - value image . the real part of the complex number can be used to construct a real - part image . the imaginary part of the complex number can be used to construct an imaginary - part image . both the real part and the imaginary part can be positive and negative values . such an image is sometimes referred to as a positive - negative image . the data processing section 170 has the function of performing image processing for determining the variance of pixel values with respect to a reconstructed image . the data processing section 170 also has the function of performing image processing for determining the variance of noise with respect to the reconstructed image . the data processing section 170 further has the function of performing image processing for adjusting the pixel values with respect to the reconstructed image . the data processing section 170 furthermore has the function of performing image processing for executing maximum intensity projection ( mip ) with respect to the image subjected to the pixel value adjustment . such image processing functions of the data processing section 170 will be described later . the data processing section 170 is an embodiment of the image processing apparatus of the present invention . the configuration of the apparatus represents an embodiment of the apparatus in accordance with the present invention . the operation of the apparatus represents an embodiment of the method in accordance with the present invention . the data processing section 170 is connected to the control section 160 . the data processing section 170 is above the control section 160 and controls it . the data processing section 170 is connected with a display section 180 and an operating section 190 . the display section 180 comprises a graphic display , etc . the operating section 190 comprises a keyboard , etc ., provided with a pointing device . the display section 180 displays the reconstructed image and several kinds of information output from the data processing section 170 . the operating section 190 is operated by a human operator , and the section 190 inputs several commands , information and so forth to the data processing section 170 . the operator interactively operates the present apparatus via the display section 180 and operating section 190 . [ 0080 ] fig2 is a block diagram of an mri apparatus of another type , which is one embodiment of the present invention . the configuration of the apparatus represents an embodiment of the apparatus in accordance with the present invention . the apparatus shown in fig2 has a magnet system 100 ′ of a type different from that in the apparatus shown in fig1 . since the apparatus has a configuration similar to that of the apparatus shown in fig1 except for the magnet system 100 ′, similar portions are designated by similar reference numerals and the explanation thereof will be omitted . the magnet system 100 ′ has a main magnetic field magnet section 102 ′, a gradient coil section 106 ′ and an rf coil section 108 ′. the main magnetic field magnet section 102 ′ and the coil sections each consists of a pair of members facing each other across a space . these sections have a generally disk - like shape and are disposed to have a common center axis . the object 300 is rested on the cradle 500 and carried into and out of the internal space ( bore ) of the magnet system 100 ′ by carrier means , which is not shown . the main magnetic field magnet section 102 ′ generates a static magnetic field in the internal space of the magnet system 100 ′. the direction of the static magnetic field is generally orthogonal to the direction of the body axis of the object 300 . that is , a “ vertical ” magnetic field is generated . the main magnetic field magnet section 102 ′ is made using a permanent magnet , for example . it will be easily recognized that the main magnetic field magnet section 102 ′ is not limited to a permanent magnet , but may be made using a super or normal conductive electromagnet or the like . the gradient coil section 106 ′ generates gradient magnetic fields for imparting gradients to the static magnetic field strength . the gradient magnetic fields to be generated are the following three : a slice gradient magnetic field , a readout gradient magnetic field and a phase encoding gradient magnetic field . the gradient coil section 106 ′ has three gradient coils , which are not shown , corresponding to these three gradient magnetic fields . the rf coil section 108 ′ transmits an rf excitation signal for exciting spins within the object 300 in the static magnetic field space . the rf coil section 108 ′ also receives magnetic resonance signals generated by the excited spins . the rf coil section 108 ′ has transmitting and receiving coils , which are not shown . for the transmitting and receiving coils , the same coil or separate dedicated coils may be used . [ 0086 ] fig3 shows a flow chart of the operation of the present apparatus . both the apparatuses shown in fig1 and 2 operate in the same way . as shown in fig3 blood flow imaging is performed at step 302 . for the blood flow imaging , a time - of - flight ( tof ) technique , phase contrast ( pc ) technique or the like is employed . moreover , the imaging is performed in multi - slice . thus , multi - slice blood flow tomographic images s 1 , s 2 , s 3 , . . . , sm are captured with respect to a three - dimensional region of the object 300 , as conceptually shown in fig4 . next , at step 304 , pixel value adjustment is performed on the blood flow tomographic images s 1 , s 2 , s 3 , . . . , sm . the pixel value adjustment is implemented by the data processing function of the data processing section 170 . the blood flow tomographic image will be referred to simply as an image hereinbelow . [ 0088 ] fig5 shows a detailed flow chart of the pixel value adjustment . as shown , slice selection is performed at step 502 . thus , one of the images s 1 , s 2 , s 3 , . . . , sm , for example , the image s 1 , is selected . next , at step 504 , calculation of the variance of noise is performed . the data processing section 170 that calculates the variance of noise at step 504 is an embodiment of the noise variance calculating means of the present invention . fig6 shows a detailed flow chart of the noise variance calculation . as shown , a local region is defined in an image at step 602 . the local region is a region to which a pixel value for use in a calculation at the next step belongs . a local region in a center of an image , for example , is defined as the first region . as the local region , an n × n pixel matrix is employed . n is 9 , for example . it should be noted that the matrix size is not limited to this value but may be any appropriate one . moreover , the pixel matrix is not limited to a square matrix but may be any appropriate region centered on a pixel . the local region will sometimes be referred to simply as a region hereinbelow . next , at step 604 , a residual sum of squares s of pixel values that belong to the region is determined . specifically , s = ∑ i k  ( p i - p _ i ) 2 , ( 1 ) p i is a pixel value , and { overscore ( p )} i is an average value of the pixel values in the n × n region centered on p i . moreover , k is , for example , 81 . next , at step 606 , a decision is made as to whether the above processes are finished for all the local regions , and if not , the local region is shifted at step 608 . thus , an adjacent n × n region , for example , is selected as a new local region . the process of step 604 is performed on the new local region to determine the residual sum of squares of pixel values . thereafter , a residual sum of squares of pixel values is determined for every local region in the image in a similar manner . the residual sums of squares thus obtained have a χ 2 distribution , and the average value thereof is κ · σ 2 . when k is large , the χ 2 distribution approximates to a gaussian distribution , and its peak position lies approximately at κ · σ 2 . next , at step 610 , a histogram of the residual sums of squares s is generated . [ 0098 ] fig7 shows the concept of the histogram of the residual sums of squares s when the image is an absolute - value image . as shown , the histogram consists of three distribution curves a , b and c . the distribution curve a is a gaussian distribution curve , resulting from noise in the uniform structure portion . the distribution curve b is a rayleigh distribution curve , resulting from noise in a portion of an fov ( field of view ) that does not contain the object 300 , i . e ., noise in a background . because the image is an absolute - value image , the distribution curve resulting from noise in the background does not conform to the gaussian distribution but to the rayleigh distribution . the distribution curve c results from the fine structure of the object , and exhibits an indeterminate distribution , unlike the two other curves . at step 612 , peak position detection is performed for such a histogram . thus , a peak position s 1 is detected for the gaussian distribution curve a , and a peak position s 2 is detected for the rayleigh distribution curve b . since the histogram has discrete values in practice , fitting to a function is preferably performed at step 612 prior to the peak detection , in that the peak positions can be detected with a good accuracy . the functions employed in the fitting are , for example , a gaussian distribution function and a rayleigh distribution function , respectively . however , the functions are not limited thereto but may be any other appropriate one . next , at step 614 , the variance of noise is calculated . the calculation of the variance of noise is performed based on the peak position s 1 or s 2 . since s 1 , s 2 and σ have respective relationships : s 2 = ( 2 - π 2 )  k · σ 2 , ( 3 ) the value of σ is determined from these relationships . the value of σ is the same whether it is determined from eq . ( 2 ) or from eq . ( 3 ). the determined value of σ is stored in the memory as the variance of noise vn . under some conditions of the distribution curve c , the peak position s 1 of the gaussian distribution curve a may not be accurately detected . in this case , the value of σ is determined based on the peak position s 2 of the rayleigh distribution curve b . moreover , with respect to an image having a larger proportion of the background portion area , the rayleigh distribution curve b is more suitable for determining the variance of noise with a good accuracy . while the preceding description is made for a case of an absolute - value image , when the image to be processed is a positive - negative image , i . e ., a real - part image or an imaginary - part image , noise in the background portion has positive and negative values centered on zero . accordingly , the histogram generated at step 610 becomes one as exemplarily shown in fig8 and it no longer has the rayleigh distribution . in this case , the variance of noise is determined based on the peak position s 1 of the gaussian distribution curve a at step 614 . a value of the variance of noise can thus be obtained directly based on an image that is actually captured . if the variance of noise is previously known , that variance may be used and the calculation may be omitted . after the variance of noise vn is thus determined , a pixel of interest is defined in the image at step 506 in the flow chart of fig5 . the first pixel of interest is , for example , a pixel in the center of the image . next , at step 508 , the variance of pixel values vi in a local region that contains the pixel of interest is calculated . the local region that contains the pixel of interest is , for example , a 5 × 5 matrix centered on the pixel of interest i , as shown in fig9 . it should be noted that the matrix size is not limited to this value but may be any appropriate one . moreover , the pixel matrix is not limited to a square matrix but may be any appropriate region centered on a pixel . the local region will sometimes be referred to simply as a region hereinbelow . the data processing section 170 that calculates the variance of pixel values vi at step 508 is an embodiment of the variance calculating means of the present invention . the following equation is employed for the calculation of the variance of pixel values vi : v i = ∑ i k  ( p i - p _ i ) 2 k , ( 4 ) next , at step 510 , a decision is made as to whether the variance of pixel values vi is significantly larger than the variance of noise vn . the decision is made using the following formula : for the value of the threshold γ , an appropriate value greater than one is employed . if the variance of pixel values in the local region that contains the pixel of interest is not significantly greater than the variance of noise , the image in the local region probably has no prominent structure , and the variance of pixel values probably originates from noise . hence , in this case , the pixel value of the pixel of interest is suppressed at step 512 . the suppression of the pixel value is achieved by , for example , multiplying the pixel value by a coefficient α . the value of the coefficient α is a positive number less than one , for example , 0 . 8 . thus , the pixel value of the pixel of interest is reduced by , for example , 0 . 8 times the original value . however , the value of the coefficient a is not limited to 0 . 8 but may be any appropriate one . moreover , the suppression of the pixel value may be achieved by , for example , subtracting a certain predefined value from the pixel value . it should be noted that the constant value does not exceed the minimum of the pixel values . if the variance of pixel values vi in the local region that contains the pixel of interest is significantly greater than the variance of noise vn , the image in the local region probably has a specific structure , such as an edge , and the variance of pixel values probably originates from the structure of the image . in this case , no special operation is applied to the pixel value . thus , the pixel value of the pixel of interest maintains its original value . the data processing section 170 that performs such pixel value adjustment is an embodiment of the pixel value adjusting means of the present invention . next , at step 514 , a decision is made as to whether the above processes are finished for all the pixels of interest , and if not , the pixel of interest is shifted to , for example , the adjacent one at step 516 , and the processes from step 508 are performed . thereafter , the same processes are repeated to adjust the pixel value for every pixel in the image s 1 . then , at step 518 , a decision is made as to whether the above processes are finished for all the slices , and if not , the slice is shifted at step 520 , and the same processes are performed on the image of that slice . thereafter , the same processes are repeated to perform the pixel value adjustment on the pixels in all the images s 1 - sm . between steps 508 and 510 , steps as shown in the flow chart of fig1 may be added . specifically , the variance of pixel values vi ′ is calculated for a local region that contains a corresponding pixel of interest in a neighboring slice at step 702 . the term ‘ neighboring slice ’ implies one or more slices adjoining the slice for which the variance of pixel values vi has been determined at step 508 . for such slices , a slice adjoining the front or the rear , or slices adjoining the front and rear may be employed , for example . at step 704 , the variance ( s ) of pixel values vi ′ is added to vi , and the added value is defined as a variance of pixel values vi for use in the decision at next step 510 . an appropriate weight may be applied to vi ′ in the addition . the data processing section 170 that calculates the variances of pixel values at step 702 is an embodiment of the pixel value variance calculating means of the present invention . the data processing section 170 that adds the variances of pixel values at step 704 is an embodiment of the adding means of the present invention . thus , a structure across a plurality of slices is reflected in the variance of pixel values vi obtained by the above processing . therefore , for example , if a blood flow image exists in a direction passing through slices , which image should appear as one point on one image , a variance of pixel values exactly reflecting such a structure can be obtained , and more exact pixel value adjustment can be achieved based on the variance . [ 0127 ] fig1 shows an effect of such pixel value adjustment as a change in a pixel value profile . the symbol b in fig1 denotes a profile before the pixel value adjustment , and there exist a distinct blood flow image b 1 and a faint blood flow image b 2 over background noise . as a result of the above - described pixel value adjustment , such a profile has pixel values of the background noise suppressed by , for example , 0 . 8 times while maintaining pixel values of the blood flow images b 1 and b 2 , resulting in a profile as shown at a in fig1 . in the profile a , the blood flow image b 2 which was faint in the original image exhibits an enlarged difference from the background noise and becomes distinct , not to mention the blood flow image b 1 . thus , elicitability of the blood flow image b 2 that was faint in the original image can be enhanced . [ 0129 ] fig1 shows another effect of the pixel value adjustment . the symbols p and q in fig1 denote profiles of two images of different slices , and the background noise level of the profile q is larger than the signal intensity of a distinct blood flow image b 1 in the profile p . by the aforementioned pixel value adjustment , such profiles have pixel values of the background noise suppressed by , for example , 0 . 8 times and therefore a profile can be obtained that has the noise level reduced relative to the signal intensity of the blood flow images b 1 and b 2 , as shown at q ′ in fig1 . thus , a difference of the blood flow images b 1 and b 2 from the noise level of the image of the slice q also becomes distinct , and both images can be elicited . [ 0131 ] fig1 shows a flow chart of another procedure of the pixel value adjustment . in fig1 , similar steps to those shown in fig5 are designated by similar reference numerals and the explanation thereof will be omitted . the difference between the procedures shown in fig5 and 13 is in pixel value processing after the decision at step 510 . specifically , if the variance of pixel values is significantly larger than the variance of noise in a local region that contains a pixel of interest , the pixel value of the pixel of interest is enhanced at step 512 ′. the enhancement of the pixel value is achieved by , for example , multiplying the pixel value by a coefficient β . the value of the coefficient β is a positive number greater than one , for example , 1 . 2 . thus , the pixel value of the pixel of interest is enlarged by , for example , 1 . 2 times the original value . it should be noted that the value of the coefficient β is not limited to 1 . 2 but may be any appropriate one . moreover , instead of multiplying by a coefficient , the enhancement of the pixel value may be achieved by , for example , adding a certain predefined value to the pixel value . if the variance of pixel values vi in the local region that contains the pixel of interest is not significantly greater than the variance of noise vn , no special operation is applied to the pixel value . thus , the pixel value of the pixel of interest maintains its original value . the data processing section 170 that performs such pixel value adjustment is an embodiment of the pixel value adjusting means of the present invention . [ 0134 ] fig1 shows an effect of such pixel value adjustment by a change in a profile of pixel values . as shown , blood flow images b 1 and b 2 in a profile before the pixel value adjustment will have enlarged pixel values as a result of the aforementioned pixel value adjustment , as shown by blood flow images b 1 ′ and b 2 ′. thus , the difference from the background noise is enlarged and elicitability is enhanced . [ 0135 ] fig1 shows another effect of the pixel value adjustment . the symbols p and q in fig1 denote profiles of two images of different slices . even when the background noise level of the profile q is larger than the signal intensity of a distinct blood flow image b 1 in the profile p , the pixel values of the blood flow images b 1 and b 2 in the profile p is enlarged by , for example , 1 . 2 times by the aforementioned pixel value adjustment , resulting in blood flow images b 1 ′ and b 2 ′. thus , the blood flow images b 1 ′ and b 2 ′ can also be elicited relative to the noise level of the image of the slice q . for the multi - slice images after the pixel adjustment as described above , maximum intensity projection ( mip ) is performed at step 306 in the flow chart of fig3 . the data processing section 170 that performs the maximum intensity projection at step 306 is an embodiment of the maximum intensity projecting means of the present invention . a program for a computer to implement the functions as described above is recorded on a recording medium in a computer - readable manner . for the recording medium , for example , any one of a magnetic recording medium , an optical recording medium , a magneto - optical recording medium and any other appropriate type of recording medium is employed . the recording medium may be a semiconductor storage medium . a storage medium is synonymous with a recording medium in the present specification . [ 0138 ] fig1 shows a conceptual diagram of the maximum intensity projection . as shown , the maximum of pixel values is extracted along a line of sight e passing through the multi - slice images s 1 - sm , and the extracted value is used as a pixel value for a projection image r . a number of lines of sight that is equal to the number of pixels in the projection image r are employed as the line of sight e . according to the pixel value adjustment as described above , since a difference between a blood flow image and noise is enhanced for every image s 1 - sm , even a faint blood flow image can be distinctly rendered without being obscured by noise . therefore , an mip image having a distinct blood flow image can be obtained even if the blood flow image is faint . such an mip image is displayed on the display section 180 at step 308 . the preceding description has been made on an example in which the image processing is performed by a data processing section in a magnetic resonance imaging apparatus ; however , it will be easily recognized that the image processing may be performed by a data processing apparatus separate from the magnetic resonance imaging apparatus , such as an ews ( engineering workstation ) or pc ( personal computer ). moreover , although the imaging apparatus has been described as being an mri apparatus , the imaging apparatus is not limited thereto but may be any other type of imaging apparatus , such as an x - ray ct ( computed tomography ) apparatus , an x - ray imaging apparatus , pet ( positron emission tomography ) or a γ - camera . furthermore , while the description has been made with reference to an example of processing a medical image , the object to be processed is not limited to a medical image , but image processing on a variety of images , such as a digital image captured by an optical instrument , can be performed . while the present invention has been described with reference to preferred embodiments hereinabove , various changes or substitutions may be made on these embodiments by those ordinarily skilled in the art pertinent to the present invention without departing from the scope of the present invention . therefore , the technical scope of the present invention encompasses not only those embodiments described above but all the embodiments that fall within the scope of the appended claims .	6
fig1 is a schematic view of a gas turbine engine 10 including a fan assembly 12 , a high - pressure compressor 14 , and a combustor 16 . engine 10 also includes a high - pressure turbine 18 and a low - pressure turbine 20 . a shaft 22 couples fan assembly 12 and turbine 20 . engine 10 has an intake side 24 and an exhaust side 26 . an engine casing 28 including an exterior surface 30 extends circumferentially around engine 10 . in one embodiment , gas turbine engine 10 is a ge90 engine commercially available from general electric company , cincinnati , ohio . engine 10 also includes a center longitudinal axis of symmetry 32 extending therethrough . in operation , air flows through fan assembly 12 and compressed air is supplied to high - pressure compressor 14 . highly compressed air is delivered to combustor 16 where it is mixed with fuel and ignited . hot gas / air mixture from combustor 16 propels turbines 18 and 20 , and turbine 20 rotates fan assembly 12 about axis 32 . fig2 is a partial cross - sectional view of combustor 16 , including a turbine nozzle 56 , of gas turbine engine 10 shown in fig1 . combustor 16 includes an annular outer liner 40 , an annular inner liner 42 , and a domed end 44 extending between outer and inner liners 40 and 42 , respectively . outer liner 40 is spaced radially inward from a combustor casing 46 and couples to inner liner 42 to define a generally annular combustion chamber 48 . combustor casing 46 is generally annular and extends downstream from a diffuser ( not shown ) positioned within domed end 44 . outer liner 40 and , combustor casing 46 define an outer passageway 52 , and inner liner 42 and an inner combustor casing 54 define an inner passageway 58 . inner liner 42 is spaced radially outward from inner combustor casing 54 . outer and inner liners 40 and 42 extend to a turbine nozzle 60 disposed downstream from diffuser . an annular turbine nozzle 56 is disposed radially inward from a casing internal wall 70 . combustor 16 is located upstream of nozzle 56 , and turbine blades 74 are located downstream from nozzle 56 . in one embodiment , engine 10 includes a plurality of nozzles 56 . nozzle 56 includes an arcuate outer band 80 ( shown in fig4 ), an arcuate inner shroud segment 82 , and a nozzle vane 84 mounted between outer band 80 and inner shroud segment 82 . nozzle vane 84 extends generally radially between outer band 80 and inner shroud segment 82 . fig3 is a perspective view of gas turbine casing assembly 54 including turbine nozzle assembly 56 . fig4 is an enlarged view of turbine nozzle 56 . fig5 is a side view of a nozzle lock 130 used with turbine nozzle 56 . outer band 80 includes a generally axially extending platform 92 including an upstream circumferential forward support flange 94 and a downstream circumferential aft rail 96 . aft rail 96 includes a radial outer portion 102 including a slot 100 therein . casing 28 includes a casing support channel 104 , a casing shoulder 106 , and a casing groove 108 . a turbine shroud forward rail 110 extends between aft rail 96 and casing groove 108 . in the exemplary embodiment , casing 28 also includes a first opening 120 and a second opening 124 that extend through casing 28 . more specifically , first opening 120 is radially outward of slot 100 , and a second opening 124 is adjacent and upstream from first opening 120 . forward support flange 94 engages casing support channel 104 to radially support outer band 80 . turbine shroud forward rail 110 radially supports aft rail 96 to casing shoulder 106 and facilitates minimizing leakage therebetween . nozzle lock 130 includes a locking pin 132 , a base 134 , and an attachment device 136 . in one embodiment , locking pin 132 is formed unitarily with base 134 . in a further embodiment base 134 includes a first aperture ( not shown ) sized to receive and fixedly retain locking pin 132 . base 134 includes a second aperture 142 for receiving attachment device 136 . in one embodiment , attachment device 136 is a blind bolt 148 including an insert 150 , and is inserted through a washer 146 . in another embodiment attachment device 136 is a rivet ( not shown ). nozzle lock 130 includes a seal 160 . in one embodiment , seal 160 is a metallic o - ring seal . locking pin 132 includes a substantially cylindrical body 164 and a tip 166 . body 164 extends substantially perpendicularly from base 134 such that tip 166 is a distance 167 from base 134 . in one embodiment nozzle lock 130 includes a plurality of locking pins 132 . fig6 is a cross - sectional view of nozzle lock 130 coupled to gas turbine engine 10 . nozzle lock 130 facilitates restricting tangential movement of nozzle 56 . base 134 is coupled to exterior surface 30 by attachment device 136 . seal 160 extends circumferentially around locking pin 132 to facilitate reducing or eliminating gas / air mixture leakage through exterior surface 30 . locking pin 132 extends through opening 120 ( shown in fig3 ) to radially engage aft rail slot 100 ( shown in fig3 ) to secure nozzle 56 to casing 28 . because nozzle 56 is secured to casing 28 , nozzle lock 130 facilitates maintaining a relative alignment of nozzle 56 within engine 10 despite nozzle 56 being subjected to tangential forces induced by the gas / air mixture . tip 166 is adapted to engage slot 100 . in an exemplary embodiment tip 166 is cylindrical . in other embodiments a shape of tip 166 is selected to satisfy system requirements while securing nozzle 56 in slot 100 , and includes , but is not limited to a square shape , a rectangular shape , or a crescent moon shape . attachment device 136 is coupled to base 134 and secures base 134 to casing 28 . attachment device 136 is inserted in second opening 124 ( shown in fig3 ) to secure base 134 to casing 28 . in an alternate embodiment attachment device 136 includes a circumferential split ring ( not shown ) that encircles turbine engine 10 and secures base 134 to casing 28 . during operation hot gas / air mixture from combustor 16 ( shown in fig1 ) is directed through nozzle 56 to turbine blades 74 ( shown in fig2 ) to rotate the turbine rotor ( not shown ). the combustion gas mixture may exert axial and tangential forces on nozzle 56 as nozzle 56 redirects the gas / air mixture . nozzle vane 84 ( shown in fig2 ) redirects the gas / air mixture to impinge on turbine blade 74 and impart a tangential force on nozzle 56 . outer band 80 and inner shroud segment 82 ( shown in fig2 ) support and position nozzle vane 84 . nozzle lock 130 secures outer band 80 to casing 28 and restrains tangential movement or flexing of nozzle 56 . base 134 is mounted to casing external surface 30 and seal 160 seals casing 28 . in one embodiment , nozzle lock 130 is installed during initial assembly . in an alternate embodiment , nozzle lock 130 is installed as an engine maintenance procedure after engine assembly . in a further embodiment , nozzle lock 130 supplements internal nozzle locks already installed on an engine , and as such , nozzle lock 130 is capable of being installed with or without a removal of other engine components . advantageously , nozzle lock 130 can be installed on an engine without disassembly of engine casing 28 or removal of engine 10 from its operating configuration , such as on an aircraft wing . in one embodiment a technician forms opening 120 in casing by drilling using standard machining techniques to maintain gas turbine cleanliness . the technician inserts locking pin 132 of nozzle lock 130 from casing exterior surface 28 through opening 120 to engage a portion of nozzle 56 . in one embodiment tip 166 engages slot 100 to secure nozzle 56 and restrict tangential movement of nozzle 56 . the technician secures nozzle lock 130 to engine casing 28 . in one embodiment the technician inserts bolt 148 through second aperture 142 ( shown in fig3 ) and into second opening 124 to secure nozzle lock 130 to casing exterior surface 28 . fig7 illustrates a first loading relationship between nozzle lock 164 and engine casing opening 120 with respect to attachment aperture 142 . fig8 illustrates a second loading relationship between nozzle lock 164 and engine casing opening 120 with respect to attachment aperture 142 . in the exemplary embodiment of fig7 a load applied to nozzle lock body 164 adjacent to nozzle outer band 80 ( shown in fig4 ) may result in unacceptably high stresses in nozzle lock 130 , if nozzle lock cylindrical body 164 is not in direct contact with case opening 120 . more specifically , fatigue failure of nozzle lock 130 may result from such loading . however , if nozzle lock cylindrical body 164 is in contact with case opening 120 stresses induced to nozzle lock 130 are facilitated to be reduced . unfortunately , due to necessary manufacturing tolerances , the above - described contact may not always be guaranteed . in the exemplary embodiment of fig8 a single attachment aperture 142 is formed in engine casing 28 with a position offset from the direction of load application . the resulting moment about aperture 142 may result in a slight physical rotation of nozzle lock assembly 130 until contact is made between nozzle lock cylindrical body 164 and case opening 120 , as shown in fig8 . this type of stress reducing , self - adjusting capability is possible because of two conditions that are present in this invention . more specifically , a first condition is that the attachment is statically unstable once clamping friction at aperture 142 is exceeded . the second such condition is that relative position of aperture 142 is not along a line of action of load application , thus resulting in a moment about aperture 142 and subsequent rotation . the above - described nozzle lock for a gas turbine engine is cost - effective and reliable . the nozzle lock secures the nozzle to the casing , thus facilitating maintaining the nozzles in alignment within the engine . furthermore , because the nozzles are secured in alignment , the nozzle lock also facilitates reducing the effects of tangential forces induced to the nozzles during engine operation . in addition , because the nozzle lock may be installed or removed from the engine without removing the engine casing , the nozzle lock also facilitates in - place engine maintenance . furthermore , the nozzle locks facilitate the nozzles self - aligning with respect to the load path during operation . as a result , the nozzle lock facilitates maintaining the nozzle in alignment in a cost - effective and reliable manner . while the invention has been described in terms of various specific embodiments , those skilled in the art will recognize that the invention can be practiced with modification within the spirit and scope of the claims .	5
fig1 is a top view of a grinding center embodied as a grinding cell 1 . this grinding cell has a common machine bed 2 on which are arranged two stations 3 , 4 for machining crankshafts 22 by grinding . the stations 3 , 4 have a common grinding table 5 on which holding apparatus and drives for each of the crankshafts 22 are present . the grinding cell also normally has a machine cover and loading and unloading apparatus for feeding in and removing the crankshafts 22 and for transporting them from the first station 3 to the second station 4 . these are not shown in fig1 , however , nor is the cnc control device with input keyboard or hydraulic and / or pneumatic supply devices shown . the first station 3 for the grinding cell 1 , which is depicted individually in fig2 , is for grinding the main bearings 23 of the crankshafts 22 . to promote understanding , the most important functional parts in the first station 3 therefore have “ main bearing ” added to their identifiers . the main bearings 23 ( fig4 ) are ground by means of a plurality of main bearing grinding wheels 10 that are arranged on a main bearing grinding spindle 9 . the main bearing grinding spindle 9 itself is attached to a main bearing compound slide rest 6 that can be moved , cnc controlled , in the z direction , which corresponds to the crankshaft longitudinal axis 29 , and in the x direction , which permits an adjustment perpendicular to the crankshaft longitudinal axis 29 . guide or slide tracks on which the main bearing compound slide rest 6 is moved in the z direction are not shown because they are covered by covers 16 . the crankshaft 22 to be machined is clamped between a main bearing workpiece headstock 7 and a main bearing tailstock 8 , as is shown in greater detail in fig4 , and in accordance with the depiction in fig2 is caused to rotate by the main bearing headstock 7 . at least two main bearings 23 on the crankshaft 22 are rough - ground or finish - ground simultaneously in the first station 3 , a time t 1 being required for this . the second station 4 in the grinding cell 1 , which is depicted individually in fig3 , is employed for machining the pin bearings 24 through 27 on the crankshaft 22 , two pin bearings 24 through 27 that are disposed in the same angular position with respect to the crankshaft longitudinal axis 29 being ground simultaneously . the time required for grinding all four pin bearings 24 through 27 is t 2 . to promote understanding , the most important functional parts of the second station 4 therefore have “ pin bearing ” added to their identifiers . the crankshaft 22 to be ground is also clamped centrally in the second station 4 , i . e . the common longitudinal axis of the clamping devices on both sides is the same as the longitudinal axis 29 of the crankshaft 22 , which is defined by its main bearings 23 . as can be seen from fig3 and 5 , in the second station 4 the crankshaft 22 is clamped at its exteriorly disposed main bearings 23 , which have been ground in the first station 3 . this produces a precise reference for the pin bearings 24 through 27 to the main bearings 23 of the crankshaft . in accordance with fig3 , pin bearing workpiece headstocks 12 , 13 are provided on both sides of the crankshaft 22 for clamping . the chucks 31 for these pin bearing workpiece headstocks 12 , 13 are provided with supports and each is driven by the c 1 or c 2 axis , which rotate absolutely synchronously . however , in the second station 4 the crankshaft 22 can also be received between tips and is then driven by a pin bearing workpiece headstock 12 , at least only on one side , the chuck of which is provided with floating clamping jaws 33 and effects an equalizing , radially no - clearance rotary drive . the crankshaft 22 is then aligned by centering it on the centering tips . the manner in which the crankshaft 22 is received in the second station can be varied and optimized according to the individual circumstances . in both stations 3 and 4 , the crankshaft 22 can be supported by one or a plurality of self - centering steadies . provided in the second station is a pin bearing compound slide 11 that can be moved in the direction of the axes z 2 and x 2 , which are perpendicular to one another , and thus can be moved parallel to the crankshaft longitudinal axis 29 and perpendicular thereto . the pin bearing compound slide 11 supports a first pin bearing grinding spindle 14 and a second pin bearing grinding spindle 15 . the first pin bearing grinding spindle 14 is securely connected hereby to the pin bearing compound slide 11 in the direction perpendicular to the crankshaft longitudinal axis 29 . in contrast , the second pin bearing grinding spindle 15 is arranged movable in the direction perpendicular to the crankshaft longitudinal axis 29 on the pin bearing compound slide 11 . its movement is controlled based on a dimensional or roundness error that is obtained from an in - process measurement during grinding . to this end , in - process measuring heads 19 for a measuring device 20 ( fig6 ) continuously measure the diameter of the pin bearings 24 , 27 or 25 , 26 , which are ground in pairs , during the grinding . each of the two pin bearing grinding spindles 14 , 15 supports a pin bearing grinding wheel 17 , 18 whose axial distance from one another must be equal to the distance between the pin bearings 14 through 17 that are to be ground in pairs . to this end , the two pin bearing grinding spindles 14 , 15 must be movable relative to one another axially on the pin bearing compound slide rest 11 , that is , in the direction of the rotational axis of their pin bearing grinding wheels 17 , 18 . the axial distance between the pin bearing grinding spindles and pin bearing grinding wheels must be adjusted every time a different type of crankshaft is to be ground or when a specific crankshaft that has a pair of pin bearings with a different distance between them is to be ground next . to this extent the change in the distance must be included in the entire control of the grinding process . the first pin bearing grinding spindle 14 or the second pin bearing grinding spindle 15 can be arranged displaceable in the direction of its longitudinal axis on the pin bearing compound slide rest 11 . fig5 , 11 and 12 provide a particularly clear depiction of the particularity of crankshafts 22 for four cylinder in - line engines : the two outer pin bearings 24 and 27 have the same angular position with respect to the rotational and longitudinal axis 29 of the crankshaft 22 , as do the two interior pin bearings 25 and 26 , the angular position of the two pairs of pin bearings 24 , 27 and 25 , 26 differing from one another . this attribute is used for operating the inventive grinding center in an economic manner . specifically , the two pin bearings 24 , 27 and 25 , 26 are each ground simultaneously using the two pin bearing grinding wheels 17 and 18 , the term “ simultaneously ” also having the same meaning as the grinding terms “ time - parallel ” or “ at the same time ”. in any case , what is meant is that the grinding process unfolds in approximately the same time , but not that it must be ended at exactly the same point in time . the second pin bearing is frequently not finish - ground until after the first pin bearing , in that e . g . a dressing amount of 0 . 02 mm is to be removed . fig6 depicts the arrangement of a measuring device 20 for continuously measuring the roundness and dimensions of a pin bearing in the second station 4 by means of a measuring head 19 . during grinding , the measuring head 19 is positioned against pin bearing 24 - 27 that is to be monitored and continuously generates signals regarding the dimensions and / or roundness of the pin bearing 24 - 27 , which signals are evaluated by the cnc control and used to generate control commands for the drives for the pin bearing compound slide 11 and / or the dimensions and roundness correction axis 44 . the position of the measuring device 20 indicated by the broken lines is a retracted position that the measuring device 20 assumes for instance during a dressing process and / or when the parts of the pin bearing grinding wheels 17 , 18 are being handled . fig7 depicts a schematic side elevation of the first station 3 in the grinding cell 1 in accordance with the section vii - vii in fig1 . at the beginning of the pin bearing grinding in the second station 4 , the mutual axial distance between the two pin bearing grinding wheels 17 , 18 is adjusted , for instance , to the distance between the pin bearings 24 and 27 . then grinding of these pin bearings 24 , 27 begins with the pin chasing method that is cnc controlled . for this , first the two pin bearing grinding spindles 14 , 15 are moved together perpendicular to the crankshaft longitudinal axis 29 . the second pin bearing grinding spindle 15 remains stationary relative to the pin bearing compound slide rest 11 . this applies both to the rough - grinding phase and the finish - grinding phase . however , the diameter just attained for each of the pin bearings 24 , 27 is measured during grinding and its roundness is determined . as the finished dimensions are neared in the finish - grinding phase , the movement by the second grinding spindle 15 is decoupled from that of the pin bearing compound slide rest 11 . the pin bearing compound slide rest 11 is moved according to the measurement on the pin bearing 24 in the sense of a dimension or roundness correction axis 44 , the final dimensions and the required roundness of the pin bearing 24 finally being attained by means of the first pin bearing grinding spindle 14 . the second pin bearing grinding spindle 27 simultaneously performs correction movements with respect to the pin bearing compound slide 11 according to the separate measurement on the pin bearing 27 if the measurements for the pin bearing 27 differ from those for the pin bearing 24 . these differences result from the continuous measurement for both pin bearings 24 and 27 . the computer for the machine control analyzes the measurement results and provides corresponding correction and control signals for the drive for the second pin bearing grinding spindle 15 . naturally , the second pin bearing grinding spindle 15 only needs to be slightly movable in the direction of the x axis with respect to the pin bearing compound slide rest 11 . an advantageous displacement path , in practice , can be , for instance , in the range of +/− 0 . 2 mm . the grinding center can be adjusted such that the grinding time t 1 is equal to the grinding time t 2 . two of the main bearings 23 are then ground in approximately the same time as a pair 24 , 27 or 25 , 26 of the pin bearings . then the pin bearing compound slide rest 11 is withdrawn , the distance between the two pin bearing grinding spindles 14 , 15 is adjusted to the distance between the center pin bearings 25 , 26 , and the grinding cycle starts over . fig8 provides a simplified schematic drawing of the first station in the grinding cell , in which drawing the main bearings 23 on the crankshaft 22 are undergoing multilayer grinding by means of main bearing grinding wheels 10 . in the first station 3 the main bearing grinding wheels 10 grind the main bearings 23 . if the planar surfaces of the cheeks of the crankshaft 22 that have the main bearing pins are to be ground , the spindle with the main bearing grinding wheels is moved axially relative to the crankshaft 22 . however , it is also possible for the crankshaft 22 to be moved along its rotational axis relative to the main grinding wheels 10 . a profiled grinding wheel 45 is arranged opposite the main bearing grinding wheels 10 on a spindle 46 that is inclined relative to the z axis , i . e . to the spindle axis of the main bearing grinding wheels 10 . the grinding wheel 45 is profiled such that and its angle to the z axis is arranged such that the flat end faces and also the cylindrical surfaces of the flange 47 on the crankshaft 22 can be ground simultaneously . the grinding wheel 45 can be adjusted along the adjusting axis x . fig9 is an elevation in accordance with fig8 in which , in contrast to the arrangement in accordance with fig8 , the profiled grinding wheel 45 with its spindle 46 is arranged on the same side of the crankshaft 22 as the main bearing grinding wheels 10 . the end - side surfaces 48 , specifically the flat end faces and the cylindrical surfaces of the flange , are ground in one work step using the profiled grinding wheel 45 , it being possible to adjust the profiled grinding wheel 45 along its adjusting axis x . in accordance with this embodiment , the main bearing grinding wheels 10 are arranged on a common spindle and grind the main bearings between the cheeks 49 of the crankshaft 22 . fig1 is a schematic elevation of the second station 4 of the grinding cell having a profiled grinding wheel 45 arranged opposite the pin bearing grinding wheels 17 , 18 for grinding the cylindrical and flat surfaces 48 of the flange 47 on the crankshaft 22 . the profiled grinding wheel 45 with its spindle 46 can be adjusted along its adjusting axis x and grinds the flange 47 in one work step . the profiled grinding wheel 45 is arranged opposite the pin bearing grinding wheels 17 , 18 in order to avoid any collision of the grinding wheels and in order to obtain simultaneous machining of the surfaces to be machined . the pin bearing grinding wheels 17 , 18 with their spindles 14 , 15 grind each pin bearing between the cheeks 49 using the pin chasing grinding method .	1
the hammer has an internal combustion engine 1 , which drives a striking mechanism 5 via a first crank drive 2 , a transmission 3 , and a second crank drive 4 . the striking mechanism 5 in turn acts on a tool 6 , in the present example a drill bit . many designs of a hammer of this type are known and therefore do not have to be explained in detail . the internal combustion engine 1 is surrounded by an engine housing 7 . the expression “ engine housing ” is selected comprehensively herein as an all - encompassing expression . of course , the engine housing 7 may also comprise a plurality of sub - housing components , that is to say for example a cylinder housing 7 a and a crank housing 7 b . the crank housing 7 b surrounds the first crank drive 2 . the transmission 3 is surrounded by a transmission housing 8 , which also receives the second crank drive 4 . the striking mechanism 5 is formed as a pneumatic spring striking mechanism and has a connecting rod 9 , which is moved by the second crank drive 4 and which moves a drive piston 10 up and down in a striking mechanism housing 11 serving as a guide housing . a percussion piston 12 is guided inside the drive piston 10 and moves against the end of the tool 6 and is guided back again via a pneumatic spring 13 formed between the drive piston 10 and the percussion piston 12 . the function of a striking tool 5 of this type is also known and does not have to be discussed in greater detail at this juncture . a cooling air fan 14 with a cooling air inlet 15 is arranged at the end face of the first crank drive 2 . the cooling air fan 14 is driven in rotation by the crankshaft of the first crank drive 2 and sucks up ambient air via the cooling air inlet 15 . the cooling air is then guided via a cooling air duct 16 to the components of the hammer to be cooled . in particular , the cooling air duct 16 guides the cooling air to an outer wall of the cylinder housing 7 a . the cooling air can then still be used to cool an exhaust gas system 17 or the striking mechanism housing 11 . the striking mechanism housing 11 should be cooled in particular in the region of the pneumatic spring 13 , because this is where high temperatures may prevail due to the air compression . a baffle plate 18 is provided inter alia to guide the cooling air flow generated by the cooling air fan 14 . in this regard , the design and cooling function with the aid of forced cooling of this type is known from the prior art . with the hammer according to the invention , a hood 19 is arranged in the upper region and surrounds the components to be cooled , at least in part . in the example shown , the hood 19 encloses part of the engine housing 7 and a considerable part of the transmission housing 8 in a tent - like manner . the striking mechanism housing 11 is not surrounded by the hood 19 . however , it is easily conceivable that the hood 19 could also extend further downwards so as to also enclose at least part of the striking mechanism housing 11 . the hood is arranged at a distance from the parts surrounded thereby so that a gap 20 is formed between the hood 19 and the housing components 7 , 8 . in the example shown in fig1 , it can be seen that the gap 20 , based on a vertical working direction of the hammer , has an inlet 21 in its lower side , said inlet initially extending vertically along the housing components 7 , 8 and ultimately discharging into a flue 22 . the flue 22 ends at an upper side of the hood 19 in the form of an opening 23 . if , during operation , the housing components 7 , 8 are heated , the air in the gap 20 is also heated . the air in the gap 20 thus flows upwardly and may ultimately emerge from the gap 20 via the opening 23 . the rising effect is intensified by the flue 22 , which can be seen clearly in particular in fig2 . due to the rising cooling air in the gap 20 , a vacuum is produced at the lower side at the inlet 21 , and therefore cool ambient air can flow into the gap 20 via the inlet 21 . a cooling air current caused by free convection is thus produced in the gap 20 and cools the outer side of the housing walls . the cooling air flow is also maintained if the operation of the hammer is abandoned and the internal combustion engine 1 is switched off . the engine components , transmission components , and striking mechanism components , which are still hot , also heat the air in the gap 20 , and therefore the cooling air flow is maintained . the flue 22 is conical , thus intensifying the flue effect . in addition , the flue is arranged on the upper side of the tent - like hood 19 at the highest point , more specifically both if the hammer stands in the vertical position provided for operation and if the hammer is put down and thus adopts a horizontal position . the flue 22 may also have an upwardly inclined course extending away from the operator . in addition , transverse ribs or transverse walls may be used in the flue 22 to stabilize the flue 22 . in this case , the opening 23 may be formed as a plurality of cooling slits , which are provided at the upper end of the flue 22 . the inlet in the flue 22 in the lower side thereof or at the transition between the gap 20 and the flue 22 can be rounded and conical so as to introduce the air current into the flue with as little resistance as possible . by contrast , the outlet in the flue 22 is formed in an angular manner at the opening 23 so that the air is prevented from flowing back into the flue 22 from the outside . this design may be advantageous in particular if the hood 19 is mounted in a resiliently movable manner in relation to the other components of the hammer . a resilient movability of this type is desired so as to achieve vibration insulation between the hood 19 , generally also carrying handles for the operator , and the rest of the hammer , which is subjected to intense vibration . it is known from de 20 2004 006 553 u1 that a pump effect can be produced between the hood and the rest of the components of the hammer due to the relative movement thus possible . this pump effect can also be used in the present case to assist the convection current and to superimpose an additional pump current . due to the described design of the flue , the pump current is conveyed in one direction , namely from bottom to top . an opposed current direction is prevented , and therefore the design of the flue achieves a similar effect to a check valve . for example , it has been found that suitable dimensions for the flue 22 include a length of the flue opening at the lower side of 90 mm and a width between 40 and 60 mm . at the upper side , the length may be 65 mm and the width may be between 20 and 35 mm . the height should be at least 25 mm . a flue height of up to 80 mm is particularly suitable . if the flue is inclined forwards in relation to the horizontal , the height may be 26 mm at the front side for example , and 77 mm at the rear side . a tank 24 , in which the fuel for the hammer is stored , is arranged above the hood 19 . other fuel - guiding components ( not illustrated in the figure ), such as a fuel valve , a fuel filter , etc ., can equally be arranged outside the hood 19 . the tank 24 is arranged at a distance above the hood 19 so that a further air gap 25 is formed between the hood 19 and the tank 24 . the air gap 25 causes additional thermal insulation , and therefore the tank 24 may be hardly heated by the hot components inside the hammer . in addition , a convection current similar to that in the gap 20 can be produced in the air gap 25 . for this purpose , the air gap 25 can be open towards the ambient environment via an inlet 26 and an outlet 27 . the inlet 26 and the outlet 27 may each extend as slits along the air gap 25 . the gap 25 runs in a u - shaped manner around the flue 22 at the outlet 27 , as shown in fig2 . the gap 20 extends laterally vertically from the housings 7 , 8 of the sub - components . the gap 20 rises at an incline towards the flue 22 above the housing components , in particular above the transmission housing 8 . the inclined rise of the gap 20 can also be seen clearly in fig2 . due to the course , inclined to a horizontal plane , above at least the transmission housing 8 , it is possible to achieve a reliable convection current , even in a region in which a substantially horizontal air current of the cooling air has to be provided , due to the at least slight rise as a result of the inclined position of the gap 20 . fig1 thus shows the inclined course of the gap 20 above the transmission housing 8 , whilst the inclined course of the gap 20 , corresponding to the upper side of the hood 19 , can be seen clearly in fig2 . the inclined course of the gap 20 above the transmission housing 8 has a further advantage , as will be explained hereinafter . according to experience , a hammer is switched off immediately once work is complete and is conventionally put down on the rear side . the side opposite the internal combustion engine in relation to the transmission 3 and the striking mechanism 5 is understood to mean the rear side , that is to say the right - hand side of the hood 19 in fig1 , which is not visible in fig2 . the hammer is normally held by an operator , standing on the rear side , by handles ( not illustrated in the figures ). when the hammer is put down on the rear side , the region of the gap 20 , which is provide above the transmission housing 8 in the working position , runs substantially vertically towards the then horizontally aligned flue 22 . an air current , which cools the components , is thus also produced in the gap 20 . the hammer can therefore also be cooled by free convection in the horizontal idle position . the tank 24 surrounds the flue 22 in a u - shaped manner , as shown in fig2 . the installation space can thus be utilized effectively . it is likewise possible to position the flue 22 slightly closer to the center , above the shaft of the tool 6 , and to arrange the tank 24 annularly around the flue 22 .	1
referring now to the drawings in which like numerals refer to like component parts , fig1 shows in side elevational view the important operational components of the insert cart and braking assembly of the present invention . a one piece clamping rod 10 has a cross - handle welded to the top thereof as indicated at 11a and 11b . clamping rod 10 extends downwardly through a clamping cam subassembly 20 and , at its lower end shown in fig2 rod 10 extends through an opening 61 in the insert cart base 60 . as shown , the rod 10 at its lower portion is not in contact with floor 5 thus being in the brake - off position . in the basic operation of the device , upper portions 11a and 11b are grasped by the operator and turned counterclockwise . rod 10 is driven downward by the action of floating compression spring 50 on the spring collar 53 and the lower portion of rod 10 thus contacts floor 5 where the insert cart is braked from further translational movement . it is to be understood that in the brake - on position , the cart can pivot about the point created by rod 10 and ground 5 by way of conventional roller casters 62 . as shown in fig3 the clamping rod 10 has two components rigidly attached thereto . the first attached component is a pivot pin 15 which passes through clamping rod 10 and is attached rigidly to it by means of set screws indicated at 16 . the second component rigidly attached to the clamping rod 10 is a spring collar 53 mounted by means of pin 54 . the purpose and function of both components will be more fully described hereinbelow . referring again to fig1 it can be understood that , as handles 11a and 11b are grasped and turned counterclockwise , pivot pin 15 follows the downwardly angled path formed by slot 30 which has been formed in the clamping cam assembly 20 . it is to be understood that a groove 32 and lip 33 construction is formed on the upper portion of slot 30 so that , once the pin 15 slides over lip 33 , the compression spring 50 strongly urges collar 53 and therefore the attached rod 10 downwardly into a braking position with floor 5 . pin 15 thus follows the path of slot 30 until it contacts a lower vertical wall 31 of the slot 30 where the pin 15 and its attached rod 10 are stopped from further movement . it is to be understood that slot 30 extends for a distance of approximately ninety degrees around the circumference of clamping cam 20 . it is contemplated that , in practice of the invention , the slope of slot 30 would be in the range of 25 - 55 degrees as measured from a horizontal plane . it should also be understood that a second slot 35 would be formed on the other side of clamping cam 20 . this second slot is indicated by dashed lines in fig1 and would be identical to slot 30 and receive the second end of pivot pin 15 , sbown in fig3 thus providing a more positive and durable clamping cam action . in viewing fig1 it can be seen that the clamping cam subassembly 20 has three sections or zones as a part thereof . a middle zone 22 has the slots 30 and 35 formed therein , said slots serving to guide the ends of pin 15 along the desired path and thereby permit compression spring 50 to force rod 10 into its downward or brake - on position . a lower reduced area zone 23 of the clamping cam subassembly 20 serves as a guide for rod 10 during its upward and downward operating motions . zone 23 by its reduced area also serves as an abutting surface for spring 50 . an upper zone 21 serves as a mounting section for the clamping cam cover plate 36 . in practice of the invention , cover plate 36 is welded to upper zone 21 . the clamping cam cover plate 36 is of importance to the overall invention since it serves in part to isolate the camming area from the operator of the cart , thus serving to reduce the likelihood of injury . cover plate 36 has an aperture 38 in a central portion thereof to allow passage and upward and downward motion of rod 10 . cover plate 36 also has four apertures 37 at its corners whereby the cover plate and the entire clamping cam subassembly 20 may be bolted or otherwise fixedly attached to the upper ends of four vertical sectional dividers 40 , said dividers 40 serving to provide four compartments for loading of newspaper inserts into the cart . two of the vertical dividers 40 are shown schematically in fig1 and the location of all four vertical dividers is shown in the top plan view of fig4 . the four apertures 37 are also shown in the plan view of fig4 . as can be seen in the views of fig1 and 4 , the vertical dividers 40 in combination with the bolted clamping cam cover plate 36 serve to completely isolate the clamping cam subassembly 20 and the moving pin 15 therein . such isolation of the camming assembly results in a system which is much less likely to result in injury to a person utilizing the cart for the simple reason that the operator &# 39 ; s hands , hair or loose clothing cannot be caught in the camming mechanism . to recapitulate the operation of the insert cart of the present invention , a cart loaded with newspaper inserts would be pushed to the desired work area with the clamping rod 10 in the brake - off position shown in fig1 and 2 i . e . pin 15 is resting in the groove 32 formed in slot 30 and also in slot 35 . upon reaching the desired point , handles 11a and 11b are grasped by the workman and turned counterclockwise thus slipping the pivot pin 15 ends over lips 33 . spring 50 , which is always under compression , then acts to force rod 10 downward into its floor 5 contacting brake - on position . as rod 10 is forced downward , ends of pin 15 move downwardly along slots 30 and 35 until said pin ends contact the lower slot walls as indicated at numeral 31 , thus stopping the downward motion of rod 10 . in the brake - on position , with rod 10 in contact with floor 5 , the cart is braked from translational movement ( for example , a rubber tip may be used on the end of rod 10 ) while still allowing cart rotational movement via casters 62 as desired by the person unloading the insert cart . from the foregoing , it can be realized by those of skill in the art that a reliable and durable , positive acting combined insert cart and brake assembly has been set forth by the applicant herein . the overall system also incorporates important safety features which greatly reduce the possibilities of injury and resultant products liability suits for users and manufactures of the device . while there has been illustrated and described what is at present considered to be a preferred embodiment of the present invention , it will be appreciated that numerous changes and modifications are likely to occur to those skilled in the art , and it is intended in the appended claims to cover all those changes and modifications which fall within the true spirit and scope of the present invention .	8
the preferred embodiments of the present invention and their advantages are best understood by referring to fig1 through 4 of the drawings . like numerals are used for like and corresponding parts of the various drawings . fig1 is a block diagram of a system 10 including a voltage detector 100 , a memory 106 , and a microprocessor 118 , according to an embodiment of the present invention . voltage detector 100 can be implemented on a single chip , is capable of detecting both power - on and low power conditions , can be programmed to detect a large number of threshold point values , and consumes a low amount of current . voltage detector 100 is connected to a power supply ( or supply voltage ) vdd and a ground gnd . voltage detector 100 is also connected to memory 106 , such as an electrically programmable read - only memory ( eeprom ), and microprocessor 118 . memory 106 stores a plurality of bits which correspond to and define a number of values for a threshold voltage that can be programmed in detector 100 . as used herein , the term “ threshold voltage ” refers to a value of supply voltage vdd which is less than its maximum value and at which supply voltage vdd may be considered to be at either a low power or power - off condition . for each threshold voltage value , a respective set of data bits may be provided in memory 106 . the plurality of bits are conveyed from memory 106 to a selectable threshold point circuit block 108 within voltage detector 100 via a plurality of control signals n . in one embodiment , a separate control signal may be provided to selectable threshold point circuit 108 for each bit of a bit set . the number of bits ( or control signals n ) determines the resolution of the programmable threshold voltage . the use of more data bits in each bit set will allow more values to be defined , and thus provide greater resolution . selectable threshold point block 108 is connected to a switch circuit at a node cc , a voltage following circuit board 107 at node aa , and to a memory 106 . selectable threshold point circuit block 108 generally functions to select one of a number of values for the threshold voltage at which supply voltage vdd is deemed to be at a low power or power - off condition . when the supply voltage vdd has a value lower than the selected threshold voltage value , then selectable threshold point circuit block 108 may pull the voltage at node cc up to the level of vdd . voltage following circuit block 107 is connected to supply voltage vdd , selectable threshold point circuit block 108 at a node aa , and a current source generator at a node bb . voltage following circuit block 107 follows or tracks supply voltage vdd . due to the operation of voltage following circuit board 107 , the voltage at node bb follows supply voltage vdd . current source generator block 110 is connected to node bb and supply voltage vdd . current source generator block 110 generally functions to generate a current which is provided to node bb . a switch circuit block 109 is connected to voltage following circuit block 107 and current source generator block 110 at node bb , and to selectable threshold voltage circuit block 108 at a node cc . switch circuit block 109 generally functions as a switch . when supply voltage vdd has a value greater then the selected threshold voltage , switch circuit block 109 pulls the voltage of node cc to ground . a voltage level detection circuit block 116 is connected to node cc and external microprocessor 118 . voltage level detection circuit block 116 generally functions to output a signal which indicates to microprocessor 118 whether the supply voltage vdd is at a low power condition or a power - on condition . this is further described herein . in operation , one of the bit sets stored in memory 106 is conveyed to selectable threshold point circuit block 108 via control signals n . the bit set essentially programs the selectable threshold point circuit 108 , thus selecting the threshold voltage value associated with that data bit set . from another perspective , the control signals define the magnitude of a pull - up current that flows from node cc through selectable threshold point circuit block 108 . voltage following circuit block 107 tracks the power supply voltage vdd and outputs a tracked voltage which appears at node bb , the input to switch circuit block 109 . the tracked voltage controls the magnitude of a pull - down current that flows from node cc through switch circuit block 109 . node cc functions as a detection node for the threshold point . when the magnitude of the voltage supply vdd is lower than the selected threshold point , the pull - down current flowing through switch circuit block 109 is less than the pull - up current flowing through selectable threshold point circuit block 108 . this pulls the voltage level of node cc to the voltage level of supply voltage vdd through selectable threshold point circuitry block 108 . the voltage level detection circuit block 116 detects this voltage value at node cc and , in response , outputs a signal which tracks the supply voltage vdd . this signifies that the value of supply voltage vdd is below the threshold point . when the magnitude of the voltage supply vdd is greater than the selected threshold point , the pull - down current flowing through switch circuit block 109 is greater than the pull - up current flowing through selectable threshold point circuit board 108 . this pulls the voltage level of node cc to ground through switch circuit block 109 . the voltage level detection circuit block 116 then detects this low voltage at node cc and , in response , outputs a driven and clearly defined low output to microprocessor 118 . this signifies that the value of the voltage supply vdd is above the threshold point . fig2 is a schematic diagram of a circuit implementation for voltage detector 100 of fig1 , according to an embodiment of the present invention . in particular , fig2 depicts a number of circuits which correspond to voltage following circuit block 107 , selectable threshold point circuit block 108 , switch circuit block 109 , current source generator block 110 , and voltage level detection circuit block 116 . voltage following circuit block 107 includes a weak nmos transistor 230 configured as a source follower . voltage following circuit block 107 functions to track supply voltage vdd . the gate terminal of transistor 230 is connected to supply voltage vdd . supply voltage vdd is provided by power source 204 , which can be a battery . the source terminal of transistor 230 is connected to node bb . the drain terminal of transistor 230 is connected to selectable threshold voltage point block 108 at node aa . selectable threshold point circuit block 108 includes a number of pmos current mirror transistors 232 , 234 , 236 , 238 , and 240 , which function as current mirrors , coupled to a number of nmos switch transistors 242 , 244 , 246 , and 248 , which function as switches . selectable threshold point circuit block 108 functions to precisely set the value of the threshold voltage . a pmos transistor 228 provides a reference for the current mirrors . the source and body terminals of current - reference transistor 228 are connected to supply voltage vdd . the gate and drain terminals of current - reference transistor 228 are connected to current - mirror - reference node aa . the gate terminals of current mirror transistors 232 , 234 , 236 , 238 , and 240 are connected to current mirror reference node aa . the source and body terminals of current mirror transistors 232 , 234 , 236 , 238 , and 240 are connected to supply voltage vdd . the drain terminal of current mirror transistor 232 is connected to node cc . the drain terminals of current mirror transistors 234 , 236 , 238 , and 240 are connected to the drain terminals of switch transistors 242 , 244 , 246 , and 248 , respectively . the source terminals of switch transistors 242 , 244 , 246 , and 248 are connected to node cc . the gate terminals of switch transistors 242 , 244 , 246 , and 248 are connected to memory 106 to receive control signals 208 , 210 , 212 and 214 , respectively , which are generated from bit sets in memory 106 . the selected value of the threshold voltage is determined by the amount of current which is allowed to flow from selectable threshold voltage circuit block 108 to node cc . if more current is allowed to flow , then the value selected for the threshold voltage will be higher . conversely , if less current is allowed to flow , then the value selected for the threshold voltage will be lower . in operation , when any of the control signals 208 , 210 , 212 and 214 have a logic high value , the respective switch transistor 242 , 244 , 246 , and / or 248 is turned on . this allows current to flow through the respective current mirror transistor 234 , 236 , 238 , and / or 240 to node cc . when any of control signals 208 , 210 , 212 and / or 214 have a logic low value , the respective switch transistor 242 , 244 , 246 , and / or 248 is turned off . this prevents current from flowing through the respective current mirror transistor 234 , 236 , 238 , and / or 240 to node cc . note that the current always flows through current - mirror transistor 232 to node cc since it is not controlled by a switch transistor . the amount of current conducted by each individual current mirror transistor 232 , 234 , 236 , 238 , and 240 is determined by its width to length ( w / l ) ratio . in one embodiment , current mirror transistors 232 , 234 , 236 , 238 , and 240 each have a different w / l ratio . thus , the total amount of current that flows to node cc from selectable threshold point circuit block 108 can be precisely set and controlled depending on which switch transistors 242 , 244 , 246 , and 248 have been turned on by respective control signals 208 , 210 , 212 and 214 ( according to a particular data bit set ). in one embodiment , switch transistors 242 , 244 , 246 , and 248 have w / l ratios of 5μ / 2μ . current - mirror reference transistor 228 and current - mirror transistor 232 have w / l ratios of 8μ / 4μ , current - mirror transistor 234 has a w / l ratio of 3μ / 4μ , current - mirror transistor 236 has a w / l ratio of 6μ / 4μ , current - mirror transistor 238 has a w / l ratio of 8μ / 4μ , and current - mirror transistor 240 has a w / l ratio of 10μ / 4μ . switch circuit block 109 includes a weak nmos transistor 112 . switch circuit block 109 allows node cc to be pulled up to the voltage level of supply voltage vdd or down to ground gnd depending on the amount of current being provided to node cc by selectable threshold point circuit block 108 and the value of the tracked supply voltage appearing at node bb . the gate terminal of transistor 112 is connected to node bb . the drain terminal of transistor 112 is connected to node cc . the source terminal of transistor 112 is connected to ground gnd . when the value of supply voltage vdd is above the selected value for the threshold voltage , transistor 112 is turned on , and the voltage at node cc is pulled low . current source generator block 110 includes an nmos transistor 250 ( which can be a depletion type transistor ), nmos transistors 252 and 254 , and a capacitor 256 . transistor 252 is configured as a diode - connected current reference transistor and transistor 254 is configured as a current mirror . the drain terminal of transistor 250 is connected to supply voltage vdd . the gate and source terminals transistor 250 , the gate and drain terminals of transistor 252 , and the gate terminal of transistor 254 are connected together at a node dd . the source terminals of transistors 252 and 254 as well as one terminal of capacitor 256 are connected to ground gnd . the other terminal of capacitor 256 and the drain terminal of transistor 254 are connected to node bb . the gate - source connected transistor 250 sets the current level passed to current reference transistor 252 . this current level is relatively constant and independent of voltage source 204 . in operation , transistor 250 provides current to current reference transistor 252 . this current is proportionately mirrored in current mirror transistor 254 . the mirrored current , acting against the pull - up current provided by pmos transistor 228 ( in the selectable threshold voltage circuit block 108 ) and weak nmos transistor 230 ( in the voltage - following circuitry block 107 ), sets the voltage at the node bb , that is , the gate voltage of weak transistor 112 ( in switch block 109 ). the voltage at node bb increases with an increasing power supply voltage vdd . capacitor 256 stabilizes the voltage at node bb . in one embodiment , nmos transistors 252 and 254 both have w / l ratios of 4μ / 4μ and capacitor 256 has a capacitance of 500ff . voltage level detection circuit block 116 includes pmos transistors 260 , 262 , and 264 , nmos transistors 266 , 268 , and 270 , and an inverter 272 . the source and body terminals of transistors 260 and 262 are connected to supply voltage vdd . the gate terminal of transistor 262 is connected to node cc . the drain terminal of transistor 262 is connected to the source terminal of transistor 264 and to the drain terminal of transistor 260 . the body terminal of transistor 264 is connected to supply voltage vdd . the gate terminal of transistor 264 is connected to node cc . the drain terminal of transistor 264 is connected to the drain terminal of transistor 266 and to the input terminal of inverter 272 . the gate terminal of transistor 266 is connected to node cc . the source terminal of transistor 266 is connected to the drain terminals of transistors 268 and 270 . the gate terminal of transistor 268 is connected to node cc . the source terminals of transistors 268 and 270 are connected to ground gnd . the gate terminals of transistor 270 and transistor 260 are connected to the output terminal of inverter 272 . the inverter 272 outputs an output signal 274 . transistors 262 , 264 , 266 , and 268 are connected as an inverter . this inverter , in combination with inverter 272 , forms a hysteresis circuit . transistors 260 and 270 provide a feedback loop . in one embodiment , transistor 268 has a w / l ratio of 10μ / 2μ , transistor 266 has a w / l ratio of 7μ / 1μ , and nmos transistor 270 has a w / l ratio of 12μ / 1μ . transistor 262 has a w / l ratio of 20μ / 2μ , transistor 264 has a w / l ratio of 15μ / 1μ , and transistor 260 has a w / l ratio of 24μ / 1μ . in operation , voltage level detection circuit block 116 monitors the voltage at node cc , which indicates when supply voltage vdd is less than or greater than the programmed threshold voltage . the threshold point for supply voltage vdd is reached when the pull - up current from the selectable threshold point circuit block 108 is equals the pull - down current in transistor 112 . if the magnitude of the supply voltage vdd is lower than the threshold point , the current flowing through selectable threshold point circuit block 108 pulls the voltage at node cc up to the level of vdd . this indicates a low power condition . in contrast , if the magnitude of the supply voltage vdd is greater than the threshold point , the current flowing through transistor 112 pulls the voltage at node cc to ground gnd . this indicates a sufficient / adequate power condition . the voltage at node cc is put through the hysteresis circuit ( consisting of two inverters ) and a feedback loop to sharpen the output signal and to prevent it from responding to small signal perturbations on the node cc at the threshold point . fig3 a - 3c are diagrams illustrating the response of the voltage detector of fig2 to a varying supply voltage input . fig3 a shows the magnitude of the supply voltage vdd and the magnitude of the voltage at node bb on the y - axis versus time on the x - axis . fig3 b shows the magnitude of the output signal 274 appearing at the output terminal of voltage detector 100 on the y - axis versus time on the x - axis when an exemplary threshold point b has been programmed . fig3 c shows the magnitude of the output signal 274 appearing at the output terminal of voltage detector 100 on the y - axis versus time on the x - axis when an exemplary threshold point a has been programmed . although fig3 b and 3c only shows the response for two programmed threshold points , threshold point a and threshold point b , skilled artisans will recognize that a large number of programmable threshold voltages can be precisely defined using selectable threshold point circuit block 108 . initially , as the level of supply voltage vdd increases from 0 . 0 volts , both the voltage at node bb and the voltage at the output terminal of voltage detector ( output signal 274 ) increase proportionally . when vdd exceeds the programmed threshold point ( approximately 2 . 5 volts for threshold point b and 4 . 3 volts for threshold point a ), the voltage at node bb increases proportionally , but the voltage at the output terminal of voltage detector 100 ( output signal 274 ) falls to approximately 0 . 0 volts . this signifies a power - on condition . as long as the magnitude of the supply voltage vdd is above the threshold point , the voltage at the output terminal of voltage detector 100 remains at approximately 0 . 0 volts . but , as the magnitude of supply voltage vdd decreases from 5 . 0 volts , the voltage at node bb decreases proportionally . when the magnitude of the supply voltage vdd decreases below the programmed threshold point ( approximately 2 . 5 volts for threshold point b and 4 . 3 volts for threshold point a ), the voltage at the output terminal of voltage detector 100 rises from 0 . 0 volts to the programmed threshold point . this indicates a low voltage condition . then as the magnitude of the supply voltage vdd continues to decrease , both the voltage at node bb and the voltage at the output terminal of voltage detector 100 decrease proportionally . fig4 is a schematic diagram of a current source generator block 210 , according to an embodiment of the present invention . current source generator block 210 can be used as an alternative to current source generator block 110 of fig2 . current source generator block 210 , like the current source generator block 110 , includes nmos transistor 250 , nmos transistors 252 and 254 , node dd , and capacitor 256 . current source generator block 210 further includes nmos transistors 300 , 302 , 304 , and 306 . nmos transistors 300 and 302 are connected in series , as are nmos transistors 304 and 306 . the source terminals of nmos transistors 302 and 306 are connected to ground gnd . the gate terminals of nmos transistors 302 and 306 are connected to node dd . the drain terminals of nmos transistors 300 and 304 are connected to node bb . the gate terminals of nmos transistors 300 and 304 are connected to receive control signals 308 and 310 , respectively . control signals 308 and 310 may be generated from data stored in memory 106 . transistor 252 functions as a current reference and each of transistors 254 , 302 , and 306 function as current mirrors . transistors 300 and 304 function as switches for current mirror transistors 302 and 306 , respectively . in operation , when any of control signals 308 or 310 have a logic high value , the respective switch transistor 300 and / or 304 is turned on . this allows current to flow through the respective current mirror transistor 302 and / or 306 to node bb . when any of control signals 308 or 310 have a logic low value , the respective switch transistor 300 and / or 304 is turned off . this prevents current from flowing through the respective current mirror 302 and / or 306 to node bb . while particular embodiments of the present invention and their advantages have been shown and described , it should be understood that various changes , substitutions , and alterations can be made therein without departing from the spirit and scope of the invention as defined by the appended claims .	6
referring initially to fig1 , a schematic diagram outlining the major processing zones of a poly ( vinyl acetal ) resin production facility 10 , configured according to one or more embodiments of the present invention , is provided . as shown in fig1 , facility 10 includes a reaction zone 20 , a wash zone 30 , a separation zone 40 , and a drying zone 50 . reactants , which typically include at least one poly ( vinyl alcohol ) and at least one aldehyde , are introduced into reaction zone 20 , along with a catalyst , and are reacted to form a slurry including a plurality of solid poly ( vinyl acetal ) resin particles . the slurry is introduced into wash zone 30 , wherein at least a portion of the particles are contacted with a wash liquid to remove contaminants and to further cool the slurry . the resulting cooled washed particle slurry is then introduced into separation zone 40 , wherein additional liquid is removed . the resulting solids - rich material can then be further dried in drying zone 50 to provide a plurality of dried resin particles . as shown in fig1 , spent wash liquid withdrawn from wash zone 30 and / or separation zone 40 may be filtered with one or more internal or external filtration devices in order to remove any residual solids . as shown in fig1 , one or more of the resulting solids - depleted and / or solids - enhanced streams can then be returned to one or more locations within the facility , upstream or downstream of the withdrawal point , for further recovery and / or use . although generally described herein with respect to the production and recovery of particles of poly ( vinyl acetal ) resin , it should also be understood that the systems and methods according to embodiments of the present invention can be utilized when producing one or more other types of polymers . for example , in some embodiments , the systems and processes described herein may be used to produce one or more thermoplastic polymers , such as , for example , polyurethanes ( pu ), poly ( ethylene - co - vinyl ) acetates ( eva ), polyvinyl chlorides ( pvc ), poly ( vinylchloride - co - methacrylate ), polyethylenes , polyolefins , ethylene acrylate ester copolymers , poly ( ethylene - co - butyl acrylate ), silicone elastomers , epoxy resins , polyvinyl alcohols , polyvinyl acetates , poly ( arylene sulfides ), cellulose esters , and acid copolymers such as ethylene / carboxylic acid copoloymers and ionomers thereof , derived from any of the previously - listed polymers , and combinations thereof . when facility 10 is used to produce particles of a poly ( vinyl acetal ) resin , two or more reaction components , such as , for example , an aldehyde and a poly ( vinyl alcohol ), may be added to a polymerization reactor ( not shown ) in reaction zone 20 via conduits 110 and 112 , as shown in fig1 . in some embodiments , at least one catalyst , such as , for example , an acid catalyst , may also be added to reaction zone 20 via conduit 114 , as shown in fig1 . although shown in separate conduits 110 , 112 , and 114 , one or more of the reaction components introduced into reaction zone 20 may be combined prior to entering the reaction zone , or one or more of the components may be added separately . additionally , the components may be added in any suitable order , or two or more may be added simultaneously . further , one or more of the components may be combined with or dissolved in one or more solvents including , but not limited to , water or another aqueous solvent , prior to , or within , reaction zone 20 . the aldehyde in conduit 112 can be any suitable aromatic or aliphatic aldehyde and , in some embodiments , may comprise at least one c 1 to c 10 aldehyde or at least one c 4 to c 8 aldehyde . the aldehyde may be introduced alone as a single aldehyde component , or may be combined with one or more other aldehydes before introduction into , or within , reaction zone 20 . examples of suitable c 4 to c 8 aldehydes can include , but are not limited to , n - butyraldehyde , iso - butyraldehyde , 2 - methylvaleraldehyde , n - hexyl aldehyde , 2 - ethylhexyl aldehyde , n - octyl aldehyde , and combinations thereof . in some embodiments , the aldehyde component may be selected from the group consisting of n - butyraldehyde , iso - butyraldehyde , 2 - methylvaleraldehyde , 2 - ethylhexyl aldehyde , and combinations thereof . in other embodiments , the aldehyde in conduit 112 can comprise one or more other aldehydes including , but not limited to , cinnamaldehyde , hexylcinnamaldehyde , benzaldehyde , hydrocinnamaldehyde , 4 - chlorobenzaldehyde , 4 - t - butylphenylacetaldehyde , propionaldehyde , 2 - phenylpropionaldehyde , and combinations thereof . in some embodiments , the aldehyde concentration of the stream in conduit 112 can be at least about 90 , at least about 95 , at least about 97 , at least about 99 weight percent , based on the total weight of the stream in conduit 112 . in some embodiments , the aldehyde concentration in the stream in conduit 112 can be in the range of from about 90 to about 99 . 9 , about 95 to about 99 , or about 99 to about 99 . 9 weight percent , with the balance being one or more other aldehydes or other impurities . in some embodiments , the concentration of poly ( vinyl ) alcohol in the reactant stream in conduit 110 can be at least about 5 , at least about 8 , at least about 10 weight percent and / or not more than about 30 , not more than about 20 , not more than about 18 , or not more than about 15 weight percent , based on the total weight of the stream in conduit 110 , with the balance being water or other solvent . the concentration of the poly ( vinyl alcohol ), or “ varnish ,” in conduit 110 can be in the range of from about 5 to about 30 , about 8 to about 20 , or about 10 to about 18 weight percent , based on the total weight of the stream . the weight ratio of aldehyde in stream 112 to poly ( vinyl alcohol ) in stream 110 added to reaction zone 20 can be at least about 0 . 10 : 1 , at least about 0 . 25 : 1 , at least about 0 . 50 : 1 and / or not more than about 2 : 1 , not more than about 1 . 5 : 1 , or not more than about 0 . 75 : 1 , or it can be in the range of from about 0 . 25 : 1 to about 1 . 5 : 1 or about 0 . 5 : 1 to about 0 . 75 : 1 . in reaction zone 20 , the temperature of the reaction can be at least about 5 , at least about 10 , at least about 15 , at least about 25 , at least about 40 , at least about 45 , at least about 50 , at least about 55 , at least about 60 , at least about 65 , at least about 70 , at least about 75 , at least about 80 and / or not more than about 105 , not more than about 100 , not more than about 95 , or not more than about 90 ° c ., or in the range of from about 5 to about 105 ° c ., from about 25 to about 100 ° c ., from about 40 to about 95 ° c ., or from about 50 to about 90 ° c . the reaction pressure can be at or near atmospheric pressure , and the residence time or average residence time may be varied as needed . details for various other parameters of the reaction are described in u . s . pat . nos . 2 , 282 , 057 and 2 , 282 , 026 and in vinyl acetal polymers , in encyclopedia of polymer science & amp ; technology , 3 rd edition , volume 8 , pages 381 - 399 , by b . e . wade ( 2003 ), the entire disclosures of which are incorporated herein by reference to the extent not inconsistent with the present disclosure . in some embodiments , the reaction performed in reaction zone 20 may be a batch reaction , while , in other embodiments , it can be semi - batch or continuous . further , the reaction may take place in a single reaction vessel , or it may be performed in two or more reaction vessels arranged in parallel or in series . the contents of the reactor may be agitated during the reaction and , in some embodiments , the reactor can be a continuous stirred tank reactor including at least one mechanical agitator . in some embodiments , the reactor may employ a high shear mixer as described in u . s . patent application no . 2010 / 0267921 , the entirety of which is incorporated by reference to the extent not inconsistent with the present disclosure . upon reaction of the poly ( vinyl alcohol ) and aldehyde in reaction zone 20 , the poly ( vinyl acetal ) resin particles precipitate out of solution and form a reaction slurry . as shown in fig1 , a stream of reaction slurry may be withdrawn from reaction zone 20 and passed to wash zone 30 via transfer conduit 116 . in some embodiments , the particle slurry withdrawn from reaction zone 20 can have a total solids content , on a dry weight basis , of at least about 5 , at least about 8 , at least about 10 , at least about 12 and / or not more than about 30 , not more than about 25 , not more than about 20 , or not more than about 18 weight percent , or in the range of from about 5 to about 30 , about 8 to about 25 , or about 10 to about 20 weight percent . as used herein , the term “ total solids content ” refers to the concentration , by weight , of solids in a given stream , based on the total weight of the stream . the dry weight of a slurry is measured by weighing the residue of a sample after complete evaporation of the liquid phase . all values provided herein for the total solids content of various streams are given on a dry weight basis , unless otherwise noted the average particle size of the poly ( vinyl acetal ) resin particles in the reaction slurry can be at least about 50 , at least about 60 , at least about 75 , at least about 80 microns , at least about 100 , at least about 150 , or at least about 200 microns and / or not more than about 1 , 000 , not more than about 800 , not more than about 700 , not more than about 600 , not more than about 500 , not more than about 400 microns , or in the range of from about 50 to about 1 , 000 , about 75 to about 500 or about 150 to about 400 microns , measured according to astm d1921 , method a . the particle slurry withdrawn from reaction zone 20 can be at or near the reaction temperature when passed to separation zone 30 . for example , the average temperature of the reaction slurry in conduit 116 can be at least about 5 , at least about 15 , at least about 25 , at least about 40 , at least about 45 , at least about 55 , at least about 55 , at least about 60 , at least about 65 , at least about 70 , at least about 75 , at least about 80 and / or not more than about 105 , not more than about 100 , not more than about 95 , not more than about 90 , not more than about 85 , or not more than about 75 ° c ., or it can be in the range of from about 5 to about 105 ° c ., from about 25 to about 100 , from about 40 to about 95 , or about 50 to about 90 ° c . in certain embodiments , facility 10 may include at least one precipitation device ( not shown ) located between reaction zone 20 and wash zone 30 . the precipitation device may be any device or vessel suitable for combining a solution of poly ( vinyl acetal ) polymer in a suitable solvent such as but not limited to methanol , ethanol , isopropanol etc . withdrawn from reaction zone 20 with water prior to introducing the resultant slurry into wash vessel 30 . according to some embodiments , such a device may be used when , for example , the slurry exiting reaction zone 20 may comprises at least one organic solvent in place of , or in addition to , water . according to some embodiments of the present invention , the particle slurry transported from reaction zone 20 to wash zone 30 via conduit 116 can optionally be combined with at least one dilution liquid , as shown by conduit 118 in fig1 , to provide a diluted reaction slurry in conduit 120 . any suitable amount of dilution liquid can be used and , in some embodiments , may be an amount sufficient to increase the mass flow rate of the reaction slurry in conduit 116 by at least about 5 , at least about 10 , at least about 20 , or at least about 30 percent . when a dilution liquid is added to the reaction slurry in conduit 116 , the ratio of the mass flow rate of the diluted reaction slurry in conduit 120 to the mass flow rate of the reaction slurry in conduit 116 can be at least about 1 . 1 : 1 , at least about 1 . 2 : 1 , at least about 1 . 5 : 1 and / or not more than about 5 : 1 , not more than about 3 : 1 , or not more than about 2 : 1 , or it can be in the range of from about 1 . 1 : 1 to about 5 : 1 , about 1 . 2 : 1 to about 3 : 1 , or about 1 . 5 : 1 to about 2 : 1 . the dilution liquid can be any liquid suitable for addition to the reaction slurry as described above . in some embodiments , the dilution liquid in conduit 118 can comprise water in an amount of at least about 25 , at least about 50 , at least about 75 , or at least about 90 weight percent . in some embodiments , the dilution liquid in conduit 118 can consist of water . the stream of dilution liquid may originate from one or more sources within or outside of facility 10 , shown in fig1 , and may or may not originate from the same source as the yet - to - be - discussed wash liquid introduced into wash zone 30 via conduit 122 . various embodiments of additional sources from which the dilution liquid may originate will be described in further detail shortly . upon combination with the dilution liquid in conduit 118 , the resulting diluted reaction slurry in conduit 120 can have a total solids content of at least about 0 . 5 , at least about 1 , at least about 2 , at least about 2 . 5 and / or not more than about 10 , not more than about 8 , not more than about 5 , or not more than about 3 weight percent , or it can be in the range of from about 0 . 5 to about 10 , about 1 to about 8 , or about 2 to about 5 weight percent . in some embodiments , the difference between the solids content of the reaction slurry in conduit 116 and the diluted reaction slurry in conduit 120 can be at least about 0 . 5 , at least about 1 , at least about 2 , at least about 5 , at least about 10 weight percent . as used herein , the phrase “ difference between ” refers to the mathematical difference between two given weight percentages , calculated by subtracting one number from the other . for example , the difference between a reaction slurry having a total solids content of 15 weight percent and a diluted reaction slurry having a total solids content of 10 weight percent is 5 weight percent ( 15 weight percent − 10 weight percent = 5 weight percent ). as used herein , the term “ different ” can mean higher or lower . in some embodiments , the solids concentration of the dilute reaction slurry in conduit 120 is lower than the solids concentration of the reaction slurry in conduit 116 . for example , the total solids concentration of the dilute reaction slurry in conduit 120 can be not more than about 90 , not more than about 75 , or not more than about 50 percent of the total solids content of the reaction slurry in conduit 116 . the temperature of the dilution liquid stream in conduit 118 can be similar to or different than the temperature of the reaction slurry in conduit 116 . in some embodiments , the dilution liquid stream in conduit 118 can be cooler than the reaction slurry in conduit 116 , such that , upon combination , the temperature of the reaction slurry is reduced . in other embodiments , the temperature of the dilution liquid in conduit 118 can be the same as or higher than the temperature of the reaction slurry in conduit 116 . the temperature of the dilution liquid in conduit 118 may be about 5 , at least about 8 , at least about 10 , at least about 12 , or at least about 15 ° c . different than the temperature of the reaction slurry in conduit 116 . in some embodiments , the temperature of the dilution liquid stream in conduit 118 can be at least about 20 , at least about 25 , at least about 30 , at least about 35 , at least about 40 and / or not more than about 70 , not more than about 60 , not more than about 50 , not more than about 45 , not more than about 40 , or not more than about 30 ° c . when the temperature of the reaction slurry in conduit 116 falls within the ranges described above , the resulting diluted slurry in conduit 120 can have a temperature of at least about 25 , at least about 30 , at least about 35 , at least about 40 and / or not more than about 70 , not more than about 65 , not more than about 60 , not more than about 55 , not more than about 50 ° c ., or it can be in the range of from about 25 to about 70 , about 30 to about 65 , or about 40 to about 60 ° c . this can , in some embodiments , represent a reduction in temperature of the reaction slurry in conduit 116 of at least about 5 , at least about 10 , at least about 15 , at least about 20 and / or not more than about 45 , not more than about 40 , not more than about 30 , or not more than about 25 ° c ., or by an amount in the range of from about 5 to about 45 , about 10 to about 40 , or about 15 to about 30 ° c . in other embodiments of the present invention , the reaction slurry in conduit 116 may be directly introduced into wash zone 30 without the addition of a dilution liquid in conduit 118 . according to such embodiments , the temperature of the reaction slurry introduced into wash zone 30 can be the same , or nearly the same , as the temperature of reaction slurry in conduit 116 described above , and the total solids content may also be within one or more of the ranges described previously . in some embodiments , facility 10 may be configured such that the dilution liquid in conduit 118 may be added on a non - continuous or as - needed basis , such that the dilution liquid in conduit 118 may be selectively added to the reaction slurry in conduit 116 . in addition to poly ( vinyl acetal ) resin particles and liquid , the reaction slurry and / or diluted reaction slurry may also include one or more other components that are typically undesirable when present in the final resin particles , especially in high concentrations . examples of these components can include , but are not limited to , residual catalyst , metal salts , unreacted materials , including aldehydes , reaction byproducts , and combinations thereof . in some embodiments , one or more of these additional components may be present in the reaction slurry and / or diluted reaction slurry in an amount of at least about 50 , at least about 100 , at least about 250 , at least about 500 , at least about 1000 and / or not more than about 15 , 000 , not more than about 12 , 500 , not more than about 10 , 000 , not more than about 7500 , not more than about 5000 , not more than about 2500 , or not more than about 1500 ppmw , or these could be present in an amount in the range of from 50 to about 15 , 000 , about 100 to about 10 , 000 , or about 500 to about 7500 parts per million by weight ( ppmw ). in many cases , failure to remove such components from the resin particles may result in increased operating inefficiencies during subsequent processing of the particles and / or defects in the final products , such as sheets or interlayers , formed with the dried resin particles . to remove these unwanted components from the poly ( vinyl acetal ) resin particles , the reaction slurry or diluted reaction slurry in conduit 120 can be introduced into a wash zone 30 , wherein at least a portion of the poly ( vinyl acetal ) resin particles may be contacted with at least one wash liquid . in some embodiments , the total amount of undesired components , including one or more of those listed above , present in the washed particle slurry removed from wash zone 30 via conduit 124 can be not more than about 1000 , not more than about 750 , not more than about 500 , not more than about 250 , not more than about 100 , not more than about 75 , not more than about 50 , or not more than about 20 ppmw . this can represent a reduction in unwanted components of at least about 50 , at least about 60 , at least about 70 , at least about 75 , at least about 85 , at least about 90 , at least about 95 percent , as compared to the slurry introduced into wash zone 30 via conduit 120 . the step of contacting the poly ( vinyl acetal ) resin particles with a wash liquid performed in wash zone 30 can be carried out in a batch , semi - batch , or continuous manner . the contacting may be performed in a single wash vessel , or in two or more wash vessels arranged in parallel or in series . in some embodiments , at least one of the reacting step performed in reaction zone 20 and the contacting step performed in wash zone 30 may be performed continuously , while the other step may be carried out in a batch or semi - batch manner . alternatively , both the reacting and contacting steps may be carried out in a batch or semi - batch manner , or both may be done continuously . the average residence time of the poly ( vinyl acetal ) resin particles within wash zone 30 can be , for example , at least about 15 , at least about 30 , at least about 60 , at least about 90 minutes and / or not more than about 360 , not more than about 300 , or not more than about 240 minutes , or it can be in the range of from about 30 to about 360 minutes , about 60 to about 300 minutes , or about 90 to about 240 minutes . as shown in fig1 , the wash liquid introduced into wash zone 30 via conduit 122 may originate from one or more sources within or outside of facility 10 . for example , in some embodiments , the wash liquid can comprise at least one liquid transported to facility 10 via conduit 121 , while , in some embodiments , all or a portion of the wash liquid in conduit 122 can originate from one or more locations within facility 10 , typically from locations at or downstream of wash zone 30 . in the embodiment shown in fig1 , portions of the wash liquid stream in conduit 122 may originate from yet - to - be - discussed filtered liquid streams in conduits 138 b and / or 146 removed from wash zone 30 and / or separation zone 40 . the wash liquid in conduit 122 can comprise any liquid suitable for contacting the poly ( vinyl acetal ) resin particles . in some embodiments , the wash liquid in conduit 122 can comprise or be water , and may include , for example , at least about 50 , at least about 60 , at least about 70 , at least about 80 , at least about 90 , at least about 95 weight percent water , based on the total weight of the liquid in conduit 122 . in some embodiments , the wash liquid may include other components , such as a neutralizing agent , in order to further reduce or remove one or more contaminants from the slurry . for example , when the slurry introduced into wash zone 30 has an acidic ph of not more than about 6 , not more than about 5 , not more than about 4 , not more than about 3 , or not more than about 2 , the wash liquid in conduit 122 may comprise a neutralizing agent having a ph of at least about 7 . 5 , at least about 8 , at least about 8 . 5 , or at least about 9 . alternatively , the wash liquid may have a ph of less than about 6 , less than about 5 , or less than about 4 , when the slurry has a basic ph greater than 8 . in some embodiments , the neutralizing agent may be added intermittently , such that the wash liquid stream in conduit 122 has an acidic or basic ph for only a portion of the contacting step performed in wash zone 30 . the wash liquid in conduit 122 may be substantially free of solids . for example , in some embodiments , the total solids content of the wash liquid in conduit 122 can be not more than about 0 . 05 , not more than about 0 . 01 , or not more than about 0 . 005 weight percent . if present , the solids in wash liquid 122 may have a smaller average particle size than the solids present in the slurry introduced into wash zone 30 and can , for example , have an average particle size of not more than about 50 , not more than about 40 , not more than about 30 , not more than about 20 , or not more than about 10 microns . the wash liquid can be at any suitable temperature and , in some embodiments , the temperature of the wash liquid in conduit 122 can be at least about 2 , at least about 5 , at least about 10 , at least about 15 , at least about 20 , at least about 25 , at least about 30 , at least about 35 and / or not more than about 90 , not more than about 85 , not more than about 80 , not more than about 75 , not more than about 65 , not more than about 50 , or not more than about 40 ° c ., or in the range of from about 2 to about 90 , about 15 to about 80 , or about 20 to about 75 ° c . depending on the origin of the wash liquid , the stream in conduit 122 ( and / or one or more streams contributing thereto ) may optionally be heated or cooled in one or more heat exchangers ( not shown in fig1 ) prior to being introduced into wash zone 30 . such heating or cooling may be performed via indirect heat exchange with one or more heat exchange fluids , such as , for example , cooling water , steam , or another process stream of higher or lower temperature , and / or it may be performed via direct heat exchange with steam or cooled or ice water . in addition to removing contaminants , the wash liquid may also reduce the temperature of the slurry in wash zone 30 . for example , in some embodiments , when contacted with the slurry , which can have a temperature within the ranges described previously , the wash liquid may reduce the temperature of the wash vessel contents by at least about 5 , at least about 10 , at least about 15 , at least about 20 , at least about 30 , or at least about 40 ° c . such a reduction may take place over a period of time of , for example , at least about 15 minutes , at least about 30 minutes , at least about 1 hour , at least about 2 hours , or at least about 3 hours . at the end of the contacting step , the washed particle slurry within wash zone 30 may have a temperature of not more than about 50 , not more than about 45 , not more than about 40 , not more than about 35 , not more than about 30 , or not more than about 25 ° c . in some embodiments , the wash liquid may be continuously introduced into wash zone 30 and one or more streams of spent wash liquid may be continuously removed from separation zone 30 as shown in fig1 . according to some embodiments of the present invention , facility 10 may further comprise one or more filtration devices configured to separate at least a portion of the poly ( vinyl acetal ) resin particles from at least a portion of the spent wash liquid within and / or removed from wash zone 30 . in some embodiments , one or more filtration devices , generally represented by filter element 60 in fig1 , may be located within one or more wash vessels ( not shown ) disposed within wash zone 30 . in the same or other embodiments , one or more filtration devices , generally represented by filter 62 in fig1 , may also be located external to the wash vessels and can be configured to filter at least a portion of the spent wash liquid and / or washed poly ( vinyl acetal ) resin slurry withdrawn from wash zone 30 via conduit 126 . specific embodiments of various filtration devices suitable for use in facility 10 will be discussed in detail shortly . when facility 10 includes at least one filter element 60 disposed within the interior of a wash vessel within wash zone 30 , at least a portion of the spent wash liquid can be passed through the filter elements before being removed from the vessel via conduit 125 . as a portion of the liquid within wash zone 30 is passed through the filter , at least a portion of the solid poly ( vinyl acetal ) resin particles can be retained within the interior of the vessel , thereby providing a solids - enriched retentate phase within the vessel and a solids - depleted permeate stream . the solids - depleted permeate stream , at least a portion of which may be withdrawn from the wash vessel as a stream of spent wash fluid in conduit 125 , may have total solids content lower than the solids - enriched retentate phase retained within the wash vessel and may also have a total solids content lower than the slurry introduced into the wash vessel in conduit 120 . in some embodiments , the spent wash liquid stream in conduit 125 may have a total solids content of at least about 0 . 001 , at least about 0 . 0025 , at least about 0 . 005 , at least about 0 . 010 , at least about 0 . 050 , at least about 0 . 10 and / or not more than about 10 , not more than about 8 , not more than about 5 , not more than about 4 , not more than about 3 , not more than about 2 , not more than about 1 , or not more than about 0 . 50 weight percent . the total solids content of the spent wash liquid stream in conduit 125 can be in the range of from about 0 . 001 to about 10 , about 0 . 005 to about 8 , or about 0 . 010 to about 5 weight percent . in some embodiments , the average particle size of the solid particles present in the solids - depleted permeate stream in conduit 125 can be smaller than the average particle size of the poly ( vinyl acetal ) resin particles in the slurry introduced into wash zone 30 . for example , the average particle size of the poly ( vinyl acetal ) resin particles present in the solids - depleted stream in conduit 125 can be not more than about 50 , not more than about 30 , not more than about 20 , not more than about 15 , not more than about 10 , or not more than about 5 microns , which may be at least about 30 , at least about 40 , at least about 50 , at least about 60 , or at least about 70 percent less than the average particle size of the poly ( vinyl acetal ) resin particles present in the slurry introduced into wash zone 30 in conduit 120 . in certain embodiments , a solids - containing stream withdrawn from wash zone 30 in conduit 126 may be introduced into at least one filter 62 located external to the wash vessel within wash zone 30 . filter 62 may be any suitable device for filtering at least a portion of the solids - containing stream and may include one or more filters , arranged in series or in parallel . each filter may further include one or more filtration elements . additional details regarding specific embodiments of suitable filters and filter elements will be discussed shortly . in some embodiments , the temperature of the solids - containing stream in conduit 126 passing through filter 62 can be at least about 25 , at least about 30 at least about 40 , at least about 45 , at least about 50 , at least about 55 , at least about 60 , or at least about 65 ° c . the total solids content of the stream in conduit 126 introduced into filter 62 can be at least about 5 , at least about 8 , at least about 10 , at least about 12 and / or not more than about 30 , not more than about 25 , not more than about 20 , or not more than about 18 weight percent , or in the range of from about 5 to about 30 , about 8 to about 25 , or about 10 to about 20 weight percent . as shown in fig1 , filter 62 may be configured to separate the solids - containing stream in conduit 126 into a solids - enriched retentate stream in conduit 132 and a solids - depleted permeate stream in conduit 134 . in some embodiments , the solids - enriched retentate stream in conduit 132 can include at least about 60 , at least about 65 , at least about 70 , at least about 75 , at least about 80 , at least about 85 , or at least about 90 percent of the total amount of solids present in the solids - containing stream introduced into filter 62 via in conduit 126 . the solids - depleted permeate stream in conduit 134 can comprise not more than about 40 , not more than about 35 , not more than about 30 , not more than about 25 , not more than about 20 , not more than about 15 , not more than about 10 , not more than about 5 , or not more than about 1 weight percent of the total amount of solids introduced into filter 62 in the solids - containing stream in conduit 126 . as it passes through filter 62 , the total solids content of the portion of the stream retained by the filter may be increased . for example , the total solids content of the retained phase may be increased by an amount of at least about 0 . 5 , at least about 1 , at least about 1 . 5 , or at least about 2 weight percent , such that the total solids content of the solids - enriched retentate stream in conduit 132 can be at least about 0 . 5 , at least about 1 , at least about 2 , at least about 4 weight percent , at least about 6 , at least about 8 , at least about 10 , at least about 12 weight percent and / or not more than about 30 , not more than about 25 , not more than about 20 , not more than about 18 , not more than about 15 , not more than about 12 weight percent . according to some embodiments , the difference between the total solids content of the solids - containing stream introduced into filter 62 and the solids - enriched retentate stream in conduit 132 can be at least about 0 . 5 , at least about 1 , at least about 2 and / or not more than about 10 , not more than about 8 , not more than about 5 , not more than about 3 , or not more than about 2 weight percent . as shown in fig1 , at least a portion of the solids - enriched retentate stream in conduit 132 can be recycled back to the process at a location at or downstream of wash zone 30 . in some embodiments , at least a portion of the solids - enriched retentate stream in conduit 132 can be returned to wash zone 30 via conduit 136 a , wherein it can be introduced directly into wash zone 30 via conduit 137 b , or it can be routed via conduit 137 a for combination with the slurry in conduit 120 prior to being introduced into wash zone 30 . in some embodiments , at least a portion of the solids - enriched retentate stream in conduit 136 b can be optionally combined with a washed particle slurry withdrawn from wash zone 30 in conduit 124 a and the combined stream may be introduced into separation zone 40 , as shown by conduit 139 . once returned to the process , the recovered poly ( vinyl acetal ) resin particles may be continued through the remaining process stages as described herein . the solids - depleted permeate stream in conduit 134 can have a total solids content less than the solids - containing stream introduced into filter 62 in conduit 126 and less than the solids - enriched retentate stream in conduit 132 . in some embodiments , the total solids content of the solids - depleted permeate stream in conduit 134 may be not more than about 1 , not more than about 0 . 5 , not more than about 0 . 1 , not more than about 0 . 05 , not more than about 0 . 01 , or not more than about 0 . 005 weight percent . as shown in fig1 , at least a portion of the solids - depleted permeate stream withdrawn from filter 62 in conduit 134 may be optionally combined with a spent wash fluid stream in conduit 125 , if present , and the combined stream can be returned to the facility 10 and reintroduced into the process at or upstream of wash zone 30 . in particular , in some embodiments , at least a portion of the permeate stream in conduit 125 and / or conduit 134 may be reintroduced directly into wash zone 30 for use as a wash liquid , as shown by conduit 138 a , or it may be combined with the wash liquid stream in conduit 122 , as shown by conduit 138 b . upon introduction into wash zone 30 , at least a portion of the recycled portion of the solids - depleted permeate stream may be used for contacting the poly ( vinyl acetal ) resin particle as described in detail previously . when all or a portion of the solids - depleted streams in conduit 125 and / or conduit 134 are recycled back to wash zone 30 , the flow rate of these recycled streams in conduits 138 a and / or 138 b can be substantially less than the fresh wash liquid in 122 . for example , in some embodiments , the flow rate of the wash liquid in conduit 122 can be at least about 25 , at least about 40 , at least about 50 , at least about 75 percent higher than the total flow rate of the spent wash liquid returned to wash zone 30 via conduits 138 a and 138 b . alternatively , all or a portion of the solids - depleted permeate stream in conduit 125 and / or the solids - depleted permeate stream in conduit 134 may be routed out of facility 10 for further storage and / or disposal , as shown by conduit 190 . turning now to fig2 , a reaction zone 20 and a wash zone 30 configured according to one or more embodiments of the present invention are shown as generally comprising a reaction vessel 220 , a wash vessel 230 , and a slurry transfer conduit 250 for transporting the reaction slurry from reaction vessel 220 to wash vessel 230 . additionally , the portion of the resin production facility shown in fig2 further comprises a dilution liquid conduit 252 for diluting at least a portion of the slurry in transfer conduit 250 , and two filtration devices 280 and 282 for respectively filtering solids from at least a portion of the washed particle slurry within the interior of and withdrawn from wash vessel 230 . in operation , one or more components introduced into reaction vessel 220 via conduit 260 may be reacted to form a solid particle slurry , as described above . the slurry may then be removed from reaction vessel 220 and passed to a wash vessel 230 via transfer conduit 250 . as shown in fig2 , transfer conduit 250 may comprise a first segment 250 a and a second segment 250 b , wherein the first segment 250 a is positioned between the slurry outlet of reaction vessel 220 and the point at which the dilution liquid in conduit 252 is introduced into transfer conduit 250 and the second segment 250 b is positioned between the point at which the dilution liquid in conduit 252 is introduced and the slurry inlet of the wash vessel 230 . in some embodiments , first segment 250 a may be positioned closer to the slurry outlet of reaction vessel 220 than to the slurry inlet of wash vessel 230 , such that the linear distance of first segment 250 a is less than the linear distance of second segment 250 b . as used herein , the term “ linear distance ” is the total distance traveled by the slurry in a given conduit and is calculated by adding the total length of straight pipe plus the equivalent length of any fittings , calculated according to standard conversion charts , for that conduit . in some embodiments , the linear distance of first segment 250 a of transfer conduit 250 can be at least about 10 , at least about 25 , at least about 35 , at least about 50 , at least about 65 , or at least about 75 percent less than the linear distance of second segment 250 b . in some embodiments , the diameter of second segment 250 b of transfer conduit 250 can be larger than the diameter of first segment 250 a . as a result , the average cross - sectional flow area of second segment 250 b of transfer conduit 250 may be at least about 10 , at least about 20 , at least about 25 , at least about 30 percent larger than the average cross - sectional flow area of first segment 250 a of transfer conduit 250 . the average velocity of the slurry passing through first and second segments 250 a , b of transfer conduit 250 can be similar or may be different from each other , although the average velocity in both segments 250 a , b may be at least about 8 , at least about 10 , at least about 12 feet per second ( ft / s ). in some embodiments , transfer conduit 250 may include one or more pressurization devices , such as , for example , a pump 240 , for increasing the pressure of the slurry , thereby maintaining sufficient pressure drop and adequate fluid velocity within transfer conduit 250 . as discussed previously , the dilution liquid in conduit 252 may originate from any suitable source , including a source within or outside of the facility . in some embodiments shown by dashed line 252 a , at least a portion of the dilution liquid in conduit 252 may originate from a different source than the wash liquid in conduit 262 introduced into wash vessel 230 , and / or at least a portion of the dilution liquid in conduit 252 may originate from the same source as the wash liquid , as shown by dashed line 252 b . prior to being introduced into transfer conduit 250 , the dilution liquid stream in conduit 252 may be passed through at least one heat exchange device , shown in fig2 as heat exchanger 246 , wherein the stream may be heated or cooled to a desired temperature via indirect heat exchange with at least one stream of heat exchange media . depending on the source of the dilution liquid and the availability of various streams , the heat exchange media used in heat exchanger 246 may be a dedicated heat exchange media , such as thermal heat transfer media or cooling water , or it may comprise all or a portion of one or more process streams within facility 10 . once combined with the dilution liquid , when present , the slurry in transfer conduit 250 may pass through at least one flow restriction device , shown in fig2 as control valve 242 , before being introduced into wash vessel 230 . the flow restriction device may be any device suitable for controlling or at least partially controlling the flow rate of the slurry between reaction vessel 220 and wash vessel 230 , and it may have an average cross - sectional flow area less than the average cross - sectional flow area of the transfer conduit adjacent to the flow restriction . for example , in some embodiments , the average cross - sectional flow area of the flow restriction may be at least about 10 , at least about 20 , at least about 30 , at least about 40 , at least about 50 , at least about 60 percent less than the average cross - sectional flow area of the transfer conduit adjacent to and on either side of the restriction . examples of suitable flow restrictions may include , but are not limited to , reduced port block valves , control valves , including automated control valves and manual control valves , orifice plates , and combinations thereof . although shown in fig2 as including a single flow restriction 242 , two or more flow restrictions , of the same or different types , may also be used depending on the specific configuration of the system . when the system shown in fig2 does not include a flow restriction , shown as control valve 242 in fig2 , the rate of discharge of the reaction slurry between reaction vessel 220 and wash vessel 230 may be quite rapid and , as a result , most poly ( vinyl acetal ) resin particles within reaction vessel 220 may have approximately the same residence time . as a result , the residence time distribution of the poly ( vinyl acetal ) resin particles may be very narrow and can approach a 6 function in the theoretical limit . in some embodiments , use of a flow restriction , shown in fig2 as flow control device 242 , may help control the flow rate of the poly ( vinyl acetal ) resin particle slurry from reaction vessel 220 to wash vessel 230 , thereby allowing the flow rate to be varied over a wider range . as a result , the residence time distribution of the poly ( vinyl acetal ) resin particles within reaction vessel 220 may be wider than if the flow restriction were not present . the breadth of the residence time distribution may depend , in part , on the flow rate of the reaction slurry discharged from reaction vessel 220 . addition of a dilution liquid via conduit 252 and / or washing of the poly ( vinyl acetal ) resin particles with a wash liquid via conduit 262 may help decelerate the reaction considerably within transfer line 250 and / or wash vessel 230 by reducing the effective concentration of the residual reactant and the catalytic species . as shown in fig2 , upon exiting flow restriction device 242 , the slurry may be directed into a slurry inlet of wash vessel 230 . upon introduction into wash vessel 230 , at least a portion of the solid particles may be contacted with a wash liquid added to vessel 230 via conduit 262 . in some embodiments , the wash liquid may be heated or cooled via indirect heat exchange with a heat transfer medium or via direct heat exchange with steam , cooled water , ice , or the like , as generally shown by exchanger 248 in fig2 , before being introduced into wash vessel 230 . additionally , as shown in fig2 , the wash liquid in conduit 262 may be introduced into wash vessel 230 in a counter - current manner , such that the solid and liquid phases are flowing in generally opposite directions . such counter - current operation may also be performed when wash zone 30 includes two or more wash vessels operated in series ( not shown ). in some embodiments , the contents of wash vessel 230 may be agitated during the contacting step with one or more agitators disposed within the interior of wash vessel 230 . the agitator or agitators , when present , may be centrally located , at or near the vertical center - line of the wash vessel , or one or more of the agitators may be off - center . additionally , one or more of the wash vessels may include baffles , or no baffles may be present . after contacting at least a portion of the solid particles with a wash liquid , at least a portion of the spent wash liquid may be withdrawn from wash vessel 230 via conduit 255 . in some embodiments , wash vessel 230 may include at least one internal filtration device , shown in fig2 as filter element 280 , disposed within the vessel for removing at least a portion of the solid particles from at least a portion of the spent wash liquid before the liquid is removed from the wash vessel 230 via conduit 255 . several embodiments of various internal filtration devices suitable for use in wash vessel 230 will be discussed in detail shortly . in some embodiments , the system shown in fig2 may include at least one external filtration device . as shown in fig2 , at least a portion of the contents of wash vessel 230 may be withdrawn via conduit 266 and may be passed through at least one external filtration device 282 to provide another solids - depleted permeate stream in conduit 256 a and a solids - enriched stream in conduit 270 . as shown in fig2 , the solids - depleted permeate stream withdrawn from filter 282 in conduit 256 a may optionally be combined with at least a portion of a spent wash liquid stream withdrawn from wash vessel 230 in conduit 255 , if present , and the combined stream in conduit 256 b may be routed for disposal via conduit 258 a or it may be combined with the wash liquid in conduit 262 via conduit 258 b and returned to wash vessel 230 . in some embodiments , all or a portion of the recycled liquid in conduit 258 b may be routed to and held in one or more intermediate hold tanks ( not shown ) for use in an upcoming wash cycle . at least a portion of the solids - enriched stream in conduit 270 may be routed to a downstream separation zone ( not shown ) via conduit 270 b , and / or , as shown in fig2 , at least a portion of the stream may be routed via conduit 270 a to be combined with the washed particle slurry withdrawn from reaction vessel 220 in conduit 250 b and the combined stream may be reintroduced into wash vessel 230 . alternatively , the stream in conduit 270 a may be directly returned to wash vessel 230 via one or more separate nozzles ( not shown ). although depicted in fig2 as including both internal and external filtration devices , it should be understood that systems configured according to various embodiments of the present invention may include at least one internal filtration device , at least one external filtration device , or at least one internal device and at least one external filtration device . when present , the internal and / or external filtration devices may be any suitable filtration devices configured to remove at least a portion of the solid particles from a liquid stream . internal and / or external filtration devices 280 , 282 may include any suitable number of filtration stages or filter elements , which , when two or more are present , may be operated in parallel or in series . any number of filter stages or elements may be used by or within the internal and / or external filtration devices and , in some embodiments , may number at least about 1 , at least about 2 , at least about 4 , at least about 8 , at least about 10 , at least about 12 and / or not more than about 50 , not more than about 40 , not more than about 30 , or not more than about 25 , or in the range of from about 1 to about 50 , about 2 to about 30 , or about 4 to about 25 . the filter elements utilized as or within the internal filtration device and / or external filtration device , when present , can be any suitable size . for example , in some embodiments , each filter element can have a total length , or longest dimension , of at least about 0 . 5 , at least about 1 , at least about 4 , at least about 6 feet and / or not more than about 40 , not more than about 30 , not more than about 20 , or not more than about 15 feet , or in the range of from about 0 . 5 to about 40 , about 1 to about 30 , or about 6 to about 15 feet . each filter element may be a single continuous element , or may comprise two or more elements coupled to one another such as , for example , via welding or other suitable technique . the inner diameter of one or more filter elements can be at least about 0 . 10 , at least about 0 . 25 , at least about 0 . 50 , at least about 1 , at least about 2 , at least about 4 , at least about 6 , at least about 8 , at least about 12 and / or not more than about 24 , not more than about 18 , not more than about 12 , not more than about 8 , not more than about 6 , not more than about 2 , not more than about 1 . 5 inches , or not more than about 1 inch , or in the range of from about 0 . 10 to about 24 , about 2 to about 18 , or about 4 to about 12 inches . according to some embodiments , at least one filter element may have a nominal filter rating of at least about 0 . 1 , at least about 0 . 50 , at least about 1 , at least about 2 and / or not more than about 50 , not more than about 30 , not more than about 25 , or not more than about 20 microns , or a rating in the range of from about 0 . 1 to about 50 , about 0 . 5 to about 30 , about 1 to about 25 , or about 2 to about 20 microns . the filter elements may be formed from any suitable material of construction including , but not limited to , stainless steel alloys , such as ss304l and ss316l , titanium , corrosion - resistant nickel and nickel alloys . ideally , each filter element is formed from a material non - reactive with the feed passing therethrough . in some embodiments , one or more of the filter elements may be made of a non - metallic material , such as ceramics , glass , and the like . whether used within internal or external filtration devices 280 or 282 , the filter elements can be mounted in any suitable manner and may , in some embodiments , comprise multiple layer filter elements secured with a mounting frame , a back plate , a mesh screen , and optional retainer bracket ( not shown ). in some embodiments , the mesh screen may be formed from one or more of the metallic materials listed above , or it may be formed from a filter cloth comprising , for example , monofilament polypropylene fabric . the filter elements utilized by filters 280 and / or 282 , when present , may be configured to minimize agglomeration and plugging of the filter surface , such that fouling of the filtration device is minimized during operation of the system . for example , in some embodiments , one or more of the filter elements utilized by filtration devices 280 and / or 282 may be backwashed filter elements . when one or more elements are backwashed , any suitable back wash fluid may be used . examples of suitable fluids can include , but are not limited to , pressurized air , nitrogen , and other inert gases . the backwash pressure and intervals are not particularly limited and can be selected to minimize agglomeration of the solid resin particles at the filter surface . in some embodiments , one or more of the filter elements are self - cleaning and are not backwashed elements . whether back - washed or self - cleaning , filter elements configured according to embodiments of the present invention can retain a substantially constant permeate flux during the operation of the filter . for example , in some embodiments , after a continuous operating period of at least about 30 minutes , at least about 1 hour , or at least about 2 hours , the average permeate flux through a specified filter element can within about 25 , within about 20 , within about 15 , or within about 10 percent of the average permeate flux at the beginning of the continuous operating period . according to some embodiments , the average permeate flux across the surface one or more filter elements employed in devices 280 and / or 282 can be at least about 0 . 10 , at least about 0 . 20 , at least about 0 . 25 , at least about 0 . 30 , or at least about 0 . 40 gallons per minute per square foot of filter surface ( gpm / ft 2 ). in some embodiments , the internal and / or external filtration devices may include one or more cross - flow filter elements . unlike dead - end filter elements , which permit the slurry being filtered to pass generally perpendicularly through the filter surface , cross - flow filter elements can be configured to permit the feed slurry to pass over a significant portion of the filter surface as a portion of the liquid phase passes through the filter element with minimal or no wet cake accumulating on the filter media surface . as a result , the cross - flow filter elements can be configured to concentrate solids in the retentate phase , thereby providing a solids - depleted permeate phase and a solids - enriched retentate phase . in some embodiments , the solids - enriched retentate stream has a concentration of solids that is not more than about 10 , not more than about 8 , not more than about 5 , not more than about 3 , or not more than about 2 weight percent different than the concentration of solids in the feed stream introduced into the filter . further , unlike most dead - end filtration devices , cross - flow filter elements may be operated in a continuous manner . in one embodiment , cross flow filter elements inside the wash vessel elements may be positioned along , or integrated into , one or more of the internal side walls or bottom wall of wash vessel 230 . as shown in fig2 , when wash vessel 230 includes one or more internal filter elements , the elements may be positioned along , or integrated into , one or more of the internal side walls or bottom wall of wash vessel 230 . in some embodiments , at least one of the internal filter elements can be positioned at or near one or more outlet nozzles ( not shown ) of wash vessel 230 . any suitable type of filter may be used as an internal filtration device and , in some embodiments , the internal filtration device disposed within wash vessel 230 may include at least one filter device selected from the group consisting of screen filters , candle filters , pressure leaf filters , and combinations thereof . in some embodiments , generally depicted in fig3 a and 3 b , wash vessel 230 can include a plurality of screen filters 380 disposed along the inner wall of vessel 230 . as shown in fig3 a and 3 b , screen filters 380 may be disposed between the interior volume 386 of wash vessel 230 and one or more outlet nozzles 390 disposed at various locations along the outer wall of vessel 230 . in some embodiments , one or more of the outer nozzles 390 may be located in the bottom one - half , bottom one - third , or bottom one - fourth of the vertical dimension of one or more of the filter elements . in other embodiments , generally shown in fig3 c and 3 d , wash vessel 230 can include a plurality of candle filters 380 spaced from one another within the interior of vessel 230 . similarly , candle filters 380 shown in fig3 c and 3 d may also be positioned between the interior of wash vessel 230 and one or more fluid outlets ( not shown ). when wash vessel 230 includes two or more internal filter elements , the elements can be spaced apart from one another within the interior of the vessel 230 . in the elements can be circumferentially spaced from one another , radially spaced from one another , and / or vertically spaced from one another . as used herein , the term “ circumferentially spaced ” refers to two elements that are spaced from each other along the inner perimeter of the vessel . an example of two circumferentially - spaced elements 480 a and 480 b located within the interior of a wash vessel 330 is schematically depicted in fig4 a . as used herein , the term “ radially spaced ” refers to two elements that are spaced from each other along a vessel radius ( r ) that extends from the vessel center line ( cl ) to the outer wall of the vessel . one example of two radially - spaced elements 480 c and 480 d within a wash vessel 330 is shown in fig4 b . as used herein , the term “ vertically spaced ” refers to two elements spaced from one another along the vertical centerline ( cl ) of the wash vessel . one example of two vertically - spaced elements 480 e and 480 f disposed within the interior of wash vessel 330 is schematically depicted in fig4 c . when more than two interior filter elements are utilized , each of the elements can be circumferentially , radially , and / or vertically spaced from one another within the interior of the vessel and may be operated in series or in parallel . additionally , as shown in fig3 a - 3 d , wash vessel 230 can include at least one agitation device 384 for agitating the contents of wash vessel 230 . the agitator may be any suitable type of mechanical agitation device can include one or more impellers 392 a , b for imparting shear force and velocity to the surrounding fluid . at least a portion of the contacting step performed in wash vessel 230 can include agitating the slurry within the wash vessel and passing at least a portion of the agitated slurry across the surface of the filter element or elements . in some embodiments , the portion of the slurry passed or flowing across the face of the filtration element within vessel 230 may do so at an average cross - flow velocity of at least about 0 . 5 , at least about 1 , at least about 2 , at least about 5 , at least about 8 , at least about 10 feet per second ( ft / s ) and / or not more than about 20 , not more than about 15 , or not more than about 12 ft / s . in some embodiments , the average cross - flow velocity can be in the range of from about 0 . 5 to about 30 , about 1 to about 15 , or about 2 to about 12 ft / s . in contrast , many dead - end filtration devices have an average cross - flow velocity near 0 ft / s . examples of dead - end filtration devices can include , but are not limited to vacuum belt filters , rotary drum filters , rotary vacuum filters , belt filters , and combinations thereof . in some embodiments , the pressure drop across the filter surface of filter element 280 may be substantially less than the pressure drop across conventional filtration devices . for example , the average cross - membrane pressure drop across the filter surface during the passing step can be not more than about 10 , not more than about 8 , not more than about 5 , not more than about 3 , or not more than about 2 pounds per square inch per square foot of filter surface ( psi / ft 2 ). such a pressure drop may be achieved in combination with the average - cross flow velocity and permeate flux described herein . referring again to fig2 , the external filtration device , shown as filter 282 , can be any device suitable for filtering a portion of the spent wash liquid withdrawn from wash vessel 230 as described previously . external filtration device 282 can include a single stage filtration device , or it may include a multiple stage filtration device having two or more filter stages arranged in series or in parallel . in some embodiments , two or more of the filter elements used in external filtration device may be the same , while , in other embodiments , one or more elements may be different . the filter elements may include one or more of the elements described herein . the velocity of the feed introduced into at least one of the filter elements of the external filtration device 282 can be at least about 2 , at least about 5 , at least about 7 , or at least about 10 ft / s and / or not more than about 35 , not more than about 30 , not more than about 25 , or not more than about 20 ft / s . in some embodiments , one or more filter elements employed by filter 282 may be cross - flow filter elements and / or one or more may be a dead - end filter element or device . in some embodiments , none of the filter elements in filter 282 may be dead - end filter elements or filtration devices . turning now to fig5 , one example of a suitable external filtration device for use with the system shown in fig2 is provided . as shown in fig5 , the filtration device includes a plurality of individual filters 582 a - d , arranged in parallel and in series . in the embodiment shown in fig5 , a solids - containing liquid stream in conduit 526 is divided into two portions in conduit 526 a and 526 b . the solids - containing liquid stream in conduit 526 can be withdrawn from a wash vessel similar to wash vessel 230 , as shown in fig2 , and can have a total solids content similar to the total solids content of the solids - containing stream in conduit 126 described above with respect to fig1 . as shown in fig5 , the first and second portions of the solids - containing stream in conduits 526 a and 526 b are passed through two parallel sets of individual filtration devices 582 a , b and 582 c , d , which are each arranged in series . each of filtration devices 582 a - d are shown in fig5 as comprising cross - flow filtration devices , which are configured to remove a portion of the liquid phase as a solids - depleted permeate stream and to concentrate the solids into a solids - enriched retentate stream . as generally shown in fig5 , the feed stream passing through each of filtration device 582 a - d passes in a direction generally parallel to the filter surface 583 a - d . this is in contrast to most dead - end filters , which permit the steam being filtered to pass through the filter in a direction generally perpendicular to the filter surface . as shown in fig5 , the concentrated solids - enriched retentate streams withdrawn from filtration devices 582 a and 582 c via respective conduits 528 a and 528 b can then be passed as feed streams to successive filtration devices 582 b and 582 d . the solids - enriched retentate streams from conduits 528 a and 528 b can then be further concentrated by passage through filtration devices 582 c and 582 d to provide further concentrated solids - enriched retentate streams in conduits 530 a and 530 b and two additional solids - depleted permeate streams in conduits 536 b and 536 d . these further enriched solids - enriched retentate streams in conduits 530 a and 530 b can then be combined and the combined solids - enriched retentate stream in conduit 532 may be routed to back to the wash zone for further washing or it may be passed to a downstream separation zone ( not shown in fig5 ) once the wash step is complete . each of the solids - depleted permeate streams in conduits 536 a - d may also be combined and routed to a location at or upstream of the wash zone , including one or more intermediate hold tanks ( not shown in fig5 ), as also discussed previously , for use in the current or a future wash cycle . optionally , one or more of filter elements 582 a - d may be backwashed via a back wash fluid , shown by dashed lines 541 a - d , which can be passed to the permeate side of filter elements 582 a - d via backwash pressure vessels 540 a - d , as shown in fig5 . referring again to fig1 , upon completion of the contacting step in wash zone 30 , a washed particle slurry comprising a plurality of washed poly ( vinyl acetal ) resin particles and at least a portion of the wash liquid , can be removed from wash zone 30 via conduit 124 . in some embodiments , at least a portion , or substantially all , of the washed poly ( vinyl acetal ) resin slurry may have passed through a filter 62 and may be into separation zone 40 via conduit 136 b , optionally after combination with a washed poly ( vinyl acetal ) resin slurry withdrawn from wash zone 30 via conduit 124 a , if present . in some embodiments , the washed particle slurry introduced into separation zone 40 via conduit 139 can have a total solids content similar to the total solids content of the reaction or diluted reaction slurry introduced into wash zone 130 in conduit 120 . for example , the total solids content of the washed particle slurry in conduit 139 can be at least about 0 . 5 , at least about 1 , at least about 2 , at least about 2 . 5 , at least about 5 , at least about 8 , at least about 10 , at least about 12 and / or not more than about 30 , not more than about 25 , not more than about 20 , not more than about 18 , not more than about 10 , not more than about 8 , not more than about 5 , or not more than about 3 weight percent . the total solids content of the washed particle slurry in conduit 139 can be in the range of from about 0 . 5 to about 30 , about 1 to about 25 , about 5 to about 20 , or about 8 to about 18 weight percent . the temperature of the washed particle slurry in conduit 139 can be substantially cooler than the reaction slurry or diluted reaction slurry introduced into wash zone 30 and may be , for example , at least about 15 , at least about 20 , at least about 25 , at least about 30 and / or not more than about 60 , not more than about 50 , not more than about 45 , not more than about 40 , or not more than about 35 ° c ., or it may be in the range of from about 15 to about 50 , about 20 to about 45 , or about 25 to about 40 ° c . as shown in fig1 , the washed particle slurry in conduit 139 , which may optionally be combined with a yet - to - be - discussed stream in conduit 150 , can be introduced into a separation zone 40 . in some embodiments , at least a portion of the washed slurry stream in conduit 124 a may be directed via conduit 124 b to a yet - to - be - discussed reslurry tank 68 and combined with a liquid stream in conduit 151 . the resulting solids - containing stream in conduit 150 may then be combined with the stream in conduit 139 before being introduced into separation zone 40 . optionally , in some embodiments , facility 10 can include at least one buffer tank ( not shown in fig1 ) positioned between wash zone 30 and separation zone 40 . when present , the buffer tank may help facilitate transfer of the washed slurry from wash zone 30 , which may be operated in a batch mode , to separation zone 40 , which may be operated in a continuous mode . according to such embodiments , the buffer tank can be configured to receive washed slurry from conduit 124 a , 136 b , and / or 150 , and to discharge slurry into separation zone 40 via conduit 139 . separation zone 40 can include one or more solid - liquid separation devices capable of separating at least about 20 , at least about 30 , at least about 40 , at least about 50 , at least about 60 , at least about 70 , or at least about 80 percent of the total amount of liquid from the washed poly ( vinyl acetal ) resin particles . examples of suitable solid - liquid separation devices can include , but are not limited to , gravity separators , centrifuges , belt filters , vacuum filters , and combinations thereof . the separation may be performed in a single vessel or multiple vessels , arranged in series or in parallel , and may be carried out under any suitable operating conditions . the resulting substantially dewatered , solids - rich material withdrawn from separation zone 40 via conduit 128 can have a total solids content of at least about 50 , at least about 55 , at least about 60 , or at least about 65 weight percent . depending on the solids content , a screw conveyor or other such device may be needed to remove the solids - rich material from separation zone 40 . in some embodiments , the solids - rich material in conduit 128 can comprise at least about 50 , at least about 60 , at least about 70 , at least about 75 , at least about 80 , at least about 85 , or at least about 90 percent of the total amount of solids introduced into separation zone 40 via conduit 139 . as shown in fig1 , a stream of liquid separated from the solids - rich material may be withdrawn from separation zone 40 via conduit 140 . in some embodiments , the separated liquid stream may also be passed through at least one filtration device , shown in fig1 as filter 64 upon removal from separation zone 40 . the filtration device can be any suitable device for separating at least a portion of the solids from the separated liquid stream in conduit 140 . in some embodiments , the filtration device may include one or more filter elements or filters , arranged in series or in parallel , and may comprise at least one cross - flow filter or filter element . one or more characteristics described above with respect to interior filter element 60 and / or external filter 62 as shown in fig1 and / or filter element 280 and filter 282 shown in fig2 may also be applicable to filter 64 shown in fig1 . as shown in fig1 , filter 64 is configured to separate the solids - containing feed stream in conduit 140 into a solids - enriched retentate stream in conduit 142 and a solids - depleted permeate stream in conduit 144 . in some embodiments , the solids - enriched retentate stream can have a total solids content of at least about 2 , at least about 5 , at least about 10 , at least about 15 and / or not more than about 50 , not more than about 40 , or not more than about 30 weight percent , or it can be in the range of from about 2 to about 50 , about 5 to about 40 , or about 10 to about 30 weight percent . the solids - depleted permeate stream in conduit 144 may have a total solids content of not more than about 10 , not more than about 5 , not more than about 2 , not more than about 1 , not more than about 0 . 5 , or not more than about 0 . 1 weight percent . the average particle size of the solids present in the solids - depleted permeate stream is not more than about 40 , not more than about 30 , not more than about 20 , not more than about 15 , or not more than about 10 microns . according to some embodiments , the solids - depleted permeate stream in conduit 144 can be reintroduced into the process at a location at or upstream of separation zone 40 . as shown in fig1 , at least a portion of the solids - depleted permeate stream in conduit 144 may be combined with the wash liquid in conduit 122 and introduced into wash zone 30 . optionally , all or a portion of the solids - depleted permeate stream in conduit 144 may be temporarily stored in at least one intermediate hold tank , shown as tank 66 in fig1 , prior to being combined with the wash liquid in conduit 122 . in some embodiments , tank 66 may be an unagitated tank and may not include any sort of mechanical agitation device . as shown in fig1 , at least a portion of the solids - enriched retentate stream withdrawn from filter 64 via conduit 142 may be routed via conduit 148 and can be recombined with the washed particle slurry introduced into separation zone 40 via conduits 148 a and 150 . additionally , or in the alternative , all or a portion of the solids - enriched retentate stream in conduit 148 may be introduced into a reslurry tank 68 via conduit 148 b and combined with a liquid stream in conduit 151 to produce a reslurried solid stream . in some embodiments , the reslurried stream in conduit 150 can be combined with the washed particle stream from wash zone 30 via conduit 124 , when present , and the combined stream may be introduced into separation zone 40 . in some embodiments , as discussed previously , the washed particle stream in conduit 124 may pass through reslurry tank 68 and may enter separation zone 40 via conduits 150 and 139 . the solids content of the reslurried stream in conduit 150 and / or the solids - containing stream in conduit 139 can be similar to that of the washed particle slurry described herein . in some embodiments , all or a portion of the solids - enriched retentate stream in conduit 142 may be passed via conduit 152 to another filtration device , shown as filter 68 in fig1 , wherein the solids - rich material in conduit 152 may be further concentrated to form a further solids - enriched retentate phase in conduit 156 and another solids - depleted permeate stream in conduit 154 . the solids - depleted permeate stream in conduit 154 may be routed to disposal , or may be reintroduced into one or more locations within the process at or upstream of separation zone 40 ( not shown in fig1 ). at least a portion of the further concentrated solids - rich material in conduit 156 , which may have a total solids content of at least about 50 , at least about 60 , at least about 70 , or at least about 80 weight percent , may be combined with at least a portion of the solids - rich material withdrawn from separation zone 40 via conduit 128 and the combined material can be introduced into drying zone 50 , as shown in fig1 . drying zone 50 may include one or more driers suitable for further drying the solids - rich material to form a plurality of dried poly ( vinyl acetal ) resin particles . in some embodiments , drying zone 50 can include a continuous drier such as a fluidized bed dryer , a circulating fluidized bed drier , or a flash drier , although any suitable drier may be used . drying zone 50 may be operated under any suitable conditions in order to remove as much liquid as possible from the poly ( vinyl acetal ) resin particles . when removed from drying zone 50 via conduit 160 , the dried poly ( vinyl acetal ) resin particles may have a total liquid content of not more than about 5 , not more than about 4 , not more than about 3 , not more than about 2 not more than about 1 weight percent . in various embodiments , the poly ( vinyl acetal ) resin particles can comprise particles of polyvinyl n - butyral ( pvb ) resin . for example , the poly ( vinyl acetal ) resin forming the particles may comprise residues of n - butyraldehyde , and may , for example , include not more than about 50 , not more than about 40 , not more than about 30 , not more than about 20 , not more than about 10 , not more than about 5 , or not more than about 2 weight percent of residues of an aldehyde other than n - butyraldehyde , based on the total weight of all aldehyde residues of the resin . when the poly ( vinyl acetal ) resin comprises a pvb resin , the molecular weight of the resins can be at least about 50 , 000 , at least about 70 , 000 , at least about 100 , 000 daltons and / or not more than about 600 , 000 , not more than about 550 , 000 , not more than about 500 , 000 , not more than about 450 , 000 , or not more than about 425 , 000 daltons , measured by size exclusion chromatography using a low angle laser light scattering ( sec / lalls ) method . as used herein , the term “ molecular weight ” refers to weight average molecular weight ( m w ). the molecular weight of the poly ( vinyl acetal ) resin can be in the range of from about 50 , 000 to about 600 , 000 , about 70 , 000 to about 450 , 000 , or about 100 , 000 to about 425 , 000 daltons . in some embodiments , the poly ( vinyl acetal ) resin in the solid particles formed as described herein can have a residual hydroxyl content and an residual acetate content within one or more ranges provided herein . as used herein , the terms “ residual hydroxyl content ” and “ residual acetate content ” refer to the amount of hydroxyl and acetate groups , respectively , that remain on a resin after processing is complete . for example , polyvinyl n - butyral can be produced by hydrolyzing polyvinyl acetate to polyvinyl alcohol , and then acetalizing the polyvinyl alcohol with n - butyraldehyde to form polyvinyl n - butyral . in the process of hydrolyzing the polyvinyl acetate , not all of the acetate groups are converted to hydroxyl groups , and residual acetate groups remain on the resin . similarly , in the process of acetalizing the polyvinyl alcohol , not all of the hydroxyl groups are converted to acetal groups , which also leaves residual hydroxyl groups on the resin . as a result , most poly ( vinyl acetal ) resins include both residual hydroxyl groups ( as vinyl hydroxyl groups ) and residual acetate groups ( as vinyl acetate groups ) as part of the polymer chain . the residual hydroxyl content and residual acetate content are expressed in weight percent , based on the weight of the polymer resin , and are measured according to astm d - 1396 , unless otherwise noted . in some embodiments , the resin used to form the poly ( vinyl acetal ) resin particles described herein can have a residual hydroxyl content of at least about 14 , at least about 14 . 5 , at least about 15 , at least about 15 . 5 , at least about 16 , at least about 16 . 5 , at least about 17 , at least about 17 . 5 , at least about 18 , at least about 18 . 5 , at least about 19 , at least about 19 . 5 and / or not more than about 45 , not more than about 40 , not more than about 35 , not more than about 33 , not more than about 30 , not more than about 27 , not more than about 25 , not more than about 22 , not more than about 21 . 5 , not more than about 21 , not more than about 20 . 5 , or not more than about 20 weight percent , or in the range of from about 14 to about 45 , about 16 to about 30 , about 18 to about 25 , about 18 . 5 to about 20 , or about 19 . 5 to about 21 weight percent . in other embodiments , the poly ( vinyl acetal ) resin can have a residual hydroxyl content of at least about 8 , at least about 9 , at least about 10 , at least about 11 weight percent and / or not more than about 16 , not more than about 14 . 5 , not more than about 13 , not more than about 11 . 5 , not more than about 11 , not more than about 10 . 5 , not more than about 10 , not more than about 9 . 5 , or not more than about 9 weight percent , or in the range of from about 8 to about 16 , about 9 to about 15 , or about 9 . 5 to about 14 . 5 weight percent . the residual acetate content of the poly ( vinyl acetal ) resin present in the solid particles formed as described herein can be , for example , not more than about 25 , not more than about 20 , not more than about 15 , not more than about 12 , not more than about 10 , not more than about 8 , not more than about 5 , not more than about 2 , or not more than about 1 weight percent , and / or the poly ( vinyl acetal ) resin can have an acetate content of at least about 1 , at least about 2 , at least about 3 , at least about 5 , at least about 10 , at least about 12 , or at least about 15 weight percent . poly ( vinyl acetal ) resin formed by processes and systems described herein may be used in a variety of applications . in some embodiments , the poly ( vinyl acetal ) resin may be used to form a polymer sheet , which may be used , for example , in automobile and architectural safety glass or in photovoltaic modules . as used herein , the term “ polymer sheet ” refers to any thermoplastic polymer composition formed by any suitable method into a thin layer that is suitable alone , or in multiple layer configuration , for use as a polymeric interlayer in various applications . resin sheets formed using poly ( vinyl acetal ) resin particles described above may further include at least one plasticizer . in some embodiments , the plasticizer may be present in an amount of at least about 5 , at least about 10 , at least about 15 , at least about 20 , at least about 25 , at least about 30 , at least about 35 , at least about 40 , at least about 45 , at least about 50 , at least about 55 , at least about 60 parts per hundred parts of resin ( phr ) and / or not more than about 120 , not more than about 110 , not more than about 105 , not more than about 100 , not more than about 95 , not more than about 90 , not more than about 85 , not more than about 75 , not more than about 70 , not more than about 65 , not more than about 60 , not more than about 55 , not more than about 50 , not more than about 45 , or not more than about 40 phr , or in the range of from about 5 to about 120 , about 10 to about 110 , about 20 to about 90 , or about 25 to about 75 phr . as used herein , the term “ parts per hundred parts of resin ” or “ phr ” refers to the amount of plasticizer present as compared to one hundred parts of resin , on a weight basis . examples of suitable plasticizers can include , but are not limited to , triethylene glycol di -( 2 - ethylhexanoate ) (“ 3geh ”), triethylene glycol di -( 2 - ethylbutyrate ), triethylene glycol diheptanoate , tetraethylene glycol diheptanoate , tetraethylene glycol di -( 2 - ethylhexanoate ) (“ 4geh ”), dihexyl adipate , dioctyl adipate , hexyl cyclohexyladipate , diisononyl adipate , heptylnonyl adipate , di ( butoxyethyl ) adipate , and bis ( 2 -( 2 - butoxyethoxy ) ethyl ) adipate , dibutyl sebacate , dioctyl sebacate , and mixtures thereof . the plasticizer may be selected from the group consisting of triethylene glycol di -( 2 - ethylhexanoate ) and tetraethylene glycol di -( 2 - ethylhexanoate ), or the plasticizer can comprise triethylene glycol di -( 2 - ethylhexanoate ). the polymer sheets may also include at least one additive for imparting particular properties or features to the interlayer . such additives can include , but are not limited to , dyes , pigments , stabilizers such as ultraviolet stabilizers , antioxidants , anti - blocking agents , flame retardants , ir absorbers or blockers such as indium tin oxide , antimony tin oxide , lanthanum hexaboride ( lab 6 ) and cesium tungsten oxide , processing aides , flow enhancing additives , lubricants , impact modifiers , nucleating agents , thermal stabilizers , uv absorbers , dispersants , surfactants , chelating agents , coupling agents , adhesives , primers , reinforcement additives , and fillers . additionally , the polymer sheets may also include various adhesion control agents (“ acas ”) can be used in the interlayers of the present disclosure to control the adhesion of the sheet to glass . suitable acas can include , but are not limited to , sodium acetate , potassium acetate , magnesium bis ( 2 - ethyl butyrate ), magnesium bis ( 2 - ethylhexanoate ), and combinations thereof . the resin sheets formed from particles as described herein may be formed according to any suitable method . exemplary methods of forming polymer sheets can include , but are not limited to , solution casting , compression molding , injection molding , melt extrusion , melt blowing , and combinations thereof . multilayer interlayers including two or more resin sheets may also be produced according to any suitable method such as , for example , co - extrusion , blown film , melt blowing , dip coating , solution coating , blade , paddle , air - knife , printing , powder coating , spray coating , and combinations thereof . in various embodiments of the present invention , the layers or interlayers may be formed by extrusion or co - extrusion . the thickness , or gauge , sheets can be at least about 10 , at least about 15 , at least about 20 mils and / or not more than about 100 , not more than about 90 , not more than about 60 , not more than about 50 , or not more than about 35 mils , or it can be in the range of from about 10 to about 100 , about 15 to about 60 , or about 20 to about 35 mils . in millimeters , the thickness can be at least about 0 . 25 , at least about 0 . 38 , at least about 0 . 51 mm and / or not more than about 2 . 54 , not more than about 2 . 29 , not more than about 1 . 52 , or not more than about 0 . 89 mm , or in the range of from about 0 . 25 to about 2 . 54 mm , about 0 . 38 to about 1 . 52 mm , or about 0 . 51 to about 0 . 89 mm . the resulting resin sheet may be utilized in a multiple layer panel that comprises a resin layer or interlayer and at least one rigid substrate . any suitable rigid substrate may be used and in some embodiments may be selected from the group consisting of glass , polycarbonate , biaxially oriented pet , copolyesters , acrylic , and combinations thereof . the panels can be used for a variety of end use applications , including , for example , for automotive windshields and windows , aircraft windshields and windows , panels for various transportation applications such as marine applications , rail applications , etc ., structural architectural panels such as windows , doors , stairs , walkways , balusters , decorative architectural panels , weather - resistant panels , such as hurricane glass or tornado glass , ballistic panels , and other similar applications . the following examples are intended to be illustrative of the present invention in order to teach one of ordinary skill in the art to make and use the invention and are not intended to limit the scope of the invention in any way . the permeate flux of several filtration devices was determined according to the following procedure . an experimental set up as shown in fig6 was constructed . the set up included an agitated reaction vessel 600 , a positive displacement pump 610 , a feed slurry line 612 , a cross - flow filtration device 620 , a filtrate recirculation line 660 , and a concentrated slurry line 670 . as poly ( vinyl alcohol ) and butyraldehyde were reacted within agitated reaction vessel 600 , the pvb resin precipitated and the resulting aqueous slurry was transported from reaction vessel 600 to filtration device 620 via slurry line 650 . various pressure transducers ( p 1 through p 4 ) and several valves were also included , as shown in fig6 . filtration device 620 included a single , 2 - foot long cross - flow filter element having an internal diameter of ⅜ inch . the total flow area of filtration device 620 was 0 . 19 ft 2 . several trials were conducted using the apparatus shown in fig6 at varying slurry flow rates and / or using differently - sized filter elements . the conditions for these trials are summarized in table 1 , below , and the permeate flux across the filtration surface for each run , as a function of time , is graphically summarized in fig7 . the inlet , outlet , and transmembrane pressures were measured using pressure transducers available from omega engineering , inc ., and filtrate quality was measured using a turbidimeter available from hach company . filtration device 620 back - pulsed only once during run a , as described below . as shown in fig7 , a fairly constant permeate flux can be maintained , even without back - pulsing when , for example , a 2 - micron filter element is used with a slurry flow rate of 2 . 6 gpm ( run b ) or a 5 - micron filter element is used at a 3 gpm slurry flow ( run c ). a gradual drop in permeate flux was observed when , for example , a 1 . 5 gpm slurry flow rate was used with the 2 - micron filter element ( run a ) and when a 3 . 2 gpm flow rate was used with a 10 - micron filter element ( run d ), as also shown in fig7 . in the case of a drop in permeate flux , a simple back - pulse may be useful , as evidenced by the rapid increase in permeate flux following a back pulse shown in run a at 110 minutes . overall , fig7 demonstrates that sustainable operation of a cross - flow filter element , with little or no back - pulsing , can be used with aqueous slurries of poly ( vinyl acetal ) resin particles . the operation of a multiple - stage filtration system suitable for concentrating a poly ( vinyl n - butyral ) resin slurry is simulated in the following prophetic example . an aqueous poly ( vinyl n - butyral ) slurry , which has a solids content of 1 weight percent , is passed through a 7 - stage cross - flow filtration device . the final filtrate withdrawn from the system has a solids content of 17 . 2 weight percent . each stage employs at least one tubular 3 / 8 - inch ( id ) filter element , and the minimum velocity of the slurry through each of the filtration stages is 5 ft / s . table 2 , below , summarizes key parameters for each stage of the filtration system , including filtration area , feed and exit flow rate , velocity , and concentration , and permeate flow rate , simulated as above . a resin production process including a reaction vessel , a wash vessel , and an interim holding tank was used to produce pvb . several process parameters , including reactor temperature , hold tank temperature , amperage of the reaction agitator , and the flow of each reactant stream , were monitored using an online control system and the value of each of these parameters was graphed as a function of time , along with the output of the flow control valve disposed between the reaction vessel and the hold tank , which indicated the opening or closing of the valve . in the comparative case shown in fig8 a , the reactor effluent stream was routed directly from the reaction vessel to the hold tank , while , in the disclosed case shown in fig9 b , a stream of dilution fluid was added to the reactor effluent upstream of the control valve and the combined stream was introduced into the hold tank . the addition of a dilution stream to the reactor effluent upstream of the control valve had three main effects on the system . first , it reduced the slurry temperature in the hold tank , which may help decrease the “ stickiness ” and agglomeration tendency of the particles . next , it reduced the concentration of solids in the reactor effluent , which may reduce the likelihood of agglomeration . finally , the use of in - line dilution stabilized the reactor effluent flow without requiring a change in line size or a reduction in velocity . further , as shown by a comparison of fig8 a and 8 b , in - line dilution of the reaction vessel effluent resulted in more stabilized operation of the flow control valve between the reaction vessel and the hold tank . while the invention has been disclosed in conjunction with a description of certain embodiments , including those that are currently believed to be the preferred embodiments , the detailed description is intended to be illustrative and should not be understood to limit the scope of the present disclosure . as would be understood by one of ordinary skill in the art , embodiments other than those described in detail herein are encompassed by the present invention . modifications and variations of the described embodiments may be made without departing from the spirit and scope of the invention it will further be understood that any of the ranges , values , or characteristics given for any single component of the present disclosure can be used interchangeably with any ranges , values or characteristics given for any of the other components of the disclosure , where compatible , to form an embodiment having defined values for each of the components , as given herein throughout . for example , an interlayer can be formed comprising poly ( vinyl butyral ) having a residual hydroxyl content in any of the ranges given in addition to comprising a plasticizers in any of the ranges given to form many permutations that are within the scope of the present disclosure , but that would be cumbersome to list . further , ranges provided for a genus or a category , such as phthalates or benzoates , can also be applied to species within the genus or members of the category , such as dioctyl terephthalate , unless otherwise noted .	1
in fig1 and 2 a steering arm 10 is depicted which has a structure generally known . as to this it is for example referred to the u . s . pat . no . 6 , 382 , 359 b1 . in this document a typical pallet truck for the walking / rider operation is shown which has a steering arm with a basic structure to which also the present invention refers . therefore , it is expressly referred to this prior art . as can be seen in fig1 and 2 the steering arm 10 has a steering rod 12 and a steering head 14 . the structure of the steering rod 12 can be clearly seen in fig8 . it has a u - shaped profile with a web plate 16 and leg portions 18 , 20 . the mentioned parts are attached to each other by welding . the shown u - profile at the end has two laterally spaced bearing eyes 22 , 24 . the bearing eyes are provided for the mounting of a steering arm to a vertical steering shaft of a pallet truck not shown . by this the steering arm 10 can be pivoted about a horizontal axis and contemporarily rotate about a vertical axis in order to effect a steering motion . as can be seen further in fig1 and 2 the steering head 14 has two gripping portions 26 , 28 on both sides of a horn portion 30 . the gripping portion 26 , 28 at the outer ends are connected to leg portions 32 , 34 which in turn are connected to a transverse portion 36 . the transverse portion 36 is attached to the steering rod 12 . the horn is centrally attached to the transverse portion and extends beyond the gripping portions 26 , 28 . such design is conventional and is not to be explained further in detail . as can be seen the described parts of the steering head 14 form two gripping openings 38 , 40 . individual actuation elements are provided on the steering head 14 for the control of functions of the pallet truck not shown . this is also not to be described in detail . from fig1 , 2 and 8 it can be seen that the steering rod 12 or the u - shaped profile of the steering rod shown in fig8 is embraced by a cushion portion 42 . as can be seen in fig8 , the cushion portion 42 is c - shaped in cross section . a web portion 44 faces the web plate 16 and covers the web plate , leg portions 46 , 48 extend approximately parallel to the leg portions 18 , 20 and lower portions 50 , 52 undergrip the leg portions 18 , 20 , with grooves in the portions , 50 , 52 accommodate lower edges of the leg portions 18 , 20 . an intermediate space 54 is formed between the web portion 44 and the web portion 16 in fig8 . it results from the fact that the leg portions 18 , 20 somewhat protrude beyond the web plate 16 . a further intermediate space is provided between the leg portions 46 , 48 on one side and the associated sides of the leg portions 18 , 20 on the other side . by this the cushion portion 42 which may be made of a suitable elastomeric cushion material , e . g . plastic foam , can be deformed inwardly upon a pressure thereon . as can be seen further in fig8 a relatively thin cover plate 56 is provided which has a u - shaped profile in cross section by bent edges which engage corresponding grooves of portions 50 , 52 of the cushion portion 42 . by means of screws one of which is shown at 58 the cover plate 56 can be attached to web plate 16 . this attachment secures the cushion portion 42 to the steering rod 12 in that it prevents the leg portions 18 , 20 from disengagement with the associated grooves of portions 50 , 52 . the basic structure of the cushion portion 42 is shown in fig3 and 4 . it can be seen that at the upper end thereof curved legs 60 , 62 extend laterally away from each other . the legs 60 , 62 engage the associated front curved surfaces of steering head 14 as shown in fig1 and 2 . the mounting of the legs 60 , 62 to the steering head 14 is described hereinafter in more detail . an arcuately shaped portion 64 is provided at the other end of the cushion portion 42 as can be seen in fig3 and 4 . the portion 64 extends upwardly beyond the web portion 44 . at the lower side it is adapted to the shape of the bearing eyes 22 , 24 and engages the bearing eyes at the associated side as can be seen in fig1 and 2 . thus , the cushion portion 42 at the lower end is supported by the steering rod 12 . fig6 shows a cross section of the cushion portion 42 in the range of the steering rod 12 . the grooves which according to fig8 accommodate the leg portions 18 , 20 are designated with 66 , 68 . the grooves which accommodate the edges of the cover plate 57 are designated with 70 , 71 . it can be seen in fig7 that the housing of the steering head 14 is composed of an upper cup portion 74 and a lower cup portion 76 . the separation line which is defined by the cup portions 74 , 76 are not shown in fig1 and 2 . the upper cup portion 74 is made of plastic material and the lower of aluminum . as can be seen fig7 , the legs 60 , 62 have a specific cross sectional profile with a first t - profile 78 and a second t - profile 80 , the associated edge portions of the cup portions 74 , 76 are shaped complementarily so that it may engage the grooves formed by the t - profiles 78 , 80 on opposing sides . thereby the legs 60 , 62 are positively retained by the housing of steering head 14 . it should be mentioned with respect to fig1 and 2 that the legs 60 , 62 are attached to the cup portions 74 , 76 of steering head 14 such that the outer surfaces of the housing of the steering head 14 and of the legs 60 , 62 are aligned with each other without a step .	1
referring now to the drawings , wherein like reference numerals indicate identical or similar parts throughout the several views , fig1 and 2 show the portable hand rails 10 shown attached to a dock 11 that has a boat 12 tied thereto . each of the hand rails 10 have a plate 13 with a u - shaped rail 20 attached thereto , such as by welding for example . the plate 13 has a pair of flanges 14 and 15 welded to the underside thereof that are aligned along a vertical plan so that they can slide between dock boards on a typical boat dock . of course they could be attached in other ways . the plate 13 has a pair of apertures 13 a disposed there through as can be seen best in fig8 . threaded members 17 extend through the apertures 13 a , through washer 20 , and is threaded into a threaded opening 18 t in pin 18 while pin 18 is disposed in the openings 19 a of cam 19 . the bottom of each threaded member 17 has a moveable flange 16 on it . directional indicator knobs 22 are optionally threadably attached to the top of threaded members 17 for reasons which will be discussed below . looking to fig7 and 8 , a jam nut 22 a is threaded onto each threaded member 17 followed by threading the directional knob 22 onto the shaft 17 . the purpose of the directional indicator knobs 22 is to be able to tell the position of flange 16 even when it is out of sight under the dock 11 . so before installation , each directional indicator knob 22 is threaded onto the threaded shaft 17 so it is in alignment with the flange 16 . after that , the jam nut 22 a is screwed in a direction to go upwardly into abutment with the directional indicator knob 22 to hold it firmly in the position selected . essentially a plane extending through the moveable flange 16 will extend through the widest part of the directional indicator knob 22 that is shown . if a symmetrical knob was to be used instead of the directional indicator knob 22 , then a line or other indicia could be placed on such round knob to be aligned with the flange 16 to indicate to the user the position of the moveable flange 16 when it is out of sight under dock boards . looking to fig3 - 8 , to use the portable hand rails 10 the moveable flanges 16 would be aligned with the fixed flanges 14 and 15 so that the these flanges 14 - 16 can be pushed down between adjacent boards 11 a and 11 b of dock 11 as shown in fig6 . the next step for the installation to put the hand rails 10 in the position shown in fig1 and 2 , would be to turn the threaded rod 90 degrees from the position shown in fig6 to the position shown in fig3 and 8 , using the directional indicator knobs 22 as an indication of when the flanges 16 are in the position shown in fig3 , 5 and 8 in solid lines and in the position in dashed lines as shown in fig6 , noting that the knob 22 in dashed lines in fig6 is also turned 90 decrees from the solid line position thereof . then , while pulling up on the directional indicator knobs 22 and thereby on threaded members 17 while the moveable flange 16 against the bottom of the dock boards 11 a / 11 b , the pin 18 of the cam handle 19 h would be turned sort of like you would thread a nut ( like the threaded pin 18 ) onto a bolt ( like the pin 17 ). this would be done by turning the handle 19 h while in the up position , kind of like using a wrench and spinning the cam 19 around the threaded rod 17 in a rotary direction to move the rod 17 and flange 16 upwardly until it is tightened to the dock board thickness generally . after that , the handle 19 h is just pushed down about the longitudinal axis of pin 18 to cause the final tightening of the flange 16 against the bottom of the boards 11 a / 11 b . in this way , the boards 11 a / 11 b are clamped tightly between the flange 16 and the plate 13 . once one side is clamped , i . e . the boards are clamped between one flange 16 and the plate 13 , the same procedure is used to tighten and clamp the boards 11 a / 11 b between the other moveable flange 16 and the other half of the plate 13 . this will produce the hand rail structure 10 shown in fig1 and 2 , noting that two hand rails 10 can be used instead of just one if desired . fig2 shows a person in dashed lines moving from the boat 12 to the dock 11 while using the handrails 10 , by grasping the top parts 20 of the handrails 10 . obviously the handrails 10 / 20 can be used to go from the dock 11 to the boat 12 in the same manner . once the user of the handrails 10 decides not to use them on the dock 11 anymore , the user merely reverses the installation steps described above to remove the handrails 10 from the dock 11 . for example if the user were to go on a fishing trip for a week , then the portable handrails 10 could be used on a dock where the user is boating / fishing , whether using the user &# 39 ; s own boat or someone else &# 39 ; s boat . but then when the vacation is over , the handrails 10 can be removed from the dock and taken home for storage and be ready for a future use at a different location . because the handrails 10 do not harm the dock itself , there should be no objection by the dock owner to their use . those skilled in the art will recognize that a wide variety of modifications , alterations , and combinations can be made with respect to the above described embodiments without departing from the spirit and scope of the invention , and that such modifications , alterations , and combinations are to be viewed as being within the ambit of the inventive concept as expressed by the attached claims .	4
a description will now be given of embodiments of the present invention with reference to drawings . fig1 to fig3 show a first embodiment of an electrode terminal 1 according to the present invention . as shown in fig1 , the electrode terminal 1 can be used as a minus output terminal ( minus output side ) of each of battery cells 2 , for example , in a battery pack 4 and the like constructed by serially connecting the multiple battery cells 2 by busbars 3 . as shown in fig3 , the battery cell 2 is a lithium ion battery , and the minus output terminal is formed from copper or copper alloy . this is because a negative - electrode - side carrier 7 ( base body for fixing electrons and ions ) connected to the minus output terminal inside the battery is formed from copper or copper alloy . in relation to a positive - electrode - side carrier , the plus output terminal ( plus output side ) is formed from aluminum or aluminum alloy . as shown in fig2 a and fig2 b , the electrode terminal 1 according to the present invention adopted as the minus output terminal is formed into inner / outer double shafts by a shaft 10 ( first connection portion ) and an outer cylinder 11 ( second connection portion ) fitting over and covering the shaft 10 . a lower - end side of the shaft 10 protrudes from the outer cylinder 11 in the axial direction . an upper - end side of the shaft 10 and an upper end portion of the outer cylinder 11 are aligned to the same level in height . the shaft portion 10 is a round shaft , and the outer cylinder 11 is formed into a cylindrical shape . in other words , a shape on a cross section orthogonal to the axial direction of the shaft 10 and the outer cylinder 11 presents a double circle , and the thickness of the outer cylinder 11 surrounding the shaft 10 is approximately constant . a base portion 12 is formed in a lower - end side of the outer cylinder 11 , and the shaft 10 protrudes downward so as to pass through the base portion 12 . moreover , a male thread portion 13 is formed on an outer peripheral surface of the outer cylinder 11 except for the base portion 12 . the base portion 12 serves to maintain a constant length of the male thread portion 13 protruding from the battery cell 2 when the electrode terminal 1 is attached to the battery cell 2 , or serves as a spacer for holding a busbar 3 lifted above the battery cell 2 when the busbar 3 is connected to the male thread portion 13 . the base portion 12 is not always necessarily provided integrally with the outer cylinder 11 , and may be provided as a separate member . according to the first embodiment , the maximum diameter of the electrode terminal 1 ( corresponding to an outer diameter of the base portion 12 ) is 5 - 25 mm , and the maximum length ( corresponding to an overall length of the shaft 10 ) is 10 - 100 mm . the nominal outer diameter of the male thread portion 13 provided on the outer cylinder 11 is 4 - 12 mm . the shaft 10 and the outer cylinder 11 are formed from metal having forming materials different from each other . the shaft 10 is formed by the same metal as of the negative - electrode - side carrier 7 of the battery cell 2 , namely copper or copper alloy . moreover , the outer cylinder 11 is formed by the same metal as of a positive - electrode - side carrier and the plus output terminal of the battery cell 2 , namely aluminum or aluminum alloy as a source material . a bonding interface in which the metal ( cu ) of the shaft 10 and the metal ( al ) of the outer cylinder 11 are brought in close contact with each other at a metal structure level by imparting deformation at an extreme high pressure ( approximately 1000 mpa , for example ) is formed in a gap between an outer peripheral surface of the shaft 10 and an inner peripheral surface of the outer cylinder 11 , and , as a result , the gap is brought into a state in which the electric conductivity and the mechanical bonding strength are increased to “ values proper for practical use as an electrode terminal ”. when such an electrode terminal 1 is attached to the battery cell 2 , a portion of the shaft 10 protruding from the outer cylinder 11 is used as an internal connection portion 15 . in other words , the internal connection portion 15 is electrically connected to the negative - electrode - side carrier 7 of the battery cell 2 . moreover , the portion of the outer cylinder 11 on which the male thread portion 13 is provided is used as an external connection portion 16 . in other words , one end portion of the busbar 3 made of aluminum , which is the same metal as the outer cylinder 11 , is connected to the external connection portion 16 . specifically , connection holes 20 are provided on both end portions of the busbar 3 as shown in fig1 and fig3 , the connection hole 20 is inserted over the external connection portion 16 ( the male thread portion 13 of the outer cylinder 11 ) of the electrode terminal 1 , and an aluminum nut 21 made of the same metal as of the outer cylinder 11 is threadedly engaged with the male thread portion 13 which is passing through the connection hole 20 . on this occasion , the external connection portion 16 , the busbar 3 , and the nut 21 constitute a connection of the same metal , which does not cause galvanic corrosion . in addition , though the dissimilar metals are present between the internal connection portion 15 and the external connection portion 16 ( between the shaft 10 and the outer cylinder 11 ), they are metallically bonded , do not cause galvanic corrosion , and are kept in a state in which the electric resistance is restrained . on the other hand , the plus output terminal preferably employs an electrode terminal in which all forming materials are formed from aluminum or aluminum alloy . the shape thereof is approximately the same as the electrode terminal 1 , and includes a base portion 23 and a male thread portion 24 . therefore , the connection hole 20 on the other side of the busbar 3 is inserted over the male thread portion 24 of the electrode terminal on the plus side , and the nut 21 is threadedly engaged with the male thread portion 24 , which is passing through the connection hole 20 . it should be understood that connection portions between the plus output terminal and the busbar 3 constitutes a connection of the same metal , which does not cause galvanic corrosion . as a result , in the battery pack 4 constructed by serially connecting the multiple battery cells 2 via the busbars 3 , galvanic corrosion is not generated in any of the connection portions , and a highly efficient electric conductivity is maintained . moreover , the electrode terminal 1 is excellent in mechanical strength , and the electrode terminal 1 is not bent or broken in an ordinary state of use . it should be noted that the busbar 3 is formed from aluminum or aluminum alloy according to the first embodiment , is light in weight , and can restrain the weight of the battery pack 4 to a small value . as a result , the battery pack 4 is advantageous in weight reduction of an electric vehicle carrying the battery pack 4 as a battery . an extrusion process is carried out under a hydrostatic pressure at an extremely high pressure in order to produce the electrode terminal 1 constituted in this way as shown in fig4 . an extrusion device 30 used for this process includes a die 31 having a single opening corresponding to the maximum diameter of the electrode terminal 1 ( corresponding to the outer diameter of the base portion 12 ) to be obtained , and extrusion molding can be carried out in an isostatic environment at an extremely high pressure ( approximately − 1000 mpa ). as a production sequence of the electrode terminal 1 , a source material for positive electrode 11 a ( metal source material ) made of the same metal as of the plus output terminal of the battery cell 2 and a source material for negative electrode 10 a ( metal source material ) made of the same metal as of the minus output terminal of the battery cell 2 are first prepared . in other words , the source material for positive electrode 11 a is aluminum or aluminum alloy , and the source material for negative electrode 10 a is copper or copper alloy . then , a billet ( source material facing each other ) in a round shaft shape structured so that the source material for positive electrode 11 a surround the source material for negative electrode 10 a in a shaft shape is formed . for example , the source material for negative electrode 10 a is formed as a round shaft member , the source material for positive electrode 11 a is formed as a hollow pipe member , and the source material for positive electrode 11 a is externally fit and inserted over the source material for negative electrode 10 a , thereby forming the billet . alternatively , the source material for negative electrode 10 a is formed as a round shaft member , the source material for positive electrode 11 a is formed as a belt - shape member , and the source material for positive electrode 11 a is wound over the source material for negative electrode 10 a , thereby forming the billet . then , the billet is loaded in the extrusion device 30 , and the extrusion device 30 is actuated in the isostatic environment at an extremely high pressure (− 1000 mpa ). as described before , the billet has such a structure that the source material for positive electrode 11 a surrounds the source material for negative electrode 10 a , and the source material for positive electrode 11 a and the source material for the negative electrode 10 a are extruded in parallel . as shown in fig4 , an opening area of the die 31 of the extrusion device 30 is smaller than a cross sectional area of the billet , the billet is compressed over the whole circumference , and is plastically deformed by causing the billet to pass through the die 31 . mating surfaces of both the source materials 10 a and 11 a come out of the die 31 , and then form “ the interface ( metallically bonded portion ) between the outer peripheral surface of the shaft 10 and the inner peripheral surface of the outer cylinder 11 ”. this extrusion processing forms a formed body 1 a in an inner / outer double - shaft configuration in which the source material for positive electrode 11 a and the source material for negative electrode 10 a are integrally bonded by means of the metallic bonding . the formed body 1 a acquired in this way is cut in the extruded direction at a predetermined interval . according to the first embodiment , the die 31 of the extrusion device 30 is formed into an opening shape corresponding to a cross sectional shape of the electrode terminal 1 , and the cut interval of the formed body 1 a is set to match the length dimension of the electrode terminal 1 . after the cut , a turning process and a male thread cutting process are applied to the source material for positive electrode 11 a , thereby forming the male thread portion 13 , forming the base portion 12 , and forming the protruded portion of the shaft 10 , resulting in completion of the electrode terminal 1 . a surface grinding and a surface treatment may be applied according to necessity . fig5 a , fig5 b , and fig6 show a second embodiment of the electrode terminal 1 according to the present invention . the electrode terminal 1 according to the second embodiment is also adopted as the minus output terminal of the battery cell 2 . as shown in fig5 a and fig5 b , the outer cylinder 11 of the electrode terminal 1 is formed to extend upward exceeding the length of the shaft 10 . in other words , the shaft 10 is not present inside the extended portion of the outer cylinder 11 , and is thus hollow . on the other hand , the shaft 10 of the electrode terminal 1 is formed to extend downward exceeding the length of the outer cylinder 11 . in addition , the base portion 12 and the male thread portion 13 are not provided on the outer cylinder 11 , and the outer cylinder 11 is thus formed into a straight cylindrical shape . it should be noted that the point that the shaft 10 is the same metal ( copper or copper alloy ) as of the negative - electrode - side carrier 7 of the battery cell 2 , and the outer cylinder 11 is the same metal ( aluminum or aluminum alloy ) as of the positive - electrode - side carrier and the plus output terminal of the battery cell 2 is the same as that of the first embodiment . moreover , the point that the outer peripheral surface of the shaft 10 and the inner peripheral surface of the outer cylinder 11 are metallically bonded by the die processing in the isostatic environment at an extremely high pressure is the same as that of the first embodiment . on the electrode terminal 1 according to the second embodiment , the portion of the shaft 10 protruding from the outer cylinder 11 is attached to the battery cell 2 as the internal connection portion 15 , and then , the hollow portion of the outer cylinder 11 is used as the external connection portion 16 . in other words , one end portion of the busbar 3 is connected to the external connection portion 16 by means of welding . specifically , as shown in fig6 , the connection hole 20 of the busbar 3 is inserted over the external connection portion 16 ( corresponding to the hollow portion ) of the electrode terminal 1 , and a periphery of the external connection portion 16 passing out the connection hole 20 may be welded by welding . both the busbar 3 and the external connection portion 16 of the welded portion are formed from aluminum or aluminum alloy , are the same metal , do not generate eutectic , and the electric resistance therebetween is not excessive . as shown in fig4 , in order to produce the electrode terminal 1 according to the second embodiment , as in the first embodiment , the extrusion device 30 is actuated in the isostatic environment at an extremely high pressure , thereby forming the formed body 1 a , and the outer cylinder 11 is then hollowed by boring ( the shaft 10 is removed to a predetermined depth ). according to the second embodiment , other configuration , actions and effects , and the production method are the same as those of the first embodiment , and therefore are not detailed . by the way , it should be understood that the disclosed embodiments are examples in terms of all the points , and are not limitative . the scope of the present invention is not represented by the above description but by claims , and it is intended that connotation equivalent to the scope of claims , and all changes within the scope of claims are included . for example , according to the first and second embodiments , though the electrode terminal 1 used as the minus output terminal is exemplified , the electrode terminal may be adopted to the plus output terminal . in this case , preferably , the shaft 10 is formed from the same metal ( aluminum or the aluminum alloy ) as of the positive - electrode - side carrier of the battery cell 2 , and the outer cylinder 11 is formed from the same metal ( copper or copper alloy ) as of the negative - electrode - side carrier 7 of the battery cell 2 . the busbar 3 is formed from copper or copper alloy . moreover , the busbar 1 according to the present invention is highly preferred for the connection of the lithium ion batteries to be installed on an automobile , and application to connection of the lithium ion batteries used for other applications poses no problem . the present application is described in detail referring to the specific embodiments , and it is apparent to a person skilled in the art that various changes and modification can be made without departing from the spirit and scope of the present invention . the present application is based on japanese patent application no . 2010 - 075916 filed on may 29 , 2010 , and the contents thereof are incorporated herein by reference .	7
fig1 is a general architecture diagram schematically illustrating an example of an interactive menu display system 100 that performs and provides the menu display and menu configuration services described herein . the interactive menu display system 100 can include any system capable of performing the processes described herein . for example , in the illustrated embodiment of fig1 , the interactive menu display system 100 communicates with one or more user computing devices 162 and one or more display devices 166 over a network 160 . in fig1 , the interactive menu display system 100 includes several components such as a menu display configuration module 122 and user interface module 124 . these components may also include further components that may not be depicted in fig1 . for example , interactive menu display system 100 can also include one or more servers , e . g ., a web server , configured to receive and respond to requests from the user computing devices 162 . the menu display configuration module 122 may be configured to , for example , manage various aspects of configuring a menu for a retail establishment . the menu display configuration module 122 may operate in conjunction with a user interface module 124 configured to generate and provide various menu configuration user interfaces described herein to enable the owner or manager to edit the menu , including menu content ( e . g ., food and drinks available at the retail establishment ), notices ( e . g ., informational items ), advertising content ( e . g ., banner advertisements , in - menu advertisements , etc . ), and presentation settings including display and layout settings , font styles and alignments , and the like . among other things , the menu display configuration module 122 and / or user interface module 124 may be configured to execute various processes , such as the process 1100 described with reference to fig1 , and the process 1200 described with reference to fig1 . also shown in fig1 , the interactive menu display system 100 may include and / or have access to one or more data stores or data sources including , for example , a menu and content data store 170 . the menu and content data store 170 may include data for the interactive menu display system , such as information or data about menu items available at a retail establishment including food and drinks ; notices including information about upcoming events , special offers for the retail establishment , information about performers and performance schedules , and the like ; advertising content , including ads for the retail establishment and / or ads for related products or services which may be displayed on the menu display user interfaces in exchange for a service fee ; data related to display settings and / or layout settings for the menu display user interfaces ; images and other display content for the menu ; and so forth . the menu and content data store 170 may store data provided by the owner and manager , either via the menu configuration user interfaces described herein or via other processes ( e . g ., an initial setup process or routine may be implemented to create or generate initial or default menu content which may then be further edited by the owner or manager using the menu configuration user interfaces ). the menu and content data store 170 may store data provided by or accessed from a third party entity , such as a third party data source of menu content including food , drinks ( e . g ., a database of information regarding one or more craft beers , such as a database provided by taphunter or other services ). also shown in fig1 , a sample user computing device 162 may include a user interface module 164 which may be configured to execute some or all of the processes described herein . this may , for example , enable the user computing device 162 to provide the menu display and / or menu configuration features to the user of the device , even when the device may be not connected to the interactive menu display system 100 over the network 160 . this may be the case , for example , if the user computing device 162 does not have wireless access , may not be connected to a cellular network , and so forth . in some embodiments , the interactive menu display system 100 may be a web - based system that may be accessed by users using an ordinary web browser . the interactive menu display system 100 may be accessible by an owner , manager , server , or other employee of the retail establishment to perform the menu configuration functions described herein . in other embodiments , aspects of the interactive menu display system 100 may also be accessible by users not associated with the retail establishment ( e . g ., customers of the retail establishment ) who may be able to view a menu and optionally place orders ( e . g ., by placing an order with a server or by placing an order directly via a user computing device ), but may not have access to the menu configuration functions provided by the interactive menu display system . the user interface module 124 of the interactive menu display system 100 may be configured to , for example , generate one or more user interfaces , such as the user interfaces described herein ( e . g ., fig2 - 17 ), to provide the menu configuration features to the user of a computing device 162 . in one embodiment , some or all of the user interfaces and / or ui elements may be generated either by the interactive menu display system 100 and provided to the user computing device 162 , or they may be generated on the user computing device 162 via the user interface module 164 , or in some combination thereof . according to one example use case scenario , a retail establishment may have one or more display devices 166 , such as commercial televisions or video monitors , to enable display of a menu of items and information for the retail establishment . for example , one display device 166 may enable display of a food menu , another display device 166 may enable display of a drinks menu , and yet another display device 166 may enable display of notices , advertisements , or other information . of course , any combination may be possible ( e . g ., one display device 166 may display food and drinks , along with notices and advertising in any combination ) using one , two , three , or more display devices 166 . the display devices 166 may present one or more menu display user interfaces which are generated by the interactive menu display system 100 based at least in part on menu data accessed from the menu and content data store 170 . an owner or manager of a retail establishment may access the menu configuration user interfaces using a user computing device 162 , the user computing device 162 may be , for example , a smart phone or tablet available to the owner , manager , or other employees at the retail establishment , or the user computing device 162 may be located elsewhere in a location remote from the retail establishment ( e . g ., the owner may be able to access the menu configuration user interfaces from home or anywhere else ). fig2 , 3 , 4 , and 5 illustrate example user interfaces presenting various portions or aspects of a menu for a retail establishment , as used in one or more embodiments of the interactive menu display system . the sample user interfaces may be displayed , for example , on one or more display devices 166 , such as commercially available televisions or video monitors . however , in some embodiments , the sample user interfaces shown in fig2 , 3 , 4 , and 5 may also be displayed on any suitable user computer device , such as a cell / smart phone , tablet , portable / mobile computing device , desktop , laptop , or personal computer , and are not limited to the samples as described herein . in some embodiments the sample user interfaces may be displayed using a web browser ( e . g ., as a web page ), a mobile application , or a standalone application . the user interfaces include examples of only certain features that an interactive menu display system may provide . in other embodiments , additional features may be provided , and they may be provided using various different user interfaces and software code . depending on the embodiment , the user interfaces and functionality described with reference to fig2 , 3 , 4 , and 5 may be provided by software executing on the one or more display devices ; by software executing on an optional intermediary computing system in communication with the one or more display devices ; by an interactive menu display system located remotely that is in communication with the one or more display devices directly or indirectly via one or more networks ; and / or some combination of software executing on the one or more display devices , the optional intermediary computing system , and the interactive menu display system . in other embodiments , analogous interfaces may be presented using audio or other forms of communication . in an embodiment , the interfaces shown in fig2 , 3 , 4 , and 5 are configured to be interactive and respond to various user interactions . such user interactions may include clicks with a mouse , typing with a keyboard , touches and / or gestures on a touch screen , voice commands , physical gestures made within a proximity of a user interface , and / or the like . fig2 is an example menu display user interface (“ ui ”) 200 presenting a menu of items available at a retail establishment , in particular a sushi and yakitori restaurant . the example menu display ui 200 may be generated by the interactive menu display system 100 according to menu and content data accessed from the menu and content data store 170 . the menu display ui 200 may comprise or include one or more portions to present one or more respective menu items and / or submenus . the example menu display ui 200 of fig2 includes six portions arranged in two rows and three columns ; however , other configurations may be possible and customized by the owner or manager of the retail establishment , for example via the menu configuration user interfaces provided by the interactive menu display system 100 ( e . g ., fig8 ). thus , for example , the example menu display ui 200 may be configured or customized to present a menu in one portion ( e . g ., a portion which utilizes most of the display area ), two portions ( e . g ., one row by two columns , or two rows by four columns ), four portions ( e . g ., two rows by two columns , one row by four columns , or four rows by one column ), and so on in any other combination . as shown in fig2 , each respective portion of the menu display ui 200 may present a menu item , along with a description , a price , and / or an image for the menu item ; or , reach respective portion may present a submenu , such as the “ favorite rolls ” submenu or the “ sake ” drinks menu . each submenu may be configured in a similar manner as described herein with reference to configuring the one or more menu items to be presented in the menu display ui . each submenu may also be configured to use a pre - generated image or graphic which includes the relevant submenu items , such that the pre - generated image or graphic may be included in a respective portion of the menu . in some embodiments , certain portions of the menu may include content which may not entirely fit within the display area of the respective portion of the menu display ui . for example , a common scenario occurs when a drinks menu or submenu includes more available drinks than can concurrently be displayed in the corresponding portion of the menu display ( e . g ., the portion of the menu display may have sufficient display area to display up to ten available drink items at one time , but the entire drinks menu may include more than ten drinks ). in such cases the menu display ui may be generated to enable automatic scrolling , paging , and / or other transitional rotation of the content within the respective portion , thereby updating the menu display ui in real - time to replace displayed menu content with other menu content that is not concurrently displayed . this way the entire contents of the menu may be displayed over a period of time , enabling the customer to view the entire menu or submenu contents in a single menu display ui . in other embodiments , instead of automatic scrolling , menu content may be periodically rotated or switched to update the menu display ui to present the entire menu or submenu contents in timed segments . for example , a drinks menu or submenu may rotate through a display pattern of showing a first set of ten drinks , followed by a second set of ten drinks , and so on until all available drinks in the menu or submenu have been presented , at which point the display pattern may be repeated . the pattern may be configured to present each timed segment for a default or a user defined period of time ( e . g ., 3 seconds , 5 seconds , etc .). the example menu display ui 200 also includes a ticker ui element 202 for displaying a scrolling , paging , or otherwise automatically updating ticker of content . although illustrated at the bottom of the menu display ui 200 , the ticker ui element 202 may be presented in any position including across the top , the middle , on the left or right side of the ui . the ticker ui element 202 may be configured using for example the ticker configuration ui illustrated and described with reference to fig1 , 12 , and 13 herein . for example , the ticker ui element 202 may be configured to display a “ live ” or real - time data feed from social media websites and / or social media networks , including facebook , twitter , instagram , micro - blogs , and the like ; and / or to display one or more user - defined messages which may be presented via the ticker ui element 202 in a rotating pattern . in one embodiment , the menu display ui 200 is configured to update or refresh periodically in near real - time in order to display the most current menu content and configuration settings . in another embodiment , the menu display ui 200 is configured to update or refresh responsive to detection of or receipt of new or updated menu content and configuration settings . in either such embodiment , the menu content and configuration settings may be updated , for example , by the owner or manager of the retail establishment via the one or more menu configuration user interfaces described herein . in this way for example , the owner or manager may update the menu to add new items or to delete items no longer available , and the interactive menu display system 100 may generate and updated menu display ui 200 to be refreshed in near real - time . this way the owner or operator may be assured that the most current menu is displayed within the retail establishment based on “ up - to - minute ” changes to the menu or items available . one benefit to such an updated menu display is that it may prevent the customer from ordering an item that is no longer available , thus preventing the undesirable customer service outcome of having to inform the customer manually that an item she ordered is not available . fig3 is another example menu display user interface (“ ui ”) 300 presenting a menu of items available at a retail establishment , in particular a sushi and yakitori restaurant . the example menu display ui 300 may be generated by the interactive menu display system 100 according to menu and content data accessed from the menu and content data store 170 . menu display ui 300 includes an example of a banner ui element 302 which may be included with the menu content . the banner ui element may be configured using for example the banner configuration ui illustrated and described with reference to fig1 herein . for example , the banner ui element 302 may be configured to display custom content such as notices or informational content regarding upcoming events ( e . g ., “ karaoke night ! . . . ”), special offers ( e . g ., “ enjoy $ 10 pitchers and $ 5 rolls ”), and other information ( e . g ., “ reservations recommended . . . ”). other types of custom content may also be included for display including , for example , advertisements or special offers from other retail establishments or businesses . for example , custom content may include an advertisement from a nearby retail establishment offering patrons a discount other special offer ( e . g ., “ show your receipt from this retail establishment and receive 10 % your next order at nearby retail establishment !”). as shown in fig3 , banner ui element 302 is displayed in the upper left corner and configured to overlay two portions of the underlying menu . however , banner ui element 302 may be configured for display in any number of ways , including for example overlaying the entire menu display , overlaying one or more respective portions of the menu display , aligned with the right edge or bottom edge of the menu display , and so on . further , in some embodiments the banner ui element 302 may be configured for display on a set interval ( e . g ., show or display for 5 seconds , hide or not display for 10 seconds , repeat ), such that the banner ui element 302 and corresponding custom content may only be displayed periodically . fig4 is example menu display user interface (“ ui ”) 400 presenting a menu of drinks available at a retail establishment . the example menu display ui 400 may be generated by the interactive menu display system 100 according to menu and content data accessed from the menu and content data store 170 . the menu display ui 400 may comprise or include one or more portions to present one or more respective drink categories and drink lists . the example menu display ui 400 of fig4 includes four portions arranged in two rows and two columns ; however , other configurations may be possible and customized by the owner or manager of the retail establishment , for example via the menu configuration user interfaces provided by the interactive menu display system 100 ( e . g ., fig8 or a similar user interface for configuration of a drinks menu ). in some embodiments , some the drink categories may include content which may not entirely fit within the display area of the respective portion of the menu display ui . for example , a brewery or bar often offers dozens or even hundreds of different beer brews which may not concurrently be displayed in the menu display , or may not concurrently be displayed in the menu display and remain legible or viewable by the customer . in such cases the menu display ui 400 may be generated to enable automatic scrolling , paging , other transitional change of the content within each respective portion , thereby updating the menu display ui in real - time to replace displayed available drinks with other menu content that is not concurrently displayed . this way the entire contents of the drinks menu may be displayed over a period of time , enabling the customer to view a legible or readable presentation of the entire drinks menu a single menu display ui . in other embodiments , instead of automatic scrolling , drinks menu content may be periodically rotated or switched to update the menu display ui to present the entire drinks menu or submenu contents in timed segments . for example , a drinks menu or submenu may rotate through a display pattern of showing a first set of ten drinks , followed by a second set of ten drinks , and so on until all available drinks in the menu or submenu have been presented , at which point the display pattern may be repeated . the pattern may be configured to present each timed segment for a default or a user defined period of time ( e . g ., 3 seconds , 5 seconds , etc .). in one embodiment , each respective drink category and corresponding portion of the menu display ui 400 may be configured to scroll or rotate content independently of each other , enabling concurrent display of multiple scrolling or rotating lists of drinks organized by the respective categories , which may be identified with names or titles ( e . g ., pilsners and pale ales , hoppy , wheat and belgian , malty and dark , of fig4 ). in some embodiments , the names or titles ( e . g ., pilsners and pale ales , hoppy , wheat and belgian , malty and dark , of fig4 ) can be displayed persistently during all or a portion of the scrolling or paging sequence . thus , the names of individual beverages such as “ 1500 pale ale ” and “ thin lizzy ” within the “ pilsners & amp ; pale ales ” category , can scroll or page with those and other beverage names , while the name of the category “ pilsners & amp ; pale ales ” is displayed persistently during such scrolling or paging , for example , at the top or other part of the portion of the menu display dedicated to the “ pilsners & amp ; pale ales ” category . in some embodiments , the portion of the menu display dedicated to the “ pilsners & amp ; pale ales ” category can be further subdivided into a scrolling / paging portion and a persistent portion , such that the category name “ pilsners & amp ; pale ales ” is displayed in the persistent portion and the beverage names are displayed in the scrolling / paging portion . similarly to the embodiment shown and described in fig3 , the menu display ui 400 may be configured to update or refresh periodically in near real - time in order to display the most current drink menu content and configuration . in another embodiment , the menu display ui 400 is configured to update or refresh responsive to detection of or receipt of new or updated menu content and configuration settings . in such embodiments , the menu content and configuration settings may be updated , for example , by the owner or manager of the retail establishment via the one or more menu configuration user interfaces described herein . in this way for example , the owner or manager may update the menu to add new drink items or to delete drink items no longer available ( e . g ., if a certain craft beer on tap has run out ), and the interactive menu display system 100 may generate and update menu display ui 200 to be refreshed in near real - time . this way the owner or operator may be assured that the most current menu is displayed within the retail establishment based on “ up - to - minute ” changes to the menu or items available . although not illustrated in fig4 , the menu display ui 400 may also be configured similarly to the menu display ui 300 of fig3 to enable display or presentation of a banner ui element . each of the features described with reference to fig3 may also be included in the menu display ui 400 of fig4 . fig5 is example menu display user interface (“ ui ”) 500 presenting a display of notices for a retail establishment . the example menu display ui 500 may be generated by the interactive menu display system 100 according to menu and content data accessed from the menu and content data store 170 . the menu display ui 500 may comprise or include one or more portions to present one or more respective notices , such as a listing of performers and related performance information and / or advertising . the example menu display ui 500 of fig5 includes four portions arranged in four rows and one column ; however , other configurations may be possible and customized by the owner or manager of the retail establishment , for example via the menu configuration user interfaces provided by the interactive menu display system 100 ( e . g ., fig8 or a similar user interface for configuration of a notice menu ). as shown in fig5 , the notice information display includes a listing of performers and related information , such as a performance time , a stage location , and a description . for example , in some establishments providing live entertainment , dancers , comedians or other types of entertainers may take the stage in a sequential order . some customers appreciate advance notice of the different performers that are scheduled to perform , and optionally statistical or personal information regarding each of those performers . optionally , the display system can also display the estimated time until each of the sequential performers will take the stage . similarly to the embodiments shown and described in fig3 and 4 , the menu display ui 500 may be configured to update or refresh periodically in near real - time in order to display the most notice content and configuration settings . thus , for example , the owner or manager may update the menu display to add new notice items or to delete notice items no longer needed or relevant ( e . g ., a performance schedule may be updated throughout the day and thus menu display information about scheduled performers may need to be updated accordingly ), and the interactive menu display system 100 may generate and update menu display ui 500 to be refreshed in near real - time . this way the owner or operator may be assured that the most current notice information is displayed within the retail establishment based on “ up - to - minute ” changes to the related information , such as performer replacements , scheduling changes , and the like . although not illustrated in fig5 , the menu display ui 500 may also be configured similarly to the menu display ui 300 of fig3 to enable display or presentation of a banner ui element . each of the features described with reference to fig3 may also be included in the menu display ui 500 of fig5 . fig6 - 17 illustrate example menu configuration user interfaces , as used in one or more embodiments of the interactive menu display system . the sample user interfaces may be displayed , for example , on a user computing device 162 via a web browser ( e . g ., as a web page ), a mobile application , or a standalone application . however , in some embodiments , the sample user interfaces shown in fig6 - 17 may also be displayed on any suitable computer device , such as a cell / smart phone , tablet , portable / mobile computing device , desktop , laptop , or personal computer , and are not limited to the samples as described herein . the user interfaces include examples of only certain features that an interactive menu display system may provide . in other embodiments , additional features may be provided , and they may be provided using various different user interfaces and software code . depending on the embodiment , the user interfaces and functionality described with reference to fig6 - 17 may be provided by software executing on the user computing device , by an interactive menu display system located remotely that is in communication with the computing device via one or more networks , and / or some combination of software executing on the computing device and the interactive menu display system . in other embodiments , analogous interfaces may be presented using audio or other forms of communication . in an embodiment , the interfaces shown in fig6 - 17 are configured to be interactive and respond to various user interactions . such user interactions may include clicks with a mouse , typing with a keyboard , touches and / or gestures on a touch screen , voice commands , physical gestures made within a proximity of a user interface , and / or the like . fig6 is an example menu display configuration ui 600 presenting a main menu of configuration options to enable a user , such as an owner or operator of a retail establishment , to customize food menu content and related display settings . the menu display configuration ui 600 includes a user - selectable option 602 to view configuration options for one or more displays or display types such as food , drink , and notices . in response to selection of one of the display options , the interactive menu display system 100 may generate or provide a different user interface for the respective selected display option . for example , selection of a “ drinks ” option may cause presentation of the menu display configuration ui 1100 illustrated and described with reference to fig1 herein , whereas selection of a “ notice ” option may cause presentation of the menu display configuration ui 1200 illustrated and described with reference to fig1 herein . the menu display configuration ui 600 may also include a user - selectable option 604 to toggle the view between the main menu configuration options as illustrated and a synchronization menu ( not illustrated ) by which the user can manually initiate synchronization of menu content and related display settings with one or more menu displays . fig6 provides several main menu options which the user may use to manage food menu content and display settings . selection of these main menu options will cause presentation of respective configuration uis . for example , a menu items option 606 may be provided , and upon selection by the user a menu item configuration user interface , such as the ui 700 of fig7 , may be presented . additionally , a background option 608 may be provided , and upon selection by the user a background configuration user interface , such as the ui 1300 of fig1 , may be presented ; a ticker option 610 may be provided , and upon selection by the user a ticker configuration user interface , such as the ui 1400 of fig1 , may be presented ; and / or a banner option 612 may be provided , and upon selection by the user a banner configuration user interface , such as the ui 1700 of fig1 , may be presented . fig7 is an example menu display configuration ui 700 presenting a menu of configuration options to enable a user , such as an owner or operator of a retail establishment , to customize menu item content and related display settings . fig7 provides several menu options which the user may use to configure menu item content and display settings . selection of these main menu options will cause presentation of respective configuration uis . for example , a point of sale interface option 702 may be provided , and upon selection by the user a point of sale configuration user interface , such as the ui 1000 of fig1 , may be presented ; an item content and style option 704 may be provided , and upon selection by the user an item content and style user interface , such as the ui 800 of fig8 , may be presented ; and / or an item defaults 706 may be provided , and upon selection by the user an item default configuration user interface , such as the ui 900 of fig9 , may be presented . fig8 is an example item content and style ui 800 presenting various configuration options to enable a user , such as an owner or operator of a retail establishment , to edit and customize menu item content and related display settings . menu item configuration options may include , for example , view navigation options such as a previous button 802 and a next button 804 to enable the user to quickly and easily navigate through multiple menu items . menu item configuration options may also include item creation and deletion options such as delete item button 806 and add before and / or add after button ( s ) 808 to enable the user to quickly add and remove items from the menu . for a particular menu item , menu item configuration options may include a title input element 810 , a description input element 812 , a price input element 816 , a horizontal alignment setting 818 with a left / center / right option 820 , and an image select option 822 which may include an associated dropdown list or menu of images available for selection . the dropdown list or menu of images available for selection may be generated , for example , based on a library or repository of images available for use with the display menu , which may be stored and / or accessed from the menu and content data store 170 . the item content and style configuration ui 800 may also present an image preview 826 which may be configured to update dynamically in response to the user &# 39 ; s selection of an image associated with the image select option 822 . the item content and style configuration ui 800 may also present , for one or more input elements ( such as the title input element 810 , the description input element 814 , and the price input element 816 ), an associated style option 812 which may , upon selection by the user , cause a popover style configuration user interface to be presented to enable the user to select one or more style options . the popover style configuration user interface may be similar to the example style configuration ui illustrated and described with reference to fig1 herein . when the user has finished providing item and content configuration settings for the menu item configuration options , the user may choose to accept 828 the changes or cancel 830 the changes . in response to the user accepting the changes , the user computing device may provide the item and content configuration settings to the interactive menu display system 100 , which may in turn re - generate or update any of the menu display uis which may be affected by any updates . in response to the user cancelling the changes , the user may be returned to another menu configuration ui , depending on the embodiment . fig9 is an example item default style settings user interface 900 presenting various configuration options to enable a user , such as an owner or operator of a retail establishment , to edit and customize menu item default display settings . item default style options may include , for example , options to configure default menu dimensions , including an option to specify whether a menu item grid 904 should be shown in the menu display , an option to specify a default number of rows 906 , and an option to specify a default number of columns 908 . additional item default style options 910 may include , for example , for each of title 912 , description 916 , and price 918 associated style options 914 . the associated style options 914 may , upon selection by the user , cause a popover style configuration user interface to be presented to enable the user to select one or more style options . the popover style configuration user interface may be similar to the example style configuration ui illustrated and described with reference to fig1 herein . further item default style options 910 may include , a horizontal alignment setting 920 with a left / center / right option 922 to indicate a default alignment for menu items within respective portions of a menu display ui . when the user has finished providing item default configuration settings for the item default configuration options , the user may choose to accept 924 the changes or cancel 926 the changes . in response to the user accepting the changes , the user computing device may provide the item default 14 configuration settings to the interactive menu display system 100 , which may in turn re - generate or update any of the menu display uis which may be affected by any updates . in response to the user cancelling the changes , the user may be returned to another menu configuration ui , depending on the embodiment . fig1 is an example point of sale configuration user interface 1000 presenting various configuration options to enable a user , such as an owner or operator of a retail establishment , to manage interfacing with a point of sale (“ pos ”) system . the pos system may be installed at the retail establishment , and may be a separate system from the interactive menu display system . interfacing between the pos system and the interactive menu display system may provide several benefits , including the ability to synchronize menu and content data for menus associated with the retail establishment with data from the pos system , which may include for example menu data related to items for sale at the retail establishment . as shown in fig1 , point of sale options may include , for example , an option 1002 to sync menu items from a pos system . this feature may be beneficial because the owner or manager of the retail establishment may have existing menu content data stored in conjunction with a pos system , which may be used to initialize or update corresponding data for the retail establishment stored in the menu and content data store 170 . this would reduce or eliminate the need to manually re - enter data for the same menu items . in another embodiment another option may be provided to enable synchronization of menu items from the interactive menu display system 100 to the pos system . depending on the embodiment the retail establishment may wish to keep one or the other of these systems as a primary data source , with the other being a secondary data source , and then periodically sync menu items from the primary data source to the secondary data source . additional point of sale options may include an option to specify whether an interface connection 1004 to the pos system is “ on ” or “ off ” and to specify a category number 1006 associated with the pos system . when the user has finished providing point of sale interface configuration settings for the point of sale options , the user may choose to accept 1008 the changes or cancel 1010 the changes . in response to the user accepting the changes , the user computing device may provide the point of sale interface configuration settings to the interactive menu display system 100 , which may in turn re - generate or update any of the menu display uis which may be affected by any updates . in response to the user cancelling the changes , the user may be returned to another menu configuration ui , depending on the embodiment . fig1 is an example menu display configuration ui 1100 presenting a main menu of configuration options to enable a user , such as an owner or operator of a retail establishment , to customize drink menu content and related display settings . similar to the menu display ui 600 of fig6 , the menu display configuration ui 1100 includes a user - selectable option 1102 to view configuration options for one or more displays or display types such as food , drink , and notices . in response to selection of one of the display options , the interactive menu display system 100 may generate or provide a different user interface for the respective selected display option . fig1 provides several main menu options which the user may use to manage drink menu content and display settings . selection of these main menu options will cause presentation of respective configuration uis . for example , a categories option 1104 may be provided , and upon selection by the user a menu item configuration user interface , similar to the ui 700 of fig7 , may be presented . additionally , a background option 1106 may be provided , and upon selection by the user a background configuration user interface , such as the ui 1300 of fig1 , may be presented ; a ticker option 1108 may be provided , and upon selection by the user a ticker configuration user interface , such as the ui 1400 of fig1 , may be presented ; and / or a banner option 1110 may be provided , and upon selection by the user a banner configuration user interface , such as the ui 1700 of fig1 , may be presented . fig1 is an example menu display configuration ui 1200 presenting a main menu of configuration options to enable a user , such as an owner or operator of a retail establishment , to customize notice menu content and related display settings . similar to the menu display ui 600 of fig6 , the menu display configuration ui 1200 includes a user - selectable option 1202 to view configuration options for one or more displays or display types such as food , drink , and notices . in response to selection of one of the display options , the interactive menu display system 100 may generate or provide a different user interface for the respective selected display option . fig1 provides several main menu options which the user may use to manage notice menu content and display settings . selection of these main menu options will cause presentation of respective configuration uis . for example , a background option 1204 may be provided , and upon selection by the user a background configuration user interface , such as the ui 1300 of fig1 , may be presented ; a ticker option 1206 may be provided , and upon selection by the user a ticker configuration user interface , such as the ui 1400 of fig1 , may be presented ; and / or a banner option 1208 may be provided , and upon selection by the user a banner configuration user interface , such as the ui 1700 of fig1 , may be presented . fig1 is an example background configuration ui 1300 presenting configuration options to enable a user , such as an owner or operator of a retail establishment , to customize a background image for a menu display . background options may include , for example , an option to select a background image 1302 , which may further include display of a list of background images 1304 available for selection . the background configuration ui 1300 may also present an image preview 1306 which may be configured to update dynamically in response to the user &# 39 ; s selection of an image from the list of background images 1304 . when the user has finished providing background configuration settings for the background options , the user may choose to accept 1308 the changes or cancel 1310 the changes . in response to the user accepting the changes , the user computing device may provide the background configuration settings to the interactive menu display system 100 , which may in turn re - generate or update any of the menu display uis which may be affected by any updates . in response to the user cancelling the changes , the user may be returned to another menu configuration ui , depending on the embodiment . fig1 is an example menu display configuration ui 1500 presenting a menu of configuration options to enable a user , such as an owner or operator of a retail establishment , to customize ticker content and display style settings . fig1 provides several menu options which the user may use to configure ticker content and display style settings . selection of these menu options will cause presentation of respective configuration uis . for example , a ticker content option 1402 may be provided , and upon selection by the user a point of sale configuration user interface , such as the ui 1500 of fig1 , may be presented ; and / or a style option 1404 may be provided , and upon selection by the user an item content and style user interface , such as the ui 1600 of fig1 , may be presented . fig1 is an example ticker configuration ui 1500 presenting configuration options to enable a user , such as an owner or operator of a retail establishment , to customize ticker content for a menu display . ticker content options may include , for example , a ticker display option 1502 which the user may set to “ on ” or “ off ” to enable or disable display of the ticker in a corresponding menu display ui . another ticker option may include a ticker type option 1504 to enable the user to choose between using a content feed , which the user can provide using a social media feed url option 1506 , or using one or more standard ticker values , which the user can provide using one or more standard ticker values 1508 . when the user has finished providing ticker content configuration settings for the ticker options , the user may choose to accept 1510 the changes or cancel 1512 the changes . in response to the user accepting the changes , the user computing device may provide the ticker configuration settings to the interactive menu display system 100 , which may in turn re - generate or update any of the menu display uis which may be affected by any updates . in response to the user cancelling the changes , the user may be returned to another menu configuration ui , depending on the embodiment . fig1 is an example style configuration ui 1600 presenting configuration options to enable a user , such as an owner or operator of a retail establishment , to customize style settings for a menu display . the style configuration ui 1600 may be provided in a variety of contexts , including but limited to : enabling configuration of style settings for a ticker , enabling configuration of style settings for menu items , enabling configuration of style settings for drink items , and so on . style options may include , for example , a text color 1602 , a background color 1606 , and a font 1610 . additional style options not shown may include a font size , font styles such as bold , italics , and underline , alignment settings , and the like . the style configuration ui 1600 may also provide an indicator of the currently selected text color 1604 and / or an indicator of the currently selected background color 1608 . when the user has finished providing style configuration settings for the style options , the user may choose to accept 1612 the changes or cancel 1614 the changes . in response to the user accepting the changes , the user computing device may provide the style configuration settings to the interactive menu display system 100 , which may in turn re - generate or update any of the menu display uis which may be affected by any updates . in response to the user cancelling the changes , the user may be returned to another menu configuration ui , depending on the embodiment . fig1 is an example banner configuration ui 1700 presenting configuration options to enable a user , such as an owner or operator of a retail establishment , to customize banner content and style for a menu display . banner options may include , for example , a social media app option 1702 which the user may set to “ on ” or “ off ” to enable or disable content from a social media application , social network , or other social media website . for example , the social media content may be accessed from a social media data feed , such as a facebook feed , a twitter feed , an instagram feed , and so on . additional banner options may include options to configure a position of the banner relative to menu items 1704 , including an option to specify an upper left corner 1706 and a lower right corner 1708 to define the corner edge boundaries of the banner . further banner options may include options to configure display intervals 1710 for timed presentation of the banner , including an option to specify an on time period 1712 and an off time period 1714 . the banner configuration ui 1700 may also provide an option to select one or more banner images 1716 , which may be presented as a dropdown menu 1718 listing one or more banner images available for display . the listing of one or more banner images may be accessed , for example , from the menu and content data store 170 . in another embodiment , the banner configuration ui 1700 may also provide an option to add or create a new banner image . the user may want to utilize this feature to , for example , create a custom banner image from a photograph of a menu item ( e . g ., food or drink ) available at the retail establishment , or of a performer who performs at the retail establishment , and so on . for example , the user may be provided with options to choose an existing photo ( e . g ., from a photo library that may be stored locally on the user &# 39 ; s computing device ), or to take anew photo ( e . g ., using a camera or video capture device on the user &# 39 ; s computing device ). once a photo is selected , the user may be presented with one or more photo editing options including options to crop the photo , apply photo filters ( e . g ., such as a filter optimized or designed to improve the appearance or presentation of food items in photographs ), and / or apply other image processing to the photo ( e . g ., color manipulation , image / photo rotation , resizing and / or zooming , image lighting effects , etc .). the user interface may also provide the user with an option to add text to be displayed with the photo , such as a title and / or a price . the user interface may also present options for the user to edit styles associated with the text ( e . g ., font size , text color , font style , etc .) via a similar style setting ui as described in the present disclosure . once the user has finished uploading the photo and selecting text , font , and style settings , the user may name the banner and be able to save the banner for use throughout the menu display . for example , the newly created banner may be saved to the menu and content data store 170 and accessed for use later in managing banner display settings via the banner configuration ui 1700 . in another embodiment , the banner configuration ui 1700 may also provide an option for the user to apply any of the one or more photo editing options described above ( e . g ., crop the photo , apply photo filters , and / or apply other image processing to the photo ) to an image selected for the banner ( e . g ., to an image that is already previously uploaded and / or available for use in the menu display , such as an image stored in the menu and content data store 170 ). this way the user can customize banner images in the image repository before or at the time of upload , or after uploading , depending on the circumstances . for example , the user may wish to re - use a certain image multiple times to create various different types of custom banners , such as with different types of filters applied and / or with different custom text ( e . g ., different prices for different times of day , for special offers or events , and so on ). when the user has finished providing banner configuration settings for the banner options , the user may choose to accept 1720 the changes or cancel 1722 the changes . in response to the user accepting the changes , the user computing device may provide the banner configuration settings to the interactive menu display system 100 , which may in turn re - generate or update any of the menu display uis which may be affected by any updates . in response to the user cancelling the changes , the user may be returned to another menu configuration ui , depending on the embodiment . fig1 is an example administrator portal user interface (“ ui ”) 1800 to enable a user , such as an owner or operator of a retail establishment , to manage one or more menu settings related to a menu display , as used in an embodiment . for example , the portal ui 1800 may be provided in an embodiment to enable the owner or manager to manage a menu from a more traditional desktop or standalone application such as a web browser . among other user control elements , the portal ui 1800 may include a sync option 1802 to enable the owner / user to manually synchronize the current menu content and layout settings with any corresponding menu display user interfaces which may be presented , for example , on display devices 166 . the example portal ui 1800 includes , via a menu on the left portion of the ui , a presentation of a drinks library submenu 1804 , which lists several different types of drinks / beverages ( e . g ., on tap , in rotation , cask , cellar , reserve , bottles , permanent ) and corresponding quantity amounts indicating an amount on - hand or available in the library . the portal ui 1800 also includes a presentation of a stores submenu 1806 listing stores available for management ( e . g ., as shown here , el segundo and lax ). the portal ui 1800 also includes a presentation of an images submenu 1808 which lists two submenu options for the user to manage , for example , banners / banner images and backgrounds , which may be stored in the menu and content data store 170 . the example portal ui 1800 of fig1 includes , a presentation of a categories submenu 1810 , which lists several different categories of drinks / beverages ( e . g ., ipas , ambers & amp ; reds , stouts & amp ; porters , white & amp ; wheat , belgian style , and bottles ), and corresponding quantity amounts indicating an amount on - hand or available in the library . the portal ui 1800 also includes a presentation of a ticker messages submenu 1812 , which may be selected by the user to manage ( e . g ., add , edit , delete , etc .) ticker - related settings , such as those illustrated and described with reference to fig1 herein . the portal ui 1800 also includes a presentation of a menu style defaults submenu 1814 , which may be selected by the user to manage ( e . g ., add , edit , delete , etc .) style and / or item default settings , such as those illustrated and described with reference to fig9 and 16 herein . the example portal ui 1800 of fig1 also illustrates a number of options which may be available to the user , including an option to add 1816 a new item to the currently selected library or category item , such as to add a new drink to the currently selected and displayed list of drinks 1830 . the portal ui 1800 also includes an option to view data 1820 , which may cause presentation of additional data related to the currently displayed list 1830 ; an option to sync 1822 the currently displayed list 1830 , for example to update any corresponding menu display user interfaces which may be presented , for example , on display devices 166 ; an option to connect to a database (“ db ”) 1824 to initiate a database connection ; an option to access a sirv store 1832 , which may provide access to special or additional templates , apps , banners , and other content which may be used with the interactive menu display system 100 ; and / or an option to print a menu 1834 , which may for example initiate printing of the menu according to the current menu library , content , style settings , and so forth . also shown in the sample portal ui 1800 of fig1 , a current item display 1826 may be provided to present detailed information about a particular item selected in the list 1830 . detailed information might include , for example , a name of a beverage , a name of the source ( e . g ., a brewery ), and / or current stock / inventory levels either in total across all stores and / or on a per - store basis as shown . the portal ui 1800 may also present a search option 1828 to enable the user to search the entire menu and / or library , including any / all food items , drink items , notice items , banners / banner images , advertising , and any other related content that may be stored in association with the menu and / or the retail establishment . fig1 is an example administrator portal user interface (“ ui ”) 1900 to enable a user , such as an owner or operator of a retail establishment , to manage user and system settings related to an interactive menu display system , as used in an embodiment . among other elements , the administrator portal ui 1900 may include an administrators control panel 1902 , which may for example , present various site configuration settings which may be managed by an owner , a general manager , or other authorized user . the site configuration settings might include for example settings related to access and presentation of the portal uis 1800 and 1900 as provided by the interactive display menu system 100 . the administrator portal ui 1900 may also include a users control panel 1904 , which may for example , enable the user to add new users 1906 or edit existing users 1908 , including managing / setting access levels , restrictions , and / or viewing options . for example , the owner or manager may wish to add a new user when a new employee is hired and grant the new user / employee certain rights and privileges with respect to administration of the menu for the retail establishment . for example , newer employees may initially be granted only viewing privileges and not be able to add to or edit the menu ; or , employees under the age of 21 may be denied access or authorization to any configuration settings related to alcoholic beverages offered by the retail establishment ; and so on . the administrator portal ui 1900 may also include a view logs control panel 1910 , which may for example , enable the user to view access logs and other system information related to user activity . the view logs may present an option to select filter options 1912 , including for example different types of filters such as pages accessed , login frequency , change log frequency , and other similar administrative log metrics which may be of interest to the owner or manager of the retail establishment . fig2 is a logical flow diagram illustrating one embodiment of a process 2000 for providing an interactive menu display , as used in an embodiment . in various embodiments , fewer blocks or additional blocks may be included in the process , or various blocks may be performed in an order different from that shown in fig2 . in particular , the blocks in fig2 may be performed by a user computing device 162 , the interactive menu display system 100 , depending for example on which computing device / software service has access to the required menu content data , for example . at block 2005 of fig2 , the interactive menu display system 100 generates a menu display user interface ( ui ) including menu of items available at a retail establishment and / or related content such as notices , advertising , and the like . the menu display user interface may be , for example , any of the example display menu user interfaces illustrated and described with reference to fig2 - 5 herein . although the example described with reference to the process 2000 involves one menu display ui , in some embodiments more than one menu display ui may be generated in parallel . for example , in one embodiment a retail establishment may have several display devices to enable display of multiple menu display user interfaces , such as a food display menu , a drinks display menu , and a notice / information display menu , each of which may be generated by the interactive menu display system 100 . at block 2010 , the interactive menu display system 100 provides the generated menu display ui for display on a first electronic display device at the retail establishment . in one embodiment , the generated menu display ui is provided directly to the first electronic display device . in another embodiment , the generated menu display ui is provided to an intermediary system , such as another computing system at the retail establishment , which may in turn provide the generated menu display ui to the first electronic display device . at block 2015 , the interactive menu display system 100 may generate a menu display commander user interface to enable an owner or manager of the retail establishment to configure content and layout settings for the menu . the menu display commander user interface may be , for example , any of the example menu configuration user interfaces illustrated and described with reference to fig6 - 17 herein . in some embodiments , the menu configuration user interfaces are optimized for display on a portable computing device such as a smart phone or a tablet . at block 2020 , the interactive menu display system 100 provides the menu display commander user interface for display on a computing device distinct from the first electronic display device . for example , the computing device may be a user computing device , such as a smart phone or a tablet , accessible by the owner or manager of the retail establishment . at block 2025 , the interactive menu display system 100 receives from the computing device content and layout settings for the menu . the content and layout settings may include any of the configuration settings described and discussed herein , such as the configuration settings described and discussed with reference to fig6 - 17 . for example , in response to the user clicking on an “ accept ” button or navigating away from a particular menu configuration user interface , the computing device may collect configuration settings data from the menu configuration user interface and send the configuration settings data to the interactive menu display system 100 . at block 2030 , the interactive menu display system 100 updates the menu display ui based on the received content and layout settings . for example , if the user updated the menu dimensions and / or layout ( e . g ., the number and / or arrangement of rows and columns ), the menu display ui may be re - generated or updated to reflect the updated menu dimensions and / or layout . in another example , if the user removed an item from the menu ( e . g ., a beer on tap may have run out and is no longer available , or a limited supply food item may have run out and is no longer available , etc . ), the menu display ui may be re - generated or updated to remove the item from the menu display . at block 2035 , the interactive menu display system 100 provides the updated menu display ui for display on the first electronic display device at the retail establishment . in one embodiment interactive menu display system 100 provides the updated menu display ui in near - real time , such that changes or updates made by the owner or manager via the menu configuration ui are propagated to the first electronic display device for display in seconds or less . in one embodiment the first electronic display device replaces the menu display ui with the updated menu display ui immediately after the interactive menu display system 100 provides the updated menu display ui to ensure that the most “ current ” menu is displayed at any given time . once the process 2000 completes blocks 2025 to 2035 , the process may be repeated on recurring , continuing , and / or periodic basis so that changes to the menu configuration may be received or detected , and the appropriate menu display user interface ( s ) may be updated in a timely manner . fig2 is a logical flow diagram illustrating a process 2100 for generating menu display user interfaces based on configuration settings received via one or more menu configuration user interfaces provided by the interactive menu display system 100 , as used in an embodiment . at block 2105 , the interactive menu display system 100 , for example via the user interface module 124 , generates an interactive menu configuration user interface to enable an owner or manager of a retail establishment to manage a display menu for the retail establishment . the interactive menu configuration user interface may be , for example , any of the example configuration menu user interfaces illustrated and described with reference to fig6 - 17 herein . the interactive menu configuration ui may provide one or more configuration options which the owner or manager can use to edit display menu content ( e . g ., menu items such as food or drink , notices , advertising or banner content , etc .) and display settings ( e . g ., layout , colors , images , font styles , etc .). at block 2110 , the interactive menu display system 100 receives a selection of configuration settings for respective menu display configuration options . in one embodiment , the interactive menu display system 100 may receive configuration settings serially for respective menu display configuration options which are presented in respective menu configuration user interfaces . for example , in response to the user clicking on an “ accept ” button or navigating away from a respective menu configuration user interface , the interactive menu display system 100 may receive configuration settings data from the respective menu configuration user interface . in another embodiment , the interactive menu display system 100 may receive configuration settings in batches for respective menu display configuration options which are presented in several user interfaces . for example , the interactive menu display system 100 may receive configuration settings data from several of the respective menu configuration user interfaces in response to the user clicking on a “ sync ” button in order to synchronize updates to multiple configuration options across several of the respective menu configuration user interfaces . at block 2115 , the interactive menu display system 100 generates one or more menu display user interfaces based on the received configuration settings . the menu display user interfaces may then be provided to , for example , one or more display devices 166 to enable the display devices 166 to present the menu display at the retail establishment . examples of menu display user interfaces which may be generated and provided by the interactive menu display system 100 are illustrated and discussed with respect to fig2 , 3 , 4 , and 5 herein . once the process 2100 completes blocks 2105 to 2115 , the process may be repeated on recurring , continuing , and / or periodic basis so that changes to the menu configuration may be received or detected , and the corresponding menu display user interface ( s ) may be updated in a timely manner . fig2 is a block diagram of an example implementation of an interactive menu display system 100 in communication with a network 160 and various systems , such as user computing device ( s ) 162 ( e . g ., a smart phone , a tablet , a laptop , a personal computer , or any other computing device ), retail establishment system ( s ) 168 , display device ( s ) 166 , and menu content data source ( s ) 170 . the interactive menu display system 100 may be used to implement systems and methods described herein , including but not limited to the processes 2000 and 2100 of fig2 and 21 , respectively . the interactive menu display system 100 includes , for example , a personal computer that is ibm , macintosh , or linux / unix compatible or a server or workstation . in one embodiment , the interactive menu display system 100 comprises a server , a laptop computer , a smart phone , a personal digital assistant , a kiosk , or an media player , for example . in one embodiment , the exemplary interactive menu display system 100 includes one or more central processing unit (“ cpu ”) 150 , which may each include a conventional or proprietary microprocessor . the interactive menu display system 100 further includes one or more memory 130 , such as random access memory (“ ram ”) for temporary storage of information , one or more read only memory (“ rom ”) for permanent storage of information , and one or more mass storage device 120 , such as a hard drive , diskette , solid state drive , or optical media storage device . typically , the modules of the interactive menu display system 100 are connected to the computer using a standard based bus system 180 . in different embodiments , the standard based bus system could be implemented in peripheral component interconnect (“ pci ”), microchannel , small computer system interface (“ scsi ”), industrial standard architecture (“ isa ”) and extended isa (“ eisa ”) architectures , for example . in addition , the functionality provided for in the components and modules of interactive menu display system 100 may be combined into fewer components and modules or further separated into additional components and modules . the interactive menu display system 100 is generally controlled and coordinated by operating system software , such as windows xp , windows vista , windows 7 , windows 8 , windows server , unix , linux , sunos , solaris , ios , blackberry os , or other compatible operating systems . in macintosh systems , the operating system may be any available operating system , such as mac os x . in other embodiments , the interactive menu display system 100 may be controlled by a proprietary operating system . conventional operating systems control and schedule computer processes for execution , perform memory management , provide file system , networking , i / o services , and provide a user interface , such as a graphical user interface (“ gui ”), among other things . the exemplary interactive menu display system 100 may include one or more commonly available input / output ( i / o ) devices and interfaces 110 , such as a keyboard , mouse , touchpad , and printer . in one embodiment , the i / o devices and interfaces 110 include one or more display devices , such as a monitor , that allows the visual presentation of data to a user . more particularly , a display device provides for the presentation of guis , application software data , and multimedia presentations , for example . the interactive menu display system 100 may also include one or more multimedia devices 140 , such as speakers , video cards , graphics accelerators , and microphones , for example . in the embodiment of fig2 , the i / o devices and interfaces 110 provide a communication interface to various external devices . in the embodiment of fig2 , the interactive menu display system 100 is electronically coupled to a network 160 , which comprises one or more of a lan , wan , and / or the internet , for example , via a wired , wireless , or combination of wired and wireless , communication link 115 . the network 160 communicates with various computing devices and / or other electronic devices via wired or wireless communication links . according to fig2 , in some embodiments information may be provided to the interactive menu display system 100 over the network 160 from one or more menu content data sources 170 . the menu content data source ( s ) 170 may include one or more internal and / or external data sources . in some embodiments , one or more of the databases or data sources may be implemented using a relational database , such as sybase , oracle , codebase and microsoft ® sql server as well as other types of databases such as , for example , a flat file database , an entity - relationship database , and object - oriented database , and / or a record - based database . the menu content data source ( s ) 170 may store , for example , data for the interactive menu display system , such as information or data about menu items available at a retail establishment including food and drinks ; notices including information about upcoming events , special offers for the retail establishment , information about performers and performance schedules , and the like ; advertising content , including ads for the retail establishment and / or ads for related products or services which may be displayed on the menu display user interfaces in exchange for a service fee ; data related to display settings and / or layout settings for the menu display user interfaces ; images and other display content for the menu ; and so forth . in the embodiment of fig2 , the interactive menu display system 100 includes a menu display configuration module 122 and a user interface module 124 that may be stored in the mass storage device 120 as executable software codes that are executed by the cpu 150 . these and other modules in the interactive menu display system 100 may include , by way of example , components , such as software components , object - oriented software components , class components and task components , processes , functions , attributes , procedures , subroutines , segments of program code , drivers , firmware , microcode , circuitry , data , databases , data structures , tables , arrays , and variables . in the embodiment shown in fig2 , the interactive menu display system 100 is configured to execute the menu display configuration module 122 and / or the user interface module 124 to perform the various methods and / or processes for mobile sightings data analysis as described herein ( such as the processes described with respect to fig2 and 21 herein ). user interface module 124 may generate and render one or more visual user interfaces ( such as the user interfaces illustrated and described with respect to fig2 - 17 ). retail establishment systems ( s ) 168 may include a point of sale (“ pos ”) system . interfacing between the pos system and the interactive menu display system may provide several benefits , including the ability to synchronize menu and content data for menus associated with the retail establishment with data from the pos system , which may include for example menu data related to items for sale at the retail establishment . retail establishment systems ( s ) 168 may also include or be in communication with one or more display device ( s ) 166 to enable display of the menu display user interfaces described herein . in one embodiment , the interactive menu display system 100 may be in communication with the one or more display device ( s ) 166 , such that the menu display user interfaces may be provided directly from the interactive menu display system 100 to the display device ( s ). in another embodiment , the interactive menu display system 100 may be in communication with the retail establishment system ( s ) 168 , such that the menu display user interfaces may be provided indirectly from the interactive menu display system 100 to the display device ( s ) through the retail establishment system ( s ) 168 . embodiments can be implemented such that all functions illustrated herein are performed on a single device , while other embodiments can be implemented in a distributed environment in which the functions are collectively performed on two or more devices that are in communication with each other . moreover , while the computing system has been used to describe one embodiment of interactive menu display system 100 , it is recognized that the user systems may be implemented as computing systems as well . in general , the word “ module ,” as used herein , refers to logic embodied in hardware or firmware , or to a collection of software instructions , possibly having entry and exit points , written in a programming language , such as , for example , java , lua , c or c ++. a software module may be compiled and linked into an executable program , installed in a dynamic link library , or may be written in an interpreted programming language such as , for example , basic , perl , or python . it will be appreciated that software modules may be callable from other modules or from themselves , and / or may be invoked in response to detected events or interrupts . software modules configured for execution on computing devices may be provided on a computer readable medium , such as a compact disc , digital video disc , flash drive , or any other tangible medium . such software code may be stored , partially or fully , on a memory device of the executing computing device , such as the interactive menu display system 100 , for execution by the computing device . software instructions may be embedded in firmware , such as an eprom . it will be further appreciated that hardware modules may be comprised of connected logic units , such as gates and flip - flops , and / or may be comprised of programmable units , such as programmable gate arrays or processors . the modules described herein are preferably implemented as software modules , but may be represented in hardware or firmware . generally , the modules described herein refer to logical modules that may be combined with other modules or divided into sub - modules despite their physical organization or storage . it is recognized that the term “ remote ” may include systems , data , objects , devices , components , or modules not stored locally , that are not accessible via the local bus . thus , remote data may include a system which is physically stored in the same room and connected to the computing system via a network . in other situations , a remote device may also be located in a separate geographic area , such as , for example , in a different location , country , and so forth . each of the processes , methods , and algorithms described in the preceding sections may be embodied in , and fully or partially automated by , code modules executed by one or more computer systems or computer processors comprising computer hardware . the code modules may be stored on any type of non - transitory computer - readable medium or computer storage device , such as hard drives , solid state memory , optical disc , and / or the like . the systems and modules may also be transmitted as generated data signals ( e . g ., as part of a carrier wave or other analog or digital propagated signal ) on a variety of computer - readable transmission mediums , including wireless - based and wired / cable - based mediums , and may take a variety of forms ( e . g ., as part of a single or multiplexed analog signal , or as multiple discrete digital packets or frames ). the processes and algorithms may be implemented partially or wholly in application - specific circuitry . the results of the disclosed processes and process steps may be stored , persistently or otherwise , in any type of non - transitory computer storage such as , e . g ., volatile or non - volatile storage . the various features and processes described above may be used independently of one another , or may be combined in various ways . all possible combinations and subcombinations are intended to fall within the scope of this disclosure . in addition , certain method or process blocks may be omitted in some implementations . the methods and processes described herein are also not limited to any particular sequence , and the blocks or states relating thereto can be performed in other sequences that are appropriate . for example , described blocks or states may be performed in an order other than that specifically disclosed , or multiple blocks or states may be combined in a single block or state . the example blocks or states may be performed in serial , in parallel , or in some other manner . blocks or states may be added to or removed from the disclosed example embodiments . the example systems and components described herein may be configured differently than described . for example , elements may be added to , removed from , or rearranged compared to the disclosed example embodiments . conditional language used herein , such as , among others , “ can ,” “ could ,” “ might ,” “ may ,” “ e . g .,” and the like , unless specifically stated otherwise , or otherwise understood within the context as used , is generally intended to convey that certain embodiments include , while other embodiments do not include , certain features , elements and / or steps . thus , such conditional language is not generally intended to imply that features , elements and / or steps are in any way required for one or more embodiments or that one or more embodiments necessarily include logic for deciding , with or without author input or prompting , whether these features , elements and / or steps are included or are to be performed in any particular embodiment . the terms “ comprising ,” “ including ,” “ having ,” and the like are synonymous and are used inclusively , in an open - ended fashion , and do not exclude additional elements , features , acts , operations , and so forth . also , the term “ or ” is used in its inclusive sense ( and not in its exclusive sense ) so that when used , for example , to connect a list of elements , the term “ or ” means one , some , or all of the elements in the list . conjunctive language such as the phrase “ at least one of x , y and z ,” unless specifically stated otherwise , is otherwise understood with the context as used in general to convey that an item , term , etc . may be either x , y or z . thus , such conjunctive language is not generally intended to imply that certain embodiments require at least one of x , at least one of y and at least one of z to each be present . while certain example embodiments have been described , these embodiments have been presented by way of example only , and are not intended to limit the scope of the disclosure . thus , nothing in the foregoing description is intended to imply that any particular element , feature , characteristic , step , module , or block is necessary or indispensable . indeed , the novel methods and systems described herein may be embodied in a variety of other forms ; furthermore , various omissions , substitutions and changes in the form of the methods and systems described herein may be made without departing from the spirit of the inventions disclosed herein . the accompanying claims and their equivalents are intended to cover such forms or modifications as would fall within the scope and spirit of certain of the inventions disclosed herein . it should be emphasized that many variations and modifications may be made to the above - described embodiments , the elements of which are to be understood as being among other acceptable examples . all such modifications and variations are intended to be included herein within the scope of this disclosure . the foregoing description details certain embodiments . it will be appreciated , however , that no matter how detailed the foregoing appears in text , the systems and methods can be practiced in many ways . for example , a feature of one embodiment may be used with a feature in a different embodiment . as is also stated above , it should be noted that the use of particular terminology when describing certain features or aspects of the systems and methods should not be taken to imply that the terminology is being re - defined herein to be restricted to including any specific characteristics of the features or aspects of the systems and methods with which that terminology is associated .	6
the present invention , an apparatus for cleaning carpets , drapes , wall coverings , and similar objects , is shown in overview in fig1 . cleaning tool head or wand 10 includes a rigid section 16 and handle 14 for manipulating an elongate nozzle 18 over the surface of the fabric . the nozzle 18 communicates internally by a flexible conduit or hose 12 with a vacuum source 20 . the vacuum source 20 may be a conventional vacuum cleaner , including a fan motor 24 and a housing 22 . the nozzle 18 also communicates , through cleaning liquid hose 53 , with a venturi 50 and pump 35 . on the other side of the venturi 50 and pump 35 is a pipe 31 communicating with cleaning liquid tank 30 . tank 30 preferably holds pure water for cleaning the fabric , but may alternatively hold a conventional cleaning liquid , such as a solution of water with detergent or a non - aqueous liquid . a suitable heating means 90 , for example a thermostat - controlled electric heater , may also be provided to heat the cleaning liquid in the tank 30 . the cleaning liquid pump 35 is disposed either between the venturi 50 and the tool 10 or , alternatively , between the venturi 50 and the tank 30 ; both positions are shown in fig1 which depicts two of the venturi 50 in various positions . the venturi position between the pump 35 and tool 10 is preferred to avoid cavitation . at the venturi 50 air from ozone delivery lines 61 and 65 is sucked into the cleaning liquid that passes from the pipe 31 into a cleaning liquid delivering hose 53 . ozonated air for the ozone delivery line 61 is made in an ozone generator 60 which is preferably of the corona discharge type . while the ozone generator 60 may instead be a uv - type ozone generator , such a uv ozone generator is not preferred because , as indicated above , it is not nearly as efficient as a corona discharge type ozone generator . air for the ozone generator 60 is supplied through an air line 76 and , optionally , an air compressor 70 . alternating voltage , needed to ozonize air within the ozone generator 60 , is supplied from a transformer 80 or other source of alternating voltage . in one embodiment of the present invention , an electrical device 82 may be used to generate high - frequency alternating current , which may then be sent to the transformer 80 for voltage increase or else applied directly to the generator 60 ( not shown ). ozone - bearing air leaves the generator through air line 76 . fig1 shows three - way selection valve 62 that can be used to direct the air selectively into one of the venturis 50 via air lines 65 or the tank 30 via an air line 63 . if desired , while the machine is resting , the two - way selection valve 62 can direct ozonated air from the generator 60 directly into the tank 30 via the air line 63 , whence it may bubble up through the cleaning liquid ; however , when the machine is actively being used , the selection valve should be rotated so that the ozonated air from the generator 60 will go directly to the pipe 31 as described above . it will be understood that the two - way selection valve 62 is not essential , i . e . it may be omitted along with the line 63 . the ozone generator 60 is conventional in design , including an inner cylindrical electrode and an outer cylindrical electrode . the air stream flows between the two electrodes where a high voltage field is created by alternating voltage impressed from the transformer 80 . the transformer 80 contains a primary winding connected to a line voltage and a secondary winding in which a voltage as high as several thousand volts is induced . this voltage is placed across the two electrodes to ozonize the air within . fig1 depicts a concentric - cylinder type of ozone generator 60 . a parallel flat plate arrangement is an alternative , conventional ozone generating configuration . the transformer 80 may be replaced by an electrical devise of conventional type which creates alternating currents at frequencies higher than line voltage . it will be understood that , while fig1 depicts two venturis 50 , placement of the ozone delivery line 65 and the venturi 50 ( or other ozonated air delivery means ) either solely downstream or solely upstream of the cleaning liquid pump 35 ( i . e . between the cleaning liquid pump 35 and the cleaning head tool 10 or between the tank 30 and the cleaning liquid pump 35 ) are alternative embodiments , which may be used alone in the present invention , although a single venturi is not illustrated . the operation of the invention is as follows : the tank 30 is filled with suitable cleaning liquid . the liquid is preferably water , because detergents can neutralize ozone . the vacuum cleaner 20 is activated and transformer 80 is energized with electricity . the air compressor 70 may optionally be activated also . pump 35 is also activated . it draws cleaning liquid from the tank 30 and forces it through the venturi 50 and onward to the cleaning liquid hose 53 and nozzle 18 . the venturi 50 contains a constricted throat region in which cleaning liquid is forced to flow more quickly , due to the narrower cross - sectional area in the throat . the high velocity of the cleaning liquid creates a partial vacuum which draws ozonized air through the ozone delivery line 65 and injects the air into the stream of cleaning liquid from pipe 31 . the air compressor 70 may optionally be used either alone or in conjunction with the venturi 50 to aid in injecting air into the cleaning liquid stream . air drawn into the air compressor 70 is forced through the air line 76 to the ozone generator 60 . the present invention , by injecting ozone - bearing air into water , moves the ozone into solution in the water and reduces the concentration in the air . pure ozone is 12 . 5 times more soluble in water than oxygen is ; the optimum concentration of ozone in air for solubility into water is 2 %. the ozone is thus removed from the air , where it can irritate persons who breath it , and put directly in contact with the fabric to be cleaned by the cleaning liquid . the cleaning liquid is then sucked up by the vacuum system before the ozone can dissolve back into the ambient air . various embodiments of the present invention may be assembled in different configurations . for example , the invention may be housed together in one enclosure or conveyance ( e . g ., a truck ), except for the hoses and cleaning head tool or wand that may be extended to the surface that is to be cleaned . for another example , the vacuum source and tank may be housed together but the ozone generator may be housed separately , as in the case of a portable or auxiliary ozone generator attached to a main unit or units that include the tank , vacuum source , or other parts of the invention . in the case of the later example , the ozonated air injection means might include : an intermediate coupling fitted between the cleaning head tool and the hoses ; a pipe fitting , valve , nozzle , or like device adapted to coupling with the liquid conduit ; an air injection needle for penetrating the liquid hose ; or any other interconnection means for coupling or injecting air into the fabric cleaning device , whether the injection is accomplished between the tank and the liquid conduit , the conduit and the cleaning head tool , directly into a hose , at a fitting , or any other way . thus , the present invention may be practiced with standard equipment consisting of cleaning apparatus , ozone generators , and auxiliary fittings or adapters for joining the generator to the cleaning apparatus . one embodiment of the present invention , shown in fig2 includes all the working parts within a housing 100 that is movable , by means of wheels 101 and a handle 114 , such that a nozzle 118 can be moved over a surface . an ozone generator 160 is mounted within the housing 100 . the housing 100 may include a tank or tanks 130 , and a rotary element 102 ( scrubbing brush , polisher , etc .) may optionally be mounted onto the housing 100 either permanently or removably . a hose connection 112 may optionally be provided for an auxiliary flexible vacuum hose ( not shown in fig2 ). a third embodiment of the present invention is depicted in fig3 . this embodiment is similar to that of fig2 but includes no internally - housed ozone generator . instead , an auxiliary portable ozone generator 160 &# 39 ; is connected to the housing 100 by means of a coupling 162 , which accepts the end of an ozonated air delivery hose 161 . in related embodiments ( not shown ) the generator 160 &# 39 ; could be demountably attached to the housing 100 , and the ozone connection made either by hose or pipe , or internally , as by a gasket and sealing surfaces on the generator 160 &# 39 ; and housing 100 . the foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can , by applying current knowledge , readily modify and / or adapt for various applications such specific embodiments , without departing from the generic concepts , and , therefore , such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments . it is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation .	0
the mixing capsule illustrated in fig1 comprises an outer capsule , generally designated 2 , adapted to receive one of the materials , schematically indicated as m1 , to be mixed ; and an inner capsule , generally designated 3 , adpated to receive the other material , schematically indicated as m2 , to be mixed . for purposes of example , the mixing capsule assembly illustrated in fig1 may be for preparing a dental amalgam ; in such case , material m2 within the inner capsule 3 is mercury which is to be mixed with a powder material m1 contained within the outer capsule 2 , this usually being done by vibrating the capsule assembly in a high - frequency vibrator , e . g . one operating at 3 , 000 cycles per minute ( 50 cycles per second ) for about five seconds . the outer capsule 2 is constituted of a main section 21 of cylindrical configuration closed at one end by an end wall 22 and open at the opposite end . a cap 23 is frictionally applied over the open end of section 21 to close it . the inner capsule 3 is of an overall length slightly less than one - half the length of the other capsule 2 . the inner capsule is also constituted of two sections , namely , an inner cyllndrical section 31 closed at one end by an end wall 32 formed with a central bore 33 , and open at the opposite end ; and an outer section 34 also closed at one end by an end wall 35 and open at the opposite end , which latter end is frictionally received over the outer face of the inner section 31 . the outer section 34 further includes a stem 36 integrally formed with end wall 35 an and extending axially of section 34 . the length of stem 36 is greater than the length of section 34 , so that the stem , when section 34 is assembled with section 31 , passes through bore 33 of section 31 and projects pa past the outer face of its end wall 32 . as shown in fig2 bore 33 in end wall 32 is of conical configuration , increasing in diameter from the outer end to the inner end . the outer tip 36a of stem 36 is of complementary conical configuration , also increasing in diameter from the outer end to a line 36b slightly inwardly of the inner face of end wall 32 in the illustrated assembled condition of the inner capsule 3 . the remaining portion 36c of stem 36 may also be tapered to provide a curved juncture 37 with end wall 35 . the juncture of end wall 35 with the outer cylindrical section 34 is preferably also curved , as shown at 38 . actually , both junctures 37 and 38 may be effected by a semicircular surface between stem 36 and the outer cylindrical wall of section 34 . the capsule assembly illustrated in fig1 and 2 is used in the following manner : first , the inner capsule 3 is opened by separating its two sections 31 and 34 , and the material m2 ( e . g ., mercury ) is introduced into section 34 whereupon section 31 is attached thereto by press - fitting stem 36 of section 34 through bore 33 of section 31 . this causes the opposite end of the inner capsule also to be closed by the engagement of the inner face of section 34 with the outer face of section 31 , as shown in fig2 . the outer capsule 2 is then opened by separating its cap 23 from its main section 22 . the inner capsule 3 is inserted with the outer capsule 2 , and also introduced within capsule 2 is the material m1 ( e . g ., powder ) to be mixed with the material m2 within the inner capsule 3 . cap 23 is then press - fitted over the open end of section 21 to close the outer capsule 2 . the outer capsule 2 , with the materials m1 and 122 within it and separated by the walls of the inner capsule 3 , may be shipped and stored with the assurance that the material m2 is sealed within the inner capsule 3 and cannot leak out to come into contact with the material m1 within the outer capsule 2 . when the illustrated capsule assembly is to be used , it is merely inserted into the usual vibrator which vibrates the capsule at about 3000 cycles per minute ( e . g ., 50 cycles per second ) parallel to the longitudinal axis of the outer capsule 2 . during this operation , the inner capsule 3 is rapidly vibrated within the outer capsule 2 , alternatively impacting against end wall 22 of the outer capsule , and against cap 23 at the opposite end of the outer capsule . during the former impacts , the projecting end 36a of stem 36 impacts against the inner face of end wall 22 , thereby causing section 31 to move ( leftwardly in fig2 ) with respect to section 34 . thus , relative movement is effected between the conical end 36a of stem 36 , and the conical bore 33 in end wall 32 , thereby slightly separating the complementary surfaces of these two elements . material m2 ( e . g ., mercury ) within the inner capsule 3 is set into motion by these vibrations , and same is thus permitted to pass through this space from inside the inner capsule 3 into the outer capsule 2 . during the movements of the inner capsule 3 in the opposite direction , i . e ., wherein its end wall 35 impacts against the inner face of cap 23 , section 31 of the inner capsule will move towards section 34 , thereby restoring the seal between the conical end 36a of stem 36 and the conical bore 33 in end wall 32 . it will thus be seen that for each reciprocatory cycle of movement of the inner capsule 3 within the outer capsule 2 , the conical end 36a of stem 36 will move sufficiently with respect to conical bore 33 so as to permit some of the material m2 to pass from the interior of the inner capsule 3 into the interior of the outer capsule 2 , and to come into direct contact with material m1 in that capsule . as one example , particularly useful for preparing dental amalgams , the length of the outer capsule 2 was 31 mm . ; its inner diameter was 10 mm . ; the length of the inner capsule 3 , from the outer face of its conical stem 36a to the outer face of end wall 35 was 12 mm ., with stem 36a projecting about 0 . 3 - 0 . 5 mm . from the outer face of end wall 32 ; and the outer diameter of the inner capsule 3 , particularly of its outer section 34 , was 8 . 5 mm . in this example , the outer capsule 2 was made of polypropylene and the inner capsule 3 was made of a harder material , namely , a polycarbonate . material m2 included within the inner capsule was mercury , and material m1 included externally of the inner capsule but internally of the outer capsule 2 was a powder which , when mixed with mercury , produced a dental amalgam . it was found that after five seconds of vibration in a conventional vibrator operating at 3000 cycles per minute ( 50 cycles per second ), all the mercury m2 left the inner capsule 3 and became thoroughly mixed with the material m1 to produce the desired amalgam . it will be appreciated that the mixing capsule assembly illustrated in fig1 and 2 provides a number of important advantages . thus , after the capsule has been assembled with the two sections 31 , 34 of the inner capsule 3 friction - fitted to effect a tight seal with respect to the material m2 within it , a high degree of assurance is provided against leakage of any of the material m2 during the normal handling and storage of the capsule assembly . the illustrated constuction also provides a high degree of assurance that all the material m2 will leave the inner capsule to mix with the material m1 during the normal high - speed vibration of the assembly . further , the inner capsule 3 while and after dispensing its material m2 , serves as a pestle to effect a thorough mixing of the two materials . moreover , there is no chance of foreign matter entering the mixture , such as the remanents of the barrier or inner bag or foil as in some of the existing mixing capsules . still further , the capsules can be conveniently filled with the required materials and assembled ready for use . finally , the parts of the illustrated capsule assembly are few , simple , and susceptible to volume production at low cost . in the above - described fig1 - 2 embodiment , it will be seen that the contents of the inner capsule 3 penetrate only through one wall of the capsule during one - half cycles of each complete cycle of vibration . fig3 illustrates a construction of the inner capsule which permits some of its contents to penetrate through the two opposite sides of the capsule , some material during the strokes in one direction , and other material during the strokes in the other direction . thus , in the construction of the inner capsule illustrated in fig3 and therein designated 103 , there are also two sections 131 and 134 respectively , with section 131 including a conical bore 133 in its end wall 132 , and section 134 including a stem 136 having a conical end 136a received within conical bore 133 . however , in the construction illustrated in fig3 conical bore 133 is tapered in the opposite direction from that of fig2 namely , decreasing in diameter from the outer face of end wall 132 to its inner space . conical tip 136a of stem 136 is formed with a complementary surface also decreasing in diameter from its outer face to its inner face . further , conical tip 136a does not project completely through bore 133 , as in fig2 but rather is normally recessed within that bore when in its normal sealing position in that bore , as illustrated in fig3 . to facilitate assembling the outer conical portion 136a to the remainder of stem 136 , portion 136a may be constructed as a separate element and then assembled to stem 136 , as by a press - fit , threads , adhesive , or the like , after section 134 has been press - fitted into section 131 of the inner capsule 103 . in addition , the outer open end 131a of section 131 projects past the outer face of section 134 when the two sections are in their assembled condition , as illustrated in fig3 . in addition , the inner face of section 131 at its outer tip 131a is inwardly tapered , as shown at 131b , such that section 134 may be press - fitted into section 131 to provide a seal between face 131b and the outer face of section 134 . however , upon movement of section 134 away from bore 133 ( i . e ., rightwardly in fig3 ), a space is formed between the inner surface 131b of section 131 , and the outer surface of section 134 , to permit some of the material within the inner capsule to leave it . it will thus be seen that when the inner capsule 133 impacts against the end wall 22 of the outer capsule 2 in fig1 the conical portion 136a of stem 136 moves leftwardly within the conical bore 133 to provide a space for permitting some of the material within the inner capsule 103 to leave ; and when the open end 131a of the inner capsule 103 impacts against cap 23 of the outer capsule , the inner section 134 moves in the opposite direction , rightwardly in fig3 to close the passage between the conical porition 136a of stem 136 and the bore 133 , and to open the passageway between the inner face of section 131 and the outer face of section 134 . thus , in the construction of inner capsule illustrated in fig3 material ( m2 ) will be ejected out through the capsule during both of the half - cycles of vibration , and therefore will be dispensed at a faster rate than in the capsule illustrated in fig2 . apart from this , the capsule of fig3 provides all the other advantages as the capsule of fig2 including its function as a pestle during the mixing operation . while the invention has been described above with respect to capsule assembles for mixing one material within the outer capsule and a second material within the inner capsule , it will be appreciated that it could be used for mixing more than two materials , for example , by providing two ( or more ) inner capsules , each according to the construction of fig2 or 3 . this is shown in fig4 wherein a single outer capsule 202 encloses two inner capsules 203a , 203b , each of which capsules may include materials to be mixed , thereby effecting a mixing of three materials . it will also be appreciated that the materials to be mixed could be included only in the two ( or more ) inner capsules , and not in the outer capsule , thereby better assuring isolation of the materials until they are to be mixed . many other variations , modifications , and applications of the invention will be apparent .	0
aspects and embodiments are directed to providing efficient and reliable methods for identification of 3d printed parts based on weight . other aspects and embodiments are directed to systems that implement identification of 3d printed parts based on weight . efficiency and reliability may be achieved by providing embodiments that enable automatically selecting a subset of 3d models that may correspond to a 3d printed part , based on the weight of the 3d printed part . it is to be appreciated that embodiments of the methods and apparatuses discussed herein are not limited in application to the details of construction and the arrangement of components set forth in the following description or illustrated in the accompanying drawings . the methods and apparatuses are capable of implementation in other embodiments and of being practiced or of being carried out in various ways . examples of specific implementations are provided herein for illustrative purposes only and are not intended to be limiting . in particular , acts , elements and features discussed in connection with any one or more embodiments are not intended to be excluded from a similar role in any other embodiment . also , the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . any references to embodiments or elements or acts of the systems and methods herein referred to in the singular may also embrace embodiments including a plurality of these elements , and any references in plural to any embodiment or element or act herein may also embrace embodiments including only a single element . the use herein of “ including ,” “ comprising ,” “ having ,” “ containing ,” “ involving ,” and variations thereof is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . references to “ or ” may be construed as inclusive so that any terms described using “ or ” may indicate any of a single , more than one , and all of the described terms . any references to front and back , left and right , top and bottom , upper and lower , and vertical and horizontal are intended for convenience of description , not to limit the present systems and methods or their components to any one positional or spatial orientation . referring to fig1 , there is illustrated one example of a process 100 for weight - based identification of 3d printed parts according to aspects disclosed herein . process 100 may be fully or partially implemented in a computer system . in one example , process 100 may be executed by a set of instructions that may be stored on a computer readable storage medium . process 100 may be implemented , for instance , in software , hardware , or combination thereof used by an operator of a manufacturing facility to efficiently identify 3d printed parts . at block 102 of process 100 in fig1 , a tray to be sorted is selected . tray sorting generally refers to identifying 3d printed parts in each tray after the parts are built in the tray . the tray may include one or more 3d printed parts built based on one or more 3d models . the one or more 3d printed parts in a tray may also correspond to one or more customer orders . in one example , the tray may be selected by a user or operator and the selection of the tray may be input to the computer system implementing weight - based identification . in some embodiments , selecting a tray at block 102 may include selecting or identifying a material and a density of the material used for 3d printing in that tray . in one embodiment , the computer system may be configured to automatically identify the material and associated density used for 3d printing in a selected tray , for example , by retrieving stored material and associated density corresponding to the selected tray . a list of 3d printing materials may be stored in the computer system . density may also be stored in the computer system as a material property for each 3d printing material . still referring to fig1 , at block 104 of process 100 , theoretical weights may be calculated for one or more 3d models . in the embodiment shown in fig1 , the 3d models for which theoretical weights are calculated may include all the 3d models assigned to the tray selected at block 102 . a 3d model assigned to a tray may be used to build a corresponding 3d part in that tray . in one embodiment , selecting a tray at block 102 may result in selection of one or more 3d models assigned to the selected tray for use at block 104 . in one practical example , a group of 1000 3d models that are assigned to a single tray selected at block 102 may be selected for use at block 104 . however , the one or more 3d models used at block 104 may generally include any of the 3d models that were used to print 3d parts in any tray . a theoretical weight for a 3d model at block 104 may be calculated by multiplying the volume of the 3d model by the density of the material used to print the 3d model in the selected tray . in one example , the density of the material may be automatically identified upon selecting a tray at block 102 . in one embodiment , block 104 may be performed only once per selected tray . if the selected tray includes 3d parts made from different materials , block 104 may be performed for each 3d printed part based on the density of the material used to print that part . at block 106 of process 100 , a 3d printed part that was built in the selected tray may be weighed . in one example , the 3d printed part may be weighed by using a scale . the 3d printed part is weighed after cleaning the part to eliminate any residual weight . cleaning may be performed prior to selecting the tray at block 102 or prior to weighing the 3d part at block 106 . in other embodiments , if cleaning does not precede weight - based identification , the process of weight - based identification may compensate for an estimated weight of residue . in one embodiment , a 3d printed part from the selected tray may be weighed by a user or operator and the weight may be input to the computer system implementing weight - based identification . at block 108 , the weight of the 3d printed part may be compared to the theoretical weights calculated for one or more 3d models . in one embodiment , the comparison may include calculating , for each 3d model used at block 104 , a value representing a deviation of the theoretical weight of the 3d model from the weight of the 3d printed part provided at block 106 . in one example , the values may be absolute values . the comparison may further include checking , for each 3d model used at block 104 , whether a value representing a deviation of its theoretical weight from the weight of the 3d printed part is within a predetermined threshold value of deviation from the weight of the 3d printed part . at block 110 of process 100 , a subset of 3d models may be selected from one or more models used at block 104 . the number of 3d models in the subset may be less than the total number of 3d models used at block 104 . the number of 3d models in the subset , i . e . the size of the subset , may be predetermined . in one example , the size may be selected by a user of the weight - based identification process . the subset of 3d models is selected based on comparing , at block 108 , the weight of the 3d printed part with the theoretical weights of one or more 3d models . in one example , a 3d model may be selected for inclusion in the subset of 3d models if a value of deviation of its theoretical weight from the weight of the 3d printed part is within a predetermined threshold value of deviation . in one embodiment , selecting a subset of 3d models in at block 110 may further include sorting the 3d models within the subset . sorting the subset of 3d models may be included within block 110 or as a separate block of process 100 . in one example , the 3d models in the subset may be sorted based on values of deviation of their respective theoretical weights from the weight of the 3d printed part . for example , the subset may be sorted such that the first 3d model in the sorted subset has the smallest value or amount of deviation from the weight of the 3d printed part , thereby being the closest match to the 3d printed part based on weight . in a computer implementation of process 100 , the selected subset of 3d models may at least partially be output or presented to a user or operator . in one example , a first subset of 3d models may be presented to the user . upon receiving a request from the user for more 3d models that may match the 3d printed part , a next subset of 3d models may be presented to the user . the user may switch between viewing the different subsets and may select one or more 3d models for viewing . at block 112 of process 100 , the 3d model that corresponds to the 3d printed part is identified . block 112 may include comparing 3d models in the subset of block 110 to the 3d printed part . in one embodiment , the comparison may include visual comparison to identify the 3d model that matches the 3d printed part . in one example , the subset of 3d models at block 110 may only include a single 3d model , and at block 112 , the selected 3d model may be confirmed to match the 3d printed part . once the 3d model from which the 3d printed part has been printed is identified at block 112 , a label corresponding to the 3d printed part may be generated at block 114 . the label may include information identifying the 3d printed part . for example , the label may be an order card and may include customer order information , a barcode , the 3d model number that matches the 3d printed part and a code for the material used to print the part ( e . g ., as shown in fig5 and discussed further below ). the label may also include a storage bin number corresponding to the 3d printed part . generating the label may include printing the label and may also include affixing or adding the label to the 3d printed part or a packaging thereof . in some embodiments , process 100 may further include removing an identified 3d printed part from the tray and removing a 3d model corresponding to the identified 3d printed part from the set of one or more 3d models used in process 100 . removing 3d models from the set of one or more 3d models used for weight based identification of 3d printed parts in a tray may increase the efficiency of weight based identification over time . in some embodiments , process 100 may further include updating a status of the 3d printed part . for example , in a computer system implementation , the status of the 3d printed part may be updated to indicate that the part has been identified or to indicate that a label has been printed for the part . the 3d printed part may be routed to one or more locations using the label . for example , the 3d printed part may be routed from the manufacturing facility to a distribution center , where it may be collected along with any other 3d printed parts from the same customer order and shipped to the customer . fig2 illustrates a user interface 120 including a listing of trays in a computer system implementing weight - based identification of 3d printed parts according to aspects of the present disclosure . in one example , interface 120 may be in the form of a table , as shown in fig2 . the interface may include a listing of trays as shown in column 122 . column 124 lists a date of 3d printing corresponding to each tray . as shown , the listing of trays in column 122 may be sorted by dates of 3d printing in column 124 . in one example , the last tray emerging from the 3d printing process may be listed first . column 126 lists number of items corresponding to each tray . in one example , the number of items in a tray may correspond to the number of 3d printed parts built in that tray . in another example , the number of items may correspond to a sum of the quantity of production orders assigned to that tray , where a production order is a request to produce one or more copies of a 3d part from a single 3d model . column 128 of interface 120 lists a weight - based sorting feature available for trays that are not yet sorted . in one example , a weight - based sorting feature corresponding to a tray may be selected to launch a computer implemented method for weight - based identification of 3d printed parts in the corresponding tray . in another example , a tray may be selected from the listing of trays that are available for weight - based sorting . selecting a tray may launch another user interface for weight - based identification of 3d printed parts in the selected tray . fig3 illustrates a user interface 130 for weight - based sorting of a selected tray 132 . the tray 132 may be selected using the interface 120 in fig2 . interface 130 provides an input cell 134 to receive a value indicative of the weight of the 3d printed part . in one example , an operator may enter the weight of a 3d printed part . in another example , a system including the user interface 130 may be configured to obtain a weight of a 3d printed part . the user interface 130 may provide a button 136 configured to launch weight - based identification of the 3d printed part corresponding to the entered weight . in one embodiment , clicking on button 136 may result in performing process 100 at blocks 106 and 108 in fig1 . the weight entered in input cell 134 may be compared to one or more of theoretical weights calculated for one or more 3d models assigned to the selected tray 132 . in response to the comparison , a subset of 3d models having theoretical weights that are closest matches to the weight entered in input cell 134 may be selected . each 3d model in the selected subset may be displayed or output in a respective 3d model window 138 of the user interface 130 . in one example , the 3d model windows 138 may be thumbnails . each 3d model window 138 may include a zoom button 140 configured to launch the 3d model in a larger overlay window . each 3d model window 138 may also include a 3d model viewer button 142 configured to launch a 3d viewer application . the number of 3d model windows 138 displayed on the user interface 130 may be selected from a menu 144 including predetermined choices . in one example , the predetermined number of 3d models to be output may be chosen to be one of 6 , 24 and 60 3d models . however , any other number may be provided for selection in menu 144 . in the example shown in fig3 , 6 3d models are selected , thereby resulting in the display of the 6 3d model windows 138 . in one embodiment , the user interface 130 may be configured to receive as input any number representing the size of the subset of 3d models , wherein the number is less than the total number of 3d models assigned to the selected tray 132 . the user interface 130 may also include buttons 146 and 148 configured to switch between displaying a first subset and a second subset of 3d models selected based on the weight in input cell 134 . in one example , the selected subset of 3d models may be sorted such that the first subset of 3d models that are displayed in user interface 130 more closely match the weight in input cell 134 compared to the second subset of 3d models . a user may identify the 3d model that matches the 3d printed part having a weight entered in input cell 134 from a displayed subset of 3d model windows 138 in fig3 . once the 3d model corresponding to the 3d printed part is identified , the user may request generating a label for the part . fig4 shows one example of a user interface 150 for printing an order card for an identified 3d printed part . the order card may include identifying information for the part . the order card may be generated and displayed in an area 152 of the user interface 150 . the user interface 150 may also provide an interface 154 for updating the status of the 3d printed part . after identifying a 3d printed part , the number of parts left to be identified in a single tray may be reduced . in one example , the number of items corresponding to a tray , as shown in column 126 of fig2 , may be reduced as 3d printed parts are identified in that tray . fig5 illustrates one example of an order card printed as a label 156 . the label 156 includes a barcode 158 . in one example , the barcode corresponds to the 3d model that matches the 3d printed part . label 156 also includes a section 159 having information identifying the 3d printed part . the identifying information may include a customer order number , production order information , a material code corresponding to the material used to 3d print the part , and a 3d model number corresponding to the part . in other examples , the label may include other identifying data . fig6 is a flow chart illustrating a computer implemented process 160 of interacting with a user of a weight - based identification system having the user interfaces in fig3 , 4 and 5 . at block 162 , a list of trays to be sorted may be output , for example , by providing the user interface 120 and a listing of trays as shown in column 122 of fig2 . at block 164 , a selection of a tray may be received from a user . for example , the user may select a tray for weight - based sorting using the user interface 120 in fig2 . in response to selecting a tray , process 160 may include launching a user interface 130 as shown in fig3 , for weight - based sorting of the selected tray . at block 166 of process 160 , a weight of a 3d printed part built in the tray may be received . the weight may be received using , for example , the input cell 134 in fig3 . process 160 may include , at block 168 , outputting a subset of 3d models that are closest matches to the 3d printed part having the input weight . additional subsets of 3d printed parts may be output at block 170 . for example , buttons 146 and 148 of the user interface 130 in fig3 may be used to output additional subsets of 3d models and to switch among displaying the different subsets of 3d models . process 160 may include receiving a selection of a 3d model from a subset of 3d models at block 172 . for example , a 3d model displayed in a 3d model window 138 of user interface 130 may be selected . a 3d model may be selected for viewing . selecting a 3d model may include visually comparing the 3d model to the 3d printed part and identifying the 3d model corresponding to the part . at block 174 of process 160 , an order card may be generated for the identified part . for example , an order card may be generated using the interface 150 of fig5 . generating an order card may include printing the order card . process 160 may further include updating the status of the identified 3d printed part at block 176 . for example , interface 154 of fig4 may be used at block 176 . in some embodiments , process 160 may further include removing a 3d model corresponding to the identified 3d printed part from one or more 3d models used for weight based identification . embodiments of the processes disclosed herein , such as process 100 in fig1 and process 160 in fig6 may be implemented in a software system that supports the production process for 3d printing at a manufacturing facility . the software system may generally allow tracking of 3d printed parts through the production process and may support processes involved in handling 3d printed parts . for example , the software system may support handling of 3d model files , creating production plans and sending shipments of 3d printed parts to distribution centers . the user interfaces 120 , 130 and 150 may be provided to facilitate interaction with an operator of the manufacturing facility . processes described above are merely illustrative embodiments of systems for weight - based identification of 3d printed parts . such illustrative embodiments are not intended to limit the scope of the present invention , as any of numerous other implementations for performing the invention . none of the claims set forth below are intended to be limited to any particular implementation of a process of weight - based identification , unless such claim includes a limitation explicitly reciting a particular implementation . processes associated with various embodiments , acts thereof and various embodiments and variations of these methods and acts , individually or in combination , may be defined by computer - readable signals tangibly embodied on a computer - readable medium , for example , a non - volatile recording medium , an integrated circuit memory element , or a combination thereof . such signals may define instructions , for example , as part of one or more programs that , as a result of being executed by a computer , instruct the computer to perform one or more of the methods or acts described herein , and / or various embodiments , variations and combinations thereof . such instructions may be written in any of a plurality of programming languages , for example , java , visual basic , c , c #, or c ++, fortran , pascal , eiffel , basic , cobol , etc ., or any of a variety of combinations thereof . the computer - readable medium on which such instructions are stored may reside on one or more of the components of a general - purpose computer described above , and may be distributed across one or more of such components . the computer - readable medium may be transportable such that the instructions stored thereon can be loaded onto any computer system resource to implement the aspects of the present invention discussed herein . in addition , it should be appreciated that the instructions stored on the computer - readable medium , described above , are not limited to instructions embodied as part of an application program running on a host computer . rather , the instructions may be embodied as any type of computer code ( e . g ., software or microcode ) that can be employed to program a processor to implement the above - discussed aspects of the present invention . various embodiments according to the invention may be implemented on one or more computer systems . these computer systems may be , for example , general - purpose computers such as those based on intel pentium - type processor , motorola powerpc , sun ultrasparc , hewlett - packard pa - risc processors , or any other type of processor . it should be appreciated that one or more of any type computer system may be used to partially or fully automate weight - based identification of 3d printed parts according to various embodiments of the invention . further , the software design system may be located on a single computer or may be distributed among a plurality of computers attached by a communications network . the computer system may include specially - programmed , special - purpose hardware , for example , an application - specific integrated circuit ( asic ). aspects of the invention may be implemented in software , hardware or firmware , or any combination thereof . further , such methods , acts , systems , system elements and components thereof may be implemented as part of the computer system described above or as an independent component . a computer system for weight - based identification of 3d printed parts may be a general - purpose computer system that is programmable using a high - level computer programming language . the computer system may be also implemented using specially programmed , special purpose hardware . in a computer system there may be a processor that is typically a commercially available processor such as the well - known pentium class processor available from the intel corporation . many other processors are available . such a processor usually executes an operating system which may be , for example , the windows nt , windows 2000 ( windows me ), windows xp , windows vista or windows 7 operating systems available from the microsoft corporation , mac os snow leopard , mac os snow lion operating systems available from apple computer , the solaris operating system available from sun microsystems , or unix available from various sources . many other operating systems may be used . the processor and operating system together define a computer platform for which application programs in high - level programming languages are written . it should be understood that the invention is not limited to a particular computer system platform , processor , operating system , or network . also , it should be apparent to those skilled in the art that the present invention is not limited to a specific programming language or computer system . further , it should be appreciated that other appropriate programming languages and other appropriate computer systems could also be used . one or more portions of the computer system may be distributed across one or more computer systems coupled to a communications network . these computer systems also may be general - purpose computer systems . for example , various aspects of the invention may be distributed among one or more computer systems configured to provide a service ( e . g ., servers ) to one or more client computers , or to perform an overall task as part of a distributed system . for example , various aspects of the invention may be performed on a client - server system that includes components distributed among one or more server systems that perform various functions according to various embodiments of the invention . these components may be executable , intermediate ( e . g ., il ) or interpreted ( e . g ., java ) code which communicate over a communication network ( e . g ., the internet ) using a communication protocol ( e . g ., tcp / ip ). it should be appreciated that the invention is not limited to executing on any particular system or group of systems . also , it should be appreciated that the invention is not limited to any particular distributed architecture , network , or communication protocol . various embodiments of the present invention may be programmed using an object - oriented programming language , such as smalltalk , java , c ++, ada , or c # ( c - sharp ). other object - oriented programming languages may also be used . alternatively , functional , scripting , and / or logical programming languages may be used . various aspects of the invention may be implemented in a non - programmed environment ( e . g ., documents created in html , xml or other format that , when viewed in a window of a browser program , render aspects of a graphical - user interface ( gui ) or perform other functions ). various aspects of the invention may be implemented as programmed or non - programmed elements , or any combination thereof . further , on each of the one or more systems that include one or more components of a system for weight - based identification of 3d printed parts , each of the components may reside in one or more locations on the system . for example , different portions of the components of a system for weight - based identification of 3d printed parts may reside in different areas of memory ( e . g ., ram , rom , disk , etc .) on the system . each of such one or more systems may include , among other components , a plurality of known components such as one or more processors , a memory system , a disk storage system , one or more network interfaces , and one or more busses or other internal communication links interconnecting the various components . systems and processes disclosed herein for weight - based identification of 3d printed parts , such as a system including user interfaces 120 , 130 and 150 in fig2 , 3 and 4 , may be implemented on a computer system described below in relation to fig7 and 8 . a system having user interfaces 120 , 130 and 150 in fig2 , 3 and 4 is merely an illustrative embodiment of the weight - based identification system . such an illustrative embodiment is not intended to limit the scope of the invention , as any of numerous other implementations of the system , for example , are possible and are intended to fall within the scope of the invention . none of the claims set forth below are intended to be limited to any particular implementation of the system unless such claim includes a limitation explicitly reciting a particular implementation . various aspects of the invention may be implemented as specialized software executing in a general - purpose computer system 180 such as that shown in fig7 . the computer system 180 may include a processor 182 connected to one or more memory devices 184 , such as a disk drive , memory , or other device for storing data . memory 184 is typically used for storing programs and data during operation of the computer system 180 . components of computer system 180 may be coupled by an interconnection mechanism 186 , which may include one or more busses ( e . g ., between components that are integrated within a same machine ) and / or a network ( e . g ., between components that reside on separate discrete machines ). the interconnection mechanism 186 enables communications ( e . g ., data , instructions ) to be exchanged between system components of system 180 . computer system 180 also includes one or more input devices 188 , for example , a keyboard , mouse , trackball , microphone , touch screen , and one or more output devices 190 , for example , a printing device , display screen , and / or speaker . in addition , computer system 180 may contain one or more interfaces ( not shown ) that connect computer system 180 to a communication network ( in addition or as an alternative to the interconnection mechanism 186 . the storage system 192 , shown in greater detail in fig8 , typically includes a computer readable and writeable nonvolatile recording medium 194 in which signals are stored that define a program to be executed by the processor or information stored on or in the medium 194 to be processed by the program . the medium may , for example , be a disk or flash memory . typically , in operation , the processor causes data to be read from the nonvolatile recording medium 194 into another memory 196 that allows for faster access to the information by the processor than does the medium 194 . this memory 196 is typically a volatile , random access memory such as a dynamic random access memory ( dram ) or static memory ( sram ). it may be located in storage system 192 , as shown , or in memory system 184 , not shown . the processor 182 generally manipulates the data within the integrated circuit memory 184 , 196 and then copies the data to the medium 194 after processing is completed . a variety of mechanisms are known for managing data movement between the medium 194 and the integrated circuit memory element 184 , 196 , and the invention is not limited thereto . the invention is not limited to a particular memory system 184 or storage system 192 . although computer system 180 is shown by way of example as one type of computer system upon which various aspects of the invention may be practiced , it should be appreciated that aspects of the invention are not limited to being implemented on the computer system as shown in fig7 . various aspects of the invention may be practiced on one or more computers having a different architecture or components that that shown in fig7 . computer system 180 may be a general - purpose computer system that is programmable using a high - level computer programming language . computer system 180 may be also implemented using specially programmed , special purpose hardware . in computer system 180 , processor 182 is typically a commercially available processor such as the well - known pentium class processor available from the intel corporation . many other processors are available . such a processor usually executes an operating system which may be , for example , the windows nt , windows 2000 ( windows me ), windows xp , windows vista or windows 7 operating systems available from the microsoft corporation , mac os snow leopard , mac os snow lion operating systems available from apple computer , the solaris operating system available from sun microsystems , or unix available from various sources . many other operating systems may be used . the processor and operating system together define a computer platform for which application programs in high - level programming languages are written . it should be understood that the invention is not limited to a particular computer system platform , processor , operating system , or network . also , it should be apparent to those skilled in the art that the present invention is not limited to a specific programming language or computer system . further , it should be appreciated that other appropriate programming languages and other appropriate computer systems could also be used . one or more portions of the computer system may be distributed across one or more computer systems ( not shown ) coupled to a communications network . these computer systems also may be general - purpose computer systems . for example , various aspects of the invention may be distributed among one or more computer systems configured to provide a service ( e . g ., servers ) to one or more client computers , or to perform an overall task as part of a distributed system . for example , various aspects of the invention may be performed on a client - server system that includes components distributed among one or more server systems that perform various functions according to various embodiments of the invention . these components may be executable , intermediate ( e . g ., il ) or interpreted ( e . g ., java ) code which communicate over a communication network ( e . g ., the internet ) using a communication protocol ( e . g ., tcp / ip ). it should be appreciated that the invention is not limited to executing on any particular system or group of systems . also , it should be appreciated that the invention is not limited to any particular distributed architecture , network , or communication protocol . various embodiments of the present invention may be programmed using an object - oriented programming language , such as smalltalk , java , c ++, ada , or c # ( c - sharp ). other object - oriented programming languages may also be used . alternatively , functional , scripting , and / or logical programming languages may be used . various aspects of the invention may be implemented in a non - programmed environment ( e . g ., documents created in html , xml or other format that , when viewed in a window of a browser program , render aspects of a graphical - user interface ( gui ) or perform other functions ). various aspects of the invention may be implemented using various internet technologies such as , for example , the well - known common gateway interface ( cgi ) script , php hyper - text preprocessor ( php ), active server pages ( asp ), hypertext markup language ( html ), extensible markup language ( xml ), java , javascript , asynchronous javascript and xml ( ajax ), flash , and other programming methods . various aspects of the invention may be implemented as programmed or non - programmed elements , or any combination thereof . having described above several aspects of at least one embodiment , it is to be appreciated various alterations , modifications , and improvements will readily occur to those skilled in the art . such alterations , modifications , and improvements are intended to be part of this disclosure and are intended to be within the scope of the invention . accordingly , the foregoing description and drawings are by way of example only , and the scope of the invention should be determined from proper construction of the appended claims , and their equivalents .	1
in a first embodiment , the present invention is a combination seating and storage unit 20 , as shown in fig1 . the unit 20 includes a storage container 22 having a front side 24 , a rear side 26 , a right side 28 and a left side 30 . the unit optionally includes a bottom or floor 32 . preferably , the storage container also includes a back 34 carrying a horizontal cushion 36 . additionally , the unit 20 includes a lid 40 . preferably , the storage container 22 is formed from roto - molded plastic . however , suitable storage units could be prepared from plywood , preferably marine plywood , aluminum , steel , or other well - known fabrication materials . the lid 40 is preferably formed of plywood , most preferably marine plywood , of a thickness sufficient to support a seated occupant . alternatively , other building materials such as aluminum , plastic , steel , or wood planking could be suitably employed . the lid 40 and the back 34 are preferably upholstered with well - known foam upholstery material covered with fabric , or most preferably vinyl . as shown in fig1 the lid 40 is connected to the storage container 22 such that when opened , the lid is oriented vertically and positioned immediately in front of the front side 24 of the storage container 22 . this positioning of the lid 40 facilitates excellent access to the interior of the storage container through an open top 38 of the storage container . in such an open position , the lid 40 is extremely stable for reasons which will be apparent from the following discussion . with reference to fig2 a double pivot hinge 50 connects the lid 40 to the storage container 22 . the double pivot hinge 50 includes a first bracket 52 , which in a preferred mode is integral with right side 28 at a location adjacent the open top 38 and the front side 24 ; in other words , near the upper position of a front corner of the container 22 . the bracket 52 carries a first pivot pin 54 . a second bracket 56 carries a second pivot pin 58 . the second bracket 56 is attached to the lid 40 generally adjacent to the midpoint between the front and rear edges of the lid 40 and most preferably slightly rearward of the midpoint of the lid 40 . first and second pivot pins 54 and 58 are each pivotally connected to a one - piece connecting arm 60 at a first end 62 and at a second end 64 , respectively . additionally , the second end 64 of the one - piece connecting arm 60 preferably includes a dogleg or bend 66 adjacent the second end 64 . the first and second ends 62 and 64 , respectively , are planar and are offset from one another so as to lie in parallel planes . the one - piece connecting arm 60 includes an integral offset portion 68 connecting the first and second ends . most preferably , the first end 62 has a roughly three - quarters of an inch offset to place the first end 62 in sliding contact with the bracket portion 52 of right side wall 28 . the second body 64 of the one - piece connecting arm 60 is therefore offset inward approximately three - quarters of an inch from the right side 28 . in a preferred embodiment , a mirror image of the double pivot hinge just explained is present at the left side 30 of the storage container 22 and at the left side of the one - piece lid 40 . most preferably , the connecting arm 60 on the right side and its equivalent member on the left side are rigidly linked together by connecting means comprising at least one rigid rod , tube or bar 70 which rigidly attaches to the connecting arms and holds them in a parallel relationship . the connecting means 70 thus prevents bending , twisting and binding of the double pivot hinge to assure dependable motion of the lid 40 as it is opened and closed from the storage container 22 . to close the lid 40 , the rearward portion of the lid 40 is pivoted rearwardly about pivot pin 58 until it reaches the open top 38 of storage container 22 . next , application of a downward force to the front edge of lid 40 causes the rearwardly edge to slide rearward into a pocket 72 which is generally defined by the lower edge of cushion 36 , the lower edge of back support 34 and the rear portion of the open top 38 of storage container 22 . the pocket 72 may be alternatively described as a front opening slot or groove at the rear of the open top 38 . as the front of the lid 40 is forced downward , the double pivot hinge 50 moves about pivot pins 54 and 58 to trap the rear edge of the lid 40 within the pocket 72 . ultimately , the configuration shown in fig4 is achieved in which the lid 40 is fully closed over the storage container 22 to provide seating over the storage container 22 . it will be evident that due to the capturing effect of pocket 72 , the rear edge of the lid 40 cannot rise until the front edge has been lifted and the lid begins to shift upward and forward . only under the most rigorous rough water conditions is any additional lockdown system required . such a lockdown system if required is provided at the front edge of the cushioned lid 40 . the usefulness of such a seating and storage system is not limited to rectangularly shaped storage containers but may also be used upon alternative shapes , such as a hexagonal corner unit , to provide both seating and storage in a corner of a vessel , such as a pontoon boat , as shown in fig5 . although the present invention has been described with reference to the preferred embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention .	0
fig1 is a perspective view of the preferred embodiment of the invention in which metal hydride heat pump 10 is constructed of body 11 which is separated into three heat exchangers , high temperature heat exchanger 12 , mid - temperature heat exchanger 14 , and low temperature heat exchanger 16 . the heat exchangers are separated by transition regions 18 and 20 which are constructed of alternating layers of heat conducting bridges 22 and thermal insulating layers 24 . thus , insulating layers 24 prevent heat transfer between heat exchangers 12 , 14 , and 16 , but thermal bridges 22 transfer heat throughout the cross section of body 11 within each transition region 18 and 20 . thermal bridges 22 are preferably constructed of high thermal conductivity foamed metal , for instance copper . a group of six parallel channels 28 , 30 , 32 , 34 , 36 , and 38 are built into body 11 and located in a circular pattern around axis 26 of body 11 . as a result of the construction of the transition regions , all the channel walls in each of the two transition regions are in thermal communication . each of the channels has an internal reciprocating container 40 , 42 , 44 , 46 , 48 , and 50 within it ( see fig2 ), and each container is attached to and moved by one of the cables 52 , 54 , or 56 . the containers are moved in a controlled intermittent sequence . while it would be possible to move each container with a separate and independently operated cable , since operation of the invention requires that pairs of containers are moved together , in the preferred embodiment , two containers are attached to each of the cables . furthermore , since each container is moved in a reciprocating motion , cables 52 , 54 , and 56 are actually constructed as closed loops to allow convenient movement of each cable by a simple motor driven pulley . although cables 52 , 54 , and 56 are shown in fig1 as closed loops , their pulleys and motor drive have been omitted for clarity . fig2 is a partial cross section schematic diagram of the preferred embodiment of the invention with the circular pattern of channels of fig1 &# 34 ; unrolled &# 34 ; into a planar configuration to better describe the operation of the invention . it should therefore be understood that channel 28 at the top of fig2 and channel 38 at the bottom of fig2 are actually , as seen in fig1 adjacent to each other . containers 40 , 42 , 44 , 46 , 48 , and 50 are all constructed to move easily within their respective channels , and as discussed earlier , the containers are attached to cable loops 52 , 54 , and 56 in pairs so that two selected containers move together in the same direction and for the same distance . each container is constructed with two hydride sections separated from each other , but with an interconnecting section which permits the interchange of gas between the hydride sections . thus , higher temperature hydride sections 58 , 60 , 62 , 64 , 66 , and 68 all enclose a higher temperature hydride such as lani4 . 75al0 . 25hx , while lower temperature hydride sections 70 , 72 , 74 , 76 , 78 , and 80 all enclose a lower temperature hydride such as mmni4 . 15fe0 . 85hy . interconnecting sections 82 , 84 , 86 , 88 , 90 , and 92 mechanically separate the higher temperature hydride sections and the lower temperature hydride sections , but permit hydrogen to pass between them . the three sections of each container are dimensioned so that the higher and lower temperature hydride sections are separated by the same distance that separates heat exchangers 12 , 14 , and 16 , so that when a hydride container is aligned with a heat exchanger , the other hydride container to which it is attached is always aligned with another heat exchanger . the dimensions are also chosen so that when one hydride container is aligned with a transition region , the attached hydride container will be aligned with the other transition region of body 11 . the arrangement for moving the containers is shown more clearly in fig2 . each cable 52 , 54 , and 56 is attached to two containers and strung around four pulleys 94 , so that the moving forces applied to each container are aligned with the channel in which the container moves . power is applied to one pulley 94 of each cable by reversible motors 96 , and the motors are connected to and controlled by timing control 95 . metal hydride heat pump 10 is thereby powered by the three low power electric motors 96 and operates as a refrigerator in the manner described below , based upon the starting positions of the various components as shown in fig2 . fig3 which is discussed concurrently with fig2 is a graph representing the thermodynamic cycle of the following described refrigerator operation of the invention . in fig3 th , tm , and tl designate the temperatures determined by the high , medium , and low temperature heat exchangers respectively , and the mh and ml lines represent the temperature and pressure relationships of the higher and lower temperature metal hydrides , respectively . the vertical axis of the graph of fig3 represents the log of the pressure , the horizontal axis of the graph represents the inverse of the temperature reading , and the dashed arrows represent the movement of hydrogen gas between the hydride sections of the containers . in fig2 when heat is applied to high temperature heat exchanger 12 at a temperature of 150 to 170 degrees c ., the higher temperature metal hydride in high temperature hydride section 60 of container 42 heats up to the input temperature of heat exchanger 12 and decomposes to release hydrogen gas . the conditions determined by this action are depicted at point a on the mh line in fig3 . the hydrogen released in high temperature section 60 then flows through interconnecting section 84 into low temperature hydride section 72 where it is absorbed by the lower temperature metal hydride at near room temperature , 15 to 30 degrees c . this temperature is determined by a heat exchange fluid introduced at mid - temperature heat exchanger 14 . as the hydrogen gas reacts with the lower temperature hydride this action is represented by point b in fig3 which is on the ml line . after a period of time sufficient for the hydride reactions to stabilize , container 42 is moved to the right so that high temperature section 60 and low temperature section 72 move into transition regions 18 and 20 , respectively . the optimum time each container is within heat exchangers 12 , 14 , and 16 is 4 - 6 minutes , and the rest of the time the containers move between positions in 1 - 3 minute steps , but this timing will vary depending upon the device parameters . at the time of the movement of container 42 to the right , container 46 which is attached to the same cable 54 , moves to the left so that its high and low temperature metal hydride containers are in the same transition regions as the same sections of container 42 . thus , section 60 of container 42 which is at 150 - 170 degree c . transfers its heat to section 64 of container 46 , which had been in contact with heat exchanger 14 and is therefore at 15 - 30 degrees c . this is the effect which yields the higher efficiency for the invention , because without the heat transfer in the transition zone , the heat energy in section 60 would merely be disposed of by flowing out to much cooler heat exchanger 14 . instead , that heat energy in section 60 is used to raise the temperature of section 64 before it comes into contact with high temperature heat exchanger 12 so the heat energy is retained within the system , and reduces the amount of heat that section 64 will later require to be raised to its temperature for emitting hydrogen . the same type of heat conservation phenomenon also occurs between low temperature hydride section 72 of container 42 and low temperature hydride section 76 of container 46 , which are also in thermal communication at transition region 20 , but at lower temperatures . when the higher temperature metal hydride in section 60 cools upon exposure to the lower temperature of section 64 its pressure - temperature condition follows line mh to point d on fig3 . after a time delay sufficient to transfer most of the heat from hydride sections 60 and 72 of container 84 to hydride sections 64 and 76 of container 88 , container 84 is again moved to the right to align hydride section 60 with mid - temperature heat exchanger 14 and align hydride section 72 with low temperature heat exchanger 16 . this movement also moves container 88 to the left to align hydride section 64 with high temperature heat exchanger 12 and align hydride section 76 with mid - temperature heat exchanger 14 . at this point container 88 begins the cycle as described for container 84 by being heated at high temperature heat exchanger 14 . returning to the action of container 84 , as hydride section 60 containing the higher temperature hydride is in contact with mid - temperature heat exchanger 14 , and hydride section 72 containing the lower temperature hydride is in contact with low temperature heat exchanger 16 , their temperatures are lowered . the lowering of temperature is sufficient to cause the higher temperature hydride in section 60 to absorb hydrogen and lower the pressure , which causes the lower temperature hydride in section 72 to release hydrogen . this release of hydrogen from the lower temperature hydride cools it to 0 to - 15 degrees c . and absorbs heat from low temperature heat exchanger 16 . eventually , after sufficient cycles have occurred to attain stable operating conditions , low temperature heat exchanger 16 is cooled to the same low temperature . for the lower temperature hydride in section 72 , this cooling effect is shown in fig3 by line ml , and the end point is point c ., at which point the hydrogen gas is transferred to the higher temperature hydride ( point d ). after a time delay sufficient to have the lower temperature hydride in section 72 absorb most of the heat it is capable of absorbing , container 84 is moved to the left and into contact with the transition regions . at this point , since container 88 is moving in the opposite direction , and has also come into contact with the transition regions , container 84 begins to absorb heat from hotter container 88 and both hydrides simultaneously beginning changing their conditions , essentially beginning to move higher on their respective lines in fig3 and away from points c and d . after a delay , container 84 then returns to its starting point with high temperature hydride section 60 in contact with high temperature heat exchanger 12 . this , of course , occurs as container 88 moves to the far right of its travel and begins removing heat from the low temperature heat exchanger . of course , it is most desirable to maintain good thermal contact between each hydride section and the surface of the channel within which it moves . conventional high thermal conductivity lubricants are generally available to fulfill this requirement . it is also apparent that during startup of the system , thermal bridges 22 do not conduct heat at full capacity , because the temperatures of the various hydride sections have not yet reached levels to afford the maximum temperature differences required . if fact , during startup it is even practical to move the first containers through the cycle without stopping at the transition regions . essentially , the invention reaches its full capacity when each metal hydride in the structure has operated through a complete thermodynamic cycle . it should be appreciated that the preceding description of operation suggests that each pair of containers has only three positions , and in the middle position both containers of the interacting pair are in contact with the same thermal bridges of the transition regions so that the thermal bridges are transferring heat between the containers . however , transition regions can also be constructed as shown in fig2 in which they are approximately twice as long as the hydride sections . thermal bridges 22 actually divide the transition regions into multiple individual heat transfer zones , and these zones are shown in fig2 as zones 15 and 17 in transition region 18 and zones 19 and 21 in transition region 20 . this geometry provides the ability to provide two different positions within each transition region for hydride sections and is consistent with the use of multiple pairs of interacting containers . fig2 shows two additional pairs of interacting containers , 82 and 92 , and 86 and 90 . each of these pairs operate in exactly the same manner as containers 84 and 88 described above , but it is highly advantageous to time the motion of the three pairs of containers so that the hydride sections of two of the pairs of containers are always in the transition regions , but in different zones . thus , when , as described above and as shown in fig2 hydride section 60 is within high temperature heat exchanger 12 and hydride section 72 is within mid - temperature heat exchanger 14 , hydride sections 58 and 66 are within zone 17 and sections 62 and 68 , are within zone 15 in transition region 18 . also , hydride sections 70 and 78 are within zone 21 and sections 74 and 80 are within zone 19 in transition region 20 . furthermore , the next step in the sequence of motion as described above in regard to the operation of the invention , with the directions of motion as shown by arrows x , y , and z in fig2 will move each container one step in the series of positions . that will put containers 84 and 88 into the transition regions and will move containers 82 and 92 out of the transition regions , thus maintaining the same configuration in the transition regions . in each such step of the sequence there are always two oppositely moving hydride sections in each of the two zones of each transition region . therefore , the transition regions of the preferred embodiment which are twice the length of the hydride sections , along with three pairs of interconnected containers and each pair moving in sequence through a four step , timed path , result in there always being two hydride sections giving up heat and two hydride sections taking on heat in each transition region . furthermore , each of the heat providers and heat receivers in each transition region is actually in a different zone , so that there is little heat transfer between the two hotter hydride sections or between the two cooler hydride sections . this structure and timing arrangement furnishes a particular benefit . it provides the action which makes the invention analogous to a counter flow heat exchanger which is more efficient than , for instance , a regenerator . furthermore it assures that in each zone within a transition region each hotter hydride section is always matched by a cooler hydride section to accept the heat . this reduces the likelihood that heat will be lost to the surrounding environment . the operation of the invention as a superheater , that is , to raise the temperature , is similar to the operation described above , except that the energy source corresponds to the medium temperature , and the temperature being generated is the higher temperature . fig4 is a graph representing the thermodynamic cycle of the operation of the invention as a heater . in fig4 th , tm , and tl designate the temperatures determined by the high , medium , and low temperature heat exchangers respectively , and the mh and ml lines represent the temperature and pressure relationships of the higher and lower temperature metal hydrides , respectively . the vertical axis of the graph of fig4 represents the log of the pressure , the horizontal axis of the graph represents the inverse of the temperature reading , and the dashed arrows represent the movement of hydrogen gas between the hydride sections of the containers . in the fig4 heating cycle , absorption point e , desorption point f , absorption point g , and desorption point l occur in sequence . zrcrfe1 . 1hz and lani5hr can be used as the high and low temperature metal hydrides , and the temperatures are 110 to 130 degrees c . for the high temperature , 100 degrees c . for the medium temperature , and 15 to 25 degrees c . for the low temperature . in typical embodiments of the invention , the containers are 26 - 50 mm in diameter and 300 - 2000 mm long , and the maximum temperature difference across the radial direction for the containers and the body is 5 - 10 degrees c . with appropriate design , the temperature difference across the annular gap between the containers and the body is no more than 1 degree c . generally , the length of the transition regions , the geometry of the containers , and the timed motion of the containers is selected so that the number of oppositely moving metal hydride sections which are in contact with the thermal bridges is maximized at all times . thus , by exchanging heat between higher and lower temperature metal hydrides which are in their cooling and heating phases , and performing that heat exchange in the most efficient manner , as in a counter flow heat exchanger , the invention yields an efficiency close to the theoretical maximum for this type of thermal energy converter , and refrigeration equipment generating a cold temperature of - 20 to - 40 degrees c . becomes possible . it is to be understood that the form of this invention as shown is merely a preferred embodiment . various changes may be made in the function and arrangement of parts ; equivalent means may be substituted for those illustrated and described ; and certain features may be used independently from others without departing from the spirit and scope of the invention as defined in the following claims . for example , a greater or lesser number of channels and containers may be incorporated within body 11 .	2
fig1 shows a perspective and exploded view that details the components of the inventive system 10 for keeping an implement 16 adjacent a person &# 39 ; s hand 20 . the system 10 will include a band 12 and a magnet 14 attached to the band 12 . the band 12 may comprise a metal that retains the magnet 14 by a magnetic attraction ; alternatively , the magnet 14 may be affixed to a surface of the band 12 by any known method , such as soldering , welding , or adhesive . alternatively , the band 12 and magnet 14 of the system 10 may comprise a single , unitary , monolithic structure , wherein the entire band is magnetized . still referring to fig1 , the system 10 will also include an implement 16 having a metallic portion 18 affixed to it . optionally , the system 10 will also include a magnet 13 that can attach to the metallic portion 18 . in preferred embodiments , the implement 16 is a rod - shaped , such as a writing instrument ( as shown ), or an awl , knife , pick , tire pressure gage , or the like . the implement may have a metallic portion 18 positioned in a generally central location of the implement 16 , so that the magnets 13 , 14 engage one another and hold the implement 16 in contact with the band 12 . of course , if the system 10 includes optional magnet 13 , it is important that the polarities of the magnets 13 , 14 be properly configured to attract one another rather than repel one another fig2 shows a perspective view of the system 10 shown in an assembled condition . the band 12 is preferably configured to be a finger ring ; however , the band may also be worn elsewhere on a wearer &# 39 ; s person , such about the wrist . the best mode anticipated for the inventive system , however , is for the band 12 to comprise a finger ring . still referring to fig2 , the system 10 includes an implement 16 ( such as a writing instrument ) and a metallic portion 18 positioned generally adjacent the central portion . the metallic portion 18 may be integral with the implement 16 , or it could be a sleeve that attaches to the implement 16 . in a preferred embodiment , the magnet 13 is adhered to the metallic portion 18 on the implement 16 , and the magnet 14 is adhered to the band 12 . as another option , the entire implement 16 may be metallic and therefore subject to magnetic attraction . in yet another option , the implement 16 may be entirely made of plastic , and the metallic portion 18 is limited to a magnet 13 embedded within or adhered to the implement . as shown in fig2 , however , the magnets 13 , 14 are positioned between the band 12 and the metallic portion 18 of the implement 16 ; preferably , the magnets 13 , 14 are each high - powered , disk - shaped magnets that will retain the implement so that it can rotate with an angular velocity w about axis l , which is generally orthogonal to a longitudinal axis of the implement 16 . other shapes and configurations for the magnets , however , are certainly within the scope of the invention . fig3 and 3a show comparative perspective views of an alternate embodiment of the band 12 portion of the invention . in this embodiment , the band 12 includes a raised portion 15 that houses the magnet 14 . in this embodiment , the magnet 14 adheres to the band 12 by fitting tightly within a cooperatively formed vessel in the raised portion 15 of the band 12 . alternatively , the magnet 14 may be retained by the band 12 by any known adhesive . as evident in fig3 , the magnet 14 is embedded within the raised portion 14 such that its top surface may be generally coplanar and flush with the uppermost part of the raised portion 14 . fig3 a depicts the band 12 , as seen from a vantage point directly above the raised portion 15 of the band . as shown , the magnet 14 is a disk - shaped magnet that is embedded within a cylindrical vessel that is formed in the raised portion 15 . of course , other configurations are within the spirit of the invention . the embodiments shown in fig3 and 3a may comprise bands 12 made of any known material , even non - metallic material such as plastic , polymers , or marble . fig4 shows a perspective view of an alternate embodiment of the system 10 in combination with the band 12 depicted in fig3 and 3a . in this embodiment , a magnet 13 is affixed directly to the implement 16 ′ without the need for a band 18 or other metallic attachment . in this embodiment , the magnet 13 may be affixed to the implement 16 ′ by any known method , including an epoxy , an adhesive , or by means of a vessel within the implement 16 ′ that is cooperatively formed to receive and retain the magnet 13 . fig5 a and 5b show comparative views of the system 10 in combination with a wearer &# 39 ; s hand 20 . as shown in fig5 a , the implement 16 ( a writing instrument ) 16 bears a metallic portion 18 positioned at a generally central location on the implement so that it may be free to rotate at an angular speed w about an axis l through the magnet 14 ( see fig2 , 4 ). referring to fig5 , it is preferred that the magnets 13 , 14 have some vertical dimension , which enables the implement to be spaced from the wearer &# 39 ; s hand 20 , as this space will facilitate free rotation of the implement 16 . referring specifically to fig5 a , the band 12 comprises a finger ring worn on the wearer &# 39 ; s hand 20 . as aforementioned , however , the band 12 may take a larger form and be worn as a wrist band . when worn on the finger , however , the band 12 enables the implement 16 to turn in direction w about an axis that is generally orthogonal the implement 16 ( and the plane of the wearer &# 39 ; s hand 20 ). having described the invention in detail , it is to be understood that this description is for illustrative purposes only . the scope and breadth of the invention shall be limited only by patent claims .	0
fig1 a depicts an exemplary embodiment for an optical path op between two transmitters / receivers txrx , each of which is connected to test signal nodes ls 1 , ls 6 forming circuit points 1 and 6 . first coupling node occ 1 is connected to transmitter / receiver txrx at circuit point 1 . with regard to the depicted optical path , first node occ 1 , at its output facing away from circuit point 1 , has a test signal node ls 2 at circuit point 2 . a line path 2 - 3 is connected , which terminates at circuit point 3 in a test signal node ls 3 . connected to this is a second coupling node occ 2 , which makes possible a branching and has two connections to line points 4 and 7 , at which test signal nodes ls 4 and ls 7 are located . line point 4 , along with a distant line point 5 , forms a normal line path 4 - 5 , which at a test signal node ls 5 , ends in a subsequent fourth coupling node occ 4 . this coupling node has a further connection to a line point 10 having a test signal node ls 10 , at which an alternative line path 7 - 10 ends . in the alternative line path , in the depicted exemplary embodiment , a third coupling node occ 3 is connected , which is provided on both sides at line points 8 and 9 with test signal nodes ls 8 , ls 9 . the other end of fourth coupling node occ 4 is connected to transmitter / receiver txrx , terminating the optical path in test signal node ls 6 . fig1 b clarifies the optical line segments arising therefrom , 1 - 2 , 2 - 3 , 3 - 4 , 4 - 5 , 5 - 6 , 7 - 8 , 8 - 9 , 9 - 10 , the line segments between line points 7 and 10 forming an alternative line path for normal line path 4 - 5 . fig1 c makes clear that for monitoring this line configuration in the event of a functioning normal path 4 - 5 , only three test segments 1 - 3 , 3 - 6 , 7 - 10 are necessary , so that test signal nodes ls 2 , ls 4 , ls 5 , ls 8 , and ls 9 can be configured as transit nodes , which do not process a test signal but rather covey it further . the test signal segments are formed according to the following rules : at all sources and sinks s / d of useful signals , a test signal segment always begins and ends at the beginning and ending of all passive transmission paths , a test signal segment always begins / ends at the beginning / ending of a normal line path protected by an alternative line path , a test signal segment always begins / ends . the optical segment in the node at the beginning / ending of a test signal segment constitutes one unit along with the test signal segment of the corresponding active transmission path . all test signal nodes that are not required at the ending of a test signal segment are configured as transit nodes , i . e ., the test signal is only conveyed further . if the absence of a test signal ls is established on test segment 1 - 3 , then no alternative path is available , so that an alarm is transmitted to a central network control system ( telecommunication management network ). the user of the network control system reacts to the line failure . on the other hand , if the test signal on normal line path 3 - 6 fails , coupling nodes occ 2 and occ 4 are induced to switch over and the test signal nodes are reconfigured , so that now test signal nodes ls 4 and ls 5 are configured as inception nodes for testing the repair of test segment 4 - 5 , whereas test signal nodes ls 7 and ls 10 , heretofore active as inception nodes , can be configured as transit nodes . test segment 3 - 6 now forms the active alternative line path , whereas normal line path 4 - 5 is no longer used . fig2 a depicts another exemplary embodiment for an optical path op between two transmitters / receivers txrx having test signal nodes ls 1 ′, ls 6 ′ at line points 1 ′, 6 ′. a first coupling node occ 1 ′ forms a branching leading to two line points 2 ′, 7 ′ having corresponding test signal nodes ls 2 ′, ls 7 ′. a second coupling node occ 2 ′ is arranged as a crossing separating filler between normal line paths 1 ′- 4 ′, 3 ′- 6 ′ and alternative line paths 7 ′- 8 ′, 9 ′- 10 ′, and it has four connections to circuit points 3 ′, 4 ′, 8 ′, 9 ′ having test signal nodes ls 3 ′, ls 4 ′, ls 8 ′, ls 9 ′. a third coupling node occ 3 ′ brings together at line point 6 ′ the two line paths that arrive at line points 5 ′, 10 ′ having test signal nodes ls 5 ′, ls 10 ′. fig2 b schematically depicts optical line segments 1 ′- 2 ′, 2 ′- 3 ′, 3 ′- 4 ′, 4 ,- 5 ′, 5 ′- 6 ′, 7 ′- 8 ′, 9 ′- 10 ′, derived therefrom . fig2 c depicts the test segments of the arrangement according to fig2 a for the undisturbed case . from the above rules , it can be seen that a line segment can belong to a plurality of test segments , as is demonstrated also in fig2 c for line segment 3 ′- 4 ′. the test segments in fig2 c are line segments 1 ′- 4 ′, 3 ′- 6 ′, 7 ′- 8 ′, and 9 ′- 10 ′. the active transmission takes place on line segments 1 ′- 2 ′- 3 ′- 4 ′- 5 ′- 6 ′. line segments 7 ′- 8 ′ and 9 ′- 10 ′ represent initially passive alternative line paths . if a disturbance resulting from the failure of the test signal is established on normal line 1 ′- 4 ′, then a switchover is caused , which is depicted in fig3 d . segment 2 ′- 3 ′ is passively connected and the active transmission now takes place on alternative line path 7 ′- 8 ′ from circuit point 1 ′ to line point 4 ′. other alternative line path 9 ′- 10 ′, in this case , is not needed as an alternative line path , and is therefore not made active . the test segments now run from 1 ′ to 4 ′ via line points 7 ′ and 8 ′, on the one hand , and from 8 ′ via 4 ′, 5 ′ to line point 6 ′, on the other hand . in addition , passive paths 2 ′- 3 ′ and 9 ′- 10 ′ are tested for the preservation or reinstatement of functionality . from fig2 d , it clear that on the basis of the present invention , only a truly necessary alternative line path is actively connected and that this active connection is achieved through the depicted formation of test segments and the testing of test signals at the ends of the test segments . the comparison of fig2 c and 2d also makes it clear that , in the normal case , test signal nodes ( ls 7 ′, ls 8 ′), functioning as inception nodes , are connected as transit nodes , and that test signal node ls 2 ′, originally connected as a transit node , is connected as an inception node , if a new configuration is required , e . g ., in accordance with fig2 d , opposite fig2 c . for test signal nodes ls 3 ′, ls 4 ′, located on overlapping test segments , one configuration is possible as a transit node in one direction and as an inception node in the other direction . as a result of the present invention , it is assured that a switchover to an alternative line path only occurs if a switchover of that type can also be expedient . if , for example , in the configuration according to fig1 a , a disturbance is detected on line path 2 - 3 , then the entire optical path 1 - 6 is unusable . if , subsequently , yet another disturbance is detected on line path 4 - 5 , a switchover to alternative line path 7 - 10 would be completely pointless , because this switchover would not lead to a usable optical path 1 - 6 . in many configurations , alternative line path 7 - 10 is used entirely or partially for other purposes , for example , to carry out a communication having a lower priority or to share in the protection of another normal line path ( shared protection ). this secondary function of alternative line path 7 - 10 would have to be interrupted if the switchover from normal line path 4 - 5 to alternative line path 7 - 10 were undertaken , although as a result nothing would be achieved for the transmission on optical path 1 - 6 . to avoid unnecessary switchovers of this type by test signal nodes lsx , test signals of at least two types are transmitted , and according to an exemplary embodiment according to the present invention that is also represented in greater detail below , test signals of three types , namely , test signal nodes lsx are also furnished with test signal receivers , which include a test signal level detector , so that the absence of a test signal — of whatever type — is recognized as an individual state . test signal nodes lsx can therefore distinguish four states on the receiving side , namely , “ test signal not present ” and “ test signal received ,” specifically corresponding to the three possible types of received test signal . the test signals for the control of switchovers or of other protective measures are utilized according to the present invention on the basis of the rules elaborated below . in the error - free state , test signal ls - hot is transmitted on the entire optical path . if , within one line segment , for example , line segment 2 - 3 in fig1 a , a fault is recognized as a result of the fact that , for example , test signal node ls 2 is no longer receiving a test signal , for example , caused by a fiber interruption for the transmission direction from test signal node ls 3 to test signal node ls 2 , then the test signal node that is configured as illustrated in fig1 c as generally a transit node transmits an lols test signal in both directions . if the test signal failure on line segment 2 - 3 were to occur in the other transmission direction , i . e ., if it were detected by test signal node ls 3 which is configured as an inception node , then the latter would transmit the lols test signal only in the reverse direction , i . e ., in the direction of test signal nodes ls 2 and ls 1 . at the ends of line path 1 - 3 , i . e ., at test signal nodes ls 1 and ls 3 , a direct transition from test signal ls - hot to test signal lols is detected , so that at these locations a switchover to an alternative line path could be undertaken if an alternative line path of this type were available ( as is the case in the exemplary embodiment illustrated in fig2 a for normal line path 2 ′- 3 ′ through alternative line path 7 ′- 8 ′). on the basis of the disturbance arising in line path 2 - 3 in the exemplary embodiment depicted in fig1 a , on all other line paths 1 - 2 , 4 - 5 , 5 - 6 of the optical path ( in this situation , potential alternative line paths 7 - 8 , 9 - 10 are not connected and therefore do not belong to the present optical path 1 - 6 ), test signals of the second type ls - cold are transmitted . if the loss of the test signal were to be detected , for example , by test signal node 5 on the basis of a disturbance , it would not result in a switchover to alternative line path 7 - 10 because the switchover would only be effected if a transition from test signal ls - hot to test signal lols took place , which , however , cannot occur due to the transmission of test signal ls - cold . the transmission of test signal ls - cold , which , in this way , prevents a switchover to alternative line path or other protective measures , can also be controlled from outside , for example , by a coupling node computer , in order to avoid inadvisable switchover reactions in the event of a foreseeable short - term disturbance . this is advantageous , for example , if in an existing network configuration a new transmission path for useful signals ( for example , a new wavelength channel ) is constructed or an existing transmission path is dismantled , since , in this context , it is possible that short - term disturbances of existing transmission paths can occur . by supplying ls - cold test signals to the optical path , potentially existing alternative path circuits are “ frozen ,” until the new operating state is reliably established . as a result , “ chain reactions ,” as a result of switchovers arising one after the other , can also be avoided . in addition , for purposes of servicing , an existing network configuration can be “ frozen ,” without having to dismantle protective mechanisms configured , for example , by a central computer . fig3 schematically depicts the design of the test signal node for a bidirectional network , in which separated fiber - optic lines are provided for both transmission directions . test signal node lsx has two transit sides ( e , o ) for connected line segments . a test signal from side e is received by a test signal receiver ew . a test signal can be transmitted from a test signal transmitter sw to side e . correspondingly , for transit side o , a test signal receiver eo and a test signal transmitter so are provided . in the depicted exemplary embodiment , test signal node lsx also has four inputs from superordinate control systems . via an input sendw , a test signal to be transmitted by test signal transmitter sw can be input from outside . the same applies for an input sendo , which establishes from outside a test signal to be transmitted by test signal transmitter so . at a further input lstp , lscp , a configuration signal is input for test signal node lsx , through which it is established whether test signal node lsx is configured as a transit node ( lscp ) or as an inception node ( lstp ). if test signal node lsx is an end node of an optical path ( e . g ., ls 1 and ls 6 in fig1 a ), it is only used as an end node ( lsip ) for one side e or o . this configuration is controlled through an input lsip . the test signals received from test signal node lsx are output as test signal information via outputs empfw , empfo to a superordinate control system , for example , a coupling node computer , so that the coupling node computer can undertake evaluations for the purpose of the switchover to protective measures , the worse state of so and eo being transmitted on empfo and the worse state of sw and ew being transmitted on empfw . if test signal node lsx is in the configuration as a transit node ( lscp ), the received test signals are retransmitted unchanged ( ew = so ; eo = sw ). only if a test signal is not received , for example , at test signal receiver ew , is signal lols transmitted in both directions by test signal transmitters so , sw . if test signal node lsx is configured as an inception node ( lstp ), then in response to the failure of reception of a test signal , for example , at test signal receiver ew , it transmits signal lols only in the corresponding reverse direction ( sw ), regularly transmitting the signal ( ls - cold ) in the other direction , however , unless the transmission of a worse test signal ( lols ) is indicated by a test signal from the other direction . test signal node lsx , receiving signal lols transmitted by test signal transmitter sw , and configured as an inception node ( lscp ), at the end of the line path that is disturbed in the other transmission direction , regularly transmits signal ls - cold in the w direction in response to the reception of lols , so that all line paths not affected by the disturbance transmit signal ls - cold in the w transmission direction . test signal nodes lsx , which as inception nodes ( lstp ) receive a signal ls - cold , transmit signal ls - hot in the opposite direction , if non - corresponding test signal receiver ew simultaneously registers a loss of a test signal , so that corresponding test signal transmitter so transmits an ls - cold test signal . on the basis of the rule that , in the reverse direction , test signal transmitter so or sw fundamentally transmits a test signal of a higher order ( failure test signal lols ; lols ls → cold ; ls → cold ls → hot , assuming an end node ( lsip ) is present or ls - hot has been received on transmitter side ), a rapid and automatic reconnection of the normal line paths is permitted after the carrying out of a line repair . fig4 depicts a flow diagram for the generation of the test signals to be transmitted via test signal transmitters so , sw as a function of the test signals received by test signal transmitters ew , eo . for a transit node ( lscp ), it only remains to be tested whether one of test signal receivers ew or eo signals a test signal failure (“ off ”) or not . if a test signal failure is established , then signal lols is transmitted in both directions . if both test signal receivers ew , eo have received a test signal , then the received test signal is once again transmitted unchanged ( sw = eo ; so = ew ). if , on the other hand , test signal node lsx is an inception node ( lstp ; an end node ( lsip ) is a subcase of an inception node ( lstp )), then in response to an established test signal failure ( for example , ew = off ) signal lols ( sw = lols ) is transmitted in the opposite direction . the same applies if the test signal failure is established by other test signal receiver eo . in this case , test signal lols is transmitted by test signal transmitter so . if a test signal is received by test signal receiver ew , eo , and if this test signal is lols , then in accordance with the above rule , test signal ls - cold ( sw = cold or so = cold ) is transmitted in the opposite direction . if the received test signal is not lols , then it can only be ls - cold or ls - hot . if the input signal of the other side is ls - hot or if the test signal node is an end node ( lsip ), then test signal ls - hot is transmitted in the opposite direction , otherwise ls - cold . the bit patterns cited above as examples for test signals ls - hot and ls - cold have an advantage in that it is very difficult to confuse the two test signals . the control system for the protective measures may be set such that in state ls - hot only a small number of other bit patterns ( lols ) suffice to send an alarm to the control computer . in state ls - cold , an alarm is reported only after a much larger number of falsely received test signal bit patterns . in this manner , it can be avoided that , in state ls - cold , failures lasting briefly lead to an alarm in the central control system of the network . if the transmission capacity of the test signal channel is selected so as to be sufficiently large , e . g ., two mbit / s , then in addition to the test signals described here , other data for controlling and monitoring can also be transmitted independent of the test signals themselves . for the test signal concept according to the present invention , it is not important how many wavelengths are transmitted simultaneously over one optical fiber , for example , in wavelength division multiplexing , because each wavelength channel has assigned to it its own test signal . each wavelength can therefore be protected by its own alternative line path . the protective measures depicted , according to the present invention , are locally controlled , for example , by the coupling node computer , so that the central control system of the network and the operator do not participate in acute switchover measures .	7
unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . the following provides a description of a helical antenna array , and antenna elements thereof , in accordance with different embodiments of the invention . in general , the array will comprise a ground plane and an array of helical antenna elements , each one of which comprising a support structure and a conductor helically supported thereby defining respective element axes extending from said ground plane in a direction substantially perpendicular thereto . for example , different embodiments may comprise two , four or more helical antenna elements , which , depending on the embodiment and the application for which the array is intended , may be substantially identical elements , or structurally or operationally different elements . as will be appreciated by the person of skill in the art , different embodiments may be designed and used for different applications . for instance , and as introduced above , helical antenna arrays are commonly used for satellite communications , which may include but are not limited to ground and / or airborne satellite communications , such as described above in the context of aircraft communications . clearly , while some of the embodiments described below may be particularly amenable for use in aircraft communication systems , these embodiments are not intended to be limited as such , as the features of these embodiments , and the operational improvements and / or advantages provided thereby , may be equally applicable in other contexts where helical antenna arrays are commonly used , as will be appreciated by the person of ordinary skill in the art . for the purpose of the following description , however , the embodiments of the invention will be described within the context of aircraft communications , and particularly , wherein an antenna array is generally mounted for operation within the limited spatial confines of a radome or the like , as commonly found at the tail end of an aircraft , and wherein operation of the antenna array requires a certain level of spatial freedom in allowing the array to sweep a suitable scan area to provide suitable coverage . accordingly , in accordance with some embodiments , improvements in the performance of the antenna array are provided in comparison with traditional arrays having similar spatial dimensions or profiles , thereby providing a potential replacement for traditional arrays without imposing changes to existing spatial restrictions for such antennas . for instance , and in accordance with some embodiments of the invention , the antenna array may incorporate one or more of the below - described modifications , which , alone or in different combinations , may increase the overall gain in the array , reduce dissipative losses in the array , mitigate mutual couplings between antenna elements , or correct the squinting effect commonly found in such arrays due to electromagnetic couplings between elements . in the context of a steerable antenna in aircraft communication systems , where a helix array may be subject to continuous reorientation by tilting the array and its beam so that it can be pointed in different directions , these modifications may , in accordance with different embodiments , allow for maintaining an overall sweeping volume of the antenna array while achieving higher gains . further , the antenna structure can generally be rotated about each of two orthogonal axes in order to synthesize volumetric coverage . in some embodiments , each axis passes through the centre of the antenna structure , thereby reducing the scan envelope of the array , i . e . the single envelope that contains the antenna assembly in all its various different scan orientations ; this scan envelope will thus fix the minimum size of the radome structure within which the antenna components can be housed . on an aircraft , there are generally many hard limitations relating to the available spaces within which the antenna can be installed ; therefore , achieving significant operational gains without significantly increasing the overall antenna structure can provide significant advantages in this field . as indicated above , however , the operational gains achieved by the embodiments of the invention herein described are equally applicable in other contexts where structural size limitations are not as strictly applicable . it will be appreciated that the examples provided below describe , in accordance with different embodiments of the invention , different features , which , alone or in combination , can allow for an improved helical antenna array performance . accordingly , the person of skill in the art will appreciate that while different features are combined in describing a same exemplary embodiment , these features may be equally considered alone or in different combinations to provide different desirable effects without departing from the general scope and nature of the present disclosure . referring now to fig1 to 4 , and in accordance with one exemplary embodiment of the invention , a helical antenna array , generally referred to using the numeral 100 , will now be described . as shown in these figures , the array 100 generally comprises a ground plane 102 and four substantially identical antenna elements 104 , each one of which extending substantially perpendicularly from the ground plane and comprising a support structure 106 and a conductor 108 ( e . g . conductive wire ) helically supported thereby . it will be appreciated that while four antenna elements are depicted herein , different numbers of antenna elements may be considered herein without departing from the general scope and nature of the present disclosure . namely the four - element examples depicted herein are meant as exemplary only , as the features described herein may be equally applicable to other arrays comprising two , three , four or more antenna elements . with reference to fig1 to 4 , the antenna array 100 further comprises one or more conductive loading elements laterally displaced relative to respective axes thereof such that , in operation , these conductive loading elements increase the effective aperture of the array and / or effectively redress , at least in part , the directionality of the helical elements toward alignment with a nominal axis of the array by countering the electromagnetic coupling between antenna elements . therefore , while the support structures described above may independently provide some improvement in array performance , the provision of such laterally displaced conductive loading elements may further , or independently , allow for improvement in operational performance . for example , fig1 depicts the provision of respective substantially annular conductive loading plates 126 disposed ( e . g . printed ) on a non - conductive support plate adjoining adjacent antenna elements , each connected ( e . g . via respective ohmic connections ) to a respective helix winding . in this embodiment , each substantially annular loading plate is displaced laterally relative to its respective winding , and provides an aperture therein , each one of which contributing to the overall performance of the array . alternatively , a conductive loading plate having one or more apertures defined therein may be provided in substantial alignment with respective antenna element axes , wherein the provision of such apertures nonetheless serves to enhance the performance of the array . referring now to fig1 to 4 , the antenna array 100 , in accordance with one embodiment of the invention , further comprises a number of additional features , which , alone or in combination , may allow for an improvement in array performance . for example , the ground plane 102 generally comprises a conductive sheet 130 or the like upon which the antenna elements 104 are mounted . as depicted in fig1 to 3 , the ground sheet 130 extends laterally to define the base of the array , and terminates along its edges in a raised lip 132 . the ground plane 102 may be shaped to define a notch 134 through which a suitable dielectric spar 136 may be introduced for cooperative coupling to an array mounting structure 138 provided on the ground plane 102 . the spar may allow for operative coupling of the array to a drive mechanism configured for rotating the array about an axis thereof . for example , the present embodiment allows for the array to rotate about a lateral axis located through a geometrical centerline of the array such that the rotation thereabout does not outwardly extend the sweeping envelope of the array . the present embodiment also allows for the array to longitudinally rotate about a perpendicular axis defined by a corresponding geometrical centerline of the array . the longitudinal rotation may be implemented through a rotation platform 140 upon which the spar 136 is mounted . accordingly , the combined mechanism allows for a reorientation of the antenna array 100 about orthogonal axes within a prescribed sweeping envelope substantially defined by the diameter of the base plane 102 and the diameter of the array at the terminal end of the helical antenna elements 104 . for this purpose , the outer edge of the ground plane may be appropriately shaped to allow for the rotation of the four - helix array without mechanical interference with the scanning mechanism . in another embodiment , one or more ground cups , rather than a single ground plane , may be used to provide , in some implementations , for greater efficiency and gain . in another embodiment , the spar 136 is manufactured of a dielectric material incorporating one or more air pockets as a means for reducing the amount of dielectric material within the array volume and thus reducing the potential impact that the spar may have on array performance . in another embodiment , the base plane 102 may further comprise a series of apertures defined therein , such as apertures 142 , wherein the dimension of these apertures allows one or more bands of electromagnetic field frequency to pass through the plane 102 with reduced attenuation comparing with a similar plane devoid of such apertures . with particular reference to fig3 , the antenna array 100 , and particularly the antenna elements 104 thereof , are generally energised by a micro strip power divider 143 , depicted herein as disposed on a printed circuit board 144 mounted to the underside of the base plane 102 , wherein the power divider 143 is itself energized by a coaxial feed 146 operatively coupled to drive circuitry provided within or via a mounting base of the array ( e . g . base 148 of fig1 ) and further incorporates a short circuited or open - circuited loading stub 150 for dispersion compensation . with reference to fig1 to 4 , the helix windings , depicted herein as helically wound conductive wires 108 , may further have electrically coupled thereto , respective conductive members attached along a section of these wires as a means of increasing capacitive loading , thereby facilitating impedance matching . for example , in this embodiment , one or more conductive plates 152 are provided toward the feeding ends of the helical windings . a person of ordinary skill in the art will nonetheless appreciate that further or alternative conductive members may be disposed about the helical windings to provide similar effects . still referring to fig1 to 4 , the nominal helix axes may further be rotated relative to each other such that the space between their respective feed points is increased for reduced coupling and increased array gain . it is apparent that the foregoing embodiments of the invention are exemplary and can be varied in many ways . such present or future variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	7
the invention discloses a test system and method with flexible extension and maintenance functions . through the disclosed test system 200 , different users ( such as programmers , test personnel , etc ) are allowed to perform operations of different functions through operating interfaces ( e . g . operating interface a 40 , operating interface b 50 , operating interface c 60 , etc ). such operations include the extension and maintenance of test programs through a development interface , the organization and design of the test procedure through an editing interface , and the test operation of different apparatuses ( e . g . apparatus a 10 , apparatus b 20 , apparatus c 30 , etc ) through an operating interface . in the following paragraphs , we use fig1 to explain the main structure and functional modules of the disclosed test system 200 . the test system 200 includes a test program database 210 , an extension and maintenance module 220 , an organizing and designing module 230 , a procedure execution module 240 , and a result display module 250 . ( 1 ) the test program database 210 stores test programs necessary for all kinds of apparatuses . all the test programs are filed according to the apparatuses they are testing and the testing contents . the storage locations and the association relations are stored in a procedure - program correspondence table in the procedure execution module 240 . ( 2 ) the extension and maintenance module 220 provide a development interface for the user to perform and / or operate new function development ( including creation , modification , and deletion ). the development interface provides a standard application program interface ( api ) and functions for the user to develop a desired test program satisfying all test operation standards . ( 3 ) the organizing and designing module 230 provides an editing interface for the user to perform editing on the test procedure ( similarly including creation , modification , and deletion ). the editing interface provides all executable test contents for the user to define different test contents and test procedures for different apparatuses through the drag - n - drop function . ( 4 ) the procedure execution module 240 is mainly used to store test procedures for all apparatuses . it also provides an operating interface for the user to selected a desired test procedure . in addition , the procedure execution module 240 also has a procedure - program correspondence table , which stores fields of procedure names , procedure function explanations , associated program names , and associated program locations . when a test procedure is running , the correspondence table is used to obtain the appropriate test program from the test program database 210 . in fact , the above - mentioned procedure execution module 240 allows the user to simultaneously perform many different test procedures on one apparatus . the implementation is performed through batch processing . therefore , the user can flexibly make adjustment on the test procedure . ( 5 ) the result display module 250 shows the test results for each apparatus for the user to clearly understand the status of each apparatus . the procedure of developing a test program is explained using fig2 . first , the user chooses the extension and maintenance function on the disclosed test system 200 through an operating interface ( e . g . operating interface a 40 , operating interface b 50 , and operating interface c 60 ) and the system generates and displays a development interface ( step 310 ). the user can then select whatever functions to be developed ( step 320 ). the selection menu includes : creating a program ( step 330 ), modifying a program ( step 340 ), and deleting a program ( step 350 ). if the user selects to create a program ( step 330 ), then the system generates a standard api and standard development items for the user to edit ( step 331 ). afterwards , the user can start to write the program ( step 332 ). if the user chooses to modify a program ( step 340 ), the system displays all test programs for the user to select and modify ( step 341 ). the user then selects a desired program to modify ( step 342 ). if the user selects to delete a program ( step 350 ), the system displays all test programs for the user to select delete ( step 351 ). the user then perform program deletion ( step 352 ). after the user completes any of the development items , the system performs the test program storage and update operation ( step 360 ). the system further prompts to ask the user whether he / she wants to continue with other development items ( step 370 ). if the user wants to continue , the system returns to step 320 ; otherwise , the extension and maintenance task is over and the procedure ends ( step 380 ). the procedure of editing a test program is explained using fig3 . first , the user chooses the organizing and designing function on the disclosed test system 200 through an operating interface ( e . g . operating interface a 40 , operating interface b 50 , and operating interface c 60 ) and the system generates and displays an editing interface ( step 410 ). the selection menu includes : creating a procedure ( step 430 ), modifying a procedure ( step 440 ), and deleting a procedure ( step 450 ). if the user selects to create a procedure ( step 430 ), then the system generates an editing interface and displays the contents of the procedure - program correspondence table ( step 431 ). afterwards , the user can start to edit the procedure ( step 432 ). if the user selects to modify a procedure ( step 440 ), the system displays all test procedures for the user to select and modify ( step 441 ). the user then modifies the contents in the procedure ( step 442 ). if the user selects to delete a procedure ( step 450 ), the system displays all test procedures for the user to select and delete ( step 451 ). the user then starts to delete the selected procedure ( step 452 ). after the user completes any of the editing items , the system performs the test program storage and update operation ( step 460 ). the system further prompts to ask the user whether he / she wants to continue with other editing items ( step 470 ). if the user wants to continue , the system returns to step 420 ; otherwise , the organizing and designing task is over and the procedure ends ( step 480 ). in addition to the flexible test program extension and maintenance and test procedure organization and design , the disclosed test system 200 further provides a method for performing test operations on apparatuses . with reference to fig4 the method is described as follows : first , the apparatuses to be tested ( e . g . apparatus a 10 , apparatus b 20 , apparatus c 30 , etc ) are connected to the test system 200 ( step 510 ). the user then uses the operating interface ( e . g . operating interface a 40 , operating interface b 50 , operating interface c 60 , etc ) generated by the system to select a test procedure to be performed ( step 520 ). accordingly , the procedure execution module 240 extracts the desired test program from the test program database 210 ( step 530 ). afterwards , the system runs in order according to the test procedure for each of the apparatuses ( step 540 ). once a test procedure is completed , the system , determines whether any unfinished test procedure exists to be performed ( step 550 ). if there are unfinished jobs , the system returns to step 530 to carry subsequent test procedures . after all test procedures are done , all test results are displayed for the user &# 39 ; s reference ( step 560 ). the apparatus test operation thus finishes ( step 570 ). [ 0026 ] fig5 is a schematic view of various operating interfaces generated when different functions are selected . we take the operating interface n 60 as an example . when the user selects to perform the apparatus test operation , the invention generates a use interface n 61 in the user operating interface n 60 . when the user selects to perform the test program extension and maintenance , the invention produces a development interface n 62 in the user operating interface n 60 . if the user selects to organize and design a test procedure , the system generates an editing interface n 63 in the user &# 39 ; s operating interface n 60 . through dedicated interfaces of different functions , the user can quickly accomplish a desired task without difficulty . the disclosed test system with flexible extension and maintenance and the method thereof utilize the design of independent structures . it does not only make the test operation more efficient , but also allows the user to easily accomplish a desired job through the associated specific interface . moreover , new test operations can be easily created using the invention to satisfy the needs of the enterprise .	6
as required , detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely exemplary of the invention that may be embodied in various and alternative forms . the figures are not necessarily to scale ; some features may be exaggerated or minimized to show details of particular components . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the present invention . in general , a method and system constructed in accordance with at least one embodiment of the present invention provides the ability to track staff , patients , or assets within a facility or tracking environment . this is accomplished through the use of badges or tags ( used interchangeably herein ) on the persons or objects needing to be tracked . to facilitate this , sensors ( usually one per room and spaced out in hallways ) and other communication links or repeaters are strategically located to provide communications to a gateway port ( usually ethernet ) into a house it system ( i . e . house data system ). infrared and rf are used between the badges and sensors for acquiring location information and rf is used exclusively by the badges back to the house it system . communication means other than ir and rf could also be used . referring now to the drawing figures , fig1 a illustrates a sample facility installation where the gateway can be located such that the tags and diagnostic communications of the sensors can be received directly by the gateway . sensors ( the ir receivers and rf transceivers ) are located in areas where location information is desired . link modules are not needed . fig1 b illustrates a sample larger facility installation where link modules are used to extend the rf coverage . the gateway to the house data system is located so that the distances to the furthest devices are minimized . sensors ( the ir receivers and rf transceivers ) are usually located one in each area to be identified . the link modules are placed in locations where they provide the necessary coverage to pick up tags and the relay the diagnostic signals of the sensors . fig2 a illustrates the rf and ir components of the rtls system for a smaller facility . they are shown identifying their ir and rf communications capabilities . tags have ir transmit and bidirectional rf capability and can communicate with sensors and a gateway . sensors have ir receive and bidirectional rf capability and can communicate with tags and a gateway . the gateway has bidirectional rf capability for communicating with tags and sensors along with a network interface which is typically ethernet to communicate with the house data system . fig2 b illustrates the rf and ir components of the rtls system for a larger facility and are shown identifying their ir and rf communications capabilities . tags have ir transmit and bidirectional rf capability and can communicate with sensors and links . link modules have bidirectional rf capability only and are capable of communicating with tags , sensors , and a gateway . sensors typically have ir receive and bidirectional rf capability . the gateway has bidirectional rf capability for communicating with links along with a network interface which is typically ethernet to communicate with the house data system . fig3 a illustrates , based on an event such as from a timer or switch closure , a tag which transmits a short ir packet consisting of a start bit and a few other bits to convey data such as mode and / or error checking compared to previous architectures where the serial number of the tag was embedded this packet length results in a length reduction typically greater than 10 to 1 . with current ir devices , the ir transmission length can be on the order of 4 - 8 milliseconds or less compared to systems where the data bits required to convey the serial number require a transmission length more on the order of 70 - 80 milliseconds or 10 % or less of what was required with the serial number embedded . this has a number of important benefits : 1 . significant reduction in battery drain since the power needed for the ir transmission consumption is a major determiner of battery life ; 2 . reduces the probability of collisions and retries to as little as one - tenth or less since shorter packets are less likely to collide ; 3 . makes possible support for longer serial numbers with lengths supported to 32 bits or more since the serial number is handled in the rf communication ( much higher rf data rate of 250 kbps ) and not in the ir ( 2 kbps data rate for ir ). while higher ir data rates are possible , this takes a toll on range and renders the location determination compromised . previous systems with embedded ir serial numbers had limitations typically set to 16 bits in the serial number to minimize the ir length but this shorter length results in only 65 , 536 unique serial numbers . consequently , rollovers ( duplication ) of serial numbers at a customer site compromises system integrity and makes for problems in the marketplace . in the small facility configuration , the tag acquires its location by sending a short ir message and receiving an rf transmission from a nearby sensor . if no response is received after a predetermined delay , the tag will retry . this process is continued on a predetermined schedule by a tag so that it is always up to date with the location id ( sensor serial number ) that it is nearest . on an independent schedule , the tag can pass on its location id to a gateway to communicate to the house data system its current location . previous designs required this to occur as part of the communication with the sensor . this architecture permits it to occur only as needed such as on location change which results in fewer rf transmissions reducing the likelihood of collisions and increasing battery life . fig3 b illustrates in a larger facility where rf range may be a problem . link modules may be employed to enable tags and sensors to communicate with the gateway at a much greater distance . the process of the tag in acquiring location information ( nearest sensor &# 39 ; s serial number ) is the same as with a smaller system but the link modules enable communication at a greater distance by repeating the tag communications to and from the gateway . the flow chart of fig4 demonstrates the process by which the tag acquires and validates its location id . the tag sends a short ir packet to the sensor ( s ). it expects an rf message back from the nearest sensor . a timeout is employed to prevent the tag from waiting an unreasonable amount of time and if no message is received the tag will , after a predetermined time delay , try again with another ir packet . when an rf packet from a sensor is received , the tag conditions its acceptance as a location by comparing with previous location ids . if the same location id is not received n times in a row , it will not accept the new location id . this validation process is desirable because the possibility exists that two tags in adjacent areas might coincide time - wise in communicating with different sensors and the sensor rf message that a tag receives could be from a sensor in a nearby area and not the one it sent its ir packet to . the validation process consists of receiving a location id from a sensor and doing this several times with varied programmable delays so that no two tags would be communicating successively with the same sensor to make it through the validation process . if a tag fails to communicate or validate with any sensor within a predetermined number of attempts , the location id will be set to a value such as zero to designate that no validated location information has been received by the tag . the validation process is the same whether or not link modules are used to extend communication with the gateway . fig5 a illustrates that in a smaller facility at predetermined time intervals the tag transmits an rf packet to the gateway . it looks for a return gateway rf packet and if not received within a predetermined amount of time it delays and retries the process . when it receives a gateway packet , it extracts its message or acknowledgment and acts on the message or goes to sleep if acknowledged . fig5 b illustrates that , similar to the smaller facility in a larger system , link modules are used to extend the range . in this case , the tag transmits an rf packet to a link module . the link module passes this on to the gateway and receives a return message . the tag waits for an acknowledgment or message and retries with the link module if it does not receive one . it acts on the message or goes to sleep if acknowledged . fig6 illustrates that , for extended range systems , the gateways and tags communicate by going through link modules which receive the tag messages and pass them on to the gateway and receive the gateway messages and pass them on to the tags . fig7 illustrates that if a switch on the tag is closed or certain other events happen on the tag , the tag will , after a predetermined delay , send a message to a link ( s ) or in the case of a smaller facility ( no links ) directly to a gateway . it will then wait for a return message or acknowledgment . if the exchange is not successful , it will retry after a predetermined delay until successful . fig8 illustrates a block diagram showing the major elements of a tag . the “ brains ” of the tag is a microprocessor which composes and sends the ir transmit packets and composes , sends and receives the rf packets . it also interacts with a motion detector ( to reduce tag functionality during inactivity for battery conservation and reduced ir / rf traffic ), switch ( es ), an rf transceiver , an ir transmitter , displays messages on an led or lcd , and provides power management . the following is a description of the approach that allows for minimizing the badge ir packet length while supporting long serial numbers . a badge containing an ir transmitter and an rf transceiver at programmable intervals sends a short infrared packet which is picked up by a nearby sensor which includes an ir receiver and an rf transceiver , among other things . this infrared packet consists of a unique bit pattern , some of which may be an error detection bit ( s ) such as parity , checksum or crc for the packet . one or more of the bits of the badge serial number may also be included in the packet to help reduce the chance of a misidentification and subsequent need for retry . an additional bit or more may be also employed to convey to the sensor a particular rf channel ( s ) to be used in responding or other mode controlling functionality . in its simplest form the ir packet is non - unique for all badges and in its more advanced form is unique to each badge . the sensor , upon receiving a badge ir transmission , responds by transmitting an rf packet in part consisting of the sensor serial number ( its id ). the exact time occurrence of this transmission from the sensor to the badge is not critical other than that it should occur within a reasonable period of time to preserve badge battery life since the receiver in the badge needs to be active until the rf transmission from the sensor has been received . if the rf transmission is not received within a reasonable interval , the badge will reinitiate the process . upon successful return of an rf transmission from the sensor , the badge extracts the sensor serial number and compares it with the last received sensor serial number . if it is the same , the badge accepts this sensor id as its current location . the badge is responsible to keep track of the sensor id as its location . any time a sensor id is received that is different from the previous , an additional exchange is desired for validation and it may be advantageous for the validation exchange to happen quicker than the normal period so as not to introduce any significant delay in the adoption of a new sensor location id . the maintenance of location information in the badge allows it to pass this information on through a link to the gateway and house system on its own schedule and with a process independent of the sensors . in the event of sensor rf transmissions being received by a badge from different locations simultaneously , there are several possibilities : the collision of the transmissions can cause neither to be received , in which case after a delay the badge retries . different badges would have different retry delays to avoid subsequent sensor rf collisions . the wrong transmission wins out . if a new location is indicated , a validation process would be performed before being accepted by the badge as a new location . different badges would have different validation retry delays to avoid subsequent sensor rf collisions . the right transmission wins out , in which case the process was successful and if its sensor id matches the previous one and the location is adopted . if it is different , it is recorded but not adopted until validated by a subsequent sequence . 1 . badge ir transmissions can be very short and only single sensor rf transmissions are needed for the badge to learn its location . 2 . the identification process is robust in that any badge change in location should go through a validation process . 3 . the badge communication only needs to be a single one - way ir transmission to the sensor . 4 . sensor communication only needs to be a one - way rf transmission to the badge . 5 . communication timing between the badge and sensor is not critical other than that it should occur within a reasonable time to not affect battery life . 6 . latency between the badge and house system is optimal since the sensor is not a part of that process . 7 . call functions from the badge and messaging to the badge , as well as prioritization of communications to and from the badge , do not involve the sensor and can be optimized independently . 8 . the amount of activity on the part of the sensor is minimal resulting in less sensor current drain making its operation on battery power practical . 9 . the fact that the sensor may have bidirectional rf capability allows diagnostic and supervisory functions between the system and sensors independent of the badges . there are a number of events that can be used to cause a badge to perform an infrared transmission to provide an update of a badge or tag location , some of which are : a specific ( and programmable ) timer function with the badge ; a user event such as a button press ; at least one embodiment of the present invention provides one or more of the following features : the short ir packet , besides helping with battery life on the packet itself , also helps with minimizing collisions in two additional ways : one , because of the reduced packet length ; and second , the frequency of occurrence of the ir packets can be reduced since the badges are aware of when they have successfully communicated with a sensor . in a one - way system where a badge never knows if it has been heard by a sensor , it therefore has to transmit on a more frequent basis . being able to optimize the fire rate based on success helps both on collisions and also on battery life independent of the packet length factor . this is provided to prevent misinterpretation of a location because of rf transmissions crisscrossing in a common area shared by two sensors when two badges in nearby areas happen to run in sync . in the architecture one may choose to validate two or more times ( up to some limit such as five ) before one accepts a new location . one can also accelerate the rate of retries during a validation sequence to reduce the impact of the retries on latency so the validation of location does not have to exact a toll on latency . the badges are aware when they fail to communicate with a sensor for some period of time and can convey that information ( the fact that they have not communicated with a sensor ) to a link and gateway to the house data system . because of the two - way rf communication capabilities that the sensors may possess , they can communicate with links on a periodic basis for diagnostic purposes to identify system problems at an early stage and improve system reliability . while exemplary embodiments are described above , it is not intended that these embodiments describe all possible forms of the invention . rather , the words used in the specification are words of description rather than limitation , and it is understood that various changes may be made without departing from the spirit and scope of the invention . additionally , the features of various implementing embodiments may be combined to form further embodiments of the invention .	6
in fig1 , an aircraft skin 10 supports a flow housing 12 that as shown , has a hollow strut 14 and a fore and aft facing flow tube 16 mounted onto the strut 14 . the flow tube 16 can have any desired cross - sectional shape , and is generally rectilinear or shaped like a flattened circle , and has an inlet end flow channel 18 through which freestream air low indicated by the arrow 20 is introduced . the flow through the flow tube 16 is controlled by having an outlet orifice 22 at the aft end of the flow tube . there is an opening 24 between the flow channel 18 and an aft branch flow channel 27 which opens to the hollow strut , which forms a branch flow channel 26 . liquid water is represented by the dashed lines 28 , and the flow housing 12 provides inertial separation of the liquid moisture so that little of the liquid water passes into the branch flow channel 26 . the branch flow channel 26 has an exhaust opening 30 at its rear or downstream side . this type of a flow housing is used in various temperature sensors , and for example is of the type shown in u . s . pat . no . 2 , 970 , 475 for a gas temperature probe . in the present invention , the flow housing 12 mounts temperature sensing probes for determining presence of icing conditions , and in this form of the invention , a probe indicated at 34 is mounted in the branch flow channel 27 of flow tube 16 , so that the freestream liquid moisture laden air impinges on the probe 34 . any liquid moisture impinging on the probe 34 will affect the power needed for heating or self - heating the probe , assuming it is desired to maintain the probe at constant temperature . a second temperature sensing probe 38 is mounted in the branch flow channel 26 , the flow in which branch channel is essentially free of liquid water , so the airflow across probe 38 is and remains substantially the same as dry , non - liquid water carrying air . since the detector must operate in icing environments the detector housing is provided with heaters 35 , preferably electrical , to prevent ice build - up . heaters 35 , for example , may be routed internally within the walls of the housing 12 or applied as a mat in a fashion similar to that currently done with many devices that must be ice protected such as temperature probes , pressure probes and antennae . to prevent deicing heat from significantly influencing the probes within the housing 12 , the flow tube , 16 , is provided with a number of small holes or perforations 36 , to bleed off the heated boundary layer that forms at the inside walls . this technique is currently used in some aircraft total temperature sensors for the same purpose . a baffle or heat shield 37 , is positioned in flow channel 26 , to further minimize the influence of deicing heaters located in the forward walls of strut 14 , or probe ( s ) located within flow channel 26 . an orifice , 39 , provides venting between the baffle 37 and the inner surface of the forward wall of the strut to prevent excessive temperature rise of the baffle wall . as shown in fig2 , where in the schematic diagram the resistances of probe 34 indicated as p 1 , and probe 38 , indicated as p 2 , are coupled into legs of a bridge circuit 40 . resistors r 1 , also indicated at 42 , and r 2 , also indicated at 43 , are coupled into the bridge and when the air in both of the branch flow channels 26 and 27 is essentially dry , and balanced to be substantially equal flow rates , the resistances of probes p 1 and p 2 ( 34 and 38 ) will react substantially the same and the bridge will remain balanced . this is indicated by the ratio p 1 / p 2 = r 1 / r 2 . the voltage source 46 , designated v supply , excites the bridge . the output of the bridge is across the opposite terminals from the input , and is designated v b in fig2 . this output signal is provided to an air data computer 50 . it should also be noted that bridge resistors r 1 and r 2 are selected to be substantially greater than the resistances of p 1 and p 2 to minimize heating of r 1 and r 2 . the computer 50 is provided with an air temperature signal from a temperature sensor or source indicated at 54 and this air temperature signal source can be a separate sensor mounted on the aircraft , or as will be explained in connection with fig3 and 4 , can be an additional probe mounted in the flow housing 12 . the sensor or source 54 provides freestream of ambient temperature . when moisture is such as that indicated by the lines 28 in flow channels 18 and 27 in fig1 , is present in the freestream air flow , the probe 34 ( p 1 ) will experience liquid moisture impingement , whereas little or no liquid moisture will impinge on probe 38 ( p 2 ). probes 34 and 38 are electrically self - heated to a temperature in the range of 50 degrees to 100 degrees c . above ambient . as an alternative to self - heating , separate heater elements integral with , or in close proximity to , the temperature sensing elements in the probes 34 and 38 can be used . the mass flow rate of flow stream in the branch channels 26 and 27 is controlled by regulating the size of outlets 22 and 30 , as well as the size of opening 24 so that the mass flow is substantially the same over each of the probes 34 and 38 . in a non - moisture situation , there will be more heat removed from each probe as the flow rate increases , but the amount of heat removed from each will be substantially the same . the bridge 40 will remain substantially balanced . thus , the output voltage designated v b is independent of the flow rate or air speed . if , however , there is liquid moisture present in the freestream airflow in branch channel 27 , the heat removed from the probe 34 ( p 1 ) is enhanced by evaporation and / or blow - off of warmed water since the probes are maintained at a temperature significantly above ambient . this results in a probe temperature change at probe 34 and a resistance change in the probe , and consequently an offset or change in output signal voltage v b . the offset in v b increases with increasing liquid water content at the same mass flow of air . there is sensitivity to frozen precipitation such as snow and ice crystals but this sensitivity will be relatively low , and will appear in the form of output voltage spikes that can be filtered by signal conditioning prior to providing the output signal to computer 50 , or filtering can be done in the computer 50 . the temperature measurement from the temperature sensor or signal source 54 is combined with the output of the bridge 40 , so that the computer provides an output that indicates icing conditions . icing conditions are indicated when the temperature t is slightly above freezing or less , and when a voltage output from the bridge circuit 40 , is caused by liquid moisture being present in branch channel 27 and impinging on probe 34 . in fig3 and 4 , an alternative form of the invention is shown . probes 34 ( p 1 ) and 38 ( p 2 ), are positioned the same as in fig1 , but an optional temperature sensing probe 60 is provided in the branch flow channel 26 . probe 60 preferably is positioned upstream of the probe 38 ( p 2 ) to avoid heating influences from the probe 38 , which as stated is held above ambient temperature . the resistance of probe 60 ( p 3 ) and a resistor 62 that is shown connected into an alternative bridge circuit 64 are chosen to be at least an order of magnitude greater than the resistances of probes 34 and 38 ( p 1 and p 2 ). this selection or resistances will significantly limit self - heating effects . the resistance element in probe p 3 is in the leg of a bridge circuit 64 that is shared by heated probes p 1 and p 2 , as shown in fig4 . this bridge arrangement affords two bridge voltage outputs , designated v 1 and v 2 in fig4 . the output v 1 indicates the change in resistance that occurs in moisture laden or water laden air in branch flow channel 27 , and v 2 is an output that is indicative of the resistance of the probe in the branch flow channel 26 , where moisture has been separated . the arrangement of fig3 and 4 reduces the dependency of determining mass flow rate , or making the mass flow rates equal over the probes 34 and 38 as shown in fig1 , because there is an independent measurement of heat loss from probes located in flow branch channels 27 and 26 . there is a known relationship between v 1 and v 2 as a function of dry airflow rate . furthermore , dry air mass flow rate can be discerned from voltage v 4 across the heated probe 38 in the dry air channel , 26 , and v 3 , the voltage drop across the temperature sensing probe 60 , also in dry air channel 26 . with moisture laden air in the channel 18 , the relationship between v 1 and v 2 will be different because of additional heat losses at probe 34 ( p 1 ) from evaporation and / or blow - off since the branch channel 27 carries the liquid moisture , while branch channel 26 carries air with little or no liquid moisture . therefore , if the voltage relationship between v 1 and v 2 changes , from the expected relationship with dry air in both branch flow channels , the presence of liquid moisture in branch flow channel 27 is indicated . voltage source v supply and voltage v 3 shown in fig4 , can be measured and provided to a computer 70 , to determine the ambient air temperature . temperature and moisture information is thus available to determine the presence of icing conditions as an output 72 from the computer 70 . the computer is provided with a set point signal so that when liquid moisture is sensed to be present and the measured air temperature is below the set point , icing conditions are indicated . it is to be noted that any type of inertial separation flow path can be utilized , and the structure shown herein is merely an example of the type that could be used . the change in direction of a flow can be caused by baffles , obstructions such as posts that cause diversion of particles , and various other shapes and forms of channels that have flow paths branching at a sufficient angle such that the heavier particles will continue in their flow direction under inertial forces and the branch path or bleed path will carry airflow that is substantially free of any liquid moisture particles . the ability to provide orifices or other flow controls such as the outlets 22 and 30 in fig1 for exhaust of fluids , is a way of ensuring that the mass flow rates in the separated channels are substantially the same , and yet inertial separation will keep the liquid particles moving in the same direction along in the straight flow path through branch channel 27 . in fig4 , the quantity r 1 / p 1 approximately equal to r 3 / p 3 and is approximately equal to r 2 / p 2 . also r 3 is substantially greater than r 1 , and r 1 is substantially equal to r 2 in order to have the bridge perform satisfactorily . in fig5 , a flow housing 80 is illustrated , and is of substantially the same form as the flow housing 12 and strut 14 , but in this instance , the flow tube 81 forms a flow channel directly from a flow inlet 84 and through a control orifice 86 at the outlet . a strut 88 is used for supporting the flow housing 80 relative to an aircraft skin 90 , and in this instance , the strut opening does not carry flow and is a hollow pipe that has no flow outlet for exiting air . the strut could be solid , in other words , in this form of the invention . a probe indicated at 92 and which can be represented as p 4 is a heated , or self - heated temperature sensitive probe that is deployed in the airstream , and there is no special ducting required . a flow housing for providing ducting is preferred particularly to control airflow over the probe , to minimize probe operating power and to protect the probe , although the probe can protrude directly into an airstream so long as the liquid water is not separated from the airstream in which the probe is mounted . in this form of icing conditions detector , the operation of the probe 92 is based upon the well known fact that power consumed by a heated body maintained at a constant temperature above ambient of the airstream is a function of the mass flow rate . it is desired to maintain the body , in this case the probe 92 , at a fixed temperature above ambient . power consumed in a dry environment will have a fixed relationship to the mass flow rate calculated from the air data information available from another source . probe 92 , which again is self - heated or with a separate heater that is shown schematically at 92 h in fig5 , is connected to a computer 96 with a controlled power source , and the computer provides power to the heater or the self heating resistor along a line 98 , and through a “ power consumed ” indicator 100 , which essentially is the power input to the probe 92 . the computer will measure the power that is drawn to maintain the temperature of the probe 92 . this power consumed signal provided along a line 102 back to the computer 96 and is maintained at a desired level . in order to provide the data or information necessary to determine the mass flow rate , a pitot ( total ) pressure input 104 , a total air temperature input 106 , and a static pressure input 108 can be used to calculate the mass flow rate , and provide the known parameters to the computer 96 for determining the power that would be consumed at the existing mass flow rate if the probe 92 is in dry air . then , using the actual power consumed from the indicator 100 , the computer provides an indication when moisture is present in the airflow . the amount of moisture can also be determined by empirical tests , or calculations that are related to the particular probe 92 , and what power this probe consumes or requires to maintain a selected temperature in airflow having liquid moisture conditions at different mass flow measurement rates . again , to assess icing conditions , a measurement of temperature from a temperature sensor 106 , providing a temperature parameter to a computer system is necessary . temperature sensing is well known in aircraft , and air data sensors . the effect of water vapor , that is , humidity , in the airflow will have little influence on performance of the detector of the present invention . the detectors are very sensitive , however , to the presence of water droplets , that is liquid water in the air . it is also recognized that the heat transfer capability of air is not only a function of mass flow rate , but also temperature . compensating for temperature , if necessary , can be done by suitable analytical techniques that would provide information to a control computer , or direct compensation in the circuitry by having temperature dependent circuit elements . the ability to provide these compensation techniques are presently done in existing mass flow measurement products . although the present invention has been described with reference to preferred embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention .	6
the explanation about the humidifying module according to the preferred embodiment of the present invention will be carried out referring to the attached drawings . fig1 a is a perspective view of the humidifying module according to the first preferred embodiment of present invention . fig1 b is a partially enlarged view of part i of fig1 . fig1 c is a sectional view along the line a - a ′ in fig1 b . as shown in fig1 a through fig1 c , a humidifying module according to the first preferred embodiment of the present invention is composed of a housing la and a plumbing 2 . a hollow fiber membrane bundle 1 b , which can achieve the moisture exchanging between the fluid passing inside and outside of the hollow fiber membrane , is installed within the housing 1 a in the condition that both end parts of the hollow fiber membrane bundle 2 b are fixed . the plumbing 2 has an inlet 2 a for loading the fluid therein , and outlets 2 b for leading the fluid , which is led through the inlet 2 s , into the hollow fiber membrane bundle 1 b , in other words , outside of the hollow fiber membranes . the plumbing 2 is inserted into the hollow fiber membrane bundle 1 b , so that the total inserted length of the plumbing 2 may be shorter than the length in the longitudinal directions of the hollow fiber membrane bundle 1 b . the location where the plumbing 2 is inserted is about central portion with respect to the thickness direction of the plumbing 2 . the shape of the housing la is a circular cylinder hollow , both sides of which are opened , and a plurality of circular through holes sout are bored along the circumference thereof . the position , a plurality of circular through holes sout are bored , is the upstream side than the fixing part 1 c ′ wherein end part of the hollow fiber membranes are fixed by adhesion using the resins , and is the opposite side with respect to the inlet 2 a of the plumbing 2 . the plumbing 2 has a bottomed cylindrical shape , and acts an inner flow passage . in other words , the plumbing 2 is a circular hollow pipe , into which a bottom bs is formed , and at the one end part of which an inlet 2 a for loading the fluid is formed . a plurality of circular through holes hout are bored at vicinity of the bottom bs along the circumference of the plumbing 2 . the plumbing 2 is arranged so that the total inserted length of the inlet 2 a , for example , the length from the fixing part 1 c to the outlet 2 b of plumbing 2 , may be shorter than the length in the longitudinal direction of the hollow fiber membrane bundle 1 b . by arranging the plumbing 2 with above described manner , the fluid loaded through the inlet 2 a comes to be supplied over the whole longitudinal direction of the hollow fiber membrane bundle 1 b as much as possible . a protrusion part 2 c having a circular cone shape is provided at the bottom bs of the plumbing 2 so that the tip part of the protrusion part 2 c may be opposite to the flow direction of the fluid loaded through the inlet 2 a . the position where a plurality of through holes hout are bored is established so that at least one through hole is provided at the downstream side with respect to the tip part of the protrusion part 2 c . to be more precise , the position x of the through hole , which is located at the most downstream side among a plurality of through holes hout , must be in the position between the tip part of the protrusion part 2 c and the bottom bs . these through holes hout are provided at vicinity of the bottom bs of the plumbing 2 along the circumference of the plumbing 2 . the shape of the through hole is not restricted to the above - described case as long as it can pass through the fluid . for example , a polygonal shape and an oval shape may be acceptable . a long hole prolonging along the circumferential direction may also be acceptable as a shape of the through hole . when the high humid gas , which is the fluid containing steam and condensed water therein , is loaded to the humidifying module 1 through the inlet 2 a of the plumbing 2 , the functions and the advantages as below can be brought out . ( 1 ) in the plumbing 2 , the route section of the high humid gas becomes small as approaches to the downstream side ( bottom bs side ) from the tip part of the protrusion part 2 c having a circular cone shape . thus , the flow rate of the high humid gas becomes high as approaches to the downstream side ( bottom bs side ). ( 2 ) in the present invention , since the protrusion part 2 c having a circular cone shape is provided , the collision area with humid gas becomes gradually wide as approaches to the downstream side . therefore , high humid gas passing through the plumbing 2 receives a shear force along the surface of the circular cone as approaches to the down stream side , and thus pushed toward the outer side ( toward the radius direction of the hollow fiber membrane ). that is , high humid gas is pushed toward the outer side more certainly than the conventional construction of the plumbing where the bottom of the plumbing is a plane shape and the fluid was received by the whole bottom part ( plane surface ). ( 3 ) as a result of the multiplier effect of these factors , high humid gas loaded through the inlet 2 a moves along the surface of the circular corn , and then smoothly passed through a plurality of through holes hout located at the outlet 2 b . therefore , the occurrence of the remained fluid at the outlet 2 b can be prevented even if the fluid containing steam and condensed water in the mixed condition is lead to the humidifying module 1 . the occurrence of the remained fluid can be prevented as this , the problems , such as the fracture of the plumbing caused by the freeze of remained fluid and the aggravation of the starting response of a fuel cell caused by the temperature dropping and freezing of the remained fluid can thus be prevented . the delay of the transient response can also be prevented . in the present invention , furthermore , since the same circular members are adopted , that is , the shape of the inner flow passage is a circular cylinder hollow shape and the shape of the protrusion part is a circular cone , a humidifying module with superior assembling efficiency can be obtained . since the fluid comes to be supplied over the whole hollow fiber membrane bundle 1 b with sufficient fluid distribution toward the radius direction , furthermore , the usability of the hollow fiber membrane can be improved . ( 4 ) in the present invention , high humid gas , supplied to the hollow fiber membranes bundle 1 b through a plurality of through holes hout of outlet 2 b , streams the outside of the hollow fiber membranes installed in the housing 1 a . at this time , the low humid gas passing through the inside of each hollow fiber membrane of the hollow fiber membrane bundle 1 b is thus humidified , and then high humid gas after giving the moisture to the low humid gas is discharged through the through holes sout provided along the circumference of the housing 1 a . ( 5 ) on the other hand , low humid gas is loaded through the opening 1 din of the housing la so that it must be a countercurrent flow with respect to the flow direction of high humid gas passing through the outside of the hollow fiber membrane . low humid gas is humidified during passing through the inside of each hollow fiber membranes of the hollow fiber membranes bundle 1 b installed in the housing 1 a , and then exhausted through the opening 1 dout of housing 1 a . the explanation about another embodiment of the protrusion part disposed at the bottom of the plumbing in the humidifying module will be carried out with referring to fig2 and fig3 . in the following explanation , except for the shape of the protrusion part or the sectional shape of the plumbing , the composition of the humidifier is same as above - described . therefore , only the explanation about the construction and the function according to the principle part will be carried out as below . the explanation about the protrusion part of the present second embodiment provided at the bottom of the plumbing , through which the fluid is supplied to the humidifier , will be carried out . [ 0074 ] fig2 a is a sectional view in the longitudinal direction of the plumbing into which the protrusion part is disposed . fig2 b is a plan view of the protrusion part looked from the inlet direction of the plumbing . to be more precise , the sectional view along the line b - b ′ in fig2 a the protrusion part 3 d of the humidifier according to the second preferred embodiment , as shown in fig2 is disposed at the bottom bs 1 of the plumbing 3 having the rectangular shape in the sectional view . the protrusion part 3 d is formed by stacking the plates of the square pole so that the size of the square pole becomes small gradually as approaches to the upstream side . so called like a pyramid shape is figured . in the present embodiment , the route section may be small as the downstream side ( bottom bs 1 side ) of the plumbing 2 approaches . since this protrusion part 3 d is formed by stacking the plates of the square pole , the protrusion part having the suitable size depending on the sectional figure of the plumbing 3 can be easily manufactured . the formation manner of the protrusion part 3 d is not restricted to this manner , for example , the machined technique may be acceptable for forming the protrusion part 3 d from one square pole . when the high humid gas , which is the fluid containing steam and condensed water therein , is loaded to the humidifying module 1 through the inlet 3 a of the plumbing 3 , the functions and the advantages as bellow can be brought out . ( 1 ) in the plumbing 3 , the route section of the high humid gas becomes small as approaches to the downstream side ( bottom bs 1 side ) from the tip part of the protrusion part 3 d having a square stairway shape . thus , the flow rate of the high humid gas becomes high as approaches to the downstream side ( bottom bs 1 side ). ( 2 ) in the present invention , since the protrusion part 3 d having a square stairway shape is provided , the collision area with humid gas becomes gradually wide as approaches to the downstream side . therefore , high humid gas passing through the plumbing 3 receives shear force along the surface of the square stairway as approaches to the down stream side , and thus pushed toward the outer side ( toward the radius direction of the hollow fiber membrane ). that is , high humid gas is pushed toward the outer side more certainly than the conventional construction of the plumbing where the bottom of the plumbing is plane shape and the fluid was received by the whole bottom part ( plan surface ). ( 3 ) as a result of the multiplier effect of these factors , high humid gas loaded through the inlet 3 a moves along the surface of the protrusion part 3 d , and then smoothly passed through a plurality of through holes hout located at the outlet 3 b . therefore , the occurrence of the remained fluid at the outlet 3 b can be prevented even if the fluid , high humid gas , containing steam and condensed water in the mixed condition , is led to the humidifying module of the present second preferred embodiment . as this , since the occurrence of the remained fluid can be prevented , the problems , such as the fracture of the plumbing caused by the freeze of remained fluid and the aggravation of the starting response of a fuel cell by the temperature dropping and freezing of the remained fluid can be prevented . the delay of the transient response can also be prevented . the explanation about the protrusion part of the present third embodiment disposed at the bottom of the plumbing , through which the fluid is supplied to the humidifier , will be carried out . [ 0084 ] fig3 a is a sectional view in the longitudinal direction of the plumbing into which the protrusion part is disposed . fig3 b is a plan view of the protrusion part looked from the inlet direction of the plumbing . to be more precise , the sectional view along the line c - c ′ in fig3 a the protrusion part 4 d according to the third preferred embodiment , as shown in fig3 is disposed at the bottom bs 1 of the plumbing 4 . the protrusion part 4 d is formed by stacking the plates of the circular pole so that the size of the circular pole becomes small gradually as approaches to the upstream side . so called like a pyramid shape is figured . in the present embodiment , the route section becomes small as the downstream side ( bottom bs 1 side ) of the plumbing 4 approaches . since this protrusion part 4 d is formed by stacking the plates of the circular pole , the protrusion part having the suitable size depending on the sectional figure of the plumbing 4 can be easily manufactured . the formation manner of the protrusion part 4 d is not restricted to this manner , for example , the machined technique may be acceptable for forming the protrusion part 4 d from one circular pole . when the high humid gas , which is the fluid containing steam and condensed water therein , is loaded to the humidifying module through the inlet 4 a of the plumbing , the functions and the advantages as bellow can be brought out . ( 1 ) in the plumbing 4 , the route section of the high humid gas becomes small as approaches to the downstream side ( bottom bs 2 side ) from the tip part of the protrusion part 4 d having a circular stairway shape . thus , the flow rate of the high humid gas becomes high as approaches to the downstream side ( bottom bs 2 side ). ( 2 ) in the present invention , since the protrusion part 4 d having a circular stairway shape is provided , the collision area with humid gas becomes gradually wide as approaches to the downstream side . therefore , high humid gas passing through the plumbing 4 receives the shear force along the surface of the circular stairway as approaches to the down stream side , and thus pushed toward the outer side ( toward the radius direction of the hollow fiber membrane ). that is , high humid gas is pushed toward the outer side more certainly than the conventional construction of the plumbing where the bottom of the plumbing is plane shape and the fluid was received by the whole bottom part ( plan surface ). ( 3 ) as a result of the multiplier effect of these factors , high humid gas loaded through the inlet 4 a moves along the surface of the circular stairway , and then smoothly passed through a plurality of the through holes tout located at the outlet 4 b . therefore , the occurrence of the remained fluid at the outlet 4 b can be prevented even if the fluid containing steam and condensed water in the mixed condition is lead to the humidifying module of the present third preferred embodiment . as this , since the occurrence of the remained fluid can be prevented , the problems , such as the fracture of the plumbing caused by the freeze of remained fluid and the aggravation of the starting response of a fuel cell by the temperature dropping and freezing of the remained fluid can be prevented . the delay of the transient response can also be prevented . the explanation about one preferred embodiment of the humidification system , in which the humidifying module having a above described construction and function of the first preferred embodiment is applied as the humidifier , will be carried out with referring to the attached drawings . the explanation about the construction of the whole humidification system of the fuel cell according to the first preferred embodiment will be carried out with referring to fig4 as below . as show in fig4 a humidification system of the fuel cell according to the first preferred embodiment is consist of a fuel cell 10 , a humidifier 11 ′, 12 ′, and a supercharger ( s / c ) 14 . the fuel cell 10 generates a electric power by the reaction of hydrogen , which is contained in a fuel gas and supplied to the anode , with the oxygen , which is contained in the air and supplied to the cathode . the humidifier 11 ′ and 12 ′ humidifies the gasses before supplied to the anode and cathode of the fuel cell 10 , respectively , by performing the moisture exchange between the gasses before supplied to the fuel cell 10 and the discharged gas discharged from the cathode side of the fuel cell . the supercharger ( s / c ) 14 supplies the air , which is an oxidizing agent gas , to the cathode of the fuel cell 10 . here , the fuel cell 10 plays a role of the humidification system . the fuel cell 10 is the solid macromolecular adopting type fuel cell , and generates the electric power by the reaction of the hydrogen contained in the fuel gas with the oxygen contained in the air . 2 h + +( 1 / 2 ) o 2 + 2 e − → h 2 o ( 2 ) here , formula ( 1 ) shows a reaction in the anode . formula ( 2 ) shows a reaction in the cathode . formula ( 3 ) shows the reaction carried out in a whole fuel cell . as a result of the reaction in the fuel cell , water comes arises at the cathode . the water generated at the cathode is generally evaporated and then discharged from the fuel cell 10 along with the air not used in the reaction . in the fuel cell 10 of the solid macromolecular membrane type , furthermore , the solid macromolecular membrane is adopted as the electrolyte layer . this fuel cell 10 has a structure formed by stacking a plurality of single cells , which is composed of a pair of gas diffusion type electrodes , and a separator for separating the fuel gas and the air . in this single cell , the solid macromolecular membrane is sandwiched by the pair of gas diffusion type electrodes , which is also sandwiched by the separator from its outer side . the humidifier 11 and 12 ′ has the humidifying module 1 to which the bottomed plumbing 2 is provided as the inner passage . a protrusion part 2 c is disposed at the bottom bs of the plumbing 2 as shown in fig1 . the hollow fiber membrane adopted in the humidifier 11 ′ is an ion hydration type non - porosity film ( for example , product name : nafion film ), which penetrates only water . on the other hand , the hollow fiber membrane adopted in the humidifier 12 ′ is a capillary - condensation type of conventional use , and is the porous film , which also penetrates gas molecules other than water . in the humidifier 11 ′, which supplies the humid fuel gas to the anode of the fuel cell 10 , since the non - porosity film is adopted , only the moisture is certainly moved to the anode side from the cathode side without passing the gasses while performing the moisture exchanging between the fuel gas ( containing hydrogen ) and the exhaust gas ( containing oxygen ) exhausted from the cathode . thus , the occurrence of the mixing of the hydrogen gas and the oxygen gas can be prevented , an ejector 13 is one of the vacuum pump for circulating the fuel gas supplied to the anode , and principal part thereof is composed of the a nozzle , a diffuser , a suction room , etc . this ejector 13 has a simple structure and excels in the operationablity and the maintainability . since there are no movable portions , such as a rotatable or a slidable portion , also excels in the durability . moreover , there is also merit that suitable materials having the corrosion resistance can be chosen depending on the type of the absorbed gas . the supercharger ( s / c ) 14 , which is a mechanical supercharger , absorbs the air of atmospheric pressure and compress it and then supply it to the cathode of the fuel cell 10 . a lysholm type compressor can also be used instead of supercharger ( s / c ) 14 . the function of the humidification system of the fuel cell according to the first preferred embodiment will be explained as follows . the fuel gas , which is a low humid gas , fed to the ejector 13 is supplied to the humidifier 11 ′ after compressed by the ejector 13 . the fuel gas ( low humid gas ) supplied to the humidifier 11 ′ is humidified by the moisture exchanging with the exhaust gas ( high humid gas ) discharged from the cathode of the fuel cell 10 while passing through the inside of the humidifying module equipped in the humidifier 11 ′, and then supplied to the anode . the hydrogen contained in the fuel gas supplied to the anode of the fuel cell 10 reacts with the oxygen contained in the air supplied to the fuel cell 10 from the supercharger ( s / c ) 14 , and thus electric power is obtained . the fuel gas not used in the reaction is supplied to the post process ( for example , a catalytic combustor ) as an exhaust gas . some of the exhaust gas are absorbed by the ejector 13 , and then circulated to the fuel cell 10 for reusing as a fuel gas . in the super charger ( s / c ) 14 , on the other hand , the air in the atmosphere is absorbed and then led to the humidifier 12 ′ as a low humid gas . the air ( low humid gas ) led to the humidifier 12 ′ is humidified by the moisture exchanging with the exhaust gas ( high humid gas ) discharged from the humidifier 11 ′ while passing through the humidifying module , and then supplied to the cathode . the air , which is supplied to the cathode in the fuel cell 10 and not used in the reaction with the hydrogen contained in the fuel gas , is supplied to the humidifier 11 ′ as an exhaust gas . the exhaust gas supplied to the humidifier 11 ′ humidifies the fuel gas supplied from the ejector 13 by achieving the moisture exchanging , and then exhausted from the humidifier 11 ′. the exhaust gas discharged from the humidifier 11 ′ is supplied to the humidifier 12 ′, and humidifies the air supplied from the supercharger ( s / c ) 14 by the moisture exchanging . the exhaust gas after the moisture exchanging , is discharged from the humidifier 12 ′, and supplied to the post process , for example , a catalytic combustor . a second preferred embodiment of the humidification system , in which the humidifying module of the first preferred embodiment is adopted as the humidifier of the fuel cell will be explained as referring to the attached drawings . in the following explanation , the same components and the plumbing as explained in the first preferred embodiment is indicated using the same symbol as in the explanation of the first preferred embodiment . as shown in fig5 the differences in the construction of the humidification system between first and second preferred embodiment is the arrangement of the humidifier 11 and 12 . the humidifier 11 carries out the moisture exchanging between the fuel gas supplied to the anode and the exhaust gas discharged from the anode . the humidifier 12 carries out the moisture exchanging between the air supplied to the cathode and the exhaust gas discharged from the cathode . in the humidification system according to the second preferred embodiment , the porous membrane is used as the hollow fiber membrane adopted in the humidifier 11 and 12 . the construction of another components expect for the above - described is same as in the first preferred embodiment , thus the explanation about them are omitted here . the function of the humidification system of the fuel cell according to the second preferred embodiment will be explained with referring to fig5 . the fuel gas , which is a low humid gas , fed to the ejector 13 is supplied to the humidifier 11 by the ejector 13 . the fuel gas ( low humid gas ) supplied to the humidifier 11 is humidified by the moisture exchanging with the exhaust gas ( high humid gas ) discharged from the anode of the fuel cell 10 while passing through the humidifying module equipped in the humidifier 11 . the hydrogen contained in the fuel gas is supplied to the anode of the fuel cell 10 and reacts with the oxygen contained in the air , which is supplied to the cathode of the fuel cell 10 from the super charger ( s / c ) 14 , and thus electric power is obtained . the fuel gas not used in the reaction is again supplied to the humidifier 11 as an exhaust gas ( off gas ). the exhaust gas led to the humidifier 11 humidifies the fuel gas supplied to the humidifier 11 from the ejector 13 by giving the moisture , and then supplied to the post process , for example , a catalytic - combustor . some of the exhaust gas discharged from the humidifier 11 are absorbed by the ejector 13 , and then circulated to the anode of the fuel cell 10 as a fuel gas . in the super charger ( s / c ) 14 , on the other hand , the air in the atmosphere is absorbed and then led to the humidifier 12 as a low humid gas . the air ( low humid gas ) led to the humidifier 12 is humidified by the moisture exchanging with the exhaust gas ( high humid gas ) discharged from the cathode of the fuel cell 10 while passing through the humidifying module , and then supplied to the cathode . the air not used in the reaction with the hydrogen contained in the fuel gas is discharged from the fuel cell 10 and supplied to the humidifier 12 as an exhaust gas . the exhaust gas supplied to the humidifier 12 humidifies the fuel gas supplied from the super charger 14 by giving the moisture , and then supplied to the post process , for example , a catalytic combustor . the operation result of the humidification system of the fuel cell according to the first preferred embodiment will be explained with referring to fig6 through fig8 . fig6 is an explaining view showing the timewise change of the humidification amount from the startup to the stable operative condition . as can be seen from fig6 the total time required for achieving the stable operating condition after obtaining the constant humidification amount is shorter than the humidification system of the conventional fuel cell . [ 0127 ] fig7 is a comparative view of the total time required for achieving the stable operating condition after startup of the humidifying module between the present invention and the conventional manner . fig7 a is an explaining view showing the timewise change of the total time required for achieving the stable operating condition after the startup of the humidifying module of the conventional technique . fig7 b is an explanation view showing the timewise change of the total time required for achieving the stable operating condition after the startup of the humidifying module of the present invention . as can be seen from fig7 a and fig7 b , in the humidifying module of the present invention , the total time required for achieving the stable operating condition after startup is shorter than the conventional manner . that is , the humidifying module of the present invention surpasses in the responsibility . [ 0129 ] fig8 is an explanation view showing the relation between the humidification amount and the temperature of the gas loaded to the hollow fiber membrane bundle . as can be seen from fig8 total humidification amount becomes higher as the temperature of the gas loaded to the hollow fiber membrane bundle is higher . as decried above , since the fuel gas supplied to the fuel cell is humidified using the humidifier of the first preferred embodiment , the occurrence of the remained water at the bottom of the plumbing can be prevented even if the fluid , steam and condensed water are contained therein , is passed through the inner flow passage . thus , the problems , such as the fracture of the plumbing caused by the freeze of remained water , and the cooling down of the high humid gas discharged from the fuel cell by the remained water , can be prevented . in the present invention , furthermore , the gas led to the hollow fiber membrane bundle can be adjusted to the desired temperature with short duration . therefore , the humidifying module of the humidification system with the superior startup responsibility and the output responsibility can be obtained . in the present invention of above described functions and construction , the advantages as below can be obtained . ( 1 ) the route section of the fluid becomes small as approaches to the downstream side ( bottom side ) from the tip part of the protrusion part . thus , the flow rate of the fluid becomes higher as approaches to the downstream side ( bottom side ). ( 2 ) the protrusion part is provided so that the collision area with fluid becomes gradually wide as approaches to the downstream side ( bottom side ). therefore , the fluid receives the shear force along the surface of the protrusion part as approaches to the down stream side . the fluid is thus pushed toward the outer side ( toward the radius direction of the inner flow passage ). that is , fluid is pushed toward the outer side more certainly than the inner flow passage of the conventional construction wherein the shape of bottom is plane shape and the fluid was received by the whole bottom ( plan surface ). ( 3 ) as a result of the multiplier effect of these factors , the fluid is smoothly passed through the outlet of the inner flow passage . thus , the occurrence of the remained fluid at the bottom can be prevented even if the fluid containing steam and condensed water in the mixed condition is led to the humidifying module . as this , in the humidifying module according to the present invention , the occurrence of the remained fluid can be prevented . the problems , such as the fracture of the plumbing caused by the freeze of remained water , and the cooling down of the high - temperature gas discharged from the fuel cell by the remained water , can thus be prevented . therefore , the humidifying module , which brings the efficient output responsibility and the startup responsibility to the fuel cell , even if it is adopted to the humidification of the gas supplied to the fuel cell . according to the present invention , furthermore , since the same circular members are adopted , that is , the shape of the inner flow passage is a cylinder shape and the shape of the protrusion part is a circular cone . thus , the humidifying module with superior workability can be obtained . since the fluid comes to be supplied over the whole hollow fiber membrane bundle with sufficient fluid distribution toward the radius direction , the usability of the hollow fiber membrane can be improved . in the present invention , the flow rate to the perpendicular direction of the fluid , in other wards , the rate of diffusion in the radial direction , is increased , because of arranging the through holes at the vicinity of the bottom part of the inner flow passage along the circumferential . thus , the fluid comes to be supplied over the whole hollow fiber membrane bundle with sufficient fluid distribution toward the radius direction , and then the usability of the hollow fiber membrane can be improved . in the present invention , at least one through hole is positioned at the downstream side than the tip part of the protrusion part . ( i ) in the plumbing , therefore , the route section of the fluid becomes small as approaches to the downstream side ( bottom side ) from the tip part of the protrusion part . thus , the flow rate of the high humid gas becomes high as approaches to the downstream side ( bottom side ). ( ii ) in the plumbing , therefore , the protrusion part is provided at the bottom of the inner flow passage so that the tip part of the protrusion part may be opposite to the flow direction of the fluid . thus , the collision area with humid gas becomes gradually wide as approaches to the downstream side . therefore , the fluid receives shear force along the surface of the protrusion part as the downstream side approaches , and is pushed toward the outer side . that is , fluid is pushed toward the outer side more certainly than the conventional construction of the plumbing where the bottom of the plumbing is plane shape and the fluid was received by the whole bottom part ( plane surface ). ( iii ) in the plumbing , as a result of the multiplier effect of these factors , when fluid is led to the inner flow passage , the fluid led therein is smoothly passed through the through hole , because at least one through hole is positioned at the downstream side than the tip part of the protrusion part . if the through hole is positioned at the upstream side than the tip part of the protrusion part , since the passing of the fluid is disturbed by the fluid rebounded from the bottom , such excellent effectiveness is not obtained .	1
the detailed explanation of the present invention is described as follows . the preferred embodiments are presented for purposes of illustrations and description , and not intended to limit the spirit and scope of the present invention . fig1 illustrates a block diagram of an illuminating apparatus 1 equipped with an ac - powered led light engine 10 designed to gear up from the bottom up and gear down from the top down the extrinsic led sub - arrays ( g 1 , g 2 , g 3 , and g 4 ) in accordance with an embodiment of the present invention . the illuminating apparatus 1 comprises a rectifier 100 coupled to an ac mains , an ac - powered led light engine 10 , and a shared current sense and modulation unit 16 , and is loaded up with a plurality of extrinsic led sub - arrays ( g 1 , g 2 , g 3 , and g 4 ). the ac - powered led light engine 10 is coupled between the rectifier 100 and the extrinsic led sub - arrays ( g 1 , g 2 , g 3 , and g 4 ), and has a normally closed current regulator 120 coupled to the rectifier 100 via its high - side terminal and used to regulate the highest led current level near the rectified sinusoidal input voltage peak , a plurality of normally closed bypass switches ( s 1 , s 2 , and s 3 ) each connected in parallel with a corresponding led sub - array except for the bottommost led sub - array g 4 and shuttling between three switch states : on , regulation , and off according to a corresponding current sense signal , and a switch controller module 14 having a plurality of switch controllers ( 140 , 142 , and 144 ), each having a first terminal , a second terminal , and a third terminal , coupled between the shared current sense and modulation unit 16 via its first terminal and a corresponding bypass switch via its third terminal as a feedback network and taking control of the three switch states . a plurality of resistors r 0 , r 4 , and r 8 , connected between the high - side terminal of the shared current sense and modulation unit 16 and the first terminals of the switch controllers ( 140 , 142 , and 144 ), in pairs with a plurality of resistors r 2 , r 6 , and r 10 , connected between the first and the second terminals of the switch controllers ( 140 , 142 , and 144 ), form a bank of voltage dividers to scale down the current sense signal . in one embodiment , the configuration of the normally closed bypass switches each can also connected in parallel with a corresponding led sub - array except for the topmost led sub - array . the rectifier 100 could be but will not be limited to a full - wave or a half - wave rectifier . each of the normally closed bypass switches s 1 , s 2 , and s 3 could be but will not be limited to an enhancement - mode or a depletion - mode n - channel metal oxide semiconductor field effect transistor ( mosfet ) in collocation with an adequate switch controller . each of the switch controllers 140 , 142 , and 144 could be but will not be limited to a bipolar junction transistor ( bjt )- based , a shunt regulator ( sr )- based , or a photo coupler ( pc )- based gate - driving circuitry in control of the three switch states . the switch controllers 140 , 142 , and 144 , assumed for simplification , not for limitation , to have exactly the same reference voltage v ref used for comparison with scaled - down current sense signals , respectively rule over the three switch states of the normally closed bypass switches s 1 , s 2 , and s 3 according to the sensed voltage across the shared current sense and modulation unit 16 . please cross - refer to fig1 and 3 . to simplify the description , the voltage divider consisting of resistors r 1 and r 2 in series would firstly be neglected , i . e . r 1 is replaced with an open circuit having a resistance of infinity and r 2 is replaced with a short circuit having a resistance of zero . during the first half of the period , the rectified sinusoidal input voltage goes up from zero to its peak . when the rising input voltage ( vi ) is still less than the forward voltage drop of the bottommost led sub - array g 4 ( 0 ≦ vi & lt ; v g4 ), no current flows into the circuit and this interval ( 0 ≦ t & lt ; t 0 ) is commonly called the dead time . when the rising input voltage ( vi ) has been high enough to forward - bias the extrinsic led sub - array g 4 but is still less than the combined forward voltage drop of the extrinsic led sub - arrays g 3 and g 4 ( v g4 ≦ vi & lt ; v g3 + g4 ), a constant current i 1 , flowing downstream through the normally closed current regulator 120 , the normally closed bypass switch s 1 , the normally closed bypass switch s 2 , the current - regulating bypass switch s 3 , and the current sense and modulation unit 16 , lights up the extrinsic led sub - array g 4 during the interval of ( t 0 ≦ t & lt ; t 1 ). the constant current i 1 would be regulated by the bypass switch s 3 via the switch controller 144 in accordance with the design formula i ⁢ ⁢ 1 × r ⁢ ⁢ 16 × r ⁢ ⁢ 10 r ⁢ ⁢ 8 + r ⁢ ⁢ 10 = v ref , r ⁢ ⁢ 10 = r ⁢ ⁢ 8 i ⁢ ⁢ 1 × r ⁢ ⁢ 16 v ref - 1 i ⁢ ⁢ 1 ⁢ = v ref r ⁢ ⁢ 16 1 + r ⁢ ⁢ 8 r ⁢ ⁢ 10 . if the constant current i 1 goes above its preset current level v ref r ⁢ ⁢ 16 1 + r ⁢ ⁢ 8 r ⁢ ⁢ 10 , the switch controller 144 turns off the bypass switch s 3 for the constant current i 1 to go down to v ref r ⁢ ⁢ 16 1 + r ⁢ ⁢ 8 r ⁢ ⁢ 10 . if the constant current i 1 goes below its preset current level v ref r ⁢ ⁢ 16 1 + r ⁢ ⁢ 8 r ⁢ ⁢ 10 , the switch controller 144 turns on the bypass switch s 3 for the constant current i 1 to go up to v ref r ⁢ ⁢ 16 1 + r ⁢ ⁢ 8 r ⁢ ⁢ 10 . that is to say , the switch controller 144 detects a scaled - down , at - reference current sense signal ( i ⁢ ⁢ 1 × r ⁢ ⁢ 16 × ⁢ r ⁢ ⁢ 10 r ⁢ ⁢ 8 + r ⁢ ⁢ 10 = v ref ) , so the bypass switch s 3 gets into its regulation state to regulate the led current flowing through the downstream led sub - array g 4 at a constant current level i 1 preset with a scaled - down resistance of the shared current sense and modulation unit 16 ( r ⁢ ⁢ 16 1 + r ⁢ ⁢ 8 r ⁢ ⁢ 10 ) , wherein r 16 stands for the resistance of the current sense and modulation unit 16 . the switch controllers 142 and 140 each detect a scaled - down , below - reference current sense signal ( i ⁢ ⁢ 1 × r ⁢ ⁢ 16 × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 & lt ; i ⁢ ⁢ 1 × r ⁢ ⁢ 16 × r ⁢ ⁢ 6 r ⁢ ⁢ 4 + r ⁢ ⁢ 6 & lt ; v ref = i ⁢ ⁢ 1 × r ⁢ ⁢ 16 × r ⁢ ⁢ 10 r ⁢ ⁢ 8 + r ⁢ ⁢ 10 ) , so the normally closed bypass switches s 1 and s 2 remain in their on state to short out the extrinsic led sub - arrays g 1 and g 2 . detecting a below - reference current sense signal via an unshown current - sensing resistor , the current regulator 120 stays in its on state and acts like a normally closed switch . when the rising input voltage ( vi ) has been high enough to forward - bias the combined led sub - arrays g 3 and g 4 but is still less than the combined forward voltage drop of the extrinsic led sub - arrays g 2 , g 3 , and g 4 ( v g3 + g4 ≦ vi & lt ; v g2 + g3 + g4 ), a constant current i 2 lights up the extrinsic led sub - arrays g 3 and g 4 during the interval of ( t 1 ≦ t & lt ; t 2 ). the switch controller 144 detects a scaled - down , above - reference current sense signal ( i ⁢ ⁢ 2 × r ⁢ ⁢ 16 × r ⁢ ⁢ 10 r ⁢ ⁢ 8 + r ⁢ ⁢ 10 & gt ; v ref ) , so the bypass switch s 3 stays in its off state to free up the extrinsic led sub - array g 3 . the constant current i 2 would be regulated by the bypass switch s 2 via the switch controller 142 in accordance with the design formula i ⁢ ⁢ 2 × r ⁢ ⁢ 16 × r ⁢ ⁢ 6 r ⁢ ⁢ 4 + r ⁢ ⁢ 6 = v ref , r ⁢ ⁢ 6 = r ⁢ ⁢ 4 i ⁢ ⁢ 2 × r ⁢ ⁢ 16 v ref - 1 i ⁢ ⁢ 2 = v ref r ⁢ ⁢ 16 1 + r ⁢ ⁢ 4 r ⁢ ⁢ 6 . that is to say , the switch controller 142 detects a scaled - down , at - reference current sense signal ( i ⁢ ⁢ 2 × r ⁢ ⁢ 16 × r ⁢ ⁢ 6 r ⁢ ⁢ 4 + r ⁢ ⁢ 6 = v ref ) , so the bypass switch s 2 gets into its regulation state to regulate the led current flowing through the downstream led sub - arrays g 3 and g 4 at a constant current level i 2 preset with a scaled - down resistance of the shared current sense and modulation unit 16 ⁢ ( r ⁢ ⁢ 16 1 + r ⁢ ⁢ 4 r ⁢ ⁢ 6 ) . the switch controller 140 detects a scaled - down , below - reference current sense signal ( i ⁢ ⁢ 2 × r ⁢ ⁢ 16 × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 & lt ; v ref ) , so the normally closed bypass switch s 1 remains in its on state to short out the extrinsic led sub - array g 1 . detecting a below - reference current sense signal via an unshown current - sensing resistor , the current regulator 120 stays in its on state and acts like a normally closed switch . when the rising input voltage ( vi ) has been high enough to forward - bias the combined led sub - arrays g 2 , g 3 , and g 4 but is still less than the combined forward voltage drop of the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 ( v g2 + g3 + g4 ≦ vi & lt ; v g1 + g2 + g3 + g4 ), a constant current i 3 lights up the extrinsic led sub - arrays g 2 , g 3 , and g 4 during the interval of ( t 2 ≦ t & lt ; t 3 ). the constant current i 3 would be regulated by the bypass switch s 1 via the switch controller 140 in accordance with the design formula i ⁢ ⁢ 3 × r ⁢ ⁢ 16 × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 = v ref , r ⁢ ⁢ 2 = r ⁢ ⁢ 0 i ⁢ ⁢ 3 × r ⁢ ⁢ 16 v ref - 1 i ⁢ ⁢ 3 = v ref r ⁢ ⁢ 16 1 + r ⁢ ⁢ 0 r ⁢ ⁢ 2 . that is to say , the switch controller 140 detects a scaled - down , at - reference current sense signal ( i ⁢ ⁢ 3 × r ⁢ ⁢ 16 × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 = v ref ) , so the bypass switch s 1 gets into its regulation state to regulate the led current flowing through the downstream led sub - arrays g 2 , g 3 , and g 4 at a constant current level i 3 preset with a scaled - down resistance of the shared current sense and modulation unit 16 ( r ⁢ ⁢ 16 1 + r ⁢ ⁢ 0 r ⁢ ⁢ 2 ) . the switch controllers 142 and 144 each detect a scaled - down , above - reference current sense signal ( i ⁢ ⁢ 3 × r ⁢ ⁢ 16 × r ⁢ ⁢ 10 r ⁢ ⁢ 8 + r ⁢ ⁢ 10 & gt ; i ⁢ ⁢ 3 × r ⁢ ⁢ 16 × r ⁢ ⁢ 6 r ⁢ ⁢ 4 + r ⁢ ⁢ 6 & gt ; v ref = i ⁢ ⁢ 3 × r ⁢ ⁢ 16 × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 ) , so the bypass switches s 2 and s 3 stay in their off state to free up the extrinsic led sub - arrays g 2 and g 3 . detecting a below - reference current sense signal via an unshown current - sensing resistor , the current regulator 120 stays in its on state and acts like a normally closed switch . when the input voltage ( vi ) is high enough to forward - bias all of the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 ( v g1 + g2 + g3 + g4 ≦ vi ), a constant current i 4 preset with an unshown current - sensing resistor in the normally closed current regulator 120 lights up all the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 in the vicinity of the peak of the rectified sinusoidal input voltage ( t 3 ≦ t & lt ; t 3 ′ ). the aforementioned constant current levels are ranked in the order of i ⁢ ⁢ 4 & gt ; i ⁢ ⁢ 3 = v ref r ⁢ ⁢ 16 1 + r ⁢ ⁢ 0 r ⁢ ⁢ 2 & gt ; i ⁢ ⁢ 2 = v ref r ⁢ ⁢ 16 1 + r ⁢ ⁢ 4 r ⁢ ⁢ 6 & gt ; i ⁢ ⁢ 1 = v ref r ⁢ ⁢ 16 1 + r ⁢ ⁢ 8 r ⁢ ⁢ 10 for an active current regulator or bypass switch to deactivate its downstream bypass switches , calling for the resistance sequence of r 10 & gt ; r 6 & gt ; r 2 , assuming the resistance equalization of r 8 = r 4 = r 0 . in this way , the ac - powered led light engine 10 gears up each extrinsic led sub - array from the bottom up . during the second half of the period , the rectified sinusoidal input voltage goes down from its peak to zero . when the falling input voltage ( vi ) is still high enough to forward - bias the combined led sub - arrays g 2 , g 3 , and g 4 but has been less than the combined forward voltage drop of the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 ( v g2 + g3 + g4 ≦ vi & lt ; v g1 + g2 + g3 + g4 ), the switch controller 140 detects a scaled - down , at - reference current sense signal ( i ⁢ ⁢ 3 × r ⁢ ⁢ 16 × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 = v ref ) , so the bypass switch s 1 gets into its regulation state to regulate the led current flowing through the downstream led sub - arrays g 2 , g 3 , and g 4 at the preset constant current level i 3 during the interval of ( t 3 ′ ≦ t & lt ; t 2 ′ ). the switch controllers 142 and 144 each detect a scaled - down above - reference current sense signal ( i ⁢ ⁢ 3 × r ⁢ ⁢ 16 × r ⁢ ⁢ 10 ⁢ r ⁢ ⁢ 8 + r ⁢ ⁢ 10 & gt ; i ⁢ ⁢ 3 × r ⁢ ⁢ 16 × r ⁢ ⁢ 6 r ⁢ ⁢ 4 + r ⁢ ⁢ 6 & gt ; v ref = i ⁢ ⁢ 3 × r ⁢ ⁢ 16 × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 ) , so the bypass switches s 2 and s 3 stay in their off state to free up the extrinsic led sub - arrays g 2 and g 3 . detecting a below - reference current sense signal via an unshown current - sensing resistor , the current regulator 120 stays in its on state and acts like a normally closed switch . when the falling input voltage ( vi ) is still high enough to forward - bias the combined led sub - arrays g 3 and g 4 but has been less than the combined forward voltage drop of the extrinsic led sub - arrays g 2 , g 3 , and g 4 ( v g3 + g4 ≦ vi & lt ; v g2 + g3 + g4 ), the switch controller 144 detects a scaled - down , above - reference current sense signal ( i ⁢ ⁢ 2 × r ⁢ ⁢ 16 × r ⁢ ⁢ 10 r ⁢ ⁢ 8 + r ⁢ ⁢ 10 & gt ; v ref ) , so the bypass switch s 3 stays in its off state to free up the extrinsic led sub - array g 3 during the interval of ( t 2 ′ ≦ t & lt ; t 1 ′ ). the switch controller 142 detects a scaled - down , at - reference current sense signal ( i ⁢ ⁢ 2 × r ⁢ ⁢ 16 × r ⁢ ⁢ 6 r ⁢ ⁢ 4 + r ⁢ ⁢ 6 = v ref ) , so the bypass switch s 2 gets into its regulation state to regulate the led current flowing through the downstream led sub - arrays g 3 and g 4 at the preset constant current level i 2 . the switch controller 140 detects a scaled - down , below - reference current sense signal ( i ⁢ ⁢ 2 × r ⁢ ⁢ 16 × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 & lt ; v ref ) , so the normally closed bypass switch s 1 goes back to its on state to short out the extrinsic led sub - array g 1 . detecting a below - reference current sense signal via an unshown current - sensing resistor , the current regulator 120 stays in its on state and acts like a normally closed switch . when the falling input voltage ( vi ) is still high enough to forward - bias the extrinsic led sub - array g 4 but has been less than the combined forward voltage drop of the extrinsic led sub - arrays g 3 and g 4 ( v g4 ≦ vi & lt ; v g3 + g4 ), the switch controller 144 detects a scaled - down , at - reference current sense signal ( i ⁢ ⁢ 1 × r ⁢ ⁢ 16 × r ⁢ ⁢ 10 r ⁢ ⁢ 8 + r ⁢ ⁢ 10 = v ref ) , so the bypass switch s 3 gets into its regulation state to regulate the led current flowing through the downstream led sub - array g 4 at the preset constant current level i 1 during the interval of ( t 1 ′ ≦ t & lt ; t 0 ′ ). the switch controllers 140 and 142 each detect a scaled - down , below - reference current sense signal ( i ⁢ ⁢ 1 × r ⁢ ⁢ 16 × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 & lt ; i ⁢ ⁢ 1 × r ⁢ ⁢ 16 × r ⁢ ⁢ 6 r ⁢ ⁢ 4 + r ⁢ ⁢ 6 & lt ; v ref = i ⁢ ⁢ 1 × r ⁢ ⁢ 16 × r ⁢ ⁢ 10 r ⁢ ⁢ 8 + r ⁢ ⁢ 10 ) , so the normally closed bypass switches s 1 and s 2 go back to their on state to short out the extrinsic led sub - arrays g 1 and g 2 . detecting a below - reference current sense signal via an unshown current - sensing resistor , the current regulator 120 stays in its on state and acts like a normally closed switch . in this way , the ac - powered led light engine 10 gears down each extrinsic led sub - array from the top down till all of the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 go out . the number of the aforementioned constant current levels for the ac - powered led light engine 10 , translating to the number of the bypass switches and the switch controllers devised to draw a quasi - sinusoidal line current waveform from the ac sinusoidal line voltage source , could be arbitrarily chosen with a design tradeoff between performance and cost . fig2 illustrates a block diagram of an illuminating apparatus 2 equipped with an ac - powered led light engine 20 designed to gear up from the bottom up and gear down from the top down the extrinsic led sub - arrays ( g 1 , g 2 , g 3 , and g 4 ) in accordance with an embodiment of the present invention . the illuminating apparatus 2 comprises a rectifier 100 coupled to an ac mains , an ac - powered led light engine 20 , and a shared current sense and modulation unit 16 , and is loaded up with a plurality of extrinsic led sub - arrays ( g 1 , g 2 , g 3 , and g 4 ). the ac - powered led light engine 20 is coupled between the rectifier 100 and the extrinsic led sub - arrays ( g 1 , g 2 , g 3 , and g 4 ), and has a normally closed current regulator ( such as the current - regulating switch s 0 ) coupled to the rectifier 100 via its high - side terminal and used to regulate the highest led current level near the rectified sinusoidal input voltage peak , a plurality of normally closed bypass switches ( s 1 , s 2 , and s 3 ) each connected in parallel with a corresponding led sub - array except for the bottommost led sub - array g 4 and shuttling between the three switch states according to a corresponding current sense signal , and a switch controller module 15 having a plurality of switch controllers ( 150 , 152 , 154 , and 156 ) each coupled between the shared current sense and modulation unit 16 and a corresponding current - regulating switch or bypass switch as a feedback network and taking control of the three switch states . a plurality of anti - clamping resistors rx 1 , rx 2 , and rx 3 , connected between the high - side terminal of the shared current sense and modulation unit 16 and the first terminals of the switch controllers ( 140 , 142 , and 144 ), would prevent the terminal voltage across the shared current sense and modulation unit 16 from being clamped at lower reference voltage levels so as not to miss out on higher current regulation levels . the normally closed bypass switches s 1 , s 2 , and s 3 as well as the switch controllers 150 , 152 , 154 , and 156 in fig2 could be identical to those in fig1 . the switch controllers 150 , 152 , 154 , and 156 , respectively ruling over the three switch states of the current - regulating switch s 0 as well as the normally closed bypass switches s 1 , s 2 , and s 3 in accordance with the sensed voltage across the shared current sense and modulation unit 16 , are assumed for simplification , not for limitation , to have exactly the same reference voltage v ref . the scaled - up reference voltages actually used for comparison with current sense signals are set up by means of connecting the first terminal of a lower switch controller to the second terminal of an upper switch controller via an optional zener diode ( zd 1 , zd 2 , and zd 3 ) to make non - integer multiples possible , and could be ranked in the following order : v 150a , ref = 4v ref + v zd1 + v zd3 & gt ; v 152a , ref = 3v ref + v zd2 + v zd3 & gt ; v 154a , ref = 2v ref + v zd3 & gt ; v 156a , ref = v ref , wherein v zd1 , v zd2 , and v zd3 are breakdown voltages of the optional zener diodes zd 1 , zd 2 , and zd 3 . please cross - refer to fig2 and 3 . during the first half of the period , the rectified sinusoidal input voltage goes up from zero to its peak . when the rising input voltage ( vi ) is still less than the forward voltage drop of the bottommost led sub - array g 4 ( 0 ≦ vi & lt ; v g4 ), no current flows into the circuit and this interval ( 0 ≦ t & lt ; t 0 ) is referred to as the dead time . when the rising input voltage ( vi ) has been high enough to forward - bias the extrinsic led sub - array g 4 but is still less than the combined forward voltage drop of the extrinsic led sub - arrays g 3 and g 4 ( v g4 ≦ vi & lt ; v g3 + g4 ), a constant current i 1 lights up the extrinsic led sub - array g 4 during the interval of ( t 0 ≦ t & lt ; t 1 ). the constant current i 1 would be regulated by the bypass switch s 3 via the switch controller 156 in accordance with the design formula i ⁢ ⁢ 1 × r ⁢ ⁢ 16 = v ref , i . e . ⁢ i ⁢ ⁢ 1 = v ref r ⁢ ⁢ 16 . that is to say , the switch controller 156 detects an at - reference current sense signal ( i 1 × r 16 = v ref ), so the bypass switch s 3 gets into its regulation state to regulate the led current flowing through the downstream led sub - array g 4 at a constant current level i 1 preset with the resistance r 16 of the shared current sense and modulation unit ( i ⁢ ⁢ 1 = v ref r ⁢ ⁢ 16 ) . the switch controllers 154 , 152 , and 150 each detect a below - reference current sense signal ( i 1 × r 16 = v ref & lt ; 2v ref + v zd3 & lt ; 3v ref + v zd2 + v zd3 & lt ; 4v ref + v zd1 + v zd2 + v zd3 ), so the current - regulating switch s 0 as well as the normally closed bypass switches s 1 and s 2 remain in their on state to short out the extrinsic led sub - arrays g 1 and g 2 . when the rising input voltage ( vi ) has been high enough to forward - bias the combined led sub - arrays g 3 and g 4 but is still less than the combined forward voltage drop of the extrinsic led sub - arrays g 2 , g 3 , and g 4 ( v g3 + g4 ≦ vi & lt ; v g2 + g3 + g4 ), a constant current i 2 lights up the extrinsic led sub - arrays g 3 and g 4 during the interval of ( t 1 ≦ t & lt ; t 2 ). the switch controller 156 detects an above - reference current sense signal ( i 2 × r 16 & gt ; v ref ), so the bypass switch s 3 stays in its off state to free up the extrinsic led sub - array g 3 . the constant current i 2 would be regulated by the bypass switch s 2 via the switch controller 154 in accordance with the design formula i 2 × r 16 = 2v ref + v zd3 , i . e . i ⁢ ⁢ 2 = 2 ⁢ ⁢ v ref + v zd ⁢ ⁢ 3 r ⁢ ⁢ 16 . that is to say , the switch controller 154 detects an at - reference current sense signal ( i 2 × r 16 = 2v ref + v zd3 ), so the bypass switch s 2 gets into its regulation state to regulate the led current flowing through the downstream led sub - arrays g 3 and g 4 at a constant current level i 2 preset with two times the reference voltage 2v ref plus the optional v zd ⁢ ⁢ 3 ( i ⁢ ⁢ 2 = 2 ⁢ ⁢ v ref + v z ⁢ ⁢ d ⁢ ⁢ 3 r ⁢ ⁢ 16 ) . the switch controllers 150 and 152 each detect a below - reference current sense signal ( i 2 × r 16 = 2v ref + v zd3 & lt ; 3v ref + v zd2 + v zd3 & lt ; 4v ref + v zd1 + v zd2 + v zd3 ), so the current - regulating switch s 0 and the normally closed bypass switch s 1 remain in their on state to short out the extrinsic led sub - array g 1 . when the rising input voltage ( vi ) has been high enough to forward - bias the combined led sub - arrays g 2 , g 3 , and g 4 but is still less than the combined forward voltage drop of the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 ( v g2 + g3 + g4 ≦ vi & lt ; v g1 + g2 + g3 + g4 ), a constant current i 3 lights up the extrinsic led sub - arrays g 2 , g 3 , and g 4 during the interval of ( t 2 ≦ t & lt ; t 3 ). the constant current i 3 would be regulated by the bypass switch s 1 via the switch controller 152 in accordance with the design formula i 3 × r 16 = 3v ref + v zd2 + v zd3 , i . e . i ⁢ ⁢ 3 = 3 ⁢ ⁢ v ref + v z ⁢ ⁢ d ⁢ ⁢ 2 + v z ⁢ ⁢ d ⁢ ⁢ 3 r ⁢ ⁢ 16 . that is to say , the switch controller 152 detects an at - reference current sense signal ( i 3 × r 16 = 3v ref + v zd2 + v zd3 ), so the bypass switch s 1 gets into its regulation state to regulate the led current flowing through the downstream led sub - arrays g 2 , g 3 , and g 4 at a constant current level i 3 preset with three times the reference voltage 3v ref plus the optional v zd2 and v z ⁢ ⁢ d ⁢ ⁢ 3 ( i ⁢ ⁢ 3 = 3 ⁢ ⁢ v ref + v z ⁢ ⁢ d ⁢ ⁢ 2 + v z ⁢ ⁢ d ⁢ ⁢ 3 r ⁢ ⁢ 16 ) . the switch controllers 156 and 154 each detect an above - reference current sense signal ( i 3 × r 16 = 3v ref + v zd2 + v zd3 & gt ; 2v ref + v zd3 & gt ; v ref ), so the bypass switches s 2 and s 3 stay in their off state to free up the extrinsic led sub - arrays g 2 and g 3 . the switch controller 150 detects a below - reference current sense signal ( i 3 × r 16 = 3v ref + v zd2 + v zd3 & lt ; 4v ref + v zd1 + v zd2 + v zd3 ), so the current - regulating switch s 0 stays in its on state and acts like a normally closed switch . when the input voltage ( vi ) is high enough to forward - bias all of the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 ( v g1 + g2 + g3 + g4 ≦ vi ), a constant current i 4 lights up all the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 during the interval of ( t 3 ≦ t & lt ; t 3 ′ ). the constant current i 4 would be regulated by the current - regulating switch s 0 via the switch controller 150 in accordance with the design formula i 4 × r 16 = 4v ref + v zd1 + v zd2 + v zd3 , i . e . i ⁢ ⁢ 4 = 4 ⁢ ⁢ v ref + v z ⁢ ⁢ d ⁢ ⁢ 1 + v z ⁢ ⁢ d ⁢ ⁢ 2 + v z ⁢ ⁢ d ⁢ ⁢ 3 r ⁢ ⁢ 16 . that is to say , the switch controller 150 detects an at - reference current sense signal ( i 4 × r 16 = 4v ref ++ v zd1 + v zd2 + v zd3 ), so the current - regulating switch s 0 gets into its regulation state to regulate the led current flowing through the downstream led sub - arrays g 1 , g 2 , g 3 , and g 4 at a constant current level i 4 preset with four times the reference voltage 4v ref plus the optional and v zd1 , v zd2 , and v zd3 ( i ⁢ ⁢ 4 = 4 ⁢ ⁢ v ref + v z ⁢ ⁢ d ⁢ ⁢ 1 + v z ⁢ ⁢ d ⁢ ⁢ 2 + v z ⁢ ⁢ d ⁢ ⁢ 3 r ⁢ ⁢ 16 ) . the switch controllers 152 , 154 , and 156 each detect an above - reference current sense signal ( i 4 × r 16 = 4v ref + v zd1 + v zd2 + v zd3 & gt ; 3v ref + v zd2 + v zd3 & gt ; 2v ref + v zd3 & gt ; v ref ), so the bypass switches s 1 , s 2 , and s 3 stay in their off state to free up the extrinsic led sub - arrays g 1 , g 2 , and g 3 . in this way , the ac - powered led light engine 20 gears up each extrinsic led sub - array from the bottom up . during the second half of the period , the rectified sinusoidal input voltage goes down from its peak to zero . when the falling input voltage ( vi ) is still high enough to forward - bias the combined led sub - arrays g 2 , g 3 , and g 4 but has been less than the combined forward voltage drop of the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 ( v g2 + g3 + g4 ≦ vi & lt ; v g1 + g2 + g3 + g4 ), the switch controller 152 detects an at - reference current sense signal ( i 3 × r 16 = 3v ref + v zd2 + v zd3 ), so the bypass switch s 1 gets into its regulation state to regulate the led current flowing through the downstream led sub - arrays g 2 , g 3 , and g 4 at the preset constant current level i 3 during the interval of ( t 3 ′ ≦ t & lt ; t 2 ′ ). the switch controllers 154 and 156 each detect an above - reference current sense signal ( i 3 × r 16 = 3v ref + v zd2 + v zd3 & gt ; 2v ref + v zd3 & gt ; v ref ), so the bypass switches s 2 and s 3 stay in their off state to free up the extrinsic led sub - arrays g 2 and g 3 . the switch controller 150 detects a below - reference current sense signal ( i 3 × r 16 = 3v ref + v zd2 + v zd3 & lt ; 4v ref + v zd1 + v zd2 + v zd3 ), so the current - regulating switch s 0 stays in its on state and acts like a normally closed switch . when the falling input voltage ( vi ) is still high enough to forward - bias the combined led sub - arrays g 3 and g 4 but has been less than the combined forward voltage drop of the extrinsic led sub - arrays g 2 , g 3 , and g 4 ( v g3 + g4 ≦ vi & lt ; v g2 + g3 + g4 ), the switch controller 156 detects an above - reference current sense signal ( i 2 × r 16 & gt ; v ref ), so the bypass switch s 3 stays in its off state to free up the led sub - array g 3 during the interval of ( t 2 ′ ≦ t & lt ; t 1 ′ ). the switch controller 154 detects an at - reference current sense signal ( i 2 × r 16 = 2v ref + v zd3 ), so the bypass switch s 2 gets into its regulation state to regulate the led current flowing through the downstream led sub - arrays g 3 and g 4 at the preset constant current level i 2 . the switch controllers 150 and 152 each detect a below - reference current sense signal ( i 2 × r 16 = 2v ref + v zd3 & lt ; 3v ref + v zd2 + v zd3 & lt ; 4v ref + v zd1 + v zd2 + v zd3 ), so the current - regulating switch s 0 remains in its on state , and the normally closed bypass switch s 1 goes back to their on state to short out the extrinsic led sub - array g 1 . when the falling input voltage ( vi ) is still high enough to forward - bias the led sub - array g 4 but has been less than the combined forward voltage drop of the extrinsic led sub - arrays g 3 and g 4 ( v g4 ≦ vi & lt ; v g3 + g4 ), the switch controller 156 detects an at - reference current sense signal ( i 1 × r 16 = v ref ), so the bypass switch s 3 gets into its regulation state to regulate the led current flowing through the downstream led sub - array g 4 at the preset constant current level i 1 during the interval of ( t 1 ′ ≦ t & lt ; t 0 ′ ). the switch controllers 150 , 152 , and 154 each detect a below - reference current sense signal ( i 1 × r 16 = v ref & lt ; 2v ref + v zd3 & lt ; 3v ref + v zd2 + v zd3 & lt ; 4v ref + v zd1 + v zd2 + v zd3 ), so the current - regulating switch s 0 remains in its on state , and the normally closed bypass switches s 1 and s 2 go back to their on state to short out the extrinsic led sub - arrays g 1 and g 2 . in this way , the ac - powered led light engine 20 gears down each extrinsic led sub - array from the top down till all of the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 go out . the number of the aforementioned constant current levels for the ac - powered led light engine 20 , translating to the number of the bypass switches and the switch controllers devised to draw a quasi - sinusoidal line current waveform from the ac sinusoidal line voltage source , could be arbitrarily chosen with a design tradeoff between performance and cost . it is worth mentioning that the ac - powered led light engines 10 and 20 could proportionally dim up and down each extrinsic led sub - array by means of varying the resistance r 16 ( unshown ) of the shared current sense and modulation unit 16 , keeping the quasi - sinusoidal line current waveform in good shape as well as maintaining almost the same high power factor ( pf ) and almost the same low total harmonic distortion ( thd ) throughout the entire dimming range . in this embodiment , the current - regulating switch s 0 controlled by the switch controller 150 can be replaced by the current regulator 120 shown in fig1 . similarly , the current - regulating switch s 0 controlled by the switch controller 150 can replace the current regulator 120 employed in other embodiments . the major difference between the current - regulating switch s 0 and the current regulator 120 would be : the highest current level i 4 regulated by the current - regulating switch s 0 , acting in concert with other bypass switches s 1 , s 2 , and s 3 , would be in proportion to the lower current levels i 3 , i 2 , and i 1 , while the highest current level i 4 regulated by the current regulator 120 , standing alone for current regulation , would be out of proportion to the lower current levels i 3 , i 2 , and i 1 . fig4 illustrates an integrated circuit having the ac - powered led light engine 10 shown in fig1 in accordance with an embodiment of the present invention . as is shown in fig4 , the integrated circuit 12 has six pins a , b , c , d , e , and f , three bypass switches s 1 , s 2 , and s 3 , as well as three switch controllers 140 , 142 , and 144 . the shared current sense and modulation unit 16 is placed outside the integrated circuit 12 to make the current levels programmable to circuit designers of the illuminating apparatus . the integrated circuit 12 has its pin a coupled to the low - side terminal of the current regulator 120 , the anode of the led sub - array g 1 , and the third terminal of the bypass switch s 1 , its pin b coupled to the output terminal of the voltage divider ( the node between the resistors r 1 and r 2 ), the low - side terminals of the resistors r 2 , r 6 , and r 10 , as well as the second terminals of the switch controllers 140 , 142 , and 144 , its pin c coupled to the second terminal of the bypass switch s 1 , the cathode of the led sub - array g 1 , and the anode of the led sub - array g 2 , its pin d coupled to the second terminal of the bypass switch s 2 , the third terminal of the bypass switch s 3 , the cathode of the led sub - array g 2 , and the anode of the led sub - array g 3 , its pin e coupled to the second terminal of the bypass switch s 3 , the cathode of the led sub - array g 3 , and the anode of the led sub - array g 4 , and its pin f coupled to the high - side terminals of the resistors r 0 , r 4 , and r 8 , the high - side terminal of the shared current sense and modulation unit 16 , and the cathode of the led sub - array g 4 . in this embodiment , the integrated circuit 12 encapsulates the ac - powered led light engine 10 shown in fig1 . it goes without saying any type of the ac - powered led light engines based on the spirit and scope of the present invention can be encapsulated in the form of an integrated circuit to reduce the apparent parts count and enable a more compact circuit design . moreover , a plurality of resulting integrated circuits of the same type could be connected in series to extend the voltage rating or in parallel to extend the current rating , depending on practical requirements for given applications . fig5 gives an example of an illuminating apparatus 5 equipped with the an ac - powered led light engine 10 shown in fig1 , wherein the ac - powered led light engine 10 is coupled between the rectifier 100 and the extrinsic led sub - arrays ( g 1 , g 2 , g 3 , and g 4 ). the illuminating apparatus 5 comprises a rectifier 100 coupled to an ac mains , an ac - powered led light engine 10 , a plurality of extrinsic led sub - arrays ( g 1 , g 2 , g 3 , and g 4 ), and a shared current sense and modulation unit 16 . the ac - powered led light engine 10 comprises a normally closed current regulator 120 , a plurality of normally closed bypass switches ( s 1 , s 2 , and s 3 ) each connected in parallel with a corresponding led sub - array except for the bottommost led sub - array g 4 and shuttling between the three switch states according to a corresponding current sense signal , and a switch controller module 114 having a plurality of switch controllers b 1 , b 2 , and b 3 each coupled between the shared current sense and modulation unit 16 and a corresponding bypass switch as a feedback network and taking control of the three switch states . each of the normally closed bypass switches s 1 , s 2 , and s 3 is a depletion - mode n - channel mosfet in collocation with an adequate switch controller . each of the switch controllers is a bjt - based gate - driving circuit , comprising a corresponding gate - discharging resistor ( r 7 , r 9 , and r 11 ) for turning on a corresponding bypass switch ( s 1 , s 2 , and s 3 ) as well as a corresponding voltage - comparing bjt ( b 1 , b 2 , and b 3 ), a corresponding voltage - dividing resistor pair ( r 0 and r 2 , r 4 and r 6 , as well as r 8 and r 10 ), a corresponding voltage - dividing resistor ( r 1 , r 3 , and r 5 ), and a corresponding voltage - clamping zener diode ( z 1 , z 2 , and z 3 ) for turning off a corresponding bypass switch ( s 1 , s 2 , and s 3 ), in control of the three switch states . in fig5 , the first part of the voltage - dividing resistor pair ( r 0 , r 4 , and r 8 ) is connected between the high - side terminal of the shared current sense and modulation unit 16 and the bases of the voltage - comparing bjts ( b 1 , b 2 , and b 3 ), while the second part of the voltage - dividing resistor pair ( r 2 , r 6 , and r 10 ) could be either connected between the bases of the voltage - comparing bjts ( b 1 , b 2 , and b 3 ) and ground or between the bases and the emitters of the voltage - comparing bjts ( b 1 , b 2 , and b 3 ), as is shown in fig1 . in this embodiment , the normally closed current regulator 120 comprises a current - regulating switch m 1 ( an enhancement - mode n - channel mosfet ), a gate - charging resistor ra , a voltage - comparing bjt b 0 , and a current - sensing resistor rb . the current - regulating switch m 1 has its drain coupled to the rectifier 100 ( the high - side terminal of the gate - charging resistor ra ), its gate coupled to the low - side terminal of the gate - charging resistor ra ( the collector of the voltage - comparing bjt b 0 ), and its source coupled to the high - side terminal of the current - sensing resistor rb ( the base of the voltage - comparing bjt b 0 ). it is crystal clear that a depletion - mode n - channel mosfet is essentially a normally closed switch . only the current - regulating switch m 1 needs to get initialized as a normally closed switch after the random power - on of the illuminating apparatus 5 . more specifically , in the initial state , m 1 &# 39 ; s intrinsic gate - source capacitor could rapidly be charged up to above its threshold voltage level via a corresponding gate - charging resistor ra so as to make its channel normally closed once the rectified sinusoidal input voltage could forward - bias the bottommost led sub - array g 4 . based on the comparison between an applied gate - source voltage v gs and a negative threshold voltage v th , a depletion - mode n - channel mosfet would operate in its on state ( v gs & gt ; v th ) due to discharging of its intrinsic gate - source capacitor via a corresponding gate - discharging resistor when a corresponding below - reference current sense signal turns a corresponding voltage - comparing bjt off , in its regulation state ( v gs = v th ) due to discharging and charging of its intrinsic gate - source capacitor via a corresponding gate - discharging resistor as well as a corresponding voltage - comparing bjt , a corresponding voltage - dividing resistor , and a corresponding voltage - clamping zener diode when a corresponding at - reference current sense signal turns a corresponding voltage - comparing bjt off and on , or in its off state ( v gs & lt ; v th ) due to charging of its intrinsic gate - source capacitor via a corresponding voltage - comparing bjt , a corresponding voltage - dividing resistor , and a corresponding voltage - clamping zener diode when a corresponding above - reference current sense signal turns a corresponding voltage - comparing bjt on . as such , all of the normally closed bypass switches s 1 , s 2 , and s 3 would shuttle between the three switch states except for the normally closed current - regulating switch m 1 excluding its off state from the three switch states . a voltage divider , comprising resistors r 1 and r 2 in series , adds a scaled - down sample of the rectified sinusoidal input voltage ( v i × r ⁢ ⁢ 2 r ⁢ ⁢ 1 + r ⁢ ⁢ 2 ) to the emitters of the voltage - comparing bjts b 1 , b 2 , and b 3 so that scaled - down current sense signals would be compared with a sinusoidal - modulated reference voltage v ref + v i × r ⁢ ⁢ 2 r ⁢ ⁢ 1 + r ⁢ ⁢ 2 rather than a fixed reference voltage v ref to further smooth a stepping current waveform into a more sinusoidal one for getting an even higher pf and an even lower thd . in this embodiment , a flicker - suppressing capacitor ( cg 1 , cg 2 , cg 3 , and cg 4 ), coupled in parallel with a corresponding led sub - array and functioning as an auxiliary supply of led current , and a corresponding charge - retaining diode ( d 1 , d 2 , d 3 , and d 4 ), coupled between a corresponding normally closed bypass switch and a corresponding flicker - suppressing capacitor to prevent capacitor charge from being consumed by other unintended circuit components instead of a corresponding led sub - array , are also incorporated to improve the flicker issue without any detriment to the high pf and low thd because each flicker - suppressing capacitor is merely charged up to a corresponding led sub - array forward voltage drop and would not set up an even higher voltage barrier for the rectified sinusoidal input voltage to get over . the aforementioned flicker - suppressing capacitors , applicable to any embodiment of the present invention , could be implemented with short - life electrolytic capacitors or , even better , an equivalent m × n matrix of non - electrolytic capacitors , such as ceramic capacitors , tantalum capacitors , or solid - state capacitors for a much longer lifespan , where the rows number m and the columns number n are associated with the voltage rating and the current rating , respectively . fig6 illustrates a schematic diagram of an illuminating apparatus 6 equipped with the ac - powered led light engine 30 . the illuminating apparatus 6 comprises a rectifier 100 coupled to an ac mains , an ac - powered led light engine 30 , a string of extrinsic led sub - arrays ( g 1 , g 2 , g 3 , and g 4 ), as well as a shared current sense and modulation unit 16 for providing current sense signals . the ac - powered led light engine 30 comprises a normally closed current regulator 120 ′, a string of normally closed bypass switches ( s 1 , s 2 , and s 3 ) each connected in parallel with a corresponding led sub - array except for the bottommost led sub - array g 4 and shuttling between the three switch states according to a corresponding current sense signal , and a switch controller module 215 having a plurality of switch controllers ( b 1 , b 2 , and b 3 ) each coupled between the shared current sense and modulation unit 16 and a corresponding bypass switch as a feedback network and taking control of the three switch states . each of the normally closed bypass switches s 1 , s 2 , and s 3 is an enhancement - mode n - channel mosfet in collocation with an adequate switch controller . the gate - charging resistors ( ra , ra 1 , ra 2 , and ra 3 ) are used to charge the intrinsic gate - source capacitors of the current regulator 120 as well as the bypass switches s 1 , s 2 , and s 3 up to above their threshold voltage so as to initialize them as normally closed switches after the random power - on of the illuminating apparatus 6 . understandable from that of fig5 , the initialization process of fig5 would not be repeated herein . each of the switch controllers is a bjt - based gate - driving circuit , comprising a corresponding gate - charging resistor ( ra 1 , ra 2 , and ra 3 ) for turning on a corresponding bypass switch ( s 1 , s 2 , and s 3 ) as well as a corresponding voltage - comparing device ( bjts b 1 , b 2 , and b 3 in conjunction with optional zener diodes zd 1 and zd 2 ), a corresponding anti - clamping resistor ( rx 1 , rx 2 , and rx 3 ), a corresponding current - limiting resistor ( rg 1 , rg 2 , and rg 3 ), and a corresponding gate - discharging diode ( dg 1 , dg 2 , and dg 3 ) for turning off a corresponding bypass switch ( s 1 , s 2 , and s 3 ), in control of the three switch states . in this embodiment , the normally closed current regulator 120 ′ comprises a current - regulating switch m 1 ( an enhancement - mode n - channel mosfet ), a gate - charging resistor ra , a shunt regulator x , and a current - sensing resistor rx . obviously , a bjt b 0 and a shunt regulator x both used for voltage comparison in the present invention are interchangeable . based on the comparison between an applied gate - source voltage v gs and a positive threshold voltage v th , an enhancement - mode n - channel mosfet would operate in its on state ( v gs & gt ; v th ) due to charging of its intrinsic gate - source capacitor via a corresponding gate - charging resistor when a corresponding below - reference current sense signal turns a corresponding voltage - comparing bjt off , in its regulation state ( v gs = v th ) due to charging and discharging of its intrinsic gate - source capacitor via a corresponding gate - charging resistor as well as a corresponding voltage - comparing device , a corresponding anti - clamping resistor , a corresponding current - limiting resistor , and a corresponding gate - discharging diode when a corresponding at - reference current sense signal turns a corresponding voltage - comparing bjt off and on , or in its off state ( v gs & lt ; v th ) due to discharging of its intrinsic gate - source capacitor via a corresponding voltage - comparing device , a corresponding anti - clamping resistor , a corresponding current - limiting resistor , and a corresponding gate - discharging diode when a corresponding above - reference current sense signal turns a corresponding voltage - comparing bjt on . as such , all of the normally closed bypass switches s 1 , s 2 , and s 3 would shuttle between the three switch states except for the normally closed current - regulating switch m 1 excluding its off state from the three switch states . a voltage divider , comprising resistors r 1 and r 2 in series , adds a scaled - down sample of the rectified sinusoidal input voltage ( v i × r ⁢ ⁢ 2 r ⁢ ⁢ 1 + r ⁢ ⁢ 2 ) to the emitter of the bottommost voltage - comparing bjt b 3 so that current sense signals would be compared with a sinusoidal - modulated reference voltage ( v ref + v i × r ⁢ ⁢ 2 r ⁢ ⁢ 1 + r ⁢ ⁢ 2 , 2 ⁢ ⁢ v ref + v z ⁢ ⁢ d ⁢ ⁢ 2 + v i × r ⁢ ⁢ 2 r ⁢ ⁢ 1 + r ⁢ ⁢ 2 , 3 ⁢ ⁢ v ref + v z ⁢ ⁢ d ⁢ ⁢ 1 + v z ⁢ ⁢ d ⁢ ⁢ 2 + v i × r ⁢ ⁢ 2 r ⁢ ⁢ 1 + r ⁢ ⁢ 2 ) rather than a fixed reference voltage ( v ref , 2v ref + v zd2 , and 3v ref + v zd1 + v zd2 ) to further smooth a stepping current waveform into a more sinusoidal one for getting an even higher pf and an even lower thd . the flicker - suppressing capacitor ( cg 1 , cg 2 , cg 3 , and cg 4 ) and the corresponding charge - retaining diode ( d 1 , d 2 , d 3 , and d 4 ) are the same as those in fig5 , and therefore do not need any elaboration . fig7 illustrates a superordinate schematic diagram of all the disclosed illuminating apparatuses in collocation with pwm -, analog -, and rheostat - dimming schemes in accordance with preferred embodiments of the present invention . to simplify the description , the voltage divider comprising resistors r 1 and r 2 in series would again be overlooked and an led light engine 10 employing a bank of voltage dividers would simultaneously be assumed . when it comes to the pwm - dimming scheme , the shared current sense and modulation unit 16 would consist of a fixed resistor rc ( providing a current sense signal for switch controllers ), a fixed resistor rd ( superimposing a scaled - down analog - dimming signal on the current sense signal ), a voltage buffer ( preventing the extracted analog - dimming signal against loading effect ), and an rc low - pass filter ( extracting the average voltage from the inputted pwm - dimming signal ). equating the pwm - dimmed , scaled - down current sense signals and the reference voltage v ref would lead to the following equations : { [ i ⁢ ⁢ 1 × ( rc // rd ) + v ave × rc rd + rc ] × r ⁢ ⁢ 10 r ⁢ ⁢ 8 + r ⁢ ⁢ 10 = v ref [ i ⁢ ⁢ 2 × ( rc // rd ) + v ave × rc rd + rc ] × r ⁢ ⁢ 6 r ⁢ ⁢ 4 + r ⁢ ⁢ 6 = v ref [ i ⁢ ⁢ 3 × ( rc // rd ) + v ave × rc rd + rc ] × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 = v ref ⇒ { i ⁢ ⁢ 1 = 1 rc // rd × [ ( 1 + r ⁢ ⁢ 8 r ⁢ ⁢ 10 ) × v ref - v ave × rc rd + rc ] i ⁢ ⁢ 2 = 1 rc // rd × [ ( 1 + r ⁢ ⁢ 4 r ⁢ ⁢ 6 ) × v ref - v ave × rc rd + rc ] i ⁢ ⁢ 3 = 1 rc // rd × [ ( 1 + r ⁢ ⁢ 0 r ⁢ ⁢ 2 ) × v ref - v ave × rc rd + rc ] , where v ave is the extracted average voltage of the inputted pwm - dimming signal in proportion to the pwm duty ratio . by adjusting the pwm duty ratio , the average current flowing through the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 to emit light could correspondingly be modulated because all the current levels i 1 , i 2 , and i 3 would decrease with an increased average voltage v ave , so the resulting light apparatus would be pwm - dimmable . when it comes to the analog - dimming scheme , the shared current sense and modulation unit 16 would retain the fixed resistor rc and the fixed resistor rd . the voltage buffer and the rc low - pass filter , both becoming unnecessary , could be removed . equating the analog - dimmed , scaled - down current sense signals and the reference voltage v ref would lead to the following equations : { [ i ⁢ ⁢ 1 × ( rc // rd ) + v analog × rc rd + rc ] × r ⁢ ⁢ 10 r ⁢ ⁢ 8 + r ⁢ ⁢ 10 = v ref [ i ⁢ ⁢ 2 × ( rc // rd ) + v analog × rc rd + rc ] × r ⁢ ⁢ 6 r ⁢ ⁢ 4 + r ⁢ ⁢ 6 = v ref [ i ⁢ ⁢ 3 × ( rc // rd ) + v analog × rc rd + rc ] × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 = v ref ⇒ { i ⁢ ⁢ 1 = 1 rc // rd × [ ( 1 + r ⁢ ⁢ 8 r ⁢ ⁢ 10 ) × v ref - v analog × rc rd + rc ] i ⁢ ⁢ 2 = 1 rc // rd × [ ( 1 + r ⁢ ⁢ 4 r ⁢ ⁢ 6 ) × v ref - v analog × rc rd + rc ] i ⁢ ⁢ 3 = 1 rc // rd × [ ( 1 + r ⁢ ⁢ 0 r ⁢ ⁢ 2 ) × v ref - v analog × rc rd + rc ] , where v analog is the inputted analog - dimming signal level . by adjusting the analog - dimming signal level , the average current flowing through the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 to emit light could correspondingly be modulated because all the current levels i 1 , i 2 , and i 3 would decrease with an increased analog - dimming signal level v analog , so the resulting light apparatus would be analog - dimmable . when it comes to the rheostat - dimming scheme , the shared current sense and modulation unit 16 would merely take on a rheostat rc . the fixed resistor rd , the voltage buffer , and the rc low - pass filter , having nothing to do , could all be removed . equating the rheostat - dimmed , scaled - down current sense signals and the reference voltage v ref would lead to the following equations : { ( i ⁢ ⁢ 1 × rc ) ) × r ⁢ ⁢ 10 r ⁢ ⁢ 8 + r ⁢ ⁢ 10 = v ref ( i ⁢ ⁢ 2 × rc ) ) × r ⁢ ⁢ 6 r ⁢ ⁢ 4 + r ⁢ ⁢ 6 = v ref ( i ⁢ ⁢ 3 × rc ) ) × r ⁢ ⁢ 2 r ⁢ ⁢ 0 + r ⁢ ⁢ 2 = v ref ⇒ { i ⁢ ⁢ 1 = 1 r ⁢ ⁢ c × ( 1 + r ⁢ ⁢ 8 r ⁢ ⁢ 10 ) × v ref i ⁢ ⁢ 2 = 1 r ⁢ ⁢ c × ( 1 + r ⁢ ⁢ 4 r ⁢ ⁢ 6 ) × v ref i ⁢ ⁢ 3 = 1 r ⁢ ⁢ c × ( 1 + r ⁢ ⁢ 0 r ⁢ ⁢ 2 ) × v ref , where r 16 is the variable resistance . by adjusting the variable resistance rc , the average current flowing through the extrinsic led sub - arrays g 1 , g 2 , g 3 , and g 4 to emit light could correspondingly be modulated because all the current levels i 1 , i 2 , and i 3 would decrease with an increased variable resistance rc , so the resulting light apparatus would be rheostat - dimmable . not only can the aforementioned variable resistance come from a single rheostat acting as the one and only variable resistor in a narrow sense , but it can also result from a series , a parallel , or a mixed combination of a number of current - sensing resistors under the control of a bank of electronic or mechanic switches in a broad sense . to sum up , all the preferred embodiments of the present invention could gear up and down the number and current of excited led sub - arrays according to the voltage level of the rectified sinusoidal input voltage for obtaining a high pf and a low thd . if further equipped with the option of disclosed flicker - suppressing capacitors , the disclosed ac - powered led light engines could improve the flicker phenomenon while maintaining exactly the same high pf and exactly the same low thd without any deterioration . in addition to being triac - dimmable via legacy phase - cut dimmers , the disclosed ac - powered led light engines are also pwm -, analog -, and rheostat - dimmable , broadening the scope of dimming applications . while the present invention is susceptible to various modifications and alternative forms , specific examples thereof have been shown in the drawings and are herein described in detail . it should be understood , however , that the present invention should not be limited to the disclosed particular forms , but to the contrary , should cover all modifications , equivalents , and alternatives falling within the spirit and scope of the appended claims .	7

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.